APALM 3.1 (2016)

eISSN: 2349-6983 pISSN: 2394-6466

Annals of Pathology and Laboratory Medicine January-March 2016; Vol. 3, Issue 1

A PA L M

Co-Editor-In-Chief Dr. Prashant Goyal Dr. Shelly Sehgal

www.apalm.org

Annals of Pathology and Laboratory Medicine Co-Editor in Chief

Dr Prashant Goyal Director-Laboratory, Accuprobe Healthcare and Diagnostics, Delhi, India Dr Shelly Sehgal Specialist Pathologist, Dept. of Pathology, SDN Hospital, Delhi, India

Associate Editors

Dr Asitava Mondal Clinical Cytologist and Oncopathologist, Kolkata, West Bengal, India Dr Sompal Singh Specialist Pathologist, Dept. of Pathology, N D M C Medical College & Hindu Rao Hospital, Delhi, India Dr Ruchika Gupta Pathologist (Scientist-C), Institute of Cytology & Preventive Oncology (ICPO), Delhi, India Prof. Vatsala Mishra HOD, Dept. of Pathology Moti Lal Nehru Medical College, Allahabad Dr Manjusha Biswas Consultant Histopathologist & Oncopathologist, Kolkata, India Dr Mudit Agarwal Director Lab Services, Nishtha Pathology Lab, New Delhi, India Prof. A S Ramaswamy Prof. & HOD, Pathology, P E S Institute of Medical Sciences and Research, Kuppam, India Dr Harsh Vardhan Singh Senior Biochemist, N D M C Medical College & Hindu Rao Hospital, Delhi, India Dr Manu Noatay Head Operations, Niche Theranostics, New Delhi, India Dr Anil Parwani Vice Chair, Anatomical Pathology; Director of Pathology Informatics and Digital Pathology The Ohio State University Wexner Medical Center, Columbus, Ohio, USA

Editorial Board Members

Dr Sarah Iqbal Ch Faculty of Pathology King Edward Medical University, Lahore, Pakistan Dr Jerad M Gardner Asst Prof, Pathology and Dermatology, University of Arkansas for Medical Sciences, Little Rock, AR, USA Dr Naila Atif Associate Prof., Histopathology, Central Park Medical College, Lahore, Pakistan Dr Rajan Chopra King Fahad Hospital, Hufof, Saudi Arabia Dr NitiSinghal Abu Dhabi, United Arab Emirates

Published by: Pacific Group of e-Journals (PaGe) Kotla Market, Mayur Vihar, New Delhi (India) Website: www.pacificejournals.com www.apalm.org E-mail: contactus@pacificejournals.com

Dr (Prof) Severino Rey Quiron Hospitals and Pontifical Catholic University, Ecuador Dr Rajeshwar Reddy Prof. & Head, Dept. of Microbiology, Gandaki Medical College, Pokhara, Nepal Dr Nasser Said-Al-Naief ODRP/ Anatomic Pathology, Loma Linda Medical Center, Loma Linda, CA, United States Dr Hoda A Hagrass Clinical Pathology dept, Faculty od Medicine Zagazig University, Sharkyia, EGYPT Dr Kemal Turker UlutaĹ&#x; Kadirli State Hospital, Central Laboratory, Osmaniye, Turkey Dr Dennis P O’Malley Pathologist, Clarient Pathology Services, Columbia, Aliso Viejo, CA Dr Parthasarathi Pramanik Consultant Forensic Pathologist, Forensic Science Laboratory. Kingston, Jamaica.

Dr Arvind Rishi Asst. Prof., Dept of Pathology, Hofstra North Shore-LIJ School of Medicine, New York, United States Dr Ahmad Mohammad Ragab Senior Consultant Pathologist, Kameda Hospital & Oncology Center - JAPAN - National Medical Institute , Egypt, Egypt Dr Amado Ona Tandoc III Research Institute for Tropical Medicine, Muntinlupa City, Philippines Dr Shamim Sheikh Dept. of Pathology, M.P. Shah Medical College, Jamnagar, Gujarat, India Dr Viral M Bhanvadia Asst. Prof. Dept. of Pathology, Shri M.P. Shah Medical College, Jamnagar, Gujarat, India Dr Navin K Sinha Director-Lab, Artemis Health Institute, Gurgaon, India Dr Soumyesh Ghosh Dept. of Pathology, SDN Hospital, Delhi, India Dr Deepti Mittal Pathologist, Haryana, India Dr Amit Agravat Asso. Prof. Dept. of Pathology, PDU Medical College, Rajkot (Gujarat), India

Advisory Editors

Dr Awanindra Kumar Head, Blood Bank & Pathology, SDN Hospital, Delhi, India Prof. Kuldeep Singh Prof. of Pathology, Govt. Medical College, Jammu, India Dr Shriniwas Rushi Histopathologist, KFCH, Riyadh, Saudi Arabia

Annals of Pathology and Laboratory Medicine Annals of Pathology and Laboratory Medicine (APALM) is an international, Double-blind peer-reviewed, indexed, open access, online and print journal with an Impact Factor (IFJ): 2.8952 and IC Value (ICV 2014): 67.16 published by ‘Pacific group of e-Journals’ (PaGe), an ISO 9001:2008 Certified academic publishing house.

APALM publishes original, peer-reviewed articles for pathologists and clinical laboratory scientists. APALM is a specialized journal in the field of Pathology and Laboratory Medicine which, inter alia, includes Histopathology, Cytopathology, Hematology, Clinical Pathology, Forensic Pathology, Blood Banking, Clinical Bio-Chemistry, Medical Microbiology (Bacteriology, Virology, Mycology, Parasitology), etc.

APALM is the top ranking Indian Journal in the field of Pathology and Laboratory Medicine, with the highest IC Value (67.16) amongst the Indian Journals in the field of Pathology and Laboratory Medicine that are indexed with Index Copernicus.

Publication Frequency Four per year, i.e. Quarterly.

Copyright •

•

•

Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work’s authorship and initial publication in this journal.

Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal’s published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal.

Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work.

Disclaimer 1.

Thoughts, Language and examples in published research papers are entirely of Authors of Research Papers.

It is not necessary that both Editor and Editorial Board are satisfied by the research paper. The responsibility of the matter of the research paper/article is entirely of author.

Scientific knowledge is ever changing. As new research and experiences broaden our knowledge, old concepts may be required to be looked into afresh. The Authors and editors of the material herein have consulted sources believed to be reliable in their efforts to provide information that is complete and in accord with the standards accepted at the time of publication. However, in view of the possibility of human error by the authors, editors, or publisher, nor any other who has been involved in the preparation of the work warrants that the information contained herein in every aspect accurate or complete, and they are not responsible for any errors or omissions or the results obtained from the use of such information. Readers are advised to confirm the information contained herein with other sources.

2.

3.

4.

In any condition and due to any reason, if any Educational/Research Institution (College or University) denies accepting the research paper published in APALM, it will not be the responsibility of the Editor, Publisher or the Management.

Only the First author is entitled to receive the print copies of all co-authors.

All the legal disputes related to PaGe are subject to Delhi Jurisdiction only

January-March, 2016 Volume 3, Number 1

Contents Review Article

Fungal Biofilm & Medical Device Associated Infection: It’s Formation, Diagnosis & Future Trends: A Review-eema

R1-9

Original Article Model for assessment of Cystatin C as predictive cardiovascular risk marker in patients

A1-7

Bose, Atindra Krishna Gho sh

with Chronic Kidney Disease Manoj Kumar, Asgar Ali, Reema Sharma, Raj Narayan Gupta, Alok Ranjan, Kishan Kumar Sharma, Rathish Nair, Sadhana Sharma Diagnostic and Prognostic Significance of E-Cadherin and Vimentin in Oral Cancer Metastasis Kafil Akhtar, Anjum Ara, Shahid Siddiqui, Rana Sherwani Morphological Sub-classification of Focal Segmental Glomerulosclerosis and Their Clinio-pathological Correlation: Experience From a Tertiary Care Centre Usha Singh, Shreekant Bharti, Vijay Kumar Jha, Punit Bahal, Mahendra Kumar, Deepa Rani, Rana Gopal Singh, Jai Prakash, Shivendra Singh, Deepa Santosh Viral etiology and assessment of HBV genotypes in Fulminant Hepatic Failure: the present scenario Hiba Sami, Meher Rizvi, Mohd Azam, M R Ajmal, Indu Shukla, Haris M Khan Seroprevalence of Co-Infections Among Blood Donors in A Blood Bank of A Tertiary Health Care Centre Ashwin Khageshan Pattanshetty, Keshav R Kulkarni, Mahesh C Baragundi Premalignant Lesions of Prostate and Its Association with Nodular Hyperplasia and Carcinoma of Prostate: A Histomorphological Study Rajeshwari K Kumbar, Karibasappa GN, N V Dravid, Ashish Patil Seroreactivity of Syphilis Among Blood Donors of A Blood Bank Ashwin K Pattanshetty, Keshav R Kulkarni, Mahesh C Baragundi

Case Report

Primary schwannoma of thyroid gland in an adolescent male: a rare case-report with review of literature Pallavi Agrawal, Neha Garg, Preeti Jain Unusual sites of metastasis of breast carcinoma to gallbladder and colon Sabah Nayef Nemri, Nazima Haider, Sohaila Fatima, Bouvier Francis Valere D’sa Sclerosing stromal tumour of ovary: A case study with the review of literature Vijay Kumar Jha, Alka Rai, Mohan Kumar, Shivi Jain, Madhu jain Incidental microfilariae detection in abdominal neoplasm on cytology: A rare case report with review of literature Pallavi Agrawal, Sanjay Kumar, Neha Garg, Kumar Rahul

A8-13 A14-21 A22-28 A29-32 A33-40 A41-44 C1-5 C6-9

C10-15 C16-18

Non-leukemic granulocytic sarcoma presenting as multiple skin nodules: A rare case report Pallavi Agrawal, Narender Kumar, Deepak Bansal, Raje Nijhawan

C19-22

Eosinophilic Cholecystitis with Lipomatosis: a rare case report and review of literature anima Dwivedi, Ramesh Chavan

C23-26

T-cell Rich Large B-cell Lymphoma: A rare variant of diffuse Large B-cell Lymphoma Mangal Motilal Pandure, Ravindra Karle, Surykant Dongre, Varsha Deshpande Cytopathological diagnosis of Giant Cell Tumor of first Metacarpal: a rare site for a common tumor Indranil Chakrabarti, Sankarshan Bhaduri, Asit Chandra Ray

C27-31

C32-35

Cover Image Giant Apocrine Hidrocystoma of the Anogenital Region: A Case Report Rajeshwari Karibasappa Kumbar, Akshay Surana, Karibabappa Gundabakta Nagappa, Nandkumar Vishwanath Dravid Primary Systemic Amyloidosis: A Case Report Tanima Dwivedi, Ramesh Chavan Lymphadenosis benigna cutis or Cutaneous lymphoid hyperplasia- a rare case report Neha Amrut Mahajan, Suparna Milind Bindu, Smita Sanjay Mulay Mermaids are real !! Sirenomelia: A case of mermaid baby Anupama Praveen Gupta, Sanjay Nanaji Parate, Dinkar Kumbhalkar Secretory carcinoma breast: A rare cytodiagnosis Ankit Kaushik, Mukul Singh, Sachin Kolte, Kusum Gupta, A K Mandal

C36-39

Letter to Editor Cytodiagnosis of Sternocleidomastoid Pseudotumour in a Neonate Presenting as

L1-2

Lateral Neck Mass Deepti Sukheeja, Naresh Rai, Neelu Vashist Mixed Serrated Polyps of the Duodenum Neeraj Dhameja Subareolar Breast Abscess in Male: A Rare Presentation Shailaja Shukla, Manjari Kishore, Sangeeta Pahuja, Rachana Meena

Published by: Pacific Group of e-Journals (PaGe) Kotla Market, Mayur Vihar, New Delhi (India)

Website: www.pacificejournals.com www.apalm.org

E-mail: contactus@pacificejournals.com

C40-43 C44-48 C49-52 C53-55

L3-4 L5-9

Review Article Fungal Biofilm & Medical Device Associated Infection: It’s Formation, Diagnosis & Future Trends: A Review Seema Bose*1, Atindra Krishna Ghosh2, Sachin Deorukhkar1 1

Dept. of Microbiology, Pravara Institute of Medical Sciences, Ahmednagar, India 2 Dept of Medicine, Pravara Institute of Medical Sciences, Ahmednagar, India

Keywords: Fungal biofilm; Biomedical device; Quorum sensing; IBIS T 5000; Electrochemical sensor

ABSTRACT

Fungal biofilm has been associated with a wide range of persistent infections, which responds poorly to antifungal drugs.

In modern day critical care; use of life saving medical devices encourages biofilm formation. Formation of biofilm on devices and prolonged hospital stay cause resistance of microorganisms to antifungal drugs. Development of resistance is due to genetic and biochemical changes in fungal cells and production of exopolysaccharide matrix. Fungal biofilm is a heterogeneous structure. There are three stages of biofilm formation, such as, microbial adhesion, maturation and disposal of biofilm. Besides, quorum-sensing play an important role in maturation and dispersion of biofilm cells. Biofilm can be detected by culture – based methods, microscopy and genotypic methods. In future, research on innovation of medical devices, newer and early diagnostic methods, new drug molecules, synthetic peptides, electrochemical sensors, atmospheric pressure and non – thermal plasma have scope to deal with biofilm – associated infection.

*Corresponding author: Dr Seema Bose, Dept. of Microbiology, Pravara Institute of Medical Sciences, Loni BK, Dist. Ahmednagar, Maharashtra, India. 413736, Phone: +919665044401 E-mail: drseema11ghosh@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

R-2

Fungal Biofilm & Medical Device Associated Infection

Introduction

The modern definition of a biofilm was very well presented

by Donlan and Costerton (2002). They reported that biofilm is a community of sessile microbial cells, irreversibly attached to an interface or to each other and surrounded by an extracellular polymeric matrix produced by them.

Their growth rate and gene transcription are altered when trapped in biofilm. [1,2]

Importance of biofilm detection in medical science Organ transplantation, immunosuppressive drug therapy, extensive use of indwelling catheters and prolonged stay in critical care units promote the prevalence of biofilm associated fungal infections. Formation of fungal biofilms on medical devices is a very serious clinical problem. This can cause dysfunction of medical device and manifestation of chronic and systemic infections. This also causes resistance to antifungal drugs. [3] Biofilm producing Candida albicans (C. albicans) are highly resistant to some of the antifungal drugs, such as, nystatin, Chlorhexidine, fluconazole and amphotericin B. The biofilm phenotypes show increased resistance to antimicrobials and treatment failure. [4] Biofilm associated infections may be polymicrobial and sometimes consist of bacterial and fungal infections together. There, they may act synergistically, resulting an increased resistance to antimicrobials. Adams et al reported a biofilm-associated infection due to Candida albicans and Staphylococcus epidermidis causing reduced susceptibility to both fluconazole and vancomycin. [5] There are several factors regarding biofilm based antimicrobial drug resistance, such as; physical barrier to phagocytosis, opsonization, stress and diffusion of antimicrobials through gel like substances of the biofilm. Further, this exopolysaccharide can electrostatically interact inhibiting action of ionic-based antimicrobials, e.g., aminoglycoside.

Besides, this enclosed matrix provides an excellent medium for the exchange of genetic information via plasmids, such as, multidrug resistance. It is still not clear about the exact mechanism of drug resistance in fungal biofilm. It is either due to genetic and biochemical alteration of fungal cells or due to production of extracellular material. Some researchers proposed that antifungal resistance of biofilm producing fungus was due to metabolic quiescence of fungal cells. Another group of workers explained that might not be possible as biofilm enclosed cells actively metabolize certain substrates, such as, XTT and Fun – 1. [3, 6, 7]

Structures of biofilm

Most of the studies on fungal biofilms were done on C. albicans and other Candida species. There are wide varieties of fungi, which can form biofilm; such as, Cryptococcus

neoformans, Cryptococcus gattii, Rhodotorula species, Aspergillus fumigatus, Malassezia pachydermatis, Histoplasma capsulatum, Paracoccidioides brasiliensis, Pneumocystis species, Fusarium species, Saccharomyces cerevisiae (S. cerevisiae), Trichosporon asahii, Coccidioides immetis, Mucorales and Blastoschizomyces.

[8] Structure of Biofilm varies between individual species.

This is a spatially heterogeneous structure and regularly varies in form. Millions of microbial cells form pillar and mushroom shaped ultra structures invaginating into surrounding medium. [9] Biofilm matrix contains 97% of water. Out of total organic carbon present in biofilm, 75 – 90% is extracellular polymeric substances, 10 – 25% microbial cells and 1 – 2% proteins, polysaccharides, peptidoglycans, lipids, phospholipids, DNA and RNA. [10,11,12] The exopolysaccharide of biofilm in mucoid strains of microorganisms is mostly made up of alginic acid, whereas, biofilm of non - mucoid strains carry little alginate. Structural integrity of biofilm mainly depends on the binding force of the ionic interactions. [13,14,15] Besides, it has hydrogen bond also, which play a little role in holding the extracellular polymeric network. [1, 2] After sometimes, microbes become dormant due to depletion of nutrients and oxygen within biofilm and accumulation of metabolic waste products. These microbial cells are known as “persister cells” and are resistant to host immune mechanisms and antimicrobials. Persister cells become activated again when nutrition and oxygen supply to them is restored. [16,17] In case of biofilm formed by filamentous fungi, the collection of hyphae and spores are enclosed in a matrix. This leads to some prominent developmental phases guided by complex molecular events. Existence of persister cells in C.albicans biofilm has not been observed directly. Carol A et al found that Biofilm produced by C. albicans on solid surfaces were three-dimensional structures and highly resistant to antifungals. This observation was important in patient care because of increasing use of medical devices in modern health care practice. [18] Biofilms produced by C. albicans is a heterogeneous structure. [19] This consists of cellular and non-cellular components. Certain genes differently regulate planktonic and biofilm grown cells. On the other hand, some workers found that S.cerevisiae adhered to biomedical devices but failed to form mature biofilm. [3]

Pathogenesis of biofilm infection in medical devices

Colonization of microorganisms on medical devices depends on interaction of three factors, namely, device, microorganisms and host factors. There are several stages of biofilm formation, maturation and disposal. a.

Microbial adhesion – Initial attachment of microorganisms to inert surfaces is reversible. This is

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Bose et al.

R-3

due to electrostatic, thermodynamic and hydrophobic interactions. This is followed by irreversible attachment and micro colonies formation. [20] After that, host’s extracellular fluid forms conditioning film. [21] Presence of bacterial capsule, molecular components of cell wall and cell membrane influence adhesion of microorganisms and subsequent biofilm formation.

P – fimbriae and functional flagella also increases the adhesion property of microbial cells. There are also some surface bound protein adhesins, which involve in secondary microbial adhesion. [22] Other factors, such as, area and type of the surface of the device, porosity, surface hydrophobicity and charge of the surface also influence biofilm formation. Prasanna SS et al observed that rough and porous surface of the device was more favorable for microbial biofilm formation. Cataions caused cross-linking of biofilm matrix. [23]

Like bacteria fungi can also form biofilm on medical implants. Hawser and Douglas found that C. albicans could form biofilm on a wide variety of abiotic surfaces.

They observed that biofilm formation by C.albicans occurred best on latex (polyvinyl chloride) or silicone elastomer and less on polyurethane or pure latex. [22] The expressions of agglutinin – like (ALS) genes cause attachment to the host cell surface. Sometimes, formation of biofilm depends on mutations, which can reduce its development. These types of mutations can interfere in adherence to surfaces. One of the many examples of this is EFGI gene. This gene is a major regulator of hyphal development and can be affected by mutation. Carol A et al also found that ACE2 gene encodes a transcription factor that regulates expression of chitinase and cell wall proteins. ACE2 deficient mutants show reduced adherence to polystyrene and thereby, less biofilm formation. [18] b. Maturation of biofilm – After accumulation of microbes on biomaterials, multiplication and production of extracellular polymers occur. This creates multiple layers of microorganisms. Maturing biofilm shows increased synthesis of extracellular polymers and more exchange of genetic information between one cell to other. Biofilm organisms also exhibit increase in resistance pattern to antimicrobials, ultra violet light and secondary metabolic products. [18,22] c. Disposal of biofilm – After certain period in a biofilm, microbes suffer from lack of nutrition. Due to lack of nutrients and accumulation of metabolic products microbial populations within a mature biofilm suffer.

Therefore, to maintain their populations biofilm cells are genetically encoded to seek fresh surface for

colonization. The process of disposal of biofilm from a surface are sloughing, abrasion, erosion and human interference. Sloughing or shedding is a more random process than either erosion or abrasion. Dispersion of a biofilm is a complex process and includes multiple effectors, signal transduction pathways and environmental signals. It has three phases – detachment from existing biofilm, translocation to other area and adherence to a new surface. Dispersion of biofilm increases the infection of medical device that is already exists. It also causes rapid spread of infection to other parts. During dispersion of a part of biofilm, some biofilm cells undergo genotypic changes and revert back to planktonic phenotype. One of the examples is up regulation of genes associated with flagella and down regulation of genes coding for exopolysaccharide synthesis and accumulation.

Besides, productions of proteases also initiate breaking down of the outer part of the biofilm. Glycosidase, proteases and deoxyribonucleases are few examples of enzymes among many that involve in breaking down of biofilm. Other than that, there are certain surfactants molecules produced by microorganisms, which contribute in dispersion of biofilm. These surfactants act by decreasing cell surface and cell to cell binding force. [24,25,26,27] Hall – Stoodley et al described three stages of dispersal of biofilm – detachment, translocation and attachment to a new surface. [28] d. Quorum sensing – The formation, maturation and dispersion of biofilm cells occur through gene expression. This gene expression is regulated between single and multiple cells via production, release, detection and response to cell-to-cell signaling molecules. These signaling molecules are called auto inducers. The entire communicative system is called quorum - sensing. Quorum- sensing allows the microbial populations to act together as a community.

This helps in growth, survival and colonization of microorganisms in a biofilm. Atkinson et al described that quorum-sensing molecule should accumulate in extracellular matrix at a required stage of growth under specific physiological conditions. It also should have the ability to recognize a specific cell receptor present in the biofilm. Besides, it should initiate a cellular response more complex than the process required to metabolize the molecule. [29] Biofilm formation is not dependent upon one specific quorum – sensing pathway. There are two quorum-sensing molecules – farnesol and tyrosol. These two molecules regulate “germ tube” formation. They also influence conversion of yeast to filamentous form and play a major role in pathogenicity and formation of biofilm. [30]

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

R-4

Fungal Biofilm & Medical Device Associated Infection

In case of C.albicans biofilm, increased expression of drug resistance genes may be responsible for antifungal drug resistance. Some of these genes are CDR1, CDR2 and MDR1. [31]

Sites of biofilm formation In modern day medical practice in a hospital, there are increasing uses of life saving devices. Examples include, needle less connectors, central venous catheters, urinary catheters, endotracheal tubes, prosthetic joints, mechanical heart valves, intrauterine devices etc. All these devices are potential sites for biofilm formation. Biofilm may form on solid surfaces having optimum moisture, soft tissue surfaces of living organisms and at liquid – air junctions.[32]

Collection of samples for biofilm detection

Samples can be collected by removal of biofilm by scrapping exposed surface or removal of part of the system carrying biofilm. Biofilm can be loosened up from the system by treating a segment of it with Ultrasonication. Catheter tips can be directly rolled over blood agar plates and incubated for culture of biofilm producing organisms[33]

Culture based methods for detection of biofilm There are three common medical device associated infections by biofilm producing organisms, such as; catheter associated urinary tract infection (CA UTI), catheter related blood stream infection (CRBSI) and ventilator associated pneumonia (VAP). For CA UTI, urine is collected from sampling port of the catheter with a sterile syringe and needle. The sample is cultured and tested for biofilm production. In case of CRBSI, infection site may show inflammation at the site of insertion. These patients may also have bacteremia. CRBSI can be diagnosed by direct inoculation of catheter tip by rolling and pressing it on culture plate. Fluid from the catheter can also be cultured. Besides, to dislodge the biofilm accumulated inside and outside the catheter, it can be sonicated and the material thus collected can be cultured. For detection of VAP, bronchoalveolar lavage (BAL) through endotracheal intubation or tracheal aspirate is collected. All the samples thus collected are inoculated in blood agar and MacConkey’s agar and incubated for 24 hours.

In case of CA UTI, if there are more than or equal to 105 colony forming units (CFU)/ ml, it is considered as significant. For BAL, 103 CFU/ml and for tracheal aspirates, 105 CFU/ml are significant. [34,35,36,37,38] The culture isolates are identified by conventional methods and tested for biofilm production. There are several culturebased techniques for detection of biofilm, such as; Congo

red agar (CRA) method, tube method (TM) and tissue culture plate (TCP) method.

In CRA method, concentrated aqueous solution of Congo red stain is prepared and sterilized by autoclave. This stain such prepared is added to autoclaved brain heart infusion agar. Then, sucrose is added to it at 550 C and dispensed in petri plates. The organism to be tested is inoculated in CRA plate and incubated at 370 for 24 to 48 hours. Biofilm producing microorganisms show dry, crystalline, black coloured colonies on CRA plate. [39,40] In TM, a tube with 10 ml of tryptic soy broth is taken and 1% glucose is added to it. This broth is inoculated with test organism and incubated at 370 C for 24 to 48 hours. After incubation, supernatant is discarded and the tube is gently washed with phosphate buffer saline. Then the tube is airdried and the adherent deposit (due to biofilm production) at the bottom and wall of the tube is stained with 0.1% crystal violet. After washing with de ionized water the tube is dried in an inverted position. [39,40] In TCP method, the wells of the plate are inoculated with fungal suspension along with positive and negative controls.

The TCP is incubated for 24 to 48 hours. Non-adherent cells are removed by washing it with phosphate buffered saline. Biofilm such produced are fixed with 2 % sodium acetate and stained with 0.1% crystal violet. After washing with deionized water the plate is dried and optical density of stained biofilm is procured by spectrophotometry.

Mathur T et al and Bose S et al found that TCP was a better test for detection of biofilm producing organisms than CRA and TM. [39,40] Biofilms can also be grown on polymethylmethacrylate strips or on silicone elastomer disks of 1.5cm2 diameter.

In both the methods standard inoculum of fungus, i.e., 1x 107 cells from overnight culture are used to form biofilm.

Fungal suspension is added to polymethylmethacrylate strips and incubated in RPMI 1640 medium. In case of silicone elastomer, the disks were placed in a 12 well tissue culture plate. Fetal bovine serum is added to it and the plate is incubated at 370 C for 24 hours on a rocker. Then the disks were washed with phosphate buffered saline (PBS) and dipped in 3 ml of standardized cell suspension (1x 107 cells). The plate is incubated at 370 C for 90 minutes.

After that, wells were washed with PBS and disks were immersed in YNB medium with 50 mM glucose. The plate is again incubated at 370 C on a rocker. Chandra J et al reported that tetrazolium XTT reduction assay and dry weight measurement quantitate biofilm formed on both polymethylmethacrylate and silicone elastomer disks.

Disks without fungal cells act as control. Assay is done in 4 replicates. [3]

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Bose et al.

R-5

Microscopy

Light Microscopy – Layer of biofilm is scrapped off from the medical device and inoculated into a culture medium.

This suspension is then poured into a flat-bottomed plate.

A coverslip is placed over the top of the plate, so that upper most surface of the liquid reaches the centre of the coverslip. The plate is incubated at 370 C for 18 hours. After that, the coverslip is taken out and dipped in 0.1% crystal violet. With the help of a light microscope, the stained cells attached to the coverslip can be visualized. [41] Use of fluorescent dyes, such as; 4,6 diamidino – 2 phenylindone (DAPI) or acridine orange (AO) to visualize biofilm cells; enhance the function of light microscopy.

These dyes can be used directly on catheter surfaces. They can stain nucleic acid of both live and dead microbial cells.

Propidium iodide can stain cells with damaged cytoplasmic membrane and 5 – cyano – 2,3 – ditolyltetrazolium chloride can stain viable cells. Live cells reduce the dye into 5 – cyano – 2,3 – ditolyltetrazolium chloride formazan. This can be appreciated by visualizing evolution of a red fluorescent precipitate. Therefore, these dyes can be used to detect effectiveness of the treatment. But Donlan et al observed that thick biofilm cells could not be detected by this method due to scattering of light by thick layers of biofilm. [2,42,43] Scanning Electron Microscopy (SEM) – By this method, catheter tip as well as culture of biofilm producing microbes both can be stained. The sample is sputter coated with a gold or palladium film. This coating allows visualizing the surface attached cells and extent of growth of biofilm. But during the preparation of the sample for electron microscopy, cells of biofilm may shrink due to complete dehydration. This excessive shrinkage can be avoided by treating the sample with ruthenium red prior to dehydration.

A modified SEM method, environmental scanning electron microscopy (ESEM) has been developed, but its magnification is less than the conventional SEM. Taj et al and Schaule et al also observed similar findings in their research. [41,43]

Genotypic Method

Polymerase chain reaction (PCR)

PCR amplifies gene sequences of a target organism causing infection. There are three steps in a PCR – 1. Nucleic acid extraction 2. Amplification of the extracted nucleic acid 3. Detection of amplified product by gel electrophoresis There is a chance of false positive result during amplification of bacterial DNA. This can be rectified by detection of messenger RNA (m RNA) and ribosomal RNA (r RNA) for detection of biofilm. Only viable cells produce m RNA, therefore, detection of m RNA in a biofilm confirms cell viability. Disadvantage of detection of m RNA in a biofilm is its rapid degradation after cell death. It can be detected only in active infection. Patrick FB et al found that low copy number and absence of universal target sequences for all bacterial cells were other limitations of detection of messenger RNA in biofilm. Ribosomal RNA is present in abundance in viable bacterial cells and disappears rapidly after cell death. A segment of r RNA is unique for a particular species of microorganism. [45,46,47] While working on clinical cases of fungal keratitis, Embong et al demonstrated that rRNA PCR technique was 90.9% sensitive and 94.7% specific. [47]

Fluorescent in situ hybridization (FISH)

In FISH, fluorescent labeled probes identifies DNA sequences of denatured DNA samples. In this method, detection of culture- negative microorganisms can also be possible in approximately six hours. But one of the disadvantage of this technique is fading of fluorescent marker and therefore, not suitable for all types of laboratories as samples cannot be stored. On the other hand this is a quick and reliable method and very useful in rapid diagnosis and treatment of biofilm-associated infections.

[48,49] Goncalves AV et al (2006) experimented with FISH using universal rRNA probe EUK516 labeled with the red CY3. After that, they stain the biofilm with calcoflour white MR2 fluorescent dye, which stained fungal cell wall blue.

They observed that, by using CW, it took less than one hour while by FISH, five hours to demonstrate filamentous fungi in water biofilm. [50]

IBIS T 5000 Technology

These molecular techniques are very sensitive and time saver but costlier and need appropriate training. This can also detect viable but non - culturable (VBNC) as well as fastidious microorganisms within biofilm. Therefore, molecular techniques help to a great extent in identification and treatment processes of a patient. Now a day, molecular method has been adopted globally. [44,45]

This technique combines broad range PCR (16s RNA PCR) and high performance mass spectrometry. By 16s RNA PCR, genes of microorganisms in biofilm are amplified.

[51] Then base composition signatures are obtained by mass spectrometry. This is a highly sensitive technique and can detect culture negative or difficult to culture microorganisms also. IBIS T 5000 technology is useful for detection of microorganisms up to species level and genes

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

R-6

Fungal Biofilm & Medical Device Associated Infection

responsible for drug resistance. [52] The advantage of broad range PCR over traditional PCR is that, it can produce products from a number of microorganisms at the same time. In conventional PCR a specific primer is required for detection of a specific microorganism. On the other hand, IBIS T5000 technology uses mass spectrometry derived base units of pathogens obtained from amplified PCR products of the sample.

Mass spectrophotometer analyzes base composition data of PCR products rapidly. Suci PA et al described that this method could be used for large-scale analysis of samples.

IBIS T 5000 technology is a fully automated system.

Therefore, no specialized expertise is required to run this machine. [53] Future trends - A multidisciplinary approach is required for prevention and treatment of biofilm and medical device associated infections. Multipronged actions like patient care and cleanliness, innovative devices and methods, newer drug molecules, synthetic antimicrobial peptides, use of acoustic waves, atmospheric pressure and non – thermal plasma should be adopted to minimize device – associated infection. New designs of biomaterials with less chance of biofilm formation look promising. [54] Newer diagnostic methods that can detect early formation of biofilm are need of the hour. Otto and Silhavy (2002) observed that disruption of quorum sensing between microbial cells might play an important role in reducing cell reproduction and biofilm formation. [55] Bellin et al (2014) showed that square wave voltammetry could be used for identification and quantification of several distinct redox active metabolites from microorganism. Development of specific electro chemical sensors for species identification and biofilm formation might be useful. [56] Biomedical devices impregnated with antimicrobials are increasingly being used to prevent colonization and biofilm formation.8 Resistance to antimicrobials are becoming more problematic with the increased use of life saving devices and prolonged hospital stay. The potential cytotoxicity and stability of the surface coating of the medical devices are to be considered while working for development of antimicrobial medical device. [57] Silver containing medical devices is widely used in practice. Silver has a broad spectrum anti bacterial, antifungal and protozoal activity. [58] But there are also some reports on silver resistant genes found in microorganisms.

[59] Martinez et al (2010) reported anticandidial biofilm activity of chitosan. They observed that, chitosan inhibited Candidal biofilm in vivo. They also found that chitosan reduced metabolic activity of biofilms and the cell viability of C.albicans and C. parapsilosis biofilm in vitro. By using SEM, these researchers demonstrated that Candidal biofilm was invaded and damaged by chitosan treatment. Chitosan

is a polymer extracted from exoskeleton of crustaceans.

Chitosan interferes with synthesis of messenger RNA and proteins of microorganisms. Interaction between negatively charged microbial cell membrane and positively charged chitosan causes leakage of intracellular constituents leading to cell death. This observation may allow further study of invention of chitosan- coated device to prevent biofilm-associated infections. [60] There is increased use of infection resistant biomaterials to prevent biofilm related infections. Most of such materials only act actively for first few days after application. Therefore, more researches are required to improve longevity of their action and to reduce microbial resistance. [61, 62]

Conclusion The adherence of microorganisms to medical devices leads to colonization and subsequently formation of biofilm.

The use of life saving indwelling medical devices causes an ongoing challenge to clinicians. To deal with this problem, we should update our understanding of human immune response to the implantation of devices as well as microbial pathogenicity cycle and biofilm formation.

This approach may reveal new biomarkers with their use for diagnostic purpose and new biofilm- related targets for chemotherapeutic challenge. There is a lot of scope for future research for early detection of biofilm formation, design of new types of biomedical devices and newer drug delivery methods to combat with biofilm associated infection.

Acknowledgement Authors are grateful to the Pravara Institute of Medical Sciences for the encouragement and support throughout the study.

Funding Nil

Competing Interests None declared

References

1. Donlan RM, Costerton W. Biofilm: survival mechanisms of clinically relevant microbes. Clin Microbiol Rev 2002; 15: 167 – 193.

2. Donlan RM. Biofilm and device associated infections.

Emerg Infect Dis 2001; 7 (2): 277 – 281.

3. Chandra J, Kuhn DM, Mukherjee PK, Hoyer LL, McCormick T, Ghannoum MA. Biofilm formation by the fungal pathogen Candida albicans: Development, Architecture and Drug resistance. J Bacteriol 2001; 183: 5385-94.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Bose et al.

R-7

4. Kojic EM, Darouiche RO. Candida infections of medical devices. Clin Microbiol Rev. 2004; 17: 255 – 267.

5. Adam B, Baillie GS, Douglas LJ. Mixed species biofilms of Candida albicans and Staphylococcus epidermidis. J med microbiol 2002; 51(4): 344-349.

6. Francolini I, Donelli G. Prevention and control of biofilm based medical device related infections.

FEMS immunology and medical microbiology 2010; 59(3): 227-238.

7. Bose S, Ghosh AK. Biofilms A Challenge to Medical Science. J Clin Diag Res 2011; 5(1): 127 – 130.

8. Sardi Jde C, Pitangui Nde S, Rodriguez – Arellanes G, Taylor ML, Fusco – Almeida AM, Mendes – Giannini MJ. Highlights in pathogenic fungal biofilms. Rev Iberoam Micol 2014; 31(1): 22 – 29.

9. Hall – Stoodley L, Costerton JW, Stoodley P. Bacterial biofilms: from the natural environment to infectious diseases. Nature reviews. Microbiol 2004; 2(2): 95 – 108.

10. Zhang X, Bishop PL, Kupferle MJ. Measurement of polysaccharides and proteins in biofilm extracellular polymers. Water science and technology 1998; 37 (4): 345 – 348.

11. Costerton JW, Montanaro L, Arciola CR. Biofilm in implant infections: its production and regulation. Int J Artificial organs 2005; 28(11): 1062 – 1068.

12. Sutherland IW. The biofilm matrix – an immobilized but dynamic microbial environment. Trends Microbiol 2001; 9(5): 222 – 227.

13. Dunne WM, Jr and Buckmire FL. Effects of divalent cataions on the synthesis of alginic acid like exopolysaccharide from mucoid Pseudomonas aeruginosa. Microbios 1985; 43(174): 193 – 216.

14. Deretic V, Govan JR, Konyecsni WM, Martin DW. Mucoid Pseudomonas aeruginosa in cystic fibrosis: mutation in the muc loci affects transcription of the algR and algD genes in response to environmental stimuli. Molecular Microbiol 1990; 4(2): 189 – 196.

15. Stapper AP, Narasimhan G, Ohman DE, Barakat J, Hentzer M, Molin S, Kharazmi A, Hoiby N, Mathee K. Alginate production affects Pseudomonas aeruginosa biofilm development and architecture, but is not essential for biofilm formation. J Med Microbiol 2004; 53(7): 679-690.

16. Lewis K. Persister cells, dormancy and infectious disease. Nature Rev Microbiol 2007; 5(1): 48 – 56.

17. Lewis K. Persister cells. Annual Rev Microbiol 2010; 64: 367 – 372.

18. Carol A, Kumamoto, Marcelo DV. Alternative Candida albicans lifestyles: growth on surfaces. Annul Rev Microbiol 2005; 59: 113 – 133.

19. Suci PA, Tyler BJ. A method for discrimination of sub populations of Candida albicans biofilm cells that exhibit relative levels of phenotypic resistance to Chlorhexidine. J Microbiol Methods 2003; 53: 313325.

20. Mayor C, Moritz R, Krischner C, Borchard W, Maibaum R, Wingender J, Flemming HC. The role of intermolecular interactions: studies of model systems for bacterial biofilms. Int J Biological Macromolecules 1999; 26(1): 3 – 16.

21. Choong S, Whitfield H. Biofilms and their role in infection in urology. BJU international 2000; 86(8): 935 – 941.

22. Toole GO, Kaplan HB, Kolter R. Biofilm formation as microbial development. Annual Rev Microbiol 2000; 54, 49 – 79.

23. Prasanna SS, Doble M. Medical biofilms – Its formation and prevention using organic molecules. J Ind Inst Sci 2008; 88: 27 -35.

24. Kaplan JB. Biofilm dispersal: mechanisms, clinical implications and potential therapeutic uses. J Dental Res 2010. 89; (3): 205 – 218.

25. Garney K, Neu TR, Horn H. Sloughing and limited substrate conditions trigger filamentous growth in heterotrophic biofilms – Measurements in flow – through tube reactor. Chem Engg Sci 2009; 64(11): 2723 – 2732.

26. Allison DG, Evans DJ, Brown MR, Gilbert P. Possible involvement of the division cycle in dispersal of Escherichia coli from biofilms. J Bacteriol 1990; 172(3); 1667 – 1669.

27. Elenter D, Milferstedt K, Zhang W, Hausner M, Morgenroth E. Influence of detachment on substrate removal and microbial ecology in a heterotrophic/ autotrophic biofilm. Water Res 2007; 41(20): 4657 – 4671.

28. Hall – Stoodley L, Stoodley P. Developmental regulation of microbial biofilms. Curr Opinion Biotech 2002; 13(3): 228 – 233.

29. Atkinson S, Williams P. Quorum sensing and social networking in the microbial world. J Royal Society, Interface/ Royal Society 2009; 6(40), 959 – 978.

30. Nowak M, kumatowski P. Biofilm caused by fungi – structure, quorum sensing, morphogenetic changes, and resistance to drugs. Wiad Pyrazytol 2009; 55(1): 19 – 25.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

R-8

Fungal Biofilm & Medical Device Associated Infection

31. Vanden B, Dromer F, Improvisi I, Lozano – Chiu M, Rex JH, Sanglard D. Antifungal drug resistance in pathogenic fungi. Med Mycol 1998; 36 suppl 1: 119 – 128.

32. Andrew PT, Caleb WD, Richard EE, Luis AA. Attachment to the biofilm formation on abiotic surfaces by Acinetobacter baumannii: involvement of a novel chaperon – usher pili assembly system.

Microbiol 2003; 149: 3473 – 3484.

33. Marion – Ferey K, Enkiri F, Pasmore M, Husson GP, Vilagines R. Methods for biofilm analysis on silicon tubing of dialysis machines. Artificial organs 2003; 27(7): 1525 – 1594.

34. Singh S, Pandya Y, Patel R, Paliwal M, Wilson A, Trivedi S. surveillance of device associated infections at a teaching hospital of rural Gujarat, India. Ind J Med Microbiol 2010; 28(4): 342 – 347.

35. Sheretz RJ, Raad II, Belani A, Koo Lc, Rand KH, Pickett DL, Straub SA, Fauerbach LL. Three-year experience with sonicated vascular catheter cultures in a clinical microbiology laboratory. J Clin Microbiol 1990; 28: 76 – 82.

36. Siegman- Igra Y, Anglim AM, Shapiro DE, Adal KA, Strain BA, Farr BM. Diagnosis of vascular catheter – related bloodstream infection: a meta analysis. J Clin Microbiol 1997; 35: 928 – 936.

37. Maki DG, Weise CE, Sarafin HW. A semi quantitative culture method for identifying intravenous catheter related infection. New Engl J Med 1977; 296: 1305 – 1309.

38. Mermel LA, Farr BM, Sherertz RJ, Raad II, O’Grady N et al. Guidelines for the management of intravascular catheter – related infections. Clin Infect Dis 2001; 1249 – 1277.

39. Mathur T, Singhal S, Khan S, Upadhya DJ, Fatma T, Rattan A. Detection of three different screening methods of biofilm formation among the clinical isolates of Staphylococci. An evaluation. Ind J Med Microbiol 2006; 24(1): 25 – 29.

40. Bose S, Khodke M, Basak S, Mallick SK. Detection of biofilm producing Staphylococci, need of the hour.

J Clin Diag Res 2009; 3: 1995 – 1920.

41. Taj Y, Essa F, Aziz F, Kazmi SU. Study on biofilm forming properties of clinical isolates of Staphylococcus aureus. J Infect Dev Ctries 2012; 5(6): 403 – 440.

42. Zufferey J, Rime B, Francioli P, Bille J. Simple method for rapid diagnosis of catheter associated infection by direct acridine orange staining of catheter tips. J Clin Microbiol 1988; 26: 175 – 177.

43. Schaule G, Griebe T, Flemming HC. Methods for investigation of biofilms, Germany. Available from: :http://www.efcweb.org/efcweb_media/Downloads/ EFC+WP10/BR99_02b.pdf [accessed on 30.10.2015].

44. Anderson M, Bollinger D, Hagler A, Hartwell H, Rivers B, Ward K, Steck TR. Viable but non culturable bacteria are present in mouse and human urine specimens J Clin Microbiol 2004; 42(2): 753 – 758.

45. Patrick FB, Rocky ST. New technologies for diagnosing orthopedic infection. Am Acad Ortho Surgeons 2011. Available from: http://www.aaos.org/ news/aaosnow/may11/research3.aspwww.aaos.org/ news/aaosnow/may11/research3.asp [accessed on 30.10.2015].

46. Birmingham P, Helm JM, Manner PA, Tuan RS. Simulated joint infection assessment by rapid detection of live bacteria with real time reverse transcription polymerase chain reaction. J Bone Joint Surg Am 2008; 90: 602 – 608.

47. Embong Z, Wan Hitam WH, Yean C, Rashid N, Kamarudin B, Abidin SK, Osman S, Zainuddin ZF, Ravichandran M. Specific detection of fungal pathogens by 18s rRNA gene PCR in microbial keratitis. BMC Opthalmol 2008; 8:7.

48. Nakamura M, Honda K, Tun J, Ogura Y, Matoba R. Application of in situ PCR to diagnose pneumonia in medico legal autopsy cases. Legal Med 2001; 3(2): 127 – 133.

49. Taksukiko H, Naohiro N, Satoshi T, Akira H, Inamori Y. Direct detection by in situ PCR of the amo A gene in biofilm resulting from a nitrogen removal process.

Appl Environ Microbiol 2001; 67(11): 5261 – 5266.

50. Goncalves AB, Isabel MS, Santos IM, Russell R, Paterson M, Nelson L. FISH and staining techniques to detect in situ fungal biofilm in water. Rev Iberoam Micol 2006; 23(3): 194 – 198.

51. Renovoise A, Brossier F, Sougakof W, Jarlier V, Aubrey A. Broad range PCR: past, present and future of bacteriology? Med et Malad Infect 2013. 43(8): 322 – 330.

52. Ecker D, Sampath R, Massire C, Blyn L, Hall TA, Eshoo MW, Hofstadler SA. Ibis T5000: a universal biosensor approach for microbiology. Nat Rev Microbiol 2008; 6(7): 553 – 558.

53. 53. David JE, Jared JD, Jose G, Abel G, James CH, Schink A, Rangarajan S et al. The Ibis T5000 Universal Processor: An automated platform for pathogen identification and strain typing. J Lab Automation 2006; 11(6): 341- 351.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Bose et al.

R-9

54. Laverty G, Gorman SP, Gilmore BF. Biofilm and implant associated infections. Barnes L and Cooper R, editors. In Biomaterials and Medical Device Associated Infections. Woodhouse publishing 2015.

19 – 46.

55. Otto K, Silhavy T. Discovery of bacterial touch sensor could lead to biofilm treatment. Available from:https:// www.princeton.edu/pr/news/02/q1/0205touchsensor. htm#top [Accessed on 05.03.2014].

56. Bellin DL, Sakhtah H, Rosenstein JK, Levin PM, Thimot J. Integrated circuit based electrochemical sensor for spatially resolved detection of redox active metabolites in biofilm. Nat Commune 2014; 5: 3256.

57. Percival SL, Woods E, Nutekpor M, Bowler P, Radford A, Cochrane C. Prevalence of silver resistance in bacteria isolated from diabetic foot ulcers and efficacy of silver – containing wound dressings. Ostomy Wound Manage 2008, 54: 30 – 40.

58. Saleh S, Taha MO, Haddadin RN, Marzooka D, Hodali H. Preparation of silver and zinc doped mulite-based

www.pacificejournals.com/apalm

ceramics showing anti bacterial biofilm properties.

Molecules 2011; 16: 2862 – 2870.

59. Silver S, Phung LT, Silver G. Silver as biocides in burn and wound dressings and bacterial resistance to silver compounds. J Ind Microbiol Biotechnol 2006; 33: 627 – 634.

60. Martinez LR, Mihu MR, Tar M, Cordero RJB, Han J, Friedman AJ, Friedman JM, Nosanchuk JD. Demonstration of antibiofilm antifungal efficacy of chitosan against candidial biofilms, using an in vivo central venous catheter model. J Infect Dis 2010; 201(1) 1436 – 1440.

61. Bose S, Ghosh AK. Diagnosis of biofilm associated infection in medical devices. Barnes L and Cooper R, editors. In Biomaterials and Medical Device Associated Infections. Woodhouse publishing 2015.

71 – 82.

62. Mitragotri S, Lahann J. Physical approaches to biomaterial design. Nat Mater 2009; 8:15 – 23.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Model For Assessment of Cystatin C as predictive Cardiovascular Risk Marker in Patients with Chronic Kidney Disease.

Manoj Kumar1, Asgar Ali2, Reema Sharma3, Raj Narayan Gupta4, Alok Ranjan5, Krishan Kumar Sharma6, Rathish Nair7, Sadhana Sharma2* 1

N.M. Hospital & Heart Centre, Ghaziabad, U.P., India.

Department of Biochemistry, All India Institute of Medical Sciences, Patna, Bihar, India.

3 Department of Biochemistry, Santosh Medical College, Ghaziabad, U.P., India.

4 Department of Biochemistry, All India Institute of Medical Sciences, Bhopal, M.P., India.

5 Department of Community and family Medicine, All India Institute of Medical Sciences, Patna, Bihar, India.

6 Department of Neurosurgery, All India Institute of Medical Sciences, Patna, Bihar, India.

7College of Nursing, All India Institute of Medical Sciences, Patna, India 2

Keywords: Cystatin C, Creatinine, Chronic Kidney Disease, Cardiovascular disease, Diabetes, HDL, LDL, VLDL.

ABSTRACT Background: Cystatin C, a protease inhibitor synthesized in all nucleated cells, has been proposed as a replacement for serum creatinine for the assessment of renal function, particularly to detect small reductions in glomerular filtration rate.

In this study we determine a novel model to access cystatin C level of patients having cardiovascular risks with chronic kidney disease if other parameters are known.

Methods: Blood samples were collected (total 397 subjects) from patients with chronic kidney disease (CKD), cardio vascular disease (CVD) and both CKD with CVD, along with the normal healthy controls. Lipid profile, urea, creatinine, hs-CRP, physiological parameters and cystatin C were analyzed.

Result: We found that proportion of diabetics were significantly higher among diseased persons as compared to control subjects (Chi-square=53.61; p=0.0001). Mean values of total cholesterol, triglyceride, VLDL, urea, creatinine and cystatin C among CKD group as well as in CVD group of patients were significantly higher (p<0.05), while total protein, albumin and haemoglobin were significantly lower (p<0.05) as compared to healthy controls. In CKD patients with CVD, the mean values of potassium, glucose, urea, creatinine, cystatin C and total leucocyte count were significantly higher (p<0.05), while total protein, albumin and hemoglobin were significantly lower (p<0.05) as compared to healthy controls.

Conclusion: This study has demonstrated a novel predictive model which is cost effective than the gold standard for the assessment of serum cystatin C which is an endogenous risk marker in the patients of cardiovascular with Chronic Kidney Disease.

*Corresponding author: Dr. Sadhana Sharma; (Prof & Head) Department of Biochemistry, AIIMS Patna, Bihar, India Zip- 801505 Phone: +91 9631280481 E-mail: drsadhanas@aiimspatna.org

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-2

Cystatin-C a predictive cardiovascular risk marker

Introduction

Materials and Methods

Chronic kidney disease (CKD) is an important public health problem worldwide, with an estimated prevalence of 13% in the Western world.[1] Epidemiological data from the US indicate that roughly 10% of the adult population shows some form of CKD; studies from Europe, Australia and Asia confirm this high prevalence. Patients with kidney disease are far more likely to die from CVD, than to develop kidney failure.[2] Chronic kidney disease does not cause pain; this is why CKD usually remains undetected for a longer period of time, until a screening test identifies the silent problems. Patients with CKD as well as with mild renal dysfunctions are known to be at an increased risk of developing CVD and cardiovascular events.[3,4] It is not clear if the risk is mediated by mechanisms secondary to renal dysfunction or by risk factors common to both CVD and decreased GFR.

The present study was carried out in renal dysfunction and cardio vascular disease patients admitted at Narinder Mohan Hospital and Heart Centre, Ghaziabad. The study was designed on total 397 subjects who were divided into four groups of CKD (71), CVD (127), CKD with CVD (37) and healthy control (162). All patients had consented for the use of their blood samples for clinical research and ethical norms were approved from Institutional Ethical Committee.

Cystatin C, produced by a majority of nuclear cells is a nonglycosylated protein of 120 residue polypeptide chain with a molecular mass of 13 kDa.[5] It has been identified in a wide range of organs using both immunocytochemistry and in-situ hybridization, and has also been measured in a range of biological fluids i.e. cerebrospinal fluid, seminal fluid, plasma, saliva, urine, milk, amniotic fluid, synovial fluid, serum and tear.[6] Many studies have confirmed the high sensitivity and specificity of cystatin C for glomerular filtration rate (GFR) estimation; in most studies it was clearly superior to creatinine with regard to renal function assessment.[7] One of the key criteria that cystatin C needs to meet to be a potential replacement for creatinine is that its production rate should be constant or at least less variable than that of creatinine.[8] Recent studies, however, have shown that plasma cystatin C concentration is influenced by factors such as age,[9] body mass index (BMI),[10] sex,[11] smoking status,[9] and high concentrations of C-reactive protein (CRP).[9,11]

Enzymatic methods used for the estimation of glucose, triglyceride, cholesterol and urea were hexokinase, glycerol phosphate oxidase-peroxidase, cholesterol oxidase-peroxidase and urease-glutamate dehydrogenase respectively (Aw, 1969). Jaffeâ&#x20AC;&#x2122;s kinetic method was used for creatinine estimation.[14]

In prior studies on general population and in the elderly, cystatin C has been shown to be a better predictor of mortality and adverse cardiovascular events than serum creatinine.[12] Several recent studies demonstrated that cystatin C is superior to serum creatinine or creatinine based estimation equation for prediction of all causes mortality and incidence of congestive heart failure.[13] It appears to be a marker of cardiovascular risk, and high concentrations of circulating cystatin C have been shown to be consistently and strongly associated with cardiovascular outcomes in different clinical scenarios. Moreover, cystatin C seems to offer more complete prognostic information than other markers of renal function. This study was designed to explore the correlation of cystatin C with cardiovascular markers in CKD patients.

Sample Collection: Blood samples were collected from various groups and routine investigations of biochemical and physiological parameters were carried out. All biochemical assays were analysed on fully automated Biochemistry analyser (Olympus AU-400). For physiological assay, fully automated Haematology analyser (Beckman Coulter LH500) was used.

HDL cholesterol estimation was carried out by first precipitating non HDL using antihuman beta-lipoprotein antibody and estimating the rest enzymatically by cholesterol oxidase-peroxidase method. LDL Cholesterol estimation was also done by the same enzymatic method but by first selectively protecting LDL, estimating the remainder, then releasing LDL and determining it selectively.[15] Na+ and K+ estimation was carried out using direct ion selective electrode module of Olympus AU analyser.

Total serum protein and albumin were estimated by Biruet and bromocresol green method respectively.[16,17] Hs-CRP was estimated using latex enhanced turbidimetric immunoassay.

Estimation of cystatin C was carried out by immune turbidimetric method. Cystatin C concentration was determined by measuring change in absorbance that resulted from the aggregation of cystatin C with anticystatin C antibody.[18] Estimation of Heamoglobin and Total Leucocyte Count was done on LH -500 Beckman Coulter analyser. The analyser accurately counts and sizes cells by detecting and measuring changes in electrical resistance when a particle (such as a cell) in a conductive liquid passes through a small aperture.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Sharma et al.

A-3

Reagents for cystatin C estimation were procured from Accurex; all other estimations were carried out using reagents from Beckman.

Statistical Analysis: It was performed using statistical software Stata (version 10, Stata Corp, USA). Data were checked for the completeness, accuracy and normality condition for continuous data. Chi-square (Ď&#x2021;2) test was applied for the assessment of independence of association and goodness-of-fit tests. Analysis of variance was applied to test the equality of means of various biochemical parameters among four groups using f-statistic. T-test was applied for testing difference of means between two groups after checking for equality of variance. Multinomial logistic regression model was used for modelling the effect of various co-factors taking each disease outcome as dependent variable in comparison to healthy control.

Linear regression analysis was performed to predict the level of cystatin C using important biochemical parameters.

RESULT The CKD was more prevalent in young males (p=0.001) as compared to females.The comparison of mean age between males and females within each category of disease and healthy controls, and among four groups within each sex category, is presented in table-1. Two-way analysis of variance was performed to test the equality of age within each type and within sex. The mean age of subjects was significantly different among three types of diseased groups and healthy controls (F=26.90, p=0.0001), but not significantly different between male and female within each type of subjects (F-statistic=2.5, p=0.114). CKD patients were comparatively younger than CVD and both, but almost comparable to healthy controls in both sex category (p>0.05). In present study, proportion of diabetics were significantly higher among diseased persons as compared to control subjects (Ď&#x2021;2=53.61; p=0.0001). Also mean glucose level was significantly higher within each category of subjects (Table-2).

The mean value of biochemical parameters (with 95% CI) of the subjects within each category is depicted in table-3.

Comparison of CKD cases with healthy controls: mean values of total cholesterol, triglyceride, VLDL, potassium, urea, creatinine and cystatin C among CKD patients were significantly higher (p<0.05), and total protein, albumin and haemoglobin were significantly lower (p<0.05) as compared to health controls. Logistic regression analysis showed that after adjusting for confounders like age, sex, diabetic status and other biochemical parameters, it was observed that low albumin (p=0.0001), high urea (p=0.0001), high creatinine (p=0.0001) and high cystatin C (p=0.03) were significantly different compared to healthy individuals. Glucose level was also found to be significantly different (p=0.005) in CKD individuals after adjusting for other confounders (Table-4).

Likelihood ratio test using chi-square statistic was used for the model selection (log likelihood= - 157.023, Chi-square = 683.60; p=0.0001). Adjusted R-square for the logistic regression analysis was 0.685, indicating a high multiple correlation.

Comparison of CVD cases with healthy controls: Mean values of total cholesterol, triglyceride, LDL, VLDL, glucose, urea, creatinine, cystatin C and total leucocyte count among CVD patients were significantly higher (p<0.05), while total protein, albumin and haemoglobin were significantly lower (p<0.05) as compared to healthy controls. Logistic regression analysis showed high LDL (p=0.003), high glucose level (p=0.001), low albumin (p=0.001), high urea (p=0.001), and high creatinine (p=0.001) were significantly different compared to healthy individuals. Diabetic status was also found to be significantly associated (p=0.005) compared to healthy individuals after adjusting for other confounders (Table-4). Likelihood ratio test using chi-square statistic was used for the model selection (log likelihood = -151.023, Chi-square = 660.45; p=0.0001). Adjusted R-square for the logistic regression analysis was 0.69, indicating a high multiple correlation.

Comparison of both CKD and CVD cases with healthy controls: Mean values of potassium, glucose, urea, creatinine, cystatin C and total count among both CKD and CVD patients were significantly higher (p<0.05) and total protein, albumin and haemoglobin were significantly

Table 1: Comparison of age by groups and sex of subjects Type

Male Mean (95%CI)

Female Mean (95%CI)

p-value

CKD

48.62 (44.12 - 53.13)

49.83 (45.23 - 54.44)

0.7071

CVD

58.66 (56.11 - 61.21)

58.41 (51.45 - 65.36)

0.938

Both CKD with CVD

65.89 (60.26 - 71.52)

57.44 (47.83 - 67.05)

0.1265

Healthy normal

49.63 (47.88 - 51.39)

46.05 (43.64 - 48.46)

0.07

F-statistic: For Type; 26.90 (0.0001); for sex 2.5 (0.114)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-4

Cystatin-C a predictive cardiovascular risk marker

Table 2: Distribution of Mean Glucose Level (95%CI) among the cases and control subjects.

Type CKD CVD Both CKD with CVD Healthy normal

Diabetic 159 (137 -181) 179 (165 - 193) 163 (142 - 185) 141(114.4 - 167.59)

Non-Diabetic 87.5 (84 - 91) 91 (87.5 - 94) 92 (83 -101) 90.61 (89.09 - 92.13)

t-statistic (p-value) 6.84 (0.000) 12.54 (0.000) 6.38 (0.000) 4.16 (0.001)

Table 3: Mean Level (95% CI) of Biochemical Profile among four groups.

Variable

CKD (n=71)

CVD (n=127)

Both (n=37)

Control (n=162)

Total Cholesterol Triglyceride HDL LDL VLDL Sodium

189 (181 - 197) 169 (158 - 179) 40.4(39.2-41.6) 114.9 (108 - 122) 33.74 (32 - 36) 138.6(137-140)

196 (187 - 205) 168 (160 - 177) 40.8 (39.5 - 42.0) 128.8 (120.6 - 136.9) 33.68 (32.0 - 35.3) 138.6(137.3-140.0)

190 (177 - 203) 152 (134 - 171) 38.2 (35.7-40.7) 121(109- 134) 30(27 - 34) 139 (137-141)

174 (168 - 180) 138(128 - 147) 43.14(41.72 - 44.55) 106(101 - 111) 27.5 (25.68 - 29.32) 140(139-140.47)

F-statistic (p-value) 7.38 (0.001) 10.35 (0.000) 5.48 (0.001) 8.79 (0.001) 10.40 (0.001) 1.34 (0.26)

Potassium Glucose Total Protein Albumin Urea Creatinine Cystatin C Haemoglobin Total Count

4.97 (4.76 - 5.18) 103.7 (94.9 - 112.5) 6.74 (6.55 - 6.92) 3.39 (3.25 - 3.54) 123 (109 - 137) 6.13 (5.32 - 6.95) 2.99 (2.61 - 3.37) 9.49 (8.93 - 10.05) 8115(7415 - 8815)

4.38 (4.26 - 4.50) 109.5(102.1 - 116.8) 6.68 (6.55 - 6.82) 3.48 (3.4 - 3.58) 67 (61 - 73) 1.88 (1.77 - 2.00) 0.98 (0.90 - 1.05) 12.25 (11.85 -12.60) 10200(9452 - 10950)

5.02 (4.65 -5.41) 134 (114 - 152) 6.39 (6.08 - 6.69) 3.27 (3.09 - 3.46) 133 (114 - 152) 4.10 (3.23 - 4.98) 2.71 (2.20 - 3.22) 11 (10 - 12) 10843(9313-12374)

4.37 (4.31 - 4.44) 94.34 (91 - 97) 7.11 (7.04 - 7.20) 4.16 (4.09 - 4.26) 24.61 (23.52 - 25.71) 0.94 (0.86 - 1.00) 0.64 (0.61 - 0.67) 13.10 (12.86 - 13.35) 7667(6963 -8371)

20.86 (0.000) 14.55 (0.000) 16.92 (0.000) 72.52 (0.0001) 170.76 (0.000) 167.41 (0.0001) 151.68 (0.000) 59.66(0.000) 10.87 (0.001)

Table 4: Logistic Regression to model Chronic Kidney Disease (CKD), Chronic Vascular Disease (CVD) and CKD with CVD using biochemical indicators.

CKD

CVD

CKD with CVD

Variables

Adjusted Beta (â&#x2013;Ą)

SE (â&#x2013;Ą)

z-statistic

p-value

Glucose

0.033

0.012

2.8

0.005

Albumin

-4.47

0.93

4.8

0.0001

Urea

0.214

0.043

4.91

0.0001

Creatinine

1.96

0.453

4.32

0.0001

Cystatin C

5.02

2.43

2.07

0.039

Low Density Lipid

0.034

0.0116

2.98

0.003

Glucose

0.038

0.0105

3.62

0.001

Albumin

-3.74

0.84

4.46

0.001

Urea

0.21

0.043

4.82

0.001

Creatinine

1.05

0.43

2.46

0.014

DM

18.8

1.05

17.92

0.0001

Low Density Lipid

0.0245

0.13

1.89

0.059

Glucose

0.044

0.011

3.81

0.001

Albumin

-4.83

0.95

5.08

0.001

Urea

0.223

0.043

5.13

0.001

Creatinine

1.47

0.468

3.15

0.002

Cystatin C

5.44

2.43

2.24

0.025

DM

21.41

0.813

26.34

0.0001

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Sharma et al. lower (p<0.05) as compared to health controls. Logistic regression analysis showed high glucose level (0.001), low albumin (p=0.001), high urea (P=0.001), high creatinine (P=0.002) and cystatin C (0.025) were significantly different compared to healthy individuals. Diabetic status was also found to be significantly associated (p=0.0001) compared to healthy individuals after adjusting for other confounders (Table-4). Likelihood ratio test using chisquare statistic was used for the model selection (log likelihood = -154.023, Chi-square = 623.45; p=0.0001).

Adjusted R-square for the logistic regression analysis was 0.685, indicating a high multiple correlation.

Figure-1 shows the multiple linear regression analysis in order to predict the value of cystatin C based on other biochemical variables. The result is indicating that age, potassium level, albumin, urea, creatinine and haemoglobin are significant predictor variables for the average cystatin C level. This model is highly significant (F-statistic at 6,388 degrees of freedom = 159.63; p=0.0001). Adjusted R-square for the regression analysis was 0.72, indicating a high multiple correlation of these variables with dependent variable i.e. cystatin C. The model for estimating cystatin C value based on these results is as follows: Mean Cystatin C = -0.98 + 0.0075(Age) + 0.186(Potassium) + 0.168(Albumin) + 0.004(Urea) + 0.31(Creatinine) + (-0.05) (Haemoglobin).

A-5

Discussion The aim of this study was to investigate the role of cystatin C as diagnostic marker in CKD patients and to elucidate its role in association with CVD. Previous studies have demonstrated that mild to moderate kidney disease independently predicts morbidity and mortality among patients suffering with cardiovascular disease and chronic heart disease (CHD).[12,19] In patients with acute coronary syndrome, an elevation of creatinine or reduction of e-GFR is related to a poor prognosis. Vanholder et al., 2005, reported that patients with chronic kidney disease are at a significant risk, for developing cardiovascular disease and latter may promote former, resulting in a vicious cycle.[20] The present study explores the role of cystatin C in CKD patients with cardiovascular disease in two different age grouped persons under diabetic and nondiabetic conditions. Further, since creatinine estimation has a limited value in CKD prognosis; hence, the study focusses on cystatin C as the marker of choice for CKD as well as CVD. In this study, the mean age of subjects was significantly different among three types of diseased subjects and healthy controls, but not significantly different between male and female within each type of subjects. CKD patients were comparatively younger than CVD and both, but almost comparable in age to healthy controls. The

Fig. 1: The figure indicating the effect of independent variables like age, potassium, albumin urea, creatinine, hemoglobin, constant on dependent variable, i.e. cystatin C. There was significant effect of age (p=0.008), potassium (p=0.001), albumin (p=0.01), urea (p=0.001), creatinine (p=0.0001), hemoglobin (p=0.016), constant (p=0.022) on Cystatin level, after controlling for other independent variables.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-6

Cystatin-C a predictive cardiovascular risk marker

proportion of diabetics, as well as the mean glucose level was significantly higher among the cases as compared to control; reinforcing the fact that diabetes is a risk factor of CVD and CKD. Across all categories and age groups, we found higher mean levels of serum cystatin C under diabetic conditions as opposed to non-diabetic one. Xie Qing et al., 2012, have shown that serum cystatin C levels were significantly associated with the presence and severity of asymptomatic coronary artery disease (CAD) in metabolic syndrome patients with normal kidney function, suggesting that cystatin C is probably more than a marker of glomerular filtration rate.[21] Trilki et al., (2013), recently reported that serum cystatin C was a marker of cardiovascular disease in type-2 diabetes patients.[22] This was also supported by a study of Andrezel et al., 2013, who had reported that in young or middle aged diabetic patient in CKD, cystatin C gave a positive correlation with CVD patients.[23] It appears that estimation of cystatin C is necessary for the patient with CKD as well as CVD and is a useful tool to diagnose chronic kidney disease in high risk groups of diabetes mellitus. This supports Noora et al., 2011, who had reported that new cystatin C assay may offer an alternative to current commercial assays to detect and monitor impaired kidney function.[24] In present study, relationship between cystatin C and cardiovascular risk factors have been linked, as our data shows that the mean values of total cholesterol, triglyceride, VLDL, urea, creatinine and cystatin C among CKD, CVD and CKD with CVD patients were significantly higher. Parikh et al., 2008, evaluated the association between cystatin C and conventional cardiovascular risk factors in 3241 predominantly white participants.[25] The authors showed that high concentrations of cystatin C were independently associated with cardiovascular risk factors such as age, female sex, BMI, low HDL, cholesterol and smoking, even in individuals without CKD or micro albuminuria. A cross-sectional analysis of data on individuals with CKD in the study disclosed a similar risk profile. Our study also shows high cystatin C levels in patients of CKD and CKD with CVD in comparison to CVD alone category, although the levels even in the latter category were significantly higher with respect to controls.

Our study shows no significant difference in serum levels of cystatin C and LDL-C in CKD and CKD with CVD patients although a significant relationship between these two parameters exists in CVD alone category. This clearly shows that in CKD patients progressing towards CVD, carrying out LDL-C estimation may not be of any help.

This may have to do with the fact that additional factors are more important in the pathogenesis of CVD in CKD patients than disturbances of cholesterol metabolism (Massy et al., 2013; LDL Cholesterol in CKD- to treat or not to treat; Kidney International 2013).[26] Similarly we

also did not find any difference in the relationship between cystatin C and HDL-Cholesterol in CKD and CKD with CVD patients. This is in accordance with an earlier study which also did not find any correlation between HDLCholesterol and cystatin C in CKD patients.[27] It has also been conclusively shown earlier by Shlipak et al., (2005) that cystatin C levels in serum are strongly correlated with mortality.[12,28] Zethelius et al., 2008, assessed a combination of biomarkers and reported improved patients stratification with cystatin C compared to established cardiovascular risk factors.[29] Despite such strong evidence, cystatin C estimations have not found many takers probably due to its high cost assay. We therefore, attempted to predict cystatin C values using the other assayed biochemical parameters. On subjecting our data to multiple linear regression analysis and adjusting for confounders like age, sex and diabetic status, we found that age, potassium level, albumin, urea, creatinine and haemoglobin are significant predictor variables for predicting the average cystatin level. This model is highly significant (F-statistic at 6,388 degrees of freedom = 159.63; p=0.0001). Adjusted R-square for the regression analysis was 0.72, indicating a high multiple correlation of these variables with dependent variable i.e. cystatin C.

Conclusion This study has demonstrated a novel predictive model which is cost effective than the gold standard for the assessment of serum cystatin C which is an endogenous marker in the patients of cardiovascular with Chronic Kidney Disease if other parameters i.e. Age, Potassium level, Albumin level, Urea level, Creatinine level and hemoglobin level are known. A limitation of our study is its small sample size. A larger prospective study may be done to further validate this equation.

Conflict Of Interest

All authors have no conflict of interest.

Funding None

Competing Interests None declared

Reference 1. Coresh J, Selvin E, Stevens LA, et al. Prevalence of chronic kidney disease in the United States. JAMA. 2007;298:2038â&#x20AC;&#x201C;2047.

2. Levey AS, Atkins R, Coresh J, et al. Chronic kidney disease as a global public health problem: Approaches and initiatives; a position statement from Kidney Disease Improving Global Outcomes. Kidney Int. 2007;72:247â&#x20AC;&#x201C;259.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Sharma et al.

A-7

3. Ninomiya T, Kiyohara Y, Doi Y, Arima H , Harada A, et al. Impact of kidney disease and blood pressure on the development of cardiovascular disease:an overview from the japan Arte-riosclerosis Longitudinal Study.

Circulation. 2008;118:2694-2701.

4. Sarnak MJ, Coronado BE, Greene T, et al.

Cardiovascular disease risk factors in chronic renal insufficiency. Clin Nephrol. 2002;57:327-35.

5. Grubb A, Löfberg H. Human γ-trace, a basic microprotein: amino acid sequence and presence in the adenohypophysis. Proc Natl Acad Sci USA. 1982;79:3024-7.

6. Mussap M, Plebani M. Biochemistry and clinical role of human cystatin C. Crit Rev Clin Lab Sci 2004;41:467-50.

7. Tanaka A, Suemaru K, Araki H. A new approach for evaluating renal function and its practical application.

J Pharmacol Sci. 2007;105:1–5.

8. Grubb A. Diagnostic value of analysis of Cystatin C and protein HC in biological fluids. Clin Nephrol.

1992;38:20-27.

9. Knight EL, Verhave JC, Spiegelman D, et al.

Factors influencing serum Cystatin C levels other than renal function and the impact on renal function measurement. Kidney Int. 2004;65:1416–21.

10. Macdonald J, Marcora S, Jibani M, et al. GFR estimation using Cystatin C is not independent of body composition. Am J Kidney Dis. 2006;48:712–719.

11. Stevens LA, Schmid CH, Greene T, et al. Factors other than glomerular filtration rate affect serum Cystatin C levels. Kidney Int. 2009;75:652–660.

12. Shlipak MG, Sarnak MJ, Katz R, Fried LF, Seliger SL, Newman AB, Siscovick DS, Stehman-Breen C. Cystatin C and the risk of death and cardiovascular events among elderly persons. N Engl J Med. 2005;352:2049-2060.

13. Shlipak MG, Katz R, Sarnak MJ et al. Cystatin C and prognosis for cardiovascular and kidney outcomes in elderly persons without chronic kidney disease. Ann Intern Med. 2006;145:237–246.

14. Jaffe M. Ueber den Niederschlag, welchen Pikrinsäure im normalen Harn erzeugt und über eine neue Reaction des Kreatinins. Zeitschrift fur Physiologische Chemie.

1886;10:391–400.

15. Esteban-salan M, Guimon-Bardesi A, et al. Analytical and clinical evaluation of two homogeneous assays for LDL–Cholesterol in hyperlipidemic patient. Clin Chem. 2000;46:1121-1131.

16. Weichselbaum TE. An accurate and rapid method for the determination of protein in small amount of blood serum and plasma. Amer J Clin Path. 1946;10:40-49.

17. Doumas BT, Watson WA, Biggs HG. Albumin standards and the measurement of serum albumin with bromcresol. Clin Chim Acta. 1971;31:87-96..

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

18. Flodin M, Hasson LO ,Larsson A. Variations in assay protocol for the Dako cystatin c method may change results by 50% with changing the result control .Clin Chem Lab Med 2006;44: 1482-1485.

19. Go AS, Chertow GM, Fan D, McCulloch CE, et al. Chronic kidney disease and the risk of death cardiovascular events, and hospitalization. N Engl J Med. 2004;531:1296-1305.

20. Vanholder R, Massy Argiles A, et al. Chronic kidney disease as cause of cardiovascular morbidity and morbidity. Nephrol Dial Trans. 2005;20:1048-1056.

21. Qing X, Furong W, Yunxia L, Jian Z, Xuping W, Ling G. Cystatin C and asymptomatic coronary artery disease in patients with metabolic syndrome and normal glomerular filtration rate. Cardiovasc Diabetol.

2012;11:108. doi: 10.1186/1475-2840-11-108.

22. Trilki S, Fekih O, Hellara I, et al. Association between serum Cystatin C levels and cardiovascular disease in type 2 diabetes patients. Ann Bio Clin. 2013;71(4):438-442.

23. Andrzej S, Krolewski, James H et al. Serum concentration of Cystatin C and risk of end–stage renal disease in diabetes. Diabetes Care. 2013;35:2311-2316.

24. Ristiniemi N, Savage C, Bruun L et al. Evaluation of a new immunoassay for Cystatin C , based on a double monoclonal principle , in men with normal and impaired renal function. Nephrol Dial. 1-6:0:2011.

25. Parikh NI, Hwang SJ, Yang Q, et al. Clinical correlates and heritability of cystatin C (from the Framingham Offspring Study). Am J Cardiol. 2008;102:1194–1198.

26. Massy ZA, de Zeeuw D. LDL cholesterol in CKD to treat or not to treat? Kidney Int. 2013;84(3):451-456.

27. Font R, Prats M, Gutiérrez C, et al. Is there a relationship between cystatin C and inflammatory status, oxidative stress and other cardiovascular risk factors in non-diabetic patients with chronic kidney disease? Nefrologia. 2009;29(3):228-235.

28. Sharma S, Ranjan R, Gupta M, et al. Serum Cystatin C compared with conventional renal function tests: A study in patients with pre-eclampsia. Annals of Pathology and Laboratory Medicine, 2014:1(2); A6A9.

29. Zethelius B, Berglund L, Sundstrom J, et al. Use of multiple biomarkers to improve the prediction of death from cardiovascular causes. N Engl J Med. 2008;358:2107–2116.

Original Article Diagnostic and Prognostic Significance of E-Cadherin and Vimentin in Oral Cancer Metastasis Kafil Akhtar1*, Anjum Ara1, Shahid A Siddiqui2, Rana K Sherwani1 1

2

Department of Pathology, Jawaharlal Nehru Medical College, AMU, Aligarh, India Department of Radiotherapy, Jawaharlal Nehru Medical College, AMU, Aligarh, India

Keywords: Oral squamous cell carcinoma, Immunohistochemistry, E-cadherin, Vimentin

ABSTRACT Background: To study the role of epithelial-to-mesenchymal transition by E- cadherin and vimentin expression in precancerous and cancerous lesions of oral cavity and oropharynx and to predict invasiveness by the specific pattern of E-cadherin and vimentin expression.

Methods: Biopsies/ specimens of oral cavity and oropharynx were evaluated for all premalignant lesions and invasive epithelial squamous lesions, by haematoxylin and eosin sections and by immunohistochemical expression of E-cadherin and vimentin, wherever. Patients follow up and therapy related changes were also studied during the period of study.

Results: E-cadherin staining showed 6/10 (60%) cases of well differentiated carcinoma with 4+ degree of expression while 0/10 case of poorly differentiated carcinoma showed 4+ and only a single case showed 3+ degree of expression with 8/10 (80%) cases of well differentiated carcinoma depicting strong staining intensity of E-cadherin. 6/10(60%) cases of well differentiated oral squamous cell carcinoma showed 1+ degree of expression of vimentin while 6/10(60%) cases of poorly differentiated carcinoma showed 4+ degree of expression. 1(1.6%) case of positive lymph node metastasis showed strong positive staining for E-cadherin and 4 (66.6%) cases showed absent staining pattern of E-cadherin. The differences in the immunoreactivities were statistically significant between CIS and mi-croinvasive or invasive carcinomas (p<0.001) in our study.

Conclusions: Invasiveness and recurrence can be analysed by the use of immunohistochemical stains of E-cadherin and vimentin, which can help in predicting the tumor behaviour, prognosis, survival and management of the patient.

Also, these biomolecules can be used as biomarkers for further research on the micro-invasion of the tumor for early diagnosis and survival of the patients.

*Corresponding author: Dr. Kafil Akhtar, Associate Professor, Department of Pathology, Jawaharlal Nehru Medical College, Aligarh Muslim University, Aligarh.(U.P)-India.

Email: drkafilakhtar@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Akhtar et al.

A-9

Introduction

: Strong- Staining pattern in present in almost all tumor cells (>95%); is as strong as in the normal epithelial cells.

Weak/Homogenous- All tumor cells are uniformly stained but more weakly expressed than in the normal squamous epi­ thelium. Absent/ Heterogenous- The intensity of E-cadherin staining differs from cell to cell and the cells without immunostaining are also included. Grading of vimentin on the basis of intensity of staining: 1+ Weak and Focal staining; 2+ Strong and Focal staining; 3+ Weak and Diffuse staining; 4+ Strong and Diffuse staining.

Loss of epithelial morphology and acquisition of mesenchymal characteristics, termed as the epithelialto-mesenchymal transition (EMT) are typical for carcinoma cells and correlate with the local invasiveness and metastatic potential of the tumor.[3] In general cells proceeding EMT exhibit down-regulation of many epithelial markers including E-cadherin, desmoplakin, cytokeratins, claudins, occluding and beta-catenin and upregulation of mesenchymal markers, including N-cadherin, vimentin, fibronectin and Snail-1/2. [4,5]

STATISTICAL ANALYSIS TESTS: Fischer exact test showed that the probability of obtaining any such set of values was given by the hypergeometric distribution:

Oral squamous cell carcinoma (OSCC) is the most common head and neck cancer and ranks as one of the top ten cancers worldwide. India has the dubious distinction of having the worldâ&#x20AC;&#x2122;s largest number of oral cancer patients with an annual age-standardised incidence of 12.5 per 1,00,000 cases and oral cancer accounts for 9.4 per cent of all cancers in India.

[1] Oral cancer is the commonest cancer in India, accounting for 50-70% of total cancer mortality and accounts for highest incidence among Asian countries.[2]

In the present study, we studied the role of EMT by decreased expression of E- cadherin and increased expression of vimentin in precancerous and cancerous lesions of oral cavity and oropharynx. The specific pattern of E-cadherin and vimentin expression can predict invasiveness and may be used as markers for early diagnoses.

Material and Methods The present study was carried out on oral and oropharyngeal lesions. Before the commencement of study, we considered ethical aspects and obtained ethical committee approval.

Biopsies/ specimens of oral cavity and oropharynx were evaluated for all premalignant lesions and invasive epithelial squamous lesions, using routine haematoxylin and eosin sections and by immunohistochemical expression of E-cadherin and vimentin, wherever possible.

Immunohistochemical analysis by using rabbit and mouse antihuman polyclonal antibodies was performed on the serial sections. The working systems for the immunohistochemical reactions were represented by Novocastra ready to use Mouse monoclonal antibodies for E-cadherin and vimentin (DAB: 3,3â&#x20AC;&#x2122;- diaminobenzidine, Dako). Patients follow up and therapy related changes were also studied during the period of study.

[7]

P value in our study, if found to be < 0.01= highly significant; 0.01 to 0.05 = significant and > 0.05= weakly significant

Results E-cadherin immunohistochemistry in our study, showed 6/10 (60%) cases with 4+ degree of expression and 3/10 (30%) cases with 3+ degree of expression in well differentiated carcinoma, while in poorly differentiated carcinoma 0/10 case showed 4+ and only a single case showed 3+ degree of expression. (Table 1) In our study, 8/10 (80%) cases of well differentiated carcinoma showed strong staining intensity of E-cadherin (Figure 1), while 1/10(10%) case of poorly differentiated carcinoma showed strong staining intensity and 8/10 (80%) cases showed weak or homogenous staining intensity.

Grading of E-Cadherin on the Basis of Percentage of the Cells Stained: 1+ < 10 % cells; 2+ 10 to 20 % cells; 3 + >20 to 50 % cells and 4+ >50 % cells. Grading of E-Cadherin on the basis of location of staining [6]: 1: Membranous staining; 2: Both membranous and cytoplasmic staining; 3: Cytoplasmic staining and 4: Absence of staining.

Grading of E-Cadherin on the basis of intensity of staining

Fig. 1: Well differentiated squamous cell carcinoma: Photomicrograph shows nests of tumor cells with strong membranous positivity of E-cadherin (3+). (IHC E-cadherin x 10X)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Significance of E-cadherin and Vimentin in Oral Cancer Metastasis

A-10

Table 1: Expression of E-cadherin in different grades of squamous cell carcinoma cases Grades of squamous cell carcinoma

No of cases

Well differentiated Moderately differentiated Poorly differentiated

10 10 10

Degree of E-cadherin expression 1+ 2+ (<10%cells ) (10-20% cells) 0 1 (10%) 2 (20%) 6 (60%) 5 (50%) 4 (40%)

E-cadherin expression can vary between tumors of the same type and even between areas of the same tumor. Our study showed 6/10(60%) cases with membranous positivity of E-cadherin in well differentiated carcinoma and 4/10 (40%) cases showed both membranous and cytoplasmic positivity.

7/10(70%) cases of poorly differentiated carcinoma showed only cytoplasmic positivity and 2/10(20%) cases showed both cytoplasmic and membranous positivity, but none showed membranous positivity.

We found that 6/10(60%) cases of well differentiated oral squamous cell carcinoma with 1+ degree of expression of vimentin while none of the case showed 4+ staining pattern.

In poorly differentiated carcinoma, 6/10(60%) cases showed 4+ degree of expression. (Figure 2 and Table 2)

Fig. 2: Poorly differentiated squamous cell carcinoma: Photomicrograph shows strong and diffuse cytoplasmic positivity of vimentin (4+). (IHC Vimentin x 40X)

3+ (>20-50%cells) 3(30%) 0 1(10%)

4+ (>50% cells) 6(60%) 2(20%) 0

Lymph node metastasis evaluation in our study showed, 6/30 cases were positive for lymph node metastasis of squamous cell carcinoma and 24/30 cases were negative for malignant cells. 1(1.6%) case of positive lymph node metastasis showed strong positive staining for E-cadherin and 4 (66.6%) cases showed absent staining pattern of E-cadherin. It was found that 16 (66.6%) cases of negative lymph node metastasis showed strong E-cadherin staining intensity in their primary site of oral squamous cell carcinoma.

We performed immunostain of E-cadherin and vimentin on 10 cases each of dysplasias and Ca-in-Situ. 8 /10(80%) cases of dysplasias showed strong 4+ degree of expression of E-cadherin and 5/10 (50%) cases of Ca-in-Situ showed strong 4+ staining (p=0.025). Our study showed a decreased expression of vimentin with majority of cases showing negative and weak expression in both dysplasias and Ca-in-Situ (p=0.013). We concluded that E-cadherin expression was significantly reduced in invasive carcinomas as compared to dysplasias and ca- in -situ and the difference in immunoreactivity was statistically significant (p <0.001). We compared the expression pattern of vimentin in dysplasias, carcinoma in situ and invasive carcinomas and concluded that vimentin expression was increased as the tumor progressed from dysplasias to cain-situ to invasive carcinomas, which was statistically significant ( p <0.001).

We also found an inverse correlation between E-cadherin and vimentin expression.18/30 cases showed strong E-cadherin expression and in these cases 15/18 (83.3%) cases showed strong vimentin negativity, while 8/11(72.7%) cases showed vimentin positivity in which E-cadherin was weakly positive, which was statistically significant (p <0.001).

Table 2: Expression of vimentin immunostain in different grades of squamous cell carcinoma cases Grades of No of cases Degree of vimentin expression squamous cell 1+ 2+ 3+ carcinoma (Weak & focal) (Strong & focal) (Weak & diffuse) Well differentiated 10 6 (60%) 3(30%) 1(10%) Moderately 10 0 2(20%) 5(50%) differentiated Poorly differentiated 10 0 0 4(40%)

4+ (Strong & diffuse) 0 3(30%) 6(60%)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Akhtar et al.

We followed up the known cases of oral squamous cell carcinoma, who underwent radiotherapy. Repeat biopsy was performed to analyse the post radiotherapy effects on the tumor grade and histological differentiation.

Immunostaining with E-cadherin and vimentin was undertaken to determine their staining pattern and findings correlated with recurrence of tumor, metastasis and prognosis. We performed E-cadherin and vimentin immunohistochemistry on the 8 cases of recurrence.

Grading the membrane staining pattern of E-cadherin, we found that majority of recurrence cases showed weak (1+ and 2+) staining pattern in all the grades of carcinoma and none showed strong (3+ or 4+) positivity. Also,1 case (50%) of poorly differentiated carcinoma, 2 cases (66.6%) of moderately differentiated carcinoma and 1 case (33.3%) of well differentiated carcinoma showed absent/ heterogenous membrane staining for E-cadherin (Figure 3) as compared to 10%, 0% and 0% respectively, in the primary cases, which signified poor prognosis in the recurrent cases.

Fig. 3: Post radiotherapy recurrent poorly differentiated carcinoma: Photomicrograph shows poor cytoplasmic positivity of E-cadherin (1+) in scattered tumor cells.

(IHC E-cadherin x 40X)

A-11 cases irrespective of tumor grade and favored the tumor cells to show more invasive pattern with more tumor recurrence and metastasis. So we concluded that vimentin was a poor prognostic marker for oral squamous cell carcinomas and poor survival indicator.

Discussion In our study, degree of E-cadherin expression decreased as the grade of the tumor was increased. Huber et al concluded in his study that the loss of E-cadherin mediated cell adhesion is prominent and overall there was a trend towards a loss of E-cadherin during carcinoma progression.[8] A study by Mehendiratta et al observed absence of staining in 0%,10%, 30%, of well, moderate and poorly differentiated oral squamous cell carcinoma, respectively.[9] Kaur et al studied E-cadherin expression in different histological grades of oral squamous cell carcinoma and reported strong expression in 90% well differentiated, 92.9% moderately differentiated and 15.4% poorly differentiated carcinoma as compared to weak and homogenous staining showed by 10%, 7.1% and 69.2% cases respectively.[6] We concluded that E-cadherin membranous positivity decreased and cytoplasmic positivity increased as the tumor grade increased from well to poorly differentiated squamous cell carcinoma, leading to poor prognosis. Kaur et al found, cytoplasmic staining in 28.6% moderately differentiated carcinoma and 61.5% cases of poorly differentiated oral squamous cell carcinoma cases.[6] Vimentin expressions increased as the tumor progressed from well to poorly differentiated carcinoma. Na-Hye Myong et al observed that normal squamous mucosa showed no immunoreactivity for vimentin. [7] However, squamous carcinoma cells revealed a relatively dense cyto足plasmic expression for vimentin, showing polygonal or multi足polar appearance and heterogeneously scattered pattern. Araujo et al who reported that vimentin positivity was found in many cells of histological high grade of tumors, with poor outcome of the patients on treatment. [10]

On immunostaining with vimentin on post radiotherapy recurrence cases, we observed that 2 cases (100%) of poorly differentiated carcinoma and 2 cases (66.6%) of moderately differentiated carcinoma showed strong (4+) cytoplasmic staining pattern as compared to 60% and 30% respectively, in primary cases. 33.3% cases of well differentiated squamous cell carcinomas depicted strong (3+ and 4+) cytoplasmic staining of vimentin in recurrence cases, as compared to 10% cases with 3+ and none with 4+ staining pattern in the primary cases, highlighting the increased cytoplasmic staining intensity in recurrent cases and poor prognosis of the patients. Our findings suggests that vimentin was more strongly expressed in recurrent

Cavallaro and Christofori have stated that loss of E-cadherin is a hallmark of metastatic carcinoma. [11] WillipinskiStapelfeldt et al in their study on proteonomic analysis of breast cancer have reported that circulating mammary tumor cells or those found as micrometastasis, show the evidence of mesenchymal conversion. [12] According to Ramaekers et al the vimentin cytoskeleton most likely occurs in epithelial cells only during the process of metastasis.[13]

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Na-Hye Myong, showed that E-cadherin immunoreactivity to be increased in the cytoplasm or lost in the cell membranes was also observed from CIS, microin足vasive and invasive

Significance of E-cadherin and Vimentin in Oral Cancer Metastasis

A-12 squamous cell carcinoma by either cytoplasmic (51%, 71%, and 95%, respectively) or membranous (49%, 23%, and 0%, re­spectively) immunoreactivities. [7] The differences in the immuno­reactivities were statistically significant between CIS and mi­croinvasive or invasive carcinomas (p<0.001) in our study. Na- Hye Myong, showed normal control tissues immunohistochemically presented almost no vimentin expression and the CIS lesions showed less than 10% of immu­noreactivity (8.8%) and microinvasive and invasive carcinomas showed a much higher vimentin expression with 53% and 67% cases, respectively. [7] Thus, it was considered that the significantly increased vimentin expression could be used as an important EMT marker in the progression of CIS into micro-invasive or invasive SCC in the human cervical tissues.

Na- Hye Myong, have reported a statistically significant inverse correlation between E-cadherin and vimentin immuno-expression, with p value of p <0.001 in their study on 119 cases, a finding concordant with our study. [7] Immunohistochemistry on recurrence cases showed more loss of E-cadherin expression, which depicted aggressive activity of the tumor. Our findings complement the evidence that movement of E-cadherin from membrane to cytoplasm was associated with increasing tumor grade and recurrence. There is loss of adhesion in the cells, increasing the metastability with more invasiveness and tumor recurrence. [14] Guzinska-Ustymowiczet al in their study on 34 colon cancer patients reported borderline significance of p=0.06 in the association between the recurrence at the postoperative site and change in location of E-cadherin expression in the tumor mass from membrane to cytoplasm.

[14] Yasuto et al have concluded that 5 years survival rates of patients in tumor with preserved E-cadherin expression was 35.2% whereas the survival rate was 20.9% with reduced E-cadherin expression.[15] A study was done by Yong et al, showed that vimentin and E-cadherin have a significant impact on cervical squamous cell carcinoma on patients of clinical stage 1 or 2. [16] It was found that there was down regulation of E-cadherin in metastasis and upregulation of vimentin in recurrence cases, as was seen in our study.

Hou et al on Kaplan-Meier survival analysis showed that the overexpression of EphA2 and vimentin, ectopic expression of β-catenin and down-regulation of E-cadherin indicated a poor outcome.[17] Fan et al mentioned that low E-cadherin expression was associated with poor prognosis in oral squamous cell carcinoma. [18] Liu et al studied oral squamous cell carcinoma and documented high expression of vimentin in 23/43(53%) tumors from patients who eventually developed a recurrent tumor and

was associated with recurrence and death (p <0.001 and < 0.001respectively).[19] The combination of up regulation of vimentin and aberrant expression of E-cadherin /βcatenin complexes at the tumor invasive front may provide a useful prognostic marker in oral squamous cell carcinoma. The post radiotherapy recurrence cases showed statistically insignificant p values (> 0.05) of E-cadherin and vimentin expression in our study, because of small sample size of post radiotherapy recurrent cases. However, further studies are required with larger sample size to show statistical significant correlation.

Conclusions Our study concludes that invasiveness and recurrence could be analysed by the immunohistochemical staining pattern of E-cadherin and vimentin, which can help in predicting the tumor behaviour, prognosis, survival and management of the patient. Also, these biomolecules can be used as biomarkers for further research on the micro-invasion of the tumor for early diagnosis and survival of the patients.

Acknowledgements We acknowledge the technical staff of the Immunohistopathology lab and the departmental head for the general support.

Funding None

Competing Interests None declared

References 1. National Cancer Registry Programme - Biennial Report (2008-2009) of the National Cancer Registry Programme. New Delhi: Indian Council of Medical Research; 2012.

2. Khandekar SP, Bagdey PS, Tiwari RR. Oral cancer and some epidemiological factors: a hospital based study. Ind J Community Med 2006; 31 (3): 157-159.

3. Hollier BG, Evans K, Mani SA. The epithelial-tomesenchymal transition and cancer stem cells: a coalition against cancer therapies. J Mammary Gland Biol 2009; 14: 29-43.

4. Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002; 2: 442454.

5. Grille SJ, Bellacosa A, Upson J, Klein-Szanto AJ, Van Roy F, Lee-Kwon W et al. The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines. Cancer Res 2003; 63: 2172-2178.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Akhtar et al.

6. Kaur G, Carnelio S, Rao N, Rao L. Expression of E-cadherin in primary oral squamous cell carcinoma and metastatic lymph nodes: an immunohistochemical study. Ind J Dent Res 2009; 20: 71-76.

7. Na-Hye Myong. Loss of E-cadherin and Acquisition of vimentin in Epithelial-Mesenchymal transition are noble indicators of Uterine Cervix Cancer progression.

Korean J Pathol 2012; 46: 341-348.

8. Huber GF, Zullig L, Soltermann A, Roessle M, Graf N, Haerle SK et al. Down regulation of E-Cadherin (ECAD)-a predictor for occult metastatic disease in sentinel node biopsy of early squamous cell carcinomas of the oral cavity and oropharynx. BMC Cancer 2011; 11: 217-218 9. Mehendirrata M, Solomon MC, Boaz K, Guddattu V, Mohindra A. Clinico-pathological correlation of E-cadherin expression at the invasive tumor front of indian oral squamous cell carcinomas: an immunohistochemical study. J Oral Maxillofacial Surg 2014; 18 (2): 217-222.

10. Araujo VC, Pinto DS Jr, Nunes FD, Araujo NS. Vimentin in oral squamous cell carcinoma. Eur Arch Otorhinolaryngol 1993; 250: 105-109.

11. Cavallaro U and Christofori G. Cell adhesion and signalling by cadherins and Ig-CAMs in cancer. Nat Rev Cancer 2004; 4: 118-123.

12. Willipinski-Stapelfeldt B, Riethdorf S, Assmann V, Woelfle U, Rau T, Sauter G, Heukeshoven J, Pantel K. Changes in cytoskeletal protein composition indicative of an epithelial-mesenchymal transition in human micrometastatic and primary breast carcinoma cells. Clin Cancer Res 2005; 11: 8006-8014.

13. Ramaekers FS, Puts JJG, Kant A, Moesker O, Jap PK, Vooijs GP. Differential diagnosis of human

www.pacificejournals.com/apalm

A-13 carcinomas, sarcomas and their metastasis using antibodies to intermediate- sized filaments. Eur J Cancer Clin Oncol 1982; 18: 1251-1252.

14. Guzinska-Ustymowicz K, Chetnik A, Kemona A. Effects of changes at the site of E-cadherin expression as an indicator of colon cancer aggressiveness. J Med Oncol 2004; 49 (1): 70-72.

15. Yasuto U, Natsugoe S, Okumura H. Slug expression in the E-cadherin preserved tumors is related to prognosis in patients with eosophageal sqamous cell carcinoma.

Clin Cancer Res 2005; 11: 1174-1180.

16. Yong MH, Chang SY, Chiou SH. Overexpression of NBSI induces epithelial â&#x20AC;&#x201C;mesenchymal transition and co-expression of NBSI and Snail predicts metastasis of head and neck cancer. Oncogene 2006; 32: 24-28.

17. Hou F, Yuan W, Huang J, Qian L, Chen Z, Wang J et al. Overexpression of EphA2 correlates with epithelial-mesenchymal transition-related proteins in gastric cancer and their prognostic importance for postoperative patients. Med Oncol 2012; 29 (4): 26912700.

18. Fan HX, Wong S, Zhou H, Liu N, Chen D, Sun M, Zeng JH. Sonic hedgehog signaling may promote invasion and metastasis of oral squamous cell carcinoma by activating MMP-9 and E-cadherin expression. Med Oncol 2014; 31: 41-43.

19. Liu LK, Jiang XY, Zhou XX, Wang DM, Song XL, Jiang HB. Up regulation of vimentin and aberrant expression of E-cadherin/beta-catenin complex in oral squamous cell carcinomas: correlation with the clinic-pathological features and patient outcome. Mod Pathol 2010; 23: 213-224.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Morphological Sub-classification of Focal Segmental Glomerulosclerosis and Their Clinio-pathological Correlation: Experience From a Tertiary Care Centre Usha Singh1, Shreekant Bharti1, Vijay Kumar Jha1, Punit Bahal2, Mahendra Kumar1*, Deepa Rani1 Rana Gopal Singh3, Jai Prakash3, Shivendra singh4, Deepa Santosh1 1

Department of Pathology, Institute Of Medical Sciences, Banaras Hindu University, India 2 Department of Pathology Rama Medical College, India 3 Department Of Nephrology, Institute Of Medical Sciences, Banaras Hindu University, India 4 Department Of Nephrology, Ram Manohar Lohia Hospital, Lucknow, India Keywords: FSGS, IgM nephropathy, Focal proliferative GN, Mesangioproliferative GN.

ABSTRACT Background: The word focal segmental glomerulosclerosis (FSGS) is used to describe the common morphologic pattern occurring due to various progressive renal diseases and also to describe the primary idiopathic lesion of FSGS. Here, we are documenting the distribution of various types of FSGS and associated morphological lesion in the renal biopsy which may help to define the underlying cause of FSGS Methods: Total 47 cases of FSGS were retrieved from the archives and classified according to Agatiâ&#x20AC;&#x2122;s classification.

Acid Fuchsin Orange G (AFOG) stain was done to look for immune deposits. Direct immunofluorescence (DIF) was done in few cases.

Result: FSGS - NOS (Not otherwise specified) was most common variant followed by perihilar and cellular variant.

Focal segmental mesangial cell proliferation and GBM thickening were commonly found in NOS variant. Interstitial non caseating granulomas and mononuclear cell infiltrate admixed with neutrophils were more frequent in perihilar FSGS. Many cases earlier diagnosed as perihilar or tip lesion, latter turned out to be NOS variety on serial sections. AFOG stain revealed mesangial deposits in 70.22% cases, suggesting immunological aetiology of the disease instead of primary FSGS. DIF was performed in seven cases and all showed predominant IgM deposits in mesangium.

Conclusion: Typing of FSGS should be done on the serial sections, especially of tip lesion. Most of FSGS cases turned out to be secondary to other glomerular disease instead of idiopathic variant. So, FSGS appear to be a morphological descriptor of various chronic renal diseases instead of being a separate entity.

*Corresponding author: Dr. Mahendra Kumar, MD, Assistant Professor, Department of Pathology, Institute Of Medical Sciences, Banaras Hindu University, Varanasi - 221005, Uttar Pradesh, India Phone: +91 9454662251 Email: drbindmahendra@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Kumar et al.

Introduction

A-15

Materials and Methods

Focal segmental Glomerulosclerosis (FSGS) presents as proteinuria of mostly nephrotic range with hypertension, microscopic hematuria and progressive deterioration of renal function. In the beginning, it was considered to be a form of minimal change glomerlonethritis (MCGN) but later, it has been identified as a separate entity because it differed from MCGN due to greater steroid resistance and rapid progression to renal failure.[1] Histologically, it shows focal segmental scarring with obliteration of glomerular capillaries and deposits of IgM and C3 on direct immunofluorescence study. Electron microscopy shows stratification and effacement of foot process.[1,2] FSGS is seen in 10 to 15% cases of children as well as young adults with nephrotic syndrome, in the age range of 20 to 30 years and 40 to 60% patients develop end stage renal disease in a course of 10 to 20 years.[1-3]

A total of 47 cases were included in this study which were diagnosed in a period of 2 years between 18th June 2008 to 17th June 2010 .Cases were taken from outpatient as well inpatient division from the Department of Nephrology of our Institute and clinical findings were collected. All blood & urine related laboratory investigations were done by standard methods. Kidney biopsies were preserved in 10% buffered formalin for preparation of paraffin blocks.

Thin serial sections of about 3 micron were cut from these blocks and three main stains including Hematoxylin and Eosin (H&E), Periodic acid schiffs (PAS) and Acid Fuchsin Orange G (AFOG) were performed. AFOG stain was done to see Immune deposits. In 7 cases, direct immunofluorescence (DIF) was also performed to see pattern and type of deposits. All the stains were done by methods described by Zolliger & Mihatsch et.al.[16]

FSGS may be Primary or secondary to various diseases like HIV infection, drugs, intravenous drug abuse, thrombosis, obesity, sickle cell disease, cyanotic congenital heart disease, Alport syndrome, hypoxic damage to kidney, reflux nephropathy, focal cortical necrosis and post nephrectomy.[4-6] Exact pathogenesis of secondary FSGS is not clear. But it seems to be due to structural and functional adaptation mediated by intrarenal vasodilatation, increased glomerular capillary pressure and plasma flow rate.[6] In familial FSGS, mutations or polymorphism of various genes encoding podocin (NPHS2), nephrin (NPHS1)[7,8], α actinin-4 (ACTN4) [9] and transient receptor potential cation channel subfamily C member 6 (TRPC6)[10-12] and phospholipase CE1 (PLCE1)[13] are present. These genes encode podocyte specific proteins which are responsible for the normal function of podocytes. Non podocyte protein genes such as CD2 associated protein (CD2AP), Wilm’s tumour gene (WT1), coenzyme Q2 (COQ2) and β4 integrins (ITG β4)[11,14] etc are also involved in familial FSGS. Of these, the NPHS2 gene mutation has been noticed in many familial and childhood FSGS who are resistant to steroids. None of our patients were sibling or progeny to each other which signified rarity of familial FSGS in our population.

Results In our study, 31 patients (65.94%) were males and 16 patients (34.05%) were females. Age wise analysis showed that most patients were between the age ranges of 16 to 30 years. About 67.82% males and 68.75% females affected

by FSGS were in the age group of 10 years to 30 years with a mean age of 20 years (Table-1).

Most common clinical manifestation was swelling of the face (72.34%) followed by lower limb edema (21.27%).

Oliguria was seen in 16 patients (34.04%) and three patients (6.38%) complained of gross hematuria, 15 to 30 days prior to their first hospital visit. One patient presented with pain in bilateral knee joints along with photosensitivity & oral ulcer. Two patients (5.44%) had severe breathlessness along with edema of feet. The last three cases turned out to be cases of SLE after complete laboratory check up but histopathology of their renal biopsies showed features of FSGS. One patient had headache for several months and one patient had on & off burning micturition for several years. Two patients reported pain only in flank (Table-II).

D’Agati et al. proposed morphological classification of FSGS and have described 5 morphological subtypes of FSGS, named Not otherwise specified (NOS), perihilar, cellular, tip and collapsing variants. He also found distinct correlation among these subtypes with clinical and laboratory findings.[15] Here we are analysing 47 cases of FSGS and aim of this study is to know the incidence of various types of FSGS in our population. In addition, we also have tried to find out other histological and laboratory findings which may be associated with secondary FSGS (Secondary to chronic renal diseases).

Majority of the patients had nephrotic range proteinuria (68.08%) and others had non nephrotic range proteinuria (31.91%). Microscopic hematuria was present in 20 (42.85%) cases and leucocyturia was noted in around half (51.06%) of the patients. All the cases showed hyaline or granular casts in the urine. The biochemical findings revealed a rise in blood urea & serum creatnine in 29 cases (61.70%), anaemia in 33 cases (70.12%)(Table-III). Serum autoantibody analysis showed ANA to be positive in 3 cases and anti ds-DNA in 2 cases. These were clinically suspected to be SLE due to the associated features of malar rash, joint pains & breathlessness and finally diagnosed as SLE.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-16

Focal Segmental Glomerulosclerosis

Table I: Age and sex distribution of FSGS Age Groups (in Years)

No. Of Cases ‘n’ (%)

Males ‘n’ (%)

Females ‘n’ (%)

‹16

8 (17.02)

3 (9.67)

5 (31.25)

16-30

24 (51.06)

18 (58.05)

6 (37.5)

31-50

8 (17.02)

5 (16.12)

3(18.75)

›50

7 (14.86)

5 (16.12)

2 (12.5)

Table II : Clinical manifestations of FSGS Symptoms

No. Of cases affected

Percentage

Facial Puffiness

34

72.34

Swelling of lower feet

10

21.27

Pain in knee joint, Photosensitivity, Oral ulcer

1

2.12

Breathlessness

2

4.24

Oliguria

16

34.04

Ascitis

1

2.12

Gross Hematuria

3

6.38

Pain in Flank

2

4.24

Fever

2

4.24

Frothy Urine

1

2.12

Headache

1

2.12

Burning Micturition

1

2.12

Table III: Important Urinary, Biochemical & Immunological findings in FSGS Laboratory findings(n=47)

No. of cases involved (%)

Nephrotic range Proteinuria

32 (68.08)

Non-nephrotic range Proteinuria

15 (31.91)

Microscopic Hematuria

20 (42.85)

Increased leucocytes in urine

24 (51.06)

Hyaline and/or Granular casts

47(100)

Raised serum Creatinine & blood urea

29 (61.70)

Anaemia

33 (70.21)

ANA Positive

03 (6.38)

ds DNA Positive

02 (4.25)

Histopathological examination of kidney biopsies (TableIV) revealed FSGS of NOS type (Figure 1a & 1b) in majority (65.95%) of the patients which showed segmental sclerosis in the perihilar, peripheral as well as in central areas. Next common type was the perihilar type (19.14%) where sclerosis was confined to the hilar region (Figure 2a & 2b) in more than 50 % of the involved glomeruli.

This was followed by the cellular type (12.77%) where endocapillary proliferation was associated with segmental sclerosis (Figure 2d). The collapsing variant was very uncommon and was seen in only one case (2.12%). We could not find any pure tip variant of FSGS. Occasional tip

type lesions were seen but all were associated with mixed perihilar and peripheral sclerosis hence all those were labelled as NOS type. Examination of serial sections of apparently perihilar, peripheral or a tip type lesion revealed mixed pattern of segmental sclerosis and hence was finally classified as NOS type. Age wise analysis showed that in all the age groups NOS variant was most common followed by perihilar and tip variant (Table-IV).

Focal mesangial cell proliferation was seen in 70.9% of NOS variety (Figure 1), 100% of the cellular variety (Figure 2d) and 11.11% of the perihilar variety. Focal GBM thickening was seen in only 29.03% cases of NOS

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Kumar et al.

A-17

Fig. 1: NOS variant of FSGS:- Segmental sclerosis in perihilar, peripheral and central region along with hyalinosis in tip area.

Focal mesangial proliferation is also noticed (Figure 1a, H&E X400). AFOG stain highlights sclerosis in various locations (Figure 1b, AFOG X400).

Fig. 2: Perihilar (a,b,c) & Cellular variant (d) of FSGS:- Segmental hyalinosis in perihilar area (Figure 2a, H&E,X400). One of the glomerulus showing moderate perihilar sclerosis along with tubular atrophy, interstitial mononuclear infiltrate and fibrosis (Figure 2b, H&E, X400). AFOG stain show deposits in sclerosed area and foam cells (Figure 2c, AFOG, X400). Cellular variant of FSGS show diffuse endocapillary proliferation and segmental sclerosis (Figure 2d, H&E, X400).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-18

Focal Segmental Glomerulosclerosis

Table IV: Distribution of various types of FSGS in different age groups AGE (IN YEARS)

TOTAL NUMBER OF CASES

TYPES OF FSGS No

<16

8

5

16-30

24

31-40 41-50 >51

NOS

PERIHILAR

CELLULAR

COLLAPSING

%

No

%

No

%

No

%

62.5

2

25

1

12.5

0

0

15

62.5

4

16.67

4

16.67

0

0

4

3

75.0

1

25.0

0

0

0

0

4

3

75.0

1

25.0

0

0

0

0

7

5

71.43

1

14.29

1

14.29

0

0

47

31

65.90

9

19.15

6

12.77

1

2.13

type. Hyaline thrombi in the capillary loops were seen in 33.33% cases of Perihilar type, 19.43% of NOS and 16.66% of cellular types respectively. Interstitial lymphoid aggregates were seen in 22.22% of perihilar type and 9.74% cases of NOS type. Non- caseating epithelioid cell granulomas were also seen in 8 cases (17.02%) and these were more common in Perihilar type (22.22%) followed by cellular (16.66%) and NOS (16.12%) types. Interstitial fibrosis was more common in perihilar type (77.77%, Figure 2b) followed by NOS type (61.21%) and cellular type (16.66%). Hyaline thickening of small & medium sized blood vessels were mostly seen in NOS (61.21%) and perihilar type (44.44%). Vasculitis was most commonly seen in NOS variant (12.88%)(Table-V).

AFOG stain showed red deposits in the mesangium in 33 cases (70.21%, Figure 2c). DIF was done in 7 cases only.

Heavy IgM with weak C3 mesangial deposit in 4 cases and weak IgM & C3 mesangial deposit in 3 cases were noted.

In addition, weak mesangial Ig A deposit in 4 cases, focal IgG deposit in 2 cases and scanty C4 deposit in 1 case were also identified.

Discussion FSGS is a leading cause of nephrotic syndrome and histologically characterised by demonstration of segmental sclerosis in a glomerulus. FSGS could be either primary or secondary. Primary FSGS occur due to molecular defects in various genes, leading to disturbance in podocytic and non podocytic protein, [10-14] however exact pathogenesis of secondary FSGS is not fully understood. Ferrario et al. proposed that all the three intrinsic cells of glomerulus, like epithelial cells, mesangial cells and endothelial cells take part in sclerosis.[17] According to their hypothesis epithelial cells get hypertrophied and produce proteinuria as well as adhesions, and proliferated mesangial cells secrete more extracellular matrix (ECM) and decrease ECM catabolism which is responsible for glomerulosclerosis. An injury to the endothelial cell also leads to platelet and fibrin

deposition and also stimulates mesangial cell proliferation with subsequent fibrous tissue formation.

Histologically, FSGS has been classified into five subtypes and there are various studies which have documented the incidence of the FSGS subtypes and their association with clinical features & prognosis. Similar to our study, Nada et al. also noted a male predominance in a ratio varying from 2.08:1 to 6:1 in various histological types of FSGS except perihilar variant where males and females were equally affected.[18] Das et al found nephrotic range proteinuria varying from 62.5% to 75% and hematuria ranging from 44.8% to 66% in various types of FSGS.[19] Almost similar to this, we also found nephrotic range proteinuria in 68.93% cases but microscopic hematuria was present in only 42.8% cases. None of the above two Indian studies mentioned about pyuria, while in present series 51.06% patients had pus cells in urine which was more than 6 per high power field. Some of the patients (10.63%) had even higher urinary pus cells up to 12/HPF. In the present series, most common histological type of FSGS was NOS type (65.95%) followed by Perihilar (19.14%), Cellular (12.77%) and collapsing (2.12%) types. We did not find pure tip lesion variant since it was associated with NOS type of FSGS. Frequency of various types of FSGS varies in different reported series. Nada et al[18] from India found high frequency of NOS (72.5%) followed by tip lesion (13.5%), cellular variant (8%), Perihilar (4%) and collapsing (2%) in a study of 210 cases within a period of 4 years. Another study from India by Das et al[19] have reported a lower frequency with NOS type being 44.6% followed by Perihilar 24.6%, collapsing 13.8%, tip lesion 12.3% and cellular type 4.6%. Reports from other countries also showed almost similar findings.

Shi et al, from China have found the NOS type being most common type which formed 55.9% cases. Interestingly, the tip lesion was next common type in their study with an incidence of 37% followed by cellular type 25.5%, Perihilar 69% and tip lesion 4.8%.[20]

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Kumar et al.

A-19

Table V: Histological findings of Renal biopsies of FSGS

Crescents ( %)

Hyaline clumps/ thrombi

Focal collapse

Periglomerular Fibrosis

Lymphoid Collection

Granulomas

Mononuclear cell infiltrate & Neutrophils

Focal fibrosis

Hyaline thickening

Fibromuscular hyperplasia

Vasculitis

Blood vessels

Focal GBM thickning (%)

Interstitium Endocapillary proliferation (%)

Glomeruli Mesangial proliferation (%)

Types of FSGS (number of cases)

NOS 31 (65.9)

22 (70.96)

–

9 (29.03)

–

6 (19.43) + 0

6 (19.34)

1 (3.22)

3 (9.74)

5 (16.12)

11 (35.48)

19 (61.21)

19 (61.21)

13 (41.27)

4 (12.88)

Perihilar 09(19.15)

1 (11.1)

–

–

1(11.1)

3 (33.33)

–

1 (11.11)

2 (22.22)

2 (22.22)

4 (44.44)

7 (77.77)

4 (44.44)

1 (11.11)

0

Cellular 06(12.77)

6 (100%)

6 (100%)

–

1 (16.66)

1 (16.66)

1 (16.66)

–

1 (16.66)

1 (16.66)

1 (16.66)

3 (50)

3 (50)

1 (16.66)

Collapsing 01(2.13)

0

0

–

0

0

0

0

0

1 (100)

0

1 (100)

0

0

0

Another study in African - American population has shown a predominance of NOS type of FSGS (44%) followed by cellular (32%) and Collapsing (24%) type. They did not find any cases of tip lesion or perihilar variant.[21] A multiethnic study done by two workers showed variable results. Strokes et al in their multiethnic study noticed that NOS type of FSGS to be more common (62.3%) followed by collapsing (23.7%), tip lesion (9.4%) and cellular (4.5%) variant. They did not find any case of Perihilar FSGS.[22] Contrary to it, another study done by Thomas et al in a multiethnic population found again higher prevalence of the NOS type followed by Perihilar (26%), tip lesion (17%) and collapsing (11%) type.[23] Some of the very recent studies have shown more pronounced frequency of NOS type. A study of 291 cases have found NOS variety in 77 %, tip variety in 13.7%, perihilar in 4.8%, collapsing in 3.4% and cellular in 1%.28 Like our study in their series most of the patients were also young adults with median age of 26 years and 25.4% patients were under 15 years of age.[24] In our study, 17% patients were below 16 years of age. A study conducted in Pakistan in children have shown again that 89% of FSGS is contributed by NOS type, 8% by collapsing type, 1.4% by tip variant, 0.7% by perihilar and 0.7% by cellular type.[25] Contrary to it, a study of 41 patients from Louisiana found low incidence of NOS (44%), followed by cellular (32%) and collapsing variant (24%).[21] Like us they also did not find any case of tip type of lesion.

significant increase of NOS variety in children between 2 to 12 years.[27] These differences may be because of subjective interpretations. In our opinion, multiple serial sections needs to be examined because a perihilar or tip lesion present in single slide often turned out to be NOS type of FSGS due to appearance of other variants of FSGS on serial sections. Secondly, Agatie’s classification system is not very clear about cellular type FSGS as similar lesion with endocapillary proliferation may be misdiagnosed as endocapillary GN in chronic phase rather than a pure cellular variety of FSGS. In our study all cases had patchy mononuclear cell infiltration in which 23.40% had very severe inflammatory infiltrate in the interstitium. In addition, non-caseating epithelioid cell granulomas and neutrophil were also noted in 17.02% & 36.17% cases respectively. About 70.96% of glomerular lesions of NOS type and all the cases of cellular type revealed focal segmental mesangial cell proliferation.

This may suggest that the glomerular lesions of FSGS in these cases are most likely due to sclerosis of proliferating lesions of chronic tubulo-interstitial nephritis which gives rise to secondary immune complex formation leading to focal mesangial cell proliferation and then scarring.

Analysis of age wise distribution of various types of FSGS revealed that NOS variety was most frequent in all age group, followed by perihilar variant, but there was no significant variation in the frequency of various types of FSGS in different age groups. Like us, other study also did not find significant association of FSGS subtypes with age of the patients.[26] Contrary to it some worker found

One of our earlier study (Usha et al, 2008) has found that about 10% renal biopsy shows mesangioproliferative GN[28] and other study have found that 20% biopsy diagnosed as MCGN show focal mesangial cell proliferation.[29] Probably these focal proliferative lesions got sclerosed and produce FSGS. Floege et al. proposed that glomerular cell proliferation and expression of platelet derived growth factor precedes FSGS.[30] Focal segmental mesangial cell proliferation is also found in IgM nephropathy. IgM and C3 have been demonstrated in segmentally sclerosed glomeruli of all types of FSGS by immunofluorescence study.[31,32] In present study, AFOG stain revealed mesangial deposits in

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-20

Focal Segmental Glomerulosclerosis

>70% cases and DIF showed IgM deposits in mesangium in all the seven cases.

Conclusion Concluding our study, we found NOS type being most common variant of FSGS followed by perihilar in all the age groups. It is important to examine serial sections of each case before morphological subtyping of FSGS. There are various associated histopathological findings in different FSGS. In view of findings of various special stain including DIF, and interstitial inflammation, we may suggest that primary FSGS is not a distinct entity; instead it may be secondary to various chronic renal diseases like IgM nephropathy or mesangioproliferative GN or focal proliferative GN or may be secondary to chronic tubulointerstitial nephritis & pyelonephritis.

Acknowledgements We are thankful to our technical staff Mr. Saroj Kumar Mukharjee, Miss Rajosari Das for technical support.

Funding None

Competing Interests None declared

Reference

1. Beaufils H, Alphonse JC, Guedon J, Legrain M: Focal glomerulosclerosis: natural history and treatment.

Report of 70 cases. Nephron. 1978; 21:75-85.

2. Magil AB: Focal and segmental glomerulosclerosis.

Mod Pathol 1991; 4:383-391.

8. Koziell A, Grech V, Hussain S, Lee G, Lenkkeri U, Tryggvason K, Scambler P. Genotype/phenotype correlations of NPHS1 and NPHS2 mutations in nephrotic syndrome advocate a functional interrelationship in glomerular filtration. Human Molecular Genetics.2002;11(4):379-388.

9. Weins A, Kenlan P, HerbertS, Le TC, Villegas I, Kaplan B S, Pollak M R. Mutational and biological analysis of α-actinin-4 in focal segmental glomerulosclerosis. Journal of the American Society of Nephrology.2005;16(12):3694-3701.

10. Winn MP, Conlon PJ, Lynn KL, Farrington MK, Creazzo T, Hawkins AF, Rosenberg PB. A mutation in the TRPC6 cation channel causes familial focal segmental glomerulosclerosis. Science.

2005;308:1801-1804.

11. Pollak MR. The genetic basis of FSGS and steroidresistant nephrosis. In Seminars in nephrology.

2003; (Vol. 23, No. 2, pp. 141-146). WB Saunders.

12. Reiser J, Polu KR, Moller CC, Kenlan P, Altintas MM, Wei C, Pollak MR. TRPC6 is a glomerular slit diaphragm-associated channel required for normal renal function. Nature genetics,2005; 37: 739-44.

13. Hinkes B, Wiggins RC, Gbadegesin R, Vlangos CN, Seelow D, Nurnberg G, Hildebrandt F. Positional cloning uncovers mutations in PLCE1 responsible for a nephrotic syndrome variant that may be reversible. Nature genetics. 2006;38(12):1397-1405.

3. Mongeau JG, Robitaille PO, Glermont MJ, Merovani A, Russo P: Focal segmental glomerulosclerosis (FSG) 20 years later. From toddler to grown-up. Clin Nephrol. 1993; 40:1-6.

14. Diomedi-Camassei F, Di Giandomenico S, Santorelli FM, Caridi G, Piemonte F, Montini G, Emma, F. COQ2 nephropathy: a newly described inherited mitochondriopathy with primary renal involvement. Journal of the American Society of Nephrology. 2007;18(10): 2773-2780.

4. Nachmann PH, Jennett JC, Folk RJ: In Brenner and Rector’s: The kidney. Tal MW, Yu ASL, Chertow. 9th edition,Elsevier Saundus. 2012, 1111-1121.

15. D’Agati V. Pathologic classification of focal segmental glomerulosclerosis. In Seminars in nephrology.

2003; (Vol. 23, No. 2, pp. 117-134). WB Saunders.

5. D’Agati VD, Fogo A B, Bruijn JA, Jennette JC. Pathologic classification of focal segmental glomerulosclerosis: a working proposal.American journal of kidney diseases. 2004; 43(2):368-382.

16. Zollinger HU, Mihatsch MJ: Renal Pathology in Biopsy: Light, Electron and Immunofluorescent Microscopy and Clinical Aspects. 1st edition. Springer Verlag Berlin Heidelberg New York. 1978:8-17.

6. Rennke H, Klein PS. Pathogenesis and significance of non primary focal and segmental glomerulosclerosis.

Am J Kidney Dis 1989;13:443-55.

17. Ferrario F, Rastaldi MP, Pasi A. Secondary focal and segmental glomerulosclerosis, Nephrology Dialysis Transplantation. 1999;14(SUPPL. 3):58-67.

Franceschini N, North KE, Kopp J B, Mckenzie L, Winkler C. NPHS2 gene, nephrotic syndrome and focal segmental glomerulosclerosis: a HuGE review. Genetics in Medicine. 2006;8(2):63-75.

18. Nada R, Kharbanda JK, Bhatti A, Minz RW, Sakhuja V, Joshi K. Primary focal segmental glomerulosclerosis in adults: is the Indian cohort different?.Nephrology Dialysis Transplantation.2009; 24(12): 3701-3707.

7.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Kumar et al.

A-21

19. Das P, Sharma A, Gupta R, Agarwal SK, Bagga A, Dinda AK. Histomorphological classification of focal segmental glomerulosclerosis: A critical evaluation of clinical, histologic and morphometric features. Saudi Journal of Kidney Diseases and Transplantation.2012; 23(5):1008.

20. Shi SF, Wang SX, Zhang YK, Zhao MH, Zou WZ.Clinicopathologic study of different variants of focal segmental glomerulosclerosis. Chinese journal of pathology. 2007;36(1):11-14.

21. Silverstein DM, Craver R. Presenting features and short-term outcome according to pathologic variant in childhood primary focal segmental glomerulosclerosis. Clinical Journal of the American Society of Nephrology, 2007; 2(4): 700-707.

22. Stokes MB, Markowitz GS, Lin J, Valeri AM, D’AGATI. Glomerular tip lesion: a distinct entity within the minimal change disease/focal segmental glomerulosclerosis spectrum. Kidney international.

2004;65(5):1690-1702.

23. Thomas DB, Franceschini N, Hogan SL, Ten Holder S, Jennette CE, Falk RJ, Jennette JC. Clinical and pathologic characteristics of focal segmental glomerulosclerosis pathologic variants. Kidney international.2006;69(5):920-926.

24. Arias LF, Jiménez CA, Arroyave MJ. Histologic variants of primary focal segmental glomerulosclerosis: presentation and outcome. Jornal Brasileiro de Nefrologia.2013; 35(2):112-119.

25. Shakeel S, Mubarak M, Kazi JI. Frequency and clinic-pathological correlations of histopathological variants of pediatric idiopathic focal segmental glomerulosclerosis. Indian Journal of Nephrology.

2014;24(3):148.

26. Taneda S, Honda K, Uchida K, Nitta K, Yumura W, Oda H, Nagata M. Histological heterogeneity of glomerular segmental lesions in focal segmental glomerulosclerosis. International urology and nephrology.2012; 44(1):183-196.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

27. D’Agati VD, Alster JM, Jennette JC, Thomas DB, Pullman J et al. Association of Histologic Variants in FSGS Clinical Trial with Presenting Features and Outcomes. Clin J Am Soc Nephrol. 2012; doi: 10.2215/cjn.06100612 28. Usha, Kumar S, Singh RG, Tapas S, Prakash J, Garbyal RS. Mesangioproliferative glomerulonephritis: an important glomerulonephritis in nephrotic syndrome of young adult. Indian J Pathol Microbiol.2008; 51:337–341 29. Waldherr R, Gubler ME, Levy M, Broyer M, Habib R. The significance of pure diffuse mesangial proliferation in idiopathic nephrotic syndrome. Clin Nephrol 1978;10:171-9.

30. Floege J, Eng E, Yound BA, Couser WG, Johnson RJ. Heparin suppresses mesangial cell proliferation and matrix expansion in experimental glomerulonephritis.

Kidney Int 1993;43:369-80.

31. Gubler MC, Waldherr R, Levy M, et al. Idiopathic nephrotic syndrome with focal and segmental sclerosis and/or hyalinosis: Clinical course response to therapy, and long-term outcome. In: Strauss J, ed.

Nephrotic Syndrome: Current Concepts in Diagnosis and Management. New York: Garland, 1979:193.

32. Gephardt GN, Tubbs RR, Popowniak KL, McMahon JT. Focal and segmental glomerulosclerosis: Immunohistologic study of 20 renal biopsy specimens.

Arch Pathol Lab Med 1986;110:902.

Original Article Viral Etiology and Assessment of HBV Genotypes in Fulminant Hepatic Failure: The Present Scenario Sami Hiba1* , Rizvi Meher2, Azam Mohd2, Ajmal MR3, Shukla Indu2, Khan Haris M2 1

Department of Microbiology, Shri Ram Murti Smarak Institute of Medical Sciences, Bhojipura, Bareilly, U P, India 2Department of Microbiology, Jawaharlal Nehru Medical College, Aligarh Muslim University, Aligarh 3 Department of Medicine, Jawaharlal Nehru Medical College, Aligarh Muslim University, Aligarh Keywords: Fulminant hepatic failure, Genotype D, HAV. HCV, HEV.

ABSTRACT Background: Fulminant hepatic failure (FHF) is defined as the rapid development of acute liver injury with severe impairment of synthetic functions and hepatic encephalopathy in patients without obvious previous liver disease. The present study was carried out to evaluate the etiology of FHF on one hand and to assess the role of HBV genotypes in acute liver failure in India on the other hand.

Methods: The patients who developed fulminant hepatic failure (FHF) were screened for HAV, HBV, HCV, HEV and HIV and Hepatitis B Core IgM, HBeAg, anti-HBs and anti-HBe were assessed. HBV genotyping was performed using Kirschbergâ&#x20AC;&#x2122;s type specific primers (TSP-PCR), heminested PCR, and Naitoâ&#x20AC;&#x2122;s monoplex PCR. SEN and TTV viruses were detected in Non-A to Non-E hepatitis (NANEH).

Results: Majority of FHF were detected in HBV 13 (38.2%) followed by 12 (35.3%) HEV. There were 8(23.5%) cases of NANEH. 3(0.88%) and 1(0.29%) of the NANEH cases were positive for SEN and TTV viruses respectively.

Genotype D was the most prevalent HBV genotype 7(55.55%) followed by genotype F 2(15.38%) and genotype A (7.69%).

Conclusion: FHF continues to be a major challenge for the clinician because of its high mortality rate and the requirement for a multidisciplinary approach.

*Corresponding author: Dr. Hiba Sami, M.B.B.S., MD (Microbiology) Assistant Professor, SRMSIMS, Bareilly UP, India Phone: +91 7895239786

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Sami et al.

A-23

Introduction Fulminant hepatic failure (FHF) or acute liver failure (ALF) is defined as the rapid development of acute liver injury with severe impairment of synthetic functions and hepatic encephalopathy in patients without obvious previous liver disease. The aetiology of ALF has a wide geographic variation.[1] In the West, acetaminophen overdose, non-A non-E hepatitis (NANEH) and idiosyncratic drug reactions constitute the bulk of cases.[2] In developing countries, on the other hand, hepatotropic viruses- hepatitis A or hepatitis B in the Far East [3] and hepatitis E in India and Bangladesh [4] seems to be the dominant cause. The most important aetiological cause of ALF in the Indian subcontinent is hepatitis E virus (HEV).[5] HEV has a high predilection for pregnant women.[6] The pathogenesis leading to the development of fulminant hepatitis B (FHB) is still being investigated. Although enhanced replication of the hepatitis virus [7] and an exuberant immune response by the host [8] are considered to be the main cause, various issues are not fully understood.

Approximately half of all acute HBV infections are subclinical. At the opposite range of the scale, the fulminant cases constitute less than 1% of acute hepatitis B (AHB) infections. Genetic analysis of HBV has shown there to be six different genotypes, A to F, based on an intergroup divergence in nucleotide sequence of 8% or more.[9] Following reports of outbreaks of fulminant hepatitis B (FHB), it has been suggested that HBV genotypes may be associated with the development of fulminant disease .[10] The present study was carried out to evaluate the etiology of FHF on one hand and to assess the role of HBV genotypes in acute liver failure in India on the other hand.

Material and Methods The study was conducted over a period of one and a half years from January 2011 to November 2012 in the Department of Microbiology, J.N. Medical College, A.M.U., Aligarh. During this period 225 cases of acute hepatitis presented to our facility amongst which 34 cases developed fulminant hepatic failure (FHF) and were recruited. Detailed history was elicited and rigorous physical examination was conducted on all the patients.

The study was conducted after obtaining permission from institutional ethics committee of J.N. Medical College and the procedure followed in the study was in accordance with institutional guidelines and informed consent was obtained from all the patients before including them in the study.

the onset of jaundice by 1-2 weeks (e.g. anorexia, nausea, vomiting, and fatigue), fever, an onset of clinical jaundice, diminished constitutional prodromal symptoms, hepatomegaly, jaundice, hyperbilirubinemia (>17 mol/l), serum amino alanine transaminase (ALT), and aspartate amino transferase (AST) at least fivefold greater than normal, HBsAg (+), anti-HBc IgM (+), anti-HBc IgG ( - ) , anti-HBs ( - ). b) Fulminant Hepatic failure/Hepatic encephalopathy: The diagnosis of FHF/ALF was made if encephalopathy developed within 8 weeks of the onset of symptoms of liver disease, in a patient with no prior known liver disease. [11] The diagnosis and grading of complications of FHF were made on standard criteria. [12] All variables included in determining the prognosis were those recorded at presentation. For complications namely cerebral oedema, renal failure and gastrointestinal bleeding, findings recorded within 48 h of hospitalization were included for analysis. c) Non-A to Non-E hepatitis (NANEH): It was diagnosed in a patient with: (I) clinical, biochemical and histological features of acute hepatitis, (II) absence of acute viral markers of known hepatitis viruses (Aâ&#x20AC;&#x201C; E), (III) no exposure to drugs, hepatotoxins, systemic infections, biliary obstruction/infection and metabolic liver diseases.

Exclusion criteria: Patients with autoimmune hepatitis, alcoholic hepatitis, drug induced hepatitis, human immunodeficiency virus co-infection, patients giving history of recent infection, surgery, trauma within the preceding two months, renal insufficiency or with other acute or chronic inflammatory diseases were excluded from this study. None of the participants had received any antiviral or immunosuppressive therapy before or during the course of this study.

Collection of specimen: For all serological assays, venous blood samples were obtained after taking an informed consent. After centrifugation the serum was stored at -40 Ě&#x160;C until used for study.

a Acute hepatitis B was defined as a condition associated with prodromal symptoms preceding

Routine Investigations: Liver function tests (LFT) like serum amino alanine transaminase (ALT), serum aspartate amino transferase (AST) and alkaline phosphatase (ALP), bilirubin (direct & indirect) total bilirubin, albumin, globulin, creatinine and international normalized ratio for prothrombin time were performed. Specific investigations like ultrasonographic examination of liver, upper GI endoscopy and liver biopsy were performed wherever feasible.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Patients positive for HBV were re-grouped as follows:

The Present Scenario

A-24 Serological investigations: All patients with hepatitis were screened for HAV (Hepatitis A virus), HBV (Hepatitis B virus), HCV (Hepatitis C virus), HEV (Hepatitis E virus) and HIV by commercially available ELISA kits: HBsAg, third generation anti-HCV, fourth generation antiHIV (J. Mitra & Co. Pvt. Ltd., India), anti-HAV IgM and anti HEV IgM (DRG International,Inc.,USA). HBc lgM antibodies were tested in HBsAg positive samples using DRG Anti- Hepatitis B Core IgM Antigen ELISA kit, (DRG International Inc., USA).The tests were performed according to the manufacturer’s instructions.

Genotyping of HBV: HBV positive cases were genotyped.

DNA was extracted from 100 μL serum by phenol chloroform extraction method. A 125 base pair sequence of the surface gene of HBV was amplified using a thermal cycler (Labnics, USA). A genotyping system based on PCR using type-specific primers was used in this study for the determination of genotypes D of hepatitis B virus according to previously described methods by Kirschberg et al. [13] Heminested PCR was performed on all the sera which could not be genotyped by the above method. Samples which could not be identified by heminested PCR were subjected to monoplex PCR using the method of Naito et al.[14] In brief, 10 ml of extracted DNA was subjected to 40 cycles of first round PCR using primers 5’-TCA CCA TAT TCT TGG GAACAA GA-3’ (nt 2823 2845, universal, sense) and 5’- CGA ACC ACT GAA CAA ATG GC-3’ (nt 685-704, universal, antisense) amplifying a 1063 bp region of S gene [14]. TSP-PCR was performed in two separate mixes A and B utilizing 1 ml of 1st round PCR product and subjecting to two rounds PCR cycles (20 cycles each) as described by Naito et al. [14] In mix A, primers specific for genotype A (5’-CTC GCG GAG ATT GAC GAG ATG T-3’ nt 113-134, type A specific, antisense), genotype B (5’-CAG GTT GGT GAG TGA CTG GAG A-3’ nt 324-345, type B specific, antisense), genotype C (5’-GGT CCT AGG AAT CCT GAT GTT G-3’ nt 165-186, type C specific, antisense) and a common universal sense primer (5’-GGC TCA AGT TCA GGA ACA GT-3’ nt 67-86, types A to C specific, sense) were used.

In the mix B a common antisense primer (5’-GGA GGC GGA TCT GCT GGC AA-3’ nt 3078-3097, specific for types D to F, antisense) along with genotype specific primer D (5’-GCC AAC AAG GTAGGA GCT-3’ nt 29792996, type D specific, sense), E (5’-CAC CAG AAA TCC AGA TTG GGA CCA-3’ nt 2955-2978, type E specific, sense), and F (52 –GTT ACG GTC CAG GGT TCA CA-3 nt 3032-3051, type F specific, sense) were used. Mix A

allowed for the specific detection of PCR products for types A (68 bp), B (281 bp), and C (122 bp), and mix B allowed for detection of types D (119 bp), E (167 bp), and F (97 bp).

SEN and TTV viruses were looked for in all Non-A to Non-E hepatitis (NANEH) by the following method: Detection of SEN virus: SEN virus DNA (349 bp) was detected using nested-PCR procedures standardized for the detection of specific sequences for SEN virus and its genotypes SENV-D (193bp) and SENV-H (118bp).

[15] The primer sequence are as follows: SENV common primers: SP15’TWCYCMAACGACCAGCTAGACCT3’, SP25’GTTTGTGGTGAGCAGAACGGA3’; SENV-D primers: SP35’CTAAGCAGCCCTAACACTCATCCAG-3’, SP45’GCAGTTGACCGCAAAGTTACAAGAG3’; SENV-H primers: SP55’TTTGGCTGCACCTTCTGGTT3’, SP65’ AGAAATGATGGGTGAGTGTTAGGG3’, where W=A/T, Y=C/T, and M=A/C. The outer PCR for SENV was carried out with a reaction mixture consisting of 12.5 ìl of 2x PCR master mix (MBI Fermentas, USA) containing 0.05 units/ìl Taq DNA polymerase in reaction buffer; PCR buffer consisting of 4 mM MgCl2, 0.4 mM dATP, 0.4 mM dCTP, 0.4 mM dGTP and 0.4 mM dTTP, 5 pmol concentration of SP1 and SP2 primers and 5 µl DNA sample. The reactions consisted of preheating at 94ºC for 4 min, 40 cycles of denaturation at 94 ºC for 15 sec, annealing at 55ºC for 50 sec, extension at 72ºC for 50 sec, and a final extension at 72ºC for 7 min.

The first nested PCR for SENV-D was carried out with the same reaction mixture with SP3 and SP4 primers and 5 ìl of the outer PCR product. The second nested PCR for SENV-H was carried out with the same reaction mixture used as above with SP5 and SP6 primers and 5 ìl of the outer PCR product. Cycling conditions for both SENV-D and SENV-H PCR were the same as for SEN-V. TTV DNA detection: 16S rRNA genes were targeted for amplification of TTV specific nucleic acid by nested PCR. Primers were synthesized from Operon, Germany (Genetix). The first set of primers were N S 1 5 ’ - G G G T G C C G A A G G T G A G T T TA C - 3 ’ , NS2-5’GCGGGGCACGAAGCACAGAAG-3’ while the second set of primers were: NS35’-AGTTTACACACCGAAGTCAAG-3’ and NS45’-AGCACAGAAGCAAGATGATTA-3’ as described by Biagini et al.[16] The first round PCR was carried out for 40 cycles with preheating at 96°C for 2 min, followed by each cycle consisting of denaturation at 94°C for 15 seconds, primer annealing at 55°C for 45 seconds and extension at

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Sami et al.

A-25

72°C for 45 seconds, followed by an additional extension at 72°C for 7 minutes in a solution containing primer NS1 (5 pmol), primer NS2 (5 pmol), DNA template (5 µl), nuclease free water (3 µl), and 2x PCR master mix (10 µl).

The second round PCR was carried out for 40 cycles, each cycle consisting of denaturation at 94°C for 15 seconds, primer annealing at 50°C for 45 seconds and extension at 72°C for 45 seconds, followed by an additional extension at 72°C for 7 minutes in a solution containing primer NS3 (5 pmol), NS4 (5 pmol), PCR product of round one (2 µl), nuclease free water (6 µl), 2x PCR master mix (10 µl). The 2x PCR master mix contained the reagents as described previously. The amplified PCR products (5 µl each) were subjected to electrophoresis and visualized under a gel documentation system (Biorad, USA).

Statistical analysis: Statistical analysis was performed with the IBM SPSS Statistics 19. Results were expressed as means ± standard deviation or as percentages. Means were compared between groups by using the t –test, ANOVA (one way analysis of variance) and frequency distributions were compared by using the chi- square test.

Results

The study group comprised of 34 FHF patients. In the two year period, majority of FHF were detected in HBV 13 (38.2%) followed by 12 (35.3%) HEV. Only one case was attributed to HCV.HAV was not associated with FHF. There were 8(23.5%) cases of NANEH (Figure 1). 3(0.88%) and 1(0.29%) of the NANEH cases were positive for SEN and TTV viruses respectively. Half of pregnant females with HEV had a fulminant outcome. The mortality rate was 30.8% in HBV and a higher 41.7% in HEV. Patients with HEV had higher grades of encephalopathy, Sepsis, renal failure and gastrointestinal bleeding was more often observed in HEV than in the non-HEV group.

Characteristics of the Fulminant Hepatitis B Patients: The clinical characteristics of the 13 FHB (Fulminant Hepatitis B) patients are shown in Table 1. The mean age was36.0 years (range, 29–71), and the ratio of male to female was 1.6 :1. The majority (61.5%) of patients were in the third decades of life. The mean peak total bilirubin was 18.5, the mean peak alanine aminotransferase was 200 IU/ml, and the mean lowest prothrombin time was 1.3.

Determination of HBV Genotype: In our study, genotype D was the most prevalent genotype, 7 (55.55%) in FHB patients (figure 2), followed by genotype F 2(15.38%) and genotype A (7.69%).3(23.07%) of the FHB samples were not typable. Although liver enzymes were highly elevated in all patients with FHF, genotype D had highest elevations in LFT followed by genotype A and F. In FHB patients, majority of patients who were HBeAg positive were older. Of the 7 genotype D cases, majority (71.42%) were HBeAg positive as against genotype F where 100% were HBeAg negative. This may indicate that apart from human immune response, viral factors of genotype D may also play a role in FHF.

Fig. 2: Agarose gel electrophoresis of HBV genotype D (using heminested PCR). PCR product of 147 bp.

Lane M:50 bp DNA ladder; lane NC: Negative Control; lane 11:postive control; lanes 3-10 samples; lanes 4,5,6,7,8,9,10:genotype D

Fig. 1

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

The Present Scenario

A-26

Table 1: Demographic profile, hepatitis B e antigen (HBeAg) status, and Biochemical profile of patients with Fulminant Hepatic Failure comparing different genotypes (n=13) Variable

Genotype D(n=7)

Genotype F(n=2)

Genotype A(n=1)

Nontypable (n=3)

Age, mean years ± SD

34.00± 17.5

50

40

30.5± 27.57

Ratio of male to female subjects

5:2

1:1

1:0

1:2

Complications Encephalopathy ARF Bleeding tendencies

3 (42.8%) 0 2 (28.6%)

1 (50%) 0 0

0 1 (100%) 1 (100%)

0 0 0

HBeAg positive, no(%)

5(71.4%)

0

1(100)

0

HBeAg negative, no(%)

2(28.5%)

2(100)

0

3(100)

ALT (IU/L) (Normal 2-15)

88.2± 81.99

12

60

110.5±48.7

AST (IU/L) (Normal 2-20)

82.8± 71.72

21

90

97±45.25

PT-INR (Normal 0.9-1.3)

3.3± 2.03

2.1

4.3

2.91± .83

MELD

26.4± 17.7

24

27

31.00± 2.82

Discussion:

The specific physiopathology of fulminant hepatic failure induced by viruses has not yet been well delineated, but some studies have suggested that the disease severity induced by these viruses may be related to genetic variability. [17] In this study, we determined the prevalence of different hepatitis viruses in patients of FHF. Hepatitis A was not associated with FHF in the present study. HAV is a ubiquitous agent in developing countries, is highly pathogenic and spreads through person-to-person transmission. The entire childhood population in such countries is exposed to HAV in the first 10 years of age and all adults are protected from HAV infection. [18] In fact, hepatitis A is a rare cause of acute viral hepatitis in adults in developing countries and the majority of HAV infections occur in children, with mild or anicteric disease. [19] The prevalence of HBV was found to be 38.2% in FHF and the mortality rate was 30.8%. The prevalence of HBV infection in previous reports of FHF has reportedly ranged from 10%-65%. [20] The mortality rate from FHF resulting from HBV has been reported to be as high as 61%-77%.[21] HCV infection was determined in 2.94% of our patients.

Hepatitis C is a rare cause of FHF in United States and Europe but a number of studies from Japan and India have found evidence of hepatitis C in the non-A, non-B group of patients. [22, 23] In our study, a high prevalence of HEV was observed (35.3%) in FHF cases which is similar to those found in other studies who reported 23-62% prevalence of HEV in the fulminant hepatic failure (FHF). [24, 25, 26]

Eight (23.5%) patients in the present study lacked acute markers of known hepatitis viruses and were classified as NANEH. SENV and TTV were found in 0.88% and 0.29% of NANEH patients. Previous studies from India have reported the existence of TTV other than A-G hepatitis viruses, causing liver diseases. [27, 28] SENV has been recently identified as a candidate agent of non A-E hepatitis virus.

[29] However, the exact role of this virus in the pathogenesis of chronic liver diseases, including chronic hepatitis and cirrhosis, and the development of hepatocellular carcinoma (HCC) remains to be verified. [30] FHB patients were further genotyped and assessed for their influence on disease severity. We found genotype D to be the most prevalent genotype followed by genotype F and genotype A. In our patients of FHB, mean LFTs in the patients with genotype D were raised five to six folds compared to normal whereas PT-INR and MELD were extremely high. HBeAg positivity was observed in 66.7 % of patients suggesting active replication in FHF patients.

Mean ALT and AST were higher in HBeAg negative patients than HBeAg positive patients.

There is a paucity of data on the clinical course of patients with genotypes other than B and C. One study from Spain reported that HBeAg seroconversion rates were similar in patients with genotypes A and D, but sustained biochemical and virological remission was more common in patients with genotype A who had HBeAg seroconversion. [30] Patients with genotype A also had a higher rate of HBsAg clearance. However, the need for liver transplantation and the deaths related to liver disease were comparable between patients with genotypes A and D. In this study,

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Sami et al.

A-27

patients with genotype D were more likely to die from liver disease than those with genotype F. The role of HBV genotype in FHB is controversial. [32] In a study from Japan, HBV genotype B was found more frequently in patients with acute forms of liver disease than in those with chronic liver disease, and more frequently in patients with fulminant hepatitis than in those with acute hepatitis.[33] These results suggested that HBV genotype B may induce more severe liver damage than other genotypes.

A study from USA showed that genotype D was more frequently found in ALF patients than in those with chronic HBV infection.[34] Based on these findings, it seems that the development of fulminant hepatitis is not clearly linked to a particular HBV genotype, and may merely reflect the predominance of certain genotypes in different populations as genotype D is the most predominant genotype in this part of North India. [35,36] However, further studies are needed to ascertain the effect of genotypes on fulminant outcome of HBV.

Conclusions

FHF continues to be a major challenge for the clinician because of its high mortality rate and the requirement for a multidisciplinary approach. HEV is a common cause of FHF in this region of North India HBV genotypes can be used to predict the course of fulminant hepatitis B.

Conflicts of interest No conflicts of interest.

References

1. Lee W, Sorrell M. Developing a world view toward acute liver failure. Hepatology. 1996; 24: 270–1.

2. Schiodt F, Rochling F, Casey D, Lee W. Acetaminophen toxicity in an urban county hospital. N Engl J Med. 1997; 337: 1112–7.

3. Trey C, Davidson C. Inc: Popper H, Schaffner F, editors. The management of fulminant hepatic failure. Progress in Liver Disease. 1970; Volume 3.

New York: Grune and Stratton: 282–98.

4. Vaquero J and Andres T. Etiology and management of fulminant hepatic failure. Current Gastroenterology Reports. 2003; 5:39–47.

5. Khuroo M. Acute liver failure in India. Hepatology.

1997; 26: 244–246.

6. Khuroo M, Teli M, Skidmore , Sofi M, Khuroo M. Incidence and severity of viral hepatitis in pregnancy.

Am J Med. 1981; 70: 252–255.

virus strain associated with fulminant hepatitis result in enhanced viral replication. J Clin Invest. 1996; 98: 2268–76.

8. Rivero M, Crespo J, Fabrega E, et al. Apoptosis mediated by the Fas system in the fulminant hepatitis by hepatitis B virus. J Viral Hepat. 2002; 9:107–13.

9. Norder H, Courouce A, Magnius L. Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology. 1994; 198:489–503.

10. Mahtab M, Rahman S, Khan M, Mamun A, Afroz S. Etiology of fulminant hepatic failure: Experience from a tertiary hospital in Bangladesh. Hepatobiliary Pancreat Dis Int. 2008; 7: 161–4.

11. Riordan S, Williams R. Treatment of hepatic encephalopathy. N Eng J Med. 1997; 337: 473–478.

12. Sherlock S, Dooley J. Diseases of the liver and biliary system, Oxford: Blackwell Scientific Publications; 1997: 9th edn.

13. O. Kirschberg, C. Schuttler, R. Repp, and S. Schaefer.

A multiplex-PCR to identify hepatitis B virus— genotypes A–F. Journal of Clinical Virology. 2004; 29: 39–43.

14. Naito H, Hayashi S, Abe K. Rapid and specific genotyping system for hepatitis B virus corresponding to six major genotypes by PCR using type-specific primers. J Clin Microbiol. 2001; 39: 362-4.

15. Tang Z, Chen X, Yu Y, Zang G. Prevalence and clinical significance of SEN virus infection in patients with non A-E hepatitis and volunteer blood donors in Shanghai. World J Gastroenterol. 2008; 14:4204–8.

16. Biagini P, Gallian P, Attoui H, Cantaloube J, de Micco P, de Lamballerie. Determination and phylogenetic analysis of partial sequences from TT virus isolates. J Gen Virol. 1999; 80:419–24.

17. Fujiwara K., Yokosuka O, Ehata T, et al. Association between severity of type A hepatitis and nucleotide variations in the 5’ non-translated region of hepatitis A virus RNA: strains from fulminant hepatitis have fewer nucleotide substitutions. Gut. 2002; 51: 82-8.

18. Khuroo M. Study of an epidemic of non-A, non-B hepatitis: possibility of another human hepatitis virus distinct from post-transfusion non-A, non-B type. Am J Med. 1980; 68: 818–823.

7. Baumert T, Rogers S, Hasegawa K, Liang T. Two core promotor mutations identified in a hepatitis B

19. Khuroo M, Rustgi V, Dawson G et al. Spectrum of hepatitisE virus in India. J Med Virol. 1994; 43: 281– 286.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-28

The Present Scenario

20. Schiodt F, Atillasoy E, Shakil O, Schiff E, Caldwell C, Kowdley K, Stribling R, et al.1999. Etiology and outcome for 295 patients with acute liver failure in the United States. Liver Transpl Surg. 1999; 5: 29 –34.

21. O’Grady J, Alexander G, Hayllar K, Williams R. Early indicators of prognosis in fulminant hepatic failure.

Gastroenterology. 1989; 97: 439 –445.

22. Farci P, Alter H, Shimoda A et al. Hepatitis C virusassociated fulminant hepatic failure. N Engl J Med. 1997; 335: 631–634.

23. Takahashi Y, Shimizu M. Aetiology and prognosis of fulminant viral hepatitis in Japan: a multicentric study.

J Gastroenterol Hepatol. 1991; 6: 159–164.

24. Nanda S, Yalchinkaya K, Panigrahi A, Acharya S, Jameel S, Panda S. Etiological role of hepatitis E virus in sporadic fulminant hepatitis. J Med Virol. 1994; 42: 133–137.

25. Nejdar S, Mitchell F, Biswas R. Simultaneous amplification and detection of specific hepatitis B virus and hepatitis C virus genomic sequences in serum samples. J Med Virol. 1994; 42: 212-6.

26. Tan D, IM S, Yao J, Ng M. Acute sporadic hepatitis E virus infection in Southern China. J Hepatology. 1995; 23: 239-45.

27. Irshad M, Chaudhuri P, Joshi Y. Superoxide dismutase and total anti-oxidant levels in various forms of liver diseases. Hepatol Res. 2002; 23: 178-184.

28. Rizvi Meher, Jahan Shafquat, Azam Mohd, Ajmal M.R, Shukla Indu, Malik Abida, et al. Prevalence and assessment of role of SEN virus in acute and chronic hepatitis in India. Tropical Gastroenterology. 2013; 34(4):227–234.

29. Umemura T, Yeo A, Sottini A, et al. SEN virus infection and its relation to transfusion-associated hepatitis. Hepatology. 2001; 33:1303–1311 30. Schroter M, Laufs R, Zollner B, Knodler B, Schafer P, Sterneck M, et al. Prevalence of SENV-H viraemia among healthy subjects and individuals at risk for parenterally transmitted diseases in Germany. J Viral Hepatology. 2002; 9: 455 – 459.

31. Sanchez-Tapias , Costa J, Mas A, Bruguera M, Rodes J. Influence of hepatitis B virus genotype on the long-term outcome of chronic hepatitis B in western patients. Gastroenterology. 2002; 123: 1848-1856.

32. Hou J, Lin Y, Waters J, et al. Detection and significance of a G1862T variant of hepatitis B virus in Chinese patients with fulminant hepatitis. J Gen Virol. 2002; 83:2291-8.

33. Imamura T, Yokosuka O, Kurihara T, et al. Distribution of hepatitis B viral genotypes and mutations in the core promoter and precore regions in acute forms of liver disease in patients from Chiba, Japan. Gut. 2003; 52:1630-7.

34. Wai C, Fontana R, Polson J, et al. The US Acute Liver Failure Study Group. Clinical outcome and virologic characteristics of hepatitis B-related acute liver failure in the United States. J Viral Hepat. 2005; 12:192-8.

35. Sami Hiba, Rizvi Meher, Azam Mohd, et al. Emergence of Hepatitis B Virus Genotype F in Aligarh Region of North India. Advances in Virology. 2013: Article ID 846849, 8 pages.

36. Chattopadhyay S, Das B, Kar P. Hepatitis B virus genotypes in chronic liver disease patients from New Delhi, India. World J Gastroenterol. 2006; 12:6702-6706.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Original Article Seroprevalence of Co-Infections Among Blood Donors in A Blood Bank of A Tertiary Health Care Centre Ashwin. P. Khageshan1*, Keshav R. Kulkarni1, Mahesh. C. Baragundi2 1

2

Dept. of pathology, S.N. Medical College, Navangar, Bagalkot- Karnataka. India Dept of Microbiology, S.N. Medical College, Navangar, Bagalkot- Karnataka. India Key words: Co infection, HIV, HBV HCV, Malaria, Syphilis, Transfusion.

ABSTRACT Introduction: Transfusion transmissible infections (TTIs) like HIV, HBV, HCV, syphilis and malaria are major problems associated with blood transfusion practices. Because of shared modes of transmission, co-infection with HIV, HBV and HCV is a significant occurrence, particularly in areas where these viruses are endemic and even amongst apparently healthy subjects like blood donors. Hence the study was undertaken to analyze the prevalence and patterns of co-infections among voluntary and replacement donors in our geographical area Methods: The present study was carried out in Blood bank of S.N Medical College, Bagalkot from July 2012 to June 2013. Two ml of blood sample was collected in labeled pilot tube at the time of collection of blood from donor tubing of blood bag. Serum was separated. The samples were tested for HIV, HBV, HCV, Malaria and Syphilis.

Results: Out of the 8187 blood donors, 7461 (91.13%) were replacement donors and remaining 726 (8.87%) were voluntary donors. Co infection was seen in 8 (0.09%) donors.

Conclusion: Co infections are more common among replacement donors. Since co infected individuals are at greater risk of hepatotoxicity following treatment with antiviral drugs, care should be taken to detect all infections among otherwise healthy donors.

*Corresponding author: Dr. Ashwin .P. Khageshan, Associate professor, Dept. of pathology, S.N. Medical college, Navangar, Bagalkot- 587102 Karnataka. India Phone: +91 9448491499 Email: drashwinp@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-30

Co-Infections Among Blood Donors

Introduction Transfusion transmissible infections (TTIs) like HIV, HBV, HCV, syphilis and malaria are major problems associated with blood transfusion practices. Transfusion of blood and blood products, although being a life saving measure, still has far reaching consequences as far as the morbidity and mortality resulting from the transfusion of infected blood is concerned. With every unit of blood, there is 1% chance of TTIs.[1] Because of shared modes of transmission, co-infection with HIV, HBV and HCV is a significant occurrence, particularly in areas where these viruses are endemic and even amongst apparently healthy subjects like blood donors.[2] WHO recommends an integrated strategy to improve blood transfusion safety by establishment of well organized blood transfusion services, blood collection from voluntary non-remunerated donors, screening of blood for at least four major TTIs with quality assured system and rational use of blood.[3] As per National AIDS Control Organization (NACO), 3.5% of HIV infection is attributed to blood transfusion.[4] Although there are many studies on prevalence of TTIs in blood donors, data on the presence of co-infection with more than one TTIs is sparse.[5,6] Hence the study was undertaken to analyze the prevalence and patterns of co-infections among voluntary and replacement donors in our geographical area.

Material and Methods The present observational study was carried out in Blood bank of S.N Medical College, Bagalkot from July 2012 to June 2013. The study was approved by institutional ethical committee. The blood bank of department of pathology, S.N Medical College is licenced blood bank with average annual collection of 8000 units of blood from healthy blood donors from in and around Bagalkot annually.

Inclusion criteria: Any donor meeting all criteria’s for eligibility of blood donation as mentioned in SOP, Blood Bank, S. N .Medical College, Bagalkot.

Exclusion criteria: Any eligible donor having any kind of reaction during the blood donation procedure was excluded from the study.

Sample collection: Two ml of blood sample was collected in labeled pilot tube at the time of collection of blood from donor tubing of blood bag. The sample was centrifuged at 3500 rpm for 5 minutes to obtain clear non hemolyzed serum.

The samples were tested for HIV, HBV, HCV, Malaria and Syphilis. Screening test for HIV was done by rapid test – HIV tridot. (manufactured by – Diagnostic enterprises, HP,

India) and confirmed by MICROLISA- HIV Ag–Ab Elisa kit (J Mitra and Co. PVT. LTD. New Delhi, India.)

Screening Test for Hepatitis B was done by HEPACARD (J Mitra and Co. PVT. LTD. New Delhi. India.) and confirmed by HEPAELISA (J Mitra and Co. PVT. LTD. New Delhi, India.)

Screening test for HCV was done by rapid test –HCV tridot. (Diagnostic enterprises, HP,India) and confirmed by HCV – MICROELISA. (J Mitra and Co. PVT. LTD. New Delhi, India.)

Test for malaria was done by rapid antigen detection testPAN MALARIA CARD (J Mitra and Co. PVT. LTD. New Delhi, India.), which is a visual, rapid and sensitive immunoassay for the qualitative diagnosis of infection with all four Plasmodium Species (P. falciparum/P. vivax/ P. malariae/P. ovale) in human whole blood .

Test for Syphilis was done by rapid test- RPR test by carbogen kit(Tulip diagnostics PVT LTD, India) along with positive and negative controls.

Those with combination of ≥2 TTIs were labeled as coinfection.

RESULTS: Table-1 shows, type of blood donors. Out of the 8187 blood donors, 7461 (91.13%) were replacement donors and remaining 726 (8.87%) were voluntary donors.

In the present study HIV reactivity was seen in 32 (0.39%) of donors. Similarly 238 (2.9%) were positive for HBV infection, 17 (0.20%) were positive for HCV infection, 4 (0.04%) were positive for syphilis infection, 4 (0.04%) were positive for malaria infection. Table-2 shows, co infection among donors.

Table-1: Showing Type of blood donors Type of donor

Percentage

Voluntary

No. of screened blood units 726

Replacement

7461

91.13%

Total

8187

100%

8.87%

Table- 2: Co infection among donors Co-infection

Voluntary donors Replacement donors

HIV+Syphilis HIV+HBV HBV+ Syphilis HBV+Malaria Total

0 0 0 0 0

1 (0.012%) 1 (0.012%) 3 (0.036%) 3 (0.036%) 8 (0.09%)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Khageshan et al.

Co infection was seen in 8 (0.09%) donors. HIV and syphilis co infection was seen in 1(0.012%) donor. HIV and HBV co infection was seen in 1(0.012%) donor. HBV and syphilis co infection was seen in 3(0.036%) donors.

HBV and malaria co infection was seen in 3(0.036%) donors. No HIV and HCV, HBV and HCV co infections were seen in the present study.

Discussion TTI’s continue to be a great threat to safe transfusion practices. Many factors favor co infection including high degree of epidemiological similarity between their mode of transmission.

Worldwide, HBV accounts for an estimated 370 million chronic infections, HCV for an estimated 130 million, and HIV for an estimated 40 million cases. In HIV infected persons an estimated 2-4 million have chronic HBV infection and 4-5 million have HCV co infection.[7] Syphilis being a sexually transmitted disease, its presence points towards indulgence in high risk behavior and consequently higher risk of exposure to infections like HIV, HBV and HCV. [8] Majority of donors in the present study were replacement donors (91.13%). The finding is in concordance with other studies. [9,10,11] Very few studies have been conducted in India on co infection among blood donors. In the present study co infection was seen in 8 (0.09%) donors. Similar to present study co infection was seen in 0.02% donors in Charan S.K. study [12] and 0.05% donors in Kaur G et al study. [13]

A-31 of HIV and HCV co infections and 11.4% HIV and HBV co infections among blood donors.

HIV and HBV co infection is reported in 0.8% by Mercy KA et al,[19] in 0.4% by Egah et al [20] and in 0.5% by Oladele et al. [21] HIV, HBV and syphilis co infection was seen in 2.8% of co infection patients by Dorga S et al.[18] Among four syphilis cases in the present study, 3 were co infected with HBV and one with HIV which could be because, syphilis can increase the susceptibility to other sexually transmitted diseases.

TTIs can be reduced by proper donor screening. In resource limited settings testing for most common infection in that geographical area should be done first followed by other common infections so that if one test turns out to be positive, other tests can be omitted and tests should be carried out before collection of blood on 2ml sample blood, so that collection of infected blood and wastage of blood bags can be minimized.

To conclude co infections are more common among replacement donors which could be due to concealing of high risk behavior and paid donors posing as relatives.

Promotion of voluntary donors would reduce the risk of TTIs. Since co infected individuals are at greater risk of hepatotoxicity following treatment with antiviral drugs, care should be taken to detect all infections among otherwise healthy donors.

References

In the present study, no HCV co infections were seen but Dorga S et al [18] have reported maximum number (34.2%)

1. Singh B, Kataria SP, Gupta R. Infectious markers in blood donors of east Delhi: Prevalence and trends.

Indian J Pathol Microbiol 2004;47:477-9.

2. Zaraski JP, Bohn B, Bastie A, Pawlotsky JM, Baud M, Bost B. Characteristics of patients with dual infection by hepatitis B and C viruses. J Hepatol. 1998;28:27-33.

3. National Blood Policy 2007, National Aid Control Organization, Ministry of Health & Family Welfare, Government of India. Available from: www.naco.nic. in. Accessed 12-03-2013.

4. Country Scenario – an update; National Aids Control Programme India, December 1996.

5. Mathai J, Sulochana PV, Satyabhama S, Nair PK, Sivakumar S. Profile of transfusion transmissible infections an associated risk factors among blood donors of Kerala. Indian J Pathol Microbiol 2002; 45:319–22.

6. Nanu A, Sharma SP, Chatterjee K, Jyoti P. Markers for transfusion-transmissible infections in north Indian voluntary and replacement blood donors: Prevalence and trends 1989–1996. Vox Sang 1997; 73:70–3.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

In the present study all the co infection donors were replacement donors, which is similar to Dorgam et al [14] and Kaur G study [13] who found co infection more among replacement donors.

This finding is in agreement with World Health Organization suggestion that, commercially remunerated donors and family replacement donors are more likely to transmit TTIs than voluntary donors.[15] A person in need of money is more likely to conceal his/her true state of health.

Kapur and Mittal have reported, among HIV positive donors, HBV positivity in 12.2% and Syphilis reactivity in 11.8% .[16] Dorga M et al have reported, among HIV seropositive donors, there was one(16.66%) sero reactive case for HCV.[14] Jain et al estimated the seroprevalance of hepatitis virus in patients infected with HIV and found that 9.9% of patients were HBs Ag positive, 6.3% were HCV positive and 1% had dual infection with HCV &HBV. [17]

A-32

Co-Infections Among Blood Donors

7. Alter MJ. Epidemiology of viral hepatitis and HIV co infection. J Hepatol 2006;44:S6-9.

8. Kaur P, Basu S. Transfusion transmitted infection: existing and emerging pathogens. J Postgrad Med 2005;51:146-51.

9. Kaur H, Sharma M, Mannan R, Manjari M, Chandey M, Madan M. Seroprevalence of HIV, Hepatitis B, Hepatitis C and Syphilis co infections among Donors in Tertiary Care Blood Bank, Punjab. Int J Den Med Res 2015; 5: 45-47.

10. Kochhar AK, Singh K, Kochhar SK. A Study To Assess Trend In Seroprevalence Of Hepatitis B Virus Infection Among Blood Donors Of Southern Haryana, India. The Internet Journal of Pathology [Internet] 2012;13(2): Available from: doi: 10.5580/2B93.

11. Singh B, Kataria SP, Gupta R. Infectious markers in blood donors of East Delhi: prevalence and trends.

Indian J Pathol Microbiol. 2004; 47: 477-9.

12. Chavan SK, Chavan KB. Seroprevalence, trend of transfusion transmittable infections and co-infections rate among blood donors at tertiary care hospital â&#x20AC;&#x201C; 10 years study. Int J Res Health Sci 2014;2: 1014-20.

13. Kaur G, Basu S, Kaur R, Kaur P, Garg S. Patterns of infections among blood donors in a tertiary care centre: A retrospective study. Nat Med J India 2010; 23: 147-149.

14. Dogra M , Dogra A, Sidhu M, Kotwal U. Seroprevalence of coinfections among blood donors in tertiary health care centre of Jammu region. Ind J Med Microbiol.2015; 33: 181-182.

15. World Health Organisation (WHO). Blood safety strategy for the African Region. Brazzaville, World Health Organisation, Regional office for Africa (WHO/AFR/RC51/9 rev 1). 2002.

16. Kapur S, Mittal A. Incidence of HIV infection and its predictors in blood donors in Delhi. Indian J Med Res 1998;108:45â&#x20AC;&#x201C;50.

17. Jain M, Chakravarti A, Verma V, Bhalla P. Seroprevalence of hepatitis viruses in patients infected with the human immunodeficiency virus. Indian J Pathol Microbiol 2009;52:17-9.

18. Dogra S, Gupta O, Singh M.S, Rawat S.S. Seroprevalence of transfusion transmissible infections and co-infections among blood donors in a tertiary care hospital of the capital: three and half year study. Int J Recent trends in Sci and Technol.2014; 12: 105-109.

19. Mercy K.A, Ijeoma I, Emmanuel K.J, Nwanyibuaku N.G. Prevalence of Hepatitis B and human immunodeficiency virus co-infection among blood donors in Abia State University teaching hospital, Aba, South East, Nigeria. Int.J.Curr.Microbiol.App. Sci 2015; 4(3): 762-768.

20. Egah DZ, Banwat, EB, Audu ES, Iya DM, Mamdong BM, Awele AA and Gomwalk NE. Hepatitis B surface antigen, Hepatitis C and HIV antibodies in a low risk blood donor group, Nigeria. East Med Health J 2007; 13:211-215.

21. Oladele OO, Adesina TB, Omolola ZT, Sunday ST. Prevalence of HBsAg and HIV among blood donors in Osogbo, Osun State, Nigeria. Int Res J Med S 2013;1 (3): 66-71.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Original Article Premalignant Lesions of Prostate and Its Association with Nodular Hyperplasia and Carcinoma of Prostate: A Histomorphological Study Rajeshwari K1*, Karibasappa GN2, N. V. Dravid1, Ashish Patil3 1

Department of Pathology ACPM Medical College Dhule, Maharashtra, India Department of Public Health Dentistry, ACPM Dental College and Hospital, Sakri Road, Dhule, Maharashtra, India.

3 Department of Urology, ACPM Medical College Dhule, Maharashtra, India.

2

Keywords: Histomorphology, Premalignant, Prostatic Lesions.

ABSTRACT Background: Identification of premalignant proliferative changes has gained importance for early diagnosis of prostatic carcinoma. In clinical practice knowing the frequency of a prostatic carcinoma diagnosed on repeat biopsies would aid primary treating physicians regarding their decisions in suspicious cases.

Aims and Objectives: 1. To identify the histomorphological features of premalignant lesions of prostate. & 2. To know the association of premalignant lesion with benign and malignant lesions of prostate.

Methods: This descriptive study was performed in the department of pathology during the study period of six years (2009-2015). A total of 1,023 prostatic biopsies were studied for the presence and association of premalignant conditions of prostate. Statistical analysis was done using SPSS 17.0.

Results: A total of 385 (37.63 %) were diagnosed as premalignant lesions of prostate. High grade prostatic intraepithelial neoplasia (HGPIN) constituted 71.6% of the cases followed by proliferative inflammatory atrophy (PIA) and atypical adenomatous hyperplasia (AAH) in 15.06% and 13.2% of the cases respectively.

Conclusion: HGPIN and PIA showed strong association with carcinoma and AAH showed weaker association with carcinoma of prostate. Hence the histomorphological diagnosis of HGPIN, PIA should be highlighted in the biopsies by the pathologist and advised for repeat biopsy of the entire gland, irrespective of clinical, biochemical and radiological findings.

*Corresponding author: Dr Rajeshwari K, Department of Pathology ACPM Medical College Dhule, Maharashtra, India Phone: +91 750768899 Email: ujwalgk@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-34

Premalignant Prostatic Lesions

Introduction

Eligibility criteria adopted in our study.

The incidence of prostatic carcinoma increases with age, and it ranks second to lung cancer in terms of incidence and mortality risk. [1] Significant advances have occurred in identifying the putative premalignant lesions of prostate. Application of modern technology such as immunochemistry, flow cytometry, fluorescent insitu hybridization (FISH) has yielded much valuable information in the study of premalignant and malignant lesions of prostate.

1. Inclusion criteria: All types of prostatic specimens like transurethral resection of prostate (TURP), needle biopsies (NB) and prostatectomy specimens were included.

The concept of tumour development through a multistep via premalignant lesions has been well documented in the number of organs including uterus, cervix, endometrial, gastrointestinal and respiratory tract [2] which is similarly seen in prostate.

Orteil gave the first description of premalignant changes in the prostate. The premalignant lesions of prostate include prostatic intraepithelial neoplasia (PIN) and atypical adenomatous hyperplasia (AAH) [3] and recently, the new lesion added to the list of premalignant lesion is proliferative inflammatory atrophy (PIA). [4] In clinical practice, AAH, HGPIN and PIA remains undetected as most of these lesions does not reveal any abnormality on clinical (digital rectal examination), biochemical (PSA level analysis and radiological (trans rectal ultrasound) evaluation.[5] Hence, histopathology remains the gold standard for diagnosis of these putative precursor lesions of prostatic carcinoma. Identification of these lesions of prostate help in early detection of carcinoma and guide the urologist for appropriate management of the patient.

Hence, the present study was undertaken to identify the premalignant lesions and its association with benign and malignant lesions of prostate and also to know the rate of prostatic carcinoma diagnosed on repeat biopsies of the premalignant lesions of the prostate.

Materials and Methods

The descriptive study was conducted for a period of six years from 2009-2015. During this period, a total of 1,023 cases were studied. The material for the present study consisted of transurethral resection of prostate (TURP), needle biopsies (NB) and prostatectomy specimens collected from patients attending the outpatient department of urology. Brief clinical data was noted from the case records, which included age, presenting symptoms, digital rectal examination (DRE) findings, serum prostatic specific antigen (PSA) levels and clinical diagnosis. All the prostatic biopsy specimens were submitted to the department of pathology.

2. Exclusion Criteria: Inadequate biopsies and poorly preserved prostatic specimens were excluded.

All the prostatic specimens were subjected to detailed gross examination fixed in 10% neutral buffered formalin and processed. Three sets of section of 3-4microns thick were cut. One set of slide was stained with routine haematoxylin and eosin (H and E) stain for histopathological diagnosis.

The second section (3µ thick) was stained with silver nitrate to visualise the Nucleolar Organizer regions (NORs) using Howel’s and Black rapid 1-step method.[6] Sections were examined under light microscopy using oil immersion lens (X100). AgNOR appears as black dots/ purple-black following toning against light blue background. The third section was subjected to specific red cell adherence test (SRCAT) as per the procedure mentioned by Kovarik S and Davidson. [7] Statistical analysis: The collected data was tabulated, analyzed and subjected for statistical analysis using SPSS 17.0 Results are presented as Mean ± SD and range for quantitative data and number and percentages for qualitative data. Depending upon the nature of data Groupwise comparisons were made either by student t- test, Fisher’s test, or Mann- Whitney test. P value of 0.05 or less is considered for statistical significance.

Results In the present study a total of 1,023 prostatic specimens were received to the department of pathology accounting for 5.1% of total specimens received. Out of 1,023 specimens, 539 cases (52.68%) were benign, 385 cases (37.63%) were premalignant and 99 cases (9.67%) were malignant (table 1). Majority of cases of premalignant lesions were in the age range of 61-70 years (48.31%) followed by 71-80 years (23.11%) and 51-60 years (14.8%) of age group (graph 1). Among the nature of specimens the premalignant lesions were common in needle biopsies (49.1%) followed by TURP (46.5%) and prostatectomy specimen (4.4%). Each prostatic specimen received in our study was semi-quantified for the volume of the gland, mucin production of the gland, and for the presence or absence of macronucleoli. Each section of the specimen was stained with proliferative marker (AgNOR) and was also tested, for the presence of antigen by SRCAT. The study found, that when the volume of gland decreases with increased mucin production having prominent nucleoli

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Rajeshwari K et al.

A-35

with increased proliferative activity of AgNOR and loss of tissue antigen is seen, as the benign gland moves towards the premalignant and malignant proatate. The mean AgNOR count of premalignant lesions is 2.3+/- 0 which is higher than the benign lesions [8]. SRCAT shows partial loss of antigen, detected by poor adhesion of erythrocytes to the surface of the epithelial cells in premalignant lesions as in contrast, to preservation of antigens in benign lesions [9] . Details of histomorphological features of premalignant lesions of prostate are given in table 2.

Out of total 385 premalignant lesions majority were HGPIN (71.6%) followed by PIA (15.06%) and AAH (13.2%). Among the HGPIN the micropapillary pattern was more common, then followed by flat and tufting pattern and cribriform pattern. In our study, we found that the cribriform pattern of HGPIN (90.4% cases), was significantly associated with malignant lesions of prostate as compared to micropapillary pattern (7.8% cases) and flat and tufting pattern(7.69% cases) of HGPIN. Among the premalignant lesions it is the HGPIN (95.3% of the cases) and PIA (94.82% of the cases) shows significant association with malignant lesions of prostate. Simple statistical method such as student t- test was used to know the significant association between various observed parameters like association of premalignant lesions with malignant and also to know its association with benign lesions of prostate.

Our study showed the statistically significant association of premalignant lesions with adenocarcinoma of prostate and was found to be significant (P < 0.05). Details of premalignant lesions and its association with benign and malignant lesions are given in table 3.

Discussion Graph 1. Age wise distribution of prostatic lesions

Prostatic carcinoma is one of the most prevalent types of carcinoma in men. The early diagnosis of carcinoma

Table 1: Distribution of prostatic lesions based on the type of specimens.

Specimen TURP Prostatectomy Needle biopsy Total

Benign 522 7 10 539 (52.68%)

Premalignant 179 17 189 385 (37.63%)

Malignant 1 3 95 99 (9.67%)

Table 2: Histomorphological features of premalignant that differentiate from benign and malignant lesions of prostate.

Sl. No.

Features

Benign

Premalignant

Malignant

1.

2.

3.

4 5

Mean volume of gland Nucleoli Mucin production Mean AgNOR count[8] SRCAT [9]

36.83 cubic microns inconspicuous decreased 1.6 +/-0.2 Preservation of antigen

20.43 cubic microns Prominent (70%) 10% 2.3 +/- 0 Partial Preservation of antigen

8.13 cubic microns Prominent (90%) 90% 4.7 +/- 0.1 Deletion of antigen

*SRCAT: Specific red cell adherence test; AgNOR: argyrophilic nucleolar organizer regions.

Table 3. Foci of premalignant lesions in association with benign and malignant lesions of prostate.

Sl. No Premalignant lesion(n=385) Benign(n=539) Malignant (n=99) HGPIN(276 cases) 13 (4.71%) 263 (95.3%) a Micropapillary pattern (203 cases) 187 (92.1%) 16 (7.8%) b Flat and tufting pattern (52 cases) 48 (92.3%) 4 (7.69%) c Cribriform pattern (21 cases) 2(9.5%) 19 (90.4%) 2.

AAH(51 cases) 47 (92.1%) 4(7.8%) 3 PIA (58 cases) 3 (5.17%) 55(94.82%)

P Value 0.021 0.037 0.033 0.043 0.036 0.025

P<0.05 *HGPIN: high grade prostatic intraepithelial neoplasia; AAH: atypical adenomatous hyperplsia ; PIA; proliferative inflammatory atrophy.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-36

Premalignant Prostatic Lesions

can be done by early detection of focus of premalignant lesion of prostate. Significant advances have been achieved in the diagnosis and treatment of prostate carcinoma with the introduction of PSA and prostate biopsy techniques. However, the histological diagnosis of premalignant lesions in biopsy specimens remains a challenge for the pathologists. The lack of availability of immunohistochemical staining, that differentiate the benign, premalignant and malignant acini, poor diagnostic significance of the absence of basal cells in some cases complicate the diagnosis of premalignant and malignant lesions of prostate.

Prostatic intraepithelial neoplasia (PIN) is a neoplastic transformation of lining epithelium of prostatic ducts and acini. The process is confined within the epithelium. [5] The term PIN was introduced in 1987 by Bostick. It is divided into two grades â&#x20AC;&#x201C; low grade PIN (LGPIN) and high grade PIN (HGPIN) based on the severity of the following alteration such as cell crowding, stratification, nuclear enlargement, pleomorphism, chromatin pattern and nucleolar appearance.[10] The prevalence of LGPIN varies considerably in different studies probably because of histological diagnosis of LGPIN shows subjective variation and many studies do not report LGPIN. [11]

Fig. 2: HGPIN with tufting pattern showing epithelial cell stratification, crowding with enlarged nucleus and prominent nucleoli in case of nodular hyperplasia. (H&E, x400)

Histologically, HGPIN is characterized by architectural and cytological alteration with large nuclear size, an increased chromatin content which is irregularly distributed with prominent nucleoli. The basal cell layer show frequent disruptions in the HGPIN (Figure 1, 2, 3).

Morphological patterns of PIN include micropapillary, cribriform and flat and tufting pattern at the architectural Fig. 3: HGPIN showing cribriform pattern of glands with luminal bridging and adjacent area of infiltrating carcinoma (H&E, x400)

level.[12] The histological variants of PIN are signet-ring, mucinous variant, foamy variant, inverted and small cell neuroendocrine variant at the cytoplasm level.[5] Among these, the cribriform pattern is the most difficult to distinguish from invasive tumours, particularly in biopsy specimens.[12]

Fig. 1: HGPIN with micropapillary pattern showing epithelial cell stratification, crowding with enlarged nucleus and prominent nucleoli in case of nodular hyperplasia. (H&E, x400)

The differential diagnosis of HGPIN includes both benign and malignant conditions. The benign conditions such as atypia induced by inflammation, infarction, radiation, transitional cell metaplasia, basal cell hyperplasia, clear cell cribriform hyperplasia. The malignant lesions include transitional cell carcinoma of prostatic ducts and acini and cribriform acinar and ductal prostatic carcinoma. Hence one should rule out all the possibilities before the diagnosis of HGPIN.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Rajeshwari K et al.

Recent literatures reveal, in adjunct to histomorphological features the newer techniques like histochemistry, immunohistochemistry (IHC), flow cytometry,, FISH and static image analysis help in understanding the molecular pathology of PIN. On IHC of 34Ebeta12, P63, CK5/6 and AMACR (P450S) show disrupted staining in HGPIN. Upregulation of EGF, overexpression of MAP kinases, bcl-2 and matrix metalloprotinases with down regulation of E- cadherin have also been noted in PIN. [13] HGPIN has a high predictive value as a marker for moderately to poorly differentiated adenocarcinoma of prostate. Hence, its identification in biopsy specimen warrants repeat biopsy for concurrent/subsequent carcinoma.[13] Current standards recommend that the patient with isolated HGPIN be re-biopsied in 0-6 months, irrespective of the serum PSA levels and DRE findings. The re-biopsy technique should entail at least systematic rebiopsy of the entire gland. Since, HGPIN is a general risk factor for carcinoma throughout the gland. These patients should be enrolled into clinical trials with chemopreventive agents.[5] Hence, on detection of HGPIN, patient therapeutically should be started on androgen deprivation therapy (ADT), hormonal therapy and radiotherapy.[13] The dysplastic prostatic epithelium is hormonal dependent and ADT reduces proliferation and enhances apoptosis.

In the present study a total of 276 cases of HGPIN out of 385 accounting for 71.6% of premalignant lesions of prostate. Out of 276 cases, 13 cases (4.7%) were associated with benign lesions and 295 cases (95.3%) were associated with malignant lesions of prostate. In 13 cases of isolated HGPIN associated with benign lesions were started on ADT therapy and these cases were followed up over a period of six months by repeated systematic re-biopsy of entire gland. Only five cases out of 13 developed adenocarcinoma accounting for 42.85% as compared to 35% of Davidson et al [14] study. The rest eight cases responded to ADT therapy and did not develop carcinoma on re-biopsy technique during their follow-up period of 6 months.

A-37 and 2 right mid-lateral and 1 and 2 left mid-lateral, unlike traditional sextant biopsy which samples only six cores. [15] Advantages of 12- core NB over traditional sextant biopsy are 1). It involves the transition zone biopsies from which additional cancers are detected. 2). It allows screening of large number cores from the entire gland. [5] 3). It helps in staging the tumour, predicting extra capsular extensions and tumour volume which are considered as prognostic factors. [15] 4). It helps in sampling high number of cores in previously determined site and adds prognostic information and help in defining the tumour biological behavior. We have also observed in our study that the quantity of cores involved with PIN is directly proportional to the occurrence of carcinoma. Hence, it is essential to highlight in the reports by the pathologist, the percentage of core involved

by HGPIN for prognostic value. Literatures have also contributed, that the incidence of 30.2% if only ½ cores showed PIN, 40% with three cores and 75% with > three cores involvement by HGPIN. [12] The malignancy does not occur on subsequent first two follow-up biopsies from PIN diagnosed patients and then the cancer is unlikely to develop later. [12] In our study, the diagnosis of HGPIN was made in combination, with histomorphological characters, alcian blue special stain and with the use of proliferative marker (AgNOR). The diagnosed HGPIN on histomorphology could not be further evaluated on IHC and flow cytometry due to poor economic constraint of patients.

In our study HGPIN was common in needle biopsy specimens accounting for 63.3 % of cases. The rise in prevalence of HGPIN in needle biopsies may probably be due to its distribution in the peripheral zone. [16] The other putative premalignant prostatic lesion described

by McNeal is atypical adenomatous hyperplasia (AAH).

[17] It represents an architectural alteration with cytological unremarkable glands [18] (figure 4).

In our study there is increase in the percentage of cancer detection rate in HGPIN cases could be attributed to the technique of 12-core needle biopsy (NB) used in the study and also due to frequent camps which were freely carried out to collect the samples in our urology institute.

The 12- core NB helps to determine the foci of prostatic carcinoma by obtaining a sufficient amount of samples at the true location without increasing the morbidity. The 12core needle biopsy (NB) involves transrectal ultrasound evaluated prostate volume and guiding the biopsies to the 12 following areas: right and left apex, right and left mid prostate, right and left base, right and left transition zone, 1

In most of the cases the AAH is an incidental finding in TURP and prostatectomy. AAH is located in the transition zone of the prostate in intimate association with BPH. [19] Microscopically AAH is characterized by partially circumscribed with pushing borders consisting of varying sizes of small glands which are closely packed and separated. The glands are lined by cuboidal- low columnar cells with moderate â&#x20AC;&#x201C; abundant, clear- eosinophilic cytoplasm. The basal cells are usually recognized focally.

The luminal borders are irregular in contrast to rigid borders of carcinomatous glands. The nuclei are round-oval, enlarged with uniform fine chromatin with inconspicuous nucleoli.[20]

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-38

Premalignant Prostatic Lesions differentiated transition zone carcinoma accounting for 1.96% of the AAH cases. Patient underwent cystoprostectomy and follow-up period; showed no recurrence till the date of review of the case.

The next putative premalignant lesion is PIA. It was first proposed by De- Marzo et al.[23] It designates focal simple/ post atrophic hyperplasia in association with inflammation.

PIA represents precursor lesion to HGPIN and therefore, prostatic adenocarcinoma. [23- 27] PIA histopathologically is characterized by closely packed small acini lined by atrophic epithelium having scanty cytoplasm with crowding of nuclei. Stroma shows inflammation with changes of elastosis and fibrosis. [23] (Figure 5).

Fig. 4: Atypical adenomatous hyperplasia (AAH) showing circumscribed cluster of glands in case of nodular hyperplasia (H&E, x100)

AAH is difficult to distinguish from low-grade prostatic adenocarcinoma (Gleason pattern 1+2). Because both are located in the transition zone and show small acinar proliferation and intraluminal crystalloids. The two distinguishing features of AAH from carcinoma are lack of cytological atypia and presence of patchy basal cells can be made out by the use of immunostains like HMWCK (CK903/34betaE12) or P63. In contrast, prostatic adenocarcinoma shows nuclear atypia, lack of basal cells and rarely expresses HMCK. AAH is considered to be a precursor of well- differentiated transition zone carcinoma. [21] It has been reported that the cancer detection rate varies between 21% and 51% on the second biopsy in patients with AAH. [22] In our study AAH constituted 51 cases out of 385 premalignant lesions of prostate accounting for 13.2% of the cases. It is commonly detected in the TURP specimens (89.9%). Around 47 cases (92.1%) showed association with benign lesions as compared to 4 cases (7.8%) association with malignant lesions. AAH shows increased association with benign lesions and TURP specimens could be probably attributed to the surgical technique of TURP carried out for BPH. TURP technique involves resection of the central zone of the prostate where BPH and AAH are common.[3] Rekhi B et al study revealed AAH in 20.6% of the cases of nodular hyperplasia and 2.6% cases of the adenocarcinoma. In our study higher percentage might be possibly due to large sample size of the benign cases.

During the follow-up period of repeated systematic rebiopsies only one case out of 51 cases developed well

Fig. 5: Proliferative inflammatory atrophy (PIA) showing areas of closely packed small acini lined by atrophic epithelium with stroma showing areas of fibrosis, elastosis and inflammation (H&E, x100)

Literature has revealed around 10.4 % of the cases of PIA on repeated systematic sextant re-biopsy show adenocarcinoma.[28] In our study 58 cases of PIA out of 385 premalignant lesions were found constituting 15.1% of premalignant lesions of prostate. Our study revealed PIA common in needle biopsy specimens and shows increased association with malignant lesions accounting for 94.82% of the cases.The increased percentage may probably be due to the occurrence of PIA in the peripheral zone and hence, there is increase in the needle biopsy specimens which is used for detection of prostatic carcinoma. During the follow-up period of re-biopsies a total of five cases out of 58 developed adenocarcinoma of prostate accounting for 8.62% of the cases the decreased percentage in the present study is due to small sample size in our study.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Rajeshwari K et al.

Conclusion

A-39

1. Polat K, Tüzel E, Aktepe F, Akdoğan B, Güler C, Uzun İ. Investigation of the incidence of latent prostate cancer and high-grade prostatic intraepithelial neoplasia in an autopsy series of Turkish males.

Turkish Journal of Urology 2009;35:96-100.

2. Del Regato JA, Sput HJ, Cox JD. Pathology of cancer. In: Harsh Berger SE, Kasper R, editors. Cancer diagnosis, treatment and prognosis. St Louis: Mosby 1985. p. 27-8.

3. Rekhi B, Jaswal TS, Arora B. Premalignant Lesions of Prostate and their association with Nodular Hyperplasia and Carcinoma Prostate. Indian Journal of Cancer 2000; 41:60 – 5.

4. Billis A. Prostatic Atrophy. Clinicopathological Significance. Int Braz J Urol 2010; 36: 401- 9.

5. Sakr AW, Montironi R, Epstein IJ, Rubin AM, Demarzo MA, Humphrey AP, et al. Prostatic intraepithelial neoplasia. In: Eble NJ, Sauter G, Epstein IJ, Sesterhenn AI editors. Pathologyand genetics tumors of the urinary system and male genital organs Lyon: IARC Press (World Health Organization. Classification of tumors 2004; 6: p.193-8.

6. Howel WM, Black DA. Controlled silver staining of nucleolus organizer regions with a protective colloidal developer: a 1- step method. Experientia 1980;15;36:1014-5 7. Kovarik S, Davidsohn I, Stejskal: ABO antigens in cancer. Detection with Mixed cell agglutination reaction. Arch Pathol 1968; 86:12-21.

8. Rajeshwari. K, Damale R, Dravid NV, Karibasappa GN. Argyrophilic Nucleolar Organizer Regions (AgNORs) as a Proliferative marker in various prostatic lesions. Indian journal of pathology and oncology 2015;2(3):126-30.

9. Rajeshwari. K, Dravid NV, Patil. AV, Nikumbh DB, Oswal SJ, Karibasappa GN et al. Diagnostic utility

of specific red cell adherence (SRCA) test in various prostatic lesions. Int. Journal of health science and research 2013;3(4):25-31.

10. Bostwick GD, Sakr W. Prostatic intraepithelial neoplasia. In: Foster SC, Bostwick GD editors.

Pathology of the prostate. Philadelphia: W.B. Saunders (Major problems in pathology) 1998 ;34:95-114.

11. Gaudin BP, Epstein IJ. Adenosis of the prostate: Histologic features in needle biopsy specimens. Am J Surg Pathol 1995; 9:737-47.

12. Rosai J. Male reproductive system. In: Rosai & Ackerman’s. Surgical Pathology. 10t h ed. Vol.1, Missouri: Mosby. 2011. p.1287-1313.

13. Rodolfo M, Roberta M, Ferran A, Antonio L. Morphological identification of the patterns of prostatic intraepithelial neoplasia and their importance. J Clin Pathol 2000; 53: 655-65.

14. Davidson D, Bostwick DG, Qian J, Sioky M, Rudders R, Stilamant M. Prostatic intraepithelial neoplasia is predictive of adenocarcinoma. J Urol 1995;154:12959.

15. Paulo E. F, M. Tobias-Machado, Marcelo A. P, Lucilla H.S, Eric R. W. Twelve Core Prostate Biopsy Versus Six Systematic Sextant Biopsies. Braz J Urol 2002;28:207-13.

16. Haggman JM, Macoska AJ, Wojno JK, Oesterling EJ. The relationship between prostatic intraepithelial neoplasia and prostate cancer: Critical issues. J Urol 1997; 158:12-22.

17. Mc Neal JE. Morphogenesis of prostatic carcinoma.

Cancer 1985;1659-66.

18. Rosai J. Male reproductive system. In: Rosai J, editor. Ackerman’s Surgical pathology. 10t h ed. Vol.1, Missouri: Mosby. 2011. p. 1304-5.

19. Bostick DG, Qian J: Atypical adenomatous hyperplasia of the prostate. Relationship with carcinoma in 217 whole-mount radical prostatecctomies. Am J Surg Pathol 1995;19: 506-18.

20. Henry BA, Anil VP. Atypical adenomatous hyperplasia (adenosis) of the prostate: a case report with review of the literature. Diagnostic pathology 2008;3:34.

21. Mettlin C, Jones GW, Murphy GP. Trends in prostate cancer in the United States, 1974-1990: Observations from the patient care evaluation studies of the American college of surgeons commission on cancer.

CA Cancer J Clin 1993;43:83-91.

22. Orhan Koca, Selahattin Çalışkan, Metin İshak Öztürk, Mustafa Güneş, M. Ihsan Karaman. Significance of

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

As most of the premalignant lesions of prostate are not diagnosed clinically, histopathology remains the gold standard in the diagnosis of premalignant lesions of prostate.

HGPIN and PIA showed strong association with malignant lesions and AAH showed weaker association. Hence, the focus of HGPIN, PIA and AAH should be highlighted by the pathologist and advised for close clinical follow-up with subsequent repeated re-biopsies which help in early detection and management of the patient.

References

A-40

Premalignant Prostatic Lesions

Atypical Small Acinar Proliferation and High-Grade Prostatic Intraepithelial Neoplasia in Prostate Biopsy.

Korean J Urol 2011;52:736-40 23. De Marzo AM, Marchi VL, Epstein JI, Nelson WG: Proliferative inflammatory atrophy of the prostate: implications for prostatic carcinogenesis. Am J Pathol 1999;155:1985- 92.

24. van Leenders GJ, Gage WR, Hicks JL, van Balken B, Aalders TW, Schalken JA, et al. Intermediate cells in human prostate epithelium are enriched in proliferative inflammatory atrophy. Am J Pathol 2003;162:1529-37.

25. Putzi MJ, De Marzo AM: Morphologic transitions between proliferative inflammatory atrophy and high-

grade prostatic intraepithelial neoplasia. Urology 2000;56: 828-32.

26. Wang W, Bergh A, Damber JE: Morphological transition of proliferative inflammatory atrophy to high-grade intraepithelial neoplasia and cancer in human prostate. Prostate 2009;69:1378-86.

27. De Marzo AM, Meeker AK, Zha S, Luo J, Nakayama M, Platz EA, et al.: Human prostate cancer precursors and pathobiology. Urology.2003; 62:55-62.

28. Postma R, Schroder FH, van der Kwast Th: Atrophy in prostate needle biopsy cores and its relationship to prostate cancer incidence in screened men. Urology 2005; 65:745-9.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Original Article Seroreactivity of Syphilis Among Blood Donors of A Blood Bank Ashwin. P. Khageshan1*, Keshav. R.Kulkarni1, Mahesh. C. Baragundi2 1 Dept. of Pathology, S.N. Medical College, Navangar, Bagalkot Karnataka. India Dept of Microbiology, S.N. Medical College, Navangar, Bagalkot Karnataka. India

2

Keywords: RPR, Transfusion, Syphilis.

ABSTRACT INTRODUCTION: Blood transfusion involves transfer of biological material from man to man. Many infectious diseases are likely to be transmitted by blood transfusion. Syphilis, known in India as Portuguese disease or firanga or firangi roga reached the subcontinent in early 16th century and soon became widespread. A comparison of the present data on syphilis reactivity among blood donors with that seen a decade back (1986 - 1990) revealed a sharp decline from 14. 6% to 9.26% in syphilis. Since there was no data from our geographical area about syphilis seroreactivity among blood donors, the present study was conducted to know the seroreactivity of syphilis among voluntary and replacement blood donors.

METHODS: The present study was carried out in Blood bank of S.N Medical College, Bagalkot from July 2012 to June 2013. Two ml of blood sample was collected in labeled pilot tube at the time of collection of blood from donor tubing of blood bag. Serum was separated. The samples were tested for syphilis by RPR test.

RESULTS: Out of the 8187 blood donors, 7461 (91.13%) were replacement donors and remaining 726 (8.87%) were voluntary donors. Out of total 8187 donors screened, 4 (0.04%) units were seroreactive for rapid plasma regain test for syphilis. Four seroreactive units were from replacement donors.

CONCLSION: Seroreactivity of syphilis is low in our geographical area. Voluntary donations are safer as compared to replacement ones and should be encouraged.

*Corresponding author: Dr. Ashwin .P. Khageshan , Associate professor, Dept. of pathology, S.N. Medical College, Navangar, Bagalkot- 587102, Karnataka. India Phone: +91 9448491499 Email: drashwinp@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-42

Seroreactivity of Syphilis in blood Donors

Introduction Blood transfusion involves transfer of biological material from man to man. Many infectious diseases are likely to be transmitted by blood transfusion.[1] Transfusion transmissible infections (TTIS) such as Human immunodeficiency virus (HIV), Hepatitis B virus (HBV), Hepatitis C virus (HCV), syphilis and malaria are among the greatest threats to blood safety for recipient. According to National Aids Control Organisation (NACO) guidelines, all mandatory tests should be carried out on donors blood samples for HIV, HBV, HCV, syphilis and malaria. The whole blood or components from any unit that tests positive should be discarded.[2] Syphilis, known in India as Portuguese disease or firanga or firangi roga reached the subcontinent in early 16th century and soon became widespread. A comparison of the present data on syphilis reactivity among blood donors with that seen a decade back (1986 - 1990) revealed a sharp decline from 14. 6% to 9.26% in syphilis.[3] Sawke et al,[4] have reported that among blood donors, total seropositive samples for syphilis to be 0.23% by using enzyme linked immunosorbent assay and rapid plasma reagin test (RPR). Hilda F etal [5] and Giri et al [6] al have reported 0.11% and 0.07% syphilis seropositivity among blood donors respectively.

The RPR test uses a stabilized suspension of antigen to which charcoal particles are added to aid in the visualization of the test reaction. The RPR test is one of the most commonly used non treponemal tests, and is a simplified version of the VDRL test.

Since there was no data from our geographical area about syphilis seroreactivity among blood donors, the present study was conducted to know the seroreactivity of syphilis among voluntary and replacement blood donors using RPR test.

reaction during the blood donation procedure was excluded from the study.

Sample collection: Two ml of blood sample was collected in labeled pilot tube at the time of collection of blood from donor tubing of blood bag. The sample was centrifuged at 3500 rpm for 5 minutes to obtain clear non hemolyzed serum.

Test for syphilis was done by RPR test (Carbogen kit-Tulip diagnostics pvt ltd, India) along with positive and negative controls.

Results

Pie chart-1, shows type of blood donors. Out of the 8187 blood donors, 7461 (91.13%) were replacement donors and remaining 726 (8.87%) were voluntary donors.

Table-1 shows, age wise distribution of syphilis positive donors. Maximum seroreactive donors (50%) were seen in 26-35 years age group.

Seroreactivity of syphilis: Among the total 8187 donors only 4 donors were positive for syphilis with a seroreactivity rate of 0.04%.

Graph-1, shows that out of total 8187 donors screened, 4 (0.04%) units were seroreactive for rapid plasma regain test for syphilis. Four seroreactive units were from replacement donors. None of the blood units from voluntary donors showed seroreactivity to RPR test for syphilis. However the difference was statistically not significant.

All four the reactive donors were males and two were married and other two were unmarried. Two reactive donors for syphilis were from urban and other two were from rural area.

Among 4 syphilis reactive donors, three were associated HBV and one was associated with HIV co infection.

Materials and Methods The present study was carried out in Blood bank of S.N Medical College, Bagalkot from July 2012 to June 2013.

The study was approved by institutional ethical committee.

The blood bank of department of pathology, S.N Medical College is licenced blood bank with average annual collection of 8000 units of blood from healthy blood donors from in and around Bagalkot annually.

Inclusion criteria: Any donor meeting all criteriaâ&#x20AC;&#x2122;s for eligibility of blood donation as mentioned in SOP, Blood Bank, S. N .Medical College, Bagalkot.

Exclusion criteria: Any eligible donor having any kind of

Pie chart No 1: Showing Type of blood donors

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Khageshan K et al.

A-43

Table 1: Age wise distribution of syphilis positive donors Age Range (yrs)

No. of reactive Samples

Percentage

18-25

0

0%

26-35

2

50%

36-45

1

25%

46 and above

1

25%

Total

4

100%

for syphilis giving the seroprevalence of 0.04%. The seroprevalence in a replacement donors was 0.05%.

No voluntary donors were found reactive for syphilis.

However the difference was statistically not significant.

Since the number of voluntary donors was less and the prevalence of syphilis was very low, large scale study is needed to establish the significance.

Table -2 shows, comparison of syphilis seroprevalence among donors in different studies.

Table 2: Comparison of syphilis seroprevalence among donors in different studies

Graph 1: Seroreactivity of Syphilis in different donor categories

Discussion

In the present study replacement donors, were 91.13% and only 8.87% were voluntary donors. This is comparable to study done by Kakkar et al (94.7%),[7] Srikrisna et al ( 98.5%) [1] and Singh et al (84.5%).[8] In contrast predominance of voluntary donors was noted by Bhattacharya et al (94.6%) [9] and Pallavi et al (64.78%). [10]

Author (yrs)

Voluntary Replacement Total

Srikrisna et al (1991)[1]

-

Garg et al (1998)[16]

0.129%

-

1.6%

0.239%

0.22%

Sonawane et al (2003) [12] 0.33%

1.12%

0.87%

Singh et al (2005) [13]

2.8%

2.6%

1.4%

Bhattacharya (2007) [9]

-

-

0.8%

Arora et al (2010) [17]

-

-

0.9%

Pallavi et al (2011) [10]

-

-

0.28%

Choudhary etal (1995) [14] 00%

00%

00%

Present study

0.05%

0.04%

00%

The seroprevalence of syphilis in our study was 0.04%, which is low compared to other studies except the study

by Choudhary et al in Sharma et al (2004) [14] study, which showed, no donors were reactive for syphilis.

In India, constant decline in the prevalence of syphilis is observed. In a study at Chandigarh major decline in syphilis has been observed. The prevalence of syphilis decreasing from 10.4% in 1977-85 to 2.5% in 1995-96. [11]

This finding of our present study might be due to the declining trends in the prevalence of syphilis in general population due to improved access to health care, improved diagnostic means, effecious treatment modalities and general health awareness among the population especially due to the emergence of HIV.

Srikrishna et al (1999), [1] Sonawane et al (2003) [12] and Singh et al (2005) [13] in their studies noted the seroprevalence of syphilis among the blood donors as 1.6%, 0.87% and 0.26% respectively.

Among 4 syphilis reactive donors, three were associated HBV and one was associated with HIV co infection which could be due to common modes of transmission of these agents.

Sharma et al (2004) [14] in a review article described in detail the changing pattern of sexually transmitted infection in India. They quote that Choudhari et al (1995) observed the seroprevalance of syphilis as zero percent among the blood donors from Lucknow.

Singh et al (2005) [13] and Matee et al (2006) [15] observed a statistically significant difference among voluntary and replacement donors suggesting that voluntary donors are safe donors

In our study we have tested the blood units with RPR test.

The cardiolipin antigen antigens used in RPR test may tend to give biological false reactive reaction (BFR) in the conditions like malaria, mumps, measles, lepromatous leprosy, collagen disease, rheumatoid arthritis, infectious mononucleosis, rubella, leptospirosis, relapsing fever etc.

The seroreactive donors for RPR test were counseled and advised confirmatory testing by other treponemal test.

In the present study out of the total 8187 screened blood donors only four donors blood units showed seroreactivity

In conclusion, Seroreactivity of syphilis is low in our geographical area. TTIs pose a definite risk to the recipient of the blood. Due to a similarity in risk factors and routes of

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-44

Seroreactivity of Syphilis in blood Donors

transmission, public awareness and education would go a long way in curbing the prevalence of these infections and increasing blood safety. Voluntary donations are safer as compared to replacement ones and should be encouraged.

References

1. Srikrishn A, Sitalaxmi S, Domodhar P. How safe are our safe blood donors?. Indian J Pathol Microbial 1999; 42:411-416.

2. NACO. Standards for blood banks and blood transfusion services 2007;33-34.

3. Thappa D, Kaimal S. Sexually transmitted infections in India: Current status (except human immunodeficiency virus/acquired immunodeficiency syndrome). Indian Journal of Dermatology 2007;52(2):78.

4. Sawke N, Sawke GK, Chawla S. Seroprevalence of common transfusion-transmitted infections among blood donors. People’s journal of scientific rearch 2010;3(1):5-7.

5. Fernandes H, D’souza P, D’souza P. Prevalence of transfusion transmitted infections in voluntary and replacement donors. Indian of Heamatology and Blood transtision 2010; 26(3) 89-91.

6. Giri PA, Deshpande JD, Phalke DB, Karle LB. Seropreveance of transfusion transmissible infections among voluntary Donoks at a terthiary care teaching hospital in rural area of India J.FAm med primary care 2012;1:48-51.

7. Kakkar N, Kaur R, Dhanoa J. Voluntary donors – need for a second look. Indian J Pathol Microbiol 2004;47:381-83.

8. Singh K, Bhat S, Shastry S. Trend in seroprevalence of hepatitis B virus infection among blood donors of coastal Karanataka. Indian J Infect Dev Ctries 2009;3:376-379.

9. Bhattacharya P, Chandra PK, Datta S, Banarjee.

Significant increase in HBV, HCV, HIV and syphilis

infection among blood donors in West Bengal, Eastern India, 2004-2005. Exploratory screening reveals high frequency of occult HBV infection. World J Gastroenterol 13:3730-3733.

10. Pallavi P, Ganesh CK, Jayashree K, Manjunath GV. Seroprevalence and trends in transfusion transmitted infections among blood donors in a University hospital Blood Bank : A 5 year study. Indian J Hematol, Blood Transfus 2011;27(1):1-6.

11. Sharma VK, Khanpur S. Changing patterns of sexually transmitted infections in India. Natl Med J India 2004; 17:310-19.

12. Sonawane BR, Birare SD, Kulkarni PV. Prevalence of seroreactivity among blood donors in rural population.

Indian J Med Sci 2003;57:405-407.

13. Singh B, Verma M, Kotru M, Verma K, Batra M. Prevalence of HIV and VDRL seropositivity in blood donors of Delhi. Indian J Med Res 2005; 122:234-236.

14. Sharma R, Cheema R, Vajpayee M, Rao U, Kumar S. Prevalence of markers of transfusion transmissible diseases in voluntary and replacement donors. The Nat med J of India 2004;17:19-21.

15. Matee M, Magesa P, Lyamuya E. Seroprevalence of human immunodeficiency virus, hepatitis B and C viruses, and syphilis infections among blood donors at the Muhimbili National Hospital in Dar Es Salaam, Tanzania. BMC Public Health 2006;6:21-29.

16. Garg S, Mathur DR, Garg DK. Comparision of seropositivity of HIV, HBV, HCV, and syphilis in replacement and voluntary blood donors in Western India. Indian J Pathol Microbiol 2001;44(4):409-412.

17. Arora D, Arora B, Kheterpal A. Seroprevalence of HIV, HBV, HCV and syphilis in blood donors in Southern Haryana. Indian J Pathol Microbiol 2010;53 (2):308-309.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Primary Schwannoma of Thyroid Gland in an Adolescent Male: a Rare Case-report with Review of Literature Pallavi Agrawal1*, Neha Garg1, Preeti Jain2 1

Department of Pathology,, Mahavir Cancer Institute & Research Centre, Patna (Bihar), India 2 Department of Surgery, Mahavir Cancer Institute & Research Centre, Patna (Bihar), India Keywords: Isthmus, Schwannoma, Thyroid gland.

ABSTRACT Primary neural tumors of thyroid are very rare and are mainly represented by schwannomas and malignant peripheral nerve sheath tumors. This report presents a rare case of schwannoma involving the isthmus of thyroid in an 11-year adolescent male. The patient presented with soft neck mass which moved with deglutition. The histological examination indicated Antoni A type schwannoma. The clinical, radiological and pathological findings of the tumor are discussed emphasizing the difficulty in reaching a correct diagnosis and planning out exact surgical treatment of the patient. Only 20 cases of primary schwannoma of thyroid gland have so far been described in literature and this is the first case report describing this entity in an adolescent age group.

*Corresponding author: Dr. Pallavi Agrawal, M.D., DNB, PDCC (Neuropathology), Department of Pathology, Mahavir Cancer Sansthan, Phulwarisharif, Patna â&#x20AC;&#x201C; 801505 (Bihar), India Phone: +91 7739165410 E-mail: dr.pallavimamc@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Primary Schwannoma of Thyroid Gland

C-2

Introduction Schwannomas are the benign tumors arising from the neuronal sheath of cranial or peripheral nerves.[1,2] Generally they occur anywhere in the body but 25-45% originates in the head and neck region and most commonly involve the intracranial nerves or their branches. The 8th cranial nerve is the most frequent site involved, followed by the 5th and the 7th cranial nerve. Extra-cranial schwannomas are rare and may develop anywhere from the base of the skull to the thoracic inlet. But they are most commonly found in the middle area of the neck. Thyroid is a rare site for schwannomas.[3] First case of primary schwannoma of thyroid was reported by Delaney and Fry,[4] though its description as first non-epithelial tumor of thyroid was made by Frantz[5] Only 20 cases of primary schwannoma of thyroid gland have been described in literature. We report the first case of thyroid schwannoma localized in the isthmus of thyroid in an adolescent male.

Grossly the excised mass measured 3×2.8×2.4 cm with a solid encapsulated yellowish-white mass measuring 3×1.8×1.5cm. Cut-surface was solid and grey-white.

No areas of hemorrhage and necrosis were identified.

Microscopic examination revealed an encapsulated nodule composed of mixed patterns of Antoni A and Antoni B areas with a predominant pattern A having Verocay bodies.

Immuno-histochemical (IHC) staining showed that the cells were strongly and diffusely positive for S-100, while they were negative for CD34, actin and CD99 (Fig-1).

Case-Report An 11-year-old male presented with an asymptomatic soft swelling in the mid-line neck region for past 3 months.

There was no history of dysphagia, odynophagia and hoarseness of voice. Physical examination revealed a 3×3cm soft, mobile, non-tender swelling that moves with deglutition. Clinically cervical lymph nodes were not palpable. The serum levels of T3, T4, TSH, thyroglobulin and calcitonin were within normal limits. Ultrasound (USG) revealed a round heterogenous midline lesion at the thyroid cartilage level with internal vascularity.

Possibility of epidermoid cyst was considered. Fine needle aspiration cytology (FNAC) was performed which showed many benign epithelial cells in a background of eosinophilic material. Non-contrast computerized tomography (NCCT) showed enlarged thyroid isthmus secondary to the presence of well- defined heterogenous nodule measuring 2.6×1.7 cm. Thyroid capsule was intact.

Both the lobes were normal. Possibility of colloid nodule was given. To confirm the diagnosis a repeat FNAC from the same lesion was performed which revealed sheets of oval to spindle cells in the background of eosinophilic material. Possibility of spindle cell lesion was considered.

To reach on to a definitive diagnosis a tru-cut biopsy was performed which revealed sheets of benign oval to spindle cells. Possibility of fibroma was considered. Following this pre-operative diagnosis the multi-disciplinary team decided to perform wide local excision in the form of isthmectomy. Surgery was indicated because of increase in size of nodule and the intra-nodular vascularization. Intraoperatively a well encapsulated mass adherent to isthmus and part of pyramidal lobe was identified. Both the lobes of thyroid were normal. Post-operatively patient recovered uneventfully. He was discharged within 2 days.

Fig. 1: [A] Cytological smear showing sheets of oval to spindle cells (400X, Giemsa). [B] Tru-cut biopsy showing spindle cell lesion (400X, H&E). [C] Encapsulated lesion showing Antoni A pattern (100X, H&E). [D] Diffuse immune-positivity for S-100 (400x, DAB).

Discussion Primary non-epithelial neoplasm of thyroid accounts for less than 1% of all thyroid neoplasm.[6] The lesions included in this category are lymphomas, teratomas, lipomas, hemangiomas and schwannomas. It has been postulated that schwannomas originate from intra-thyroidal sensory nerves or sympathetic and para-sympathetic nerves.[3] A review of literature revealed only 20 cases of primary schwannoma of thyroid. This is the first case showing involvement of thyroid isthmus by primary schwannoma in an adolescent male. Majority of the cases are reported in the elderly age-group. Details of the cases are shown in Table-1.

It is very difficult to diagnose thyroid schwannomas preoperatively. Patient generally presents with a mass in the lower neck and rarely with hoarseness, dysphagia or odynophagia. Sometimes due to extension of the mass

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Agrawal et al.

C-3

Age/Sex Clinical Presentation Delaney and Fry et al,1953 [4]

47/M

USG

FNAC

Asymptomatic neck selling

Surgery done

IHC

Hemi- thyroidectomy

Goldstein et al, 1982 [7]

??

Thyroid nodule with cystic changes compressing the Neck swelling with trachea dyspnoea

Aoki etal, 1993 [8]

57/M

Asymptomatic Neck Solid tumor in right swelling lobe

Mikosch et al,1997 [9]

31/M

Sujita et al, 1998 [10]

46/F

Jayaram et al, 1999 [11]

41/M

Enucleation of thyroid tumor Inconclusive USG guided Asymptomatic Neck Hypoechoic thyroid FNAC: Suspicious of neural tumour Hemi- thyroidectomy swelling nodule Asymptomatic Neck Well defined solid Inflammatory cells swelling thyroid lesion seen-inconclusive Hemi- thyroidectomy USG guided aspirate; pallisading S 100 +ve (done pattern of spindle on fine needle Asymptomatic Neck cells aspirate) swelling Hypoechoic nodule Hemi- thyroidectomy

Al-Ghamdi etal, 2000 [12]

42/F

Midline neck swelling

Possibility of thyroid malignancy

Inconclusive

Total thyroidectomy

Gustafson et al, 2001 [13]

20/F

Asymptomatic Neck Hypoechoic thyroid swelling nodule

Inconclusive

Hemi- thyroidectomy

Yoshiyuki etal, 2003 [14]

16/F

Baglaj etal, 2004 [15]

12/F

De Paoli et al, 2005 [16]

63/F

Aron et al (2 cases), 2005 [17]

34/M

Mangro etal, 2008 [18]

52/F

Uri , Baron et al, 2009 [19]

57/F

Subramaniam et al, 2010 [20] Nidhi Mangal et al, 2010 [21]

30/F 25/F

Jungsuk Ann et al,2010 [22]

14/M

Ibrahim etal, 2011 [23]

70/M

Graceffa G etal, 2013 [3]

47/M

Harsh Dhar etal, 2014 [24]

47/M

Neck swelling

Benign thyroid lesion

Total thyroidectomy

Heterogenous mass

Hemi- thyroidectomy

Asymptomatic Neck Hypoechoic thyroid swelling nodule

Hemi- thyroidectomy

Enlarging neck mass Total thyroidectomy with foreign body Hypoechoic nodule USG guided apirate- done i/v/o suspected sensation in throat with rich vascularity malignancy inconclusive USG guided aspirates s/o Asymptomatic Neck Hypoechoic nodule schwannoma swelling with cystic spaces Hemi- thyroidectomy

S-100+ve

S-100+ve; Vimentin+ve

S 100 +ve

Asymptomatic Neck 3cm solid nodule in Inflammatory cells S-100+ve; swelling right lobe seen-inconclusive Total thyroidectomy Vimentin+ve k/c/o Hashimotos Suspicious of S-100+ve; with hypothyroid malignant thyroid CAM52+ve; Prominent status neoplasm MNF116+ve hypoechoic nodule Total thyroidectomy Thyroid nodule with large cystic Asymptomatic Neck degeneration swelling Colloid goitre Hemi- thyroidectomy Asymptomatic Neck Benign thyroid swelling nodule Hemi- thyroidectomy Paucicellular Asymptomatic Neck Hypoechoic nodule aspirate with few S 100 +ve ; Tgb ve round cells and Hemi- thyroidectomy swelling with cystic changes Mass in left lobe of thyroid Hoarseness of voice Symptomatic cold Hypoechoic thyroid nodule nodule

Swelling right lobe

www.pacificejournals.com/apalm

Hyperechoic thyroid nodule

Non-diagnostic Nodular goitre Benign thyroid lesion. Bethseda category 2 lesion

Left sided Lobectomy Total thyroidectomy

S-100+ve; Vimentin+ve S-100+ve; Vimentin+ve S-100+ve; Vimentin+ve

eISSN: 2349-6983; pISSN: 2394-6466

Primary Schwannoma of Thyroid Gland

C-4 into the retrosternal space patient presents with respiratory distress. The serum levels of thyroid hormones are generally within normal limits in such cases. Radiologically USG can only delineate the extent of the mass and provide the clue whether the lesion is solid or cystic. CT scan does not provide any other specific features. The CT appearance of schwannomas is usually a well circumscribed homogenous mass of soft tissue density. CT findings of inhomogeneity may suggest malignancy in neurogenic tumors. Diagnostic support by thyroid scintigraphy is not always necessary.

[7,10]

About 80% of cold nodules of thyroid are diagnosed as benign epithelial tumor, with the remainder being malignant.[19] The high risk of malignancy in such cases mandates FNAC of every suspicious nodule. Considering this FNAC was performed in our case which revealed presence of benign epithelial cells. For definitive diagnosis core needle biopsy was performed which revealed presence of benign spindle cells.

The cases which lack typical morphological features of a lesion, many spindle cell lesions enter into the differential diagnosis including mesenchymal lesions like leiomyoma, solitary fibrous tumor and hemangiopericytoma.

Leiomyoma shows characteristic whorling pattern and immune-positivity for SMA and vimentin. Solitary fibrous tumor (SFT) represents a single spectrum of mesenchymal tumors, of which hemangiopericytoma is now considered a cellular phenotypic variant. Classically, SFTs are composed of variably pleomorphic spindle cells admixed with collagen and have ‘patternless’ arrangement or in short fascicles, while tumors within the previously separated hemangiopericytoma spectrum are composed of ovoid, monomorphic cells with thin-walled anastomosing vessels.

Histological features of both can be seen in the same tumor and both are CD34 reactive and have dilated staghornlike vascular network. The typical histopathological features of schwannoma include the presence of cells with slender wavy nuclei, fibrillarystroma, nuclear palisading and presence of verocay bodies. Antoni A areas alternate with hypo-cellular myxoid areas containing blood vessels (Antoni B areas). Mitotic figures are rare. S-100, SMA, CD34 and CD99 positive immuno-staining provide important aid in the diagnosis of neural sheath tumors and may be mandatory for distinguishing schwannomas from other spindle lesions.[19]

Conclusion To conclude despite of its rarity, schwannoma like other non-epithelial thyroid tumors should be considered in the pre-operative differential diagnosis of thyroid nodule.

Surgical excision is considered to be curative and treatment

of choice. The close routine co-operation is required between the histopathologist, radiologist and surgeon to cut down unnecessary massive surgeries. In addition the surgeon should also ask for frozen section in the absence of pre-operative diagnosis. Thus, the only diagnostic tool for exact typing of the tumor is histopathological examination supported by IHC.

Conflict of Interest

The authors declare that they have no conflict of interest related to the publication of this manuscript.

Acknowledgement The author would like to record the appreciation for the thoughtful and skilled guidance of the Consultants of the Department of Pathology, Mahavir Cancer Institute and Research Centre, Patna. Without the willing assistance of these people, it would have been difficult to work on this topic.

References 1. Rohaizak M, Meah FA. Cervical Sympathetic Schwannoma Simulating a Thyroid Nodule. Med J Malaysia 2002; 57:218 - 20.

2. Cashman E, Skinner L J, Timon C. Thyroid Swelling: An Unusual Presentation of a Cervical Sympathetic Chain Schwannoma. Medscape 2008; 10(8): 201.

3. Graceffa G, Cipolla C Florena AM, Gentile I, Pompei G,Latteri MA. Primary schwannoma of the thyroid gland involving the isthmus: report of a case. Surgery Today. 2012; 1.

4. Delaney WE, Fry KE. Neurilemmoma of the thyroid gland. Ann Surg. 1964; 160: 1014 - 6.

5. Frantz VK. Pathology of thyroid. In: Warner SC, editor. The thyroid: a fundamental and clinical text.

2nded. New York: Harper and Row. 1962; 321.

6. Million RR, Cassisi NJ. Management of head and neck cancer. Philadelphia: Lippincott. 2nd ed, 1994; 785-810.

7. Goldstein J, Tovi F, Siddi J. Primary Schwannoma of thyroid gland. IntSurg J. 1982; 67: 433-4.

8. Aoki T, Kumeda S, Iwasa T, Inokawa K, Hori T, Makiuchi M. Primary neurilemoma of the thyroid gland: report of a case. Surg Today. 1993; 23: 265 – 268.

9. Mikosch P, Gallowitsch HJ, Kresnik E, Lind P. Schwannoma of the neck simulating a thyroid nodule, Thyroid. 1997; 7(3): 449 - 51.

10. R Sugita, T Nomura, F Yuda, Primary Schwannoma of the Thyroid Gland: CT Findings , AJR. 1998: 171.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Agrawal et al.

C-5

11. Jayaram G; Schwannoma of thyroid diagnosed by fine needle aspiration cytology. Acta Cytologica. 1999; 43: 743 - 744.

12. Al-Ghamdi S, Fageeh N, Dewan M. Malignant schwannoma of the thyroid gland. Otolaryngol Head Neck Surg. 2000; 122: 143–144.

13. Gustafson LM, Liu JH, Rutter MJ, Stern Y, Cotton RT ; Primary neurilemoma of the thyroid gland: a case report; Am J Otolaryngol. 2001 Jan-Feb; 22(1): 84 86.

14. Yoshiyuki I, Takemi T, Katsuyoshi H. A case of schwannoma of the thyroid. J JpnSurgAssoc. 2003; 64: 2105 – 2108.

15. Baglaj M, Markowska-Woyciechowska A, SawiczBirkowska K, Dorobisz U. Primary neurilemmoma of the thyroid gland in a 12-year-old girl. J PediatrSurg.

2004; 39: 1418 – 1420.

16. De Paoli F, Giugliano G, Casadio C, Tredici P, Bruschini R, De Fiori E.Schwannoma of thyroid bed.

A case report and considerations on interdisciplinary collaboration. Acta Otorhinolaryngol Ital 2005; 25: 250-254.

17. Aron, M., Kapila, K. and Verma, K. Neural tumours of the neck presenting as thyroid nodules: a report of three cases. Cytopathology. 2005; 16: 206 –209.

18. Magro G, Torrisi A, Amico P, Lo Presti C, Ippolito G, Ippolito O. Ancient schwannoma of the thyroid. Am J Case Rep. 2008; 9: 182 – 187.

19. Uri O, Baron E, Lefel O, BittermanA. Primary schwannoma of the thyroid gland presenting as an asymptomatic cold nodule. American Journal of Otolaryngology - Head and Neck Medicine and Surgery. 2009; 30(6): 427 – 429.

20. Subramaniam V, Adarsha TV, Khandige S. SchwannomaOf The Thyroid Gland – A Case Report.

Jurnalul de Chirurgie Iasi. 2010; 6(4).

21. Mangal N, Agarwal A K, Sharma VK, Sharma S; Neurilemmoma of the thyroid gland : A rare case presentation ,Indian Journal of Pathology and Microbiology. 2010; 53(4).

22. J Ann, Y L Oh , J S Shin , H S Sheong: Primary Schwannoma of thyroid gland ,Acta Cytologica. 2010; 54.

23. Ibrahim WG, Khalek MSA, Crawford BE, Kandil EH. Hoarseness due to thyroid mass. The Journal of Medicine. 2011; 69(1): 39 - 40.

24. Dhar DH, Dabholkar DJP, Kandalkar DB, Godke DR. Primary thyroid Schwannoma Masquerading as a thyroid nodule: A case report with review of literature.

SEAJCRR. 20

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Case Report Unusual Sites of Metastasis of Breast Carcinoma to Gallbladder and Colon.

Sabah Nayef Nemri1, Nazima Haider2*, Sohaila Fatima2, Bouvier Francis Valere Dâ&#x20AC;&#x2122;SA1 1

Aseer Central Hospital, Abha 62529, Saudi Arabia King Khalid University, Abha, 62529, Saudi Arabia

2

Keywords: Breast Carcinoma, Unusual Metastasis, Gall Blabber, Intestine

ABSTRACT Breast cancer is usually associated with metastasis to lungs, bones and liver. Metastatic pattern of Infiltrating Lobular Carcinoma differs from Infiltrating Ductal Carcinoma with higher frequency of tumor extension to bone, gastrointestinal tract, genital tract, meninges and serosa. We here present two rare case reports showing this unusual pattern of metastasis of infiltrating lobular breast carcinoma to colon and gall bladder. Because of its rarity, nonspecific clinical presentation and the variable radiographic features, the diagnosis of intestinal and biliary tract metastasis by breast carcinoma is difficult.

*Corresponding author: Dr Nazima Haider, King Khalid University, Abha 62529, Saudi Arabia Phone: +91 966559938735 E-mail: nazima_haider@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Unusual Sites of Metastasis of Breast Carcinoma

C-7

Introduction Breast carcinoma is the most common malignancy of women worldwide. It is most commonly associated with metastases to the liver, lung, bone, and the brain. Invasive lobular carcinoma (ILC) of the breast accounts for 5 to 15% of breast carcinomas and is the second most common histologic type of invasive breast cancer after invasive ductal carcinoma (IDC). Metastatic pattern of ILC differs from IDC. [1] We here present two rare case reports showing this unusual pattern of metastasis of infiltrating lobular breast carcinoma to colon and gall bladder (GB).

Case Report CASE 1: A 73 year old Saudi female presented in Surgical emergency with complain of pain in right hypochondrium and jaundice. Blood tests showed deranged liver function tests with raised Bilirubin - 4 mg/dL ( 0.1 - 1.2 mg/dL ), raised Alkaline phosphatase - 300 U/L ( 45- 115 U/L), raised Aspartate aminotransferase - 100 U/L( 8- 48 U/L) and raised Alanine aminotransferase -150 U/L( 7- 55U/L).

Complete blood count showed increased White blood cell count - 15,000 /uL( 4000- 11000/uL) and decreased Hemoglobin -10 g/dL( 12- 16 g/dL). Ultrasound was done which revealed enlarged GB 12 x 3 cm with irregular thickening along with massive biliary dilatation due to ampullary stricture. Liver was normal. Common bile duct stenting was done. Later on cholecystectomy was performed and sent for histopathological examination.

Whole body CT (Computerized Tomography) did not reveal any other organ involvement.

Gross examination showed an enlarged GB 11.5x 2,5 cm with irregularly thickened wall maximum thickness

Fig. 1: Tumor cells in single file arrangement in mucosa and muscle layer of gallbladder. (Hematoxylin and Eosin, 10X and Inset, 40X)

1cm. On serosal side two attached lymph nodes were seen,1.5x0.8cm and 3x2cm respectively.

Microscopy showed malignant cells in single file arrangement in mucosa, muscle layer and serosa of GB. (Fig.1) Overlying GB mucosa was normal to atrophic.

Immunohistochemistry revealed these cells to be Cytokeratin(CK) CK 7 +, CK 20 -, Estrogen receptor ER+.

(Fig. 2) Lymph nodes were positive for malignancy. A diagnosis of metastatic carcinoma to GB most likely from breast was made. She had undergone radical mastectomy 7 years ago for invasive carcinoma.

CASE 2: A 46 year old female presented to the surgical OPD (outpatient department) with complaint of pain in abdomen, nausea and alteration of bowel habits from 2 months. Ultrasound of the abdomen showed multiple colonic strictures suggestive of crohnâ&#x20AC;&#x2122;s disease.

Colonoscopy was performed confirming colonic strictures and colonoscopic biopsy was sent for histopathological examination. Microscopic examination showed patchy infiltration of lamina propria by sheets of malignant pleomorphic cells in cord like pattern. Overlying colonic mucosa was normal. (Fig.3) Immunohistochemistry showed them to be CK 7+, CK20-, ER + and negative for CKAE1, CD 68, TTF1. (Fig.4) A diagnosis of metastatic carcinoma to colon most likely from breast was made. On further clinical examination, a small mass in right breast was found with tru-cut biopsy confirming primary invasive lobular carcinoma. (Fig.5) Whole body CT scan did not reveal any other lesion.

Fig. 2: Immunohistochemical study by Cytokeratin 7 and Estrogen receptor showing positivity for malignant cells. (CK 7 immunostain, 10X and Inset showing ER immunostain, 20X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Nemri et al.

C-8

Fig. 3: Tumor cells in single file arrangement (arrow) in lamina propria with normal colonic glands. (Hematoxylin and Eosin, 10X and Inset, 40X)

Fig. 5: Tumor cells in single file arrangement (arrow) in Trucut biopsy of right breast. (Hematoxylin and Eosin, 10X) and Inset showing E-cadherin negativity. (10X)

Fig. 4: Immunohistochemical study by Cytokeratin 7 and Estrogen receptor showing positivity for malignant cells. (CK 7 and ER immunostain, 10X)

Discussion Breast carcinoma is one of the most common human cancers accounting for one quarter of all female cancers.

Breast cancer is usually associated with metastases to lungs, bones and liver. Invasive lobular carcinoma (ILC) of the breast accounts for 5 to 15% of breast carcinomas and is the second most common histologic type of invasive breast cancer after invasive ductal carcinoma (IDC). Metastatic pattern of ILC differs from IDC with higher frequency of tumor extension to bone, gastrointestinal tract, genital tract, meninges and serosa. [1] Because of its rarity, nonspecific clinical presentation and the variable radiographic features, www.pacificejournals.com/apalm

the diagnosis of intestinal and biliary tract metastasis by breast carcinoma is difficult. [2,3] Metastasis to the gallbladder is very rare and was found only in 4.8% of cancer patients in a large study. The tumor which is most likely to metastasize to the gallbladder is carcinoma stomach and malignant melanoma. [4]. Metastatic breast carcinoma involving the gallbladder or biliary tract is very rare and presents with abdominal pain, symptoms of cholecystitis and obstructive jaundice as seen in our case.[5] Gastrointestinal (GI) metastasis of breast cancer is also rare and is particularly uncommon at the time of initial diagnosis as was our case. In one sudy, only 1% of the patients eISSN: 2349-6983; pISSN: 2394-6466

C-9

Unusual Sites of Metastasis of Breast Carcinoma

with breast cancer were found to have gastro-intestinal metastasis.[6] However, the occurrence in autopsy series varied from 8% to 35%. [7] The clinical manifestations of the majority of gastrointestinal metastases include abdominal pain, diarrhea, GI bleeding, intestinal obstruction and intussusception.[8] In order to differentiate primary and metastatic tumors, histopathological comparison of breast and GI specimens is essential. The morphological similarity to breast cancer and the absence of dysplasia in epithelium of intestine or gallbladder suggests a metastatic growth as was seen in our case. Primary site of disease can be found out with the help of careful history and clinical examination, histopathological examination and immuno-histochemistry.

Gallbladder and intestinal metastases of breast carcinoma are particularly linked to lobular histotype. With respect to the underlying mechanism, molecular events, such as alterations of E-cadherin expression is implicated in this rare hematogenous metastasis.[1, 9]. However, few cases of infiltrating ductal carcinoma metastasizing to gall bladder and intestine have also been reported.[10,11,12] Although rare, Gastrointestinal and biliary metastasis should be considered in patients of breast carcinoma especially in cases of infiltrating lobular type.

Treatment of metastatic breast cancer is generally nonsurgical, with systemic chemotherapy, biologic agents with HER2-neu positivity or anti-estrogen targeted treatment. Surgery is used for diagnosis and palliation. [13]

Conclusion Metastatic disease should be considered when a patient experiences GI symptoms with a history of breast cancer or conversely primary breast cancer should be thoroughly searched in case of metastasis to GI or biliary tract.

Acknowledgements Nil

Funding None

Competing Interests None declared

Reference

1. WHO classification of tumors. Tumors of breast and female genital organs. Editors: Tavassoli F A, Devilee P, IARC press, 2003; 9-26.

2. Eljabu W, Finch G, Nottingham J, Vaingankar N. Metastatic deposits of breast lobular carcinoma to

small bowel and rectum. Int J Breast Cancer. 2011; 413949.

3. Di Vita M, Zanghì A, Lanzafame S, Cavallaro A, Piccolo G, Berretta M, Grosso G, Cappellani A. Gallbladder metastases of breast cancer: from clinicalpathological patterns to diagnostic and therapeutic strategy. Clin Ter. 2011; 162:451-6.

4.

Yoon WJ, Yoon Y B, Kim Y J, Ryu J K, KimY T. Metastasis to the gallbladder: A single-center experience of 20 cases in South Korea. World J Gastroenterol. 2009; 14; 15: 4806-9.

5. Shah RJ, Koehler A, and Long J D. Bile peritonitis secondary to breast cancer metastatic to the gallbladder. American Journal of Gastroenterology.

2000; 95,1379–81.

6. Borst M J, Ingold J A. Metastatic patterns of invasive lobular versus invasive ductal carcinoma of the breast.

Surgery. 1993;114(4):637-41 7. Washington K and McDonagh D. Secondary tumors of the gastrointestinal tract: surgical pathologic findings and comparison with autopsy survey. Modern Pathology. 1995; 8, 427–433.

8. Yokota T, Kunii Y, Kagami M, Yamada Y, Takahashi M, Kikuchi S, Nakamura M, Yamauchi H. Metastatic breast carcinoma masquerading as primary colon cancer. Am J Gastroenterol. 2000;95:3014–6.

9.

Zagouri F, Sergentanis TN, Koulocheri D, Nonni A, Bousiotou A, Domeyer P, Michalopoulos N V, Dardamanis D, Konstadoulakis M M and Zografos G C. Bilateral synchronous breast carcinomas followed by a metastasis to the gall bladder: a case report. World J Surg Oncol. 2007; 5: 101.

10. Murguia E Quiroga D Canteros G,Cesar SanMartino.

Gallbladder metastases from ductal papillary carcinoma of the breast. Journal of Hepato-BiliaryPancreatic Surgery November 2006, 13:591-593.

11. Ferlicot S, Vincent-Salomon A, Médioni J, Genin P, Rosty C, Sigal-Zafrani B, Fréneaux P, Jouve M, Thiery JP, SastreGarau X. Wide metastatic spreading in infiltrating lobular carcinoma of the breast. European Journal of Cancer. 2004; 40:336–41.

12. Ikeda Y, Morita N, Ikeda T. Metachronous rectal metastasis from invasive ductal carcinoma of male breast. Endoscopy. 2008;40:108-9.

13. Smith NZ. Treating metastatic breast cancer with systemic chemotherapies: current trends and future perspectives. Clin J Oncol Nurs. 2012;16:33–43

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Sclerosing Stromal Tumour of Ovary : A Case Study with the Review of Literature Vijay Kumar Jha1*, Alka Rai2, Mohan Kumar1, Shivi Jain3, Madhu Jain4 1

Dept. Of Pathology, Institute Of Medical Sciences, Banaras Hindu University, Varanasi, India Deptt. Of Obstetrics and Gynecology, Heritage Institute of Medical Sciences, Varanasi, India 3 Deptt. Of Radiodiagnosis and Imaging, Institute Of Medical Sciences, Banaras Hindu University, Varanasi, India 4 Deptt. Of Obstetrics and Gynecology , Institute Of Medical Sciences, Banaras Hindu University, Varanasi, India 2

Keywords: Sclerosing Stromal Tumour, Sex Cord Stromal Tumour, Ovary, Vascular Proliferation, Immunohistochemistry

ABSTRACT Sclerosing stromal tumour of ovary is a rare and distinct type of sex cord stromal tumours with benign course and excellent prognosis. It affects mostly young females in their second and third decade of life. Nearly all the reported cases of sclerosing stromal tumour of ovary are unilateral with menstrual irregularities, pain abdomen and lower abdominal mass as commonest clinical presentations. Most of the cases are hormonically inactive, however, hormone production has been documented in various studies. Histopathology and IHC confirms the diagnosis. Surgical excision is the treatment of choice. No recurrence has been reported yet. We are describing a histopathologically confirmed case of a young girl who presented with complaints of menorrhagia and pain abdomen. Radiological examination and peroperative findings raised the suspicion of malignancy. It is important to consider sclerosing stromal tumour in young females presenting with complex ovarian mass.

*Corresponding author: Dr. Vijay Kumar Jha, Senior resident, Deptt. Of Pathology, Institute Of Medical Sciences, Banaras Hindu University, Varanasi, India, 221005 Phone: +91 8960202107 E-mail: vj.bhu07@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

C-11

Sclerosing Stromal Tumour of Ovary

Introduction Sclerosing stromal tumour (SST) is an extremely rare benign ovarian neoplasm, a subtype of sex cord stromal tumours comprising 1.5 - 6% of all ovarian sex cord stromal tumours.[1] Fewer than 208 cases of SST have been described in literature since its first description in 1973 signifying rarity of this entity.[2] SST is the disease of young female occurring in their second and third decade of life.[2,3,4] About 80% of the cases are seen in patients below 30 years of age.[1,2,4,5] Patients usually present with menstrual irregularities, pelvic pain and abdominal lump.[6] Some cases show features like amenorrhoea, anovulation, endometrial hyperplasia and hirsutism related to hormone production.[2,4,7] Majority of the cases of SST are hormonically inactive, however, there are reports of androgen and estrogen excess in this tumour.[2,3] Distinct clinical, histopathological and radiological features differentiate SST from other ovarian sex cord tumours.

[2,4,8] Histopathological examination and IHC confirms the diagnosis.[2] Sclerosing stromal tumour, a solid cystic mass with rich vascularity is often misdiagnosed as malignancy on ultrasonography and other radiological examinations.

[2,4] Proper diagnosis is essential for preventing morbidity associated with extensive surgical intervention done in cases of ovarian malignancy.

Herein, we describe a case of SST in an 18 year old female who presented with polymenorrhagia and abdominal pain.

Case Report An eighteen year old unmarried girl presented with complaints of polymenorrhagia for six years and pain abdomen for two years. On examination there was a large firm lower abdominal mass. Past and present medical history were unremarkable.

Patients haematological and biochemical profiles were within normal limit except mild anemia (Hb -12gm/dl).

Serum tumour markers were within normal range ( AFP -1.0 ng/ml, CA125 – 10.1U/ml, βHCG – 1.0 mIU/l & CEA – 3.63 ng/ml). Hormonal assay was not done in this case.

Radiological findings: USG revealed a solid cystic right adnexal mass of 7.8x6.3 cm with normal left ovary, uterus and endometrium. CT scan showed a well defined complex solid cystic mass measuring 6.7x5.4x5.9 cm with many internal septae. MRI showed a relatively defined heterogenous right adnexal mass measuring 9.8x6.1x8.2cm with solid cystic areas without evidence of haemorrhage and necrosis. Ipsilateral ovary could not be identified separately from the mass (Fig1A). Radiological examination did not reveal any fluid collection in peritoneal

cavity or pouch of Douglas. All other visceral organs were normal and there was no evidence of any mass lesion.

Histopathology: gross specimen (Fig.1B) measured 8x8x4 cm with intact capsule and smooth external surface. Cut surface was pale white in colour, firm to hard in consistency, predominantly solid with scattered cystic areas. Multiple tiny yellowish specks were also noted. Normal ovarian tissue was not identified. Fallopian tube present on the external surface of the mass meaured 6x1x0.6 cm and was unremarkable.

Specimen was fixed in 10% buffered neutral formalin and processed according to standard laboratory protocols.

Haematoxylin and eosin (H&E) and PAS stained slides were examined. Immunohistochemistry for Inhibin, Vimentin, SMA, VEGF, CK, EMA, CD34, estrogen receptor (ER) and progesterone receptor (PR) was done.

Microscopic examination revealed an encapsulated tumour having cellular and hypocellular areas imparting a pseudolobular appearance (Fig.1C). Cellular areas showed dual population of cells comprising of spindled fibroblastic cells and round, oval to polygonal cells with clear to eosinophilc cytoplasm and round regular nuclei (Fig.1D). Cellular lobules were separated by dense collagenised and oedematous stroma (Fig.1E). Many thin walled blood vessels, some with branching simulating hemangiopericytomatous pattern (Fig.1F) were also seen in the cellular areas. Normal ovarian stroma was idenfied in few sections. No mitotic activity was noted. PAS stain was negative.

IHC findings: tumour cells showed positive staining for Inhibin (fig.2A), PR (Fig.2B) vimentin (Fig.2C), SMA (Fig.2D), VEGF (Fig.2E) and CD34 (Fig.2F) while CK, EMA and ER were negative.

Based on above clinical, radiological, histopathological and IHC findings a diagnosis of sclerosing stromal tumour of ovary was established.

Discussion Ovarian tumours are very uncommon in adolescent girls and majority of these tumours are of germ cell origin.[3] SST of the ovary is an extremely rare and distinct subtype of sex cord stromal tumours.[3] Most common clinical presentations are menstrual irregularities, pain abdomen and palpable abdomino-pelvic mass.[2,3,4,6,7] Some of the patients present with anovulation, infertility and features of hirsutism that resolves after removal of the tumour[2,7] and is probably due to hormone production. Both androgen and estrogen production has been described.[2] Return of normal menstruation in patients with menstrual irregularities

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Kumar Jha et al.

C-12

Fig. 1: Panel of photographs displays MRI image (T2 weighted) showing heterogeneously enhancing solid cystic ovarian mass without evidence of haemorrhage and necrosis (Fig.1A), cut surface of the mass showing predominantly solid pale white areas with interspersed cystic spaces (Fig.1B), micrograph shows pseudolobular arrangement with cellular nodules and hypocellular interlobular areas (Fig.1C, H&E stain, 40X), cellular area having clear theca like cells with round regular nuclei (Fig.1D, H&E stain, 400X), Interlobular hypocellular collagenized oedematous stroma (Fig.1E, H&E stain, 100X), Cellular nodule showing marked vascular proliferation, some with branching (Fig.1F, H&E stain, 100X)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-13

Sclerosing Stromal Tumour of Ovary

Fig.2 Panel of photographs shows immunohistochemical expression of inhibin (Fig.2A, 200X) progesterone receptors (Fig.2B,200X), vimentin (Fig.2C,200X) SMA (Fig.2D, 200X), VEGF (Fig.2E, 200X) and CD34 (Fig.2F, 200X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Kumar Jha et al. following surgical excision of the mass has been described.

[2] Sclerosing stromal tumour is unilateral mostly.[2,4] Etiology of this tumour is not very well defined, however, ultrastructural features suggest origin from pluripotent immature myoid stromal cells of ovarian cortex.[3,9] Histopathology reveals characteristic pseudolobular arrangement with cellular areas and hypocellular interlobular areas.[2,6] Cellular lobules consists of dual population of cells comprising of spindled fibroblastic cells and round, oval to polygonal lipid containing cells.[2,4] In some cases clear cells show signet ring cell morphology with eccentric nuclei. Such cases need differentiation from Krukenbergs tumour.[1,4] Cellular areas also show many thin walled blood vessels mimicking vascular tumours.

Interlobular areas show fibrosis, collagen deposition and oedema.[2] Oedema in SST is focal or confined within interlobular areas in contrast to massive ovarian oedema.

[3,4]

Immunohistochemical analysis of SST shows positive staining for alpha inhibin, calretinin, SMA, vimentin, ER, PR and VEGF.[2,3,4,10-12] Some authors have reported VEGF positivity in round, clear theca like cells.[6] Epithelial markers CK and epithelial membrane antigen (EMA) are negative.[2,4,5] In various studies inhibin, calretinin, alpha glutathione S-transferase (α-GST) and CD34 were found useful to differentiate STT from thecoma, fibroma and other sex cord stromal tumours.[2,5,10] CD34 highlights endothelium of proliferated vascular channels that differentiates SST from thecoma and fibroma.[2] In our case SMA, vimentin, inhibin, PR, VEGF and CD34 were positive while CK , ER, and EMA were negative.

Immunohistochemical studies in SST show variable results, however, predominant positivity for inhibin, calretinin, SMA and vimentin suggests sclerosing stromal tumour of ovary.[2] Cytogenetic studies using FISH technique show trisomy of chromosome 12 in about 13-21% of the cases while in one study trisomy 16 was found.[6,13] This tumour needs differentiation from other sex cord stromal tumours like fibroma, thecoma, Juvenile granulosa cell tumour, metastatic carcinoma, Krukenbergs tumour, massive ovarian oedema and vascular tumours.

[2,4] Characteristic clinical presentation, radiological, histopatholgical and immunohistochemical profile differentiates SST from other benign and malignant mimickers.[8] It is difficult to diagnose this tumour based on USG and other radiological investigations due to complex solid cystic appearance and rich vascularity simulating malignant ovarian mass.[2,4] However, MRI findings are more specific www.pacificejournals.com/apalm

C-14 in differentiating SST from malignancy and other sex cord stromal tumours.[4] MRI show pseudolobulation having low intensity cellular nodules against high intensity stroma on T2 weighted images.

Conclusion Despite of its rarity, SST needs consideration in Young females presenting with unilateral solid cystic complex ovarian mass and related symptoms as it has benign course and very good prognosis with less aggressive surgical treatment. Characteristic histopathology and immunohistochemistry establishes the diagnosis.

Acknowledgements None

Funding None

Competing Interests None declared

Reference 1. Peng HH, Chang TC, Hsueh S. Sclerosing stromal tumor of ovary. Med J 2003;26:444-8.

2. Ozdemir O, Sari ME, Sen E, Kurt A, Ileri AB, Atalay CR. Sclerosing stromal tumour of the ovary: A case report and the review of literature. Niger Med J 2014;55:432-7 3. Kaygusuz EI, Cesur S, Cetiner H, Yavuz H, Koc N. Sclerosing stromal tumour in young women: Clinicopathologic and immunohistochemical spectrum. J Clin Diagn Res. 2013;7:1932–5.

4. Akbulut M, Colakoglu N, Soysal ME, and Duzcan SE. “Sclerosing stromal tumor of the ovary: report of a case and review of the literature,” Agean pathology journal, 2004;1:84-89.

5. Tiltman AJ. Sclerosing stromal tumor of the ovary. Int J Gynecol Pathol. 1985;4:362–69.

6. Kawauchi S, Tsujı T, Kaku T, Kamura T, Nakano H, Tsuneyoshi M. Sclerosing stromal tumor of the ovary: a clinicopathologic, immunohistochemical, ultrastructual and cytogenetic analysis with special reference to its vasculature. Am J Surg Pathol. 1998;22:83–92.

7. Cashell AW, Cohen ML. Masculinizing slerosing stromal tumor of the ovary during pregnancy. Gynecol Oncol. 1991;43:281–85.

8. Liang YF, Zeng JC, Ruan JB, Kang DP, Wang LM, Chen C, JF Xu. Ovarian sclerosing stromal tumor in a young woman with ectopic pregnancy: Clinical, eISSN: 2349-6983; pISSN: 2394-6466

Sclerosing Stromal Tumour of Ovary

C-15 pathological, and immunohistochemical studies. Int J Clin Exp Pathol. 2013;7:456–9.

9. Lam RMY, Geittmann P. Sclerosing stromal tumor of the ovary: a light, electronmicroscopic and enzyme histochemical study. Int J Gynecol Petrol. 1998;7:280–90.

10. Ismail SM, Walker SM. Bilateral virilizing sclerosing stromal tumors of the ovary in a pregnant woman with Gorlin’s syndrome: implications for pathologenesis of ovarian stromal neoplasms. Histopathology.1990;17:159–63.

11. Lifschitz-Mercer B, Open M, Kushnir I, Jacob N, Czernobilsky B. Hyaline globules and progesterone receptors in an ovarian sclerosing stromal tumor. Histopathology. 1995;27:195–97.

12. Kostopoulou E, Moulla A, Giakoustidis D, Leontsini M. Sclerosing stromal tumor of the ovary: immunohistochemical and cytogenetic analyses of three cases. Eur J Gynaecol Oncol. 2004;25(2):257–60.

13. Lopes JM, Seruca R, Hall AP, Branco P, Castedo SM. Cytogenetic study of a sclerosing stromal tumor of the ovary. Cancer Genet Cytogenet. 1990;49:103–6.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Incidental Filariasis in Abdominal Neoplasm: Cytodiagnosis of Two Cases with a Review of Literature Pallavi Agrawal1*, Sanjay Kumar1, Neha Garg1, Kumar Rahul2 1

Department of Pathology, Mahavir Cancer Institute & Research Centre, Patna, Bihar, India Department of Radiology, Mahavir Cancer Institute & Research Centre, Patna, Bihar, India

2

Keywords: Filariasis, Cytology, Adenocarcinoma

ABSTRACT Lymphatic filariasis is a major health problem in Indian sub-continent. Their presence at extra-nodal sites is very rare since they are found predominantly in the lymphatic channels and nodes. Very few numbers of cases have been reported till date showing the presence of microfilariae concomitant with abdominal neoplasm. It has been postulated that neoangiogenesis in the malignancies as well as obstruction caused by microfilariae leads to the rupture of these fragile vessels causing extravasation of microfilariae. So in suspected cases cytology can prove to be an effective tool for early diagnosis and management.

*Corresponding author: Dr. Pallavi Agrawal, Department of Pathology, Mahavir Cancer Sansthan, Phulwarisharif, Patna â&#x20AC;&#x201C; 801505 (Bihar), India Phone: +91 7739165410 E-mail: dr.pallavimamc@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Incidental Filariasis in Abdominal Neoplasm

C-17

Introduction

Lymphaticfilariasis is a major health problem in the Indian sub-continent with Wuchereriabancrofti comprising the commonest species. Transmission in India is chiefly via bite of the Culex quinquefasciatus mosquito[1-2]. Other filarial species include Brugia malayi, Onchocerca volvulus, Loa loa etc. Extra-nodal filariasis is a rare entity. Microfilaria have been detected at various extra-nodal sites like breast, thyroid, bone marrow, pleural cavity etc3-5. Till date only few cases have been reported where filariasis coexisted with the malignancy of hepato-biliary system and ampulla of Vater together6-10. We hereby report the rare coexistence of microfilariae in association with the adenocarcinoma of gallbladder and peri-ampullary carcinoma in two separate cases.

Case Reports

Case 1: A 50-year-old female presented with a painful abdominal lump measuring 5×5 cm for the past 4 months.

Ultrasound abdomen revealed a heterogenous mass measuring 5.2×5.0 cm in the gall-bladder infiltrating into adjacent liver parenchyma. There was no history of fever, jaundice and gastro-intestinal bleed. Clinically the lymph nodes were not palpable. Ultrasound-guided fine needle aspiration cytology (USG-FNAC) was done and the cytological smear showed presence of sheathed microfilariae of Wuchereria bancrofti having tail end free of nuclei, along with clusters of malignant cells having hyperchromatic nucleus with moderate atypia (Fig 1).

Laboratory investigations including both biochemical and hematological were within normal limits. Peripheral smear showed no eosinophilia or microfilaremia. This case was diagnosed as ‘adenocarcinoma of gall-bladder with coexistent filariasis’. The patient underwent surgical resection for the malignancy. The histopathological

Fig. 1: High-power photomicrograph showing sheathed microfilariae of Wuchereriabancrofti with no nuclei at the tail end. Inset shows malignant cells forming acini.

(MayGrunwald Giemsa, 100X)

examination revealed well-differentiated adenocarcinoma of gall-bladder having short and long tubular glands lined by columnar cells having hyperchromatic and pleomorphic nuclei. The patient also received single dose of diethylcarbamazapine (DEC) 6mg/kg body weight for the concomitant infestation.

Case 2: A 58-year-old male presented with pain abdomen for past 2 months. Clinical examination revealed jaundice with moderate hepatomegaly. Computerized tomography (CT) abdomen revealed peri-ampullary mass measuring 3.2×2.8 cm, infiltrating the surrounding retro-peritoneal fat. Few mildly enlarged left para-aortic lymph nodes were also seen. CT abdomen revealed a peri-ampullary mass measuring 3.2×2.8 cm, infiltrating the surrounding retroperitoneal fat. Few mildly enlarged left para-aortic lymph nodes were also seen. CT guided FNAC was undertaken which yielded blood-mixed fluidy aspirate with presence of microfilariae and few degenerated cells. FNAC was repeated and the smear showed malignant clusters. No filaremia was noted in the repeat FNAC smear. The patient underwent endoscopic retrograde cholangio-pancreatography (ERCP) biliary stenting for the malignancy and received DEC for the filariasis.

Discussion

Filariasis is an endemic problem in India affecting Bihar, West-Bengal and coastal region of south India11.

Microfilaria gain access to the human lymphatics on being transmitted by the bite of Culex mosquito. Man is the definitive host while mosquito is the intermediate host. The microfilaria is picked up by the mosquito during human bite. Then microfilaria undergoes the developmental stages and forms a highly active and motile larval form (3rd stage) which migrates to the proboscis of the mosquito. Human infection occurs when this 3rd stage larval form is released into the puncture site by the female Culex mosquito during blood-feeding. Morphologically the microfilariae of both W. Bancrofti and B. malayi are sheathed. It is important to remember that sheaths may be lost during smearing, and stain poorly with Giemsa, thereby creating confusion. Wuchererial larvae are large, have relatively smooth outlines with multiple columns of prominent nuclei in the body, a tail tip free of nuclei and and a cephalic space as broad as it is long12. Though the presence of microfilariae at extra-nodal sites is seen as an incidental finding but possible mechanism for the same may be the fragile vessels formed by angiogenesis and lymph-angiogenesis in tumor may rupture on their own or due to trauma caused by FNAC thus leading to the extravasation of microfilaria. The reported cases of this uncommon association are mentioned in Table 1.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Agrawal et al.

C-18

The filarial genome project points towards role of some immune-suppressant molecules in lowering the immunity of the host or resultant poor immune surveillance. The molecules which help in evading the immune mechanism are cysteine protease inhibitor, TGF homologues, serine protease inhibitors. Though some glycoprotein molecules secreted also provide anti-oxidant effect against freeradical injury. This lowered immunity predisposes the host to opportunistic infections and neoplasm. DEC is the drug of choice for filariasis being effective against both adult and microfilarial form. Ivermectin in a single dose of 200400 microgram per kilograms of body weight can be used as second line of treatment13.

Table 1: Incidental association of microfilariae with abdominal neoplasms.

STUDY

ASSOCIATED NEOPLASM

Agarwal et al. [6]

Cavernous hemangioma of liver

Mohan et al. [7]

Carcinoma pancreas

Arakeri et al. [8]

Hepato-cellular carcinoma

Khan AA et al. [9]

Metastatic Adenocarcinoma

Gupta K et al. [10]

Non-HodgkinLymphoma

Conclusion In endemic areas the cytological smear for suspected neoplastic disease must be properly evaluated for detecting coexistent filarial infestation. Patients with benign or malignant pathological conditions may be the silent carriers of filarial infection and cytology can be an effective tool for timely eradication and treatment.

unsuspected cases at different sites. DiagnCytopathol.

2012; 40: 292-6.

3. Sharma P, Tyagi S. An unusual cause ofeosinophilia in AML-M4 without the Inv (16) abnormality. J Blood DisordTransfus. 2010;1:104. doi: 10.4172/21559864.1000104.

4. Varghese TR, Raghuveer CV, Pai MR, Bansal R. Microfilaria in cytological smears: A report of six cases. ActaCytol.1996; 40: 290-301.

5. Ahluwalia C, Choudhary M, Bajaj P. Incidental detection of Microfilaria in aspirates from Ewingâ&#x20AC;&#x2122;s sarcoma of bone. DiagnCytopathol.2003; 29: 31-2.

6. Agarwal R, Khanna D, Barthwal SP. Microfilariae in association with neoplastic lesion: Report of five cases. Cytopathology 2001;12:120-126.

7. Mohan S, Andley M, Ravi R, Kumar A. An unusual association with carcinoma pancreas: A case report.

Cytopathology 2005;16:215-6.

8. Arkari SU, Yelikar BR. Microfilariae in cytological smears of hepatocellular carcinoma. J Cytol 2007;24:158-9.

9. Khan AA, Vasenwala SM, Ahmad S. Coexistent metastatic adenocarcinoma and microfilaria in ascitic fluid. ActaCytol 1993;37:643-4.

10. Gupta K, Sehgal A, Puri MM, Sidhwa HK. Microfilaria in association with other diseases: A report of six cases. ActaCytol 2002;46:776-8.

Conflict of Interest

11. Chatterjee KD : Phyllum Nemathelmenthes, class nematoda. In Parasitology (Protozoology & Helminthology) in relation to Clinical Medicine 12 Edn Calcutta: Chatterjee. Med. Publishers; 1980: 190-9.

References

12. Sharma P, Kumar N, Jain P, Gur R, Jain S. Chronic Wuchereriasis Presenting as a Vaginoperineal Fistula.

ActaCytologica 2005;49:335-338.

The authors declare that they have no conflict of interest related to the publication of this manuscript.

1. Gupta K, Sehgal A, Puri MM, Sidhwa HK. Microfilariae in association with other diseases. A report of 6 cases. ActaCytol. 2002;46: 776-8.

2. Mondal SK. Incidental detection of filarial in fine needle aspirates: a cytologic study of 14 clinically

www.pacificejournals.com/apalm

13. Dreyer G, Addis D, Nomes J et al. Direct assessment of the adulticidal efficacy of repeat high-dose Ivermectin in Bancroftian filariasis. Trop Med Int Health.1996; 1:427.

eISSN: 2349-6983; pISSN: 2394-6466

Case Report Non-leukemic Granulocytic Sarcoma Presenting as Multiple Skin Nodules: A Rare Case Report Pallavi Agrawal1*, Narender Kumar2, Deepak Bansal3, Raje Nijhawan4 1

Department of Pathology, Postgraduate Institute of Medical Education & Research, Chandigarh, India.

2 Department of Haematology, Postgraduate Institute of Medical Education & Research, Chandigarh, India.

3 Hematology-Oncology Division of Department of Pediatrics, Postgraduate Institute of Medical Education & Research, Chandigarh, India.

4 Department of Cytology and Gynaecological Pathology, Postgraduate Institute of Medical Education & Research, Chandigarh, India.

Keywords: Bone Marrow, Fine Needle Aspiration Cytology, Flow-Cytometry, Granulocytic Sarcoma

ABSTRACT Granulocytic sarcoma (GS) is a localized lesion comprising of immature granulocytes, monocytes, or both; involving extramedullary sites. GS is also known as myeloid sarcoma is a subtype of Acute myeloid leukaemia (AML) and related precursor neoplasms as per recent WHO classification of tumors of hematopoietic and lymphoid tissues. GS with no evidence of leukemia (non-leukemic GS) is a very rare. Here we report a 10 year old male child who presented with facial and back swelling which was subsequently diagnosed as non-leukemic GS by flow-cytometry examination on aspirated material. The patient was treated with chemotherapy as for regular AML, However succumbs after 2 course of chemotherapy due to febrile neutropenia.

*Corresponding author: Dr. Pallavi Agrawal, M.D., DNB, PDCC (Neuropathology), Postgraduate Institute of Medical Education & Research, Sector 12, Chandigarh 160012, India Phone: +91 7739165410 E-mail: dr.pallavimamc@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Agrawal et al.

Introduction Granulocytic Sarcoma (GS) is a localized tumor formed by immature myeloid cells or myeloblasts at an extramedullary site.[1] According to WHO classification of tumors of hematopoietic and lymphoid tissues; this is a part of Acute myeloid leukaemia (AML) and related precursor neoplasms. It usually occurs in patients of AML as well as in patients with myeloproliferative neoplasms (MPN’s). On rare occasions, GS may present without any other hematological malignancies and hence known as nonleukemic GS. The common sites of these nonleukemic GS are skin, central nervous system, lymph nodes, gastrointestinal tract, and gall bladder.[2] These usually present as diagnostic dilemmas because of absence of a prior diagnosis of leukemia and hence need be differentiated from other solid malignancies such as carcinomas, lymphomas etc. Here we describe a case of non-leukemic GS in a 10 year old male child who presented with facial and back swelling.

Case Report A 10 year-old-male child was admitted to pediatric unit for complaints of fever and nodules over the left side of face and back for 1.5 months. On examination he had moderate pallor, cervical lymphadenopathy and bluish coloured subcutaneous nodules over face and back. The clinical possibilities of bacterial infection, acute leukemia and lymphoma were considered and the patient was investigated accordingly. Ultrasound abdomen revealed mild hepatomegaly with mild splenomegaly. Complete blood count showed hemoglobin of 6.9 gm/dl, platelet count

C-20 of 213×109/L and total leucocyte count of 17.2×109/L with differential count of 65% neutrophils, 27% lymphocytes, 16% monocytes and 2% eosinophils. There were no leukemic cells in the peripheral smear. The blood cultures were sterile. Due to high degree of clinical suspicion of leukemia Vs lymphoma, a bone marrow examination and fine needle aspiration cytology (FNAC) were performed.

The bone marrow was normocellular and showed adequate representation of all three hematopoietic lineages.

There was no evidence of leukemia, myelodysplasia, myeloproliferative neoplasm and lymphoma involvement with in the bone marrow aspirate and biopsy [Fig-1]. On the other hand FNAC smears from the facial swelling were cellular and showed scattered immature mononuclear cells [Fig-2]. These cells were 2-3 times larger than the size of mature lymphocyte and had fine nuclear chromatin, conspicuous nucleoli and mild to moderate amount of amphophilic cytoplasm containing fine granules.

The background showed few mature lymphocytes and polymorphs. FNAC smears from the left cervical lymph node also revealed atypical cells with similar morphology.

Sample for flow-cytometry (FCM) was also taken at the same time from these subcutaneous nodules. The FCM examination revealed approximately 22.5% CD 45 positive events which showed presence of myeloid and monocytic markers (CD 45, HLA DR, CD 13, CD 117, CD 11c and CD14) and absence of all lymphoid markers (CD 3, CD 5, CD4, CD 8, CD 10, CD19, CD20, CD 22 and CD 79a) [Fig-3]. In view of absence of bone marrow involvement and presence of immature cells on FNAC along with presence of myeloid and monocytic markers on FCM, the

Fig. 1: [A] Bone marrow aspirate show presence of normal hematopoietic elements (MGG, 400X). [B] Bone marrow trephine biopsy also reveals normocellular marrow spaces (H&E, 400X). There is no evidence of involvement by leukemia.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-21

Non-leukemic Granulocytic Sarcoma

Fig. 2: [A] FNAC shows cellular smear with presence of singly scattered mononuclear cells (MGG, 200X). [B] High power view show that these cells have opened up nuclear chromatin, high nuclear cytoplasmic ratio and granular cytoplasm (MGG, 400X).

Fig. 3: [A] Panel of scatter plots showing the multicolor immunophenotyping from aspirated sample from facial swelling. The events are seen on side scatter (SSC) versus CD45 plot. The events in CD45 region are gated as P2 (22.5% of all events) and the same cells are analyzed in subsequent plots. [B] These cells show expression of HLA-DR and are negative for CD34. [C] These cells are positive for CD 13 and are negative for CD 3. [D] The same cell populations show expression of CD11c and CD14.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Agrawal et al. diagnosis of non-leukemic GS was considered. The patient was initiated on chemotherapy as for regular AML with UKMRC-AML protocol (The first induction course included Cytosine Arabinoside, Daunorubicin and Etoposide) and the lesions clinically resolved following the first course of chemotherapy. Unfortunately the patient had died after 2 course of chemotherapy due to febrile neutropenia.

Discussion GS is a rare extramedullary tumor that consists of immature granulocytic cells. This tumor was first described in 1811 and originally called as chloroma by King in 1853.[1- 3] Granulocytic sarcoma has been reported to occur in almost every anatomic location. These most common sites are the skin (13%–22%), central skeleton (9%–25%), and lymph nodes (15%–25%).[4] GS is associated with 3% -8% of acute myeloid leukemia (AML) cases and rarely with MPN’s. The exact incidence of nonleukemic GS is not well known. Benet C et al had found approximately 7.5% of the patients having leukemic skin infiltration without any underlying myeloid neoplasm, in a series of 173 patients with leukemia cutis.[5] Due to its rarity, non-leukemic GS is frequently misdiagnosed as other common malignancies. The differential diagnosis of nonleukemic GS is similar to that of GS which includes large cell NHL, lymphoblastic lymphoma, undifferentiated cancer, malignant melanoma, extra-medullary hematopoiesis and inflammation. [6] The critical point is to think about this entity and if there is a suspicion, the diagnosis must be confirmed by either immuno-histochemistry or FCM examination. In the index case FNAC of aspirated material also suggest the possibility of hematological malignancy however the exact diagnosis was confirmed by FCM on aspirated material from subcutaneous nodule.

Non-leukemic GS represents therapeutic dilemma as well because the optimal therapy for non-leukemic GS has not been determined. Several previous studies report that more than 80% of patients with nonleukemic GS who were treated by surgical excision or local radiation therapy eventually developed overt systemic leukemia within a few months. Some studies suggest that localized therapy alone would not be sufficient for the treatment of non-leukemic GS.[7-9] Yamauchi and Yasuda had reviewed 72 cases and concluded that the nonleukemic period after the diagnosis of GS was significantly longer in the patients who were treated with systemic chemotherapy, in comparison with the patients who did not received systemic chemotherapy.

[2] The long-term prognosis of non-leukemic GS remains poor (as in our case) and the majority of these died within an average of 16.5 months after diagnosis.[ 10]

C-22 diagnosed by FNAC and FCM of the aspirated material.

In cases with a high index of suspicion, the applications of ancillary techniques are mandatory for confirmation of disease. Patients with nonleukemic GS should be treated with intensive systemic chemotherapy in the early course of the disease to decrease mortality.

Conflict of interest

The authors declare that they have no conflict of interest.

Source of support Nil

References 1. Meis JM, Butler JJ, Osborne BM, Manning JT. Granulocytic sarcoma in nonleukemic patients. Cancer 1986; 58: 2697–709.

2. Yamauchi K, Yasuda M. Comparison in treatments of nonleukemic granulocytic sarcoma: Report of two cases and a review of 72 cases in the literature. Cancer 2002; 94:1739–46.

3. King A. A case of chloroma. Monthly J Med 1853; 17: 97.

4. Rodríguez Guerrero JM, Martín Hidalgo JR, Alonso Alejandro E, Pérez Ríos N, Roussel J, Rodríguez Pardo F et al. Granulocytic sarcoma (chloroma) of small bowel: an infrequent cause of intestinal obstruction.

Gastroenterol Hepatol 2003; 26: 347–50.

5. Bénet C, Gomez A, Aguilar C, Delattre C, Vergier B, Beylot- Barry M, et al. Histologic and immunohistologic characterization of skin localization of myeloid disorders: a study of 173 cases. Am J Clin Pathol 2011;135: 278–290.

6. Audouin J, Comperat E, Le Tourneau A, CamilleriBroët S, Adida C, Molina T et al. Myeloid sarcoma: clinical and morphologic criteria useful for diagnosis.

Int J Surg Pathol. 2003; 11: 271-82.

7. Neiman RS, Barcos M, Berard C, Bonner H, Mann R, Rydell RE et al. Granulocytic sarcoma: a clinicopathologic study of 61 biopsied cases. Cancer 1981; 48: 1426-37.

8. Spahr J, Behm FG, Schneider V. Preleukemic granulocytic sarcoma of cervix and vagina: initial manifestation by cytology. Acta Cytol 1982; 26: 55-60.

9. Krause JR. Granulocytic sarcoma preceding acute leukemia: a report of six cases. Cancer 1979; 44: 1017-21.

Nonleukemic GS is a very rare disease and have poor prognosis. This rare case of nonleukemic GS was

10. Lan TY, Lin DT, Tien HF, Yang RS, Chen CY, Wu K. Prognostic factors of treatment outcomes in patients with granulocytic sarcoma. Acta Haematol. 2009; 122: 238-46.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Conclusion

Case Report Eosinophilic Cholecystitis with Lipomatosis: A Rare Case Report and Review of Literature Tanima Dwivedi*, Ramesh Chavan Department of Pathology, KLE Universityâ&#x20AC;&#x2122;s J.N. Medical College, Belgaum, Karnataka, India Keywords: Eosinophilic Cholecystitis, Cholelithiasis, Eosinophils, Lipomatosis, Hyperplastic cholecystoses

ABSTRACT Eosinophilic cholecystitis and Lipomatosis of gallbladder are two different diseases, rarely occurring together. Both are diagnosed histopathologically. A 45 years old female who underwent routine elective laparoscopic cholecystectomy for chronic cholecystitis was diagnosed eosinophilic cholecystitis with cholelithiasis and lipomatosis on histopathological examination of gall bladder. This could be first case report of this unique combination. The rarity of the condition prompted us to report this case.

*Corresponding author: Dr Tanima Dwivedi, Post Graduate, Department of Pathology, KLE Universityâ&#x20AC;&#x2122;s J.N. Medical College, Belgaum, Karnataka (India)-590010 Phone: +91 9818774359 E-mail: tanimadwivedi@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Dwivedi et al.

Introduction Eosinophilic cholecystitis and lipomatosis of the gall bladder are two different entities, rarely occurring together Eosinophilic cholecystitis is a rare form of cholecystitis in which the eosinophils are predominant component of inflammatory cells in the wall of the gall bladder. It has prevalence of 0.25-6.4% in all cholecystitis. [1] Etiology of eosinophilic cholecystitis is still unknown. [2] Whereas lipomatosis of the gall-bladder is an unusual form of hyperplastic cholecystoses in which fatty proliferation of the subserosa of the gall-bladder wall occurs. The pathogenesis is uncertain, but chronic inflammatory changes may play significant role. [3] We were unable to find any literature about this rare combination.

Case Report A 45 year old female was admitted with complaints of abdominal pain and tenderness and guarding in the right upper quadrant since 1 year which was radiating to the back. She also complained of nausea and increase in the intensity of pain with fullness of stomach after having fatty food. No history of vomiting, jaundice, fever. There was no past history for allergies for anything or any drug intake.

On examination she was stable, afebrile. Icterus, cyanosis, pallor and clubbing were absent. Tenderness and guarding was present in right upper quadrant. Murphy’s sign was positive. Her investigation revealed Haemoglobin- 10.7 gm/dl, Total Leukocyte count- 11,700/cu.mm, Differential Leukocyte count: Neutrophils – 75%, Lymphocytes – 23%, Monocyte – 01% and Eosinophils – 01%. Absolute Eosinophil count was 0.12 X 103 / cu.mm.

A-25 Liver function tests showed Total Bilirubin– 0.8 mg/ dl with Direct Bilirubin– 0.2 mg/dl, Total Protein– 7 gm/dl, Albumin- 4mg/dl, A:G-1:3, Alanine transminase – 15 IU/L, Aspartate transminase – 21 IU/L, Urea- 14 mg/dl, Creatinine-0.8 mg/dl and Random Blood Glucose- 121 mg/dl. Serum electrolyte was normal (S. Sodium– 132 mEq/ L and S. Potassium– 4 mEq/L). Stool examination showed no parasite or ova.

Ultrasound examination of the abdomen revealed partially distended gall bladder with a calculus measuring 2.1 X 0.9 cm. Liver, bile duct and rest of abdominal viscera were unremarkable.

She underwent routine elective laparoscopic cholecystectomy under general anaesthesia. Per operatively a single pigment stone was identified in gall bladder and gall bladder wall was thickened.

On gross examination gall bladder measured 9.5 X 3.5 X 2cms [Figure 1A] .Cut surface showed velvety mucosa with thickened wall. Single large brown black coloured stone measuring 2 X 1.5cms was also present [Figure 1B].

Microscopic examination of the gallbladder showed thickened muscularis mucosa and mixed inflammatory infiltrate comprising predominately eosinophils (>90% of inflammatory infiltrate) which were present in all layers of the gallbladder. Significant amount of adipose tissue were seen in the muscularis mucosa [Figure 2A, 2B, 2C].

A histopathological diagnosis of Eosinophilic Cholecystitis with Cholelithiasis and Lipomatosis was made. The patient

Fig. 1A: Gross image of gall bladder., (1B) : Cut Surface of gall bladder showing thickened wall with adipose tissue in its wall.

Fig. 2A: Gallbladder showing inflammatory infiltrate in all the layer including eosinophils and adipose tissue in muscularis wall. (H&E 40X)., (2B): Marked Proliferation of Mature Adipose Tissue In Muscularis Mucosa Layer.

(H&E 40X)., (2C): Gallbladder submucosa showing >90% eosinophils (H&E 400X)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-26

Eosinophilic Cholecystitis with Lipomatosis

had unremarkable recovery and was discharged without any complication.

Discussion

Eosinophilic cholecystitis was first described by Albort et al in 1949 in French literature.[2] Till 2007, 24 cases of eosinophilic cholecystitis were reported in literature.[4] Etiology of eosinophilic cholecystitis is still unknown; however the postulated causes include allergies, parasites like Clonorchis sinensis and Ascariasis, hypereosinophilic syndrome, and eosinophilic gastroenteritis. Drugs like cephalosporin, erythromycin and a few herbal medicines also may contribute to this entity.[1,2,4,5,6,7] Usually itâ&#x20AC;&#x2122;s an acalculous cholecystitis but in rare cases itâ&#x20AC;&#x2122;s seen with gall bladder stones.[2,7] In this patient a gall stone was present which is rare association.

There is no specific clinical manifestation of eosinophilic cholecystitis apart from cholecystitis and diagnosis is by histopathological examination. When it is associated with systemic hypereosinophilic syndromes, laboratory investigation reveals peripheral eosinophilia. [1] The diagnosis of eosinophilic cholecystitis is based on histopathology of cholecystectomy specimens when 90% eosinophils infiltration is present within the wall of gallbladder. [1] Eosinophilic cholecystitis has been classified according to cellular infiltrate in the wall of the gall bladder as eosinophilic cholecystitis if it comprises of 90 % of

eosinophils and lympho-eosinophilic if infiltrate comprises of 50-75% eosinophils. [1] Table 1 shows reported cases of eosinophilic cholecystitis and lipomatosis in the literature.

Lipomatosis is a rare form of hyperplastic cholecystoses which is non-inflammatory pathologic processes resulting in benign proliferation of the normal gall-bladder tissue elements. In lipomatosis, the gall-bladder wall is thickened by fatty proliferation in the subserosa. [3] Its pathogenesis is poorly understood. Some studies considered chronic infection may play significant role. [3]

Conclusion We present this case because of the rare occurrence of eosinophilic cholecystitis with cholelithiasis and lipomatosis. A pathologist should be aware of this rare condition, since the physical findings of eosinophilic cholecystitis are indistinguishable from manifestation of the common acute cholecystitis. Therefore, there is need to investigate the patient carefully for other associated illnesses, which might have a worse prognosis than cholecystitis itself. Cholecystectomy remains the definitive treatment of this disease.

Acknowledgements None

Funding None

Competing Interests None declared

Table 1: Reported cases of eosinophilic cholecystitis and lipomatosis in the literature: S Age /sex Clinical Feature Eosinophilia Gall stone Dilated Histopathological no Common diagnosis Bile Duct 1. 55 yrs/ Abdominal Pain Absent Present Present Eosinophilic Female with Jaundice Cholecystitis 2. 49 yrs / Abdominal Pain Absent Present Absent Eosinophilic Female Cholecystitis 3. 60 yrs / Abdominal Pain Absent Absent Absent Lipomatosis Female 4. 41 yrs / Abdominal Pain Absent Multiple Present Eosinophilic Male Cholecystitis 5. 30 yrs / Abdominal Absent Absent Absent Eosinophilic Female Pain Nausea , Cholecystitis vomiting 6. 30 yrs / Abdominal Pain Present Multiple Eosinophilic Female Cholecystitis 7. 22 yrs / Abdominal Pain Present Multiple Eosinophilic Female Cholecystitis 8. 15 yrs / Abdominal Absent Absent Absent Eosinophilic Male Pain Nausea , Cholecystitis vomiting

Post operative period Uneventful

Reference No:

Uneventful

2

Uneventful

3

Uneventful

5

Uneventful

8

Uneventful

9

Uneventful

9

Uneventful

10

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

1

Dwivedi et al.

Reference 1. Sahu.SK, Srivastava P, Chauhan N, Kishore S, Sachan PK, Bahl DV. Eosinophilic Cholecystitis: A Case Report. The Internet Journal of Surgery 2007; 9 (1):4.

2. Malik KA. Eosinophilic cholecystitis: An infrequent cause of cholecystectomy. Pak J Med Sci 2010; 26(3):724-725.

3. Mahajan M, Sharma R, Sharma P, Gupta A. Ultrasonography and computed tomography imaging findings in lipomatosis of the gall bladder. Biomed Imaging Interv J 2013; 9(1):2.

A-27 6. Toyohara M, Yoshikawa M, Fukul H. Eosinophilic Cholecystitis along with pericarditis caused by Ascaris Lumbricoides:A case report. World J Gastroenterol 2007; 13(27):3760-2.

7. Dabbs DJ. Eosinophilic and lymphoeosinophilic cholecystitis. Am J Surg Pathol 1993; 17:497-501.

8. Kataria SP, Batra A, Singh G, Boombak E,Kumar S,Sen R. Eosinophilic Cholecystitis Associated with Papillary Hyperplasia of Gall Bladder. Iranian Journal of Pathology 2014 ;9 (4):281- 4.

4. Shakov R, Simoni G, villacin A, Baddoura W. Eosinophilic Cholecystitis, with a Review of the Literature. Ann of Clin & Lab Sci 2007; 37(2).

9. Choudhury M, Pujani M, Katiyar Y, Jyotsna P L, Rautela A.Idiopathic Eosinophilic Cholecystitis with Cholelithiasis: A Report of Two Cases. Turkish Journal of Pathology 2014 ;30( 2):142-144.

5. Singh DK, Shankar R, Gondal R, Malhotra V, Mishra P. Idiopathic eosinophilic cholecystitis with cholelithiasis: A case report and review of literature.

Internet Journal of Surgery 2008; 16:2.

10. Pan PJ, Chen YC, Tsai JJ. Idiopathic eosinophilic cholecystitis: A cause of hydrops of gallbladder in a young adolescent. Clinical Gastroenterology and Hepatology 2013;11(6):26.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Case Report T-cell Rich Large B-cell Lymphoma: A Rare Variant of Diffuse Large B Cell Lymphoma Mangal Pandure*, Ravindra Karle, Surykant Dongre, Varsha Deshpande Dept of Pathology .Pravara Institute of Medical Sciences. Loni, India Keywords: Non Hodgkinâ&#x20AC;&#x2122;s Lymphoma, Diffuse large B cell Lymphoma, T-cell histiocyte rich B cell lymphoma

ABSTRACT T-Cell Rich-B cell Lymphoma (TCRBCL) is separately defined by World Health Organisation(WHO), it is a subtype of Diffuse Large B cell Lymphoma (DLBCL). It is an aggressive disorder treated same as that of DLBCL. But some times it may not respond to therapy and it has poor prognosis. It requires careful histopathological examination and immunohistochemistry (IHC) for confirmation. We reported a rare case of subcutaneous T cell rich B cell lymphoma, which is confirmed by IHC which shows CD20 and CD3 marker positive.

*Corresponding author: Dr Mangal Motilal Pandure, Rural Medical College, Loni.Tal Rahata. Dist Ahmednagar, Maharashtra. India Phone: +91 9850125424 E-mail: mangal.garute11@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Pandure et al.

C-28

Introduction

It is an entity, accounting for approximately 1-2% of all non-Hodgkinâ&#x20AC;&#x2122;s lymphoma and generally believed to be a subtype of diffuse large B-cell lymphoma in the Revised European-American Lymphoma classification and upcoming WHO classification.[1] In 2008 according to WHO classification, THRBCL is included as specific subtype of diffuse large B cell lymphoma.2 TCRBCL are recently described ,unusual non-Hodgkin lymphoma that has diffuse morphology, a predominance of reactive T-cell and minority of neoplastic cell.[3] The neoplastic large B cell constitute less than 20% to 25% of the total cell population scattered among predominant component of reactive T lymphocytes and variable number of histiocytes including epitheloid cells and occasional eosinophil in background.[4] The diagnosis of TCRBCL can be confirmed with immunohistochemical analysis because neoplastic B cell are immunoreactive for CD20 , LCA and reactive T cell are positive for CD3,CD43 and CD4.[3]

Case Report(S)

A Fifty five years old male presented with back pain since fifteen days which aggravate on sitting position and during walking .Pain radiates to para spinal region. On examination the mass of size of 8x3 cm located on left subscapular region, fixed to subcutaneous tissue. Covering skin was free, no signs of inflammation. Clinicaly diagnosed as sarcomatous lesion. MRI study of dorsolumber spine (plain and contrast) revealed, partial collapse of D2 and L1 vertebral bodies with enhancing lesion involving multiple vertebrae (i.e C3, D1, D2, D3, D6, D10, D12 , L1, L2 and L5) causing significant obliteration of subarachnoid spaces and compression of spinal cord at thelevel D2, D12, L1 and L2 (figure1,2) Lesion was diagnosed as metastatic in nature. Excision biopsy performed from subscapular mass.

Biopsy mass measured 4x3x1 cm. Cut section showed greyish white appearance.(Figure 3 ) On Haematoxylin and Eosin stain (figure-4,5) biopsy examination showed tumour along with areas of necrosis. Tumour cells are arranged in sheets and cords. Cells are separated by thick fibrous septa. Individual tumour cells are round, large with large pleomorphic hyperchomatic nuclei, irregular nuclear margin, prominent 1-2 nucleoli and scanty cytoplasm.

Tumour cells are infiltrating skeletal muscle. Vascular proliferation along with lymphocytic infiltration between tumour cells noted. Diagnosis of Diffuse Large B cell Lymphoma was given. Advised immunohistochemistry for confirmation. It was done (By polymer detection kit) and positive for B cell marker CD20 ( Figure 6) and T cell marker CD3(figure7). Final diagnosis of T-cell rich Diffuse Large B cell lymphoma was reported.

Fig. 1: STIR SAG showing fracture of D2, D12 and L2 BMP (560X1484)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

T-cell Rich Large B Cell Lymphoma

C-29

Fig. 2: T2W SAG showing multiple metastasis

Fig. 3: Cut section shows greyish white appearance

Fig. 4: H & E X 100: Shows Infiltration Large cell with infiltration of T cell on background along with subcutaneous tissue ( skeletal muscle.)

Fig. 5: Section shows Infiltration Large cell with infiltration of T cell on background with skeletal muscle (H&E, X100).

Fig. 6: CD20 staining X100: Shows membranous staining of large B cell.

Fig. 7: CD3 staining X100: Membranous staining of reactive T cell.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Pandure et al.

Discussion Diffuse large B cell lymphoma (DLBCL) is a most common lymphoid malignancy in adults accounting for 40% of all non-Hodgkin lymphoma.[3] T cell / histiocytic rich B cell lymphoma is uncommon morphologic variant of DLBCL and it represents 1 -3% of all DLBCLs in recent series.

[3,5,6] It accounts for 1-2% of all Non Hodgkin lymphoma.3,1 TC/HRBCL currently categorized as a variant of diffuse large B-cell lymphoma as per WHO and Revised European American classification of lymphoid neoplasm.[1,7,8 ] The entity was first described as “T-cell-rich B cell lymphoma” in 1988 By Ramsay et al.[5] TCRBCL is recently described as histologic variant of B Cell Lymphoma characterized by minor population of clonal B cell distributed in background of numerically predominant polyclonal T lymphocyte.[9,10] As per WHO classification of 2001, T-cell / histiocytic-rich large B cell lymphoma (THRBCL) is defined by the presence of limited number of scattered large B cell in a background rich in T cell with or without histiocytes.[11] Most of the patients with TCRBCL present with nodal disease involving various sites of body. Extra nodal involvement has been reported in liver, soft tissue, spleen, nesopharynx, brain, tongue, mediastinum and bone, dura, stomach.[3,4] TCHRBCL occurs at a younger age than traditional DLBCL with a median age in the fourth decade of life compared with the sixth decade for DLBCLs as a whole. A male predominance has been noted in most series.[5] The reported mean age of occurrence of this disease is 40 years.[7]

C-30 BAX/BSAP,OCT2 BOB1. The cells are uniformly negative for CD15 and rarely show weak positivity for CD30 .CD5 and CD138 are uniformly negative. BCL-6 and CD79a are expressed by majority of tumor. CD10 are positive in in only a minority of cases.[5] Our case is immunoreactive for CD20 and CD3.

First, primary cutaneous TCRBCL is so rare that only few of cases have been reported in the literature. Second, TCRBCL in general is frequently misdiagnosed as pseudolymphoma, pleomorphic peripheral T-cell lymphoma or lymphocytepredominant Hodgkin’s lymphoma.[1] According to author, who considered this variant as an aggressive lesion and it is associated with poor prognosis by other author.[3] TCRBCL is an aggressive B cell NHL and it should be treated as high grade large cell lymphoma according to some author.[10]TCHRBCL is very aggressive disorder, which often does not respond to therapy.[11] CHOP (Cyclophosphamide, doxorubicin, vincristine and prednisolone) chemotherapy in combination with rituximab is used in TCHRBCL treatment as it is used in all CD 20 positive nodal and extra nodal lymphoma. Response to the treatment and prognosis of cases with TCHRBCL are similar to the DLBCL cases at the same stage.[6] Recent series have shown complete response rate to CHOP-like therapy in the range of 56- 63% with 3- year and 5- year overall survival rates, estimated at 50-64%.[5] More than 90% of patientsdetected to have stage III or IV disease, and bone marrow involvement is common (>50%).

The prognosis in such cases is poor, with 5 year survival by 20%.But this may be explainable by the high proportion of patients havingadvanced stage disease .[13]

Our patient is of older age group and presented with extra nodular subcutaneous lesion at left subscapular region. The neoplastic B lymphocyte display a heterogeneous spectrum of morphology, which includescentroblast, immunoblast, multinucleate RS like cell along with lymphocytes and histiocytes, as well as large cleaved and noncleaved cells.

[4] The malignant B cell constitutes less than 10%.[2,7,8,9,12] and reactive T cell on the background constitutes more than 50%.[7,13,14]

Conclusion

The diagnosis of TCRBCL can be confirmed with immunohistochemical analysis because of neoplastic B cell are immunoreactive for CD20 , LCA ,CD79a[4] and reactive T cell are positive for CD3, CD43,CD4 and CD45RO positive[3, 7]

Funding

Jeremy S Abrason stated that on immunohistochemical analysis malignant B cell of TC/HRBCL shows mark positivity for CD4, CD20 and B cell transcription factor

Reference

www.pacificejournals.com/apalm

We reported rare case of T cell rich large B cell lymphoma.

This is an aggressive disorder, treated as high grade large cell lymphoma, which requires proper clinical evaluation, histopathologicalstudy as well as immunohistochemistry to confirm diagnosis and for proper management.

Acknowledgements None None

Competing Interests None declared

1. Shiyong Li, Constance A Griffin, Risa B Mann, Michael J Borowitz. Primary Cutaneous T-Cell—Rich eISSN: 2349-6983; pISSN: 2394-6466

T-cell Rich Large B Cell Lymphoma

C-31

2.

3.

4.

5.

6.

7.

8.

B-Cell Lymphoma: Clinically Distinct from Its Nodal Counterpart? Modern Pathology 2001;14:10-13.

Pitttaluga S, Elaine S, Jaffe. T-cell/histiocyte-rich B-cell lymphoma. Haematologica. 2010; 95:352-356.

Bheemanagouda GP, Hallikeri KS, Krishna RP. T-CellRich Diffuse Large B-cell Lymphoma Presenting as an Intraosseous Maxillary Neoplasm. World Journal of Dentistry 2011; 2:53-55.

Jun Wang, Nora C. J. Sun, Sanford M. Weinstain.,RinoldoCanalis. Primary T-Cell –Rich B-Cell Lymphoma of the EthmoidSinus. Arch Pathol Lab Med 2000; 124:1213-1216.

Jeremy S. Abramson. T-Cell/Histiocyte Rich B-Cell Lymphoma: Biology, Diagnosis and Management.

The Oncologist 2006; 11(4):384-392.

Koksal AR, Alkin H, Ergun M, Boga S, Mehmet Bayram, Canan Alkim et.al. First case of T-cell/ histiocyte-rich B-cell lymphoma presenting with duodenal obstruction. Libyan Journal Med 2013;8:22955 Olaniyi JA, Oluwasola AO, Ibijola A. Therapy Outcome of a T-Cell-Rich-B-Cell lymphoma (TCRBCL) Patient with R-CHOP in Ibadan, Nigeria : a case report. Mediterranaean Journal of Haematology And Infectious Disease 2011; 3 open Journal System.

Chung-Che Chang, Ellen Bunyi-Teopengco, Camellia Eshoa, Christhoper R Chitamber, Bal Kapalath.CD5+ T-Cell/Histiocyte_Rich Large B-Cell Lymphoma.

Modern Pathology 2002; 15: 1051-7.

9. Jose Rodriguez J, WC Pugh, Cabanillas F. T- Cell – Rich B- cell lymphoma. Blood 1993;82(5): 15861589.

10. Shahabuddin D, Raghuveer CV. Reed-Sternberg-like cells in T- cellrich B-cell lymphoma: a diagnostic dilemma. Indian Journal of PatholMicrobiol 2003; 46(1):55-56.

11. Peter Van Loo, Thomas Tousseyn, Vera Vanhentenrijk, Daan Delabie, Agnieszka Maleka. T-cell/histiocyte –rich large B-cell lymphoma shows transcriptional features suggestive a tolerogenic host immune responce.Haematologica 2010; 95:440-448.

12. R C Gatter, R A Warnke. Diffuse Large B cell Lymphoma.World Health Organisation Classification of Tumours. Pathology and Genetics. Tumors of hemopoietic and lymphoid tissue.Third edition .PlaceLyon.Published by IARC press,, International Agency for research on Cancer. 2001:173.

13. Jhon K C Chan. Tumours of Lymphoreticularsystem.

Christopher D. M. Flecher. Tumours of lymphoreticular system .Diagnostic Histopathology of Tumors. Third Edition. Vol 2.Place- Philadelphia. Published by Churchill Livingstone ELSVIER.2007: page 1204.

14. Thomas J. Cummings, Timothy T. Stenzel, Gordon Klintworth, Glenn J Jaffe. .T-Cell—Rich Large B-Cell Lymphoma. Arch Pathol Lab Med. 2005;129:1050-1053.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Cytopathological Diagnosis of Giant Cell Tumor of First Metacarpal: A Rare Site for a Common Tumor Indranil Chakrabarti1, Sankarshan Bhaduri1, Asit Chandra Roy2 1

2

Department of Pathology, North Bengal Medical College, Darjeeling (WB), India Department of Radiodiagnosis, North Bengal Medical College, Darjeeling (WB), India Keywords: Giant Cell Tumor, Metacarpal, Cytology

ABSTRACT Giant cell tumor (GCT) or osteoclastoma is a common benign tumor which is locally aggressive and is of unknown etiology. They usually occur in young adults (commonly between 20-50 years) at the epiphysis region of long bones.

Small bones of hand are very rare sites of these tumors. Here, we present the case of a 18-year-old male who presented with a swelling in the right thenar region. The X-ray revealed an osteolytic lesion in the first metacarpal bone of right hand with soft tissue swelling. Fine-needle aspiration cytology (FNAC) and subsequent histopathology revealed a giant cell tumor. The case is presented because of the unusual site of the tumor and the characteristic radio-cytopathological findings.

*Corresponding author: Dr. Indranil Chakrabarti; Associate Professor, Department of Pathology, North Bengal Medical College; P.O. :Sushrutanagar, District: Darjeeling.

West Bengal, India . 734012.

Phone: +91 9433187448 E-mail: drinch@rediffmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Giant Cell Tumor of First Metacarpal

C-33

Introduction Giant cell tumor (GCT) of the bone is a benign, aggressive tumor with frequent local recurrences and potential for metastasis and malignant transformation.[1]It usually occurs in young adults (commonly between 20- 40 years) with peak incidence in the 3rd decade. The male: female ratio is 3:4. Nearly 85-90 % occur in the epiphyses of long bones of which 46.2% occur around knee joint.[2] Other frequent sites are distal radius, proximal humerus and fibula. 4% occur in pelvic bone. The small bones of the hand and feet are very rarely involved.[3] Giant cell tumors of hand represent as low as 2% cases.[2,4] Here we are presenting a case of giant cell tumor of first metacarpal bone of right hand diagnosed by FNAC, which is a very rare site for such tumor.

Case Report(S) An 18 year-old male, presented to the Surgical Out-patient Department with the chief complaints of swelling and pain over the right thenar region for 6 months and 4 months respectively. The swelling was insidious in onset and gradually increasing in size. Pain was mild to moderate in intensity and was dull aching in nature It was relieved on medication but aggravated by activity. There was no history of trauma or any constitutional symptoms.

On physical examination, there was a localized ovoid swelling 4 X 3 cm over the right thenar region opposing the first metacarpal with well- defined margins and stretching of overlying skin but the overlying skin was free. (Figure 1a)The swelling was hard in consistency and tender on deep palpation.

Fig. 1: (a) Photograph showing the swelling in the right thenar region; (b) X-Ray showing an expansile osteolytic lesion involving the whole of first metacarpal bone with soap bubble appearance.

Radiographs revealed an expansile osteolytic lesion involving the whole of first metacarpal bone and with soap bubble appearance, cortical break and soft tissue swelling (Figure 1b) The complete blood counts and thyroid function tests were within normal limits.

Fine needle aspiration was subsequently performed which revealed cellular smears comprising of a dual population of mono-nuclear spindle cells in cohesive clusters as well as arranged in singles along with osteoclastic giant cells containing numerous uniform nuclei. The spindle cells had ovoid nuclei, bland chromatin, small nucleoli, moderate amount of cytoplasm and were devoid of nuclear pleomorphism. (Figure 2) Rayâ&#x20AC;&#x2122;s amputation was performed which involved excision of the entire finger with the corresponding first metacarpal.

The cytological diagnosis was confirmed by histopathological examination of the excised tumor which comprised of two main components, stromal cells and osteoclastic giant cells. The giant cells were large, uniformly distributed throughout the lesion, have 20 -30 nuclei mostly arranged toward the center. The mono nuclear cells were round to oval and nuclei resembled those of giant cells. No atypical mitosis or necrosis was noted. Presence of giant cells and stromal cells were noted in lymphovascular spaces at the periphery of the tumor.

(Figure 3) After surgery the patient recovered in 2 months and after 6 months of follow up, there were no signs of recurrence both clinically and radiologically.

Fig. 2: Microphotograph showing the osteoclast-like giant cells with scattered stromal cells in a hemorrhagic background. (MGG stain; X100); Inset shows two such giant cells. (H&E; X 400)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Chakrabarti et al.

C-34 giant cells, in giant cell tumor of tendon sheath there is presence of mono nuclear histiocyte-like polygonal to spindle cells, foamy macrophages, hemosiderin laden macrophages and few multinucleated giant cells.[8] Aneurysmal bone cysts have radiological features same as giant cell tumor. Most characteristic findings are large amount of blood obtained during aspiration, paucicellular smears, scattered osteoclastic giant cells, spindle shaped fibroblastic cells and hemosiderin laden macrophages.

Osteoblastoma occurs mainly in the vertebral column in the third decade with male predominance. Cytology reveals cells of osteoblastic type, clusters of spindle cells mixed with osteoclastic giant cells.

Fig. 3: Microphotograph showing the characteristic histopathological features of uniformly distributed giant cells among the benign looking stromal cells. Inset shows tumor emboli in lymphovascular spaces. (H&E; X 100)

Discussion Giant cell tumor of the bone is a benign, locally aggressive lesion having potential of metastasis and malignant transformation. It is a tumor composed of connective tissue stromal cells having the capacity to recruit and interact with multinucleated giant cells that exhibits phenotypic features of osteoclasts. [1],[5] Giant cell tumors predominate in epiphyseal region of long bones (75-90%). Spine and innominate bones are involved occasionally. Giant cell tumors of the bones of the hand are very rare accounting for only 2% of cases. Overall they appear in a younger age group and have shorter duration of symptoms averaging 6 months or less before diagnosis is made.[2],[4] Radiological features reveal expansile, lytic lesion with soap bubble appearance[6] as was seen in our case.

Cytological features comprise of a cellular smear consisting of a double population of mononuclear spindle cells and giant cells of osteoclastic type.[7]

Chondroblastomas are rare tumors arising mostly in the epiphysis of long bones during the second decade with a male preponderance. Cytology shows mononuclear cells with well-formed cytoplasm, rounded nuclei, osteoclast like giant cells and fragments of chondroid matrix.

Giant cell reparative granuloma and brown tumor of hyperparathyroidism contain areas of aggregated giant cells having less nuclei than giant cell tumor and more fibrotic stroma and hemorrhage and hemosiderin deposit than giant cell tumor.

Chondromyxoid fibroma is a very rare tumor occurring in the metaphyseal region of long bones in second or third decade and comprises of myxoid background matrix, cartilage fragments, dispersed spindle shaped fibroblastic cells and osteoclastic giant cells.

Nonossifying fibroma is very rare on fine needle aspiration cytology. Only one case was reported which comprised of fibroblast like cells, histiocytic cells with foamy or vacuolated cytoplasm and osteoclastic giant cells. A foreign body giant cell reaction contains only giant cells but not mononuclear cell stroma.

Osteosarcoma may contain giant cells but there will be pleomorphism and nuclear atypia in osteosarcoma.[9]

Giant cell tumor of tendon sheath is a soft tissue lesion of the hands and feet which appears on plain radiograph as a fairly circumscribed soft tissue mass with few cases showing cortical erosion. While a giant cell tumor of bone show a dual population of stromal cells and multinucleated

Due to the presence of multiple giant cell containing lesions, diagnosing giant cell tumor on cytology is quite difficult. Clinicoradiological correlation as well as histopathological confirmation is necessary for diagnosis.

In our case, there were both stromal cells and osteoclast like giant cells but features of other giant cell containing lesions like giant cell tumor of tendon sheath, aneurysmal bone cyst, osteoblastoma, chondroblastoma, brown tumor of hyper parathyroidism, reparative granuloma of jaw, foreign body giant cell reaction were absent. The X- ray finding coupled with the cytological features guided the diagnosis of giant cell tumor although the location was not

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Differential diagnosis includes giant cell tumor of tendon sheath, aneurysmal bone cyst, osteoblastoma, chondroblastoma, brown tumor of hyper-parathyroidism, reparative granuloma of jaw, chondromyxoid fibroma, non-ossifying fibroma, foreign body giant cell reaction and osteosarcoma.[6,7]

Giant Cell Tumor of First Metacarpal

C-35 a common one. However the subsequent histopathological examination confirmed the cytological diagnosis.

The treatment of giant cell tumor should be surgical when feasible. It consists of curettage with bone grafting or en bloc excision with replacement by allograft.[6]

Conclusion Giant cell tumor involving the base of metacarpal bone and is a very rare site for giant cell tumor. Giant cell tumor in the small bones of the hand can present a challenge both in radiological diagnosis due to rarity and in pathologic diagnosis due to similarities with other reactive, benign or malignant giant cell containing lesions. This case is presented because of the unusual site of the tumor and characteristic radio-cytomorphological features which helped to arrive at a confirmatory diagnosis.

Acknowledgements NIL

3. Huvos AG. Bone tumors: diagnosis, treatment, and prognosis. Second ed. Philadelphia, Pa: Saunders, 1991; 429-467.

4. Dahlin DC, Cupps RE, Johnson EW. Giant-cell tumor: a study of 195 cases. Cancer 1970; 25:1061-1070.

5. Murphey MD, Nomikos GC, Flemming DJ, Gannon FH, Temple HT, Kransdorf MJ. Imaging of giant cell and giant cell reparative granuloma of bone: radiologic-pathologic correlation. RadioGraphics 2001; 21:1283-309.

6. Wold LE, Swee RG. Giant cell tumor of the small bones of the hands and feet. SeminDiagnPathol 1984; 1:173-84.

7. Akerman M, Domanski H. Bone. In, Orell SR(ed).

Orell &Sterrett’s Fine Needle Aspiration Cytology, Fifth edition. Gurgaon, Elsevier, 2012; 417-18.

Funding None

Competing Interests None declared

Reference

2. Unni KK, Inwards CY. Giant cell tumor (Osteoclastoma). In, Unni KK (ed). Dahlin’s Bone Tumors, Sixth edition. Singapore, Lipincott Williams & Wilkins, 2010; 226.

1. Goldenberg RR, Campbell CJ, Bonfiglio M. Giant cell tumour: An analysis of 218 cases. J Bone Joint Surg Am. 1970;52:619–64.

8. Gupta K, Dey P, Goldsmith R, Vasishta RK. Comparison of cytologic features of giant-cell tumor and giant-cell tumor of tendon sheath. Diagn Cytopathol. 2004 ;30(1):14-8.

9. Akerman M. Benign & malignant tumors of bone.

In, Gray W(ed). Diagnostic cytopathology, Second edition. London, Elsevier, 2004;887-91.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Giant Apocrine Hidrocystoma of the Anogenital Region: A Case Report Rajeshwari K1*, Akshay Surana1, Karibasappa G.N2., N. V. Dravid1 1

Department of Pathology ACPM Medical College, Dhule, Maharashtra, India Department of Public Health Dentistry, ACPM Dental College, Dhule, Maharashtra, India.

2

Keywords: Apocrine Gland, Hidrocystoma, Adnexal Neoplasm

ABSTRACT Hidrocystomas are rare, benign, cystic lesions of the sweat glands. They result from proliferation of the apocrine secretory coil or eccrine duct. Hidrocystomas are of two types, apocrine and eccrine depending on the origin of the cyst.

These commonly occur over the head and neck region and their size ranges from few millimeters to a centimeter in diameter. The tumours more than two centimeters in diameter are called as giant apocrine hidrocystoma. The occurrence of such giant apocrine hidrocystoma over the anogenital region is rare and we found that there is paucity of literatures regarding the apocrine hidrocystoma having atypical presentation. The differential diagnosis of the cystic neoplasms often poses a diagnostic challenge in this site.

Hence, we present the case of giant apocrine hidrocystoma in a 23-year-old male patient measuring 2.5x2.3 cm in size and located in the anogenital region. The excisional biopsy of the lesion was performed. Histopathologically, the lesion showed double-layered secretary epithelium of apocrine type.

Here, we discuss a rare case of giant apocrine hidrocystoma over the anogenital region and highlight its histopathological features and its close differential diagnosis of cystic lesions over the anogenital region.

*Corresponding author: Dr Rajeshwari K, Department of Pathology ACPM Medical College Dhule, Maharashtra, India Phone: +91 750768899 E-mail: ujwalgk@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Giant Apocrine Hidrocystoma

C-37

Introduction Hidrocystoma are rare, benign, cystic lesions of the sweat glands. They result from proliferation of the apocrine secretory coil or eccrine duct. Hydrocystoma are of two types, apocrine and eccrine depending on the origin of the cyst. Apocrine hydrocystomas are cystic lesions arising from the apocrine secretary coil, whereas eccrine hydrocystomas represent retention cysts of the eccrine duct. [1] Apocrine hydrocystoma normally have varying diameters of 3-15mm in size and tumours more than 20mm are called as giant apocrine hidrocystoma. [2] They are commonly found on head, neck and the trunk regions [3] and the rare sites of presentation are axilla, penis and anal region [4]. They usually present as solitary, dome shaped with varying colours like translucent to skincoloured, erythematous, brown and blue/purple colour. [1] To the best of our knowledge there are very few case reports in the English literature on giant apocrine hidrocystoma at a rare site in the anogenital region.

Herein, we present a rare case of giant, solitary apocrine hidrocystoma of 28mm in size located in the anogenital region causing functional morbidity.

Case Report A 23year-old-male patient presented to surgical outpatient Department with a history of swelling, located in between the anus and scrotal region since five months (figure 1).

The patient underwent en-block resection of the lesion under general anesthesia and the specimen was subjected to histopathological examination.

Pathological findings; The gross examination of the specimen showed cyst measuring 2.5x2.3 cm with grayish white in colour. The histopathological examination of the paraffin section stained haematoxylin and eosin (H and E) revealed presence of cyst in the dermis (figure 2).

The cyst was lined by an inner layer of secretary columnar epithelium which lay above an outer myoepithelial cell layer (figure 3).

At places, the secretary epithelium showed decapitation, which suggested the diagnosis of apocrine hidrocystoma (Figure 4).

Discussion Apocrine hidrocystoma are benign cystic tumours of the secretary portion of apocrine sweat glands, first described by Mehregan in 1964. [5] Since, most of the adnexal neoplasms exhibit a morphological differentiation towards one / more types of adnexal structures which are found in the normal skin, (pilosebaceous units, eccrine and apocrine glands) and hence, very essential to know the histomorphological features of adnexal neoplasms.

Patient presented with history of difficulty in sitting position and doing routine work. There was no history of trauma. Medical and family histories were insignificant.

Local examination revealed there was a solitary swelling of 2.8x 2.5 cm in size occupying between the anus and scrotal region and was covered with skin. Fluctuation was positive. Clinical diagnosis of adnexal tumour was offered.

The apocrine glands are most frequently present in the axilla, the groin, the external auditory canal, and the eyelids and on the nipple. The exact stimulus for the development of an apocrine hidrocystoma is unknown. The occlusion or blockage of the sweat duct apparatus, results in the retention of sweat and a dilated cystic structure, are considered to be the causes. They are believed to be the adenomatous cystic proliferation of the apocrine gland. [6]

Fig. 1: solitary swelling occupying the anogenital region.

Fig. 2: Hidrocystoma located in the dermis (H&E).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Rajeshwari K et al.

C-38

Fig. 3: Cyst lined by an inner layer of secretary columnar epithelium, which lies above an outer myoepithelial cell layer (H and E, 100X).

Fig. 4: Cyst wall with secretary epithelial cells with apocrine snouts (H and E, 400X).

The literatures suggest that apocrine hidrocystoma are relatively common in the united states. There is no predilection for sex, race or geographic region for apocrine hidrocystoma. It occurs in adulthood, although there is no particular age group for its occurrence. Apocrine hidrocystoma usually are asymptomatic, no seasonal variation, familial tendencies have been identified. They grow slowly and usually persist indefinitely. [3] Patient approaches either due to cosmetic reason or functional morbidity.

like secretary epithelium that characterized apocrine hidrocystoma.

Apocrine hidrocystoma may appear as single/multiple with varying diameter of 3-15mm. Tumours more than 20mm are called as giant apocrine hidrocystoma. [2] Clinically eccrine and apocrine hidrocystoma has got similar presentation. However, the apocrine type produces oily, foamy secretions whereas eccrine type produces watery secretions. Histopathologically, apocrine hidrocystomas demonstrate multiple cystic spaces, papillary projections and an outer wall of myoepithelial cells, in contrast to eccrine hidrocystomas which have a single cystic cavity, no papillary projections and is lined by one or two layers of cuboidal epithelial cells. [7] In addition to histomorphology various literatures show the adjunct methods like special stain, electron microscopy and immunohistochemistry in confirming the diagnosis and to differentiate it from other differentials. [1]

Very often, the apocrine hidrocystoma present as blueblack coloured nodules and hence, their differentiation from melanoma and basal cell carcinoma is important. [8] In the genital region the differential diagnosis of cystic lesions include acquired haemangioma, lymphangioma, sclerosing lymphadenitis, hiadenoma papilleferum and syringocystadenoma.

Acquired lymphangiomas usually occurs due to alteration in the lymphatic drainage and histologically shows multiple dilated lymphatic channels filled with lymph or blood.

Sclerosing lymphangitis histologically shows hypertrophy of lymphatic vessels. In hiadenoma papilleferum there are multiple papillary projections into the cystic spaces lined by a single layer of columnar cells with decapitation secretion of the apocrine glands. [9] Whereas in syringocystadenoma histopathologically reveal hyperkeratotic, parakeratotic squamous epithelium with glandular papillary proliferation connected to the epidermis having dense plasma cell infiltrate. [10] Spontaneous resolution is rare and successful management is by excision with complete cyst wall removal in order to avoid recurrence. Multiple cysts are treated with laser thermo-ablation curettage and botulinum toxin.

The other clinical differential diagnosis includes epidermal inclusion cyst, haemangioma, lymphangioma, mucoid cyst, sebaceous cyst, molluscum contagiosum and atypical basal cell carcinoma. But these lesions differ from the apocrine hidrocystoma histologically[3] as it lacks the apocrine-

We have opted for en-block excision of the complete cyst and postoperatively patient doing well, with no recurrence till the date of review of the case.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

To the best of our knowledge in the English literatures there are very few case reports, on a rare tumour of giant apocrine

Giant Apocrine Hidrocystoma

C-39 hidrocystoma located at a rare site in the anogenital region presenting with functional and cosmetic disfigurement despite its histologically benign nature. Hence, the present case has been reported for its rarity, size and its unusual presentation.

Conclusion Although giant apocrine hidrocystoma are rare and typically asymptomatic, still they are of interest as they closely resemble serious skin disorders which include both benign and malignant conditions which have to be ruled out. Awareness of this entity helps the surgeon in decision making regarding the surgical management.

References 1. Kentaro K, Shuichi F, Harumi I, Yuji M, Fumio I, Kaoru K. Apocrine Hidrocystoma of the Lower Lip: A Case Report and Literature Review. Head and Neck Pathol 2014; 8:117â&#x20AC;&#x201C;121.

2. Prabhu A, Prabhu M, Niranjan K, Grampurohit UV. Recurrent giant apocrine hidrocystoma of the eyelid: A case report. Egyptian Dermatology Online Journal 2014; 10;10.

3. Vani D, Dayananda T R, Shashidhar HB, Bharathi M, Hareesh R S Kumar, V Ravikumar. Multiple Apocrine

Hidrocystomas: A Case Report. Journal of Clinical and Diagnostic Research 2013;7:171-72.

4. Choudhary S, Suba G, Ramesh BS, Shanmukan MB. Hydrocystoma of eyelid: a case report. Int. J. Curr.

Res. Aca. Rev 2015;3:159-61.

5. Mehregan AH. Apocrine cystadenoma, a clinicopatholoical study with special reference to the pigmented variety. Arch Dermatol 1964;90: 274-79.

6. Rapini RP. Apocrine Hidrocystoma. http://www. emedicine.com/derm/ topic35.htm.

7. Vashi N, Mandal R. Giant multi-loculated apocrine hidrocystomas. Dermatol Online J 2010;16:16 8. Choudhary S, G Suba, BS Ramesh and MB Shanmukan. Hydrocystoma of eyelid: a case report.

Int. J. Curr. Res. Aca. Rev. 2015; 3(3): 159-61.

9. Yi-Shan L, Jyh-Seng W, Tzong-Shiun L. A 25-yearold man with a dome-shaped translucent nodule on the glans penis. Dermatologica Sinica. 2010; 28:177â&#x20AC;&#x201C;78.

10. Vishwapriya.M.G ,Darshan.P.M, Deshpande.S.A , Suvernekar.S.V. Syringocystadenoma PapilliferumCase Report. IOSR Journal of Dental and Medical Sciences 2013; 5(1):43-6.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Primary Systemic Amyloidosis: A Case Report Tanima Dwivedi, Ramesh Chavan Department of Pathology, KLE Universityâ&#x20AC;&#x2122;s J.N. Medical College, Belgaum, Karnataka(India)-590010 Keywords: Primary Systemic Amyloidosis, Idiopathic , Plasma Cell Dyscrasia, AL amyloidosis

ABSTRACT Primary systemic amyloidosis is a rare entity. We report a case of primary systemic primary amyloidosis, an elderly male presented with generalized weakness since 6 months. Clinical examination revealed typical waxy lesions in the periorbital area with macroglossia. Serum electrophoresis was normal, however, bone marrow examination showed increased plasma cell with a good number of both binucleated and immature plasma cells. Diagnosis was confirmed by skin biopsy using haemotoxylin & eosin staining and congo red staining. Polarised microscopy was not done because of unavailability. We present the myriad manifestations of this uncommon disease entity.

*Corresponding author: Dr Tanima Dwivedi, Post Graduate, Department of Pathology, KLE Universityâ&#x20AC;&#x2122;s J.N. Medical College, Belgaum, Karnataka(India)-590010 Phone: +91 7406741788, 9818774359 E-mail: tanimadwivedi@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-42

Primary Systemic Amyloidosis

Introduction Primary systemic amyloidosis (AL amyloidosis) is a rare disease with an age-adjusted incidence of 5.1 to 12.8 per million person-years.[1] It is a plasma cell dyscrasia of unknown etiology with production of monoclonal chains.[2] Immunoglobulin light chains, or fragments of light chains, produced by these plasma cell clones form extracellular amyloid fibrils which are deposited in the organs.[3] Most frequently organ involved are heart, smooth and skeletal muscle, and other soft tissues, kidney, liver and spleen.[2] It’s the disease of elderly.

Case Report A 61 years old male patient was presented to skin department with chief complaints of pigmentation around the eyes since 1 year and generalized weakness since 6 month. Therewere no other systemic complaints or any chronic illnesses in the past.

On examination waxy papules, purpura and ecchymoses were seen in the periorbital region [Figure 1A] with macroglossia [Figure 1B]. Per abdomen examination and Neurological examination was unremarkable On investigations, he had hemoglobin of 10.4 g/dl with neutrophilic leucocytosis. Urine examination was normal.

24 hrs urine examination negative of albumin and urinary Bences Jones proteins were absent. Liver and kidney function tests were normal. Serum protein electrophoresis was normal (serum albumin-3.60, serum α1 globulin- 0.23, serum α2 globulin-0.55, γ globulin-1.50, No M band was seen.

Skin biopsy showed flattened epidermis with eosinophilic material deposition in the papillary dermis [Figure 2A] .Skin appendages appeared normal. Congo red stain was positive [Figure 2B]. Polarised microscopy was not done.

Bone marrow examination showed normoblastic normocellular marrow with plasmacytosis (10%). There were good number of both mature and immature plasma cells. Few of the plasma cells are binucleated [Figure 2C].

No other biopsies or aspirate were performed to demonstrate the amyloid.

Discussion Amyloid is a pathologic proteinaceous substance deposited in the extracellular space in various tissues and organs of the body. [5] In light microscope and H & E stains, amyloid appears as an amorphous, hyaline, eosinophilic, extracellular substance which encroaches on and produces pressure atrophy of adjacent cells. [5] The Congo red stain result in a brick red staining reaction. It gives green birefringence in polarizing microscopy. These staining characteristics result from the cross beta-pleated sheet conformation of the polypeptide backbone of the amyloid fibrils. These fibrils are ultrastructurally continuous, nonbranching with diameter of 8 to 12 nm and of indeterminate length. [2, 5] Systemic amyloidosis can be classified as follows: (1) Primary systemic amyloidosis, usually with no evidence of preceding or coexisting disease, plasma cell dyscrasia or paraproteinemia, amyloid is derived from monoclonal immunoglobulin light chain and is called as AL amyloid; (2) Amyloidosis associated with multiple myeloma; or (3) Secondary systemic amyloidosis with evidence of coexisting previous chronic inflammatory or infectious conditions.[3,6,7] Amyloid fibrils in secondary systemic amyloidosis are derived from cleavage fragment of the circulating acute phase reactant serum amyloid A protein.

This serum amyloid A protein is synthesized in liver during inflammation. [3, 8]

Figure 1A: Showing waxy papules, purpura and ecchymoses in the periorbital region., (1B): Macroglossia with ecchymosis on hard palate (arrow).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Dwivedi et al.

A-43

Fig. 2A: Skin biopsy showed flattened epidermis with eosinophilic material deposition in the papillary dermis (400X)., (2B) : Congo red showing brick red staining reaction in the dermis.(400X)., (2C): Bone marrow aspiration (wright stain ) showing increase in plasma cells (arrow).(1000X)

Historically, the distinction between Primary systemic amyloidosis (AL amyloidosis) and Secondary systemic amyloidosis (AA amyloidosis) was made utilizing the latterâ&#x20AC;&#x2122;s sensitivity to permanganate.[2] Loss of Congo red staining after treatment with potassium permanganate is a property of AA amyloid that can distinguish it from other types.[2] In our case, congo stain was retained after the potassium permanganate treatment.

Amyloidosis confined to the skin is known as primary localized cutaneous amyloidosis. Amyloid in these cases are derived from keratin released from apoptotic keratinocytes. [2, 3] Different forms of primary localized cutaneous amyloidosis are lichen amyloidosis, macular amyloidosis and nodular amyloidosis. [2] They all differ in their clinical presentation. Lichen amyloidosis is the most common form of primary localized cutaneous amyloidosis, it present as multiple pruritic, red/brown, scaly papule which can coalesce to thickened verrucous surfaces. It usually, occurs in male, aged 50-60 years and most common site are shins, thighs, feet, and forearms. [2] Macular amyloidosis present over upper back in early www.pacificejournals.com/apalm

adult life, as pruritic macules showing pigmentation with a reticulated pattern. [2] Nodular amyloidosis is the rarest form, it occurs on the trunk, limbs, extremities, face, and genitals as single or multiple nodules. [2] Whereas primary systemic amyloidosis present as petechiae , ecchymoses, waxy papules, nodules or plaques around the eyelids, neck, groin and anogenital area. [2] In multiple myeloma associated AL amyloidosis, neoplastic plasma cell clone produces precursor light chains of immunoglobulin (Bences Jones protein) which can be detected in serum or urine electrophoresis.[3] Systemic amyloidosis is found in 5-15% of multiple myeloma patients but majority of the patient with AL amyloidosis donâ&#x20AC;&#x2122;t have obvious B cell or plasma cell neoplasm i.e. idiopathic, however these patients have underlying B cell dyscrasia in which production of abnormal protein and increased plasma cell population on the bone marrow examination rather than tumour masses is the predominant manisfestation.[2,3] Amyloid can be deposited in any tissues which lead to distortion of tissue architecture and organomegaly and organ dysfunction. eISSN: 2349-6983; pISSN: 2394-6466

A-44

Primary Systemic Amyloidosis

Mucocutaneous involvement is seen in 30-40% of AL amyloidosis patients. [7] The most common cutaneous lesions are petechiae and ecchymoses.[2] They are the result of deposition of amyloid in vessel wall causing capillary wall fragility which can rupture even from minor trauma, it is also called as “pinch purpura” .[2] Periorbital area is most common site of purpura formation. Senile purpura also is due to capillary fragility but it is rarely seen on face. [3] Amyloid deposition in superficial dermis produces shiny waxy papules and commonest sites are eyelids, face, flexor surface and the buccal mucosa. When it is deposited around pilosebaceous unit, it leads to destruction of hair leading to alopecia. Direct infiltration of skin can result in scleroderma. [4] Infiltration in nail matrix results in whitening of nails, banding, brittleness and onycholysis.

Amyloid deposition in tongue leads to macroglossia.

Macroglossia is reported in 19% of patients with primary systemic amyloidosis. [7] Carpel tunnel syndrome is seen 25% cases of primary systemic amyloidosis. [2, 3] Infiltration to peripheral nerves causes peripheral neuropathy. [2, 3] Cardiac involvement leads to conduction defects, arrhythmias and congestive cardiac failure. [2, 3] The major cause of death in primary systemic amyloidosis is cardiac failure and renal failure. [3] The median survival of patient with myeloma associated AL amyloidosis is 5months to 2.1 years. [7] Treatment aim is to reduce the precursor protein by decreasing the proliferation of plasma cells, by cytotoxic agents, immunosuprresants, .Anti neoplastic drugs can be used to slow down the renal impairment by inhibiting polymerization of amyloid fibrils.

Conclusion Primary systemic amyloidosis is a rare condition with poor prognosis. Its timely recognition has important implication for management and prognostication in order to reduce morbidity and mortality. This case is presented, due to

rarity of the condition and also to increase awareness of its characteristic features and help in diagnosis.

Acknowledgements None

Funding None

Competing Interests None declared

Reference 1. Falk RH, Comenzo RL, Skinner M. The Systemic Amyloidoses. N Engl J Med 1997:898-909 2. Maize JC, Metcalf J. Metabolic diseases of the skin.

In : Elder DE, Elenitas R, Murphy GF, Johnson BL etal. Lever’s Histopathology of the Skin. 10th ed.

Philedelphia: Wolter Kluwer; 2009 p.425-9.

3. Saoji V, Chaudhari S, Gohokar D. Primary Systemic Amyloidosis: Three different presentations. Indian J Dermatol Venereol Leprol 2009;75:394-7.

4. Silverstein SR. Primary systemic amyloidosis and the dermatologist: where classic skin lesions may provide the clue for early diagnosis. Dermatology Online Journal 11(1):5 5. Kumar V, Abbas A, Fausto N. Diseases of Immune System. In: Kumar V, Abbas A, Fausto N editors.

Robbins and Cortran’s Pathologic Basis of Diseases.

8th ed. Philadelphia: WB Saunders: 2010. Pg 249-57.

6. Amyloidosis. Available from : http://en.wikipedia.org/ wiki/Amyloidosis. [Last accessed 16.09.2013].

7. Baethge BA, Jacobson DR. Amyloidosis, overview.

Available from: http://emedicine.medscape.com/ article/1093258-overview. [Last accessed 16.09.2013].

8. Bandhlish A, Aggarwal A, Koranne RV. A clinicoepidemiological study of macular amyloidosis from North India. Indian J Dermatol 2012;57:269-74.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Case Report Lymphadenosis Benigna Cutis or Cutaneous Lymphoid Hyperplasia: A Rare Case Report Neha Amrut Mahajan*, Suparna Milind Bindu, Smita Sanjay Mulay Department of Pathology, MGM Medical College, Aurangabad, India Keywords: Lymphadenosis Benigna Cutis, Lymphocytoma Cutis, Pseudolymphomas.

ABSTRACT Lymphadenosis benigna cutis or cutaneous lymphoid hyperplasia or lymphocytoma cutis or pseudolymphoma is classified as one of the inflammatory disorder in which accumulation of lymphocytes on skin resemble, clinically and histologically as, cutaneous lymphomas. It manifests as asymptomatic, indolent, nodular lesions of different sizes varying between 2 and 5 cm, usually solitary, mainly on exposed areas of the body like face and neck. The presence of polymorphous cell infiltrates comprising of T and B lymphocytes, plasma cells, eosinophils, histiocytes and dendritic cells along with lack of atypical lymphocytes after incisional biopsy support diagnosis of pseudolymphoma. We report a 25 year old man who presented with bilateral postauricular swellings. The diagnosis was made as lymphocytoma cutis histologically and confirmed by immunohistochemistry. We report this case due to its distinct presentation and rarity of site and unusual size.

*Corresponding author: Dr Neha Amrut Mahajan, 41, Atharva, besides water tank, Vedant Nagar, Railway Station Road, Auranagabad, 431005, Maharashtra, India E-mail: nehaamahajan@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Lymphadenosis Benigna Cutis

C-45

Introduction Lymphocytoma cutis or lymphadenosis benigna cutis are localized or disseminated cutaneous proliferations of lymphocytes that are considered benign or reactive in nature. These are localized to head and neck region, and are seen as violaceous tumor ranging upto 4cm in diameter or as groupings pink small papules.[1]The presence of polymorphous cell infiltrates comprising of T and B lymphocytes, plasma cells, eosinophils, histiocytes and dendritic cells along with lack of atypical lymphocytes after excisional biopsy supports diagnosis of pseudolymphoma.

[2] Final diagnosis is confirmed by Immunohistochemistry.

Herein, we report a case of lymphadenosis benigna cutis due to its rarity and unusual size.

Case Report

25 year old male presented with bilateral post auricular swellings(fig. 1) since 12 years. Left sided swelling was seen from 12 years, it was excised six years back, since then it has recurred. Right sided swelling appeared since 6 years, gradually increased to present size. Onset was insidious and symptomless. The swelling was non tender and caused no discomfort for the patient. The patient came for cosmetic reasons. Left sided swelling measured 6x5x3 cm while right sided swelling measured 4x3x1 cm. The surface was smooth and no regional lymphadenopathy noted.There was no past history of drug intake, insect bite, tattooing, scabies, vaccination, acupuncture or photosensitivity. CT scan gave the differential diagnosis of

lipoma, dermoid cyst, sebaceous cyst, nerve sheath tumor, keloid or parotid tumor. Both the swellings were excised and send for pathological examination.

Gross: Received two skin covered masses of sizes 5x4x3cm and 4x3x2 cm. Cut section was grayish white. (fig 2) Microscopy: Multiple sections studied showed skin lining, underneath dermis showed mild increase in sebaceous glands and hair follicles along with scant perivascular and periadnexal lymphoid infiltrate. The deeper dermis showed infiltration by lymphocytes and histiocytes. There were lymphoid follicles with germinal centres along with admixture of inflammatory cells. (fig 3& 4) The case was diagnosed histopathologically as cutaneous lymphoid hyperplasia or lymphocytoma cutis. Immunohistochemistry showed positivity for T cell marker CD3 as well as B cell marker CD20, suggesting polyclonal nature, thereby differentiating from cutaneous lymphomas.(fig 5 &6).

Discussion

The term cutaneous lymphoid hyperplasia (CLH) was coined by Caro and Helwig[2] in 1969. The disease also has been called lymphadenosis benigna cutis, SpieglerFendt pseudolymphoma, lymphocytoma cutis, and cutaneous lymphoplasia.[3] Cutaneous lymphadenoma is an uncommon benign epithelial neoplasm with a prominent lymphocytic infiltrate with pilosebaceous and an eccrine origin which clinically resembles CLH.[4]

Fig.1: Image showing bilateral postauricular swellings.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Mahajan et al.

C-46

Fig 2 Figures showing two skin covered swellings, on cut surface grayish white in colour

Fig 3 Section showing lymphoid follicles in dermis with inflammatory infiltrate in background (H & E, 10X)

Fig. 4: Section showing lymphoid follicles with germinal centres & lymphocytes, histocytes (H&E-40X)

Fig. 5: CD3 positivity -10X ( Tcell marker)

Fig. 6: CD20 positivity -10X ( B cell marker)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Lymphadenosis Benigna Cutis

C-47 Although the pathogenesis of CLH remains unknown and most cases are idiopathic, certain drugs and long- term antigenic stimulation are implicated in many cases.[5] Other causes include arthropod bite, borrelia infection, as a postzoster phenomenon[6];in HIV infected individuals[7] or after tattoos, exposure to gold and nickel, vaccinations, and taking drugs such as antihistaminics and phenytoin.[8,9] The natural history of localized lesions is initial enlargement, sometimes followed by involution; disseminated lesions tend to be more persistant. Evolution to lymphoma over a period of years has been reported, but some of these cases may have been lymphomas from the beginning that were undetectable from the beginning with older diagnostic methods. [1] A female preponderance is seen. It is more common in patients under 40 years of age.[10] Microscopy shows nodular or diffuse infiltrate more in superficial dermis(top heavy).Adnexal structures are spared, though sometimes show distortion or hyperplastic hair follicles with mild inflammation. The hallmark of pseudolymphomas is formation of lymphoid follicles containing mixed population of lymphoid cells. Flow cytometry shows polyclonal lymphocytic population. Differential diagnosis include: cutaneous lymphoma, sarcoidosis, erythematous lupus, angiolymphoid hyperplasia, lumina eruption and rosacea.[11,12] Histopathologically cutaneous,follicular,centre cell lymphoma is characterized by diffuse growth pattern with proliferation of neoplastic centrocytes and centroblasts.[13] Follicle compostion in follicular lymphoma is neoplastic, monomorphous and clonal, whereas in cutaneous lymphoid hyperplasia it is benign, polymorphous and polyclonal.[14] Other IHC markers which can be applied to these cases can be CD19+,CD79a+,Ki 67 / MIB-1 antibody and BCl-6 expression.

Our patient had an unusually large lesion seen as bilateral post auricular swelling .The patient was suffering for more than 6 years without any malignant transformation.

In most of the cases, the lesion subsides spontaneously.

Response to various treatment modalities are doubtful.[15] In our case, the patient underwent excision of swellings.

Further follow up of this patient unfortunately could not be maintained.

Conclusion Differentiation of pseudolymphomas from lymphomas is difficult on histopathology alone. Immunohistochemistry is very helpful for final diagnosis. Pseudolymphomas can be cured in most of the cases, Proper follow up of the cases is needed to look for malignant transformation.

Acknowledgements None

Funding None

Competing Interests None declared

Reference

1. Stacey E Millis, Darryl Carter, Joel K Greenson.

Sternberg`s Diagnostic Surgical Pathology.5th ed vol I.Philadelphia, Wolter Kluwer/Lippincortt Williams & Wilkins;2010.p.64 2. Caro WA, Helwig EB: Cutaneous hyperplasia.Cancer, 1969, 24:487-501

lymphoid

3. 3. Arai E, Shimizu M, Hirose T. A review of 55 cases of cutaneous lymphoid hyperplasia: reassessment of the histopathologic findings leading to reclassification of 4 lesions as cutaneous marginal zone lymphoma and 19 as pseudolymphomatous folliculitis. Hum Pathol.2005;36:505-11.

4. Diaz-Cascajo C, Borghi S, Rey-Lopez A, CarreteroHernandez

G.

Cutaneous

lymphadenoma.

A

peculiar variant of nodular trichoblastoma. Am J Dermatopathol. 1996;18:186-91.

5. May SA, Netto G, Domiati-Saad R, et al. Cutaneous lymphoid hyperplasia and marginal zone B-cell lymphoma following vaccination. J Am Acad Dermatol. 2005;53:512-516.

6. Roo E, Villegas C, Lopez Bran E, Jimenez E, Valle P, Sanchez Yus E. Postzoster cutaneous pseudolymphomas. Arch Dermatol 1994;130:661-3.

7. Bachelez H, Hadida F, Parizot C, Flageul B, Kemula M, Dubertret L et al. Oligoclonal expansion of HIV specific cytotoxic CD8 T lymphocytes in skin of HIV 1 infected patients with cutaneous pseudolymphoma.

J Clin Invest 1998;101:2506-2516.

8. Lanzafame S, Micali G. [Cutaneous lymphoid hyperplasia(pseudolymphoma) secondary to vaccination]. Pathologica 1993;85:555-61.

9. Magro CM, Crowson AN. Drugs with antihistaminic property as a cause of cutaneous lymphoid hyperplasia.

J Am Acad Dermatol 1995,32:419-28.

10. Ploysangam T, Breneman DL, Mutasim DF. Cutaneous pseudolymphomas. J Am Acad Dermatol 1998;38:877-95;quiz 896-7.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Mahajan et al.

C-48

11. Sampaio SAP, Rivitti EA. Dermatologia 3rd ed. Sao Paulo:Artes Medicas; 2007.p.1270-1.

12. Pecantha PLVB, Pereira Jr AC, Castro O. Diagnostico differential histopathologico e immunehisquimico entre linforma maligne pseudolinfomas (linfocitoma): Estudo de tres casos. An Bras Dermatol.1995;70:319-21.

13. Kerl H et al. Primary cutaneous B cell lymphoma.Keio J Med 2001;50:269-273.

14. David Elder, Rosalie Elentisas, Bernett Johnson et al. Lever`s Histopathology of the Skin.9th ed.

Philadelphia, Wolter Kluwer/Lippincortt Williams & Wilkins.2005.p.933.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

15. Mackie RM: Cutaneous lymphomas and lymphocytic infiltrates. In Champion RH, Burton JL, Burns DA, et al(eds).Textbook of dermatology, Vol 3,6th edition, Blackwell Scientific Publications,Oxford, p 23732402,1998.

Case Report Mermaids are Real!! Sirenomelia: A Case of Mermaid Baby Anupama Praveen Gupta*, Sanjay Nanaji Parate, Dinkar T. Kumbhalkar Department of Pathology, Government Medical College, Nagpur, India Keywords: Sirenomelia , Mermaid, Polymalformative Syndrome

ABSTRACT We report a case of sirenomelia baby (mermaid syndrome) born to a thirty years old female at 36 weeks of gestation. It is a rare syndrome in which there is fusion of lower limbs.

Classification of caudal regression syndrome (CRS) from sirenomelia is still debated. According to some authors, this syndrome should be classified separately from caudal regression syndrome and is likely to be the result of an abnormality taking place during the fourth gestational week, causing developmental abnormalities in the lower extremities, pelvis, genitalia, urinary tract and digestive organs. Despite recent progress in pathology, the etiopathogenesis of sirenomelia is still debated.

*Corresponding author: Dr Anupama Praveen Gupta, 203, Shyam Dham, C.A. Road, Babulban, Nagpur, Maharashtra, India, 440008 Phone: +91 9422477887, 0712-2020809 E-mail: pama_gpta@rediffmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Gupta et al.

C-50

Introduction

Sirenomelia also known as “mermaid syndrome” is a polymalformative syndrome characterized by fusion of lower limbs, single umbilical artery, severe malformation of urogenital and lower gastrointestinal tract. It is a rare syndrome (0.8 to 4.2/100,000 births) [1, 2] which continues to cause many controversies concerning its etiopathogenesis.

Controversy exists in the literature regarding whether sirenomelia occurs as a separate entity or the extreme form of caudal regression syndrome (CRS). However, the presence of two umbilical arteries, non-lethal renal anomalies, non-fused lower limbs, abdominal wall defects, and abnormalities of tracheoesophageal tree, neural tube, and heart differentiate CRS from sirenomelia. In addition, CRS is strongly associated with maternal diabetes. [3, 4] The same applies regarding its relationship with narrow pelvis syndrome and VATER (vertebral defect, anal atresia, interauricular communication; interventricular communication, tracheal and esophageal atresia, and renal or radial agenesis) syndrome. [5] We report a case of sirenomelia.

We will discuss the classification and etiopathogenesis of this syndrome.

Case Report

A thirty years old female gave birth to baby by caesarian section performed at thirty six weeks of gestation for breech presentation and severe oligohydramnios. She was gravida 2 para2. Her husband was forty years old. She was not diabetic, non hypertensive, had no thyroid disorder or any evidence of infection and had no history of consumption of any teratogenic drugs. She had history of previous lower segment caesarian section with breech presentation and had delivered full term normal female child.

Antenatal ultra-sonography during this pregnancy revealed single viable fetus with breech presentation, oligohydramnios, and intra uterine growth retardation. Due to severe oligohydramnios the bladder, stomach, and spine could not be assessed. Kidneys were not visualized. The baby had respiratory distress but cried immediately after birth. Baby died within six hours of birth.

Autopsy revealed anomalous baby with weight 1.8 kilo grams. Body length was 40 cm, normal hair, large sized ears, nasal passage showed bleeding and eyes were closed.

The lower limbs were fused ending with two feet, right one with one big toe and left with two toes. (Fig1 A) There were no external genitalia or anus. (Fig1 B) There was a single umbilical artery. X-ray showed normal upper skeleton, two femurs, two tibias and one fibula (Fig 1 C).

Internal examination revealed normal 4 chambered heart.

There was patent ductus arteriosus (Fig 2 D).Gastrointestinal www.pacificejournals.com/apalm

Fig. (1A): Showing fetus with fused lower limbs and large ear., (1B): Showing imperforated anus., (1C) : X ray showing two femur, two tibia and one fibula (white arrow)

tract (GIT) revealed imperforated anus, dilated rectum which was lying in pelvic cavity. (Fig 2 C) Rest of GIT was within normal limits with muconium in the cavity.

One pancreas like structure was noticed. Two tiny cystic structures of size 0.2 x0.5 cm and 1x1 cm respectively suggestive of rudimentary kidneys were identified with attached thickened beaded cord like single structure (Fig 2 A, B). No bladder was identified.

Histopathology revealed congested lungs, spleen, liver, thymus and pancreas. Cystic structures revealed kidney with multiple cysts lined by cuboidal lining, primitive glomeruli, primitive tubules and intervening mesenchyme indicating cystic renal dysplasia (Fig 3A, B). Adrenals were identified which showed nodularity. Beaded cord like structures revealed tubules lined by ciliated columnar lining and small tubules lined by cuboidal lining indicating primitive testes and epididymis (Fig 3 C, D).

Diagnosis was offered as” Sirenomelia- Sympus Dipus type II” with imperforated anus, cystic renal dysplasia, absent urinary bladder, patent ductus arteriosus, primitive testicular tissue and nodular adrenals. [6]

Discussion

Sirenomelia, best defined by Stevenson as “a limb anomaly in which the normally paired lower limbs are replaced by a single midline limb,” [7] is an extremely rare congenital malformative disorder with a prevalence of approximately one per 100,000. [8] The syndrome of caudal regression was first used by Duhamel which consists of anomalies of the rectum, the urinary and genital systems, the lumbosacral spine, and the lower limbs. The most severe end of the spectrum is the fusion of the lower limbs and the major organ malformations, known as sirenomelia or mermaid syndrome, while the mildest end is imperforate anus.

[9] A debate still exists to whether CRS and sirenomelia eISSN: 2349-6983; pISSN: 2394-6466

Sirenomelia

C-51

Fig. 2A: Showing rudimentary kidneys., (2B): Cut section of kidneys showing multiple cysts., (2C): Showing imperforated, dilated rectum., (2D): Showing patent ductus arteriosus

Fig. (3A): (10x, H and E) - Kidney showing cystic renal dysplasia., (3B): (40x, H and E) -Showing rudimentary glomerulus and tubules., (3C): (10x, H and E) - Showing epididymus., (3D): (40 x H and E) - Showing testicular tubules.

are separate entities or whether they represent parts of a pathogenic spectrum.

2. Teratogens like retinoic acid, cadmium, cyclophosphamide have reported to cause sirenomelia in mice. However no case of sirenomelia has been observed on accidental exposure of these products.

Cocaine, organic solvents of fat and appetite suppressors (diethylpropion) has been implicated in some cases of CRS in humans. [5]

Duhamel endorsed a CRS-sirenomelia spectrum that encompasses variable severities of “an embryonal defect in the formation of the caudal region.” Whereas Jones segregated sirenomelia from CRS and asserted that they are unrelated pathogenetically. Apart from fusion of the lower extremities, a distinctive anatomic feature of sirenomelia is an abberrent umbilical artery that arises from the abdominal aorta, called “persistent vitelline artery.” [10] A study by Orioli et al described the prevalence, associated malformations, and maternal characteristics among cases with sirenomelia. [8] Stocker and Heifetz classified sirenomelia in seven types: [6]

(I) (II) (III) (IV) (V) (VI) (VII)

All thigh and leg bones present.

Single fibula.

Absent fibulae.

Partially fused femurs, fused fibulae.

Partially fused femurs, absent fibulae.

Single femur, single tibia.

Single femur absent tibiae.

Several etiologic factors have been suggested: 1. Maternal diabetes is the only maternal disease known to be associated with sirenomelia. However it is more common with CRS.

3. Several family cases of CRS have been reported suggesting genetic predisposition 4. “Vascular steal” theory by Stevenson on the basis of dissection of the abdominal vasculature in eleven cases of sirenomelia has demonstrated a pattern of vascular abnormality. [11] The common feature is the presence of a single large artery, arising from high in the abdominal cavity, which assumes the function of the umbilical arteries and diverts nutrients from the caudal end of the embryo distal to the level of its origin. The steal vessel derives from the vitelline artery complex, an early embryonic vascular network that supplies the yolk sac. Arteries below the level of this steal vessel are underdeveloped and tissues dependent upon them for nutrient supply fail to develop, are malformed, or arrest in some incomplete stage. In contrast to the prevailing view that sirenomelia arises by posterior fusion of the two developing lower limbs, these studies suggest that the single lower extremity in sirenomelia arises from failure of the lower limb bud field to be cleaved into two lateral masses by an

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Gupta et al.

C-52

intervening allantois. Adra et al consider Stevenson’s theory of the vascular steal as a possible etiopathogenic of CRS, while Stanton maintains that this theory cannot explain all the abnormalities encountered in the sirenomelia sequence and that the observations of Stevenson are a consequence and not a cause of the syndrome. [1,12] 5. 9% to 15% of the cases of sirenomelia are associated with twin monozygotic pregnancies. The relative risk is multiplied 100-fold in the case of twin pregnancies. [13] Sirenomelia is fatal in most cases because of the characteristic pulmonary hypoplasia and renal agenesia.

About 50% of the children are born alive after eight or nine months of pregnancy. Death occurs in the five days following birth. [6] Post-natal management requires the presence of kidneys, even if they are dysgenesic. [1] Murphy et al reported one case where a child born with sirenomelia survived. [14] Very few cases have been reported recently, one of them is by S. Samal et al who have reported two cases of sirenomelia where maternal drug abuse and overt diabetes may have been the cause of this rare anomaly.

Both their babies died after few hours of birth. [15] Our case had single umbilical artery, fused lower limbs and cystic renal dysplasia. Baby died within six hours of birth.

Conclusion

Mermaids (Sirenomelia sequence) are real. It is a rare syndrome associated with various degree of vascular involvement in which prenatal diagnosis is essential for proper management. Probably study of molecular genetics will help to unravel the mystery.

Acknowledgements None

Funding None

Competing Interests None

Reference

1. Stanton MP, Penington EC, Huston JM. A surviving infant with Sirenomelia (Mermaid syndrome) associated with absent bladder. J Pediatr Surg. 2003;38(8):1266–8.

3. Mohammed Z. Seidahmed, Omer B. Abdelbasit, Khalid A. Alhussein,Abeer M. Miqdad, Mohammed I. Khalil, Mustafa A. Salih, Sirenomelia and severe caudal regression syndrome.Saudi Med J 2014;35:S36-S43 4. Mills JL, Baker L, Goldman AS. Malformations in infants of diabetic mothers occur before the seventh gestational week. Implications for treatment. Diabetes.1979;28:292–293.

5. Anis Fadhlaoui, Mohamed Khrouf, Soumaya Gaigi, Fethi Zhioua, Anis Chaker. The Sirenomelia Sequence: A Case History. Clin Med Insights Case Rep. 2010; 3: 41–49.

6. Stocker JT, Heifetz SA. Sirenomelia. A morphological study of 33 cases and review of the literature. Perspect Pediatr Pathol 1987; 10: 7-50.

7. Stevenson RE. Limbs. In: Stevenson RE, Hall JG, editors. Human malformations and related anomalies.

2nd ed. New York (NY): Oxford University Press; 2006. p. 835-925.

8. Orioli IM, Amar E, Arteaga-Vazquez J, Bakker MK, Bianca S, Botto LD, et al. Sirenomelia: an epidemiologic study in a large dataset from the International Clearinghouse of Birth Defects Surveillance and Research, and literature review. Am J Med Genet C Semin Med Genet 2011; 157C: 358-373.

9. Duhamel B. From the mermaid to anal imperforation: the syndrome of caudal regression. Arch Dis Child 1961; 36: 152-5.

10. Jones KL. Philadelphia (PA): Elsevier Saunders; 2006. Smith’s Recognizable Patterns of Human Malformation; pp. 728–729.

11. Stevenson RE, Jones KL, Phelan MC, et al.

Vascular steal: the pathogenic mechanism producing sirenomelia and associated defects of viscera and soft tissues. Pediatrics.1986;78:451–7.

12. Adra A, Cordero D, Mejides A, et al. Caudal regression syndrome: Etio-pathogenesis, prenatal diagnosis and perinatal management. Obstet Gynecol Surv. 1994;49(7):508–76.

13. Dilorenzo M, Brandt ML, Veilleux A. Sirenomelia in an identical twin. A case report. J Pediatr Surg. 1991;26:1334.

14. Murphy JJ, Fraser GC, Blair GK. Sirenomelia: case of a surviving mermaid. J Ped Surg. 1992:27;(10):1265–8.

2. Banerjee A, Faridi MM, Banerjee TK, Mandal RN, Aggarwal A. Sirenomelia. Indian J Pediatr. 2003;70(7):589–91

15. S.K. Samal, S. Rathod .Sirenomelia: The mermaid syndrome: Report of two cases. J Nat Sci Biol and Med. 2015; 6: 264–266.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Case Report Secretory Carcinoma of Breast: A Rare Cytodiagnosis Ankit Kaushik*, Mukul Singh, Sachin Kolte, Kusum Gupta, A K Mandal Dept. of Pathology, VMMC and Safdarjung Hospital Delhi, India Keywords: FNAC, Secretory carcinoma, Breast

ABSTRACT Secretory carcinoma is a rare low grade malignant breast carcinoma of children and adults. Since patients are often young and presents with indolent breast lump in the breast, a high degree of suspicion is often needed for the clinical diagnosis. Fine needle aspiration cytology (FNAC) is often the primary investigation, and because of the indolent clinical presentation, rarity of tumour and unanticipated cytological findings a primary cytological diagnosis of secretory carcinoma is often difficult.

We present a case of 13-year-old female, presented with a well defined mobile right breast lump. The aspiration cytology revealed highly cellular smears consisted of singly scattered and loosely cohesive cluster of monomorphic cell population of round to ovoid cells with bland cytological appearance in background of thick mucinous material, leading to cytological diagnosis of secretory carcinoma.

A primary diagnosis of secretory carcinoma on FNAC can provide early and definite surgical management including simple mastectomy with axillary lymph node resection recommended for treatment of secretory carcinoma.

*Corresponding author: Dr Ankit Kaushik, B -19 Mahesh Park, Modinagar, Ghaziabad, U.P., 201201, India Phone: +919953816240 E-mail: kaushikankit30@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Kaushik et al.

C-54

Introduction Secretory carcinoma, also called as juvenile carcinoma, is a rare breast carcinoma with a frequency of 0.15% of all breast malignancy[1,2]. Although initially diagnosed in children, it was later found to affect all age groups including adults[3]. The patients clinically presents with an indolent, well-defined mobile breast lump leading to common clinical diagnosis of fibroadenoma. Fine needle aspiration cytology (FNAC) is often the first investigation; because of the rarity of tumour the cytological diagnosis can be missed.

This case report presents an insight in to the cytological findings of secretory carcinoma and establishes FNAC as an important investigation tool in the early diagnosis of breast carcinoma.

Case Report A 13-year-old female presented to cytology department with a painless breast lump for 3 months. On examination the lump was located in the upper outer quadrant, well defined hard and mobile. A clinical impression of benign breast disease with a possibility of fibroadenoma was made.

FNAC was done from the breast lesion; the aspirate was blood mixed. Both wet fixed and dried smears were made.

The slides were both giemsa and papanicolou stained. On microscopy the smears were cellular showing tumour cells arranged in loose sheets and singly scattered in a thick proteinaceous background. The cell population was single type and consist of cells having round to oval shape with abundant pale to granular cytoplasm with centrally placed ovoid nuclei. The cytoplasm shows both intracytoplasmic and extracytoplasmic vacuoles with occasional signet ring type cells. No significant pleomorphism and mitosis was found in the cytological smears. A diagnosis of secretory carcinoma was given on cytology and excision was advised.

The tumour was excised. Grossly the tumour was well circumscribed and measured 3x2.5x2 cm. the cut surface was grey tan in appearance. On microscopy the tumour was circumscribed with tumour cells arranged in compact, tubular to microcystic pattern. The cells are large granular with pale staining cytoplasm with numerous intracytoplasmic and extracytoplasmic vacuole filled with intensely eosinophilic material that was found to be PAS positive. The nucleus was ovoid with small nucleoli. No mitosis or necrosis was observed.

Fig. 1: Smears were cellular showing monotonus tumour cells arranged in loose sheets and singly scattered in a thick proteinaceous background. The cells were round to oval with abundant pale to granular cytoplasm with both intracytopasmic and extracytoplasmic vacuole and occasional signet ring type cells. (Giemsa: 40 x)

Fig. 2: Section showing intracellular and extracellular dark pink PAS positive material in secretory carcinoma (PAS stain:40x)

Discussion Secretory carcinoma is a rare malignant low grade tumour of breast, predominantly affecting adolescent and younger age group with distinct histopathology type.[1]

Based on above findings a diagnosis of secretory carcinoma breast was given on histopathology which subsequently confirmed the cytological diagnosis of secretory carcinoma breast.

On cytology malignant nature of the tumor were established by high cellularity and absence of bimodal cell population with monotonus cell population of round to ovoid epithelial cell population of cells showing minimal atypia and pleomorphism ruling out the cytological differential like lactational adenoma.[4] The presence of intracytoplasmic and extracytoplasmic vacuole and occasionally signet

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Secretory Carcinoma Breast

C-55 ring type cells were filled with homogenous eosinophilic material representing the secretory component of the tumour. The mucosubstances is strongly PAS positive and diastase resistance, and also shows positivity with alcian blue[5].

It more commonly affects females. It is a low grade carcinoma with a solid, microcystic and tubular architecture.

The tumor is called secretory because the tumour cells produce abundant intracellular and extracellular material.

Immunohistochemistry shows that the tumour cells are often found positive to EMA, alpha lactalbumin and S 100 and negative for estrogen receptor.[6] Treatment included simple mastectomy with axillary lymph node dissection as frequency of axillary metastasis is as common as the other breast cancer. The tumour is of good prognosis especially in children with tumour recurrence of up to 20 years, although metastasis and tumour recurrence were noticed more in adult. A long term follow-up is advised as late recurrence is often noted in these tumors.

Conclusion Secretory carcinoma is an extremely rare malignant breast tumour. A very strong clinical suspicion is needed for establishing clinical diagnosis of secretory carcinoma.

FNAC can act as a rapid and effective diagnostic tool for early diagnosis and helps in definite surgical management.

Acknowledgements None

Funding None

Competing Interests No

References 1. Botta G, Fessia L, Ghiringhello B. Juvenile milk protein secreting carcinoma. Virchows Arch A Pathol Anat Histol.1982; 395: 145-52.

2. Lamovec J, Bracko M . Secretory carcinoma of the breast: light microscopical, immunohistochemical and flow cytometric study. Mod Pathol. 1994;7: 475-9.

3. Rosen PP, Cranor ML. Secretory carcinoma of the breast. Arch Pathol Lab Med. 1991; 115: 141-4.

4. Shanthi V, Rama Krishna BA, Rao NM, Sujatha C. Cytodiagnosis of secretory carcinoma of the breast. J Cytol. 2012 Jan-Mar; 29(1): 63-5.

5. Jayaram G, Looi LM, Yip CH. Fine needle aspiration cytology of secretory carcinoma of breast: a case report. Â Malays J Pathol. 1997;19:69-73.

6. Lamovec J, Bracko M . Secretory carcinoma of the breast: light microscopical, immunohistochemical and flow cytometric study. Mod Pathol.1994; 7: 475- 9.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Letter to Editor Cytodiagnosis Of Sternocleidomastoid Pseudotumour In A Neonate Presenting As Lateral Neck Mass Deepti Sukheeja*, Naresh N Rai, Neelu Vashist Department of Pathology, Government Medical College, Kota, Rajasthan, India

Dear Sir, Sternocleidomastoid pseudotumour (SCMP) is an uncommon clinical entity presenting as lateral neck mass in a neonate.It is known to regress spontaneously. FNAC plays an important role by helping in early diagnosis and preventing any unnecessary surgical intervention. A one month old male child presented with torticollis [Figure 1a].

He had a hard immobile swelling on lateral aspect of neck on left side measuring 3 Ă&#x2014; 2cm. His mother revealed history of prolonged labour . Post partum period went uneventful.

His general physical examination was unremarkable.USG was done which showed thickened sternocleidomastoid muscle with a fusiform swelling [Figure 1b].

FNAC was performed from the swelling with 23G needle and 10 ml plastic disposable syringe. The wet smears were fixed in 95% ethanol and processed for Papanicolaou stain and the air dried smears were stained with May-GrunwaldGiemsa stain.Microscopy showed moderately cellular smear composed of oval to spindle shaped fibroblastic cells scattered singly or in loose cohesive clusters. Cells were having plump oval to spindle nuclei with wispy cytoplasm . Background showed focal areas of myxoid material [Figure 2]. Based on above cytological finding, a diagnosis of sternocleidomastoid tumor of infancy was suggested, and the patient was managed conservatively.The lesion resolved after five months.

SCMP is a benign and self-limiting disorder presenting in neonates with history of difficult labour. Mostly it disappears without any surgical intervention. The right side is more commonly affected than left and males are affected more than females. History of complicated delivery and birth injury are associated in more than 50% cases.[1]Various theories proposed behind its development

are intramuscular hemorrhage due to complicated delivery.

It is also suggested as hamartomatous process unrelated to any traumatic cause. [2] The cytological features of SCMP can show fibroblasts having bland nuclei, degenerated atrophic skeletal muscle fibres in a clear background without any inflammation.

Muscle giant cells; numerous, plump fibroblasts; and collagen can be found along with bare nuclei in the background. According to a study done by Sharma et al on cytology of eight cases collagen was found in all cases. [2] However it was not present in our case.

Other differential diagnosis of neonatal neck swellings are abscess, lymphadenitis, hematoma congenital lesions like cystic hygroma, branchial cleft cyst thyroglossal duct cyst, hemangiomas, teratomas, dermoid cysts or neoplastic lesions like lipomas, rhabdomyosarcoma fibrosarcoma, neuroblastoma and lymphoma [2].FNAC is a very fruitful procedure in excluding these causes. The key to prevent this deformity is early diagnosis and conservative management of the affected muscle, with only 5% of cases needing surgical intervention in a large prospective series[4].

To conclude, Lateral neck mass in a neonate may mimick a neoplasm. An early FNAC is not only diagnostic but also prevents unnecessary surgical intervention. Conservative management is the key to prevent this disease.

Acknowledgements none

Funding None

Competing Interests None declared

*Corresponding author: Dr Deepti Sukheeja, H.N 1, Vigyan Nagar Special, Kota-5 Rajasthan, India Phone: +91-8058010655 E-mail: deeptisukheeja2001@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

L-2

Cytology of Sternocleidomastoid Tumour

Reference

Fig. 1: 1a: Neonate presenting as left sided neck swelling.

1b: USG showing fusiform enlargement of SCM muscle.

1. Baisakh MR, Mishra M, Narayanan R, Mohanty R. Cytodiagnosis of sternocleidomastoid tumor of infancy. J Cytol. 2012; 29: 149–151.

2. Sharma S, Mishra K, Khanna G. Fibromatosis colli in infants- a cytologic study of eight cases. Acta Cytol.

2003;47:359–62.

3. Rajalakshmi V, Selvambigai G, Jaiganesh: Cytomorphology of fibromatosis colli. J Cytol 2009, 26:41-42 4. Cheng JC, Wong MW, Tang SP, Chen TMK, Shum SLF, Wong EMC. Clinical determinants of the outcome of manual stretching in the treatment of congenital muscular torticollis in infants. A prospective study of 821 cases. J Bone Joint Surg Am 2001; 83:679–687

Fig. 2: MGG Stained smear (100X) showing cluster of bland spindle cells with inset showing myxoid stroma (upper left) and multinucleated giant cell (lower left)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Letter to Editor Mixed Serrated Polyps of the Duodenum Neeraj Dhameja* Department of Pathology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, UP, India.

Sir, Serrated polyps are a recently described group of epithelial lesions of the colorectum characterized morphologically by serrations giving a saw tooth appearance.[1] They are classified as Hyperplastic polyp, Sessile serrated polyp/ adenoma and traditional serrated adenoma in the 2010 WHO classification of Tumours of the Digestive System.[2] Hyperplastic polyps are more common in the distal colon and rectum, show serrations in the upper part of the crypts and are usually benign. Sessile serrated polyps/adenomas (SSA/P) are frequent in the proximal colon, have serrations involving the bases of the crypts and crypt architecture abnormalities including L-shaped or inverted T-shaped crypts with horizontal expansion. Molecularly, they show BRAF mutation, CpG island methylation (CIMP-H) and microsatellite instability (MSI-H). Traditional serrated adenomas (TSA) are rare distal colon and rectal serrated lesions showing villiform structures, ectopic crypt foci and eosinophilic cytoplasm. They show KRAS mutation and are CIMP-L.[3] SSA/P and TSA can progress to colorectal carcinoma and are associated with serrated pathway neoplasia.[3] Sometimes, these serrated polyps can be multiple and can present as serrated polyposis syndrome.

[2] Serrated polyps are very rare in the duodenum and only few case reports TSA are described. No case of SSA/P has been described in the duodenum.

We recently diagnosed one case of 45 year female presenting with pain abdomen. The upper gastrointestinal endoscopy showed a large polyp in the second part of the duodenum measuring around 2.0cm with few surrounding smaller polyps measuring around 0.5cm (on gross examination, appeared to be 5-6 pieces, each showing polyps of different morphologies on microscopic examination). The largest

polyp showed features of traditional serrated adenoma with villous structures, ectopic crypt foci, elongated nuclei and eosinophilic cytoplasm. (Fig.1). One of the smaller polyps showed marked crypt serrations involving whole crypt length with abnormal crypt architecture including horizontal crypt (Fig.2) and it was diagnosed as sessile serrated polyp based on WHO criteria.[1,3] Two other smaller polyps howed features of tubulovillous adenomas.

So the present case had multiple polyps of different morphologies.

Serrated adenomas were first described in the colon and rectum by Longacre and Fernoglio-Preiser[4] and Torlakovic et al[5] first described sessile serrated adenomas/polyps. Serrated polyps are rare in the duodenum. The first case of duodenal serrated adenoma was described by Rubio CA[6] in a case of familial adenomatous polyposis. Tubular, villous and tubulovillous adenomas were also identified. The largest case series of duodenal serrated adenomas (morphologically traditional serrated adenomas) comprising of 13 cases was described

by Rosty C et al[7] . In this study, the authors described the morphological, immunohistochemical and molecular features of traditional serrated adenomas and concluded that duodenal serrated adenomas are different from that of colorectal because of absence of BRAF mutation. In the present case, molecular studies could not be done because of unavailability and this is the lacunae. However, both traditional serrated adenoma and sessile serrated polyps are described in this case which have previously not been described. This patient also had multiple polyps showing variable morphologies, so the same criteria which are used to define serrated polyposis syndrome in the colorectum can be applied in the duodenum is not clear.

*Corresponding author: Dr Neeraj Dhameja, Asst. Prof. Department of Pathology, Institute of Medical Sciences, Banaras Hindu University, Varanasi, UP, India.

E-mail: doctorneeraj146@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

L-4

Mixed Serrated Polyps of the Duodenum

References 1. Rosty C, Bettington M. Serrated colorectal polyps and polyposis. Diagnostic Histopathology 2013;20:30-36.

2. Snover DC, Ahnen DJ, Burt RW, Odze RD. Serrated polyps of the colon and rectum and serrated polyposis.

In: Bosman FT, Carneiro F, Hruban RH, Theise ND, eds. WHO classification of the digestive system. Lyon, France: IARC Press, 2010;160-5.

3. Bettington M, Walker N, Cloustan A, Brown I, Leggett B, Whitehall V. The serrated pathway to colorectal carcinoma: current concepts and challenges.

Histopathology 2013;62:367-386.

Fig. 1: Largest polyp showing prominent serrations, ectopic crypt foci and eosinophilic cytoplasm.

4. Longacre TA, Fenoglio-Preiser CM. Mixed hyperplastic adenomatous polyps/serrated adenomas: a distinct form of colorectal neoplasia. Am J Surg pathol 1990;14:524-537.

5. Torlakovic E, Snover DC. Serrated adenomatous polyposis in humans. Gastroenterology 1996;110:748755.

6. Rubio CA. Serrated adenoma of the duodenum. J Clin Pathol 2004;57:1219-1221.

7. Rosty C, Campbell C, Clendenning M, Bettington M, Duchanan DD, Brown IS. Do serrated neoplasms of the small intestine represent a distinct entity?

Pathological findings and molecular alterations in a series of 13 cases. Histopathology 2015;66:333-342.

Fig. 2: Smaller polyp showing prominent serrations with horizontal crypts

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016

Letter to Editor Subareolar Breast Abscess in Male: A Rare Presentation Shailaja Shukla, Manjari Kishore*, Sangeeta Pahuja, Rachana Meena 1

Dept of Pathology, Lady Hardinge Medical College, New Delhi, India

Dear Sir, Subareolar abscess (SA) is a distinct clinicopathological condition in female breast. However, few case reports of Subareolar breast abscess have been published in males also.

Though Gynaecomastia is the most common cause of benign masses in male breast [1,2], rarely other benign lesions like subareolar abscess, lipoma, pilar cysts are also noted. Herein, we report a case of subareolar breast abscess in male.

A 40 years old male presented with an ill defined swelling in left breast in the retromammary region for last four months and was progressively increasing in size. On examination, swelling was approximately 1X1 cms, non-tender, slightly fixed. There was no discharge from the nipple, no history of trauma or any contact of tuberculosis.

Fine needle aspiration cytology was performed maintaining aseptic conditions and smears were made & stained with Geimsa, Pap and Ziehl-Nelsen stain. On microscopic examination, smears consisted mainly of neutrophils and macrophages (Fig 1, 2). Innumerable squamous cells, appearing anucleated were also noted alongwith foreign body giant cells and keratinous debris in the background (Fig 1b). Zeihl-Nelsen stain for Acid Fast bacilli was negative.

Fig. 1 (a&b): Hallmark of Subareolar abscess: presence of squamous cells and neutrophils (Pap, X100).

Multinucleated Giant cells noted in Fig 1b (Pap, X 200)

Fig. 2: Subareolar abscess with squames, neutrophils & macrophages

Subareolar abscess is a long-standing inflammatory condition in the region of nipple. Initially the patient presents with pain & swelling, but gradually it forms abscess and chances of sinus tract formation and recurrences increase.

In a study by Galdblun & Oertel[3], it was stated that apart from polymorphonuclear neutrophils, presence of anucleated squames is must for the diagnosis of Subareolar abscess, as it rules out the possibility of mastitis.

To conclude, Subareolar abscess is an important entity which should be kept in mind by pathologists while evaluating breast mass in males[4]. FNAC is widely used, simple and cost effective means which helps in making early diagnosis of SA. Accurate and early diagnosis of SA in males help surgeons in adopting proper surgical intervention for the lesion as these are prone for recurrences[5].

Acknowledgements None

*Corresponding author: Dr. Manjari Kishore, A-1, 1/10 A, Rajender Nagar, Sahibabad, Ghaziabad, U.P (201005) India Phone: +91 - 8105104471 E-mail: drmanjarik@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

L-6

Subareolar Breast Abscess in Male

Funding None

Competing Interests None declared

REFERENCE 1. Das DK, Junaid TA, Mathews SB, Ajrawi TG, Ahmed MS, Madda JP, Mirza K: Fine needle aspiration cytology diagnosis of male breast lesions: A study of 185 cases. Acta Cytol 1995;39:870–6.

2. Sinha RK, Sinha MK, Gaurav K, Kumar A. Idiopathic bilateral male breast abscess. BMJ Case Rep. 2014 Mar 10;2014 3. Galblum LI, Oertel YC: Subareolar abscess of the breast: Diagnosis by fine needle aspiration. Am J Clin Pathol 1983;80: 496–9.

4. Rajaram ST, Kini H, RauAR, Pai RR. Subareolar abscess in the male breast. Diagn Cytopathol. 2008;36:766–7.

5. Yanai A, Hirabayashi S, Ueda K, Okabe K: Treatment of recurrent subareolar abscess. Ann Plast Surg 1987;18:314–318

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 01, January - March 2016