APALM 3.3 (2016)

eISSN: 2349-6983 pISSN: 2394-6466

Annals of Pathology and Laboratory Medicine July-Sept. 2016; Vol. 3, Issue 3

Cover design: Dr Prashant

Co-Editor-in-Chief Dr Prashant Goyal Dr Shelly Sehgal

www.apalm.org

Annals of Pathology and Laboratory Medicine Co-Editor in Chief

Dr Nasser Said-Al-Naief ODRP/ Anatomic Pathology, Loma Linda Medical Center, Loma Linda, CA, United States Dr Hoda A Hagrass Clinical Pathology dept, Faculty od Medicine Zagazig University, Sharkyia, Egypt Dr Kemal Turker UlutaĹ&#x; Kadirli State Hospital, Central Laboratory, Osmaniye, Turkey Dr Dennis P O’Malley Pathologist, Clarient Pathology Services, Columbia, Aliso Viejo, CA, United States Dr Parthasarathi Pramanik Consultant Forensic Pathologist, Forensic Science Laboratory, Kingston, Jamaica Dr Arvind Rishi Asst. Prof., Dept of Pathology, Hofstra North Shore-LIJ School of Medicine, New York, United States Dr Ahmad Mohammad Ragab - Senior Consultant Pathologist, Kameda Hospital & Oncology Center - JAPAN - National Medical Institute, Egypt Dr Amado Ona Tandoc III Research Institute for Tropical Medicine, Muntinlupa City, Philippines Dr Shamim Sheikh Dept. of Pathology, M.P. Shah Medical College, Jamnagar, Gujarat, India Dr Viral M Bhanvadia Asst. Prof. Dept. of Pathology, Shri M.P. Shah Medical College, Jamnagar, Gujarat, India Dr Navin K Sinha Director-Lab, Artemis Health Institute, Gurgaon, India Dr Soumyesh Ghosh Dept. of Pathology, SDN Hospital, Delhi, India Dr Deepti Mittal Pathologist, Haryana, India Dr Amit Agravat Asso. Prof. Dept. of Pathology, PDU Medical College, Rajkot, Gujarat, India

Dr Prashant Goyal Director-Laboratory, Accuprobe Healthcare and Diagnostics, Delhi, India Dr Shelly Sehgal Specialist Pathologist, Department of Pathology, SDN Hospital, Delhi, India

Associate Editor

Dr Asitava Mondal Clinical Cytologist and Oncopathologist, Kolkata, West Bengal, India Dr Sompal Singh Specialist Pathologist, Dept. of Pathology, N D M C Medical College & Hindu Rao Hospital, Delhi, India Dr Ruchika Gupta Pathologist (Scientist-C), Institute of Cytology & Preventive Oncology (ICPO), Delhi, India Prof. Vatsala Mishra HOD, Dept. of Pathology Moti Lal Nehru Medical College, Allahabad, India Dr Manjusha Biswas Consultant Histopathologist & Oncopathologist, Kolkata, India Dr Mudit Agarwal Director Lab Services, Nishtha Pathology Lab, New Delhi, India Dr A S Ramaswamy Specialist Pathologist, Lifeline Hospital, Salalah, Sultanate of Oman Dr Harsh Vardhan Singh Senior Biochemist, N D M C Medical College & Hindu Rao Hospital, Delhi, India Dr Manu Noatay Head Operations, Niche Theranostics, New Delhi, India Dr Anil Parwani Vice Chair, Anatomical Pathology; Director of Pathology Informatics and Digital Pathology The Ohio State University Wexner Medical Center, Columbus, Ohio, United States

Editorial Board Members

Dr Sarah Iqbal Ch Faculty of Pathology King Edward Medical University, Lahore, Pakistan Dr Jerad M Gardner Asst Prof, Pathology and Dermatology, University of Arkansas for Medical Sciences, Little Rock, AR, United States Dr Naila Atif Associate Prof., Histopathology, Central Park Medical College, Lahore, Pakistan Dr Rajan Chopra King Fahad Hospital, Hufof, Saudi Arabia Dr Niti Singhal Abu Dhabi, United Arab Emirates Dr (Prof) Severino Rey Quiron Hospitals and Pontifical Catholic University, Ecuador Dr Rajeshwar Reddy Prof. & Head, Dept. of Microbiology, Gandaki Medical College, Pokhara, Nepal

Published by: Pacific Group of e-Journals (PaGe) Kotla Market, Mayur Vihar, New Delhi (India) Website: www.pacificejournals.com www.apalm.org E-mail: contactus@pacificejournals.com

Advisory Editors

Dr Awanindra Kumar Head, Blood Bank & Pathology, SDN Hospital, Delhi, India Prof. Kuldeep Singh Prof. of Pathology, Govt. Medical College, Jammu, India Dr Shriniwas Rushi Histopathologist, KFCH, Riyadh, Saudi Arabia

I

Annals of Pathology and Laboratory Medicine Disclaimer

Annals of Pathology and Laboratory Medicine (APALM) is an international, Double-blind peer-reviewed, indexed, open access, online and print journal with an Impact Factor (IFJ): 2.8952 and IC Value (ICV 2014): 67.16 published by ‘Pacific group of e-Journals’ (PaGe), an ISO 9001:2008 Certified academic publishing house.

1. Thoughts, Language and examples in published research papers are entirely of Authors of Research Papers. It is not necessary that both Editor and Editorial Board are satisfied by the research paper.

The responsibility of the matter of the research paper/ article is entirely of author. Scientific knowledge is ever changing. As new research and experiences broaden our knowledge, old concepts may be required to be looked into afresh. The Authors and editors of the material herein have consulted sources believed to be reliable in their efforts to provide information that is complete and in accord with the standards accepted at the time of publication. However, in view of the possibility of human error by the authors, editors, or publisher, nor any other who has been involved in the preparation of the work warrants that the information contained herein in every aspect accurate or complete, and they are not responsible for any errors or omissions or the results obtained from the use of such information. Readers are advised to confirm the information contained herein with other sources.

APALM publishes original, peer-reviewed articles for pathologists and clinical laboratory scientists. APALM is a specialized journal in the field of Pathology and Laboratory Medicine which, inter alia, includes Histopathology, Cytopathology, Hematology, Clinical Pathology, Forensic Pathology, Blood Banking, Clinical Bio-Chemistry, Medical Microbiology (Bacteriology, Virology, Mycology, Parasitology), etc.

APALM is the top ranking Indian Journal in the field of Pathology and Laboratory Medicine, with the highest IC Value (67.16) amongst the Indian Journals in the field of Pathology and Laboratory Medicine that are indexed with Index Copernicus.

Publication Frequency Four per year, i.e. Quarterly.

Copyright •

•

•

2.

Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under a Creative Commons Attribution License that allows others to share the work with an acknowledgement of the work’s authorship and initial publication in this journal.

3.

Authors are able to enter into separate, additional contractual arrangements for the non-exclusive distribution of the journal’s published version of the work (e.g., post it to an institutional repository or publish it in a book), with an acknowledgement of its initial publication in this journal.

4.

Authors are permitted and encouraged to post their work online (e.g., in institutional repositories or on their website) prior to and during the submission process, as it can lead to productive exchanges, as well as earlier and greater citation of published work.

II

In any condition and due to any reason, if any Educational/Research Institution (College or University) denies accepting the research paper published in APALM, it will not be the responsibility of the Editor, Publisher or the Management.

Only the First author is entitled to receive the print copies of all co-authors.

All the legal disputes related to PaGe are subject to Delhi Jurisdiction only

Contents Original Article A Feasible Flowchart to Screen EBV-Positive Diffuse Large B Cell Lymphoma of the

A114-A120

Bone and Soft Tissue Extirpations: Whole-Specimen Freezing Delivers Superior Pathological Evaluation Veronica Taylor, Dora Lam-Himlin, Monique Harize, Shipra Garg, David Carpentieri, Steve Taylor

A121-A127

Audit of Diagnostic Tissue for The Diagnosis of Non-small cell Lung Cancer Madeeha Ruqaiya Dean, Stephen Della-Fiorentine

A128-A133

Elderly: A Molecular Approach Simona Ferrari, Luca Caschera, Giuseppe Deda, Michelina Maria Carla Amato, Ombretta Annibali, Carla Rabitti, Anna Crescenzi, Tommasangelo Petitti, Giuseppe Avvisati, Andrea Onetti Muda, Francesca Zalfa, Antonella Bianchi

A Hospital Based Study of Hb Variant and Beta Thalassaemia Mutational Pattern Characterization Among the People of Northeast Region of India Monalisha Saikia Borah, Dr. Prasanta Kumar Bhattacharya, Dr. Mauchumi Saikia Pathak, Dr. Dulal Kalita

A134-A140

Evaluation and Correlation of Clinical, Histopathological and Direct Immunofluorescence Findings in Vesicobullous Disorders of Skin - A Cross Sectional Study with Review of Literature Geetika Sharma, Shilpi Agarwal, Ram Chander

A141-A147

A Clinicopathological Study of Lesions of Spinal Cord and its Coverings: A tertiary Care Hospital Experience Nitin M Gadgil, Chetan Sudhakar Chaudhari, Sangeeta R Margam, Mohd.Unzer Mohd.Umar Khan, Prashant Vijay Kumavat, Ganesh R Kshirsagar

A148-A156

Assessment of Serum βhCG, Lipid Profile and Uric Acid Levels in Early Second Trimester as Predictors of Pregnancy Induced Hypertension.

Akansha Singh, Poonam Khambra, K Usha Rani, Ashish Kumar Mandal

A157-A161

Correlation of p53 Expression with Clinicopathological Characteristics of Breast Carcinoma Kamal Kant Gupta, Ashok Kumar Dash, Debi Prasad Mishra

A162-A170

CD-10: An Emerging biomarker in Prognostication of Infiltrating Duct Carcinoma Breast Shrikant Nema, Sanjeev Narang

A171-A175

Megakaryocytes in Chronic Phase of Chronic Myeloid Leukemia: A Descriptive Case Series Arun Kumar Arunachalam, Mili Jain, Ashutosh Kumar, Rashmi Kushwaha, Uma Shankar Singh, Anil Kumar Tripathi

A176-A182

Overexpression of Her2/Neu in Gastric Carcinoma: Association with Histological Type, Tumor Grade and H. Pylori infection Piyali Ghosh, Indranil Chakrabarti, Sourav Bhowmick, Mimi Gangopadhyay, Mamata Guha Mallick Sinha, Sudip Bhattacharya

A183-A188

Usefulness of Cytological Grading in Predicting Tumor Behavior in Breast CarcinomaAn Institutional Experience Kishna Kanth, V Satyanarayana

A189-A194

Spectrum of Fibro Osseous Lesions: A Retrospective Study Sajitha K, Kishan Prasad H L, Netra M Sajjan, Jayaprakash Shetty K

A195-A200

III

Case Report

Punica Granatum v/s Lawsonia Inermis: An in Vitro Anti-Fungal Study.

Pallav Singhal, Narendra Nath Singh, Gadiputi Sreedhar, Manu Batra, Sumita Bannerji, Soumi Ghanta

A201-A205

Diagnostic Dilemma at Preoperative Biopsy Diagnosis of Oral Cavity Lesions with Recommendations Madhu Ishwar Chaturvedi, Arshad K Pathan

A206-A211

Establishing Reference Value of Biochemical Parameters: A Must Before Ensuring Quality in Biochemistry Diagnostic Lab Gitanjali Goyal, K.M.D. Singh Panag

A212-A216

The Reactive Lymphocyte: A Morphological Indicator of Platelet Counts in Dengue Seropostive Patients Archana Shetty, Padmapriya Kasukurti, Vijaya C, Jyalakshmi V.J

A217-A223

Histopathological Analysis of Unusual Findings in Appendectomy Specimens: A Retrospective Study and Literature Review.

Dhiraj Nikumbh, Rajesh Y Thakur, Sudhir Singhavi, Shirish Gondane

A224-A229

Detection of Plasmid-mediated Ampc β-lactamases Among E.coli and Klebsiella pneumoniae by Multiplex PCR�

Anuradha Basavaraju, Praveena Muttaraju

A230-A236

Documentation of Myeloproliferative Disorder as the Commonest Hematological Malignancy in Predominant Rural Based Pilot Study at Punjab (India): An Incidental Finding or Association.

Rahul Mannan, Mridu Manjari, Sonam Sharma, Komalpreet Bhatia, Gagandeep Singh, Tejinder Bhasin

A237-A243

Evaluation of the Causes of deferral Among Blood Donors: A Retrospective Study Akanksha V. Gaajre, Yasmeen Sahir Khatib, Richa Patel, Asha Premlata Oraon

A244-A248

New Bone Formation in Haematological Malignancies- A Novel Observation in a series Of 5 Cases Amita Jain Gupta, Poonam Rani, Roopal Rathi, Tejinder Singh

C112-C116

A Case Report of Soft Tissue Myoepithelial Carcinoma in the Neck & Post-auricular Region: A Diagnostic Challenge Shilpi Agarwal, Gautambir Singh, Deeksha Singh, Preeti Rai

C117-C120

Primary Squamous Cell Carcinoma of Renal Pelvis : A Masquerade Jasvinder Kaur Bhatia, Samir Gupta, Sunil Julmaria

C121-C124

Wilms Tumour with Neural Differentiation: A Rare Histological Presentation Ritika Singh, Leelawathi Dawson, A K Mandal Rare Presentation of Medullary Carcinoma of Thyroid with Predominant Spindle Cell Pattern & Abundant Calcification Namrata Nargotra, Abhijit Das, Sompal Singh, Rakesh Kumar Deepak, Ila Tyagi

C125-C129 C130-C134

Tuberculous Versus Malignant Peritoneal Effusion: A Diagnostic Dilemma when Both Conditions Coexist Shailaja Shukla, Preeti Rai, Geetika Sharma, Aruna Chikkara

C135-C137

Warthin Like Variant of Papillary Carcinoma Thyroid Against the Background of Hashimotos Thyroiditis : A Case report Swati Patki, Ganesh R Kshirsagar, Sheetal Yadav, Nitin Gadgil

C138-C141

IV

Perianal Rhabdomyosarcoma Presenting Post Surgery for Hirschsprungs Disease: A Rare Presentation Shailaja Shukla, Manjari Kishore, Sangeeta Pahuja, Priya Thomas

C142-C145

Chorangioma with Chorangiosis, Placenta: A Rare Entity of Clinical Significance Swati Singla, Ankit Kaushik, Charanjeet Alhuwalia, Gaurav Singla, Ashish Kumar Mandal

C146-C148

Inflammatory Cloacogenic Polyp: A Rare Case Report.

Smita Surendra Masamatti, Nayan Anant Ramteerthakar, Amit Bapuso Pandav, Alka Vikas Gosavi A Rare Case of Extraovarian Granulosa Cell Tumor Presenting as a Retroperitoneal Mass.

Pranita Medhi, Swagata Dowerah Accelerated Phase of Chediak Higashi Syndrome: An Unusual Case of Pancytopenia Manjari Kishore, Sadhna Marwah, Vijay Kumar, Pooja Suteri, A.S. Nigam Synchronous Tumors of Endometrium and Bilateral Fallopian Tubes: A Rare Case Report Ashmeet Kaur, Mansi Faujdar, Shubha Gupta Cover Image A Rare Case of Renal Pelvis Urothelial Carcinoma In Situ Associated with Hydronephrosis and Atrophic Kidney Neeraj Dhameja, Vikas Kailashiya, Vikash .

Letter to Editor Lymphocytoma Cutis on Fine Needle Aspiration Cytology Shailaja Shukla, Mona Bargotya, Geetika Sharma, Taru Garg

Cysticercosis of Breast Presenting as a Breast Lump: Cytological Diagnosis of a Rare Case.

Swati Bhardwaj, Akansha Singh, Charanjeet Ahluwalia, Ashish Kumar Mandal

Published by: Pacific Group of e-Journals (PaGe) Kotla Market, Mayur Vihar, New Delhi (India)

Website: www.pacificejournals.com www.apalm.org

E-mail: contactus@pacificejournals.com

V

C149-C152 C153-C155 C156-C160 C161-C164 C165-C169

L11-L12 L13-L14

Original Article A Feasible Flowchart to Screen EBV-Positive Diffuse Large B Cell Lymphoma of the elderly: A Molecular Approach Simona Ferrari1, Luca Caschera2, Giuseppe Deda1, Michelina Maria Carla Amato1, Ombretta Annibali3 Carla Rabitti1, Anna Crescenzi1, Tommasangelo Petitti4, Giuseppe Avvisati5, Andrea Onetti Muda1 Francesca Zalfa6* and Antonella Bianchi1* Unit of Anatomical Pathology, Department of Medicine, Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy 2 Unit of Radiology, University of Milan, via Festa del Perdono, 7, 20122, Milan, Italy.

3 Unit of Hematology, Stem Cell Transplantation, Transfusion Medicine and Cellular Therapy, Department of Medicine, Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

4 Unit of Hygiene Public Health and Statistics, Department of Medicine, Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

5 Unit of Hematology, Stem Cell Transplantation, Transfusion Medicine and Cellular Therapy, Department of Medicine, Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

6 Unit of Microscopic and Ultrastructural Anatomy, Department of Medicine, Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

1

Keywords: Epstein-Barr virus, Diffuse large B cell lymphoma, EBER in situ hybridization, Quantitative real time PCR.

ABSTRACT Background: Epstein Barr Virus-positive diffuse large B cell lymphoma of the elderly (DLBCL-EBV+-e), initially described in 2003, is a provisional entity in the 4th edition of the World Health Organization (WHO) Classification of tumors of hematopoietic and lymphoid tissues and is defined as an EBV+ monoclonal large B cell proliferation that occurs in patients >50 years of age and in whom there is no known immunodeficiency or history of lymphoma. It is associated with a poor prognosis but could be treated with the association of novel therapeutic approaches. EBER in situ hybridization (EBER-ISH) is the gold standard assay for defining a tumor as EBV-related, however there are no uniform criteria for the percentage of EBV-positive cells in DLBCL-EBV+-e.

Methods: We applied to Formalin Fixed Paraffin Embedded (FFPE) tissue of 43 novel DLBCL over 50 years Q-PCR for the detection of viral DNA in concert with EBER-ISH. Result: Only one case was defined as true DLBCL-EBV+-e being Q-PCR positive with a value of log EBV DNA/105 cells ≥ 6 and EBER-ISH positive.

Conclusion: In the current study we applied to FFPE tissue of DLBCL-EBV+-e a reliable and feasible Q-PCR/EBERISH combined protocol for the screening of EBV status. Our protocol could help to better identify the DLBCL-EBV+-e patients eligible for novel therapeutic approaches.

*Corresponding author: Antonella Bianchi. Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

Phone: +39225411153, Fax: +3906225411926, Email: a.bianchi@unicampus.it Francesca Zalfa. Università Campus Bio-Medico di Roma, via Álvaro del Portillo 21, 00128 Rome, Italy.

Phone: +39225419142, Fax: +3906225411157, E-mail: f.zalfa@unicampus.it

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Ferrari et al.

Introduction

Epstein-Barr virus (EBV) is a ubiquitous human DNA γ-herpesvirus. It infects asymptomatically >90% of population worldwide and it is the causative agent of infectious mononucleosis (IM). It is associated with a wide spectrum of epithelial and lymphoproliferative diseases.[1,2] The 4th edition of the World Health Organization (WHO) Classification of tumors of hematopoietic and lymphoid tissues defines the Epstein Barr Virus-positive diffuse large B cell lymphoma of the elderly (DLBCL-EBV+-e) as an EBV-positive diffuse large B cell lymphoma (DLBCL) of patients older than 50 years, without any known underlying immunosuppression or prior lymphoproliferative disease.

[3] There is a higher prevalence of EBV-positive DLBCL among East Asians (8,7%-11,4%) compared with <5% in Western Countries.[1] Beltran et al. has reported the highest frequency of EBV-positive DLBCL in a Peruvian population, 14,9%.[4] It has been postulated that DLBCL-EBV+-e might be caused by the senescence of the immune system as a part of the normal aging process, based largely on shared features with immunodeficiency-associated lymphoproliferative disorders (LPDs).[5,6] Such lymphoma shows an EBV latency pattern Type II or III.[5] The oncogenic mechanisms of EBV in DLBCL-EBV+-e are thought to be attributable predominantly to LMP1, a 63kDa membrane protein that elicits NF-kB, P13K/ATK, MAPK and JAK/STAT pathways by mimicking CD40, which is expressed constitutively on the B-cell membrane involving in B-cell activation and proliferation.[2,5] Several published studies have shown that DLBCLEBV+-e is associated with a poorer prognosis compared to age-matched DLBCL without EBV infection, independent of the International Prognostic Index (IPI).

[1,7] Currently, there is no uniformly accepted treatment for DLBCL-EBV+-e beyond the current standard therapy for DLBCL.[6] However, novel therapeutic approaches need to be considered, including EBV-specific adoptive immunotherapy, miRNA-targeted therapy, combination therapy based on EBV lytic phase induction followed by exposure of the tumor cells to anti-herpesvirus drug, and targeting specific signaling pathways such as NFkB pathway.[5] Therefore, the identification even of few DLBCL-EBV+-e cases ensures these patients may benefit from these novel therapies.

A-115 positive cells ranging from 10% of to almost all tumor cells.[1,9,10] Moreover, due to the low prevalence of the EBV-positive DLBCL cases, this approach is not uniformly recommended in all DLBCL patients older than 50 years.[6] For these reasons and considering the potential prognostic and predictive value of EBV tumoral status, we developed a reliable and feasible Q-PCR/EBER-ISH combined protocol to assess the EBV presence in DLBCL-e cells.

Materials and Methods

Forty-three (43) newly diagnosed primary DLBCL > 50 years, without known underlying immunosuppression condition, of whom paraffin blocks were available and well preserved, were tested for EBV presence. Of these patients 28 had nodal and 15 extra-nodal DLBCL. All patients were diagnosed and treated at the Unit of Hematology of the University Hospital Campus Bio-Medico of Rome (UCBM). Collection of cases was in accordance with data safety laws and institutional review board requirements.

DNA was extracted from Formalin Fixed Paraffin Embedded (FFPE) sections using the High Pure FFPET DNA Isolation Kit (Roche) prior microdissection to enrich the tissue of neoplastic cells, and DNA quantity and quality was evaluated spectroscopically.

Specific amplification of the viral DNA was carried out by quantitative real time PCR (Q-PCR), using the EBV Real-TM Quant kit (Dia-Chem) according to manufacture.

This real time test provides a qualitative and quantitative detection of LMP-gene of EBV DNA in biological materials (including FFPE samples).

For each control and patient specimen, the concentration of EBV DNA (or number of viral DNA copies per cell) was expressed as logarithm of EBV DNA in 105 cells and calculated using the following formula: log [EBV DNA copies/β-globin DNA copies x 2x105] = log (copies EBV DNA/105 cells).

The samples were considered as negative for EBV status if in the channel JOE (Yellow) the value of Ct was ≥ 30 cycles.

The gold standard assay for determining whether a biopsied tumor is EBV-related is the EBER in situ hybridization (EBER-ISH).[6,8] However, the criteria for defining EBVpositive DLBCL vary among the studies and there is no uniform consensus about the cut-off value of EBER-ISH

The analytical specificity of the primers and probes was validated with negative samples. They did not generate any signal with the specific EBV primers and probes.

The specificity of the kit was 100%. The potential crossreactivity of the kit was tested against the group control (CMV, HSV 1 & 2, HHV6, HHV8, VZV, Parvovirus and other ones). It was not observed any cross-reactivity with other pathogens. The sensitivity of the kit was not less than 200 copies/ml or 50 copies of EBV DNA per 105 cells.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-116

Molecular Flowchart for EBV+ DLBCL of the Elderly

EBER-ISH was then performed on paraffin section using a fluorescein-conjugated PNA probe targeting EBER RNA (Dako) according to manufacture. A tumor was considered EBV-related if the EBER signal was localized in more than 10% of neoplastic cells.[1] A case was considered EBER-negative if EBER staining was undetected or was apparently only in benign-appearing lymphoid cells.[11,12] Two well-known EBER-ISH positive neoplasms, a classical Hodgkin’s Lymphoma (cHL) and a B-cell Lymphoma associated with HIV infection, were considered as positive controls.

Result

Using the Q-PCR analysis, twenty-nine (29) out of 43 (67,44%) of the cases examined were negative for the presence of viral DNA, 13/43 (30,23%) of cases were positive having a number of viral DNA copies per cell (log EBV DNA/105 cells) less than 6 and 1/43 (2,32%)

was positive having a number of viral DNA copies per cell greater than 6 (Table 1).

All cases have been also tested with EBER-ISH. None of Q-PCR negative (Ct ≥ 30 cycles) DLBCL-e patients showed EBER-ISH positivity (Table 1 and Figure 1).

Only one case was defined as DLBCL-EBV+-e being Q-PCR positive, with a value of log EBV DNA/105 cells ≥ 6 and EBER-ISH positive, with a percentage of neoplastic cells > 80% (Figure 1, panel a). In our cohort the prevalence of DLBCL-EBV+-e was 2,32%, in agreement with the data reported in the literature for the Western population.[1] The control cases showed at Q-PCR a copy number higher than 6. EBER-ISH was positive only in the Hodgkin/Reed Sternberg cells of the classical Hodgkin’s Lymphoma (Figure 1, panel b) and in > 60% of cells of the B-cell lymphoma associated to HIV infection (Figure 1, panel c).

Table 1: UCBM cohort of primary DLBCLs with > 50 years and without known underlying immunosuppression condition. For each sample is reported the Q-PCR score (expressed both as “DNA EBV copies in 105 cells” and “Log EBV copies in 105 cells”) and EBER-ISH positive (POS) or negative (NEG) result.

Sample number EBV copies/105 cells Log EBV/105 cells EBER-ISH 2002-1 0 / NEG 2003-1 0 / NEG 2003-2 0 / NEG 2003-3 49810,19881 4,7 NEG 2005-1 0 / NEG 2005-2 (CTRL+) 1790411,71 6,25 POS in RS cells 2006-1 0 / NEG 2006-2 21180,10767 4,32 NEG 2006-3 0 / NEG 2007-1 0 / NEG 2009-1 13283,20495 4,12 NEG 2009-2 0 / NEG 2009-3 26630,5743 4,42 NEG 2009-4 155469,4994 5,19 NEG 2010-1 0 / NEG 2010-2 139636,9303 5,14 NEG 2010-3 0 / NEG 2010-4 0 / NEG 2010-5 0 / NEG 2011-1 47465,15021 4,67 NEG 2011-2 0 / NEG 2011-3 0 / NEG 2011-4 19076,22415 4,28 NEG 2011-5 0 / NEG 2011-6 0 / NEG 2011-7 0 / NEG 2011-8 0 / NEG 2011-9 0 / NEG 2011-10 0 / NEG 2011-11 0 / NEG 2011-12 169733,0092 5,23 NEG 2012-1 0 / NEG

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Ferrari et al.

Sample number 2012-2 2012-3 2012-4 2012-5 2012-6 2012-7 2012-8 2013-1 2013-2 2013-3 2013-4 2013-5 2013-6 (CTRL+)

A-117 EBV copies/105 cells 0 0 42649,30616 0 20624,66117 34747,20526 49263578,61 0 0 25151,3774 0 0 3642383,665

Log EBV/105 cells / / 4,63 / 4,31 4,54 7,7 / / 4,4 / / 6,56

EBER-ISH NEG NEG NEG NEG NEG NEG POS in > 80% neopl. cells NEG NEG NEG NEG NEG POS in > 60% neopl. cells

Fig. 1: Representative EBER-ISH images. Representative EBER-ISH images for: (panel a) the unique EBV+ DLBCL-e case (sample 2012-8); (panel b) a classical Hodgkinâ&#x20AC;&#x2122;s Lymphoma as a positive control (CTRL+) that shows the positivity only in the Hodgkin/Reed Sternberg cells (sample 2005-2); (panel c) a B-cell lymphoma associated to HIV infection (CTRL+; sample 2013-6); (panel d) a negative sample both in Q-PCR and in EBER-ISH (sample 2012-2); (panel e) a EBER-ISH negative sample with a Q-PCR score positive <6 (sample 2012-4). The magnification is 40X for each panel.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-118

Molecular Flowchart for EBV+ DLBCL of the Elderly

Discussion

DLBCL-EBV+-e is defined as a histologically malignant polymorphic or monomorphic B cell lymphoproliferation in patients older than 50 years without any known immunodeficiency or prior lymphoma. The clinical behavior is aggressive, with frequent extranodal presentation (e.g stomach, lung, tonsils and skin) and overall poor prognosis. There is some morphologic overlap with cHL, also encountered in the elderly but reported to have a better prognosis. The lesion is thought to be related to defective immune surveillance of EBV secondary to immunosenescence, the natural decay of the immune system as a consequence of aging.[13,14] The cutoff value of 50 years used to define this type of lymphoma is arbitrary, because patients <50 years can also be affected.[5] For this reason, the update of the 4th edition of the WHO Classification of tumors of hematopoietic and lymphoid tissues, expected for mid-2016, likely will define the disease EBV+ DLBCL, NOS, avoiding the term “elderly”.

According to the exact definition of this entity at the moment, we restricted our study to patients older than 50 years, considering that in the future our approach could be extended to a larger cohort of DLBCL or other type EBV related neoplasms.

Our results obtained on this selected cohort, show that, using Q-PCR as a screening test, all cases negative for Q-PCR (Ct ≥ 30 cycles) would not need to be subjected to the EBER-ISH (about 70%), with a considerable time, costs and resources saving. Furthermore, we show that Q-PCR positive cases with a value of log EBV DNA/105 ≥ 6 would correspond to the real expression of the virus inside of neoplastic cells, while Q-PCR positive cases with a value of log EBV/105 cell < 6 would correspond to the presence of EBV-DNA in the latently infected memory B cells (type 0 latency). These normal B cells, virtually present in the tissue and not eliminable with microdissection, are not detected by EBER-ISH.[2,8,11,15] Accordingly, we verified the presence of EBV specific IgG in the sera of the patients with a positive value of log EBV/105 cell < 6.

Moreover, the evidence of an association between EBV and cancer is well defined. EBV has a causative role in IM and X linked lymphoproliferative disease and has a strong association with Burkitt’s lymphoma, cHL, lymphomatoid granulomatosis, primary effusion lymphoma, plasmablastic lymphoma, posttransplant lymphoproliferative disorders, extranodal NK/T cell lymphoma, nasal type, and nasopharyngeal carcinoma.[16,17] Dojcinov et al. also described EBV-driven proliferations presenting in cutaneous or mucosal sites, termed

mucocutaneous ulcer, that are histologically alarming, but have a much more indolent and often self-limited clinical course.[18] Then, although it is to be taken with caution, log EBV/105 cell = 6 could be considered a cut-off value useful to reveal the presence of the virus inside of neoplastic cells (Figure 2), not only in DLBCL but also in these other types of EBV related diseases.

Of note, using EBER-ISH analysis there are no uniform criteria for percentage of EBV-positive cells in EBVpositive DLBCL. Wada and other authors[19,20] emphasized the need for establishing uniform criteria for EBV positivity, either >20%, >50% or almost all tumor cells.

Hofscheier et al[10] interpreted EBER-positive DLBCL with <20% EBER as clonally unrelated EBV transformed B cells or secondary EBV infection in an established B-cell clone.

Therefore, if this approach will be confirmed with a larger cohort of DLBCL or other type EBV related neoplasms, it could not only potentially avoid EBER-ISH analysis, but also solve the difficulties to define uniform criteria for EBER-ISH. In addition to already mentioned novel therapeutical strategies, several clinical trials are also currently ongoing for the treatment of EBV positive lymphomas. In particular, the combination of arginine butyrate and ganciclovir induced clinical responses in 10 of 15 patients (67%) diagnosed with EBV positive lymphoma.[21] Preclinically, bortezomib and simvastatin have shown to be effective at inducing apoptosis in EBV-positive lymphoblastoid cell lines (LCLs) and at delaying onset of lymphoma and increasing survival in SCID mice injected with EBVpositive LCLs.[22] Both medications seem to exert their effect by blocking NF-kB pathway signaling.

Conclusion

DLBCL-EBV+-e reflects the heterogeneity of B-cell neoplasms and the complexity of the WHO classification.

The promising results of our study encourage to confirm the reliability of our new Q-PCR/EBER-ISH combined protocol (Figure 2) on a larger series of EBV+ related processes, to better identify patients eligible for novel therapeutic approaches.

Acknowledgements

The authors are deeply grateful to Prof. V.M. Fazio for scientific support and to Drs. V. Bartolucci and D. Righi for excellent technical assistance.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Ferrari et al.

A-119

Fig. 2: Flowchart of our diagnostic protocol. Flowchart of our diagnostic protocol. The asterisk indicates DLBCLs with > 50 years and without known underlying immunosuppression condition. The dashed box highlights the optional step according to the cut-off value log EBV/105 cell = 6.

Funding

1. Hoeller S, Tzankov A, Pileri SA, Went P, Dirnhofer S. Epstein-Barr virus-positive diffuse large B-cell lymphoma in elderly patients is rare in Western populations. Hum Pathol. 2010;41(3):352-7.

2. Murata T, Sato Y, Kimura H. Modes of infection and oncogenesis by the Epstein-Barr virus. Rev Med Virol.

2014;24(4):242-53.

3. Swerdlow SH, Cancer IAfRo, Organization WH. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues: International Agency for Research on Cancer; 2008.

4. Beltran BE, Castillo JJ, Morales D, de Mendoza FH, Quinones P, Miranda RN, et al. EBV-positive diffuse large B-cell lymphoma of the elderly: a case series from Peru. Am J Hematol. 2011;86(8):663-7.

5. Ok CY, Papathomas TG, Medeiros LJ, Young KH. EBV-positive diffuse large B-cell lymphoma of the elderly. Blood. 2013;122(3):328-40.

6. Castillo JJ, Beltran BE, Miranda RN, Paydas S, Winer ES, Butera JN. Epstein-barr virus-positive diffuse large B-cell lymphoma of the elderly: what we know so far. Oncologist. 2011;16(1):87-96.

7. Montes-Moreno S, Odqvist L, Diaz-Perez JA, Lopez AB, de Villambrosia SG, Mazorra F, et al.

EBV-positive diffuse large B-cell lymphoma of the elderly is an aggressive post-germinal center B-cell neoplasm characterized by prominent nuclear factorkB activation. Mod Pathol. 2012;25(7):968-82.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

None

Competing Interests None declared

Reference

A-120

Molecular Flowchart for EBV+ DLBCL of the Elderly

8. Gulley ML, Tang W. Laboratory assays for Epstein-Barr virus-related disease. J Mol Diagn.

2008;10(4):279-92.

9. Wada N, Ikeda J, Hori Y, Fujita S, Ogawa H, Soma T, et al. Epstein-barr virus in diffuse large B-Cell lymphoma in immunocompetent patients in Japan is as low as in Western Countries. J Med Virol. 2011;83(2):317-21.

10. Hofscheier A, Ponciano A, Bonzheim I, Adam P, LomeMaldonado C, Vela T, et al. Geographic variation in the prevalence of Epstein-Barr virus-positive diffuse large B-cell lymphoma of the elderly: a comparative analysis of a Mexican and a German population. Mod Pathol. 2011;24(8):1046-54.

11. Ryan JL, Fan H, Glaser SL, Schichman SA, Raab-Traub N, Gulley ML. Epstein-Barr virus quantitation by realtime PCR targeting multiple gene segments: a novel approach to screen for the virus in paraffin-embedded tissue and plasma. J Mol Diagn. 2004;6(4):378-85.

12. Gulley ML, Glaser SL, Craig FE, Borowitz M, Mann RB, Shema SJ, et al. Guidelines for interpreting EBER in situ hybridization and LMP1 immunohistochemical tests for detecting Epstein-Barr virus in Hodgkin lymphoma. Am J Clin Pathol. 2002;117(2):259-67.

13. Oyama T, Yamamoto K, Asano N, Oshiro A, Suzuki R, Kagami Y, et al. Age-related EBV-associated B-cell lymphoproliferative disorders constitute a distinct clinicopathologic group: a study of 96 patients. Clin Cancer Res. 2007;13(17):5124-32.

14. Menon MP, Pittaluga S, Jaffe ES. The histological and biological spectrum of diffuse large B-cell lymphoma in the World Health Organization classification.

Cancer J. 2012;18(5):411-20.

15. Vockerodt M, Yap LF, Shannon-Lowe C, Curley H, Wei W, Vrzalikova K, et al. The Epstein-Barr

virus and the pathogenesis of lymphoma. J Pathol.

2015;235(2):312-22.

Cohen JI, Bollard CM, Khanna R, Pittaluga S. Current understanding of the role of Epstein-Barr virus in lymphomagenesis and therapeutic approaches to EBVassociated lymphomas. Leuk Lymphoma. 2008;49 Suppl 1:27-34.

Thorley-Lawson DA, Gross A. Persistence of the Epstein-Barr virus and the origins of associated lymphomas. N Engl J Med. 2004;350(13):1328-37.

Dojcinov SD, Venkataraman G, Pittaluga S, Wlodarska I, Schrager JA, Raffeld M, et al. Agerelated EBV-associated lymphoproliferative disorders in the Western population: a spectrum of reactive lymphoid hyperplasia and lymphoma. Blood.

2011;117(18):4726-35.

Park S, Lee J, Ko YH, Han A, Jun HJ, Lee SC, et al.

The impact of Epstein-Barr virus status on clinical outcome in diffuse large B-cell lymphoma. Blood.

2007;110(3):972-8.

Chuang SS, Ichinohasama R, Yang CC, Wang WC, Chou CK, Liao YL, et al. Multicentric primary intestinal EBV-positive diffuse large B cell lymphoma of the elderly presenting with perforation. Int J Hematol. 2010;91(3):534-8.

Perrine SP, Hermine O, Small T, Suarez F, Oâ&#x20AC;&#x2122;Reilly R, Boulad F, et al. A phase 1/2 trial of arginine butyrate and ganciclovir in patients with EpsteinBarr virus-associated lymphoid malignancies. Blood.

2007;109(6):2571-8.

Katano H, Pesnicak L, Cohen JI. Simvastatin induces apoptosis of Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines and delays development of EBV lymphomas. Proc Natl Acad Sci U S A. 2004;101(14):4960-5.

16.

17.

18.

19.

20.

21.

22.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Bone and Soft Tissue Extirpations: Whole-Specimen Freezing Delivers Superior Pathological Evalulation Veronica Taylor1, Dora Lam-Himlin1, Monique Harize2, Shipra Garg2, David Carpentieri2 and Steve Taylor2* Department of Laboratory Medicine and Pathology, Mayo Clinic, Scottsdale, AZ Department of Pathology and Laboratory Medicine, Phoenix Children’s Hospital, Phoenix, AZ 1

2

Keywords: Whole-Specimen Freezing, Slab-Sectioning

ABSTRACT Background: Bone resections involved by either benign or malignant disease are complex specimens requiring special processing. Irrespective of experience, many pathologists, residents, and pathologists’ assistants (PAs) are apprehensive of these resections due to their infrequency. For these extirpations, serial slab-sections are ideal for identifying margin status, size of tumor, documentation of diagnosis, tumor classification, imaging correlation and presence of discontinuous lesions. However, the variable density of bone and soft tissues creates a challenge for prosectors to reliably yield multiple intact thin slabs. Standardized protocols provide both reassurance and a systematic approach and herein we describe a method as implemented at the sister institutions of Mayo Clinic Hospital in Phoenix and Phoenix Children’s Hospital.

Methods: Utilizing the approach of whole-specimen freezing and slab-sectioning, we prospectively processed 41 cases of bone and soft tissue resections between 2011 and 2014 and histologic sections were retrospectively evaluated for freeze artifact, bone dust, thermal injury and immunoreactivity. Slab-sectioning following whole-specimen freezing resulted in crisply visible anatomic relationships across multiple planes allowing for superior gross inspection, easy correlation with prior imaging, photographic documentation and ease in the selection of histologic sections.

Result: Microscopically, freeze artifact was present in 6 of 39 (15%) cases available for review, but was insignificant to interpretation and was not affected by freeze duration (up to 72 hours). No loss of immunoreactivity was present (0 of 5 cases) and neither bone dust nor thermal injury were significant findings in any of the cases.

Conclusion: The protocol is easy to follow, yields reproducible results and induces no significant freeze artifact, providing excellent histomorphology regardless of tumor type involving bone. We recommend slab-sectioning following whole-specimen freezing and we offer our procedure in detail.

*Corresponding author: Steve Taylor, Phoenix Children’s Hospital, Dpt. of Pathology and Laboratory Medicine, 1919 E Thomas Rd, Phoenix, AZ 85016 Phone: 1-602-933-3036 Email: ktaylor3@phoenixchildrens.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-122

Bone/Soft Tissue Whole-Specimen Freezing

Introduction

Specimens submitted for pathological examination composed of bone range from core biopsies to curetted lesions to large-scale resections which often require specialized handling, additional processing steps and unique tools for analysis. As these tissues are procured from many different surgical procedures, bone tumors may be received in myriad states. Specialized equipment, such as diamond or band saws, is usually required as is the necessity for additional processing steps such as decalcification, radiography and photography. The goals of specimen evaluation are multiple, including documentation of diagnosis, margin status, disease extent, tumor classification, imaging correlation, and response to neoadjuvant treatment, if applicable.[1] To this end, standard protocols for processing bone extirpations are desirable because they yield reproducible results. The following procedure is easy to follow and affords the pathologist a precise gross examination and exceptional histology, thereby yielding all of the information necessary to render a clear diagnostic report.

Materials and Methods

We detail here our standard method of whole-specimen freezing and slab-sectioning process; standard grossing elements are beyond the scope of this discussion and have been previously described.[2-5] Upon receipt of the intact specimen, gross photographs are obtained and archived in the institutional lab information system (LIS). The specimen is radiographed as roentgenograms provide diagnostic information and delineate tumor burden for the prosector, thus determining how the specimen should be sectioned.[1-2,4,6-8] Radiographs may be obtained with a Faxitron x-ray cabinet or if the specimen is too large it may be transported in a safe, mindful manner to radiology for imaging. If radiographing is not a feasible option, the patient’s previous imaging is reviewed in conjunction with the clinical and radiologic impressions which can also assist in proper orientation for subsequent sectioning and analysis.2,4-5,7-9 The specimen is oriented and measurements are taken, making note of vessels, soft tissue, skin, etc. as described.2-5 Prior to sectioning, communication with the submitting surgeon ensures all margins or areas of concern are addressed. The margins of interest are sampled before inking the specimen, i.e. vascular or neurovascular bundles, as these may be difficult to find after inking. These samples are placed in a duly labeled cassette for future processing.

The specimen is inked in one or more colors depending on preference or the number of margins to be assessed. All areas of previous sampling, such as a vascular margin, may be inked with a different color for re-identification. Metal hardware, if either adherent to or embedded within the

specimen, is extricated. Radiographing the specimen allows the prosector to visualize the extent of implanted hardware that cannot be removed and helps guide sectioning. The specimen is placed in a freezer (-70° C to -140° C) for a minimum of four hours before sectioning. Ensure the specimen is completely frozen to prevent thawing during sectioning; it may be left in the freezer overnight or over the weekend without risk of introducing artifact.

Utilizing proper protective equipment (gown/apron, gloves, Kevlar gloves, impact-resistant face shield and respirator mask), the specimen is retrieved from the freezer and is sectioned. A saw suitable for bone and soft tissue is employed, such as a Torrey or comparable butcher saw. The first cut is a transverse section to include the bone and soft tissue margins--an en face section--which is subsequently fixed, decalcified and submitted. Positive surgical margins are correlated with local recurrence7-8,10 and a predictor of poor prognosis.11 If the extirpation is large, such as a leg disarticulated at the hip, the specimen may be sectioned into smaller components—tumor versus non-tumor—for ease of subsequent cutting. Utilize imaging studies for reference to divide the resection. The specimen should then be cut along its long axis in 4-6 mm serial slices, either coronal or sagittal, in the plane demonstrating maximum tumor burden and using one continuous cut.1-2,4-6,8-9 The opposing end/side slabs may be further sectioned in a perpendicular fashion to demonstrate tumor relationship to these margins. The resulting slabs are gently cleaned of bone dust under cool, running water with the aid of a sponge, scour pad or surgical brush. Save tissue for ancillary studies if warranted. Slabs are wrapped in moist paper towels to prevent sections from adhering to one another taking care to maintain orientation. The specimen slabs are then photographed (Fig.1) and the images stored in the LIS. Reconstruct the specimen and record tumor measurements and margin relationships. Consult with the case pathologist and review the specimen to determine which slab should be submitted. Once selected, this slab should be photographed separately and stored as described.

Keep in mind the overall aims of histologic sampling when determining areas for submission: tumor classification/ subclassification, presence or absence of lesional tissue, anatomic distribution, if tumor is present how much is viable versus necrotic and documentation of any reactive processes.1 One of the best prognostic factors following neoadjuvant chemotherapy is tumor necrosis greater than 90%.1,3,6-7,9-11 To this end, one entire slab must be submitted for histologic evaluation. Please note some primary bone malignancies other than osteosarcoma and the Ewing’s family of tumors may not require extensive evaluation. In these cases, refer to your institution’s standard of practice regarding submission guidelines.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Taylor et al.

www.pacificejournals.com/apalm

A-123

eISSN: 2349-6983; pISSN: 2394-6466

A-124

Bone/Soft Tissue Whole-Specimen Freezing

Fix the entire specimen for a minimum of 24 hours.

Proper fixation ensures excellent morphology even with subsequent decalcification. Once the specimen is fixed, a lymph node search may be performed and all soft tissue margins and malleable areas of noncalcified tumor are sampled prior to placing the specimen into decalcification fluid. Decalcify the specimen in its entirety in the event additional sections are required. Check the specimen on a routine basis to prevent over decalcification which, depending on the agent employed, may hinder routine histochemical or immunohistochemical staining. At the termination of decalcification, rinse the specimen in running water to ensure removal of all decalcifying agent and sample. The sections submitted should be annotated on an accompanying map diagram. The corresponding archived images may be printed off and the map sections carefully drawn onto the picture which will go with the report for the pathologist to reference during interpretation.

Further, the image may be manipulated in a picture editing program, such as Power Point, and the map diagram printed off and delivered to the pathologist for reference at microscopic review. All map diagrams should be archived and saved in the patient’s permanent record.

Result

Using this method, we prospectively processed 41 cases of bone and soft tissue resections between 2011 and 2014. All slides available for review were analyzed by the Pathologists’ Assistants with the Pathologists. Parameters examined included presence or absence of freeze artifact, bone dust and thermal injury and their significance to interpretation and also effects of this method on immunoreactivity and molecular testing. Our cohort of 39 tumors available for review included osteogenic sarcoma (26), Ewing sarcoma (4), chondrosarcoma (2), synovial sarcoma (2), metastatic renal cell carcinoma (1), neuroendocrine carcinoma (1), chordoma (1), enchondroma (1) and ghost cell odontogenic carcinoma (1). Histologically, each case demonstrated a minor degree of freeze artifact in the attached soft tissues.

In relation to the lesional components, freeze artifact was identified in 6 of 39 (15%) cases available for review, but was insignificant to interpretation and was not affected by freeze duration (up to 72 hours). In fact, lack of nuclear detail and cytoplasmic shrinkage were attributed more to over-decalcification and inadequate fixation, respectively, than to freeze artifact. No loss of immunoreactivity was seen (0 of 5 cases). Cases requiring molecular analysis were performed on previous biopsy material. Neither bone dust nor thermal injury was significant in any of the cases (0 of 39). Slab-sectioning following whole-specimen freezing resulted in crisply visible anatomic relationships across multiple planes and provided excellent histomorphology

regardless of tumor type. Further, pathologic fractures and both small and large joints remained intact with this method. This method was easy to employ and gives the prosector a standardized protocol to follow that yields excellent, reproducible results (Fig. 2).

Discussion

Bone tumors are procured from many different surgical procedures and thus may be received in various forms: curetted fragments to whole limb extirpations. The goals of specimen evaluation are multiple, including documentation of diagnosis, margin status, extent of disease, tumor classification, imaging correlation, and treatment efficacy, if applicable. To this end, a systematic approach to prosect these specimens is desirable because it yields easily reproducible results and provides the pathologist with the information necessary to render an accurate diagnosis encompassing all of the required report elements.

As described above, the entire extirpation is frozen for ease of sectioning and excellent retention of margin status. Several sources have proposed dissecting away the soft tissue to expose the normal and lesional bone before sectioning; 1-2,4-9 however, this may prove problematic in accurately submitting and reporting margin relationships.

Shaving off soft tissue in the “region” of the tumor fails to accurately access tumor relationships. Freezing allows for all of the soft tissue margins to be definitively described and reported as the attached tissue stays intact versus “shredding” when cut at room temperature. Some extirpations may be large; i.e. an entire leg or arm with attached shoulder. These specimens should be approached in the same manner; however, they may be separated into smaller more manageable segments, such as tumor versus non-tumor. Strict correlation with previous or current imaging is integral if the prosector divides the specimen as to not impair tumor relationships. From our experience, table saws are the most efficient at sectioning the larger resections. Diamond saws, such as the table top Isomet (Lake Bluff, IL) may be used for smaller resections.

Devices to assist in specimen stabilization are helpful; most table saws are equipped with guides to aid specimen cutting. Blocks of wood may be employed as wedges if proper guides are not available. As with all procedures in the gross room, safety is paramount. All personnel should be properly trained in the safety and use of saws and don appropriate protective equipment prior to their operation.

Using the protocol described above, we prospectively processed 41 bone and soft tissue tumors encompassing a wide variety of malignancies and retrospectively analyzed these cases for freeze artifact, thermal injury, bone dust, immunoreactivity and molecular testing results. Overall,

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Taylor et al.

www.pacificejournals.com/apalm

A-125

eISSN: 2349-6983; pISSN: 2394-6466

A-126

Bone/Soft Tissue Whole-Specimen Freezing

the method provided not only allows for excellent gross inspection but also yielded superb histoarchitecture. Of the 39 cases available for review, each case revealed minor freeze artifact in the attached soft tissue. In regards to the lesional/treated components, 6 of 39 (15%) cases harbored some degree of freeze artifact but was insignificant to interpretation and was not affected by freeze duration up to 72 hours. The artifact may have resulted from large, bulkier resections freezing more slowly than smaller resections. Further, lack of nuclear detail and cytoplasmic shrinkage were attributed more to over decalcification and inadequate fixation, respectively, than freeze artifact.

Indeed, fixation is critical and the slabs should be separated by paper towels/gauze to ensure adequate exposure to the fixative of choice. Further, frequent monitoring for the endpoint during decalcification is also integral for subsequent histologic preparation. Decalcifying specimens over the

course of the weekend without proper monitoring should be avoided. Immunoreactivity was retained in 100% of the cases (5 of 5). Thermal injury inflicted by the cutting implement was not identified; however, cautery artifact from the surgical procedure employed was present in virtually every case. Bone dust was present in both resection margins and routine sections but was insignificant to interpretation. Care should be taken to thoroughly scrub the slabs to remove all macroscopic evidence of bone dust as to not impair histologic interpretation. Unfortunately, we could not gauge molecular test results as these studies were carried out on previous specimens.

Slab-sectioning following whole-specimen freezing resulted in crisply visible anatomic relationships across multiple planes examined and provided excellent histomorphology regardless of tumor type. We offer our standardized protocol in detail (Table 1).

Table 1: Whole-Specimen Freezing and Slab-Sectioning Protocol Take gross photographs and store as either a hard copy or in the lab information system (LIS) Evaluate the specimen as described. Sample margins of interest and ink the specimen.

Radiograph the specimen as x-rays provide diagnostic information, delineate tumor burden and drive specimen section or review the patientâ&#x20AC;&#x2122;s previous imaging and/or radiological impressions which provide similar information.

Remove any metal hardware, if possible, following radiographic imaging.

Place the specimen in a freezer (-70 to -140°C) for a minimum of four hours - longer duration will not induce detrimental freeze artifact.

Use a saw suitable for cutting bone and soft tissue, such as a band saw or comparable butcher saw.

The first cut should be transverse to include the entire bone and soft tissue margin which is subsequently fixed, decalcified and submitted. Positive surgical margins correlate with local recurrence and are a predictor of poor prognosis.

Following cuts should be made along the long axis in 4-6 mm serial slices, either coronal or sagittal, in the plane demonstrating maximum tumor burden, utilizing one continuous cut. The opposing end/side slabs may be further sectioned in a perpendicular fashion to demonstrate tumor relationship to these margins.

Gently clean slabs from bone dust under cool running water with the aid of a sponge or surgical brush and then photograph and save the images as a hard copy or archive in the LIS. Review slabs with the Pathologist to determine the section most representative of the tumor. One of the best prognostic factors following neoadjuvant chemotherapy is tumor necrosis greater than 90%. To this end, one entire slab must be submitted for histologic evaluation.

Fix the selected slabs for analysis in 10% neutral buffered formalin for a minimum of 24 hours.

Following fixation, perform lymph node search and sample all soft tissue margins and areas of noncalcified tumor prior to decalcification. Submit remaining sections following decal.

Map the sections as they are taken on the corresponding image.

Sectioning maps are utilized by the Pathologist during review and then stored either in the LIS or with the patientâ&#x20AC;&#x2122;s permanent record.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Taylor et al.

Conclusion

Due to their infrequency in standard practice, resections harboring bone tumors may intimidate even the most experienced prosector. Whole-specimen freezing followed by slab-sectioning keeps the specimen strikingly intact.

These multiple thin slabs allow for exceptional gross evaluation providing a vivid overall assessment of the tumor in relation to the soft tissue and bone margins, correlation with radiologic studies, photographic documentation and determining tissue for histologic sampling. The protocol is easy to follow, yields reproducible results and induces no detrimental freeze artifact, providing superb histomorphology regardless of the tumor type involving bone. We recommend slab-sectioning following wholespecimen freezing for all bone tumor resections.

Acknowledgements None

Funding None

Competing Interests None

Reference:

1. Raymond, AK, Jaffe, N. Osteosarcoma multidisciplinary approach to the management from the pathologistâ&#x20AC;&#x2122;s perspective. Cancer Treat Res. 2009;152:63-84.

2. Lester, SC. Bone and Joints. In: Lester, SC. Manual of Surgical Pathology. 2nd ed. China: Elsevier; 2006:228-231.

www.pacificejournals.com/apalm

A-127 3. Abdul-Karim FW, Bauer TW, Kilpatrick SE, Raymond KA, et al. Recommendations for the reporting of bone tumors. Hum Pathol. 2004;35:1173-1178.

4. McCarthy EF. Bone. In: Westra WH, Hruban RH, Phelps TH, Isacson C. Surgical pathology and dissection: an illustrated guide. 2 ed. New York, NY: Springer; 2003:114-119.

5. Rosai J. Extremitiesâ&#x20AC;&#x201D;amputation for osseous tumor.

In: Rosai J. Manual of surgical pathology gross room procedures. Minneapolis, MN: University of Minnesota Press; 1981:B7-B8.

6. Khuu H, Moore D, Young S, Jaffe KA, et al.

Examination of tumor and tumor-like conditions of bone. Ann Diagn Pathol. 1999;3:364-369.

7. Patterson K. The pathologic handling of skeletal tumors. Am J Clin Path. 1998;109:S53-S66 (supplemental).

8. Weatherby RP, Unni KK: Practical aspects of handling orthopedic specimens in the surgical pathology laboratory. Pathol Ann. 1982;17:1-31.

9. Wold E. Practical approach to processing osteosarcomas in the surgical pathology laboratory.

Ped Dev Path. 1998;1:449-454.

10. Rajani R, Gibbs CP. Treatment of bone tumors. Surg Pathol Clin. 2012;5(1):301-318.

11. Janeway KA, Barkauskas DA, Krailo MD, Meyers PA, et al. Outcome for adolescent and young adult patients with osteosarcoma. Cancer. 2012;118:4597-4605.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Audit of Diagnostic Tissue for the Diagnosis of Non-small Cell Lung Cancer Madeeha Ruqaiya Dean* and Stephen Della-Fiorentine University of Western Sydney, Australia

Keywords: Lung Cancer, Cancer, Egfr, Alk, Biomarker

ABSTRACT Background: Non-small cell lung cancer (NSCLC) harbouring Epidermal Growth Factor Receptor (EGFR) and Anaplastic Lymphoma Kinase (ALK) mutations respond well to tyrosine kinase inhibitors (TKIs). This response is better than that seen with standard chemotherapy. Adequate tissue specimens are necessary for accurate identification of biomarkers in NSCLC to determine subtype and targeted treatment. The aim of this study is to ascertain which biopsy method provides the highest proportion of adequate tissue specimens for biomarker testing.

Methods: TheMosaiq® database was accessed to retrieve information regarding all (164) patients diagnosed with NSCLC between 12/02/2011-15/2/13. The biopsy methods used, patient characteristics and adequacy of tissue obtained for biomarker testing were analysed using the SPSS software.

Result: From the 41 patients tested for biomarkers, surgical resection provided the highest proportion of adequate tissue specimens (100%) compared with fine needle (89%) and core biopsy (61%) respectively.

Conclusion: In conclusion, patients with NSCLC who are unsuitable for surgery, fine needle biopsy can be considered before core biopsy for biomarker testing given the higher proportion of adequate tissue specimens obtained. Larger scale trials are required to assess tissue acquisition, processing and reporting for biomarker testing in order to standardise detection of driver mutations for personalised cancer therapy.

*Corresponding author: Madeeha Ruqaiya Dean, University of Western Sydney, Australia Phone: +61402124200 Email: madeeha_d11@hotmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Dean et al.

A-129

Introduction

Lung cancer is the leading cause of cancer deaths in Australia and worldwide.[1,2] In Australia, lung cancer accounts for 18.9% of all cancer deaths and approximately 1.35 million deaths worldwide annually.1-3 Most (approximately 85-90%) lung cancers are non small cell lung cancers (NSCLC).4-6 In Australia, 61% of males and 64% of females with lung cancer have NSCLC.7 NSCLC are epithelial cancers and the most common types are adenocarcinoma, squamous cell and large cell carcinoma.4 5, 8, 9 Currently the five year survival for NSCLC is poor (less than 15% overall) and worsens with increasing stage (Stage I > 45%, Stage II > 30%, III 5-15%; IV 1%).1, 5, 10 Most NSCLC are diagnosed at an advanced stage (40% at stage IV) and are linked to poor survival rates.11, 12 A major challenge is to improve the prognosis of patients with NSCLC, especially those with advanced disease.

Patients diagnosed with NSCLC are treated according to the stage of the disease. Early stage disease is commonly treated with curative intent (surgical resection or radiation therapy and adjuvant chemotherapy) whereas advanced disease is managed palliatively (radiation and/ or chemotherapy). In the last decade, newer targeted molecular therapies are paving the way in personalised cancer treatments.13 Approximately 10-15% of NSCLC are Epidermal Growth Factor Receptor (EGFR) positive and 2-7% are Echinoderm Microtubule Associated Protein Like-4 Anaplastic Lymphoma Kinase (EML4-ALK) positive tumours.4, 6, 8, 14 Testing for these mutations are important for treatment decision pathway.15 Use of Tyrosine Kinase Inhibitors (TKIs) produce higher response rates, longer progression free survival intervals and significantly improve quality of life in patients with advanced NSCLC with EGFR activating mutations compared to chemotherapy.15-17 Optimal biomarker testing requires adequate tissue sampling as well as appropriate processing and handling of the tissue specimen. There are differing opinions in the literature regarding adequate tissue sampling and processing. Currently guidelines state when to test for EGFR and ALK mutations, however, the amount of tissue required for genetic testing is not standardized. 18-22 Without standardized protocols for tissue collection/preparation, it is difficult to determine the number of cancer cells required in a specimen for successful targeted mutation testing.

Large diagnostic biopsies are not always possible due patient factors such as age, chronic obstructive pulmonary disease (COPD), body mass index, surgical risk, size of tumour, location of tumour and metastases.21, 23 These factors may limit the amount of tissue obtainable for the diagnosis of NSCLC and biomarker testing. Studies www.pacificejournals.com/apalm

indicate that cytological specimens are adequate and suitable alternatives if tissue samples are insufficient.18,23-26 Approximately 60-70% patients with NSCLC present at stage IIIb or IV. 19,27,28 In these advanced stages, surgery is not appropriate. With distant metastases, fine needle or core biopsies are often used to obtain tissue specimens for genetic testing. Commonly, they yield insufficient tissue for testing.19 The critical component of tissue biopsy is to ensure a quality sample that contains adequate numbers of cancer cells to allow for microarray testing irrespective of primary or metastatic tumour origin.

Due to the conflicting recommendations in the literature about adequate tissue retrieval and tissue processing, this study aims to assess and compare which biopsy type provides the greatest proportion of adequate tissue specimens for the diagnostic testing of EGFR and ALK mutations at the MCTC. Analysing the current practices and examining the proportion of adequate diagnostic tissue specimen via each biopsy modality will inform the development of a diagnostic algorithm for EGFR and ALK testing.

Materials And Methods

Participant Selection: This study is a retrospective audit of all 164 patients on the Mosaiq® database diagnosed with NSCLC at Campbelltown and Liverpool Hospitals between 12/02/2011-15/02/2013. Patients had previously provided written consent to the Macarthur Cancer Therapy Centre for the use of their clinical information. This audit included patients who were diagnosed with NSCLC irrespective of gene testing for EGFR and ALK mutations.

Patients without a histology of NSCLC were excluded from the study. Those who were tested for EGFR and ALK mutations were grouped together as ‘gene mutation tested’ patients. Biomarker mutation testing for EGFR testing was limited to exons 18-21 and ALK. The use of any recommended biomarker mutation analysis method was permissible. The biopsy methods used for the EGFR and ALK tested patients were examined for the highest proportion of adequate tissue yield for each biopsy type.

Biopsy types were grouped as follows: –

fine needle (fine needle aspiration biopsy and pleural effusion)

–

core biopsy (core needle biopsy, EBUS, bronchoscopy, CT guided core needle biopsy and pleural biopsy)

–

surgical resection (surgical resection and VATs)

Adequate tissue yield was defined as any biopsy sample that was able to provide a positive or negative result for biomarker mutation analysis. eISSN: 2349-6983; pISSN: 2394-6466

A-130

Non-Small Cell Lung Cancer

There were no timeline restrictions as to when the biomarker mutation testing should have been done within the allocated study timeframe. Of the 164 patients diagnosed with NSCLC, the age, gender, smoking status, smoking history and COPD status were documented.

Within smoking status, ‘never smoker’ was defined as smoking less than 100 cigarettes. This data was entered into an Excel Spreadsheet and the data was de-identified during this process to maintain patient privacy. The variables were analysed for their distribution amongst each subtype of NSCLC (squamous cell carcinoma, adenocarcinoma, large cell carcinoma, bronchoalveolar carcinoma, mixed carcinoma and NSCLC NOS). Further analyses of the same variables were conducted amongst patients based on biomarker testing status. The supervisor checked the reliability of obtained data after data collection.

≤0.05 was considered statistically significant. Due to the small sample size, the obtained results were rounded off to whole numbers.

Result

Characteristics of Patients Diagnosed with Nsclc at Macarthur Cancer Therapy Centre: Of the 164 patients diagnosed with NSCLC, adenocarcinoma was the most frequently diagnosed subtype 31% (51) (Table 1). More patients were diagnosed with large cell carcinomas 27% (44) than squamous cell carcinomas 24% (40) (Table 1).

A larger number of males 57% (29) were diagnosed with adenocarcinoma compared to females 43% (22) (Table 1).

Which biopsy type provided the highest proportion of tissue samples adequate for biomarker testing at Macarthur Cancer Therapy Centre?: Adequacy of tissue sampling for biomarker testing was highest for surgical resection (100%) compared with fine needle biopsy (89%) and core biopsy (61%) respectively (Table 2). Whilst the difference in sampling adequacy was not statistically different between surgical resection and fine needle biopsy (p 0.30), the difference between surgical resection and core biopsy was statistically significant (p 0.03). There was no statistically significant difference in sampling adequacy between fine needle biopsy and core biopsy (p 0.12).

Data Analysis: The de-identified data was initially entered into an Excel Spreadsheet and was later imported into SPSS statistical software for analysis. Chi square was used to calculate the p values for the adequacy of tissue obtained for genetic testing for each biopsy type and to ascertain if there was any relationship amongst different variables against NSCLC subtypes. Unknown or missing variables were not included whilst calculating p values. A p value of Table 1: Patient Characteristics amongst the subtypes of NSCLC Characteristic Age <30 years 30-45.9 46-55.9 56-64.9 65-74.9 75-84.9 >85 TOTAL Gender Male Female Smoking Status (total) Current Ex-smoker Never COPD (total) Yes No Pack Years (total) 0-12 13-40 >40

Total NSCLC Squamous Adenocarcinoma N % N % N %

Large Cell NSCLC NOS Bronchoalveolar N % N % N %

Mixed N %

1 5 11 58 65 19 5 164

1 3 7 35 40 12 3 100

0 2 3 12 14 8 1 40

0 5 8 30 35 20 3 100

0 3 3 18 24 2 1 51

0 6 6 35 47 4 2 100

1 0 4 19 15 5 0 44

2.3 0 9 43 34 11 0 100

0 0 0 8 8 3 2 21

0 0 0 38 38 14 9.5 100

0 0 1 0 1 0 0 2

0 0 50 0 50 0 0 100

0 0 0 0 0 0 1 17 3 50 1 17 1 17 6 100

101 63

62 38

26 14

65 35

29 22

57 43

30 14

68 32

11 10

52 48

2 0

100 0

3 3

50 50

140

100

34

24

44

31

37

26

20

14

1

1

4

3

52 69 14 83 66 17

39 51 10 100 80 20

15 17 2 25 24 1

44 50 6 30 96 4

11 27 6 25 17 8

25 61 14 30 68 32

15 19 3 21 17 4

41 51 8 25 81 19

11 6 3 9 7 2

55 30 15 11 78 22

1 0 0 * *

100 0 0 * *

0 2 2 3 1 2

0 50 50 4 33 67

121

100

28

23

33

27

30

25

14

10

13

11

4

3

27 38 45

22 31 37

4 9 15

14 32 53

10 12 11

30 36 33

5 10 15

17 33 50

5 5 4

36 36 29

0 1 0

0 100 0

3 1 0

75 25 0

*Missing data not included in calculations

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Dean et al.

A-131

Table 2: Adequacy of tissue samples by biopsy type amongst patients tested for EGFR and ALK mutation Characteristic

Fine Needle Biopsy

Core Biopsy

Surgical Resection

N

Column %

N

Column%

N

Column%

Specimen adequate for testing

8

89

14

61

9

100

Specimen inadequate for testing

1

11

9

39

0

0

TOTAL

9

100

23

100

9

100

Discussion

Adequacy of Tissue Obtained for Biomarker Testing: The results of this study support Sun et al.â&#x20AC;&#x2122;s29 and Ma et al.â&#x20AC;&#x2122;s30 findings that indicated surgical resections were superior to core and fine biopsies at detecting EGFR mutations. In the literature, core biopsies were reported to be superior to fine needle biopsies29,30and this may be due to differences in cell block preparation/fixation and sequencing methods. At MCTC, this study has shown fine needle biopsy provided a higher proportion of adequate tissue specimens than core biopsy for biomarker testing. As the majority of biomarker tested patients are stage IIIB and IV NSCLC, fine needle biopsy could mean benefit for both the patient and the healthcare system as it is less invasive, less time consuming, requires less operator training and is cheaper than core biopsy. Thus, it should be the first biopsy method for biomarker testing in late stage NSCLC. In those patients with surgically resectable disease (usually early stage NSCLC), surgically resected specimens will obviate the need for any biopsy. Additionally, fine needle biopsies carry less procedural risk and this supports its use as the primary biopsy method.

Though fine needle biopsy is safer than other biopsy methods, it could mean more patients undergo reflex testing at the time of lung cancer diagnosis. This would result in increased healthcare costs through additional workload, stress, time investment and medication costs for targeted EGFR and ALK therapy. Arguments regarding fine needle biopsies hindering biomarker detection have been disproven by already published data30-34 that illustrated small biopsies provided comparable tissue specimens to surgical resection when adequate gene amplification techniques, tumour enrichment strategies and exfoliative cytology are employed to help increase diagnostic tissue yield.

To optimise fine needle biopsies it will be beneficial to have a multidisciplinary team approach when deciding on initial biopsy method. The initial biopsy method should be the least invasive biopsy method that provides adequate tissue sampling. A pre- biopsy review of imaging to initiate adequate procedural planning, increasing the use of image guided biopsy methods to optimise tissue acquisition and receiving immediate rapid on site evaluation of tissue www.pacificejournals.com/apalm

specimens by a pathologist or cyto-techincian could improve tissue samples retrieved by the interventionist.

Strengths Of The Study: This study has investigated a small population of lung cancer patients in Greater Western Sydney and the proposed algorithm will be used within the same population. Such an individualized approach is a strength of this study. In addition, there is a paucity of evidence in this area from the Australian literature. Though this audit is small, it is Australian and contributes to the data regarding EGFR and ALK biomarker testing. It is my hope that this audit may assist with future studies to improve and guide tissue acquisition methods for efficient biomarker testing to enable timely targeted TKI therapy.

Limitations Of The Study: The obvious limitation is the small sample size. Furthermore, detailed analyses of the data was limited by missing patient information parameters.

For example, associations between patient factors and initial biopsy method were difficult to assess. The stage at which patients were diagnosed with NSCLC, the site of the biopsy specimen (primary or metastatic) and any previous cancer treatment were not noted. This information could have shed more light on the appropriateness of the biopsy method chosen for gene testing.

Future Directions: A larger study comparing the adequacy of fine needle biopsy and core biopsy tissue specimens for gene mutation testing should be considered at other cancer services to add to the data from the MCTC. The study should also endeavor to ascertain the quantity of tissue specimen and percentage tumour cellularity required for adequate diagnostic specimens. This information will help devise a diagnostic algorithm that will guide future biopsy practices at the MCTC and optimise gene testing for the local population of patients with NSCLC in the Greater Western Sydney region.

Conclusion

This audit suggests that surgical biopsy provides the most adequate tissue acquisition compared to fine and core biopsies respectively. Surgical biopsies are not always appropriate and this study suggests that fine needle biopsy provides a higher proportion of adequate tissue specimens compared to core biopsy. Using fine needle biopsy as the initial method of tissue acquisition reduces cost, time and eISSN: 2349-6983; pISSN: 2394-6466

A-132

Non-Small Cell Lung Cancer

procedural complications, whilst maintaining adequate tissue sampling. Further large scale trials in collaboration with pulmonologists, pathologists, oncologists (medical and radiation), radiologists and respiratory physicians needs to be undertaken to standardise and optimise tissue specimen collection, processing and reporting for biomarker testing at MCTC in order to complement the evolving transition towards personalised cancer therapy.

Acknowledgements

Sincere thanks to A/Professor Wendy Stevens for her generous support during the entire research process.

Funding

No Funding

Competing Interests

No competing interests declared

Reference:

1. Crino L, Weder W, van Meerbeeck J, Felip E. Early stage and locally advanced (non-metastatic) nonsmall-cell lung cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up.

Ann Oncol. 2010;103(21).

2. Government A. Lung Cancer Statistics. In: Australia C, editor. Sydney2013.

3. Reck M, Hermes A, Tan EH, Felip E, Klughammer B, Baselga J. Tissue sampling in lung cancer: a review in light of the MERIT experience. Lung Cancer.

2011;74(1):1-6.

4. Langer CJ. Individualized therapy for patients with nonsmall cell lung cancer: emerging trends and challenges.

Crit Rev OncolHematol. 2012;83(1):130-44.

5. Society AC. Non small cell lung cancer survival rates by stage. 2013 [updated 12/7/2013; cited 2013 1 October]; Available from: http://www.cancer.org/ cancer/lungcancer-non-smallcell/detailedguide/nonsmall-cell-lung-cancer-survival-rates.

6. Dacic. Molecular Testing of Lung Carcinoma.

Pathology Case Reviews. 2014;19(1):36-9.

7. Canberra AIoHaW. Lung Cancer in Australia- an overview. In: AIHW, editor. Canberra 2011.

8. Sakashita S, Sakashita M, Sound Tsao M. Genes and pathology of non-small cell lung carcinoma.

SeminOncol. 2014;41(1):28-39.

9. Travis WD, Brambilla E, Noguchi M, Nicholson AG, Geisinger KR, Yatabe Y, et al. International association for the study of lung cancer/american thoracic society/european respiratory society international multidisciplinary classification of lung adenocarcinoma. J ThoracOncol. 2011;6(2):244-85.

10. Lim EH, Zhang SL, Yu K, Nga ME, Ahmed DA, Agasthian T, et al. An alternative approach to determining therapeutic choices in advanced nonsmall cell lung carcinoma (NSCLC): maximizing the diagnostic procedure and the use of low-volume lung biopsies. J ThoracOncol. 2007;2(5):387-96.

11. Institute NC. Non-Small Cell Lung Cancer Treatment (PDQ). National Institue of Health; 2013 [updated 30/05/20132013 September 29]; Available from: http://www.cancer.gov/cancertopics/pdq/treatment/ non-small-cell-lung/healthprofessional/page1.

12. Janku F, Stewart DJ, Kurzrock R. Targeted therapy in non-small-cell lung cancer--is it becoming a reality?

Nat Rev ClinOncol. 2010;7(7):401-14.

13. Tsao MS. Molecular testing to personalise EGFR and ALK inhibitor therapies in lung cancer. American Association for Cancer Research.2014 15 January 2014.

14. Marchetti A, Ardizzoni A, Papotti M, Crinò L, Rossi G, Gridelli C, et al. Recommendations for the Analysis of ALK Gene Rearrangements in Nonâ&#x20AC;&#x201C;Small-Cell Lung Cancer: A Consensus of the Italian Association of Medical Oncology and the Italian Society of Pathology and Cytopathology. Journal of Thoracic Oncology.

2013;8(3):352-8 10.1097/JTO.0b013e31827d5280.

15. Reck M. A major step towards individualized therapy of lung cancer with gefitinib: the IPASS trial and beyond.

Expert Rev Anticancer Ther. 2010;10(6):955-65.

16. NIH. EGFR-TK mutation testing in adults with locally advanced or metastatic non small cell lung cancer. In: Excellence NIfHca, editor.: NICE; 2013.

17. Reungwetwattana T, Dy GK. Targeted therapies in development for non-small cell lung cancer: J Carcinog. 2013 Dec 31;12:22. eCollection 2013.

18. Hlinkova K, Babal P, Berzinec P, Majer I, MikleBarathova Z, Piackova B, et al. Evaluation of 2-year experience with EGFR mutation analysis of small diagnostic samples. DiagnMolPathol. 2013;22(2):70-5.

19. MSAC. MSAC Application document 1173: Final Decision Analytical Protocol(DAP) to guide the assessment of Epidermal Growth Factor Receptor (EGFR) gene mutation testing for eligibility for erlotinib treatment as a first-line therapy in patients with locally advanced or metastatic non-small cell lung cancer(NSCLC). In: Ageing DoHa, editor.2012.

20. Keedy VL, Temin S, Somerfield MR, Beasley MB, Johnson DH, McShane LM, et al. American Society of Clinical Oncology provisional clinical opinion: epidermal growth factor receptor (EGFR) Mutation testing for patients with advanced non-small-cell lung

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Dean et al.

A-133

cancer considering first-line EGFR tyrosine kinase inhibitor therapy. J ClinOncol. 2011;29(15):2121-7.

21. Vansteenkiste J, De Ruysscher D, Eberhardt WE, Lim E, Senan S, Felip E, et al. Early and locally advanced non-small-cell lung cancer (NSCLC): ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol. 2013;16:16.

22. Lindeman NI, Cagle PT, Beasley MB, Chitale DA, Dacic S, Giaccone G, et al. Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: guideline from the College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. J ThoracOncol. 2013;8(7):823-59.

23. Ellison G, Zhu G, Moulis A, Dearden S, Speake G, McCormack R. EGFR mutation testing in lung cancer: a review of available methods and their use for analysis of tumour tissue and cytology samples. J ClinPathol.

2013;66(2):79-89.

24. Lindeman NI CP, Beasley MB et al. Molecular testing guidelines for slection of lung cancer patients for EGFR and ALK Tyrosine Kinase Inhibitors: Guidelines from the College of American Pathologists (CAP), International Association for the Study of Lung Cancer (IASLC), Association for Molecular Pathology (AMP). Arch Pathol Lab Med.

27. G K. Challenges in NSCLC testing- Barriers to implementation2012; 11(4): Available from: http:// www.oncologyex.com/pdf/vol11_no4/comment_ nsclc-molecular-testing.pdf.

28. Pirker R, Herth FJF, Kerr KM, Filipits M, Taron M, Gandara D, et al. Consensus for EGFR Mutation Testing in Non-small Cell Lung Cancer: Results from a European Workshop. Journal of Thoracic Oncology.

2010;5(10):1706-13 10.097/JTO.0b013e3181f1c8de.

29. Sun MH, Yang F, Shen L, Zhang L, Chen Y, Cai X, et al. [Detection of epidermal growth factor receptor mutations in non-small-cell lung carcinoma by direct sequencing and correlations with clinicopathological characteristics and sample types]. Zhonghua Bing Li XueZaZhi. 2011;40(10):655-9.

30. Ma ES, Ng WK, Wong CL. EGFR gene mutation study in cytology specimens. ActaCytol. 2012;56(6):661-8.

31. B S. Core needle lung biopsy specimens:adequacy for EGFR and KRAS mutational analysis. Amerian journal of roentgenology. 2010 01/2010;194(1):266-9.

32. Smouse J CD, Edmund S, Janne P, Joshi V, Zou K, Lindeman N. EGFR mutations are detected comparably in cytological and surgical pathology specimens of nonsmall cell lung cancer. Cancer Cytopathology.

2009 2009;117(1):67-72.

25. Fassina A, Cappellesso R, Simonato F, Lanza C, Marzari A, Fassan M. Fine needle aspiration of non-small cell lung cancer: current state and future perspective. Cytopathology. 2012;23(4):213-9.

33. Hagiwara K, Kobayashi K. Importance of the cytological samples for the epidermal growth factor receptor gene mutation test for non-small cell lung cancer. Cancer Science. 2013;104(3):291-7.

26. Sekhon HS, Souza CA, Gomes MM. Advances in cytopathology for lung cancer: the impact and challenges of new technologies. ThoracSurgClin.

2013;23(2):163-78.

34. Thunnissen E, Bubendorf L, Dietel M, Elmberger G, Kerr K, Lopez-Rios F, et al. EML4-ALK testing in non-small cell carcinomas of the lung: a review with recommendations. Virchows Arch. 2012;461(3):245-57.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Original Article A Hospital Based Study Of Hb Variant and Beta Thalassaemia Mutational Pattern Characterization Among the People of Northeast Region of India Monalisha Saikia Borah1, Prasanta Kumar Bhattacharya2*, Mauchumi Saikia Pathak3 and Dulal Kalita4 Department of Biochemistry, Gauhati Medical College & Hospital, Guwahati, Assam, India Department of General Medicine, North Eastern Indira Gandhi Regional Institute of Health and Medical Sciences, Shillong, Meghalaya, India 3 Department of Biochemistry, Silchar Medical College & Hospital, Silchar, Assam, India 4 Department of Paediatrics, Gauhati Medical College & Hospital, Guwahati, Assam, India 1

2

Keywords: Haemoglobinopathies, Thalassaemia, Hb Variants, HPLC, ARMS-PCR, Beta Thalassaemia Mutation.

ABSTRACT Background: Haemoglobinopathies and thalassaemia are the most common genetic disorders prevalent worldwide. In North East India, Hb E, β- thalassaemia, Hb S and Compound HbE-β thalassaemia are the most prevalent Hb variants.

Aim:Detection of Hb variants are done by High Performance Liquid Chromatography (HPLC) based Haemoglobin testing system. The beta thalassaemia mutation is being analyzed here to get first hand information on the type of beta thalassaemia mutation prevailing among the population of Northeast region of India.

Methods: The Hb variants were identified by HPLC based method and the beta thalassaemia mutations namely IVS 1-5 (G->C), IVS 1-1 (G->A), IVS 1-1 (G-T), Codon 8/9 and Codon 41/42 were characterized by ARMS-PCR. Results: Among the 460 cases referred for Hb variant diagnosis, 313 (68.04%) were positive for Haemoglobinopathies or thalassaemias and the rest 147 (31.96%) did not have any type of haemoglobinopathies or thalassaemia. Total 149 cases were having either beta thalassaemia major, beta thalassaemia minor or compound heterozygous with beta thalassaemia. The mutational patterns were identified, in 105 samples (70.469%) and in the rest 44 samples (29.53%) the mutational patterns remained uncharacterized. Among the 105 samples, 63.09% were positive for IVS 1-5 (G->C) mutation and 7.38% were positive with Codon 41/42 mutation.

Conclusion: This preliminary information regarding the Hb variants occurrence and mutational pattern is important for establishing prenatal diagnosis programmes. The results showed that, Haemoglobinopathies and thalassaemia are common among the people of North east region of India and need counseling and awareness programme to reduce the risk of occurrence of this genetic disorder.

*Corresponding author: Dr. Prasanta Kumar Bhattacharya, Professor and Head, Department of General Medicine, North Eastern Indira Gandhi Regional Institute of Health and Medical Sciences (NEIGRIHMS), Shillong-793018, Meghalaya, India Email: pkbdr78@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Borah et al.

Introduction

Haemoglobinopathies and thalassaemia are the most common haematological genetic disorders.

Haemoglobinopathies are characterized by the production of structurally defective haemoglobin because of abnormalities in the formation of the globin moiety and thalassaemias are characterized by a reduced rate of normal haemoglobin due to decreased synthesis or absent of synthesis of the globin polypeptide chains. [1] With variable geographic distribution, haemoglobinopathies are the worldwide prevalent monogenic disorders.[2] In Southeast Asia and the Indian subcontinent, this has been considered as common disorders of blood posing a major genetic and public health problem.[3] Thalassaemia has been recognized by the World Health Organization as an important inherited disorder which has an impact mainly on the populations of low income countries. The prevalence of variant haemoglobins varies considerably with geographic location and racial group. Four haemoglobin variants, Hb S, Hb C, Hb E, and Hb D each affects millions worldwide and they represent a major public health problem in many areas of the world including South East Asia. The structural alterations, referred in case of Haemoglobinopathies, are mostly due to the substitution of amino acid.[4] Haemoglobin E trait is the third most common haemoglobin disorder in the world and the most frequent in Southeast Asia, where its prevalence is estimated to be 30%. Although Haemoglobin E trait is associated with no morbidity, the offspring of individuals who carry this haemoglobin variant may exhibit haemoglobin E- β-thalassaemia if the other parent has β-thalassaemia trait and contributes that gene. This combination is the most common cause of transfusion-dependent thalassaemia in areas of Southeast Asia.[5] A high incidence of haemoglobinopathies and thalassaemias are encountered and their combination is unique for the northeast region of India. In upper Assam of Northeast India, there is a high rate of occurrence of these Haemoglobinopathies and thalassaemia.[6] The overall prevalence of β-thalassaemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassaemia trait in 59 ethnic groups varied from 0 to 9.3 %. Hb E trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of Hb E trait varied from 41.1 to 66.7 %. Few subjects with δβ- thalassaemia, HPFH, Hb S trait, Hb D trait, Hb E homozygous and Hb E β-thalassaemia as well as Hb S homozygous and Hb S-β-thalassaemia (<1 %) were also identified. [7] Haemoglobin E (Hb E) trait (15.42%) was the most common variant identified in rural community of Darjeeling district, West Bengal in an antenatal screening followed by the prevalence of homozygous Hb E, Hb E www.pacificejournals.com/apalm

A-135 beta thalassaemia, beta-thalassaemia trait and hemoglobin S-trait was 6.91%, 0.53%, 2.12% and 1.06% respectively with a rare single case of hemoglobin J Meerut.[8] Majority of β-thalassaemias are caused by point mutations.

[9] Studies on the molecular genetics of thalassaemia in various ethnic groups have shown that each group tends to have it is own set of common mutations. These mutations affect the gene expression by a variety of mechanisms.[10] More than 200 different β- thalassaemia mutations have been identified all over the world, and among them, about 28 mutations have been documented in Indian patients.

6 mutations, 619 bp deletion at 3’ end of β- globin gene, IVS 1-5 (G->C), IVS 1-1 (G-T), Codon 8/9 and Codon 41/42 and nonsense codon 15, account for 90-94% of the beta-mutations in India.[11] The IVS-1-5 mutation is the commonest mutation found in the Indian population and its prevalence (in homozygous state) varies from 22.8 to 81.4% in different regions of India, being the highest in Tamil Nadu in southeastern India. In the north-western part of India the 619 bp deletion mutation is the commonest beta-thalassaemia mutation observed in patients originating from Sindh, Gujarat or among the families migrated from Pakistan during partition of the country in 1947.[12] In India, mutations of codon 5 and codons 47/48 were found exclusively in migrants from Pakistan and mutation of codon 88 was detected only in subjects from Punjab, Haryana and Uttar Pradesh.[13] Seven β- thalassaemia mutations accounting for 89 % (71 of 80) of the alleles in Eastern Indian population have been identified and majority (67.5%) was due to IVS-1 mutation. [14] In South Western Maharashtra 93.66 % in 126 β-thalassaemia carrier subjects were either IVS I-5 (G–>C), IVS I-1 (G– >T), codon 8–9 (+G), codon 41/42 (–TCTT), Codon 15 (G–>A), and 619 bp and 6.34 % remained uncharacterized.

65.07 % showed the most common type of mutation, IVS I-5 (G–>C), followed by IVS I-1 (G–>T) showed by 9.52 % subjects. 2.38 % subjects showed 619 bp deletion, codon 8/9 (+G) and codon 15 (G–>A) mutations were present in 6.34% each. Only 3.96 % subjects showed codon 41/42 (–TCTT).[15]

Materials and Methods

Ethical Clearance was obtained from the Institutional Ethics Committee for this hospital based study.

The blood samples were collected from anaemic subjects attending / admitted to Gauhati Medical College and Hospital, who were suspected of having variant haemoglobin after clinical observation or from subjects who were already diagnosed with Hb variants but who were free of blood transfusion or blood transfusion not given within a period of 3 months. The Gauhati Medical eISSN: 2349-6983; pISSN: 2394-6466

A-136

A Hospital Based Study of Hb...

College & Hospital of Assam is one of the largest tertiary care hospital of Northeast region of India and many patients from all the neighbouring states of Assam comes here for medical treatment. A total of 460 cases from different regions of Northeast Indian populations were screened for Haemoglobinopathies and thalassaemia within a period of 2 years. Clinical and family history was recorded in a Proforma and the blood samples were collected after taking written Informed Consent. In case of minor the parents/ guardians were asked to sign the consent form.

About 2.5 ml of venous blood was collected in vaccutainer coated with Ethylene Diamine Tetra acetic acid (EDTA) as an anticoagulant. The blood samples were analyzed for Complete blood count (CBC) using the automated haematology analyzer (pocH-100i, Sysmex Corporation, Kobe Japan),[16] within 24 hours of blood collection. On the same day itself the blood samples were screened for Haemoglobinopathies and thalassaemia and the characterization of the samples along with quantification of the different Hb components, i.e. Hb A, Hb A2, Hb A2/E, Hb F, etc were done by the fully automated ion exchange high performance liquid chromatography (HPLC) based Haemoglobin Testing System (D-10,Bio Rad, USA).[17] The samples which were positive for beta thalassaemia major or minor or samples which were positive for Compound Hb E –beta thalassaemia and Compound Sbeta thalassaemia, those samples were stored in -20oC freezer for molecular analysis.

The genomic DNA was isolated using Column based genomic DNA extraction kits.

ARMS-PCR (Amplification Refractory Mutation System Polymerase Chain Reaction) was done to identify the beta thalassaemia mutation pattern among the five studied mutations viz. IVS1-5 (G->C), IVS1-1 (G->T), CD8/9, CD 41/42 (-TCTT) and IVS 1-1(G->A). Primer sets which were selected for ARMS analysis of mutations for beta thalassaemia are shown in Table 1 and 2. [18,19] For all ARMS-PCR reactions Primer C:5--CAA TGT ATC ATG CCT CTT TGC ACC -3- and Primer D:5--GAG TCA AGG CTG AGA GAT GCA GGA- 3’ was used as an internal control which yield a product size of 861 bp.

Optimization of ARMS –PCR reaction was accomplished after several trials. A 25μl PCR reaction mix was prepared by adding Deionized water, 10X buffer containing 15mM MgCl2, dNTPs, Internal Control Primers (Forward & Reverse), Mutant or Normal Primer, Common reverse primer for Mutant or Normal, Taq DNA Polymerase and the DNA sample.

To detect the mutations, ARMS-PCR programme was adopted according to Varawalla et.al., 1991, with some modifications. Amplification is done with 1 cycle Initial denaturation at 93 oC for 5 mins, 25 cycles each of denaturation at 93oC for 1 minute and annealing at 66oC for 2 mins, 1 cycle each of extension at 66oC for 3 minutes and final extension at 72oC for 5 minutes and finally a 10oC as holding temperature.

Table 1: Primer sequences used for the detection of the common beta thalassaemia mutations by ARMS – PCR.[18, 19] MUTATION

OLIGONUCLEOTIDE SEQUENCE

SECOND PRIMER

PRODUCT SIZE (BASE PAIR)

IVS1-5 (G->C)

CTCCTTAAACCTGTCTTGTAACCTTGTTAG

B

285

IVSI-1 (G->T)

TTAAACCTGTCTTGTAACCTTGATACGAAA

B

281

Cd 8/9 (+G)

CCTTGCCCCACAGGGCAGTAACGGCACACC

B

225

Cd 41/42 (-TCTT)

GAGTGGACAGATCCCCAAAGGACTCAACCT

B

439

IVSI-1 (G->A)

TTAAACCTGTCTTGTAACCTTGATACCGAT

B

281

*Note: Sequence of Primer B: ACCTCACCCTGTGGAGCCAC

Table 2: Primer sequences used for the detection of the normal DNA sequences by ARMS –PCR.[18, 19] MUTATION

OLIGONUCLEOTIDE SEQUENCE

SECOND PRIMER

PRODUCT SIZE (BASE PAIR)

IVS1-5 (G->C)

CTCCTTAAACCTGTCTTGTAACCTTGTTAC

B

285

IVSI-1 (G->T)

GATGAAGTTGGTGGTGAGGCCCTGGGTAGG

A

455

Cd 8/9 (+G)

CCTTGCCCCACAGGGCAGTAACGGCACACT

B

225

Cd 41/42(-TCTT)

GAGTGGACAGATCCCCAAAGGACTCAAAGA

B

439

IVSI-1 (G->A)

TTAAACCTGTCTTGTAACCTTGATACCCAC

B

281

*Note: Sequence of Primer A: CCCCTTCCTATGACATGAACTTAA Sequence of Primer B: ACCTCACCCTGTGGAGCCAC

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Borah et al.

A-137

The ARMS-PCR products and the ladder marker are resolved by electrophoresis. DNA bands are visualized using Gel Documentation system and the pattern of bands obtained on the gel are observed by comparing both the mutant and normal set according to the product size with that of the DNA ladder to detect the mutations accordingly.

The data generated from the study after investigations were computed and analyzed using Microsoft Excel.

Results

Information available for individual samples after HPLC indicates that out of the total 460 subjects, 313 (68.04%) were positive for Haemoglobinopathies or thalassaemias and the rest 147 (31.96%) did not have any type of haemoglobinopathies or thalassaemia. The occurrence of the different type of Hb variants in the study group were Hb E heterozygous (110, 23.9%); Hb E homozygous (32, 6.9%); Beta thalassaemia minor (101, 21.9%); Beta thalassaemia major (10, 2.7%), Compound Hb E- beta thalassaemia (37, 8.04%); Hb S trait (14, 3.04%); Hb S disease (8, 1.7%)and Compound Hb S- beta thalassaemia (1, 0.22%) and No Haemoglobinopathies or thalassaemia(147, 31.96%) (Figure 1: Bar Diagram Showing Occurrence of Haemoglobinopathies and Thalassaemia).

Molecular study was carried out in the samples which were positive for beta thalassaemia minor, beta thalassaemia major, Compound Hb E- beta thalassaemia and Compound Hb S- beta thalassaemia. Molecular analysis revealed that out of the 149 beta thalassaemia cases studied for mutational pattern, IVS 1-5 (G->C) was the most common mutation identified among them.

Fig. 1: Bar Diagram Showing Occurrence Haemoglobinopathies and Thalassaemia

www.pacificejournals.com/apalm

of

In all successful ARMS-PCR reactions, the internal control product of 861 bp molecular weight was observed, which was considered as a mandatory sign of successful reaction upon gel electrophoresis of the amplified products. So out of the 149 cases studied for beta thalassaemia mutational pattern, in 105 samples (70.469%), the mutational patterns were identified. Among which 63.09% were positive for IVS 1-5 (G->C) mutation [Figure 2] and 7.38% were positive with Codon 41/42 mutation [Figure 3]. In the rest 44 samples (29.53%) the mutational pattern remained uncharacterized. The results showed that, IVS 1-5 (G>C) mutations is the most frequent mutation compared with other mutations studied among the beta thalassaemic samples of this Northeast region of India.

Fig. 2: Gel picture showing Thalassaemia Mutation

IVS

1-5

G->C

Beta

Fig. 3: Gel Picture Showing Sample Positive For Cd 41/42 Beta Thalassaemia Mutation

eISSN: 2349-6983; pISSN: 2394-6466

A-138

A Hospital Based Study of Hb...

Discussion

The haemoglobinopathies and thalassaemia are genetic disorders and are prevalent worldwide. The most frequently observed haemoglobin variants in different parts of the world are Hb E, Hb S, Hb D, Hb C etc.

Haemoglobin E is one of the most common haemoglobin variant prevalent especially in the South East Asian countries. The Northeast region of India along with Assam is a hot-spot zone for homozygous and heterozygous Hb E. Also Hb S, Compound Hb E- beta thalassaemia and beta thalassaemia is encountered among the people of Northeast region of India.

In this study, the molecular basis of beta thalassaemia have been investigated among individuals from the Northeast region of India and 2 different β- thalassaemia mutations among the five studied were detected in 70.47% of the individuals investigated. Out of the studied cases, the IVS 1-5 (G->C) was the most common beta thalassaemia mutation encountered among the investigated individuals accounting for 63.089% and the beta thalassaemia mutation Codon 41/42 was detected in 7.38% of the individuals.

The study correlates with previous study by Varawalla et.al.,[19] where the most common mutation identified among Asian Indians were IVS 1-5 (G->C). Also in that study the prevalence rate of IVS 1-5 (G->C) mutation and codon 41/42 mutation encountered in individuals from Bangladesh and Bengal were 60% and 20% respectively which are the neighbouring region of the Northeast India and in this study also the mutations IVS 1-5 (G->C) and codon 41/42 mutations detected in the study group are 63.089% and 7.38% respectively which slightly coincides with the previous study of Varawallla et.al., (1991).

According to a study by Panigrahi I., et.al.,[20] IVS 1-5 (G>C) is the most common mutation in the Indian population and in the Eastern region of India a high frequency of IVS 1-5 (G->C) ( 72%) is being reported followed by 11% prevalence of codon 41/42 mutation. Sinha S. et.al.,[21] studied the β- thalassaemia mutations in India at state and regional levels and reported that the prevalence of IVS 1-5 (G->C) varied from 44.8% in the North to 71.4% in the East region of India and in the study the alleles from Northeast region (n=461) were included in the all India analysis where the prevalence rate of IVS 1-5 (G->C) was recorded to be 54.7 % and codon 41/42 prevalence rate was recorded as 6.1%. This present study on beta thalassaemia mutation patterns is relevant with the other beta thalassaemia profiling studies which were conducted by other researchers.

Verma I.C. et.al.,[13] characterized the mutations in the betathalassaemia gene and analyzed their regional distribution

in Indi a and found out that among the Indians who were not migrant from Pakistan, the predominant mutation was IVS 1-5 (G->C), varying from 85% in the southern states and 66-70% in the eastern states to 47- 60% in the northern states. Mutations at codon 8/9 and codon 41/42 were distributed in all regions of India with frequency varying from 3% to 15% and the pattern of the mutations identified is similar with the findings of this research work.

Vaz F.E.E. et.al.,[22] analyzed beta thalassaemia mutations among the Indian population referred to their diagnostic centre, by ARMS PCR and the state- wide and communitywide distribution patterns of mutations indicated that IVS 1-5 (G->C) is the most common beta thalassaemia allele in the Indian population. Comparatively, in this research work also the most common beta thalassaemia mutation identified is IVS 1-5 (G->C) among the individuals of Northeast India.

On the other hand, codon 8/9, IVS1-1 (G->A) and IVS 1-1 (G->T) mutations were not found in all the beta thalassaemic samples investigated in this study. However, this does not means that these mutations were not present in Northeast Indian individuals, taken into consideration the small number of samples which, of course, were not presenting the real number of the thalassaemic patients in Northeast India. Moreover, the results showed that, IVS1-5 (G->C) and codon 41/42 mutations were the higher frequent compared with other mutations studied in the thalassaemic samples.

Conclusion

The study revealed that, haemoglobinopathies and thalassaemiais widespread among the people of the Northeast region of India. Identification of mutational pattern among the five beta thalassaemia mutations IV1-5 (G->C), Codon 41/42, IVS 1-1(G->T), IVS1-1(G->A) and Codon 8/9 were done and the molecular analysis revealed that out of the 149 beta thalassaemia cases studied for mutational pattern, IVS 1-5 (G->C) mutations is the most frequent mutation compared with other mutations studied among the beta thalassaemic samples of this Northeast region of India.

The mutations codon 8/9, IVS1-1 (G->A) and IVS 1-1 (G->T) were not found in the beta thalassaemic samples investigated in this study. However, this does not implies that these mutations were not present in Northeast Indian individuals, because the number of samples in this study was small, which, of course, were not presenting the real number of the thalassaemic patients in Northeast India.

More extensive study is required to determine the exact prevalence rate of the mutational pattern.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Borah et al.

It may be concluded that in this region of the country, the rate of occurrence of these genetic disease is high.

Northeast region of India is a hotspot zone for the variant Hb E. The occurrence of this inherited disease can be curbed by implementing awareness programs, by imparting genetic counseling, by carrier screening, and by screening high risk couples of beta thalassaemia. Reduction of the rate of occurrence of such genetic disease is very much important because patients with genetic disease like beta thalassaemia major are burden for the family and society.

Properly designed community- based studies are required as a health priority to curb genetic diseases. Mutation patters of different communities may help in the quick identification of beta thalassaemia mutations for prenatal diagnosis.

Molecular analysis like profiling of the beta thalassaemia mutations at state and at regional levels are very much necessary for genetic education, screening and for genetic counseling. Mutational pattern study may help in successfully establishing a program of genetic counseling and may help in prenatal diagnosis of beta thalassaemia in order to reduce the burden of this disease in the society.

Acknowledgements

The authors are thankful to Department of Biotechnology (DBT), Ministry of Science & Technology, Government of India for the financial support.

Competing Interests

There is no competing interest.

Funding Source DBT, Govt. of India

References

1. Das R. Disorders of Haemoglobin Structure and Synthesis. In: Saxena R, Pati HR, Mahapatra M, editors. deGruchy’s Clinical Haematology in Medical Practice, 6thed. Wiley India Pvt. Ltd.; 2013. 120-145.

2. Krafft A, Breymann C. Haemoglobinopathy in Pregnancy: Diagnosis and Treatment. Current Medicinal Chemistry. 2004; 11 (21):2903-2909.

3. Fucharoen S, Winichagoon P. Haemoglobinopathies in Southeast Asia: molecular biology and clinical medicine. Haemoglobin. 1997; 21: 299-319.

4. Lukens JN. The abnormal hemoglobins: General Principles. In Lee GR, Foerster J, Lukens JN, Paraskevas F, Greer JP and Rodgera GM editors.

Wintrobe’s Clinical Hematology, 10th ed.Maryland, USA: William & Wilkins publisher; 1999. 1329-1345. www.pacificejournals.com/apalm

A-139 5. Goldbloom RB. Screening for Haemoglobinopathies in Canada. In: Canadian Task Force on the Periodic Health Examination. Canadian Guide to Clinical Preventive Health Care. Ottawa: Health Canada.

6. Baruah MK, Saikia M, Baruah A. Pattern of hemoglobinopathies and thalassemias in upper Assam region of North Eastern India- High performance liquid chromatography studies in 9000 patients. Indian J PatholMicrobiol.2014;57:236-43.

7. Mohanty D, Colah RB, Gorakshakar AC, et.al.

Prevalence of beta thalassaemia and other Haemoglobinopathies in six cities in India- a multi centre study. J. Community Genetic. 2013; 4: 33-42.

8. Ghosh N, Chakrabarti I, Chakraborty M, Goswami BK. A community based pilot study on prevalence of haemoglobinopathies among the antenatal women in a rural area of Darjeeling district, West Bengal. Int J Med Public Health. 2013; 3:107-10.

9. Rund D, Rachmilewitz E. Beta-thalassemia. New Eng. J. Med. 2005; 353(11): 1135-46.

10. Owen TM, Chan KD, Dietz L, Zehnder JL, Schrijver I. Comprehensive and Efficient HBB Mutation Analysis for Detection of Hemoglobinopathies in a Pan-Ethnic Population. Am J ClinPathol. 2010; 133:700-707.

11. Balgir RS. The Burden of haemoglobinopatheies in India and the challenges ahead. Current Science.

2010; 79 (11): 1536-1547.

12. Grow K, Vashist M, Abrol P, Sharma S, Yadav R. Beta thalassaemia in India- current status and the challenges ahead. International Journal of Pharmacy and Pharmaceutical Sciences. 2014; 6(4): 28-33.

13. Verma IC, Saxena R, Thomas E, Jain PK. Regional distribution of beta thalassaemia mutations in India.

Human Genetics. 1997; 100 (1): 109-13.

14. Dastidar DG, Dutta RN, Gupta P, Old JM. Detection of beta thalassaemia mutation in eastern Indian population by polymerase chain reaction. Indian J Med Res. 1994; 100: 111-114.

15. Satpute SB, Bankar MP, Momin AA. The prevalence of β-thalassaemia mutations in south western Maharashtra. Indian Journal of Clinical Biochemistry.

2012; 27(4); 389-393.

16. Instruction Manual.pocH-100i, SYSMEX Corporation, Kobe, Japan, Asia Pacific Edition B. 17. Instruction Manual. D-10 Dual Program, Bio-Rad Laboratories, United States. eISSN: 2349-6983; pISSN: 2394-6466

A-140

A Hospital Based Study of Hb...

18. Ithanet Electronic Infrastructure for Thalassaemia Research Network. Protocol for Amplification Refractory Mutation System (ARMS). Available from http://portal.ithanet.eu.

19. Varawalla NY, Old JM, Sarkar R, Venkatesan R, Weatherall DJ. The spectrum of beta thalassaemia mutations on the Indian subcontinent- the basis for prenatal diagnosis. Br.J. Hematol. 1991; 78:242-247.

20. Panigrahi I, Marwaha RK. Mutational spectrum of thalassaemias in India. Indian Journal of Human Genetics. 2007; 13(1): 36-37.

21. Sinha S, Black ML, Agarwal S, Colah R. et. al.

Profiling beta thalassaemia mutations in India at state and regional levels- implications for genetic education, screening and counseling programmes. The HUGO Journal.2009; 3:51-62.

22. Vaz FEE, Mahadik CBT, Banerjee MK, Gangal SG. Distribution of beta thalassaemia mutations in Indian population referred to a diagnostic center. Hemoglobin.

2000, 24(3): 184-194.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Evaluation and Correlation of Clinical, Histopathological and Direct Immunofluorescence Findings in Vesicobullous Disorders of Skin: A Cross Sectional Study with Review of Literature Geetika Sharma1*, Shilpi Agarwal1 and Ram Chander2 Department of Pathology, Lady Hardinge Medical College & Hospital, New Delhi, India Department of Dermatology and STD, Lady Hardinge Medical College & Hospital, New Delhi, India 1

2

Keywords: Direct Immunofluorescence, Vesicobullous Disorders, Skin.

ABSTRACT Background: To assess and correlate the clinical, histopathological and DIF features and compare the sensitivity of DIF with that of histopathology in autoimmune bullous disorders of skin.

Methods: A cross-sectional descriptive hospital based study was conducted on 45 patients who had active vesicobullous lesions. After a detailed cutaneous examination, two punch biopsies were taken, one from lesional skin for histopathological study and another from perilesional skin for DIF. Biopsies from 31 patients were deemed fit to be included in the study.

Result: Based on clinical, histopathological and DIF findings the most common final diagnosis was Pemphigus Vulgaris (PV), 18/31 cases. On histopathology, characteristic histopathological features were seen in 15/18 cases of PV, 6/11 cases of Pemphigus Foliaceous (PF), 3/4 cases of Bullous Pemphigoid (BP) and a single case of Dermatitis Herpitiformis (DH) while 4/31 cases showed non specific findings (NS). DIF was positive in 30/31 cases (96.77%) except in a single case of DH. Good clinicoâ&#x20AC;&#x201C;histo-immunological correlation was seen in 21/31 cases (67.7%). In 25/31 cases (80.06%) good histo-immunological correlation (p < 0.05; significant) was observed while 6/31 cases (19.3%) showed discordance between histological and DIF findings. The senstivity of the histopathology in the pemphigus group (PV + PF + Paraneoplastic Pemphigus), BP and DH was 88%, 75% and 100% respectively while on DIF it was 100% for the pemphigus group and BP. Single case of DH was negative on DIF. Conclusion: As compared to histopathology, DIF has better sensitivity and it is an indispensible tool especially in vesicobullous skin lesions that are difficult to diagnose on the basis of clinical and histopathological features.

*Corresponding author: Dr. Geetika Sharma, House number 362, Sector 8, Panchkula, Haryana, India, Pincode -134109 Phone : +919560835225, +919013952791 Email: aqua.gs2009@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-142

Direct Immunofluorescence in Skin

Introduction

Autoimmune bullous disorders are a heterogeneous group of diseases in which components of the epidermis and basement membrane zone (BMZ) are the focus of attack.

[1] Their accurate diagnosis requires detailed clinical examination, histopathological evaluation followed by direct immunofluorescence study (DIF). [2] DIF plays an essential role in the diagnosis, classification and treatment of various immunobullous disorders as it shows distinct immunofluorescence patterns. [3] Patients in clinical remission with positive DIF findings show early relapse of disease which also emphasizes the role of DIF in prognosticating and monitoring of disease activity. [1,4,5] Thus, DIF is considered gold standard for the diagnosis of autoimmune bullous disorders, specially in patients with clinical and/or histopathological dilemma. [4,6,7,8] However, in developing countries like India, DIF is done only in the few centers due to its high cost, requirement of technical skill and difficulty in maintaining the facility.

Therefore, this study was undertaken to assess and correlate the clinical, histopathological and DIF features of various vesicobullous diseases of the skin and compare the sensitivity of DIF with that of histopathology.

Materials and Methods

A cross-sectional descriptive hospital based study was conducted on 45 patients attending the Departments of Dermatology and Pathology, Lady Hardinge Medical College and associated Hospitals, New Delhi over a period of 2 years who were clinically diagnosed with active vesicobullous diseases, irrespective of age and sex.

Patients with no active lesions and on systemic steroids/ immunosuppressive therapy for the last three months were excluded from the study.

In all the patients, two punch biopsies from skin were taken. Biopsy for histopathological examination was taken from the lesional skin, put in 10% neutral formalin solution and stained with haematoxyline and eosin.

On histopathological examination the lesions were categorized based on: 





Site of blister separation plane (Subcorneal/granular, Intraepidermal/spinous, Suprabasal, Subepidermal) Nature of inflammatory infiltrate (Neutrophil, Eosinophil, Lymphocytes & Mast cells) within the bulla cavity Presence/Absence of acantholytic cells within the bulla cavity

Another biopsy for DIF was taken from the perilesional skin (i.e. 3-4 mm punch biopsy from clinically normal

appearing skin within 2 cm from the lesion except from hands, feet, neck, groin and mucous membrane), put in Michel’s medium and kept at -70 °C to -20°C until cut.

Before cutting, the biopsy for DIF was washed thrice in phosphate–buffered saline (PBS) at pH 7.2 for 15 minutes each and was embedded in OCT in cryostat and 4-6 micron sections were obtained on poly–L-Lysine slides at -20°C to -25°C (minimum of six sections per biopsy). For DIF staining, sections were brought at room temperature after rinsing thrice with PBS for 10 min each and five frozen sections of each biopsy were overlaid with 40-50 µl each of optimally diluted fluorescein isothiocyanate (FITC) conjugated monoclonal anti human antisera (IgG, IgA, IgM, C3 and fibrinogen, supplied by Diagnostic biosystems) and sixth section with PBS (Control) for at least 1 hour. After washing the sections again thrice in PBS they were mounted with Buffered glycerin mountant and finally examined under NIKON fluorescence microscope fitted with an ultraviolet lamp source, under ideal citation and barrier filter combination. 





On DIF examination the following parameters were evaluated: Site of deposition of immunoreactants (Epidermis/ BMZ/Dermis) Pattern of Immunofluorescence (Linear/Granular/ both) Intensity of fluorescence (graded as“+++”: Strongly positive, “++”: Moderately positive, “+”: Weakly positive and “-”: Negative)

Result

Among the 45 vesicobullous skin biopsies received, 14 biopsies were excluded from the study. Amongst these 14 biopsies, 8 biopsies without epidermis were inadequate for opinion, 4 biopsy samples were dried up & in 2 biopsies, patients were later found to be on steroids. Finally in the 31 cases studied, the most common age group was 4th – 5thdecade (29.03%) with M:F ratio of 0.82:1.

Single definitive clinical diagnosis given in 24/31 cases (77.4%) were: PV(13/31), PF(6/31), BP(3/31), PNP(1/31) & DH(1/31) which were consistent with the final diagnosis after histopathology and DIF findings. In 7/31 (22.5%) cases, differential clinical diagnosis were considered .

Definitive histopathological diagnoses were made in 27/31 cases (87.1%) while, 4/31 (12.9%) cases showed non-specific findings on histopathology. DIF positivity was seen in 30/31 cases (96.77%). Based on clinical, histopathological and DIF findings the most common final diagnosis was PV 18/31cases (58.06%). (Table 1) In 18 clinically diagnosed cases of PV, females were affected twice more commonly than males. The most common

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Sharma et al. site of involvement was face in 15/18 cases (83.3%) with 12/18 cases (66.6%) showing oral involvement. The most common cutaneous lesion was “Flaccid normal”-15/18 cases (83.3%). On histopathology, 16 cases showed histopathological features of PV with presence of suprabasal bulla with characteristic tomb stone appearance and acantholytic cells which on DIF examination showed strong positivity for IgG+++ at Intercellular substance (ICS) with lace like Network Continuous pattern (NC) in the lower part of the epidermis with 4 cases showing additional weak C3 +. Two cases which showed nonspecific findings on histopathology i.e. (superficial, dermal, perivascular and perineural mixed inflammatory infiltrate) on DIF examination, showed strong positivity for IgG+++ at Intercellular substance (ICS) with lace like Network Continuous pattern and hence diagnosed as PV. (Table 1&2 ; Figure1) In 11 clinically diagnosed cases of PF, slight male preponderance was seen. The abdomen and back were involved in 100% of the cases however no oral invovement was seen. The most common cutaneous lesion was “Flaccid erythematous” (6/7 cases: 85.71%).

On histopathology, only 6 cases showed characteristic histopathological features of PF i.e. subcorneal bullae with presence of acantholytic cells which on further, DIF examination showed ICS IgG +++ predominantly in the upper part of the epidermis.Three cases were diagnosed as PV both on histopathology as well as on DIF study.

Two cases which showed non–specific findings on histopathology ,on DIF examination showed IgG +++ ICS lace like Network Continuous pattern in upper and lower epidermis and hence diagnosed as PF and PV respectively.

(Table 1&2 ; Figure 2) Among 4 clinically suspected cases of BP, males were more commonly affected than females. All the cases showed involvement of upper extremities with oral lesions seen in ¼ cases (25%). The most common cutaneous lesion was “Tense Erythematous” (3/4 cases: 75%). On histopathology, only 3 showed definitive histopathogical features of BP characterized by presence of subepidemal bulla with presence of acantolytic cells and eosinophils which on DIF examination showed continous homogenous linear (CHL) IgG +++ & C3 ++ at basement membrane zone (BMZ). Single case showed non-specific findings on histopathology which had IgG+++ & C3 +++ on DIF examination , hence diagnosed as BP. (Table 1&2 ; Figure 3a&b)

A-143 leukemia, in addition to oral lesions showed involvement of upper and lower extremity and was diagnosed as erythema multiforme (EM) on histopathology. On further DIF examination IgG +++ & C3 ++ deposition was seen at both ICS and BMZ with network continuous and continuous homogenous pattern and was confirmed as EM like variant of PNP. (Table 1&2 ; Figure 4a&b) Another single female patient, clinically suspected to be having dermatitis herpetiformis with involvement of upper & lower extremities and scalp was concordant with the histopathological findings but DIF examination was negative. (Table 1,2) In 21/31 cases (67.7%) good clinico–immunohistopathological correlation was seen while ten cases i.e. 10/31 (32.25%) showed clinico-histo-immunological discordance. (Table 3) .In 25/31 cases (80.06%) good histo-immunological correlation (p <0.05significant) was observed while six out of 31 cases (6/31) i.e. 19.3% showed discordance between histological and DIF findings

Discussion

DIF is a robust tool for a proper diagnostic labeling of all vesicobullous lesions of the skin. The comparative findings of the previous studies on immunobullous lesions by various authors as compared to our present study are tabulated as follows: (Table 4,5) Single case of dermatitis herpitiformis was negative on DIF and these findings were concordant with Zone JJ et al [11] & Lourdes Sousa et al [12] who emphasized the normal appearing skin adjacent to the active lesion as the preferred biopsy site in DH as immunoreactants degrades in the lesional site due to inflammation giving rise to negative DIF. In 21/31 cases (67.7%) good clinico–immunohistopathological correlation was seen while ten cases i.e. 10/31 (32.25%) showed clinico-histo-immunological discordance. (Table 3) .In 25/31 cases (80.06%) good histo-immunological correlation (p <0.05significant) was observed while six out of 31 cases (6/31) i.e. 19.3% showed discordance between histological and DIF findings Clinico-histo-Immunoconcordance of present study was consistent with Walker Ranjana et al.

Single clinically suspected female patient of paraneoplastic pemphigus (PNP), a follow up case of chronic lymphocytic

The senstivity of histopathology in the pemphigus group (PV+PF+PNP), BP and DH was 88%,75% and 100% respectively while senstivity on the DIF was 100% in pemphigus group and BP. Single case of DH was negative on DIF. (TABLE 6)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-144

Direct Immunofluorescence in Skin

Table 1: Distribution of cases according to clinical diagnosis, gender, histopathological diagnosis, DIF findings and final diagnosis Clinical diagnosis

Bullous Disorders

Definitive

Differential

Male (%)

Female (%)

Histopathology Diagnosis

DIF Examinnation Positive cases

Immuno reactant

Site/ Pattern ICS/ lace like NC ICS/ lace like NC

Final Diagnosis (Frequency of cases &%)

Pemphigus 6 12 16-PV IgG (14) vulgaris 13 5 18 18 (58.06) (33.3) (66.6) 2-NS IgG+ C3 (4) (PV) Pemphigus 6- PF 9 2 foliaceous 6 5 3-PV 7 IgG (7) 7 (22.58) (81.8) (18.18) (PF) 2-NS Bullous 3 1 3 â&#x20AC;&#x201C; BP BMZ/ pemphigoid 3 1 4 IgG+ C3 (4) 4 (12.9) (75) (25) 1-NS CHL (BP) Paraneoplastic ICS/NC 1 Erythema pemphigus 1 0 0 1 IgG+ C3 + 1 (3.32) (100) multiforme (PNP) BMZ/ CHL Dermatitis 1 herpetiformis 1 0 0 DH Negative â&#x20AC;&#x201C; 1(3.23) (100) (DH) [ PV- Pemphigus vulgaris, PF- Pemphigus foliaceous, BP- Bullous pemphigoid, PNP- Paraneoplastic pemphigus, DH- Dermatitis herpetiformis, NS- Nonspecific findings, ICS- Intercellular substance, NC- Network continuous, BMZ -Basement membrane zone, CHL- Continous homogenous linear, DIF- Direct immunofluorescence findings ]

TABLE 2: Distribution of cases in the study group according to intensity of immunoreactant PV PF BP n=18 n=7 n=4 IgG+++ & C3+ 4 0 0 IgG+++ & C3++ 0 0 3 IgG+++ & C3+++ 0 0 1 IgG+++ 14 7 0

PNP n=1 0 1 0 0

DH n=1 0 0 0 0

[PV- Pemphigus vulgaris, PF- Pemphigus foliaceous, BP- Bullous pemphigoid, PNP- Paraneoplastic pemphigus, DH- Dermatitis herpetiformis]

TABLE 3: Discordant clinical and/or histo-immunological findings (10/31 cases) Clinical diagnosis Histopathological diagnosis 5 PV/ PF/ PE 1 PF/CBD 1 BP/ EBA/ EM 1 PV 1 DH 1 PNP TOTAL

4 PV 1 Inconclusive Inconclusive Inconclusive Inconclusive 1 DH 1 EM

10 CASES

DIF diagnosis 5 PV 1 PF 1 BP 1 PV Negative 1 PNP

[PV- Pemphigus vulgaris, PF- Pemphigus foliaceous, BP- Bullous pemphigoid, PNP- Paraneoplastic pemphigus, DH- Dermatitis herpetiformis, EM- Erythema Multiforme, PE- Pemphigus erythematosus, CBD- Chronic bullous disease of childhood, EBA- Epidermolysis bullosa acquisita]

Table 4: Comparative findings of the previous studies as compared to our present study Study No. of Maximum Most common type of Age Sex (year) cases frequency of cases immunoreactant PV (18) IgG (18) Present study 4th-5th F>M 31 PF (11) IgG (7) (2:1) BP (4) IgG+C3 (4) S. Arundaati PV (36) IgG (24) 4th-5th F>M et al, [8] 68 BP (8) IgG+C3 (8) (1.27:1) (2013) PF (6) IgG (3) Lebe et al, [9] (2012)

197

BP (66) DH (58) PV (51)

5th- 6th

F>M (1.01:1)

IgG+C3 (25) IgA+C3 (3) IgG (30)

Site of deposition ICS, lace like ICS, lacelike Linear BMZ ICS, lace like Linear BMZ ICS, lace like Linear BMZ Granular, BMZ & papillary dermis ICS, lace like

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Sharma et al.

Study (year)

A-145 No. of cases

Maximum frequency of cases

Age

Ranjana Walker Minz et al, [7] (2010)

267

Non –bullous immune complex vasculitis (45) Bullous PV (22) BP (13) Lichen Planus (7)

–

Kabir AN et al, [10] (2009)

204

DH (38) PV (20) BP (13)

11-20 yrs

F>M (1.68:1)

IgA (5) IgG (15) C3 (12)

PV (29) BP (22) NS (15)

–

–

IgG (26) IgG+C3 (17) IgG +C3 (2)

Inchara et al, [6] (2007)

100

Sex

Most common type of immunoreactant IgA

Site of deposition Rings in vessel wall

F>M (1.2:1) IgG IgG+C3 IgM

ICS, lace like Linear BMZ In Cytoid bodies Granular in dermal papillae ICS, lace like Linear BMZ ICS, lace like Linear BMZ ICS, lace like +C3 in dermal vessels

[PV- Pemphigus vulgaris, PF- Pemphigus foliaceous, BP- Bullous pemphigoid, PNP- Paraneoplastic pemphigus, DH- Dermatitis herpetiformis , NS- Non specific findings, ICS- Intercellular substance, BMZ -Basement membrane zone ]

TABLE 5: Comparative findings regarding clinico- histo- immunological concordance as well as disconcordance of our study as compared to previous studies .

PRESENT Walker Ranjana KabirAN Inchara YK Lebe benu FINDINGS STUDY et al [7] (2010) et al [10] (2009) et al [6] (2007) et al [9] (2012) Clinico-histo67.7% 70% 40% 73% 33.5% Immunoconcordance Histo-Immunoconcordance 80.06% – – – – Clinico-immunoconcordance – 77% – – – Clinico-histo32.25% – 20.8% 9% 62.4% immunodisconcordance Histo-immunodisconcordance

19.3%

7%

–

TABLE 6: Comparison of sensitivity of DIF with that of Histopathology Final diagnosis Sensitivity on histopathology Pemphigus group (PV+PF+PNP) 88.0% BP 75%

–

– Sensitivity on DIF 100% 100%

[PV- Pemphigus vulgaris, PF- Pemphigus foliaceous, BP- Bullous pemphigoid, PNP- Paraneoplastic pemphigus]

Fig. 1: DIF of PV shows full thickness lace like ICS IgG with Network Continuous pattern with strong intensity predominantly in lower part of the epidermis.

Fig. 2: DIF of PF shows full thickness lace like ICS IgG with Network Continuous pattern mainly in upper part of the epidermis

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-146

Direct Immunofluorescence in Skin

Fig. 3: a) DIF of BP shows strong linear homogenous IgG deposition at BMZ.

Fig. 3: b) Strong linear homogenous deposition of C3 at BMZ

Fig. 4: a) DIF of PNP shows full thickness IgG deposition at ICS and BMZ.

Fig. 4: b) Strong linear homogenous BMZ deposition of C3

Conclusion

Reference

Diagnosis of vesicobullous lesions of skin is enhanced

by DIF in those cases that pose a diagnostic dilemma both clinically and histopathologically. DIF has better sensitivity as compared to histopathology, but it should always be used in conjuction with histopathology and clinical features as the combination of three yields the best results. Thus, histopathology and DIF examination are complementary and does not supplement one another.

Acknowledgements None

Funding None

Competing Interests None Declared

1. Huilgol SC, Bhogal BS, Black MM. Immunofluorescence of the immunobullous disorders Part two: The clinical disorders. Indian J Dermatol Venereol Leprol. 1995 Sep-Oct;61(5):255-64.

2. Wu H, Allan AE, Harrist TJ. Noninfectious Vesicobullous and Vesiculopustular Diseases. In: Elder DE, Elenitsas R, Rosenbach M, Editors. Leverâ&#x20AC;&#x2122;s Histopathology of The Skin. 11th edition. Philadelphia: Lippincott Williams & Wilkins; 2009: 990-1147.

3. Mohan KH, Pai S, Rao R, Sripathi H, Prabhu S. Techniques of immunofluorescence and their significance. Ind J Dermatol Venereol Leprol.

2008;74(4):415-419.

4. Sethi KJ, Kanwar A J, Kaur S, Sehgal S. Direct immunofluorescence as a diagnostic and prognostic

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Sharma et al.

5.

6.

7.

8.

marker in pemphigus. Indian J Dermatol Venereol Leprol 1992;58:379-83 Ratnam KV, Pang BK. Pemphigus in remission: value of negative direct immunofluorescence in management.

J Am Acad Dermatol. 1994 Apr;30(4):547-50.

Inchara YK, Rajalakshmi T. Direct immunofluorescence in cutaneous vesiculobullous lesions. Indian J Pathol Microbiol. 2007 Oct;50(4):730-2.

Minz RW, Chhabra S, Singh S, Radotra BD, Kumar B. Direct immunofluorescence of skin biopsy: perspective of an immunopathologist. Indian J Dermatol Venereol Leprol. 2010 Mar-Apr;76(2):150-7.

Arundhathi S, Ragunatha S, and Mahadeva KC. A Cross-sectional Study of Clinical, Histopathological and Direct Immunofluorescence Spectrum of Vesiculobullous Disorders. J Clin Diagn Res. 2013 Dec;7(12):2788-92.

www.pacificejournals.com/apalm

A-147 9. Lebe B, Gül Nıflıoğlu G, Seyrek S, Ellıdokuz H. Evaluation of clinical and histopathologic/ direct immunofluorescence diagnosis in autoimmune vesiculobullous dermatitis: utility of direct immunofluorescence. Turk Patoloji Derg.

2012;28(1):11-6.

10. Kabir AN, Das RK, Kamal M. Direct Immunofluorescence Test of Skin Biopsy SamplesResult of 204 Cases. Dinajpur Med ColJ 2009 Jan; 2 (1) : 8-12.

11. Sousa L, Bajanca R, Cabral J, Fiadeiro T. Dermatitis herpetiformis: should direct immunofluorescence be the only diagnostic criterion? Pediatr Dermatol. 2002 Jul-Aug;19(4):336-9.

12. Zone JJ, Meyer LJ, Petersen MJ. Deposition of granular IgA relative to clinical lesions in dermatitis herpetiformis. Arch Dermatol. 1996 Aug;132(8):912-8.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article A Clinicopathological Study of Lesions of Spinal Cord and its Coverings: A Tertiary Care Hospital Experience Nitin M.Gadgil, Chetan S. Chaudhari*, Sangeeta R.Margam, Mohd. Unzer Mohd. Umar Khan, and Prashant V Kumavat, Ganesh R Kshirsagar Dept of Pathology, Lokmanya Tilak Municipal Medical College & General Hospital, Sion, Mumbai, India

Keywords: Spinal Cord Tumours, Extramedullary, Extradural, Intradural

ABSTRACT Background: The human central nervous system is highly evolved and an enormously complex system. Aim of our study was to analyse the clinical and radiological spectrum of spinal cord lesions with histopathological morphology, according to recent WHO classification of tumors of Central Nervous System and to highlight any changing trends in the spinal cord lesions if detected in context of Indian patientâ&#x20AC;&#x2122;s profile.

Methods: Our study comprised of a total 85 surgical resection specimens of lesions of spinal cord and its covering studied over a consecutive period of 12 years in a tertiary care hospital. Primary vertebral tumors and paraspinal soft tissue lesions were excluded. Descriptive cross-sectional study of cases including detailed clinical data of age, sex, duration of disease, type of lesion, and radiological findings of the patients was obtained. All cases were analyzed by examining Hematoxylin and Eosin stained slides with use of special stains and immunohistochemistry, as needed.

Result: Male predominance was noted with ratio of 1.3:1 with maximum cases seen in 21-40 years. Pain was the most frequent symptom, followed by paraplegia and sensory dysfunction. Thoracic segment of the spinal cord was most commonly involved, followed by lumbar and cervical .The most common site was extradural , followed by intradural extramedullary and intradural intramedullary lesions. Out of total, we had 69.4% cases of tumors of spinal cord and its covering, 23.5% intraspinal tuberculosis and 7.1% cases of benign cystic lesions. Amongst the tumors,Commonest tumor was Nerve sheath tumors ( 42%) followed by meningioma ( 25% ), astrocytoma (12.5%), metastasis (8%), ependymoma (7%). There were single rare cases of glioblastoma multiforme,paraganglioma, ganglioneuroma,PNET. Conclusion: Tumors of spinal cord are considered to be rare .The management of spinal cord lesions requires proper diagnosis which depends on clinical manifestation, radiography and its correlation with histological type and grade.

*Corresponding author: Dr. Chetan Sudhakar Chaudhari, 11, Jagannath darshan, M. D. Keni Road, Near,RBI Quarters, Bhandup Village (E), Mumbai, India Phone : +91 9819133606 Email: drchetanchaudhari26@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Gadgil et al.

Introduction

Tumours of spinal cord are much less frequent that intracranial ones, showing approximately four intracranial tumours for a single spinal tumour with variation depending on histological types. The intracranial to spinal ratio of astrocytomas is 10:1, whereas for ependymoma it varies from 3:1 to 20:1 depending on specific histological variant. Spinal cord tumours occur predominantly in 21-40 age groups and are less common in childhood and old age.

According to their location, spinal tumors are conveniently classified as extradural and intradural, although some can be both inside and outside the dura. Intradural tumors can be intramedullary (intramedullary spinal cord tumor) [IMSCT] or extramedullary (intradural extramedullary) [IDEM].Most of the intramedullary tumors are malignant and belong to the glioma group. [1] In the glioma group, ependymoma is the most frequent among adults constituting 60% of intramedullary tumors while astrocytoma is common in children. Among the extramedullary tumors, schwannoma and meningioma are frequently encountered.

Non glial neoplasms like hemangioblastomas, metastasis, lymphoma, paraganglioma and primitive neuroectodermal tumors are much less common. Although tuberculosis remains a major health problem in developing countries, tuberculoma involving the central nervous system is still uncommon compared with the involvement of the other systems. Intramedullary tuberculomas are rare and constitute only 0.2 to 0.5% of all central nervous system (CNS) tuberculomas. Among patients with spinal tuberculosis, 55% present with vertebral body involvement, 39% with intraspinal granulomatous lesions without bone involvement, and only 7% with intramedullary lesions. [2, 3] The ultimate prognosis depends on the histopathological nature of the removed tissue hence pathologist has to play the most important and crucial role in diagnosing and assessing the nature of lesion.

Materials and Methods

Our study comprised of a total 85 surgical resection specimens operated for lesions of spinal cord and its covering in all age groups including primary tumours, metastatic tumours invading or compressing the spinal cord and tuberculosis, studied over a consecutive period of 12 years in a one of the largest tertiary care hospital having 1700 beds. Primary bone tumors involving the vertebrae and paraspinal soft tissue were excluded. Tuberculosis remains a major health problem in developing countries, hence its lesions presenting as mass with clinicopathological profile was also included. Descriptive cross-sectional study of cases with detailed clinical data of age, sex, duration of disease, type of lesion, clinical and radiological findings of the patients was obtained. All cases were analyzed by www.pacificejournals.com/apalm

A-149 examining Hematoxylin and Eosin stained slides with use of special stains and immunohistochemistry as required.

Findings in the study were compared with previous ones in English literature with special emphasis on Asian studies to note any changing trends in patterns of presentation, location of different entities.

Result

Frequencies in results were calculated by Chi square test for categorical variables. Mann-Whitney U test was used for non parametric variables. The majority of cases were seen in the 21-30 years age group comprising 28.23% cases (24/85 cases) followed by 18.82% cases (16/85 cases) in the 31-40 years age group. In the 2130 years age group, tuberculosis forms the largest group with 41.66% cases followed by schwannoma comprising 29.16% cases. In the 31-40 and 41-50 years age group, meningioma forms the largest group comprising followed by schwannoma. In the 11-20 year age group, astrocytoma forms the major group comprising 33.33% cases and 16.67% cases each of epidermal cyst, schwannoma and neurofibroma. In the 0-10 years age group, we have one case each of Astrocytoma, Ganglioneuroma, Neurofibroma, Schwannoma,PNET and Arachnoid cyst. In >60 years age group we have total 2 cases of which one belongs to Metastatic carcinoma (Table 1) We had 59 cases of tumors of spinal cord and its covering.

Out of which the commonest tumor was schwannoma comprising 32.2% cases (19/59 cases) followed by 25.42% cases (15/59 cases) of meningioma, third group was formed by astrocytoma with 13.55% cases (8/59 cases including glioblastoma) and fourth formed by Neurofibroma with 10.16% cases (6/59 cases) followed by metastatic carcinoma with 8.47% cases (5/59 cases) followed by ependymoma with 6.77% cases (4/59 cases).

(Fig 1) it is evident that maximum number of cases was seen in the group of 31-40 year age group, followed by 21-30 year age. The youngest case was 0.5 years of age and the oldest patient was 66 years of age with mean age of presentation being 32.25 years. Overall there were 30 males and 29 females with Male to Female ratio 1.03:1 (p value 0.4)(Fig 2).

Tumors were distributed along various segments of spine with different frequencies but except meningioma, other lesions did not show segment specific propensity (p value 0.6) Tumors involved more commonly the thoracic level of the spine with 47.5% cases followed by cervical region comprising 24.5% cases. There were 22.9% cases of tumors involving the lumbar region and the last group eISSN: 2349-6983; pISSN: 2394-6466

A-150

Clinicopathological Study of Spinal Cord Lesion

i.e. sacral region included 4.9% cases (Fig 3). Local pain (backache+neck pain) was the most common presentation comprising 57.64% cases (49/85 cases) followed by paraplegia/muscle weakness seen in 48.23% cases (41/85 cases); the third group is formed by referral pain (Pain in the limbs, radiating pain) seen in 22.35% cases (19/85 cases) followed by sensory dysfunction (paresthesia, sensory loss, impaired sensation) with 21.17% cases (18/85 cases). The other symptoms included swelling of the back,incontinence of urine, vomiting and headache.

(Table 2). Duration of symptoms were ranging from 0.5month to 120 months with average duration of 14 months.

Most number of lesions were extradural comprising 43.52% cases (37/85 cases) followed by intradural extramedullary lesions constituting 41.17% cases (35/85 cases) and last group was formed by intradural intramedullary lesions with 15.29% cases (13/85 cases).Among tumors of spinal cord and its covering, most common group was intradural extramedullary with 50.84% cases (30/59 cases) followed by extradural group with 28.81% cases (17/59 cases) and last group is of intradural intramedullary with 20.33% cases (12/59 cases). Benign cystic lesions were commonly seen in extradural site with 83% cases (5/6 cases). Meningioma most commonly involves the thoracic spine constituting 80% of all cases of Meningioma (12/15 cases) and Schwannoma involves the lumbar spine frequently with 42.1% cases (8/19 cases). Astrocytoma was more commonly seen in the cervical spine with 71.4% cases (5/7 cases) and equal number of schwannoma cases were also seen in the cervical spine. Tuberculosis was more commonly seen in thoracic spine 45% (9/20 cases) followed by lumbar with 35% (7/20 cases). Benign cystic lesions were seen in thoracic 3/6 cases (50% cases) and lumbar region 2/6 cases (33.33% cases) frequently.

(Table 3)

Discussion

Primary tumors of the spinal cord are ten to fifteen times less common than primary intracranial tumors. Spinal tumors are classified based on their anatomical location as extradural, intradural extramedullary and intradural intramedullary. Primary spinal tumors are typically intradural in location whereas extradural tumors are typically due to metastatic disease. [4] Spinal tumors are rare and potentially devastating lesions that threaten the patientâ&#x20AC;&#x2122;s mobility or even life. The incidence of various tumors in our study is closely comparable to the study conducted by Lalitha and Dastur et al [5] (Table 4) (metastatic group excluded). In our study, thoracic spine

was the most common location for spinal cord tumors which was comparable to other national and international studies [5, 6, 7, 8, 9,10].There was almost an equal distribution of cases in cervical and lumbar spine which was similar to study conducted by Moein P et al[10]. Spinal cord tumors may cause pain, sensory changes, and motor problems.

Nerve pain in the leg may indicate a problem in the spine at the nerveâ&#x20AC;&#x2122;s origin. Given the relative infrequency of spinal tumors, however, these types of symptoms more commonly result from degenerative disc disease, or other, more common problems especially at cervical and lumbar spine levels. Although degenerative disc disease is not so common at thoracic level, but it is the most common location for spinal cord tumors and so the role of pathologist in determining the etiology of symptoms by examining tissue along with radiological correlation is immense, for offering proper mode of management.

In our study we reported a total of 25 cases of nerve sheath tumors with 19 cases of schwannoma and 6 cases of neurofibromas, of these 68% were intradural extramedullary and 32% were extradural comparable to Govada N et al [11] . Spinal schwannoma accounts for about 25% of intradural spinal cord tumors in adults. We reported 19 cases with M: F ratio slightly lower than the other studies. Most common location was lumbar (42.1% cases) and Pain was the most common complaint, as similarly observed by Jagadesh BK et al [12] followed by muscle weakness. Histologically, it is composed of two components, Antoni A and Antoni B areas, Antoni A is cellular and consists of spindle shaped Schwann cells which show nuclear palisading.

Antoni B is less cellular with Schwann cells suspended in a loose myxoid matrix. One of the cases showed cystic degeneration. On MRI all the cases had well circumscribed masses with 4 cases isointense and 15 cases hypointense on T1W images and all were hyperintense on T2W images with variable contrast enhancement. Neurofibromas are much less common than schwannoma within the spine.

Out of 25 cases of nerve sheath tumors we had 6 cases of neurofibromas. In our study they were most commonly seen in the 3rd to 4th decade. They were commonly seen in the cervical spine with 50% cases in concordance with Hirano K et al [13] (43.5% cases) followed by sacral and lumbar spine. In our study we had no cases associated with neurofibromatosis. Microscopically it showed a tumor composed of elongated spindle cells with poorly defined pale cytoplasm and buckled nuclei admixed with small nerve fibers. All the cases had well circumscribed lesion that were hypo to isointense on T1 weighted and hyperintense on T2 weighted images usually with uniform contrast enhancement.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gadgil et al.

A-151

Spinal meningioma constitute 25% of all spinal cord tumors, it is the second most common intradural extramedullary tumor after the nerve sheath tumors comparable to our study. We had 15 cases of meningioma predominantly seen in the 4th and 5th decade with mean age 42.8.There is a female preponderance with M: F ratio being 1:2. This female preponderance was seen in most of the studies.

Thoracic (80% cases) was the commonest site as is found in many national and international studies followed by lumbar and cervical spine. [12, 13] Compared with reports from other parts of the world, there are evident differences in the frequencies of nerve sheath cell tumors (NSCTs: schwannoma and neurofibromas) and meningioma. In Asian countries, including our study the frequency of NSCTs is higher than that of meningioma while in non Asian countries the incidence of meningioma is almost equal to or higher than that of NSCTs. Histologically meningioma exhibit wide range of appearances reflecting the mesenchymal and epithelial histogenetic potential of arachnoid cells. We had 8 cases of meningothelial meningioma, 6 were psammomatous meningioma and one was papillary variant. Meningothelial meningioma shows large lobules of cells with poorly defined cell borders and formation of characteristic whorls. The cells have nuclei with finely distributed chromatin and inconspicuous nucleoli. Psammomatous meningioma shows tumour cells arranged in whorls with hyalinised and calcified centers called psammoma bodies (Fig 3). All the cases had a circumscribed mass primarily hypo to iso intense on T1 weighted and hyper to isointense on T2 weighted images with uniformly contrast enhancing tumors. A solitary intradural extramedullary (IDEM) thoracic spine mass in a middle aged female should suggest the diagnosis.

of primary glioblastoma of spinal cord. [15,16] Pilocytic astrocytoma on H &E showed classic biphasic pattern with compacted piloid cells and loosely textured multipolar cells with Rosenthal fibers (tapered corkscrew shaped, intense eosinophilic hyaline masses) and eosinophilic granular bodies(Fig 3). Anaplastic astrocytoma showed increased cellularity, nuclear pleomorphism and prominent mitotic activity. Micro vascular proliferation and necrosis were absent.

In our study we observed a total of 8 cases of astrocytoma with male predominance having M: F ratio of 3:1 higher than the other studies. They were most commonly seen in 2nd and 3rd decade with mean age of 19.5 years. In our study the most common location was cervical followed by thoracic and majority of the cases (63%) belonging to lower grade (grade I or II) and 37% were high grade which was comparable to study by Lee SM et al[14], Moein P et al[10]. We had a single case of glioblastoma multiforme in a 12 year old male child. Primary GBM of the spinal cord is a rare condition. The relatively low proportion of absolute number of neuroglial cells as compared to brain in the spinal cord probably accounts for the rarity of these neoplasms in the spinal cord. [15] Glioblastoma represents approximately 3% of all intramedullary spinal cord tumors.

The spinal variety is mostly seen during the second and third decades and shows a predilection for the cervical and thoracic region. In the literature there are few case reports

Miller and Torack described the first case of Paraganglioma and since then only isolated cases have been reported in the literature. [18, 19] This uncommon entity comprises only 3.4 to 3.8% of all tumors affecting cauda equina region.

We report a case of 35 year old female who presented with lower backache and pain in the lower limbs since 4 years. . MRI showed presence of intradural extramedullary space occupying lesion extending from L3-S1 which was well defined. The tumor appeared as iso to hypointense with respect to the spinal cord on the T1-weighted sequences and hyperintense on T2 weighted image, contrast MRI showed uniform enhancement of the tumor.

Histopathology shows nests of tumor cells separated by a fine vascular network representing a Zellballen pattern.

(Fig 4) Immunohistochemistry showed positivity for synaptophysin and chromogranin. We had a very rare case of multifocal PNET tumour, IDEM by location, nowadays generally known as Ewingâ&#x20AC;&#x2122;s sarcoma family

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

We observed 4 cases of ependymoma with M: F ratio of 3:1 with mean age of 34.7 years comparable to Moein P et al. We had 3 cases of cellular ependymoma and a single case of myxopapillary ependymoma variant.MRI showed Intense homogenous contrast enhancement in 3/4 cases and 1 case showed multiple minimal enhancing lesions.

Here we find well defined lesions which are an important finding as for such tumors complete resection is possible.

The histology of the ependymoma WHO grade II showed moderately cellular glioma with monomorphic nuclear morphology, characterized by round to oval nuclei. Mitoses were absent. Characteristic perivascular pseudo rosettes and ependymal rosettes were seen. In our study we had 5 cases of metastasis compressing the spinal cord with mean age of 55.4 years. Spinal epidural metastases are found in 5â&#x20AC;&#x201C;10% of all patients with cancer and are much more frequent than spinal leptomeningeal or intramedullary metastases. The Prostate, breast and lung cancer are the most common origin of spinal epidural metastasis followed by non-Hodgkin lymphoma, multiple myeloma and renal cancer. [17] In our study we had 2 cases with lung cancer as the primary lesion, 2 cases with primary breast carcinoma and one with unknown primary cancer.

A-152

Clinicopathological Study of Spinal Cord Lesion

tumors (ESFTs), in a 30 year old male. Multifocal ES is extremely rare, with an incidence ranging from 1.1% to 4.3%.chromosomal translocations t(11;22)(q24;q12) gene characterises these spinal ESFTs with positive CD 99 expression.A rare case of Ganglioneuroma was seen in our study of 9 year old female child, presented with backache since 2 months. MRI shows presence of an extradural space occupying lesion which is hypointense on T1 and hyperintense on T2 extending from D7-D10. . H&E stained section showed large ganglion cells scattered in a stroma composed of spindle shaped cells.(Fig 5)

tuberculomas is 1:20 .We had 20 cases of tuberculosis of spinal cord, 14 males and 6 females, with 50% cases occurring in the range of 21-30 years with mean age 31.4 years and M: F ratio 2.3:1. Most common location was in the thoracic spine with 45% cases.18 cases were extradural in location and 2 cases with intramedullary location.

Intramedullary tuberculomas are rare with subacute presentation of progressive spinal cord compression symptoms and constitute only 0.2 to 0.5% of all central nervous system tuberculomas. Given the rarity of spinal intramedullary tuberculoma, there is no standardized treatment protocol for this condition. Our results matched with Jain AK et al [19] who reported 17 cases with same clinical and pathological features. Spinal tuberculoma may occur at any level although it shows a predilection for the thoracic region as seen in our study.

Tuberculosis still remains major public health problem in India, hence to study its disease pattern involving spinal region is essential. Tuberculomas of central nervous system are more common than of spinal column. The approximate proportion between intraspinal and intracranial Table 1: Incidence of lesions of spinal cord in various age groups 1) 0-10 2) 11-20 3) 21-30 4) 31-40 YEARS YEARS YEARS YEARS

AGE GROUP 

6) 51-60 7) >60 YEARS YEARS

M

F

Total Avge age Avge duration in yrs of symptoms in months



LESIONS TUBERCULOSIS ARACHNOID CYST GANGLIONEUROMA EPIDERMAL CYST ASTROCYTOMA MENINGIOMA NEUROFIBROMA SCHWANNOMA EPENDYMOMA PARAGANGLIOMA METASTATIC CARCINOMA TOTAL

5) 41- 50 YEARS

– 1 1 – 1 – 1 1 – – –

1 – – 2 4 1 2 2 – – –

10 1 – 1 1 1 1 7 2 – –

3 – – – 2 5 1 3 1 1 –

4 – – – – 5 – 4 – – 2

2 1 – – – 2 1 2 1 – 2

– 14 – 1 – – – 3 – 6 1 5 – 3 – 10 – 3 – – 1 3

6 2 1 – 2 10 3 9 1 1 2

20 3 1 3 8 15 6 19 4 1 5

31.4 41 9 17.33 19.5 42.8 27.6 34 34.75 35 55.4

5.23 5.33 3 23.27 7.20 8.16 22.27 13.8 2.75 48.67 2.93

5

12

24

16

15

11

2 48

37

85

31.61

12.96

Table 2: Clinical Manifestations in lesions of spinal cord and its covering CLINICAL FEATURES Swelling of back Backache Weakness of lower limbs Paraplegia Pain in limbs Paresthesia Radiating pain Incontinence of urine Headache Painful neck rotation Vomiting Sinus Discharge Previous surgery

NUMBER OF CASES 4 48 16 25 18 18 1 4 2 1 1 1 1

PERCENTAGE (n=85) 4.7 56.47 18.82 29.41 21.17 21.17 1.17 4.7 2.35 1.17 1.17 1.17 1.17

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gadgil et al.

A-153

Table 3: Site wise distribution of lesions of spinal cord and covering Lesions

Extradural

TUBERCULOSIS

15

Intradural Extra– medullary 4

Intradural intra– medullay

Cervical

Thoracic

lumbar

sacral

total

1

2

9

7

2

20

EPIDERMAL CYST ARACHNOID CYST/ METASTASIC CARCINOMA GANGLIONEUROMA ASTROCYTOMA MENINGIOMA NEUROFIBROMA SCHWANNOMA EPENDYMOMA PARAGANGLIOMA Total

5

1

–

1

3

2

–

6

5

–

–

–

4

1

–

5

1

–

–

–

1

–

–

1

– 3 2 6 – – 37

– 12 4 13 – 1 35

8 – – – 4 – 13

5 1 3 5 – – 17

2 12 – 5 3 – 39

1 2 1 8 1 1 24

– – 2 1 – – 5

8 15 6 19 4 1 85

Table 4: Comparison of common entities of spinal cord tumors with various International & National studies.

References

NSCTs* (%)

Meningioma (%)

Neuroepithelial Tumors (%)

Vascular Tumors(%)

Metastasis (%)

Lalitha and Dastur [5]

39.92

25.5

20.9

5.8

–

Schellinger et al

24.4

28.9

29.2

–

–

32.3

29.7

24.4

–

–

52.2

15.2

10.9

3.3

–

[6]

Kaye et al [7] Cheang et al

[8]

Herbert H Engelhard et al

21.2

24.4

23.7

–

–

Moein P et al[10]

33.0

15.0

38.0

–

–

Present Study

42.36

25.42

23.52

–

8.47

[9]

(* Nerve Sheath Cell Tumor)

Fig. 1: Spinal cord tumors with their respective percentage

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-154

Clinicopathological Study of Spinal Cord Lesion

Fig. 2: The relative distribution of spinal cord tumors with respect to age & sex

Fig 3: Astrocytoma:MRI-Hypointense lesion with cord expansion extending from T5 to T8 level on T1w image (3 A), Post contrast images demonstrate patchy irregular peripheral enhancement (3 B).Pilocytic astrocytoma (WHO grade I) showing bipolar piloid cells, Rosenthal fibres(arrow) and eosinophilic granular body(arrowhead)(H&E 100x) (3C), showing Rosenthal fibres(arrow) which are PAS positive(PAS Diastase 400x)(3D).Myxopapillary ependymoma (WHO grade I):MRI-well defined post contrast image shows homogenous enhancement of the lesion at the level of L2 (3 E), cuboidal to elongated tumor cells dispersed in a myxoid background (H&E 100x, 400x) (3 F).Meningioma:MRI- intense homogenous enhancement on contrast with a dural tail (3 G), Psammomatous meningioma( WHO grade I) with numerous calcified psammoma bodies and meningothelial cells(H&E 400x)(3 H)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gadgil et al.

A-155

Fig 4: Paraganglioma (WHO grade I): MRI-: Well defined isointense lesion on T1w from L3 to S1 level and hyperintense on T2w (4 A), characteristic â&#x20AC;&#x153;zellballenâ&#x20AC;? pattern of nests of tumor cells separated by fibrovascular stroma (H &E100 (4B). Glioblastoma Multiforme (WHO grade IV): MRI- hyperintense lesion is seen expanding the spinal cord from C2 to C5 on T2w images. The cord is swollen and edematous at this level (4C), foci of necrosis surrounded by radially oriented small fusiform and few undifferentiated glioma cells in a pseudopalisading pattern (H&E 100x) (4D).Arachnoid cyst :MRI- sagittal T1w hypointens showing a sharply defined tumor extending from T12-L1 compressing the spinal cord (4 E), arachnoid cyst showing a cyst wall demonstrating a thin arachnoid layer lined by discrete meningothelial cells (H&E 100x). (4 F).

Fig 5: Ewings Sarcoma/p PNET (WHO grade IV): Highly cellular tumor, consisting mainly of small round to oval cells with hyperchromatic nuclei and remarkably scanty cytoplasm (H &E X 400x) (5A), Immunoreactive for MIC2- Strong Cytoplasmic Membranous Positivity (5B), FLI-1 Weak Positive (5C). Ganglioneuroma (WHO grade I): Large ganglion cells scattered in a stroma composed of spindle shaped cells(H &E X 100x) (5D), Characteristic tubercular lesion with Epitheloid cell granuloma with rim of lymphocytes and central caseous necrosis(5E).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-156

Clinicopathological Study of Spinal Cord Lesion

Conclusion

The incidence of spinal meningioma is less in developing countries than western populations. Rare histological variants like primitive neuroectodermal tumors should also be considered for histological differential diagnosis of spinal tumors. Intramedullary tumors present at a younger age in developing countries and tuberculosis still should be considered as possible lesion presenting as compressive mass like lesions at this site in Indian population. The ultimate prognosis depends on the histopathological type and grade of the removed tumour, hence pathologist has to play the most important and crucial role in diagnosing and assessing the nature of lesion.

Acknowledgements

Dr. A. D. Kalgutkar, Prof & Head , Dept of pathology, LTMMC, Sion, Mumbai

Funding None

Competing Interests None declared

Reference

1. Parsa AT, Chi JH, Acosta FL Jr, Ames CP, McCormick PC. Intramedullary spinal cord tumors: molecular insights and surgical innovation. Clin Neurosurg.

2005; 52:76-84.

2. Yen HL, Lee RJ, Lin JW, Chen HJ: Multiple tuberculomas in the Brain and spinal cord: a case report. Spine. 2003; 28: 499-502.

3. Muthukumar N, Venkatesh G, Senthilbabu S, Rajbaskar R. Surgery for intramedullary tuberculoma of the spinal cord (report of 2 cases). Surg Neurol.

2006; 66: 69-74.

4. Chamberlain MC, Tredway TL. Adult primary intradural spinal cord tumors: A review. Curr Neurol Neurosci Rep. 2011; 11: 320-328.

5. Lalitha VS, Dastur DK. Neoplasms of the central nervous system—histological types in 2237 cases.

Indian J Cancer. 1980; 17:102–106.

6. Schellinger KA, Propp JM, Villano JL, McCarthy BJ. Descriptive epidemiology of primary spinal cord tumors. J Neurooncol. 2008; 87:173–179.

7. Kaye AH, Giles GG, Gonzales M. Primary central nervous system tumors in Australia: a profile of clinical practice from the Australian Brain Tumor Register. Aust N Z J Surg. 1993; 63: 33–38.

8. Cheang CM, Hwang SL, Hwong SL. An analysis of intraspinal tumors in south Taiwan. Kaohsiung J Med Sci. 1997; 13:229–236.

9. Engelhard HH, Villano JL, Porter KR, Stewart AK, Barua M, Barker FG, Newton HB. Clinical presentation, histology, and treatment in 430 patients with primary tumors of the spinal cord, spinal meninges, or cauda equina. J Neurosurg Spine. 2010;13:67–77.

10. Moein P, Behnamfar O, Farajzadegan Z. A 12-year old study on primary spinal cord tumors in Isfahan, Iran. J res med sci. 2013 Jan; 18(1): 17-21.

11. Govada N, Chowdary KR, Jeshtadi A, Gollapalli S, Dara K. Spinal nerve sheath tumors: Analysis of 20 cases with review of literature. Int J Res Health Sci [Internet]. 2014 Jan; 2(1):140-5.

12. Jagadesh BK, Reddy S, Ponraj S, Murali GV, Govindappa CHV, Hanuman DS. Clinicopathological study of intradural extramedullary spinal cord tumors.

Sch J Med Case Rep. 2014; 2(2): 108-111.

13. Hirano K, Imagama S, Sato K, Kato F, Yukawa Y, Yoshihara H, Kamiya M,et al.. Primary spinal cord tumors: review of 678 surgically treated patients in Japan. A multicenter study. Eur Spine J. 2012 Oct; 21(10): 2019-2026.

14. Lee SM, Cho YE, Kwon YM. Neurological outcome after surgical treatment of intramedullary spinal cord tumors. Korean J Spine. 2014 Sep; 11(3): 121-126.

15. Prasad GL, Borkar SA, Subbarao KC, Suri V, Mahapatra AK. Primary spinal cord glioblastoma: A report of two cases. Neurology India. 2012 May-Jun; 60(3): 333-335.

16. Parsa AT, Lee J, Parney IF et al. Spinal cord and intradural-extraparenchymal spinal tumors: current best care practices and strategies. Journal of NeuroOncology. 2004; 69: 291-318.

17. Lee SS, Kim MK, Sym SJ, Kim SW, Kim WK, Kim SB, Ahn JH. Intramedullary spinal cord metastasis: a single institution experience. J Neurooncol. 2007 Aug; 84(1):85-89.

18. Han San Oh, Tae Wan Kim, Kwan Ho Park. Spinal Paraganglioma Adherent to the Cauda Equina. Korean J Spine. 2014 Dec; 11(4): 252–254.

19. Hsieh CT, Tsai WC, Tang CT, Liu MY. Paraganglioma of the cauda equina. Neurology India. 2009 Nov-Dec; 57(6):833-834.

20. Jain AK, Singh S, Sinha S, Dhammi IK, Kumar S. Intraspinal tubercular granuloma- an analysis of 17 cases. Indian J Orthop. 2003; 37:12-13.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Assessment of Serum βhCG, Lipid Profile and Uric Acid Levels in Early Second Trimester as Predictors of Pregnancy Induced Hypertension Akansha Singh1*, Poonam Khambra2, K Usha Rani3 and Ashish Kumar Mandal1 Department of pathology, VMMC & Safdarjung hospital, New Delhi, India 2 Department of Pathology, MGH Hospital, RK Puram, New Delhi, India 3 Department of Obstetrics and Gynaecology, VMMC & Safdarjung Hospital, New Delhi, India 1

Keywords: ????

ABSTRACT Background: Pregnancy induced hypertension is one of commonest complication affecting pregnant females with serious implications on both maternal and fetal health. Our aim is to assess the importance of measuring serum βhCG, lipid profile and uric acid levels in early second trimester of at-risk pregnant females Methods: A prospective study was conducted on 55 pregnant females visiting antenatal outpatient department of the Obstetrics and Gynaecology and department of pathology of MGH Hospital, RK Puram, New Delhi from January 2011 to December 2012. The study group included 25 at risk pregnant females and 30 females with normal pregnancy Results: In study group, the mean systolic and diastolic group was found to be higher than the healthy controls. The serum βhCG, lipid profile and uric acid levels were also found on higher side in the hypertensive group as compared to the normotensive pregnant females.

Conclusion: Evaluation of maternal βhCG, lipid profile and uric acid can serve as reliable predictors of pregnancy induced hypertension. Early identification of at-risk women may help in taking timely preventive and curative management to prevent or halt pregnancy related complications.

*Corresponding author: Dr. Akansha Singh, A-147 Pandara Road, Near India Gate, Delhi- 110003 Email: dr.akansha1985@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-158

Early Predictors of Pregnancy Induced Hypertension

Introduction

Pregnancy is a physiological process but needs strict monitoring throughout gestational period to circumvent perilouscomplications like pregnancy induced hypertension (PIH), gestational diabetes etc. Pregnancy induced hypertension is a disease influencing 5–10 % of all pregnant women.[1] Pregnancy induced hypertension, defined as hypertension after 20 weeks of pregnancy in a woman with edema and proteinuria without previous history of hypertension.[2] Pregnancy induced hypertension is one of the existing medical illness which is responsible for majority of pregnancy related morbidity and mortality.[3] Recently, multiple hypothesis have been postulated to understand the complex etiopathogenesis which enlists (i) placental ischemia, (ii) altered endothelial cell function, possibly secondary to altered lipid metabolism (iii) immune maladaptation and (iv) genetic imprinting.[4] PIH is considered to be a trophoblastic disorder and the supporting evidence comes from the fact that these patients may suffer from either hyperplacentosis or an abnormal placentation.[5] In PIH, there is mid-trimester surge of βhCGdue to overwhelming secretory response of the immunologically modified trophoblast.[6] Also, there is 2-3 times rise in serum triglyceride concentration which are likely to get accumulated in the uterine spiral arteries contributing to endothelial activation and damage.[2,7] Serum uric acid is known to decrease in early pregnancy but patients presenting with PIH shows elevated levels even in third trimester in association with relatively less urate excretion.[8] Uniqueness of this paper is reflected by comparative study of serumβhCG, lipid profile and uric acid in pregnant females for early diagnosis, timely intervention and close surveillance of pregnancy induced hypertension. To best of our knowledge this is the first study based on assessment of triple biochemical parameters in an effort to avert the dreadful complications of pregnancy induced hypertension.

Material and Methods

This was a prospective and observational study, conducted on 25 patients and 30 healthy age matched controls. The study population includes pregnant females visiting antenatal outpatient department of the Obstetrics and Gynaecology of MGH Hospital, RK Puram, New Delhi from January 2011 to December 2012.

All patients and controls were investigated for serum βhCG, lipid profile and uric acid in beginning of second trimester (14–20 weeks). 3 ml of blood was collected after 12 h of fasting in plain vacutainer under aseptic precautions. The blood was allowed to stand undisturbed for half-an hour

and followed by centrifugation at 2500 rpm for 15 minutes.

The comparative study of serum βhCG, lipid profile and uric acid were done between the normotensive controls (group I) and pregnancy-induced hypertension patients (group II).

Patients of hypertension diagnosed before 20 weeks of gestation, diabetes mellitus, molar pregnancy and any other chronic illness were excluded from the study.

Serum βhCG was determined by ELISA (enzyme linked immunoassay) using AIA 360 fully automated Tosho immunoassay analyser. Serum lipid profile and uric acid were performed on fully automated biochemistry analyser (Logotech) using immunofluorescence method. Total lipids were calculated as 250 + serum triglyceride + serum cholesterol. VLDL was calculated as serum triglyceride divided by 5.

Statistical Analysis: Mean ± SD of all the parameters of interest were calculated for PIH and for normal separately and difference of means between the two groups was tested by t-test.

Results

In the study group, 12/25 pregnant females were in the age range of 25-29 years constituting 48% of the population, similarly in the control group majority of population were falling in the same age group comprising of 33.33% of the population (Table 1& figure 1) The result illustrates that 16/25 females of study group and 14/30 females of the control group were primigravidas constituting 54.54% of the total population. On the other hand, 25/55 females were multigravidas constituting 45.45% of the total population (Table 2 & figure 2) Blood pressure was recorded for all patients at each visit.

Mean Systolic BP and diastolic BP of the study group was 136 mm of Hg and 85.42 mm of Hg and was higher as compared to control group which was 110.4 mm of Hg and 72.0 mm of Hg respectively. At the time of delivery, mean systolic and diastolic BP was higher in the study group in comparison to healthy controls (p<0.05). Blood pressure returned to normal within one month after delivery (Table 3).

The levels of βhCG in the study group (41500) was comparatively higher than the control group (22500) which was statistically significant (p=0.0001). The serum cholesterol (218.4), LDL(136) and uric acid levels(6.3) were also noted to be higher in the study population as compared to normal population and was statistically significant (p<0.05). However, the triglycerides, HDL, VLDL values were not statistically significant (Table 4, figure 3& 4)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Singh et al.

A-159

Table 1: Distribution of cases according to age Age (years) 20-24 25-29 30-34 35-39

Study group (n=25) 7 12 5 1

% 28 48 20 2

Control group (n=30) 12 10 06 02

% 40 33.33 20 6.66

Table 2: Distribution of cases according to parity Parity G1 G2 G3 G4

Study group(n=25) 16 06 02 01

Control group(n=30) 14 10 04 02

Total cases(n=55) 30 16 06 03

Table 3: Comparison of systolic and diastolic blood pressure between study and control groups.

Blood pressure (mm of Hg) Diastolic BP Systolic BP Diastolic BP Systolic BP

At 14-20 weeks Study group (n=25) Mean ± SD 85.42 ± 5.75 136 ± 5.42 At delivery 92.4 ± 4.6 141.2 ± 5.2

Control group(n=30) Mean ± SD 72.0 ± 5.6 110.4 ± 3.2

p Value

76.6 ± 4.6 120.30 ± 1.9

0.0001 0.0001

0.0001 0.0001

Table 4: Comparison of B-HCG and serum lipid profile between study and control groups Variables βhCG (mIU/ml) Cholesterol (mg/dl) Triglycerides (mg/dl) HDL (mg/dl) VLDL (mg/dl) LDL (mg/dl) Uric acid (mg/dl)

Study group (n=25) Mean±SD 41500 ± 14000 218.40 ± 40.29 210 ± 57.3 45.38 ± 22.74 48.18 ± 18.5 136 ± 46.2 6.3 ± 3.6

Fig. 1: Distribution of cases according to age

www.pacificejournals.com/apalm

Control group(n=30) Mean±SD 22500 ± 4500 188 ± 30.13 185.5 ± 46.5 49 ± 17.8 45.04 ± 21 107 ± 16.3 3.9 ± 2.2

p Value 0.0001 0.002 0.08 0.51 0.56 0.002 0.003

Fig. 2: Distribution of cases according to parity

eISSN: 2349-6983; pISSN: 2394-6466

A-160

Early Predictors of Pregnancy Induced Hypertension

Fig. 3: Comparsion of lipid profile and uric acid between patient and control group

Fig. 4: Comparsion of βhCG between patient and control group

Discussion

LDL in women who subsequently developed PIH were significantly higher than in normotensive patients.[14]

In our present study, we investigated the importance of βhCG, lipid profile and uric acid in pregnancy induced hypertension. This study included 55 pregnant females who visited antenatal OPD, 54.5% females were primigravidas and 50.9% were in the age range of 20-25 years with mean age of presentation of 23.5 years. The cases were categorized into study and control group and monitored throughout the gestational period and followed till the delivery and in postpartum period. The study group included 25 pregnant females who subsequently developed pregnancy induced hypertension and rest 30 females remained normotensivethroughout the pregnancy.

The main factor for dyslipidemia in PIH is hyperestrogenemic state as estrogen induces hepatic production of TGs through VLDL, this process is modulated by hyperinsulinism that starts in pregnancy.[9]The dyslipidemic profile seen in preeclamptic women is also attributed to dysregulation of the lipoprotein lipase.[10] Another important event in the pathogenesis of PIH is endothelial dysfunction which is secondary to generation of oxidative stress.[11] In our present study, serum levels of TC, triglycerides andLDL were increased in the hypertensive group and were significantly increased while, the level of HDL, triglycerides and VLDL were not statistically significant.

This discordance in the values of lipid profile of the study and control group may be attributed to the small sample size. Our findings were supported by similar other studies.

Lorentzen et al. concluded that higher serum-free fatty acids and triglyceride are noted before 20 weeks of gestation in women developing PIH.[12] Similar results were demonstrated by Cekmen et al. with higher plasma triglyceride and LDL levels and significantly lower HDL levels in PIH subjects than in control group.[13]Vidyabati et al. also concluded that total cholesterol; VLDL, and

Our results showed that pregnant women having very high serum βhCG level around 45000 mIU/ml at the early second trimester developed PIH later in their pregnancy with p value of 0.0001 which is statistically significant.

It is believed that increasedβhCG secretion may result as a consequence of abnormal placental invasion or placental immaturity. Some advocates that it may due to abnormal trophoblastic response to hypoxia and subsequent development of a hypersecretory state.[4]Exact pathogenesis remains unknown, but the supporting findings showed patients suffering from PIH had increased density of β-hCGpositive trophoblast along with an increased intensity of β-hCG immunostaining within the placental villi.[15] During early pregnancy, the levels of uric acid are bound to decrease pertaining to increased renal perfusion and uricosuric effects of estrogen with a surge noticed in later half of the pregnancy. In contrast, the PIH patients show slightly higher serum uric acid levels even during the first trimester due to relative reduction in urinary urate excretion.[16] The mechanism of uric acid mediated damage to maternal vasculature resulting in failed placental bed formation is due to interference in trophoblast invasion.

This consequently leads to ischemia reperfusion injury to the placenta and oxidative stress.[17] There are various factors responsible for increased uric acid in preeclampsia; abnormal renal function, increased tissue breakdown, acidosis and increased activity of the enzyme xanthine oxidase/dehydrogenase[18].Our findings showed elevation of serum uric acid levels in early pregnancy of pre-ecclamptic females. Similar results were concluded

by Bellomo et al in a study conducted on 163 pregnant females in which approximately 45% females developed

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Singh et al.

A-161

PIH. It was noticed that increased serum uric acid levels confers an 8–9 fold risk for PIH and also a 1.6–1.7-fold risk for small for gestational age (SGA) infants.[19]

8.

Thus, a triple assessment of maternal lipid profile,βhCGand uric acid levels in mid-trimester pregnancy helps in early recognition and better management of patients at risk of pregnancy-induced hypertension.

9.

Conclusion

Maternal dyslipidemia along with elevated maternal serum ßhCG and uric acid at second trimester are very good non-invasive predictors of PIH which may assist in timely intervention to prevent both maternal and fetal complications.

Acknowledgements None

Funding

10.

11.

12.

None

Competing Interests None declared

References

1. Yadav K, Aggarwal S, Verma K. Serum bhCG and Lipid Profile in Early Second Trimester as Predictors of Pregnancy-Induced Hypertension. J ObstetGynaecol India 2014;64(3):169-74.

2. Nayan S, Meena ML, Hooja N, Fatima A, Singh N, Aseri S. A Study of Comparison of Serum Lipid Profile of Women with Pregnancy Induced Hypertension and Normal Pregnancy. Sch. Acad.

J. Biosci. 2014;2(11):834-836.

3. Cunningham FG, Leveno KJ, Bloom SL, et al.

Pregnancy hypertension. In: Kenneth J, et al., editors.

Williamsobsterics. 23. New York: McGraw-Hill; 2010. p. 706.

4. Vidyabati RK, Hijam D, Singh NK, Singh WG. Serum βhCG and lipid profile in early second trimester as predictors of pregnancy induced hypertension.

J ObstetGynecol India. 2014;60(1):44-50.

5. Kaur G, Jain V, Mehta S, Himani S. Prediction of PIH by Maternal Serum Beta HCG Levels in the Second Trimester (13–20 Weeks) of Pregnancy.

J ObstetGynaecol India. 2012;62(1):32–34.

6. Hsu CD, Chan DW, Iriye B. Elevated serum human chorionic gonadotropin as evidence of secretory response in severe preeclampsia. Am J Obstet Gynecol.

1994;170:1135–1138.

7. Jayanta De, Mukhopadhyay AK, Saha PK. Study of serum lipid profile in pregnancy induced www.pacificejournals.com/apalm

13.

14.

15.

16.

17.

18.

19.

hypertension. Indian Journal of Clinical Biochemistry 2006;21(2):165-168.

Johnson RJ, Kanbay M, Kang DH, Lozada L, Feig D. Uric acid: A Clinically Useful Marker to Distinguish Preeclampsia from Gestational Hypertension.

Hypertension 2011;58(4):548–549.

Adegoke OA, Iyare EE, Gbenebitse SO. Fasting plasma glucose and cholesterol levels in pregnant Nigerian women. Niger Postgrad Med J. 2003;10(1):32-6.

Sattar N, Greer IA, Louden J et al. Lipoprotein subfraction changes in normal pregnancy: threshold effect of plasma triglyceride on appearance of small dense low density lipoprotein. J ClinEndocrinolMetab 1997;82:2483-91.

Lorentzen B, Henriksen T. Plasma lipids and vascular dysfunction in preeclampsia. SeminReprodEndocrinol 1998;16:33-9.

Lorentzen B, Endressen MJ, Clausen T, et al. Fasting serum free fatty acids and triglycerides are increased before 20 weeks of gestation in women who later develop preeclampsia. Hypertens Pregnancy.

1994;13:103–9 Cekmen MB, Erbagci AB, Balat A, et al. Plasma lipid and lipoprotein concentrations in pregnancy induced hypertension. ClinBiochem. 2003;36:575–578.

Vidyabati RK, Davina H, Singh NK, et al. Serum βhCG levels and lipid profile in early second trimester as predictors of pregnancy induced hypertension.

J ObstetGynecol India. 2010;60(1):44–50.

Mallick MP, Ray S, Medhi R, Bisai S. Elevated serum βhCG and dyslipidemia in second trimester aspredictors of subsequent Pregnancy Induced Hypertension.

Bangladesh Med Res Counc Bull 2014; 40: 97-101.

Johnson RJ, Kanbay M, Kang DH, Lozada GL, Feig D. Uric acid: A Clinically Useful Marker to Distinguish Preeclampsia from Gestational Hypertension.

Hypertension. 2011;58(4):548–549.

Bainbridge SA, Roberts JM, von Versen-Hoynck F, Koch J, Edmunds L, Hubel CA. Uric acid attenuates trophoblast invasion and integration into endothelial cell monolayers. Am J Physiol Cell Physiol.

2009;297:440–450.

Tejal P, Astha D. Relationship of Serum Uric Acid Level to Maternal and Perinatal Outcome in Patientswith Hypertensive Disorders of Pregnancy.

GMJ. 2014;69(2):45-46.

Bellomo G, Venanzi S, Saronio P, Verdura C. prognostic significance of serum uric acid in women with gestational hypertension. Hypertension.

2011;58(4):548-9. eISSN: 2349-6983; pISSN: 2394-6466

Original Article Correlation of p53 Expression with Clinicopathological Characteristics of Breast Carcinoma Kamal Kant Gupta*, Ashok Kumar Dash and Debi Parsad Mishra Department Of Pathology, M.K.C.G. Medical College, Berhampur, India

Keywords: Breast Cancer, Invasive Ductal Carcinoma, Lymph Node, Nucleus, P53 Over Expression, Immunohistochemical.

ABSTRACT Background: Breast carcinoma has become the most common malignancy in the female population. The p53 gene is a breast cancer progression gene that regulates the cell cycle and DNA repair and itâ&#x20AC;&#x2122;s over expression associated with a worse prognosis. The importance of studying the various prognostic factors in breast carcinoma so as to identify patients at high risk of early recurrence and thus to more effectively target aggressive adjuvant chemotherapy, radical mastectomy & intensive follow up protocols.

Methods: The prospective study was conducted in the department of Pathology, M.K.C.G. Medical College, Berhampur from 2013 to 2015. Immuno-histochemical evaluation of a total 72 Patients was conducted who were confirmed to have breast carcinoma histologically.

Result: Our study showed that majority of 64 cases was positive for p53 expression. Maximum no. of T1, T2, T3 tumors showed moderate & high p53 expression. Maximum number of cases showed moderate & high p53 expression in patients with N2 & N3 lymph node involvement. 50% of patients showed high p53 expression in patients with N3 lymph node involvement. 47% of Grade I tumors showed moderate p53 expression. Maximum no. of Grade II tumors and 41% of Grade III showed moderate to high p53 expression. Invasive Ductal carcinoma (Not Otherwise Specific) showed maximum of moderate to high p53 expression.

Conclusion: A significant correlation of p53 with tumor grade and also with lymph node status was found, but not with tumor size. In breast cancer, we suggested that the over expression of p53 protein in the nucleus is an indicator of poor prognosis.

*Corresponding author: Dr Kamal Kant Gupta, Postgraduate Student, Department of pathology, M.KC.G. Medical College, Berhampur-760004, India.

Phone: 91-8093970832 Email: Dr.kamalkantgupta@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Gupta et al.

Introduction

Breast carcinoma has become the most common malignancy in the female population, effecting one in eight women and is one of the leading causes of mortality among women in developing countries.[1] The number of tumor-related features available to predict the prognosis of patients with breast cancer has grown markedly in recent time period.

Lymph node status, tumor size and histological grade are now supplemented with measurements of steroid hormones receptors, proliferation index, tumor suppressor genes, and growth factors, oncogenes and oncogenes products. Tumor size and axillary lymph node status are most important classic variables in the predicting the prognosis of breast cancer. Several investigators have shown that the 5 year recurrence rates in patients with axillary node negative cases varies from 11% for those with tumor size <2 cm to 24% for those with tumor size >5 cm.[2,3] In node-negative breast cancer cases, the single most important prognostic factor is tumor size and one of the strongest predictors for dissemination & rate of relapse in these cases.[4] However, axillary node status is the single most important prognostic factor for patients with early breast cancer. Many studies had shown that treatment outcome was very poor in cases which had axillary lymph node metastasis as compared to node negative breast cancer cases.[2] Recent attention has been directed singularly at molecular classification of breast cancer. While molecular and genetic testing is very elegant, prognostic and predictive, they are expensive and not yet widely available. [5] The p53 tumor suppressor gene, located on the short (p) arm of chromosome 17, is a another proved breast cancer progression gene that regulates the cell cycle and DNA repair .[6,7] Unlike normal p53, nonfunctional mutated p53 accumulates in the nucleus of tumor cells, and therefore, it can be detected by immunohistochemical analysis. Multiple studies have shown that p53 over expression in breast cancer is associated with a worse prognosis.[6] Recent studies have suggested that p53 status might have a different predictive value for the efficacy of anthracycline/alkylating agent based chemotherapy regimen between triple negative & non triple negative breast cancers.[8] The above facts reassert the importance of studying the various prognostic factors in breast carcinoma so as to identify patients at high risk of early recurrence and thus to more effectively target aggressive adjuvant chemotherapy, radical mastectomy & intensive follow up protocols.

A-163 were confirmed to have breast carcinoma histologically.

The haematoxylin & eosin (H&E) stained slides of the cases were retrieved & screened for confirmation of diagnosis followed by selection of the appropriate paraffin blocks. The representative neoplastic tissue blocks (paraffin embedded) were cut at 3.0µ on poly-L-Lysine coated slides. One of the sections was routinely stained with H&E. The histological grading of the tumor was done on H&E stained sections according to Modified Bloom & Richardson Grading. Patients included in our study were mastectomy specimen with axillary clearance and needle biopsy, Incision biopsy, Enucleation & simple mastectomy, those who did not give consent for IHC, Inadequate tissue samples, Improperly preserved tissues were excluded.

Breast carcinoma was used as a positive control. Tumor cells with nuclear staining were accepted as positive. The extent of positive p53 was graded semi quantitative for intensity and distribution. p53 overexpression were taken as Negative, Low, Moderate, High when less than 5%, 5% - 19%, 20% - 50%, >50% of cells were positive for p53.

Tumor size was divided into three groups < 20mm, 20 mm – 49mm, >49mm on gross examination.

Statistical Method: Descriptive statistical analysis has been carried out in the present study. Results on continuous measurements are presented on mean± SD (min-max) and results on categorical measurement are presented in number (%).

Significant figures of P value:   

+ suggestive significance (P value: 0.05 < P < 0.10) * Moderately significance (P value: 0.01 < P ≤ 0.05) ** strongly significance (P Value: P ≤ 0.01)

For all such categorical data chi-square test was applied using graph pad prism software version 5.0. P value <0.05 was considered as the minimum level of significance.

Result

A prospective clinical correlation study of 72 patients with breast cancers over a period from 2013-2015 was undertaken in Department of Pathology to study immunohistochemical detection of p53 & its correlation with tumor size, sub types, histological grade and lymph node involvement.

The present study was conducted in the department of Pathology, M.K.C.G. Medical College, Berhampur. Study duration was from 2013 to 2015. Immuno-histochemical evaluation of a total 72 Patients was conducted who

In the present study, Age ranged from 21- 73 years & the mean age was 50 yrs. Majority, 40 cases (55.6%) belonged to 41-60 yrs. No pre-pubertal cases were encountered during the study period. Most of the patients were postmenopausal 38 cases (52.8%). Most of the cases presented with Breast Lump which was the commonest symptoms in 56 cases (77.8 %). Followed by breast lump with nipple discharge

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Materials and Methods:

A-164

p53 Expression in Breast Carcinoma

in 6 cases (8.4 %), breast lump with pain & breast lump with skin involvement involving 4 cases (5.5%) each & 2 cases (2.8%) had breast lump with ulcer. Majority 41 (56.9%) cases showed tumor in upper outer quadrant, followed by 16 cases (22.3%) in upper inner quadrant.

Only 7 cases involved the central breast. 5 and 3 cases involved lower outer & inner quadrant respectively, no tumor found to involve entire breast. In the present study, SBR grade II was the most common grade having 33 cases (45.8%). Followed by Grade III with 22 cases (30.6%) & Grade I with 17 cases (23.6 %). Present study showed that Predominant histologic subtype is infiltrating Ductal Carcinoma (NOS) accounting for 62 cases (86.1%). The other histological subtype encountered were 4 cases (5.5%) of medullary carcinoma and 4 cases (5.6%) of lobular carcinoma. We encountered 1 case (1.4%) of mucinous carcinoma & metaplastic carcinoma each. Majority 58 cases (80.6 %) had lymph node metastasis of tumor. 14 cases (19.4%) had either no lymph node in mastectomy specimen or no lymph node metastasis. We had 58 cases with lymph node involvement. Out of which majority 26 cases (36.1%) had 1-3 lymph node involvement. Followed Table 1: P53 Expression P53 expression Negative (<5%) Positive (5-19%) Positive (20-50%) Positive (>50) TOTAL

by 24 cases (33.3%) having 4-9 lymph node involvement.

8 cases (11.1%) had â&#x2030;Ľ 10 lymph node involvement.

Our study showed that majority of 64 cases (88.9%) were positive for p53 expression of which maximum 26 cases (36.1%) showed > 50% of P53 expression. 28 cases (38.9%) had 20-50% of p53 expression (Table 1).

Maximum no. of T1, T2, T3 tumors showed moderate & high p53 expression ( Table 2 ). 50% of patients with N0 patients were negative for p53 & rest showed varying p53 expression. Maximum number of cases showed moderate & high p53 expression in patients with 1-3(N2) & 4-9(N3) lymph node involvement ( Table 3 ). 47% of Grade I tumors showed moderate p53 expression (Figure 1a, b ). Maximum no. of Grade II tumors showed moderate to high p53 expression (Figure 2a, b ). 41.0% of Grade III tumors showed high p53 expression (Figure 3a, b) (Table 4 ). IDC (NOS) showed maximum of moderate to high p53 expression. Out of 4 cases of LCA, 2 showed moderate & 2 showed low p53 expression (Figure 4a, b).

One case of mucinous carcinoma and metaplastic carcinoma each showed high p53 expression (Figure 5a,b ; 6a,b).

Number of patients 8 10 28 26 72

Percentage % 11.1 % 13.9 % 38.9% 36.1 % 100.0 %

Table 2: Correlation of P53 with tumor size Tumor size (mm)

Number of patients

< 20 mm (T1) 20 â&#x20AC;&#x201C; <50 mm (T2) >50 mm (T3) Total

12(16.7%) 46(63.9%) 14(19.4%) 72(100%)

P-53 expression <5% 3 3 2 8

5-19% 2 6 2 10

20-50% 4 19 5 28

>50% 3 18 5 26

Table 3: Correlation of p53 with Lymph node status Lymph node status

Number of patients

Negative (N0) Positive (1-3) Positive (4-9) Positive (>9) Total

14 26 24 8 72

<5% 7 0 1 0 8

P53 Expression 5-19% 20-49% 2 3 5 12 1 11 2 2 10 28

>49% 2 9 11 4 26

<5% 3 3 2 8

P53 expression 5-19% 20-49% 5 8 3 13 2 7 10 28

>49% 1 16 9 26

Table 4: Correlation of P53 with tumor grade Histological (SBR) grade

Number of pt (n=72)

Grade I Grade II Grade III Total

17 33 22 72

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gupta et al.

A-165

TABLE 5: Correlation of P53 & Lymph node status with other studies Number of lymph node involved

Ivkovic-Kapicl T. et al[22]

Jeong Han et al[23]

Banu Lebe et al [19]

Present study

P<0.05 Significant association

P> 0.5 No significant association

P> 0.05 No significant association

P = 0.0002 *** significant association

N0- (0 lymph node) N1- (1- 3 lymph node) N2- (4-9 lymph node) N3- (≥ 10 lymph node)

Fig. 1a: Microphotograph of Grade I, IDC (NOS) showing prominent tubular formation (H&E, ×400).

Fig. 1b: Microphotograph showing High (95%) P53 expression (IHC, ×400)

Fig. 2a: Microphotograph showing a case of grade II (IDC-NOS) with tumor cells arranged in nests and cords (H&E, ×400).

Fig. 2b: Microphotograph expression. (IHC, ×400)

www.pacificejournals.com/apalm

showing

moderate

eISSN: 2349-6983; pISSN: 2394-6466

P53

A-166

p53 Expression in Breast Carcinoma

Fig. 3a: Microphotograph of Grade III (NOS) showing pleomorphic tumor cells in sheets (H&E, ×400).

Fig. 3b: Microphotograph showing high p53 expression (IHC X 400)

Fig. 4a: Microphotograph of Lobular carcinoma showing predominant tumor cells which are of low grade & less pleomorphic in Indian file pattern. (H&E, ×100, ×400).

Fig. 4b: Microphotograph showing High p53 expression (IHC x400 )

Fig. 5a: Microphotograph showing tumor cells in a pool of extracellular mucin (H&E, ×400).

Fig. 5b: Microphotograph showing high p53 expression (IHC x 400).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gupta et al.

A-167

Fig. 6a: Microphotograph of metaplastic carcinoma Showing sheets of spindle shapes cells with no morphologic epithelial differentiation. Inset: showing spindle cells with atypical mitosis.(H&E, Ă&#x2014;400).

Fig. 6b: Microphotograph showing high p53 expression (IHC x 400)

Discussion

Breast carcinoma is a disease with a tremendous heterogeneity in its clinical behaviour. Pathological variables such as tumor size, histological type, histological grade, lymph node metastasis, vascular space invasion, tumor cell proliferation, extent of ductal carcinoma in situ are the predictors of prognosis & for the need of adjuvant therapy. Biomarkers such as ER, PR, HER- 2, expression represent the most acceptable ones for predicting prognosis, response/resistance to treatment and in deciding the use of newer drugs such as transtuzumab in the case of HER-2 over expression.

one of the most powerful predictors of tumor behaviour in breast cancer. Larger tumor size has poor 5 year survival rate. In present study, Maximum number of tumors was (T2) 20-50 mm size which was similar to study conducted

by Raina et al[14] and Badwe et al.[15] But a major difference we found was 19.4 % tumors were of size > 5 cms, possibly includes those cases presented late to the clinics or because of lack of awareness among the population. Since most of the breast cancer mass are relatively painless & are ignored by the patients till they reach a significant palpable size or cause complications like skin or nipple involvement, till then it remains undiagnosed.

It is a documented fact that advancement of age increases the risk of breast cancer and most women are over the age of 60 yrs when diagnosed.[9] Although there is evidence that Indian women are more likely to develop breast cancer at earlier ages than their Western counterparts.[10] The age of presentation in our study ranged from 21 to 73 years with mean age of 50 years. Similar observation was made by Christy BA.[11] The early age of presentation as compared to Robab et al [9] & Costa M et al [10] was seen because of low socioeconomic status in general population. In the present study, 56.9 % (41 cases) were in upper outer quadrant, which was slightly higher compared to studies by Meena et al [12] (54%), Costa M et al [10] (54.1%) & Christy BA [11] (50%).

The relatively high proportion of carcinomas arising in the upper outer quadrant of the breasts is argued to support the hypothesis that underarm cosmetics cause breast cancer.

The standard hypothesis is a reflection of the greater amount of breast tissue in this quadrant.[13] Tumor size is

In the present study, 86.1% (62 Cases) were IDC (NOS).

Similar observations were made by Zfarani B et al[16], Peiro G et al.[17] Other types of carcinoma had varied incidence in different studies. Zafarani et al[16] reported no other types of carcinoma whereas we got 9.7% of cases which included medullary carcinoma, mucinous carcinoma, & metaplastic carcinoma. Grade of any tumor is based on the fact that degrees of malignancy of tumor are reflected in their morphological structure. Our study showed that Majority of studies including our study have reported majority of carcinomas to be histological grade 2; Grade 1 tumors were variable in different studies. Tumor grade is the description of a tumor based on how abnormal the tumor cells and tumor tissue look under a microscope and indicates how quickly the tumor is likely to grow and spread. It differs depending on the type of cancer and one of the factors considered when planning treatment for a patient. It is a well established fact that the larger the tumour diameter,

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-168

p53 Expression in Breast Carcinoma

the greater the number of axillary lymph nodes metastatic, also the worse the outcome.[18] In our study, Since there were tumors of >2 cm or more in 83.3% of cases, a higher lymph node involvement by the tumor cells was found in 80.6% of cases when compared to other studies.

The p53 gene appears to play a prime role in controlling cell proliferation and apoptosis, and in DNA repair. The genetic changes most commonly found in breast cancer are alterations in the p53 tumor-suppressor gene, with an incidence ranging from 15 to 50% in different series.

Our study Showed no significant association between p53 with tumor size. Similar observations were made in study conducted by Banu Lebe et al.[19] These variations can be explained by the quality of the tissue used (frozen, fixed, stored for a long time, etc), the number and type of antibody used, and also the interpretation of the results; it is well known that some positive cells do not take the stain, which often happens. [20]. It may also depend on the number of cases of each histologic type in a given series, since the accumulation of p53 protein is more common in high grade ductal carcinoma and medullary carcinoma.[21] The most important prognostic factor for breast cancer is lymph-node status. Nevertheless, numerous attempts have been made to find other parameters that will aid in predicting the clinical outcome more accurately and in selecting the most appropriate therapy for each case. In our study, there was a significant association of P53 with Lymph node involvement & similar observations were made in study conducted by Ivkovic-Kapicl et al.[22] Feki et al.[20] found a correlation between p53 and other prognostic factors. But P53 expression was not shown to be an independent prognostic factor in disease-free interval or ten-year survival. No significant association was found in study conducted by Jeong Han et al [23] & Banu Lebe et al.

[19] It is also possible that the p53 protein plays an important role in the progression of malignant human tumors.[23] In breast cancer, immunohistochemical positivity is found in up to 25% of in situ carcinomas, which suggests that they may occur in early stages of the disease, before it becomes infiltrating. The staining pattern of metastatic lymph nodes are usually similar to those of primary tumors; only very rarely does a positive stain for p53 occur in a node when the tumor is negative. [24, 25] In our study, We found a significant association between tumor grade and p53 expression. Our finding coincides with studies conducted by Yamashita et al[26] and Jamaica D. Cass et al ( Table 6 ).[27] The p53 alteration may reflect a greater degree of tumor progression and a higher proliferation rate, as well as a greater probability of micro metastases. Mutation and the over expression of p53 protein are directly related to histological grade and

cell-proliferation fraction. Cases positive for p53 could be interpreted as those which have lost a mechanism for controlling the inhibition of cell proliferation and have gained an activator for malignancy potential.[21] In our study we had maximum number of IDC (NOS) cases and very few numbers of other histopathological types; hence we could not find correlation of p53 with histological type of tumor. But study conducted by Sirvent et al [21] showed p53 expression distribution by histological type highlighted the absence of any preference for p53 positivity and/or negativity in the case of ductal carcinoma, negativity in lobular carcinoma and strong positivity in medullary carcinoma.

TABLE 6 Correlation of P53 & tumor grade with other studies.

Histological (SBR) grade

Yamashita et al.[26]

Jamaica D. Cass et al[27]

Present study

Grade I

P<0.0001 Significant association

P=0.032 Significant association

P = 0.0342 Significant association

ď Ź

ď Ź Grade

II

ď Ź Grade

III

Tumor grade, a parameter although easily assessed on core biopsies, but is not sufficient to define prognosis and it cannot be assessed optimally in post neoadjuvant settings.[28] Furthermore, as more conservative surgeries and staging techniques increasingly are introduced into the management of breast carcinoma e.g., increasing use of fine needle aspiration over tissue biopsies, much useful prognostic information, including tumor size, tumor grading, vascular invasion and lymph node involvement, will not be available. In this setting new markers such as p53 can be applied on small samples and they may be of prognostic significance which will be invaluable.[29] There are studies contradicting our findings and the differences may be due to heterogeneous group of population, different methods for assaying p53, or different cut offs to designate high or low.

Conclusion

In conclusion; we found a significant correlation of P53 with tumor grade and also with lymph node status, but not with tumor size. Breast cancer aggressiveness appears to be directly related to the percentage of p53 positive cancer cells. The p53 alteration reflects a greater degree of tumor progression and a higher proliferation rate and hence over expression of both proteins is directly related to histological grade and cell-proliferation fraction. Cases positive for p53 could be interpreted as those which have lost a mechanism for controlling the inhibition of cell proliferation and have gained an activator for malignancy potential. In breast cancer, we suggested that the over expression of p53

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gupta et al.

A-169

protein in the nucleus is an indicator of poor prognosis.

We are of the opinion a large scale, standard multivariate studies to determine correlation between high p53 index and other prognostic markers in breast carcinoma patients.

10. Costa JM, Tadroo T, hitton G, Birdsong G. Breast fine needle aspiration cytology utility as a screening tool for clinically palpable lesion. Actacytol 1993; 37(4): 461-77.

Acknowledgements

11. Hasty P, Christy BA. p53 as an intervention target for cancer and aging. Pathobiology of Aging & Agerelated Diseases. 2013:8; 3.

Nil

Funding None.

Competing Interests None Declared

REFERENCE

1. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. GLOBOCAN v1. 2, Cancer Incidence and Mortality Worldwide: IARC Cancer Base No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer; 2010.

2. Carter D, Schnitt SJ, Millis RR. Chapter 9. The breast: Sternberg SS, Mills SE, Carter D, editors. Sternberg’s diagnostic surgical pathology. 5th ed. Lippincott Williams & Wilkins; 2004: 321.

3. Susan C. Lester. Chapter 23. The Breast. Robbins and Cortan Pathologic Basis of Disease. 8th Edition. South asia: Elsevier publication; 2011: 1089.

4. Mirza AN, Mirza N Q, Vlastos G, Singletary SE. Prognostic factors in node-negative breast cancer: a review of studies with sample size more than 200 and follow-up more than 5 years. Annals of surgery.

2002 Jan 1;235(1):10-26 5. Taylor CR, Shi SR, Barr NJ, Wu N. Techniques of immunohistochemistry: principles, pitfalls, and standardization. Diagnostic immunohistochemistry.

2nd edition, Churchill Livingston. Elsevier; 2006: 3-44.

6. Gu, Jian, et al. “Roles of tumor suppressor and telomere maintenance genes in cancer and aging—an epidemiological study.” Carcinogenesis 2005; 26.10: 1741-1747.

7. Liu, Kang, et al. “Regulation of p53 by TopBP1: a potential mechanism for p53 inactivation in cancer.” Molecular and cellular biology 2009; 29.10: 2673-2693.

8. Axelrod DE., et al. “Prognosis for survival of young women with breast cancer by quantitative p53 immunohistochemistry.” Cancer and clinical oncology 2012; 1.1: 52-65.

9. Robab S, et al. “Immunohistochemical assessment of P53 protein and its correlation with clinicopathological characteristics in breast cancer patients.” Indian Journal of Science and Technology 2014; 7.4: 472-479. www.pacificejournals.com/apalm

12. Meena SP, Hemrajani DK, Joshi N. A comparative and evaluative study of cytological and histological grading system profile in malignant neoplasm of breast--an important prognostic factor. Indian journal of pathology & microbiology. 2006 Apr; 49(2):199-202.

13. Lee AH. Why is carcinoma of the breast more frequent in the upper outer quadrant? A case series based on needle core biopsy diagnoses. The Breast. 2005 Apr 30;14(2):151-2.

14. Raina V, Bhutani M. Bedi R. Sharma A, Deo SV, Shukla NK et al. Clinical features and prognostic factors of early cancer at a major cancer canter in north india. Indian Journal cancer. 2005; 42: 40-5 15. Badwe RA, Gangawal S, Mittra I, Desai PB. Clinicopathological features and prognosis of breast cancer in different religious communities in India. Indian Journal of cancer. 1990 Dec; 27(4):220-8.

16. Zafrani B, Aubriot MH, Mouret E, De Cremoux P, De Rycke Y, Nicolas A, Boudou E, Vincent-Salomon A, Magdelenat H, Sastre-Garau X. High sensitivity and specificity of immunohistochemistry for the detection of hormone receptors in breast carcinoma: comparison with biochemical determination in a prospective study of 793 cases. Histopathology. 2000;37(6):536-45.

17. Peiró G, Adrover E, Aranda FI, Peiró FM, Niveiro M, Sánchez-Payá J. Prognostic Implications of HER-2 Status in Steroid Receptor–Positive, Lymph Node– Negative Breast Carcinoma. American journal of clinical pathology. 2007 May 1;127(5):780-6.

18. Pleşan DM, Georgescu CV, Pătrană NI, Pleşan C, Stoica D. Immunohistochemical study of p53 and Ki67 in a group of patients with mammary carcinoma.

Rom J Morphol Embryol. 2010; 51(3): 459-65.

19. Lebe BA, Canda TÜ, Tuna BU, Sagol O, Ozer E. The evaluation of p53 and Ki67 expressions in invasive micropapillary carcinoma of the breast and its relation with other prognostic parameters: Thirty two cases.

Turk J Cancer. 2002; 32:48-14.

20. Feki A, Irminger-Finger I. Mutational spectrum of p53 mutations in primary breast and ovarian tumors.

Critical reviews in oncology/hematology. 2004 Nov 30; 52(2):103-16. eISSN: 2349-6983; pISSN: 2394-6466

A-170

p53 Expression in Breast Carcinoma

21. Sirvent JJ, Salvado MT, Santafe M, Martinez S, Brunet J, Alvaro T, Palacios J. p53 in breast cancer.

Its relation to histological grade, lymph-node status, hormone receptors, cell-proliferation fraction (ki-67) and c-erbB-2. Immunohistochemical study of 153 cases. Histopathol 1995;10: 531 -539 22. Ivković-Kapicl T, Panjković M, Ninčić D, KneževićUšaj S. Factors correlating with lymph node metastases in patients with T1 ductal invasive breast cancer.

Archive of Oncology. 2006;14(1-2):19-22.

23. Han JS, Cao D, Molberg KH, Sarode VR, Rao R, Sutton LM, Peng Y. Hormone receptor status rather than HER2 status is significantly associated with increased Ki-67 and p53 expression in triple-negative breast carcinomas, and high expression of Ki-67 but not p53 is significantly associated with axillary nodal metastasis in triple-negative and high-grade non– triple-negative breast carcinomas. American journal of clinical pathology. 2011 Feb 1;135(2):230-7.

24. Porter PL, Gown AM, Kramp SG, Coltrera MD. Widespread p53 overexpression in human malignant tumors. An immunohistochemical study using methacarn-fixed, embedded tissue. The American journal of pathology. 1992 Jan; 140(1):145-153.

25. Song HS, Do YR, Kang SH, Jeong KY, Kim YS. Prognostic significance of immunohistochemical

expression of p53 gene product in operable breast cancer. Cancer Research and Treatment. 2006 Dec 31;38(4):218-23.

26. Yamashita H, Nishio M, Toyama T, Sugiura H, Zhang Z, Kobayashi S, Iwase H. Coexistence of HER2 overexpression and p53 protein accumulation is a strong prognostic molecular marker in breast cancer. Breast Cancer Res. 2004 Jan 1;6(1):R24-30.

27. Cass JD, Varma S, Day AG, Sangrar W, Rajput AB, Raptis LH, Squire J, Madarnas Y, SenGupta SK, Elliott BE. Automated quantitative analysis of p53, cyclin D1, Ki67 and pERK expression in breast carcinoma does not differ from expert pathologist scoring and correlates with clinico-pathological characteristics.

Cancers. 2012 Jul 18;4(3):725-42.

28. Matsubara N, Mukai H, Fujii S, Wada N. Different prognostic significance of Ki-67 change between pre-and post-neoadjuvant chemotherapy in various subtypes of breast cancer. Breast cancer research and treatment. 2013 Jan 1; 137(1): 203-12.

29. Billgren AM, Tani E, Liedberg A, Skoog L, Rutqvist LE. Prognostic significance of tumor cell proliferation analyzed in fine needle aspirates from primary breast cancer. Breast cancer research and treatment. 2002 Jan 1; 71(2):161-70.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article CD-10: An Emerging Biomarker in Prognostication of Infiltrating Duct Carcinoma Breast S.K. Nema* and Sanjeev Narang Dept. of Pathology, Index Medical College, Hospital & Research Centre, Index City, Indore, India

Keywords: IDC, CD10, ER, PR, Her2neu

ABSTRACT Background: All carcinomas of the breast can be classified based on the hormone receptors on cells and also by cell of origin. Generally most of health setup in developing countries carries out assessment of tumour behavior for breast cancer based on three parameters: tumour size, lymph node status, and histological grade. A few better established medical institutes have added immunohistochemistry to forecast the tumour outcome and guide the clinicians for better management of such patients. In carcinoma breast prognostic panel consisting of Estrogen Receptor (ER), Progesterone Receptor (PR) & Her2neu is being commonly used for prognostication of the Infiltrating duct carcinomas (IDC). With new breakthrough in the field it has become clear that stroma also plays a significant role in the spread of carcinoma breast and the proliferation rate of tumors has been shown to be a good predictor of aggressiveness of the tumor, hence new markers such as Ki67gene over expression and CD 10 have been added to the armament for prognostication . The aims of this study are to estimate the frequency of expression of stromal CD10 in invasive breast carcinomas and also to assess prognostic significance of stromal CD10 marker.

Methods: In this study, we examined 20 cases of invasive breast carcinoma. Apart from routine H&E stain, the selected cases were stained with concurrent immunohistochemical prognostic panel (ER, PR, Her2neu) and CD10 stromal marker, to characterize and to identify prognostic markers that can identify tumors with more aggressive behavior.

Result: We found 06 cases were of the triple-negative phenotype (ER, PR, Her2neu) and all exhibited strong CD10 stromal positivity. The majority of these tumors were grade III, IDC. There were positive associations with larger size, pushing margins, poorer Nottingham Prognostic Index (NPI). In all tumors, we considered tumor size, lymph node stage, and hormone receptors as the most useful prognostic markers and found that the traditional markers indicating poor outcome correlated well with CD 10 stromal positivity in 80% cases.

Conclusion: In the present study all triple-negative cases with positive nodal status , larger tumor size and higher grade, the hormonal expression revealed a strong correlation with CD 10 marker which appears to be a very strong potential and the most useful emerging prognostic marker.

*Corresponding author: Dr. (Maj. Gen) S.K. Nema, Professor & Head, 102, Elite Saket, 103 Saket nagar, Indore, MP, India Phone: +91 8989535934 Email: sknema@hotmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-172

CD-10 in Prognostication of Ca Breast

Introduction

Carcinoma breast is a growing menace world over and is taking its toll relentlessly. It is the leading cause of death in Indian women. It is estimated that about 1, 15,000 new patients are added every year and there are approximately 53,000 deaths.[1] Human breast carcinomas represent a heterogeneous group of tumors that are diverse in behavior, outcome, and response to therapy. Workers from all over the globe are trying to come up with novel strategies for early diagnosis as well as to find markers for better prognostication. Traditionally, prognostication in breast cancer relied on the clinicopathological parameters and individual molecular markers such as hormone receptors.

All carcinomas of the breast can be classified based on the hormone receptors on cells and also by cell of origin.

Assessment of tumor behavior for any breast cancer has been based on three parameters: tumor size, lymph node status, and histological grade. Authors have suggested many tools which have been have been used to improve the predictive value of the above individual factors; these include TNM staging and Nottingham prognostic index (NPI). To these, hormonal status of patients is added to pronounce the prognosis of these cases. These include Estrogen receptor (ER), Progesterone receptor (PR), and Her2neu. [2] With new research in the field it has become clear that stroma also plays a significant role in the spread of carcinoma breast and the proliferation rate of tumors has been shown to be a good predictor of aggressiveness of the tumor, hence new markers such as Ki67gene over expression and CD 10 have been added to the armament for prognostication of these tumours. Although breast cancer is an epithelial malignancy, never the less the stroma has a key role in its development and pathogenesis.

The scientists have dwelled upon this fact and are trying to establish that stromal markers may become novel factors in assessing the prognosis of invasive breast cancer. These have not been studied extensively till date. More recently, a combination of CD10 with the established four markers (ER, PR, Her2neu and Ki67) has been shown to have a strong prognostic impact that is similar to that of gene expression assays described by many studies. Expression of CD10 has been sometimes observed in the stromal cells of invasive ductal carcinoma, but its clinical significance has never been studied. It has been recently documented that CD-10 is present on the stromal cells in some cases of carcinoma breast. It has also been postulated that CD-10 is upregulated in these cases.

CD10 is a cell surface neutral endopeptidase that is not consistently expressed in the stromal cells of the normal

breast. Normally the basal cells are ER negative but they are CD-10 positive and therefore CD-10 is used as a marker for basal cells. CD-10 is a 90- to 110-kDa cell surface zinc dependent metalloproteinase which is known as “Common Acute Lymphoblastic Leukaemia Antigen” (CALLA). It is now known that CD-10 is constantly expressed by the myoepithelial cells of the human breast during development and after maturation. It is considered a specific and useful marker for myoepithelial cells. [3] The aims of this study are to estimate the frequency of expression of stromal CD10 in invasive breast carcinomas and also to assess prognostic significance of stromal CD10 marker.

Material and Methods

This study investigated 20 cases of invasive breast carcinoma obtained from patients presenting from January to December 2015. Patient’s clinical history and tumor characteristics were assessed in a uniform fashion. A scheme for prognostication was formulated to follow up these cases for assessing a disease free interval (DFI) and to detect the overall survival (OS). The DFI was defined as the interval (in months) from the date of the primary surgery to the first loco-regional recurrence or distant metastasis. The OS was the time, in months, from the date of the primary surgery to the time of breast cancer-related death. The NPI was calculated by using the following equation: NPI = 0.2 tumor size (cm) + grade (1–3) + lymph node score (1–3).

[4] A total of 20 cases of infiltrating carcinoma of breast were included in the study. Representative sections were taken and Hematoxylin and Eosin (H&E) staining was done (Fig1). Immunohistochemistry was performed with ER (Fig3), PR(Fig4), Her2neu(Fig5), and CD10(Fig2), stromal marker. Stromal expression of CD10 (>10% stromal positivity was considered positive) in IDC was noted and was statistically analyzed with different known traditional prognostic markers of breast carcinoma.

Result

In the current study, 20 cases of IDC were analysed for 3 traditional markers ER,PR and Her2neu and we correlated them with CD10 stromal positive cases. We encountered a triple-negative phenotype in 06 cases. All these patients were >40 years of ageThe majority (95%) of tumors were ductal carcinoma of no special type (duct/NST) Table 2 shows the main features of triple-negative tumors compared with nontriple-negative tumors concerning different clinicopathological variables and biomarkers used in the current study. Triple-negative phenotype was associated with larger size, grade 3 tumors, and pushing margin. Significant association was found with lymph node

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Nema et al.

A-173

status. The stromal invasion seen by H&E stained section and positive CD 10 status was well delineated in all triple negative phenotypes (Figs. 1 -5).

There were positive associations with larger size, pushing margins, poorer Nottingham Prognostic Index (NPI). In all tumors, we considered tumor size, lymph node stage, and hormone receptors as the most useful prognostic markers and found that the traditional markers indicating poor outcome correlated well with CD 10 stromal positivity in 80% cases.

We found 06 cases were of the triple-negative phenotype (ER, PR, Her2neu) and all exhibited strong CD10 stromal positivity. The majority of these tumors were grade III, IDC.

Table: 1.Relation of CD10 with Age, Tumour size, Lymphnode (LN) metastasis and HPE Grade S. No

Parameter

No: of Cases

CD10 +ve

CD10-ve

1.

Age >40 years

20

11

09

2.a.

Tumour size<5cms

04

03

01

2.b.

Tumour size>5cms

16

10

06

3.a.

Axillary LN +ve

10

08

02

3.b.

Axillary LN-ve

10

03

07

4.a

HPE Grade I

01

00

01

4.b.

HPE Grade II

07

05

02

4.c.

HPE Grade III

12

09

03

Table:2 Comparison of CD10 with traditional IHC Panel S. No

IHC

No: of Cases

CD-10 Positive

CD10 Negative

1.a

ER +ve

14

06

08

1.b

ER-ve

06

06

00

2.a

PR+ve

05

04

01

2.b

PR-ve

15

07

08

3.a

Her2neu +ve

14

10

04

3.b

Her2neu -ve

06

06

00

4.

Triple –ve

06

06

00

Fig. 1: Stromal Infiltration H & E(40x)

www.pacificejournals.com/apalm

Fig. 2: Stromal Infiltration CD-10 (10x)

eISSN: 2349-6983; pISSN: 2394-6466

A-174

CD-10 in Prognostication of Ca Breast

Discussion

Proliferation of stromal cells is a common feature in cancer invasion and metastasis. CD10 is a zincdependent peptidase (metalloproteinase), surface neutral endopeptidase which degrades a variety of bioactive peptides. Earlier studies suggested that CD10 expression in tumor stroma is associated with biological aggressiveness of the tumor. To date, only one study has addressed the clinical significance of stromal CD10 expression in IDC. [5]

Fig. 3: ER positive (40x)

Fig. 4: PR positive (10x)

Fig. 5: Her2neu positive (40x)

In the present study, we used immunohistochemical staining to investigate the expression of CD10 in the stroma of IDC. Normal myoepithelial cells lining the acinar and ductal structures in normal parenchyma adjacent to the tumor were used as positive internal control. According to the scoring system adopted, stromal CD10 expression was found in 80% of the cases (including 25% weakly positive and 55% strongly positive specimens) which is a significant frequency. Makretsov et al. found stromal CD10 expression in 79% of IDC. [6] Masaki et al. proposed that the CD10 expression to be considered positive when more than 10% of the stromal cells in vicinity of the neoplastic epithelial cells, were positive. Based on this criterion, they detected stromal CD10 expression in 19% of IDC. [7] In this study we had 45% cases showed CD10 positivity in stroma surrounding the sheets of neoplastic epithelial cells.

We in this study also observed that the lymph node metastasis correlates significantly with stromal CD10 positivity; therein the CD-10 is maximally positive in 08 out of 10 cases having lymph node metastasis which is in concordance with the study by Cui yazhon et al who reported this biomarker as positive in cases associated with lymphnode metastasis. [8] Our study shows that out of the 20 cases included, 12 were grade III and out of these 09 exhibited strong CD-10 positivity which is in agreement with the findings reported by Nikita A Makretstov et al in a study that was done on 438 cases and exhibited the maximum CD-10 positivity in grade III cases. We found that other than grade III tumours (60%), there were Grade II cases (35%) were also CD-10 positive.

Stromal expression of CD10 was found to be significantly associated with increasing tumor grade .According to a study by Makretsov et al. percentage positivity of strong CD10 increased from 29% to 59% in grade I to grade III. Our results also showed very similar trends. One case in our study was of IDC with extensive in situ component.

Extensive in situ component was clearly highlighted by strong positivity of CD10 in myoepithelial cells. The same case also showed foci of strong stromal CD10 positivity indicating invasion. [6] Martinez et al. proved in their study that there is a relationship between the presence

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Nema et al. of extensive intraductal component and the risk of local recurrence for patient with IDC treated with conservative surgery and radiation surgery. [9] We in this study concentrated on the most commonly used traditional biomarkers in vogue; those are ER, PR and Her2neu and their relation with CD10 stromal marker. The hormone receptor-negative group includes absent hormone receptor (ER & PR) and absent Her2neu expression called as triple-negative subtype of IDC. These tumours have been reported to have very poor prognosis. In our study we found 14 cases were ER Positive (Fig3) and Her2neu positive (Fig5). All 06 ER negative and Her2neu negative cases correspondingly showed CD10 stromal positivity (Fig2).

Only few studies are available which have emphasized that extensive intraductal CD 10 positive component constitutes a very important predictive factor for local recurrences.

One such study showed statistically significant correlation between strong CD10 staining and ER negativity. We also report strong positivity for the CD 10 marker in all 06 ER negative cases. Therefore in our study, CD10 was found to have good correlation with ER negativity; however, it was not statistically significant probably due to less number of cases in our study. Makretsov et al. showed statistically significant correlation between strong CD10 positive staining and ER negativity. [6]

A-175

Acknowledgements

We sincerely acknowledge the contributions of Shri Suresh S. Bhadoria, the Chairman of our Institute in preparing this article.

Funding None

Competing Interests None declared

References

When we stratified the cases in the present study all triplenegative cases with nodal status positive, larger tumor size and higher grade, the hormonal expression revealed a strong correlation with CD 10 marker which appears to be a very strong potential and the most useful prognostic marker.

1. Two-year report of the population based cancer registries, 1999-2000, National cancer registry programme. (Last accessed on 2013 Nov 15) in ICMR Report [Internet] 2. Mori I, Yang Q, Kakudo K. Predictive and prognostic markers for invasive breast cancer. Pathol Int. 2002; 52: 186–194.

3. Makretsov NA, Hayes M, Carter BA, et al. Stromal CD10 expression in invasive breast carcinoma correlates with poor prognosis, estrogen receptor negativity, and high grade. Mod Pathol 2007; 20(1): 84-9.

4. Galea MH, Blamey RW, Elston CE, Ellis IO. The Nottingham Prognostic Index in primary breast cancer. Breast Cancer Res Treat.1992; 22: 207–219.

5. Iwaya K, Ogawa H, Izumi M, Kuroda M, Mukai K. Stromal expression of CD10 in invasive breast carcinoma: a new predictor of clinical outcome.

Virchows Arch 2002; 440(6): 589-93.

6. Makretsov NA, Hayes M, Carter BA, Dabiri S, Gilks CB, Huntsman DG. Stromal CD10 expression in invasive breast carcinoma correlates with poor prognosis, estrogen receptor negativity, and high grade. Modern Pathology, 2007.1, 84–89, 7. Masaki T, Keiichi I, Masahiko K, Miki I. The stromal expression of CD10 in breast carcinoma. J of Tokyo Med University 2001; 59: 45-50.

8. Yazho C, Wenlv S, Weidong Z, Licun W. Clinicopathological significance of stromal myofibroblast in invasive ductal carcinoma of breast.

Tumor boil 2004;25:290-5.

9. Martinez, C. Bianco, M. De Santis, et al., EGFR related peptides and their cognate receptors in breast cancer in Breast Cancer; In: Molecular Genetics Pathogenesis and Therapeutics, Humana Press, Totowa, NJ, USA, 2nd edition, 2001, 31–57.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Same study also reported no statistical significance between stromal CD10 expression and PR status. This is in agreement with our study, where CD10 was found to have good negative correlation with PR status. In this study we found only 07 mild CD10 positivity in 15 PR negative cases whereas 05 PR positive cases showed CD10 positivity in 04 cases.

Conclusion

Though this was a pilot study the follow up was possible in two cases that are disease free for last 10 months. Another 03 patients who were triple negative are also doing well for last 06 months. None of the CD10 positive cases have shown any evidence of recurrence till now.

Original Article Megakaryocytes in Chronic Phase of Chronic Myeloid Leukemia: A Descriptive Case Series Arun Kumar Arunachalam1, Mili Jain1*, Ashutosh Kumar1, Rashmi Kushwaha1, Uma Shankar Singh1 and Anil Kumar Tripathi2 Department of Pathology, King George’s Medical University, Lucknow, U.P., India Department of Clinical Hematology, King George’s Medical University, Lucknow, U.P., India 1

2

Keywords: Chronic Myeloid Leukemia, Megakaryocytes, Micromegakaryocytes, Bone Marrow Fibrosis.

ABSTRACT Background: Megakaryocytic proliferation and functional alterations are frequently observed in various myeloproliferative neoplasms (MPN). An analysis of these alterations provides clue to the diagnosis of MPN such as essential thrombocythemia and myelofibrosis. We in our descriptive study have tried to evaluate and identify the morphological features of the megakaryocytes seen in chronic myeloid leukemia- chronic phase (CML-CP).

Methods: Bone marrow aspirate and trephine biopsy from 31 newly diagnosed cases of CML-CP were evaluated for the morphological parameters including count, distribution, clustering, cytoplasmic granularity, nuclear lobes, micromegakaryocytes, fragmented nuclei, bare nuclei, and emperipolesis. All the cases were also evaluated for marrow reticulin fibrosis Result: Megakaryocytic count was increased in 58% of cases (18 out of 31), 67.7% had parasinusoidal distribution, 67.7% had no megakaryocytic clusters. Hypolobation of nuclei and presence of micromegakaryocytes were consistent findings in all the cases. The megakaryocyte count showed a positive correlation with the grade of marrow reticulin fibrosis and peripheral blood platelet count.

Conclusion: Characteristic changes in megakaryocyte number, distribution and morphological features is seen in CMLCP and may help in differentiating it from other MPN’s.

*Corresponding author: Dr Mili Jain, Department of Pathology, King George’s Medical University, Lucknow, U.P., India. Pin code- 226003 Phone: + 91 9793546090, 05224075989 Email: milijain786@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Arunachalam et al.

Introduction

The myeloproliferative neoplasms (MPNs) being clonal hematopoietic stem cell disorders are characterised by alterations in one or more myeloid lineages which include megakaryocytes. Megakaryocytic alterations play key diagnostic role in recognition of entities such as Primary myelofibosis (PMF) and Essential thrombocythaemia (ET).

[1] These alterations also affect the clinical presentation, progression to fibrosis, prognosis and treatment. [2] The early phases of MPNs may have overlapping clinical and laboratory features such as cases of chronic myeloid leukemia in chronic phase (CML-CP) and Polycythemia vera (PV) with markedly raised megakaryocyte count. An analysis of changes in the megakaryocyte lineage can help in differentiating various MPN disorders in such situations.

In our work we extensively studied the megakaryocyte alterations (numerical and morphological) in 31 cases of chronic myeloid leukemia- chronic phase (CML-CP).

Materials and Methods

In this prospective descriptive study 31 newly diagnosed cases of CML-CP were selected as the study group. To compare the megakaryocyte counts, 25 aspiration smears and trephine sections which were reported as normal haematopoiesis with normal peripheral blood parameters, were selected at random. Morphological assessment of megakaryocyte parameters was done on bone marrow aspirate smears, touch and roll imprints of biopsies and biopsy tissue sections. After getting an informed consent, the bone marrow aspiration and biopsy were done from the posterior superior iliac spine with the patient in corresponding lateral decubitus position. [3] The aspirate, touch and roll imprints were stained with Leishmann stain and the biopsy sections were stained with hematoxylin and eosin. [4] Silver stain was used for detection of reticulin fibrosis. [5] The slides were examined independently by two observers and the final observations were made subsequently. The diagnosis in all cases was confirmed as CML after demonstration of BCR-ABL fusion using fluorescence in situ hybridization (FISH) or Reverse transcriptase polymerase chain reaction (RT-PCR).

A minimum of 40 megakaryocytes were assessed in each case. The megakaryocyte parameters assessed were as follows: Megakaryocyte Count, Distribution and Clustering: The number of megakaryocyte per 10 HPFs was estimated. The distribution of megakaryocytes in the trephine sections was categorized into parasinusoidal, paratrabecular, diffuse and parasinusoidal with occasional paratrabecular distribution.

Presence of groups of five or more megakaryocyte was considered as megakaryocytic cluster. www.pacificejournals.com/apalm

A-177 Cytoplasmic Granularity: Megakaryocyte with pale grey or water clear cytoplasm with sparse or no granules were noted as hypo granular megakaryocyte while increased granularity which obscures rest of the cytoplasmic details were categorized as hypergranular forms. [6] Nuclear Lobes: The number of nuclear lobes in each megakaryocyte was noted based on which the megakaryocytes were segregated into four groups: Megakaryocyte with a single nuclear lobe, 2-3 nuclear lobes, 4-5 nuclear lobes and megakaryocyte with >5 nuclear lobes.

Dysplastic Features i.e Micromegakaryocyte and Fragmented Nuclei: Megakaryocyte with size equivalent to a large lymphocyte/monocyte, were categorized under micromegakaryocyte. [6] Megakaryocyte where the nuclear lobes are disjointed resulting in two or more segments of nucleus containing one or more nuclear lobe(s) within a single megakaryocyte were categorized under megakaryocytes with fragmented nuclei.

Miscellaneous Findings i.e. Bare Nuclei and Emperipolesis: Megakaryocytes with naked nucleus (either normal or dwarf) not surrounded by cytoplasm were noted as bare nuclei. Presence of marrow elements of either granulocytic or erythroid series within the megakaryocyte cytoplasm were noted as emperipolesis.

Grading of fibrosis on trephine biopsy was done based on the WHO grading of bone marrow fibrosis. [7] The statistical analysis was done using SPSS (Statistical Package for Social Sciences) Version 15.0 statistical Analysis Software. The values were represented in Number (%) and Mean ± SD.

Result

Megakaryocyte Count: The average megakaryocyte count in both aspirate smears and biopsy sections were higher in CML-CP when compared with the controls. 18 of the 31 CML-CP cases (58.0%) had an elevated megakaryocyte count, 10 (32.2%) had normal megakaryocyte count and 3(9.6%) had a lower megakaryocyte count. The other megakaryocyte parameters were analysed after dividing cases in three groups of normal, increased and decreased megakaryocyte count. [Table 1,2,3] Peripheral Blood Platelet Count: On comparison of platelet count with megakaryocyte count it was seen that the mean platelet count was significantly (p value 0.00) higher (mean 6.11lac/mm3) in case with raised megakaryocytic count as compared to those with normal or low megakaryocytic count. eISSN: 2349-6983; pISSN: 2394-6466

A-178

Megakaryocyte Morphology in CML-CP

Splenomegaly: The three groups did not show any statistically significant difference in the grade of splenomegaly (p value 0.960)

were seen in 33.3% (n=6) and 10% (n=1) cases with increased and normal megakaryocytic count respectively.

[Figure 1 B]

Fibrosis: Reticulin fibrosis was detected in 29 of the 31 cases (93.5%). In the overall 31 cases, 2 cases (6.5%) had no fibrosis in the marrow, 11 cases (35.5%) had Grade I fibrosis, and 12 cases (38.6%) had Grade II fibrosis while 6 cases (19.4%) had Grade III fibrosis. [Figure 2 C, 2D, 2E] Of the 17 cases which had megakaryocytic count more than 20 per hpf 13 had either grade II or III fibrosis. The three groups did not show significant difference in the fibrosis grade (p value 0.927).

Nuclear Lobes: Hypolobation was prominent in all the cases with an average of 46.94% of the total megakaryocytes.

The mean percentage of single lobed megakaryocytes was highest in cases with increased megakaryocytic count. The percentage of megakaryocytes with more than 5 nuclear lobes was significantly low with an average of 4.75% megakaryocytes. The mean percentage was lowest in cases with raised megakaryocytic count. [Figure 1C, 1D, 1E, 2B]

Distribution: The megakaryocyte in 21 (67.7%) cases had a parasinusoidal distribution, 4 (12.9%) cases had a diffuse distribution and 6 (19.3%) cases predominantly had parasinusoidal distribution with occasional paratrabecular megakaryocytes. Thus parasinusoidal was the predominant distribution pattern in majority of the cases. The paratrabecular or diffuse pattern of distribution was limited to the cases with a markedly elevated megakaryocyte count (p value 0.070)

Micromegakaryocytes: Micromegakaryocyte was seen in all the cases. The mean percentage of micromegakaryocytes was 26.6, 39, and 48.6 in cases with decreased, normal, increased megakaryocytic count respectively. [Figure1F, 2A] Nuclear Fragmentation: 48.4% of the cases showed occasional fragmentation in their megakaryocytic nuclei.

[Figure 1G] Bare Nuclei: Bare nuclei were detected in 71.0% of the cases.

Clusters: Megakaryocytic clusters were seen in 10 (32.3%) cases. Of these cases majority had increased megakaryocyte count (p value 0.04) [Figure 1A]

Emperipolesis: Emperipolesis was observed in 29% of the cases. This was more frequently seen in cases with raised megakaryocytic count. [Figure 1H]

Granularity: Normal cytoplasmic granularity was seen in 77.4 %( n=24) of the cases. Hypogranular megakaryocytes

Table 1 : Comparision of Platelet count, splenomegaly, grade of bone marrow fibrosis in case groups according to megakaryocyte count

No. in aspirate

No. In biopsy

PC

Splenomegaly

Fibrosis grade

Meg Count Decreased Normal Increased Total Decreased Normal Increased Total Decreased Normal Increased Total Decreased Normal Increased Total Decreased Normal Increased Total

N 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31

Mean 4.333 8.300 21.944 15.839 5.667 11.700 36.611 25.581 1.740 2.345 6.112 4.474 2.33 2.20 2.17 2.19 1.67 1.80 1.67 1.71

Minimum 3.0 6.0 7.0 3.0 5.0 7.0 18.0 5.0 1.2 1.2 2.0 1.2 2 0 0 0 1 1 0 0

Maximum 6.0 10.0 43.0 43.0 6.0 16.0 89.0 89.0 2.4 3.4 12.5 12.5 3 3 3 3 2 3 3 3

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

p- value 0.001

0.000

0.000

0.960

0.927

Arunachalam et al.

A-179

Table 2 : Comparison of megakaryocyte arrangement, distribution, cytoplasmic granularity in case groups according to megakaryocyte count

MEGAKARYOCYTE CLUSTER

DIFFUSE

PARSINUSOIDAL/ PARATRABECULAR PAR-SINUSOIDAL

GANULARITY

HYPOGRANULAR

MEG COUNT DECREASED NORMAL INCREASED TOTAL DECREASED NORMAL INCREASED TOTAL DECREASED NORMAL INCREASED TOTAL DECREASED NORMAL INCREASED TOTAL DECREASED NORMAL INCREASED TOTAL DECREASED NORMAL INCREASED TOTAL

N 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31

Mean .00 .10 .50 .32 .00 .00 .22 .13 .00 .00 .33 .19 1.00 1.00 .83 .90 1.00 .90 .61 .74 .00 .10 .33 .23

Minimum 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 1 0 0 0 0 0 0 0

Maximum 0 1 1 1 0 0 1 1 0 0 1 1 1 1 1 1 1 1 1 1 0 1 1 1

p- value 0.042

0.205 0.070

0.324

0.148

0.244

Table 3: Comparision of megakaryocyte nuclear features, % of micromegakaryocyte in case groups according to megakaryocyte count Meg Count Decreased Normal 1-2 Nuclei Increased Total Decreased Normal 2-3 Nuclei Increased Total Decreased Normal 4-5 Nuclei Increased Total Decreased Normal > 5 Nuclei Increased Total Decreased Normal % of Micromegakaryocytes Increased Total Decreased Normal Bare nuclei Increased Total Decreased Normal Emperipolesis Increased Total Decreased Normal Disjointed Nuclei Increased Total

www.pacificejournals.com/apalm

N 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31 3 10 18 31

Mean 30.000 41.500 52.778 46.935 38.333 35.000 32.778 34.032 26.667 18.500 12.500 15.806 5.000 5.000 1.944 3.226 26.667 39.000 48.611 43.387 .00 .70 .83 .71 .00 .20 .39 .29 .00 .50 .56 .48

Minimum 20.0 15.0 20.0 15.0 30.0 10.0 10.0 10.0 10.0 10.0 .0 .0 .0 .0 .0 .0 15.0 20.0 15.0 15.0 0 0 0 0 0 0 0 0 0 0 0 0

Maximum 40.0 75.0 85.0 85.0 50.0 50.0 50.0 50.0 40.0 30.0 40.0 40.0 10.0 15.0 15.0 15.0 35.0 70.0 80.0 80.0 0 1 1 1 0 1 1 1 0 1 1 1

eISSN: 2349-6983; pISSN: 2394-6466

p- value 0.096 0.708

0.118

0.215 0.196

0.010

0.312 0.218

A-180

Megakaryocyte Morphology in CML-CP

Fig. 1:

Bone marrow aspirate (Leishman stain) A: Megakaryocyte cluster (100X) B: Hypogranular megakaryocyte (400X) C: Multilobated megakaryocyte (400X) D: Bilobed megakaryocyte (400X) E: Monolobated megakaryocyte (400X) F: Micromegakaryocyte (400X) G: Disjointed nuclei in megakaryocyte (400X) H: Emperipolesis (400)

Fig. 2:

Trephine biopsy section A: Increased megakaryocyte with micromegakaryocytes (Hematoxylin & eosin 400X) B: Disjointed nuclei in megakaryocyte (Hematoxylin & eosin 400X) C: Grade I fibrosis (Reticulin stain 400X) D: Grade III fibrosis in CML-BP (Reticulin stain 40X) E: Grade II fibrosis (Reticulin stain 40X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Arunachalam et al.

Discussion

A spectrum of megakaryocyte alterations was seen in our study group. The mean megakaryocyte count per 10 hpf was higher in our cases in comparison to the normal controls. On classifying cases as CML with granulocytic proliferation (CML-G) and CML cases with both granulocytic and megakaryocytic proliferation (CML-GM) on the basis of the criteria set by Yookarin Khonglah et al., the distribution in each group was 42% and 58% respectively. [8] These values were intermediate to the distribution of cases reported in the studies by Yookarin Khonglah et al. (67% & 33%) and Bartl R et al. (45% & 55%). [8, 9] The increased megakaryocyte count was reflected in peripheral blood smear as raised platelet count. A fair number of cases (n=13) however had a normal or low megakaryocyte count in coherence with the previous reports. [10] The variability in megakaryocyte count may be due to underlying molecular triggers or marrow microenviorment. The cases with increased megakaryocyte count (CML-GM subgroup) also showed prominent clustering of megakaryocytes as reported in earlier studies. [11] No megakaryocyte clustering was observed in CML-G. This difference is probably due to the higher megakaryocyte count in the CML-GM group when compared to the other two groups.

The distribution pattern was predominantly parasinusoidal.

In cases with increased megakaryocyte count occasional paratrabecular or diffusely distributed megakaryocytes could be appreciated however predominant paratrabecular distribution characteristic for Myelodysplastic Syndrome (MDS) [12] was not seen. The paratrabecular area in CML is usually obliterated with granulocytic proliferation.

Dysplastic features namely hypolobation and micromegakaryocyte were constantly seen in all patients consistent with the previous studies. [11, 13] These hypolobated and dwarf megakaryocytes are significant in differentiating cases of CMLCP with raised platelet counts from other MPNs such as ET (hyperlobated megakaryocytes), PMF (enlarged megakaryocytes with cloudy nuclear chromatin). The nuclear lobulation was in general shifted towards left with decreased number of mature forms. Disjointed nuclei characteristically seen in PMF and MDS were seen in half of the cases however the percentage of megakaryocytes was low (<10%).

Cytoplasm hypo granularity is predominantly a feature of megakaryocytes in MDS. [14] Majority of the cases had normal granular megakarocytes, however 6 cases with increased megakaryocyte count had few dysplastic hypo granular megakaryocytes again a characterstic feature of MDS. [14] The presence of these dysplastic changes may be explained by proneness to dysplasia due to increased proliferation.

A-181 platelet shedding) were seen in varying proportions in all cases. However they are not of much significance in differentiation among the MPN as it is increased in all CMPD. [11] Emperipolesis was observed in 29% of cases, a value comparable to that reported by Bobik Ret al. [15] as 25% and Cashell AW et al. [16] as 17%. The parameter however is not much significant in differentiating among the various diagnoses of MPDs as emperipolesis has been consistently reported in all classes of MPN. [15, 16] A positive correlation was seen between the megakaryocyte count and grade of fibrosis suggesting a pathogenetic link between the two. [17, 18] Growth factors like platelet derived growth factor (PDGF) and LOX protein have been suggested as factors inducing marrow fibrosis. [19]

Conclusion

A spectrum of morphological changes is seen in megakaryocytes in cases of CML -CP. An increase in megakaryocyte count in over half of the cases indicate towards a stem cell abnormality however since not all cases show an increase in the megakaryocyte count other factors at the molecular level do come into play. Probability of clustering increases with increase in megakaryocyte count. The distribution was predominantly parasinusoidal.

Hypolobated nuclei and micromegakaryocytes were a consistent finding in all cases. Additional dysplastic features of hypogranular cytoplasm and nuclear fragmentation were seen in cases with increased megakaryocyte count.

The megakaryocyte count showed positive correlation with reticulin fibrosis grade.

A study of megakaryocyte parameters in other phases of CML may bring out the differences in various phases of CML. Also the megakaryocytic parameters helpful in prediction of the evolution of the disease may be identified.

Acknowledgements None

Funding None

Competing Interests None declared

Reference

Miscellaneous parameters such as bare nuclei (probably representing final stage of megakaryopoiesis after

1. Vardiman JW, Thiele J, Arber DA, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes.

Blood 2009 Jul 30;114(5):937-51 2. Georgii A, Buesche G, Kreft A. The histopathology of chronic myeloproliferative diseases. Baillieres Clin Haematol Dec 1998; 11(4):721-49.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-182

Megakaryocyte Morphology in CML-CP

3. BatesI, Burthem J. Bone Marrow Biopsy. In: Bain BJ, Bates I, Laffan MA, Lewis SM, editors Dacie and Lewis Practical Hematology. 11th ed. London:Churchill Livingstone Elsevier; 2012.123-137 4. Bain BJ, Lewis SM. Preparation and Staining Methods for Blood and Bone Marrow Films. In: Bain BJ, Bates I, Laffan MA, Lewis SM, editors Dacie and Lewis Practical Hematology. 11th ed. London:Churchill Livingstone Elsevier; 2012.57-68 5. Jones LM, Bancroft JD, Gamble M. Connective Tissues and Stains. In: Bancroft JD, Gamble M, editors Bancroft’s Theory and Practice of Histological Techniques. 6th ed. Churchill Livingstone Elsevier; 2007.135-160.

6. Muhury M, Mathai AM, Rai S, Naik R, Pai MR, Sinha R. Megakaryocytic alterations in thrombocytopenia: A bone marrow aspiration study. Indian J Pathol Microbiol 2009; 52(4):490-4.

7. Thiele J, Kvasnicka HM, Faccheti F, Franco V, Walt JV, Orazi A. European consensus on grading bone marrow fibrosis and assessment of cellularity. Haematologica 2005; 90(8):1128-32.

8. Khonglah Y, Basu D, Dutta TK. Bone marrow trephine biopsy findings in chronic myeloid leukemia. Malays J Pathol 2002; 24(1):37 - 43.

9. Bartl R, Frisch B, Wilmanns W. Potential of bone marrow biopsy in chronic myeloproliferative disorders. Eur J Haematol 1993; 50(1):41-52.

10. Kaloutsi V, Fritsch RS, Buhr T, Restrepo-Specht I, Widjaja W, Georgii A. Megakaryocytes in chronic myeloproliferative disorders: numerical density correlated between different entities. Virchows Arch A Pathol Anat Histopathol 1991; 418(6):493-7.

11. Nafe R, Holgado de Colombo S, Choritz H, Georgii A. Morphometry of megakaryocytes for supporting

12.

13.

14.

15.

16.

17.

18.

19.

the histologic diagnosis of chronic myeloproliferative diseases. The Pathologist 1995;16(1):34-40.

Thiele J, Quitmann H, Wagner S, Fischer R. Dysmegakaryopoiesis in myelodysplastic syndromes (MDS): An immunomorphometric study of bone marrow trephine biopsy specimens. J Clin Pathol 1991; 44:300-305.

Michiels JJ. Diagnostic criteria of the myeloproliferative disorders (MPD): essential thrombocythaemia, polycythaemia vera and chronic megakaryocytic granulocytic metaplasia. Neth J Med 1997 Aug; 51(2):57-64.

Wong KF, Chan JK. Are dysplastic and hypogranular megakaryocytes specific markers for myelodysplastic syndrome? Br J haematol 1991; 77:509-514.

Bobik R, Podolak-Dawidziak M, Kiełbiński M, Jeleń M, Wróbel T.Emperipolesis in megakaryocytes in patients with thrombocytosis in the course of myeloproliferative disorders. Acta Haematol Pol 1995;26(2):179-83.

Cashell AW, Buss DH. The frequency and significance of megakaryocytic emperipolesis in myeloproliferative and reactive states. Ann Hematol Jun 1992; 64(6):2736.

Lazzarino M, Morra E, Castello A, et al. Myelofibrosis in chronic granulocytic leukaemia: clinicopathologic correlations and prognostic significance. Br J Haematol 1986;64:227-40.

Buhr T, Georgii A, H. Myelofibrosis in chronic myeloproliferative disorders. Incidence among subtypes according to the Hannover Classification.

Choritz Pathol Res Pract 1993; 189:121-32.

Papadantonakis N, Matsuura S, Ravid K. Megakaryocyte pathology and bone marrow fibrosis: lysyl oxidase connection. Blood 2012;120(9):1774-8.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Overexpression of Her2/Neu in Gastric Carcinoma: Association with Histological Type, Tumor Grade and H. Pylori Infection Piyali Ghosh1, Indranil Chakrabarti2, Sourav Bhowmick3, Mimi Gangopadhyay2, Mamata Guha Mallick Sinha4 and Sudip Bhattacharya5 1

Department of Pathology, Calcutta National Medical College, West Bengal, India 2 Department of Pathology, North Bengal Medical College, Darjeeling, India 3 Department of Pathology, Ruby General Hospital, West Bengal, India 4 Department of Pathology, SSKM Hospital, West Bengal, India 5 Department of Orthopedics, Habra State General Hospital, West Bengal, India Keywords: Gastric Carcinoma, HER2, Helicobacter Pylori

ABSTRACT Introduction: Gastric cancer is the second leading cause of cancer mortality in the world and its management, especially in advanced stages, has evolved relatively little. In particular, no targeted modality has so far been incorporated for treatment. HER2 over-expression is increasingly recognized as a frequent molecular abnormality, driven as in breast cancer by gene amplification. There is mounting evidence of the role of HER2 over-expression in patients with gastric cancer, and it has been strongly correlated to poorer outcomes and a more aggressive disease.

Aims and objective: The purpose of this study is to establish the clinicoepidemiological, histopathological and immunohistochemical particularities of the gastric carcinomas, and to identify the factors with a prognostic value.

Materials and methods: The present study included 54 cases of gastric carcinoma, who had undergone endoscopy guided biopsy or gastrectomy. Expression of HER2 oncoprotein by immunohistochemistry and detection of Helicobacter pylori was done using modified Giemsa stain. Expression of HER2 was correlated with patientâ&#x20AC;&#x2122;s clinicopathological parameters.

Results: HER2+ rates were 22.22% (12/54). HER2 over-expression was associated with poorly differentiated carcinoma (P = 0.0159) and intestinal type of gastric carcinoma (P=0.0245). Conclusion: In this study, HER2 expression was seen more in intestinal type of gastric carcinoma as compared to the diffuse type involving mostly poorly differentiated cases. Regarding H. pylori, we found no correlation between its presence and the over-expression of HER2. So, the results of this study may contribute to a better knowledge of the efficacy of trastuzumab-based therapy in HER2 positive gastric cancers but the outcome of anti H. pylori medication in HER2 positive cases still remain inconclusive.

*Corresponding author: Dr. Indranil Chakrabarti, Department of Pathology, North Bengal Medical College Sushrutanagar, District: Darjeeling, West Bengal, India-734012 Phone: + 91 9433187448 Email: drinch@rediffmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-184

HER2/neu and H.Pylori in Gastric Carcinomas

Introduction

5μm thickness were stained by haematoxylin and eosin (H and E) for histopathological study and modified Giemsa for detection of H.pylori. In addition, 4μm sections were cut from paraffin blocks of tumour tissue and taken on a glass slide coated with poly L lysine for immunohistochemistry (IHC) to detect HER2 overexpression. The technique for IHC included antigen retrieval in Tris-EDTA buffer by pressure cooker method, blocking endogenous peroxidase with 3% hydrogen peroxide, incubating with primary mouse monoclonal antibody against HER2 protein (CB11), linking with secondary antibody, enzyme labelling with streptavidin-horseradish peroxidase, developing chromogen with di-amino benzidine (DAB) and counterstaining with haematoxylin. Positive and negative controls were checked with each batch of slides. Statistical analysis was performed using Microsoft Excel and SPSS software version 11.5. The results were considered statistically significant if p <0.05.

Helicobacter pylori (H. pylori), previously named Campylobacter pyloridis, is a Gramnegative, microaerophilic bacterium found in the stomach. It has been known that H. pylori have a major role in EGFR receptor expression in gastric mucosal cells. [8] Changes like growth, proliferation and differentiation are observed with EGF receptor expression. This overexpression may cause development of gastric cancer. There are studies, which have indicated that EGF and EGFR levels were decreased in cells with H. pylori eradication. [8]

Results and Analysis

Gastric cancer is the fourth most commonly diagnosed malignancy and the second most common cause of cancer related death worldwide.[1,2,3]Although there has been great improvement in the early diagnosis of gastric cancer, in combination with the recent progress of surgical techniques and comprehensive use of chemotherapy and radiotherapy, the 5-year survival rate for gastric cancer remains as low as 20% to 30%.[4]In regard to gastric cancer, molecularly targeted therapy is also gaining status. There is mounting evidence of HER2 expression in gastric carcinoma correlating with poor outcomes and a more aggressive disease.[5]According to the ToGA clinical trial reported in 2010 [6,7], patients with HER2 overexpression receiving chemotherapy and trastuzumab had a significant longer median overall survival without any additional adverse side effects. So, targeted therapy has great potential in improving the treatment of gastric cancer.

The limited number of studies in the literature has investigated HER2 status both in gastric and its metastatic tissues. However, after extensive search the relationship of this status with H. Pylori has been found only in one recent study in this year. So, this study will be helpful for assessment of prognostic significance of HER2 in gastric carcinoma along with the role of anti H. Pylori medication in Her2 positive cases.

Aims and Objective: The present study was undertaken to evaluate the pattern and intensity of HER2/neu expression in different histomorphologic variants as well as grades of gastric carcinoma and to find out the frequency of H pylori infection in HER2/neu positive gastric carcinoma patients.

Materials and Methods

The study was carried out during the time period of one year from June 2011 to May, 2012 after obtaining the permission of Institutional Ethics Committee. A total of 54 histologically diagnosed cases of gastric carcinoma were included. All the relevant history was recorded.

After conventional processing, paraffin sections of

After data accumulation they were analysed and the following results were obtained.

A total number of 54 cases were included in the study and were morphologically classified as per Lauren classification of gastric carcinomas ( Figure 1) Regarding immunohistochemical staining for HER2/ neu following data were obtained: 30 cases out of 54 cases (55.56%) showed negative staining (score 0 and 1+).

Intense complete staining (score 3+) were detected in 12 cases (22.22%). The remaining 12 cases (22.22%) showed moderate partial membranous staining (2+) in >10% cells.

(Table -1) (Figure 2) Overexpression of HER2 oncoprotein was seen predominantly in patients over 50 years of age and male population.(Table -2&3) Most of the cases showing HER2 over expression were intestinal type (P= 0.0245) except two cases where diffuse type showed positivity. No other histological variant (mixed and indeterminate type) showed positivity.(Table-4) HER2 over expression was seen in 8 cases (P=0.0159) of high grade gastric carcinomas. (Table -5) Among the 12 cases which showed positive staining of HER2 oncoprotein, H. pylori was detected in 2 cases (P value= 1) using modified Giemsa stain. (Table -6) (Figure 1D)

Discussion

In this study out of 54 gastric carcinoma only 12 cases were HER2 positive and HER2 status was correlated with

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Ghosh et al.

A-185

Table 1: Distribution of study population depending on the pattern of stainingPattern and intensity of staining of HER2 oncoprotein

No. of cases

Percentage (%)

No membrane staining or <10% of cells stained (score 0)

12

22.22

Faint/barely perceptible membranous reactivity In 10% of cells or higher or reactivity in only part Of the cell membrane (score 1+)

18

33.33

Weak to moderate complete or basolateral membranous reactivity in 10% of tumor cells or higher (score 2+)

12

22.22

Strong complete or basolateral membranous Reactivity in 10% of tumor cells or higher (score 3+)

12

22.22

Total

54

100

Table 2: Correlation of HER2 over expression with the age of the patients in this study population Age of the patients

Pattern of HER2 overexpression (positive)

Pattern of HER2 overexpression (negative)

>50 years

9

26

â&#x2030;¤50 years

3

16

Analytical statistics Fisher exact probability test, P-value=0.5061 Df=1

Table 3: Correlation of HER2/NEU over expression with the sex of the patients in this study population Sex of the patients

Pattern of HER2 overexpression (positive)

Pattern of HER2 overexpression (negative)

Male

7

35

Female

5

7

Analytical statistics Chi-square test value= 0.05 with P-value 0.8229

Table 4: Correlation of HER2/NEU over expression with the histological type of the tumor in this study populationHistological types

Pattern of HER2 overexpression (positive)

Pattern of HER2 overexpression (negative)

Intestinal

10

19

Diffuse & others

2

23

Analytical statistics Fisher exact probability test, P value=0.0245 Df=1

Table 5: Correlation of HER2/NEU over expression with the histological grade of the tumor in this study populationHistological grade

Pattern of HER2 overexpression (positive)

Pattern of HER2 overexpression (negative)

Analytical statistics

Poorly differentiated

8

11

Well & moderately differentiated

4

31

Fisher exact probability test, P value=0.0159 Df=1

Table 6: Correlation of HER2/NEU over expression with the active H. pylori infection in this study populationDetection of H. pylori by modified Giemsa

Pattern of HER2 overexpression (positive)

Pattern of HER2 overexpression (negative)

Analytical statistics

Yes

2

9

No

10

33

Fisher exact probability test, P value=1 Df=1

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-186

HER2/neu and H.Pylori in Gastric Carcinomas

Fig. 1: Gastric carcinomas (A) Intestinal type (H&E stain; 100X).

(B) Diffuse type with signet ring cells (H&E stain; 400X).

(C) Mixed type with well differentiated glands and diffuse sheets of signet ring Cells.

(D) H. Pylori in a case of gastric carcinoma (arrows) (Modified Giemsa Stain ; 1000X).

Fig. 2: HER2/neu positivity of gastric carcinomas A: HER2 Score 0 (400X) (B) HER2 Score 1+ (400X) (C)HER2 Score 2+ (400X) (D) HER2 Score 3+ (100X)

sex, being more frequent in men, with age at diagnosis (>50 years), more frequent in older patients which was similar to findings of previous studies by Yu G Zet al in 2009[9], Moelans CBet al in 2011[10] and Alina Bădescu et al in 2012.[11]But Sekaran A et al in 2012 and Federica Grillo et al in their study in 2013 showed that there was no significant difference noted in HER2 overexpression or amplification when compared to age or sex of the patient or tumor site.[12],[13]

observed that in the current review that based on the Lauren classification in relation to HER2, a higher level of overexpression or amplification was found in the intestinal phenotype compared to the diffuse or mixed types.

Positive membranous staining (score 3+) was observed in 12 cases (22.22%). Sekaran A et al in their study in 2012 in Indian population showed that results of HER2 overexpression in Indian population were quite high (44.2%).[12] Slesak B et al in 1998[14], Takehana T[15] in 2002 and many other studies reported that HER2 was over-ex­ pressed in gastric carcinomas at a range of 8% to 56%.

In 30 cases (55.56%) of our study there was negative staining (score 0 and 1+). The remaining 12 cases (22.22%) showed moderate partial membranous staining (2+). Study of Federica Grillo et.al. in 2013[13] showed only 24% of IHC-positive (score 3+). These findings have also been described by Kim et al in 2011. [16] Most of the cases (10 cases; 83.33%) of HER2 over expression were intestinal type. The remaining two cases were diffuse type. These associations were found to be statistically significant with a P value of 0.0245. No other histological variant (mixed and indeterminate type) showed positivity. Jan Trøst Jørgensen et al in their study in 2012[17]

M. Tanner et al in their study in 2012[18] told that HER2 over expression was strongly associated with the intestinal type as defined according to Lauren’s classification (21.5% versus 2.2% in the diffuse type, P = 0.0051). Alina Bădescu et al in their study in 2012[11], observed that the overexpression of Her2 was more frequent in intestinal type than diffuse (66.67% vs.20%), with a statistical significance difference between the two histological types (p=0.01), the picture also reflecting in other studies of previous years like study of Park DI et al in 2006[19] and Zhang XL in 2009[20]. Sekaran et al in 2012[12] studied HER2 expression in 52 patients of gastric adenocarcinoma in Hyderabad, India. Twenty three of 52 patients showed HER2 over-expression. They found similar overexpression of HER2 in both intestinal and diffuse histological types.

In this study HER2/neu over expression was positive in 8 cases of poorly differentiated gastric carcinomas among 12 positive cases with a statistical significance difference between the two histological grade (poorly differentiated versus well and moderately differentiated) (p=0.0159).

Most studies have shown that it is more common in cases of well-differentiated gastric carcinomas like the study of Zhang XL et al in 2009[20], Cidon EU et al in 2011[21], Alina Bădescu et al in 2012[11] But they added that positive staining was also found in poorly differentiated carcinomas

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Ghosh et al. indicates that HER2 is not uniquely linked to a specific differentiated type.

In this study among12 cases (which showed positive staining for HER2) 2 cases showed active H pylori infection which were detected using modified Giemsa stain with P value of 1. So, in our study correlation between H. pylori and HER2 over-expression was found to be statistically insignificant. After extensive search of the literature, we have found no other study stating the correlation between H. pylori and HER2 over-expression. But in one study Fatih Selcukbiricik et al in 2013 proposed the fact that H. pylori positive cases may have poor prognosis due to possible HER2 positivity metastasize in lymph nodes in gastric carcinoma patients. [8]

Conclusion

In this study, HER2 expression was seen more in intestinal type of gastric carcinoma as compared to the diffuse type involving mostly poorly differentiated cases. Regarding H. pylori, we found no correlation between its presence and the over-expression of HER2. So, the results of this study may contribute to a better knowledge of the efficacy of trastuzumab-based therapy in HER2 positive gastric cancers but the outcome of anti H. pylori medication in HER2 positive cases still remain inconclusive.

Acknowledgements None

Funding None

Competing Interests None declared

References

1. Hu B, El Hajj N, Sittler S, Lammert N, Barnes R, Meloni-Ehrig A. Gastric cancer: Classification, histology and application of molecular pathology. J Gastrointest Oncol 2012;3(3):251-61 2. Parkin DM. International variation. Oncogene 2004; 23:6329-40.

3. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer 2010; 127:2893-917.

4. Wang S, Zheng G, Chen L, Xiong B. Effect of HER2/neu Over-expression on Prognosis in Gastric Cancer: A Meta-analysis. Asian Pacific J Cancer Prev; 12:1417-23.

5. Meza-Junco J, Sawyer MB. Metastatic gastric cancer focus on targeted therapies. Biologics 2012; 6:137–46. www.pacificejournals.com/apalm

A-187 6. Han HS, Lauwers GY. Gastric Carcinoma. Available fromhttp://www.dako.com/28830_14dec10_ connection15_ HER2 in Gastric cancer.pdf.

7. Bang YJ, Van Cutsem E, Feyereislova A, Chung HC, Shen L, Sawaki A, et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomised controlled trial. Lancet 2010;376:687–97.

8. Selcukbiricik F, Tural D, Erdamar S, Buyukunal E, Demirelli F, Serdengecti S.Is Helicobacter pylori a poor prognostic factor for HER-2 SISH positive gastric cancer? Asian Pac J Cancer Prev. 2013;14(5):3319-22.

9.

Yu GZ, Chen Y, Wang JJ. Overexpression of Grb2/ HER2 signaling in Chinese gastric cancer: their relationship with clinicopathological parameters and prognostic significance, J Cancer Res Clin Oncol, 2009, 135(10):1331–39.

10. Moelans CB, Milne AN, Morsink FH, Offerhaus GJ, van Diest PJ. Low frequency of HER2 amplification and overexpression in early onset gastric cancer. Cell Oncol 2011; 34: 89-95.

11. Bădescu A, Georgescu CV, Vere CC, Crăiţoiu S, Grigore D.Correlations between HER2 oncoprotein, VEGF expression, MVD and clinicopathological parameters in gastric cancer. Rom J Morphol Embryol 2012; 53(4):997–1005.

12. Sekaran A, Kandagaddala RS, Darisetty S, Lakhtakia S, Ayyagari S, Rao GV, et al. HER2 expression in gastric cancer in Indian population-An immunohistochemistry and fluorescence in situ hybridization study. Indian J Gastroenterol. 2012; 31(3):106-10.

13. Federica Grillo, Matteo Fassan, Chiara Ceccaroli, Cinzia Giacometti, Monica Curto, Vittorina Zagonel et al. The reliability of endoscopic biopsies in assessing HER2 status in gastric and gastroesophageal junction cancer: a study comparing biopsies with surgical samples. Translational Oncology,2013;6(1):10-16.

14. Slesak B, Harlozinska A, Porebska I, Bojarowski T,

Lapinska J, Rzeszutko M,et al. Expression of epidermal growth factor receptor family proteins (EGFR, c-erbB-2 and c-erbB-3) in gastric cancer and chronic gastritis. Anticancer Res 1998;18:2727-32.

15. Takehana T, Kunitomo K, Kono K, Kitahara F, Iizuka H,

Matsumoto Y et al. Status of c-erbB-2 in gastric adeno­ carcinoma: a comparative study of immunohistochemis­ try, fluorescence in situ hybridization and enzyme-linked immuno-sorbent assay. Int J Cancer 2002;98:833-7.

eISSN: 2349-6983; pISSN: 2394-6466

A-188

HER2/neu and H.Pylori in Gastric Carcinomas

16. Kim KC, Koh YW, Chang HM, Kim TH, Yook JH, Kim BS et al. Evaluation of HER2 protein expression in gastric carcinomas: comparative analysis of 1,414 cases of whole-tissue sections and 595 cases of tissue microarrays. Ann Surg Oncol 2011; 18, 2833–40.

17. Jan Trøst Jørgensen, Maria Hersom. HER2 as a Prognostic Marker in Gastric Cancer - A Systematic Analysis of Data from the Literature. Journal of Cancer 2012; 3: 137-44.

18. Tanner M, Hollmen M, Junttila TT, Kapanen AI, Tommola S, Soini Yet al. Amplification of HER-2 in gastric carcinoma: association with Topoisomerase II alpha gene amplification, intestinal type, poor

prognosis and sensitivity to trastuzumab. Ann Oncol 2005; 16:273–78.

19. Park DI, Yun JW, Park JH, Oh SJ, Kim HJ, Cho YK, et al. HER-2/neu amplification is an independent prognostic factor in gastric cancer. Dig Dis Sci. 2006;51(8):1371-9 20. Zhang XL, Yang YS, Xu DP, Qu JH, Guo MZ, Gong Y et al. Comparative study on overexpression of HER2/ neu and HER3 in gastric cancer. World J Surg. 2009 Oct;33(10):2112-8.

21. Cidon EU, Centeno RG, Lagarto EG, Peral JI. HER2 Evaluation in a Specific Gastric Cancer Population with the Highest Rate of Mortality in Spain, J Oncol 2011; 2011:391564.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Usefulness of Cytological Grading in Predicting Tumor Behavior in Breast Carcinoma-An Institutional Experience G. V. R. N. Krishnakanth* and V. Satyanarayana Department of pathology, Kamineni Institute of Medical Sciences, Narketpally, India Keywords: Fine Needle Aspiration Cytology, Cytological Grading, Histological Grading, Breast Carcinoma

ABSTRACT Background: Breast carcinoma is a frequently encountered malignancyand several modifications are under-way in the management of breast malignancies including Neo-adjuvant chemotherapy.In this context to give an idea to the oncologist about the behavior of the tumor through FNAC is becoming increasingly expected.So,in this study an attempt has been made to compare cytological grading with histological grading and the usefulness of cytology alone in predicting tumor behavior has been evaluated.

Methods: 40 cases of breast carcinoma for which both cytological samples andhistological specimens are available are included in the study.Robinsonâ&#x20AC;&#x2122;s method is used for cytological grading.Elstonand Ellis modification of BloomRichardson grading method is used for histological grading.The exactness of cytological grading is compared by its concordance with histological grading.

Result: 83.6% of overall concordance of cytological grading was obtained.

Conclusion: Based on the fairly good level of concordance between cytological and histological findings in the study,it can be concluded that Robinsonâ&#x20AC;&#x2122;s method of cytological grading is a fairly dependable method that can be used to give an exact idea to the oncologist about the tumor behavior

*Corresponding author: Dr G.V.R.N.Krishna kanth, Associate Professor, Department of pathology, Kamineni Institute of Medical Sciences, Narketpally, India Phone: + 91 09550047530 Email: kkanth343@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-190

Cytological Grading in Breast Carcinoma

Introduction

.The present study not only applies the Robinson grading system but also studies its concordance with histological grading system, Elston and Ellis Nottingham modification of Bloom and Richardson method.

Breast carcinoma is the most common malignant tumor and the leading cause of cancer deaths in women with more than 1,000,000 cases occurring worldwide annually.[1] Accurate diagnosis of breast cancer is made in 99% of cases by the combination of clinical examination, mammography and simple, noninvasive, cost-effective outpatient department procedure, fine-needle aspiration cytology (FNAC).

Technique of FNAC has wide applicability and utility for the tumors which are easily palpable on external examination.[2],[3] In developed world, the practice and usefulness of breast FNA have been overshadowed by core needle biopsy. On the contrary, in developing countries like India, even today, the core needle biopsy is still not practiced routinely at most of the medical centers. The treatment of breast carcinoma cases is begun with the first hand diagnosis made on FNAC. Moreover, for resourcepoor countries, FNA in comparison to core needle biopsy, is cheaper, less invasive, can sample different areas of the lesion in the same sitting at no added expenses and usually fetch good results the same day.[4],[5] The acceptance of FNA report reliability both by surgeons and pathologists allows for radical surgery on the basis of an FNA diagnosis.

Regrettably, instead of signing a more precise “surgical pathology” type diagnosis on FNA, its widest application is limited to just categorizing the breast lesion as benign or malignant. The prognostic markers important for deciding the treatment modality should be conveyed to the surgeon, as recognition of the aggressiveness of the disease is central to the effective medical management of breast cancer and avoid the needless morbidity.[6],[7],[8].With the advent of neoadjuvant chemotherapy,the need for giving an idea of the aggressiveness of the tumor by FNAC has further more increased.

Materials and Methods

The work represents the retrospective andprospective study of breast carcinomas diagnosed onFNAC in the Department of Pathology from January2013 to January 2016. 40 cases of infiltrating duct cellbreast carcinoma diagnosed on FNAC and confirmed on histology were included in the study. FNAC was done by using 10 ml syringewith 2223 gauge needle using aseptic standardtechnique. Smears were alcohol fixed and stained with H&E,alsoair dried and stained withleishman’sstain. Cytological features were carefullyevaluated and breast carcinomas were graded usingRobinson’s grading system[9]. Six parameters viz. Cell dissociation, Cell size, Cell uniformity, Nucleoli,Nuclear margin and Chromatin pattern were carefullyevaluated.

[Table 1].

After observing cyto-morphology of these six criteria,each criteria was given one to three score. Sum ofeach score of these criteria was added and based on total score, breast cancers were graded viz. Grade Iwith score of 6 to 11, Grade II with score of 12-14and Grade III with score of 15-18.

Surgical specimens received for histopathological examination were fixed in 10% formalin. Three to foursections were taken from tumor and paraffinprocessed.

Three to five thick micron sections werecut and stained with Haematoxylin and Eosin stain[H&E]. Histological typing of tumors was done according to world health organization (WHO) 2003.[10] Histological grading was done according toElston’s and Ellis’s modification of Bloom-Richardson method.[11]Criteria such as tubule formation, nuclear morphology and mitotic count were evaluated. [Table 2] Cytological and histological grades were correlatedto find the concordance between the two grading systems.

Of the different cytological grading (CG) methods corresponding to Elston-Ellis modified SBR HG, the method described by Robinson et al,[9]was found to be useful in grading breast carcinoma in fine needle aspiration Tabel-1 cytological grading by Robinson’s system score

1

2

3

Cell dissociation

Cells mostly in clusters

Mixture of single cells and clusters

Mostly single cells

Cell size

1-2 times size of RBC

3-4 time size of RBC

>= 5 times size of RBC

Cell uniformity

Monomorphic

Mildly pleomorphic

Pleomorphic

Nucleoli

Indistinct

Noticeable

Prominent or Pleomorphic

Nuclear margins

Smooth

Slightly irregular/folds and grooves

Buds and clefts

Chromatin

Vesicular

Granular

Clumped and cleared

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Krishnakanth et al.

A-191

Table-2 Histological grading of breast carcinoma.(Elston and Ellis modified Bloom and Richardson grading system) (Nottinghamâ&#x20AC;&#x2122;s grading) score

1

2

3

Tubule formation

Tubular formation in > 75 % of the tumor

Tubular formation in 10 to 75 % of the tumor

Tubular formation in < 10 % of the tumor

Nuclear pleomorphism

Nuclei with minimal variation in size and shape

Nuclei with moderate variation in size and shape

Nuclei with marked variation in size and shape

Mitotic count per 10 high power fields

0-5/hpf

6-10/hpf

>11/hpf

Results

Tables 3,4 show the results of cytological grading of breast cancer clearlyshowing that moderately differentiated tumors constituted the majority followed by poorly differentiated and then well differentiated tumors.

Similar pattern is also observed with histological grading as shown in Tables 5,6.

The cytological pictures of grade 1,grade 2,grade 3 are depicted in Figures1,2,3.

Regarding concordance of CG with HG, out of the 6 cases cytologically graded as grade 1,4 cases were histologically grade 1 and 2 cases were histologically grade 2.Thus the concordance of CG with HG would be 66% for grade 1 tumors.

With respect to grade 2,out of the 27 cases cytologically graded as grade 2,only 23 cases were histologically grade 2.Among the remaining 4 cases,3 cases were histologically grade 1,one was histologically grade 3.Thus the concordance of CG with HG would be 85% for grade 2 tumors.

With respect to grade 3 tumors,all the 7 cases that were cytologically grade 3 were also graded as grade 3 on histology.Thus the concordance rate for grade 3 tumors is 100%.The overall concordance rate between CG and HG would be 83.6%.

Chi-square test was done and a chi-square value of 0.2205,degree of freedom of 2 and pvalue of 0.8956 was obtained

Table 3-scores of all the 6 cytological features Cytological feature Cell dissociation Cell size Cell uniformity Nucleoli Nuclear margins Chromatin

No of cases with score 1 10 6 7 6 4 5

No of cases with score 2 21 23 26 29 30 28

No of cases with score 3 9 11 7 5 6 7

Table-4 cytological grading based on the total score obtained Total Score 6-11 12-14 15-18

Grade I II III

Degree of Differentiation Well differentiated Moderately differentiated Poorly differentiated

No of cases 6 27 7

Percentage of cases 15% 67.5% 17.5%

Table-5 showing scores of histological features Histological feature Tubule formation Nuclear features Mitotic count

Score 1 6 10 7

Score 2 27 24 28

Score 3 7 6 5

Table-6 showing histological grading based on total score obtained Total score 3-5 6-7 8-9

Grade I II III

www.pacificejournals.com/apalm

Degree of differentiation Well differentiated Moderately differentiated Poorly differentiated

No of cases 7 25 8

percentage 17.5% 62.5% 20%

eISSN: 2349-6983; pISSN: 2394-6466

A-192

Cytological Grading in Breast Carcinoma

Discussion

Breast cancer is one of the most common causes of death in many developed countries in middle-aged women and is becoming frequent in developing countries. In India, breast cancer is the second most prevalent cancer in women after cervical cancer. [12]

Fig. 1: showing the features of cytological grade1

The idea of CG is to assess the tumor in situ, so that the most suitable treatment could be selected immediately, and the morbidity associated with overtreatment of low grade tumors could be avoided. According to uniform approach to breast FNAC as recommended by the National Cancer Institute, tumor grading on FNA material should be in reports of FNAC for prognostication. [13]Again simultaneous performance of CG and HG helps in measuring accuracy of CG in breast carcinoma. Histological concordance gives the cytopathologist a feedback and helps in increasing the efficiency of work.

Various CG systems of breast carcinoma are presently in use. Robinsonâ&#x20AC;&#x2122;s grading system is found to be better in various studies because of its simplicity, specificity and reproducibility. [14],[15],[16],[17]It uses six different parameters namely; cell dissociation, cell size, cell uniformity, nucleolus, nuclear margin and nuclear chromatin.

Robinsonâ&#x20AC;&#x2122;s CG had a concordance rate ranging from 56.9% to 89.1% with HG in different previous studies. [18]

Fig. 2: showing the features of cytological grade 2

Fig. 3: showing the features of cytological grade 3

In the present study, out of total 40 cases, 06 (15.0%), 27 (67.5%) and 07 (1.57%) cases were graded as grade I, II and grade III respectively. Hence majority of cases were in CG grade II which is comparable with previous studies.

Robinson et al. in their study of 608 cases had the distribution of cases as 38.3%, 38.5% and 23.2% in cytological grades I, II and III respectively. [9] Pandit and Parekh et al. graded 75 breast carcinomas by same method and found 34.7% each in grades I and II, and 30.6% in grade III. [19]A similar study was carried out using Robinsonâ&#x20AC;&#x2122;s criteria by Das et al. showed that 28.8% cases were grade I, 46.2% as grade II and 25.0% as grade III. [14] The result of the present study showed similar concordance with these studies.

Regarding concordance of CG with HG, the present study showed 66% concordance in grade I, and 85% concordance in grade II and100% concordance in grade III. The overall concordance of CG with HG is 83.6% which is comparable with other published data. The original study by Robinson et al. found only 57% concordance, while Das et al., Sinha and Sinha and Lingegowda et al. found 71.2%, 73.0% and 64.0% concordance between CG and HG respectively.

[9],[16],[20],[21] Sood et al. found highest concordance (75%) in grade I tumors and lowest (60%) in grade III tumors with overall concordance of 68.67%.[22].A study carried out by

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Krishnakanth et al.

Saha et al. found absolute concordance of 77.19% between CG and HG using Robinson’s grading system involving 57 cases of breast carcinoma. [17] P value of 0.8956 shows that the discordance between CG and HG is statistically not significant and cytological grading by Robinson’s method is a reliable replica of Nottingham’s histological grading system.

Majority of discordance between CG and HG was observed in grade I tumors (4/6). Of the 6 cases graded as grade I by CG, only 4 cases were graded as grade I by HG and other 2 cases were graded as grade II. In the majority of cases there is one grade difference. Similar results were obtained by Pandit and Parekh et al. [19] and Das et al. [14].Among the 40 cases,3 cases were undergraded by one grade and similarly another 3 cases were overgraded by one grade Histological grading was based on the degree of tubule formation, mitosis and nuclear pleomorphism. As tubule formation and mitotic index were difficult to assess on cytology, it might be the cause of discordance between cytological and HG systems.[23-25]In CG, much importance have been given to nuclear features like nuclear size, nucleoli, nuclear membrane and chromatin pattern in contrast to HG; in which nuclear feature in only one component. This can also lead to cytohistological disparity in grading of breast carcinomas.

Current management of breast carcinoma relies on various clinical and pathological prognostic andpredictive factors for guiding the selection of treatment options.The three main prognostic determinants used in routine practice are lymph node status,tumor size and histological grade.

Nottingham grading system used in the present study for comparison of the cytological grading is the grading system recommended by various bodies.[14,26]Higher concordance values of the Robinson’s cytological grade with the internationally accepted Nottingham’s histological grade would mean that the Robinson’s cytological grading system can be universally used for clinical decision making even beforesurgical intervention is contemplated.This would be the dawn of accessibility of morebetter treatment options.

Conclusion

In the present study, a high degree of concordance was seen between cytological and HG system. Preoperative grading using FNAC helps in determining neo adjuvant chemotherapy as well as prognostication. This grading system is relatively a new approach in diagnostic pathology, and its arena is ever increasing. The method is in its infancy.

It could be said in confidence that this grading system will be fruitful in prognostication of malignant breast lesions and may become mandatory in the near future www.pacificejournals.com/apalm

A-193

Acknowledgements

My sincere gratitude and thanks to all the staff members in the department of pathology,post graduates and technicians for their help in collecting and analyzing the material

Funding None

Competing Interests None declared

References

1. Rosai J. Ackerman’s Surgical Pathology. 9 th ed.

Edinburgh: Mosby; 2004. p. 1787-839 2. Kaufman Z, Shpitz B, Shapiro M, Rona R, Lew S, Dinbar A. Triple approach in the diagnosis of dominant breast masses: Combined physical examination, mammography, and fine-needle aspiration.

J SurgOncol 1994;56:254-7.

3. Steinberg JL, Trudeau ME, Ryder DE, Fishell E, Chapman JA, McCready DR, et al. Combined fine-needle aspiration, physical examination and mammography in the diagnosis of palpable breast masses: Their relation to outcome for women with primary breast cancer. Can J Surg 1996;39:302-11.

4. Silverman JF, Elsheikh TM, Singh HK. The role of fine needle aspiration cytology of the breast in the core biopsy era. Pathol Case Rev 2007;12:44-8 5. Berner A, Davidson B, Sigstad E, Risberg B. Fine-needle aspiration cytology vs. core biopsy in the diagnosis of breast lesions. DiagnCytopathol 2003;29:344-8.

6. Silverman JF. Diagnostic accuracy, cost-effectiveness, and triage role of fine-needle aspiration biopsy in the diagnosis of palpable breast lesions. Breast J 1995;1:3-8.

7. Hatada T, Ishii H, Ichii S, Okada K, Fujiwara Y, Yamamura T. Diagnostic value of ultrasound-guided fine-needle aspiration biopsy, core-needle biopsy, and evaluation of combined use in the diagnosis of breast lesions. J Am CollSurg 2000;190:299-303.

8. Kaufmann M, von Minckwitz G, Mamounas EP, Cameron D, Carey LA, Cristofanilli M, et al.

Recommendations from an international consensus conference on the current status and future of neo adjuvant systemic therapy in primary breast cancer.

Ann SurgOncol 2012;19:1508-16 9. Robinson IA, McKee G, Nicholson A, D′Arcy J, Jackson PA, Cook MG, et al. Prognostic value of cytological grading of fine-needle aspirates from breast carcinomas. Lancet 1994;343:947-93. eISSN: 2349-6983; pISSN: 2394-6466

A-194

Cytological Grading in Breast Carcinoma

10. Tavassoli FA, Devilee P. World Health Organizationclassification of tumors. Pathology and Genetics.Tumors of the breast and female genital organs. IARCPress: Lyon. 2003 11. Elston CW, Ellis IO. Pathological prognostic factors inbreast cancer. The value of histological grade in breastcancer – Experience from a large study with long termfollows up. Histopathology 1991; 19(5): 403-410 12. Rao DN, Ganesh B. Estimate of cancer incidence in India in 1991. Indian J Cancer 1998;35:10-8.

13. The uniform approach to breast fine needle aspiration biopsy. A synopsis .ActaCytol 1996;40:1120-69.

14. Das AK, Kapila K, Dinda AK, Verma K. Comparative evaluation of grading of breast carcinomas in fine needle aspirates by two methods. Indian J Med Res 2003;118:247-50.

15. Wani FA, Bhardwaj S, Kumar D, Katoch P. Cytological grading of breast cancers and comparative evaluation of two grading systems. J Cytol 2010;27:55-814.

16. Rekha TS, Nandini NM, Dhar M. Validity of different cytological grading systems of breast carcinoma - a hospital-based study in South India. Asian Pac J Cancer Prev 2011;12:3013-6.

17. Saha K, Raychaudhuri G, Chattopadhyay BK, Das I. Comparative evaluation of six cytological grading systems in breast carcinoma. J Cytol 2013;30:8793.16.

18. Pandya AN, Shah NP. Comparative evaluation of Robinson′s cytological grading with Elston and Ellis′ Nottingham Modification of Bloom Richardson histopathology grading for breast carcinoma.Natl J Community Med 2012;3:491-58.

19. Pandit AA, Parekh HJ. Cytologic grading of breast carcinoma; comparison of four grading systems.

J Cytol 2000;17:39-4417 20. Sinha S, Sinha N, Bandyopadhyay R, Mondal SK. Robinson′s cytological grading on aspirates of breast carcinoma: Correlation with Bloom Richardson′s histological grading. J Cytol 2009;26:140-3.

21. Lingegowda JB, MuddeGowda PH, Ramakantha CK, Chandrasekar HR. Cytohistological correlation of grading in breast carcinoma. DiagnCytopathol 2011;39:251-79.

22. Sood N, Nigam JS, Yadav P, Rewri S, Sharma A, Omhare A, et al. Comparative Study of Cytomorphological Robinson′s Grading for Breast Carcinoma with Modified Bloom-Richardson Histopathological Grading. Pathology Res Int 2013;2013:146542.

23. Dabbs DJ, Silverman JF. Prognostic factors from the fine-needle aspirate: Breast carcinoma nuclear grade.

DiagnCytopathol 1994;10:203-8.

24. Howell LP, Gandour-Edwards R, O′Sullivan D. Application of the Scarff-Bloom-Richardson tumor grading system to fine-needle aspirates of the breast.

Am J ClinPathol 1994;101:262-5.

25. Masood S. Prognostic factors in breast cancer: Use of cytologic preparations. DiagnCytopathol 1995;13:388-90 26. Pathology reporting of breast disease:A joint document incorporating the third edition of the NHS breast screening programme guidelines for pathology reporting in breast cancer screening and the second edition of the Royal college of pathologist’s minimum dataset for breast cancer histopathology.2005,Sheffield;NHS cancer screening programmes and the Royal college of Pathologists.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Spectrum of Fibro Osseous Lesions: A Retrospective Study Sajitha K*, Kishan Prasad H L, Netra Sajjan and Jayaprakash Shetty K Dept of Pathology, K S Hegde Medical Academy, Mangalore, India Keywords: Fibro-osseous, Fibrous Dysplasia, Cemento-ossifying Fibroma

ABSTRACT Background: Fibroosseous lesions (FOL) are a group of lesions which affect the jaw and the craniofacial bones and are a challenge to pathologists and clinicians in their diagnosis and treatment. It includes developmental lesions, reactive lesions and neoplasms. Many other lesions share the clinical, radiological and histopathological features of FOL. The identification of benign FOL and their sub classification is important because the therapeutic management varies depending on the actual disease process. The aim of this study was to analyse the spectrum of FOL and its mimickers that presented in our hospital and to study its clinicopathological aspects.

Methods: A retrospective analysis of 31 cases of benign FOL and its mimickers which presented between 2007 & 2013 was done in the Dept of pathology. Clinical data and X-ray findings were obtained from the medical records department.

Result: Among 31 cases studied, 15 cases were diagnosed as FOLs and 16 as fibro-osseous like lesions. FOLs were most commonly seen in females in 1st to 3rd decade with a predilection for facial bones. Commonest lesion was fibrous dysplasia - 11 cases (73.3%), followed by 2 cases each of cemento ossifying fibroma and osteofibrous dysplasia (13.3%).The commonest diseases among the mimickers included Aneurysmal Bone Cyst- 6 cases (37.5%), followed by osteoid osteoma - 4 cases (25%), 2 cases (12.5%) each of pagets disease of bone & osteoblastoma and 1 case (6.3%) each of brown tumour of hyperparathyroidism and cementoblastoma and these were most commonly seen in long bones. In histopathology, FOLs show densely collagenous fibroblastic tissue containing metaplastic bone where as fibro osseous like lesions exhibit less fibrous tissue in the stroma.

Conclusion: A definitive diagnosis of a FOLs and its differentiation from its mimickers requires correlation of histological features with the clinical, radiographic and intraoperative findings.

*Corresponding author: Dr Sajitha K, 4 C, KSHEMA Staff Quarters, Deralakatte, Mangalore, India Phone: + 91 9741993622 Email: drsk29@hotmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-196

Benign Fibro Osseous Lesions

Introduction

The term Fibroosseous lesions (FOL) refers to a process in which the normal architecture of bone is replaced by fibrous tissue containing varying amount of foci of mineralization.

These lesions are rare and predominantly affect jaws and craniofacial bones. This group comprises of tumours and tumour like lesions which are histologically similar but have different clinical behavior[1] Many authors have put forth different classification systems to classify FOL. Various lesions demonstrate clinical, radiological and microscopic features that are similar to those encountered in recognized fibro-osseous conditions.

[2] The differential diagnosis include osteoid osteoma, osteoblastoma, pagets disease of bone, brown tumour of hyperparathyroidism and cementoblastoma. However these lesions do not completely fulfil the histological criteria for FOLs as defined by Waldron. [3] A definite diagnosis may thus require extensive investigation for classification and interpretation of histological appearance along with radiological and clinical data.

AIM: To analyse the spectrum of fibroosseous lesions received in our department and to differentiate it from its mimickers.

Materials and Methods

A total of 31 cases of FOLs were retrospectively analysed from 2007-2013 in the Department of pathology of a tertiary hospital situated in the outskirts of Mangalore.

The clinical data and radiological findings were obtained from case files. The diagnosis was based on the clinical

findings, radiological appearances and histopathological examination.

Result

A total of 31 cases were studied, among them 15 cases were diagnosed as FOLs and 16 cases as fibroosseous like lesions. The commonest lesion among FOLs was fibrous dysplasia 11cases (73.4%) followed by 2 cases (13.3%) each of cemento-ossifying fibroma and osteofibrous dysplasia (Table 1). Majority of the fibrous dysplasia were mono ostotic. One case was polyostotic fibrous dysplasia in which patient presented with multiple lytic lesions in the proximal & distal tibia and distal radius. Histopathological examination showed fibrous dysplasia with extensive areas of cartilaginous differentiation and hence the diagnosis of fibrocartilagenous dysplasia was made. The fibro osseous like lesions were Aneurysmal bone cyst(ABC) â&#x20AC;&#x201C; 6 cases (37.5%), followed by osteoid osteoma - 4 cases (25%), Paget disease and osteoblastoma -2 cases each (12.5%), and 1 case (6.3%) each of brown tumour of hyperparathyroidism and cementoblastoma (Table 2). FOL were most commonly seen in the 2st and 3rd decades and 40% of the lesions were in the 3rd decade. It was more common in females compared to males. The mimickers of FOLs showed a male predilection and majority of cases (43.7%) cases presented in the first decade. The most common site involved among FOL was craniofacial bones (56.6%) followed by long bones. Among the mimickers the most common site was long bones (62.5%) followed by craniofacial bones. Histopathologically, FOLs showed densely collagenous fibroblastic tissue containing metaplastic bone where as fibroosseous like lesions exhibited less fibrous tissue in the stroma.

Table 1 -Distribution of Fibro osseous lesions- (Total no of cases â&#x20AC;&#x201C; 15) Type of lesion

No of cases

Percentage

Fibrous Dysplasia

11

73.40

Cemento-ossifying Fibroma

02

13.30

Osteofibrous Dysplasia

02

13.30

Type of Lesion

No of cases

Percentage

Aneurysmal Bone Cyst

06

37.5

Pagets Disease

02

12.5

Osteoblastoma

02

12.5

Osteoid Osteoma

04

25

Brown Tumor

01

6.25

Cementoblastoma

01

6.25

Table 2 - Distribution of fibro-osseous like lesions (Total -16 cases)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Sajitha K et al.

A-197

Table 3 - Benign Fibro- osseous lesions FOL

Present study

Abdulai et al1

Ogunsalu et al4

Sharanya et al16

Langdon et al 17

Fibrous dysplasia

11

16

17

20

15

Cementoossifying fibroma

02

36

10

60

19

Osteofibrous dysplasia

02

-

-

-

-

Cementoid lesions

-

-

05

-

05

Total

15

52

32

80

39

Table 4 â&#x20AC;&#x201C;Comparison of Age and Sex incidence (M/F) for FOL in various studies â&#x20AC;&#x201C; BFOL

Present study

Abdulai et al1

Ogunsalu et al4

Langdon et al17

Hammer et al15

Age

Sex

Age

Sex

Age

Sex

Age

Sex

Age

FD

34.5

1/1.2

21.7

1/1.3

25.8

2/3

24

1/1.5

-

COF

20

0/2

19.9

1/1.6

26.5

2/3

35

1/1.23

26

Discussion

Fibro-osseous lesions (FOL) of bones comprise a diverse group of conditions that include developmental lesions, reactive or dysplastic lesions, and neoplasms. Due to this diversity, they are a diagnostic challenge to the pathologist.

Regardless of the subtype, FOLs demonstrate replacement of normal bone by fibrous connective tissue along with an admixture of mineralized product, which may be osteoid, mature bone, and /or cementum-like calcifications. A number of lesions mimic FOL histologically and the differential diagnosis includes aneurysmal bone cyst, osteoblastoma, osteoid osteoma, pagets disease of bone, brown tumor of hyperparathyroidism and cementoblastoma.

Before 1970, the term FOL included fibrous dysplasia, ossifying fibroma, fibrous osteoma and osteoblastoma.

[4] Waldron in his classification suggested that the FOL originate from the periodontal ligament which contains multipotent cells which are known to differentiate into fibrous tissue cells, cementum and bone. [5] The latest classification given by WHO in 2005 considers these lesions as a spectrum of clinicopathological entities in which the diagnosis can only be made after taking into consideration the clinical, histological and radiological features. [2],[6] Under this classification, the major fibro-osseous lesions include fibrous dysplasia (FD), osseous dysplasia, ossifying fibroma with their various subtypes. More recently, Eversole (2008) classified the benign FOL based on the pathogenetic mechanisms and the lesions included neoplasms, developmental lesions and inflammatory or reactive processes. [3] A specific diagnosis is needed as the treatment varies from none to surgical removal. Radiographically, FOL vary from a simple radiolucent lesion, a radiopaque lesion or a mixed radiolucent/radiopaque lesion. These can be well defined or ill-defined. There may or may not be expansion of bone. [7] www.pacificejournals.com/apalm

Sex 1.2/1

Fibrous dysplasia, Osteofibrous dysplasia and Cementoossifying fibroma: FD is a benign FOL commonly seen in infancy and childhood or young adults. [8],[9] The femur, tibia, skull and facial bones, or ribs are most commonly affected. Females are more commonly affected than males.

[4] When the disease is limited to the single bone it is called monoostotic and involvement of two or more bones is known as polyostotic fibrous dysplasia. When it is seen with pigmentation it is termed Jaffe-lichtenstein syndrome and if associated with multiple endocrinopathies and cafe au lait spots, it is termed as McCune Albright syndrome.

Fibrous dysplasia also forms a component of Mazabraud syndrome where it is seen along with soft tissue myxomas.

[10] Radiologically, the lesions are poorly defined and described as orange peel or ground glass in appearance.

Microscopically, FD shows irregular bony trabeculae giving the appearance of the chinese letter pattern. These bony trabeculae do not have any osteoblastic rimming (Fig 1A). However, a few lesions may show osteoblastic rimming. [10] In the present study, one case of fibrous dysplasia showed bony trabeculae which resembled cementum like material (Fig 1B).

Osteofibrous dysplasia is similar to FD on histopathology except for the presence of osteoblastic rimming. (Fig 1C & 1D). The other differentiating feature is the location of FD in medullary cavity and osteofibrous dysplasia in the cortical region and the presence of cytokeratin positive epithelial cells in osteofibrous dysplasia. [8] Ossifying Fibroma is commonly seen in the jaw bones and is a true neoplasm with a potential for continued growth if not excised. Radiologically, in contrast to FD, ossifying fibromas are well circumscribed and present as expansile mass with a sclerotic rim. Histology shows fibrous tissue arranged in a storiform pattern and variable amount of bony trabeculae or cementum like spherules. [5],[9] The eISSN: 2349-6983; pISSN: 2394-6466

A-198

Benign Fibro Osseous Lesions

bony trabeculae show a uniform pattern of mineralization throughout the lesion in fibrous dysplasia while the mineralization pattern varies from place to place in ossifying fibroma. Whenever the cementum like material is predominant, it is termed as cementifying fibroma.

Radiologically, it is seen associated with tooth and have to be distinguished from Cemento Ossifying Dysplasias (COD). Ossifying fibromas tend to present at a slightly younger age than COD. A diagnosis of COD is favoured when histology shows thick, curvilinear trabeculae resembling ginger roots and cavernous vascular spaces.

These lesions are less than 2 cm in size and less cellular.

[10],[11]

Paget disease and brown tumor of hyperparathyroidism: Osteitis deformans or Paget disease of bone is characterized by rapid turnover and remodelling of bone throughout the skeleton. Unlike FD, osteitis deformans is a disease of the elderly. [12] Brown tumor of hyperparathyroidism is common in diaphysis of long bones, the jaw, or the skull, which on microscopic examination shows many clustered giant cells in a fibrovascular cellular stroma. It mimics giant cell tumor on histopathology. [13] In the jaws, it closely resembles central giant cell granuloma (CGCG). However, CGCG is most commonly seen in the younger age group.

Paget disease and brown tumor of hyperparathyroidism also share the similar features and have to be differentiated correlating with the laboratory findings. Calcium and parathyroid hormone levels are normal in Paget disease of bone whereas they are increased in brown tumor of hyperparathyroidism. [13] There is marked elevation of alkaline phosphatase in Pagetâ&#x20AC;&#x2122;s disease. In our case, a similar picture was seen with normal calcium and PTH levels in the Pagetâ&#x20AC;&#x2122;s disease and an increased levels of the same in hyperparathyroidism.

Osteoblastoma, Osteoid osteoma, Cementoblastoma and Aneurysmal Bone Cyst: Osteoblastoma (OB) and osteoid osteoma are benign neoplasms which resemble FOLs. It is difficult to differentiate OB and osteoid osteoma on histotology alone. Osteoid osteoma is seen commonly in males and presents with intense pain relieved by analgesics and small well circumscribed radiolucent nidus of <1.5 cm.

Osteoblastomas are usually more than 2 cm and in contrast to osteoid osteoma, the pain associated with OB is not relieved by analgesics.

Cementoblastoma (CB) is an odontogenic neoplasm representing <1% of all odontogenic tumors. A cementoblastoma is characterized by the formation of cementum like tissue in connection with the root of a tooth [6] (Fig 2A). Histologically, CB and OB have the same appearance including peripheral spiculae rimmed by plump

osteoblasts (Fig 2B). This histologic similarity between OB and CB indicates that the diagnosis of cementoblastoma should be made only when the lesion is connected with a tooth. [14],[15] Radiologically, the tumor appears as a radioopaque mass that is fused to one or more tooth roots and is surrounded by a thin radiolucent rim. [2],[14] ABC is seen predominantly in the first two decades of life and comprise of blood filled cystic spaces separated by connective tissue septa containing fibroblasts, osteoclasttype giant cells and reactive woven bone. It is rare in craniofacial bones. Histologically, interconnected, ossified woven bone rimmed by osteoblasts is seen. Fibrous tissue, vessels and multinucleated giant cells are also identified.

Radiologically, ABC presents as a lytic, eccentric, expansile mass with well defined margins.

Comparison of our study with other studies: [1],[4].

[15],[16],[17] In our study, the predominant FOL was fibrous dysplasia which correlated with the findings of Ogunsalu et al. [4] In other studies, the predominant lesion was ossifying fibroma.[1],[16],[17] The average age of presentation of fibrous dysplasia was 34 years in our study while in other studies the mean age was slightly lower.[1],[4],[16],[17] For ossjfying fibroma, the mean age of presentation was 20 and this correlated with the other studies. The FOL showed an increased incidence among the women in our study as well as the other studies. Out of the eleven (11) cases of fibrous dysplasia, ten (10) were mono-ostotic while the one case was polyostotic and was reported as fibrocartilagenous dysplasia.

In our study, we also evaluated the lesions which histologically mimick the major FOL. Sixteen of our cases were classified as fibro-osseous like lesions and their parameters were compared with those of FOL. The commonest mimicker was aneurysmal bone cyst followed by osteiod osteoma. Although osteoid osteoma has a rare rate of recurrence, we had one case of recurrent osteoid osteoma. The age of presentation was lower than that of FOL and majority of the patients were in the adolescent age group. The predominant site of these lesions was the long bones, femur and tibia followed by the cranio-facial bones.

In this study, we encountered difficulty in distinguishing fibrous dysplasia from osteo-fibrous dysplasia in cases where the thin trabeculae of woven bone in FD showed focal osteoblastic rimming. The final diagnosis was made based on the radiological findings. The histological findings in cementoblastoma were identical to osteoblastoma. A diagnosis was made based on the direct connection with the surface of the tooth. The clinical parameters like increased serum calcium levels and parathormone levels were useful in distinguishing brown tumor of hyperparathyroidism from Pagetâ&#x20AC;&#x2122;s disease.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Sajitha K et al.

A-199

Fig. 1A: Histopathology of Fibrous Dysplasia ( H & E ×100) showing cellular fibrous tissue containing irregular bony trabeculae.; Fig 1B – Focal areas in Fibrous Dysplasia showing cementum like material (H&E × 100).; Fig 1C – Histopathology of osteofibrous dysplasia (H&E × 100).; Fig 1D – Osteofibrous dysplasia (H&E × 400) showing bony trabeculae rimmed by osteoblasts.

Fig. 2A: Cementoblastoma – CT scan – Showing association with tooth.; Fig 2B – Histopathology of Cementoblastoma (H & E × 100) - Peripheral trabeculae rimmed by plump osteoblasts.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-200

Benign Fibro Osseous Lesions

Conclusion

A number of diseases exhibit findings that closely mimic those seen in FOL. Thus, a definitive diagnosis of a FOL and its differentiation from its mimickers requires correlation of the histologic features with the clinical, radiographic, and intraoperative findings. Their successful management depends on the accurate histopathological diagnosis. Histologically, FOL show more fibrous tissue with metaplastic bone and slender thin bony trabeculae whereas the mimickers exhibit less fibrous tissue.

Acknowledgements None

Funding None

Competing Interests Nil

Reference

1. Abdulai AE, Gyasi RK. Iddarissu MI. Benign Fibroosseous lesions of the facial skeleton: Analysis of 52 cases seen at the Korle Bu teaching hospital.

Ghana Med J 2004;38(3):96-100.

2. Alawi F. Benign fibro-osseous diseases of the maxillofacial bones. A review and differential diagnosis. Am J Clin Pathol 2002;118:50-70.

3. Rajpal K, Agarwal R, Chhabra R, Bhattacharya M. Updated classification schemes for Fibro-osseous lesions of the oral & maxillofacial region: A review.

IOSR Journal of Dental and Medical Sciences 2014;13(2):99-103.

4. Ogunsalu CO, Lewis A, Doonquah L. Benign fibroosseous lesions of the jaw bones in Jamaica; analysis of 32 cases. Oral diseases 2001;7;155-62.

5. Hall G. Fibro-osseous lesions of the head and neck.

Diagnostic Histopathol 2012;18(4):149-58.

6. Barnes L, Eveson JW, Reichart P, Sidransky D. World Health Organisation Classification of Pathology and Genetics of Tumours of Head and neck tumors. Lyon Press. 2005:318-23.

7. Bahl R, Sandhu S, Gupta M. Benign fibro-osseous lesions of jaw- A review. International dental journal of students research 2012;1:56-68.

8. Eisenberg E, Eisenbud L. Benign fibro-osseous diseases: current concepts in historical perspective.

Oral Maxillofac Surg Clin North Am 1997;9:551-62.

9. Neville BW, Damm DD, Allen CM. Bone pathology.

In: Neville BW, Damm DD, Allen CM, et al, eds. Oral and Maxillofacial Pathology. 2nd ed. Philadelphia, PA: Saunders;2002:542-78.

10. Bustamante EV, Albiol GL, Aytes BL, Escoda CG. Benign fibro-osseous lesions of the maxilla: Analysis of 11 cases. Med Oral Patol Oral Cir Bucal 2008;13(10):53-6.

11. Su L, Weathers DW, Waldron CA. Distinguishing features of focal cement-osseous dysplasia and cement-ossifying fibroma II. A clinical and radiological spectrum of 316 cases. Oral Surg Oral Med Oral Pathol Radiol Endod 1997;84:540-9.

12. Eversole R, ElMofty S, Su L. Benign fibro-osseous lesions of the craniofacial complex. A review. Head and Neck Pathology 2008;2:177-202.

13. Bullogh PG. Orthopaedic pathology.5th ed .Missouri, Elsevier c2010:194-99.

14. Slootweg PJ. Cementoblastoma and osteoblastoma: Comparison of histologic features. J Oral Pathol Med1992;21:385-9.

15. Hamner JE, Scofield HH, Coryn J. Benign fibroosseous jaw lesions of periodontal membrane origin: An analysis of 249 cases. Cancer 1968;22:861-78.

16. Prabhu S, Sharanya S. Fibro-osseous lesions of oral and maxilla-facial region: Retrospective analysis for 20 years. Journal of Oral and Maxillofacial Pathology.

2013;17:36-40.

17. Langdon JD, Rapidis AD, Patel MF. Ossifying Fibroma â&#x20AC;&#x201C; One disease or six? An analysis of 39 fibroosseous lesions of the jaws. Br J Oral Surg 1976;14:1-11.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Punica Granatum v/s Lawsonia Inermis: An In Vitro Anti-Fungal study Pallav Singhal1*, Narendra Nath Singh2, Gadiputi Sreedhar3, Manu Batra4, Sumita Bannerji5 and Soumi Ghanta6 Department Of Oral Pathology And Microbiology, Sarjug Dental College, Darbhanga,India Department Of Oral Pathology And Microbiology, Kothiwal Dental College, Moradabad, India 3 Department Of Oral Pathology And Microbiology, Babu Banarasi Das College Of Dental Sciences, Lucknow, India 4 Department Of Public Health Dentistry, Surendera Dental College And Research Institute, Sri Ganganagar, India 5 Department Of Oral Pathology And Microbiology, The Dental College, Regional Institute Of Medical Sciences, Imphal, India 6 Oral Medicine And Radiology, Haldia Institute Of Dental Sciences And Research, Haldia, West Bengal, India 1

2

Keywords: Henna Leaves; Pomegranate Peel, Antifungal Activity, Candida.

ABSTRACT Background: Incidence of Fungal diseases is increasing with emerging immunodeficiency conditions. Discovery of antibiotics to combat these infections marked a resolution, but their inappropriate use blocked the action of antibiotics, change their target or ability to penetrate cells. Therefore there is a need for alternative potent antifungal products.

Aims & Objectives: To determine and compare the fungicidal action of pomegranate peel and henna leaves extract on candida.

Methods: Herbal extract was prepared from sundried, powdered Pomegranate peel and henna leaves and stored at 4˚c until use. Candida was grown in Sabouraud Agar media by the sample collected from throat swab. Sterile filter disc immersed in extract was loaded onto the prepared plates with the control as clotrimazole disc. The zone of inhibition was measured at time interval of 18-24 hours after incubation and readings were statistically analysed.

Results: The Henna lemon extract was superior to the Pomegranate ethanol extract. The minimum inhibition zone for Pomegranate ethanol extract was 14.3±0.58 mm which is lesser than that of lawsonia lemon extract and standard antibiotic with 18.6±0.58 mm of inhibition zone.

Conclusion: The results showed that punica granatum and lawsonia inermis has a potent antifungal activity and the potential use of these products as cheap, nontoxic with less side-effects and as a convenient adjuvants to pharmaceutical antifungal products and need for further investigations to be used for clinical implications in humans.

*Corresponding author: Dr. Pallav Singhal, T-29, SECTOR-12, NOIDA (U.P), Pin-201301. INDIA Phone: + 91 9935816485 Email: drpallavsinghal@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-202

Anti-Fungal Study

Introduction

Incidence of fungal disease is increasing with emerging immunodeficiency conditions. Also the long term use of antibacterial antibiotics destroy harmful as well as beneficial flora in the body, eliminating the yeast’s natural competitors for resources. A weakened or undeveloped immune system or metabolic illness such as diabetes, HIV/ AIDS, mononucleosis, cancer treatments, steroids, stress and nutrient deficiency is significant predisposing factor for candida diseases.

Discovery of antifungal antibiotics to combat these infections marked a resolution, but their inappropriate use blocked the action of antibiotics leading to various drawbacks in terms of toxicity, side-effects, drug interactions, resistance, lack of fungicidal efficacy and cost. The nature of the resistance to a few drugs has been identified as related to altered transport, modification of an enzyme, and a change in membrane composition. [1] Therefore fungal infections have become an increasingly important cause of disease among both immunocompetent and immunocompromised individuals.[2] The Henna plant, Lawsonia inermis Linnis known since with healing attributes and now is the subject of intense scientific study. The plant belongs to the family Lythraceae and is traditionally used to develop a red or black colouringto hands, feet and hair in occasions such as weddings and religious festivals. The plant is planted in home as hedges and as an ornament. The leaves of the plants are small, lanceolate, dark-green and glabrous, opposite, with very short petioles. The plant leaf contains a red orange color component, lawsone (2-hydroxy, 4-Napthoquinone). According to phytochemical analysis of henna, powdered leaves contain about 0.5-1.5% lawsone, the chief constituent responsible for the dyeing properties of the plant. Henna also contains mannite, tannic acid, mucilage, gallic acid and napthoquinone.[3] In ancient Greek mythology, pomegranates are known as the “fruit of the dead”, which is an ancient fruit that has not changed much throughout the history of man. It was found in the Indus Valley so early that there is a word in Sanskrit for pomegranate. Pomegranate belongs to punicaceae family. The major class of pomegranate phytochemicals is the polyphenols (phenolic rings bearing multiple hydroxyl groups) that predominate in the fruit. Pomegranate polyphenols include flavonoids (flavonols, flavanols and anthocyanins), condensed tannins (proanthocyanidins) and hydrolysable tannins (ellagitannins and gallotannins).

Hydrolyzable tannins (HTs) are found in the peels (rind, husk, or pericarp), membranes and piths of the fruit.

HTs are predominant polyphenols found in pomegranate juice and account for 92% of its antioxidant activity.[4]

Some researchers investigating the antifungal activities of pomegranate against Candida species reported that the fruit peel of Punica granatum L. was the most effective for inhibiting C.albicans growth.[5] To substitute antibiotics therapeutic efficacy, many indigenous plants are used. Phytochemical analysis of punica granatum and lawsonia inermis had proved their antifungal efficacy which can offer viable alternative which can offer cheap, effective and less toxic module without any side-effects.

Material and method

The study was carried out in the department of Oral Pathology of Kothiwal Dental College, Moradabad, U.P., India. The ethical clearance was obtained from institutional ethical committee. Henna leaves and pomegranate peels used in this study were collected from the Moradabad city.

Clotrimazole solution was used as a reference standard drug for comparison.

Preparation of Pomegranate Ethanol Extract: After washing, the peels were separated from the mesocarp and were sun dried for 3 days. The dried peels were ground in an electric grinder to produce a powder. 10 gm of powder was mixed with 100 ml of 100% ethanol and was continuously stirred at room temperature for 24 hours on a shaking device. The contents were then filtered with double filter paper and sterile filters to remove any impurities. The sample was stored at 4°C until use.

Preparation of Henna Lemon Extract: Fresh Henna leaves were dried in sun and were powdered in an electric grinder. 10 gm of powder was mixed with 10 ml of lemon juice to obtain a paste like consistency. Henna mix was kept for rest for 6-8 hours. The contents were centrifuged and supernatant was collected and used immediately.

Candida Strain: Throat swab of a diabetic individual was obtained and was swabbed over the surface of the Sabouraud Dextrose Agar (SDA) plate. The plate is then incubated in an incubator at 37°C for 48 hours.Creamy white, moist colonies were obtained (Fig. 1a) which were PAS (periodic acid Schiff) positive (Fig. 1b).

Method: The disc diffusion method was used to determine the anticandidal activity in vitro. The candida colonies were picked by an inoculation loop and were streaked over a new SDA plates. Sterile, Filter paper discs of 6 mm in diameterwere loaded with respective extracts and a control (Clotrimazole) and were placed with sterile tweezers onto the plates. The plates were then incubated at 37°C for 48 hours. The zone of inhibition around each disc was measured in mm. The descriptive results were presented as mean ± SD (standard deviation).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Singhal et al.

A-203

Results

Comparison of antifungal activity of henna lemon extract and pomegranate peel extract with the control was done by one way ANOVA and significantly different pairs was identified by post-hocTurkey test. Statistical analysis was conducted using SPSS version 20.0 (SPSS, Inc., Chicago, IL, USA).

A significant zone of inhibition was recorded (p=.000) from a total of 30 samples each (Table 1). Average Zone of inhibition (Figure 2) by Henna lemon extract (18.66 mm) is more than that of pomegranate ethanol extract (14.33 mm) but is comparable to Clotrimazole (18.6 mm).

Table 1: Comparison of antifungal activity of henna lemon extract and pomegranate peel extract with the control at 48 hours.

Mean

SD

Variance

Control

18.6 (Fig 2a)

0.58

0.57

Pomegranate

14.33(Fig 2b)

0.577

0.94

Henna

18.66(Fig 2c)

0.577

0.65

Significant pairs (post hoc Turkey test)

F-value

P-value

56.33

.000**

Control & pomegranate; pomegranate & Heena

** Highly significant

Fig. 1: a â&#x20AC;&#x201C; Candida colonies, b â&#x20AC;&#x201C; PAS test (Candida Hyphae, 10X)

Fig. 2: Zone of inhibition; a- clotrimazole, b- Pomegranate, c-Henna

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-204

Anti-Fungal Study

Discussion

Candidiasis one of the most common opportunistic infection secondary to immunodeficiency is treated by various synthetic antifungal agents topically. Azoles are becoming increasingly popular in the management of oral candidosis. They act by inhibition of cytochrome p-450 enzyme that is involved in cell membrane synthesis in fungi. The principle target is 14α-demethylase, which converts 14α-methylsterols to ergosterol in the fungal cell membrane, causing alteration of the fungal cell membrane by blocking the 14α-demethylation step in the synthesis of ergosterol, an important constituent of fungal cell membrane, which thus become permeable to intra-cellular constituents and leads to alteration in several membraneassociated functions.[6]But, these agents have limitations of having adverse effects and are costly.

In the present study throat swab of diabetic individual was used to isolate candida, which was then cultured on SDA. Analysis of the Candida species isolated from differentanatomical sites showed a remarkable diversity of Candida species distribution. It was noted that C. albicans were isolated mainly from the oral cavity, respiratory tract and high vaginal swabs.[7]Fungal infections are more common in Diabetes mellitus, particularly those caused

by Candida.[8]The most frequently used primary isolation medium for Candida is SDA which, although permitting growth of Candida, suppresses the growth of many species of oralbacteria due to its low Ph.[9] During an attempt to stain the capsules of certain fungi, brilliant staining with the periodic-acid-Schiff-reagent technique (Hotchkiss-McManus stain) was observed.

[10] Cawson & Lehner demonstrated that microscopical examination of PAS-stained smears was the most helpful single investigation in candida infection.[11] Disc diffusion method used to determine the anti-fungal efficacy of pomegranate and henna leaves compared with Clotrimazole was statistically significant with maximum inhibition zone of 14.33±0.58, 18.66±0.58, and 18.66±0.58mm respectively in which the findings of henna extract andClotrimazole are similar.Disc diffusion method is easy to perform and gives accurate and precise results.

[12] The findings of our study are comparable with Saadabi MAA(2007) and Pai MBH et al (2010).[13] Therapy for Candida infections has become a challenge.

Treatment is difficult due to the eukaryotic nature of fungal cells, which are similar to host cells. Few antifungal agents are in clinical use, and therefore therapy is limited by drugsafety considerations and their narrow spectrum of activity, efficacy and resistance.[14]

The active antifungal compounds in the peel extract of pomegranate are Punicalagin, Castgalagin, Granatin, catechin, Gallocatechin, kaempferol, and querectin. The synergistic interaction of these compounds increases the antifungal activity of pomegranate peel extract.

Tannins are known to precipitate proteins which might be responsible for inhibitory action of extract.[13]The effect of tannins on microbial metabolismcan be measured by their action on membranes.They can cross the cell wall, composed ofseveral polysaccharides and proteins, and bind to itssurface. This adhesion can also help determining minimuminhibitory concentrations for yeasts and bacteria.

[15] By transmission electron microscopy, treated cells with punicalagin showed a thickened cell wall,changes in the space between cell wall and the plasmamembrane, vacuoles, and a reduction in cytoplasmic content.[16] Application of lemon on hand after applying henna paste has been practiced since ancient times to darken its colour.

The acid in the lemon juice releases the dye (Lawsone) out in the henna.Phytochemical analysis of henna leaves showed tannic acid, napthaquinone (hennotannic acid), crysophanic acid, anthraquinones, mucilage, mannite, gallic acid, cyanogenic glycosides, sterols and triterpenes.

[3] Lawsonia leaves contain 0.5%-1.5% lawsone (2 hydroxy1,4-napthaquinone) and exhibit strong fungitoxicity where napthaquinones were found to be active factor which acts on the cell membrane, alter the enzyme secretion of the fungi and inhibit metabolic activity of fungi and catalase production.Catalase is essential enzyme in fungi for the conversion H2O2 in to oxygen and water. If this enzyme is not produce then H2O2 will accumulate in large quantity and toxic to the cell.[17] Naphthoquinones interact with biological targetsby forming covalent bonds or via their ability to undergo reversible oxidation-reduction reactions. The mechanism of action usually involves the generation of reactive oxygen species (ROS) by the redox cycle under aerobic conditions, by the inhibition of electron transport, by DNA intercalating and/or alkylating agents of biomolecules, and/or as topoisomerase inhibitors.[18]Lawsone has been shown to be effective against candida albicans isolated from patients with HIV/AIDS.[19] It is not possible to make a direct correlation between the observed activity of the plant extracts in vitro and the actual effects when used in vivo for the diseases observed by the indigenous people and traditional healers. Therefore it is important that these extracts should also be further investigated to evaluate their role clinically.

Conclusion

Candida spp. Is the most common fungal pathogen responsible for invasive infections. Apart from C. albicans,

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Singhal et al. other species such as C.glabrata, Candida tropicalis, C. parapsilosis, Candida kruseiand Candida dubliniensishave also been isolated from saliva of infected subjects.The present study is just a venture from the usual clinical approach. The use of medicinal plants against candida can be a viable alternative to other antifungal agents as these offers cheap and effective module. It is to be concluded that punica granatum and lawsonia inermis extract can serve as an effective means to control candidal infections and can be used as a replacement to topical antifungal products.

Therefore these herbs needs further investigations so as to isolate and characterize their active components for pharmacological testing and studies on toxicity in humans, formulations, optimal concentration for clinical applications and comparative studies with antifungal drugs currently in use.

A-205

1. Goldway M, Teff D, Schmidt R, Oppenheim AB, Koltin Y. Multidrug resistance in Candida albicans: disruption of the BENr gene. Antimicrob Agents Chemother1995;39(2):422-6.

2. White TC. Antifungal drug resistance in Candida albicans. ASM News 1997;63:427–433.

3. Saadabi MAA. “Evaluation of Lawsonia inermis L. (Sudanese Henna) Leaf extracts as an antimicrobial agent”. Res. J. Biol. Sci. 2007;2(4):419-423.

4. Dahham SS, Ali MR, Tabassum H, Khan M. Studies on Antibacterial and Antifungal Activity of Pomegranate (PunicagranatumL.). American-Eurasian J. Agric. & Environ. Sci.2010;9(3):273-281.

5. Orak HH, Demirci AS, Gumus T. Antifungal and Antibacterial Activity of Pomegranate (Punica GranatumL.CV.) Peel. EJEAFChe 2011;10(3):1958-69.

6. Ellepola ANB, Samaranayake LP. Oral candida infections and actinomycotics. Crit Rev Oral Biol Med 2000;11(2):172-98.

7. Ng KP, Kuan CS, Kaur H, Na SL, Atiya N, Velayuthan RD. Candida species epidemiology 2000–2013: a laboratory based report.Trop Med Int Health 2015. doi: 10.1111/tmi.12577

8. Casqueiro J, Alves C.Infections in patients with diabetes mellitus: A review of pathogenesis. Indian J EndocrinolMetab 2012;16(Suppl1):S27–S36.

9. Raju SB, Rajappa S. Isolation and Identification of Candida from the Oral Cavity. ISRN Dent 2011;2011:487921.

10. Kligman AM, Mescon H. The periodic-acid-schiff stain for the demonstration of fungi in animal tissue.

J Bacteriol 1950;60(4):415–421.

11. RindumJL, Stenderup A, Holmstrup P. Identification of Candida albicanstypes related to healthy and pathological oral mucosa. J Oral Pathol Med 1994;23(9):406-12.

12. Xia H, Keane CT, Beattie S, O’Morain CA. Standardization of disk diffusion test and its clinical significance for susceptibility testing of metronidazole against Helicobacter pylori. Antimicrob Agents Chemother 1994;38(10):2357–2361.

13. Pai MB, Prashant GM, Murlikrishna KS, Shivakumar KM, Chandu GN. Antifungal efficacy of Punicagranatum, Acacia nilotica, Cuminumcyminum and Foeniculumvulgare on Candida albicans: An invitro study. Indian J Dent Res2010;21(3):334-6.

14. Endo EH Cortez DA, Ueda-Nakamura T, Nakamura CV, Dias Filho BP.Potent antifungal activity of extracts and pure compound isolated frompomegranate peels and synergism with fluconazole against Candida albicans. Res Microbiol 2010;161(7):534-540 15. Vasconcelos LC, Sampaio FC, Sampaio MC, Pereira Mdo S, HiginoJS, Peixoto MH.Inhibitory Concentration of Adherence of Punicagranatum Linn (pomegranate) Gel against S. mutans, S. Mitis and C. albicans. Braz Dent J 2006;17(3):223-7.

16. Miguel MG, Neves MA and Antunes MD. Pomegranate (PunicagranatumL.): A medicinal plantwith myriad biological properties - A short review. J. Med. Plants Res.2010;4(25):2836-2847.

17. KhanZS and Nasreen S.Phytochemical analysis, antifungal activity and mode of actionof methanol extracts from plants against pathogens. Journal of Agricultural Technology 2010;6(4):793-805 18. Lopez LI, Nery Flores SD, Silva BelmaresSY, Saenz Galindo A. Naphthoquinones: biological properties and synthesis of lawsone and derivatives - a structured review. Vitae 2014;21(3):248-258.

19. Babu PD, Subhasree RS. Antimicrobial Activities of Lawsonia inermis- A Review. Acad. J. Plant Sci. 2009;2(4):231-232.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Acknowledgements None

Funding None

Competing Interests None declared

References

Original Article Diagnostic Dilemma at Preoperative Biopsy Diagnosis of Oral Cavity Lesions with Recommendations Madhu I Chaturvedi* and Arshad K Pathan Pathology department, LTM Medical College and General hospital Sion , Mumbai, India Keywords: Biopsy, Oral Cavity, Pitfalls, Problems

ABSTRACT Background: Oral cavity lesions of varied nature present in varying patterns from a plaque to a proliferative growth.

Biopsy is an important preoperative diagnostic tool for the diagnosis of lesions ranging from simple tumour like lesions to malignancies and deciding the treatment and extent of surgery. At times it becomes difficult for a pathologist, to decide exact nature of the growth at biopsy. The authors share their experience and dilemma during reporting and views to solve them.

Methods: All the punch biopsies and subsequent surgical resections of oral cavity received in department of pathology were reviewed over a period of two years. They were subjected to routine tissue processing in automatic tissue processor, 4-5 microns section cutting and routine H& E staining. Histopathology was evaluated. All the tumours were classified according to WHO classification of Head and Neck tumours. Tumour like lesions was evaluated on the basis of features described by various authors in the literature. Specificity, sensitivity, accuracy, percentage of false negative and false positive, and positive and negative predictive value of the oral cavity biopsy was evaluated.

Result: Majority of the oral cavity lesions irrespective of nature, presented as exophytic proliferative growth (83.9%).

The diagnostic accuracy of biopsy for evaluating oral cavity lesions was 95.1%. There were 6.9% false negative reports.

Sensitivity and positive predictive value of the method to detect malignant and premalignant lesions was 93.1% and 100% respectively, whereas, specificity and negative predictive value was 100% and 85 %. In total 19 cases, problem of histopathology assessment was encountered.

Conclusion: To prevent problems and pitfalls in assessing the nature of oral cavity lesion prior to surgery, the reporting pathologist should take utmost care in proper orientation and processing of the tiny oral cavity biopsies, be aware of accurate definitions , characteristic features and criteria of malignancy and should have a close co-ordination with the treating surgeon.

*Corresponding author: Dr Madhu I Chaturvedi, Associate Professor , Second floor ,Pathology department, College building, LTM Medical college and General hospital , Sion,Mumbai. 400022.

Phone: + 91 9820322802 Email: madhu_chaturvedi@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Chaturvedi et al.

A-207

Introduction

predictive value of the oral cavity biopsy was evaluated using formulas as follows: [7]

Oral cavity is subjected to broad spectrum of agents leading to changes in oral mucosa. The changes inflicted by these varied agents in oral mucosa may range from a white patch, a plaque, an ulcer or a growth. These changes can be the cause of anxiety in an individual as they raise the suspicion of cancer. All the oral cavity lesions are first biopsied before proceeding to the final surgical procedure of local excision or wide local excision or radical resection surgery, depending on the pathological assessment of the biopsy. Therefore, pathologists play an important role to differentiate them and their judgment is crucial in deciding to adopt an adequate treatment strategy. Tissue specimens from the oral cavity are often small in size and many tissue alterations can occur at various stages: during surgical removal and tissue processing, interfering with the pathologistâ&#x20AC;&#x2122;s ability to provide an accurate diagnosis.

Therefore, the present study was conducted to evaluate the role of biopsy in the assessment of true nature of oral cavity lesions and its problems and pitfalls.

Materials and Methods

The present analytical type of cross-sectional study was conducted in a 1400 bedded tertiary care hospital. This hospital caters to the health problems of lower and middle income group population from the area in near vicinity as well as patients referred from nearby suburbs. Approval of the institutional ethics committee was taken to conduct this study.

To minimize misclassification errors and for the purpose of evaluation, the extent of oral cavity was defined according to American Joint Committee on Cancer Staging [1]. The oral cavity extends from the skin- vermillion junction of the lips to the junction of the hard and soft palate above and to the line of the circumvallate papillae of the tongue below. Thus, the lesions arising from lips, buccal mucosa, upper and lower alveolar ridge, retromolar trigone, floor of the mouth, hard palate and anterior two third of tongue were included in the present study.

1. Specificity: True negative/True negative+ False positive x 100 2. Sensitivity: True positive/True positive+False negative x 3. Positive predictive value: True positive/True positive + False positive x 100 4. Negative predictive value: True negative/ True negative + False negative x 100 5. Accuracy: True positives+ True negatives True positive+ False positive+ False negative + True negative

Result

Total number of specimens of tumours and tumour like lesions received over a period of two years were 1911, of which, 152(8%) were from oral cavity.

Oral cavity lesions presented as many growth patterns like plaque, ulcer, and cyst. Majority of the oral cavity lesions irrespective of nature, presented as exophytic proliferative growth (83.9%) that caused high suspicion of malignancy especially in elderly patients. Behaviour wise distribution of growth patterns is shown in Table 1 The diagnostic accuracy of biopsy for evaluating oral cavity lesions was 95.1%. There were 6.9% false negative reports but no false positive reports. Sensitivity and positive predictive value of the method to detect malignant and premalignant lesions was 93.1% and 100% respectively, whereas, specificity and negative predictive value was 100% and 85 % respectively.

Problems and Pitfalls of Biopsy of Oral Cavity Lesions: In total 19 cases, problem of histopathological assessment was encountered as follows:

Specificity, sensitivity, accuracy, percentage of false negative and false positive, and positive and negative

1. Inconclusive due to superficial biopsy (9 cases) (figure 1): Punch biopsy was not of sufficient size and depth to include part of the advancing front of the tumour. Reorientation was asked for in all the cases but even the recut slides showed only benign keratinised stratified squamous epithelium with no underlying stroma.

2. Interpretation dilemma due to proliferative lesion with no sufficient adjacent normal mucosa and underlying stroma (2 cases): Verrucous hyperplasia vs. verrucous carcinoma: Section from punch biopsy showed on histology tortuous hyperplastic squamous epithelium with parakeratosis,hyperkeratosis, minimal cytologic atypia (figure 2a) and inter anastomosing broad rete ridges (figure 2b).Biopsy was not of

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

All the punch biopsies and subsequent surgical resections received in department of pathology, were reviewed over a period of two years. They were subjected to routine tissue processing in automatic tissue processor, 4-5 microns section cutting and routine H& E staining. Histopathology was evaluated. All the tumours were classified according to WHO classification of Head and Neck tumours. [2] Tumour like lesions were evaluated on the basis of features described by various authors in the literature [3, 4, 5, 6]

A-208

Biopsy Diagnosis of Oral Cavity Lesions

sufficient size and depth to include part of the advancing front of the tumour or adjacent normal mucosa. Therefore, a descriptive report was issued and inadequacy of the tissue to opine on malignant nature of the growth was stated. The laboratory received a wide local excision specimen of the patient.

Histopathology of wide local excision revealed broad pushing blunt squamous epithelial downgrowths, and thus diagnosis of verrucous carcinoma was confirmed.

3. Interpretation dilemma due to proliferative lesion with superficial invasion surrounded by dense inflammation (1 case): pseudoepitheliomatous hyperplasia verses well differentiated squamous cell carcinoma with superficial invasion: Section from the biopsy showed predominantly hyperplastic squamous epithelium with dense lymphocytic inflammation in the underlying stroma and intact basement membrane. A keratin pearl and a focus of subtle disruption in basement membrane with few atypical squamous epithelial cells were noted superficially in the stroma surrounded by dense inflammation (figure 4). The diagnosis of suspicion of malignancy was conveyed to the surgeon. Wide local excision revealed unequivocal invasion in other focus.

4. No precise histological categorisation (2 cases): Verrucous hyperplasia was described as hyperplastic squamous epithelium with no atypia and a case of fibroepithelial polyp was described as normal squamous epithelium with fibrocollagenous connective tissue stroma.

5. Interpretation error (5 cases): Hyperplastic and hyperkeratotic squamous epithelium vs. WellModerately differentiated squamous carcinoma : Sections from punch biopsy of proliferative growths showed either inter- anastomosing thick bands of well differentiated squamous epithelium with minimal atypia and entrapped fibrovascular connective tissue and keratin pearls. There was no basement membrane breach (figure 4a) or islands of well differentiated squamous epithelium with intact basement membrane in the submucosa (figure 4b). These islands were considered as tangential cuts of hyperplastic rete ridges.The Cases were diagnosed as hyperplastic and hyperkeratotic squamous epithelium with no evidence of malignancy. Resection specimen was received in all cases. Sections showed unequivocal invasion and well differentiated squamous cell carcinoma.

Table 1: Site wise and behavior wise distribution of all tumour and tumour like lesions of the oral cavity (in number and percentages) Site Malignant Benign Premalignant Tumour like Total (n=85, 59.4%) (n=21, 14.7%) (n=17, 11.9%) (n=20, 14%) (n=143,100%) Lip 8(36.4%) 4(18.2%) 2(9.1%) 8(36.4%) 22(15.4%) Buccal mucosa 31(58.5%) 8(15.1%) 10(18.9%) 4(7.5%) 53(37.1%) Tongue 24(63.2%) 8(21.1%) 3(7.9%) 3(7.9%) 38(26.6%) Gingivo- buccal sulcus 13(81.3%) 1(6.2%) 1(6.2%) 1(6.2%) 16(11.2%) RMT 5(71.4%) 0 0 2(28.6%) 7(4.9%) FOM 5(62.5%) 0 1(12.5%) 2(25%) 8(5.6%) Hard palate 1(100%) 0 0 0 1(0.7%)

Fig. 1: Inconclusive biopsy from proliferative growth of buccal mucosa, due to superficial nature with no underlying stroma( H&E,400X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Chaturvedi et al.

A-209

Fig. 2: Interpretation dilemma: verrucous hyperplasia vs.verrucous carcinoma. Biopsy shows (a) hyperplastic, hyperkeratotic squamous epithelium and (b) interanastomosing broad rete ridges but no normal adjacent mucosa or advancing front in underlying stroma (H&E, 400X).

Fig. 3: Interpretation dilemma: pseudoepitheliomatous hyperplasia verses well differentiated SCC with minimal invasion (a) predominantly hyperplastic rete ridges with intact basement membrane , dense inflammation in underlying stroma, subtle focus of atypical squamous cells (short arrow) , keratin pearl in superficial stroma (long arrow), H&E,100X. (b) Subtle focus of disrupted basement membrane and atypical squamous epithelial cells (H&E, 400X).

Fig. 4: Hyperplastic and hyperkeratotic squamous epithelium vs. Well differentiated squamous carcinoma : (a) interanastomosing thick bands of well differentiated squamous epithelium with minimal atypia (b) islands of well differentiated squamous epithelium with intact basement membrane in the submucosa (H&E, 400X).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-210

Biopsy Diagnosis of Oral Cavity Lesions

Discussion

Both benign and malignant lesions predominantly present as exophytic proliferative growth. This develops suspicion of cancer and causes apprehension in the minds of both patients and clinicians. Problems may occur at all stages of the histopathological diagnosis from the collection and orientation of specimen by the surgeon, processing of received tissues and interpretation. [8] In a superficial/inconclusive biopsy, the problem could be insufficient sampling by the surgeon. The biopsy taken may be of insufficient size and depth. It may be due to poor orientation of the tissue within the block. Therefore, utmost care should be taken right at the time of taking biopsy and subsequent processing. Generally, larger is the sample greater is the chance of an accurate diagnosis.

Fixation causes shrinkage. Preferably, we suggest that the biopsy size should be 4-5 mm and not less than 2 mm.

The greater size of tissue biopsy, allows for the shrinkage and permits the pathologist to better orient and cut the specimen avoiding tangential sectioning. Biopsy should be visualized under magnifying lens, to identify mucosa and underlying tissue accurately, and then wrapped in a filter paper with proper orientation so that both mucosa and underlying tissue remain parallel to the surface of paraffin block and are exposed to cutting edge of knife. All samples should be coloured by using eosin or bouinâ&#x20AC;&#x2122;s fluid that impart pink or yellow colour respectively and chances of loss of tissue during processing are minimized.[8,9] Interpretation dilemma often occurs in distinguishing verrucous hyperplasia and verrucous carcinoma if incisional biopsy is not of sufficient depth and does not include adjacent normal epithelium. Therefore, surgeon should be asked to collect biopsy from the edge of the tumour, so that the sample includes normal adjacent tissue as well. Multiple biopsies should be collected in single sitting which will minimize the chances of insufficient sampling and will not develop the need of re-biopsy that will cause trouble to patient. For smaller, discrete lesions, an excisional biopsy may be more ideal. [9, 10] Pathologists should be aware of the fact that Verrucous hyperplasia simulates Verrucous carcinoma, but are entirely exophytic , superficial and lack the downward proliferation of the rete pegs beyond the level of the adjacent squamous epithelium. Unlike this, verrucous carcinoma exhibits both upward and downward hyperplastic growth with orderly maturation and typically downgrowth is made up of bulbous ,blunt rete pegs with pushing and well differentiated edges, and shows presence of neutrophils in the form of small intraepidermal abscesses. These are important diagnostic clues.[11,12]

The precise histological categorisation or misinterpretation of mucosal lesions that include an exophytic growth component is a difficult and often encountered experience.

Awareness of accurate definitions, clinical and histological characteristics can alleviate such problems and errors. For this pathologist need to keep their knowledge up to date by frequent reading and attending dermatopathology CME. The diagnosis of OSCC is usually straight forward when island or cords or isolated malignant squamous epithelial cells are seen in between the submucosa connective tissue or skeletal muscle fibres or fat lobules or salivary gland lobules. This is unequivocal invasion. But interpretational error in the diagnosis of well differentiated squamous cell carcinoma may occur as section from incision biopsy may show on histology, tortuous centrally-keratinising columns of proliferated squamous epithelium with minimal cytologic atypia or unequivocal / submucosal invasion cannot be established or suspicion that whether â&#x20AC;&#x2DC;Islandsâ&#x20AC;&#x2122; of epithelium within the lamina propria, represented tangential cuts of rete processes, especially if these were long and bulbous as in some reactive conditions. Subepithelial brisk inflammatory reaction may cause difficulty in the assessment of breech in the continuity of the basement membrane and in turn compromise assessment of the invasive front.

In such cases If there is uncertainty whether or not invasion has occurred in a background of severe dysplasia, proliferative or not, the histology should be reported as lacking unequivocal evidence of invasion. Re-biopsy should be considered and surgeon should be informed of the dilemma.[8] In his review article Bruce M Weing also considered sampling as a major issue in the evaluation of SCC of the upper aerodigestive tract. He has stated that in the absence of adequate representative tissue including epithelial-to-stroma interface, one should be circumspect relative to a diagnosis of SCC. He has considered few benign lesions as diagnostic pitfalls in the diagnosis of SCC that include pseudoepitheliomatous hyperplasia, necrotizing sialometaplasia, juxtaoral organ of Chievitz, and radiation atypia. About verrucous carcinoma (VC) author has discussed that the pathologic diagnosis of VC may be extremely difficult. Both clinician and pathologists should be aware of this fact. To this end, adequate biopsy material is critical to interpretation and should include a good epithelial-stromal interface. The pathologist should not overinterpret a verrucoid lesion as a carcinoma without seeing the relationship to the underlying stroma.[13 ]

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Chaturvedi et al.

A-211

Conclusion

Hitopathology evaluation determines the accurate diagnosis and nature of the various exophytic proliferative lesions of the oral cavity.

To alleviate all problems of histopathology assessment, proper sampling, orientation of biopsy within the block, proper trimming of block, awareness of precise histopathology definitions, characteristic features of various entities, differential diagnosis and diagnostic algorithms provided by dermatopathologists is must, as accurate diagnosis carries prognostic implications.

6.

7.

8.

Acknowledgements

Dr. A.D. Kalgutkar, Professor and HOD Pathology,LTMMC and LTMGH for her general support

Funding

9.

None

Competing Interests None declared

Reference

1. Stephen BE., David RB., Carolyn CC., April GF., Frederick LG., Andi T (Eds.): AJCC Cancer Staging Manual. Lip and Oral Cavity. 7th ed. Springer Verlag, New York 2009:29-41.

2. Barnes L., Everson J.W., Reichart P., Sidransky D. (Eds.): World Health Organization Classification of Tumors. Pathology and Genetics of Head and Neck Tumors. IARC Press: Lyon 2005:168.

3. Peter AH, Louis PD, John DP (Eds.): Washington manual of Surgical Pathology. Oral cavity and oropharynx. 1st ed. Lippincott Williams and Wilkins: USA 2008.

4. Noel W., Kurt M., Richard J.C., Suster S., Lawrence MW. (Eds.): Modern Surgical Pathology. Head and Neck. 2nd ed. (1). WB Saunders: Philadelphia 2009:1.

5. Crispian S., Oslei PA, Jose B, Pedro DD, Adalberto MT (Eds.): Oral Medicine and Pathology at glance.

www.pacificejournals.com/apalm

10.

11.

12.

13.

Swellings: reactive lesions. 1st ed. Wiley Blackwell: UK 2010.

Barnes L (Ed.): Surgical Pathology of Head and Neck.

Benign and non neoplastic disease. 2nd ed. (1). Marcel dekker inc.: New York 2001: 239.

Glaros AG, Kline RB. Understanding of the accuracy of tests with cutting scores: The sensitivity,specificity, and predictive value model. Journal of clinical psychology, 1988:44(6); 1013-24.

Woolgar JA, Triantafyllou A. Pitfalls and procedures in the histopathological diagnosis of oral and oropharyngeal squamous cell carcinoma and a review of the role of pathology in prognosis.

Oral Oncol, 2009:45; 361-85. doi: 10.1016/j. oraloncology.2008.07.016. Epub 2008 .Available from http://www.ncbi.nim.nih.gov/pubmed/18849188.

Kumaraswamy K L, Vidhya M, Rao PK, Mukunda A. Oral biopsy: Oral pathologist’s perspective.

J Can Res Ther, 2012:8(2):192-8. Doi: 10.4103/09731482.98969 Available from http://www.cancerjournal. net/text.asp?2012/8/2/192/98969.

Poh CF, Ng S, Berean KW, Williams PM, Rosin MP, Zhang L. Biopsy and histopathologic diagnosis of oral premalignant and malignant lesions. J Can Dent Assoc 2008;74(3):283-8.

Mills SE, Carter D.(Eds): Sternberg’s diagnostic surgical pathology. The jaws and oral cavity. 5th ed.

(1). Wolters Kluwers/ Lippincot Williams &Willkins, Philadelphia 2010;789-90.

Santoro A, Pannone G, Contaldo M, Sangueddce F, Esposito V,Serpico R et al. A Troubling Diagnosis of Verrucous Squamous Cell Carcinoma (“the Bad Kind” of Keratosis) and the Need of Clinical and Pathological Correlations: A Review of the Literature with a Case Report. Journal of skin cancer, 2011. Available from http://dx.doi.org/10.1155/2011/370605 Weing BM. Squamous cell carcinoma of the upper aerodigestive tract: precursors and problematic variants. Mod Pathol 2002;15(3):229-54.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Establishing Reference Value of Biochemical Parameters - A Must Before Ensuring Quality in Biochemistry Diagnostic Lab Gitanjali* and Panag KMDS Dept of Biochemistry GGS Medical College, Faridkot, Punjab, India Keywords: Reference values, Biochemistry, General population

ABSTRACT Background: Quality assurance in a laboratory comprises of a set of factors which besides numerous preanalytical, analytical and post analytical variables also include effect of age and sex on various parameters. Present study was done to know the impact of these factors on various biochemical variables and reference values of the various biochemical parameters were set according to age and sex.

Methodology: The present study was conducted on 200 apparently healthy individuals from Malwa belt of Punjab.

The participants were divided according to age and sex. All the parameters were measured by standard lab protocols/ methods.

Result: In addition to various preanalytical, analytical & post analytical variables, some of the parameters showed significant variations according to age and sex. Serum creatinine,uric acid, AST,ALP and Calcium showed significant difference in males as compared to females(p<0.05). Parameters like Urea, Creatinine, uric acid ,total protein and cholesterol showed significant difference in individuals who were more than 50 years when compared with individuals less than 50 years (p<0.05).

Conclusion: These reference values will be used to compare the results of various biochemical parameters of patients coming to our tertiary care hospital. Also the setting of reference value should be done as a protocol before assuring quality control in the lab. But there is need for more elaborative studies with more number of participitants and it should be comparable with the results from multiple laboratories that are using same methodology and instruments.

*Corresponding author: Dr Gitanjali, Associate Professor, Dept of Biochemistry GGS Medical College, Faridkot, Punjab, India Email: gitanjaligoyal@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Gitanjali et al.

Introduction

Health of an individual is conceptually different in different countries, in the same country at different times and in same individuals at different ages. It is thus a relative and not an absolute state. This means that the condition of individuals must be related to or compared with reference data.

On comparing the individuals data collected during the medical interview, clinical examination, and supplementary investigations with the reference data, the condition of individuals can be interpreted. A patientâ&#x20AC;&#x2122;s laboratory result simply is not medically useful if appropriate data for comparison are lacking. It is thus the central role of the laboratory scientist to aid the clinician in interpreting observed values by providing relevant reference values and presenting them in a convenient and practical form.[1] A good quality assurance in a tertiary care diagnostic laboratory requires establishing physiological ranges of various biochemical parameters which may vary according to age, gender and geographic distribution.

The concept of reference values was introduced in 1969.[2] Reference values are result of tests obtained from sample(s) of an individual or individuals of a defined description.

[3] Determining reference values of healthy subjects of a geographic location in a hospital laboratory assumes significance as results can vary in different setting and it would serve as reference for less heterogeneous population and subjects attending the hospital. [4] Reference ranges for biochemical parameters are nonexistent in this population where, like in many other countries of the third world it is common practice to use reference ranges established for western population for interpretation of lab results.[5] As recommended by the IFCC at least 120 reference subjects are required for the establishment of reference values.[4]

A-213 were enrolled for the study. The persons with abnormal blood cell counts, deranged blood sugar level, abnormal triglyceride levels were excluded from the study. About 10 ml of blood was collected after overnight fasting. Serum was separated after centrifugation at 3000 rpm for 10 min.

Routine investigations were done on fully autoanalyzer Beckman Coulter AU 480. Blood glucose was based on hexokinase enzymatic method,[6] Urea/BUN was measured by urease reaction coupled to decrease in NADH by l-glutamate dehydrogenase,[7] Creatinine measurement was based on Jaffe reaction,[8] uric acid was measured by reaction of uricase and peroxidase reaction.

[9] Cholesterol measurement was based on cholesterol esterase and peroxidase,[10] Triglyceride was based on GK GPO Peroxide,[11] HDL was measured by release of HDL and reaction with CHE and peroxidase,[12]TBI, DBI were measured by Vanden berg reaction and Diazo method.[13] ALP was measured by rate of conversion of p-nitro-phenylphosphate to p-nitrophenol.[14] ALT and AST were based on coupling of transamination reaction with consumption of NADH for LDH reaction,[15]TP was estimated by reaction with cupric ion in alkaline medium,[16] Albumin estimation was based on its reaction with bromocresol green.[17] Statistical Analysis: Stastical analysis was done using SPSS version 20.All the values were given as Mean + SD .p Value was calculated using Karl Pearson formula.

Quality Control

All pre-analytical, analytical and post analytical precautions were taken into consideration for ensuring proper quality. All Standard Operating Procedures (SOPs) were followed for sample collection, processing, storage and handling. Internal quality control (QC) was done for each parameter by using lyophilized Quality Control levels from BIORAD. The reference ranges were considered only after verification of control ranges. Westgard Rules were followed to ensure quality.

The need for establishment of baseline reference with which to monitor the complete quality protocol as well as to monitor pathological changes in the patients coming for investigations is there.

Results

The present study was aimed to establish reference values of various biochemical parameters in healthy individuals according to sex and age.

After appropriate informed and written consent, detailed history regarding socioeconomic status and medical history to rule out common illnesses, 200 healthy individuals

The values were comparable to those as given in the protocols but the values of some parameters which show significance difference according to gender and age as highlighted by asterisk in tables (p<0.05). Parameters like Urea, Creatinine, uric acid ,total protein and cholesterol showed significant difference in individuals who were more than 50 years when compared with individuals less than 50 years. Similar findings were found by other authors also.[4]

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Materials and Methods

The subjects were divided according to sex and age. The parameters were compared among males and females (Table 1).

A-214

Establishing Reference Value of Biochemical Parameters - A Must Before Ensuring Quality in ...

Table 1: showing reference range of various biochemical parameters in males and females Parameter

Mean (SD) value in Males

Mean (SD) value in Females

Reference Range as per kit insert

Glucose (mg%)

87.3 (10.9)

86.4 (9.6)

70-105

Urea/BUN (mg%)

18.1 (5.1)

17.4 (4.1)

7-25

*Creatinine (mg%)

0.90 (0.25)

0.80 (0.25)

M = 0.7-1.3 F = 0.6-1.2

*Uric acid (mg%)

5.38 (1.0)

4.90 (0.85)

M = 4.4-7.6 F = 2.3-6.6

TBI (mg%)

0.88 (0.4)

0.80 (0.3)

0.3-1

DBI (mg%)

0.3 (0.14)

0.2 (0.09)

0-0.2

*AST (U/L)

14.9 (5.3)

13.8 (4.1)

13-39

ALT (U/L)

20.65 (5.8)

19.2 (6.0)

7-52

*ALP (U/L)

69.6 (12.4)

67 (11.8)

34-104

TP (g%)

7.33 (1.4)

7.17 (1.1)

6.4-8.9

ALB (g%)

4.67 (0.71)

4.01(0.5)

3.7-5.3 4.2-5.5

Chol (mg%)

193.5(38)

189.8(36.6)

136-290

TG (mg%)

113.4(30.9)

109.9(28.8)

48-352

HDL (mg%)

47.1(8.9)

49.0(8.4)

30-67

*Ca (mg%)

9.38(1.5)

9.03(1.3)

8.6-10.3

Serum creatinine,uric acid, AST,ALP and Calcium showed significant difference in males as compared to females(p<0.05) The subjects were divided in two groups according to age.Group I less than 50 years and group II with age group more than 50 years.

Table 2: showing reference range of various biochemical parameters according to age.

Parameter

Mean(S.D) Age <50 years

Mean(S.D) Age >50 years

Glucose (mg%)

87(11.3)

87.6(10.5)

*Urea/BUN (mg%)

16(10.0)

19(12.1)

*Creatinine (mg%)

0.7(0.2)

0.81(0.3)

*Uric acid (mg%)

4.50(1.1)

4.8(0.9)

TBI (mg%)

0.80(0.2)

0.81(0.29)

DBI (mg%)

0.3(0.14)

0.3(0.1)

AST (U/L)

13.98(5.92)

14.67(5.37)

ALT (U/L)

21.2(6.1)

20.9(5.6)

ALP (U/L)

65(22.3)

65(23.2)

*TP (g%)

7.5(2.0)

6.38(2.14)

ALB (g%)

4.11(0.6)

4.04(0.4)

*Chol (mg%)

184(24.3)

198(24.7)

TG (mg%)

102.3(35.3)

123(30.3)

HDL (mg%)

47.8(7.30)

46.9(7.10)

Ca (mg%)

9.60(0.7)

9.11(0.6)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gitanjali et al.

A-215

Fig. 1: showing values of parameters having significant difference according to sex.

Fig. 2: showing reference value of some Biochemical parameters according to age

Discussion

in females may be due to the greater muscle mass in males than females. [23] The higher UA in males relative to females could be explained by the higher clearance rate in females than in males. [24] Increase of ALT with advancing age in both males and females suggests that ALT levels are age dependent Ideally, specimens for the production of reference values for clinical use should be collected under conditions as similar as possible to those prevailing in clinical practice.

As several factors cause increased variability of analytes, it is necessary to standardize the pre-analytical procedures.

Important among biological factors are those that modify the metabolism of lipids, amino acids, and carbohydrates.

Meals,prolonged fasting, pharmacologically active substances, hormonal supplementation therapy,stress, and physical exercise may have an effect on the metabolic state of the reference individual.Hemodynamic factors like change in posture,[25] recent exercise, or tourniquet pressure can bring about an increase in the concentrations of proteins, calcium, fatty acids, and bilirubin. Intake of ethanol,anticonvulsant drugs may induce synthesis of liver enzymes (eg. gammaglutamyltransferase) and this may increase the clearance of many substances, thus affecting their concentration in serum.

A reference range of a clinical chemistry parameter is a set of values used in the interpretation of a clinical chemistry report. There are two types of reference ranges categorized as subject based and group based. When doing a follow up on patients, a clinician often use a subject-based reference range to determine the progress made in the management of a pathological disorder. To establish whether a patient has a certain pathological disorder however, group-base reference range is used in the interpretation of laboratory report.[18] In clinical management of patients, physicians rely on blood chemistry analytes for accurate diagnosis, proper treatment and follow-up of patients. Correct interpretation of the results from these analytes presupposes that the clinician and the laboratory medicine physician have good reference information. Published reference ranges in literature do not sometimes represent adequately the specific population from which the patient comes from based on age, sex, genetics,diet, and altitude. In addition, reference ranges produced by reagent manufacturers are determined from analysis of blood samples of a few health workers who do not represent the general population.

Reference information is often the weakest data provided by clinical laboratories even though such data is very useful for the correct and proper interpretation of laboratory results. It is therefore recommended that each clinical chemistry laboratory establish its own reference range for biochemical parameters.[19] Our findings are in accordance with other authors which states that differences in the reference limits could be due to differences in the geographical location ,methods and equipments used, sample size, posture, race, regional differences in the dietary intakes of foods rich in these analytes, and genetics. [20-22]Increase in creatinine with the advancement of age for both sexes could be due to muscle degradation with age. Higher creatinine levels in males than www.pacificejournals.com/apalm

Limitation of the Study: The limitation of the study is that the participants were considered to be normal which is a broad term. Also the sample size was small according to age, and sex .

Conclusion

These reference values will be used to compare the results of various biochemical parameters of patients coming to our tertiary care hospital. Also the setting of reference value should be done as a protocol before assuring quality control in the lab. But there is need for more elaborative studies with more number of participitants and it should be comparable with the results from multiple laboratories that are using same methodology and instruments. eISSN: 2349-6983; pISSN: 2394-6466

A-216

Establishing Reference Value of Biochemical Parameters - A Must Before Ensuring Quality in ...

References

1. Solbergm H. International Federation of Clinical Chemistry, Expert Panel on Theory of Reference Values: Approved Recommendation on the theory of reference values. Part 1. The Concept of Reference Values. J. Clin.

Chem. Clin.Biochem. 1987;25: 337-342.

2. Grasbeck R, Saris NE. Establishment and use of normal values. Scand J Lab Invest 1969; 26:62-3 3. Soldberg HE. Establishment and use of reference values. In: Teitz text book of clinical chemistry, 2nd Ed. Burtis CA and Ashwood ER eds. Saundres, Philadelphia 1996; 356-86.

4. SujataWangkheimayum, Determination of reference values of some routine clinical biochemical parameters of apparently healthy North Indian subjects. J of Biochemistry Research 2013; 1(1):1-6.

5. G.A. Alemnji, J.Mbuagbaw, G.Teto, S. Nkengafac, E.Folefac, N.Atems, B.K wingwah and T.Asonganyi.

Reference ranges for serum biochemical parameters among Healthy Cameroonians to support HIV Vaccine and Related Clinuicxal Trials.The oprn Clinicaql Chemistry2010;3:66-71.

6. Stein M W,Clinical methods analysis,Academic Press,1965;117.

7.

of

enzymatic

Talke H, Schubert GE. Enzymatic urea determination in the blood and serum in the warburg optical test.

Klivische Wochenschrift1965;43:174.

8. Fabiny DI, Ertingshausen G. Automated reaction rate method for determination of serum creatinine.Clin Chem.1971;17:696.

9. Fossati P, Prencipe L, Berti . Enzymic Creatinine Assay: A New Colorimetric Method Based on Hydrogen Peroxide Measurement G.Clin Cherm,1980;26:227.

10. Allain CC, Poon L S, Chan C S G,Richmond W Fu P C. Enzymatic determination of total serum cholesterol .Clin chem. 1974;12:403.

11. Trinder P,Ann Determination of Glucose in Blood Using Glucose Oxidase with an Alternative Oxygen Acceptor. Clin Biochem 1969;6:24.

12. Vnaden Berg A Mueller P, Biochem Z, Uber eine direct and eine indirect Diazo reaction of Bilirubin1916;77:90 13. Bowers GN, Mc Comb RB, Measurement of total alkaline phosphatase activity in human serum.Clin Chem 1975;21:1988-1995.

14. IFCC Methods for the Measurement of Catalytic Concentration of Enzymes Clin Chem.1977; 23:887.

15. Wroblewski F, La Due JS. Serum glutamic pyruvic transaminase in cardiac and hepatic disease.Pros Soc Exp Biol Med 1956;91:569.

16. Weichselaaum TE, Amer An accurate and rapid method for the determination of proteins in small amounts of blood serum and plasma. J Clin Path1946 ;16:40.

17. Rodkey FL Direct Spectrophotometric Determination of Albumin in Human Serum Clin chem. 1965;2: 478.

18. IFCC. Approved recommendation on the theory of reference values. Journal of Clinical Chemistry and Clinical Biochemistry 1981; 25(5): 337-342.

19. Ferre Masterrer, M, Fuentes, A.X. Puchal, An indirect reference limit estimated from patients results by three mathematical procedures. Clinica Chemica Acta 1999; 279(1-2): 97-105.

20. Rosen, FS., Cooper, M.D. and Wedgwood,R.J.The primary immunodeficiencies. New England Journal of Medicine 1984; 311: 235-242.

21. Erasmus RT., Ray U., Nathaniel K. and Dowes G. Reference ranges for serum creatinine and urea in elderly coastal Melanesians. Papua New Guinea Medical Journal 1997; 40(2): 89-91.

22. Reidenberg MM., Gu, Z-P., Lorenzo, B., Coutinho, E., Athayde, C., Frick, J., Alvarez, F., Brache, V.and Emuveyan, E.E. Differences in serum potassium concentrations in normal men in different geographic locations. Clinical Chemistry 1993; 39(1): 72-75.

23. Jagarinec, N., Fleger, M., Surina, B., Vrhovsks, H.,Hebrung, N. and Predenkerokuvic, V. Pedriatic Reference Interval for 34 biochemical analytes in urban school children and aldolescent. Clinical Chemistry Laboratory Medicine 1998; 36(5): 327-337 24. Jannie W, Treuting JJ, Donald, C.C. Metabolic intermediates and inorganic ions. In:Clinincal diagnosis and management; 16th edition; Philadelphia; London and Toronto; WB Saunders company. 1979; pp 259-304.

25. Felding, P., Tryding, N., Hyltoft, P. et al. Effects of posture on concentrations of blood constituents in healthy adults: Practical application of blood specimen collection procedures recommended by the Scandinavian Committee on Reference Values. Scand.

J. Clin. Lab. Invest.1980: 40; 615-621.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article The Reactive Lymphocyte: A Morphological Indicator of Platelet Counts in Dengue Seropostive Patients Archana Shetty*, Padmapriya Kasukurti, Vijaya C and Jayalakshmi V. J Dept. of Pathology, Sapthagiri Institute of Medical Sciences and Research Center, Bangalore, India Keywords: Dengue, Lymphocyte, Thrombocytopenia, Leucopenia, Peripheral smear

ABSTRACT Background: Dengue fever is an emerging cause of morbidity and mortality, in tropical countries, with increasing global incidence reaching epidemic proportions. Infected humans show rapid progression to severe and fatal outcomes based on their immunity. The peripheral smear is a cost effective and simple investigation, which provides a plethora of valuable information.

Methods: This cross sectional study was carried out by studying the peripheral smears of seropositive dengue patients admitted in our hospital on the day one of admission. Total leukocyte counts, absolute lymphocyte counts, platelet counts along with a detailed morphological assessment of reactive lymphocytes were done concurrently by three pathologists on a total of 300 cases with thrombocytopenia. Of these, 100 cases were studied in each of the three categories of thrombocytopenia >1, 00,000 (1), 51 â&#x20AC;&#x201C; 10, 00,000(2) < 50000(3).The size, basophilia, chromatin, nucleoli, cytoplasm and rosetting of RBCs with skirting were assessed in the reactive lymphocytes.

Results: It was observed that reactive lymphocytes, almost the same size, having the same amount of cytoplasm as a mature lymphocyte, with minimal basophilia, condensed chromatin , & with prominent RBC rosetting were associated with higher platelet counts. ( category 1). Larger lymphocytes, with abundant basophilic cytoplasm and with minimal cytoplasmic skirting were significantly associated with lower platelet counts and absolute lymphocytosis.

Conclusion: In the present era of advanced automation, the morphological study of the reactive lymphocyte on peripheral smears is an indispensable and cost effective indicator of platelet counts and remains a valuable adjunct in prognosticating patients with Dengue fever.

*Corresponding author: Dr. Archana Shetty, Assistant Professor, Pathology, Sapthagiri Institute of Medical Sciences and Research Center Hesaraghatta main road, street no.15, Bangalore 560098 INDIA Phoen : +91 9986577343 Email: archanashetty2924@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-218

Reactive Lymphocyte Morphology in Dengue

Introduction

Dengue fever is an acute infectious disease caused by a ssRNA virus of the flaviviridae family and transmitted to humans by the bite of Aedes Aegypti and Aedes albopticus mosquitoes. The word “dengue” is derived from the Swahili phrase Ka-dinga pepo, meaning “cramp-like seizure”.[1] It is an emerging cause of mortality and morbidity, especially in tropical countries like India. A thirty fold rise in dengue has been reported in the past three decades, with more than 75% of cases affecting the Asia- Pacific region. [2, 3, 4] Though dengue fever may be self limiting, the progression to Dengue haemorrhagic fever or dengue shock syndrome with a severe host response can be lethal if not adequately treated. While dengue can be identified early based on the clinical presentation and serological investigations, haematological parameters play a crucial role in indicating its progression to a fatal outcome. [5] Though thrombocytopenia, leucopoenia and lymphocytosis are described as the characteristic haematological findings in dengue, morphology of the reactive lymphocyte is often under reported in this modern era of automation. This study highlights the various morphological differences in reactive lymphocytes and their association with thrombocytopenia a in sero- positive dengue cases. As adults have been documented to have more severe outcomes, we have focused our study in this age group. [5]

Materials and Methods

A cross sectional observational study was conducted over a period of three months, from October 2015 to December 2015 in our tertiary care center hematology laboratory. The cases were collected during the peak of the dengue season.

The inclusion criteria were all serologically proven dengue cases in the adult population on day one of admission.

Dengue testing was done using a rapid solid phase Immunochromatographic test for the qualitative detection of NS1 antigen and the differential detection of Ig M and Ig G antibodies to Dengue virus in human serum .Other cases of febrile thrombocytopenia, such as those associated with other infections and malignant processes were excluded.

An automated analyzer was used to obtain hematological parameters from anticoagulated venous blood samples.

These parameters were standardized by routine external and internal quality control checks. All peripheral smears showing artifactual clumping, satellitism and pseudothrombocytopenia were excluded from the study.

Platelet counts of <1.5 lakh/cmm were considered to be cases of thrombocytopenia. One hundred appropriate cases were collected in each of the categories of thrombocytopenia with platelet counts greater than 1, 00,000 (Category 1), 51,000-1, 00,000 (Category 2) and <50,000 (Category 3)

respectively. All samples were systematically analyzed for platelet counts, total leukocyte count, absolute lymphocyte counts, and percentage of reactive lymphocytes with a note of the demographic data such as age and sex The lymphocytes were studied for their morphological changes (size, basophilia, nuclear chromatin, cytoplasm, skirting, and nucleoli) in comparison with a mature small lymphocyte in each slide. These morphological parameters were quantified on a three tiered grading system. These criteria were objectively quantified by three pathologists using a pentahead research microscope. Each of these six morphological parameters were separately assessed in the above mentioned categories of thrombocytopenia, scored and tabulated. The scores were then studied for their significant association as shown in the table below (Table 1) with platelet counts and absolute lymphocyte counts using chi – square test. A P value of < 0.05 was considered to be statistically significant.

Results

300 cases of thrombocytopenia in dengue were studied in total. The pattern of dengue serology was as follows in the cases taken up for study (Table 2).The youngest patient was 18 years old and the oldest was 82 years old, with a majority of the cases in the age group of 21- 30 years (39%) (Table 3) Majority of the patients were males (192 cases– 64%) and the remaining were females (108 cases– 36%), with a sex ratio of 1.7:1. The total leukocyte count in the cases studied was distributed as follows. (Table 4) Examination of the peripheral smears, showed the following proportion of reactive lymphocytes to mature lymphocytes in each slide in each case. (Table 5).

All the cases showed reactive lymphocytes Most of the cases (91%) showed a high proportion of reactive lymphocytes on smears. The below parameters of lymphocyte morphology were studied and were found to be significantly associated with the different categories of thrombocytopenia. The results were tabulated as follows (Table 6) SIZE: It was observed that the size of the lymphocytes co – related significantly with the platelet counts. Majority of the cases in category 1 thrombocytopenia were less than two times the size of a mature lymphocyte (48%), whereas most of the lymphocytes in category 3 thrombocytopenia were observed to be three times the size of a mature lymphocyte (58%). Majority of the Lymphocytes in category two thrombocytopenia were found to be twice the size of a mature lymphocyte (68%) Basophilia: Intense basophilia of the cytoplasm was found to be significantly present in category 3

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Shetty et al.

A-219

thrombocytopenia (56%).There was a decrease in intensity of the basophilia with higher platelet counts, the least basophilia being seen in category 1.

most of the lymphocytes in category 3 showed no skirting.

[Figure 1, figure 2 and Figure 3] The lymphocyte morphology parameters were studied in relation with absolute lymphocytosis, normal ALC and absolute lymphopenia (Table 7)

Nucleoli: Most of the cases in category 2 and 3 (62% & 56%) showed indistinct nucleoli, while most of the category 1 lymphocytes showed no nucleoli similar to mature lymphocytes (66%).

All three hundred cases were further studied with respect to their absolute lymphocyte counts independent of the thrombocytopenia categories. Though some of the parameters were not found to be significantly associated with Absolute Lymphocyte counts, of noteworthy importance are the size, amount of cytoplasm and skirting noted in these reactive lymphocytes. In cases of absolute lymphopenia, most of the reactive lymphocytes showed size and cytoplasm less than two times that of a mature lymphocyte (54% and 52%) with increased skirting of cytoplasm (45%) and RBC rosetting. However most of the cases with lymphocytosis as is evidenced in the above table, showed size thrice that of a mature lymphocyte (62%) with abundant cytoplasm (46%) and significantly minimal skirting (44%).

Chromatin: Most of the cases in category 2 and 3 (54% each) showed moderate condensation of chromatin, with most of the category 1 lymphocytes showing condensed cytoplasm, similar to mature lymphocytes (42%).

Cytoplasm: Cases in category 3 were found to be the ones with most abundant cytoplasm (48%), however relatively few cases in the other categories showed increased cytoplasm.

Skirting: The cytoplasmic skirting with rosetting of RBCS was found to be maximal with category 1 (44%) and minimal in category 3 (2%). It was also noted that

Table 1: Grading of morphological parameters of the lymphocyte on the peripheral smear Parameter

Grade 1

Grade 2

Grade 3

Size

Less than 2 times the size of small lymphocyte

>X 2 times the size of a small lymphocyte

X 3 times the size of a small lymphocyte

Basophilia

Mild

Moderate

Intense

Nucleoli

No nucleoli

Indistinct nucleoli

Prominent nucleoli Open chromatin

Chromatin

Condensed

Moderately condensed

Cytoplasm

Mildly increased

Moderately increased

Abundant

Skirting of cytoplasm

No skirting

Moderate skirting

Abundant skirting with rosetting of RBCâ&#x20AC;&#x2122;S

Table 2: Pattern of Dengue antigen and antibody distribution Serology NS 1 + NS 1 + Ig M + NS 1 + Ig G+ Total

No. of cases 71% ( 213 cases) 20% ( 60 cases) 09 % (27 cases) 300 cases

Table3: Table showing age distribution of the cases Age Group <20 21- 30 31- 40 41-50 51- 60 61- 70 71- 80 >80 Total

www.pacificejournals.com/apalm

No. of cases 42 118 54 36 24 06 12 08 300

eISSN: 2349-6983; pISSN: 2394-6466

A-220

Reactive Lymphocyte Morphology in Dengue

Table 4: Table showing variation in total leukocyte counts Total Leukocyte count Leucopenia<4000cells/cmm Normal Leucocytosis>11,000 cells /cmm Table 5: Table showing proportion of reactive lymphocytes Reactive lymphocytes Absent <10% >10%

Number of cases 144 92 64

Percentage 48 30.6 21.3 Number of cases 0 27 (09%) 273 (91%)

Table 6: Study of the association of morphological grades of reactive lymphocyte parameters with categories of thrombocytopenia Size (n) Basophilia(n) Nucleoli(n) Chromatin(n) Cytoplasm(n) Skirting(n) 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 C 1 48 44 08 64 32 04 66 30 04 42 40 18 42 52 06 20 36 44 C 2 14 68 18 38 76 46 34 56 10 38 54 08 24 56 20 38 50 12 C 3 2 4 40 58 18 20 14 14 62 24 26 54 20 8 44 48 62 36 2 N= 300 N=300 N=300 N=300 N=300 N=300 p value < 0.0001 p value < 0.0001 p value < 0.0001 p value =0.017 p value =0.0017 p value = 0.001 Platelet counts C1= Category 1 (>1lakh/cmm) C2= Category 2 (51,000- 1lakh/cmm) Category 3 =(<50,000lakh/cmm) n= number of cases in each category N= total number of cases

Table 7: Study of the association of morphological grades of reactive lymphocyte parameters with counts.

Size (n) Basophilia(n) Nucleoli(n) Chromatin(n) Cytoplasm(n) 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 L1 18 22 64 26 34 28 30 46 10 22 48 12 16 40 48 L2 34 68 50 38 76 46 60 84 22 68 80 24 51 94 07 L3 18 20 14 18 20 14 24 16 18 18 18 10 23 20 01 N= 300 N=300 N=300 N=300 N=300 P value <0.0001 P value = 0.462 P value = 0.227 P value = 0.106 P value=<0.0001

absolute lymphocyte Skirting(n) 1 2 3 46 35 23 63 69 20 12 12 20 N=300 P value= 0.0001

L1 (104 cases) = Lymphocytosis (>3400cells/cumm) L2 (152 cases) =Normal (1000-3400cells/cumm) L3 (44 cases) = Lymphopenia (<1000cells/cumm) ) n= number of cases in each category N= total number of cases

Fig. 1: Peripheral smear with lymphocyte showing mild increase in size, condensed chromatin and RBC rosetting corresponding to platelet count >1 lakh/cmm Figure 2: Peripheral smear with larger lymphocytes with , moderately condensed chromatin, mild cytoplasmic basophilia corresponding to platelet count 50,000- 1 lakh/cmm Figure 3: Peripheral smear with larger lymphocytes with open chromatin , intense cytoplasmic basophilia without RBC rosetting corresponding to platelet count < 50,000 [Leishman stain x400x]

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Shetty et al.

Discussion

Dengue is the commonest cause of febrile thrombocytopenia investigated in our hematology laboratory. Serological diagnosis of dengue virus infection is routinely done by demonstration of the NS-1 antigen and anti dengue virus antibodies in the patients’ serum depending upon the day of illness using commercial kits. [1]Our study reports a higher male: female ratio of 1.7:1, and is in agreement with authors like Agarwal et al and Ray et al , who also reported the seropositivity of dengue to be twice as common in males ,with a M: F ratio of 1.9: 1 and 1: 0.57 respectively. The widely recognized notion is that hospital based registries in Asian countries traditionally report more males seeking treatment.[6] Dengue infected patients are demonstrated to consistently have leucopoenia, absolute lymphocytosis, thrombocytopenia and raised haematocrit. [7]Our study demonstrated 48% of cases having leucopoenia. Other workers like Mehta et al [8] and Chakravarthi et al [5] have demonstrated a higher proportion of leucopenic cases (63% and 60%) ,whereas Arshad et al [9] and Tahir eta l [7] have reported the same to be 49% and 56% respectively. (in concordance with our study). However, Rushmavathi et al [10] and Dutta et al [11] have reported far lesser cases of leucopoenia in Dengue constituting 33.3% and 30% respectively.

It has been reported that B lymphocytes are the primary circulating cells infected by the dengue virus. The over production of these B cells, along with cytokines like IL – 6 trigger an aberrant maturation of plasma cells and atypical lymphocytes leading to the generation of autoantibodies causing platelet destruction and hence thrombocytopenia.

The presence of these IgM platelet autoantibodies not only induces platelet lysis via complement activation, but also inhibits ADP induced platelet aggregation. [5]Also direct infection of the bone marrow megakaryocytic precursors and their suppression [7] has been proposed to contribute to thrombocytopenia. This aberrant immune activation has been documented to cause inversion of CD4/8 counts, cytokine overproduction, monocytosis atypical lymphocytosis contributing to the immunopathogenesis of dengue fever.[5,7]

A-221 consistently seen in all cases (100%). This agrees closely with observations made by Rushmavathi et a l [10] who reported 81.1% cases showing reactive lymphocytes and Jameel et al[7] who reported the same as 93%. Some authors have demonstrated a lower proportion of the same, such as Mehta et al [8] who found only 72 % of cases having atypical lymphocytes.

The intermediate forms between typical lymphocytes and plasma cells are referred to by the authors as atypical; however, various other terms such as variant lymphocyte and abnormal lymphocytes are also used in literature for the same. [14]. We have limited the nomenclature to the term “reactive”. Originally described by Turk in 1907 and further classified n detail by Downey in 1923, the reactive lymphocyte has been broadly studied in infectious mononucleosis. [15] The Reactive lymphocytes are large non neoplastic lymphocytes with an increased proportion of cytoplasm with basophilic cytoplasmic edges, often engaging neighbouring red cells (skirting) Nucleoli may occasionally be evident. [16 17].However, not much data exists in literature regarding lymphocyte morphology on peripheral smear in dengue. The importance of these reactive lymphocytes lies in the fact that higher counts are seen in patients with severe dengue than non- severe dengue. [18] While there has been a semantic overlap between the criteria and nomenclature of atypical / typical reactive lymphocytes, [19] not much literature could be gathered regarding a systematic approach to the morphology of the same. Hence the present study has taken into account all morphological parameters described in standard text books.

Studies attempting to identify the co – relation of changing lymphocyte morphology with different categories of thrombocytopenia are scarce, hence the authors have semi – quantitatively studied six morphological parameters in cases with platelet counts less than 50,000, 51000- 1,00,000 and greater than 1 lakh/cmm.

Flow cytometric studies also demonstrate that atypical lymphocytes progressively express CD -19, a B cell marker. Atypical/reactive lymphocytes appear early in the pathogenesis of dengue It is also postulated that these reactive lymphocytes may represent a response to non – specific viral stimulation. [5, 12, 13] A systematic labour intensive review of the peripheral smears in all 300 cases in our study showed that atypical lymphocytes were

Although diagnostic and supportive tests are many, manual review of peripheral smears, though labour intensive often proves to be an excellent tool to supplement the automated data. [20] The reactive lymphocytes in category1 (greater than 1 lakh/cmm platelet count) in our study were found to be less than twice the size and having the same amount of cytoplasm as a mature lymphocyte, with least basophilia, condensed chromatin and no nucleoli, but with maximal RBC skirting of cytoplasm often showing rosetting of greater than three RBCS. The reactive lymphocytes in category 2 (51000- 1,00,000 lakh/cmm) in our study were found to be on an average twice the size of a mature lymphocyte with moderate amount of

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-222

Reactive Lymphocyte Morphology in Dengue

cytoplasm, intermediate basophilia, indistinct nucleoli, partial chromatin condensation and moderate skirting.

The reactive lymphocytes in category 3 (<50,000 /cmm) in our study were markedly increased in size, often three times the size of a mature lymphocyte, with abundant basophilic cytoplasm, indistinct nucleoli, partially condensed chromatin and almost absent skirting. However, these features were not progressively studied in the same patient due to difficulty in follow up owing to attrition, different days of presentation and varying host responses to treatment.

In cases of lymphopenia, the lymphocytes showed only a mild increase in size and amount of cytoplasm , but with increased skirting of the cytoplasm .Cases of absolute lymphocytosis showed larger lymphocytes with abundant cytoplasm and minimal skirting.

Studies till date have documented the morphological features of a reactive lymphocyte in peripheral smears of dengue patients like basophilia, abundance of cytoplasm, open nuclear chromatin, increase in size and resetting of RBCs. [7] However these features have not been graded or studied for their statistical association with thrombocytopenia as consistently highlighted by many authors. [9, 14]

Conclusion

Morphological study of the reactive lymphocyte proves to be a highly useful and cost effective adjunct in prognosticating patients with dengue fever. Complimented with other hematological, serological and biochemical parameters, it is an effective indicator of the progressive immune response and disease activity in the host .In the modern age of advanced molecular and genetic analysis, peripheral smear examination is an indispensable diagnostic tool, as it can help study the various morphological parameters that are being under reported in the current era of automation.

In our study we concluded that reactive lymphocytes slightly larger than a mature lymphocyte and with skirting and scalloped cytoplasmic edges are associated with higher platelet counts and lymphopenia, while larger lymphocytes with rounded edges and intense basophilia of the cytoplasm are significantly associated with lower platelet counts and absolute lymphocytosis. Despite the complex features and inter – observer variability, these features remain highly valuable indicators of dengue pathophysiology.

Funding None

Competing Interests None declared

References

1. Gupta N, Srivastava S, Jain A, Chaturvedi UC. Dengue In India .Indian Journal Of Medical Research 2012 ;136(3):373-90 2. Rashmi MV, Hamsaveera H. Hametalological and biomedical markers as predictors of Dengue Infection Malays J Pathol. 2015; 37 (3):247-51 3. Donald S. Shepard, Yara A. Halasa, Brij Kishore Tyagi, S. Vivek Adhish, Deoki Nandan, K. S. Karthiga, Vidya Chellaswamy, Mukul Gaba, Narendra K. Arora, the INCLEN Study Group Economic and Disease Burden of Dengue Illness in India Am J Trop Med Hyg. 2014; 91(6): 1235–1242 4. World Health Organization (WHO). Global strategy for dengue prevention and control 2012–2020.

Geneva: WHO; 2012 5. Lei HY, Yeh TM, Liu HS, Lin YS, Chen SH, Liu CC. Immunopathogenesis of dengue virus infection.

J Biomed Sci. 2001; 8(5): 377-88 6. Chakravarti A, Roy P, Malik S, Siddiqui O, Thakur P. A study on gender-related differences in laboratory characteristics of dengue fever. Indian J Med Microbiol 2016;34:82-4 7. Jameel T, Mehmood K, Mujtaba G , Choudhry N, Afzal N, Paul R.F Changing haematological parameters in dengue viral infection. J Ayub Med Coll Abbottabad.

2012; 24(1):3-6.

8. Mehta R.C, Goswami H.M., Katara R.K., Patel P.S., Parikh U.V., Vegad M.M. and Jain P.Y. Importance of Complete blood count and Peripheral smear examination in early diagnosis of dengue patients Journal of Infectious Diseases. Journal of Infectious Diseases Letters 2.1 (2013): 22-24.

9. Arshad I, Malik FA, Hussain A, Shahida A. Dengue fever clinico-pathologic correlations and their association with poor outcome. Professional Med J.2011; 18(1): 57-63 10. Rusmawati I, Asma Hanim H, Naznin M, Salman MS, Norlelawati AT. A descriptive study of blood films of patients serologically positive for dengue in Hospital Tengku Ampuan Afzan, Kuantan. IntMed J Malaysia.

2010; 9(2): 35-7 11. Dutta P, Khan SA, Borah J, Mahanta J. Demographic and clinical features of patients with dengue in Northeastern region of India: A retrospective cross sectional study during 2009-2011. J Virol Microbiol.

2012 Article ID 786298, 11 pages 12. Natasha Ali, Mohammad Usman, Naveen Syed, Mohammad Khurshid. Haemorrhagic manifestations

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Shetty et al.

13.

14.

15.

16.

and utility of haematological parameters in dengue fever: A tertiary care centre experience at Karachi.

Scandinavian Journal of Infectious Diseases 2007;39 (1112): 1025–8 Jampangern W, Vongthoung K, Jittmittraphap A,Worapongpaiboon S, Characterization of atypical lymphocytes and immunophenotypes of lymphocytes in patients with dengue virus infection. Asian Pac J Allergy Immunol. 2007 ;25(1):27-36 Wim van der Meer, Warry van Gelder, Ries de Keijzer, and Hans Willems The divergent morphological classification of variant lymphocytes in blood smears J ClinPathol. 2007 Jul; 60(7): 838–839 Simon M.W. The atypical lymphocyte. International Journal of Pediatrics 2003;181:20 – 22 Marshall A. Lichtman, Thomas J. Kipps, Uri Seligsohn, Kenneth Kaushansky, Josef T. Prchal Williams Hematology, Eighth edition China ;McGraw –Hill companies:2010 pages 1144-1146

www.pacificejournals.com/apalm

A-223 17. Lewis SM, Bain BJ. Dacie and Lewis Practical Haematology.

Churchill Livingstone 2006, Philadelphia tenth edition Chapter 5 ; Red cell morphology in health and disease. Pages 108-110 18. Thanachartwet V, Oer-Areemitr N, Chamnanchanunt S Sahassananda D, Jittmittraphap A Suwannakudt P, Desakorn V Wattanathum A. Identification of clinical factors associated with severe dengue among Thai adults: a prospective study BMC Infect Dis. 2015 Oct 14;15:420 19. Sun P, Kowalski EM, Cheng CK, Shawwa A, Liwski RS, Juskevicius R. Predictive significance of absolute lymphocyte count and morphology in adults with a new onset peripheral blood lymphocytosis J Clin Pathol. 2014 Dec; 67(12):1062-6 20. Tseng V, Morgan AS, Leith CP, Yang DT Efficient assessment of peripheral blood lymphocytosis in adults: developing new thresholds for blood smear review by pathologists Clin Chem Lab Med. 2014;52(12):1763-70

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Histopathological Analysis of Unusual Findings in Appendectomy Specimens: A Retrospective Study and Literature Review Dhiraj B. Nikumbh1*, Rajesh Y. Thakur2, Sudhir Singhavi3 and Shirish Gondane1 Dept of Pathology, JMFâ&#x20AC;&#x2122;S ACPM, Medical college, Dhule, India 2 Dept of Pathology, SBH, GMC, Dhule, India 3 Consultant Pediatric Surgeon, Dhule, India

1

Keywords: Appendicitis, Unusual Findings, Carcinoid Tumor, Histopathological Analysis.

ABSTRACT Background: Acute appendicitis has remained a clinical entity and an ongoing diagnostic challenge. Appendicitis is one of the commonest surgical emergencies. However, histopathological studies are the gold standards for diagnosis of acute appendicitis. Though faecoliths are the usual cause of obstruction, other unusual findings can be the cause too, ranging from inflammatory conditions to malignancies.

Aims and Objectives: To document and compare unusual histopathological findings in appendectomy specimens in our center.

Methods: The clinicopathological records of resected appendices submitted to histopathology department over the period of 4 years from January 2012 to December 2015 were reviewed retrospectively. From accumulated information from 790 appendectomies, 44 appendectomy specimens had unusual histopathological findings were included in the study. Patient who underwent incidental appendectomy during other surgeries were excluded from the study.

Results: Out of 790 appendectomy specimens, acute appendicitis accounted for 302(38.2%) with peak occurrence in the age group 11-20 years (38.9%) and 21-30 years (27.7%) with male predominance (2.34:1). Unusual findings were noted in 44 (5.6%) cases by histopathology. Most common findings included obliterative appendicitis (77.3%), followed by eosinophilic appendicitis (6.8%) and granulomatous appendicitis (4.5%).Other unusual findings include diverticulum, mucocele, carcinoid and signet ring adenocarcinoma of the appendix.

Conclusion: The gross examination at the time of surgery cannot detect all the abnormalities of the appendix. Although unusual or co-existing pathologies can be rarely seen during appendectomy, all the appendectomy specimens should be sent for routine histopathological examination to avoid missing of any clinically important and treatable condition.

*Corresponding author: Dr Dhiraj B Nikumbh, Associate Professor, Dept of Pathology, JMFâ&#x20AC;&#x2122;S ACPM, Medical College, Dhule, Maharashtra, India.

Email: drdhirajnikumbh@rediffmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Nikumbh et al.

Introduction

Appendicitis is one of most common acute surgical conditions of the abdomen and an appendectomy is one of the most frequent performed operations worldwide. [1] The life time risk for appendicitis is 7% commonly occurring in adolescent and young adults. In developing countries like India, the incidence is increasing in most urban centers, probably due to adoption of western diet. [2] Despite of advances in technology and imaging modalities, there is dilemma in the clinical diagnosis of acute appendicitis. Histopathological examination still remains the gold standard method for confirmation of appendicitis. [2] Obstruction of lumen is the dominant factor in acute appendicitis and although faecoliths and lymphoid hyperplasia are the usual cause of obstruction, some unusual factors could be involved.[3] Unusual causes of obstructions are enterobiasis, ascariasis, tuberculosis, carcinoid tumor ,primary or secondary adenocarcinoma, lymphoma, dysplastic changes, mucocele, gastro-intestinal stromal tumor, eosinophilic granuloma etc. [3] Even though , there are many case reports in English written medical literature, reports with meticulous analysis of all cases with appendicitis are small in number. [4-8] The aim of the present study is to determine the various histological diagnoses of surgically removed appendices and to find out unusual factors for appendicitis and compare them with other researchers.

A-225 laboratory examination), 44 specimens (5.6%) were with unusual histopathological findings after final pathological evaluation. The peak age incidence of appendicitis was found in the age group 11-20 years with 38.9% (Table No. 1).

Table 1: The distribution of acute appendicitis cases according to age group.

Sr.No

Age group

No. Of cases

Percentage (%)

1

0-10

68

8.6

2

11-20

307

38.9

3

21-30

218

27.7

4

31-40

118

14.9

5

41-50

69

8.7

6

>51

10

1.2

Total

790

100

There were 554(70.1%) males and 236 (29.9%) females among 790 cases of appendicitis with male: female ratio 2.36:1 (Table No. 2).

Table 2: The distribution of acute appendicitis cases according to sex Gender

No. Of cases

Percentage (%)

Male

554

70.1

Female

236

29.9

Total

790

100

Material and Methods

After the final histopathological analysis in 790 cases of appendicitis, majorities were acute appendicitis (38.9%) and unusual findings were noted in 44 (5.6%) cases.

(Table No. 3).

All the surgically resected appendices submitted to the department of Pathology were included in this retrospective study. Patient who underwent incidental appendectomy during other surgeries and negative appendectomies were excluded from the study. Histopathological reports were analyzed according to diagnosis and unusual findings were noted and data was compared.

Total of 790 specimens of appendices were received in the histopathology department during the period of 4 years from January 2012 to December 2015. Out of 790 appendicitis (clinically diagnosed on the physical and

Table 3: The varied spectrum of histopathological diagnoses of appendicitis.

No. Of Percentage Sr.No HPE diagnosis cases (%) Acute nonspecific 1 302 38.2 appendicitis Acute perforative/ 2 obliterative 78 9.9 appendicitis Acute suppurative/ 3 necrotizing 63 7.9 appendicitis Recurrent /follicular 4 75 9.5 appendicitis Chronic nonspecific 5 225 28.5 appendicitis Gangrenous 6 03 0.4 appendicitis 7 Unusual appendicitis 44 5.6 Total 790 100

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

The present study was conducted in Hi-Tech Diagnostic center, Dhule and GMC, Ambajogai. Total of 790 specimen of appendices were received in the histopathology department during a period of 4 years from January 2012 to December 2015 and were reviewed retrospectively, with special reference to age , sex, operative and histology reports.

Results

A-226

Unusual Appendectomy Lesions

In Unusual findings of appendicitis on histology, acute on chronic obliterative appendicitis was observed in majority of the cases (77.3%) followed by acute eosinophilic appendicitis (6.8%) and granulomatous appendicitis (4.5%).

In rare histopathological findings, we found single case of diverticulum of appendix, carcinoid tumor and mucocele (2.3%) respectively. The signet ring adenocarcinoma was seen in 2 cases (4.5%) (Table No.4). There were no unusual findings like E.vermicularis, T.saginata and Non Hodgkinâ&#x20AC;&#x2122;s lymphoma (NHL) in our study.

Table 5: Comparison of Unusual HPE findings Sr. No.

Authors ( year)

1

Duzgun AP et al[10] (2004) Abdul rehman Salem Al Mulhim[11] (2011) Akbulut S et al.[12] (2011) Emre A et al.[13] (2013) Menon I et al .[14] (2014) Present study (2015)

2 3 4 5

Table 4: Unusual findings on histology Sr. No.

Unusual/rare finding

No. Of cases

Percentage (%)

1

Chronic obliterative appendicitis

34

77.3

2

Acute eosinophilic appendicitis

03

6.8

3

Granulomatous appendicitis

02

4.5

4

Diverticulum appendicitis

01

2.3

5

Mucocele appendix

01

2.3

6

Carcinoid appendix

01

2.3

7

Signet ring adenocarcinoma

02

4.5

8

E.vermicularis and parasites

Nil

-

9

NHL

Nil

-

10

Leiomyoma of appendix

Nil

-

Total

44

100

Discussion

Acute appendicitis is the most common surgical emergency for a number of decades and the appendectomy is the most frequently performed abdominal operation. [9] Obstruction of the lumen seems to be the essential for developing an appendiceal infection. Although faecoliths and lymphoid hyperplasia are the usual causes of the obstruction, some unusual factors could also be involved. [10-14] The present study on unusual findings of appendix on histology(5.6%) is compared with Abdul rehman Salem Al Mulnin [11] , Emre A et al.[13] and Menon I et al .[14] Duzgun AP et al.[10] and Akbulut S et al.[12] found 0.7% and 1% respectively. ( Table No.5).

6

Period No. of Unusual Percentage of cases findings (%) study on HPE (years) 6 2458 19 0.70 3

1324

67

5.10

4.8

5262

54

1.02

4

1255

88

7.00

7

2157

138

6.40

4

790

44

5.60

We encounter mostly chronic obliterative appendicitis as unusual finding (77.3%) due to faecoliths (Fig 1a &2a).

Lymphoid hyperplasia was noted mostly in first decades of the life. Development of the luminal obstruction, regardless of etiology has been proposed as the most significant factor in the etiopathogenesis of acute appendicitis. The most common cause of unusual findings by Emre A et al.[13] was fibrous obliteration (64.8%) due to neurogenic proliferation. Such findings were not seen in our study.

The histological criterion for the diagnosis of acute appendicitis is polymorphonuclear leucocytic infiltration of the muscularis mucosa. The incidence of primary chronic appendicitis as a pathologic or clinical entity has been greatly disputed. Much more frequently recurrent acute attacks may be inappropriately referred to as chronic appendicitis. Extensive fibrosis of the appendiceal architecture implies a chronic inflammatory reaction within the wall , supports the diagnosis of chronic obliterative appendicitis. The appendectomy resolves the chronic appendicitis. Recurrent appendicitis especially in children occurs due to hyperplasia of lymphoid follicles in the wall, some other causes in the adults are due to excess mucin production. [10-14] The diagnosis of chronic and recurrent is clinically important due to its different causes.

Recurrent right iliac fossa pain in mainly females may be due to many other gynecology causes including chronic appendicitis. The complications and follow up of varied diagnosis is different.

Acute eosinophilic appendicitis was noted in 3 cases in present study (Fig 1b&2b). Same was comparable with Emre A et al.[13] in one case only .Specifically eosinophilic appendicitis may be presented as obliterative appendicitis due to fibrosis.[15] Tally et al.[16] given the strict criteria for eosinophilic appendicitis as-Presence of gastrointestinal

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Nikumbh et al. symptoms, biopsies demonstrating eosinophilic infiltration of one or more cases of GIT and no evidence of parasitic or extrinsic disease. All the criteria’s were fulfilled by our cases. Postoperatively, Stool examination was negative for ova, cyst or worm infestation on three separate occasions. Granulomatous appendicitis was observed in two cases (4.5%) in our study. Tuberculosis is known to be a disease of developing countries. The GI system is ranked sixth among all extrapulmonary involvements.

[12] The appendix may be affected secondary to ileocecal tuberculosis but appendicular tuberculosis may occur in an even rarer primary form without any evidence of the disease elsewhere.[12] The reported incidence of appendicular tuberculosis varies from 0.1 to 3% among all appendectomies performed.[12] . An accurate diagnosis is usually established after histopathological examination of specimen. Histopathologically, submucosal caseating granuloma and Langhans giant cells suggesting tuberculosis of the appendix (Fig 1c&2c). The transmural inflammation was not there in our case with no fissure formation. Ziehl Neelsen stain (20%) showed few acid fast bacilli in our case. Histologically we are able to differentiate the other differential such as Crohns disease or malignancy.

Appendicular diverticula are very rare and the reported incidence in appendectomy specimen has ranged from 0.004 to 2.1% .[17,18] . It may be single or multiple , congenital or acquired and usually smaller than 0.5 cms located within the distal third of appendix on the mesenteric border.[13] Acquired diverticulum is more prevalent then congenital consisting of mucosa and subserosa herniated through vascular cleft in the muscular layer.[13] . It usually asymptomatic, but the most common complications such as perforation and infection can cause abdominal pain that mimics acute appendicitis.[17,18] We found only one case (2.3%) of appendicular diverticula as compared with Emre A et al .[13] (Fig 1e) We found one case of mucocele of appendix was presented with eosinophilic appendicitis.[19] .First described in 1842, mucocele is an obstructive dilatation of appendix resulting from intraluminal accumulation of mucoid material. [19] (fig 1d). The incidence of this condition in appendectomy specimens has been described as retention cyst, mucosal hyperplasia, mucinous cystadenoma and cystadenocarcinoma.[13] Emre A et al [13] also found only one case of mucocele, comparable with our study.

A-227 An appendiceal carcinoid tumor is found in 0.3 – 2.27 % of patients undergoing an appendectomy.[13] It is rare for carcinoids to be diagnosed preoperatively, they are usually found incidentally during appendectomy.[12,20] ; as in our case .The 13 years female patient presented with acute appendicitis with perforation with tiny nodule of 0.6 cms at tip of appendix (fig .1f).

[20]

In 70-85% of cases, the carcinoid tumors are less than 1cm and are located at the tip of appendix.[12] The majority of appendiceal carcinoids are benign and metastasis is rare.

A near zero rate , of calculated risk of metastasis from tumor less than 1 cm allow for management by simple appendectomy as in our case. However greater than 2cms are associated with increased risk of metastasis, usually managed by right hemicolectomy.[10,12,20] . Histologically comprises of nest of uniform monotonous cells with salt and pepper chromatin (fig 2d&e). Akbulut S et al .[12] and Emre A et al.[13] found 5 and 11 cases of carcinoid tumors in view of larger studies.

In present study, we found 2 cases of signet ring adenocarcinoma in older patients with characteristic histology of signet ring cells in mucoid background (Fig 2f).

Primary adenocarcinoma of appendix is an extraordinary rare tumor and its incidence was 0.01% as per Akbulut S et al.[12] . It behaved aggressively hence oncologic resection with right hemicolectomy is the treatment of choice.[10,12] Our both cases were secondarily involved adenocarcinoma from colon on further exploration. There was no unusual findings like E.vermicularis, Non Hodgkin’s Lymphoma, Neuroma, Leiomyoma in our study and comparable with Akbulut S et al. [12] and Emre A et al. [13]

Conclusion

Right iliac fossa pain has the many differentials depends on the age group. Obstruction of the lumen is the dominant factor in acute appendicitis and although faecoliths and lymphoid hyperplasia are the usual causes of obstructions, some unusual factors could also be involved. Most appendiceal carcinoids and primary adenocarcinoma are diagnosed incidentally during surgery for acute appendicitis.

An appendiceal carcinoid tumor is considered the most common type of appendiceal primary malignant lesion and accounts for almost 60% of all appendiceal tumors.

Certainly early diagnosis of cancer and initiation of treatment is extremely beneficial for patient’s survival.

Hence, even when appendectomy specimen shows normal macroscopic features, complete histopathological analysis may provide clinically useful insights into patient’s condition and help to improve patient outcome by revealing a previously unrecognized disease.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-228

Fig. 1:

Unusual Appendectomy Lesions

Gross features of unusual findings in appendectomy specimens. a) Obliterative appendicitis with lumen completely obliterated by faecoliths b) Eosinophilic appendicitis also presented with fibrosed and occluded lumen c) Granulomatous appendicitis with tiny whitish tubercle on serosal aspect d) Mucocele on cut section with dilated lumen and thick wall with mucoid fluid exudation e) Diverticulum of appendix with large, dilated lumen and congested blood vessels on serosal aspect f) Carcinoid tumor at tip of appendix presented with perforative appendicitis covered with brown exudation

Fig. 2: Unusual histopathological findings.

a) Chronic obliterative appendicitis with fibrous obliteration and lymphocytic infiltration (H&E, x100).

b) Eosinophilic appendicitis. The muscularis propria of appendix with dense and diffuse infiltration by eosinophils (H & E, x100) , Inset( H & E, x400).

c) Granulomatous appendicitis. Submucosal granuloma with caseation necrosis (H & E, x100).

d) Carcinoid tumor presenting ulceration of the mucosa with submucosal tumor (H & E, x100)

e) Nests of uniform tumor cells with salt and paper chromatin in submucosa (H & E, x400) f) Signet ring adenocarcinoma with characteristics signet ring cells with eccentric nucleus and vacuolated cytoplasm (H & E, x400)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Nikumbh et al.

A-229

Acknowledgements None

11.

Funding None

Competing Interests None Declared

12.

References

1. Turner JR. The Gastrointestinal tract, In: Kumar,Abbas,Fausto (eds). Robins and Cotran Pathologic basis of disease. 8th edn. Saunders: Philadelphia; 2010. pp870-1.

2. Oguntola AS, Adeoti ML, Oyemolade TA. Appendicitis: Trends in incidence, age, sex, and seasonal variations in South-Western Nigeria. Ann Afr Med 2010;9:213-7.

3. Agarwala N, Liu CY. Laparoscopic appendectomy. J Am As-soc Gynecol Laparosc 2003; 10: 166-168 4. Ojo OS, Udeh SC, Odesanmi WO. Review of the histopathologi-cal findings in appendices removed for acute appendicitis in Ni-gerians. J R Coll Surg Edinb 1991;36:245-8.

5. Ross E, Ruiz ME. Pathology of the cecal appendix in our country. An analysis of 936 surgical specimens of appendectomy. GEN 1995;49:140-4.

6. Blair NP, Bugis SP, Turner LJ, MacLeod MM. Review of the pathologic diagnoses of 2,216 appendectomy specimens. Am J Surg 1993;165:618-20 7. Royes CA, DuQuesnay DR, Coard K, Fletcher PR. Appendicec-tomy at the University Hospital of the West Indies (1984-1988). A retrospective review. West Indian Med J 1991;40:159-62.

8. Butler C. Surgical pathology of acute appendicitis.

Hum Pathol 1981;12:870-8.

9. Shrestha R, Ranabhat SR, Tiwari MHistopathologic analysis of appendectomy specimens. Journal of Pathology of Nepal (2012) Vol. 2, 215 - 219 10. Duzgun AP, Moran M, Uzun S, Ozmen MM, Ozer VM, Seckin S et al. Unusual findings in appendicectomy

www.pacificejournals.com/apalm

13.

14.

15.

16.

17.

18.

19.

20.

specimens: Evaluation of 2458 cases and review of the litera-ture. Indian J Surg 2004; 66: 221-226 Abdulrahman Saleh Al-Mulhim.Unusual findings in appendicectomy specimens: Local experience in Al-Ahsa region of Saudi Arabia. Journal of Clinical Pathology and Forensic Medicine.2011; 2(1): 40-41.

Akbulut S, Tas M, Sogutcu N, Arikanoglu Z, Basbug M, Ulku A. Unusual histopathological findings in appendectomy specimens: a retrospective analysis and literature review. World J Gastroenterol.

2011;17(15):1961–1970 Emre A, Akbulut S, Bozdag Z, Yilmaz M, Kanlioz M, Emre R et al.Routine Histopathologic Examination of Appendectomy Specimens: Retrospective Analysis of 1255 Patients Int Surg. 2013 Oct-Dec; 98(4): 354–362 Memon I, Moorpani K, Rehman S. Unusual histopathological findings of appendectomy specifimens. Pak J Med Dent 2014; 3(3):3-7.

Kanthikar SN, Nikumbh DB, Desale SS. Primary Eosinophilic Obliterative Appendicitis. Online J Health Allied Scs. 2014;13(1):6.

Talley NJ, Shorter RG, Phillips SF, Zinsmeister AR. Eosinophilic gastroenteritis: A clinicopathological study of patients with disease of the mucosa, muscle layer, and subserosal tissues. Gut.1990;31:54-8.

Manzanares-Campillo Mdel C, Pardo-García R, Martín-Fernández J. Appendicular pseudodiverticula and acute appendicitis. Our 12-year experience. Rev Esp Enferm Dig. 2011;103(11):582–585 Coulier B, Pierard F, Malbecq S. Appendicular diverticulitis in an Amyand’s hernia. JBR-BTR. 2010;93(2):114.

Sunil V Jagtap, Dhiraj B Nikumbh, Ashok Y Kshirsagar, Sujata R Kanetkar, Ashish Bohra.

Eosinophilic appendicitis presented as mucocele: a rare clinical entity . IJHSR. 2012;2(2):99-103.

Shapiro R, Eldar S, Sadot E, Venturero M, Papa MZ, Zippel DB. The significance of occult carcinoids in the era of laparoscopic appendectomies. Surg Endosc 2010; 24: 2197-2199

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Detection of Plasmid-mediated Ampc β-lactamases Among E.coli and Klebsiella pneumoniae by Multiplex PCR Anuradha Basavaraju* and Praveena Muttaraju Department of Microbiology Mamata Medical College, Khammam, Telangana state, India Keywords: AmpC Beta-lactamase, ESBL, E.coli, Klebsiella, PCR

ABSTRACT Background: Gram negative bacteria are acquiring drug resistance due to Extended spectrum beta lactamase (ESBL) production and also Plasmid mediated AmpC beta-lactamases (PMABLs). This is one of the major causes of multi-drug resistance among E.coli and Klebsiellainclinical practice. Detection of PMABL genes by molecular methods such as multiplex PCR gives accurate results in specific identification.

Methods: ESBL producing strains of 40 E.coli and Klebsiella were tested phenotypically for Plasmid mediated AmpC beta-lactamase production by using cefoxitin disk. The genes coding for PMABLs production was tested by multiplex PCR. Antibiotic susceptibility pattern of the isolates was also tested.

Results: 22(55%) of E.coli and 17(42.5%) of Klebsiella pneumoniae were phenotypically producing AmpC beta-lactamases. On genotypic testing 15(37.5%) E.coli and 11(28%) Klebsiella pneumoniae were positive for plasmid mediated AmpC beta-lactamases. Plasmid encoded AmpC genes in E.coli are CIT/EBC, CIT, and EBC. In Klebsiella pneumoniae the genes were CIT/DHA, CIT, and DHA. All the isolates showed 100% resistance to Cefoxitin and amox/ clav and also higher degrees of resistance to cefotaxime, ceftazidime, cefepime, aztreonam and piperacillin/ tazobactam.

Conclusion: ESBL producing strains of E.coli and Klebsiella are developing drug resistance due to the production of PMABLs. Detection of genes coding for PMABL production are best tested by multiplex PCR which gives accurate results than phenotypic detection methods.

*Corresponding author: Dr. Anuradha Basavaraju, Professor & HOD, Department of Microbiology, Mamata Medical College, Khammam, Telangana State, India-507002.

Phone: +91 9848097479 Email: radha97479@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Basavaraju et al.

Introduction

The plasmid mediated AmpC β-lactamases (PMABLs) originate from the chromosomally located AmpC genes of several Gram negative bacteria. The productions of PMABL confers resistance to many β-lactam antibiotics including cephalosporins like cefotaxime, cefotetan, oxyimino-cephalosporins like cefotaxime, ceftazidime, ceftriaxone, also to monobactams like aztreonam and are not inhibited by clavulanic acid. [1, 2, and 3] Horizontal gene transfer is the mechanism which is mainly found for the spread of antibiotic resistance genes.

[4] The resistance exhibited by these plasmid mediated β-lactamase enzymes is rare, difficult to detect and they also have broad spectrum of resistance. They are of special concern because self-transmissibility permits their spread among different bacteria. [5, 6] AmpC genes originate from Hafniaalvei, Morganellamorganii, Citrobacterfreundii, Enterobacter cloacae and two unknown organisms. [7] The transferable AmpC gene products are commonly called plasmid mediated AmpC β-lactamases. [8, 9, and 10] PMABLs can be divided into five structurally distinct clusters: the Citrobacterfreundii cluster represented by CMY-2, the Enterobacter spp. Cluster with MIR-1 and ACT-1, the Morganellamorganii group with DHA-1, the Hafniaalvei cluster represented by ACC-1, the Aeromonas spp. Cluster with MOX-1 (also called CMY-1) and FOX-1 enzymes that constitute two distinct sub groups. [11] Plasmid mediated AmpC β-lactamases cannot be reliably detected by standard susceptibility testing methods in the clinical laboratory.[12] Phenotypic tests are not reliable and may result in misreporting and treatment failures. The co-existence of ESBLs may also mask the phenotypic detection. Moreover there are no CLSI guidelines available for proper detection and confirmation of PMABL. (Black et al) [13] described the EDTA disk test and Young et al [14] described the “modified” Hodge test for detecting the presence of AmpC β-lactamases that could be carried out routinely in a busy clinical laboratory. Another test using boronic acid was described by Coudron. [15] However none of these tests can distinguish plasmid mediated hyper production of AmpC from chromosomal or any other mechanism of over production of an AmpC β-lactamase.

Hence genotypic characterization is considered the gold standard. [11] The present study was conducted to detect PMABLs in the clinical isolates of Klebsiella pneumoniae and E.coli, to characterize the genes encoding the pAmpC enzymes and also to determine their antibiotic susceptibility pattern. www.pacificejournals.com/apalm

A-231

Materials and Methods

The study group comprised of40 ESBL producing isolates of Klebsiella pneumoniae and E.coli. The isolates were selected randomly and study was conducted for a period of 6 months. Ethical committee clearance was obtained.

Organisms showing synergy between the amoxy/clav (30/10 mcg) disk and cefoxitin (30mcg) were considered as ESBL producing strains. Amp C production was phenotypically tested by using cefoxitin (30mcg) disc and zone diameter of <14mm was considered as resistant.

Antibiotic susceptibility was determined by Kirby Bauer disk diffusion method for the following antibiotics: cefoxitin (30mcg), ceftazidime (30mcg), aztreonam (30mcg), amoxy/clav (30/10mcg), cefipime (30mcg), piperacillin/tazobatam (100/10 mcg), cefotaxime (30 mcg) (Supplied by Hi media laboratories, Mumbai, India.) E.coli ATCC 25922 strain was used as control and the results interpreted as per CLSI guidelines.

Detection of Plasmid encoded AmpC genes: PCR based genotyping assay was done to characterize the plasmid mediated AmpC β-lactamases using the primer sequences according to Hanson et al. [16] The order of the work: 1. DNA sample preparation 2. Multiplex PCR 3. Genotype confirmation using PCR with individual primer sets DNA Sample Preparation: The agar slant cultures were used to inoculate 3ml Luria-Bertani (LB) medium by scratching the surface of agar slant with a sterile micropipette tip. The tubes were kept in a rotator shaker at 37C 180rpm overnight. Next morning, an aliquot of 1ml was taken into micro centrifuge tube and centrifuged at 10,000rpm for 10min at room temperature. The supernatant was discarded and the pellet washed with water and finally suspended in 500ul deionized water. The suspension was boiled at 950C for 20min to lyse the cells. It was then centrifuged and the supernatant was used as a source of bacterial DNA for the PCR. Multiplex PCR: The PCR reactions were initially carried out in a Multiplex pattern with the six pairs of primers. The primers used for PCR amplification are listed below.

PCR was done as follows: Total reaction volume: 5ul Template: 0.5ul crude lysate 10X PCR buffer (containing 17.5mM MgCl2): 0.5ul dNTPs: 0.25ul (containing 2.5mM each) Primer: 0.25ul each from a 10pM stock Taq Polymerase (From Himedia): 0.5U eISSN: 2349-6983; pISSN: 2394-6466

A-232

Detection of Plasmid mediated AmpC Beta-lactamases

Cycling Conditions:

DHAMF 5´ AAC TTT CAC AGG TGT GCT GGG T 3´ (22 bases)

1. Initial setting at95oC for 5min 2. Second step includes 35 cycles of 95oC for 15sec, 62oC for 15 sec, 72oC for 45sec 3. Followed by a final extension at 72oC for 5min.

The products were analysed on 2% agaroseTris-acetateEDTA gels pre - stained with ethidium bromide.

DHAMR 5´ CCG TAC GCA TAC TGG CTT TGC 3´

(21 bases)

ACCMF 5´ AAC AGC CTC AGC AGC CGG TTA 3´

(21 bases)

ACCMR 5´ TC GCC GCA TC ATC CCT AGC 3´

(21 bases)

EBCMF 5´ TCG GTA AAG CCG ATG TTG CGG 3´

(21 bases)

EBCMR 5´ CTT CCA CTG CGG CTG CAA GTT 3´

(21 bases)

FOXMR 5´ AAC ATG GGG TAT CAG GGA GAT G 3´ (22 bases)

The samples which showed a band in multiplex PCR were further analysed using the individual primer sets to confirm the result.

FOXMR 5´ CAA AGC GCG TAA CCG GAT TGG 3´ (21 bases)

Statistical methods: All data was kept in terms of number of cases and percentages. P value < 0.05 was considered statistically significant. Microsoft Excel 2007 and SPSS were used to do the calculations.

In addition to the regular end-point PCR, a quick PCR method was also checked (According to Hansen et al). The composition of the PCR mixture for the rapid PCR was the same except the buffer contains magnesium sulphate (at 4mM concentration) instead of Magnesium chloride.

Results

40 ESBL producing strains of E.coli and Klebsiella pneumoniae were tested for cefoxitin resistance and were considered as putative AmpC producers. Out of40, 22(55%) E.coli and 15(37.5%) Klebsiella pneumoniae were phenotypically positive for Amp C production.

Table no.1

The cycling conditions for the rapid PCR are as follows.

1. Initial temperature 95oC for 30sec 2. Second step includes 35 cycles of 95oC for 5 sec, 58oC for 10sec, 72oC for 10sec 3. Followed by a final extension at 72oC for 10sec

Normal (singlet) PCR: The samples which showed a band in multiplex PCR were further analysed using the individual primer sets to confirm the result. In addition a quick PCR method was also checked (according to Hanson et al)..

Plasmid mediated AmpC genes were detected by Multiplex PCR in the phenotypically positive E. coli and Klebsiella pneumonia strains. The plasmid mediated AmpC genes detected in E.coli belonged to CIT and EBC families. In Klebsiella pneumonia strains the genes belonging to CIT and DHA were detected. No genes belonging to FOX, MOX, and ACC were detected. Table no. 2

The sequences of the primers are as follows: (supplied by Bio serve pvt ltd, Hyderabad, India.)

Figure 1, 2, 3 and 4 shows the gel pictures of the Multiplex and individual PCR products.

MOXMF 5´ GCT GCT CAA GGA GCA CAG GAT 3´ (21 bases)

Antibiotic susceptibility testing showed that all PMABL producing strains were resistant to aztreonam (80%), amoxy/clav (100%), cefotaxime (85%), piperacillin/ tazobatam (50%), cefipime (100%), cefoxitin (100%), and ceftazidime (50%). Table no.3

The products were analysed on 2% agaroseTris-acetateEDTA gels prestained with ethidium bromide.

MOXMR 5´ CAC ATT GAC ATA GGT GTG GTG C 3´ (22 bases) CITMF

5´ TGG CCA GAA CTG ACA GGC AAA 3´ (21 bases)

CITMR

5´ TTT CTC CTG AAC GTG GCT GGC 3´

(21 bases)

Table 1: Total no. of isolates showing phenotypic and genotypic result for PMABLs organism

Phenotypic positive

Genotype positive

E.coli (n= 40 )

22(55%)

15 (37.5%)

Klebsiella pneumonia (n= 40 )

17 (42.5%)

11(28%)

Table 2: Types of AmpC genes in each organism Organism (total no. of positive isolates)

Plasmid encoded AmpC gene types

E.coli ( 15)

CIT/EBC , CIT , EBC

Klebsiella pneumoniae ( 11 )

CIT/DHA , CIT , DHA

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Basavaraju et al.

A-233

Table 3: Antibiotic resistance pattern of E.coli and Klebsiella pneumoniae with reference to AmpC production CX- cefoxitin, CTX-cefotaxime, CAZ- Ceftazidime, FEP-cefepime, AT-aztreonam, AMC- Amoxy/clav, p/taz-piperacillin/tazobactam (Disks obtained from Hi media, Mumbai, India) Antibiotic

CX 30µg

CTX 30µg

CAZ 30µg

FEP 30µg

AT 30µg

AMC 30/10µg

PIT 100/10µg

E.coli (n= )

100%

85%

78%

72%

80%

100%

67%

Klebsiella pneumoniae

100%

79%

63%

68%

86%

100%

50%

Organism

Fig. 1: Gel Picture Showing PCR Amplification of CIT, EBC and DHA Genes

Fig. 2: Gel Picture Showing PCR Amplification of MOX Genes

Fig. 3: Gel Picture Showing PCR Amplification of EBC Genes

Fig. 4: Gel Picture Showing PCR Amplification of CIT Genes

Discussion

In India AmpC producing strains of Enterobacteriaceae have emerged as a challenge in hospitalised as well as community based patients. [19]

In our study 55% of E.coli and 42.5% of Klebsiella pneumoniae strains were detected to be AmpC β-lactamase producers phenotypically .Various studies from different parts of the country during the last decade AmpC production has been reported . From Delhi 6.9% of E.coli and 6.18% of Klebsiella pneumonia, [20] from some parts of Kolkata 47.8% of E.coli and 13% of Klebsiella spp. were reported as AmpC β-lactamase producers. [21] 3.3% of E.coli and 2.2% of Klebsiella spp. from Karnataka and 3.4% of E.coli and 4.8% of Klebsiella spp. from some regions of Andhra Pradesh were found to have AmpC enzymes. [22, 23, 24, and 25] This large difference and variation may be due to the difference in the selection criteria of isolates, the

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Beta lactamases continue to be the leading cause of resistance to β-lactam antibiotics in gram negative bacteria.

There has been an increased incidence and prevalence of ESBLs, the enzymes that hydrolyse and cause resistance to oxyimino-cephalosporins and aztreonam. [17] Compared to ESBL producers, isolates producing AmpC β-lactamase are resistant to additional β-lactams and insusceptible to currently available β-lactam inhibitors and have the potential for developing resistance to carbapenems. [18]

A-234

Detection of Plasmid mediated AmpC Beta-lactamases

variation in the ability to produce AmpC β-lactamases among different Gram negative bacteria, different clinical specimens and also it’s prevalence in different geographical areas. More over the studies based on phenotypic detection cannot differentiate between the plasmid mediated enzyme producers and chromosomal hyper producers or porin loss mutants. The phenotypic studies could not differentiate the types or families of plasmid mediated AmpC β-lactamase.

[7, 26] This recent increase in AmpC producing isolates indicates that more and more isolates are acquiring resistant mechanisms making the antibiotic treatment ineffective. [27] Hence there is a need to use molecular identification methods to detect and distinguish AmpC- mediated resistance from other β-lactamase resistance mechanisms.

Differentiation between these types of organisms would prevent the unnecessary usage of cephalosporins and carbapenems which ensures effective therapeutic intervention and optimal clinical outcome. [28, 29] In our study multiplex PCR was used for the detection of family specific AmpC genes ACC, FOX, MOX, DHA, CIT andEBC in E.coli and Klebsiella pneumoniae. Out of 22 (55%) of phenotypically AmpC positive strains of E.coli 15 (37.5%) showed genotypes CIT and CIT/EBC. out of 17(42%) of phenotypically AmpC positive strains of Klebsiella 11(28%) showed the Geno types CIT, CIT/DHA. In one study by HaengSJ et al, 22 Klebsiella pneumonia isolates showed DHA type. [30] In one study by Neil Woodford et al CIT genotype was found in E.coli strains and DHA genotype was found in Klebsiella spp. [31] correlating with our study.

Shahidet al has demonstrated the occurrence of CIT, EBC and CIT/EBC (blaCITandblaEBC) in both E.coli and Klebsiella spp. by using multiplex PCR [32] which is correlating with our study.

In one study by Shanti et al detected CIT, EBC and DHA family specific genes along with other types. [33] In our study AmpC producing E.coli and Klebsiella isolates showed 100% resistance to cefoxitin and amoxy/ clav which may be due to hyper production of β-lactamases and inhibitor resistant TEM β-lactamases. Resistance to cefoxitin can also indicate the reduced outer membrane permeability. [34] All AmpC producers showed high resistance to aztreonam (80%), cefotaxime 79%, ceftazidime 63%, cefipime (68%) and piperacillin/tazobatam (67 %.).In a study by Sasirekhaet al there was high resistance to amoxy/Clav, aztreonam 42.85% of resistance to cefepime. [27]

In a study by Renukaet al showed high resistance pattern 81.63% to amoxy/Clav, cefpodoxime 72.44%, aztreonam 67.34%, and piperacillin / tazobatam (69%) and were multidrug resistant .[35] In view of the above findings there is a need to detect drug resistant strains to prevent the spread of drug resistance in hospitals as well as in the community.

Limitations of our study: In the present study PMABL genes were detected but other mechanisms of cefoxitin resistance such as porin loss mutants and chromosomal hyper producers were not considered and detected.

Conclusions

The most important aspect for a clinical microbiologist is detection of PMABLs and their susceptibility pattern among gram negative organisms. In our study ESBL producing Klebsiella and E.coli strains showed PMABL CIT, EBC, CIT/EBC, DHA, CIT/DHA genes by multiplex PCR. These strains with AmpC genes are often resistant to multiple antimicrobial agents making it difficult to select an effective antibiotic. To detect AmpC resistance clinical laboratories will need to use combination of phenotypic and molecular identification methods. The multiplex PCR technique described in this study will be an important tool for the detection of PMABL genes in Gram negative bacteria.

Abbreviations

PMABL: Plasmid mediated AmpC beta- lactamase ESBL: Extended spectrum beta- lactamase PCR: Polymerase chain reaction EDTA: Ethylene diamine tetra acetic acid

Funding None

Competing Interests None Declared

References

1. Dahyot S, Mammeri H. Hydrolysis Spectrum Extension of CMY-2-Like β-Lactamases Resulting from Structural Alteration in the Y-X-N Loop. Antimicrob Agents and Chemother. 2011; 56(3):1151-1156.

2. Gupta V, Kumarasamy K, Gulati N, Garg R, Krishnan P, Chander J. AmpC β-lactamases in nosocomial isolates of Klebsiella pneumonia from India. Indian J of Med Res. 2012; 136(2):237-241.

3. Haldorsen B, Aasnaes B, Dahl KH, Hanssen AM, Simonsen GS, Walsh TR, et al. The AmpC phenotype in Norwegian clinical isolates of Escherichia coli

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Basavaraju et al. is associated with an acquired ISEcp-1-like AmpC element of hyper production of the endogenous AmpC. J of AntimicrobChemother. 2008; 62:694-702.

A-235

14. Yong D, Park R, Yum JH, et al. Further modification of the Hodge test to screen AmpC beta-lactamase (CMY1)-producing strains of Escherichia coli and Klebsiella pneumonia. J Microbiol Methods. 2009; 34:38-43.

15. Coudron PE. Inhibitor-based methods for detection of plasmid- mediated AmpC β-lactamase in Klebsiella spp. Escherichia coli and Proteus mirabilis.

J ClinMicrobiol. 2005; 43:4163-4167.

16. Hanson ND, Thomson KS, Moland ES, Sanders CC, Berthold G, Penn RG Molecular characterization of a multiply resistant Klebsiella pneumonia encoding ESBLs and a plasmid-mediated AmpC. J AntimicrobChemother. 1999; 44:377-380.

17. Alden R, Lee S, Wang WALL, Bennett JV and Eickhoff TC Ann. Intern. Med.1971; 74:657-664.

18. Jacoby AG Clinical Microbiological Reviews. Jan, 2009; 161-182.

19. Baurenfeind A, Schneider I, Jungwirth R, Sahly H, Ullmann U. Anovel type of AmpC β-lactamase, ACC-1, produced by a Klebsiella pneumonia strain causing nosocomial pneumonia. Antimicrob Agents Chemother 1999; 43:1924-31.

20. Singhal S, Mathur T, Khan S, Upadhyay DJ, Chug S, Gaind R, et al. Evaluation of methods for AmpC β-lactamase in Gram negative clinical isolates from tertiary care hospitals. Indian Med Microbiol 2005;23:120-4 21. Arora S, Bal M, AmpC β-lactamase producing bacterial isolates from Kolkata hospital. Indian J Med Res 2005; 122:224-33.

22. Taneja N, Rao P, Arora J, Dogra A. Occurrence of ESBL and AmpC β-lactamases and susceptibility to newer antimicrobial agents in complicated UTI. Indian J Med Res 2008; 127:85-8.

23. Subha A, Renuka Devi V, Ananthan S, AmpC β-lactamase producing multidrug resistant strains of Klebsiella spp. and Escherichia coli isolated from children under five in Chennai. Indian J Med Res 2003; 117:13-18.

24. Ratna AK, Menon I, Kapur I, Kulkarni R. Occurrence and detection of AmpCβ-lactamases t a referral hospital in Karnataka. Indian J Med Res 2003; 118:29-32.

25. Hemalatha V, Padma M, Sekar U, Vinodh TM, Arunkumar AS. Detection of AmpC β-lactamases production in Escherichia Coli & Klebsiella by an inhibitor based method. Indian J Med Res 2007; 126:220-3.

26. Alvarez M, Tran JH, Chow N, Jacoby GA Epidemiology of conjugative plasmid-mediated AmpC β-lactamases in the United states. Antimicrobial Agents Chemother2004; 48:533-7.

27. Sasirekha B, Shiva Kumar S Occurrence of plasmidmediated AmpC β-lactamases among Escherichia coli

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

4. De la Cruz F, Davies J. Horizontal gene transfer and the origin of species: lessons from bacteria. Trends in Microbiol. 2000; 8(3):128-133.

5. Lee W, Jung B, Hong HG, Song W, Jeong SH, Lee K, et al. Comparison of 3 Phenotypic-detection Methods for Identifying Plasmid-mediated AmpC β-lactamaseproducing Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis Strains. Korean J Lab Med. 2009; 29:448-454.

6. Manoharan A, Sugumar M, Kumar A, Jose H, Mathai D. ICMR-ESBL Study Group. Phenotypic & molecular characterization of AmpC β-lactamases among Escherichia coli, Klebsiella spp. &Enterobacter spp. From five Indian Medical Centres. Indian J Med Res. 2012; 135(3):359-364.

7. Perez-Perez FJ, Hanson ND. Detection of plasmidmediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J ClinMicrobiol. 2002; 40:2153-62.

8. Thomson KS, Smith Moland E. The new beta lactamases of Gram negative bacteria at the dawn of the new millennium. Microbes Infect. 2000; 2:1225-1235.

9. Bush K. New beta lactamases in Gram negative bacteria: diversity and impact on the selection of antimicrobial therapy. Clin Infect Dis. 2001; 32:1085-1089.

10. Bauernfeind A, Chong Y, Lee K. Plasmid-encoded AmpC beta lactamases: how far have we gone 10 years after the discovery? Bonsai Med J. 1998; 39:520-525.

11. Mohamudha PR, Harish BN, Parija SC. Molecular description of plasmid-mediated AmpC β-lactamases among nosocomial isolates of Escherichia coli & Klebsiella pneumonia from six different hospitals in India. Indian J Med Res. 2012; 135(1)114-119.

12. Kenneth HR, Bradley T, Hilary S, Christine H, Judith AJ, Andrea Z. Clinical Laboratory Detection of AmpC β-Lactamase, Does it affect patient Outcome? Am J ClinPathol. 2011; 135:572-576.

13. Black JA, Moland ES, Thomson KS. AmpC disk test for detection of plasmid-mediated AmpC beta-lactamases in Enterobacteriaceae lacking chromosomal AmpC beta-lactamases. J ClinMicrobiol. 2005; 43:3110-3113.

A-236

Detection of Plasmid mediated AmpC Beta-lactamases

and Klebsiella pneumonia clinical isolates in a tertiary care hospital in Bangalore. Indian J Microbiol 2012; 52(2):174-179.

28. Black JA, Thomson KS, Buynak JD, Pitout JDD Evaluation of β-lactamase inhibitors indisk tests for detection of plasmid-mediated AmpC β-lactamases in well characterized clinical strains of Klebsiella spp.

J ClinMicrobiol 2005;43:4168-71.

29. Hernandez-Alles S, Benedi VJ, Martinez-Martinez L, Pascual A, Aguilar A, Tomas JM, et al. Development of resistance during antimicrobial therapy caused by insertion sequence interruption of Porin genes.

Antimicrob Agents Chemother 1999; 43:937-9.

30. Haeng SJ, Kwon IL, Jeong HS, Hee JJ, Si Hyun K, Ja Young L, Seung HO, Hye Ran K, Chulhun LC, WeanGyu K, and Jeong NL Prevalence of plasmid mediated quinolone resistance and it is association with extended spectrum β-lactamase and AmpC β-lactamase in Enterobacteriaceae. KJLM 2011; 31(4):257.

31. Neil wood F, Suganya R, Fagan EJ, Hill LRR, Hopkins LK, Kaufmann ME, James K, Marie F Wide geographic spread of diverse acquired AmpC β-lactamases among Escherichia coli and Klebsiella spp. in the UK and Ireland. Journal of Antimicrobial Chemotherapy 2001; 59:102-105.

32. Shahid M, Sobia F, Anuradha S, and Haris MK Journal of Clinical Microbiology 2012; 1779-1782.

33. Shanti M, Sekae U, Arunagiri K, Sekar B Detection of AmpC genes encoding for β-lactamases in Escherichia coli and Klebsiella pneumonia Indian J Med Microbiol 2012;30:290-5.

34. Thomson KS, Controversies about extended spectrum and AmpC β-lactamases. Emerging Infectious Diseases 7,333-6.

35. Renuka R, Ravindranath G, Ajay kumar O, Kelmani CR Prevalence of MDR-ESBL producing Klebsiella pneumonia isolated from clinical samples J Microbiol Biotech Res. 2013;3(1):32-39.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Original Article Documentation of Myeloproliferative Disorder as the Commonest Hematological Malignancy in Predominant Rural Based Pilot Study at Punjab (India): An Incidental Finding or Association Rahul Mannan1, Mridu Manjari1, Sonam Sharma2*, Komalpreet Bhatia1, Gagandeep Singh1 and Tejinder Bhasin1 Department of Pathology, Sri Guru Ram Das Institute of Medical Sciences and Research, Amritsar , Punjab, India 2 Department of Pathology, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India

1

Keywords: Bone Marrow, India, Malignancy, Punjab, Spectrum

ABSTRACT Background: Pilot studies (standard scientific tool) are helpful for researchers in conducting preliminary analysis before committing resources for a main study to follow. The present pilot study was undertaken in the northern part of India so as to take a glimpse of the pattern of hematological malignancies in an area which is mostly based on the agricultural economy and the hazards associated with it. These demographic based studies are often helpful in defining the burden and to ascertain the trends of the disease in the selected population.

Method: A 3 year retrospective study was conducted in the hematopathology unit of the Department of Pathology, Sri Guru Ram Das Institute of Medical Sciences and Research, Amritsar, Punjab (India) from a period of January 2012 to December 2014. Data regarding demographic/epidemiological details including clinical presentation, indication for the procedure was noted. Only the cases of hematological malignancies were included in the study. The results thus obtained were recorded and analyzed by descriptive statistics.

Results: Of 1840 cases, 147 (7.98%) were hematological malignancies with Male to Female ratio being 2:1. After retrieving the residential records, it was noted that most of the patients were natives of Punjab state. The most common peripheral blood finding in hematological malignancies cases were pancytopenia ( 38.09 % ) , followed by bicytopenia ( 27.2 % ). According to the clinical presentation most common presentation recorded was hepatomegaly (42.1%), followed by splenomegaly (28.57%). The commonest hematological malignancy in our study was MPD (Chronic Myeloid Leukaemia primarily) followed by Lympho-proliferative disorders (which included Chronic Lymphocytic Leukaemia, Non Hodgkinâ&#x20AC;&#x2122;s Lymphoma and Hairy Cell Leukaemia). Combining both the categories, the so called chronic leukaemias contributed almost 2/3 of cases (72.78%).

Conclusions: In contrast to most of the reported institutional based cases from India and the neighboring countries (including many developing countries of Asia) which have recorded acute leukaemia (ALL/AML) overall as the most common hematological malignancy ; the higher incidence of chronic leukaemias in our study is interesting.

The finding of CML as more common of the chronic leukaemias in comparison to the CLL and other LPDâ&#x20AC;&#x2122;s is noteworthy.

This trend needs to be watched carefully and a further study is planned to monitor the overall outcome over the next few years.

*Corresponding author: Dr. Sonam Sharma, B-5, Varun CGHS Ltd., Plot No. GH-03, Sector - 52, Gurgaon - 122003, Haryana, India.

Phone: +91 9999841393 Email: drsonamsharma@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A-238

Documentation of Myeloproliferative Disorder as the Commonest Hematological Malignancy

Introduction

Hematological disorders manifest in many ways.

A patient may be asymptomatic as in compensated anemia or may be suffering with a life threatening emergency as in a hematological malignancy (HM) per se or due to the complication of its therapy (tumor lysis syndrome). Apart from the clinical history, routine hematological investigations, ancillary investigations (such as electrophoresis and other special tests), including cytochemistry and radiological investigations; Bone marrow examination (bone marrow aspiration and biopsy) are considered essential and are corner stone of management of hematological disorders.[1] Although in cases of HM; flowcytometry is often considered gold standard in reaching a diagnosis, the importance of a minimal invasive and a outpatient procedure to reach an initial diagnosis cannot be overstated especially in third world and resource challenged countries where such facilities and other molecular studies are out of reach for much of the population. In most instances bone marrow examination is the most definitive method of differentiating hematological malignancies from non- malignant hematological disorders.

The underlying cause of most HMs remains unaccountable.

Many factors such as infectious agents, autoimmunity, drugs, inherited disorders and environmental agents have been implicated.[2] The present study was essentially a pilot study which was undertaken over a period of three years in a single tertiary care centre in the northern part of India so as to take a glimpse of the pattern of HM in an area which is mostly based on the agricultural economy and the hazards associated with it. A comparison was also drawn with areas in and around Indian subcontinent and rest of the industrialized world. These demographic based studies are helpful in defining the burden and to ascertain the trends of the disease in the selected population. This in many instances imparts valuable knowledge and information to plan and implement various health programmes and correctional measures to limit the disease burden.

Objectives of This Study are 1) To find out the demographic spectrum of HMs according to age and sex2 ) To correlate between the PBF findings ,clinical presentations and bone marrow aspiration and biopsy findings, and 3) To sub-type the individual HMs for ascertaining the pattern.

Materials & Methods

A 3 year retrospective study was conducted in the Department of Pathology, Sri Guru Ram Das Institute of Medical Sciences and Research, Amritsar, Punjab (India)

from a period of January 2012 to December 2014 catering to majorly rural and urban dwellers as well. The study was approved by research ethics committee of the institute. In total 1840 cases were studied by retrieving the records from the departmental archives. Detailed information regarding age, sex, clinical presentation, indication for the procedure was noted. Data was collected and subsequently analyzed .The findings on aspirate and biopsy were compared to each other. The standard technique was employed for obtaining the aspirate samples using the Salahâ&#x20AC;&#x2122;s needle from posterior superior iliac spine. The trephine biopsy was performed using Jamshidi needle with the length of the biopsy core ranging from 1 to 3 cm. The biopsy was then fixed for minimum of 24 hours in 10% buffered formalin and then decalcified overnight in mixture of 8 % hydrochloric acid and 10 % formic acid in equal amounts. The fixation of the biopsy core was followed by automated tissue processing, paraffin embedding and sectioning. All the aspirate smears were routinely stained

by May Grunwald Giemsa (MGG) while the trephine biopsy sections were stained by routine Hematoxylin and Eosin (H&E) stain. The demographic variables were sex and age grouping. The research variable was pattern of the disorder on bone marrow aspirate examination.

All the cases of non malignant hematological disorders (nutritional etc.) and myelodyspalasia were excluded from the study. Only the cases of hematological malignancies (HM) were included in the study. In all the cases informed and written consents were obtained. The clinical details as well as the slides were reviewed again by trained hematopathologists. The results thus obtained were recorded and analyzed by the means of descriptive statistics.

Results

Of 1840 cases, 1693 (92.01%) were non-malignant hematological disorder (TABLE 1) and 147 (7.98%) were hematological malignancies with Male to Female ratio being 2:1. After retrieving the residential records, it was noted that most of the patients were natives of Punjab state.

The most common peripheral blood finding in hematological malignancies cases were pancytopenia (38.09 %), followed by bicytopenia (27.2 %), anemia (16.32%), thrombocytopenia (15.64%) and normocytic normochromic picture (4.08% ) respectively (TABLE 2).

According to the clinical presentation most common presentation recorded was hepatomegaly (42.1%), followed by splenomegaly (28.57%), lymphadenopathy (18.36) and pallor (10.88%) (TABLE 3). For malignancies most common age group involved was

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Mannan et al.

A-239

60 years and above (63 cases; 42.8 %) (TABLE 4).

Hematological malignancies cases comprised of myeloproliferative disorders (MPD) comprising of 69 cases (46.9 %) followed by lympho-proliferative disorder

(LPD) comprising of total 38 cases (25.8%) followed by acute leukaemias total 24 cases (16.32 %) , plasma cell dyscrasia total 9 cases (6.1 %) and bone marrow infiltrative disorder total 7 cases (4.7 %) respectively (TABLE 5).

Table 1: Distribution of malignant vs non-malignant hematological disorders in bone marrow.

YEAR 2014

NON -MALIGNANT 671

MALIGNANT 74

TOTAL 743

2013 2012

493 531 1695 92.02

32 41 147 7.9

525 572 1840

2013 12 08 06 05 00

2012 14 12 08 08 02

PERCENTAGE

Table 2: Various PBF findings in hematological malignancies.

PRESENTATION PANCYTOPENIA BICYTOPENIA ANEMIA THROMBOCYTOPENIA NORMAL

2014 30 20 10 10 04

Table 3: Various clinical presentation in hematological malignancies.

CAUSES HEPATOMEGALY SPLENOMEGALY LYMPHADENOPATHY GENERALIZED WEAKNESS

2014 35 21 10 08

2013 12 10 07 03

2012 15 11 10 05

TOTAL 62 42 27 16

40-60 27 09 12 48 32.6

MORE THAN 60 30 15 18 63 42.8

Table 4: Distribution of hematological malignancies according to various age groups.

YEAR 2014 2013 2012 TOTAL PERCENTAGE

0-15 04 02 03 09 6.1

15-40 13 06 08 27 18.3

Table 5: Subtyping of various hematological malignancies detected.

YEAR

ACUTE LYMPHO PROLIFERATIVE MYELOPROLIFERATIVE LEUKEMIA DISORDERS DISORDER

2014

11

2013 2012

PLASMA CELL DYSCARIASIS

BONE MARROW INFILTRATION

19

29

7

04

04

10

17

01

01

09

09

23

01

02

TOTAL

24

38

69

9

7

PERCENTAGE

16.32

25.8

46.9

6.1

4.7

Discussion

It is well documented that developing countries bear upto 50 % of all the global cancer burden and of these HMs constitute 3 % of all malignancies with an incidence rates of 300,500 per year.[3] According to data published by IARC regarding incidence of HMs; it is 3.6 %, 4.6%, 3.5%

and 2.5% of all the malignancies in south-east Asia, Nepal, India and China. However; individual centre based studies yield important information as they can be used to compare the rates calculated from the local area not only with the individual country average but also with different parts of the country and internationally as well. In the present pilot

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-240

Documentation of Myeloproliferative Disorder as the Commonest Hematological Malignancy

study we tried to analyze the data obtained from the patients reporting to our institute to know the relative frequency of different hematological disorders with emphasis mainly on the spectrum of hematological malignancies.

Employing this principle we found that in our institute HMs constituted 7.98% in our study which was much lower than the other institute based (local) reported series in and around India such as 18 % reported by Tahlan et al [4] , 27.12% by Rahman et al [5], and 47.48% by Al –Ghazaly J et al. [6] Organomegaly constituting hepato splenomegaly (70.74%) was the commonest clinical presentation noted in our study unlike pallor and lymphadenopathy noted in other studies. Rate of splenomegaly in many studies has been documented around 40 % of all the splenomegaly patients and around 50% in many patients of HM especially the ones suffering from CML.[7, 8] Male preponderance was seen across almost all of the lesions in our study except in multiple myeloma and Hodgkin’s disease. However; in many studies around the world LPD- (Chronic Lymphocytic leukemia and Non Hodgkin’s lymphoma) are more common in female population.[9, 10] The finding of male preponderance in this part of the world maybe due to more assertiveness of the males to seek healthcare and neglect by the females over

healthcare which is a prevalent behavior throughout the resource challenged countries.

Peripheral blood film (PBF) is a basic and a highly informative hematological tool at the clinician’s disposal in screening, diagnosis and monitoring of disease progression and therapeutic response. The most common PBF finding in hematological malignancies cases in our study in decreasing order was pancytopenia, bicytopenia, anemia, thrombocytopenia and normocytic normochromic picture. The findings almost concur with work done by other researchers who have also noted cytopenias as the most common presentation in hematological malignancies with bicytopenia being the most common.[9, 11] Most of our patients were of pancytopenia with bicytopenia being the second most common presentation on PBF. Hence, presence of pancytopenia or bicytopenia in a PBF should be very carefully assessed by the reviewing hematologist.

In our study, we observed MPDs accounting for upto half the cases of all hematological malignancies (46.9 %). Most of these cases were of chronic myeloid leukemia (CML) chronic phase with very few cases of accelerated phase and the blast crisis [Figure 1a & 1b]. The second most prevalent hematological malignancy was LPD (25.8%) [Figure 2a & 2b] followed by acute leukaemias (16.32 %) [Figure 3a & 3b], plasma cell dyscrasia (6.1 %) [Figure 4a & 4b] and bone marrow infiltrative disorders 7 (4.7 %) respectively.

Fig. 1a: Bone marrow aspiration smear of CML showing myelocytes, meta myelocytes and band forms (MGG, x 10) with corresponding tissue section in Figure 1b (H&E, x 10). Figure 2a : CLL bone marrow aspiration revealing mainly mature lymphocytes (MGG, x 10) with diffuse pattern of infiltration on bone marrow biopsy in Figure 2b (H&E, x 10).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Mannan et al.

A-241

Fig. 3a: Bone marrow aspiration smear showing cellular infiltration of blasts in a case of acute leukaemia (MGG, x 20) with corresponding tissue section in Figure 3b (H&E, x 10). Figure 4a : Increased number of plasma cells in a case of multiple myeloma on bone marrow aspiration (MGG, x 10) with corresponding tissue section in Figure 4b (H&E, x 10).

It is interesting to note that while in most of the reported institutional based cases from India and the neighboring countries of Nepal, Bangladesh, Pakistan including many developing countries of Asia have recorded acute leukaemia (ALL/AML) overall as the most common hematological malignancy recorded followed by lymphomas. According to the published research, Pudasaini S et al [12] and Rahim et al [4] have reported acute leukaemia to be 12.3% and 24.28 % respectively with some researchers such as Al â&#x20AC;&#x201C;Ghazy [5] and Tahlan et al [3] reporting them to be as high as 41 % and 37.31 % respectively.

in this study that lymphatic leukaemia. This also is in line with the reports from the western hemisphere and some African studies.

In fact the high prevalence of chronic leukaemias especially CML noted in this study agrees with observations from published studies from Africa and the USA, where LPDâ&#x20AC;&#x2122;s are the most common HM followed by CML.[17, 18, 19]

The finding of number of chronic leukaemias being more than that of acute leukaemias is in line with observations that had been made in various studies of African and industrialized western world where there is a definite preponderance of the chronic leukaemia.[14, 15, 16, 17] Similarly morphologically when chronic leukaemia were segregated; the myeloid was found to be more common

CML as the most frequent HM in this study, accounting for 43.53% of the hematological malignancies reviewed are comparatively higher and unique finding compared with the figures from other studies. A possible reason for the lower number of cases encountered for the acute leukaemias in our study may be due to the fact that not many pediatric patients were included in the study and also it may also point towards an unfortunate fact of higher child mortality rate in our country where many basic facilities for diagnosis and treatment are often out of reach and the presence of a world class apex centre in the form of Post Graduate Institute of Medical Education and Research at Chandigarh which is in vicinity of our institute. Several other factors may also be contributory to the above finding as it is documented that the mean survival of acute leukaemic patients is low in developing countries due to late presentation in hospital, unavailability of required chemotherapeutic drugs either due to poor financial status of the patients, or due to

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

In contrast the commonest HM in our study was MPD (CML primarily) followed by LPD (which included CLL, NHL and HCL). Combining both the categories, the so called chronic leukaemias contributed almost 2/3 of cases (72.78%). In most of the studies described above of the Asian population the LPD/NHLs were the second most common HMs after leukemia.[3, 5, 11, 13]

A-242

Documentation of Myeloproliferative Disorder as the Commonest Hematological Malignancy

difficulty in procuring the drugs.[20, 21] This unfortunate trend is well documented in the minority sub-populations of African Americans and Hispanics also in comparison to white Caucasians.[22] The higher incidence of chronic leukaemias in our study correlating with western hemisphere may also have an interesting hypothesis as the habits ( food and social) and also the overall human development index (HDI) and average per capita income in this area of India is comparable to many of the middle income economies. The dietary habit and the environmental risk factors are almost now similar to the population of the western hemisphere. The longevity of the Punjabi population (higher life expectancy rates) and the patients of CML responding to the novel treatment of imitanib mesylate leading to improved 5 year survival rates can also have a bearing on the final results.

The finding of CML as more common of the chronic leukaemias in comparison to the CLL and other LPD’s is noteworthy. This trend needs to be watched carefully and a further study is planned to monitor the trend over the next few years. Much of the occupation in Punjab (India) is agricultural based and the wide spread use of insecticide and pesticide as contaminant in soil and ground water of Punjabi population leading to malignancies is well documented. If this has a role in evolution of CML in Punjabi adult population at risk needs to be investigated as a recent study has corroborated increased risk of myeloid leukaemia with manufacturing and application of pesticides.[23]

Conclusion

Pilot studies are standard scientific tools allowing researchers to do a preliminary analysis before committing resources and man power to serious research. The present pilot study highlights the recognition of MPD as the commonest HM in Punjabi population of north India.

Although a single centre experience but this adds to information and can comment upon the current scenario and trends of HM in hitherto unstudied population. On basis of these findings further studies are being planned in collaboration with other state sponsored and non state sponsored institutes in this belt to calculate and corroborate the findings of the study with the risk factor of pesticide concentration with sub-type of leukaemias and the with different population sub-groups.

Acknowledgements No

Funding None

Competing Interests None

References

1. Wise-Draper T. Medscape [Internet]. New York: WebMD; 2014. Bone Marrow Aspiration and Biopsy; [Updated 2015 Mar 31; cited 2015 Nov 17]. Available from:http://emedicine.medscape.com/article/207575overview.

2. Rodriguez-Abreu D, Bordoni A, Zucca E. Epidemiology of hematological malignancies. Ann Oncol 2007;1:i3-i8.

3. Ghartimagar D, Ghosh A, Narasimhar R, Talwar OP. Hematological and non-hematological malignancies in a tertiary care hospital in Nepal- 11 year study.

Nepal Med Coll J 2012; 14(3): 187-92.

4. Tahlan A, Bansal C, Palta A, Chauhan S. Spectrum and analysis of bone marrow findings in anemic cases.

Indian J Med Sci 2008;62(8):336-9.

5. Rahim F, Ahmad I, Islam S, Hussain M, Khattak TA, Bano Q. Spectrum of hematological disorders in children observed in 424 consecutive bone marrow aspirations/biopsies. Pak J Med Sci 2005;21(4):433-6.

6. Al-Ghazaly J, Al-Selwi AH, Abdullah M, Al-Jahafi AK, Al-Dubai W, Al Hashdi A. Pattern of haematological diseases diagnosed by bone marrow examination in Yemen. A developing country experience. Clin Lab Haematol 2006;28:376-81.

7. Ali N, Anwar M, Ayyub M, Nadeem M, Ejaz A, Qureshi AH, et al. Hematological evaluation of splenomegaly.

J Coll Physicians Surg Pak 2004;14(7):404-6.

8. Murakami J, Shimizu Y. Hepatic Manifestations in Hematological Disorders. Int J Hepatol 2013;2013:484903. doi: 10.1155/2013/484903. Epub 2013 Mar 31.

9. Ekwere TA, Benson Ino-Ekanem M, Motilewa O. Indications and Spectrum of Haematological Disorders from Bone Marrow Aspiration Examination: A Three Year Review Study. Global J Hematol Blood Transfus 2015;2:4-8.

10. Babutaunde A, Awiwero C, Olatunji P, Durotoye I. Pattern of haematological malignancies in Iloron, Nigeria: A ten year review. Internet J Hematol 2008;5(2):15-20.

11. Jha A. Spectrum of haematological malignancies and peripheral cytopenias. J Nepal Health Res Counc 2013;11(25):273-8.

12. Pudasaini S, Prasad KBR, Rauniyar SK, Shrestha R, Gautam K, Pathak R, et al. Interpretation of bone

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Mannan et al. marrow aspiration in hematological disorder. J of Pathology of Nepal 2012; 2: 309-12.

13. Kusum A, Negi G, Gaur DS, Kishore S, Meena H, Sharma A, et al. Hematological malignancies diagnosed by bone marrow examination in a tertiary hospital at Uttarakhand, India. Indian J Hematol Blood Transfus 2008;24(1):7-11.

14. Levy LM. The pattern of Leukaemia in adult Zimbabweans. Centr Afr J Med 1984;30 (4):57-63.

15. Shamebo M. Acute Leukaemias in adult Ethiopians in a teaching hospital. Ethiop Med J 1994;32(1):17-25.

16. Xie Y, Davies SM, Xiang Y, Robison LL, Ross JA. Trends in Leukaemia incidence and survival in the United States (1973-1998). Cancer 2003;97(9):2229-35.

17. Wu X, Groves FD, McLaughlin CC, Jemal A, Martin JA, Chen VW. Cancer incidence patterns among adolescents and young adults in the United States.

Cancer Causes Control. 2005;16(3):309-20.

18. Williams CKO. Some biological and epidemiological characteristics of human leukaemias in Africans. In: Virus-associated cancers in Africa. Lynn: International Agency for Cancer Research; 1985. p. 1-4.

www.pacificejournals.com/apalm

A-243 19. Anderson, RE, Ischida K, Li Y, Ishimaru T, Nishiyama H. Geographical aspects of malignant lymphoma and multiple myeloma: selected comparisons involving Japan, England and United States. Am J Pathol 1970;61(1):85-98.

20. Ferra C, Marcos P, Misis M, Morgades M, Bordeje ML, Oriol A, et al. Outcome and prognostic factors in patients with haematologic malignancies admitted to the intensive care unit: a single -centre experience. Int J Haematol 2007;85(3):195-202.

21. Kulkarni KP, Arora RS, Marwaha RK. Survival outcome of childhood acute lymphoblastic leukemia in India: a resource-limited perspective of more than 40 years. J Pediatr Hematol Oncol 2011;33(6):475-9.

22. Pulte D, Redaniel MT, Jansen L, Brenner H, Jeffreys M. Recent Trends In Survival Of Adult Patients With Acute Leukemia: Overall Improvements, But Persistent And Partly Increasing Disparity In Survival Of Patients From Minority Groups. Haematologica 2013;98(2):222-9.

23. Van Maele-Fabry G, Duhayon S, Lison D. A systemic review of myeloid leukemia and occupational pesticide exposure. Cancer Causes Control. 2007; 18(5): 457-78.

eISSN: 2349-6983; pISSN: 2394-6466

Original Article Evaluation of The Causes of Deferral Among Blood Donors: A Retrospective Study Akanksha V. Gaajre, Yasmeen Khatib*, Richa Patel and Asha Premlata Oraon Dept of Pathology, Dr R N Cooper Medical General Hospital, Mumbai, India Keywords: : Anemia, Blood Donors, Deferral, Deferral Reasons

ABSTRACT Background: Blood transfusion is an essential part of patients care. It is well known that large number of apparently healthy donors are unable to donate blood successfully because of varied reasons. The aim of this study was to evaluate and analyze the rate and causes of deferral among donors Methods: The present retrospective study was carried out in the department of pathology, Dr.R.N. Cooper Hospital, Mumbai. The retrospective data was retrived from the institutional database over a period of five years from 20112015. Based on the history and physical examination findings all blood donors were classified into fit for donation or deferred donors.

Results: Of the 11,386 subjects who presented to our department during the study period, a total of 838 (7.36%) subjects were deferred. The rate of deferral was the highest in the age group of 36-45 years (35.6%) followed by 2635 years (29.1%) and then 18â&#x20AC;&#x201C;25 years (20.4%) . Percentage of deferral among a total number of registered males and females were 6.14 % (613/9981) and 16.0 % (225/1405), respectively. The main reason for deferral was low hemoglobin (Hb) (44.9%), followed by high blood pressure 17.7%), on medication (13.6%) and alcohol consumption within 72 hours (9.5%).

Conclusion: By knowing the causes of deferral, proper strategies can be devised whereby people in the community can be educated regarding the causes of deferral and importance of blood donation.

*Corresponding author: Dr. Yasmeen Khatib, Associate Professor. Dept of pathology, Dr R N Cooper Medical General Hospital, Mumbai, India Phone: +91 9987063770 Email: sahirkhatib@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Gaajre et al.

Introduction

Blood is life. Blood transfusion has been used since 1930s for various indications. Transfusion therapy is a well established treatment in various medical and surgical procedures.[1] However, it requires an adequate supply of safe blood. Stringent donor screening criteria are designed to protect both the blood donor and recipient from harm [2]The National AIDS Control Organizationâ&#x20AC;&#x2122;s (NACO) statistics show that the annual rate of blood donation in India is about 7.4 million units, against the requirement of 10 million units[3]. Criteria for whole blood donor selection and deferral in India are based partially on scientific facts borrowed from developed countries and partially on tradition.[4] It is well known that quite a large number of apparently healthy donors are not able to donate blood successfully because of varied reasons , either permanently or temporarily.Temporarily deferred donors require proper follow-up and management so as not to lead to a diminished supply of future donors[5].

Proper education and screening could help in improving donor as well as recipient safety [6].

Very few studies done in India in the past have provided different common reasons for deferral of whole blood donors, highlighting differing demographic profile in different parts of the country.[4,7,8] But more studies are required regarding various aspects of deferral which can help to format the strategies to increase the pool of voluntary donors without compromising on the quality of the blood and safety to the donor and the recipient. The present study was undertaken to evaluate and analyse the rate and causes of deferral among donors.

Materials and Methods

The present retrospective study was conducted in the department of pathology, Dr. R. N. Cooper Hospital, Mumbai. The retrospective data was retrieved from the institutional database of our hospital over a period of five years from 2011-2015.

A-245 the donors was performed with regards to haemoglobin, blood pressure, temperature and pulse rate & regularity, as per recommendations of Directorate General of Health Sciences, Government of India[9]. The subjects who fulfilled the following criteria of physical examination such as pulse rate- 80-100 beats/min, systolic blood pressure-100-180 mm Hg, diastolic blood pressure- 50100 mmHg, haemoglobin >12.5 gm% were considered fit for donation and the rest were deferred. Detailed information on donor deferral including the cause of deferral was recorded in separate deferral register. The data thus collected was further analysed by observational and descriptive statistics.

Result

Of the total 11,386 subjects who presented to our department during the study period, a total of 10548 ( 92.6 %) subjects were selected for donation, of whom 9792(92.8 %) were males, and the rest were females 756 (7.2 %) (Table No.1). Majority ( 34.6%) of the donors presenting for the donation were between 18 and 25 years of age, followed by age group of 26-35 years ( 33.9%) (Table No.2). Total 838 (7.36%) individuals were deferred from donation because of various reasons. The age of deferred donors ranged from 17 to 65 years. The rate of deferral was the highest in the age group of 36-45 years (35.6%) followed by 26-35 years (29.1%) and then 18â&#x20AC;&#x201C;25 years (20.4%) (Table No.2). Of the total donors who presented for blood donation, 12.3% were females (n=1405), however many of them were deferred so that they contributed only 7.2% of selected donors.Percentage of deferral among a total number of registered males and females were 6.14 % (613/9981) and 16.0 % (225/1405), respectively. So significantly higher percentage of females were deferred as compared to males.

All the donors who visited over this period, of all age groups and both sexes, were included. The blood donations were carried out from the donors at outdoor blood donation camps and in-house blood bank in our hospital. The donors were voluntary or replacement donors who included relatives or friends of the patients.

The donors were first required to fill up a registration form, which carried all the information like personal details, demographic details, occupation details and medical history regarding risk factors like history of previous surgery, hospitalisation, blood transfusion. The donors were then screened and a brief physical examination of

The most common cause for deferral was anemia (low haemoglobin) both in male and female donors, accounting for 44.9% of deferral in our study. The other leading causes in order of frequency were high blood pressure(17.7%), on medication (13.6%) and alcohol consumption within 72 hours(9.5%). The remaining causes for deferral were age<18 years (2.1%), history of jaundice (3%), recent infection/fever (3.1%), history of thyroid disease(1.2%) and other miscellaneous causes. Anaemia (low haemoglobin) was most commonly observed in the age group of 36-45 years (16.1%) followed by 26-35 years of age (13.4%) (Table No.3). Majority of the females( 63%) were deferred because of low haemoglobin ( Table No 4).High blood pressure was also commonly seen the age group of 36-45 years as a cause of deferral in our study.(Table No.4).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-246

Causes of Deferral Among Blood Donors

Table 1: Demographic Profile of Donors Gender

Total Donors

No Of Deferred Donors

No Of Selected Donors

% Of Deferred Donors

Male

9981 (87.7%)

613 (73.2%)

9792 (92.8%)

6.14%

Female

1405 (12.3%)

225 (26.8%)

756 (7.2%)

16.01%

Total

11386 (100%)

838 (100%)

10548 (100%)

7.36%

Table 2: Donor Distribution According to The Age Total Donors

Deferral % in respective age category

18 (2.1%)

18 (0.2%)

100%

3765 (35.7%)

171 (20.4%)

3936 (34.6%)

4.34%

3620 (34.3%)

244 (29.1 %)

3864 (33.9%)

6.31%

4. 36 -45

2273 (21.5%)

299 (35.6%)

2572 (22.6%)

11.63%

5. 46 -60

890 (8.4%)

102 (12.1%)

992(8.7%)

10.28%

6. > 60

0 (0)

4 (0.4%)

4 (0.03%)

100%

Total

10548 (100%)

838 (100%)

11386 (100%)

7.36%

Age Group

Selected Donors

Deferred Donors

1. < 18

0 (0)

2. 18 - 25 3. 26 - 35

Table 3: Causes of deferral among different age groups.

Cause of deferral

18 â&#x20AC;&#x201C; 25 years

26 - 35 years

36 -45 years

46 -60 years

N.A

Total

High BP

33(3.9%)

36(4.3%)

54(6.3%)

25(3%)

0(0%)

148 (17.7%)

Low HB

9.8(9.8%)

112(13.4%)

135(16.1%)

47(5.6%)

0(0%)

376 (44.9%)

On Medication

13(1.6%)

39(4.6%)

52(6.2%)

10(1.2%)

0(0%)

114 (13.6%)

Alcohol

9(1%)

25(3%)

30(3.6%)

16(1.9%)

0(0%)

80 (9.5%)

Low BP

8(1%)

6(0.7%)

6(0.7%)

1(0.1%)

0(0%)

21 (2.5%)

Infection/fever)

11(1.3%)

8(1.1%)

6(0.7%)

1(0.1%)

0(0%)

26 (3.1%)

H-Tattoo

2(0.25%)

2(0.25%)

0(0%)

0(0%)

0(0%)

4 (0.5%)

H-Jaundice

5(0.6%)

14(1.6%)

6(0.7%)

0(0%)

0(0%)

25 (3.0%)

H-Thyroid

5(0.6%)

0(0%)

5(0.6%)

0(0%)

0(0%)

10 (1.2%)

Age<18

0(0%)

0(0%)

0(0%)

0(0%)

18(2.1%)

18 (2.1%)

Others

3(0.35%)

2(0.25%)

5(0.6%)

2(0.25%)

4(0.5%)

16 (1.9%)

Total

171(20.4%)

244(29.1%)

299(35.7%)

102(12.2%)

22(2.6%)

838 (100%)

Table No.4-Causes of deferral in male and female donors.

Causes of deferral

Male

Female

Total

High BP Low HB

108 (17.6%)

40 (17.7%)

148 (17.7%)

234 (38.2%)

142 (63.0%)

376 (44.9%)

On Medication

103 (16.8%)

11 (4.9%)

114 (13.6%)

Alcohol

80 (13.1%)

0 (0%)

80 (9.5%)

Low BP

15 (2.5%)

6 (2.5%)

21 (2.5%)

H-infectious ds %)

19 (3.1%)

7 (3.1%)

26 (3.1%)

H-Tattoo

3(0.5%)

1 (0.5%)

4 (0.5%)

H-Jaundice

18 (3.0%)

7 (3.0%)

25 (3.0%)

H-Thyroid

7 (1.2%)

3 (1.2%)

10 (1.2%)

Age<18

13 (2.1%)

5 (2.2%)

18 (2.1%)

Others

12 (1.9%)

4 (1.9%)

16 (1.9%)

Total

613 (100%)

225 (100%)

838 (100%)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Gaajre et al.

Discussion

Paucity of healthy safe donors has always been a serious problem for blood banks all over the world. An adequate supply of blood is required but not at the cost of either donor or recipient safety[8]. Criteria for whole blood donor selection and deferral in India are based partially on scientific facts borrowed from developed countries and partially on tradition. However, sufficient in-house data and its scientific validation are still required to test the applicability of these criteria in our blood donors[4].

Deferral of the donors creates negative feelings about blood donation.

Of the total 11,386 subjects who presented to our department during the study period 92.8 % were males and only 7.2% were females which clearly shows male predominance regarding blood donation. Many studies [4,6,7] showed that female donor population was very low similar to our study and the reason may be due to more incidence of anemia, fear and lack of awareness among females.

The rate of deferral differs from region to region and sometimes in the same region from one centre to another.

The overall incidence of deferral in our study was 7.36% which was consistent with the other reported Indian studies by Sundar et al [7], Chenna et al [8], Bobati et al[10], Unnikrishnan et al. (5.2%)[11]. But higher rates of deferral were also observed by some authors in their studies.

Taneja K et al observed 17.1% of deferral [6],Mangwan (17.88% )[12] while Agnihotri N[4] reported the deferral incidence of 11.6%. Charles et al. reported a very high deferral rate of 35.6% in Trinidad and Tobago[13]. Such possible differences in deferral rates could be due to different donor selection criteria followed or various prevailing medical and endemic conditions[8].

The most common cause for deferral in our study was anemia (low haemoglobin) which was similar to previous studies conducted elsewhere[4,6,8,10,13]. Anemia accounted for 38.2% deferrals in males and 63% deferrals in females, implying that deferral in female donors due to anemia is nearly twice than in male donors. With such a high incidence of anemia, it may be useful to setup an anemia clinic along with blood donation camps so as to treat, counsel and maintain followup of temporarily deferred donors due to anemia. Kumar et al [14] stated in their study that education, motivation, and treatment of these deferred donors due to anemia are important aspects in blood banking, so that these donors can be recruited again as seen in our study.

A-247 Charles et al. reported high deferral rate of 35.6% due to high-risk sexual activity, replacement system which pressures unsuitable relatives and friends into donation and ι and β thalassemia traits which are prevalent in Trinidad and Tobago[13].

Many studies[4,6,7,15] showed that female donor population was very low similar to our study and the reason may be due to more incidence of anemia, fear and lack of awareness among females.

As reported by many other studies in India [4,6,7,8] high blood pressure was found to be the second most common cause of deferral in our study contributing to 17.7% deferral. But Bobati et al [10] reported alcohol consumption as second common cause of deferral. Majority of the donors who were deferred because of high blood pressure were in the age group of 36-45 years with nearly equal incidence in males and in females. (Table No. 3 & Table No.4). Hypertension often goes undiagnosed and is usually an incidental finding in rural area. This signifies hypertension as the common undiagnosed epidemic in rural health sectors [11].

13.6% deferral were due to donors on medication in our study, as observed by Agnihotri N in his study [4] History of alcohol consumption within 72 h was another leading cause in the present study exclusively seen in males, with high percentage in the age group of 36-45 years (Table No.3) Alcohol consumption was the second leading cause of deferral in a study conducted by Bobati et al[10]. This needs attention and can be resolved by counseling the donors and educating them about the adverse effects of alcohol.

History of jaundice was responsible for only 3% deferral in our study. The remaining causes of deferral were history of recent infection/fever, low blood pressure at the time of examination, age< 18 years, history of thyroid diseases, tattoo and miscellaneous causes. It is important to determine the incidence and causes of deferral among donors to guide the recruitment and retention efforts at local, regional and national level.

Conclusion

However, Unnikrishnan et al[11] reported medication in the past 72 hours as most common cause of deferral and

To conclude, incidence of donor deferral in our study was 7.36% with anemia being the most common cause of deferral both in males and females followed by high blood pressure.These deferred donors should be helped to overcome their problems, so that they can be prevented from being permanently deferred and encouraged to become regular donors. By knowing the causes of deferral, proper strategies can be devised whereby people in the community can be educated regarding the causes of deferral and importance of blood donation.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

A-248

Causes of Deferral Among Blood Donors

Acknowledgements No

Funding None

Competing Interests None Declared

Reference

1. Diwan R, Mathur M. Incidence and pattern of transfusion transmitted infection in voluntary donors in a teaching hospital “A four year retrospective study” JPBMS, 2012:22(01) 2. Sharma T, Singh B, Bhatt GC. Profile of deferral of blood donors in regional blood transfusion center in North India. Asian J Transfus Sci 2013;7:163-4 3. Department of AIDS Control Ministry of Health and Family Welfare Government of IndiaAnnual report 2008- 2009 pg 27 [Online]. Available from: http:// nacoonline.org/upload/Publication/Annual_Report_ NACO_2008-09.pdf.

4. Agnihotri N. Whole blood donor deferral analysis at a center in Western India. Asian J Transfus Sci 2010;4:116-22.

5. Chauhan DN, Desai KN, Trivedi HJ, Agnihotri AS. Evaluation of blood donor deferral causes: a tertiarycare center-based study. Int J ed Sci Public Health 2015;4:389-392 6. Taneja K, Bhardwaj K, Arora S, Agarwal A. Analysis of the reasons for deferral of prospective blood donors in a Tertiary Care Hospital in North India. J Appl Hematol 2015;6:154-6 7. Sundar P, Sangeetha SK, Seema DM, Marimuthu P, Shivanna N. Pre-donation deferral of blood donors

in South Indian set-up: An analysis. Asian J Transfus Sci 2010;4:112-115 8. Chenna D, Shastry S, Murugesan M, Baliga PB. Implication of deferral pattern on the donor pool: Study at a Tertiary Care Hospital. J Appl Hematol 2015;6:111-4 9. Saran RK. Transfusion Medicine Technical Manual, Directorate General of Health Services. 2nd ed. New Delhi: Govt. of India; 2003 10. Bobati SS, Basavraj V, Prakash P. Analysis of predonation loss of blood donors due to deferrals - in a tertiary care hospital set up. Int J Health Allied Sci 2016;5:15-8 11. Unnikrishnan B, Rao P, Kumar N, Ganti S, Prasad R, Amarnath A, et al. Profile of blood donors and reasons for deferral in coastal South India. Australas Med J 2011;4:379-85 12. Mangwana S. Analysis of blood donor deferral pattern: Scenario in a Tertiary Health Care Hospital in India.

Asian J Transfus Sci 2013;7:160-1 13. Charles KS, Hughes P, Gadd R, Bodkyn CJ, Rodriguez M. Evaluation of blood donor deferral causes in the Trinidad and Tobago National Blood Transfusion Service. Transfus Med 2010;20:11-4.

14. Alok K, Satyendra P, Sharma SM, Ingole NS, Gangane N. Impact of counseling on temporarily deferred donor in a tertiary care hospital, central India: A prospective study . Int J Med Public Health 2014;4:400-3 15. Radhiga ST, Kalpana S, Selvakumar and Natarajan MV. Evaluation of Deferral Causes Among Voluntary Blood Donors in Chennai –A Retrospective Study. Int J Med Health Sci. January 2013,Vol-2;(1) 42-47

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report New Bone Formation in Haematological MalignanciesA Novel Observation in A Series of 5 Cases Amita Jain Gupta, Poonam Rani*, Roopal Rathi, Tejinder Singh Department of Pathology, Maulana Azad Medical College, Delhi, India

Keywords: New Bone Formation, Bone Marrow, Haematological Malignancy, Leukemia

ABSTRACT New bone formation in haematological malignancies is rare and its clinical significance is not known. Only very few cases of new bone formation in haematological malignancies have been described however, it is well known in metastatic prostate and breast cancer. Cases of acute megakaryocytic leukemia, primary myelofibrosis and pediatric cases of acute myeloid leukemia have also demonstrated osteosclerosis and have been associated with poor prognosis.

New bone formation is an incidental finding in bone marrow biopsy and an association with cytopenias and fibrosis has been noted. Marrow replacement by new bone aggravates the already existent cytopenias, which occur due to malignant cells replacing the normal hematopoietic precursors.

We describe two cases of acute Leukemia and three cases of Non-Hodgkin Lymphoma with new bone formation evident in bone marrow biopsy with the newly formed woven bone replacing the normal marrow elements.

Pancytopenia was seen in 3 cases and bicytopenia in remaining two cases. Also fibrosis was present in two cases.

New bone formation may be found in hematological malignancies and contributes to pancytopenia and should be searched for. Medications modulating bone metabolism may be evaluated along with the chemotherapy in such patients, as they might increase the rate of remission in the hematological neoplasms. Recognition of bony changes in the marrow due to the leukemia effect per se; and not as a part of generalized bone disease, may prevent a battery of tests and further medication of the patient for bone disease.

*Corresponding author: Dr. Poonam Rani, C-312/B, street no -5, New Usmanpur, Delhi-110053, (INDIA) Phone: +91 9871357125

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Jain Gupta et al.

Introduction

New bone formation and its role has been rarely reported and studied in leukemia/ lymphoma involving the bone marrow. It is a frequent finding in metastasis from prostate and breast cancer. There is lack of knowledge about its implications on the clinical course. Marrow replacement by new bone aggravates the already existent cytopenias, which occur due to malignant cells replacing the normal hematopoietic precursors. We document 5 cases of new bone formation in different hematological malignancies and discuss the implication of this finding.

Case Report(S)

5 cases of different haematological malignancies were found to have new bone formation in bone marrow biopsy, and are described below.

Case 1: A 14 year old male patient presented with complaints of fever since one month, fatigue and weight loss. Abdominal examination revealed hepatosplenomegaly (HSM) (liver 6cm and spleen 7 cm below costal margin).

His hemoglobin was 5g/dl, total leucocyte count was 3000/ mm3, and platelet count 7000/ mm3. On peripheral smear, Red blood cells (RBC) were normocytic normochromic red cells with presence of few macrocytes and 27% blasts having scant cytoplasm, high N/C ratio and 1-2 prominent nucleoli. Bone marrow aspirate (BMA) smears were diluted with peripheral blood however, revealed similar blast cells constituting 81% of marrow nucleated cells. Cytochemistry performed on peripheral blood (PB) as well as bone marrow demonstrated block positivity for Periodic Acid Schiff stain in blasts while they were negative for myeloperoxidase stain. Immunophenotyping was performed on peripheral blood using flow cytometry.

20 % cells with low side scatter and dim CD 45 positivity were gated, corresponding to blast population. Out of gated cells 98% cells showed moderate CD19 and CD 10 expression.(Image1) The blasts were negative for cytoplasmic CD3, cytoplasmic MPO, cytoplasmic CD79a, CD 13, CD2 and CD7. A diagnosis of CALLA positive B cell Acute Lymphoblastic Leukemia(ALL) was given.

Bone marrow biopsy showed complete replacement of marrow by blasts with marked paucity of hematopoietic elements. Also seen were tongues of woven bone invading the marrow spaces. (Image2) Case 2: A 17 year old female presented with pain abdomen and fatigue. On examination patient had pallor and hepatosplenomegaly. Hemogram findings were hemoglobin- 6.3g/dl, total leucocyte count -6930/mm3, platelet count - 90000/mm3. Peripheral smears showed macrocytic blood picture with presence of 5 nucleated RBC / 100 WBC and left shift in myeloid series. Differential www.pacificejournals.com/apalm

C-113 leucocyte count: Myelocytes 6, Metamyelocytes3, Polymorphs 59, Lymphocytes 24, Monocyte 7, Eosinophil 1 %. There were no atypical cells in the peripheral blood.

But, bone marrow aspirate revealed 85% blasts replacing the bone marrow with near total absence of myeloid, erythroid and megakaryocytic series. Blasts had high N/C ratio, coarse nuclear chromatin and indistinct nucleoli.

Blasts showed block positivity for Periodic acid Schiff and were negative for MPO on cytochemistry. The bone marrow was not available in EDTA so flow cytometric analysis could not be performed. Bone marrow biopsy picture was also replaced by blast cells with similar morphology as bone marrow aspirate.(Image3) The immunohistochemical markers were non-contributory. A diagnosis of acute aleukemic leukemia (lymphoid) was given. This case also showed new bone formation and was associated with grade 2 fibrosis.

Case 3: A 50 year old female presented with complaints of fever since 20 days and fatigue. Per-abdominal examination revealed hepatosplenomegaly and multiple abdominal lymph nodes. Hemogram showed bicytopenia (Hemoglobin of 6.2g/dl, Total Leucocyte Count: 4,350/ mm3 and platelet count -60000/ mm3). Red cells were normocytic normochromic with rouleaux formation.

On peripheral smear, differential count was: Atypical cells-6, polymorphs-20, lymphocytes-70, Monocyte-2, Eosinophils-2%. Bone marrow imprint smears were hypercellular and showed sheets of atypical cells, which were large with eccentric nucleus and pale basophilic cytoplasm, open chromatin and occasional 1-2 nucleoli.

There was marked paucity of hematopoietic precursors.

The bone marrow biopsy was hypercellular. Marrow spaces were replaced by diffuse sheets of atypical lymphoid cells with coarse nuclear chromatin and moderate amount of cytoplasm. Other hematopoietic precursors were scanty in number. There was evidence of new bone formation which was laid down over endosteal surfaces of preexisting bony trabeculae like the above cases. (Image4) On immunohistochemistry (IHC), atypical cells were immunoreactive for B cell marker (CD 19) and were negative for T cell marker, anti-myeloperoxidase. The reactive lymphocytes which comprised a small population expressed T cell marker. On the basis of morphological and immunohistochemical findings, the final diagnosis of NonHodgkin lymphoma- B cell type (B-NHL) was made.

Case 4: An eighteen year old patient presented with fever and pallor. Hemogram showed pancytopenia with hemoglobin- 3.2 g/dl, total leucocyte count â&#x20AC;&#x201C; 1230/mm3 and platelet count of 9000/mm3. The differential count showed 5 % atypical cells. Bone marrow aspirate was a dry tap. Bone marrow biopsy was markedly hypercellular eISSN: 2349-6983; pISSN: 2394-6466

New Bone Formation in Haematological Malignancies

C-114 and nearly half of the marrow demonstrated infiltration by monomorphic cells along with marrow fibrosis and focal necrosis. The atypical cells had vesicular nuclei with some cells showing nuclear indentation and were positive for CD19. There was frequent mitosis. Marked paucity of hematopoeitic precursors was noted. This case also showed new bone formation. (Image5) Patient was diagnosed as Non-Hodgkin lymphoma, B cell type.

Case 5: was a 28 year old male patient with weight loss, anorexia and pain abdomen since six months. The spleen was enlarged to 2 cm below costal margin. Peripheral blood examination revealed pancytopenia (Hemoglobin4.2 g/dl, Total Leucocyte Count- 3200/mm3 and Platelet count -30000/mm3. The bone marrow biopsy showed fibrosis and thus aspirate was not possible. There was single cell coagulative necrosis along with few atypical

hyperchromatic monomorphic lymphoid cells in a nodular deposit in the biopsy. No granuloma formation/ Reed Sternberg cell could be identified in the multiple serial sections. There was focal gelatinous marrow transformation along with normal hematopoietic precursors in rest of the marrow spaces. This case also had new bone formation in the form of tongues of osteoid arising from well-formed bony trabeculae. (Image6) Immunohistochemistry was noncontributory. The diagnosis of Non-Hodgkin lymphoma was suggested on the basis of morphology as in the present case the atypical lymphoid cells were present in nodular deposit rather than in diffuse pattern as seen in leukemia.

The bone marrow involvement by lymphoma can be either nodular, diffuse or paratrabecular whereas in cases of acute leukemia the involvement is either paratrabecular or diffuse thus differentiating the present case from acute leukemia.

Image 1 (Case 1): CD10 & CD19 positive blasts on Flow cytometry.

Image3 (Case 2): Blasts in bone marrow aspirate. No blasts identified in peripheral blood. (Giemsa, 200X): Aleukemic leukemia

Image2 (Case 1): Bone marrow biopsy shows new bone formation in case of acute lymphoblastic leukemia. (H&E, 200X)

Image4 (Case 3): Tongues of new bone invading the tumor cells; Non Hodgkin Lymphoma (H&E, 200X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Jain Gupta et al.

C-115

Image5 (Case 4): Bone marrow biopsy showing osteogenesis in Non Hodgkin Lymphoma. (H&E, 200X) TABLE 1: Clinical and hematological findings Case Age Sex HSM Atypical Cells (Years ) In PB(%) 1 14 M + 27 2 17 F + 0 3 4 5

50 18 28

F M M

+ + +

06 05 0

Image 6 (Case 5): New bone formation along with nodular deposit of atypical lymphoid cells in Non Hodgkin Lymphoma. (H&E, 200X)

Atypical Cells In BMA (%) 81 85

Bone marrow biopsy Replaced Replaced

Fibrosis

Diagnosis

_ _

95 80 Dry Tap

Replaced Interstitial Nodular

_ + +

B-ALL Aleukemic leukemia (ALL) NHL-B NHL-B NHL

**NOTE: HSM: Hepatosplenomegaly, PB: Peripheral Blood, BMA: Bone Marrow Aspirate, BMB: Bone Marrow Biopsy, B-ALL: Acute Lymphoblastic Leukemia-B Cell type, NHL-B- Non Hodgkin Lymphoma, B cell type, (+): present, (-): absent

Discussion

Bone metabolism is a dynamic process with ongoning resorption and formation in a delicate balance. It is regulated by various hormones, vitamins and cytokines.

The new bone formed is woven in character and is laid down on the endosteal surfaces of pre-existing trabeculae (appositional growth) or as islands of osteoid within the marrow spaces (intramedullary ossification). In bone marrow, new bone formation occurs frequently in cases of metastasis secondary to carcinoma prostrate, breast, kidney and stomach.[1 ]Documentation of new bone formation in the bone marrow in lymphoid hematological malignancies is sparse. However, osteosclerosis has been found in association with myeloid malignancies like acute megakaryocytic leukemia, primary myelofibrosis and pediatric cases of acute myeloid leukemia.[2,3,4]

a large number of skeletal changes in patients with acute lymphoblastic leukemia including periosteal new bone formation, osteopenia and presence of sclerosis in the skeleton. It was observed that patients with larger number of bony lesions were symptomatic for a longer duration before they presented for chemotherapy and thus these changes need to be detected earlier. The recognition of these changes by treating doctors can lead to earlier diagnosis and initiation of therapy for leukemia.[5] New bone formation is also being implicated as a cause of cytopenias along with already known other causes (leukemic infiltration and marrow fibrosis). Majority of the cases with new bone formation are known to have fibrosis. [2,3,4] Similarly two of our 5 cases (NHL) also had marrow fibrosis.

Five cases of lymphoid malignancies described above are exclusive as new bone formation has been reported rarely in lymphoid leukaemia/lymphoma. Heinrich et al observed

Exact mechanism of bone formation in haematological malignancies is not clearly defined. Bone marrow stromal cells, which play a role in causation of various haematological malignancies, are postulated to have a role in new bone formation in few myeloproliferative

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

New Bone Formation in Haematological Malignancies

C-116 neoplasms. They are activated by various cytokines (PDGF, TGF-β, FGF and VEGF) released by neoplastic cells to synthesize extracellular matrix. Osteoprotegrin and Bone morphogentic protein-1 production in Acute pan-myelosis with myelofibrosis may contribute to increased osteoblastic activity resulting in osteosclerosis.[6] The study of these factors may help in development of targeted therapy for individual patients. Thus, recognition of these findings and investigation of their mechanism are of importance.

neoplasms. More cases should be evaluated for new bone formation and to study its effect on prognosis, if any.

Changes in serum calcium and alkaline phosphatase (ALP) levels can occur owing to the alteration in bone metabolism due to leukaemic cells in various hematological malignancies. Their levels normalize along with restoration of normal cellularity in the marrow treatment.[3] It has been suggested that increased bone formation might lead to hypocalcaemia and hypophosphatemia and this might be induced by leukemic cells. Chemotherapy targeted for the specific leukemia along with calcitriol and etidronate sodium administered to such a patient might resolve the bony changes along with contribution in remission of leukemia.[7]

None

We suggest that recognition of bony changes in the marrow due to the leukemia effect per se; and not as a part of generalized bone disease, may prevent a battery of tests and further medication of the patient for bone disease.

The limitation of our study is that we were not able to follow up these patients to assess prognosis. Further studies need to be taken up for studying the effect of this novel finding on prognosis of patient.

Conclusion

New bone formation in haematological malignancies is rare and its clinical significance is not known. It leads to bone marrow replacement causing cytopenias and aggravating the already non-functional bone marrow due to leukemic infiltration of the cells and fibrosis. A work up of pretreatment and post remission serum calcium, phosphorus, alkaline phosphatase levels and CT scan needs to be done to detect the changes in skeleton. Also, these medications modulating the bone need to be tested if they can increase the rate of remission in the hematological

Acknowledgements None

Funding None

Competing Interests Reference

1. Ibrahim T, Flamini E, Mercatali L, Sacanna E, Serra P, Amadori D. Pathogenesis of osteoblastic bone metastases from prostate cancer. Cancer. 2010 Mar 15; 116 (6):1406-18.

2. Karasick S, Karasick D, Schilling J. Acute megakaryoblastic leukemia (acute “malignant” myelofibrosis): An unusual cause of osteosclerosis.

Skeletal Radiol. 1982. 9:45-6.

3. Ward DE, Fondaw MB, Shroff SK, Reddy VS, Khaled YA. Diffuse osteosclerosis-associated acute myeloid leukemia. J Clin Oncol. 2012 Jan 1;30 (1):e3-4.

4. Diamond T, Smith A, Schnier R, Manoharan A. Syndrome of myelofibrosis and osteosclerosis: A series of case reports and review of the literature.

Bone. 2002; 30:498-501.

5. Heinrich SD, Gallagher D, Warrior R, Phelan K, George VT, MacEwen GD. The prognostic significance of the skeletal manifestations of acute lymphoblastic leukemia of childhood. J Pediatr Orthop.1994 ;14(1):105-11.

6. Tripodo C, Sangaletti S, Piccaluga PP, Prakash S, Franco G, Borrello I et al. The bone marrow stroma in hematological neoplasms--a guilty bystander. Nat Rev Clin Oncol. 2011; 29; 8(8):456-66.

7. Schenkein DP, O’Neill WC, Shapiro J, Miller KB. Accelerated bone formation causing profound hypocalcemia in acute leukemia. Ann Intern Med. 1986;105(3): 375-8.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Case Report A Case Report of Soft Tissue Myoepithelial Carcinoma in The Neck & Post-Auricular Region: A Diagnostic Challenge Shilpi Agarwal1, Gautambir Singh2, Deeksha Singh*1, Preeti Rai1 Department of Pathology, Lady Hardinge Medical College and Smt. Sucheta Kriplani Hospital, Delhi, India Department of Otorhinolaryngology, Lady Hardinge Medical College and Smt. Sucheta Kriplani Hospital, Delhi, India 1

2

Keywords: Soft Tissue; Myoepithelial Carcinoma; Head & Neck; Cytology

ABSTRACT Myoepithelial carcinoma also known as malignant myoepithelioma is a rare aggressive tumor that has been recently described in soft tissue. It is composed exclusively of myoepithelial cells with absence of ductal epithelial structures.

We describe a patient with myoepithelial carcinoma of soft tissue occurring in the head and neck. It poses a diagnostic challenge on Fine needle aspiration cytology (FNAC) due to wide spectrum of myoepithelial cell morphology & lack of established criteria for malignancy. The pathologists should be aware of this entity for early and correct diagnosis. To our knowledge, cytological findings of soft tissue myoepithelial carcinoma have not been reported in the literature so far.

*Corresponding author: Dr. Deeksha Singh, C1/04, Mangal Apartments, Vasundhara Enclave, Delhi 110096, India E-mail: deepshikha.singh293@gmail.com Phone: +91 9811714485

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Soft Tissue Myoepithelial Carcinoma

C-118

Introduction

The World Health Organisation defines myoepthelioma of soft tissue as a rare tumour composed exclusively of myoepithelial cells in solid, trabecular, myxoid or reticular growth pattern.[1] The tumour cells vary from spindle to plasmacytoid, epithelioid, and clear cells, which have immunohistochemical and electron-microscopic features of myoepithelial differentiation.[1,2] Only 15% of the soft tissue myoepithelial tumors occur in the head and neck region, usually located in the subcutaneous tissue while less than 30% occur in the deep soft tissue.[3] It has been postulated that soft tissue myoepitheliomas arise from deep seated adnexal structures.[4]

Case Report

A 48 yrs female presented with two rapidly enlarging masses in the head & neck region. The midline neck mass, measuring 10 x 8 x 8cm, was present since 5 months.

Overlying skin was focally ulcerated. A scar of previous surgery; done one year back for midline neck mass was seen; of which no documents were available. The postauricular mass, measuring 4 x 3cm was present since 3 months. The ultrasound (USG) neck was suggestive of carcinoma thyroid & FNAC (from outside) was reported as poorly differentiated carcinoma, thyroid.

We performed FNAC from both the masses from multiple sites which revealed similar morphology. The smears were highly cellular predominantly showing spindle shaped cells mixed with some plasmacytoid cells arranged singly, in small groups as well as three-dimensional tissue fragments showing nuclear overlapping and crowding.

Abundant pink material (possibly amyloid) and myxoid stroma were also seen intermixed with these neoplastic cells. The spindle cells had scant delicate pale cytoplasm having ill-defined borders, oval to spindle shaped nuclei with moderate anisonucleosis, uniformly distributed fine chromatin & inconspicuous nucleoli [Figure 1(a)].

The plasmacytoid cells were monotonous with moderate amounts of dense non-granular eosinophilic to clear cytoplasm having well-defined borders, round to oval eccentrically located nucleus with moderate anisonucleosis uniformly distributed fine chromatin with few cells showing prominent nucleoli [Figure 1(b)]. Occasional binucleated cells & mitotic figures were identified. No normal thyroid or salivary gland tissue was seen.

In view of the cytological findings & USG neck report, possibility of Medullary Carcinoma, thyroid was considered and the serum calcitonin level was done which came out to be normal. Therefore, CECT neck was advised.

The CECT neck revealed well-defined, heterogenously enhancing, soft tissue density masses in subcutaneous plane in neck & post-auricular region separate from thyroid & salivary glands, along with lytic lesions in cervical vertebrae & upper lobes of bilateral lungs suggestive of malignant lesion.

In view of heterogenous cytomorphology of neoplastic cells and CECT report, various differential diagnoses of soft tissue malignancy having spindle & plasmacytoid cells were considered. Epithelioid MPNST was ruled out by the absence of nuclear palisading, macronucleoli & rhabdoid cells. Epithelioid Sarcoma was ruled out due to lack of pleomorphic nuclei, prominent nucleoli & necrosis. Cutaneous Leiomyosarcoma was excluded by the absence of cigar shaped hyperchromatic nucleus & fibrillary eosinophilic cytoplasm. Moreover, it rarely shows hyalinisation & myxoid change. Amelanotic melanoma was excluded by the absence of hyperchromatic nuclei with prominent nucleoli / intranuclear inclusions.

Parachordoma shows spindle to epithelioid cells, with abundant clear, vacuolated cytoplasm. Metastatic sarcomatoid carcinoma generally shows epithelial tumor cells with hyperchromatic nuclei, prominent nucleoli, and a high nuclear to cytoplasmic ratio. Hence, a cytological diagnosis of Myoepithelial carcinoma of soft tissue was suggested and urgent excisison was advised.

Both masses were resected. The midline neck mass measured 10 x 8 x 8cm and the post-auricular mass measured 4 x 3cm. Both the masses were skin covered, solid, well circumscribed, multinodular, grey-white, firm with foci of hemorrhage, necrosis & myxoid change.

Histopathogical examination of both the masses showed well circumscribed, multinodular tumor located in the dermis & subcutaneous tissue, separated by fibrous septa.

The tumor was composed predominantly of spindle cells arranged in fascicles & reticular pattern along with nests of plasmacytoid cells. Extensive hyalinisation with foci of necrosis & myxoid change were also seen. The neoplastic cells had moderate amount of eosinophilic to clear cytoplasm, moderate anisonuleosis, vesicular chromatin & 0-1 nucleoli and 2-4 mitosis/HPF [Figure 2].

Immunohistochemically, the tumor cells were positive for pan-cytokeratin, vimentin, smooth muscle actin, calponin, CD10 & S-100 [Figure 3]. While EMA, desmin, myogenin, HMB45, BCL2 & CD34 were negative. Thus, confirming the diagnosis of myoepithelial carcinoma of soft tissue.

Discussion

The myoepithelial tumors are common in salivary gland (1.5%),[5] and rarely occur in extrasalivary locations, such

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Agarwal et al.

C-119

Fig. 1: FNAC smears of neck mass showing (a) spindle shaped cells (Papanicolaou, 400x) & (b) plasmacytoid cells (H&E, 400x)

Fig. 2: The tumor revealed (a) fascicles of spindle shaped cells [H&E, 400x] (b) nests of plasmacytoid cells with frequent mitoses (arrow) [H&E, 400x]

Fig. 3: The tumor cells showing positivity for (a) Calponin [400x] & (b) Pan-cytokeratin (focal) [400x]

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Soft Tissue Myoepithelial Carcinoma

C-120 as soft tissue.[2-4,6,7] Myoepithelial carcinoma is usually diagnosed in third to fifth decade.[8] Approximately 40% of all soft tissue myoepithelial tumours are malignant.[3] Preoperative cytological diagnosis of soft tissue myoepithelial carcinoma with diverse cytomorphology is difficult, as it may be mistaken for soft tissue tumor.

[6] On cytology, Darvishian F et al and Chhieng DC et al described that nuclear pleomorphism, coarse chromatin, prominent nucleoli, mitosis & necrosis were seen exclusively; however not always, in malignant myoepithelial lesions.[9,10] Hornick and Fletcher et al suggested that even moderate cytological atypia such as prominent nucleoli, vesicular or coarse chromatin & pleomorphism in soft tissue myoepithelioma should be regarded as myoepithelial carcinoma.[3] Histologically, an infiltrative growth pattern is insufficient to diagnose soft tissue myoepithelial carcinoma.[3,7] Moderate to severe nuclear atypia is the only reliable criteria for malignancy.

[1] Treatment includes wide surgical excision with lymph node dissection & radiotherapy.[2,8]

Conclusion

Bridge J. WHO classification of tumours of soft tissue & bone. 4th edition. Geneva: WHO Press; 2013: 368-9.

2. Neto AG, Pineda-Daboin K, Luna MA. Myoepithelioma of the soft tissue of the head and neck: a case report and a review of the literature. Head Neck. 2004; 26: 470-3.

3. Hornick JL, Fletcher CDM. Myoepithelial tumors of soft tissue. A clinicopathologic and immunohistochemical study of 101 cases with evaluation of prognostic parameters. Am J Surg Pathol. 2003; 27: 1183–96.

4. Kilpatrick SE, Hitchcock MG, Kraus MD, Calonje E, Fletcher CDM. Mixed tumors and myoepitheliomas of soft tissue: a clinicopathologic study of 19 cases with a unifying concept. Am J Surg Pathol. 1997; 21: 13-22.

5. Ellis GL, Auclair PL. Tumors of the salivary glands.

In: Atlas of Tumor Pathology. 3rd edition. Washington, D.C.: Armed Forces Institute of Pathology; 1996: 17-68.

6. Park SJ, Kim AR, Gu MJ, Choi JH, Shin JH. Imprint Cytology of Soft Tissue Myoepithelioma: A Case Study. Korean J Pathol. 2013; 47: 299-303.

Myoepithelial carcinoma should be considered in the differential diagnosis of soft tissue epithelioid and spindle cell neoplasms. Histopathology & immunohistochemistry are essential for unequivocal diagnosis.

7. Serry P, Van der Vorst S, Weynand B, Ledeghen S, Rombaux P, Machiels JP, et al. Aggressive soft tissue myoepithelial carcinoma in the neck: A case report.

Oral Oncol. 2006; 42: 295– 299.

Acknowledgements

8. Franchi A, Palomba A, Roselli G, Gambini C, Beltrami G, Capanna R, et al. Primary juxtacortical myoepithelioma/mixed tumor of the bone: a report of 3 cases with clinicopathologic, immunohistochemical, ultrastructural, and molecular characterization. Hum Pathol. 2013; 44: 566–77.

None

Funding None

Competing Interests None declared.

References

1. Fletcher CDM, Antonescu CR, Heim S, Hornick JL. Myoepithelioma/Myoepithelial carcinoma/Mixed tumor. In: Fletcher CDM, Hogendoorn, Mertens F,

9. Farbod Darvishian, Oscar Lin. Myoepithelial CellRich Neoplasms: Cytologic Features of Benign and Malignant Lesions. Cancer. 2004; 102: 355-61.

10. Chhieng DC, Paulino AF. Cytology of myoepithelial carcinoma of the salivary gland. Cancer. 2002; 96: 32–36.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Case Report Primary Squamous Cell Carcinoma of Renal Pelvis: A Masquerade Jasvinder Kaur Bhatia*1, Samir Gupta2, Sunil Julmaria3 Department of Pathology, Armed Forces Medical college Pune, India Department of Adv Surgery & Oncosurgery Command Hospital Western Command, Chandimandir, India 3 Department of Surgery, Command Hospital Western Command , Chandimandir, India 1

2

Keywords: Renal Pelvis, Squamous Cell Carcinoma, Urothelial Carcinoma

ABSTRACT Squamous cell carcinoma (SCC) of the renal pelvis is a rare tumour with myriad of presentations. We report a case who presented with perinephric abscess and diagnosis of Squamous cell carcinoma was made only after histopathologicalexamination. Case is being reported to highlight the unusual presentation of this very rare neoplasm and stress the importance of high degree of suspicion of squamous cell carcinoma of renal pelvis in cases of nephrolithiasis who present with loin pain and a suspicion of perinephric abscess. Squamous cell carcinoma of the renal pelvis is a masquerader which can present in any form and must be considered in the differentials in patients who have a history of renal stones and present with vague symptoms.

*Corresponding author: Dr Jasvinder Kaur Bhatia, Department of Pathology, Armed Forces Medical College, Pune-40, India.

E-mail: drjkbhatia@gmail.com Phone: +91 8552825142

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Squamous Cell Carcinoma of Renal Pelvis

C-122

Introduction

Squamous cell carcinoma (SCC) of the renal pelvis is a rare tumour with myriad of presentations. We report a case who presented with perinephric abscess and abscess was drained in a peripheral hospital. Squamous cell carcinoma was diagnosed by histopathological examination of the excised necrosed tissue and nephrectomy specimen. She also gave a history of nephrolithiasis in the past. Case is being reported to highlight the unusual presentation of this very rare neoplasm and stress the importance of high degree of suspicion in cases of nephrolithiasis who present with loin pain and perinephric abscess.

the perinephric and pelvic fat. The tumour was excised piecemeal. Postoperative period was uneventful.

Microscopic examination of hematoxylin and eosin stained sections showed well differentiated squamous cell carcinoma involving the kidney, pelvis and extending to the perinephric fat. There were keratin pearls and individual cell keratinization. Large areas of necrosis were seen.

Extensive sampling did not reveal associated urothelial carcinoma (Fig1,2).The tumour was seen infiltrating the renal capsule and perirenal fat. No lymphovascular invasion was seen. Large areas of necrosis werenoted.

Case Report

A 50 year old female presented with 3 month history of loin pain,low grade intermittent fever of twomonth duration and burning micturition on and off of one month duration.

She had been operated for left renal calculus 8 years back.

She had also been operated and had undergone abdominal hysterectomy eight years back for fibroid uterus. She was a hypertensive on anti-hypertensives and a diabetic on medication. She was initially managed at a peripheral hospital where ultrasonography (USG) of the abdomen revealed nephrolithiasis left kidney with large renal abscess with perinephric and subcutaneous extension and (Rt) mild hydroureteronephrosis with (Rt) ureterocele.?

Emphysematouspyelonephritis/neoplastic pathology.

Fig. 1. Photomicrograph (H&E, X100) showing well differentiated squamous cell carcinoma of renal pelvis.

Incision and drainage along with excision of necrotic tissue was done atthe peripheral center however she started discharging pus from the wound and was referred to our hospital. Her routine hematological and biochemical investigations were within normal limits. Urine examination showed few pus cells (<3/hpf) Histopathological examination of necrosed perinephric tissue revealed well differentiated squamous cell carcinoma.

CECT Abdomen and Pelvis revealed 10x9.3x6.5 cm sized, solid, isodense (28-35 HU), heterogeneously enhancing (48-69 HU), focal mass seen arising from superior pole of the left kidney suggestive of Renal Cell Carcinoma. This mass was seen to infiltrate the posterior perinephric space and posterior renal fascia and psoas muscle. There was no evidence of left renal vein involvement. Lt(T3NoMx) Left radical nephrectomy was done. Per-operatively, there was 20x20cm irregular and necrotic mass which was seen to be infiltrating the posterior abdominal wall, diaphragm and skin posteriorly. Gross examination showed an irregular grey white tumour measuring 10x9.7x9cm, distorting the architecture of the kidney involving the renal parenchyma and extending to pelvis, and infiltrating

Fig. 2. Photomicrograph (H&E, X400) showing individual cell keratinisation and keratin pearls

Discussion

Primary squamous cell carcinoma of the renal pelvis is a rare tumour and comprises less than 1% of urinary tract neoplasms. It is postulated that SCC arises due to squamous metaplasia of the urothelium.[1,2] Renal calculi, infection, exogenous and endogenous chemicals, smoking, vitamin A deficiency, hormonal factors and schistosomiasis have been incriminated in causing squamous metaplasia.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Kaur Bhatia et al.

C-123

Association with renal calculi has been reported to be 87-100% in various studies. Squamous cell carcinoma has also been found to be associated with chronic pyelonephritis, transplanted kidney with chronic rejection, phenacetinabuse, and tuberculosis.[4] [3]

It is very difficult to differentiate SCC from other conditions and tumours of the kidney by radio imaging and may lead to diagnostic dilemma as in this case.Histopathology is the mainstay of diagnosis in these cases.

In a study, it was found that squamous cell carcinoma presents in pTa/T1/T2 stage in only 4% of the cases.

Overall survival in these patients is inferior to patients with transitional cell carcinoma. However, No difference was found in prognosis between urothelial carcinoma and squamous cell carcinoma stage for stage.[5,6] Generally these tumours are moderately to poorly differentiated and are aggressive[5], but our case was unusual as this tumour was well differentiated with presence of individual cell keratinization and keratin pearls.

Primary squamous cell carcinomas of the renal pelvis arising from the superior pole of the kidney are rare but have been reported.[7] One of the main differentials is Urothelial Carcinoma with squamous differentiation. Squamous differentiation, defined by the presence of intercellular bridges or keratinization, occurs in 21% of urothelial carcinomas of the bladder, and in 44% of tumours of the renal pelvis.[8] The diagnosis of squamous cell carcinoma is reserved for pure lesions without any associated urothelial component, including urothelial carcinoma in situ. Cases which have associated urothelial carcinoma are diagnosed as urothelial carcinoma with squamous differentiation.9] Therefore extensive sampling is required to rule out urothelialcarcinoma with squamous differentiation. This tumour was purely well differentiated squamous cell carcinoma.

Extensive sampling of the tumour revealed squamous metaplasia of the transitional epithelium (Fig 3). This finding rules out metastatic squamous cell carcinoma and primary squamous cell carcinoma of the kidney.

Conclusion

In conclusion, SCC of renal pelvis is a rare tumour associated with renal stones. Patients may present with vague symptoms like loin pain. A high degree of suspicion, including history of renal calculi, supplemented by radioimaging CT may help in diagnosing this tumour. It www.pacificejournals.com/apalm

Fig. 3: Photomicrograph (H&E, X100) of the renal pelvis showing transitional epithelium in the lower part and invasive squamous cell carcinoma in the upper part.

is also important to rule out urothelial carcinoma with squamous differentiation. Exact cause of this tumour is not known, however as it is known in patients of renal calculi , close follow up of these individuals is warranted.

Acknowledgements Nil

Funding None

Competing Interests None declared

References

1. Kalayci OT, Bozdag Z, Sonmezgoz F, Sahin N. Squamous cell carcinoma of the renal pelvis associated with kidney stones: radiologic imaging features with gross and histopathological correlation. J Clin Imaging Sci. 2013 Jan;3:14.

2. Sivaramakrishna B, Aron M, Ansari MS, Seth A, Goel R, Mundada OP, et al. Squamous cell carcinoma of the renal pelvis manifesting after percutaneous nephrolithotomy for long standing calculus.

International Urology & Nephrology. 36(2):149151, 2004.

3. Tyagi N, Sharma S, Tyagi SP, Maheshwari V, Nath P, Asharf SM, et al. A histomorphologic and ultrastructural study of the malignant tumors of the renal pelvis. J Postgrad Med 1993;39:197-201 4. Kamonchanok J, Chutintorn S. Squamous Cell Carcinoma of the Renal Pelvis as a Result of LongStanding Staghorn Calculi. Case Rep Oncol. 2015 Sep-Dec; 8(3): 399â&#x20AC;&#x201C;404.

eISSN: 2349-6983; pISSN: 2394-6466

Squamous Cell Carcinoma of Renal Pelvis

C-124 5. Holmäng S, Lele SM, Johansson SL. Squamous cell carcinoma of the renal pelvis and ureter: incidence, symptoms, treatment and outcome. J Urol.

2007;178:51–6.

6. David B, Tina R , Sherry W, Anthony M , Joseph R, Geral C.survival of patients with squamous cell Malignancies of the Upper Urinary Tract.Clinical Medicine Insights: Oncology 2012:6 11–18.

7. Murugappan N, Manjusha ML, Varun GP, NavilS, Aditya N. Squamous Cell Carcinoma of the Renal Pelvis, A Rare Site for a Commonly Known

Malignancy. Journal of Clinical and Diagnostic Research. 2016 Jan, Vol-10(1): PD04-PD06 8. Eble J.N., Sauter G., Epstein J.I., Sesterhenn I.A. (Eds.): WHO Classification of Tumours. Pathology and Genetics of Tumours of the Urinary System and Male Genital Organs. Lyon IARC Press: 2004.89-158 9. Reuter VE. The urothelial tract: Renal pelvis, ureter, urinary bladder and urethra. In: Mills SE, Carter D, Greenson JK, Oberman HA, Reuter V, Stoler MH, editors. Sternberg’s Diagnostic Surgical Pathology, 4 th ed. Philadelphia: Lippincott Williams and Wilkins; 2004. 2058-9

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Case Report Wilms tumour with neural differentiation: A rare histological presentation Ritika Singh*, Leelawathi Dawson, A.K. Mandal Department of Pathology Vardhaman Mahavir Medical College & Safdarjung Hospital, Delhi, India Keywords: Wilm’s Tumor, Neural Differentiation,WT1, Synaptophysin.

ABSTRACT Wilm’s tumour is the most common malignant renal tumour of childhood presenting most commonly between the age groups of 1 to 6 years. It exhibits histogenetic heterogeneity. A 4 year old female child presented with complaints of right abdominal pain and mass per abdomen for the past six months .The patient underwent right sided nephrectomy and the specimen was sent for histopathological examination .Cut surface of the tumour was variegated with extensive areas of necrosis and haemorrhage On microscopy the tumour cells were predominantly blastematous , arranged as diffuse sheets of tumor cells with focal nesting pattern in some areas. Tumour cells showed diffuse anaplasia.

These tumour cells showed positivity for WT1 ,vimentin, synaptophysin and p53. No evidence of any epithelial or stromal differentiation was noted. Findings suggested a diagnosis of monophasic variant( blastemal) Wilm’s tumor with neural differentiation.

*Corresponding author: Ritika Singh, F- 6 Police Station, Chanakya Puri, New Delhi 110021.

E-mail: ritika84singh@gmail.com Phone: +91 9958492397

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Wilms Tumour with Neural Differentiation

C-126

Introduction

Wilm’s tumour is the most common malignant renal tumour of childhood. It presents most commonly between the age groups of 1 to 6 years.[1] It is a complex embryonal tumour arising from metanephric blastema . Neural differentiation in Wilm’s tumor suggests a possible histogenetic heterogeneity.[2] The present case reported highlights a rare occurence of neural differentiation in Wilm’s tumor.

Case Report

A 4 year old female child presented with complaints of right side abdominal pain for the last two years. Abdominal examination revealed a solid right hypochondrial and lumbar mass. The child had no other physical abnormality.

Family history did not yield any contributory finding.

Computed tomography scan performed revealed a large mass with heterogenous density nearly replacing the right kidney sparing the peripheral lower pole. The other kidney showed no abnormality.

No evidence of metastasis was present.

The patient underwent right sided nephrectomy and the specimen was sent for histopathological examination.

Gross Examination: The nephrectomy specimen submitted measured 12x9x8 cms and weighed 500grams(Figure 1a). It’s external surface was bosselated , encapsulated and severely congested. Cut surface showed a grey-tan

tumour with extensive areas of necrosis and haemorrhage measuring 12x7x7 cms replacing almost the entire renal parenchyma and extending into the perinephric fat ,renal pelvis and renal sinus with only a peripheral rim of normal renal parenchyma. The attached ureter measures 1.5 cms in length.

Microscopic Examination: Microscopic examination showed a diffuse arrangement of predominantly blastemal tumour cells arranged in sheets(Figure 1b) with focal nesting pattern seen in some areas .These cells were small, closely packed cells with a high nuclear-to-cytoplasmic ratio and indistinct cytoplasmic borders. Their nuclei showed moderate to severe degree of pleomorphism .Diffuse anaplasia was noted with extensive areas of necrosis and hemorrhage. Mitotic activity was frequent with atypical mitotic figures . No evidence of differentiation toward epithelial or stromal cell types was noted on light microscopic .Tumor was seen to infiltrate the renal sinus,perinephric fat and renal capsule.Cut end of ureter was free of tumour.

Immunohistochemistry: Immunohistochemical study done showed tumour cells showing positivity for WT1(95% of tumour) vimentin, synaptophysin (40% of tumour) and p53 and negative for cytokeratin and LCA, S100,GFAP,CD99,chromogranin and N.S.E, myogenin.

(Figure2a,2b) A histological diagnosis of monophasic variant of nephroblastoma (blastemal predominant)with neural differentiation was rendered.

Fig. 1. a. Nephrectomy specimen showing a variegated tumor replacing almost entire renal parenchyma with areas of hemorrhage and necrosis. b. Microscopy showing sheets of blastematous tumor cells with predominantly diffuse and focal nesting pattern with diffuse anaplasia .(H&E 40X).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Singh et al.

C-127

Fig. 2. a.Diffuse WT1 nuclear positivity expressed by tumour cells (IHC 40X) ,inset showing WT1 positive tumour with adjacent renal parenchyma.b.Tumor cells showing cytoplasmic positivity for synaptophysin (IHC 40 X).

Discussion

Wilm’s tumor (WT) is a histologically diverse tumor . It is derived from nephrogenic blastemal cells and can exhibit a wide range of histologic appearances that replicate the developing kidney. However aberrant differentiation of the metanephrogenic blastema may lead to heterologous differentiation of Wilm’s tumour[3].

[1]

Specific genetic loci have been implicated in Wilm’ tumorigenesis including the WT1 tumor suppressor gene at chromosome 11p13, WT2 at chromosome 11p15,and loci at chromosomes 1p13 and 16q[4] .

Wilm’s tumor (WT) tumour typically exhibits a triphasic differentiation. In blastemal predominant WT light microscopy reveals small, round or oval cells, which are densely packed in diffuse or nested patterns. WTs do not exhibit a specific immunophenotype. The blastemal component is typically reactive for vimentin and usually shows desmin reactivity and shows nuclear positivity for WT1 in the blastemal predominant tumor cells . [5] This histologic pattern alone is most likely to cause diagnostic difficulty especially in small biopsies as it simulates many other small round cell neoplasms .[6] The differential diagnosis includes lymphoma, Ewing’s sarcoma/peripheral neuroectodermal tumor(EWS/PNET), rhabdomyosarcoma(RMS) and desmoplastic small round cell tumour(DSRCT).[7]

the present case the blastematous tumour cells expressed WT1 along with vimentin and synaptophysin.The absence of CD99, N.S.E ,CD45,myogenin expression in tumour cells and presence of nuclear positivity of WT1 helped to distinguish blastemal predominant WT from ‘s Ewing’s sarcoma (EWS) /PNET, lymphoma, rhabdomyosarcoma.[7] The present case can be differentiated from desmoplastic small round cell tumour by histological findings which reveals clusters of small to medium sized cells with hyperchromatic nuclei and increased nuclear/cytoplasm ratio, surrounded by a dense desmoplastic stroma. [9] Immunohistochemical findings suggest a trilinear coexpression including the epithelial marker keratin, the mesenchymal markers desmin and vimentin.[10] The role of neural differentiation in renal tumorigenesis was well described and theorized by Pierre Masson,who had postulated that Wilms tumors (or “embryonal adenosarcomas”)arose from the neural crest[11]. However the metanephrogenic blastema theory may account for the origin of the cells found in most cases of Wilm’s tumor suggesting the capability of these tumor cells towards multidirectional differentiation[3].

WT are distinguished from the above mentioned differential diagnosis by the presence of nephrogenic tissue as a major component and with immunohistochemical analysis.[8] In

Neural elements such as glial tissue, pseudorosettes, primitive neuroblastema, ganglion cells, and neuroendocrine cells have been described previously in Wilm’s tumour [8]but in the present study no stromal differentiation towards any of these elements was noted .The tumor cells showed focal nesting pattern which has been described in blastematous areas of Wilm’s tumour[12].

Neural differentiation in WT has been also associated with

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Wilms Tumour with Neural Differentiation

C-128 reactivity for chromogranin, and synaptophysin along with WT1 but staining for S -100 and glial fibrillary acidic protein protein (GFAP) has been found to be variable. [1,13] Orazzi et al in 1988 described neuroendocrine differentiation in Wilms tumor in which 90% of the blastematous cells showed strong positivity for Grimelius stain along with immunohistochemistry showing NSE, vimentin and low molecular weight cytokeratins and electron microscopy also favouring the same.[14] In the present case also histology is not conclusive to point out neural differentiation in the blastematous WT cells and only by immunohistochemical analysis synaptophysin expression in tumor cells were confirmed.

Neural differentiation in WT needs to be differentiated from other renal tumors such as primary renal teratoma and anaplastic sarcoma of the kidney (ASK),and malignant ectomesenchymoma (MEM)[15]. Primary renal teratomas also show heterotopic organogenesis such as skin adnexa, intestinal mucosal epithelium, and neuroglial tissue .[2] MEMs are characterized by both neuroectodermal (neuroblastoma, ganglioneuroblastoma, ganglioneuroma, peripheral primitive neuroectodermal tumor) and mesenchymal components (usually rhabdomyosarcoma) [16] .ASK are composed of small primitive mesenchymal cells coexisting with a spindle cell component exhibiting anaplastic nuclear changes .[17]

Acknowledgements Nil

Funding None

Competing Interests None

Refrences

1. Hussong JW, Perkins SL, Huff V, et al. Familial Wilms’ tumor with neural elements: characterization by histology, immunohistochemistry, and genetic analysis. Pediatr Dev Pathol.2000;3:561-567.

2. Beckwith JB: Wilm’s tumour and renal tumors of childhood: a selective review from the National Wilms’ Tumor Study Pathology Center. Hum Pathol.

14: 481-492, 1983.

3. Osterheld et al: Role of DNA Ploidy and Immunohistochemistry in Wilms’ Tumours Adverse prognosis. Anticancer Research .2008.28: 751-756.

4. Perlman E, Grosfeld JL, Togashi K, Boccon-Gibod L. Pathology and Genetics of Tumors of the Urinary System and Male GenitalOrgans. In: Eble JN, Sauter G, Epstein JI, Sesterhenn IA, eds.World Health Organization Classification of Tumours. Lyon,France: IARC Press; 2004:48-52.

Presence of larger areas with blastema-like cells, positive immunohistochemical staining of WT-1 in the blastemalike foci along with synaptophysin expression in the tumour cells favoured the diagnosis of Wilm’s tumor with neural differentiation and was not reported in the latter mentioned lesions.

5. Folpe AL, Patterson K, Gown AM. Antibodies to desmin identify the blastemal component of nephroblastoma. Mod Pathol.1997;10:895-900.

In the present case as theWT1 and synaptophysin positive WT showed predominantly diffuse blastemal predominant ,it was associated with marked aggressiveness, but with a high survival rate due to the good response to chemotherapy as reported by Beckwith [18].

7. Gregorio A, Corrias MV, Castriconi R, Dondero A. Small round blue cell tumours: diagnostic and prognostic usefulness of the expression of B7-H3 surface molecule. Histopathology. 2008 Jul; 53(1): 73–80.

However there is a need for further evaluation of these tumour cells by electron microscopic analysis and cytogenetic analysis to know the debatable origin of neural expression in blastemal predominant Wilm’s tumour .

8. Harbitz F: Sind einige der sogennanten ‘adenosarcome’ in dennieren in Wierlich Neuroblastome?

Acta Pathol Microbiol Immunol Scand. 1932: 9: 199.

Conclusion

The present case reported highlights a rare histological variant of Wilm’s tumor and emphasizes the ability of nephroblastoma tumor cells for a multidirectional differentiation.

6. Meis-Kindblom JM, Stenman G, Kindblom LG. Differential diagnosis of small round cell tumors.

Semin. Diagn. Pathol. 1996;13:213–241.

9. Amato R.J., Ellerhorst J.A., Ayala A.G. Intraabdominal desmoplastic small round cell tumor: report and discussion of five cases. Cancer. 1996;78(4):845–851.

10. Gerald WL., Rosai J. Desmoplastic small round cell tumor with multi-phenotypic differentiation. Zentralbl Pathol. 1993;139:141–151.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Singh et al.

C-129

11. Masson P. The role of neural crests in the embryonal adenosarcoma of the kidney. Am I Cancer. 1938: 33: 1-32.

12. Argani P, Beckwith BJ. Renal Neoplasms of Childhood.In: Mills SE, editors. Sternberg’s Diagnostic Surgical Pathology. Lippincott Williams & Wilkins;2010.1804-1805.

13. Magee F, Mah RG, Taylor GP, Dimmick JE. Neural differentiation in Wilms’ tumor. Hum Pathol. 1987; 18: 33-37.

14. Orazi A, Lombardi L, Trumper L, Cattoretti G, Ballerini E. Nephroblastoma with neuroendocrine differentiation.Tumori .1989;75(2):171-6.

15. Seo J, Suh YL, Choi HY. Adult teratoid Wilms’ tumor with prominent neuroepithelial differentiation. Pathol Int. 2009; 59 (1): 44-48.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

16. Kösem M, Ýbiloðlu Y, Bakan V, Köseoðlu B. Ectomesenchymoma: case report and review of the literature. Turk J Pediatr. 2004;46: 82-87.

17. Labanaris AP, Zugor V, Smiszek R, Nützel R, Kühn R. Anaplastic sarcoma of the kidney. The Scientific World Journal. 2009; 9:97-101.

18. Beckwith JB, Zuppan CE, Browning NG, et al. Histological analysis of aggressiveness and responsiveness in Wilms’ tumor. Med Pediatr Oncol 1996;27:422-8.

Case Report Rare Presentation of Medullary Carcinoma of Thyroid with Predominant Spindle Cell Pattern & abundant Calcification Abhijit Das1, Namrata Nargotra*1, Sompal Singh1, Rakesh Kumar Deepak2, Ila Tyagi1 Department of Pathology, North Delhi Municipal Corporation Medical College & Hindu Rao Hospital, Delhi 2 All India Institute Of Medical Sciences, New Delhi

1

Keywords: Medullary Carcinoma Thyroid, C Cells, Spindle Cell Morphology, Calcification.

ABSTRACT Medullary carcinoma thyroid (MTC) is a malignant tumour showing C-cell differentiation. It accounts for 10% of all thyroid malignancies. Many histological variants have been described in literatures. Among them most predominant one is the classical variant, comprising almost one third of all. Predominantly spindle cell pattern is seen very rarely.

MTCs are mostly seen in middle aged patient. It is rarely seen in second decade except familial type. Here we present a case of MTC with predominant spindle cell morphology & abundant calcification in a 19 years old female patient.

*Corresponding author: Dr. Namrata Nargotra, C/O Lt. Gen Amit Sarin11, BR Mehta Lane Kasturba Gandhi Marg (near India Gate) New Delhi 110001, India E-mail: drnamrata50@gmail.com Phone: +91 9971210566

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Das et al.

C-131

Introduction

Thyroid cancers account for 1% of all cancer cases, whereas MTS comprises of 10% of all thyroid malignancies.[1,2] It occurs in all age groups, mostly seen in middle aged patient with a female predominance. It is seen less commonly in second decade of life. Though MTC is a rare tumour, it shows wide varieties of morphological patterns.[3] Most common pattern encountered is the classical pattern where it shows sheets of round to polygonal cells with neuroendocrine features, separated by hyalinised fibrous stroma sometimes containing amyloid. Pure spindle cell pattern occurs less commonly.[4] Calcification in MTCs is also seen rarely.[4] Here we report a case of MTC in a younger female patient in which we showed predominantly spindle cell pattern along with ample amount of calcification both cytologically & histologically.

Case Report

A 19 years old female patient presented with gradually increasing, tender, midline neck swelling of 2 years duration, which was initially small in size. On clinical examination, patient was conscious & oriented. Swelling was diffuse & firm, moving with deglutition. Family history was negative. Biochemical examination showed mild raised calcitonin level (8.9 mg/dl) & normal serum parathormone level. Thyroid function test was within normal range. Computed tomography of neck & FNAC were advised. Imaging revealed a thyroid mass. Cytosmears showed predominantly spindle cell population arranged in groups as well as singly scattered, mostly monomorphic spindle to oval nuclei showed granular type of chromatin (Fig 1, 2). Focally amyloid material was also noted. On cytology medullary carcinoma of thyroid was suggested.

Near total thyroidectomy was performed & the specimen

was sent for histopathological examination. Grossly thyroid gland was slightly enlarged (left lobe- 6x4x3.5 cm, right lobe- 6.5x4x3.5 cm & isthmus- 2x1.5x1 cm).

Externally capsule was intact. Cut sections of both lobes showed a bilateral, multifocal, circumscribed gray white tumour measuring 3.5x2x2 cm in left lobe & 3.5x2.5x2 cm in right lobe (Fig 3). On histological examination, tumour showed predominantly monomorphic spindle cell pattern, arranged in small nests, sheets as well as in short fascicles, separated by thin fibrovascular septa. Tumour cells showed oval to spindle nuclei with granular chromatin & moderate amount of granular eosinophilic cytoplasm (Fig 4, 5).

Abundant eosinophilic amyloid material & large areas of calcification were also identified (Fig 6 & 7). Rest of the thyroid parenchyma showed adenomatous changes. C-cell hyperplasia, vascular invasion were not seen. Tumour cells were strongly positive for calcitonin & carcinoembryonic antigen (Fig 8, 9). Final diagnosis of medullary carcinoma of thyroid with abundant calcification was given. After a follow up of 5 months, patient is doing well & completely asymptomatic.

Discussion

Medullary carcinoma of thyroid was first described

by Hazard et al.[5] It accounts for 10% of all thyroid malignancies.[1,6] Around 20% of MTCs are associated with autosomal dominant inherited MEN (multiple endocrine neoplasia) syndromes (specially MEN 2A & 2B), while rest 80% cases are sporadic. MTCs affect patients of wide age ranges. Familial MTCs occur at an earlier age, while sporadic MTCs at a later stage. Patients usually present with a painless thyroid mass, which is mostly bilateral or multicentric in familial cases & unilateral in sporadic cases.

[7] Our patient was 19 years old, presented with gradually

Fig. 1: Cytosmear shows predominantly spindle cell population arranged in groups as well as singly scattered (Giemsa, 40X).

Fig 2: Cytosmear shows monomorphic spindle to oval nuclei with granular type of chromatin (Giemsa, 400X).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Thyroid Medullary Carcinoma with Spindle Cell Pattern

C-132

Fig. 3: Cut sections of both lobes showed a bilateral, circumscribed gray white tumour.

Fig 6: Microsection showing large areas of calcification (H&E, 100X).

Fig. 4: Tumour cells showed oval to spindle nuclei with granular chromatin & moderate amount of granular eosinophilic cytoplasm (H&E, 100X).

Fig 7: Abundant eosinophilic amyloid material & areas of calcification (H&E, 200X).

Fig 5: Tumour cells showed oval to spindle nuclei with granular chromatin & moderate amount of granular eosinophilic cytoplasm (H&E, 400X).

Fig 8: Tumour cells were strongly positive for calcitonin (DAB, 400X).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Das et al.

C-133 are usually well defined tumor, often showing lymph node involvement, vascular invasion & extrathyroidal extension.

[4,7] In our case, the tumour was well circumscribed & did not show any lymph nodal involvement, vascular invasion or any other extrathyroidal extension. Desai et al mentioned that around 19% of MTCs showed presence of calcification.[4] Another study also mentioned about calcification, but none of these studies have described about the relative amount of calcification. We found abnormally large amount of calcification in our case which we think an unusual presentation.

Conclusion Fig 9: Tumour cells were strongly carcinoembryonic antigen (DAB, 400X).

positive

for

increasing tender thyroid mass which was multicentric & showed bilateral lobes involvement. About 50% of the MTC patients present with cervical lymphadenopathy at the time of presentation.[7,8] In present case the patient did not show any lymph nodal involvement. Familial cases are associated with extrathyroidal findings like hyperparathyroidism, symptoms of pheochromocytoma, pituitary, pancreatic dysfunctions & mucosal neuromas.[8,9] There were no such findings in our patient.

In spite of rarity various morphological patterns described in literatures are classical, pseudopapillary, small cell, microglandular, cribriform, follicular, rosette like, oncocytic, osteosarcoma like, cystic, whorled & encapsulated. Among these, classical pattern accounts for almost 1/3rd of all. It shows sheets of cells having round to oval nuclei with salt & pepper like chromatin, separated by hyalinised fibrous septa of variable thickness containing amyloid.[4,10] MTC with predominant spindle cell morphology is seen less commonly. However studies showed that these morphological patterns did not have any significance differences in tumour prognosis.[4] Histological criteria for diagnosis of MTCs depend on growth pattern, cytological features of a neuroendocrine tumor & amyloid deposition. Immunohistochemistry is used for confirmation.[4] Most of the literatures mentioned that MTCs are more common in women as compared to men, mostly occurring at middle age.[8,9,11] One study from India showed male predominance with a male to female ratio of 1:0.45.[4] Sporadic tumour presentation in second decade of life is very rare. Our 19 years old female patient presented with neck swelling of 2 years duration. MTCs www.pacificejournals.com/apalm

In conclusion, predominant spindle cell pattern with abundant calcification in medullary thyroid carcinoma in a younger asymptomatic patient is a rare presentation.

Acknowledgements

We would like to thank our consultants of Department of Pathology, Hindu Rao Hospital for their guidance, otherwise it would not have been possible to work on it.

Funding None.

Competing Interests None declared.

Reference

1. Rosai J, Carcangiu ML, DeLellis RA, Tumors of the Thyroid Gland. Atlas of Tumor Pathology, Armed Forces Institute of Pathology, Washington, D.C. 1992 2. Baloch ZW, LiVolsi VA. Pathology of thyroid gland In: VA LiVolsi, SL Asa (eds), Endocrine Pathology, Churchill Livingstone, New York, 2002: 61-101.

3. Scopa CD. Histopathology of thyroid tumors. An overview. Hormones (Athens). 2004;3:100-10.

4. Desai SS, Sarkar S, Borges AM. A study of histopathological features of medullary carcinoma of the thyroid: cases from a single institute in India.

Indian J Cancer. 2005;42:25-9.

5. Hazard JB, Hawk WA, Crile G Jr. Medullary (solid) carcinoma of the thyroid; a clinicopathologic entity. J Clin Endocrinol Metab. 1959;19:152-61.

6. Papotti M, Volante M, Giuliano A, Fassina A, Fusco A, Bussolati G, Santoro M, Chiappetta G. RET/PTC activation in hyalinizing trabecular tumors of the thyroid. Am J Surg Pathol. 2000;24:1615-21.

7. Thompson LD. Medullary thyroid carcinoma. Ear Nose Throat J. 2010;89:301-2. eISSN: 2349-6983; pISSN: 2394-6466

Thyroid Medullary Carcinoma with Spindle Cell Pattern

C-134 8. Moo-Young TA, Traugott AL, Moley JF. Sporadic and familial medullary thyroid arcinoma: State of the art.

Surg Clin North Am 2009; 89: 1193-1204.

9. Takami H. Medullary thyroid carcinoma and multiple endocrine neoplasia type 2. Endocr Pathol 2003; 14: 123-31.

10. Etit D, Faquin WC, Gaz R, et al. Histopathologic and clinical features of medullary microcarcinoma and

C-cell hyperplasia in prophylactic thyroidectomies for medullary carcinoma: A study of 42 cases. Arch Pathol Lab Med 2008; 132 (11): 1767-73.

11. Williams ED, Brown CL, Donaich I. Pathological and clinical findings in a series of 67 cases of medullary carcinoma of the thyroid. J Clin Pathol 1966; 19: 103-13.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Case Report Tuberculous Versus Malignant Peritoneal Effusion: A Diagnostic Dilemma When Both Conditions Coexist Shailaja Shukla*, Preeti Rai, Geetika Sharma, Aruna Chikkara Department of Pathology, Lady Hardinge Medical College, New Delhi, India

Keywords: Peritoneal Effusion, Peritonitis Carcinomatosis, Ovarian Cancer, Tuberculous Peritonitis, Tubo-Ovarian Masses

ABSTRACT Differential diagnosis between tuberculous peritonitis and peritonitis carcinomatosis is often extremely difficult as they share common clinical and radiologic findings like ascitis, adnexal masses and elevated CA 125 levels in women. The diagnostic dilemma is further confounded when the two conditions co-exist. Overwhelming clinical features of tuberculosis may at times mask the co-existent malignant pathology leading to its underdiagnosis by the clinicians, thereby impacting the further management of the patient.

We present a case of an elderly woman who presented with abdominal distension and weight loss. Her CA 125 level was raised to 529 U/ml. Imaging studies revealed adnexal masses and ascitis. Ovarian malignancy was highly suspected but histology of endometrial biopsy showed tuberculosis. Anti-tubercular treatment was administered and the patient showed mild initial improvement but worsening of clinical and biochemical parameters occurred later due to co-existent malignancy for which no treatment was given.

This case highlights the importance of a co-ordinated team work between the physician, radiologist and the pathologist. It also emphasizes the need for careful, correct and detailed analysis and interpretation of the biochemical and pathological test results to reach to a correct diagnosis.

*Corresponding author: Dr. Shailaja Shukla, Professor of Pathology, Lady Hardinge Medical College, New Delhi-110001, INDIA E-mail: shailajashukla@gmail.com, shukla_shailaja@yahoo.com Phone: +91 9811439308, 91-011-28033599

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Tuberculous vs Malignant Ascites

C-136

Introduction

The detection of pelvic mass with ascitis and elevated CA 125 levels is highly suspicious of ovarian cancer, but there are various benign conditions especially peritoneal tuberculosis (TB), which may mimic the above findings and thus create dilemma in the diagnosis and treatment of the disease. TB and advanced ovarian carcinoma are two important differential diagnoses to be considered in an elderly female patient presenting with ascitis and bilateral tubo-ovarian masses .These entities are often mistaken one for the other by clinicians as they share common clinical and radiological findings. The confusion is compounded when the two conditions co-exist in a given patient.

Case Summary

We present a case of 50 year old woman complaining of two episodes of post-menopausal bleed and abdominal distension for past 3 months. She also gave history of loss of weight and appetite and fever off and on for past one month. There was no history of TB in the past. Physical examination showed no significant findings except abdominal distension with ascitis. Chest radiograph was within normal limits. Ultrasonography (USG) of abdomen revealed bilateral tubo-ovarian masses with gross ascitis.

Her haematological and routine biochemical investigations were within normal range but her ESR was raised to 62mm in 1st hour. Based upon these findings, a provisional clinical diagnosis of peritoneal TB was made and an ascitic fluid tap was performed. Grossly, ascitic fluid was turbid with specific gravity of 1.040, protein 4 gm/dl, sugar 40 mg/dl.

Adenosine Deaminase levels were increased to 47.78 U/ ml. Culture showed no growth. Cytological examination of ascitic fluid showed total leucocyte count of 450 cell/cumm and differential cell count of neutrophils 10%, lymphocyte

Fig. 1: Peritoneal fluid cytology showing few atypical cells suspicious of malignancy (papanicolaou, x400).

90%. Microscopic examination showed presence of reactive mesothelial cells, few lymphocytes and occasional clusters of atypical cells, suspicious of malignancy (Figure 1). Subsequently CA 125 levels were performed which were raised to 529U/ml. In the meanwhile, the patient underwent cervical Pap smear examination and endometrial biopsy to further investigate the post-menopausal bleed. Cervical Pap was negative for intraepithelial lesion or malignancy, however, showed reactive cellular changes associated with inflammation. Endometrial biopsy showed features of tubercular endometritis. Acid fast bacilli were seen on Zeihl-Neelsen stain (Figure 2).

The patient was started on antitubercular treatment.

Initially, the patient showed some improvement. Her fever subsided and the ascitis reduced. But her general condition started deteriorating one and half months later. The ascitis began to increase and a repeat USG examination showed a heteroechoic predominantly solid lesion involving bilateral adnexa suggestive of carcinoma ovaries. Later, CECT abdomen also showed bilateral ovarian masses with nodular peritoneal pelvic deposits. The CA 125 levels were also markedly elevated to 1453 U/ml. Ultrasound guided FNA was performed from tubo-ovarian mass and the cytology smears showed features suggestive of papillary serous carcinoma (Figure 3). Histopathological confirmation could not be obtained as the patient expired two days later.

Discussion

Peritoneal TB, the third most common cause of ascites after liver cirrhosis and neoplasia, accounts for 25-30% cases of abdominal TB in the tropics.[1] It presents clinically with ascites, tubo-ovarian mass and elevated CA-125 levels which mimics advanced ovarian carcinoma. Although, the

Fig. 2: Endometrial biopsy showing granulomatous reaction with Langhanâ&#x20AC;&#x2122;s giant cell(H&E, x100).Inset showing acid fast bacillus on Z-N stain, x1000.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Shukla et al.

C-137 too of the peritoneum; has been described.[7] To the best of our knowledge,this is the first report of the coexistence of serous carcinoma of ovary and tuberculous peritonitis.

It is important that the physician must not get overwhelmed by a diagnosis of tuberculosis and should explore the possibility of a co-existent malignancy especially in a setting where clinical and radiological data cannot differentiate between the two conditions. Moreover, the presence of suspicious cells in an effusion, however few, should never be ignored and a more aggressive diagnostic approach must be adopted. If ovarian FNAC/ biopsy had followed the initial findings of suspicious cells in the peritoneal fluid, the unnecessary delay in proper diagnosis and management of the patient could have been avoided.

Fig. 3: FNA smear of ovarian mass showing papillaroid fragment of malignant cells (Wright- Giemsa,x400).

diagnosis of TB requires microbiological confirmation, the incidence of microbiological isolation of the agent in ascitic fluid is quite low (under 50%) with high false negative rates.[2] In the present case also, mycobacteria could not be detected in the ascitic fluid. ADA activity levels of greater than 32.3U/L in ascitic fluid are almost 100% sensitive and 96% specific for the diagnosis of tuberculous peritonitis.

[3] The correct diagnosis of tuberculous peritonitis can be reached taking into account the manifold clinical features of the disease and on bacteriologic proof of tuberculosis somewhere in the body.[2] The present case fulfilled almost all the clinic-radiological and biochemical criteria required for diagnosis of peritoneal TB. She had documented evidence of endometrial TB; elevated ADA (47.8U/ml) activity in ascitic fluid and raised CA 125 levels.

Acknowledgement Nil

Funding Nil

Conflict of Interest Nil

References

In cases of peritoneal TB, CA 125 levels start falling after initiation of anti TB therapy and decrease to normal levels after treatment.[1,4,6] Persistent elevated levels should alert the physician to a possibility of a co-existent ovarian cancer.

Till date, only one case of coexistence of tuberculous peritonitis and primary papillary serous carcinoma; that

1. Vagenas K, Stratis C, Spyropoulos C, Spiliotis J etal.Peritoneal carcinomatosis versus peritoneal tuberculosis: a rare diagnostic dilemma in ovarian masses. Cancer Therapy 2005;3:489-494.

2. Bayramicli-Uygur O, Dabak G, Dabak R. A clinical dilemma: Abdominal tuberculosis. World J Gastroenterol 2003;9:1098-1101.

3. Kadayifci A, Simsek H, Savas MC, Toppare M. Serum tumor markers in chronic liver disease. Neoplasma 1996;43:17-21.

4. Wu JF, Li HJ, Lee PI, Ni YH et al. Tuberculous peritonitis mimicking peritonitis carcinomatosis: a case report. Eur J Pediatr 2003;162:853-855.

5. Mpiura B, Rabinovich A, Leron E, Yanai-Inbar I et al.Peritoneal tuberculosis- an uncommon disease that may deceive gynaecologist. Eur J GynecolOncol 2003;110:230-234.

6. Corapcioglu F, Guvenc BH, Nazan Sarper, Aysen Aydogan et al. Peritoneal tuberculosis with elevated serum CA125 level mimicking advanced ovarian carcinoma in an adolescent. The Turkish Journal of Pediatrics 2006;48:69-72.

7. Xiang-QianHou, Hai-Hong Cui, Xing Jin. Coexistence of tuberculous peritonitis and primary papillaryserous carcinoma of the peritoneum: A case report and review of the literature. World J Gastroenterol 2009;15(6):761-763.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Serum Ca 125 levels are raised not only in epithelial ovarian cancer but also in various benign and inflammatory conditions such as menstruation, pregnancy,endometriosis, PID, genital TB and non- gynaecological conditions like various liver and lung diseases where the serum CA 125 levels are usually <500 U/L. In the present case, a markedly elevated serum CA125 level of 529U/L favoured a diagnosis of ovarian cancer vis-a-vis peritoneal TB but the patient was put under ATT because very high levels (>1000U/L) have been reported in some patients with peritoneal TB. [1, 4-6]Moreover, she had histopathologic evidence of endometrial TB. The few suspicious cells seen in ascitic fluid were totally ignored.

Case Report Warthin Like Variant of Papillary Carcinoma Thyroid Against the Background of Hashimotos Thyroiditis : A Case Report Swati Vijay Patki*, Ganesh R Kshirsagar, Sheetal Yadav, Nitin M Gadgil Department of Pathology, LTMMC and LTMGH, Sion, Mumbai, India Keywords: Papillary thyroid carcinoma, Warthin-like variant of PTC.

ABSTRACT Papillary thyroid carcinoma (PTC) is the most common malignant neoplasm of the thyroid gland with many variants . The Warthin-like variant of PTC (WLPTC) is a rare accounting for 1-2% of PTC that is considered to be a subtype of the oncocytic variant. A 35-year-old female sought consult for assessment of a painless right neck tumor.

Fine-needle aspiration biopsy report was given as hashimotos thyroiditis with hurthe cell neoplasm . The patient underwent right hemithyroidectomy. Grossly a single lobe of thyroid which was nodular on external surface and cut surface there was a single nodule measuring 1 cm in diameter,whitish in appearance with few areas of congestion.

Microscopically, the tumor was composed of papillae lined by cells with eosinophilic cytoplasm, nuclear chromatin clearing, grooves, and pseudoinclusions and a characteristic lymphoplasmacytic infiltrate of the papillae cores. At places the thyroid parenchyma shows follicles of vaying sizes along with lymphoid follicles.

*Corresponding author: Dr. Swati Vijay Patki, A-202, Tilak Shanti CHS, Tilak Nagar, Mumbai-400089, INDIA Phone: +91 919869707382 E-mail: drspkulkarni@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Patki et al.

C-139

Introduction

The Warthin-like PTC is a variant that is characterized by a papillary growth of oncocytic cells with classic nuclear features of PTC and an associated brisk lymphoplasmacytic infiltrate in the papillary stalks. The variant is so-named because of its close resemblance to parotid gland Warthin tumor. These tumors often have an associated chronic lymphocytic thyroiditis with oxyphilia in the background thyroid. The differential diagnosis includes the tall cell variant of PTC; however, despite the oncocytic cells, the cells are not twice as tall as they are wide.[1] The prognosis of this lesion is similar to that reported with typical PTC. We have seen unusual cases of Warthin-like PTC transition to tall cell PTC at its invasive edge and then invade into extrathyroidal soft tissues. The clinical behavior of such lesions seems to more closely follow that of Warthin-like papillary carcinoma than the tall cell phenotype. Defining the histologic variant of thyroid carcinoma is an important clinical implication as their progression, recurrence, aggressiveness, and prognosis differ. Warthin-like variant is one of the rarest histologic variants of papillary thyroid cancer.[2] Warthin-like variant is an uncommon and relatively unknown variant of papillary thyroid carcinoma that has been usually associated with an excellent prognosis.

Interestingly, BRAF mutations have been reported to be present in up to 75% of the patients. It is frequently associated with Hashimoto’s thyroiditis and presents unique morphological features that make it recognizable on histologic examination. The cytological diagnosis is difficult to assess due to the overlap in its findings with the classical variant and Hashimoto’s thyroiditis.[3] Papillary, follicular, and anaplastic thyroid cancers are follicular epithelial-derived cancers. Papillary and follicular cancers are considered differentiated cancers and patients with these tumors are treated similarly, nevertheless being biologically different.[4] On their pathogenesis, proteins in the mitogen-activated protein kinase (MAPK) pathway have gained interest as almost 70% of differentiated thyroid cancers may present exclusive nonoverlapping activation mutations in BRAF, RET, or RAS. Several histologic subtypes of papillary thyroid cancer (PTC) have been described. Of these the follicular variant is the most common and the so-called “Warthin-like” (WL) variant has been seldom reported . Oncocytic metaplasia is usually seen in both benign and malignant lesions of thyroid.The true oncocytic tumors are classified as Hurthle cell tumors, which are characterized by distinct cytology and clinical behavior. However, follicular cell–derived tumors and even medullary carcinoma can exhibit prominent oncocytic change.[ 5]Among the follicular derived tumors, papillary carcinoma can show both focal and extensive oncocytic www.pacificejournals.com/apalm

Fig. 1: warthin like variant of papillary carcinoma thyroid (40X): Shows few papillary(white arrow) fragments with lymphoid infiltrates(blue arrow).

Fig. 2: Shows papillae lined by bilayered oncocytic epithelium and lymphoid aggregates .

Fig. 3: Shows papillae lined by bilayered epithelium with eosinophilic cytoplasm, nuclear chromatin clearing, grooves, and pseudoinclusions and a characteristic lymphoplasmacytic infiltrate of the papillae cores.

eISSN: 2349-6983; pISSN: 2394-6466

Warthin Like Variant of Papillary Carcinoma Thyroid

C-140

Fig. 1: Section Shows papillae lined by bilayered epithelium with eosinophilic cytoplasm, nuclear chromatin clearing, grooves, and pseudoinclusions and a characteristic lymphoplasmacytic infiltrate of the papillae cores. (H&E, x1000)

Fig. 2: Hashimotos Thyroiditis : Shows thyroid parenchyma shows follicles of vaying sizes along with lymphoid follicles (100X).

change. Hurthle cell variant of papillary carcinoma accounts for 1% to 11% of all papillary carcinomas. These tumors are characterized by papillary formation lined by oncocytic cells and clinically behave similarly to conventional papillary carcinoma. Warthin like variant of papillary carcinoma, resembles the warthin tumor of salivary gland is rare ,has indolent course and is one amongst the thyroid lesions to show oncocytic metaplasia.[6]

Case Report

A 35-year-old female sought consult for assessment of a painless right sided neck tumor, denied having a family history of thyroid disease, exposure to irradiation, or any

other risk factor associated with thyroid cancer. Physical examination revealed painless, nonfixed, regular, and hard nodule of 1 × 2 cm in the inferior right thyroid lobe. Dyspnea, dysphagia, dysphonia and cervical lymphadenopathy were absent. Fine-needle aspiration biopsy report was given as hashimotos thyroiditis with hurthe cell neoplasm. The patient underwent right hemithyroidectomy. Grossly a single lobe of thyroid which was nodular on external surface and cut surface there was a single nodule measuring 1cm in diameter,whitish in appearance with few areas of congestion. Microscopically, the tumor was composed of papillae lined by cells with eosinophilic cytoplasm, nuclear chromatin clearing, grooves, and pseudoinclusions and a characteristic lymphoplasmacytic infiltrate of the papillae cores. At places the thyroid parenchyma shows follicles of vaying sizes along with lymphoid follicles. A rim of normal thyroid parenchyma was also seen .

Discussion

World Health Organization (WHO) recognizes 9 main histopathological papillary thyroid cancer variants: follicular, macrofollicular, oncocytic, clear cell, diffuse sclerosing, tall cell variant, columnar cell, solid, and cribriform . [1 ]The most recent edition of the WHO classification of tumors of endocrine organs classifies “Warthin-like tumor” under the oncocytic variant section.

We believe it is important to acknowledge all these variants due to a more aggressive biological behavior of at least two of them (tall and columnar cell variants). The Warthin-like variant is morphologically characterized by a papillary architecture with an oncocytic epithelial lining and a lymphoplasmacytic core infiltrate . Also important to mention is its well-known association to Hashimoto’s thyroiditis present in the nonneoplastic thyroid tissue .[2] Papillary carcinoma and its variants can exhibit different degrees of oncocytic metaplasia. Hurthle cell and tall cell variants of papillary carcinoma show prominent oncocytic change. Papillary Hurthle cell carcinomas comprise 1% to 11% of all papillary carcinomas and are characterized by papillary architecture lined by oncocytic cells with nuclear features of papillary carcinoma.[3] However, they usually lack lymphoplasmacytic infiltrate and a strong association with lymphocytic thyroiditis, as seen in the Warthinlike variant. The tall cell variant of papillary carcinoma is characterized by papillary growth pattern, oncocytic elongated tumor cells with a height twice that of their width, and papillary cancer nuclei. Clinically, this variant of papillary cancer can behave in a more aggressive fashion and is frequently associated with extrathyroidal extension, vascular invasion, lymph node anddistant metastases,

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Patki et al.

C-141

and tumor recurrence. The presence of HT in PTC has been associated with favorable prognostic features, such as lower rates of lymph node metastasis, extrathyroidal extension, and TNM stage, and lower frequency of BRAF V600E mutation .[4] The peculiar lymphoid infiltrates in the papillary stalks suggest that WLPTC might have a distinguished entity .WLPTC is commonly accompanied

by HT in a background . In the present study, HT was seen in 80% of all WLPTC cases. We hypothesized that WLPTC might have better prognosis than classic PTC due to an association with HT. However, there were no significant differences in clinicopathologic factors (age, sex, multifocality, pT stage, extrathyroid extension, and lymph node metastasis) except for tumor size, HT, and BRAF mutation between WLPTC and classic PTC.[5] When we compared WLPTC and classic PTC with HT only, there were no significant differences in age, sex, multifocality, Pt stage, extrathyroid extension, lymph node metastasis, or even tumor size or BRAF V600E mutation between groups. Thus, we suggest that the pathologic and clinical behaviors of WLPTCs are similar to those of classic PTC, especially classic PTC with HT .[6]

further studies with larger series and long-term monitoring are required to establish this with certainty.

Acknowledgements None

Funding None.

Competing Interests None declared.

References

Warthin-like variant is an uncommon variant of papillary thyroid carcinoma. It is frequently associated with Hashimoto’s thyroiditis and presents unique morphological features that make it easily recognizable on the histologic examination. The cytological diagnosis is difficult to assess due to the overlap in its findings with the classical variant and Hashimoto’s thyroiditis Prognosis are the same as those reported for the classic variant. However BRAF mutations have been reported to be present in up to 75% of the patients with Warthin-like variant. Consequently,

1. Zubair W. Baloch M ,Virginia A. Warthin-like Papillary Carcinoma of the Thyroid Arch Pathol Lab Med 2000;124 :26-28 2. Yeo M N, Bae J S, Lee S, Kim M, Lim D. The WarthinLike Variant of Papillary Thyroid Carcinoma:A Comparison with Classic Type in the Patients with Coexisting Hashimoto’s Thyroiditis, International Journal of Endocrinology 2015;1:34-36 3. Colunga K ,Solis A, Falcón L A, Quintana O A. WarthinLike Papillary Thyroid Carcinoma Associated with Lymphadenopathy and Hashimoto’s Thyroiditis * Case Rep Endocrinol. 2015;25:18-19 4. Paliogiannis P, Attene F, Trogu T, Trignano M .Warthin-Like Papillary Carcinoma of the Thyroid Gland:Case Reports in Oncological Medicine 2012:12;15-19 5. Robyn L, Sylvia L, LiVols S, Virginia A. Warthin-like Tumor” of the Thyroid ,American Journal of Surgical Pathology:1995:12:11-15 6. Rosai J. Rosai and Ackerman’s Surgical Pathology,Soft tissue.10thed. NewYork: Mosby Elsevier;2011.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Conclussion

Case Report Perianal Rhabdomyosarcoma Presenting Post Surgery for Hirschsprungâ&#x20AC;&#x2122;s Disease: A Rare Presentation Shailaja Shukla, Manjari Kishore*, Sangeeta Pahuja and Priya Thomas 1

Dept of Pathology, Lady Hardinge Medical College, New Delhi, India

Keywords: Cytopathology, Hirschsprungâ&#x20AC;&#x2122;s, Perineal, Rhabdomyosarcoma

ABSTRACT Perianal region is an uncommon site for Rhabdomyosarcoma. Early diagnosis is essential in these cases, as 25% of patients present with metastasis at the time of diagnosis. FNAC is simple and useful procedure for making an early diagnosis and helping clinicians for prompt intervention. Previously, a single case had been reported of rhabdomyosarcoma occuring 2 years after a surgery for hamartoma at the same site. Herein, we report a case of perianal rhabdomyosarcoma which occurred 5 years after a pull through procedure done for Hirschsprungs disease and this rare association has not been reported yet in literature.

*Corresponding author: Dr. Manjari Kishore, A-1, 1/10 A, Rajender Nagar, Sahibabad, Ghaziabad, U.P (201005) INDIA Phone: +91 8105104471, 01204566722 E-mail: drmanjarik@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Shukla et al.

C-143

Introduction

Perineal or perianal rhabdomyosarcoma are extremely rare and occur in <2% of primary cases. Overall, rhabdomyosarcoma is the most common soft tissue sarcoma of childhood with an incidence of 4-7 per million in the age group of 15 years or younger. The common sites of involvement are head and neck, genitourinary tract, extremities with perianal region being an uncommon location. They usually have regional lymph node metastasis at the presentation and comparatively poor prognosis.

Many a time misdiagnosed as perirectal or gluteal abscess delaying the diagnosis and treatment. Previously, a single case had been reported of rhabdomyosarcoma occurring 2 years after a surgery for hamartoma at the same site [1].

Herein, we report a case of perianal rhabdomyosarcoma which occurred 5 years after a pull through procedure done for Hirschsprungs disease. No such association has been reported till date which makes the present case to be of its first kind to be published.

Case Report

A seven year old female child presented with an irregular, polypoidal perianal mass of 2 months duration. The patient also had a history of Hirschsprungs disease at 1.5 years of age, which was diagnosed on histopathological

examination. She had undergone a pull through procedure for the correction of disease 5 years back. Following surgery, she did not have any problem. But recently, a rapidly growing mass was detected by the patientâ&#x20AC;&#x2122;s parents in last 2 months. On examination, the mass was lobulated, non-tender mass measuring 6X4.5 cms with normal appearing overlying skin (Fig1A). The mass was external to the anal opening and no abnormality was detected on per-rectal examination. Clinically the provisional diagnosis was anal papilloma or melanoma.

Fine needle aspiration cytology examination done revealed small round cells with scant fragile cytoplasm, round nucleus and prominent nucleoli, suggestive of small blue round cell tumor (?) rhabdomyosarcoma (Fig 1B).

Further to confirm the diagnosis made on cytopathological examination, a cell block was made. Smears showed round cells arranged in nests and sheets with scant cytoplasm, with prominent nucleoli and many mitotic figures (Fig 2A & B). Strap cells were also noted (Inset 2B).

Immunohistochemical studies confirmed the diagnosis of rhabdomyosarcoma with positive expression of Vimentin, Desmin and Myogenin (Fig 3A-C). However, Cytokeratin, LCA, NSE were negative (Fig 3D-F).

Fig. 1A: Gross picture of the lobulated tumor in perianal area. Fig 1 B: Smears showing small round cells with scant fragile cytoplasm, round nucleus and prominent nucleolus (Giemsa, X 400).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-144a

Perianal Rhabdomyosarcoma

Fig. 2A & 2B: Sections showing round cells arranged in nests and sheets with scant cytoplasm , with prominent nucleolus and many mitotic figures. Inset (2 B) shows a strap cell. (2 A: H&E, X100; 2 B: H&E, X400).

Fig. 3-C: Tumor cells showing immunoreactivity for Vimentin (3A), Desmin (3B) & Myogenin (3C), respectively. [X400]. Fig 3D-F: Photomicrograph showing negative expression of CK (3D), LCA (3E) & NSE (3F), respectively. [X400]

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Shukla et al.

C-144b

Considering the clinical, cytological, histopathological and immunohistochemical aspects, finally a diagnosis of Perianal Rhabdomyosarcoma (Embryonal type) occurring after pull through procedure done for Hirschsprungs disease was made. The patient was advised to undergo extensive surgical resection along with chemotherapy and was under follow up for only two months after which she was lost to follow up.

Discussion

Rhabdomyosarcoma is a malignant tumor of striated muscle origin and is the most common soft tissue sarcoma of childhood with an incidence of 4-7 per million children in the age group of fifteen years or younger [2,3] . The common sites of involvement are head & neck, genitourinary tract, extremities. Less commonly trunk, intrathoracic region, perineal/ perianal region, biliary tract are also involved. Perianal rhabdomyosarcoma is rare condition and rare cases of anorectal rhabdomyosarcoma have been reported in medical literature [4]. It is interesting to note that when we consider the lesions of somatic origin, leiomyoma or leiomyosarcoma are the common tumors and originating in lower portion of genitourinary system, rarely in anorectum. Tumors encountered in early period of life are usually of epithelial origin. Usually the lesions of somatic origin are rare including tumors of colon and rectum in children. Hence, considering its rarity in children, it becomes difficult to timely diagnose these lesions from clinical aspect.

The important misleading points are variation in growth characteristics, gross and histopathological findings. They may occur as apparently well-defined, encapsulated, perineal mass; easily getting confused with condyloma acuminata, fibromas or fibromyosarcoma. But the most important crux to be remembered is that the highly malignant behavior of these tumors is the key to rational therapy [5-6]. Similarly, gross features are important to be noted as the gross consistency in rhabdomyosarcoma varies in proportion to their collagen content. They are not as firm as fibroma or fibromyosarcoma. Sometimes they may present with reddish discoloration caused by hemorrhage or necrosis. There are cases in literature where perianal rhabdomyosarcoma presented with abscess [7].

the first of its kind to be reported as because association of perianal rhabdomyosarcoma occurring after pull through procedure for Hirschsprungs disease has never been reported in literature till date. However, there has been a report of perianal RMS after surgery for hamartoma at same site. Previously a single case had been reported of rhabdomyosarcoma occurring 2 years after a surgery for hamartoma at the same site [1]. Our case was after pull through surgery for Hirschprung’s disease. No case was reported in the past relating the two.

It is important to differentiate this entity from other small blue round cell tumor which is noted in children. Hence, role of immunohistochemistry is of utmost importance which helps in excluding other entities. A proper approach using correct immunohistochemical markers help in specifically diagnosing the exact type of malignant process involved.

Perianal RMS are high-risk tumors. According to the Intergroup RMS Study Group (IRSG) review of 71 children with perineal or anal RMS from 1972 through to 1997, the prognosis is poor, with a 5-year failure-free survival rate of only 45% and overall survival (OS) rate of 49% Multimodal treatment should be initiated without delay [8]. A perianal site is unusual and is associated with high risk and a low cure rate [9-10]. The treatment of choice for RMS combines intensive chemotherapy, high-dose radiotherapy and complete surgical excision, but there is no established treatment strategy for RMS of the perineum or anus, in particularly in the Intergroup Rhabdomyosarcoma Staging (IRS) reports, as these locations are rare. The few cases of perianal RMS that have been reported have been associated with frequent sphincter disorders or anal ulcerations [11-12]. Wide first-line curative surgery is possible but causes loss of sphincter function. Multimodal treatment may preserve sphincter function and achieve remission without major complications, and should not be withheld because of young age.

Conclusion

The histopathological findings in rhabdomyosarcoma in children is different from that seen in adults. In children, the lesion appears to originate from primitive mesenchymal cells with marked cellular distortion and myxomatous elements. They grow very rapidly in infants and children giving a clue to that they are of embryonic origin arising from immature myeloblasts rather than mature striated muscle as seen in adults. The present case is

Perianal region is a rare location for rhabdomyosarcoma and it can mimic some benign condition clinically as in the present case. Early diagnosis is essential in case of rhabdomyosarcoma, as 25% patients present with metastasis at the time of diagnosis. Fine needle aspiration cytology, core needle biopsy and immunohistochemistry should be used as a diagnostic tool for perianal mass lesion. The present case is unique because of its occurrence after five years of pull-through surgery for Hirschsprungs disease and is the first case to be published in literature.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Perianal Rhabdomyosarcoma

C-145

Acknowledgements None

Funding None

Competing Interests None declared.

References

1. Piche N, Patey N, Dal Soglio D, Samson Y, Bouchard S.Perianal rhabdomyosarcoma presenting 21 months after hamartoma excision.Pediatr Surg Int. 2012 Jul;28(7):731-5.

2. Hicks J, Flaitz C. Rhabdomyosarcoma of the head and neck in children. Oral Oncol 2002;38: 450-9.

3. Rubin E, Farber EL, eds. Pathology. Vol 1. Philadelphia:. J.B. Lippincott Company. 1994: 1343-4.

4. Raney RB Jr, Crist W, Hays D, et al. Soft tissue sarcoma of the perineal region in childhood. A report from the Intergroup Rhabdomyosarcoma Studies I and II, 1972 through 1984. Cancer 1990;65:2787-92.

5. Sasajima K, Okawa K, Sasamoto Y, et al. Pararectal rhabdomyosarcoma: report of a case. Dis Colon Rectum 1980;23:576-7.

6. Ali R, Ozkalemkas F, Ozan U, et al. Rhabdomyosarcoma of the perianal region presenting as acute leukemia.

Ann Hematol 2004;83:729-30.

9. Blakely ML, Andrassy RJ, Raney RB, Anderson JR, Wiener ES, Rodeberg DA, et al. Prognostic factors and surgical treatment guidelines for children with rhabdomyosarcoma of the perineum or anus: a report of Intergroup Rhabdomyosarcoma Studies I through IV, 1972 through 1997. J Pediatr Surg.2003;38(3):347– 353.

10. Watanabe Y, Yamaguchi A, Isogai M, Kaneoka Y, Suzuki M, Ando H, et al. Treatment strategies for perianal rhabdomyosarcoma: report of two cases. Surg Today.2004;34(8):719–724.

11. Haie-Meder C, Mazeron R, H, Oberlin O. [Brachytherapy pediatric rhabdomyosarcomas] Radiother. 2013;17(2):155–158.

Martelli role in Cancer

12. Martelli H, Haie-Meder C, Branchereau S, FranchiAbella S, Ghigna MR, Dumas I, et al. Conservative surgery plus brachytherapy treatment for boys with prostate and/or bladder neck rhabdomyosarcoma: a single team experience.

J. Pediatr.

Surg.2009;44(1):190–196.

7. Hill DA, Dehner LP, Gow KW, Pappo AS, Crawford D, Pflaumer SM, Furman WL, Hayes-Jordan AA, McDermott MB.Perianal rhabdomyosarcoma presenting as a perirectal abscess: A report of 11 cases.J Pediatr Surg. 2002 Apr;37(4):576-81.

8. Marnewick J, Hulme-Moir M. Embryonal rhabdomyosarcoma of the rectum: report of a case and possible treatment option. Colorectal Dis 2010;12:e170-1.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report Chorangioma with Chorangiosis, Placenta: A Rare Entity of Clinical Significance Swati Singla, Ankit Kaushik, Charanjeet Ahluwalia, Gaurav Singla* and Ashish Kumar Mandal Department of Pathology, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India Keywords: Chorangioma, Placenta , Chorangiosis

ABSTRACT Placental chorangiomas are benign vascular tumours of placenta arising from chorionic tissue with an average incidence of 0.5-1%. Hypertension and diabetes are found more often in combination with chorangimas than they are in otherwise normal pregnancies. It is often associated with adverse clinical outcome like preeclampsia, IUD. Chorangiosis is characterized by an increase in number of small sized vascular channel with in chorionic villi.

Chorangiosis is considered as hypoxia related angiogenesis mainly associated with numerous maternal, foetal and placental disorders.

Though both of the conditions have been described separately in literature we present a case with both these conditions.

*Corresponding author: Dr. Gaurav Singla, Department of pathology, Safdarjung Hospital and Vardhman Mahavir Medical College, New Delhi-110029, INDIA Phone: +91 9811989652 Fax: 011-26198455 E-mail: gauravjoncy1987@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Singla et al.

C-147

Introduction

Chorangioma also known as placental hemangioma is a benign tumor of the placenta that occurs in 0.5 â&#x20AC;&#x201C; 1 % of carefully examined placentas. Their frequency rises in women over 30 years old. They are often found in primipara and twin pregnancies. Hypertension and diabetes are found more often in combination with chorangiomas than they are in otherwise normal pregnancies.[1]They are more common in high altitudes and are also associated with preeclampsia which suggest that low oxygen tension may play a role in their development. Chorangiosis is a placental change characterized by hypervascular terminal chorionic villi without stromal hypercellularity.[2] It occurs in 5 â&#x20AC;&#x201C; 6% of placentae and have been associated with high mortality (42%) and major congenital malformations (39%).[2] Both of these entities have been described in the literature separately . We present a case report where both the findings were present in the same placenta.

Fig. 1: Shows reddish brown area (chorangioma) at placental margin

Case History

A 25 year old G2P1L1 presented at term with fetal distress.

A Lower segment Cesarean section was performed and was uneventful. The weight of the baby was 2.8 kg at birth. Haematological, echocardiographic and abdominal ultrasound of the baby were normal.

The placenta was sent to the histopathology department for pathological examination. Grossly placenta measured 17x13x3 cm and weighed 550 gm. Membranes were intact.

Maternal surface showed 15 cotyledons and fetal surface was unremarkable. Serial sections of placenta showed a well circumscribed reddish-brown area at placental margin measuring 5x3x2 cm (Fig.1).

On microscopy the well circumscribed reddish brown area of placenta showed numerous small capillary sized channels (Fig.2) with occasional large sized vascular spaces and focal areas of calcification. Section from the surrounding normal placenta showed increased number of capillary sized vascular channels varying in number from 10-12/ villi in ten different regions (Fig.3). Immunohistochemistry for smooth muscle actin was negative showing absence of pericytes (Fig.4). Hence the final diagnosis of chorangioma with chorangiosis, placenta was made.

Fig. 2: Shows numerous small capillary sized channels with occasional large sized vascular spaces (200x) (H &E)

Discussion

Chorangioma is a non trophoblastic tumour characterized by abnormal vascular development within the placental parenchyma. It is most commonly observed in the third, and less frequently in the second trimester of pregnancy. It may either present as a solitary nodule or, less frequently, as multiple nodules.[3] It is most commonly found on the fetal surface of the placenta, often in the vicinity

Fig. 3: Shows increased number of capillary sized channels per villi (400x ) (H&E)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

Chorangioma with Chorangiosis

C-148

pericytes, involve stem villi, and usually occur in immature placentas of less than 32 weeks. The case we present here is unusual because even though the size of hemangioma was large it did not cause any abnormalities in the fetus, and the pregnancy was uneventful. We also observed associated chorioangiosis in the placental villi. This possibly resulted from a compensatory mechanism because of the reduction of the functional parenchyma.[9]Chorangiosis also has an important potential clinical significance and should be mentioned in the pathology report so that the patient should be investigated for associated conditions like diabetes, anaemia, syphilis , pre-eclampsia etc.

Acknowledgement Fig. 1: IHC for SMA is negative pericytes (400x)

showing absence of

of umbilical cord insertion, with larger tumors being usually attached to the chorion. The clinical significance of chorangioma is size-dependent. Small chorangiomas possess no clinical significance. On the contrary, clinically significant chorangiomas, greater than 5 cm or multiple, may be associated with hydroamnios, hemorrhage, premature delivery, premature placental separation and placenta previa.

[4] These manifestations may result in severe fetal distress and intrauterine death. They may also lead to nonimune hydrops fetalis.[4] Anaemia, thrombocytopenia or congestive cardiac failure may be seen in a neonate. The normal terminal chorionic villi should contain no more than five vascular channels, even when the same vessel is present in more than one plane of section. [5]The diagnostic criteria of chorangiosis was established by Altshuler[2] in 1984 as the presence of 10 villi, each with 10 or more vascular channels in 10 or more areas of 3 or more of random, non infarcted placental areas.

Chorangiosis is considered as hypoxia related angiogenesis mainly associated with numerous maternal, foetal and placental disorders. [2,6,7 ] The maternal complications consist of pregnancy induced hypertension (PIH), pre-eclampsia, abruptio placentae, diabetes mellitus, severe anaemia and syphilis while fetal complications consist of fetal intrauterine growth retardation and intra uterine fetal death.

Placentomegaly and chronic villitis may occur in placenta.

Chorangiosis has to be differentiated from chorangiomatosis. Chorangiomatosis is seen before 32 weeks of gestation and involve more proximal elements of villous tree, show increased stromal cellularity and stromal collagenisation.[7] Chorangiosis is more common after 37 weeks of pregnancy, is a diffuse process involving the tips of terminal villi and has numerous closely approximating capillaries with intact basement membrane. [7, 8] In chorangiomatosis, villous capillaries are also numerically increased, but unlike chorangiosis, they are accompanied by

All authors have contributed significantly, and that all authors are in agreement with the content of the manuscript.

Declaration Funding - None

The author(s) have no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. The authors have no conflicts of interest to declare.

References

1. Guschmann M, Henrich W, Entezami M, Dudenhausen JW. Chorangioma – new insights into a well-known problem I. Results of a clinical and morphological study of 136 cases. J Perinat Med. 2003;31:163–169.

2. Altshuler G. Chorangiosis: an important placental sign of neonatal morbidity and mortality. Arch Path Lab Med 1984; 108 : 71-74 3. Lež C, Fures R, Hrgovic Z, Belina S, Fajdic J, Münstedt K. Chorangioma placentae. Rare Tumors 2010; 2.:67 4. D’Ercole C, Cravello L, Boubli L, Stanko Belina, Josip Fajdic , Karsten Münstedt . Large chorioangioma associated with hydrops fetalis: prenatal diagnosis and management. Fetal Diagn Ther. 1996;11:357–60.

5. De La ossa MM. Cahello-Inchausti B, Robinson M.J. Placental chorangiosis. Arch Path Lab Med 2001; 125 : 1258-58.

6. Ogino S, Redline RW. Villous capillary leisions of the placenta: Distinction between chorangioma, chorangiomatosis and chorangiosis. Hum Path 2000; 31 : 945-54.

7. Caldarella A, Buccoliero AM, Taddei GL. Chorangiosis: report of three cases and review of the literature Pathol Res Pract 2003; 199 : 847-50.

8. Bittencourt AL, Chagas K, Calabrick VAT .Large placental hemangioma diagnosed by ultrasonography - a case report. Sao Paulo Med. J.1995;113:6.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report Inflammatory Cloacogenic Polyp: A Rare Case Report Smita Surendra. Masamatti*, Nayan Anant. Ramteerthakar, Amit Bapuso. Pandav and Alka Vikas. Gosavi Department of Pathology, Government medical college, Miraj, Maharashtra, India Keywords: Mucosal Prolapse Syndrome, Malignancy, Solitary Rectal Ulcer Syndrome

ABSTRACT Inflammatory cloacogenic polyps (ICPs) are considered to be part of the spectrum of manifestations of mucosal prolapse, which includes solitary rectal ulcer syndrome (SRUS), rectal prolapse, intussusceptions and rectocele.

The ICP is thought to result from mucosal prolapse, which produces local trauma and ischemic injury followed by inflammation, repair and regenerative changes. The estimated annual incidence of ICPs is 1 to 3.6 per 1, 00,000 among all solitary rectal ulcers. Here we present a case of forty year old woman who presented with recurrent rectal bleeding, passing of mucus in stools and altered bowel habits since 1 and half years. Surgical resection of the polyp was done and the histopathological findings were consistent with ICP. Hence ICPs should be considered in the differential diagnosis of anorectal lesions.

*Corresponding author: Dr Smita Surendra. Masamatti, DQ 14, Staff quarters, Sapthagiri Medical college and Hospital. Chikkasandra, Hesargatta Main road, Bangalore 560090. India Phone: +91 9741147555 E-mail: smitamas@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Inflammatory Cloacogenic Polyp

C-150

Introduction

ICPs are benign lesions arising from the transitional zone of the anorectal junction and may macroscopically resemble anorectal malignancies. [1]It was first described in 1981 as an unusual polyp of the anus. The term “mucosal prolapse syndrome” was proposed by du Boulay et al in 1983 to describe the characteristic features of the lesions, solitary rectal ulcer and related disorders which are thought to share mucosal prolapse as the underlying pathogenic mechanism.[2] In this report we describe another case of ICP with all typical histopathological features.

Case Report

A forty year old female presented with complaints of recurrent rectal bleeding, passing of mucous in stools and altered bowel habits, on and off since one and half years. On per rectal examination, there was no evidence of hemorrhoid or mucosal prolapse. A presumptive diagnosis of inflammatory bowel disease was given and was treated symptomatically. But later on the symptoms were aggravated and sigmoidoscopy was advised. The scopy findings revealed a single, soft, fleshy, sessile polyp arising from the anterior wall of rectum. Following this, colonoscopy was done to rule out similar lesions in rest of the intestine. The colonoscopy and other routine investigations were within normal limits. Cervical Pap smear was taken to rule out HPV associated intraepithelial lesion and it didn’t reveal any abnormality. Surgical resection of the polyp was done and was sent to histopathology section. Following excision, there has not been any history of recurrences during a follow up period of 6 months.

Gross examination: The polyp was sessile, irregular, grey white in color with a rough surface and measured 2.8x1.2x0.5 cms. The cut surface showed whitish appearance (Figure 1). Grossly it was diagnosed as adenomatous polyp.

Fig. 1: Gross picture of the polyp showing homogenous whitish appearance on cut surface.

Fig. 2: Microphotograph of polyp showing both squamous and columnar lining epithelium (H and E, X40).

Microscopic examination: Sections studied showed a polyp covered by both squamous and columnar epithelium (Figure 2). It showed a villiform configuration with surface ulceration and was covered with fibrinous exudates (Figure 3). Within the stroma, there was central splaying of fibres of the muscularis mucosae and showed fibromuscular obliteration of the lamina propria (Figure 4). There was no evidence of dysplasia in the lining epithelium or in the glands.

Discussion

Inflammatory cloacogenic polyp is a rare type of anorectal polyp that was first described in literature by Lobert and Appleman in 1981. It is a very rare anorectal lesion as the estimated annual incidence is around 1 to 3.6 per 1,

Fig. 3: Microphotograph showing villiform configuration of glands with focal mucosal ulceration (H and E, X100).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Masamatti et al.

Fig. 4: Central splaying of muscularis mucosae fibers in lamina propria (H and E, X100).

00,000 among all solitary rectal ulcers. [3] ICP is thought to result from mucosal prolapse which produces local trauma and ischemic injury followed by inflammation, repair and regenerative changes. [2] ICPs prolapse because of the malfunction of the internal anal sphincter and smooth muscle of rectum. [4]The lesions are more common in women during the third and fourth decade of life, as seen in our case; however, Poon et al and Washington K have reported ICPs occurring in children aged between 8 to 15 years. [5,6] ICPs are located usually at the anterior wall of anorectal junction but Scott H previously reported in his case series that they can arise from anterior, posterior or even anterolateral wall of rectum.

Previous studies done by Scott H and Lobert and Appleman showed associated lesions such as SRUS/prolapse, Crohnâ&#x20AC;&#x2122;s, hemorrhoids and adenocarcinoma along with ICP, but in our case there were no associated findings. [7] Microscopically the present case showed all the features of ICP. The lining epithelium or glandular epithelium did not show any evidence of dysplasia in our case, while I.M.Hanson reported a case of intraepithelial neoplasia in ICP which was associated with HPV. [2] There are reports of squamous cell carcinoma in situ and invasive squamous cell carcinoma arising in ICP. These cases showed association with HPV 16 which was demonstrated by PCR. The markers p53 and ki 67(MIB-1) have been suggested to be used in challenging histopathological cases of dysplasia.

[1] Anal intraepithelial neoplasia shows similarities with cervical intraepithelial neoplasia being associated with HPV infection and multifocal female genital intraepithelial neoplasms.[2] The differential diagnosis consists of both malignant and benign lesions. Malignant lesions include carcinomas of www.pacificejournals.com/apalm

C-151 the anus and rectum. Benign lesions include submucosal lesions of the colon like fibroblastic polyps, Peutz Jeghers polyp, adenomas with secondary prolapse and SRUS, inflammatory cap polyps and inflammatory myoglandular polyps. [1] In ICPs, the smooth muscle surrounds individual crypts while in Peutz Jeghers, the prominent arborizing smooth muscle bundles surrounds groups of crypts. The lack of dysplastic nuclear changes readily distinguishes these inflammatory polyps from tubular and villous adenomas. [3] The fibroblastic polyp, which may also show epithelial serration, but epithelial and inflammatory components are less pronounced. The lamina propria proliferation is fibrocollagenous, rather than fibromuscular, a feature which may be highlighted with use of a trichrome stain.

Other entities like inflammatory fibroid polyps, mucosal ganglioneuromas and leiomyomas of the muscularis mucosae are unlikely to be confused with polypoid mucosal prolapse, given the lack of an epithelial component, but may be distinguished Immunohistochemically if required.[8] A few cases with histological changes identical to mucosal prolapse syndrome have been described in association with an invasive carcinoma, most of which were detected in superficial biopsy and the carcinoma was infiltrating the underlying submucosa. The mechanism for the mucosal prolapse like changes is postulated to be localized ischemia related to the malignancy.

Surgical excision along with correction of prolapse is the most common path of treatment. [4]

Conclusion

ICPs could be the first manifestation of Crohnâ&#x20AC;&#x2122;s disease or associated with a more proximal adenocarcinoma.

ICPs may mimic adenomas and anorectal malignancies macroscopically, endoscopically and histologically.

Hence pathologists must be cautious in evaluating ICP because of the frequent findings of crypts displaced into the submucosa. In case of ICPs with anal intraepithelial neoplasia, long term follow up of the patient should be kept. The pathologists, clinicians and Endoscopists must be aware that although ICP is often associated with SRUS/ mucosal prolapse, it may also occur in other clinical settings.

Acknowledgements None

Funding None

Competing Interests None

eISSN: 2349-6983; pISSN: 2394-6466

Inflammatory Cloacogenic Polyp

C-152

Reference

1. Kalogerinis PT, Morfesis FA, Georgakila S, Georgakilas AG. Correction of anal prolapse associated with resolution of cloacogenic polyp lesions. Implications to anorectal cancer. J Biochem Tech 2009; 1(2):62-4.

2. Hanson IM, Armstrong GR. Anal intraepithelial neoplasia in an inflammatory cloacogenic polyp. J Clin Pathol 1999; 52(5):393-4.

3. Iacobuzio-Donahue, C.A, Montgomery,E.A. Epithelial neoplasms of the colorectum. 2nd ed. Philadelphia.

In:John R. Goldblum, editor. Gastrointestinal and liver pathology, ELSEVIER SAUNDERS; 2005.pg 410-40.

4. Calva-Rodriquez R, Gonzalez-Palafox MA, Rivera-Dominquez ME, Garcia-Salazar JM, CalvaCerqueria BcD. Inflammatory cloacogenic polyp. Rev Gastroenterol Mex. 2007; 72(4):371-5.

5. Poon KK, Mills S, Booth IW, Murphy MS. Inflammatory cloacogenic polyp: an unrecognized cause of hematochezia and tenesmus in childhood. J pediatr. 1997; 130(2):327-9.

6. Washington K, Rourk MH, McDonagh D, Oldham KT. Inflammatory cloacogenic polyp in a child: part of the spectrum of solitary rectal ulcer syndrome. Pediatr Pathol 1993; 13(4): 409-14.

7. Saul SH. Inflammatory cloacogenic polyp: Relationships to solitary rectal ulcer syndrome/ mucosal prolapsed and other bowel disorders. Human pathology 1987; 18(11): 1120-25.

8. Parfitt JR, Shepherd NA. Polypoid mucosal prolapse complicating low rectal adenomas: beware the inflammatory cloacogenic polyp! Histopathology.

2008; 53(1):91-6.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report A Rare Case of Extraovarian Granulosa Cell Tumor Presenting as a Retroperitoneal Mass Pranita Medhi*1 and Swagata Dowerah2 Department of Pathology, Assam Medical College, Dibrugarh, India

Keywords: Granulosa Cell Tumor, Extraovarian, Retroperitoneal

ABSTRACT Introduction: Granulosa cell tumors (GCT) are the most common malignant sex cordâ&#x20AC;&#x201D;stromal tumors of the ovary. Rarely, they can occur at extraovarian site with very few cases mentioned in literature.

Case history: A 45 yr old lady presented with pain abdomen and on ultrasonography, bilateral ovarian cyst was found. Patient underwent total abdominal hysterectomy with bilateral salpingoophorectomy and during surgery, a retroperitoneal mass was discovered which was excised. On gross examination, the mass measured 7x5x5cms, was solid with areas of hemorrhage and focal areas of necrosis . Microscopy showed solid sheets of cells with round to ovoid nuclei and scanty cytoplasm. Some of the cells showed nuclear grooves. A diagnosis of extraovarian adult granulose cell tumor was madeand immunostaining with inhibin was positive.

Conclusion: Extraovarian granulosa cell tumor needs to be kept in mind in a female patient with a retroperitoneal mass. This case is presented due to its rarity and also to emphasise the fact that these tumors are often missed in the pre operative evaluation of patients and need histopathology for proper diagnosis.

*Corresponding author: Dr. Pranita Medhi, Department of Pathology, Assam Medical College, Dibrugarh, India E-mail: pranita_medhi@yahoo.co.in

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

A Rare Case of Extraovarian Granulosa Cell Tumor

C-154

Introduction

Granulosa cell tumors (GCT) are the most common malignant sex cordâ&#x20AC;&#x201D;stromal tumors of the ovary.

Histopathological examination of GCT distinguish two subtypes: an adult type GCT that is found typically in older women and a juvenile type GCT that is recognized primarily in children and young adults.[1] Rarely, GCT can develop at an extraovarian site. In the English language literature, only a few numbers of cases have been presented so far. We present a case of a 45 year old female presenting with a retroperitoneal mass which was diagnosed as granulosa cell tumor on histopathology.

To the best of our knowledge, this is the 4th reported case of extraovarian granulosa cell tumor from India.

Case Report

A 45 year old lady presented to the gynaecology OPD with chief complains of pain in the abdomen which started 6 months back. Ultrasonography revealed bilateral ovarian cyst. Routine blood examination was within normal limit.

Surgery was performed for ovarian cyst during which a retroperitoneal mass was noted, separate from the ovaries. Patient underwent total abdominal hysterectomy with bilateral salpingoophorectomy along with removal of the retroperitoneal mass. A provisional diagnosis of retroperitoneal sarcoma was made and the specimen sent for histopathological examination. On gross examination, bilateral ovaries were cystic containing serous fluid.

An irregular tan coloured mass was received measuring 7x5x5cms. Cut section was solid with areas of hemorrhage and focal areas of necrosis. [Fig.1] Microscopic examination of sections from the ovaries showed serous cysts. Endometrium showed mild endometrial hyperplasia.

Sections from the mass showed solid sheets of cells with round to ovoid nuclei and scanty cytoplasm. Some of the cells showed nuclear grooves. Few mitotic figures were noted [Fig 2.3] A diagnosis of extraovarian adult granulosa cell tumor (diffuse type) was made on the basis of histomorphologic features. Immunohistochemistry showed positivity for inhibin confirming the diagnosis.

The patient is currently on follow up.

Fig. 1: Showing tumor mass along with the resected specimen of uterus and ovaries.

Fig. 2: Showing sheets of neoplastic granulosa cells in diffuse pattern( H&E, 40X)

Discussion

Granulosa cell tumors (GCTs) comprise 2%-5% of all ovarian tumors . [2] Recurrence or metastasis can be seen many years after initial treatment. Primary extraovarian GCT is an extremely rare tumor. [3] Due to the origin of sex cord from mesonephros, the ectopic gonadal stromal tissue is believed to be responsible for the histogenesis of extraovarian sex-cord stromal

Fig. 3: Showing cells round to ovoid nuclei, scanty cytoplasm and occasional mitotic figure(H&E,100X)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Medhi et al.

C-155

tumors. [4] According to the theory proposed by Motta and Makabe [5] both coelomic epithelium and mesonephros may contribute to the origin of pregranulosa cells. The influence of mesonephros in the origin of the sex cord explains why the sites of extraovarian sex-cord stomal tumors are limited to the broad ligament, retroperitoneum, and adrenals; all of these differentiate close to the mesonephros or the mesonephric duct [5].

The clinical signs and symptoms of extraovarian GCT , based on a study of cases published in literature, are similar to those of ovarian GCT. These symptoms include presence of a mass, irregular vaginal bleeding, postcoital bleeding, and hemiperitoneum. Extraovarian granulosa cell tumor have been seen to develop in retroperitoneum [6] [7] , broad ligament [8], mesentery, omentum, liver, adrenals, and so forth [6].

Several histologically similar tumors need to be differentiated from GCTs - these include undifferentiated carcinoma, small-cell or neuroendocrine carcinoma, endometrial stromal sarcoma, carcinoid, malignant melanoma, intraabdominal desmoplastic small-cell tumor [9] GCTs are characterized by immunopositivity for calretinin, melan-A, inhibin-alpha, and progesterone receptors and by negativity for EMA. In our case, the tumor was positive for inhibin. This along with characteristic histopathological features helped in clinching the diagnosis. Only three previous cases of extraovarian granulose cell tumor have been previously reported from India, to the best of our knowledge.[6][10][11]

Conclusion

It needs to be emphasised that it may be impossible to diagnose these cases in the preoperative work up of the patient and in such cases, it is only after surgery that we arrive at a diagnosis. Extraovarian granulosa cell tumor needs to be kept in mind in a female patient with a retroperitoneal mass. The prognosis for extraovarian sexcord stromal tumors seems favorable; however, long-term follow-up of these patients needs to be done.

Acknowledgements Nil

Funding None

www.pacificejournals.com/apalm

Competing Interests None

Reference

1. Geetha P, Nair MK. Granulosa cell tumours of the ovary. Aust N Z J Obstet Gynaecol 2010; 50: 216-20.

2. Schumer ST, Cannistra SA. Granulosa cell tumor of the ovary. J Clin Oncol. 2003;21(6): p. 1180-1189.

3. Kim SH, Park HJ, Linton JA, et al. Extraovarian granulosa cell tumour. Yonsei Med J. 2001;42(3): p.

360-360.

4. AG. B. Differentiation of mammalian embryonic gonad. Physiol Rev.. 1986;66(1): p. 71-117.

5. Motta PM, Makabe S. Germ cells in the ovarian surface during fetal development in humans. A threedimensional microanatomical study by scanning and transmission electron microscopy. J Submicrosc Cytol. 1986; 81: p. 271-290.

6. P. C. Paul, J. Chakraborty, S. Chakrabarti, B. Chattopadhyay. Extraovarian granulosa cell tumor.

Indian Journal of Pathology and Microbiology.

2009;52(2): p. 231-233.

7. M. Keitoku, I. Konishi, K. Nanbu, et al., “. Extraovarian sex cord-stromal tumor: case report and review of the literature. International Journal of Gynecological Pathology. 1997;16(2): p. 180-185.

8. Y. Sakai. Granulosa cell tumor arising in the wall of müllerian cyst of the broad ligament: report of a case and immunohistochemical study. Archives of Gynecology and Obstetrics. 2007;275(2): p. 145-148.

9. Young RH, Schully RE.. Sex cord-stromal, steroid cell, and other ovarian tumors with endocrine, and paracrine manifestations. In RJ K, editor. Blaustein’s Pathology of the Female Genital Tract, 4th ed. New York: Springer-Verlag; 1995. p. 791-793 10. Manjiri R. Naniwadekar and N. J. Patil, “Extraovarian Granulosa Cell Tumor of Mesentery: A Case Report,”Pathology Research International, vol. 2010, Article ID 292606, 3 pages, 2010. doi:10.4061/2010/292606 11. Neeli, S. I. and P. R. Malur. (2010). “Primary Retroperitoneal Extraovarian Granulosa Cell Tumor: A Case Report.”UroToday Int J 3(6).

eISSN: 2349-6983; pISSN: 2394-6466

Case Report Accelerated Phase of Chediak Higashi Syndrome: An Unusual Case of Pancytopenia Manjari Kishore*, Sadhna Marwah, Vijay Kumar, Pooja Suteri and A.S. Nigam Dept of Pathology, PGIMER, Dr. RML Hospital, New Delhi, India Keywords: Accelerated Phase, Bone Marrow, Chediak Higashi, Leukocytes, Pancytopenia.

ABSTRACT Chediak Higashi Syndrome (CHS) is a rare and fatal disease with varied clinical features and laboratory findings.

Early diagnosis can be made by screening the blood smear and bone marrow for giant granules in leukocytes.

Accelerated phase has poor prognosis. Hematopoietic stem cell transplantation (HSCT) has good role, if done in early stage of disease. Hence, a prompt and accurate diagnosis should be given, so that timely intervention can be done. The present case highlights an accelerated phase of CHS in an infant presenting for the first time with recurrent infections and organomegaly.

*Corresponding author: Dr. Manjari Kishore, Senior Resident, Dept. Of Pathology, PGIMER, Dr. RML Hospital, New Delhi. India Phone: +91 8105104471 E-mail: drmanjarik@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

Kishore et al.

C-157

Introduction

Chediak Higashi Sydrome (CHS) is a rare autosomal recessive and fatal congenital disorder characterized by blonde hair, recurrent infections, ocular abnormalities, bleeding diathesis and neurological impairment along with abnormally large granules in leukocytes. Accelerated phase of the disease has poor prognosis and is infrequent to notice this phase at initial presentation [1]. Diagnosis is made on the basis of clinical features, hair analysis and identification of characteristic giant azurophilic granules in white blood cells in peripheral smear and bone marrow aspirate/ biopsy. Herein, we present a case of an infant with CHS presenting in accelerated phase.

Case Report:

A 1 year old male child presented with complaints of fever for one and a half months, abdominal distension for 10 days and bleeding from ear for 2 days. He also had a history of repeated episodes of loose stools for last six months and one episode of melaena. History of febrile illness at 9 and 11 month of age was also given by the parents, nature of which was not known. The child was product of non-consanguineous marriage (single child from second marriage). The mother’s first husband died due to brain tumor (she had three children from the first marriage- one alive 11 year old female child, the other two siblings died; however, the cause of death was not known). The patient also had history of tuberculosis contact. On examination, child had pallor, silver-grey hair, hypopigmentation in iris and also over face, trunk, abdomen and limbs along with massive hepatosplenomegaly (Fig 1-2).

Blood examination showed pancytopenia with hemoglobin-8.9gm/dl, total leukocyte count -2200/µL and platelet count-30,000/µL (Fig 3). Red blood cells showed mild to moderate anisopoikilocytosis with predominantly microcytic hypochromic picture. Neutrophils showed presence of coarse, large eosinophilic granules (Fig 4, 5 B). Coarse granules were also seen in lymphocytes & some monocytes (Fig 3, 5 A). Bone marrow examination revealed maturing cells of myeloid series with presence of coarse large round, eosinophilic granules. An evidence of hemophagocytosis was also noted.

Fig. 1: Child with abdominal hypopigmented areas (red arrow).

distension

and

Fig. 2 A & B: Child presented with silvery grey hair.

Ultrasound of the abdomen revealed hepatosplenomegaly.

Biochemical investigations showed increased levels of serum triglycerides and serum ferritin. Histological examination of hair shafts showed evenly distributed melanin granules of regular diameter that were bigger than those seen in normal hair. On the basis of clinical details along with biochemical, hematological and radiological findings, a diagnosis of “Accelerated phase of Chediak Higashi syndrome” was made.

Fig. 3: Peripheral smear from child with CHS showing pancytopenia and lymphocyte showing granule in cytoplasm (Giemsa X100).

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-158

Accelerated Phase of Chediak Higashi Syndrome

Fig. 4: Neutrophil showing giant granules in cytoplasm (Giemsa X200).

Fig. 5 A & B: Granules in WBCs (monocyte & neutrophil) in Peripheral smear from child with Chediak Higashi Syndrome (Giemsa X400).

Discussion

aureus and Streptococcus species. Strict hygiene should be maintained to prevent any further infection. Platelet transfusion is given for treatment in accelerated phase, if the patient presents with bleeding episodes. Hence, drugs interfering with platelet function should be avoided. The child in present case had an episode of melaena before being admitted to hospital.

Chediak Higashi Syndrome is a rare disorder affecting multiple system of body characterized by partial oculocutaneous albinism, severe immune deficiency resulting in recurrent infections, pathognomonic abnormal giant granules in neutrophils, lymphocytes, monocytes, platelets and an accelerated lymphohistiocytic phase. It is an autosomal recessive disease, both parents contributing a defective gene to the child to show symptoms. This disorder is seen in children but rare cases have been reported in adults [2].

This disease entity was first described by Beguez Cesar in 1943, in three siblings presenting with neutropenia and abnormal granules in leukocytes [3]. In 1952, Chediak (Cuban hematologist), described the full clinical and hematological features and in 1954, Higashi (Japanese pediatrician) discovered the Sudan block B (SBB) positivity for inclusion [3, 4].

The age of onset is usually 4-10 years, mean age being 6 years and most of the children die before age of 10. Even if child is alive, he/she will develop neurological problems [5].

This disease is described in 2 phases, i.e. chronic (stable) and accelerated (progressive). In stable patients, there is history of repeated infection. Accelerated phase of this disease can occur shortly after birth or may occur years later. In children, who develop accelerated phase, later in life, complication like olivo-cerebellar degeneration and amyloid deposits may also occur [5].

In the case presented here, the child was just one year old and presented in accelerated phase of the disease, however, no neurological impairment was noted in the child. The patient presenting in chronic phase present with recurrent bacterial skin infection with Staphylococcus

Role of Ebstein Barr Virus is also implicated in the accelerated phase, causing persistent lymphoproliferation resulting in leukemia/ lymphoma, just like in accelerated phase of disease [6]. As the presentation of the patients with CHS is vague and non-specific, clinically, sometimes, there can be confusion with leukemia/ lymphoma.

Nargund et al reported a similar case of CHS, where the initial clinical diagnosis given was leukemia/ lymphoma [6] . Hemophagocytic syndrome (HPS) is an important consideration to be kept in mind while assessing CHS. The accelerated phase is seen in 85% of individuals affected with CHS [7]. The diagnosis of accelerated phase is done according to the guidelines of Histiocytic Society last revised latest in 2004 [7]. This is based on the presence of a genetic defect like mutation in LYST gene done by sequence analysis or five of the following 8 features: 1.

2.

3.

4.

5.

6.

7.

8.

History of unexplained, persistent or recurrent fever Splenomegaly Cytopenias (in any 2 of lineage) Hypertriglyceridemia and/ hypofibrinogenemia Evidence of hemophagocytosis in bone marrow Low or absent NK cell activity Elevated serum ferritin levels (>500 microgram/L) Elevated CD25 levels (> 2400 U/ mL)

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Kishore et al.

In the present case, diagnosis of accelerated phase of CHS was given as the patient presented with persistent fever, diarrhoea, ear bleed, discolouration of face, trunk , abdomen, limbs , blonde hair, hypopigmentation of eyes, increased serum ferritin levels, hypertrygyceridemia and hepatosplenomegaly with characteristic peripheral smear and bone marrow findings.

In CHS, the characteristic feature is presence of huge lysosomes and cytoplasmic inclusions within different hematopoietic cells like WBCs. Molecular defect seen is the abnormality in granule morphogenesis which is due to mutation of lysosomal trafficking gene 2, termed as CHS1/ LYST gene and located on long arm of chromosome 1 (1q). This results in abnormality in function of lysosomal trafficking regulator protein and ultimately affecting the size and function of lysosomes. Accelerated phase of CHS has usually an unfavorable prognosis resulting in fatal outcome. The causes of death are usually infection and bleeding. Ideally, allogeneic bone marrow transplantation is the treatment of choice for patient diagnosed early with CHS, especially in chronic phase or if the patient is in remission [11]. Results are not effective in accelerated phase of the disease. Treatment given is supportive management with appropriate antibiotic, antiviral therapy, ascorbic acid and management of complications with platelet transfusion.

Some trials for etoposide, steroid, intrathecal methotrexate have also been done [7]. Parental screening for this disease is also important using blood smear. Prenatal screening can be done by showing lysosomal phosphatase positivity in amniocytes, chorionic villous sampling [8].

Giant granules can also be noted in AML/ CML and are termed as Pseudo-CHS anomaly [7, 8]. The other diseases which show few of the similar features as CHS are Prader Willi and Angelman, presenting with hypopigmentation but no ophthalmic albinism. However, few of the genetic disorders show oculocutaneous albinism like Griscelli syndrome & Hermansky-Pudlak syndrome, but in both these diseases no giant granules are noted. Considering the clinical, peripheral blood and bone marrow cytomorphological findings, few differential diagnoses which can be considered in the present case have been tabulated below (Table 1) [7, 8].

C-159 Table 1 Differential diagnosis for Chediak Higashi Syndrome Chediak Higashi Elejalde Griscelli Syndrome disease disease Mode of inheritance

Autosomal recessive (AR)

AR

AR

Recurrent infection & immune defect

Present

Absent

Present

Accelerated phase

Present

Absent

Present

Giant leukocytic granules

Present

Absent

Absent

Conclusion

Chediak Higashi Syndrome is a rare inherited hematological disorder of neutrophil function defect in paediatric age group. The presence of characteristic clinical profile and characteristic cytomorphological findings in peripheral smear and bone marrow aspirate smears is important for the diagnosis of CHS in the accelerated phase. As it is an autosomal recessive condition screening the family members can help detect the disease. Molecular testing for CHS1 gene, if available, is helpful for prenatal diagnosis in suspected cases. Hematopoietic Stem Cell Transplantation (HSCT) is the only curative treatment. Early stem cell transplant offers better survival and cure.

Acknowledgements None

Funding None

Competing Interests None Declared

Reference

In the present case, the child had recurrent infections and giant leukocytic granules in peripheral smear and bone marrow aspirate, which helped in differentiating CHS from the other diseases as mentioned above (Table No.1). Based on the clinical, biochemical, hematological and radiological investigations, a diagnosis of accelerated phase of CHS was made. As stem cell transplantation is the definitive treatment for this case, child was given supportive management and advised for marrow transplantation.

1. Roy A, Kar R, Basu D, Srivani S, Badhe BA. Clinicohematological profile of Chediak Higashi: experience from a tertiary care center in south India. Indian J Pathol Microbiol 2011;54:547–51.

2. Kaplan J, De Domenico I, Ward DM. Chediak-Higashi syndrome. Curr Opin Hematol 2008; 15:22-9.

3. Beguez-Cesar A. Neutropeneiacronicamaligna familiar con granulaciounesatipicas de los leucocitos.

Bol Soc Cubana Pediatr 1943;15:900–22.

4. Chediak MM. New leukocyte anomaly of constitutional and familial character. Rev Hematol 1952;7:362–7.

5. Tardieu M, Lacroix C, Neven B, Bordigoni P, de Saint Basile G, Blanche S, et al. Progressive neurologic

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-160

Accelerated Phase of Chediak Higashi Syndrome

dysfunctions 20 years after allogeneic bone marrow transplantation for Chediak- Higashi syndrome. Blood 2005; 106:40-2.

6. Nargund AR, Madhumathi DS, Premalatha CS, Rao CR, Appaji L, Lakshmidevi V. Accelerated phase of Chediak-Higashi syndrome mimicking lymphoma: a case report. J Pediatr Hematol Oncol 2010; 32:e223-6.

7. Eapen M, DeLaat CA, Baker KS, Cairo MS, Cowan MJ, Kurtzberg J, et al. Haematopoietic cell transplantation for Chediak-Higashi syndrome. Bone Marrow Transplant 2007; 39:411-5.

8. Diukman R, Tanigawa S, Cown MJ, Globus MS. Prenatal diagnosis of Chediak- Higashi Syndrome.

Prenat Diagn. 1992;12(11):877-85.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report Synchronous Tumors of Endometrium and Bilateral Fallopian Tubes: A Rare Case Report Dr Ashmeet Kaur*, Dr Mansi Faujdar and Dr Shubha Gupta Dept. of Pathology, Santokba Durlabhji Memorial Hospital, Jaipur, India Keywords: Synchronous Tumors, Fallopian Tube, Endometrium, Primary, Carcinoma

ABSTRACT Although the simultaneous presentation of fallopian tube and ovarian carcinoma is well described, little is known about a similar phenomenon involving the fallopian tube and endometrium . We present a rare case of synchronous primary endometrial and bilateral fallopian tubes carcinoma seen in the Department of Pathology at Santokba Durlabhji Hospital, Jaipur. Fallopian tube tumors that could have represented luminal extension of the endometrial carcinoma or that represented an unequivocal metastasis to the fallopian tube were excluded.

*Corresponding author: Dr Ashmeet Kaur, Senior Resident, Dept. of Pathology, Santokba Durlabhji Memorial Hospital, Jaipur, India E-mail: ashmeetkochar@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

C-162

Synchronous Tumors

Introduction

The primary fallopian tube carcinoma is a rare gynaecologic malignancy with the rates reported in the literature ranging from 0.1 to 1.8% .[1] Though mutations of p53,[2] and loss of heterozygosity at several loci on chromosome 13q play a role in the pathogenesis of BRCA1 related ovarian and fallopian tube cancer ,[3] no such association is documented for synchronous endometrial carcinoma and fallopian tube carcinoma. The occurrence of synchronous endometrial and bilateral fallopian tubes carcinoma is very rare, with only a few cases documented in literature so far.[4,5-8] Synchronous multiple tumors of female genital tract are relatively rare comprising only 1-6% of genital neoplasms.

We present a rare case of a 60 year old postmenopausal woman operated by radical hysterectomy for endometrial carcinoma .Fallopian tubes on both sides also showed endometroid tumor within its lumen, thereby manifesting synchronous adenocarcinoma-endometroid type in uterus & bilateral fallopian tubes (with no direct communication between them).

Fig. 1: Endometrial adenocarcinoma , endometroid type involving the endometrial cavity (H &E, 10X)

Case Report

A 60 year old post menopausal female (Parity index – G2P2L2), presented with the complaints of white discharge and abdominal pain since 1 year duration. The abdominal pain was a dull ache in the right lower abdomen, which radiated to the back. On physical examination her BP was 140/80; her Body Mass Index (BMI) was 35. There was no history of fever and chills. The abdominal examination revealed tenderness in the right iliac fossa and there was no ascites. The general and other systemic examinations were unremarkable. The per-vaginal examination revealed a retroverted uterus and tenderness noted in the right fornix and the left fornix showed motion tenderness.

On investigations, hemoglobin was 7g/dl, total leucocyte count was 4.6×103 /µl, and platelet count was 1.5lakh/ mm3. Sagittal T2-weighted MRI image showed a tumor of cervix that extended into the uterine cavity and had no lateral extension. A pelvic Ultrasound (US) was conducted reporting a 10-mm endometrial thickening.

Subsequently endometrial biopsy was carried out which confirmed Invasive adenocarcinoma. Thereafter the patient underwent total hysterectomy with bilateral adnexa and bilateral pelvic lymph nodes.

On cutting, uterine canal was dilated & full of growth measuring 5x3x1.5cms. On microscopic examination it was diagnosed as moderately differentiated AdenocarcinomaEndometroid Type. The growth was superficially invading the myometrium (less than half the thickness of myometrium).

Fig. 2a: Proximal end of one fallopian tube which is unremarkable (H &E, 4X). Fig 2b, Proximal end of other fallopian tube which is unremarkable (H &E, 4X) Fig 2c, Middle part of one fallopian tube showing endometroid carcinoma (H &E, 10X) Fig 2d, Middle part of other fallopian tube showing carcinoma in situ changes (H &E, 10X)

Each fallopian tube was dilated .Serosal surface was unremarkable.On opening, a well defined nodule measuring 1×1 and 0.5×1cm is seen in both the tubes.

On microscopic examination, both fallopian tubes showed tumor with features of endometroid carcinoma with adjoining epithelium showing carcinoma in situ.

The tumor was superficially invading the muscle layer.

Although the proximal part of both fallopian tubes were unremarkable. Bilateral ovaries were unremarkable. Both sided parametrium and vaginal cuff were negative for the presence of tumor. All lymph nodes showed features

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Kaur et al.

C-163

of reactive hyperplasia and were negative for metastasis.

There was no lymphatic or vascular permeation. Final FIGO staging for endometrium was stage1A and fallopian tubes as 1B. Case was opined as Synchronous Adenocarcinoma - Endometroid type in uterus & bilateral fallopian tubes (with no direct communication between them)

Discussion

The occurrence of synchronous primary endometrial and fallopian tube carcinomas is very rare, with only a few cases documented in the literature.[4,6,7,8] Patients are usually postmenopausal, obese and nulliparous.[4,8] The main symptoms are abdominal pain, vaginal bleeding and palpable pelvic mass.[4,7,8] In our case, the patient was postmenopausal and presented with white discharge.

The mechanism of multiple primary cancers is not fully known, but many hypotheses have been suggested, such as family history, immunologic and genetic defects, prolonged exposure to carcinogens, radiation and chemotherapy for the primary cancer. While the etiology and pathogenesis of these tumors remain unclear, it has been proposed that embryologically similar tissues, when simultaneously subjected to either hormonal influences or carcinogens may develop synchronous neoplasms in genetically susceptible individuals.[9] Eifel et al suggested that the response of uterine corpus, fallopian tubes, and ovarian epithelium as a morphological unit could explain the development of synchronous endometroid tumors in different components of mullerian system.[10,11] The theory of ‘‘secondary Mullerian system’’ proposed that the epithelia of cervix, uterus, fallopian tubes, ovaries, and peritoneal surface had shared molecular receptors responding to carcinogenic stimulus leading to the development of multiple primary malignancies synchronously[6,11-14]. The hypothesis could provide explanation to synchronous malignancies of similar histology. The epithelial linings of endometrium, fallopian tubes, ovaries and peritoneum have molecular receptors ( the so called secondary Mullerian system)responding to the same carcinogenic stimulus and therefore development of synchronous primary tumors of similar histology.[12-14]

phenomena may be associated with the development of malignancies arising simultaneously in genital tissues.

[6,11,16-19]

The diagnostic criteria for synchronous tumors include either the detection of similar histological subtypes or all of the following rules if histologic subtypes are similar; (1)both tumors confined to primary sites,(2)no direct extension between tumors, (3) no lymphovascular tumor emboli, (4) no or only superficial myometrial invasion ,(5) no distant metastasis.[20-22] In our case, the endometrium and fallopian tube carcinomas both showed similar histopathology - adenocarcinoma (endometroid type). However, extension to fallopian tube from endometrial carcinoma was ruled out considering the fact that there was no direct extension of the endometrial tumor to the tube as the proximal part of the fallopian tubes on both sides was unremarkable histologically, there being a gap of about 2 cms. There was no serosal involvement of the fallopian tube. Lesion was arising as a discrete nodule from the tubal mucosa projecting into the lumen, distending the lumen and metastasis was ruled out as the fallopian tube lining and endometrium showed carcinoma in situ changes. Thus, both were considered as primaries.

Conclusion

Synchronous tumors of bilateral fallopian tubes and endometrium are very rare. It is very important for a pathologist to sample extensively all components of hysterectomy specimen for diagnosis of synchronous tumors and to confidently identify all tumors as primary neoplasms. Overall survival and treatment would vary considerably as multiple primary neoplasms of endometrium and bilateral fallopian tubes have good prognosis in terms of survival as compared to single primary with metastatic disease. The prognosis for these synchronous early stage tumors is good.

Acknowledgements

The authors declare no conflict of interest.

Funding None

A similar phenomenon may also be valid for tubal endometrioid lesions. Culton et al 4 published 13 cases of synchronous independent primary endometrial and tubal carcinomas.

Competing Interests

It is also possible that the synchronous presence of these cancers is an indicator of an etiologically distinct condition.

[8,16] Perhaps patients have a more fragile genome and prior genetic damage may predispose them to synchronous cancers.[8,16-18] Thus, embryologic, hormonal or other

1. Ghosh S, Goyal P, Sehgal S, Shukla P, Kumar A, Singh S. Journal of Gynecologic Surgery. April 2014, 30(2): 111-113. doi:10.1089/gyn.2013.0075..

2. Barbara MN, Rochelle LG, Kimberly HA, Chris H. Jokinen, Lauren E. Kernochan, Catherine C. Pizzi.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

None Declared

References

C-164

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

Synchronous Tumors

The Molecular Pathogenesis of Hereditary Ovarian Carcinoma: Alterations in the Tubal Epithelium of Women with BRCA1 and BRCA2 Mutations. Cancer 2010; 116(22): 5261–5271.

Jongsma APM, Piek JMJ, Zweemer RP, et al.

Molecular evidence for putative tumour suppressor genes on chromosome 13q specific to BRCA1 related ovarian and fallopian tube cancer . J Clin Pathol: Mol Pathol 2002;55:305–309 Culton LK, Deavers MT, Silva EG, Liu J, Malpica A. Endometrioid carcinoma simultaneously involving the uterus and the fallopian tube: a clinicopathologic study of 13 cases. Am J Surg Pathol 2006; 30:844-9.

Wang H, Xiao SS, Zeng F. Synchronous primary endometrial and fallopian tube cancers: one case report. J South Med Univ 2011; 31(12):2093-4.

Eisner RF, Nieberg RK, Berek JS .Synchronous primary neoplasms of female reproductive tract.

Gynecol Oncol 1989; 33:335.

Baekelandt M, Jorunn Nesbakken A, Kristensen GB, Trope CG, Abeler VM. Carcinoma of the fallopian tube. Cancer 2000;89:20-76.

Terzakis E, Androutsopoulos , Grigoriadis C, et al.

Synchronous primary endometrial and fallopian tube cancers. Eur J Gynaecol Oncol 2010 ; 31(4) : 467-8.

Tong Seo-Yun , Sek Lee Yong,Park Jong Sup, et al.Clinical analysis of synchronous neoplasms of female reproductive tract .European Jrnl of Obs and Gyn and reproductive biology . 2008; 136: 78-82.

Parazini,La Vechia C,Bocciolone L et al.The epidemiology of endometrial cancer.Gynecol Oncol.1991;41:1-16 Eifel P, Hendrickson M, Ross J, Ballon S, Martinez A, Kempson R. Simultaneous presentation of carcinoma involving the ovary and the uterine corpus. Cancer 1982;50:163–70.

Lauchlan SC. The secondary Mu¨ llerian system.

Obstet Gynecol Surv 1972;27:133–46.

13. Sica V, Nola E, Contieri E et al. Estradiol and progesterone receptors in malignant gastrointestinal tumors. Cancer Res 1984;44:4670–4.

14. Chiang YC, Chen CA , Huang CY, Hsieh CY, Cheng WF. Synchronous primary cancers of the endometrium and ovary . Int J Gynecol Cancer 2008; 18: 159–164 15. Kambi Deepthi P, Mallikarjuna M N, Santosh CS, Abhishek V. Synchronous malignancies of ovary, fallopian tube and cervix- A rare case. Intl J of Biomed and Adv Research 2013; 4:9.

16. Herrinton LJ, Voigt LF, Weiss NS, Beresford SA, Wingo PA. Risk factors for synchronous primary endometrial and ovarian cancers. Ann Epidemiol 2011;11:529.

17. Androutsopoulos G, Adonakis G, Tsamantas A, et al . Synchronous primary cancers in a woman with scleroderma:a case report.Euro J Gynaecol Oncol 2008 ;29:548.

18. Palm L, Marcus V, Gilbert L, Chong G, Foulkes WD. Synchronous occult cancers of the endometrium and fallopian tube in an MSH2 mutation carrier at time of prophylactic surgery.Gynecol Oncol 2008;111:575.

19. Woodruff JD, Solomon D, Sullivant H. Multifocal disease in the upper genital canal. Obstet Gynecol 1985;65:695.

20. Ulbright T, Roth L. Metastatic and independent cancers of the endometrium and ovary: a clinicopathologic study of 34 cases. Hum Pathol. 1985; 16 :28– 34.

21. Scully RE, Young RH, Clement PB. Tumors of the ovary, maldeveloped gonads, fallopian tube, and broad ligament. Atlas of tumor pathology. Bethesda, MD: Armed Forces Institute of Pathology. 1998.

22. Ree YS, Cho SH, Kim SR, et al. Synchronous primary endometrial and ovarian cancer with three different histologic patterns: a case report. Int J Gynecol Cancer.

2003, 13, 678–682.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Case Report A Rare Case of Renal Pelvis Urothelial Carcinoma in Situ Associated with Hydronephrosis and Atrophic Kidney Neeraj Dhameja, Vikas Kailashiya and Vikash* Dept. of Pathology, Institute of Medical Sciences ,BHU Varanasi, India Keywords: Urothelial Carcinoma in Situ; Atrophic Kidney; Hydronephrosis; Renal Stone

ABSTRACT Urothelial tumours involving the renal pelvis or ureter are relatively uncommon, accounting for about 5% to 7% of all renal tumours and about 5% of all urothelial tumours. Main risk factors for urothelial tumors include smoking, high tea intake and long term use of certain analgesic like phenacetin.

Upper urinary tract urothelial tumors can be associated with renal stone disease or hydronephrosis but association is rare with only few case reports.

Upper urinary tract tumors associated with renal stone and hydronephrosis are often missed in urine cytological examination and ultrasound. Therefore it is important to carefully examine the gross specimen and microscopy, keeping in mind the possibility of upper urinary tract tumors in such cases.

Here we report a case of renal pelvis urothelial carcinoma in situ associated with hydronephrosis and atrophic kidney for its rarity.

*Corresponding author: Dr Vikash, Room no-204, Sushruta Hostel, Trauma center, BHU Varanasi, U.P.-221005, INDIA Phone: +91 7704094687 E-mail: mail-vikas25187@gmail.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

C-166

Renal Pelvis Urothelial Carcinoma in Situ

Introduction

Urothelial tumors involving the renal pelvis or ureter are relatively uncommon, accounting for about 5% to 7% of all renal tumors and about 5% of all urothelial tumors.

[1] It accounts for more than 90% of renal pelvic tumors.

Other carcinoma type include squamous cell carcinoma and adenocarcinoma which are rare. Urothelial neoplasm have sequence of dysplasia, carcinoma in situ and invasive malignancy.[2] Carcinoma in situ is a neoplastic change of urothelium without breach of basement membrane. It is considered a high grade neoplasm and require specific treatment.[3] It occurs more commonly in elderly males. Risk factors include smoking, high tea intake and long term use of analgesic like phenacetin.[4] Although rare, upper urothelial tumors can be associated with renal stone disease and hydronephrosis.

Here we report a case of renal pelvis urothelial carcinoma in situ associated with hydronephrosis and atrophic kidney for its rarity.

Case Report

In this case a 55 year male patient presented with left sided loin pain and 3-4 episodes of intermittent gross hematuria and there were no other significant urinary complains. There was no history of chronic analgesic intake or smoking.

On examination there was no suprapubic fullness, abdominal tenderness or prostatic enlargement. Urine examination and other biochemical parameters were within normal limits.

Ultrasound was performed which showed grossly enlarged hydronephrotic left sided kidney with dilated ureter and multiple ureteric calculi (Fig 1). On right side there was large stag horn calculi with only mild hydronephrosis.

Subsequently, DTPA renal scan was done to check kidney function. On left side kidney was enlarged hydronephrotic and practically non-functioning. Ride side kidney was normal in size with normal parenchymal function and nondrainage pattern.

Patient first underwent right sided PCNL to remove renal stone to prevent further damage to right side kidney followed by left sided nephroureterectomy after 3 months to remove non functioning left sided kidney.

We received formalin fixed left nephroureterectomy specimen measuring 11x9x5cm. Cortex was thinned out and kidney showed marked hydronephrotic change and atrohphy of normal renal parenchyma. Entire kidney was converted into a cyst like structure (Fig. 2). There was attached ureter of 12cm in length without cuff of urinary bladder. Cyst and ureter both were filled with brownish material and pelvis mucosa was erythematous.

Microscopic examination revealed reduced normal renal parenchyma with dense lymphomononuclear infiltrate, few sclerosed glomeruli, atrophic tubules and dilated palvicalyseal system which was lined by markedly dysplastic urothelial lining (Fig 3a). Cells showing loss of polarity, high nuclear cytoplasmic ratio, nuclear hyperchromasia, pleomorphism involving whole thickness of urothelium (Fig. 3b,3c,3d). Multiple section were examined and none of them showed invasive foci. Lumen was filled with hemorrhagic and necrotic material and ureteric stump was free of tumor.

Because marked reactive changes can also mimic dysplastic cells, we performed immunohistochemistry Ki67 and p53 to check cell proliferation and neoplastic change. Ki67 and p53 are considered the progression marker of tumor and are useful to rule out reactive changes3. According to studies Ki67 and p53 are expressed in <5% of only basal layer of cells. Expression in whole thickness and in >10% of basal cells usually confirm high grade malignancy or carcinoma in situ5. In our case both Ki67 and p53 showed increased expression beyond basal layer cells (Fig.4a,4b).

Based on these morphological and immunohistochemistry features a diagnosis of urothelial carcinoma in situ with hydronephrosis and atrophic kidney was given. Because finding of carcinoma in situ was incidental and no bladder cuff was removed along with ureter we advised close follow up of patient.

Discussion

Very few case report has been described having urothelial malignancy in non-functioning with nephrolithic kidney.

Wani et al.[1] described a similar case report of Rare upper urothelial malignancy in non-functioning nephrolithic kidney.

Frequency of neoplastic lesion in renal pelvis and ureter are approximately similar, but only 1/10th as common as bladder counterpart.[6,7] Ninety-five percent of neoplasm are of epithelial origin and in that around 80% are malignant.

Common benign epithelial lesion include urothelial papilloma and inverted papilloma; while common malignant epithelial lesions are urothelial carcinoma, squamous carcinoma and adenocarcinoma. Urothelial carcinoma account for 90% of these cases.[8] Urotheilal neoplasm have sequence of dysplasia, carcinoma insitu and invasive malignancy.[2] Carcinoma insitu is the neoplastic change of the epithelium without breach of basement membrane. It is considered a high grade neoplasm and require specific treatment.[3] It is seen that mucosa adjacent to invasive pelvic and ureteral tumors is dysplastic in 95% of specimen which also

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Dhameja et al.

Fig. 1: Ultrasound showing left kidney hydronephrosis.

C-167

Fig. 2: Gross specimen showing markedly pelvicalyseal system and thinned out cortex.

dilated

Fig. 3: Low power view showing atrophic kidney with sclerosed glomeruli, thick walled blood vessels and dysplastic urothelium. (40X)(a). Figure showing full thickness severely dysplastic urothelial cells 100X (b), 400X (c,d)

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

C-168

Renal Pelvis Urothelial Carcinoma in Situ

Fig. 4: Immunohistochemisty showing increased expression of Ki67 (200X)(a)and p53 (400X) (b) in superficial layer.

support this progressive change. The severity of dysplasia correlate with the grade of adjacent tumor and identifies patient at risk of metachronous tumours of other sites.[9-12] Carcinoma in situ occur more commonly in elderly males.

[13,14] They can present with hematuria or loin pain.[15] Our patient also had complain of left sided loin pain and 3-4 episodes of intermittent gross hematuria. Risk factors include smoking, high tea intake and long term use of analgesic like phenacetin.[4] There were no such history in this patient. In our case probable cause of neoplastic change was long standing renal pelvic stone with hydronephrosis due to chronic irritation. This association is rare and only few cases are reported. Upper urinary tract tumors associated with renal stone and hydronephrosis are often missed in urine cytological examination because degenerative changes in cells produced by chronic irritation of epithelium. We have performed urine cytology which did not show any abnormalities. As patient underwent nephroureterectomy on left side to remove non functional kidney, there was no suspicion of neoplastic pathology and bladder cuff was not removed. Only after microscopic examination we found sever dysplastic changes of renal pelvis epithelium amounting to carcinoma insitu. Therefore it is important to carefully examine the urine sample, gross specimen and microscopy, keeping in mind the possibility of upper urinary tract tumors in such cases, so that better treatment and follow up can be provided to these patients.

Prognosis is usually excellent if patient with carcinoma insitu is treated with radical nephroureterectomy.

The gold standard of treatment for patients with upper urinary tract urothelial neoplasm and normal contralateral kidney is complete nephroureterectomy with removal of cuff of urinary bladder. It is important to remove the

cuff of urinary bladder due to high rate of ureteral stump recurrence, which has been reported to be between 3075%.[16] In our case bladder cuff was not removed because carcinoma in situ was detected incidentally after surgery.

Therefore close follow up of patient was advised.

Conclusion

Although rare renal pelvic stone with hydronephrosis and atrophic kidney can be associated with neoplastic transformation of epithelium, therefore it is important to keep in mind the possibility of such association with proper preoperative investigation especially urine cytology and CT/MRI scan, so that appropriate treatment can be provided to patient.

Acknowledgements No

Funding None

Competing Interests None Declared

Reference

1. Wani B, Bhole A, Yeola M, Rathod V. Rare upper urothelial malignancy in non-functioning nephrolithic kidney .The Internet Journal of Urology 2008; 6(1).

2. Cheng L, Cheville JC, Neumann RM, Bostwick DG Natural history of urothelial dysplasia of the bladder m J Surg Pathol. 1999 Apr;23(4):443-7 3. MallofrĂŠ C, Castill M, Vanesa M, Manel S. Immunohistochemical Expression of CK20, p53, and Ki-67 as Objective Markers of Urothelial Dysplasia Mod Pathol. 2003;16(3):187â&#x20AC;&#x201C;191

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September 2016

Dhameja et al.

4. McLaughlin JK, Blot WJ, Mandel JS, et al. Etiology of cancer of the renal pelvis. J Natl Cancer Inst. 1983; 71: 287–291.

C-169

9. McCarron JP Jr, Chasko SB, Gray GF Jr. Systematic mapping of nephroureterectomy specimens removed for urothelial cancer: pathological findings and clinical correlations. J Urol. 1982; 128: 243–246.

10. Heney NM, Nocks BN, Daly JJ, et al. Prognostic factors in carcinoma of the ureter. J Urol. 1981; 125: 632–636.

11. Nocks BN, Heney NM, Daly JJ, et al. Transitional cell carcinoma of renal pelvis. Urology 1982; 19: 472–477.

12. Nielsen K, Ostri P. Primary tumors of the renal pelvis: evaluation of clinical and pathological features in a consecutive series of 10 years. J Urol.1988; 140: 19–21.

13. Mazeman E. Tumours of the upper urinary tract calyces, renal pelvis and ureter. Eur Urol .1976; 2: 120–126.

14. Guinan P, Vogelzang NJ, Randazzo R, et al. Renal pelvic cancer: a review of 611 patients treated in Illinois 1975– 1985. Cancer Incidence and End Results Committee. Urology 1992; 40: 393–399 15. Kirkali Z, Tuzel E. Transitional cell carcinoma of the ureter and renal pelvis. Crit Rev Oncol Hematol. 2003; 47: 155–169.

16. Kalyan CL, Christopher RP. Treatment of Upper Tract Urothelial Carcinoma: A Review of Surgical and Adjuvant Therapy.Rev Urol.2006;8(2):61-70.

www.pacificejournals.com/apalm

eISSN: 2349-6983; pISSN: 2394-6466

5. Hui Y, Anthony S,Leong Y. Histologic Grading of Noninvasive Papillary Urothelial Tumor. Am J Clin Pathol. 2004;121(5) 6. Booth CM, Cameron KM, Pugh RC. Urothelial carcinoma of the kidney and ureter. Br J Urol 1980; 52: 430–435.

7. McCarron JP, Mills C, Vaughn ED Jr. Tumors of the renal pelvis and ureter: current concepts and management.Semin Urol.1983; 1: 75–81.

8. Bennington JL, Beckwith JB. Atlas of tumor pathology, second series, fascicle 12, tumors of the kidney, renal pelvis, and ureter. Armed Forces Institute of Pathology. United States Government Press 1975

Letter to Editor Lymphocytoma Cutis on Fine Needle Aspiration Cytology Shailaja Shukla*1, Mona Bargotya1, Geetika Sharma1, Taru Garg2 1 Department of Pathology, Lady Hardinge Medical College, New Delhi, India Department of Dermatology, Venerology and Leprosy, Lady Hardinge Medical College, New Delhi, India

2

Sir,

Lymphocytoma cutis (LCC) is a rare psuedolymphoma also known as â&#x20AC;&#x2DC;cutaneous lymphoid hyperplasiaâ&#x20AC;&#x2122;(CLH).It is not a specific diseasebut a response to a variety of known and unknown stimuli that results in the accumulation of lymphocytes and other inflammatory cells in a localized region.It manifests clinically as asymptomatic, indolent, nodular lesions of different sizes varying between 2 and 5 cm, usually solitary, mainly on exposed area of the body like face (70%) and neck. Most of the cases cannot be attributed to any cause and are termed idiopathic.When the cause is known, it should be included in the diagnosis.

Individuals of any age may be affected, but lymphocytoma cutis is most common in early adulthood.The median age of presentation is 34 years, with females affected more than males (2:1). Lymphocytoma cutis is not associated with mortality and is rarely associated with morbidity other than minor pain or pruritus and generally heals without scarring.

Herein, we are describing a case of lymphocytoma cutis in a 42 year old female who presented with a solitary, firm red colored nodule measuring 2.5x2cm on left cheek for past one month. The nodule was not itchy and there was no recent history of drug intake, tattooing, insect bite or allergy. There were no constitutional symptoms and associated lymphadenopathy and/or organomegaly. FNA smears were moderately cellular showing polymorphous population of lymphoid cells comprising of mature and transformed lymphocytes along with few plasma cells and occasional tingible body macrophage. A diagnosis of lymphocytoma cutis was suggested. However, biopsy confirmation could not be done as the patient refused due to cosmetic reasons.

Pathogenesis of LCC remains unknown and most cases are idiopathic.Certain drugs (phenytoin, phenobarbital,

fluoxetine) and long-term antigenic stimulation (tattoos, trauma, body piercing, jewelery, cobalt, leeches, and insect bites) are implicated in many cases.[1] Rarely, infectious agents such as Borrelia species and Molluscum contagiosum have been linked with CLH. Borrelial lymphocytoma is more common in children than adults and is most often observed in Europe.[2] There was no such irritant implicated in our patient though she gave a history of having changed her cosmetic facecream recently.

Although patients usually are asymptomatic, many seek treatment for cosmetic reasons.Lesions of LCC often regress spontaneously,though some cases become chronic and others recur locally.[3] Biopsy is necessary to establish a diagnosis of LCC. On histologic examination, lesions of LCC may display multiple lymphoid follicles and dense superficial to deep infiltration of mostly mature lymphocytes. Lymphocytes often are admixed with histiocytes and occasional plasma cells showing a polyclonal pattern on immunohistochemical staining. In contrast, cutaneous lymphomas are monoclonal in nature on IHC. In the absence of a biopsy, the benign clinical behavior and a mixed population of lymphoid infiltrate along with presence of tingible body macrophages pointed to a diagnosis of pseudolymphoma or LCC. However, a clinical follow-up for 5 years is warranted as cutaneous B-cell lymphoma may sometimes have an indolent course.[3]Moreover, it is now believed that pseudolymphomatous and lymphomatous proliferations represent two ends of a spectrum where antigen-driven lymphoproliferation progresses to lymphoma[4] e.g, Helicobacter pylori-related gastric MALT lymphoma.

Reported therapies for persistent or idiopathic cases include local corticosteroids, cryosurgery, local radiation, excision, interferon alpha application, and laser ablation.Our patient

*Corresponding author: Dr. Shailaja Shukla, Professor of Pathology, Lady Hardinge Medical College, New Delhi-110001 Phone: +91 9811439308, 011-28033599 E-mail: shailajashukla@gmail.com, shukla_shailaja@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

L-12

Cytology of Lymphocytoma Cutis

is responding well to topical corticosteroids and the size of her lesion has reduced considerably. The present case highlights the role of a simple procedure like FNAC in establishing the diagnosis of LCC in the rare event where biopsy cannot be performed. However, precaution must be taken that cytological features are interpreted in the light of clinical findings.

Fig. 1: Erythematous nodule on face.

Acknowledgement Nil

Funding Nil

References

1. Nihal M, Mikkola D, Horvath N, et al. Cutaneous lymphoid hyperplasia: a lymphoproliferative continuum with lymphomatous potential. Hum Pathol 2003;34: 617-22.

2. Colli C, Leinweber B, Mullegger R, Chott A, Kerl H, Cerroni L. Borrelia burgdorferiassociated lymphocytoma cutis: clinicopathologic, immunophenotypic, and molecular study of 106 cases. J Cutan Pathol 2004;31(3):232-40.

3. Ploysangam T, Breneman DL, Mutasim DF. Cutaneous pseudolymphomas. J Am Acad Dermato l1998;38:877-95.

4. Albrecht J, Fine LA, Pietle W. Drug-associated lymphoma and pseudolymphoma : recognition and management. DermatolClin 2007;25(2): 233-44.

Fig. 2(a): FNAC smear showing polymorphous population of lymphoid cells (Wright-Giemsa x400).

Fig. 2(b): FNAC smear showing mature and transformed lymphocytes and plasma cells (Wright-Giemsa x1000).

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Letter to Editor Cysticercosis of Breast Presenting as A Breast Lump: Cytological Diagnosis of A Rare Case Swati Bhardwaj*, Akansha Singh, Charanjeet Ahluwalia, Ashish Kumar Mandal Department of Pathology, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi

Dear Sir,

Cysticercosis is a parasitic infection caused by Cysticercus cellulosae, the larval stage of Taenia solium. Rumler first described cysticercosis in 1555. [1] It came to be known in the 19th century that cysticercosis is caused by the ingestion of Taenia solium eggs. [2] It is a common parasitic infection spread by feco-oral route.

It may affect any organ or site in the body. The common sites of occurrence are skeletal muscle, and subcutaneous tissue. [3] Cysticercosis of breast is a rare presentation. It is usually diagnosed incidentally, as a cord like swelling, or uncommonly as a well-defined lump. Therefore, it should be considered as a possibility in the differential diagnosis of a breast lump, especially in endemic areas.

A 45 year old married woman, presented to the FNAC clinic with the complaint of a lump in her right breast present since 5 months. The lump was non tender, mobile, firm and well defined. It measured 3X2 cm, present in the lower inner quadrant. There was no overlying skin involvement.

The nipple areola complex was normal with no history of any nipple discharge. There was no fixity to chest wall. No axillary lymph nodes were palpable. A clinical diagnosis of fibroadenoma was made. Mammography had been performed that showed features of a BIRADS 2 lesion.

FNAC yielded blood mixed fluid. The smears were paucicellular showing few lymphocytes, occasional eosinophils in a blood mixed fluid background. Few variably sized fragments of cysticercus cellulosae were seen showing a parenchymal layer of loose fibrillary stroma with numerous small round to oval nuclei (Figure 1). Thus, a diagnosis of Cysticercosis was made.

Fig. 1: FNAC smear showing a paucicellular aspirate showing cysticercus cellulosae fragment, against an inflammatory background. (Giemsa, 20 X).

In India, a review study of 8,364 breast aspirates over 15 years (1978-1992) in All India Institute of Medical Sciences, New Delhi, demonstrated only 8 cases of cysticercosis.[4] Thus, Cysticercosis of the breast is a rare disease presentation.

Tapeworm has two hosts, a definitive and an intermediate host. Man is the only definitive host. Pigs, dogs, cats, and sheep may act as an intermediate host, pigs being the commonest. Transmission of infection to humans can be caused by ingestion of inadequately cooked pork or due to ingestion of food or water contaminated with eggs.

Diagnosis of cysticercus can be made on FNAC, or biopsy. Over the past many years, FNAC has emerged as a superior, non invasive, quick procedure in diagnosing parasitic lesions like cysticercosis.

*Corresponding author: Dr. Swati Bhardwaj, 289, Sector-38, Gurgaon-122001, Haryana.

Phone: +91 -9811859747, 0124-2200289 E-mail: swat.bhardwaj@yahoo.com

This work is licensed under the Creative Commons Attribution 4.0 License. Published by Pacific Group of e-Journals (PaGe)

L-14

Cysticercosis of Breast

It is important to clinically consider a diagnosis of parasitic breast lumps. Also, it hints at the possibility of clinical misdiagnoses, creating confusion with a fibroadenoma, as was seen in our case; and sometimes, even with malignancy. [5] The presence of clear, paucicellular fluid background, few inflammatory cells including lymphocytes, and eosinophils, and histiocytes must alert the cytopathologist to search carefully for fragments of parasites. In the absence of a parasitic fragment in the first attempt, it is prudent to perform a repeat aspirate which is likely to yield parasitic fragments and establish a diagnosis on FNAC alone.

Acknowledgements None

Funding None

Competing Interests None declared

Reference

1. Cox, FEG. History of Human Parasitology. Clinical Microbiology Reviews. 2002; 15:595-612.

2. KĂźchenmeister, F. The cysticercus transformed within the organism of man into Taenia solium. Lancet. 2003; 362: 547-556.

3. Chi HS, Chi JG: A histopathological study on human Cysticercosis. Kisaengchunghak Chapchi. 1978; 16(2):123-133.

4. Kapila K, Verma K. Diagnosis of parasites in fine needle breast aspirates. Acta Cytol. 1996; 40(4): 653-6.

5. Bhattacharjee HK, Ramman TR, Argarwal L, Nain M, Thomas S. Isolated Cysticercosis of the breast masquerading as a breast tumour: report of a case and review of literature. Ann Trop Med Parasitol. 2011; 105(6): 455-461.

Annals of Pathology and Laboratory Medicine, Vol. 03, No. 03, July - September, 2016

Our other journals

Annals of Applied BioSciences Annals of Applied Bio-Sciences (AABS) is an international, fast double-blind peer-reviewed, indexed, open access, online and print multidisciplinary journal with high impact factor (2.9254) and IC value (56.90)

Annals of Woman and Child Health Annals of Woman and Child Health (AWCH) is an International, Fast Double-blind peer-reviewed, Indexed, Open access, online multidisciplinary journal, related to woman and child health

Pacific Group of eJournals ISO 9001:2008 Certified academic publishing house

www.pacificejournals.com