A Report on Diarrhea and Its Impact on Health of Public Life

View with images and charts A Report on Diarrhea and Its Impact on Health of Public Life 1. Introduction 1.1: Diarrhea- a potential killer: Diarrhea is defined as the phenomenon with unusually frequent bowel movements and excessive watery evacuations of fecal material. Diarrheal diseases are major causes of morbidity, with attack rates ranging from 2 to 12 or more episodes per person per year, especially in developing countries. It is the second leading cause of death in children under five years old, and is responsible for killing 1.5 million children every year. Nearly one in five children under the age of five dies as a result of dehydration, weakened immunity or malnutrition associated with diarrhea (UNICEF/WHO, 2009). Dehydration is a common phenomenon among patients with acute diarrhea and most people who die from diarrhea actually die from severe to moderate dehydration and fluid loss.

Diarrhea is usually a symptom of gastrointestinal infection, which can be caused by a variety of bacterial, viral and parasitic organisms. Infection is spread through contaminated food or drinking-water or from person to person as a result of poor personal hygiene especially in the developing world. Typically, diarrhea can be classified into two categories based on the duration and severity of the disease: • •

Acute diarrhea: Diarrhea that lasts less than a week and is usually related to a bacterial, viral or parasitic infection.

Chronic diarrhea: Chronic diarrhea lasts more than four weeks and is usually related to functional disorders like irritable bowel syndrome or inflammatory bowel diseases like Crohn’s disease.

Diarrhea has both short-term and long-lasting effects ranging from severe dehydration to malnutrition. Since dehydration is the most lethal consequence of diarrhea; particularly in children and it must be treated promptly to avoid serious health problems.

1.2: Pathophysiologic classification of Diarrhea: Whatever the cause of diarrhea it is, this disorder belongs to one of the following clinical manifestations which are given below.

Secretory diarrhea Secretory diarrhea means that there is an increase in the active secretion, or an inhibition of absorption with little to no structural damage. This is most commonly caused by cholera toxin - a protein secreted by the bacterium Vibrio cholerae that stimulates the secretion of anions, especially chloride ions (Kaper, 1996b).

Osmotic diarrhea This condition arises when excess amount of water is drawn into the bowels. This may be the result of celiac disease, pancreatic disease, or laxatives. Too much magnesium, vitamin C, undigested lactose, or undigested fructose can also trigger osmotic diarrhea. If excessive amounts of solutes are retained in the intestinal lumen, water will not be absorbed and diarrhea will result.

Exudative diarrhea Exudative diarrhea occurs with the presence of blood and pus in the stool. This occurs with inflammatory bowel diseases such as Crohn's disease or ulcerative colitis.

Inflammatory diarrhea It occurs due to damage to the brush border or mucosal lining. This condition causes a passive loss of protein rich fluids. The absorption of the lost fluids is also decreased. Its causes may be viral, bacterial or parasitic infection. In some individuals, disturbed autoimmunity such as inflammatory bowel diseases can cause inflammatory diarrhea Motility-related diarrhea Motility-related diarrhea occurs owing to a rapid movement of food through the intestinal area (hypermotility). If the food moves too quickly there is not enough time to absorb sufficient nutrients and water. Sometimes, it causes severe pain in the lower abdomen right after eating any edible.

Dysentery The presence of blood in the stools is usually a sign of dysentery, rather than diarrhea. Any diarrheal episode in which the loose or watery stools contain visible red blood will be termed as Dysentery. It is most often caused by Shigella species (bacillary dysentery) or Entamoeba histolytica (amoebic dysentery).

1.3: Causes of diarrhea Acute diarrhea is usually caused by bacterial, viral, or parasitic infection while chronic diarrhea is usually related to a functional disorder. The most common causes of diarrhea include the following (NIH, 2011): • Bacterial infections: Several types of bacteria consumed through contaminated food or water can cause diarrhea. Common culprits include diarrheagenic Escherichia coli (E. coli), Campylobacter, Salmonella spp. and Shigella spp.

•

Viral infections: Many viruses cause diarrhea, including rotavirus, norovirus, cytomegalovirus, herpes simplex virus, and viral hepatitis. Infection with the rotavirus is the most common cause of acute diarrhea in children.

•

Parasitic infections: Parasites can enter the body through food or water and settle in the digestive system. Parasites that cause diarrhea include Giardia lamblia, Entamoeba histolytica, and Cryptosporidium.

• •

Functional bowel disorders: Diarrhea can be a symptom of irritable bowel syndrome.

Intestinal diseases: Inflammatory bowel disease, ulcerative colitis, Crohn’s disease, and celiac disease often lead to diarrhea.

•

Food intolerances and sensitivities: Some people have difficulty digesting certain ingredients, such as lactose, the sugar found in milk and milk products. Some people may have diarrhea if they eat certain types of sugar substitutes in excessive quantities.

•

Reaction to medicines: Antibiotics, cancer drugs, and antacids containing magnesium can cause diarrhea as well.

1.4: Acute infectious diarrhea Acute diarrhea, defined as an increased frequency of defecation (three or more times per day or at least 200 g of stool per day) lasting less than 14 days, may be accompanied by nausea, vomiting, abdominal cramping or malnutrition (Thielman and Guerrant, 2004). Bacteria, virus and parasites are the major enteric pathogens or causative agents of infectious diarrhea in people of all ages but responsible for a high level of mortality, particularly in children below 5 years of age (Cheng et al., 2005).

1.4.1: Etiological agents Our knowledge of infectious diarrheal disease has expanded enormously over the past decade, particularly with regard to understanding the pathogenesis of infectious diarrhea. A broad spectrum of pathogens is responsible for causing diarrhea which appears to occur worldwide, although some seem to be more frequent in developing countries (Black, 1984).

An overview of the agents in diarrhea is given in Figure: 1.1.

Figure 1.1: Overview of causative agents in diarrhea.

1.4.2: Transmission of diarrheal disease Most of the pathogenic organisms that cause diarrhea and all the pathogens that are known to be major causes of diarrhea are transmitted primarily or exclusively by the fecal–oral route (Feache, 1984). Diarrheal disease may spread through contaminated food and drinking water or from person to person as a result of poor hygiene and sanitation. Younger children fed weaning foods prepared under unhygienic conditions are exposed to food-borne pathogens and are at a higher risk of being affected with diarrheal disease (Barrel, 1979). According to a report published by WHO and UNICEF in 2010, an estimated 2.6 billion people in the developing world lack improved sanitation facilities, and nearly one billion people do not have access to safe drinking water. These unsanitary environments allow diarrhea-causing pathogens to spread more easily.

1.5: Pathogenic Escherichia coli: Escherichia coli named after its discoverer Theodore Escherich, also termed as E. coli are gram negative, rod shaped bacilli under the family Enterobacteriaceae (Figure 1.2) that are commonly found in the gut of warm blooded organisms. Most of them are commensal which benefit the host by providing vitamins (Bentley and Meganathan, 1982) and preventing other pathogenic bacteria within the intestine (Hudault et al., 2001). However, there are several highly adapted E. coli strains that have acquired specific virulence attributes, which confers an increased ability to adapt to new niches and allows them to cause a broad spectrum of disease (Kaper et al., 2004). Horizontal gene transfer events have allowed the transition of some E. coli strains from commensals to pathogens (Baumler, 1997) usually through the acquisition of a pathogenicity island (Lee, 1996). E. coli has been implicated as an agent of diarrheal disease since the 1920s (Nataro et al., 1998) and particular gene clusters such as the attaching and effacing genes (now commonly found in EPEC) are transferred from pathogenic bacteria to commensal E. coli enabling E. coli to become fully pathogenic (McDaniel and Kaper, 1997).

Figure 1.2: Pathogenic Escherichia coli.

(Source: http://edweb.tusd.k12.az.us) Three general clinical syndromes result from infection with inherently pathogenic E. coli strains: (i) urinary tract infection, (ii) sepsis/meningitis, and (iii) enteric/diarrheal disease

(Nataro and Kaper, 1998). This study will particularly focus on the diarrheagenic Escherichia coli (here abbreviated as DEC) which include several emerging pathogens of worldwide public health importance.

1.6: Diarrheagenic Escherichia coli (DEC): Diarrheagenic Escherichia coli (DEC) strains are major pathogens associated with enteric disease worldwide. Diarrheagenic Escherichia coli pathotypes represent a leading bacterial cause of pediatric diarrhea in developing regions (Nataro and Kaper, 1998), with some responsible for traveler’s diarrhea (Ericsson, 2003; Qadri F, 2005), and are also an emerging cause of diarrhea in industrialized countries (Cohen et al., 2005; Robins-Browne, 2004).

However, some strains of DEC can cause severe and life-threatening diarrhea in children and adults.

DEC strains can be divided into six main categories on the basis of distinct molecular, clinical and pathological features (Levine, 1987; Nataro and Kaper, 1998). The main pathotypes of DEC are:  

Enterotoxigenic E. coli (ETEC) Enteropathogenic E. coli (EPEC)



Enteroaggregative E. coli (EAEC)



Enterohemorrhagic E. coli (EHEC, also known as Shiga toxin–producing E. coli [STEC])



Enteroinvasive E. coli (EIEC)



Diffusely adherent E. coli (DAEC)

Figure 1.3: Pathogenic schema of diarrhoeagenic E. coli.

The six recognized categories of diarrhoeagenic E. coli each have unique features in their interaction with eukaryotic cells. Here, the interaction of each category with a typical target cell is schematically represented. AAF, aggregative adherence fimbriae; BFP, bundleforming pilus; CFA, colonization factor antigen; DAF, decay-accelerating factor; EAST1,

enteroaggregative E. coli ST1; LT, heat-labile enterotoxin; ShET1, Shigella enterotoxin 1; ST, heat-stable enterotoxin.

Table 1.1. Diarrheagenic E. coli: virulence determinants and characteristics of disease ETEC fimbrial adhesins e.g. CFA/I, CFA/II, K88.

K99 non invasive produce LT and/or ST toxin watery diarrhoea in infants, adults and travelers to ETEC endemic countries; no inflammation, no fever EPEC non fimbrial adhesin (intimin) EPEC adherence factor (EAF) enables localized adherence of bacteria to intestinal cells moderately invasive (not as invasive as Shigella or EIEC) does not produce LT or ST; some reports of Shiga-like toxin usually infantile diarrhea; watery diarrhea with blood, some inflammation, no fever; symptoms probably result mainly from invasion rather than toxigenesis EAEC adhesins not fully characterized non invasive produce ST-like toxin (EAST) and a hemolysin persistent diarrhea in young children without inflammation or fever EHEC adhesins not characterized, probably fimbriae moderately invasive does not produce LT or ST but does

produce Shiga toxin pediatric diarrhea, copious bloody discharge (hemorrhagic colitis), intense inflammatory response, may be complicated by hemolytic uremia EIEC nonfimbrial adhesins, possibly outer membrane protein invasive (penetrate and multiply within epithelial cells) does not produce Shiga toxin dysentery-like diarrhea (mucous, blood), severe inflammation, fever DAEC: produce a fimbrial adhesin or a related adhesin. patients infected with DAEC had watery diarrhea without blood or fecal leukocytes induce a cytopathic signal transduction effect.

E. coli strains whose study has advanced mostly over the last decade, i.e., enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC) and enteropathogenic E. coli (EPEC). Since the categories of diarrheagenic E. coli are differentiated on the basis of pathogenic features, emphasis will be placed on the mechanisms of disease and the major virulence factors of the agents associated with their pathogenicity.

1.7: Enterotoxigenic Escherichia coli (ETEC): ETEC is defined as E. coli strains that elaborate at least one member of two defined groups of enterotoxins: heat-labile enterotoxin (LT) and heat-stable enterotoxin (ST) (Levine, 1987).

Although ETEC strains were first recognized as causes of diarrheal disease in piglets, where the disease continues to cause lethal infection in newborn animals (Alexander, 1994), its ability to cause diarrhea in humans was first demonstrated in human volunteers (DuPont, 1971). Infection with ETEC can cause watery diarrhea that can range from a mild, selflimiting illness to a severe purging disease similar to cholera. It is associated with childhood diarrhea in the developing world and travelers' diarrhea (TD) among those visiting developing countries or regions of poor sanitation (Nataro and Kaper, 1998; Qadri F, 2005).

ETEC possess a wide variety of O (somatic), K (capsular) and H (flagellar) antigens on its surface. After the discovery of several different molecular structures, including fimbriae, the K phenotype led experts to suggest restructuring the K antigen designation to include only acidic polysaccharides (Lior, 1996). Since then proteinaceous fimbrial antigens have been removed from the K series and have been given F designations (Orskov I, 1982). Specific virulence factors differentiate ETEC from other categories of diarrheagenic E. coli such as enterotoxins and colonization factors (CFs) (MK., 1997; Sjöling A, 2007). Characteristically, ETEC colonize the small intestine by adhering to the epithelium and induce secretion by elaborating toxins without invasion or damage to cells. CFs allow the organisms to readily colonize the small intestines and stimulate the lining of the intestines causing them to secrete excessive fluid thus causing diarrhea.

Figure 1.4: Enterotoxigenic E. coli adhereing to cultured human epithelial cells.

(Source: Laboratoire de Bactériologie, Faculté de Pharmacie, Clermont Ferrand, France).

1.8: Virulence factors of ETEC The distinguishing virulence factors of ETEC that make the organism pathogenic are enterotoxins and colonization factor antigens. At the beginning of pathogenesis, ETEC must adhere and colonize to small bowel enterocytes and elaborate enterotoxins that provoke intestinal secretion and diarrhea. Colonization is mediated by one or more proteinaceous fimbrial or fibrillar colonization factors (CFs), which are designated by CFA (colonization factor antigen), CS (coli surface antigen) or PCF (putative colonization factor) followed by a number (Kaper, 2004). Hence, the major virulence factors of ETEC are: •

Enterotoxins (LT and/or ST)

•

Colonization factors (CFs)

Figure 1.5: Virulence factors of entertoxigenic E. coli.

(Source: Open Courseware of Johns Hopkins Bloomberg School of Public Health.)

1.8.1: Toxins Enterotoxins are major virulent factors that are released by ETEC after successful fimbrial adhesion to mammalian intestinal cells. Following colonization, ETEC strains produce heatlabile (LT) and/or heat-stable (ST) enterotoxins, and strains may express either or both (Nataro and Kaper, 1998).

1.8.1.1: Heat-labile toxins (LT): Heat-labile toxins (LTs) are a class of enterotoxins that are closely related in structure and function to cholera toxin (CT), which is expressed by Vibrio cholerae (Spangler, 1992). LT and CT share many characteristics including holotoxin structure, protein sequence (80% identity), primary receptor identity, enzymatic activity, and activity in animal and cell culture assays (Dickinson, 1995). LT enterotoxins are further classified into two major groups: LT-I and LT-II based on their pathogenicity in human and other animals and do not cross-react immunologically. 

LT-I:

LT-I, expressed by ETEC strains that are pathogenic for both humans and animals is an oligomeric toxin of 86 kDa composed of one 28-kDa A subunit and five identical 11.5-kDa B subunits (Streatfield, 1992). The B subunits are arranged in a ring or "doughnut" shape and bind strongly to the ganglioside GM1 and weakly to GD1b and some intestinal glycoproteins (Teneberg, 1994). The A subunit is responsible for the enzymatic activity of the toxin. Since LT-I is expressed by ETEC strains that are pathogenic for both humans and animals, these two variants are called LTh (LTh-I) and LTp (LTp-I) after their initial discovery in strains isolated from humans and pigs, respectively. 

LT-II:

LT-II is found primarily in animal ETEC isolates and rarely in human isolates, but it has not been associated with disease in either organism. The LT-II serogroup of the LT family shows 55 to 57% identity to LT-I and CT in the A subunit but essentially no homology to LT-I or CT in the B subunits (Fukuta, 1988; Spangler, 1992). Two antigenic variants of LT-II, LT-IIa and LT-IIb, are detected so far.

Figure 1.6: Architecture of the heat labile enterotoxin (LT) of ETEC.

(Source: http://www.bmsc.washington.edu)

1.8.1.2: Heat-stable (ST) toxins: Heat stable enterotoxins (STs) of ETEC are small, monomeric single peptide toxins that contain multiple cysteine residues, whose disulfide bonds account for the heat stability of these toxins. It include two unrelated classes, STa and STb which differ in both structure and mechanism of action (Kaper, 2004). 

STa:

STa is an 18- or 19-amino-acid peptide with a molecular mass of 2 kDa in which six cysteine residues form three intramolecular disulphide bridges. There are two variants of STa, designated STp (ST porcine or STIa) and STh (ST human or STIb) after their initial discovery in strains isolated from pigs or humans, respectively. Both variants can be found in human ETEC strains (Nataro and Kaper, 1998).

Figure 1.7: The crystal structure of heat stable toxin (STa) of E. coli.

(Source: OPM database)



STb:

STb is associated primarily with ETEC strains isolated from pigs, although some human ETEC isolates expressing STb have been reported. STb is initially synthesized as a 71-aminoacid precursor protein, which is processed to a mature 48-amino-acid protein (Dreyfus, 1992).

The STb protein sequence has no homology to that of STa, although it does contain four cysteine residues which form disulfide bonds (Arriaga, 1995).

1.9: Mechanism of ETEC Pathogenesis ETEC infection causes a toxin-mediated diarrhea that is similar to, but less severe than cholera. ETEC initially adhere to the surface of small intestinal enterocytes through ligand– receptor interactions via fimbriae, known as adherence antigens or colonization factor antigens (CFs) (Evans, 1975 ).

After colonization, ETEC secrete plasmid-encoded heat labile enterotoxin (LT) and/or heatstable enterotoxin (ST). LT toxin, closely related to cholera toxin gets endocytosed and

translocated through the cell in a process involving trans-Golgi vesicular transport (Lencer, 1995).

The cellular target of LT is adenylate cyclase located on the basolateral membrane of epithelial cells. The B subunit of LT toxin binds to the target cells via a specific receptor that has been identified as GM1 ganglioside and the A subunit acts by transferring an ADPribosyl moiety from NAD to the alpha subunit of the GTP-binding protein, G S, which stimulates adenylate cyclase activity. ADP-ribosylation of the GS subunit results in adenylate cyclase being permanently activated, leading to increased levels of intracellular cyclic AMP (cAMP). Excess intracellular cAMP leads to hypersecretion of water and electrolytes into the bowel lumen, when these actions exceed, resulting in secretion of anions (predominantly Cl by a direct effect, and HCO3 indirectly) by crypt cells and a decrease in absorption of Na+ and Cl by absorptive cells (Kaper, 1996a).

The main receptors for the secreted STh toxin is a transmembrane enzyme guanyl cyclase (GC) located in the apical membrane of the intestinal cells. When ST binds to GC it promotes an increase in intracellular levels of cyclic guanosine monophosphate (cGMP) (Mezoff AG, 1992 ; Mooi FR, 1994). The increase in cGMP allows activation of CFTR through phosphorylation-dependent cGMP protein kinase II generating an increase in salt and water secretion and inhibition of sodium absorption via the apical Na/H channel (Mezoff AG, 1992 ).

Figure 1.8: Mechanism of virulence of enterotoxigenic Escherichia coli (ETEC).

1.10: Colonization Factors (CFs): To cause diarrhea, ETEC strains must first adhere to enterocytes of the small intestine by means of bacterial appendages known as colonization factors (CFs). These adhesions are host specific and exclusively found in human porcine or bovine strains (Mooi FR, 1994). More than 25 colonization factors (CFs) have been recognized among human ETEC and many more are about to be characterized (Gaastra, 1996).

Majority of the colonization factors are fimbriae, i.e. rigid hair like pertinacious appendages.

Fibrillae, in contrast are thinner and more flexible filaments and some CFs are composed of two fibrillae arranged in a helix, called helicoidal. Furthermore, some other CFs has been reported as non-fimbrial (Hultgren SJ, 1993). On the basis of their morphological characteristics, the CFs can be subdivided on the following: rigid rods, bundle forming

flexible rods, and thin flexible wiry structures. Human ETEC strains possess their own array of colonization fimbriae, the CFAs (Mooi FR, 1994).

Figure 1.9: CF expressing ETEC. Source: (Dolores G. Evans, 1977) A nomenclature for the CFs designating them as coli surface antigen (CS) was introduced in the mid-1990s (Gaastra, 1996); list showing the old and new CFs is shown in Table 1.2.

Table 1.2: Past and present designations for colonization factors of ETEC Nomenclature OF CFs Old name

New name

CFA/I

CFA/I

CS1

CS1

CS2

CS2

CS3

CS3

CS4

CS4

CS5

CS5

CS6

CS6

CS7

CS7

CFA/III

CS8

PCFO159

CS12

PCFO9

CS13

PCFO166

CS14

8786

CS15

CS17

CS17

PCFO20

CS18

CS19

CS19

CS20

CS20

Longus

CS21

CS22

CS22

CFA/I is composed of a single protein assembled in a tight helical configuration. CFA/II is composed of three separate antigens named coli surface antigen 1 (CS1), CS2, and CS3 of which CS3 is expressed either alone or concomitantly with CS1 or CS2. Similarly, CFA/IV is composed of the three antigens CS4, CS5, and CS6. CS6 is usually expressed alone or in conjunction with either CS4 or CS5 or with CS8. Putative colonization factors that are found with varying frequencies include CS7, CS8 (CFA/III), CS12 (PCFO159), CS14 (PCFO166) and CS17. Within each of these families there are cross-reactive epitopes that have been considered as candidates for vaccine development (Rudin A, 1994).

1.11: Enteroaggregative Escherichia coli (EAEC): Enteroaggregative Escherichia coli (EAEC) is a pathotype of diarrheagenic E. coli defined by its characteristic aggregative, or stacked brick, pattern of adherence to HEp-2 epithelial cells in culture (Nataro and Kaper, 1998). The first association of EAEC with diarrheal disease was reported in 1987 (Nataro JP, 1987). Since then, EAEC has emerged as an important pathogen in several clinical scenarios, including traveler’s diarrhea (Adachi JA, 2001), endemic pediatric diarrhea among children in developing (Okeke IN, 2000) and developed (Pabst WL, 2003) countries.

Figure 1.10: HEp-2 cell assay for enteroaggregative E. coli (EAEC). EAEC has a characteristic aggregative pattern of adherence on the surface of the human epithelial tissue culture (HEp-2) cells (Huang and Dupont, 2004).

EAEC characteristically produce watery, often prolonged diarrhea, which can be associated with abdominal pain and low-grade fever (Huppertz HI, 1997). The largest outbreak of EAEC diarrhea was described in Japan, where a total of 2697 of 6636 school children from 16 different schools became ill after consuming contaminated school lunches (Itoh Y, 1997).

1.12: Virulence factors of EAEC EAEC initially adhere to intestinal mucosa and form a mucoid biofilm then induce toxic effects on the intestinal mucosa that result in diarrhea (Nataro, 2001). EAEC colonization can occur in the mucosa of both the small and large bowels, which can lead to mild inflammation in the colon (Cheng, 2008). Adhesins, toxins, and several other factors, which could contribute to disease are considered as EAEC virulence factors.

1.12.1: Adhesins The EAEC-defining criterion-aggregative adherence-suggests that adhesins have an important role in pathogenesis. Microscopy, genetic, and phenotypic studies show that EAEC

adhesins are multiple and diverse. The first EAEC adhesin described at the molecular level was the aggregative adherence fimbriae I (AAFI), expressed by EAEC strain (EAEC-17-2).

The cloned AAFI fimbriae conferred the aggregative phenotype and agglutination of human erythrocytes on non-pathogenic E. coli (Nataro JP, 1992). Expression of AAF/I needs two regions of the EAEC virulence plasmid (pAA), structural subunit gene aggA (Savarino SJ, 1994) and gene that encodes an AraC-type transcriptional activator called AggR (Nataro JP, 1994). Some of the EAEC strains also contain AAFII which is 25% identical and 47% similar to AAFI (Czeczulin JR, 1997). AAF fimbriae have been shown to mediate aggregative adherence to epithelial cells, haemagglutination, and to be necessary for biofilm formation (Nataro JP, 1992; Sheikh J, 2001).

1.12.2: Cytotoxins The first EAEC virulence factor that was implicated as a potential cause of diarrhea in laboratory studies was the enteroaggregative heat-stable toxin EAST-1 (Vial PA, 1988).

Plasmid encoded EAST-1 is a 38-amino acid peptide with homology to the heat-stable enterotoxin of enterotoxigenic E coli (ETEC) and the endogenous signaling peptide guanylin (Nataro, 2001). Another plasmid encoded toxin (Pet), a serine protease autotransporter is capable of reducing resistance and increasing short-circuit current across rat jejunal tissue (Navarro-Garcia F, 1998). In addition to this enterotoxin activity, Pet has cytotoxic activity against cultured intestinal epithelial cells and erythrocytes (Navarro-Garcia F, 1998).

1.13: Mechanism of EAEC Pathogenesis EAEC is associated with a complex pathogen-host immune interaction which has some common mode of action in the infected individual. The common features of EAEC pathogenesis can be described in following stages: Stage I involves initial adherence to the intestinal mucosa and/or the mucus layer which is denoted as aggregative adherence (AA) (Okeke IN, 2000). AAF/I and AAF/II are the structural subunits of aggregative adherence fimbriae and are leading candidates for factors that may facilitate initial colonization.

Stage II involves enhanced mucus production, apparently leading to deposition of a thick mucus containing biofilm encrusted with EAEC. The blanket may promote persistent colonization and perhaps nutrient malabsorption.

In the final stage of EAEC pathogenesis, an inflammatory response with cytokine release, mucosal toxicity and fluid secretion is observed. Plasmid mediated toxin encoded by pet gene on pAA plasmid induces enterotoxic and cytotoxic effects leading to host innate immune system to respond by releasing high level of IL-8 (Steiner TS, 1998).

Figure 1.11: Pathogenesis of EAEC infection. Enteroagreggative E. coli (EAEC) attaches to enterocytes in both the small and large bowels through aggregative adherence fimbriae (AAF) that stimulate a strong interleukin-8 (IL-8) response, allowing biofilms to form on the surface of cells. Plasmid-encoded toxin (Pet) is a serine protease autotransporter that targets Îą-fodrin which disrupts the actin cytoskeleton and induces exfoliation (Source: Macmillan Publishers Limited).

1.14: Clinical manifestation of EAEC infection EAEC-infected patients develop watery diarrhea, without fecal blood or leukocytes. Few patients experience prolonged illness, and most cases resolve without antibiotic therapy. Most infants and children infected with EAEC experience a self-limiting illness resembling that seen in adults. However, a minority of infants may develop persistent diarrhea (longer than 14 days), which may require antibiotics and nutritional support (Cobeljic M, 1996).

1.15: Enteropathogenic Escherichia coli (EPEC): Enteropathogenic Escherichia coli (EPEC) is an important category of diarrheagenic E. coli which has been linked to infant diarrhea in the developing world. In particular, EPEC was the first strain of E. coli incriminated as the cause of outbreaks of infantile diarrhea in the 1940s and 1950s (Bray, 1945). EPEC are characterized by their ability to induce attaching-effacing (A/E) lesions in the intestine (Moon et al., 1983). EPEC colonizes the small intestine and causes typical attaching-and-effacing lesions characterized by the degeneration of microvilli and intimate adherence of bacteria to epithelial membranes. The genes required for the production of these lesions are located on a pathogenicity island known as the locus for enterocyte effacement (LEE), which encodes (i) intimin, an outer membrane protein product of the eae gene that acts as an adhesin, (ii) a type III protein secretory system, and (iii) several effector proteins secreted by the type III system, including a translocated intimin receptor, Tir, which, once bound to intimin, serves as an anchor for host cytoskeletal proteins (Celli J, 2000).

Figure 1.12: Attaching and effacing histopathology caused by EPEC. The attaching and effacing histopathology results in pedestal-like structures (Source: Nature © Macmillan Magazines Ltd, 1992).

EPEC are divided into two subtypes:

•

•

Typical EPEC and

•

Atypical EPEC (ATEC)

Typical EPEC

In addition to having LEE, typical EPEC strains carry a 90-kb EPEC adherence factor (EAF) plasmid that encodes type IV-like bundle-forming pili (BFP) (Tobe T, 1999). BFP facilitate the adherence of bacteria to the intestinal mucosa and to each other, allowing them to form micro-colonies on epithelial cells in vitro and in vivo (Cleary J, 2004; Tobe T, 2001). Studies with adult volunteers have demonstrated that intimin, EAF plasmid and BFP are essential virulence determinants of EPEC (Donnenberg MS, 1993).

Atypical EPEC (ATEC) Atypical EPEC (ATEC) (Daniel Mu¨ller, 2006) strains harbor the LEE pathogenicity island but, due to the lack of the EAF plasmid, they mostly adhere in a diffuse pattern to epithelial cells (Ga¨rtner, 2004). There is evidence that atypical EPEC (ATEC), which have eae gene but lack EAF plasmid and bfp gene, are also pathogenic (Trabulsi LR, 2002).

1.16: Virulence factors of EPEC Different virulent factors of EPEC have been identified based on their ability to show localized adherence to intestinal epithelial cell or attaching and effacing (A/E) lesion on epithelial cells. The main virulence factors that are responsible for the pathogenicity of EPEC include locus of enterocyte effacement (LEE) and EPEC adherence factor (EAF plasmid). 

Locus of enterocyte effacement (LEE)

Virulent EPEC strains contain a 35.5 kb chromosomal region in which cluster of genes (eae, espB, and esc) responsible for pathogenicity occur in close proximity (McDaniel, 1995). This region which encodes a type III secretion system, multiple secreted proteins, and a bacterial adhesin called intimin is called locus of enterocyte effacement (LEE). The LEE contains the eae (stands for E. coli attaching and effacing) gene, encoding the outer membrane protein

intimin. This protein mediates intimate adherence to target eukaryotic cells upon interaction with its translocated receptor Tir (stands for translocated intimin receptor), a protein encoded upstream of the eae gene on the LEE. 

EAF plasmids

The BFP (bundle forming pilli) is encoded on plasmids which range in size from 50 to 70 MDa, called the EAF plasmids. Downstream of the bfp gene there is a cluster of three genes encoding a transcriptional activator (Per), which positively regulates several chromosomal and plasmid genes necessary for the pathogenesis of EPEC. Beyond the per genes is a 1-kb restriction fragment that has been extensively used as a diagnostic DNA probe, called the EAF probe.

1.17: Mechanism of EPEC Pathogenesis A three-stage model of EPEC pathogenesis, comprising of localized adherence, signal transduction and intimate attachment, was first proposed in 1992 (Donnenberg MS, 1993).

The first stage in EPEC pathogenesis involves the initial adherence of bacteria to epithelial cells. Previous studies have implicated the BFP as the initial EPEC attachment factor (Giron, 1991).

The second stage of EPEC infection is characterized by signal transduction. One key finding which has facilitated the study of EPEC pathogenesis was that EPEC secreted a number of proteins via a type III secretion pathway (Jarvis, 1995). The type III secretion system appears dedicated to the secretion of specific proteins, including Tir, EspA, EspB and EspD which are essential for the subversion of host cell signal transduction pathways and the formation of A/E lesions (Kenny, 1995).

The third stage of EPEC infection is characterized by enterocyte effacement, pedestal formation at the apical enterocyte–cell membrane and intimate bacterial attachment to the host cell. This is mediated by a 94 kDa outer membrane protein, intimin. Intimin, encoded by eae gene (E. coli attaching-and-effacing) can modulate a strong antibody response and responsible for full virulence of EPEC (Donnenberg MS, 1993). Then intimin binds to Tir (translocated intimin receptor) of host cell which clusters Tir beneath adherent EPEC. Thus, directly linking extracellular EPEC to the epithelial membrane and anchoring it to the host cell actin and cytokeratin cytoskeleton networks (Batchelor, 2004 ). The type III secretion system is then activated and various effector proteins- including Tir, EspF, EspG, EspH and Map- are translocated into the host cell. EPEC binds through the interaction of intimin with Tir inserted in the membrane and numerous cytoskeletal proteins accumulate underneath the attached bacteria. Protein kinase C (PKC), phospholipase Cγ, myosin light-chain kinase and mitogen-activated protein (MAP) kinases are activated, which leads to several downstream effects, including increased permeability of cell membrane. Diarrhea results from multiple mechanisms, including active ion secretion, increased intestinal permeability, intestinal inflammation and loss of absorptive surface area resulting from microvillus effacement (Figure: 1.13).

Figure 1.13: Pathogenesis of enteropathogenic Escherichia coli (EPEC).

(Source: Nature © Macmillan Magazines Ltd).

1.18: Clinical manifestation of EPEC infection The incubation period is variable for EPEC infection. Clinical features of EPEC infection in children include: − − − −

severe acute diarrhea low grade fever vomiting may be persistent diarrhea resulting weight loss and malnutrition even death.

1.19: Treatment and management of Diarrhea The treatment for diarrhea caused by the three categories of diarrheagenic E. coli (DEC) includes rehydration strategies and antimicrobial therapy. Treatment is primarily supportive and directed toward maintaining hydration and electrolyte balance. Antibiotic therapy is also indicated in case of severe diarrhea. The adjustment and maintenance of hydration is always most important.

Adequate dietary management (including breastfeeding), micronutrient supplementation (zinc, vitamin A, folic acid, copper, and selenium), rehydration (especially with low osmolar ORS), and antimicrobials (to cover bacteria and parasites) are key parts of therapy to manage children with persistent diarrhea (Ochoa TJ, 2004). 

Rehydration

Supplement of fluid and minerals in the form of oral saline (ORS) is the simplest way of rehydration until the diarrhea ceases. Intravenous fluids (such as Ringer’s lactate) are required initially for all patients with severe dehydration. 

Antimicrobials

Diarrhea in children is caused not only by ETEC, EAEC and EPEC but also by other bacterial and viral agents. Therefore it has been difficult to study the effect of antimicrobials in children with different pathotypes of diarrheagenic E. coli. In adults following severe cases, ciprofloxacin, azithromycin, tetracycline, erythromycin, cotrimoxazole are the usual antibiotic of choice.

1.20: Aims and objectives of the study: 1.20.1: General objective: The objective of the study was to determine the prevalence of three categories of diarrheagenic Escherichia coli (DEC) - enterotoxigenic Escherichia coli (ETEC), enteroaggregative Escherichia coli (EAEC) and enteropathogenic Escherichia coli (EPEC) infection among the patients of Kumudini hospital, in Mirzapur from January 2010to August 2011.

1.20.2: The specific objectives of the present study were: 1) Determination and confirmation of ETEC, EAEC and EPEC from diarrheal stool specimens by microbiological culture methods.

2) Rapid detection of ETEC organisms in stool samples by genotypic method using polymerase chain reaction (PCR) and characterization of ETEC by phenotypic methods (ELISA, dot blot immunoassay using specific monoclonal antibodies).

3) Detection of EAEC and EPEC from diarrheal stool specimens genotypically using specific primers in multiplex PCR. 4) Association of ETEC, EAEC and EPEC with demographic data of the patients in a particular area in Bangladesh.

1.20.3: Future prospective of the study: Future prospective of this study is to assist development of vaccine against diarrhea caused

by ETEC, EAEC and EPEC. In case of ETEC, various purified CFs have been considered as oral immunogens are less suitable since they are expensive to prepare and sensitive to proteolytic degradation (Levine, 2001). For this reason ETEC toxins (LT, ST) are the best target for the development of vaccine together with formalin inactivated whole cell bacteria where the CFs are still immunogenic but not as labile as purified antigen. Since there are currently no vaccines for prevention of EAEC and EPEC infection, it needs to have extensive studies and knowledge on the pathogenesis and virulence pattern in human for successful introduction of interventions against these pathogens.

2. Methods and Materials 2.1: Study campus: This study was carried out at the International Centre for Diarrheal Disease Research, Bangladesh (icddr,b) in Dhaka. Stool specimens were collected from January, 2010 to

August, 2011 from diarrheal patients at Kumudini Hospital, Mirzapur (Tangail district, Bangladesh) to screen diarrheagenic Escherichia coli (ETEC, EAEC and EPEC) and Vibrio cholerae. This study was approved by the Research Review Committee (RRC) and Ethical Review Committee (ERC) of the centre.

2.2: Clinical specimens and screening: Stool samples collected from patients and controls were placed in Cary-Blair transport medium and in sterile plastic containers, transported to the laboratory, and inoculated on MacConkey agar media within 24 h. In addition, information regarding age, sex, and clinical features (fever, vomiting and dehydration status) as well as data on the duration of diarrhea, etc. was also collected from the patients. These specimens were then screened for Diarrheagenic

Escherichia coli (DEC) and Vibrio cholerae. PCR (Polymerase Chain Reaction) and ganglioside GM1-ELISA (Enzyme-linked immunosorbent assay) techniques were performed to confirm genotypic and phenotypic detection of ETEC toxin. Later, ETEC toxin positive colonies were tetsed by dot-blot method to detect the colonization factors. Detection of diarrheagenic Escherichia coli was performed by multiplex PCR. Detection of V. cholerae O1/O139 was done using specific monoclonal antibodies.

Diarrheal stool

Microbiological analysis

Molecular method: PCR

Immunological method: ELISA, Dot blot

Figure 2.1 Screening of clinical samples using different methods.

2.3: Study design: The underlying flow-chart is the overview of the study plan to detect diarrheagenic Escherichia coli (ETEC, EAEC and EPEC) and Vibrio cholerae from the samples of patients: Stool and Carry Blair from diarrheal patient of Kumudini Hospital

For E. coli detection

For V. cholerae detection

Streaked Streakedon onMacConkey MacConkey agar agarplate plate

Streaked on TTGA plate

E. E.coli colispecific specificcolony colonywas was tested for Diarrheagenic tested for Diarrheagenic E. E. coli coli

Multiplex MultiplexPCR PCRto to detect EAEC and detect EAEC and EPEC EPEC

Serological conformation with serogroups of V. cholerae O1/O139 using monoclonal antibodies

Multiplex MultiplexPCR PCRto to detect ETEC detect ETEC

IfIfPCR PCRpositive positive

GM1 GM1ELISA ELISAto todetect detectETEC ETEC toxin toxin phenotype phenotype

Dot Dotblot blotto todetect detect ETEC CFs ETEC CFs

Figure 2.2: Flowchart for detection of DEC and Vibrio cholerae.

2.4: Identification of Escherichia coli: E. coli was recovered easily from clinical specimens on MacConkey agar, on the basis of their morphology. To confirm detection of E. coli freshly collected stool specimens were plated on to MacConkey agar plates and incubated at 37째C overnight. Six individual lactosefermenting colonies with deep pink colour from each clinical sample were tested. The different categories of diarrheagenic E. coli were detected by PCR method and the ETEC toxins were detected by ganglioside GM1-ELISA method.

Deep pink colonies of lactose fermenting E. coli

Figure 2.3: E. coli colonies growing on MacConkey agar plate.

2.4.1: Multiplex PCR for the detection of ETEC genes (LT and/or ST)  Reference strains : Table 2.1: Reference ETEC strains used for the detection of LT and/or ST genes Strains

Toxin types

E. coli ST 64111 E. coli 286C2 E. coli 195 E. coli VM 75688 E. coli E34420C

STh+ LT+ STp LT+, STh+ ST-, LT-

Multiplex Polymerase chain reaction (MPCR) was performed to amplify desired genes of ETEC (LT and/or ST) where LT and ST gene specific primers were used together in one master mixture preparation. After completion of master mixture preparation genomic DNA added to appropriate volume of master mixture and then PCR was done using thermal cycler.

Genomic DNA was prepared using following steps: 

Template Preparation: •

100 µL of PBS was poured to each Eppendorf tube.

•

One loop of bacteria was taken from MacConkey agar plates (from a pool of six colonies) and suspended in an eppendorf tube containing 100µL of phosphate buffered saline (PBS) for the detection of LT or ST by PCR.

•

The suspension was heated at 100°C on water bath for 10 minutes.

•

Transferred the tubes on ice and kept for a minute.

•

Centrifuge the suspension at 12,000 rpm for 10 minutes.

•

The supernatant was the template, ready to use; 3.5µL of supernatant was used for each PCR reaction.

 Specific primer sequence used: Toxins LT

Primers Forward Reverse Forward Reverse Forward Reverse

STp STh

Primer Sequence 5’-ACG GCG TTA CTA TCC TCT C-3’ 5’- TGG TCT CGG TCA GAT ATG TG-3’ 5’-TCT TTC CCC TCT TTT AGT CAG-3’ 5’-ACA GGC AGG ATT ACA ACA AAG-3’ 5’-TAC AAG CAG GAT TAC AAC AC-3’ 5’-AGT GGT CCT GAA AGC ATG-3’

 Master mixture preparation : Table 2.2: Preparation of master mixture for ETEC detection Component

Volume

PCR buffer, with MgCl2 (10X)

2.5 μL

MgCl2 (25 mM)

0.5 µL

dNTPs (2.5 mM each)

4.0 μL

Primer LT mixture (4 pm/µl)

2.0 μL

Primer STp mixture (4 pm/µl)

2.0 μL

Primer STh mixture (4 pm/µl)

2.0 μL

Taq. Polymerase (5U/µl)

0.15 µL

Deionized water

10.85 µL

Total

23.65 μL

•

1.5 μL DNA templates added in each tube.

 The thermal cycle

Table 2.3: The thermal cycle of ETEC Multiplex PCR reaction First step

95°C for 5 minutes (initial denaturation)

Second step

94°C for denaturation-30 seconds 54°C for primer annealing-30 seconds 72°C for elongation-30 seconds

Third step

40 Cycles

72°C for 5 minutes (final extension step) 4°C until use

 Size of toxin products: LT

250bp

STp STh

163bp 100bp

 Agarose Gel Preparation (2%): Amplified PCR products were analyzed by agarose gel electrophoresis on 2% agarose gel.

Agarose gel was prepared by adding 2g Ultra pure agarose in 100 ml 1X TBE buffer (Invitogen, ultra pure) and melted at med high temperature in micro oven for 3-4 minutes.

•

4µL of ethidium bromide was added to the gel, mixed well and poured on a gel casting.

• 30-40 minutes allowed for gel formation.



Agarose Gel Electrophoresis:

•

4µL of loading dye was mixed with 26 µL of PCR product and loaded into the gel.

•

Amplified PCR products were separated at 150 volt for 30 minutes.

•

The band was observed on a Gel documentation system (BIORAD) under UV light.

2.4.2: Detection of LT and ST toxin producing isolates by ELISA: The procedure for detection of LT is based on the binding of the B-subunit of the toxin to GM1 ganglioside and the detection of ST is based on its ability to inhibit the binding of ST to the GM1 and ST-CTB conjugates by ELISA technique.  Procedure

•

For coating purpose 100 µL of ganglioside GM1 solution, 0.3µg/mL, was added to each well of an ELISA plate and incubated at room temperature overnight (these plates could be stored at +4°C for about 2 weeks until used).

•

GM1-coated plates were washed twice with PBS and then concentrated solution of non-interacting protein, bovine serum albumin (BSA) (0.1% BSAPBS, 200 µL /well) is added to plates and incubated at 37°C for 30 minutes.

This step is known as blocking, because the serum proteins block non-specific adsorption of other proteins to the plate.

•

Plates were washed once with PBS and 100 µL of Luria-Bertani (LB) broth containing 45 µg/mL of lincomycin was added to each well of the plate.

•

Six individual colonies (for one sample) from MacConkey plates (using which PCR was done) were inoculated, single bacterial colony/well, with wooden sticks. The outside rows and columns of the ELISA plate were excluded to avoid background.

•

The plates were covered with a plastic film (to prevent evaporation) and incubated with shaking at 250 rpm overnight at 37 oC. These plates were used for the detection of LT toxin.

•

On next day, another GM1 coated ELISA plate (for each to be tested for LT) was washed twice with PBS and blocked with 200 µL 0.1% BSA-PBS at 37oC for 30 minutes. These plates were used for the detection of ST.

•

The plates were washed once with PBS and then 100 µL of recombinant STCTB conjugate solution was added. Plates were incubated at room temperature for 60 min.

•

The plates were washed three times with PBS and then 50 µL volumes of the overnight cultures from the plates for detection of LT were transferred to the corresponding wells in the plates used for the detection of ST. Then 50 µL of anti-ST mAb (1:3 dilution) was immediately added and incubated at room temperature for 90 min.

•

Following this LT plates were washed three times with PBS contained 0.05% Tween and 100 µL of anti-LT mAb (LT 39:13:1) was added immediately and incubated at room temperature for 90 min.

•

Both types of plates (LT and ST) were washed three times with PBS-Tween.

•

After that 100 µL of conjugate (anti-mouse IgG-HRP, 1:1000 dilutions in BSA-PBS-Tween) was added into each well and incubated at room temperature for 90 minutes.

•

All plates were washed three times with PBS-Tween.

•

Developed with OPD (orthophenyl diamine), prepared by dissolving in 10 mg of 0.1 M sodium citrate buffer, (pH 4.5), to which was added 4 µL of 30% H2O2 immediately before use. The substrate was added 100 µL/well and incubated at room temperature. Absorbance was measured at 450 nm after 20 min for LT-plates; 10-15 min for the ST-plate if strong colour reaction at 450 nm (maximum absorbance should not exceed 1.5) in a microplate reader (Titertek).

•

For each plate LT-positive, ST-positive, LT and ST positive, LT and ST negative strains were used as control to interpret the result and control the experiment.

 Reference strains for toxin identification:

ETEC strains

ST

LT

ST64111

+

-

286C2

-

+

VM75688

+

+

E34420C

-

-

+ / - = phenotype of control strains, positive or negative for the toxin phenotypes

2.4.3: Interpretation of results:

• For detection of LT: The background was defined as the mean absorbance determined for LT-negative control strains. A positive result was an absorbance at 450 nm value of ≥ mean background value was used as the cut off level for positive samples.

• For detection of ST: The background was defined as the mean of the absorbance at 450 nm of the ST-negative control strains. The 50% inhibition concentration value (IC50) was calculated according to the equation below: IC50 =

mean absorbance for ST - negative control strains ( E. coli E34420C and 286C2 ) 2

•

The results were calculated as ≥50% inhibition of the absorbance value measured as compared to the absorbance value obtained with the negative reference strains.

•

LT positive result: Absorbance value of ≥0.1 above background.

•

An isolate was considered enterotoxin positive if ≥1 colony showed a positive reaction in ST- and/or LT ELISA.

•

The test was invalid if the reference strain gave a result that was not consistent with its assigned toxin profile.

2.5: Phenotypic detection of colonization factors (CFs):

Dot Blot assay The presence of CFs on the ETEC isolates was detected by rapid dot blot assay using specific monoclonal antibodies for the different antigens. Toxin positive colonies on MacConkey agar plate were plated on to colonization factor antigen agar (CFA agar) with bile salts and were incubated at 37°C, overnight. For testing CS21 only, colonies were cultured on Trypticase Soy agar (TSA) plate containing 5% sheep blood. From each sample, enterotoxin positive E. coli colonies from CFA plus bile, and TSA plates are tested for the expression of CFA/I, CS1, CS2, CS3, CS4, CS5, CS6, CS7, CS8, CS12, CS14, CS17 and CS21 by dot blot assay using monoclonal antibodies specific for the different CS antigens.  Procedure: •

Nitrocellulose membrane sheets or strips were cut, approximately 5x5mm/dot, one sheet or strip for each CF-type to test. Before blocking the nitrocellulose membranes gloves and forceps were used.

•

Strips of nitrocellulose filter paper (0.45 µm, Sigma, St. Louis, MO) were soaked in phosphate buffered saline (PBS, 10 mM, pH 7.2) and allowed to dry for 5-30 minutes.

•

Two µL of bacterial suspension (corresponding to 4-10 McFarland standards) was applied on the strips as a dot on the membrane using a micropipette and allowed to dry for at least five minutes (the membranes could be stored refrigerated at 4-8°C for about 1 week).

•

The membrane was blocked in 1% BSA-PBS for 20 minutes at room temperature (1825°C) on a platform rotator (Heidolph Rotamax 120) with slow rocking (approximately at 50 rpm). An incubation tray (BioRad) was used for nitrocellulose strips.

•

After the blocking liquid was discarded, the same volume of antibody solution monoclonal antibodies diluted 1:30-1:50 was added and incubated for two hours in a humid chamber at room temperature on the rotary shaker. Antibody solution was prepared in 0.1% BSA-PBS with 0.05% Tween 20.

•

After washing 3 times with PBS-0.05 % Tween 20 the same volume of the enzyme conjugate diluted in 0.1% BSA-PBS-0.05 %Tween (goat anti-mouse IgG HRP Jackson, dilution 1:1500) was added and incubated for two hours in a humid chamber at room temperature on the rotator.

•

Strips were washed 3 times within 5 minutes with PBS-0.05%Tween and once with PBS and substrate solution (4-chloro-1-naphtol-H2O2 in TBS) was added to develop color for about fifteen minutes.

•

The membranes were thoroughly washed with tap water and dried.

2.5.1: Interpretation of results: Black, bluish or gray dots on the strips represented positive reactions. The colour intensity was compared with positive controls on each strip. For the test to be valid the control strains all gave positive results for assigned CFs.

2.6: Multiplex PCR for the detection of EPEC and EAEC: Multiplex PCR for categorization of E. coli into EAEC and EPEC was done using established primers for detection of virulence genes either on the chromosome or encoded by plasmids in these dominant pathotypes.  Materials:

1. Genomic DNA collected from the following E. coli strains : Table 2.4: E. coli strains used to isolate genomic DNA E. coli strain

Target gene(s)

Control strain

EAEC EPEC

aatA bfpA, eae

JM221/042 bfp-eae937

Atypical EPEC

eae

-

DNA templates were prepared by the same thermal heating method as was utilized for preparing templates for the detection of ETEC toxin genes.

2. Primers used for the amplification of target genes: Commercially available lyophilized primers were used that has been diluted to 1:5 and finally the working concentration of primer solution became 20 pmol/µL. For multiplex PCR three set of primers were used together in master mixture preparation.

Table 2.5: List of primers used for the detection of EAEC and EPEC strains Primer Name

Primer Sequence

Target gene

Amplimer size (bp)

bfpA (F)

5′TCTCTATGTGCATACGGAGC3′

bfpA

367

bfpA (R)

5′CCATACTGATTGCCGCAAT3′

eae (F)

5′CCCGAATTCGGCACAAGCATAAGC3′

eae (R)

5′CCCGGATCCGTCTCGCCAGTATTC3′

aatA (F)

5′CTGGCGAAAGACTGTATCAT3′

aatA (R)

5′CAATGTATAGAAATCCGCTGTT3′

eae

881

aatA

630

 Reaction mixture for PCR: The primers were used to detect the presence of specific virulence genes of different pathotypes in one reaction and only the correct PCR products were amplified. The compositions of master mixture for one PCR sample and the thermal cycle of multiplex PCR reaction is shown in Table 2.6 and Table 2.7, respectively.

Table 2.6: Master mixture preparation per PCR sample Component

Amount

PCR buffer, with MgCl2 (10X)

2.0 µl 0.5 µl

MgCl2 (25 mM) dNTPs (2.5 mM each) bfpA Primer (Forward) bfpA Primer (Reverse) eae Primer (Forward) eae Primer (Reverse)

2.0 µl 0.4 µl 0.4 µl 0.44 µl 0.44µl

aat Primer (Forward)

0.4 µl

aat Primer (Reverse)

0.4 µl

Taq. Polymerase (5U/µl) Deionized water Sample Template Total

0.22 µl 9.0 µl 3.5 µl 19.7 µl

Table 2.7: The thermal cycle of multiplex PCR reaction

First step

96°C for 4 minutes (preheating step)

Second step

95°C for denaturation-20 seconds 57°C for primer annealing-30 seconds 72°C for elongation-1 minute

Third step



72°C for 7 minutes (final extension step) 4°C until use

Agarose gel (2%) preparation and Electrophoresis:

35 cycles

•

Agarose gel was prepared by as above 2.0% gel.

•

3µL of loading dye was mixed with 20 µL of PCR product and loaded into the gel.

•

Amplified PCR products were separated at 120 volt for 45 minutes by agarose gel electrophoresis on the gel.

•

100bp DNA ladder has been used.

•

The band was observed on a Gel documentation system (BIORAD) under UV light.

 Interpretation of results The products were run on 2% agarose gels for better resolution and visualized under UV light. Only the targeted PCR products were amplified, and by mixing the primers and performing multiplex PCR, it was verified that the primers in each panel could detect the presence of specific target virulence genes in one reaction Table 2.8: Association of PCR products with virulence factors

Primer

Amplicon size

Interpretations

eae

881bp

E. coli attaching and effacing gene of EPEC

aat

630bp

aatA gene from the pAA plasmid of EAEC

bfpA

367bp

bundle forming pilli attachment genes of EPEC

2.7: Serological detection of Vibrio cholerae: The genus Vibrio is named for the unique, rapid to- and fro- motility, which is characteristic of this group of organism. Inhibition of motility by specific antibodies was used to confirm the serogroup of the pathogen. Stool specimens from the diarrheal patients were plated on TTGA (taurocholate-tellurite-gelatin agar) plate. V. cholerae positive stool gives a transparent colony with a dark black zone of potassium tellurite in the middle of TTGA plate (Figure: 2.4).

Figure 2.4: Vibrio cholerae colonies on TTGA plate.

2.7.1: Serotyping of Vibrio cholerae: For serotyping, V. cholerae O1- or V. cholerae O139-specific mouse monoclonal antibodies were used. Mouse monoclonal antibodies rose against V. cholerae O1 (Inaba and Ogawa serotypes) {M. Rahman, 1987} and O139 isolates {Shimada, 1993} were used for testing the serotype. At first a slide was taken and divided into three parts by marking with wax pencil.

Then three types of antisera (V. cholerae 01- Inaba, V. cholerae 01- Ogawa and V. cholerae 0139-specific rabbit antisera) was put on each part of the slide. With a loop half of the colony from the TTGA plate was applied on the slide where antibody was present. Agglutination was observed when specific colony for the antisera was present. The occurrence of clear agglutination within 2 minutes was considered a positive reaction.

2.8: Statistical methods: Statistical analyses were done with GraphPad Prism 5 software using Chi-square test. P values < 0.05 were considered significant. Some of the graphs were made using Microsoft Office Excel 2007.

3. Results 3.1: Study subjects From January 2010 to August 2011 a total of 2,581 fecal specimens from Mirzapur (Tangail district, Bangladesh) surveillance study were analyzed for the genotypic and phenotypic detection and characterization of enterotoxins and colonization factors (CFs) of enterotoxigenic E. coli (ETEC) at the ICDDR,B. Of these 2,581 specimens every 5 th specimen was incorporated for the screening of other diarrheagenic E. colienteroaggregative E. coli (EAEC) and enteropathogenic E. coli (EPEC). Hence 414 stool samples from diarrheal patients were tested for EAEC and EPEC by use of the multiplex PCR method described earlier. In addition, the prevalence of Vibrio cholerae O1 in the specimens from the Mirzapur surveillance study was also determined.

3.2: Prevalence of ETEC in study subjects

A total of 2,581 diarrheal stool specimens were analyzed in the study period starting from January, 2010 to August, 2011. About 4% (97 of 2,581) of all stool specimens were found positive for ETEC. The presence of ETEC virulent genes (LT and ST) were determined by ETEC multiplex PCR and the expression of toxins were confirmed by GM1-ELISA. In this study, prevalence of Vibrio cholerae O1 serotype was detected as 2.56% (66 of 2,581) with 100% being of the Ogawa serotype. However, no Vibrio cholerae O1 Inaba or Vibrio cholerae O139 serogroup was detected during this time period.

3.3: Toxin profiles of ETEC strains E. coli isolates from the stool specimens of the patients with diarrhea were tested for toxin production. Heat labile enterotoxin (LT) and heat stable enterotoxin (ST) gene specific primers were used to identify the toxin genes using PCR method (Figure: 3.1).

A B C D E F

G H I

J

K

L M

N O P Q

R S T

LT (250 bp) STp (100 bp) STh (66 bp)

Figure 3.1: Agarose gel electrophoresis for the detection of LT/ST genes of ETEC isolated from diarrheal stool specimens. Lane A and lane B represent positive controls for STh and STp and lane C and lane D for LT/STh and LT/STp, respectively. Lane E is for negative control. Lane F-T are for tested isolates where lane F is positive for LT/STp and P is positive for LT/STh.

After detection of the toxins genotypically, the positive colonies were subjected to ELISA for phenotypic detection. Both PCR and ELISA results confirmed that among 97 ETEC positive

cases, 38 strains expressed LT and 22 strains expressed ST whereas 37 ETEC strains expressed LT and ST simultaneously.

3.3.1: Toxin phenotyping Characteristically ETEC produce one or more enterotoxins that can be heat-labile (LT) or heat-stable (ST). During the two year (2010-2011) period, 4% (n=97) ETEC isolates were collected from 2,581 stool specimens. Of these, 39% (n =38) were LT only producers 23% (n =22) were ST only producers, and 38% (n =37) were both LT and ST producers. Thus, only LT- producing ETEC isolates were the most prevalent, followed by the LT-and ST-producing isolates and only ST -producing ETEC isolates (Figure 3.2).

Figure 3.2: Distribution of enterotoxins in ETEC isolated from the stool specimens.

3.3.2: Toxin Genotyping Multiplex PCR was used for simultaneous detection of the gene eltB (LT) and the ST variants st1 (STp) and estA (STh) more specifically. Of the 22 ST toxin producing strains, STh was detected in 100 % (n=22) of the ETEC isolated. Additionally, among 37 LT/ST toxin positive

strains, 86 % (n=32) strains were positive for LT/STh while 14% (n=5) were positive for LT/STp (Figure 3.3).

Figure 3.3: Two variants of LT/ST toxin detected from stool specimens.

3.4: Identification of Colonization Factors of ETEC strain 3.4.1: Phenotypic Assay: Dot blot The colonization factors (CFs) of ETEC strains were determined by immuno-dot blot assay.

Phenotypic characterization of colonization factors of the 97 ETEC strains were carried out by immuno-dot-blot assay applying 13 different colonization factors specific monoclonal antibodies ( Figure: 3.4).

A

B

C

D

E

F

G

H

I

J

K

L

M

18 14 11 8

2 1 CS1 CS2

CS3

CS4 CS5 CS6

CS7

C17 CFA/I CS8 CS14 CS12 CS21

Figure 3.4: Immuno-dot blot assay for the detection of colonization factors in ETEC isolates. The lanes A-M represent CS1, CS2, CS3, CS4, CS5, CS6, CS7, CS17, CFA/I, CS8, CS14, CS12 and CS21 respectively. The colonies from different ETEC isolates were spotted on each strip.

The spots above are positive controls on the strips indicate positive results for different colonization factors identified in different ETEC isolates. Spot 1 and 2 represent positive control for each specific CF. Spot 8, 11 and 14 are positive strains for (CS1+CS3+CS21), CS7 and CS14 respectively. Rest of the strains is negative for all 13 colonization factors.

3.4.2: Percentage of CF positive and CF negative strains in case of different toxins Among the 97 toxin positive ETEC isolates 45% (n= 43) ETEC strains were found to be colonization factor (CF) positive for 1 or more of the 13 CFs and remaining 55% (n= 54) strains were considered as CF negative as they did not show any positive spot on the nitrocellulose strips. For LT toxin, 27% (10 of 38) strains were CF positive; 69% (15 of 22) strains were CF positive for ST toxin and 49% (18 of 37) strains were CF positive for

LT/STh toxin. On the other hand LT/STp strains expressed none of the CFs tested. The following figure shows percentage of CF positive and negative strains in case of different toxins.

Figure 3.5: Percentage of CF positive and negative strains in different toxin types of ETEC.

3.4.3: Comparison and prevalence of different Colonization Factors (CFs) during 2010 and 2011 From the data analyses of colonization factors (percentage of total CF positive isolates) expressed by toxin positive ETEC isolates, it was found that among 13 different types of CFs only nine different CFs were

prevalent during 2010 and 2011. Fig: 3.6 represent the

distribution as well as comparison of different CFs found on the ETEC isolates in individual years.

Figure 3.6: Prevalence of different CFs in study Years (2010 and 2011). In 2010, the most prevalent CF was CS5+CS6 followed by CFA/I, CS12, CS7, CS17 and CS1+CS3+CS21 whereas CS1+CS3+CS21 is the most prevalent one in 2011 which is followed by CS2+CS3, CS5 +CS6, CFA/I, CS12, CS17 and CS6 respectively. No toxin positive ETEC isolates were positive for CS1+CS3+CS21, CS2+CS3 and CS6 in 2010 that are exclusively produced by some of the ETEC isolates in 2011 and in case of CS7, it is found only in 2010 but not in 2011.

3.4.4: Relevance of the toxin pattern and the expression of different CFs in ETEC isolates A comparison of the toxin pattern and the expression of different CFs were carried out which is shown in Table 3.1.

Table 3.1: Association of toxins and CFs in ETEC isolates.

Toxin produced

ST

LT

LT/ST

Total no. of CF (+ve ) isolates

15

10

18

CF patterns

No. (% of isolates)

CFA/I

8(53.33)

CS12

1(6.66)

CS2+CS3+CS21

1(6.66)

CS1+CS3+CS21

3(20.0)

CS2+CS3

1(6.66)

CS6

1(6.66)

CS12

6(60.0)

CS17

2(20.0)

CS2+CS3

1(10.0)

CS7

1(10.0)

CS5+CS6

11(61.11)

CS2+CS3+CS21

2(11.11)

CS1+CS3+CS21

3(16.66)

CS2+CS3

2(11.11)

3.4.5: Overall percentage of different CFs The overall percentage of 13 detected CFs from January, 2010 to August, 2011 is shown in the Figure 3.7. The coli surface (CS) antigen CS5+CS6 of the colonization factor antigen was the most prevalent (26%) followed by CFA/I (19%), CS12 (16%) and CS1+CS3+CS21 (14%). Additionally, other CFs detected in decreasing order were CS2+CS3 (9%), CS2+CS3+CS21 (7%), CS17 (3%) and CS6 (2%) = CS7 (2%).

Figure 3.7: Percentage of different colonization factors on ETEC isolates.

3.5: Detection and characterization of Diarrheagenic E. coli (DEC) from stool specimens of patients Among the six categories of diarrheagenic E. coli (DEC), for the detection of EAEC, EPEC and atypical EPEC (ATEC) multiplex PCR was performed. Isolated E. coli from stool specimen of diarrheal patients (n=414) were tested for identification of DEC pathotypes using

specific primers for virulence genes of EAEC (aat), EPEC (eae and bfpA) and atypical EPEC (eae) (Fig: 3.8).

A

B

C

D

E

F

G

H

eae aatA

bfpA

Figure 3.8: Multiplex PCR amplification of diarrheagenic E. coli from diarrheal patients. Lane B and C represent positive controls for EPEC and EAEC control strains respectively while lane D, E F, G and H represent specimens positive for EAEC, EPEC and atypical EPEC (ATEC) and negative control. Lane A is for 100 kb DNA marker.

3.5.1: Diarrheagenic E. coli pathotypes identified among clinical samples during January 2010 to August 2011 During the study period from January 2010 to August 2011, under the KH surveillance study every 5th patient from 2,581 patients (n= 414) was screened for EAEC and EPEC. In this study, a subgroup of EPEC was also identified as atypical EPEC (here termed as ATEC) which harbors eae gene but lacks bfpA gene. DEC were detected in 14% patients (59) of the total (n=414) specimens tested.

Table 3.2: Distribution of virulence genes among the isolated DEC DEC (types and genes)

Number (%)

% of all patients (n=414)

EAEC

41

10

aatA

41 (100)

EPEC

14

eae +bfpA

11 (78.6)

bfpA

3 (2.14)

ATEC

4

eae

4 (100)

3

1

Of the total 59 isolates of diarrheagenic E. coli, 70% (n=41) were classified as typical EAEC, harboring the aatA gene, 24% (n=14) were classified as EPEC harboring both eae and bfpA or bfpA gene alone and 6% (n=4) were classified as atypical EPEC (ATEC) harboring eae gene only (Table 3.2 and Figure: 3.9).

Figure 3.9: Distribution of isolated DEC pathotypes in PCR positive specimens.

3.6: Association between different categories of DEC with social demographic data of the study subjects

In this study, a total number of 414 patients were studied and data analyses show association between different categories of diarrheagenic E. coli with age, sex and dehydration status of the patients as well (Table: 3.3). Among the patients who were positive for any of the DEC isolates in the PCR assay, most of them are under five years (60 months) of age whereas very few of these infected patients were above five years of age.

Table 3.3: Association between different types of DEC strains with age, sex and dehydration status of patients Description

EAEC (n=41)

EPEC (n=14)

23 (72%)

8 (25%)

ATEC (n=4)

Total (n=59)

Age(months) 0-12

1 (3%)

32

13-60

16 (70%)

4 (17%)

3 (13.0%)

23

>60

2 (50.0%)

2 (50.0%)

0 (0.0%)

4

Male

20 (71%)

5 (18%)

3 (11%)

28

Female

21 (68%)

9 (29%)

1 (3%)

31

Sex

Dehydration status Some None

7 (78%) 34 (68%)

1 (11%) 13 (26%)

1 (11%) 3 (6%)

9 50

In the above analysis, patients are grouped into three categories based on their respective ages. It has been shown that the youngest group (0-12 months) has the highest incidence of being infected with every class of diarrheagenic E. coli and the patients aged between 13-60 months have a greater prevalence of DEC infection than the age group above 60 months.

In all the isolated DEC from patients with different age groups, sex and clinical status, it was clear that EAEC is the predominant etiological agent of childhood diarrhea having a strong

association either with young children with diarrhea or with sex specific groups followed by EPEC and ATEC, respectively (Table: 3.3).

3.6.1: Age-related susceptibility to infection with diarrheagenic E. coli in patients To find out association between different categories of DEC with different ages, studied patients were classified into three groups as 0-12 months, 13-60 months and patients aged above 60 months. The relative age-susceptibility to infection with EAEC, EPEC and ATEC are shown in Figure: 3.10.

80

***

EAEC

***

EPEC

% of isolates

60

ATEC

40

***

20 0

0-12

13-60

>60

Age in months

Figure 3.10: Prevalence of DEC in different age groups.

Among the age groups, infants aged less than 12 months are more susceptible to infection with EAEC (72%) which is significantly higher (p<0.001) than EPEC (25%) and ATEC (3%). Thus, diarrheagenic E. coli (DEC) have been recognized as important pediatric enteropathogen in this study (Table 3.3). Children aged between 13-60 months are more likely (p<0.001) to be infected with EAEC (70%) than infection with EPEC (17%) and ATEC (13%). EAEC (50% of) and EPEC (50%) infected patients aged above 60 months in a same likelihood but no infection occurred by ATEC in this group.

3.6.2: Sex specific prevalence of diarrheagenic E. coli in the diarrheal patients Of the patients infected with any of the categories of DEC, 49% (n=28) of them were male while 51% (n=31) of them were female. EAEC infected both male and female in a similar proportion and no significance (p=0.84) with sex was observed regarding this issue. Although few patients (n=14) were positive for EPEC, it is more likely (p<0.001) to affect female

patients (64%) compared to males (36%). Only 7% of total DEC (n=4) patients were positive for atypical EPEC (ATEC) and 75% (n=3) of them were male and only 25% (n=1) female was infected with ATEC (Figure: 3.11).

***

Percntage of isolates

80

*** 60

Male Female

40 20 0

EAEC

EPEC

ATEC

Type of infection Figure 3.11: Sex specific prevalence of DEC in patients.

3.7: Seasonality of diarrheagenic E. coli (DEC) during January 2010 to August 2011 The seasonality of DEC infection was analyzed for selected pathogens like EAEC, EPEC and atypical EPEC during the study years. In Bangladesh, the months from December to February are cooler winter months, the months from March to May are hot, dry, spring months, and June to November are hot, wet, monsoon rainy months.

3.7.1: Comparative prevalence of Diarrheagenic E. coli in patients under the study Three categories of DEC (EAEC, EPEC and atypical EPEC) were isolated from the selected patients under this study. It has been observed that EAEC has become the most prevalent than the remaining among the isolated DEC pathogens in the diarrheal patients as its occurrence is found throughout the whole year. Month wise total of respective infection with these three

agents of DEC during January 2010 to August 2011 make a comparative distribution pattern shown in Figure: 3.12.

Figure 3.12: Comparative prevalence of Diarrheagenic E. coli.

Considering the above distribution patterns (Figure: 3.12) of the isolated pathogens under DEC groups, it was observed that EAEC infections were present throughout the year but interestingly peaked in winter months with continuity of infections in hot and wet seasons as well. On the other hand prevalence of EPEC infections has been seen three times in a year and atypical EPEC remained the least prevalent pathogen in the comparison. In case of atypical EPEC (ATEC) infection, no remarkable conclusion can be drawn regarding seasonality as its frequency is low (only 4 during the study years) throughout the year compared to other infections.

3.8: Seasonality pattern of Enterotoxigenic Escherichia coli (ETEC) and Vibrio cholerae O1 From January, 2010 to August, 2011, the number of cases per month (month-wise totals for the study years) for ETEC and Vibrio cholerae (VC) is shown in the Figure 3.13.

Figure 3.13: Number of ETEC and Vibrio cholerae diarrheal cases per month.

As shown in Figure 3.13, the first peak for ETEC and Vibrio cholerae was observed in May and the second and highest peak in July. In this study, infection with ETEC showed significantly

higher incidence starting from March and persisted until July and gradually reached to the basal level during November compared to infection with Vibrio cholerae. The graph also reveals that peak for ETEC infection comes first then Vibrio cholera infection raises.

4. Discussion Different categories of diarrheagenic E. coli (DEC) organisms have an important role in causing infectious diarrhea especially in children (Cohen et al., 2005; Levine et al., 1993) of the developing world as well as in the developed countries (Caprioli et al., 1996; Nataro et al., 2006). Of the six recognized diarrheagenic categories of Escherichia coli (Nataro and Kaper, 1998), enterotoxigenic Escherichia coli (ETEC) and enteropathogenic Escherichia coli (EPEC) were listed as the highest priority for vaccine development after rotavirus because of their high morbidity and mortality rates (Black, 2002). In recent years, enteroaggregative Escherichia coli (EAEC) has been recognized importantly as an emerging enteric pathogen associated with pediatric diarrhea (Huang and Dupont, 2004) with acute and persistent illness around the world (Cerna et al., 2003).

Among the known enteric pathogens, ETEC is the leading bacterial cause of infectious diarrhea in the developing world, causing infantile or cholera-like disease in all age groups (Black, 1993) and also a major cause of travelersâ&#x20AC;&#x2122; diarrhea (Black, 1990; Ericsson, 2003).

Infection with ETEC is responsible for 280 million to 400 million episodes of diarrhea, many of which lead to malnutrition, and about 380,000 deaths annually (WHO, 2006). A strong association of ETEC with diarrhea (18%) has been found in Bangladesh, which is similar to many other developing countries (M. Ansaruzzaman, 2007; Peter Echeverria, 1989).

ETEC is the most common among all the diarrheagenic E. coli (DEC) reported (WHO, 1999) and produces diarrheal disease, having cholera like symptoms both in children and adults.

ETEC have some virulence factors, important among which are the-heat labile toxin (LT), heat stable toxin (ST) and colonization factors (CFs). In this study, carried out in Mirzapur (Tangail district, Bangladesh), from January 2010 to August 2011, a total of 2,581 diarrheal stool specimens from patients of Kumudini hospital, enrolled in KH surveillance study were screened for the presence of ETEC virulent genes (LT, STh, STp) by ETEC multiplex PCR method. About 4% (97 of 2,581) of all stool specimens were positive for ETEC in multiplex PCR method which were confirmed by GM1-ELISA technique later on. Specificity and sensitivity of PCR result is usually much more reliable. There were three groups of enterotoxins isolated in the ETEC positive samples. Among them LT was 39%, ST was 23% and LT/ST was 38%; thus almost 77% of the ETEC strains expressed LT, either LT alone or in combination with ST and 61% of the ETEC strains expressed ST, either as ST alone or in combination with LT. Earlier studies in a different area from Bangladesh has shown that the prevalent toxin type on ETEC was ST, which was produced by approximately 75% of the total ETEC isolates (about 50% were positive for ST production and 25% were positive for LT and ST production) (Qadri et al., 2005a). However, the present results showed that heat labile toxin (LT) has been expressed by 39% of the isolates. In case of the ST toxin, 100% of isolates were STh and no STp was detected. Additionally, in case of LT/ST toxin, 86% strains were positive for LT/STh while only 14% was positive for LT/STp. Thus a different toxin profile of ETEC has been seen in the study area recently.

The positive colonies for the toxins were also plated onto colonization factor antigen (CFA) agar plates with bile salts for testing colonization factors (Qadri et al., 2000a). Trypticase soy agar (TSA) containing 5% sheep blood was used to test for the colonization factor the longus antigen CS21 which is not expressed on CFA agar medium (Qadri et al., 2000b).

It has been observed that CFA/I and CFA/II (now designated as CS1, CS2, CS3 combinations of coli surface antigen) were commonly present on ETEC isolated from patients with diarrhea in a study carried out in Bangladesh from 1980 to 1982 (Gaastra, 1996; Gothefors, 1985). In an earlier study carried out in September 1996 to August 1998 showed that the prevalence of the CFs are found in the following decreasing order: CS4+CS6, CS5+CS6, CS6, CFA/I, CS2+CS3, CS1+CS3, CS3, CS7, CS14, CS12, CS17 and CS8. Six CF types were found to be most prevalent including CFA/I, CS1, CS2, CS3, CS4, CS5+CS6 (Qadri et al., 2005a).

However, in the present study different types of colonization factors were also observed. Among different colonization factors, CS5+CS6 was the predominant phenotype, followed by CFA/I, CS12 and CS1+CS3+CS21. CS2+CS3, CS2+CS3+CS21, CS17, CS6 and CS7 expressing ETEC strains were less frequently isolated from stool specimens. CS4+CS6 which were predominant (19%) in the 1996-1998 study (Qadri et al., 2000a) are absent in the present study. Thus, it can be concluded that the colonization factor profile also varied over time and location.

During the previous study period (Qadri et al., 2005a), 78% (130 of 167) of the LT- and STproducing ETEC isolates, 61% (200 of 327) of the ST only-producing ETEC isolates and 24% (40 of 168) of the LT only-producing ETEC isolates were CF positive. But in the present study, 27% (10 of 38) of LT toxin, 69% (15 of 22) of STh toxin and 49% (18 of 37) of LT/STh producing ETEC strains were CF positive during the study period. So, the pattern of colonization factor expression with respect to toxin type has also diverged.

In the present study period CFA/I and CS6 were found exclusively in ST-toxin expressing ETEC isolates while CS5+CS6 was found to be expressed on LT/ST toxin expressing ETEC isolates and CS7 and CS17 were detected only in LT toxin expressing ETEC isolates.

During the study period from January 2010 to August 2011, a significant percentage of enteroaggregative Escherichia coli (EAEC) (10%) infection was seen followed by enteropathogenic E. coli (EPEC) (4%) and atypical EPEC (1%) infection among the diarrheal patients. Among the 414 stool specimens tested for other DEC pathotypes, about 10% (41 of 414) were positive for EAEC virulence gene detected by multiplex PCR method. In earlier studies of diarrheagenic E. coli infection in Bangladesh (Albert et al., 1999; 1995) EAEC was not the prevalent amongst causative agents of diarrhea as they did not find correlation of EAEC infection with diarrhea. But in this study, the most prevalent causative agent of diarrhea is EAEC showing heterogeneity with the previous findings. Moreover a greater

prevalence of EAEC infection in children less than five years of age (<60 months) in this study provides a significant correlation with childhood diarrhea which is supportive to the findings around the developing world (Nguyen et al., 2005; Ochoa et al., 2009) in recent times. The predominance of EAEC infection in children at their first year of life in this study reveals that infants are at a greater risk of being affected with this pathotype of DEC and this finding is consistent with the results of previous findings in Bangladesh (Albert et al., 1995) and in other developing countries as well (Nazek Al-Gallas, 2007; Sabrina J Moyo, 2007).

The age-specific differences suggest that infants having immature immune systems may be exposed to contaminated formula of milk, foods or environment or may have not been protected completely by breast feeding (Akbar, 2008).

To identify virulent EAEC strain in diarrheal patients, specific primer for the aatA gene in the pAA plasmid of EAEC has been used in multiplex PCR method in this study. Since EAEC was the most prevalent, it can be concluded that this pathotype has become virulent by harboring aatA gene in the pAA plasmid and prevails in the study area.

Enteropathogenic E. coli (EPEC) are also a major cause of human infantile diarrhea predominantly in less-developed countries but are also identified with increasing frequency in industrialized areas (Afset, 2004; Albert et al., 1995). In the present study EPEC was the second most common DEC isolated and most of these were typical EPEC with both eae plus bfpA genes and bfpA gene alone. EPEC is divided into typical EPEC and atypical EPEC (ATEC) according to the presence of eae, eae plus bfp gene and bfp gene only (Daniel Mu¨ller, 2006). The prevalence of EPEC (typical and atypical) in our study was about 5% (14+4/414) among all patients. Among the EPEC (typical and atypical) infected patients most of them were children aged below five years and infection is prevalent in infants. It has been established that typical EPEC is well recognized as a cause of gastroenteritis in infants (Nataro and Kaper, 1998) and it continues to be a major enteric pathogen in children less than five years of age preferably in infants in this study. This is an agreement with the previous finding of Albert et al. who also reported EPEC as one of the most prevalent diarrheal pathogens in children less than 12 months of age at Dhaka, Bangladesh in 1995 and 1999.

Very low numbers of atypical EPEC (ATEC) (4 out of 414) was isolated from the stool specimens of diarrheal patients in the present study which were exclusively from children under five years of age. Since no coinfection was seen in these cases it also represents an association of atypical EPEC infection with childhood diarrhea. In accordance with the previous study carried out in this region by Albert et al. in 1999 who reported atypical EPEC

as EAF probe negative strain as a causative agent of childhood diarrhea as well as other reports globally (Afset, 2004; Contreras CA, 2010), it can be concluded that atypical EPEC (ATEC) is not one of the major causative agents of childhood diarrhea.

As seen in the present study, there was no association of EAEC infection prevalence with sex of the infected patients whereas EPEC (typical and atypical) infection discriminated between the patients based on sex; typical EPEC infection was prevalent in female individuals while atypical EPEC (ATEC) infection was prevalent in males. It can be hypothesized that female children are more susceptible to infectious diarrhea because they are more malnourished compared to boys in Bangladesh (Vincent Fauveau, 1991).

In addition, about 3% Vibrio cholerae O1 was detected from the stool specimens under the same study using mouse monoclonal antibody that was used for serotyping. V. cholerae O1 is the most common bacterial pathogen which causes acute watery diarrhea in Bangladesh and shares similar features e.g. clinical manifestations, seasonality and endemicity with ETEC (Faruque, 1998). During the study period about 3% (66 of 2,581) of V. cholerae O1 positive strains were isolated while none of the isolates were V. cholerae O139 positive. Vibrio cholerae O139 emerged in 1992 as a major cause of epidemic cholera. However, the incidence of disease due to this serogroup has subsequently decreased for almost a decade. In April 2002, there was a dramatic increase of V. cholerae O139 in Bangladesh (Qadri et al., 2005b). Since then no V. cholerae O139 has been isolated from stools of diarrheal patients.

V. cholerae O1 has two serotypes- Ogawa and Inaba. Serotype Ogawa was the most prevalent one throughout the study period accounting for 100% of the strains and no Inaba serotype was detected.

The seasonality of infection were also analyzed for diarrheagenic E. coli (DEC) and Vibrio cholerae during this study period. ETEC and EAEC infections were present almost throughout the year. In case of EAEC infection, it showed unusual seasonality having a sudden peak in cooler winter months with a continuous infection in hot and wet monsoon season. On the other hand ETEC infections were common throughout the year but peaked from summer to monsoon seasons. There did not appear a distinguishing seasonality for EPEC infection thereby the findings are consistent with the previous findings (Albert et al., 1999) regarding these enteric pathogens. Moreover, earlier studies have shown that V. cholerae O1 has a biannual seasonality with peaks seen in the spring and in the monsoon and

then decreasing later. In this study, a changed seasonality with an extended peak during October and November was found.

This current study was carried out in Tangail whereas the earlier studies on diarrheagenic Escherichia coli (Albert et al., 1999; 1995; M. Ansaruzzaman, 2007; Qadri et al., 2000a) were carried out in Dhaka. The difference in the prevalence of enterotoxigenic Escherichia coli (ETEC), enteroaggregative Escherichia coli (EAEC), enteropathogenic Escherichia coli (EPEC), Vibrio cholerae O1 can be due to the difference in study site also.

In summary, the implementation of multiplex PCR method in this study successfully identified major diarrheagenic E. coli pathotypes (ETEC, EAEC and EPEC) from clinical specimens. We believe that this study provides the basis for the systematic evaluation of E. coli diarrheal pathogens in Bangladesh, from stools specimens of patients with diarrhea but also from food sources, and water samples for human consumption. Future studies should, thus, focus on revealing and identifying the risk factors and transmission routes for these emerging pathogens within the study area and even beyond. Therefore, surveillance for diarrheal etiologic agents in developing nations is necessary to understand the local epidemiology of infectious diarrhea and to measure the burden of disease in children (Gomez-Duarte, 2009). Based on this information it may be possible to implement public health measures directed to control and prevent infectious diarrhea especially caused by diarrheagenic E. coli.

5. References