311
Transcriptional control of plant genes responsive to pathogens Paul J Rushton and lmre E Somssich* Transcriptional defence
system
activation
of genes
against
pathogens.
within the promoters been defined cognate
counterparts plants, defence
factors.
in animals,
reflecting
&-acting
of many of these
and investigators
transacting
is a vital part of the plants genes
have started Some
whereas
are present
have developed
have only in a unique
system.
Addresses Max-Planck-lnstitut Fur Zuchtungsforschung, Department of Biochemistry, Carl-von-Linne-Weg 10, D-50829 Ktiln, Germany *e-mail: somssich@mpiz-koeln.mpg.de Current Opinion in Plant Biology
1998, 1:31 l-31 5
http://biomednet.com/elecref/136952660010031
degrade fungal cell walls and to inhibit if1 vivo and in vitro [3].
fungal growth both
have recently to isolate their
of these factors
others
the fact that plants
elements
1
0 Current Biology Ltd ISSN 1369-5266 Abbreviations 4coumarate:CoA ligase 4CL EREBP ethylene-responsive element binding protein jasmonic acid JA MRE MYB recognition element PR pathogenesis-related PAL phenylalanine ammonia-lyase SA salicyclic acid
Introduction Perception of a pathogen by a plant triggers rapid defence responses via a number of signal transduction pathways. A major target of signal transduction is the cell nucleus where the terminal signals lead to the transcriptional activation of numerous genes and consequently to the de mvo synthesis of a variety of proteins and antimicrobial compounds [ 1,2*]. Studies with different plant pathology systems have revealed that the active response of plants to attempted microbial ingress is associated with dramatic reprogramming of cellular metabolism [2*]. Expression of a large array of genes whose products are involved both in diverse primary and secondary metabolic pathways are rapidly induced or strongly upregulated. These include genes encoding enzymes of the shikimate and the general phenylpropanoid pathways along with enzymes from subsequent branch pathways. Another group of genes, termed pathogenesis-related (PR) genes (comprised of classes l-lo), has often been found associated with the defence response [3]. The function of many PR proteins remains unknown but some are glucanases and chitinases. P-glucanases hydrolyse P-linked glucans, whereas chitinases degrade chitin, the major structural component of the cell walls of many fungi. Additionally, some plant chitinases also have lyzozymal activity. @I,3 glucanase, in concert with chitinase have been shown to
The expression of pathogen-responsive genes shows both a temporal and spatial hierarchy. Some genes undergo a rapid localised activation at the site of infection, whereas others are more slowly activated either locally and/or systemically. Plant hormones, including salicylic acid (SA), ethylene and jasmonic acid (JA), have been implicated in acting as secondary signals following pathogen attack and enhanced expression of many pathogen-responsive genes can be induced by these plant hormones [4**].
Regulatory components responsive genes
of pathogen-
Differences in the expression patterns of pathogen-responsive genes are a result of the architecture of the promoters; pathogen-responsive promoters being dissimilar in the number, order and type of regulatory elements present. This places the promoters at the end of one or more signal transduction pathways as the plant responds to pathogen attack. Despite the differences in architecture, functional dissection of the promoter regions of some of these genes is starting to uncover common &acting elements and has provided us with the tools to identify distinct DNA-binding proteins required to modulate transcription. Interestingly, some of the cognate factors, for example EREBP and WRKY proteins, appear unique to plants whereas others such as bZIP and MYB proteins also have counterparts in animals. The GCC Box and EREBPs
The GCC Box (AGCCGCC; Figure 1) is found in the promoter regions of many pathogen-responsive genes [5,6*]. This &acting element has been shown to function as an ethylene response element [S]. The biosynthesis of ethylene increases rapidly during plant-pathogen interactions and ethylene then acts through the GCC Box to induce the expression of pathogen-responsive genes [5,7**]. Interestingly, although similar elements also act as low temperature response elements and water deficit response elements, the GCC Box has yet to be found in the promoters of ethylene-regulated genes involved in some of the other ethylene responses, such as fruit ripening [8’,9]. It seems, therefore, that ethylene perception involves distinct regulatory mechanisms. A number of proteins that bind to GCC Boxes have been isolated and found to be members of the EREBP (ethylene-responsive element binding protein) family of DNA-binding proteins [5,6*,7**,8*]. EREBPs contain a DNA-binding domain that is also present in the APETALAZ family of proteins [6*]. The homeotic gene APETALAZ plays a central role in the regulation of
312
Plant-microbe
Fiaure
interactions
1
TATA ATG
Pcrnl-1
1
m
I
m
TATA ATG
PcPALl
I
m
I
BTG
A/cMs,5 ,
G
H
HH
TATA ATG
I
hWn2 GCC GCC
n
TATA ATG
NtPR-la
I
m
m
MRE?
MRE?
I
Current Opinion in Plant Biology
Schematic representation of pathogen responsive &-acting elements (W-, P-, L-, G-, H-boxes, GCC-MRE-elements) and their cognate interacting factors (WRKY, BPF-1, MYB, GIHBFl, KAP112, EREBP). The promoter regions of the Petroselinum crisispumPRl-1 (fcPR7-7) and phenylalanine ammonia-lyase 1 (PcPAL 7), the Phaseolus vulgaris chalcone synthase (pVCH.95) and the Nicotiana tabacum glucanase 2 (NtGlnP), and PRl (NrPf?-la) genes are shown. The relative positions of the interacting partners in relation to their respective TATA-boxes and the translation start sites (ATG) are given but are not drawn to scale. bZlP factors, such cs GIHBFl, are known to bind as dimers. Thus, a homodimer of G/HBFl is indicated binding to the G-box although it cannot be excluded that G/HBFl binds instead with an unknown second factor as a heterodimer to this element. Arrows point to additional elements which may be contacted by the respective factors as described in the text.
flower development in Arabidopsis thaliana [lo]. The first EREBPs to be isolated were tobacco EREBP-1, -2, -3 and -4 [S]. All four bind specifically to GCC Boxes and are ethylene-inducible in leaves. More recently, CBFl, an EREBP from A. thahana, was isolated by a yeast one-hybrid screen using a dehydration response element (GCCGAC) as the ‘bait’ DNA [8*]. This suggests that members of the EREBP family may play a wider role in the response to various stresses. In addition, CBFl is capable of transactivation in yeast and this requires a functional &acting element [8*]. Further evidence for a role for EREBPs in plant defence has come from yeast two-hybrid experiments using the tomato resistance gene Pto as a ‘bait’ protein [7**]. Pto confers resistance to Pseudomonas syringae strains carrying the corresponding avrPto avirulence genes. Pto is a protein kinase and was shown to interact with three proteins: Pti4, Pti5 and Pti
6. Pti4/5/6 are EREBPs and bind specifically to GCC boxes. In tobacco carrying a Pto transgene, expression of an EREBP gene was specifically enhanced upon infection with a bacterial strain harboring the avrPto avirulence gene. This suggests a direct link between a resistance gene and the specific activation of plant defence genes and implies that Pto confers resistance by activating a signalling pathway that leads through EREBPs to activation of PR genes containing GCC boxes.
W Boxes and WRKY proteins There are two types of well studied W Box [ll] elements, the first contains the hexamer sequence TTGACC whilst the second consists of the two tetramer half sites TGAC-Nx-GTCA. A W Box in the parsley PR-10 class gene, PRZ-I, is the site of a fungal elicitor-inducible DNA-binding activity [12]. A similar activity also binds to a W Box in the promoter of the tobacco chitinase have shown not only that gene CHNSO [13]. Experiments W Boxes are functional elicitor response elements in the parsley PRl genes [ll], the maize PR-1 class gene PRms [14], and the tobacco class I chitinase gene CHNSO [13,15] but also that they are sufficient to direct elicitor responsive expression in transient expression systems [11,14]. Other pathogen-responsive promoters contain W Box sequences within functional areas of the promoters. These include the potato glutathione S-transferase gstl (PrpZ) [16], PRlO genes from asparagus (AoPRZ ) (171 and potato (PR-ZUa) [18], and the stilbene synthase gene, VstZ, from grapevine encoding an enzyme of phytoalexin biosynthesis [19]. Thus, W Boxes may be a general feature of a large subset of pathogen-responsive gene promoters. W Boxes are binding sites for the WRKY family of DNA-binding proteins [ll,ZO]. In parsley, three WRKY proteins, WRKYl, -2 and -3, bind specifically to functional W Boxes in the PRI-I and PRI-2 promoters [ll]. The optimal binding site for the A thahana WRKY protein ZAP1 also has two W Boxes [ZO]. WRKY proteins are defined by the presence of the WRKY domain. This contains the amino acid sequence WRKYGQK that is conserved in all WRKY domains so far analysed. On the carboxy terminal side of the protein to this is what appears to be a novel zinc finger-like structure [11,20,21]. Zinc-fingers are protein regions containing cysteine and/or histidine residues which are predicted to form a finger structure by binding a single zinc atom. In several cases, it has been demonstrated that the zinc-finger region and zinc are required for DNA binding of the protein. In other cases, however, the zinc-finger constitutes an interface for interaction with other specific proteins [22]. Outside of the WRKY domain, most WRKY proteins are dissimilar, though they do possess features found in transcription factors. Indeed, ZAP1 can transactivate, both in plant cells and in yeast and this transactivation is dependent on the presence of the W Box [20]. Furthermore, the parsley WRKYl protein is targeted to the nucleus (T Eulgem and IE Somssich, unpublished data) and fungal
Transcriptional control of plant genes responsive to pathogens Rushton
elicitor induces rapid and transient changes in the mRNA levels of WRKYl, -2 and -3 [ll]. Thus, WRKY proteins appear to be transcription factors that play a role during plant defence by binding to W Boxes in the promoters of pathogen-responsive genes. MRE-like
sequences
and MYB factors
Another class of &-acting elements is represented by Boxes P and L from the parsley phenylalanine ammonialyase (PAL) and 4-coumarate:CoA ligase (4CL) genes and the H-box from the bean chalcone synthase gene C~SZ~ [23,241. These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs). Boxes P and L were initially identified within the parsley PAL1 promoter as the sites of fungal elicitor-inducible DNA-protein interactions [25] and were subsequently shown to bind a MYB-like protein, BPF-1 [26,‘27’]. BPF-1 mRNA accumulates rapidly in elicitor-treated parsley cells suggesting that it participates in the plant defence response [26]. Boxes P and L from the parsley PALI, 4CLI arrd 4CL.2 promoters can be specifically bound by MYB proteins [27’]. Furthermore, expression of the tobacco 4CL gene, along with other MRE-containing genes encoding enzymes of phenylpropanoid metabolism, was significantly repressed in transgenic tobacco plants overexpressing an Anthhum majus MYB protein [28’]. Additionally, a flower-specific MYB can activate transcription from the A. thaliana gPAL2 promoter through similar elements [29]. Functional studies with the H-box indicated that it cannot function to a high level alone. Gain of function experiments, however, show that it is active in combination with a G-Box element (see below) in transgenic tobacco plants in establishing the characteristic tissue-specific pattern of expression and mutations in either the H-box or G-Box reduced the response to tobacco mosaic virus (TMV) infection [24,30]. Finally, the tobacco MYBl gene is induced by TMV during the hypersensitive response and the development of systemic acquired resistance [31]. Application of SA induced expression of MYBI within 15 minutes. Although the MYBl protein can bind in vitro to a MYB consensus binding site found in the tobacco PRI-a promoter [31], it remains unclear whether this DNA element is of functional importance for PRI-a expression and whether it represents the itz vtio target site for MYBl. G-Boxes,
as-l-like
elements
and bZlP factors
G-Boxes (CACGTG) function during the regulation of diverse genes by environmental cues, such as abscisic acid (ABA), light, UV radiation and wounding, as well as pathogen signals [32]. G-Boxes are members of the family of ACGT-containing &acting elements and have been implicated in the expression of a number of genes during pathogen attack [33]. Often they function in concert with other &acting elements as in the case of the G-Box and H-box from the bean C/s25 promoter [24].
and Somssich
313
Another class of elements implicated in the plant defense response, consists of as-l-like elements. The as-1 (or OCJ) element (CTGACGTAAGGGATGACGCAC) was initially identified in the 35s promoter of cauliflower mosaic virus and the nos and ocs promoters of Agrobacterium tumijkiens [34,35]. The as-2 element confers responsiveness to several signals, including SA, auxin, jasmonates and hydrogen peroxide [4”]. Although the as-l element is responsible for the activation of a number of pathogen genes, it is not clear whether functional as-Z-like elements are found widely in plant genes [34]. Both the G-Box and the as-l or ocs element are bound by bZIP proteins, a well characterised class of transcription factors also found in animals where they regulate, both positively and negatively, various cellular processes. bZIP proteins appear to play important roles during the activation of a number of genes during plant defence. A bZIP protein from soybean binds to the G-Box in the bean CXrl5 promoter [36*]. This protein, G/HBF-1, can also bind to the adjacent H-box. The significance of this relaxed binding specificity is unclear. Although the mRNA and protein levels of G/HBF-1 do not increase during the induction of its putative target genes, the protein itself is rapidly phosphorylated and in vitro phosphorylation enhances binding to one (H-box III) out of the three H-boxes present in the CijsZ5 promoter. A serine kinase capable of phosphorylating G/HBF-1 was also identified and this kinase is rapidly and transiently stimulated in elicitor-treated cells [36*]. Biittner and Singh [6*] showed that an ocs element-binding protein (OBF4) interacts with an EREBP suggesting that cross-coupling between EREBP and bZIP factors may be involved in the regulation of gene expression during the plant defence response. Apart from being a binding site for bZIP proteins, the G-Box is also a potential basic helix-loop-helix bHLH protein binding site (CACNTG) [37]. bHLH factors are present in plants [38] but although MYB/bHLH interacting partners control flower pigmentation [39’], no role has yet been assigned to them during plant defence. Additional
regulatory
elements
and DNA-binding
proteins
Salicylic acid (SA) is an important signal in plant defence [4**] and a SA-response element (SARE) has been identified in the tobacco PRZ-d gene. A 76 bp fragment conferred a 20-fold induction by SA in transgenic tobacco plants and protein binding studies indicated that the core sequence of this SARE is TTCGACCTCC [40]. The nature of the binding factor is unknown. Matton et a/. [18] identified an elicitor-responsive region within the potato PR-IOa ‘gene that is recognised by two nuclear factors, PBF-1 and PBF-2. Both wounding and elicitor treatment induce the phosphorylation of PBF-1 (411. Neither PBF-1 nor PBF-2 has been cloned. The region contains the sequence TGAC-Nb-GTCA, however,
3 14
Plant-microbe
interactions
that is identical to Box W3 from parsley suggesting that the region contains a W Box and, by implication, that PBF-1 and PBF-2 are WRKY proteins.
An excellent review dealing with various aspects of plant defence including pathogen perception, signal transduction and activation of local and systemic responses. Genetic approaches in dissecting signalling pathways are also discussed. 5.
Two H-box binding activities, KAP-1 and KAP-2, have been purified from bean [42]. Elicitation with glutathione did not affect their total cellular activities but instead increased their specific activities in the nuclear fraction. KAP-1 and KAP-2 appear different from the other characterised H-box binding factor G/HBF but their identities remain unknown.
6. .
BUttner M, Singh KB: Arabidopsis theliene ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein. Proc Nat/ Acad Sci USA 1997, 94:5981-5988. Data is presented showing that interaction between EREBP and bZlP transcription factors can occur and that such cross-coupling may be important in regulating gene expression during the plant defence response. z
In some cases, promoter areas have been delineated that contain pathogen-responsive &acting elements that have yet to be clearly defined [19,43-45]. Sometimes these regions contain sequences similar to already characterised elements, but this is not always the case. Similarly, less well characterised proteins have also been implicated in the regulation of defence-related genes [46,47]. The future will certainly see additions to our list of regulatory elements and cognate transcription factors.
Conclusions The past few years have marked a period of significant progress in defining both &acting elements within the regulatory regions of pathogen-responsive genes and the rralls-acting factors that bind them. Continuing efforts should add to this knowledge and also facilitate the isolation of additional signal transduction components upstream in these pathways. From a biotechnology standpoint, these discoveries may prove valuable in gene transfer strategies aimed at improving plant tolerance to pathogens. Looking to the future, the biggest challenge will be the establishment of causal in vivo relationships between the binding of distinct or overlapping groups of factors to specific elements and the regulation of target gene expression.
..
References
and recommended
8. .
Stockinger EJ, Gilmour SJ, Thomashow MF: Arabidopsis thaliana CM1 encodes an AP2 domain-conteining transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA reaulatorv element that stimulates transcriotion in resoonse to-low temperature and water deficit P~ockatl Acad &i USA 1997. 94:1035-l 040. _-- .-._. The isolation an Arabidopsis factor, CBFl, is described which binds specifically to DNA elements present in the promoters of many cold-regulated plant genes. The CBFI protein contains an AP2 DNA-binding domain also present in EREBPs, suggesting that EREBP-like proteins may be involved in regulating diverse genes responsive to different stresses. 9.
Deikman J: Molecular mechanisms of ethylene regulation of gene transcription. Physiol Plant 1997, 100:561-566.
10.
Jofuku KD, den Boer BGW, van Montagu M, Okamuro JK: Control of Arabidopsis flower and seed development by the homeotic gene APELATA2. Plant Cell 1997, 115:437-451.
Il.
Rushton PJ, Tones JT, Parniske M, Wernert P, Hahlbrock K, Somssich IE: Interaction of elicitor-induced DNA binding
proteins with elicitor response elements in the promoters of parsley PRl genes. EMBO J 1996, 15:5690-5700. 12.
Meier I, Hahlbrock K, Somssich IE: Elicitor-inducible and constftutive in vivo DNA footprints indicete novel c&-acting elements in the promoter of a parsley gene encoding pathogenesis-related protein 1. Plant Cell 1 QQl, 3:309-315.
13.
Fukuda Y: Interaction of tobacco nuclear proteins with an elicitor-responsive element in the promoter of a basic class I chitinase gene. P/ant MO/ Biol 1997, 34:81-87.
14.
Ravent6s D, Jensen AB, Rask M-B, Casacuberta JM, Mundy J, San Segundo B: A 20 by &-acting element is both necessary and sufficient to mediate elicitor response of a maize PRms gene. Plant J 1995, 71147-f 56.
15.
Fukuda Y, Shinshi H: Characterization of a novel &-acting element that is responsive to a fungal elicitor in the promoter of a tobacco class I chitinase gene. P/ant MO/ EJioll994, 24:485-493.
16.
Hahn K, Strittmatter G: Pathogen defence gene prpl-I from potato encodes an auxin-responsive glutethione transferease. Eur J Biochem 1994, 228:61 Q-826.
reading
Papers of particular interest, published within the annual period of review, have been highlighted as:
. .. 1.
of special interest of outstanding interest
Somssich IE, Hahlbrock K: Pathogen defence in plants-a paradigm of biological complexity. Trends P/ant Sci 1998, 3:8690. A short review focusing on the biochemical complexity of the plant defence response set in motion upon pathogen attack. 3.
Kombrink E, Somssich IE: Pathogenesis-relsfed proteins and plant defense. In The ~Uycota Part A, P/ant Relationships, Edited by Carroll G, Tudzynski P. Berlin: Springer-Verlag; 1 997:107-l 28.
4. ..
Yang Y, Shah J, Klessig DF: Signal perception and transduction in plant defense responses. Genes Dev 1997, 11 :I 62 l-l 639.
S-
17
Warner S/U, Scott R, Draper J: Isolation of an asparagus intracellular PR gene (AoPRI) wound-responsive promoter by the inverse polymerase chain reaction and its characterization in transgenic tobacco. Plant J 1993, 3:191-201.
18.
Matton DP, Prescott G, Bertrand C, Camirand A, Brisson N: Identification of cis-acting elements involved in the regulation of the 17 kDa pathogenesis-related gene S7%2 in potato. Plant Mel Biol 1993, 22:279-291.
19.
Schubert R, Fischer R, Hain R, Schreier PH, Bahnweg G, Ernst D, Sandermann HJ: An ozone-responsive region of the grapevine resveratrol synthase promoter differs from the basal pathogen-responsive sequence. Plant MO/ Biol 1997, 34:417426.
Hammond-Kosack KE, Jones JDG: Resistance gene-dependent plant defense responses. P/ant Cell 1996, 8:1773-l 791.
2. .
Zhou J, Tang X, Martin GE: The bto kinase conferring resistance to tomato bacterial speck disease interacts with proteins that bind a &-element of pathogenesis-related genes. EM80 J
1997, 18:3207-3218. The identification of three tomato EREBP-type proteins (Pti4/5/6) which interact with the Pto kinase is described, using the yeast two-hybrid system. F’ti4/5/6 specifically recognized and bound GCC boxes that are present within the promoters of several PR genes. This work establishes, for the first time, a direct link between a plant resistance gene and activation of downstream defence genes.
Acknowledgements We thank all colleagues for providing preprints and unpublished data and Klaus Hahlbrock, Robert Cormack, ‘I’homas Eulgcm, Silke Robatzek and Bernd Weisshaar (all K8ln) for discussions and critical reading of the manuscript.
Ohme-Takagi M, Shinshi H: Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element Plant Cell 1995, 71173-l 82.
Transcriptional
control
responsive
to pathogens
response of potato proteinase Physiol 1992, 99:627-631.
20.
de Pater S, Greco V, Pham K, Memelink J, Kijne J: Characterization of a zinc-dependent transcriptional activator from Arebidopsk. Nucleic Acids Res 1996, 24~4624-4631.
21.
Rushton PJ, Macdonald H, Huttly AK, Lazarus CM, Hooley R: Members of a new family of DNA-binding proteins bind to a conservative &-element in the promoters of a-Amy2 genes. P/ant MO/ Bioll995, 29:691-702.
22.
Mackay JP, Crossley M: Zinc fingers are sticking together. Trends Biochem Sci 1996, 23:1-4.
23.
Logemann E, Pamiske M, Hahlbrock K: Modes of expression and common structural features of the complete phenylalanine ammonia-lyase gene family in parsley. Proc Nat/ Acad Sci USA 1995, 92:5905-5909.
24.
Faktor 0, Kooter JM, Loake GJ, Dixon RA, Lamb CJ: Differential utilization of reaulatorv cis-elements for stress-induced and tissue-specific &tivityof a French bean chalcone synthase promoter. P/ant Sci 1997, 124:175-l 62.
25.
Lois R, Dietrich A, Hahlbrock K, Schulz W: A phenylalanine ammonia-lyase gene from parsley: structure, regulation and identification of elicitor and light responsive &-acting elements. EMBO J 1989, 8:1641-i 646.
26.
of plant genes
da Costa e Silva 0, Klein L, Schmelzer E, Treuini GF, Hahlbrock K: BPF-I, a pathogen-induced DNA-binding protein involved in the plant defense response. P/ant J 1993, 4:125135.
Rushton and Somssich
inhibitor II promoter.
315
P/ant
34.
Ellis JG, Tokuhisa JG, Llewellyn DJ, Bouchez D, Singh K, Dennis ES, Peacock WS: Does the ocs-element occur as a functional component of the promoters of plant genes? P/ant J 1993, 41433-443.
35.
Lam E, Benfey PN, Gilmartin PM, Fang R-X, Chua N-H: Sitespecific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc Nat/ Acad Sci USA 1989, 86:7890-7894.
36. .
Drage-Laser W, Kaiser A, Lindsay WP, Halkier BA, Loake GJ, Doerner P, Dixon RA, Lamb C: Rapid stimulation of a soybean protein-serine kinase that phosphorylates a novel bZlP DNA-binding protein, G/HBF-I, during the induction of early transcription-dependent defenses. EMBO J 1997, 16:728-738. Isolated a soybean bZlP factor,G/HBF-1, that binds to both the G- and Hbox. In addition, a cytosolic kinase was identified whose activity increases rapidly upon elicitation of soybean cells and enhances binding of G/HBF-1 to its DNA target. 37.
Kawagoe Y, Murai N: A novel basic region/helix-loop-helix protein binds to a G-box motif CACGTG of the bean storage protein bate-phaseolin gene. Plant Sci 1996, 116:47-57.
38.
de Pater S, Pham K, Memelink J, Kijne J: RAP-1 is an Arabidopsis MYC-like R protein homologue, that binds to G-box sequence motifs. P/ant MO/ Biol 1997, 34:169-l 74.
39.
Feldbrilgge M, Sprenger M, Hahlbrock K, Weisshaar B: PcMYBl, a novel plant protein containing a DNA-binding domain with one MYB repeat interacts in viva with a light-regulatory promoter unit. P/ant J 1997, 11 :I 079-I 093. The isolation of a parsley MYB-like factor and demonstration that cis-acting elements such as the P- and L- boxes, common to several phenylpropanoid gene promoters, are MYB recognition elements (MREs). 27. .
26. .
Tamagnone L, Merida A, Parr A, Mackay S, CulianezMacia FA, Roberts K, Martin C: The AmMYB308 and AmMYB330 transcription factors from Antirrhinum regulate phenylpropanoid and lignin biosynthesis in transgenic tobacco. P/ant Cell 1996, IO:1 35-l 54. The demonstration that overexpression of two Antirrhinum MYB proteins in tobacco plants specifically repressed phenolic acid metabolism and lignin biosynthesis probably by binding to their normal target genes. 29.
Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Martin C, Bevan M: A flower-specific Myb protein activates transcription of phenylpropa&oid biosynthetic genes. EMBO 1994, 13:128-137.
Martin C, Paz-Ares J: MYB transcription factors in plants. fiends Genet 1997, 13:67-73. i nice review on the role of plant MYB transcription factors in controlling secondary metabolism, cell morphology, cellular proliferation and plant responses to hormones. 40.
Shah J, Klessig DF: Identification of a salicylic acid-responsive element in the promoter of the tobacco pathogenesis-related rn-1,3-glucanase gene, pR-2d. P/ant J 1996, IO:1 089-I 101.
41.
Desorbs C. Subramaniam R. Matton DP. Brisson N: The activation of the pot&o PR-foe gene’ required &e phophorylation of the nuclear factor PBF-1. P/ant Cell 1995, 7:589-598.
42.
Yu LM, Lamb CJ, Dixon RA: Purification and biochemical characterization of proteins which bind to the H-box ciselement implicated in transcriptional activation of plant defense genes. P/ant J 1993, 3:805-816.
43.
Rouster J, Leah R, Mundy J, Cameron-Mills V: Identification of a methyl jasmonate-responsive region in the promoter of a lipoxygenase 1 gene expressed in barley grain. P/ant J 1997, 11:513-523.
44.
Grimmia B. Matern U: Structure of the oarslev caffeovl-CoA Omethyl;ansferas’e gene, harbouring a novel elicitor responsive &-acting element P/ant MO/ Biol 1997, 33:323-341.
45.
Yin S, Mei L, Newman J, Back K, Chappell J: Regulation of sesquiterpene cyclase gene expression. Characterization of an elicitor- and pathogen-inducible promoter. P/ant Physioll997, 115437451.
J
30.
Faktor 0, Loake G, Dixon RA, Lamb CJ: The G-box and H-box in a 39 bp region of a French bean chalcone synthase promoter constitutes a tissue-specific regulatory element P/ant J 1997, 11:1105-1113.
31.
Yang Y, Klessig DF: Isolation and characterization of a tobacco mosaic virus-inducible myb oncogene homolog from tobacco. Proc Nat/ Acad Sci USA 1996, 93:14972-l 4977.
32.
Menkens AE, Schindler U, Cashmore AR: The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZlP proteins. Trends Biochem Sci 1995, 20:506510.
46.
Brandt J, Thordal-Christensen H, Vad K, Gregersen PL, Collinge DB: A pathogen-induced gene of barley encodes a protein showing high similarity to a protein kinase regulator. P/ant J 1992, 2:815-820.
33.
Kim S-R, Choi J-L, Costa MA, An G: Identification of G-box sequence as an essential element for methyl jasmonate
47.
Zhu J-K, Hasegawa PM, Bressan RA: Molecular aspects of osmotic stress in plants. Crit Rev P/ant Sci 1997, 16:253-277.