JOB Vol2 N2 - 2011 by Paolo Trisi

ISSN: 2036-6795

Poste Italiane s.p.a. - Spedizione in Abbonamento Postale - 70% - S1/FG

Journal Journal of of Osteology Osteology and Biomaterials Biomaterials and

Volume 2 Number 2 2 0 1 1

Tixos has a porous surface characterized by interconnected cavities, with predetermined

lasermade

geometry promoting faster bone formation*.

Direct Laser Metal Forming technique by LEADER

IMPLANTS

Faster Bone Growth inside the cavities of the microfused titanium surface New Bone Formation inside the Implant cavities and pores in human after 8 weeks

Bone growth inside the Implant concavities titanium

bone

50 µm

100 µm

Strong adherence between the implant neck and soft tissues Mucosal connective fibers inserted on the surface of Tixos implant (blue)

* References available upon request.

L E AD E R I

Mucosal connettive fibers show perpendicular insertion to the implant surface

20 µm

LEADER ITALIA s.r.l. Via Aquileja, 49 - 20092 Cinisello Balsamo (MI) ITALY ph. +39 02 618651 - fax +39 02 61290676 www.leaderitalia.it - export@leaderitalia.it

Designer of implants in Cranio-Maxillo-Facial Surgery, Dental Implantology and Orthodontics since 2000

log o t n a pl

ntic o d o h

Ort

mp i e r P

ge r u s nt

in Train

Together think tomorrow

www. t e k k a . c o m Head ofďŹ ce: te ka - ZI de Sacuny - BP 82 - 118 avenue Marcel MĂŠrieux - 69530 Brignais - FRANCE - tel. +33 (0)4 78 56 97 00 - fax +33 (0)4 78 56 01 63 - tekka@tekka.fr

www. t e k k a . c o m Head ofﬁce: te ka - ZI de Sacuny - BP 82 - 118 avenue Marcel Mérieux - 69530 Brignais - FRANCE - tel. +33 (0)4 78 56 97 00 - fax +33 (0)4 78 56 01 63 - tekka@tekka.fr

te ka Universal System®

PRO

ivers

Un ESS

ersa

iv L® Un A T S E

Twi

The condensing thread becomes the common thread of the te ka Universal System® dental range. This new generation design ensures a progressive bone condensation, an improved force distribution in tissues and an optimal osseointegration.

ivers

® Un nKon

ersa

niv ne U In-Ko ®

iv T® Un UES

T-Q

Associated with a unique surgical kit, te ka Universal System® includes all kind of philosophies: morse taper and ﬂat connections, Bone and Tissue level implants. All these ranges are complementary, thus giving an appropriate answer according to therapeutic indications, clinical cases and aesthetic requirements.

www. t e k k a . c o m Head ofﬁce: te ka - ZI de Sacuny - BP 82 - 118 avenue Marcel Mérieux - 69530 Brignais - FRANCE - tel. +33 (0)4 78 56 97 00 - fax +33 (0)4 78 56 01 63 - tekka@tekka.fr

www.nanotite.it www.biomax.it

OROLOGIO IMPLANTARE™

Tempo, Tempo, Tempo. Una tecnologia per ogni tempo

Impianto conico NanoTite™ OROLOGIO IMPLANTARE™

TECNOLOGIA IMPLANTARE 2

Morfologia implantare per l’alta stabilità primaria (Bite in Bone) e superficie nanotecnologica NanoTite™ (Bone Bonding®)

TEMPO: 1-30 giorni

via Zamenhof 615 / 36100 VICENZA T 0444.913410 / F 0444.913695

Ricerca, tecnologia e professionalità. Insieme creiamo valore

Journal of Osteology and Biomaterials The official journal of the BioCRA and SENAME Societies

BioCRA Biomaterial Clinical and histological Research Association President Giampiero Massei Deputy-president Alberto Rebaudi Scientific Director Paolo Trisi Secretary Teocrito Carlesi Editor in-chief Paolo Trisi, DDS PhD Scientfic director BioCRA, Pescara, Italy Associate Editor Gilberto Sammartino, MD DDS University of Naples Federico II, Naples, Italy Francesco Carinci, MD DMD University of Ferrara, Ferrara, Italy Assistant Editor Teocrito Carlesi, DDS Secretary BioCRA, Chieti, Italy Managing Editor Renato C. Barbacane, MD University G. d’Annunzio, Chieti, Italy

www.osteobiom.com

SENAME The South European, North African, Middle Eastern Implantology and Modern Dentistry Society President Gilberto Sammartino Deputy-president Ahamed M. Osman Scientific Director Paolo Trisi Secretary Arzu Demircioglu

Editorial Board

Roberto Abundo, Turin, Italy Mario Aimetti, Turin, Italy Moshe Ayalon, Hadera, Israel Luigi Ambrosio, Naples, Italy Massimo Balsamo, Thiene, Italy Francesco Benazzo, Pavia, Italy Ermanno Bonucci, Roma, Italy Mauro Bovi, Rome, Italy Maria Luisa Brandi, Firenze, Italy Paul W. Brown, Pennsylvania, USA Ranieri Cancedda, Genova, Italy Saverio Capodiferro, Bari, Italy Sergio Caputi, Chieti, Italy Chih-Hwa Chen, Keelung, Taiwan Joseph Choukroun, Nice, France Gabriela Ciapetti, Bologna, Italy Giuseppe Corrente, Turin, Italy Massimo Del Fabbro, Milan, Italy Marco Esposito, Manchester, UK Antonello Falco, Pescara, Italy Gianfranco Favia, Bari, Italy Paolo Filipponi, Umbertide, Italy Pier Maria Fornasari, Bologna, Italy Bruno Frediani, Siena, Italy Sergio Gandolfo, Turin, Italy David Garber, Atlanta, USA Zhimon Jacobson, Boston, USA Jack T Krauser, Boca Raton, USA Richard J. Lazzara, West Palm Beach, USA Lorenzo Lo Muzio, Foggia, Italy Gastone Marotti, Modena, Italy Christian T. Makary, Beirut, Lebanon

Gideon Mann, Jerusalem, Israel Ivan Martin, Basel, Switzerland Milena Mastrogiacomo, Genoa, Italy Anthony McGrath, Santmore, UK Alvaro Ordonez, Coral Gables, USA Zeev Ormianer, Tel-Aviv, Israel Carla Palumbo, Modena, Italy Sandro Palla, Zurich, Switzerland Ady Palti, Kraichtal, Germany Michele Paolantonio, Chieti, Italy Giorgio Perfetti, Chieti, Italy Adriano Piattelli, Chieti, Italy Domenique P. Pioletti, Lausanne, Switzerland Paulo Rossetti, Saint Paul, Brasil Sergio Rosini, Pisa, Italy Ugo Ripamonti, Johannesburg, South Africa Henry Salama, Atlanta, USA Maurice Salama, Atlanta, USA Lucia Savarino, Bologna, Italy Arnaud Scherberich, Basel, Switzerland Nicola Marco Sforza, Bologna, Italy Christian FJ Stappert, New York, USA Marius Steigman, Neckargemünd, Germany Hiroshi Takayanagi, Tokyo, Japan Dennis Tarnow, San Francisco, USA Tiziano Testori, Milan, Italy Anna Teti, L’Aquila, Italy Oriana Trubiani, Chieti, Italy Alexander Veis, Thessaloniki, Greece Raffaele Volpi, Rome, Italy Giovanni Vozzi, Pisa, Italy Hom-Lay Wang, Michigan, USA Xuejun Wen, South Carolina, USA

Journal of Osteology and Biomaterials (ISSN: 2036-6795; On-line version ISSN 2036-6809) is the official journal of the Biomaterial Clinical and histological Research Association (BioCRA) and SENAME Societies. The Journal is published three times a year, one volume per year, by TRIDENT APS, Via Silvio Pellico 68, 65123 Pescara, Italy. Copyright ©2011 by TRIDENT APS. All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information and retrieval system, without permission in writing from the publisher. The views expressed herein are those of the publisher or the Biomaterial Clinical and histological Research Association (BioCRA). Information included herein is not professional advice and is not intended to replace the judgment of a practitioner with respect to particular patients, procedures, or practices. To the extent permissible under applicable laws, the publisher and BioCRA disclaim responsibility for any injury and/ or damage to person or property as result of any actual or alleged libellous statements, infringement of intellectual property or other proprietary or privacy rights, or from the use or operation of any ideas, instructions, procedure, products, or methods contained in the material therein. The publisher assumes no responsibility for unsolicited manuscript.

Listed in: EBSCO Publishing and Biomat.net. Sent for listing in Thompson-Reuters ISI Current Contents and MedLine Indexing Service (Index Medicus).

Volume 2 - Number 2 - 2011

Instructions to Authors Review/editing of manuscripts. Manuscripts will be reviewed by the editorial chairman and will be subjected to blind review by the appropriate section editor and editorial board consultants with expertise in the field that the article encompasses. The publisher reserves the right to edit accepted manuscripts to fit the space available and to ensure conciseness, clarity, and stylistic consistency, subject to the author’s final approval. Adherence to guidelines. Manuscripts that are not prepared according to these guidelines will be returned to the author before review. MANUSCRIPT PREPARATION The journal will follow as much as possible the recommendations of the International Committee of Medical Journal Editors (Vancouver Group) in regard to preparation of manuscripts and authorship (Uniform requirements for manuscripts submitted to biomedical journals. Ann Intern Med 1997;126:36–47). See www.icmje.org. Manuscripts should be double-spaced with at least a one-inch margin all around. Number all pages. Do not include author names as headers or footers on each page. Title page. Page 1 should include the title of the article and the name, degrees, title, professional affiliation, and full address of all authors. Phone, fax, and e-mail address must also be provided for the corresponding author, who will be assumed to be the first-listed author unless otherwise noted. If the paper was presented before an organized group, the name of the organization, location, and date should be included. Abstract/key words. Page 2 of the manuscript should include the article title, a maximum of 300-word abstract, and a list of key words not to exceed 6. Abstracts for basic and clinical research articles must be structured with the following sections: (1) Aim, (2) Materials and Methods, (3) Results, and (4) Conclusions. Abstracts for all other types of articles (ie, literature reviews, clinical reports, technologies, and case reports) should not exceed 250 words and need not be structured. Introduction. Summarize the rationale and purpose of the study, giving only pertinent references. Clearly state the working hypothesis. Materials and Methods. Present materials and methods in sufficient detail to allow confirmation of the observations. Published methods should be referenced and discussed only briefly, unless modifications have been made. Indicate the statistical methods used, if applicable. Results. Present results in a logical sequence in the text, tables, and illustrations. Do not repeat in the text all the data in the tables or illustrations; emphasize only important observations. Discussion. Emphasize the new and important aspects of the study and the conclusions that follow from them. Do not repeat in detail data or other material given in the Introduction or Results section. Relate observations to other relevant studies and point out the implications of the findings and their limitations. Conclusions. Link the conclusions with the goals of the study but avoid unqualified statements and conclusions not adequately supported by the data. In particular, authors should avoid making statements on economic benefits and costs unless their manuscript includes the appropriate economic data and analyses. Acknowledgments. Acknowledge persons who have made substantive contributions to the study. Specify grant or other financial support, citing the name of the supporting organization and grant number. Abbreviations. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard unit of measurement. Trade names. Generic terms are to be used whenever possible, but trade names and manufacturer name, city, state, and country should be included parenthetically at first mention. REFERENCES All references must be cited in the text, numbered in order of appearance. The reference list should appear at the end of the

Journal of Osteology and Biomaterials

article in numeric sequence. Do not include unpublished data or personal communications in the reference list. Cite such references parenthetically in the text and include a date. Avoid using abstracts as references. Provide complete information for each reference, including names of all authors (up to six). If the reference is part of a book, also include title of the chapter and names of the book’s editor(s). Journal reference style: Lazzara RJ, Testori T, Trisi P, Porter SS, Weinstein RL. A human histologic analysis of osseotite and machined surfaces using implants with 2 opposing surfaces. Int J Periodontics Restorative Dent 1999;19:117-29. Book reference style: Skalak R. Aspects of biomechanical considerations. In: Brånemark P-l, Zarb GA, Albrektsson T (eds). Tissue-Integrated Prostheses: Osseointegration in Clinical Dentistry. Chicago. Quintessence 1985:117-128. ILLUSTRATIONS AND TABLES - All illustrations must be numbered and cited in the text in order of appearance. - Illustrations and tables should be embedded in a PC Word document. JPEG files are highly recommended. For graphs and charts, do not use patterned fills. Solid tones or colors are recommended instead. - All illustrations and tables should be grouped at the end of the text. Radiographs–Submit the original radiograph as well as two sets of prints. Color–Color is used at the discretion of the publisher. No charge is made for such illustrations. Original slides (35-mm transparencies) must be submitted, plus two sets of prints made from them. Electronic Files–must contain all parts of the manuscript including figures and tables Resolution must be at least 600 dpi; files saved in jpeg format are preferred. Legends–Figure legends should be grouped on a separate sheet and typed double-spaced. UNITS OF MEASUREMENT Measurements of length, height, weight, and volume should be reported in metric units or their decimal multiples. Temperatures should be given in degrees Celsius and blood pressure in millimeters of mercury. All hematologic and clinical chemistry measurements should be reported in the metric system in terms of the International System of Units (SI). Description of teeth should use the American Dental Association (i.e., Universal/National) numbering system. COPYRIGHT All manuscripts accepted for publication become the property of TRIDENT APS. A copyright form must be signed by the authors, and returned to the Managing Editor. A file containing this form always accompanies the acceptance e-mail. Ethical Considerations in the Conduct and Reporting of Research: Protection of Human Subjects and Animals in Research When reporting experiments on human subjects, authors should indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2008. If doubt exists whether the research was conducted in accordance with the Helsinki Declaration, the authors must explain the rationale for their approach and demonstrate that the institutional review body explicitly approved the doubtful aspects of the study. When reporting experiments on animals, authors should indicate whether the institutional and national guide for the care and use of laboratory animals was followed. It should be noted that certain research protocols may require human subject informed consent. It is the responsibility of the author to obtain this. Conflicts of Interest A conflict of interest and financial disclosure form must be submitted for each author. In the interest of transparency and to allow readers to form their own assessment of potential biases that may have influ-

enced the results of research studies, the Journal of Osteology and Biomaterials now requires that all authors declare potential competing interests relating to papers accepted for publication. Conflicts of interest are defined as those influences that may potentially undermine the objectivity or integrity of the research, or create a perceived conflict of interest. Authors are required to submit: 1) A statement in the manuscript, following Acknowledgments, that includes the source of any funding for the study, and defines the commercial relationships of each author. If an author has no commercial relationships to declare, a statement to that effect should be included. This statement should include financial relationships that may pose a conflict of interest or potential conflict of interest. These may include financial support for research (salaries, equipment, supplies, travel reimbursement); employment or anticipated employment by any organization that may gain or lose financially through publication of the paper; and personal financial interests such as shares in or ownership of companies affected by publication of the research, patents or patent applications whose value may be affected by this publication, and consulting fees or royalties from organizations which may profit or lose as a result of publication. An example is shown below. 2) A conflict of interest and financial disclosure form for each author. This form can be found on JOB website (http://www. osteobiom.com). The form should be completed by each author and provided to the corresponding author. The corresponding author is responsible for submitting these forms from each author when the manuscript is submitted. These forms should be sent to fax number +39 085 28427. These forms can also be uploaded in the cover letter area during the manuscript submission process. Conflict of interest information will not be used as a basis for suitability of the manuscript for publication. Example of conflict of interest statement: This study was supported by a grant from the Company____, City, State. Drs. ____, ____ and____ report no financial relationships related to any products involved in this study. Dr. ____ is on the scientific advisory board for ____ and gives lectures sponsored by the company. Dr. ____ is a consultant and shareholder of the “ private company____”, City, State. Dr. _____ is employed full-time as chief technical officer of the ____ Company. REPRINTS Corresponding authors may purchase reprints at the time pages are received for proofreading. Reprints can be purchased in 4-color or black and white. Submit manuscripts via JOB’s online submission service: www.osteobiom.com Manuscripts should be written in PC Word (doc) file format with tables preferably embedded at the end of the document. Original figures in pdf, tif or jpg. No paper version is required. Info: info@osteobiom.com

For advertising, subscription information, back numbers and sponsorship contact: TRIDENT APS: Via Silvio Pellico 68, 65123 Pescara, Italy E-mail: info@osteobiom.com Web site: www.osteobiom.com www.biocra.com Printed by Grafiche Gercap - Foggia - Italy Graphic by ArtWork sas - Vasto - Italy Direttore responsabile: Giuseppe Tagliente Registrazione n° 124 tribunale di -Vasto- Italy Distribuzione gratuita per i soci BioCRA. The Journal is printed on acid-free paper that meets the minimum requirements of ANSI Standard Z39.48-1984 (Permanence of Paper).

Journal of Osteology and Biomaterials The official journal of the BioCRA and SENAME Societies

contents Original articles

taper connection implants placed in grafted sinuses: 87 Morse 1- to 6-year results of a prospective study on 99 patients. Carlo Mangano, Francesco Mangano, Jamil Awad Shibli, Rachel Lilian Sammons, Vittoria Perrotti, Adriano Piattelli

99 109

Tricalcium phosphate acts on stem cells derived from adipose tissue. Vincenzo Sollazzo, Ilaria Zollino, Annalisa Palmieri, Ambra Girardi, Francesca Farinella, Antonio Scarano, Alessandra Lucchese, Francesco Carinci

The use of a pyrocarbon radial head prosthesis in the treatment of Mason IV lesions of the elbow: a clinical study. Vincenzo Sollazzo, Vincenzo Lorusso

117

The immediate functional loading of seven and mistral implants with new multi unit titanium abutments. 24 Months follow up report. Luca Di Alberti, Dario Bertossi, Federica Donnini, Fabio Tamborrino, Teocrito Carlesi, Pierfrancesco Nocini, Lorenzo Lo Muzio

surface implants stability in the anorganic 125 NanoTiteâ&#x201E;˘ bovine bone grafted maxillary sinus measured by resonance frequency analysis: 3-year report. Salvatore Dâ&#x20AC;&#x2122;Amato, Nicola Sgaramella, Angelo Itro, Giuseppe Colella

135

A study on the interparietal bone in adult human skulls. Jaswinder Kaur, Zora Singh

Volume 2 - Number 2 - 2011

BioCRA

Original article

Morse taper connection implants placed in grafted sinuses: 1- to 6-year results of a prospective study on 99 patients. Carlo Mangano MD, DDS1*, Francesco Mangano DDS2, Jamil Awad Shibli DDS, MS, PhD3, Rachel Lilian Sammons PhD4, Vittoria Perrotti DDS, PhD5, Adriano Piattelli MD, DDS, MS6 Aim: This study evaluated the implant survival, the implant-crown success and the prosthetic complications of Morse taper connection implants placed in grafted sinuses with two different surgical approaches (one- and two-stage approach). Materials and methods: At each annual recall, clinical, radiographic and prosthetic parameters were assessed. The implant-crown success criteria included the absence of pain; suppuration and clinical mobility, an average distance between the implant shoulder and the first visible bone contact (DIB) < 2.0 mm from initial surgery, and the absence of prosthetic complications at the implantabutment interface. Results: A total of 294 Morse taper connection implants (Leone Implant SystemR, Florence, Italy) were inserted after 124 sinus floor elevation procedures in 99 consecutive patients. Ninety-five implants were placed simultaneously (onestage) and 199 implants in a staged procedure, 6 months after sinus grafting (twostage). Prosthetic restorations were fixed partial prostheses (91 units), single crowns (52 units) and fixed full-arches (12 units). The overall cumulative implant survival rate was 98.92% (one-stage: 97.62%; two-stage: 99.49%). The overall implant-crown success was 98.63% (one-stage: 97.85%; two-stage: 98.99%). No prosthetic complications at implant-abutment interface were reported. After 6 years, the mean DIB was 1.09 mm ± 0.32 (one-stage: 1.17 mm ± 0.22; two-stage: 1.07 mm ± 0.34). Conclusions: Within the limits of the present study, it can be concluded that the use of Morse taper connection implants in conjunction with sinus floor elevation represents a successful procedure for the rehabilitation of the edentulous posterior maxilla. (J Osteol Biomat 2011; 2:87-97)

Key words: Maxillary sinus floor augmentation, implant survival, implant-crown success, Morse taper connection implants, platform switching. Consultant, Department of Biomaterial Sciences, Dental School, University of Insubria, Varese, Italy Private Practice, Gravedona (Como), Italy 3 Head of Oral Implantology Clinic and assistant Professor, Department of Periodontology, Dental Research Division, Guarulhos University, Guarulhos, SP, Brazil 4 Senior Lecturer, Department of Biomaterials, Dental School, University of Birmingham, Birmingham, UK 5 Research Fellow, Dental School, University of Chieti-Pescara, Italy 6 Professor and Chairman of the Department of Oral Pathology and Oral Medicine, Dental School, University G. D’Annunzio, Chieti, Italy 1

Corresponding author: * Carlo Mangano MD, DDS P.zza Trento 4, 22015, Gravedona (Como) Italy Tel-fax +39-0344-85524 e-mail: camangan@gmail.com - web www.drmangano.com

INTRODUCTION The edentulous posterior maxilla generally provides a limited amount of bone volume because of severe postextraction alveolar crest resorption coupled with age-linked sinus pneumatization1. This anatomic limitation provides challenges that may affect successful osseointegration and the fabrication of a functional and aesthetic implant-supported restoration, dictating the need for reconstructive osseous surgery to re-establish adequate bone volume for implant positioning1,2. Maxillary sinus floor augmentation has become a reliable, commonly used surgical procedure to increase bone volume in the posterior maxilla2-6. Currently, two major techniques are available to perform this procedure: the lateral window approach7, which is still the most common surgical procedure for sinus floor elevation, and the transalveolar osteotomy technique8. Besides the surgical technique for sinus floor elevation, there are many variables that may alter the outcome of this procedure, such as the timing of implant insertion in relation to grafting (one- or two-stage approach, i.e. simultaneous implant placement into the augmented sinus graft or secondary placement after reconsolidation of the bone graft), the type of grafting material, the use

Volume 2 - Number 2 - 2011

Mangano C. et al.

mediate implant placement. The study protocol was approved by the Ethical Committee of the University of Varese and was conducted in accordance with the Helsinki Declaration of 1975, as revised in 2008.

Figure1. Scanning electron microscopy of the implant surface.

of barrier membranes over the lateral window and the type of implants used2. Many years ago, the principle of Morse taper implant-abutment connection was introduced in oral implantology9,10. Morse taper implant-abutment connection is based on the principle of “cold welding” obtained by high contact pressure and frictional resistance between the surfaces of the implant and the abutment9,10. The connection is called “self-locking” if the taper angle is less than 5°. Several clinical studies have indicated that the use of Morse taper connection implants represents a successful procedure for the rehabilitation of partially and completely edentulous arches, with excellent survival and success rates11-14. Therefore, the purpose of this prospective study was to evaluate the cumulative survival rate, the implant-crown success and the prosthetic complications of Morse

Journal of Osteology and Biomaterials

taper connection implants placed in grafted sinuses with two different surgical approaches (one- and two-stage approach). MATERIALS AND METHODS Patient population Between January 2003 and December 2008 all patients who were referred for maxillary sinus augmentation for placement of endosseous implants, were considered for inclusion in this prospective clinical study. Inclusion criteria were adequate bone height and width to place an implant of at least 3.3 mm in diameter and 8.0 mm in length. Exclusion criteria consisted of poor oral hygiene, non-treated periodontal diseases, active sinus infection, history of persistent sinus infections, heavy smoking habit (more than 15 cigarettes/day). All patients read and signed a written consent form for im-

Implant design and surface characterization Screw-shaped implants, made of grade-5 titanium alloy were used (Leone Implant SystemR, Florence, Italy)12-14. The surfaces were blasted with 350 μm Al3O2 particles and acid-etched with HNO3, after which the Ra value, i.e., the mean peak-valley distance of surface irregularities, was 3 μm (Fig.1). This implant system uses a cone Morse taper interference-fit (TIF) locking-taper combined with an internal hexagon. The Morse taper presents a taper angle of 1.5o (Fig.2). Pre-operative work-up A complete examination of the oral hard and soft tissues was carried out for each patient. Panoramic radio-

Figure 2. Drawing of the Morse taper connection implant (Leone Implant SystemR, Florence, Italy) used in this study. The system is composed of an implant and an abutment joined together by a selflocking connection that combines a Morse taper (taper angle = 1.5°) with an internal hexagon with a positional function.

Mangano C. et al.

graphs formed the basis for the primary investigation. In selected cases, computed tomography (CT) scans were used as the final investigation. CT datasets were acquired using a cone beam scanner and then transferred in the DICOM format to implant navigation software to perform a three-dimensional reconstruction of the jaws. Available bone volume, bone quality, anatomy and any existing sinus pathology were evidenced. With this navigation software, moreover, it was possible to correctly assess the width of each implant site, the thickness and the density of the cortical plates and the cancellous bone, as well as the ridge angulations. Pre-operative work-ups included an assessment of the edentulous ridges using casts and diagnostic wax-up. Surgical protocol Two days prior to the intervention, patients were instructed to rinse with chlorhexidine mouthwash 0.2% for 1 minute twice a day. Patients also rinsed for 1 minute prior to the augmentation procedure. All patients received prophylactic antibiotic therapy: 2g of amoxicillin + clavulanic acid 1 h (AugmentinR, Glaxo- Smithkline Beecham, Brentford, UK) before the intervention and continued the take antibiotics post-operatively (1 g amoxicillin + clavulanic acid, twice a day for 6 days). All patients were treated under local anaesthesia using articaine 4% with adrenaline 1:100000 (UbistesinR, 3M Espe, St. Paul, MN, USA). In all cases (staged and simultaneous implant placement) the surgical procedure was carried out according to the lateral window approach. After a horizontal crestal incision and two vertical inci-

sions in the buccal mucosa, a pedicled mucoperiosteal flap was raised to expose the lateral wall of the maxillary sinus. A bone window approximately 1x1 cm was outlined with a piezo-surgery equipment (Implant Center IIR, Piezo Ultrasonic Surgery, Satelec Acteon Group, Merignac, France) under constant saline irrigation. Care was taken not to penetrate the Schneiderian membrane. In case of perforation of the sinus membrane, a collagen barrier (EZ CureR, Leone, Florence, Italy) was used to contain the graft. The sinus mucosa was separated from the bony surface of the sinus floor with an elevator. The bony window fragment was removed. In all cases of staged procedure, after sinus floor elevation the space created between the maxillary alveolar process and the new sinus floor was filled with coral derived porous hydroxyapatite blocks (BiocoralR, Biocoral Inc, Le Garenne Colombes, France) that were shaped and modeled by the surgeon. Porous hydroxyapatite granules were also used to completely fill the small gaps between porous material blocks and residual bone crest. The granules were mixed with tetracycline powder (AmbramicinaR, Scharper spa, Sesto San Giovanni, Italy) to obtain a local antibiotic effect and this mixture was moistened with physiological saline solution so that the composition could be more easily moulded to fit into the gaps. The bony window fragment and a collagen barrier were used to seal the sinus window and complete wound closure was performed with non-resorbable sutures. The grafted sinuses were allowed to heal for 6 months before implant placement. Implant insertion was performed si-

Figure 3. Radiographic image of the sinus after elevation with porous hydroxyapatite.

multaneously only if a minimum bone height of 5 mm was conserved in order to guarantee primary implant stability. In all cases of simultaneous procedure, porous hydroxyapatite blocks (BiocoralR, Biocoral Inc, Le Garenne Colombes, France) were packed to the mesial aspect of the cavity, and then implants were inserted. Preparation of implant sites was carried out with spiral drills of increasing diameter (2.8 mm to place an implant with 3.3 mm diameter; 2.8 and 3.5 mm, to place an implant with 4.1 mm diameter; an additional 4.2 mm drill was used to prepare the site for 4.8 mm diameter implants), under constant irrigation. Implants were positioned at the bone crest level. Primary stability was evaluated, then porous hydroxyapatite granules mixed with tetracycline powder were packed and condensed in the residual spaces around implants, in order to completely fill the defect. The bony window fragment and a collagen barrier were used to seal the sinus window and flaps were sutured submerging the implants. In all cases, post-operative pain was controlled by administering 100 mg nimesulide (AulinR, Roche Pharmaceutical, Basel, Switzerland) every 12 hours for 2 days, and detailed instruc-

Volume 2 - Number 2 - 2011

Mangano C. et al.

tions about oral hygiene were given, including mouth rinses with 0.12% chlorhexidine (ChlorexidineR, OralB, Boston, MA, USA) administered for 7 days. Suture removal was performed at 8-10 days post-surgery.

Table 1. Localization of 294 inserted implants in the posterior maxilla. Implant sites First premolar Second premolar First molar Second molar Total

N째 of implants 29 92 143 30 294

Table 2. Distribution of the implants by length and diameter (mm) Length 8.0 10.0 12.0 14.0 diameter 3.3 5 5 4.1 20 55 59 44 4.8 7 41 45 13 total 27 101 109 57

Total 10 178 106 294

Table 3. Indication for the placement of 294 Morse taper connection implants in the posterior maxilla. Type of restoration Single-tooth restorations (SCs) Fixed partial prostheses (FPPs, 2 elements) Fixed partial prostheses (FPPs, 3-4 elements) Fixed full-arches Total

Table 4. Overall cumulative survival rate. Implants at Drop-outs Time interval the start of the During the (months) interval interval 0-12 294 2 12-24 253 1 24-36 192 36-48 136 1 48-60 82 60-72 41 1

Journal of Osteology and Biomaterials

N째 of units 52 40 51 12 155

Implants under risk 292 252 192 135 82 40

N째 of implants 52 80 114 48 294

Healing period A submerged technique was used to place the implants. The healing time was 3-6 months (staged procedure = 3 months; simultaneous implant placement = 6 months). Second-stage surgery was conducted to gain access to the underlying implants and healing abutments were placed. In all prosthetic rehabilitation protocols for fixed partial prostheses (FPPs), single crowns (SCs) and fixed full-arches (FFAs), the abutments were placed and activated two weeks after the second surgery, so that acrylic interim restorations were made. These interim restorations remained in situ for 3 months, and after this period definitive restorations were placed. All the definitive restorations were ceramo-metallic, cemented with a temporary cement (Temp-BondR, Kerr, Orange, CA, USA).

Survival rate Failures during Cumulative within the period the interval survival rate (%) (%) 2 99.31% 99.31% 1 99.60% 98.92% 100.0% 98.92% 100.0% 98.92% 100.0% 98.92% 100.0% 98.92%

Mangano C. et al.

Table 5. Overall implant failures. Time interval (months)

Lack of osseointegration

0-12 12-24 24-36 36-48 48-60 60-72

1 1

Clinical and radiographic evaluation Between January 2003 and September 2010, at each annual follow-up session, for each single implant, the following clinical parameters were investigated: - presence / absence of pain sensitivity13-14 - presence / absence of suppuration - exudation - presence / absence of implant mobility, tested manually using the handles of two dental mirrors14 Moreover, intraoral periapical radiographs were taken for each implant, using a Rinn alignment system with a rigid film-object-X-ray source coupled to a beam-aiming device in order to achieve reproducible exposure geometry14,15. Customized positioners were used, for precise repositioning and stabilization of the radiographic template. Radiographs were taken at the baseline (immediately after implant insertion) and at each annual follow up session, for two purposes: - to evaluate the presence / absence of continuous periimplant radiolucencies - to measure the distance between the implant shoulder

Recurrent peri-implantitis 1 1

and the first visible bone contact (DIB) in mm, at the mesial and distal implant site. For the second measurement, crestal bone level changes were recorded as changes in the vertical dimension of the bone around the implant, so that an evaluation of peri-implant crestal bone stability was gained with time. In order to correct for dimensional distortion in the radiograph, the apparent dimension of each implant (directly measured on the radiograph) was compared with the true implant length using the following equation: Rx implant length Rx DIB = True implant length True DIB This equation was used to establish the eventual amount of vertical bone loss at the mesial and distal site of the implant14,15. Prosthesis function To test prosthesis function, at each annual scheduled check, static and dynamic occlusion was evaluated, using standard occluding papers. Careful attention was dedicated to the analysis of prosthetic complications at the implant-abutment interface (abutment loosening, abutment fracture), which

Progressive bone loss 1 1

Total 2 1 3

were considered as primary endpoints of this study, and consequently registered13,14. All the other potential complications (such as ceramic fractures) were also reported, even if they did not represent primary endpoints of this work. Implant survival and implant-crown success criteria The evaluation of implant survival and implant crown success was performed according to modern clinical, radiographic and prosthetic parameters16. Implants were basically divided into two categories: “surviving” and “failed” implants. An implant was classified as a “surviving implant” when it was still in function at the last follow up control session. Implant losses and implants presenting pain upon function or clinical mobility were all failure categories. The conditions for which implant removal could be indicated included failure of osseointegration or infection, recurrent peri-implantitis, or implant loss due to mechanical overload. Statistical analysis was carried out with life table analysis of Cutler and Ederer17. Among “surviving” implants, with regard to the collected clinical and ra-

Volume 2 - Number 2 - 2011

Mangano C. et al.

Table 6. Cumulative survival rate for implants placed 6 months after maxillary sinus elevation (two-stage procedure). Implants at Drop-outs Survival rate Time interval Implants Failures during Cumulative the start of the During the within the period (months) under risk the interval survival rate (%) interval interval (%) 0-12 199 1 198 1 99.49% 99.49% 12-24 177 1 176 100.0% 99.49% 24-36 132 132 100.0% 99.49% 36-48 94 94 100.0% 99.49% 48-60 60 60 100.0% 99.49% 60-72 31 1 30 100.0% 99.49%

Table 7. Cumulative survival rate for implants placed simultaneously with maxillary sinus elevation (one-stage procedure). Implants at Drop-outs Survival rate Time interval Implants Failures during Cumulative the start of the During the within the period (months) under risk the interval survival rate (%) interval interval (%) 0-12 95 1 94 1 98.93% 98.93% 12-24 76 76 1 98.68% 97.62% 24-36 60 60 100.0% 97.62% 36-48 42 1 41 100.0% 97.62% 48-60 22 22 100.0% 97.62% 60-72 10 10 100.0% 97.62% diographic parameters, three different groups were distinguished16: Group 1: implant success (optimum health): - absence of pain or tenderness upon function - absence of suppuration - absence of clinical mobility - DIB < 2.0 mm - no exudate history Group 2: satisfactory survival: - absence of pain on function - absence of suppuration - absence of clinical mobility - DIB 2-4 mm - no exudate history

Journal of Osteology and Biomaterials

Group 3: compromised survival: - sensitivity on function - absence of clinical mobility - DIB > 4 mm - possible exudate history Finally, prosthesis function was taken into account, with particular attention to the implant-abutment connection. The absence of prosthetic complications at the implant abutment interface (such as abutment loosening or abutment fracture) was considered of primary importance in this study. For this reason, implant-crown success was defined as the condition of the implants in the Group 1 (implant success, optimum health), presenting in addition no prosthetic complications at the implant-abutment interface.

RESULTS Patient population and implant supported restorations Ninety-nine patients (69 men, 30 women, aged between 35-76 years, average 61.6) were enrolled in this study. Twenty-five patients had bilateral indication for maxillary sinus augmentation, giving a total of 124 sinus augmentation procedures. Eighty-five of these procedures did not entail simultaneous implant placement. All the procedures generated adequate bone for placement of implants at least 8 mm in length, which would rest wholly in previous host and/or regenerated bone, so that 199 implants (71 patients) were subsequently placed in these augmented sinus areas. For all these implants, a two-stage procedure (first stage: si-

Mangano C. et al.

mulative survival rate was 99.49% (one “early failure”) for two-stage procedure (Tab. 6), while the one-stage procedure showed a cumulative survival rate of 97.62% (one “early failure”; one “late failure”) (Tab. 7). With regard to the position of the failed implants, one was a second premolar, one a first molar and one a second molar. Figure 4. Radiographic image of the implants placed in the regenerated sinus.

Figure 5. Radiographic control of the implants after the application of definitive restorations.

Figure 6. Radiographic control of the implants at 6 years.

Figure 7. The fixed partial prosthesis in situ after 6 years.

nus grafting; second stage: placements of the implants) was needed, because less than 5 mm of bone height at the most inferior point of the maxillary sinus was conserved, and the residual original bone of the alveolar crest was not adequate to obtain primary implant stability. Ninety-five implants (28 patients) were placed by a onestage procedure at the time of lateral approach sinus augmentation therapy (one-stage procedure, simultaneous implant placement). The distribution of implants by localization, length and diameter was in accordance with Tab. 1-2. The various indications for implant therapy were listed in Tab. 3. Each fixed full-arch prosthesis was supported by 8 implants.

Implant Survival At the end of the study, the overall cumulative Implant Survival rate was 98.92%, with 291 implants still in function (Tab. 4). Three implants failed and had to be removed. Two implants were classified as “early failures”, showing clinical mobility due to lack of osseointegration (one implant) or recurrent infections with pain and suppuration (one implant) before the connection of the abutment. One implant was classified as a “late failure”, as it failed after the abutment connection, during the second year of function. This “late failure” was attributed to progressive bone loss due to mechanical overloading, without clinical signs of peri-implant infection (Tab. 5). With regard to the surgical approach, the cu-

Implant-crown success In total, 291 implants were still in function at the end of the study. Among these implants, 287/291 (98.63%) were classified in the implant-crown success group (two-stage: 196/198 = 98.99%; one-stage: 91/93 = 97.85%). None of these implants caused pain or exhibited clinical mobility, suppuration or exudation, the DIB was < 2.0 mm, and none exhibited any prosthetic complication at the implant-abutment interface. Four implants (4/291=1.37%) were classified in the second group, among the satisfactory survival implants (two-stage: 2/198 = 1.01%; onestage: 2/93 = 2.15%). These implants did not cause any pain or clinical mobility, suppuration or exudation, but they had a DIB between 2 and 4 mm. No implants were placed in the third group, compromised survival. The overall radiographic evaluation of the implants revealed a mean distance from the implant shoulder to the first crestal bone to implant contact (DIB) of respectively 0.85, 0.86, 0.97, 1.06, 1.07 mm at 12, 24, 36, 48 and 60 months after implant insertion. At the 6-year examination, the overall mean bone level was situated 1.09 ± 0.32 mm from the reference point (Tab. 8; Fig. 3-7). Minimal changes were seen in the bone level between the 1- and 6-year examina-

Volume 2 - Number 2 - 2011

Mangano C. et al.

Table 8. Overall distance between the implant shoulder and the first visible bone contact (DIB) in mm. Time (months) 72 60 48 36 24 12

Mean 1.09 1.07 1.06 0.97 0.86 0.85

SD 0.32 0.33 0.33 0.32 0.30 0.31

Median 1.10 1.10 1.10 0.98 0.88 0.88

Confidence interval (95%) 0.99- 1.2 1.00- 1.15 1.01- 1.12 0.92- 1.02 0.83- 0.90 0.81- 0.88

Table 9. Distance between the implant shoulder and the first visible bone contact (DIB) in mm for implants placed 6 months after maxillary sinus elevation (twostage procedure). Time (months) 72 60 48 36 24 12

Mean 1.07 1.07 1.06 0.95 0.85 0.83

SD 0.34 0.34 0.34 0.32 0.30 0.31

Median 1.12 1.15 1.10 0.98 0.88 0.87

Confidence interval (95%) 0.95- 1.19 0.98- 1.16 0.99- 1.13 0.89- 1.00 0.80- 0.89 0.79- 0.87

Table 10. Distance between the implant shoulder and the first visible bone contact (DIB) in mm for implants placed simultaneously with maxillary sinus elevation (one-stage procedure). Time (months) Mean SD Median Confidence interval (95%) 72 1.17 0.22 1.07 1.02- 1.32 60 1.09 0.31 1.06 0.95- 1.22 48 1.07 0.33 1.10 0.97- 1.18 36 1.02 0.32 0.98 0.94- 1.11 24 0.91 0.29 0.88 0.84- 0.97 12 0.89 0.30 0.88 0.83- 0.95

tions, and between the two groups of implants (6-year DIB: one-stage 1.17 Âą 0.22 mm; two-stage 1.07 Âą 0.34 mm) (Tab. 9-10). No prosthetic complications were observed. DISCUSSION Maxillary sinus augmentation is a method of attaining sufficient bone height for posterior maxillary implant

Journal of Osteology and Biomaterials

placement and has proven to be a highly successful and predictable technique2-7,18. A systematic review18 indicated that the insertion of dental implants in combination with maxillary sinus floor elevation is a predictable procedure, showing high implant survival rates (90.1%; 95% CI: 86.4%-92.8%) and low incidence of surgical complications 18 . The best results (98.3% implant sur-

vival after 3 years) were obtained using rough surface implants with membrane coverage of the lateral window. In a more recent systematic review, in which 54 clinical studies were included, for a total of 11746 implants placed in 3638 patients, an overall implant survival of 95.2% was found (95% CI: 93.4%-96.2%)2. In this study, simultaneous implant placement showed better outcomes (implant survival 96.3%; 95% CI: 93.2%-99.5%) than delayed placement (implant survival 93.6%; 95% CI: 91.4%-95.5%)2. In a recent clinical study, it has been evidenced that sinus floor elevation procedures with simultaneous or staged implant placement were not associated with increased risk for implant failure19. Previous studies have reported excellent survival and success rates for sinus grafting and implant placement in both one- and twostage protocols20-22. These results are in contrast with a previous study, in which different cumulative success rates were reported for one-stage (from 83% to 100% in a follow-up of 12 to 60 months) and two-stage (from 91% to 100% in a 6- to 46- month follow-up) protocols23. In our 6-year prospective study, excellent survival (overall: 98.92%; onestage: 97.62%; two-stage: 99.49%) and implant-crown success rates (overall: 98.63%; one-stage: 97.85%; two-stage: 98.99%) were found in both one- and two-stage procedures. The choice of placing implants simultaneously to the grafting procedure or at a later stage is generally influenced by the amount of residual crestal bone height, which must be sufficient to provide implants with adequate primary stability. A recent literature review, aiming to find a

Mangano C. et al.

correlation between the amount of remaining crestal alveolar bone before sinus augmentation and implant survival in grafted areas, suggested a higher implant success predictability as the available bone height increased24. Many literature reports cite autogenous bone as the best reconstructive material because of its osteoconductive and osteoinductive properties25,26. At an average observation of 49 months, sinus lift grafting with autogenous bone reported yields an implant cumulative success rate of 94% (CI: 91.9%-96.2%)27. Bone substitutes such as allogeneic, xenogenic or synthetic grafts have also been employed with success2. Recent reviews of literature2 showed that survival rates for implants placed in grafts made of bone substitutes alone and grafts of composite material were slightly better than the survival rates for implants placed in 100% autogenous grafts2,28. For this reason, the authors recommended the use of bone substitutes for sinus augmentation, in order to reduce donor-site morbidity2,28. These results were confirmed in two recent systematic reviews of the literature4,29, in which the type of graft did not seem to be associated with the success of the procedure, its complication, or implant survival. Length of healing period, simultaneous implant placement or a staged approach, sinusitis or graft loss did not modify the lack of effect of graft material on the final outcomes4. In accordance with a previous report30, the present study has reported excellent results with the use of a coralline carbonate calcium phosphate for grafting of the maxillary sinus. In compara-

tive studies31, findings support a positive influence of rough surfaces on osseointegration in maxillary bone. In a recent systematic review for implant survival in maxillary sinus augmentation, implants with rough surfaces displayed a higher survival (97.6%; CI: 96.7%98.5%) than implants with machined surfaces (89.4%; CI: 83.0%-95.8%), independently of the graft type2. These results confirmed the findings of a previous review of the literature6, in which dental implants placed in the posterior augmented maxilla showed an average survival rate of 92.6%. In the same study, in fact, the use of rough-surfaced implants and particulate bone resulted in an increased implant survival rate (94.5%)6; using a membrane to cover the graft, the implant survival rate increased to 98.6%6. In the present study, with the use of sandblasted, Morse taper connection implants, excellent implant survival and success rates were reported, in accordance with the aforementioned studies2,6,30,31. Moreover, no prosthetic complications were reported at the implant-abutment interface, in accordance with previous studies on Morse taper connection implants11-14. Stability of the implant-abutment connection has been addressed to eliminate screw loosening but also to distribute load more favorably in bone9,10. The effect of implant-abutment design on marginal bone level is highly debatable, but some studies have suggested that micromovements at the implant abutment interface could lead to bone resorption32. This hypothesis still has to be tested but Morse taper connection implants can certainly avoid micromovements at the implant-

abutment interface, preventing crestal bone loss around implants9-14. Marginal bone stability is one of the most important reference criteria to evaluate implant success over time16. Even if the etiological factors associated with early crestal bone loss have not been completely clarified, the main factors hypothesized to be involved in the process of bone loss include surgical trauma, the formation of a biological distance, micromovements of the abutment32, and the presence and size of a microgap between the implant and the abutment33,34. It is noteworthy that all implants with screw type implant-abutment connections show a microgap of variable dimensions (40100 micron) at the implant-abutment interface33-35. Scientific evidence 33-35 supports the fact that bone loss is due to combined and sustained activation of inflammatory cells that appear with the microgap at the bone level. The bacterial leakage and persistent colonization of the microgap at the implantabutment interface are responsible for generating a chemotactic stimulus that initiates and sustains recruitment of inflammatory cells33,34. This finally results in the development of peri-implant inflammation and bone loss33,34. If the absence of an implant-abutment microgap is associated with reduced peri-implant inflammation and minimal bone loss, the Morse taper implant-abutment connection could provide an efficient seal against microbial penetration significantly reducing the microgap (1-3 micron) dimensions at the implant-abutment interface, and contributing to a minimal level of periimplant tissue inflammation35. With

Volume 2 - Number 2 - 2011

Mangano C. et al.

Morse taper connection implants the gap is closed so tightly that the abutment and the fixture behave like a single piece; for this reason, there is effectively no microgap and therefore no bacterial leakage35. With the tapered interference fit, moreover, the abutment emergence geometry leads to â&#x20AC;&#x153;platform switchingâ&#x20AC;? advantages36,37. The biological rationale of the platform switching design or horizontal set-off at the implant abutment interface is actually explained as the consequence of the horizontal repositioning of the microgap36,37. Basically, the principle involved is to distance the abutmentfixture microgap away from the bone as far as possible. This is very important, as the microgap harbors bacteria that produce toxins; if bacteria are more distant from the bone, it is subsequently possible to minimize bone loss36,37. Another consequence of platform switching design is the increased space for more connective tissue, to improve the biological seal11-14,36,37. This space can guarantee excellent soft tissue healing, with a thicker and larger well-organized amount of peri-implant soft tissues, protecting the bone crest from resorption, as demonstrated by many recent clinical reports11-14,36,37. The present study seems to confirm this excellent bone stability, as minimal changes have been observed between the mean distance from the implant shoulder to the first crestal bone to implant contact (DIB) at 1- and 6- year examinations. In fact, the mean bone level of the fixture was situated 0.85 mm and 1.09 mm from the reference point, after 1 and 6 years of functional loading, respectively.

Journal of Osteology and Biomaterials

CONCLUSIONS Within the limits of the present study, it can be concluded that the use of Morse taper connection implants in conjunction with sinus floor elevation represents a successful procedure for the rehabilitation of the edentolous posterior maxilla, with excellent implant survival (overall: 98.92%; one-stage: 97.62%; two-stage: 99.49%) and implant-crown success (overall: 98.63%; one-stage: 97.85%; two-stage: 98.99%) rates. The high mechanical stability of Morse taper connection implants significantly reduces prosthetic complications at the implant-abutment interface. DISCLOSURE The authors declare that they have no financial relationship with any commercial firm that may pose a conflict of interest for this study. No grants, equipment, or other sources of support were provided.

REFERENCE 1. Chiapasco M, Zaniboni M, Rimondini L. Dental implants placed in grafted maxillary sinuses: a retrospective analysis of clinical outcome according to the initial clinical situation and a proposal of defect classification. Clin Oral Implants Res 2008; 19: 416-428. 2. Del Fabbro M, Bortolin M, Taschieri S, Rosano G, Testori T. Implant survival in maxillary sinus augmentation. An updated systematic review. J Osteol Biomat 2010; 1: 69-79. 3. Tiwana P, Kushner G, Haug R. Maxillary sinus augmentation. Dent Clin North Am 2006; 50: 409-424. 4. Nkenke E, Stelzle F. Clinical outcomes of sinus floor augmentation for implant placement using autogenous bone or bone substitutes: a systematic review. Clin Oral Implants Res 2009; 20 (suppl 4): 124-133. 5. Aghaloo T, Moy P. Which hard tissue augmentation techniques are the most successful in furnishing bony support for implant placement? Int J Oral Maxillofac Implants 2007; 22 (suppl): 49-70. 6. Wallace S, Froum S. Effect of maxillary sinus augmentation on the survival of endosseous dental implants. A systematic review. Ann Periodontol 2003; 8: 328-343. 7. Tatum H. Maxillary and sinus implant reconstructions. Dent Clin North Am 1986; 30: 207-229. 8. Summers R. A new concept in maxillary implant surgery: the osteotome technique. Compendium 1994; 15: 152, 154-156, 158 passim; quiz 162. 9. Merz B, Hunenbart S, Belser U. Mechanics of the implant-abutment connection: An 8-degree taper compared to a butt joint connection. Int J Oral Maxillofac Implants 2000; 15:519-526. 10. Bozkaya D, Muftu S. Mechanics of the tapered interference fit in dental implants. J Biomech 2003; 36:1649-1658. 11. Mangano C, Bartolucci G. Single-tooth replacement by Morse taper connection implants: A retrospective study of 80 implants. Int J Oral Maxillofac Implants 2001; 16: 675680.

Mangano C. et al.

12. Mangano C, Mangano F, Piattelli A, Iezzi G, Mangano A, La Colla L. Prospective clinical evaluation of 307 single tooth Morse taper connection implants: a multicenter study. Int J Oral Maxillofac Implants 2010; 25: 394-400. 13. Mangano C, Mangano F, Piattelli A, Iezzi G, Mangano A, La Colla L. Prospective clinical evaluation of 1920 Morse taper connection implants: results after 4 years of functional loading. Clin Oral Implants Res 2009; 20: 254261. 14. Mangano C, Mangano F, Shibli J, Tettamanti L, Figliuzzi M, d’Avila S, Sammons R, Piattelli A. Prospective evaluation of 2,549 morse taper connection implants: 1- to 6-year data. J Periodontol 2011; 82: 52-61. 15. Weber H, Crohin C, Fiorellini J. A 5 year prospective clinical and radiographic study of non submerged dental implants. Clin Oral Implants Res 2000 11: 144-153. 16. Misch C, Perel M, Wang H, Sammartino G, Galindo Moreno P, Trisi P, Steigmann M, Rebaudi A, Palti A, Pikos M, Schwartz-Arad D, Choukroun J, Gutierrez Perez J, Marenzi G, Valavanis D. Implant success, survival, and failure: the international congress of oral implantologists (ICOI) Pisa consensus conference. Implant Dent 2008 ; 17 : 5-15. 17. Cutler S, Ederer F. Maximum utilization of the life table method in analyzing survival. J Chronic Dis 1958; 6: 699-712. 18. Pjetursson B, Tan W, Zwahlen M, Lang N. A systematic review of the success of sinus floor elevation and survival of implants inserted in combination with sinus floor elevation. J Clin Periodontol 2008; 35(8 suppl): 216-240. 19. Huynh-Ba G, Friedberg J, Vogiatzi D, Ioannidou E. Implant failure predictors in the posterior maxilla: a retrospective study of 273 consecutive implants. J Periodontol 2008; 79: 2256-2261. 20. Tetsch J, Tetsch P, Lysek D. Long-term results after lateral and osteotome technique sinus floor elevation: a retrospective analysis of 2190 implants over a time period of 15 years. Clin Oral Implants Res 2010; 21: 497-503. 21. Ferrigno N, Laureti M, Fanali S. Dental implants placement in conjunction with osteotome sinus floor elevation: a 12-year life-

table analysis from a prospective study on 588 ITI implants. Clin Oral Implants Res 2006; 17: 194-205.

32. Heckmann S, Linke J, Graef F, Foitzkin C, Wichmann M, Weber H. Stress and inflammation as a detrimental combination for peri-implant bone loss. J Dent Res 2006; 85: 711-716.

22. Bornstein M, Chappuis V, von Arx T, Buser D. Performance of dental implants after staged sinus floor elevation procedures: 5-year results of a prospective study in partially edentolous patients. Clin Oral Implants Res 2008; 19: 1034-1043.

33. Broggini N, McManus L, Hermann J, Medina R, Oates T, Schenk R, Buser D, Mellonig J, Cochran D. Persistent acute inflammation at the abutment interface. J Dent Res 2003; 82: 232-237.

23. Tong D, Rioux K, Drangsholt M, Beirne O. A review of survival rate for implants placed in grafted maxillary sinuses using meta-analysis. Int J Oral Maxillofac Implants 1998; 13: 175182.

34. Piattelli A, Vrespa G, Petrone G, Iezzi G, Annibali S, Scarano A. Role of the microgap between implant and abutment: a retrospective histologic evaluation in monkeys. J Periodontol 2003; 74: 346-352.

24. Rios H, Avila G, Galindo P, Bratu E, Wang H. The influence of remaining alveolar bone upon lateral window sinus augmentation implant survival. Implant Dent 2009;18: 402-12.

35. Dibart S, Warbington M, Su MF, Skobe Z. In vitro evaluation of the implant abutment bacterial seal: the locking taper system. Int J Oral Maxillofac Implants 2005; 20: 732-737.

25. Pinholt E. Branemark and ITI dental implants in the human bone-grafted maxilla: a comparative evaluation. Clin Oral Implants Res 2003; 14: 584-592.

36. Vigolo P, Givani A. Platform switched restorations on wide diameter implants: a 5-year clinical prospective study. Int J Oral Maxillofac Implants 2009; 24: 103-109.

26. Merkx M, Maltha J, Stoelinga P. Assessment of the value of inorganic bone additives in sinus floor augmentation: a review of clinical reports. Int J Oral Maxillofac Surg 2003; 32: 1-6. 27. Khoury F. Augmentation of the sinus floor with mandibular bone block and simultaneous implantation: a 6-year clinical investigation. Int J Oral Maxillofac Implants 1999; 14: 557-564.

37. Prosper L, Redaelli S, Pasi M, Zarone F, Radaelli G, Gherlone E. A randomized prospective multicenter trial evaluating the platform switching technique for the prevention of post-restorative crestal bone loss. Int J Oral Maxillofac Implants 2009; 24: 299-308.

28. Del Fabbro M, Rosano G, Taschieri S. Implant survival rates after maxillary sinus augmentation. Eur J Oral Sci 2008; 116: 497-506. 29. Browaeys H, Bouvry P, de Bruyn H. A literature review on biomaterials in sinus augmentation procedures. Clin Implant Dent Relat Res 2007; 9: 166-177. 30. Lee J, Jung U, Kim C, Choi S, Cho K. Histologic and clinical evaluation for maxillary sinus augmentation using macroporous biphasic calcium phosphate in human. Clin Oral Implants Res 2008; 19: 767-771. 31. Khang W, Feldman S, Hawley C, Gunsolley J. A multicenter study comparing dual acidetched and machined-surfaced implants in various bone qualities. J Periodontol 2001; 72: 1384-1390.

Volume 2 - Number 2 - 2011

BioCRA

Original article

Tricalcium phosphate acts on stem cells derived from adipose tissue. Vincenzo Sollazzo MD1, Ilaria Zollino MD2, Annalisa Palmieri PhD2, Ambra Girardi Dr3, Francesca Farinella Dr2, Antonio Scarano MD4, Alessandra Lucchese MD2 , Francesco Carinci MD2*

Aim Tricalcium Phosphate (TCP) is used successfully as bone substitutes and scaffolds for tissue engineering and implantology to its capacity to enhance bone formation in vivo. To study the osteoinductive properties of Tricalcium Phosphate, the expression levels of bone related genes in human mesenchymal stem cells treated with this biomaterial were analyzed. Materials and Methods Using real time Reverse Transcription-Polymerase Chain Reaction the quantitative expression of specific genes, like transcriptional factors (RUNX2 and SP7), bone related genes (SPP1, COL1A1, COL3A1, ALPL, and FOSL1) and mesenchymal stem cells marker (ENG) was examined. Results TCP causes induction of bone related genes like RUNX2, COL1A1 and ALPL. In contrast, the expression of ENG was decreased in stem cells treated with TCP respect to untreated cells, indicating the differentiation effect of this biomaterial on stem cells. Conclusion The results obtained are relevant to better understand the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects. (J Osteol Biomat 2011; 2:99-107)

Key words: Stem cells, tricalcium phosphate, differentiation, bone

Orthopedic Clinic, University of Ferrara, Corso Giovecca 203, 44121, Ferrara, Italy Department of Maxillofacial Surgery, University of Ferrara, Corso Giovecca 203, 44121, Ferrara, Italy 3 Department of Histology, Embryology and Applied Biology, University of Bologna, Via Belmeloro 8, 40100, Bologna, Italy 4 School of Dentistry, University of Chieti, Via Vestini 31, Chieti, Italy 1 2

Corresponding author: * Prof. Francesco Carinci, MD, Dept. of D.M.C.C.C. University of Ferrara, Corso Giovecca, 203, 44100 Ferrara, (Italy), Tel/Fax :0039-0532-455582 E-mail:crc@unife.it Web:www.carinci.org

INTRODUCTION The posterior maxilla is a particularly compromised area due to the sinus pneumatization, bone reabsorption after tooth loss or the sum of both circumstances.1 Elevation and augmentation of the maxillary sinus with the “Sinus lift procedure” provides a way to increase the amount of available bone and the placement of longer implants.2 Several grafting materials have been used in sinus augmentation procedures including autogenous bone, demineralized freeze-dried bone (DFDBA), hydroxyapatite (HAP), β-tricalcium phosphate (β-TCP), anorganic deproteinized bovine bone and combination of these and others.3 Autogenous bone grafts obtained from the patient himself is very successful in bone regeneration and serves as a gold standard.4 However, the collection of autogeneous bone has some disadvantages, such as the limited quantity and shape of available bone, the resorption of the bone graft and carries with it extra risks for morbidity such as the need for a second surgery at the donor site.5 Therefore, various bone grafting materials have been used as alternatives or supplements to autogenous bone. Bone grafting materials may produce bone formation by osteogenesis, osteoin-

Volume 2 - Number 2 - 2011

100 Sollazzo V. et al.

duction or osteoconduction. Whereas osteogenesis is obtained by providing osteogenic cells and matrix directly in the graft (e.g. autogenous bone, distraction osteogenesis),6 osteoinduction postulates that the grafted material is chemotactic to undifferentiated progenitor cells inducing them to differentiate into osteoblasts.7 Osteoconduction permits outgrowth of osteogenic cells from existing bone surfaces into the graft material.7 Both, synthetic and allograft materials, are available at present. From the group of the synthetic materials, many ceramics have proven to be biocompatible. Key factors seem to be their ability to bond bone minerals directly and to promote new bone formation by osteoconduction.8 Among the resorbable ceramics are materials such as β-TCP. Ceramics possess osteoconductive properties, but they do not have intrinsic osteoinductive capacity.9 They are unable to induce new bone formation in extraosseous sites. This incapacity of inducing bone formation on its own can be overcome by seeding osteoprogenitor cells onto ceramic matrices.9,10 Demineralized bone matrix (DBM)— as an allogenous material—contains bone morphogenic and matrix proteins in contrast to ceramic materials. Bone morphogenic proteins (BMP) are potent osteoinductive glycoproteins while matrix proteins, such as different collagens provide an osteoconductive matrix.11 Calcium Phosphate have gained much attention due to their usefulness as bone substitutes and scaffolds for tissue engineering.12 The pure phase of β-TCP has good biodegradability and osteoconductivity,13 and it is used suc-

Journal of Osteology and Biomaterials

cessfully in hand surgery, osteology, maxillofacial and implantology surgery, where it has demonstrated its capacity to form bone on reabsorption by the organism.14 Because few reports analyze the genetic effects of TCP on stem cells the expression of genes related to the osteoblast differentiation were analyzed using cultures of Adipose Derived Stem Cell (ADSC) cultivated on TCP scaffolds. To investigate the osteogenic differentiation of ADSC, the quantitative expression of the mRNA of specific genes, like transcriptional factors (RUNX2 and SP7), bone related genes (SPP1, COL1A1, COL3A1, ALPL, and FOSL1) and mesenchymal stem cells marker (ENG) were examined by means of real time Reverse Transcription-Polymerase Chain Reaction (real time RT-PCR).

MATERIALS AND METHODS Stem isolation Human adipose tissue was obtained by liposuction of adult volunteers patients. Fat was finely minced with a sterile scissors and transferred in a tube containing digestive solution (DMEM containing 1 mg/mL of collagenase type II). The tube was placed in 37C˚ water bath for 60 min, swirling occasionally. The sample was centrifugated at 3000 rpm for 5 minutes. Then was removed from centrifuge, shaked vigorously (to complete separation of stromal cells from primary adipocytes), and centrifugated again for 5 minutes. The oil on the top of the tube (which includes primary adipocytes) was aspirated and discarded, while the stromal fraction at the bottom was washed for tree times with 10 mL of PBSA 1X and centrifugated again for 5 minutes. After last wash the pellet was resuspended in 10 mL of Alphamem medium (Sigma Aldrich, Inc., St Louis, Mo, USA) supplemented with 10% fetal calf serum, antibiotics (Penicillin 100 U/mL and Streptomycin 100 micrograms/mL - Sigma, Chemical Co., St Louis, Mo, USA) and amminoacids (L-Glutamine - Sigma, Chemical Co., St Louis, Mo, USA). The medium was changed after 2-3 days. When the cells were subconfluent, they were harvested and characterized for staminality by osteogenic induction. Osteogenic induction The osteogenic differentiation was performed with osteogenic medium containing 0.1 µM dexamethasone, 10 µM glycerophosphate and 50 µM ascorbic acid. The medium was changed every 3 days after initial plating.

Sollazzo V. et al.

101

Figure 1. Calcium accumulation in ADSC after 3 weeks of osteoinduction, visualized by Alizarin Red staining (A). Untreated ADSC (B). Original magnification x20

Alizarin red staining To evaluate calcium deposition, after 21 days of osteogenic medium, cells were washed with PBSA 1X, fixed with 10% formalin, rinsed three times with PBSA 1X and treated 5 minutes with 2% Alizarin red. Cell culture For the assay, ADSC at second passage were trypsinized upon subconfluence and seeded on TCP scaffolds (Fin-Ceramica Faenza S.p.A., Faenza, Italy). Another set of wells containing untreated cells were used as control. The medium was changed every 3 days. The cells were maintained in a humidified atmosphere of 5% CO2 at 37°C. Cells were harvested at two time points, 15 and 30 days, for RNA extraction. Quantitative real-time reversetranscriptase polymerase chain reaction was performed to measure mRNA expression of several osteogenic marker genes.

RNA processing Reverse transcription to cDNA was performed directly from cultured cell lysate using the TaqMAN Gene Expression Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA), following manufacturer’s instructions. Briefly, cultured cells were lysed with lysis buffer and RNA released in this solution. Cell lysate were reverse transcribed to cDNA using the RT Enzyme Mix and appropriate RT buffer (Ambion Inc., Austin, TX, USA). Finally the cDNA was amplified by realtime PCR using the included TaqMan Gene Expression Master Mix and the specific assay designed for the investigated genes. Real time PCR Expression was quantified using real time RT-PCR. The gene expression levels were normalized to the expression of the housekeeping gene RPL13A and were expressed as fold changes relative to the expression of the untreated ADSC. Quantification was done with the delta/ delta calculation method.15

Forward and reverse primers and probes for the selected genes were designed using primer express software (Applied Biosystems, Foster City, CA, USA) and are listed in Table 1. All PCR reactions were performed in a 20 µl volume using the ABI PRISM 7500 (Applied Biosystems, Foster City, CA, USA). Each reaction contained 10 µl 2X TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA, USA), 400 nM concentration of each primer and 200 nM of the probe, and cDNA. The amplification profile was initiated by 10-minute incubation at 95°C, followed by two-step amplification of 15 seconds at 95°C and 60 seconds at 60°C for 40 cycles. All experiments were performed including non-template controls to exclude reagents contamination. PCRs were performed with two biological replicates.

Volume 2 - Number 2 - 2011

102 Sollazzo V. et al.

Figure 2. Gene expression analysis of ADSC on TCP sacffolds for 15 days.

RESULTS The multilineage ability of ADSC was demonstrated inducing differentiation into osteoblasts, using a specific induction medium. After 3 weeks mineralized nodules were observed under the microscope as a result of calcium accumulation. This calcium accumulation was analyzed by Alizarin Red staining (Fig. 1). To study how TCP can induce osteoblast differentiation in ADSC, transcriptional expressions of several osteoblast-related genes (RUNX2, SP7, SPP1, COLIA1, COL3A1, ALPL and FOSL1) and mesenchymal stem cells marker (ENG) were examined after 15 and 30 days of TCP. After 15 days of treatment TCP enhanced the expression of bone related genes like RUNX2, COL1A1 and ALPL. The treatment did not affect the mRNA expression of COL3A1 that was similarly in both treated and untreated ADSC. SP7, FOSL1 and SPP1 were decreased in the presence of TCP at day 15 (Fig. 2).

Journal of Osteology and Biomaterials

The results of real-time PCR showed that after 30 days of treatment, compared to the control cells, two trascriptional factors RUNX2 and SP7 were up-regulated. The expression of others genes were decreased (Fig. 3). The expression of ENG was significantly decreased in stem cells treated with TCP at 15 and 30 days, indicating the differentiation effect of this biomaterial on stem cells.

DISCUSSION Repair of large bone defects represents a challenge to several fields of Medicine since autogenous grafts are not available in large amounts and its removal causes morbidity at the donor site.16 A new tissue-engineering approach is to cultivate bone marrow stromal cells (BMSCs) on matrices to further increase the bioactivity of the cell-matrix composite before implantation.9,17 Numerous studies demonstrated that BMSCs on suitable matrices prior to implantation can improve healing of large bone defects.18 Ideally, the matrix serves as a scaffold that is subsequently replaced by newly formed bone in vivo. In keeping with the tissue engineering concept, these cells are cultivated on three-dimensional (3D) scaffolds to replace 3D tissue defects. Therefore, resorbable materials are favored that provide a certain 3D stability.19 Bioactive calcium phosphates, such as hydroxyapatite (HAP) and Î˛-tricalcium phosphate (Î˛-TCP), have been intensively investigated as the cell scaffold for bone tissue engineering20 because it is well recognized that they are compatible to natural bone tissue and osteoconductive. However, the HAP is not practically degraded under the physical condition and remains inside the bone tissue regenerated. Therefore, as one trial to control the in vivo degradability, the HAP is combined with organic materials, such as collagen and glycolidelactide copolymer. It has been reported that the combination improves the degradation and mechanical properties for scaffolds.21 Especially, the combined collagen and HAP has been extensively

Sollazzo V. et al.

Figure 3: Gene expression analysis of ADSC on TCP sacffolds for 30 days.

utilized for bone tissue engineering since the structure is similar to that of nature bone tissue. On the other hand, β-TCP is advantageous from the viewpoint of biodegradability, but brittle compared with HAP. Combination with organic materials has also been trial to overcome the drawback of material properties.21 In the study conducted by Niemeyera et al.22 BMSCs were cultivated and differentiated towards the osteogenic lineage on mineralized collagen sponges and α-tricalcium phosphate (α-TCP). They demonstrated effective 3D growth of BMSCs on both scaffolds investigated. However, improved osteogenic differentiation was observed on the scaffolds as compared to control monolayers. Of the two matrices, mineralized collagen was superior to α-TCP with regard to seeding efficacy, increase in osteogenic marker genes and 3D cell alignment. Different results derived from the comparison between the use of autologous

bone and β-TCP and using β-TCP mixed with autologous aspirated bone. Szabo et al.,23 in a study of four patients requiring bilateral sinus lifts, they compared the use of autologous bone with β-TCP. Their results demonstrated the use of this material to obtain new bone. Histology showed the presence of 29.39% bone in the samples taken from patients on whom this material was used. Individual response had a lot of impact on the results, since those patients who had slow new bone formation, were so in both sinuses regardless of the material used. The results of Aguirre Zorzano et al.1 using β-TCP mixed with autologous aspirated bone were similar, with samples showing a mean 30.7% osseous tissue. Reinhardt and Kreusser24 treated 50 patients with sinus lifts using β-TCP as filling material and installing 101 implants of different Kinds. The histological study showed reabsorption of the grafted material to be in the same proportion as the

103

neo-osseous formation and absence of inflammatory signs. Recently, Szabo et al.25 have described a multicenter study with a split mouth method of sinus lift procedure, using β-TCP graft in one side and autogenous bone in the other side. After six months their results did not show any statistical relation to the kind of material graft, the mean bone percentage for β-TCP was 36.47% and for the bone 38.34%. In our study, mesenchymal stem cells from adipose tissue were isolated and induced to differentiate in osteoblasts using a specific induction medium. Our results showed that with appropriate medium, cells were able to undergo osteogenic features, demonstrating their differentiation ability. To study how TCP can induce osteoblast differentiation in mesenchymal stem cells, ADSC were cultivated for 15 and 30 days on TCP scaffolds. The expression levels of bone related genes and mesenchymal stem cells marker were analyzed, using real time Reverse Transcription-Polymerase Chain Reaction. ENG (CD105), a surface marker used to define a bone mesenchymal stem cell population capable of multilineage differentiation26 was down expressed in treated ADSC respect to control at 15 days of treatment with TCP. Its expression decreased further to 30 days of treatment indicating the differentiation effect of this biomaterial on stem cells. This gene is a receptor for TGF-β1 and -β327 and modulates TGF-β signaling by interacting with related molecules, such as TGF-β1, -β3 and BMP-2, -7. The members of TFG-β superfamily are mediators of cell proliferation and dif-

Volume 2 - Number 2 - 2011

104

Table 1. Primer and probes used in real time PCR Gene symbol

Gene name

SPP1

osteopontin

COL1A1

collagen type I alpha1

RUNX2

runt-related transcription factor 2

ALPL

alkaline phospatasi

COL3A1

collagen, type III, alpha 1

ENG

endoglin

FOSL1

FOS-like antigen 1

SP7

osterix

RPL13A

ribosomal protein L13

ferentiation and play regulatory roles in cartilage and bone formation.28 The disappearance of the CD105 antigen during osteogenesis suggests that this protein, like others in the TFG-β superfamily, is involved in the regulation of osteogenesis.29 Two transcriptional factors had an opposite expression. RUNX2 was up-regulated in treated ADSC respect to control while SP7 was down-expressed. RUNX2 is an important modulator of osteoblast differentiation and plays a fundamental role in osteoblast maturation and homeostasis. RUNX2-null mice have no osteoblasts and consequently bone tissue.30 This gene was up-regulated in ADSC cultivated with TCP for 15 days and its expression continued to increase after 30 days of treatment. Thus we demonstrated that TCP plates increase the activity of RUNX2 gene,

Journal of Osteology and Biomaterials

Primer sequence (5’>3’) F-GCCAGTTGCAGCCTTCTCA R-AAAAGCAAATCACTGCAATTCTCA F-TAGGGTCTAGACATGTTCAGCTTTGT R-GTGATTGGTGGGATGTCTTCGT F-TCTACCACCCCGCTGTCTTC R-TGGCAGTGTCATCATCTGAAATG F-CCGTGGCAACTCTATCTTTGG R-CAGGCCCATTGCCATACAG F-CCCACTATTATTTTGGCACAACAG R-AACGGATCCTGAGTCACAGACA F-TCATCACCACAGCGGAAAAA R-GGTAGAGGCCCAGCTGGAA F-CGCGAGCGGAACAAGCT R-GCAGCCCAGATTTCTCATCTTC F-ACTCACACCCGGGAGAAGAA R-GGTGGTCGCTTCGGGTAAA F-AAAGCGGATGGTGGTTCCT R-GCCCCAGATAGGCAAACTTTC

which is a key point in osteodifferentiation. SP7, is a zinc finger transcriptional factor that regulates bone formation and osteoblast differentiation in vitro and in vivo and is downstream of RUNX2; In the first 15 days of treatment the SP7 expression was down-regulated during osteogenic induction, probably because this gene regulates the later stages of osteoblast differentiation and bone development. Its expression began to increase after 30 days of treatment. TCP also modulate the expression of genes encoding for collagenic extracellular matrix proteins like collagen type 1α1 (COL1A1) and collagen type 3α1 (COL3A1). COL1A1 was up- regulated in treated compared to the control when exposed to TCP for 15 days. Its expression de-

Probe sequence (5’>3’) CCAAACGCCGACCAAGGAAAACTCAC CCTCTTAGCGGCCACCGCCCT ACTGGGCTTCCTGCCATCACCGA CCATGCTGAGTGACACAGACAAGAAGCC ATGTTCCCATCTTGGTCAGTCCTATGCG TGCACTGCCTCAACATGGACAGCCT ACTTCCTGCAGGCGGAGACTGACAAAC TCACCTGCCTGCTCTTGCTCCAAGC CTGCCCTCAAGGTCGTGCGTCTG

creased after 30 days of treatment, probably because TCP induces differentiation and matrix synthesis in the early stages of osteoblasts differentiation and proliferation. Harris et al.31 demonstrated that Type I collagen synthesis is associated with osteoblastic differentiation in the early stage, followed by the synthesis of ALP. COL3A1 was significantly down-expressed as compared to the control when exposed to TCP, probably because this gene is activated in the late stage of differentiation and is related to extracellular matrix synthesis. Increasing in ALPL expression is associated with osteoblast differentiation.32 β-TCP enhanced the expression of this gene after 15 days of treatment. Its expression decreased at the end of the 30 days. Several studies demonstrated that

Sollazzo V. et al.

the potency of individual substances to induce alkaline phosphatase varies in a species-dependent manner. Glucocorticoids such as dexamethasone are potent inducers in human and rat stromal cells, but they have no effect on alkaline phosphatase activity in mouse stromal cells33,34 At the contrary bone morphogenetic proteins (BMPs) are potent inducers of osteogenesis in both mouse and rat bone marrow stromal cells35 but Diefenderfer et al showed that BMP-2 alone is a poor osteoblast inducer in human marrow derived stromal cells.36 SSP1 encodes osteopontin, which is a phosphoglycoprotein of bone matrix and it is the most representative non collagenic component of extracellular bone matrix.37 Osteopontin is actively involved in bone resorbitive processes directly by ostoclasts.38 Osteopontin produced by osteoblasts, show high affinity to the molecules of hydroxylapatite in extracellular matrix and it is chemo-attractant to osteoclasts.39 In our study osteopontin was significantly down-expressed when exposed to TCP. Therefore TCP seem to act reducing bone resorption processes.Another investigated gene was FOSL-1 that encodes for Fra-1 a component of the dimeric transcription factor activator protein-1 (AP-1). AP-1 sites are present in the promoters of many osteoblast genes, including alkaline phosphatase, collagen I, osteocalcin. The differential expression of Fos family members could play a role in the regulation of bone-specific gene expression significant for osteoblast differentiation.40 In our study FOSL-1 was down-regulated up to 30 days. Kim et al.41 studying

105

the effect of a new anabolic agents that stimulate bone formation, find that this gene is activated in the late stage of differentiation, during the calcium deposition. TCP is an inducer of osteogenesis on human stem cells as demonstrated by the activation of of bone related genes: RUNX2, ALPL and COL1A1. It is our understanding, therefore, that more investigations with different time points and mesenchymal stem cells derived from other tissues are needed in order to get a global comprehension of the molecular events related to TCP action. The data reported can be relevant to better understand the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects.

Volume 2 - Number 2 - 2011

106 Sollazzo V. et al.

REFERENCE 1. Aguirre Zorzano LA, Rodriguez Tojo MJ, Aguirre Urizar JM. Maxillary sinus lift with intraoral autologous bone and B--tricalcium phosphate: histological and histomorphometric clinical study. Med Oral Patol Oral Cir Bucal 2007;12:E532-6.

11. Gebhart M, Lane J. A radiographical and biomechanical study of demineralized bone matrix implanted into a bone defect of rat femurs with and without bone marrow. Acta Orthop Belg 1991;57:130-43.

2. Uckan S, Deniz K, Dayangac E et al. Early implant survival in posterior maxilla with or without beta-tricalcium phosphate sinus floor graft. J Oral Maxillofac Surg;68:1642-5.

12. Flautre B, Descamps M, Delecourt C et al. Porous HA ceramic for bone replacement: role of the pores and interconnections - experimental study in the rabbit. J Mater Sci Mater Med 2001;12:679-82.

3. Handschel J, Simonowska M, Naujoks C et al. A histomorphometric meta-analysis of sinus elevation with various grafting materials. Head Face Med 2009;5:12.

13. Matsuno T, Nakamura T, Kuremoto K et al. Development of beta-tricalcium phosphate/collagen sponge composite for bone regeneration. Dent Mater J 2006;25:13844.

4. Jensen OT, Shulman LB, Block MS et al. Report of the Sinus Consensus Conference of 1996. Int J Oral Maxillofac Implants 1998;13 Suppl:11-45. 5. Miyamoto Y, Ishikawa K, Takechi M et al. Basic properties of calcium phosphate cement containing atelocollagen in its liquid or powder phases. Biomaterials 1998;19:707-15. 6. Ortakoglu K, Karacay S, Sencimen M et al. Distraction osteogenesis in a severe mandibular deficiency. Head Face Med 2007;3:7. 7. Tadjoedin ES, de Lange GL, Bronckers AL et al. Deproteinized cancellous bovine bone (Bio-Oss) as bone substitute for sinus floor elevation. A retrospective, histomorphometrical study of five cases. J Clin Periodontol 2003;30:261-70. 8. Rueger JM, Linhart W, Sommerfeldt D. [Biologic reactions to calcium phosphate ceramic implantations. Results of animal experiments]. Orthopade 1998;27:8995. 9. Heymann D, Delecrin J, Deschamps C et al. [In vitro assessment of combining osteogenic cells with macroporous calcium-phosphate ceramics]. Rev Chir Orthop Reparatrice Appar Mot 2001;87:8-17. 10. Toquet J, Rohanizadeh R, Guicheux J et al. Osteogenic potential in vitro of human bone marrow cells cultured on macropo-

Journal of Osteology and Biomaterials

rous biphasic calcium phosphate ceramic. J Biomed Mater Res 1999;44:98-108.

14. Mangano C, Bartolucci EG, Mazzocco C. A new porous hydroxyapatite for promotion of bone regeneration in maxillary sinus augmentation: clinical and histologic study in humans. Int J Oral Maxillofac Implants 2003;18:23-30. 15. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8. 16. Arrington ED, Smith WJ, Chambers HG et al. Complications of iliac crest bone graft harvesting. Clin Orthop Relat Res 1996:300-9. 17. Mankani MH, Kuznetsov SA, Fowler B et al. In vivo bone formation by human bone marrow stromal cells: effect of carrier particle size and shape. Biotechnol Bioeng 2001;72:96-107. 18. Kon E, Muraglia A, Corsi A et al. Autologous bone marrow stromal cells loaded onto porous hydroxyapatite ceramic accelerate bone repair in critical-size defects of sheep long bones. J Biomed Mater Res 2000;49:328-37. 19. Schaefer DJ, Klemt C, Zhang XH et al. [Tissue engineering with mesenchymal stem cells for cartilage and bone regeneration]. Chirurg 2000;71:1001-8. 20. Livingston T, Ducheyne P, Garino J. In vivo evaluation of a bioactive scaffold for

Sollazzo V. et al.

bone tissue engineering. J Biomed Mater Res 2002;62:1-13. 21. Lickorish D, Ramshaw JA, Werkmeister JA et al. Collagen-hydroxyapatite composite prepared by biomimetic process. J Biomed Mater Res A 2004;68:19-27. 22. Niemeyera P, Krauseb U, Fellenberga J et al. Evaluation of Mineralized Collagen and Îą-Tricalcium Phosphate as Scaffolds for Tissue Engineering of Bone Using Human Mesenchymal Stem Cells. Cells Tissues Organs 2004;177:68-78. 23. Szabo G, Suba Z, Hrabak K et al. Autogenous bone versus beta-tricalcium phosphate graft alone for bilateral sinus elevations (2- and 3-dimensional computed tomographic, histologic, and histomorphometric evaluations): preliminary results. Int J Oral Maxillofac Implants 2001;16:681-92. 24. Reinhardt C, Kreusser B. Restrospective study of dental implantation with sinus lift and Cerasorb augmentation. Dent Implantol 2000;14:18-26. 25. Szabo G, Huys L, Coulthard P et al. A prospective multicenter randomized clinical trial of autogenous bone versus beta-tricalcium phosphate graft alone for bilateral sinus elevation: histologic and histomorphometric evaluation. Int J Oral Maxillofac Implants 2005;20:371-81. 26. Jin HJ, Park SK, Oh W et al. Downregulation of CD105 is associated with multi-lineage differentiation in human umbilical cord blood-derived mesenchymal stem cells. Biochem Biophys Res Commun 2009;381:676-81. 27. Barry FP, Boynton RE, Haynesworth S et al. The monoclonal antibody SH-2, raised against human mesenchymal stem cells, recognizes an epitope on endoglin (CD105). Biochem Biophys Res Commun 1999;265:134-9. 28. Jakob M, Demarteau O, Schafer D et al. Specific growth factors during the expansion and redifferentiation of adult human articular chondrocytes enhance chondrogenesis and cartilaginous tissue formation in vitro. J Cell Biochem 2001;81:368-77.

29. Haynesworth SE, Baber MA, Caplan AI. Cell surface antigens on human marrowderived mesenchymal cells are detected by monoclonal antibodies. Bone 1992;13:6980. 30. Ziros PG, Basdra EK, Papavassiliou AG. Runx2: of bone and stretch. Int J Biochem Cell Biol 2008;40:1659-63. 31. Harris SE, Bonewald LF, Harris MA et al. Effects of transforming growth factor beta on bone nodule formation and expression of bone morphogenetic protein 2, osteocalcin, osteopontin, alkaline phosphatase, and type I collagen mRNA in long-term cultures of fetal rat calvarial osteoblasts. J Bone Miner Res 1994;9:855-63. 32. Turksen K, Bhargava U, Moe HK et al. Isolation of monoclonal antibodies recognizing rat bone-associated molecules in vitro and in vivo. J Histochem Cytochem 1992;40:1339-52.

107

in vitro and ex vivo study of remodeling bone. J Bone Miner Res 1995;10:1666-80. 39. Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive ceramic-based materials with designed reactivity for bone tissue regeneration. J R Soc Interface 2009;6 Suppl 3:S349-60. 40. McCabe LR, Banerjee C, Kundu R et al. Developmental expression and activities of specific fos and jun proteins are functionally related to osteoblast maturation: role of Fra-2 and Jun D during differentiation. Endocrinology 1996;137:4398-408. 41. Kim JM, Lee SU, Kim YS et al. Baicalein stimulates osteoblast differentiation via coordinating activation of MAP kinases and transcription factors. J Cell Biochem 2008;104:1906-17.

33. Leboy PS, Beresford JN, Devlin C et al. Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell cultures. J Cell Physiol 1991;146:370-8. 34. Beresford JN, Joyner CJ, Devlin C et al. The effects of dexamethasone and 1,25-dihydroxyvitamin D3 on osteogenic differentiation of human marrow stromal cells in vitro. Arch Oral Biol 1994;39:941-7. 35. Balk ML, Bray J, Day C et al. Effect of rhBMP-2 on the osteogenic potential of bone marrow stromal cells from an osteogenesis imperfecta mouse (oim). Bone 1997;21:7-15. 36. Diefenderfer DL, Osyczka AM, Garino JP et al. Regulation of BMP-induced transcription in cultured human bone marrow stromal cells. J Bone Joint Surg Am 2003;85-A Suppl 3:19-28. 37. McKee MD, Farach-Carson MC, Butler WT et al. Ultrastructural immunolocalization of noncollagenous (osteopontin and osteocalcin) and plasma (albumin and alpha 2HS-glycoprotein) proteins in rat bone. J Bone Miner Res 1993;8:485-96. 38. Dodds RA, Connor JR, James IE et al. Human osteoclasts, not osteoblasts, deposit osteopontin onto resorption surfaces: an

Volume 2 - Number 2 - 2011

BioCRA

109

Original article

The use of a pyrocarbon radial head prosthesis in the treatment of Mason IV lesions of the elbow: a clinical study. Vincenzo Sollazzo MD,1* Vincenzo Lorusso MD1

Aim Radial head fractures are common injuries frequently associated with other lesions like ulna or humerus fractures-dislocation and ligament rupture. The radial head replacement should be performed in irreparable radial head fractures associated or not with elbow dislocation, medial collateral or lateral ulnar collateral ligament disruption, Monteggia variants, coronoid process fractures and forearm interosseous membrane disruption. Materials and Methods In the present study we present the results of a series of 12 patients with a Mason IV fracture undergone to radial head replacement with prostheses in which the head is made of pyrocarbonof (Mopyc, Amplimedical). The mean age of patients was of 52.6 years (38â&#x20AC;&#x201C;76) and the mean follow-up was of 33 months (6-56). Results At a medium follow-up we observed a good range of movement, absent or moderate pain, no important deficit in grip strength. No clinical instability was found. At X-rays follow-up we didnâ&#x20AC;&#x2122;t observe heterotopic ossifications, periprosthesis osteolysis, or prosthesis loosening. Conclusions Our good results support the use of Mopyc prosthesis for the radial head replacement in type IV Mason-Johnston lesions of the elbow. (J Osteol Biomat 2011; 2:109-115)

Key words: radial head prosthesis, elbow, Mason IV lesions, pyrocarbon

Orthopedic Clinic, University of Ferrara, Corso Giovecca 203, 44120 Ferrara, Italy

Corresponding author: * Vincenzo Sollazzo MD Orthopedic Clinic - University of Ferrara Corso Giovecca 203 - 44120 Ferrara, Italy Phone: +39532236573 - Fax: +39532209250 Email: slv@unife.it

INTRODUCTION Radial head fractures are common injuries, representing the 33% of all elbow fractures and the 1.7%-5.4% of all fractures.1 They are more frequent in women than in men and occur most often between 30 and 40 years of age. These injuries, usually resulting from a fall with axial load onto the pronated-extended forearm and outstretched hand, are frequently associated with other lesions like ulna or humerus fractures-dislocation and ligament rupture. Other common injury mechanisms are a backward fall onto an extended-supinated forearm or a direct blow to the elbow. The management of radial head fractures requires a thorough knowledge of its stabilizing function in the complex kinematics of the elbow. The poor results reported in the Literature about the treatment of these fractures are probably due to understimation of associated injuries of the other structures that stabilize the joint. Radial shortening with wrist pain, decreased grip strength and weak forearm rotation, subluxation of the elbow and arthritic degeneration may be caused, respectively, by lesions of interosseus membrane and medial and collateral ligament. These lesions are very common in comminuted fractures, as shown by Johansson2 (medial

Volume 2 - Number 2 - 2011

110

Sollazzo V. et al.

Table 1.

FLEXION-EXTENSION PRONATION SUPINATION GRIP STRENGTH

collateral ligament or capsular disruption in 85% of Mason III fractures) and Davidson3 (disruption of interosseus membrane and in 9% of medial collateral ligament in 91%). The medial collateral ligament is the primary constraint of the elbow joint to valgus stress and the radial head is therefore a secondary stabilizer of the joint where the ligaments are intact. The medial collateral ligament is inserted at the base of the coronoid process and an associated fracture at this site, as in Regan-Morrey type II and III, reduces the function the ligament.

AVERAGE RESULT 128째 74째 72째 31 KG. 88% OF NON INJURIED SIDE The radial head plays a major role in the transmission of forces. The 60% of a load applied to the hand is transmitted through the joint radiocapitellar during elbow flexion against resistance.4 This force increases with the extension of the elbow and forearm pronation up to 90% of body weight.5 The radial head is responsible for the axial stability of the forearm, especially in the setting of an interosseus ligament disruption,6 and is a valgus stabilizer in the setting of an incompetent medial collateral ligament. Radial head excision has little ef-

Figure 1. The prosthesis (Mopyc, Amplimedical, Assago-MI, Italy) has a pyrocarbon head and a modular neck and stem. This extensive modularity permit 48 possibilities of stem/ neck/head combinations and allows a good anatomic adaptability.

Journal of Osteology and Biomaterials

fect on the elbow valgus stability if this ligament is intact. The rupture of both lateral and medial ligament causes laxity and elbow subluxation.7 The Mason classification is widely used for the classification of the types of fractures.8 Type I includes undisplaced or minimally displaced (less than 2mm) marginal lip fractures with no mechanical block to motion. Type II includes larger displaced fractures with or without a mechanical block. Types III are displaced comminuted radial head or neck fractures which cannot be reconstructed. Johnson added a fourth type, a radial head fracture with an elbow dislocation.9 The distinction between type II and type III is problematic and many Mason II fractures are reclassified to type III during surgery. Type I and undisplaced type II fractures can be treated conservatively with early mobilization while displaced type II fractures can be treated with rigid internal fixation. Type III fractures should be treated with excision if stable or with radial head replacement with prosthesis if unstable. The elbow is considered to be unstable if it subluxes at > 40째 of extension. Suture of lateral (and medial, where possible) ligament should be performed and coronoid/ proximal ulnar fractures should be rigidly fixed if possible.10 The radial head replacement should be performed in irreparable radial head fractures (rim fracture > 30%) associated or not with elbow dislocation medial collateral or lateral ulnar collateral ligament disruption, Monteggia variants, coronoid process fractures and forearm interosseous membrane disruption (EssexLopresti).11

Sollazzo V. et al.

Figures 2. The Kocher surgical approach (A); The choice of the size of the neck and of the head of the prosthesis (B); The preparation of the radial canal (C); The definitive implant with pyrocarbon head (D).

Speed first reported the use of prosthesis to replace the radial head in 1941 with the goal to prevent the proximal migration of the radius and cubitus valgus.12 Over the years, different materials were introduced until Swansonâ&#x20AC;&#x2122;s silicone implants.13 The silastic prosthesis are still being inserted despite the evidence that they are an inferior material when compared to metal prostheses. Silicone is not rigid enough to support the weight of the lateral column of the elbow, therefore it deforms under load and transfers minimal load to the capitellum. Its function is therefore of spacer with no increase in axial or valgus stability. Complication as fracture of silicon implants and silicone-based synovitis are widely described.14,15 At present, a large number of metallic radial head prosthesis is available and, in contrast with silicon rubber, they pro-

vide good elbow stability.16 The functional outcome after radial head prosthesis in the treatment of radial head fractures, associated with instability of the elbow, has shown to be relatively satisfactory.17,18 Radial head prosthesis is also indicated for pain and mobility reduction in selective cases of degenerative radioulnar proximal arthritis, rheumatoid arthritis, radial head fracture sequelae, radial head resection with complications on the elbow and/or distal radioulnar joint. In the present study we present the results of a series of 12 patients with a Mason IV fracture undergone to radial head replacement with prostheses in which the head is made of pirocarbon (Mopyc, Amplimedical, Assago-MI, Italy).

111

MATERIALS AND METHODS Between September 2005 and December 2009 (Tab.1) we treated 12 patients with fracture-dislocation of elbow (Mason-Johnston IV). In three cases the lesion was associated with a proximal ulnar fracture and in one case with a omolateral lunate dislocation. No distal radioulnar joint instability was noticed among the patients. Mean age was 52.6 years (38â&#x20AC;&#x201C;76). There were 5 men and 7 women. The dominant arm was injured in 50% of the cases (7 sn and 5 dx). The evaluation of the patients included anteroposterior and lateral X-rays to study the integration of the prosthesis and the status of the elbow joint and a personal interview/ physical examination at 3-6-12 months. The ranges of motion were measured with a goniometer. The grip strength was measured with a Jamar-type dynamometer on both sides. The mean follow-up was 33 months (6â&#x20AC;&#x201C;56). The prosthesis (Mopyc, Amplimedical) is modular and formed with three components: head, neck and stem (Fig. 1). The head in pyrocarbon has a spherical shape in order to fit in the proximal radial notch. The proximal part is concave to fit into the capitellum. Pyrolytic carbon was first used for artificial heart valves in 1969 and later in the orthopaedic field for MCP arthroplasties,19 20 the PIP arthroplasties21 and the Proximal Scaphoid Implant.22 Pyrocarbon is extremely biocompatible and has high wear resistance: the polishing of pyrocarbon can be superior to the other materials used in the orthopaedic field (Ra=0.03 lm) allowing perfect gliding on lateral condyle without damage or wear. Its density and elasticity modulus are very close to that of bone and al-

Volume 2 - Number 2 - 2011

112

Sollazzo V. et al.

Figure 3. Postero-lateral dislocation of the elbow with displaced fracture of the radial head associated in a 37 years old male patient (A) and preoperative X Rays (B). X rays at follow-up 48 months after surgical treatment (C,D)

low a good transmission of mechanical strength between bone and implant and thanks to its mechanical properties, pyrocarbon is nicely adapted the

Journal of Osteology and Biomaterials

contact with the articular cartilage. The neck and the stem are made of TAGV (titanium alloy). The neck has a 15째 angulation to restore the anatomical

axis. The orientation of the neck is critical and facilitated by an anallary guide. The stem in titanium is cementless fixed thanks to an expansion device

Sollazzo V. et al.

113

Table 2.

DOMINANT SIDE NO

HOMOLATERAL LUNATE DISLOCATION

YES

PROXIMAL ULNAR FRACTURE

YES

CASE

AGE

SEX

controlled by a dynamic screw allowing primary fixation. There are three sizes for the head, four sizes for the neck (5, 7, 9, 11 mm length) and four sizes for the stem. This extensive modularity (48 possibilities of stem/neck/head combinations) allows anatomic adaptability and minimal bone resection. The forearm was operated in a pronated position in order to avoid neurological damage to the posterior interosseous nerve, as described by Diliberti et al.23 We used the Kocher approach (Fig.2). The parts of the broken head were reassembled on a table to ensure that the whole head had been resected and to choose the size of the prosthetic head. A cutting guide was used in order to achieve a good resection, which must be perpendicular to the axis of the radius. The radial shaft was prepared and the trial stem was

ASSOCIATED INJURIE

PROXIMAL ULNAR FRACTURE

introduced. The positioning and height of the prosthesis are essential for the success of the implantation. Four sizes of neck are available. The head had to reach the limit between the trochlear notch and the radial notch of the ulna. In a pronated position, the angulation had to be in the same plane as the first metacarpal bone, enabling the radius to cross over the ulna while pronating. In a supinated position, the radial head had to ‘‘watch’’ in the direction of the capitellum. After removal of the trial elements, the stem was inserted. The expansion screw was then applied with the expansion screwdriver. After stem locking, the head and the neck were assembled together with a special device on the table and inserted together on the stem. Suture of anular ligament and lateral collateral ulnar ligament was performed.

RESULTS We observed good clinical results (as resumed in Tab.2). The average range of movement in flexion extension was 128° (100°-150°). The average pronation was 74° (60°-80°). The average supination was 73° (60°-80°). The average grip strength was 31 kg (20-45), the 88% of the non-injured side. At 3 months 4 patients presented a slight pain at rest; eight presented a moderate pain during daily activities. At 6 months, five patients presented a slight pain during repetitive activities. No clinical instability was found. No heterotopic ossifications, no radio-ulnar synostosis, no periprosthesis osteolysis, no prosthesis loosening was observed at X-rays at the latest follow-up.

Volume 2 - Number 2 - 2011

114

Sollazzo V. et al.

CONCLUSIONS Radial head prosthesis represents the gold standard in the Mason-Johnston type IV fractures because it is the only procedure able to restitute the height of the radius, to obtain stability of the elbow, to permit a good rotation of the forearm and to prevent proximal migration of the radius.24,25 The unsatisfactory results and the complications described in Literature are attributable to the materials previously used. Silicon rubber implants are not able to transfer load and can cause silicone-based synovitis. Also metallic implants present complications. Radial head replacement is an unilateral arthroplasty and the contact between the cartilage and a metallic prosthesis can damage the humeral articular surface.26,27 The head of the prosthesis that we used in this series of patients is made of pyrocarbon. This material has a high wear resistance, an elasticity modulus close to that of bone and good biocompatibility properties therefore it is adapted to the contact with articular cartilage. The convex shape of the peripheral aspect of the prosthetic head allows a good contact between the articular surfaces and a better forearm rotation. Stem, neck and head are available in different sizes allowing 48 combinations for perfect adaptation in each individual case. The possibility to restore the anatomical axis with the guide for the 15° neck-shaft angle and the possibility to choose different sizes llows to avoid such complications as over and under stuffing or malrotation of implant. In this paper we report the results of the treatment of fracture-dislocation of the elbow (Mason-Johnston IV) with

Journal of Osteology and Biomaterials

a modular prosthesis in a series of 12 patients. Our good results are consistent with those described in the Literature.17,28 At a medium follow-up we observed a good range of movement, absent or moderate pain, no important deficit in grip strength. No clinical instability was found. At X-rays followup we didn’t observe heterotopic ossifications, periprosthesis osteolysis, or prosthesis loosening. Our good results support the use of Mopyc prosthesis for the radial head replacement in type IV Mason-Johnston lesions of the elbow. Acknowledgments This work was supported by FAR from the University of Ferrara (V.S.), Ferrara, Italy, and from Regione Emilia Romagna, Programma di Ricerca Regione Università, 2007–2009, Area 1B: Patologia osteoarticolare: ricerca pre-clinica e applicazioni cliniche della medicina rigenerativa, Unità Operativa n. 14.

Sollazzo V. et al.

REFERENCES 1. Morrey BF. The elbow and its disorders. Philadelphia: Saunders W.B.; 1993. 2. Johansson O. Capsular and ligament injuries of the elbow joint. A clinical and arthrographic study. Acta Chir Scand Suppl 1962;Suppl 287:1-159.

ment arthroplasty. J Bone Joint Surg Am 1981;63:1039-49. 14. Morrey BF, Askew L, Chao EY. Silastic prosthetic replacement for the radial head. J Bone Joint Surg Am 1981;63:4548.

3. Davidson PA, Moseley JB Jr, Tullos HS. Radial head fracture. A potentially complex injury. Clin Orthop Relat Res 1993:224-30.

15. Vanderwilde RS, Morrey BF, Melberg MW et al. Inflammatory arthritis after failure of silicone rubber replacement of the radial head. J Bone Joint Surg Br 1994;76:78-81.

4. Halls AA, Travill A. Transmission of Pressures across the Elbow Joint. Anat Rec 1964;150:243-7.

16. Calfee R, Madom I, Weiss AP. Radial head arthroplasty. J Hand Surg Am 2006;31:314-21.

5. Morrey BF, An KN, Stormont TJ. Force transmission through the radial head. J Bone Joint Surg Am 1988;70:250-6.

17. Popovic N, Gillet P, Rodriguez A et al. Fracture of the radial head with associated elbow dislocation: results of treatment using a floating radial head prosthesis. J Orthop Trauma 2000;14:171-7.

6. Sellman DC, Seitz WH Jr, Postak PD et al. Reconstructive strategies for radioulnar dissociation: a biomechanical study. J Orthop Trauma 1995;9:516-22. 7. Morrey BF, Tanaka S, An KN. Valgus stability of the elbow. A definition of primary and secondary constraints. Clin Orthop Relat Res 1991:187-95. 8. Mason ML. Some observations on fractures of the head of the radius with a review of one hundred cases. Br J Surg 1954;42:123-32. 9. Johnston GW. A follow-up of one hundred cases of fracture of the head of the radius with a review of the literature. Ulster Med J 1962;31:51-6. 10. Graham JWK. Management of radial head fractures with implant arthroplasty. The Journal of Hand Surgery 2004;4:1126. 11. Madsen JE, Flugsrud G. Radial Head Fractures: Idications and technique for Primary Arthroplasty. European Journal of Trauma and Emergency Surgery 2008;2:105-12.

18. Harrington IJ, Sekyi-Otu A, Barrington TW et al. The functional outcome with metallic radial head implants in the treatment of unstable elbow fractures: a longterm review. J Trauma 2001;50:46-52.

115

replacement in the medial collateral-ligament deficient elbow. J Bone Joint Surg Am 2004;86-A:2629-35. 25. Van Glabbeek F, van Riet RP, Baumfeld JA et al. The kinematic importance of radial neck length in radial head replacement. Med Eng Phys 2005;27:336-42. 26. Alnot JY, Katz V, Hardy P. GUEPAR radial head prosthesis for recent and old fractures: a series of 22 cases. Rev Chir Orthop Reparatrice Appar Mot 2003;89:304-9. 27. Liew VS, Cooper IC, Ferreira LM et al. The effect of metallic radial head arthroplasty on radiocapitellar joint contact area. Clin Biomech (Bristol, Avon) 2003;18:115-8. 28. Allieu Y, Winter M, Pequignot JP et al. Radial head replacement with a pyrocarbon head prosthesis: preliminary results of a multicentric prospective study. Eur J Orthop Surg Traumatol 2006;16:1-9.

19. Cook SD, Thomas KA, Kester MA. Wear characteristics of the canine acetabulum against different femoral prostheses. J Bone Joint Surg Br 1989;71:189-97. 20. Cook SD, Beckenbaugh RD, Redondo J et al. Long-term follow-up of pyrolytic carbon metacarpophalangeal implants. J Bone Joint Surg Am 1999;81:635-48. 21. Moutet F, Guinard D, Gerard P et al. A new titanium-carbon finger joint implant. Apropos of 15 initial cases. Ann Chir Main Memb Super 1994;13:345-53. 22. Pequignot JP, Lussiez B, Allieu Y. A adaptive proximal scaphoid implant. Chir Main 2000;19:276-85.

12. Speed K. Ferrule caps for the head of the radiu. Surg Gynecol Obstet 1941;73:845â&#x20AC;&#x201C;50.

23. Diliberti T, Botte MJ, Abrams RA. Anatomical considerations regarding the posterior interosseous nerve during posterolateral approaches to the proximal part of the radius. J Bone Joint Surg Am 2000;82:809-13.

13. Swanson AB, Jaeger SH, La Rochelle D. Comminuted fractures of the radial head. The role of silicone-implant replace-

24. Van Glabbeek F, Van Riet RP, Baumfeld JA et al. Detrimental effects of overstuffing or understuffing with a radial head

Volume 2 - Number 2 - 2011

BioCRA

117

Original article

The immediate functional loading of seven and mistral implants with new multi unit titanium abutments. 24 Months follow up report. Luca Di Alberti1-3*, Dario Bertossi2, Federica Donnini3, Fabio Tamborrino1-4, Teocrito Carlesi5, Pierfrancesco Nocini2, Lorenzo Lo Muzio1

Aim The ultimate goal of an immediate loading protocol is to reduce the number of surgical interventions and shorten the time frame between surgery and prosthetic delivery, all without sacrificing implant success rates. The aim of this study was to evaluate the use of a new titanium abutments for screw retained prosthesis in edentulous patients in a immediate loading procedure in order to reduct the number of surgical steps. Materials and Methods 20 patients completely edentulous, 10 maxillae and 10 mandibles were treated with 6 implants and 5 implants respectively for a total of 110 implants. All patients received SLA screw-shaped Seven and-or Mistral implants (MIS, Shalomi, Israel). The treatment objective involved delivery of the provisional prosthesis within 4 h of implant placement, final rehabilitation was completed 6 months later. The patients were on a strict recall program during the first 6 months and Periapical radiographs were also performed subsequently, after 3, 6, 12 and 24 months of occlusal loading. Results and conclusions One implant was lost out of the 110 inserted. The observed marginal bone change around immediate loaded implants was similar to that reported for delayed loading implants in the literature. The immediate loading of SLA surface Seven and Mistral implants for support of full-arch prostheses represents a viable therapy for the totally edentulous maxilla and mandible. (J Osteol Biomat 2011; 2:117-123)

Key Words: immediate loading, dental implant, multi unit titanium abutments, full-argh prostheses

Department of Dental Sciences, University of Foggia Section of Oral and Maxillofacial Surgery Department of Surgery, University of Verona, Italy 3 Private practice, Chieti, Italy 4 Private practice, Lecce, Italy 5 Private practice, Vasto (Ch), Italy 1 2

Correspondence to: * Dr Luca Di Alberti Via Colonnetta, 22 66013 Chieti, Italy dialbertiluca@yahoo.it

INTRODUCTION Immediate loading of dental implants has been defined as a situation where the superstructure is attached to the implants at time of the surgery and no later than 72 h after surgery1,2. The definition of immediate functional loading also includes occlusion with the teeth of the opposite jaw. Under these conditions, successful immediate loading of screw-type dental implants has been reported as early as 1979 3. Micromovements have been deeply studied in dental implants loading but the question of reduction of micromovements has not been addressed in controlled studies dealing with immediate loading of oral implants. Passive fit of provisional prostheses has been mentioned as an important factor in the osseointegration of immediately loaded implants. A prosthesis that is ill-fitting may become loose, resulting in increased stress on the implants, which can lead to excessive micromotion and loss of an implant 4 . In this context, it has been hypothesized that screw-retained passively fitting restorations may be superior to cement-retained ones with respect to this problem, because they are less likely to loosen. If a cemented restoration is desired, the abutments should be long enough to provide adequate retention4.

Volume 2 - Number 2 - 2011

118

Di Alberti L. et al.

The exclusion criteria for dental implants, immediate loading and immediate functional loading are of extreme importance and they include insufficient bone volume, severe maxillomandibular skeletal discrepancy, drug and alcohol abuse, heavy smoking, local radiotherapy to the head and neck region for malignancies, antiblastic chemotherapy, severe chronic renal or liver disease, uncontrolled diabetes, stroke, recent infarction, pregnancy at the time of evaluation, haemophilia, bleeding disorders or coumadin therapy, metabolic disorders, acute infection of the implant site, signs of chronic bone disease, and general contraindications for surgical procedures4-10. The ultimate goal of an immediate loading protocol is to reduce the number of surgical interventions and shorten the time frame between surgery and prosthetic delivery, all without sacrificing implant success rates. The aim of this study is to evaluate the use of new titanium abutments for screw-retained prosthesis in edentulous maxillary bones in a immediate loading procedure in order to reduce the number of surgical steps. MATERIALS AND METHODS The study was performed in two clinical centers by two investigators who followed the same clinical protocol for immediate occlusal loading of implants placed in the edentulous mandible or maxilla. 20 patients were enrolled in the study. Of these patients 10 maxillae and 10 mandibles were treated with 6 implants and 5 implants respectively for a total of 110 implants. All patients were edentolous on the maxilla and/or the mandible at the time of surgery. All patients were treated with Seven and/

Journal of Osteology and Biomaterials

Figure 1. Follow up control at 3 months after surgery and loading. It is possible to note the quality of the soft tissues and the integration with all titanium components.

or Mistral implants (MIS, Israel) and a screwed resin prosthetic appliance as a provisional was fixed at the time of surgery. Inclusion and exclusion criteria Patients were included in the study according to the following criteria: (1) completely edentulous in the jaws; (2) rehabilitation with oral implants considered an elective treatment; (3) physically able to tolerate conventional surgical and restorative procedures; (4) informed consent signed; (5) implants seated with a torque >45Ncm showing good primary stability; and (6) dense/ normal bone quality. Bone quality was scored according to the classification proposed by Trisi &Rao (14) as dense (type I according to the classification proposed by Lekholm & Zarb, normal (type II窶的II) and soft (type IV) bone. (Table 1). The exclusion criteria were: (1) active infection in the sites intended for im-

plant placement; (2) systemic diseases such as diabetes (all types, regardless of control); (3) treatment with therapeutic radiation to the head within the past 12 months; (4) need for bone augmentation at the intended implant site; (5) radiographic evidence of unresorbed allograft at the implant site; (6) severe bruxism; (7) pregnancy; and (8) patients smoking more than 10 cigarettes a day. (Table 2). Success criteria The following success criteria were applied in evaluating each implant: (1) no clinically detectable mobility when tested with Ostell; (2) no evidence of peri-implant radiolucency on periapical radiographs; (3) no recurrent or persistent peri-implant infection; (4) no complaint of pain at the site of treatment; (5) no complaint of neuropathies or paraesthesia; (6) crestal bone loss not exceeding 1.5mm by the end of the first year of functional loading 11.

Di Alberti L. et al. 119

Table 1. Inclusion criteria of the clinical study. INCLUSION CRITERIA 1

Controlled diabetic patients Rehabilitation with oral implants considered an elective treatment Physically able to tolerate conventional surgical and restorative procedures;

2 3 4

Informed consent signed

Implants seated with a torque >40 Ncm showing good primary stability

Dense/normal bone quality

Table 2. Exclusion criteria of the clinical study

EXCLUSION CRITERIA 1

Active infection in the sites intended for implant placement

Systemic diseases other than diabetes

3 4 5

Radiation therapy to the head within the past 12 months Need for bone augmentation at the intended implant sites Radiographic evidence of unresorbed allograft at the implant sites

Severe bruxism

Pregnancy

Patients smoking more than 10 cigarettes a day

Surgical procedures All patients received SLA screw-shaped Seven and-or Mistral implants (MIS, Israel). All clinicians followed the implant manufacturers instructions for implant site preparation and implant insertion procedures. The initial primary stability was assessed by setting the insertion torque of the surgical unit and recorded according to the following modified classification: ‘tight’ when torque was >45Ncm, ‘firm’ between 30 and 44Ncm

or ‘loose’ when less than 30 Ncm (modified of Testori et al.15). The type, length and the diameter of the individual implants could vary from subject to subject, depending upon bone quality and quantity at each surgical site. (Table 3). Prosthetic procedures The treatment objective involved delivery of the provisional prosthesis within 4 h of implant placement, by utilizing standard abutments (MIS, Shlomi, Is-

rael) and the prosthetic procedure that best suited the clinical case. The design of the prosthesis was determined by a collaborative effort between the surgeon, the restorative doctor and the patient, as long as the outcome was consistent with the study’s objectives. A reinforced acrylic provisional bridge was relined over titanium provisional multi unit cylinders and immediately screwed onto the abutments. The occlusion was carefully checked. Follow-up procedures No specific diet was recommended to the patients. The patients were on a strict recall program during the first 6 months: every week during the first month, and every two weeks between the second and third month and every month until the sixth month. Orthopantograms and periapical radiographs were obtained for image analysis at implant insertion. Periapical radiographs were also performed subsequently, after 3, 6 , 12 and 24 months of occlusal loading. Radiographic evaluation Peri-implant marginal bone change was evaluated utilizing a computerized measuring technique applied to intraoral periapical radiographs (RVG, Kodak, USA). The evaluation of the marginal bone level around the implants was carried out using Kodak RVG’s image analysis software (Kodak, USA). Bone loss at each follow-up visit was calculated for each implant by determining the difference between baseline values.

Volume 2 - Number 2 - 2011

120

Di Alberti L. et al.

Table 3. Characteristics of 110 immediately loaded implants.

IMPLANT LENGHT

IMPLANT DIAMETER

Figure 2. Components for immediate loading for Seven implants.

Figure 3. Components for Mistral implants.

RESULTS One implant was lost out of the 110 inserted. The implant showed extensive marginal bone resorption and signs of peri-implantitis. The patient had a history of bruxism/ smoking and periodontitis. The implant lost was located distally (ie. the last implant placed) in one of the mandibles. (Table 4). No patients enrolled in the study

Journal of Osteology and Biomaterials

11.5

TOTAL

110

dropped out during the study period and all patient showed great satisfaction for the effectiveness of the treatment. The RFA registrations showed higher values for mesial-distal measurements than for buccal-palatal ones; 65.3 ISQ (SD 6) vs. 55.8 ISQ (SD 6.9) for all implants. Radiographic findings The marginal bone level was situated more coronally for the study implants at all points in time in comparison to the literature . After 6 months the marginal bone level was on average 0.7mm (SD 1.1) below the implant shoulder for the mandibular implants and 1.7mm (SD 1.2) for the maxillary implants. On average 0.8mm (SD 1.2) of bone loss was observed for the mandibular implants in comparison to a loss of 1.8mm (SD 1) for the control implants during the 12 month period (P<0.05) More implants in the maxillary group showed bone loss during these 12 months. A combination of marginal bone loss and soft tissue health problems were found for two implants in one maxillary patient.

Technical complications Resin-related technical complications occurred more often in mandibular than in maxillary patients. One study provisional bridge showed loosening of assembly screws at the three month check-up. The occurrence of adverse events after prosthodontic treatment are shown in Table. It was clear in this study that the titanium abutments were effective in preventing technical complications, in both the maxilla and mandible. DISCUSSION There is a tendency in medicine to reduce the treatment time and simplify the treatment in order to increase patient acceptance and reduce the risk of complications. Treatment simplification for implant dentistry may be obtained either by early or by immediate loading procedures . Early loading has been made possible by using textured surfaces that promote osseointegration12-15. By contrast, immediate occlusal loading procedures can be successful only when the amount of micro-motion at the boneâ&#x20AC;&#x201C;implant interface is kept beneath

Di Alberti L. et al. 121

Table 4. Analysis of 148 immediately loaded implants

Interval Time (Months)

N째 of Patients

N째 of Implants

Failed Implants

148

100

147

99,32

147

100

99,32

147

100

99,32

147

100

99,32

147

100

99,32

147

100

99,32

147

100

99,32

147

100

99,32

a certain threshold during the healing phase16,17. Extended bone implants integration periods and multiple surgeries present challenges towards gaining patient acceptance for implant therapy as a treatment option in partially dentate and edentulous jaws. Immediate loading of oral implants could potentially overcome these problems. It is widely accepted that immediate loading is a desirable procedure, if the outcome in terms of implant survival and success is comparable with that of conventional loading. Therefore, it has been the aim of the present study to show the clinical outcome and indications for screwed immediate loaded prosthetic appliances, to assess the level of evidence and to discuss implant survival and success rates of this protocol. The experience in immediate occlusal loading of oral implants has led to different consensus papers 1,2,18. In most of the studies on immediate loading, good

bone quality has been mentioned as an important prognostic factor for the success of the procedure 5,19. Although this conclusion seems reasonable, the level of evidence that supports this assumption is low. The same is true for the implant lengths and diameters that should be used for immediate loading. In a controlled study, rough implant surfaces improved the survival rate of im-

Interval Survival Cumulative rate (%) Survival Rate (%)

mediately loaded implants 20; however, the influence of the rough as opposed to machined surfaces was not significant. Review papers on immediate loading have addressed additional biomechanical aspects of this procedure 5,17,21. Based on different experimental studies, they have stated that a micromotion threshold should not be exceeded;

Figure 4. Particular of the titanium abutment components for immediate loading of Seven and Mistral implants.

Volume 2 - Number 2 - 2011

122

Di Alberti L. et al.

Figure 5. Full arch resin embedded prosthesis with titanium components inserted and ready to be fitted over multi-unit and trans-octa attachments.

otherwise, osseointegration would be hindered. The critical threshold seems to be 50–15 µm)16,22. Therefore, it has been claimed that a high initial stability is necessary for immediate loading of dental implants24,25. Besides high initial stability, it has been stressed that immediately loaded implants in multi-unit situations should be rigidly splinted by their superstructures26,27. In order to optimize splinting, metal reinforced superstructures have been used; however, it could be shown that high success rates may be achieved

with superstructures that were not metal reinforced26. Again, there are no evidence-based data that support the hypothesis that superstructures supported by immediately loaded implants should be metal reinforced. RFA was used to assess implant stability after 2 years. Measurements were made in both the mesial–distal and the buccal–palatal directions. Interestingly, the buccal–palatal measurements were some 10 ISQ units lower than the mesial–distal readings. This supports the findings of Veltri et al.28. The

Figure 6. 24 months X-ray follow-up of full arch immediate loading with screwed titanium components firstly and finally with screwed Toronto bridge over Seven and Mistral implants

Journal of Osteology and Biomaterials

RFA technique measures stability as a function of interface stiffness and the results indicate a higher stiffness in the mesial–distal direction. This finding can be explained by the fact that the bone is thinner at the buccal and palatal aspects of the implants. However, the manufacturers’ recommendation is to make measurements perpendicular to the jaw bone which may give a false impression of low stability. Other authors have also used RFA on the present implant design in the maxilla and reported similar ISQ values for measurements in the buccal–palatal directions29. No implant, abutment, abutment screw or assembly screw fractured during the 2 years of function. This is in accordance with the results obtained by Jemt30 after two-stage implant installation. In the present study, 20 patients received their provisional prosthesis as planned, within 4 h after surgery, whereas their final rehabilitation was completed 6 months later. All the patients were pleased that they could avoid wearing a removable prosthesis and be fitted with a fixed appliance within 4 h. In this study, the observed marginal bone change around immediate loaded implants was similar to that reported for delayed loading implants in the literature11. We conclude that immediate loading of SLA surface Seven and Mistral implants for support of full-arch prostheses represents a viable therapy for the totally edentulous maxilla and mandible.

Di Alberti L. et al. 123

REFERENCES 1. Aparicio C, Rangert B, Sennerby L. Immediate/early loading of dental implants: a report from the Sociedad Espanola de Implantes World Congress consensus meeting in Barcelona, Spain, 2002. Clin Implant Dent Relat Res 2003;5:57–60. 2. Cochran DL, Morton D, Weber HP. Consensus statements and recommended clinical procedures regarding loading protocols for endosseous dental implants. Int J Oral Maxillof Implants 2004;19s:109–113. 3. Ledermann PD. Stegprothetische Versorgung des zahnlosen Unterkiefers mit Hilfe von plasmabeschichteten Titanschraubenimplantaten. Deutsche Zahnarztliche Zeitschrift 1979;34:3–7. 4. Jaffin RA, Kumar A, Berman CL. Immediate loading of dental implants in the completely edentulous maxilla: a clinical report. Int J Oral Maxillof Implants 2004;19:721–730. 5. Chiapasco M, Abati S, Romeo E, Vogel G. Implant-retained mandibular overdentures with Branemark System MKII implants: a prospective comparative study between delayed and immediate loading. Int J Oral Maxillof Implants 2001;16:537–546. 6. Chow J, Hui E, Liu J, Li D, Wat P, Li W, Yau YK, Law H. The Hong Kong Bridge Protocol. Immediate loading ofmandibular Branemark fixtures using a fixed provisional prosthesis: preliminary results. Clin Implant Dent Relat Res 2001;3:166–174. 7. Hui E, Chow J, Li D, Liu J, Wat P, Law H. Immediate provisional for single-tooth implant replacement with Bra°nemark system: preliminary report. Clin Implant Dent Relat Res 2001;3: 79–86. 8. Proussaefs P, Kan J, Lozada J, Kleinman A, Farnos A. Effects of immediate loading with threaded hydroxyapatite-coated root-form implants on single premolar replacements: a preliminary report. Int J Oral Maxillof Implants 2002;17:567–572. 9. Proussaefs P, Lozada J. Immediate loading of hydroxyapatite-coated implants in the maxillary premolar area: three-year results of a pilot study. J Prosthet Dent 2004;91:228– 233. 10. Ibanez JC, Tahhan MJ, Zamar JA, Menendez AB, Juaneda AM, Zamar NJ, Monqaut JL Immediate occlusal loading of double acid-etched surface titanium implants in 41

consecutive full-arch cases in the mandible and maxilla: 6- to 74-month results. J Periodontol 2005;76:1972–1981. 11. Albrektsson T, Zarb G, Worthington P, Eriksson A. The long-termefficacy of currently used dental implants: a review and proposed criteria of success. Int J Oral Maxillof Implants 1986;1: 11–25. 12. Buser D, Schenk RK, Steinemann SG, Fiorellini JP, Fox CH, Stich H. Influence of surface characteristics on bone integration of titanium implants: a histomorphometric study in miniature pigs. J Biomed Mat Res 1991;25:889–902. 13. Cochran DL, Schenk RK, Lussi A, Higginbottom FL, Buser D. Bone response to unloaded and loaded titanium implants with a sandblasted and acid-etched surface: a histometric study in the canine mandible. J Biomed Mater Res 1998;40:1–11. 14. Trisi P, Rao W, Rebaudi A. A histometric comparison of smooth and rough titanium implants in human low-density jawbone. Int J Oral Maxillofac Implants 1999;14:698– 698. 15. Testori T, Del Fabbro M, Feldman S, Vincenzi G, Sullivan D, Rossi R Jr, Anitua E, Bianchi F, Francetti L, Weinstein RL. A multicenter prospective evaluation of 2-months Osseotites implants placed in the posterior jaws: 3-year follow-up results. Clin Oral Implants Res 2002;13:154–161. 16. Szmukler-Moncler S, Salama H, Reingewirtz Y, Dubruille JH. Timing of loading and effect of micromotion on bonedental implant interface: review of experimental literature. J Biomed Mater Res 1998;43:192–203. 17. Szmukler-Moncler S, Piattelli A, Favero GA, Dubruille JH. Considerations preliminary to the application of early and immediate loading protocols in dental implantology. Clin Oral Implants Res 2000;11:12–25. 18. Misch CE, Hahn J, Judy KW, Lemons JE, Linkow LI, Lozada JL, Mills E, Misch CM, Salama H, Sharawy M, Testori T, Wang HL. Immediate function consensus conference. workshop guidelines on immediate loading in implant dentistry. November 7, 2003. J Oral Implantol 2004a;30:283–288. 19. Romeo E, Chiapasco M, Lazza A, Casentini P, Ghisolfi M, Iorio M, Vogel G. Implant- retained mandibular overdentures

with ITI implants. Clin Oral Implants Res 2002;13:495–501. 20. Rocci A, Martignoni M, Burgos PM, Gottlow J. Histology of retrieved immediately and early loaded oxidized implants: light microscopic observations after 5 to 9 months of loading in the posterior mandible. Clin Implant Dent Relat Res 2003;5s1: 88–98. 21. Gapski R, Wang HL, Mascarenhas P, Lang NP. Critical review of immediate implantloading. Clin Oral Implants Res 2003;14:515–527. 22. Maniatopoulos C, Pilliar RM, Smith DC. Threaded versus porous-surfaced designs for implant stabilization in bone-endodontic implant model. J Biomed Mater Res 1986;20:1309–1333. 24. Calandriello R, Tomatis M. Simplified treatment of the atrophic posterior maxilla via immediate/early function and tilted implants: a prospective 1-year clinical study. Clin Implant Dent Relat Res 2005;7s1:S1– S12. 25. Chaushu G, Chaushu S, Tzohar A, Dayan D. Immediate loading of single-tooth implants: immediate versus non-immediate implantation. A clinical report. Int J Oral Maxillofac Implants 2001;16:267–272. 26. Nikellis I, Levi A, Nicolopoulos C. Immediate loading of 190 endosseous dental implants: a prospective observational study of 40 patient treatments with up to 2-year data. Int J Oral Maxillofac Implants 2004;19:116–123. 27. van Steenberghe D, Molly L, Jacobs R, Vandekerckhove B, Quirynen M, Naert I. The immediate rehabilitation by means of a ready-made final fixed prosthesis in the edentulous mandible: a 1-year follow-up study on 50 consecutive patients. Clin Oral Implants Res 2004;15:360–365. 28. Veltri M, Balleri P, Ferrari M. Influence of transducer orientation on Osstellt stability measurements of osseointegrated implants. Clin Implant Dent Relat Res 2007;9:60–64. 29. Zix J, Kessler-Liechti G, Mericske-Stern R. Stability measurements of 1-stage implants in the maxilla by means of resonance frequency analysis: a pilot study. Int J Oral Maxillofac Implants 2005;20:747–752. 30. Jemt T. Fixed implant-supported prostheses in the edentulous maxilla. Clin Oral Implant Res 1994;5:142–147.

Volume 2 - Number 2 - 2011

BioCRA

Original article

125

NanoTite™ surface implants stability in the anorganic bovine bone grafted maxillary sinus measured by resonance frequency analysis: 3-year report Salvatore D’Amato MDS1, Nicola Sgaramella MD,DDS1, Angelo Itro MDS1* Giuseppe Colella MD,MDS

Aim The primary aims of this study were to: (1) investigate value and possible advantages in terms of survival rate of NanoTiteTM surface implants used in critical bone conditions such as the severely atrophic posterior maxilla (residual bone height 3-6 mm) simultaneously reconstructed with sinus floor elevation technique utilizing nonabsorbable membrane and anorganic bovine bone (BioOss Geistlich Pharma AG) as only graft material, and (2) examine the reliability of resonance frequency analysis (RFA) measurements to assess and monitor implant stability also in such cases. Materials and Methods Five consecutive patients presenting severely atrophic posterior maxillae were treated with 12 NanoTiteTM surface implants in conjunction with sinus lifting using nonabsorbable membrane and Bio-Oss as only graft material. Resonance frequency analysis measurements (Osstell Mentor TM; Ostell AB, Gothenburg, Sweden) was carried out at implant placement and four months, six months, and three years postoperatively. Results At 3-year follow-up the survival rate of NanoTiteTM surface implants was 100%. RFA mean value was 58.75 implant stability quotient (ISQ) at implant placement time and gradually increased during the examination time ending with an average ISQ of 75 at 3-year follow-up. Conclusions Although the present investigation is based on a limited sample, its results support the possible benefits of utilizing NanoTiteTM surface implants in case of implant placement and simultaneous reconstruction of the severely atrophic posterior maxilla through sinus elevation technique. Resonance frequency analysis system appears to be a reliable method to assess and monitor implant stability also in case of severely atrophic posterior maxilla (residual bone height 3-6 mm) simultaneously grafted with anorganic bovine bone alone. (J Osteol Biomat 2011; 2:125-133)

Key words: dental implants; CaP surface; sinus graft; bovine bone; resonance frequency analysis Department of Head and Neck Surgery, Second University of Naples, Piazza Miraglia, 80100, Naples, Italy

Correspondence author: *Angelo Itro MDS, Full Professor Dentistry Department of Head and Neck Surgery, Second University of Naples, Piazza Miraglia, 80100, Naples, Italy Tel.: +390815665263; Fax: +390815665294 E-mail: angelo.itro@unina2.it

INTRODUCTION Implant stability can be defined as the absence of clinical mobility. Osseointegration can be considered the implant stability following an initial healing period after implant insertion when new bone formation and remodeling are accomplished. Achieving and maintaining implant stability are prerequisites for successful clinical outcome with dental implants. Implant survival rate in critical bone conditions may be optimized by the modification of macro- and micro-surface topography. Despite most researchers have not found rough or smooth implant surfaces to impact on implant stability1 there is evidence that osseointegration can be different with different implant surfaces2. Rough surface tends to provide favourable conditions for clot stabilization, thus favouring earlier osseointegration3-4. The NanoTiteTM surface, presenting the well-researched, rough, acid-etched OsseotiteTM surface modified with nanometer-sized calcium phosphate (CaP) particles, creates a more complex surface topography, increases the micro-surface area and seems to provide greater micro-complexity for new bone attachment and formation. In the posterior maxilla the morphological changes and bone resorption following teeth loss often limit the availa-

Volume 2 - Number 2 - 2011

126

D'Amato S. et al.

ble bone height for implant placement. In such cases sinus floor elevation can be obtained through grafting5. Several biomechanical methods are widely used to evaluate implant osseointegration including removal torque measurements6, push/pull-out tests7, and tensile pull-off tests8. On other hands, resonance frequency analysis (RFA) evaluates implant stability by the resonance response to a ‘microscopic’ bending force transmitted through a transducer to the bone/ implant interface. Resonance frequency analysis measurement value is represented by a quantitative parameter, the implant stability quotient (ISQ) which ranges from 1 (lowest stability) to 100 (highest stability)9. The primary aims of this study were to: (1) investigate value and possible advantages in terms of survival rate of NanoTiteTM surface implants used in critical bone conditions such as severely atrophic posterior maxillae simultaneously reconstructed with sinus floor elevation technique utilizing nonabsorbable membrane and anorganic bovine bone (Bio-Oss) as only graft material, and (2) examine the reliability of resonance frequency analysis measurements to assess and monitor implant stability also in such cases. MATERIALS AND METHODS Patients and implants In the course of our investigation, five consecutive patients underwent implant surgery in the atrophic posterior maxilla combined with sinus floor augmentation. Patients group included three male and two female, the mean age being 53 years (range 27-65 years).

Journal of Osteology and Biomaterials

Patients were at time for surgery non smokers in good health conditions. Pre-surgical examination focused on maxillary sinuses status, dental status, soft tissue conditions, occlusion and maxillomandibular relationship. No patient showed symptoms or signs of neither sinus pathology or active periodontitis or other dental/oral pathology. Patients were informed about planned treatment and its potential risks and complications and informed consent was obtained in all cases. All patients received oral hygiene instructions before treatment start. Panoramic X-rays and computer tomography scans (CT) were taken for all patients. The residual alveolar bone volume in the posterior atrophic maxilla was estimated on the panoramic X-rays and measured on CT scan (Fig.1) at every edentulous single-tooth radiological position. All measurements were taken by the same operator, and each measurement was taken twice to obtain an average. Inclusion criteria for the present study were residual bone height (RBH) < 6 mm and residual bone width > 4 mm at every implant site. The mean residual bone height of the examined sites was 4.9 mm (range 3-6 mm). Patients were treated with 12 NanoTiteTM surface, parallel walled, internal connection Certain, 13 x 4.1 Biomet 3i implants. Implant distribution is shown in table 1. Presurgical care Amoxicillin + clavulanate potassium 1g and Nimesulide 100 mg per os were given to patients 30 to 60 minutes preoperatively. Patients used chlorhexi-

dine 0.12% rinse immediately before surgery. Surgical Procedure After local anesthesia with ecocain, a midcrestal incision was made, with mesial and distal releasing incisions extending well up into the buccal fold, a full thickness mucoperiosteal flap was reflected and the lateral aspect of the maxillary sinus was exposed. With a diamond ball drill (Ø 2 mm) a boxshaped osteotomy for anthrostomy was performed and the Schneiderian membrane was exposed. The membrane was detached from the bony walls of the internal caudal aspect of the sinus and then elevated in the sinus cavity together with the undetached bony window. Care was taken not to lacerate the elevated sinus membrane. The implant sites were prepared in an undersized way in accordance with normal procedure and the implants were inserted at a mean torque of 20 Ncm. Clinical implant stability was then assessed by finger pressure on the fixture mount. Apically, the implants supported the bony box (Fig.2). The sinus was delicately packed with heterologous particulate bone graft material, Bio-Oss (spongious granuale, particle size 0.25–1 mm; Geistlich Pharma AG) (Fig.3), and a resorbable membrane (Bio-Guide Geistlich Pharma AG) was applied. Fixture mount was removed and before applying the cover screw a Smartpeg Type 15 was applied to the Certain connection of the implant. Resonance frequency analysis measurements (Osstell Mentor TM; Ostell AB) was then carried out obtaining five different measurements at each implant

D'Amato S. et al.

site: on the axial, buccal, palatal, mesial, and distal aspect of the implant. Before wound closure with 5-0 monomid sutures, periosteal incisions were made when tension releasing on the flap was required. The same operator performed surgery in all cases. An intraoral radiograph of the implant sites was obtained directly after surgery. Postoperative care Amoxicillin + clavulanate potassium 1g, 1 x 2/die for 7 days and Nimesulide 100 mg, 1 x 2/die for 5 days was prescribed together with chlorhexidine 0.12% rinse twice a day for two weeks. Sutures were removed after 10 to 14 days. Patients were not allowed to use any removable prostheses during the initial three weeks of healing. Prosthodontic procedure Cover screws were removed and healing abutments were installed at 4 months, at the second stage surgery time. At 6 months implants were functionally loaded with provisional or, alternatively, definitive restorations. Follow-up and resonance frequency monitoring Follow-up examinations were carried out at 4 months, 6 months and 3 years after surgery. RFA measurement and intraoral radiographs (Fig 4) were then obtained. The RFA measurements were carried out by the same operator who performed the first measurement at implant insertion time and in the same way as previously described on removal of the cover screw (at 4 months), on removal of the healing abutment (at 6

months), and on removal of the prosthesis and abutment (at 3 years) (Fig.5). RESULTS During the time of the present investigation no dropout occurred. No early or delayed postoperative complication was recorded for the treated patients. At 3-year follow up implant survival rate resulted to be 100%. The reported ISQ value for each implant was the average of the five different measurements. Implants showed ISQ values ranging from 41 to 68 (mean value 58.75) at surgical time. At that time clinical implant stability, estimated with finger pressure on the fixture mount, was considered to be sufficient for all implants although two of them showed ISQ value of 41 and 42, respectively (Fig.6). From implant surgery time through the 4 months and 6 months examination to the 3-year follow up ISQ values gradually increased for all implants, ending with an average ISQ of 75 (Table 1). DISCUSSION One of the most important factors that determine implant success is the achievement and maintenance of implant stability. Primary stability, related to resistance to micromotion during healing, is over the time synonymous with implant osseointegration. Primary implant stability is influenced by biomechanical properties and volume of the bone tissue at implant site, surgical technique and implant features such as macrodesign, lenght and diameter, threadsâ&#x20AC;&#x2122; form, and surface microstructure. The role of surface roughness in osseointegration has been widely discussed in literature

127

although remains a point of controversy10,11. This discrepancy might depend on the fact that only some few studies used an adequate loading situation in large animal models, besides, in these models, the duration of the healing period is itself a matter of controversy. Nevertheless rough-surfaced implants tend to yield higher implant-bone contact values than polished ones during the initial healing period12-17. A complex surface microtopography or surface roughness is indeed thought to accelerate early peri-implant bone healing thus improving osseointegration which is desirable in critical bone situations when the requirements for the interaction of implants and biosystem increase (irradiated bone, bone augmentation, softened bone). Several experimental evidences suggest that, in vivo, osseointegration correlates with optimum roughness values12,18. OsseotiteTM implant is treated in a dual acid-etching procedure using hydrochloric and sulphuric acids which makes the surface moderately rough. This implant has been widely studied in terms of clinical outcome showing well documented, reliable long-term results. Testori et al showed a cumulative OsseotiteTM implants success rate in a 4 years follow-up of 98.7%, with a 99.4% success rate in the posterior mandible and 98.4% success rate in the posterior maxilla19. NanoTiteTM implants present the rough OsseotiteTM surface modified with nanometer-sized calcium phosphate (CaP) particles. Compared to OsseotiteTM surface implants NanoTiteTM implants show an increased microsurface area by 200% maximizing the

Volume 2 - Number 2 - 2011

128

D'Amato S. et al.

Table 1: residual bone heights at implant sites, implants distribution, ISQ values at surgical time, 4 months, 6 months and 3 years. Patient

Patient 1

Patient 2

Patient 3

Patient 4 Patient 5

Implant

Bone height

Tooth

ISQ surgical time

ISQ 4 months

ISQ 6 months

ISQ 3 years

Implant 1

5 mm

Implant 2

4 mm

Implant 3

3 mm

Implant 4

6 mm

Implant 5

5 mm

Implant 6

5 mm

Implant 7

5 mm

Implant 8

4 mm

Implant 9

4 mm

Implant 10

3 mm

Implant 11

6 mm

Implant 12

5 mm

potential biological benefits of calcium phosphate. CaP deposits on an implant surface enhance early osseointegration by increasing activation of platelets which play an initiating role in the osteogenesis activating the osteogenetic cells to migrate to the surface of the implant. On the implant surface, these cells differentiate into osteoblasts and start the new bone formation20. When compared to OsseotiteTM surface implants NanoTiteTM implants showed increased peri-implant endosseous healing properties (higher percentages bone-implant contact and bone area) in the maxillary native bone20. Thus, indications for utilizing NanoTiteTM surface implants might be more challenging implant cases when acceleration of early peri-implant bone healing might be very useful, such as limited bone quality and/or quantity or immediate placement or loading21. The results of the present investigation, with an implant survival rate of 100% and 4.9 mm

Journal of Osteology and Biomaterials

as mean residual bone height of the simultaneously grafted posterior maxillae seem to confirm this hypothesis. When placing implants in the posterior maxilla, the recommended procedure is dependent on the residual bone height. The consensus conference held in 1996 on sinus lifting5 made recommendations on the surgical approach in relation to the RBH. With class A RBH (RBH â&#x2030;Ľ10mm), the classic implant procedure is performed. With class B RBH (RBH=7-9mm), the osteotomy technique should be used in combination with immediate implant placement. With class C RBH (RBH=4-6mm), a lateral approach involving a grafting material with immediate or delayed implants is advised. With class D RBH (RBH=1-3mm), a lateral approach involving bone-grafting material and delayed implant placement is recommended. Patients of the present investigation belonged to class C and D and also in case of RBH=3mm the one-stage

surgical technique was utilized because clinical primary implant stability was considered sufficient. A meta-analysis of the survival rate of implants placed in combination with sinus floor elevation indicated an estimated annual failure rate of 3.48% translating into a 3-year implant survival of 90.1%. When failure rates was analyzed based on subject level, the estimated annual failure was 6.04% translating into 16.6% of the subjects experiencing implant loss over 3 years. The best results (98.3% 3-year survival rate) were obtained using rough surface implants with membrane coverage of the lateral window22. The placement of resorbable membranes over augmented sinuses does not present additional risks and, in case of particulate graft material, has the additional effect of stabilizing the graft particles23. Bone substitutes may replace autogenous bone for sinus lift procedure in the atrophic posterior maxilla. In a

D'Amato S. et al.

129

Figure1. Presurgical CT image of region 3 in patient 4 (RBH=3mm)

systematic review, different maxillary sinus graft materials were compared in terms of implant survival: a total of 5.128 implants with follow-up times ranging from 12 to 102 months were analysed. Survival rate was 92% for implants placed into autogenous and autogenous/composite grafts, 93.3% for implants placed into allogenic/nonautogenous composite grafts, 81% for implants placed into alloplast and alloplast/xenograft materials, and 95.6% for implants placed into xenograft materials alone24. Bio-Oss is a deproteinized, sterilized bovine bone extensively used in bone regeneration procedures. Bio-Oss particles do not interfere with the normal osseous healing process after sinus lift procedures and promote new bone formation being an osseoconductive material25. In the course of our investigation Bio-Oss was used as only sinus graft material. Resonance frequency analysis is a noninvasive, objective method to evaluate implant stability which has been validated through in vitro and in vivo studies26-29. The clinical outcome of im-

Figure 2. Patient 4 at surgical time (implant insertion)

Figure 3. Patient 4 at surgical time (the sinus was delicately packed with heterologous particulate bone graft material, Bio-Oss )

plants placed in different bone quality, in relation to cutting torque at surgery, finite element model, and RFA suggests that this technique is valuable in the evaluation of implant stability. The advantage of this method in comparison with other methods of measuring implant stability (Periotest pro-

cedure, knocking sound test, cutting torque, etc.) lies in the reproducibility of the values that are attained. For this reason, RFA has become increasingly widespread and ISQ values are increasingly taken into account when evaluating the clinical performance of dental implants possibly demonstrat-

Volume 2 - Number 2 - 2011

130

D'Amato S. et al.

Figure 4. Intraoral X-rays at surgical time, 4 months, 6 months and 3 years (Patient 4)

Journal of Osteology and Biomaterials

ing evidence for the extent of implant osseointegration30-33. Considering that higher failure rates are associated with immediate loaded or grafted implants and that failure is often related to biomechanical factors, an assessment of implant stability may significantly lower the risk of failure. High ISQ value is indicative of a successful implant treatment with a small risk for future failure. Low or decreasing ISQ value points to an increased risk for implant complications, but the exact resonance frequency analysis threshold values have not been identified yet even though ISQ<40 has been advocated34. Thus RFA application, cannot be confined exclusively to a single value because, to date, no reference values for long-term implant integration and failure, respectively, are available in the literature. Therefore, as the present study showed, several measurements should be carried out during initial implant healing and loading. Several clinical works indicated a relationship between bone density and primary implant stability. Implants in soft bone with low primary stability show a marked increase in RFA value compared with implants in dense bone probably as a result of marginal bone remodeling. At one year a comparable level of stability is usually reached for successful implants. For BrĂĽnemark type implants the safe ISQ value seems to be in the range of 65-7535. This assumption is in accordance with the RFA values trend showed for implants in the present study. In an in vitro experiment Ito et al hypothesized that the marginal region is the most important for the outcome of resonance frequency analysis measure-

ments36. This study also indicated that implant length may not have a significant impact on resonance frequency analysis measurements, a notion that has also been espoused in several other studies. Schleier et al37 demonstrated that there was no direct association between bone volume and implant stability as determined through RFA for implants placed in elevated sinus floors and the authors concluded that RFA value is probably more dependent on the structure and extent of the cortical bone in the coronal third of the implant rather than the total bone volume. The average pre-operative RBH was though 8.4 +/- 2.2mm at the premolar and 7.3 +/- 3.1mm at the molar regions. On the other hand in an animal study Fenner and coworker38 showed that a residual subsinusal height of less than 4 mm was associated with initial statistically lower implant stability compared to implants placed in RBH ranging from 4 to 8 mm when simultaneous implant placement and sinus graft with particulate autogenous bone was performed. This initial difference in RFA became not statistically relevant at 6 months of functional loading. In the present investigation, ISQ value at implant placement for the two implants installed in sites with RBH=3 mm was 41 respectively 42. For the same two implants ISQ values were 76 respectively 74 at 3-year follow-up. These results seem to be in agreement with FennerÂ´s findings. Hallman et al39 stated that no statistically significant difference in clinical and radiological outcome and RFA values could be demonstrate comparing implants placed in native bone and grafted sinuses with a 80:20 mixture of

131

Figure 5. Patient 4 at 3-year follow-up (ISQ measurement with Osstell Mentor™)

deproteinized bovine bone and autogenous bone. To our knowledge no RFA study for implants placed in augmented sinuses with bovine bone alone is available in literature; the high mean ISQ value and implant survival rate in the present investigation supports the reliability of Bio-Oss™ as only graft material also in case of severely limited RBH. CONCLUSIONS Although the present investigation is based on a limited sample, its results support the possible benefits of utilizing NanoTite™ surface implants in case of implant placement and simultaneous reconstruction of the severely

atrophic posterior maxilla trough sinus elevation technique. Resonance frequency analysis system appears to be a reliable method to assess and monitor implant stability also in case of severe atrophy in the

posterior maxilla (residual bone height 3-6 mm) grafted with Bio-Oss™ alone which resulted to be a valuable sinus graft material also in such degree of atrophy.

Figure 6. ISQ values at 6 months and 3 years after surgery of implant in position 3 in patient 4

Volume 2 - Number 2 - 2011

132

REFERENCES 1. Al-Nawas B, Groetz KA, Goetz H. Comparative histomorphometry and resonance frequency analysis of implants with moderately rough surfaces in a loaded animal model. Clin Oral Impl Res 2008;19:1-8. 2. Albrektsson T, Wennerberg A. Oral implant surfaces: review focusing on clinical knowledge of different surfaces. Int J Prosthodont 2004;17:544-564. 3. Shalabi MM, Gortemaker A, Vanâ&#x20AC;&#x2122;t Hof MA, Jansen JA, Creugers NHJ. Implant surface roughness and bone healing: a systematic review. J Dent Res 2006;85:495-500. 4. Davies JE. Mechanisms of endosseous integration. Int J Prosthodont 1998;11:391401. 5. Jensen OT, Shulman LB, Block MS, Iacone VJ. Report of the sinus consensus conference of 1996. Int J Oral Maxillofac Implants 1998;19:199-207. 6. Johansson CB, Albrektsson T. Integration of screw implants in the rabbit: a 1-year follow-up of removable torque of titanium implants. Int J Oral Maxillofac Implants 1987;2:69-75. 7. Thomas KA, Kay JF, Cook SD, Jarcho M. The effect of surface macrotexture and hydroxyapatite coating on the mechanical strengths and histologic profiles of titanium implant materials. J Biomed Mater Res 1987;21:1395-1414. 8. Steinemann SG, Eulenberger J, Maeusli P-A, Schroder A. Adhesion of bone to titanium. In: Christel P, Meunier A, Lee AJC (eds). Biological and Biomechanical Performance of Biomaterials. Amsterdam, The Netherlands: Elsevier 1986;409-414. 9. Meredith N, Alleyne D, Cawleym P. Quantitative determination of the stability of the implant-tissue interface using resonance frequency analysis. Clin Oral Implants Res 1996;7:261-267. 10. Esposito M, Coulthard P, Thomsen P, Worthington HV. Interventions for replacing missing teeth: different types of dental implants. The Cochrane Database of Systematic Reviews 2005.

Journal of Osteology and Biomaterials

11. Vercaigne S, Wolke JG, Naert I, Jansen JA. Bone healing capacity of titanium plasma-sprayed and hydroxylapatite-coated oral implants. Clin Oral Implants Res 1998;9:261-271. 12. Stanford CM. Surface modification of biomedical and dental implants and the processes of inflammation, wound healing and bone formation. Int J Mol Sci 2010;11:354-369. 13. Feighan JE, Goldberg VM, Davy D, Parr JA, Stevenson S. The influence of surface blasting on the incorporation of titaniumalloy implants in a rabbit intramedullary model. J Bone Joint Surg Am 1995;77:13801395. 14. Larsson C, Thomsen P, Aronsson BO, Rodahl M, Lausmaa J, Kasemo B, Ericson LE. Bone response to surface-modified titanium implants: studies on the early tissue response to machined and electropolished implants with different oxide thicknesses. Biomaterials 1996;17:605-616. 15. Chang YS, Gu HO, Kobayashi M, Oka M. Influence of various structure treatments on histological fixation of titanium implants. J Arthroplasty 1998;13:816-825. 16. Suzuki K, Aoki K, Ohya K. Effects of surface roughness of titanium implants on bone remodeling activity of femur in rabbits. Bone 1997;21:507-514. 17. Abrahamsson I, Zitzmann NU, Berglundh T, Wennerberg A, Lindhe J. Bone and soft tissue integration to titanium implants with different surface topography: an experimental study in the dog. Int J Oral Maxillofac Implants 2001;16:323-332. 18. Wennerberg A, Hallgren C, Johansson C, Danelli S. A histomorphometric evaluation of screw-shaped implants each prepared with two surface roughnesses. Clin Oral Implants Res 1998;9:11-19. 19. Testori T, Wiseman L, Woolfe S, Porter SS. A prospective multicenter clinical study of the Osseotite implant: four-year interim report. Int J Oral Maxillofac Implants 2001;16:193-200. 20. Telleman G, Albrektsson T, Hoffman M, Johansson CB, Vissink A, Meijer HJ, Raghoe-

D'Amato S. et al.

bar GM. Peri-implant endosseous healing properties of dual acid-etched mini-implants with a nanometer-sized deposition of CaP: a histological and histomorphometric human study. Clin Implant Dent Relat Res 2010;12:153-160. 21. Ostman PO, Hupalo M, Del Castillo R, Emery RW, Cocchetto R, Vincenzi G, Wagenberg B, Vanassche B, Valentin A, Clausen G, Hogan P, GoenĂŠ R, Evans C, Testori T. Immediate provisionalization of NanoTite implants in support of single-tooth and unilateral restorations: one-year interim report of a prospective, multicenter study. Clin Implant Dent Relat Res 2010;12:e47-55. 22. Pjetursson BE, Tan WC, Zwahlen M, Lang NP. A systematic review of the success of sinus floor elevation and survival of implants inserted in combination with sinus floor elevation. J Clin Periodontol 2008;35:216-240. 23. Choi K. The effects of resorbable membrane on human maxillary sinus graft: a pilot study. Int J Oral Maxillofac Implants 2009;24:73-80. 24. Aghaloo TL, Moy PK. Which hard tissue augmentation techniques are the most successful in furnishing bony support for implant placement? Int J Oral Maxillofac Implants 2007;22:49-70.

Oral Implants Res 1997;8:226-233. 29. Su YY. Application of a wireless resonance frequency transducer to assess primary stability of orthodontic mini-implants: an in vitro study in pig ilia. Int J Oral Maxillofac Implants 2009;24:647-654. 30. Friberg B, Sennerby L, Meredith N, Lekholm U. A comparison between cutting torque and resonance frequency measurements of maxillary implants. A 20-month clinical study. Int J Oral Maxillofac Surg 1999;28:297-303. 31. Friberg B, Sennerby L, Linden B, Grondahl K, Lekholm U. Stability measurements of one-stage BrĂĽnemark implants during healing in mandibles. A clinical resonance frequency analysis study. Int J Oral Maxillofac Surg 1999;28:266-272.

133

and endoscope-guided internal sinus floor elevation: 2-year post-loading outcomes. Clin Oral Impl Res 2008;19:1163-1170. 38. Fenner M, Vairaktaris E, Stockmann P, Schlegel KA, Neukam FW, Nkenke E. Influence of residual alveolar bone height on implant stability in the maxilla: an experimental animal study. Clin Oral Impl Res 2009;20:751-755. 39. Hallman M, Sennerby L, Zetterqvist L, Lundgren S. A 3-year prospective follow-up study of implant-supported fixed prostheses in patients subjected to maxillary sinus floor augmentation with a 80:20 mixture of deproteinized bovine bone and autogenous bone. Clinical, radiographic and resonance frequency analysis. Int J Oral Maxillofac Surg 2005;34:273-280.

32. Bischof M, Nedir R, Szmukler-Moncler S, Bernard JP, Samson J. Implant stability measurement of delayed and immediately loaded implants during healing. A clinical RF study with SLA ITI implants. Clin Oral Implants Res 2004;15:529-539. 33. Huang HM, Lee SY, Yeh CY, Lin CT. Resonance frequency assessment of dental implant stability with various bone qualities: a numerical approach. Clin Oral Implants Res 2002;13:65-74.

25. Orsini G, Traini T, Scarano A. Maxillary sinus augmentation with Bio-Oss particles: a light, scanning, and transmission electron microscopy study in man. J Biomed Mater Res B Appl Biomater 2005;74:448-457.

34. Scarano A, Carinci F, Quaranta A. Correlation between implant stability quotient (ISQ) with clinical and histological aspects of dental implants removed for mobility. Int J Immunopathol Pharmacol 2007;20:33-36.

26. Meredith N, Cawley P, Alleyne D. Quantitative determination of the stability of the implant-tissue interface using resonance frequency analysis. Clin Oral Implants Res 1996;7:261-267.

35. Sennerby L, Meredith N. Implant stability measurements using resonance frequency analysis: biological and biomechanical aspects and clinical implications. Periodontology 2000 2008;47:51-66.

27. Meredith N, Shagaldi F, Alleyne D, Sennerby L, Cawley P. The application of resonance frequency measurements to study the stability of titanium implants during healing in the rabbit tibia. Clin Oral Implants Res 1997;8:234-243.

36. Ito Y, Sato D, Yoneda S, Ito D, Kondo H, Kasugai S. Relevance of resonance frequency analysis to evaluate dental implant stability: simulation and histomorphometrical animal experiments. Clin Oral Implants Res 2007,18:1-6.

28. Meredith N, Book K, Friberg B, Jemt T, Sennerby L. Resonance frequency measurements of implant stability in vivo. Clin

37. Schleier P, Bierfreund G, Schultze-Mosgau S, Moldenhauer F, Kupper H, Freilich M. Simultaneous dental implant placement

Volume 2 - Number 2 - 2011

BioCRA

Original article

135

A study on the interparietal bone in adult human skulls. Jaswinder Kaur MS1*, Zora Singh PhD2

The squamous occipital bone consists of two parts: supraoccipital & interpariatal. Usually the interparietal bone fuses with the supraoccipital, but sometimes it remains as separate bone. In this study a total of 80 adult dry skulls were examined to determine whether or not the interparietal bone was present. The incidence of interparietal bone was observed in 5 skulls (6.3%). Sutural bones (wormian bones) were seen in 5 skulls at lambda. (J Osteol Biomat 2011; 2:135-138)

Key Words: interparietal bone, human skulls, sutural bones, lambda

Department of Anatomy Adesh Institute of Medical Sciences & research, Barnala Road, Bathinda 2 Department of Anatomy GGS Medical College Faridkot 1

Correspondence to *Jaswinder kaur - M.S Anatomy Associate professor â&#x20AC;&#x201C; Department of Anatomy, Adesh Institute of Medical Sciences & research, Barnala Road, Bathinda Phone- 9876005164Â ; Fax- 0164-2742902 E mail: jaswindpreet@gmail.com

INTRODUCTION The interparietal part of the occipital bone (above the highest nuchal line) develops in membrane and ossification begins with paired centres which rapidly become continuous with each other and with the lower squamous ossification below the highest nuchal lines ( supraoccipital part). The interparietal portion may remain partially separated from the supraoccipital portion by a suture; it is then called the interparietal or inca bone. But, as with bones which ossify in membrane, additional centres occurring in front of the interparietal bone may fail to fuse; they are then named pre-interparietal bones1. The squamous portion of the occipital bone consists of two different parts: the upper, interparietal part, which is a membrane bone, and the lower, supraoccipital part, which is a cartilage bone. According to some researchers, the boundary between these parts is the highest nuchal line2-6 Others, however, have identified the boundary to be the superior nuchal line7-8. In a recent experimental study on human fetuses Srivastava9 concluded that the boundary is the highest nuchal line, but in contrast to previous studies, states that the supraoccipital part, which lies below this line, is partly membranous bone and partly cartilage bone. The

Volume 2 - Number 2 - 2011

136

Table 1. Interparietal bone Present

Number of cases

Percentage

Single

2.5

Multiple

1.3

Wormian bones

6.3

Present

Number of cases

Percentage

Single

1.3

Multiple

1.3

Table 2. Pre-interparietal bone

Table 3. Incidence of Interparietal Bone Author

Percentage

Shrivastava (1977)

0.8

Singh et al (1979)

1.6

Pal et al (1984)

2.6

Cireli et al (1985)

4.0

Saxena et al (1986)

2.5

Magden & Muftuoglu (1990)

1.6

Gopinathan (1992)

0.8

Aycan (1993)

6.6

Katkici & Gumusburum (1995)

0.99

Present study

6.3

area between the highest and superior nuchal lines, is called the intermediate segment, is composed of membranous bone. The membranous part of the occipital bone develops above the superior nuchal lines by three pairs of centres9; the first pair, in which each centre consists of one nucleus, lies between the superior and highest nuchal lines and is known as the torus occipitalis transverses or lamella triangularis. These two ossification centres form the intermediate segment. Above the intermediate segment, there is a second pair of

Journal of Osteology and Biomaterials

centres, one on each side of the midline, each of which has two nuclei, lateral and medial. These four nuclei form the lateral plate of the interparietal. The lateral portion of the lateral plate is separated from the intermediate segment by the lateral fissure. The third pair of centres consists of two nuclei on each side, upper and lower, forming the medial plate of the interparietal. Between the two medial plates there is a deep median fissure. Thus, formation of the interparietal bone depends on the separation of the intermediate segment and the lateral

plate by the sutura occipitalis transversa. This means that the interparietal bone is formed by the lateral and medial plates together. Failure of fusion of these centres or their nuclei with each other or the intermediate segment gives rise to various anomalies of the interparietal bone9. MATERIALS AND METHODS The material used in this study consisted of 80 dry adult human skulls from the Department of Anatomy, Adesh Institute of Medical Sciences & Research, Bathinda and GGS Medical College, Faridkot, India. These were examined to determine whether or not the interparietal bobe was present and incidence was observed. The sutural bones were also observed. RESULTS A total of 5 skulls of interparietal bones were determined out of 80 dry human skulls examined. The incidence of interparietal bones was 6.3%.Sutural bones were present in between the parietal and occipital bone. These were present in 5 skulls. In one skull, A single separate and triangular median pre interparietal (Figure 1.) bone was seen below lambda as failure of fusion of upper nuclei of medial plate with lower nuclei.

Figure 1. A single separate & triangular interparietal bone was seen below lambda

137

In one skull, multiple preinterparietal bones were seen below lambda.

Figure 5. Multiple inter parietal bones above lambda Figure 2. Multiple pre interparietal bones below lambda

In one skull, A single separate small interparietal bone was present above lambda on left side

In one skull, Multiple interparietal bones were present above lambda

Figure 6. skull showing Wormian bones

Figure 3. A single separate small interparietal bone above lambda on left side

In one skull, a single separate interparietal bone was seen above lambda on right side.

Figure 4. A single separate interparietal bone above lambda on right side

DISCUSSION Ranke (1913) described that there were two pairs of ossification centres located in the interparietal area above the highest nuchal line. Sometimes a third pair of centre (preinterparietal) is seen in addition to two pairs of centres10-13. As per Shrivastava (1977)12 pre-interparietal bone develops due to the presence of the third pair of centres. According to Pal et al (1984) and Pal (1987)13-14 the term “ pre-interparietal” is misleading therefore these bones should be referred to as upper central piece or pieces of the interparietal bone. According to Srivastava (1992)9 preinterparietal bone develops as a result of failure of fusion between the upper and lower nuclei of the me-

dial plate and are actually part of the interparietal bone. The author claims that all bones developing in the region of lambda and lambdoid suture outside the limits of the interparietal area are sutural or wormian bones with separate ossification centres. The incidence of preinterparietal bone was 2.9% by Shrivastava (1977), 0.8% by Singh et al (1979), 2.5% by Saxena et al (1986) and 0.8% by Gopinathan (1992)18. According to Pal et al (1984) a true pre-interparietal bone is triangular in shape and found posterior to lambda. In the present study, it was found in only one skull. The bone which was called “pre-interparietal” in previous studies is actually part of interparietal or sutural bone. The embryological development of interparietal or sutural part of occipital bone has been clarified with a study published by Shrivastava (1992) similar to Pal et al (1984) and Pal (1987). The present study also suggests that the term pre-interparietal is a misnomer and should not be used. The findings of the present study was identical to those of Aycan (1993). CONCLUSIONS In conclusion, the interparietal bone can appear in various forms depending on the ossification centres and their nuclei in this region. Therefore, all bones that are not sutural or wormian bones in the interparietal part of the occipital bone when it occurs in man are part of the interparietal bone.

Volume 2 - Number 2 - 2011

138

REFRENCES 1. Frazer JE. Anatomy of the human skeleton, 6th ed. London: J.&A. Churchill Ltd. 1965;187-190. 2. Pal GP. Variations of the interparietal bone in man. Journal of Anatomy 1987;152: 205-208 3. Romanes GJ. Cunningham`s text book of anatomy. 12th ed. Oxford University Press, Oxford,New York, Tronto.1981;140 4. Saxena SK, Choudhary DS, Jain SP. Interparietal bones in Nigerian skulls. Journal of Anatomy 1986;144:235-237 5. Singh PJ, Gupta CD, Arora AK. Incidence of interparietal bones in adult skulls of Agra region. Anatomical Anzeles 1979;145:528-531 6. Williams PL, Warwick R, Dyson M, Bannister LH .Gray`s Anatomy. 37th ed. Churchill Livingstone, London. 1989;371-373. 7. Breathnach AS. Frazer`s Anatomy of the human skeleton. 6th ed.J & A Churchill, London. 1989;190 8. Hamilton WJ. Textbook of Anatomy. 2nd ed. Macmillan, London. 1976;71 9. Shrivastava HC. Ossification of the Membranous portion of the squamous part of the occipital bone in man. Journal of Anatomy 1992;180:219-224 10. Ranke J. Qain`s Elements of Anatomy (vol IV) 11th ed. Longman Green & Co. London.1913;53-55 11. Breathnach AS. Frazer`s Anatomy of the Human skeleton. In: Individual bones of skull.6th ed. J. & A. Churchill Ltd. London.1965;190 12. Shrivastava HC. Development of ossification centres in the squamous portion of the occipital bone in man. Journal of Anatomy 1977; 180:219-224 13. Pal GP, Tamankar BP, Routal RV, Bhagwat SS .The ossification of the membraneous part of the squmaous occipital bone in man. Journal of Anatomy 1984; 138:259-266 14. Pal G P .Variations of the interparietal bone in man. Journal of Anatomy 1987;152:205-208 15. Cireli E, Ustun EE , Tetik S. Os occipital varyasyonlarive radyolojik. Ege Universities Tip Faultesi Dergisi 1985;24:3-35 16. Magden O, Muftuoglu A. Insan democraniumunda sutural ve epectal kemiklerin

Journal of Osteology and Biomaterials

varyasyonlari, Istanbul Universities Cerrahpasa Tip Fakultesi 1990; 21:319-323 17. Aycan K. Development of interparietal bones & their variations. Erciyes Universities Saglik Billimleri Dergisis 1993;2:70-76 18. Gopinathan K. A rare anomaly of 5 ossicles in the pre-interparietal part of the squamous occipital part in North Indians. Journal of Anatomy 1992; 180:201-202

Should you load the implant now or later? Or much later? Today, more implant patients ask for early loading. More patients less qualified for implants ask to be treated, too. And every patient wants the loading to be successful. Correctly assessing implant stability is a key parameter in either situation. Osstell ISQ is a measuring tool that does this for you – in an accurate and objective way. Even when osseointegration is well underway. It helps you, the treating doctor, make optimal loading decisions. You quickly detect implants that aren’t performing as expected and need

www.osstell.com

more healing time (or even to be replaced). By preventing premature loading, Osstell ISQ becomes a quality-assurance system for your clinic. It makes your treatment of challenging patients easier and more predictable – allowing you to treat more patients more successfully. 248 studies (on last count) and ten years of clinical experience around the world confirm the usefulness of Osstell ISQ. Simply put, it lets you choose the best protocol for every patient. And track the performance of every implant – now, later and much later.

osteocom.net

2.0

The italian web network of the osteointegration community

osteoblog, the most effective

osteofriends, the new social

system to receive updates on any new scientiďŹ c and technological breakthroughs by aggregating multi-user information.

network for central, interactive on-line sharing and management of patient treatment plans, shared by doctors, specialists, laboratories and companies.

osteovision, the added-value

osteogate, a virtual display of

goods to offer an online online multimedia platform for updates and interactive education information and quick search tool to learn about the latest for professional learning. technology, saving time and offering a wider range of options.

www.osteocom.net

143

appointments September 2-3, 2011 “Where Science meets Clinics” Symposium of AO Exploratory Research Davos, Switzerland Information: www.aofoundation.org/er

November 7-10, 2011 International Symposium on Clusters and Nano-Structures Richmond, Virginia, USA Information: iscan@vcu.edu

September 14-17, 2011 2011 FDI Annual World Dental Congress 56th AMIC Dental Expo Mexico City, Mexico Information: www.fdicongress.org

November 26-29, 2011 DenTech China 2011 Shanghai, China Information: www.dentech.com.cn

September 23-25, 2011 14 ° Congresso Internazionale di Terapia Implantare Biomet 3i Verona, Italy Information: www.biometitaly.it October 12-15, 2011 EAO Scientific Meeting Atene, Grece Information: www.eao.com November 01-04, 2011 20th International Conference on Oral and Maxillofacial Surgery Santiago, Chile Information: www.icoms2011.com November 01-03, 2011 Dentistry 2011 Abu Dhabi, United Arab Emirates Information: www.dentistryme.com November 2-4, 2011 World Conference on Regenerative Medicine Leipzig, Germany Information: www.wcrm-leipzig.de

February 7-11, 2012 AAOS Annual Meeting San Francisco, California, USA Information: www.aaos.org March 1-3, 2012 Academy of Osseointegration’s 2012 Annual Meeting Phoenix, Arizona, USA Information: www.osseo.org March 11-15, 2012 Annual Meeting & Exhibition: Linking Science and Technology for Global Solutions Orlando, FL, USA Information: www.tms.org April 19-21, 2012 Osteology Rimini, Italy Information: www.osteology.org June 1-5, 2012 2012 World Biomaterials Congress Chengdu, China Information: www.biomaterials.org

Volume 2 - Number 2 - 2011

now available throughout

Europe

AlloDerm® RTM Regenerative Tissue Matrix

Mem-Lok

MinerOss® Cortical & Cancellous Chips

Grafton® DBM Demineralized Bone Matrix

Resorbable Collagen Membrane

LADDEC®

Cancellous Bovine Xenograft

BioHorizons Biologic Solutions:

Evidence-based grafting options for hard and soft tissue augmentation

Soft Tissue Augmentation with AlloDerm® Regenerative Tissue Matrix (RTM) Case images courtesy of Dr. Edward P. Allen, Dallas, TX Multiple studies conclude that AlloDerm® RTM is equivalent to connective tissue and leads to a natural esthetic outcome for gingival augmentation procedures.1,2

Gingival recession leads to decrease in aesthetics and soft tissue function2

2 week post-op demonstrates AlloDerm® RTM ability for rapid revascularization and cell repopulation2

18 month post-op shows AlloDerm® RTM incorporated similar to normal gingival tissue2

For more information, email us at ordersuk@biohorizons.com or contact your market representative below: Belgium, Holland, Luxembourg: UK and all other EU countries: Lithuania, Latvia, Estonia: Germany, Austria: France, Spain: Romania: Italy: USA:

31 61 094 0750 44 1344 752560 370 5 276 1377 49 7661 909989 0 34 91 713 10 84 40 21 326 5798 39 06 874 4031 888 246 8338

www.biohorizons.com

1. Gapski R, Park C.A., Wang Hom-Lay. Acellular Dermal Matrix for Mucogingival Surgery: A Meta-Analysis. J Periodontology 2005;76:1814-1822. 2. Cummings L, Kaldahl W, Allen E.P. Histologic Evaluation of Autogenous Connective Tissue and Acellular Dermal Matrix Grafts in Humans. J Periodontology 2004;76:178-186. MinerOss® and Mem-Lok® are registered trademarks of BioHorizons, Inc. Grafton® DBM and LADDEC® are registered trademarks of Osteotech, Inc. AlloDerm® and AlloDerm GBR® are registered trademarks of LifeCell™ Corp. Mem-Lok® is manufactured by Collagen Matrix, Inc. SPMP11043 REV A MAR 2011

Brazil – The place of ImplantNews. Brazil is a country full of richness: most of animal and plant species are found here, we are the fifth world economic power, four times winner of the world football championship, and now chosen to receive the Olympic Games on 2016. Also, is the country were the most important Implant Dentistry periodical of the Latin America is produced – The ImplantNews.

Edited

the

Portuguese

language,

the

ImplantNews periodical publishes more than 80 articles on basic and clinical research per year – by the best Brazilian and foreign authors, seen by more than 5,000 specialists on this topic.

On your next travel to Brazil, do not forget to enjoy our natural landscapes in the company of ImplantNews scientific periodical. Surely, your trip will be even better!

• 7 years of uninterrupted printing and distribution. • 8 editions per year, each with 132 pages and colored figures. • More than 500 articles and 1,200 authors already published. • More than 5,000 paid subscribers around Brazil and worldwide.

Visit us at: www.implantnews.com.br

documentazione sui siti post-estrattivi: Geistlich Biomaterials Italia S.r.l. e-mail: info@geistlich.it Per gratuitamente fax: ricevere 0445-370433 documentazione sui siti post-estrattivi: Geistlich Biomaterials Italia S.r.l. e-mail: info@geistlich.it fax: 0445-370433

Il Kit dei Migliori. Il Kit dei Migliori. Geistlich Combi-Kit Collagen – il kit vincente per risultati validi e predicibili nella ridge preservation e nei piccoli incrementi. Geistlich Combi-Kit Collagen – il kit vincente per risultati validi e predicibili nella ridge preservation e nei piccoli incrementi. Geistlich ® gen e Bio-Oss Colla ide® G oBi h lic Geist

Geistlichio 2010 gg n e a daBim O o- ss Collage ®

Gide Biolictihne Geibistna l Geistlich ab gen Combi-Kit Colla ®

010 da maggio 2 eistlich abbinati nel G llagen Co it -K Combi

www.geistlich-pharma.com

LEADING REGENERATION