The Rock — February 2017

The Rock

ALWAYS ON BEARINGNEWS.ORG

Follow us @rbhsbearingnews

Features

SPORTS

New businesses give ease to lonely people seeking cuddles and positive physical touch, B2

Lady Bruins prepare for game against Jefferson City High School in annual matchup, C3

COMMENTARY

Breaking the stigma and coming to terms with antidepressants, medicine improves mental health, C6

The Student Voice of Rock Bridge High School Since 1973 • 4303 S. Providence Rd. Columbia MO, 65203 • Vol. 44 Issue 4 • February 2, 2017

Celebration with criticism Inaugural festivities place bias under spotlight Ji-Ho Lee

T

he inauguration of president Donald Trump was livestreamed in the media center Jan. 20.

Beth Shapiro, RBHS media specialist, showed a fact-checking website next to the video, an act that Shapiro said was agreed upon by other media specialists in Columbia Public Schools (CPS).

Shapiro said she was surprised when, after the speech had ended, RBHS principal Dr. Jennifer Rukstad spoke with her, saying the school board had “heard about” what she had done and “was not happy with it.”

Dr. Rukstad said that someone informed the school board that Shapiro showed a fact-checking website adjacent to the inauguration and made the decision to have the fact-checking website taken down. A choice that, in her opinion, was made as a result of the context of today’s boisterous political climate — a sentiment expressed by citizens and politicians alike.

“The issue of bias in the media and fake news and this phenomenon of constantly questioning the media and their sources has never been bigger — not in any recent history — than this election cycle,” Dr. Rukstad said. “It is the dividing line for many people. The candidates, the election, the way it went, the way it was influenced or not, all of those things, it’s a completely unique situation.”

CPS superintendent Dr. Peter Stiepleman explained that the district had planned for the inauguration for months, and Dr. Rukstad was following instructions.

See NEWS, A2

abby o’connor / flashback

Inauguration celebration: Seniors Jordan Smith and Wilson Fitzgerald discuss the inauguration with Susan Lidholm, the sponsor of Young Republicans. Several members of the club gathered in Lidholm’s room to watch the inaugural festivities Jan. 20.

New law induces felony charge Ji-Ho Lee

I

n an age of improved technology and social media, messages, comments and opinions can be distributed nearly instantly. In turn, many high school students become victims of bullying and harassment that takes place behind screens. A new law in Missouri would impose significant consequences on students involved in conflicts, both in person and online.

Section 565.090.1 of the Missouri Revised Statutes

asserts that if an individual causes “emotional distress to another person,” one can be charged with first-degree harassment and a class E felony.

Third-degree assault and a class E felony can be administered if an individual “knowingly causes physical injury to another person,” according to Section 565.054.1.

Because of the severity of these consequences, assistant principal Dr. Tim Baker does not support the new legislation.

“We are not against the law

itself, but we are against consequences that are associated with the law,” Dr. Baker said.

“These things can literally lead to a felony. A felony for a high school kid is severe. You don’t need a felony on your record because you made one mistake on social media.”

Nearly all of the social media harassment issues that Dr. Baker deals with occur on Facebook and are typically reported by students, he said. After the problem is introduced, assistant principals must follow a new inves-

tigation protocol assigned by the Columbia Public Schools (CPS) district.

“We determine whether [the harassment] gets reported [to law enforcement] or not,” Dr. Baker explained.

“If [the incident] fits into the definition of bullying as the district’s policy states it, we report it to Officer [Keisha] Edwards. Hopefully, it isn’t a law violation, but that’s for her to decide, not us.”

The Student Handbook for the Columbia Public Secondary Schools defines bullying as the “intimidation or harassment of a student or multiple students.” Whether the bullying occurs physically, verbally or online, the impact reverberates beyond just the involved students.

“The problem with social media is that everybody sees it,” Dr. Baker said. “[Cyberbullying] affects teachers as much as everybody because, if something gets out there at night, by the time we get to school the next day, everybody knows about it, and it does affect classrooms, and that does create problems for teachers.”

Skyler Froese

Hacking hinders Greitens pushes for school choice options courtwarming ÉlÉa-marie gilles

Ji-Ho Lee

S

chool choice advocates in Missouri have begun helping Gov. Eric Greitens and his new administration support legislation that uses state money accounts to help children with disabilities. The bill would give these families a broader choice in their education, an effort that his predecessor, Gov. Jay Nixon, had blocked.

The accounts, which transfer state dollars to parents through a bank account, is for educational costs, including private school tuition, online class tuition

or fees, textbooks, tutoring, therapy and standardized tests, including the ACT and SAT. Senator Ed Emery of Lamar, who filed the new legislation late last year, stated in his press release that, “It is meant to help support students with disabilities such as autism, developmental delays, learning disabilities and hearing or speech impairments.”

Though the bill only focuses on a small number of students, the Greitens’ administration says supporting students with disabilities is just the beginning of a push for control over one’s school choice

Grace Vance

in Missouri. Greitens’ spokesman Parker Briden says if all goes well with the law, more school choice legislation is to come in the future.

“If the [savings account] program is successful, as it has been in other states, we should learn from that success,” Briden said. “We’re really excited to see where it goes from here.”

Greiten’s reasoning for pushing the bill at this time surrounds the success that similar legislation has found in other states. Though the success could change in Missouri, Briden says it is unlikely.

S

tudent Council determined on Monday that the original list of courtwarming candidates had to be amended because of suspected fraudulent voting.

Although Student Council announced the names of 11 boys as courtwarming king candidates Friday, Jan. 27, Kelley Wittenborn, Student Council’s teacher sponsor, said during the weekend new information came to light that threw a shadow on the original list.

Wittenborn said she and Media Center Specialist Dennis Murphy, as well as Student Council officers, discovered there were roughly 50 to 60 fraudulent votes cast.

See FRAUD, A2

See GREITENS, A2

LOOK FOR THE HOVERING VIDEO: For multi-media content, use the Aurasma app to enhance your reading experience. Download “Aurasma” from the App Store or the Google Play Store.

Use the QR code to direct you to The Rock’s channel. It will automatically subscribe.

1

Hover your device over images with the video icon.

Video will appear in seconds.

2

BEARINGNEWS

For fast, fresh, daily coverage of Rock Bridge High School news, sports, features and other content, visit http://www.bearingnews.org.

INDEX News • • • • • • A1 Editorials • • • • • • A5 Personality Profile • • • • • • A7 Features • • • • • • B1 In-Depths • • • • • • B3 Sports• • • • • • C1 A&E • • • • • • C5 Commentary • • • • • • C6

A2 | news

The Rock | www.bearingnews.org | february 2, 2017

A GAME FOR THE THRONE: Members of

the courtwarming court — from left to right, seniors Boon Palipatana, Elliot Bones, Jack Allen, Justin Hajicek, Carlo Montano, Ji-Ho Lee, Ben Lopez, Chase Ford, Nick Wright, Vishal Patel — talk among themselves after posing for various portraits and group photos before school Tuesday.

ÉlÉa-marie gilles / the rock

Voter fraud compromises court FRAUD, A1

“What we did [Monday] morning, I had Mr. Murphy remove all of the votes that came from the invalid IP address and then we recalculated,” Wittenborn said, which “produced a fairly different top 10. When I had all of that information, I went to Mr. [Activities Director David] Egan, and we, together, made the decision that for the honor and transparency of the system, we had to go forward with the new list.”

Even before the end of the school day Friday, students questioned the validity of the list, Wittenborn said.

“There was kind of a pretty aggressive kickback from the student body and a lot of pretty substantial rumors circulating about there [being] ... boys who manipulated, hacked and overrode [the system,]” she said. “More or less, they manipulated the data.”

Wittenborn explained that rumors typically circulate during elections, but this situation was substantial enough to draw more investigation.

Of the original 11 names announced Friday, five remain in the group that will participate in courtwarming activities next week. Five other senior boys are now on the list.

“With the previous list, we had a tie of 11,” she said. “Six were removed and five were added. So the new names are Ji-Ho Lee, Vishal Patel, Chase Ford, Carlo Montano and Jack Allen.”

Allen found out because someone brought him a note to come to a meeting after school Monday, he said.

“I showed up to the room, and then they talked about the whole situation with the messed up system, and I found out I was on the new list,” he said. “I was happy. Just to know I was voted by my peers is a good feeling to have.”

The meeting included the 11 boys from the initial list as well as those five on the new list that Student Council released Monday. Senior Ben Howser, one student who said he participated in the fraud, was on the original list but not at the meeting.

“We wanted to prank everyone and put all 10 of our friends in the top 10 court. I got everyone’s student numbers who [could vote] and then we hacked into the computer, and I made a bot, [a software that runs automated tasks] that voted for all 10 of my friends with those student numbers and fake generated names,” Howser said. “I did that and ran it,

then my friends got nominated for top 30. People were suspicious because we let it slip — pretty much everyone knows that I did that instead of voting legitimately.”

Principal Dr. Jennifer Rukstad, who was out of school Monday, said she wasn’t aware of the problem until she saw Student Council’s statement on Monday night. While she said there is no policy on discipline for this situation, administrators use restorative practices as a guideline.

“Our practice is to support student activities in a way that things remain fair as intended. Once I have an opportunity to understand what happened and who did it, we’ll make some decisions,” Dr. Rukstad said.

“We don’t have a policy. We start with a positive predisposition, and we deal with things as they come.”

Dr. Rukstad said some “conversations would have to happen” with those involved and those who were harmed. Considering the methods used to change the results, Howser said he could have made the prank less conspicuous.

“There was a lot more votes than there should have been for us, so they knew something was up. You could tell if you looked at all of them, like

“I think if that was [Howser’s] 20, 30, 40 more than anyone else,” Howser said. “There was a sheet senior prank, then he can be proud there that you’d have to sign off [on]. of it, but I would still maybe encourThat’s where we kind of messed age him to apologize. I’m not mad. It things up because the sheet didn’t was just a hassle to have to deal with check out with however many votes all the drama,” Wittenborn said. “The there was for all of us, we just had to officers and Dalton [Nunamaker] had highlight them. That was a pretty big to work pretty tirelessly all weekend to try to figure it out.” mistake that we did.”

NunaHowser maker, the said he did Student it as part This was a senior prank. That’s Council of a sewhat it was. It kind of worked committee nior prank, because ... not all, but most of chair for which he the courtstates is Student Council was upset.” warming “worth it” — Ben Howser, senior king candespite didates, knowing there could be further disciplinary ensures king-related activities are action besides being removed from successfully run. Amidst the altered results, he worked with Murphy, Witcourt.

“This was a senior prank. That’s tenborn and other Student Council what it was. It kind of worked,” he members to make decisions for the said, “because … not all, but most present and future.

“We’re considering using our stuof Student Council was upset [along with some of the administration], and dent IDs that have barcodes on them if we can get the technology,” NunaI think it’s pretty funny.”

Though Wittenborn said senior maker said. “For now, we are doing pranks are an integral part of senior paper ballots for king voting next culture, she urges the individuals week.”

Additional reporting by Elad involved to understand that their acGov-Ari and Skyler Froese. tions impact more than themselves.

Fake news draws attention

Students, staff address false information NEWS, A1

photo courtesy of ellen ferrell

inauguration celebration: Gov. Eric Greitens

delivers a speech during his inaugural ball at the Capitol Rotunda celebrating his victory Jan. 9.

Greitens pushes for school choice GREITENS, A1

“Alabama, Georgia, Mississippi, Idaho, Arizona, North and South Carolina have all enacted similar legislation that has proven quite succesful for them,” Briden said. “In each state, the data shows the same conclusion that allowing these families to choose school’s helps the kids.”

Not all are receptive, as Ally Smith, a special needs educator at RBHS, said more must be done to help special needs students in public schools to not take away from public education.

“I cannot speak for parents, but as specialists we feel it’s important to continue helping public education,” Smith said.

“Our programs are already underfunded as it is, so a bill like this could help, but it will also take away a lot from other students and their families.”

District personnel feel similar to Grupe, as the potential for lost funding takes away from bettering the public school system. CPS Director of Special Education Tori Ballew says the district will do all it can to continue serving students.

“Whatever may happen with the bill, I believe I speak for all CPS employees when I say that we will do all we can to support special needs students,” Ballew said. “No matter what their families choose to do with their education, we will support them and their families.”

Going forward, Smith wants to better the level of care RBHS specialists give for special needs students no matter what may be on the horizon.

“This is a sensitive issue, but it’s important that we talk about it,” Smith said. “We want what is best for these kids.”

The campaigns of Hillary Clinton and Donald Trump divided the country, creating rivalry and contention among citizens.

With the recent election of Trump, those sentiments have increased, sparking bias and disagreement around the country, even in the halls of RBHS. As a result, students and teachers become consumers of rhetoric from politicians and news organizations. As a result, Dr. Stiepleman explained, a “Cabinet’s directive” ordered schools to display CSPAN’s coverage because it was the only program that did not offer additional commentary. In response, faculty members, including Shapiro, have tried to assist students in identifying today’s biased news.

“It was not my intention to make any kind of political statement, this was simply an exercise in information literacy,” Shapiro said. “My job as a media specialist is to help people find reliable sources. I would have done the same thing if another candidate had won. It’s to get people to think critically about information.”

Dr. Rukstad believes the media specialists did not intentionally express bias but the polarizing nature of the election made additional gestures like the fact checking website a display of commentary on behalf of the school.

While she appreciates the assistance offered by the specialists, she said the volatility of today’s culture makes it difficult for anything to be unbiased.

The decision to show a fact-checking website was a part of a year-long effort to help students find reliable sources and research objectively. Faculty members, such as civics teacher Kelley Wittenborn, are strongly supportive of Shapiro’s efforts.

“That’s been Shapiro’s’ platform all year,” Wittenborn said. “She’s been helping students find websites that were trustworthy and how to figure out if a news story was real or fake.”

As a result of the bias in media, AP

World History teacher Shawnna Matteson said critical thinking and thorough research are necessary. Matteson said people need to fight the natural tendency to read and support uncontextualized, impassioned rhetoric that agrees with preexisting opinions.

“As an educator I think it’s important to be informed,” Matteson said. “There’s so much misinformation out there that if you can’t think critically, you’re just going to follow the whims of whoever is talking the loudest.”

Concepts of fairness and objectivity are not foreign ones but individuals, as they get more exposed to the world, often lose sense of these ideals, Matteson said.

Junior Max Simmons believes unbiased news and neutral classroom settings are vital to learning, especially for students.

The New York Times has a learning index available to teachers with unbiased lesson plans; it’s resources like these Simmons wishes teachers would use more.

“Unbiased news is a very large problem,” Simmons said. “Many people get most of their news from social media . . . and with many people who don’t know the difference between fair and biased media, an opinion is formed in their head without them realizing it because they don’t get the full story.”

Shapiro recognizes the necessity of pursuing unbiased, factual news, encouraging and supporting students to seek the truth.

In her how-to-find-objective-news presentations to social studies classes, Shapiro shared with students a statistic from Stanford that found 80-90 percent of students can’t differentiate from fake or real news.

“It’s enormously important [to think critically in the internet age] because we have just an infinite amount of information,” Shapiro said. “You do have to be a critical thinker in order to find sources you can rely on. You have to look at whether something is current or relevant. You have to look at various sources so that you’re not just getting information from one source.”

joy park

kRIS CHO

news | a3

The Rock | www.bearingnews.org | february 2, 2017

Curriculum varies based upon school Ji-Ho Lee

W

hile the first day of school for the 2017-2018 academic year appears distant, next year’s students have already turned in course request sheets. Students have opportunities to request elective classes, though some courses are required.

These guidelines, set by the Missouri Department of Elementary and Secondary Education (DESE), refer to the number of credits in certain departments that are needed to graduate.

The manner in which students achieve those credits differ from student to student, as certain courses are offered in some schools but not others. Director of Counseling Betsy Jones explains that the Columbia Public Schools (CPS) district makes the decision to make a class available, but offering the class to students is up to individual schools.

RBHS, for example, offers classes that are not available at Hickman (HHS) or Battle High School (BHS).

“RBHS is the only school that offers astronomy, and that’s originally because we taught it in a planetarium,” Jones said. “RBHS is the only [school] that teaches Geoscience, while BHS and HHS offer Microbiology.”

Course offerings change from school to school as they are based on the certifications and interests of teachers, Jones said. For example, science teachers can be certified in three different areas, meaning one teacher who teaches biology may not be able teach a physical science, Jones explained.

While the science departments of schools have discrepancies, the majority of Columbia Public School (CPS) students will take physics, biology and chemistry. RBHS does, however, offer a plethora of science classes like Geoscience, Oceanography and Zoology. Especially

for juniors. Chemistry is the most common class because of its applicability, Jones explained.

“We try to prepare [students] to be successful in all college majors, so we try to think of a general college preparatory curriculum and having chemistry is a good idea,” Jones said.

“We try to make sure that college is not your first exposure to the curriculum so that you would have had some background knowledge.”

Similar to science, the English and social studies departments at RBHS have certain differences compared to other CPS high schools.

One universal aspect among the schools, however, is the social studies class that is offered to each grade.

“The Missouri State Board of Education requires that all high school students throughout the state [take] at least one course in civics, world history, and U.S. history, but it allows individual school districts to determine the order in which to sequence those courses,” said Nick

kristine cho / the rock

Making choices: Incoming freshman and sophomores visit various tables in order to make decisions on what classes to take during the upcoming school year. Teachers displayed their students’ achievements, attempting to convince students to register for their classes.

Kremer, CPS’s high school coordinator of language arts and social studies. “When the social studies department engaged in program evaluation three years ago, we did seriously consider moving Civics to 11th or 12th grade and moving Modern U.S. history to ninth grade, but a majority of committee members ultimately voted to maintain the existing sequence.”

Perhaps the largest difference between RBHS and other CPS high schools is that the former offers only integrated, team-taught block courses for English and Social Studies classes, while HHS and BHS offer both combined and individual classes.

“We think it is better for students to learn essential literacy skills through social studies and English as opposed to learning them separately,” social studies department chair Austin Reed said. “Our kids seem to be college ready. They seem to read and write at high levels and our kids perform very well on standardized tests.

So our kids seem to benefit from the [integrated system].”

The integrated system first began in the 1990s when certain faculty members believed that a team-teaching approach improved the academic experience and learning as a whole.

Sophomore Maddie Murphy, however, would prefer to learn about the two topics in two different classes.

“I would rather spend my writing time writing about something other than what I’m learning about in my [history] class, because it’s not very interesting to me,” Murphy said. “I would care about learning more and about the class more if [the subjects] were individualized.”

Reed understands the perspective of students such as Murphy. Because of the academic success and intellectual investment that is provided for students, however, Reed believes the integrated system is more successful.

“Historically, looking at [Advanced Placement] tests, ACT scores and PSAT scores, our students experience real success,” Reed said.

“We’ve integrated classes for years, and there’s no reason to change that if kids are learning and scoring well on the tests.”

Regardless of the different class structures that are offered around CPS, Kremer believes the goal of the social studies department is to prepare students for a brighter future.

“I think our department’s ultimate goal is to help students become more knowledgeable of the world around them,” Kremer said. “[We want to] equip them with the skills they need to be able to effectively engage in that world to produce positive change for our society.”

Anti-bullying law brings harsh charges to CPS LAW, A1

The Cyberbullying Research Center reports that more than half of all teens experience cyberbullying and 10 to 20 percent experience it regularly. Sophomore Evan Eimers has endured firsthand experiences of bullying. A victim of rumors and invasions of privacy as a result of social media, Eimers understands the issues that arise from online harassment. As a result of her personal past, she believes the new law will be beneficial.

“I’m all for the law to stop people from publicly harassing others,” Eimers said. “Anything to ensure that girls or guys have the safety and security they need to be in their own school.”

For students such as senior Boon Palipatana, however, social media has been nothing but positive and helpful.

“Having family in Thailand, it’s not every day where I can stroll across the street and talk to them, so thanks to new innovations like Facebook, I can interact with them,” Palipatana said. “I think for the most part, social media is a good thing and you have to know how to ignore the negative things that pop up and focus on the positive stuff.”

Regardless of what incidents have occurred or might occur in the future, the goal for Dr. Baker remains the same.

“Our number one priority is to keep kids safe,” Dr. Baker said. “If we have an issue, we will make sure the kids are safe at school. After that, we are always going to call parents and let them know; that’s a big priority.

We have to keep parents aware at all times just in case something happens at home.”

jOY PARK

A4 | advertisements

The Rock | www.bearingnews.org | February 2, 2017

editorials | a5

The Rock | www.bearingnews.org | February 2, 2017

Captured on camera, good and bad shots

moy zhong

Cruel and unusual State law invites harsh retribution, enduring effects

D

ay after day, students encounter both friends and tormentors. Forced interaction among two or more adolescents often sparks tension, and students release their aggression in many forms ranging from verbal to physical confrontation.

In the past, these fights would result in a stern sit down with administrators and parents, and at worst a parent would press charges.

As of Jan. 1, 2017, any person, including high school attendees, that have been in a fight or participated in verbal or physical assault can be arrested and charged with a class E felony, according to Section 565.090.1 of the Missouri Revised Statutes.

According to this law, students who cause their peers emotional or physical harm may be subject to arrest and felony charges. In addition to the open ended wording, this law creates a multitude of concerning issues and problems.

Little justification can be found in convicting a 14-year-old of a felony for doing what kids do. From an early age, students solve their problems through physical expressions, and to expect a 14-year-old to be rid of all childlike tendencies is preposterous.

Adding a felonious title to a young stu-

dent’s record is destructive. These records administrators to make an arrest.

In Section 558 of the Missouri Revised create enormous roadblocks for felons applying to jobs, internships, colleges or other po- Statutes, public school systems must take acsitions. By pinpointing a singular event in a tion against cyberbullying covering verbal young person’s life, the student is put in the assault to stalking. With multiple scenarios, charges and punishmetaphorical ‘sysments addressed by tem’ creating lifelong ramifications.

Should the new law be applied the statute, the bill covers all aspects By weighing a teen’s to high school students? of the issue, makactions so heaving this new clause ily, an action so comredundant. monplace in school, The Rock staff voted Finally, the lack lawmakers have esof specificity in sentially closed the wording is worridoors of opportunity some as it leaves for many students. verdicts up to interAccording to pretation. The new crchealth.com, more legislation states than 200,000 students are assaulted per day. With such monumental that one can be charged with first-degree hafigures, placement in the correctional systems rassment if “he or she, without good cause, is taking an easy way out. By removing stu- engages in any act with the purpose to cause dents from the schools and into jail, lawmak- emotional distress to another person, and such ers temporarily remove rather than fix the act does cause such person to suffer emotional problem of violence in schools. Also, neglect- distress.” The revision does not outline the vaing to spend the necessary time and effort on a lidity of said causes, what sort of harassment child who acts up, they are essentially remov- nor the degree of emotional distress.

From redundancy to vagueness to ruining ing the possibility for correction and growth.

On top of the physical aspect of harassment, futures, this new bill does little to benefit the social media has shone a new light in the past safety of students. Despite discouraging malidecade. Cyberbullying takes the front page of cious attacks, which are already discouraged, middle and high school agendas, and the issue the law is an inappropriate addition to Misis again tackled in Missouri. With a plethora of souri school systems. With so many flaws in laws taking actions against electronic harass- this law, the only logical course of action is to ment, this new law creates an easy way out for petition and remove this destructive law.

Yes - 0 NO - 25

New technology veils academic issue Skyler Froese

I

feel like every week I hear something new about the iPads.

Claims go from every student getting an iPad, to every student getting a laptop, to only certain students getting laptops and every theory in between. The guesses don’t even include when this will happen. From what I’ve heard the school will get them some time between fourth hour and 2021. iPads are now omnipresent, and many think they are the key to academic growth. Despite the notoriety of the iPads, they are more or less useless. The constant stream of new technology is an abuse of resources to address rampant problems in the district. iPads don’t contribute to learning the way they were intended to, and the technology helps the school skirt around the more pressing issue of prioritizing the expansion and quality of school staff.

The initial purchase of iPads for Columbia Public Schools (CPS) cost a whopping $460,000. This enormous bill was made to make a more modern style of learning.

Since then the use of the prod-

Joy Park

The Rock Rock Bridge High School 4303 S. Providence Rd., Columbia, Mo. 65203 Vol. 44, Issue 4 February 2, 2017 Population: 1,962 Students, 148 Faculty Circulation: 1,500 Contact Information: Phone: 573-214-3141 Website: bearingnews.org Advertising: $50 – 1/4 Page $100 – 1/2 Page $150 – Full Page

uct has only grown, and in some places like Battle High School, there is a one to one iPad to student ratio. While the technology tries to make information accessible, it is often already blocked by the school or slowed down by school wifi. This has made the iPads a hindrance in many cases.

They are often so slow working and confusing that using them just stops class.

The iPads are rarely even used.

Most AP teachers still opt for physical materials in class.

The days that iPads are used are an exception, not the future making, education revolutionizing standard that they were intended to be.

Teachers are right to ignore the $200 – Backpage The Journalism Newspaper and Honors Seminar classes produce The Rock, Bearing News and Southpaw.

The paper’s purpose is to accurately inform, educate and enlighten readers in an open forum.

The Rock is a member of the National Scholastic Press Association, Columbia Scholastic Press Association and Quill & Scroll.

Adviser: Robin Stover Editors-In-Chief:

iPads. According to Psychology Today, iPads make no measurable improvement on learning or performance. In fact, they can barely compete with traditional materials in terms of comprehension. iPads are incapable of making up for their extreme cost because of their lackluster performance, but they are meant to solve a bigger problem.

CPS is treating iPads like a bandaid, but the problem is no paper cut.

It’s a stopped heart. In this growing city, public schools are struggling to cope with the overflow of students.

Elementary and middle schools are overfilled and more importantly understaffed. A smaller teacher to student Dzung nguyen Ji-Ho Lee, Katherine Sarafianos, Grace Vance Production Manager: Ji-Ho Lee Art Editor: Joy Park Design Editor: Joy Park Business Manager: Katherine Sarafianos Photo Editors: Tyson Jamieson, Cassidy Viox News Editor: Rochita Ghosh Features Editor: Nikol Slatinska Editorials Editor: Ji-Ho Lee

ratio leads to academic success, according to the Center for Public Education. More frequent and individual attention allows students to work more effectively through material and retain that knowledge. Having more staff, and more experienced staff, is what will make a difference in student’s performance.

The critical error CPS has made is confusing “individual” with “alone.” A lower teacher to student ratio would allow for a more individualized style, but the intended use of iPads is to replace the missing teachers and make students learn unaided by another human being. iPads take the money that could make legitimate change in schools and completely misuse the funds.

The district takes praise for trying to improve schools, but they are going in the wrong direction.

Buying iPads is like putting a new rug on a rotted floor; it makes it more outwardly attractive, but someone will still fall through.

The money being put toward iPads and personal computers is a waste, and the district must refocus that money toward staff for academics to improve.

Commentary Editor: Grace Vance In-Depths Editor: Skyler Froese A&E Editor: Elad Gov-Ari Sports Editor: Faaris Khan Staff Writers: Grace Dorsey, Ann Fitzmaurice, Siena Juhlin, Ji-Sung Lee, Emily Oba, Katie Whaley Artists: Dzung Nguyen, Joanna Yu, Moy Zhong Photographers: Kristine Cho, Yousuf El-Jayyousi, Éléa Gilles Videographers: Cameron Fuller, Madison Wright

A6 | editorials

The Rock | www.bearingnews.org | February 2, 2017

Ban opinions, fix the world Katie Whaley

W

hile problems such as poverty, terrorism, global warming and sickness that ravage our world may seem ghastly and de-

structive, they pale in comparison to the largest, most catastrophic issue of them all: opinions Opinions are biased judgments that are commonly unsupported by facts. When individuals acquire an opinion about a topic, that belief quickly takes over their conscience.

Consequently, common sense completely escapes their body as that opinion blinds them from the factual truth. If opinions continue to infiltrate the minds of everyday citizens, societies around the world will collapse into chaos and anarchy, as logic and sanity will no longer exist. Opinions

joanna yu

need to be abolished to prevent such events from happening.

All forms of conflict are birthed from clashing opinions. Ask any One Direction fan about that. Since so many people hold a passionate hatred for the band, supporters must be armed with metal baseball bats, pitchforks and tridents just to survive a trip to the grocery store. Without opinions, not only would fangirls be safe, but no one would have to worry about getting into brawls because eradicating opinions would erase all conflict, as well.

Without opinions, the internet would be paradise, too. Easily offended people, as well as insulting posts and videos, simply wouldn’t exist. There would be no more superfluous rants in YouTube comments, pretentious and petty captions on Instagram photos and certainly no bloodshed between rival fandoms.

Social media would become a peaceful wonderland filled with fields of memes to frolic in if opinions were expunged.

If opinions continue to exist, people will become increasingly more upset, and no one will have enough self-confidence to accomplish anything. Hearing an opinion that opposes one’s own perception is by far the most upsetting thing that can ever happen. When rude individuals persecute innocent, law-abiding citizens for their outfit choice or body odor, the victim of the opinion is going to be emotionally scarred from that incident for the rest of their life.

In fact, that citizen would have lost so much self-confidence, he or she would change their whole wardrobe, maybe even their name, and relocate to another city where they could find

escape from the embarrassment and shame that haunts them. Simply put, opinions ruin lives.

In addition, opinions are detrimental to one’s aspirations. An example would be a little league baseball player may dream of playing professional baseball when he’s older.

He practices hard and has loads of self-confidence in his baseball ability, until his teammates tell him he’s the worst batter on the team and will never make it. The player’s ambitions crumble as his teammates tease him, and he loses the motivation to keep swinging. All opinions are devastating to the goals and hopes of dreamers and need to be eradicated to let dreams become realities.

The biggest trouble with opinions, however, is they offend everybody.

No matter what or how carefully something is said, someone is going to be offended.

For instance, when critics of President Donald Trump insult him on Twitter, fury builds up inside of him, forcing an eruption of heated, enraged self-defense that is expressed through social media. The outburst, however, manages to offend the people who first offended Trump. This cycle, destructive and inescapable, will continue forever.

Conclusively, opinions need to be abolished because they offend everyone and entice the innocent into saying and doing things they wouldn’t have done before. They cause conflict, destroy arrogance and incline people into doing bad things. The world would be a happier and safer place if no one believed in anything and no one argued with other people whose thoughts, at the end of the day, have as much worth as theirs.

Unfair blame given to CPS Cassidy Viox

E joy park

Challenges today lead to success tomorrow Ji-Sung Lee

M

erely 39.2 percent of Physics 1 AP testers scored higher than a three, according to the AP Student Score Distribution from the 2015 College Board. Students often shy away from the difficulty and accelerated curriculum of these classes, craving high GPA’s and good test scores, inevitably stunting their full potential.

As students enter high school, they are often scared of taking challenging classes in fear of a low GPA leading to college rejection. The Princeton Review, however, believes colleges want to see balance more than just good grades.

Because of the stress college applications evoke in high schoolers, many students prioritize an impressive report card over challenging and interesting courses. Instead of taking rigorous classes that sound appealing, students become immersed in hypothetical scenarios of a hard class hurting their GPA. As a result, they fall back on more leisurely classes. Because high value is placed in awards such as valedictorian, which is determined by GPA, people sacrifice their interest in education to obtain something as shallow as a good GPA. Students must realize that an education has lifelong impacts while a GPA matters only for a brief time frame. Colleges are often more interested in unique applicants with balanced resumes than 4.0 GPAs. It is also vital that students pursue intellectual interests in high school to explore and discover potential future interests. Because colleges offer a more rigorous curriculum in which students select more nar-

row areas of interest, if students are unable to challenge themselves and pursue their interests in high school, failure is unfortunately inevitable in a collegiate setting.

One aspect of balance that colleges seek is a combination of challenging coursework and extracurricular activities. While a busy schedule may be intimidating to some high schoolers, they will learn time management skills and build beneficial habits for the future.

Students should realize that taking challenging classes improves their likelihood of future success.

The National Survey of Student Engagement states that students “were more likely to engage in a variety of effective educational practices” when being questioned and challenged in classes. When students do not further their intellectual ability, their growth and potential is stunted.

With the competitive spirit that grades bring, the National Association of Secondary School Principals states that as many as half of all school districts are considering to forgo titles such as valedictorian.

Educators have come out and explained the negative message it sends out to students with unhealthy and sometimes unfair competition.

When choosing classes, keep in mind the eternal and beneficial effects an education brings opposed to a GPA that lasts only so long, usually accomplished by easily passing classes unless you choose to challenge yourself. Students should value gaining information on topics that interest them rather than focusing on specific titles and perfect grades because an education is defined by more than a letter grade.

very student knows the drill: put a spoon under a pillow, flush ice cubes down the toilet and wear pajamas inside out. Meanwhile, the Columbia Public Schools (CPS) superintendent, Dr. Peter Stiepleman, evaluates the weather for the next day. During the night, Dr. Stiepleman and his crew spend hours in contact with weather services as they look at forecasts.

They assess timing, temperature, daylight times, precipitation and road conditions to make the decision that affects the entire district. Students stay awake until five in the morning to confirm a day of relaxation, but the CPS notification never comes.

Then, without hesitation, teenagers open Twitter and brainstorm something comical enough to get attention, hoping Dr. Stiepleman will notice.

The truth is, Dr. Stiepleman does notice, and he does care about student’s opinions, but his job is far too complex to be characterized as ‘the man who decides snow days.’

In order to demonstrate the difficulty of being the superintendant, think of Dr. Stiepleman as a C.E.O. of a company.

CPS is the third largest employer in Columbia, making Dr. Stiepleman the boss of everyone employed. He doesn’t just choose late starts and days off of school. He’s choosing both miniscule and major details for a

district of more than 18,000 students and 3,000 employees. The district has more than 40 buildings and locations, and covers 300 square miles of land, each mile having different demographics and circumstances.

In addition to teenagers barking at him on Twitter, Dr. Stiepleman sets the pace for the district. Simultaneously, he communicates with the Board of Education, faculty and the entire community. The district brings complicated issues to him that involve hundreds, if not thousands of students, all while mitigating dangerous situations and doing his best to keep everybody safe.

Dr. Stiepleman’s list of jobs could go on; there is always something for him to be focused on. Chief administrators are responsible for financial issues, making sure the needs of facilities are met, creating guidelines for curriculum and enforcing them, meeting state and federal standards and pleasing students and parents of the seventh largest school district in Missouri.

Those who do not recognize the importance of Dr. Stiepleman’s job may believe he is paid to scroll through his phone all day and see what students are saying about him.

Although he does have time to interact with students, his day is filled with important duties, beginning at 6 a.m. when he broadcasts updates impacting the school district through the radio.

The rest of his day is then occupied by meetings with organizations, councilmen and women, the Board of Education and many others.

On a typical Monday, Dr. Stiepleman attends 10 meetings and discusses topics much more important than the insults students throw at him.

His day ends at about 11 p.m. after he sends an update to all CPS employees about the board meetings, and he might rest for a few hours if he isn’t busy driving the roads at 2 a.m. for students’ safety.

Being the chief administrator of CPS is not an easy task. Canceling school because of demanding kids who don’t want to finish their math homework is a small responsibility compared to Dr. Stiepleman’s other duties.

If the weather is not hazardous and roads are safe for driving, don’t expect Dr. Stiepleman to cancel school.

If the roads suddenly become dangerous and Dr. Stiepleman doesn’t cancel school in time, don’t expect him to predict the weather. If Dr. Stiepleman does cancel school and the forecasts are wrong, don’t get upset with him for pursuing the safety of his students.

Teenagers proposing that he lose his job because of his supposedly unfair snow day decision is ludicrous. If his decisions during icy weather are the only things students and parents can complain about, he’s doing a phenomenal job as a chief administrator and superintendent.

2 AM ROAD INSPECTION

MEANWHILE... dzung nguyen

The Rock | www.bearingnews.org | february 2, 2017

Personality Profiles | a7

Tyson Jamieson and Cassidy Viox/The rock

Tuning to the sound of talent Musician pushing the limits of brilliance with dedication Ji-Ho Lee

F

or most infants, a special blanket, a particular song or set of toys can mitigate a tearful tantrum. For Martin Shapiro, a piano did the trick.

“He was a very colicky baby, and he cried all the time,” Martin’s mother, Beth Shapiro said. “When we would play the piano, that would be something that would quiet him down. He’s kind of just been a musical kid.”

Martin Shapiro’s innate ability to learn and play music at an impressive level is obvious. He eloquently plays the piano, french horn, trumpet — for which he was named to the all-state band, a nearly impossible feat — as well as trombone, saxophone and vibraphone.

“Martin is like a lot of students in our band program who are very talented, so to single out Martin above so many talented kids is difficult,” Steve Mathews, RBHS Band Director said. “I would say that what sets Martin apart is his ability to apply his musicianship to almost any instrument he picks up. So in that regard, there aren’t too many students I have

ran into that have that level of versatility.”

Despite his talent and ability, Martin can often become frustrated with his music, especially the french horn, when making repetitive mistakes.

Beth Shapiro believes the personality and characteristics of her son may spark his frustration.

“He can be a perfectionist with what he wants himself to be able to do,” Beth Shapiro said. “Sometimes he will not be able to play something that he hears in his mind, and he definitely gets frustrated.”

That dissatisfaction, although irritating, motivates Martin to continue to improve. Combined with the expectations that he has received from band directors and family, occasional impediments inspire him to continue.

“The frustration can help me because I don’t give up and say, ‘Whatever, it will be fine.’ I make sure that if there is an issue, no matter how much it bothers me, it will go away,” Martin said. “So that frustration can inspire me to keep playing and practicing sometimes.”

Along with music, Martin has had a continuous interest in other hob-

bies that are far different from music. of time jamming at home together.”

His interest and talent make MarAs he has gotten older, however, his passion for music has been strongest. tin a unique musician. He has taken “Music, architecture and railroads traditional lessons for french horn have all always been interests of and piano, teaching himself most of mine, and they still are,” Martin said. the instruments that he plays.

“I have grown up in a really musi“When I was really little, when I was three or four, I started kind of mess- cal family, and so I’ve had a lot of ing around on the piano, just kind exposure to different genres and music,” Marof fooling tin said. around and “Playing that’s when new instrumy interest The frustration can help me ments is [in music] because I don’t give up and just fun. I started ... say, ‘Whatever, it will be fine.’ like learnI think I I make sure that if there is an ing new ingot more issue, no matter how much it struments, into music bothers me, it will go away.” and it’s an when I was interest in eighth — Martin Shapiro, senior g r a d e . that kind of just popped up.”

When I got into jazz music.”

Martin’s mother believes the few Martin’s older brother, Daniel, an all-state trumpet player in his own lessons that Martin has taken play an right, may also have encouraged influential role in impacting his development as a young musician.

Martin’s interest in music. “[Martin’s] jazz theory lessons “Music is something that the two brothers have shared growing up, started out with piano, but he is able and when they are home, they both to express some of the theory and make a lot of music together; so that his knowledge of jazz through other is something that they have grown up instruments, as well,” Beth Shapiro with together and just enjoyed,” Beth said. “It’s a combination of a talent Shapiro said. “They just spend a lot and musicality that is in him to teach

himself, but that is fostered through formal lessons, and I do think those formal lessons have had an effect even when he is self taught.”

Ultimately, Martin hopes to become a professional musician. Because of the ever-changing nature of the professional music scene, however, he is unsure about who he wishes to play for. He has a better idea of what and where he wants to play.

“As for my professional aspirations, I’d like to play the piano and jazz primarily. Those are sort of my two main focuses,” Martin said. “As for where I want to play, probably some huge metropolitan area with a good performing and recording scene, like New York or something.”

Mathews notices Martin’s continuous attempts to practice and improve in his pursuit of becoming a professional.

His high volume of playing and practicing, and attendance in nationally recognized summer jazz camps has improved his musical ability, as well as his perfectionist personality.

“He is highly critical of himself,” Mathews said. “Because of that, he pushes himself to that next higher level as a musician.”

A8 | advertisements

The Rock | www.bearingnews.org | february 2, 2017

FEATURES

a closer look Lonely individuals seek consolation and friendship provided by professional cuddling businesses, B2

It’s more than

Puppy love Emotional support knows no age limit Katie Whaley

S

ophomore Brenna Cornelison’s computer screen brightens as a familiar face pops up. She beams, happy to see her boyfriend after a long day at school, even if it was just a Skype call.

The two instantly begin chatting about their days as they start pulling out textbooks and notes from that day. Music plays in the background as the couple works, and they often take small breaks to talk and laugh in between cramming Advanced Placement (AP) notes.

Cornelison and her boyfriend, sophomore Austin Ashbaugh, are both in challenging and time-consuming classes, such as engineering and advanced placement world studies. Many couples would be stressed in finding out how to allocate time for one another with so much work to do, but they have figured out a good balance between spending time together and doing work.

“Sometimes [extracurriculars] make it difficult to see one another except at

school,” Ashbaugh said. “During finals week, when we both had an extraordinary amount of homework every night, we would have study dates and make the most out of just spending time with one another at lunch.”

Despite the lack of time, Cornelison believes there are more positives than negatives when it comes to dating while in high school. The contrary aspects include having another person to worry about and help through stressful times, she explained, but having someone as a source of support simply outweighs all the bad features completely.

“I’m super bad at getting work done and not getting distracted. Austin [Ashbaugh] has helped with that and gotten me through so many midstudy freak outs,” Cornelison said.

“Having someone who you know you can talk to about anything, any time you need to and [having a] person to go to when you just need a really long hug is nice.”

RBHS counselor Dr. Jordan Alexander views being in a relationship as a balance between being part of a couple while simultaneously being an individual. While each couple should have open, honest communication and share mutual respect, he believes those dating should also allow their partner to follow other interests and friendships. Along that line, he recognizes teens are still developing their identities, hence, he suggests they wait and evaluate the circumstances before officially establishing a relationship.

“High school relationships present unique challenges. For one, students sometimes

feel that they are in a fishbowl and everyone is watching them. Friends, who may be trying to help, can add to the “drama” involved in relationships and complicate and amplify conflicts in relationships. Also, students are growing and changing in many life areas and it’s a challenge to stay in healthy relationships when both sides are growing, often times apart, to different interests or values,” Dr. Alexander said. “If your partner is in the same school, relationships can be distracting and move the focus away from academics, which should be students’ first priority during school. As adults, we are still growing, but we become more clear about who we are as individuals and more clear about what we seek and desire in relationships with others [when we’re older].”

While Ashbaugh said his relationship is fulfilling, he realizes there are practical constraints of being a young couple such as money, a driver’s license and time.

“In high school, it is difficult to do many of the things deemed normal in a relationship. Instead of a fancy dinner, you may have to eat off of styrofoam trays cross-legged in the tunnel,” Ashbaugh said. “Later in life, a relationship becomes more involved with living together and being with one another very regularly. In high school you have to find a way to do the same thing except rely on weekend dates and just enjoying those little bits of each other’s company to keep a relationship going.”

Even though teenagers do not have the opportunity to date and go on dates as adult couples as Ashbaugh ex-

plained, they consider their relationships just as serious and legitimate as older people. Adults, however, see teens dating as frivolous. According to a 2007 study by Teenage Research Unlimited, adults typically dismiss adolescent relationships as superficial, while adolescents do not agree: half of all teens report having been in a dating relationship and nearly one-third of all teens said they have been in a serious relationship.

One reason why adults may be opposed to teenage relationships is because of how disconnected couples seem because of technology. Unlike the high school relationships older generations had, social media heavily influences today’s teenage couples. Twitter, Facebook and Instagram open up a whole new world for couples, which comes with more negatives than positives, Ashbaugh believes. He said social media can cause people in relationships to avoid direct confrontation with each other over issues and instead post about them online, bottling up bad emotions that could have been fixed through upfront conversation and honesty.

“People believe that they are invisible on social media, so instead of voicing any problems in a relationship to their boyfriend or girlfriend and having a conversation about whatever needs and expectations were being ignored, they go online and write a post on it,” Ashbaugh said. “I honestly believe that online social media can wreak havoc on relationships. . . I know I sound like a grandpa, but it seems so many relationships lose trust overtime due to the lack of face to face conversation.”

s e g a Healthy relationships at different 14-18 Separate your relationship from your school responsibilities.

joa nn a

yu

18-25 Romantic development culminates in a single, committed relationship of extended duration.

25-40 You don’t have to be in contact 24/7.

Give each other space and privacy.

40-60 Passionate love during the young adulthood years is replaced by compassionate love during the later years.

60+ Focus on maintaining positive social interactions with friends and family.

h pat ing arn e l , y l e dai n, elit rmatio o f n I y g source: National Center for Biotechnolo

B2 | Features

The Rock | www.bearingnews.org | February 2, 2017

Lonely seek comfort through positive touch Cassidy Viox

W

ith regard to loneliness, The Beatles sing, “Where do they come from? All the lonely people. Where do they all belong?” The Beatles brought up an interesting question that, if answered, could explain recent phenomenons.

New services providing emotional companionship, such as Rent a Friend or Cuddle Up to Me, expose the chronic loneliness of people.

According to an article from Fortune, the number of people that feel lonely increased from 11 to 43 percent from the 1970s to 2012. Rice University psychology professor Dr. Brian Denny said the present social environment does not satisfy the needs of social connectedness.

While the purpose of networking is to fulfill everybody’s intrinsic drive for relationships, it makes people more isolated.

“In some sense, you may indeed be connected. In another sense, you’re isolated because these people aren’t actually there,” Dr. Denny said. “They could also be more assemerable. They could be here today, gone tomorrow. They could change their social media profile or delete their account entirely or their habits change.

They’re not proximate to you anymore.”

Through the increased emotions of loneliness, businesses have emerged to relieve solitude. According to an article from Psychology Today, physical touch is

a human need that decreases violence and increases trust. Samantha Hess, the owner of Cuddle Up to Me, a professional cuddling business, said cuddling can release hormones and reduce anxiety.

“Positive touch is the miracle drug of our age with the only side effect being a desire to care for ourselves and those around us more,” Hess said.

Hess started Cuddle Up to Me with hopes of reaching out to those who feel unloved. She cares for men and women of all ages, backgrounds and circumstances.

Hess said there are many misconceptions about her cuddling business, such as covering up prostitution. Although this is true for some businesses, cuddlers such as Hess are professionally trained with more than 40 hours of prerequisite cuddling.

“Professional cuddling works to overcome fears, traumas and taboos by creating a safe space for each human to feel respected, accepted and important just as they are,” Hess said. “A true professional will do all of this while openly discussing how to avoid codependency without manipulation, discrimination or fear.”

As businesses such as Hess’ become more popular, they are looking for certified cuddlers. Oliver Smith, a 2016 alumnus, considered working toward his cuddling certification while he was a RBHS student. Smith described himself as small, round and soft, both physically and metaphorically. Listening to others talk about their lives and hardships caught his atten-

tion, but he soon gave up on getting his think it depends, of course, as so many license when he found out certifiers only things do, on exactly what you need to rent a friend for. What sort of emotional accept female cuddlers.

“While I was born female, I identify help do you need? If it’s really something as male. More importantly, the website deeper, I would think that you would eisays 99 percent of the clients are older ther want to talk to a professional where men. While I don’t want to automati- you know that the person would have a cally categorize everyone negatively, professional motivation.”

Hess is fully aware of these doubts I’m uncomfortable and anxious around men. It also says most clients are over 50, and speculations and says professional which as much as I’d like to make some cuddling is something that must be given old person’s day with a hug, I’m not sure firsthand to be understood. She encourages people to I’m comfortable do research, spending the watch interminimum 30 minviews and utes cuddling with Positive touch is the miracle have an open them, especially drug of our age with the only mind. If the if I don’t know side effect being a desire to cuddling serthem.” care for ourselves and those vice doesn’t Despite the work, then a benefits to cudaround us more. person is out dling, Dr. Denny — Samantha Hess, some money is skeptical about Owner of Cuddle Up to Me and moves on. the long term adBut if it does vantages. Because these businesses are so new, unbiased data satisfy one’s needs, then it can provide are rare and there is little evidence that numerous benefits.

“If you want to feel loved and appreshows its effectiveness. While the services may satisfy a desire to have somebody ciated in a platonic way, if you want to right at the client’s fingertips, it may not overcome traumas or insecurities, if you ultimately get somebody where they need want to feel better, give it a try,” Hess said. “We know how much bravery it to be emotionally.

“My prediction is people may feel ul- takes to say we need or want something timately that it rings a bit hollow in some from someone else, but we are here to tell circumstances,” Dr. Denny said. “I think you that we need and want the world to it’s a very interesting question to see. I change, one hug at a time.”

tyson jamieson / the rock

Easing moods with self-deprecation Katie Whaley

E

Dzung nguyen

veryone has imperfections, yet the late comedian Rodney Dangerfield braved the task of highlighting his own flaws to the scrutiny of the public eye as a career. Back in the ‘80s, Dangerfield was one of the most popular comedians, from dazzling hundreds of cheering fans at his own venue to starring in hit comedy movies such as Caddyshack and Back To School. Dangerfield became a household name and his jingle “No respect!” a catchphrase of America. How he captivated the nation? By making himself look bad.

Named “the king of selfdeprecation” by New York Times journalist Stephen Holden, Dangerfield’s endless jokes about his failing sexual abilities, condemns of marriage and reflections on ugliness, obesity and stupidity were fan favorites.

Senior Ellen Dill-Hirsch sees self-deprecation as a form of comedy, like Dangerfield’s gag. Self-deprecation is more for professional comedy than for everyday life, but she can see some upsides to self-ridicule.

“It’s necessary for [people] to make fun of themselves, especially in the entertain-

ment business where comedians will be facing harsh comments anyways,” Dill-Hirsch said. “People in the spotlight will be critiqued for almost everything, whether it be physical appearance or their belief… so it’s important [for them] to take things lightly.”

Merriam Webster defines self-deprecation as belittling or being excessively modest.

In that sense, self-deprecating humor consists of criticizing oneself in a lighthearted way as entertainment. It’s strange, based off the definition, but viewing this humor can come from devaluing oneself.

In a 2008 study, anthropologist Gil Greengross and psychologist Geoffrey F. Miller found that self-deprecating humor can have a positive or negative impact on a person.

High-status individuals benefit from the humor because listeners perceive them as modest and confident. Lowstatus people, however, may be counterproductive because it suggests they are defeatists.

Dr. Golan Shahar, a professor of clinical-health psychology at Ben-Gurion University of the Negev, Israel, has his own opinion on self-criticism and why it’s used. He believes self-deprecating jokes activate teens’ interests. Adoles-

cence is a period where the mind seeks to understand issues and these jokes can be a way through each teens’ struggle with self-criticism.

“Teens are fascinated by their identity and self. Jokes are a form of information processing; they are ways for us to know ourselves. When strong self-critical thoughts come up, jokes are a way to modulate and make sense of those thoughts,” Dr. Shahar said. “If the joke includes an accepting and playful tone, then such jokes might actually serve to diffuse self-criticism.

In contrast, if the joke includes a harsh, punitive, gleeful tone, it is merely an expression of malignant self-criticism and should be neutralized.”

A playful tone rings in sophomore Khalid Ibdah.

Ibdah likes to make people laugh, and one of the ways he achieves this is through making spirited jokes. Though the style of humor downplays his intelligence and pokes fun at his imperfections, he considers the jokes to be upbeat and something everyone can relate to.

“I personally know I am not being serious [when making self-deprecating jokes].

It gives me control over my own humor, and it has taken

control from those who have teased me in the past,” Ibdah said. “I personally see these problems reflected in other people, so it’s a nice way to make light of them and. . . make them seem kind of silly and lighthearted.”

So far, self-deprecating humor is beneficial to highstatus individuals, a drawback to low-status individuals, and a way for teens to know themselves. If this is true, are other deprecating jokes made at someone else’s expense just as acceptable?

In 2000, psychology professors Leslie M. Janes and James M. Olson conducted a study over the difference between self-deprecating and other deprecating humor. Participants were split into two groups: one that viewed a video with a self-deprecating host, and another with a host deprecating his assistant. Afterward, all participants were asked to perform tasks. The results showed those who watched the other deprecating video had a bigger fear of failure, while those who watched the self-deprecating video did not.

The professors explained that those who watched the other deprecation video were afraid of being the target.

Despite this crude humor, sophomore Harper Dailey and her friends often tease each other in another depreciating way, but it’s not meant to be taken seriously. She believes other deprecation can be hurtful, but if people are on a level of friendship and comfort, then it’s acceptable.

“I don’t really like [other deprecation] personally, because you never know what someone’s going through,” Dailey said. “If you’re close enough with each other, it’s fine though. But if you’re just casual friends, then it’s too personal.”

Ibdah and his friends make both self-deprecating and other deprecating jokes, too. Yet, instead of feeling the need to conform, he believes it’s more of a bonding experience.

“Everyone has insecurities that come and go. These jokes typically don’t play to the serious nature of [the insecurities] and can instead lighten the mood and tension in most situations,” Ibdah said. “People in the past tried to hide their insecurities, not to say that people don’t do that today, it’s just that more people today don’t see them as a weakness but as something we all share and something to get through together.”

in-depths | b3

The Rock | www.bearingnews.org | February 2, 2017

A nEW

aGE IN

Quizzes inside!

GENETICS

D

NA is the most minimal and fundamental part of humanity, from the smallest cell to the longest limb. The small and mighty code, however, is anything but consistent. Though these mutations can make traits like a perfect ear, they

can also put a life in danger. As STEM fields expand our understanding, they also create the new controversy of the 21st century: Can humans control their genes?

gnohz yom

B4 | in-depths

The Rock | www.bearingnews.org | febRUARY 2, 2017

Ethics challenge ideal baby Grace Vance

O

ne year ago, sophomore Malik Ibdah would have never guessed that a video explaining the transcription process of deoxyribonucleic acid (DNA) to messenger ribonucleic acid (RNA) would spark his interest in biology.

Spending hours pouring over research and peering through a microscope wasn’t exactly appealing to him — he would rather be indulging in some of his favorite activities like working with ceramics or playing music.

In fact, since the fourth grade, he was committed to becoming a chemist — until October of 2016 in his biology class, that is.

“I was sick the day my class learned about [making mRNA], so I went on Schoology and studied the notes my teacher uploaded to understand it, and that’s where it started,” Malik Ibdah said. “Once I got interested, my dad, who is a biochemist, started really getting me engaged [in] it and taught me some really cool things.”

One of the topics within biology that particularly interested him was the ethical side of science. For his final essay in Biology, he wrote about G1528c, a genetic mutation his father, Dr. Jamal Ibdah, discovered, that causes complications for the mother.

Throughout the essay, he analyzed the different hypothetical options a mother with a baby with the mutation could undergo, such as an abortion or genetic therapy.

While situations like G1528c are hypothetical, there are thousands of real cases of mothers weighing the same questions. They may be contemplating genetic testing for their baby, creating a child through in vitro fertilization or even terminating their baby based off of a foreseen disease. Dr. Jamal Ibdah has dealt with similar situations with his patients that prioritize ethics.

As a physician and a scientist, Dr. Jamal Ibdah has conducted research to find the cause of acute fatty liver in pregnancy, which is life-threatening to the fetus and mother. This study later led to the discovery

of a new genetic mutation.

For emerging professionals in biology like Malik Ibdah, the ethical boundaries of science have become increasingly present.

Technologies such as genetic testing have enabled professionals to predict and alter genes in humans. This leaves the idea of “designer babies,” or genetically engineering an in vitro baby’s genes, a reality.

While others ask for these tests, biology teacher Kerri Graham wasn’t worried about the genes of her children and chose not to get genetic testing. Graham said it was a personal choice on her and her husband’s part.

“When we found out we were pregnant with twins, we had the option of extra testing.

You always have the option of genetic testing with any p r e g n a n c y, ” Graham said.

“We talked a little bit about it — I had a background in all of that — and I didn’t want to have my kids genetically tested before they were born because I knew I was going to love them no

matter what, however they came unto this Earth.”

Graham was 24 weeks into her pregnancy when she went to the hospital. The doctors put her on bedrest for three months because she had gone into labor. Although it was a high stress pregnancy, she felt comfortable not getting genetic tests done.

“All infants go through newborn screening, and there’s a set of about 30 diseases, that if they’re born in a hospital, are typical for them to be tested for,” Graham said. “My boys were tested for all of those normal things that are just easy to be tested for.”

In Graham’s situation, she was thankful for her ample knowledge on child development because of her job as a science teacher, and said she felt “empowered with information” to make decisions she felt thoroughly comfortable with.

Dr. Jamal Ibdah feels similarly with his line of work, saying his knowledge in science and health has allowed him to make decisions in the differing circumstances his patients encounter. He said he used genetic screening in families that were suspected to

have the disease throughout his research.

“Genetic testing can provide important medical information and can be life-saving.

There are some ethical issues that can be associated with genetic testing. One aspect is prenatal testing for a genetic mutation and the decision regarding continuation of pregnancy taking in consideration the health of the mother,” Dr. Jamal Ibdah said. “Although I did not personally deal with situations that present ethical dilemma, professionals should adapt a teamwork approach to genetic testing.”

Even though moral questions continue to arise in science, Malik Ibdah said answering them should be reflected on each family’s personal values and, as a future biologist, on an ethical and unbiased manner.

“I believe professionals [in biology] should be able to alter the natural birth process if the situation calls for it, such as life threatening complications,” Malik Ibdah said. “I also believe testing a baby for disorders and potentially terminating the fetus for a said disorder is ethical because it can cause life threatening situations for the mother or cause the baby to live an awful life with said disorder if it’s severe enough.”

While Graham teaches her classes about the morality of certain technological advances in science, she said her aim is to show the positive and negative effects of the topic so that her students can make informed decisions later in life.

“Science is about exploring and figuring out if we can do it, but then that social-ethical piece has to come into ‘Should we do it?’ and by what moral and ethical codes are we following in making that decision?” Graham said. “...When it comes to some of these genetic technologies and humans, I think there could be some positive impacts for sure, like when you look at particularly certain genetic diseases. I think we need to be super mindful about how we proceed if we are going to alter our DNA, that we are not selecting purposefully against and further discriminating against with our selecting.”

CGTAGCTACGTACGCTACGTA CGTAGGCGTA GTA CGTACGTA CGTA TACGTA C CGCCATACGTA CACGTA CGCGTATCGCGTATAACGTA CG TA CBGTCBGTABBGTGTAACGTACCGTAGTACGTACGTTA CGTACGTA GBTAACGTA CGTACGTA CGTACGTA CGTACGTA CGTACGTAA C CG GT CGTACGTA CGTACAGTA CGTACGTA CGTGTA CGTACGTA CGTA

What genetic tests are there?

Obesity Macular degeneration Parkinson’s Bipolar disorder Cancer Celiac disease

MOY ZHONG / Source: LIvescience.com

Tests predict disease Rochita Ghosh

W

ake up early. Inhale a few puffs of albuterol, a medicine to prevent constrictions of the muscles in the bronchioles’ walls. Then, do a vest, a machine that decreases mucus buildup in the lungs. Take hypersal, which helps to break down any bacteria in the same area further. Take enzyme pills and vitamins alongside eating. Come home and take albuterol and do another vest again.

Repeat. Sleep. Repeat.

Such is the lifestyle that junior Jeffrey Mullen has grown used to for his cystic fibrosis (CF), which is an inherited disorder that causes mucus to build up in the lungs and block air flow, according to the CF Foundation. CF also inhibits the production of certain digestive enzymes, the reason for Mullen’s enzyme pills. While Mullen has become accustomed to the routine, when he was younger, CF posed a number of problems for him.

“It was frustrating when it came to sports,” Mullen said. “My CF controls what I can do, especially [then], but I still did many sports like baseball, soccer and basketball.”

He and his family, however, were able to easily obtain a diagnosis of CF and information on how to treat it. For studies teacher Shawnna Matteson, she and her husband weren’t aware of a rare disease that ran in the family until far into their adulthood.

“My husband’s grandfather was originally diagnosed with MS [multiple sclerosis] and treated as such,” Matteson said. “He had several strokes that were debilitating. He got to a place where he was bedridden, unable to speak, that sort of thing. Eventually he did pass away back in 1997. When he died, he donated

his body to research to study MS. What they discovered [was] that he didn’t have MS. He had this other genetic disease, CADASIL.” CADASIL, or cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, is a hereditary disease that significantly increases the risk for stroke and other impairments. It affects blood flow in small blood vessels, especially those in the brain, according to the U.S. National Library of Medicine. Because these muscle cells are abnormal, they tend to die faster than normal cells and can also cause migraines, hallucinations and epilepsy.

When Matteson discovered the possibility of the condition, she began researching it. She came across advice that said if CADASIL runs in the family, it is important to go through genetic screening to determine if a parent possesses it before having a child. She was pregnant with her second child at the time.

Matteson is unsure whether knowing about CADASIL previously would have changed her decisions to have children, though the knowledge brings up a new flurry of worries for them like if her children would have the condition, she said.

Likewise, when Mullen was diagnosed with CF, he said it was out of the blue for his parents since they hadn’t undergone genetic screening.

“My parents freaked [out] because they didn’t know anything about it, and they tried really hard [to understand it],” Mullen said. “Over time, they knew pretty much everything [and] my dad became part of the board on the MU hospital. Because of [that] and many others that have CF, they now do genetic screening when a baby is born regardless to make sure the baby is healthy.”

Nowadays, genetic screening can influence the decision to have a child. Dr. Sarah Soden, an associate professor at the University of Missouri-Kansas City School of Medicine, said the rise of innovations in genetic technology and the awareness of hereditary diseases have contributed to the number of parents that request genetic screening. Dr. Soden said the former is what caused the requests to increase.

“Usually, parents who request a genetic test are aware of a possible hereditary condition, which is a circumstance I would recommend going through genetic testing in,” Dr. Soden said. “Whether they want to have a child or go with adoption is their decision, ultimately.”

Genetic screening, however, may not be a viable option to an individual, as is the case for Matteson. She and her husband have decided not to undergo testing to see if her husband does carry the gene for CADASIL, for insurance purposes.

“Part of the fear of finding out whether [or] not he carries it is health insurance,” Matteson said. “Especially with the ACA [Affordable Care Act] potentially being repealed and the policy with pre-existing conditions, it could be very easy for an insurance company to say ‘No, you have this disease, we won’t cover the costs of this illness because you know about it already.’ It’s kind of a weight hanging over our heads.”

Although this worries Matteson, she said she tries not dwell on it too much as this is just one of the many things life chose to throw at her family; it could have been anything else just as bad.

“I feel like everybody’s got their burdens, and life’s just a choice anyway,” Matteson said. “We make the most of it, plan for the worst and hope for the best.”

The Rock | www.bearingnews.org | febRUARY 2, 2017

Engineering builds hereditary future Cassidy Viox

A

fter 30 years of research and experimentation, modern genetic technology is in the position to drastically change organisms, large and small, through genetic engineering.

The altering of genes makes microscopic changes to the sequencing of deoxyribonucleic acid (DNA). The altering of DNA is not visible to the eye or even through microscopes but can change the makeup and physical attributes of the grown organism.

Dr. James West, an associate professor of medicine at Vanderbilt University and 1987 RBHS alumnus, has years of research knowledge. Currently, the National Health Institute funds Dr. West to cure pulmonary arterial hypertension by gene editing. Dr. West is also working on genetically improving cattle for a growing population and finding solutions to withering syndrome, a disease that affects the West Coast ecosystem and nearly driven some snails and coastal animals to extinction.

“We’re curing disease, improving animal welfare and reducing the impact of humanity on the planet,” Dr. West said. “Genetic engineering is going to make us and our animals live longer, have higher productivity and a lower environmental impact.”

Jaehyung Rhee, a 2016 RBHS alumna, lived in South Korea where she interned for Soaam, a dog cloning facility. In addition to cloning dogs, the facility is also working on pigs, cows, cats and extinct creatures. Rhee believes her work at the lab was ultimately positive because of the potential for biomedical advancements.

“All technology comes with positive and negative sides,” Rhee said. “The ethical procedure that goes behind a lot of science I don’t completely agree with, but I know that that’s what it takes for advancement.”

Most governments place strict guidelines on cloning, so Rhee believes human cloning will never be explored fully. For the future, researchers will continue to explore the genome, and one day it could revolutionize the medical field and solve many of the world’s problems.

“There are biomedical labs that are trying to clone tissues or trying to genetically clone organs and I think that’s totally viable as research goes on, not even with just cloning but with cancer genes,” Rhee, who is pursuing a future career in biomedical engineering, said. “They will definitely advance medicine. With regulations and adequate supervision from governments, I definitely think [genetic engineering] will make society more efficient and intelligent.”

Genetically modified organisms (GMOs) are vital to the food processing industry. According to an article from Center for Food Safety, 75 percent of processed food, 92 percent of corn and 94 percent of cotton in the U.S. are genetically modified products. Many of the food labels on GMOs may not be entirely correct since most GMOs aren’t labeled as “modified,” which causes problems when regulators want to know what is in the food.

When the modification is added, it can change the genetic makeup of the food enough to cause an allergic reaction, even if the person wasn’t allergic before. While modification may add allergenic material to a plant, there are some GMOs that solve issues with allergies, such as peanuts that have reactive allergens taken out.

ACGTA GCGTA A CGA GTACG ACGTA

Adopted the white color of brahman cows

Senior Jake Walters is highly allergic to peanuts and is hopeful for the future of genetic engineering.

“I wouldn’t be a pioneer of any studies, but if it was proven, I would trust it,” Walters said. “[I hope] they can apply this to all allergy cases. I’m excited to hear how it turns out.”

Outside of the lab, GMOs and genetic engineering are useful to other occupations. Many agrarian workers handle modified foods every day. Junior Henry Wilson’s family owns a cattle farm, where he was raised to appreciate the efficiency of GMOs. On a macro level, Wilson sees GMOs as a global benefit. For third-world countries, GMOs may be a matter of life or death. According to an article from the National Center of Biotechnology Information, insect damage is responsible for 15 percent of the world’s pre-harvest food losses, and that’s almost entirely in developing countries. The United States percentage of insect damage is much lower because of the modern technology available. In addition to saving the crops, GMOs can also yield more crops and produce larger, more nutritious foods.

“GMOs can allow for a less expensive food supply,” said Wilson, who sees hunger as a major global problem. “With improvement they can also help the almost certain effects of climate change by creating a stronger crop.”

Many people support genetic modification for crops, as it holds agricultural and nutritional benefits. Junior Quinn Cunningham believes in the importance of GMO usage in crops but is opposed to genetically modifying farm animals.

Cunningham predicts lab-grown meat made from stem cells of animals will be an option for carnivores in the next decade. Lab-grown meat could eliminate the cruelty of animal farms and save the life of an animal. With genetically modified animals, however, Cunningham is afraid that lab-grown meat will not compete with modified animals and will lead to more animal cruelty. “[Factory farms] are the darkest realms of hell for all their inhabitants. I support any opportunity to end the current system of mass genocide and am opposed to any technology which promises to make conventional meat cheaper for the average consumer,” Cunningham said.

“Cheapening the price of conventional meat is an inevitable consequence of genetically modifying animals.”

Genetic engineering may be the solution to problems that other technology caused, including the increase in greenhouse gases. Dr. West described the free molecules of carbon in the atmosphere as a gold mine for genetic engineers.

“By the middle of the century, people won’t be complaining that we’re putting too much carbon into the air. They’ll be complaining we’re taking too much out,” Dr. West said. “Several people I know and I are leveraging the increased atmospheric and ocean carbon to make land and ocean plants and animals more productive.”

Dr. West and many other engineers actively work to see how their research can impact the world by using what’s already in the environment to make change.

“The biotech revolution is going to make the computing revolution look petty,” Dr. West said.

“It is the solution to most of humanity and the planet’s most vexing problems.”

Dr. West’s better cows

Are more tolerant to high temperatures

Made through the process of gene editing

Yields meat like Angus cattle moy zhong / SOURCE: Think Progress

in-depths | B5

Quiz T e s t y o u r genetic smarts!

How many chromosomes are there?

Where is DNA stored in the cell?

What does it mean to be a carrier of a genetic abnormality?

What‘s the most common chromosomal abnormality?

How many base pairs are in the human genome?

Get answers at bearingnews.org

B6 | in-depths

The Rock | www.bearingnews.org | February 2, 2017

Genetic quirks create opportunity Nikol Slatinska

O

ne might define good genes as having a fast metabolism, athletic talent or the charming good looks of a movie star. What many people don’t initially consider to be on their most desired genes list are genetic qualities that set a select few apart from the rest of the population.

Sophomore Bradley Snyder knows what it’s like to be different, thanks to a trait called absolute pitch, which one in every 10,000 people have. Commonly known as perfect pitch, the anomaly involves the capability to identify or sing a musical note after hearing it. Those who have this ability have one of the two types of perfect pitch: active, which means they can sing back a note after hearing it, or passive, meaning that they can identify it.

Snyder, who has both active and passive perfect pitch, discovered his talent around the age of five.

“I heard a song that I really liked from a movie, so I went home and picked it out on the piano. My mom plays piano and was super surprised that I had learned it in the right key, so she thought I might have had perfect pitch,” Snyder said. “I found out for sure at the beginning of freshman year when some friends and I were messing around, and every song they played for me I was able to play back correctly.”

Learning that he had the trait inspired Snyder to become involved in music. He takes piano lessons and is also learning to play guitar and trumpet. He said he would like to take vocal lessons in the future.

Although researchers are not certain

whether or not perfect pitch is inherited, some factors suggest it is. For example, researchers at the University of California in San Francisco concluded the phenomenon is more prevalent among populations of European Jews, Indians and East Asians.

Researchers also found in order to have perfect pitch, one must be genetically predisposed and begin music training before age six.

Nobody in Snyder’s family is as musically gifted as he is, although his mom does play the piano. Because of the rarity of this ability, Snyder considers himself lucky to have the trait and all of the opportunities that come with it.

“People usually think it’s pretty cool [that I have perfect pitch], and they usually don’t believe me so they test me. It’s kind of fun,” Snyder said. “It’s also awesome if I want to join a band because usually people will let me play with them when they hear I have perfect pitch.”

While perfect pitch and other helpful genetic anomalies can help provoke one’s musical talent and be an interesting conversational topic, Dr. Michael Criscitiello, an associate professor at the Texas A&M University’s Department of Veterinary Medicine and Biomedical Sciences, thinks of truly good genes as pertaining more to one’s health rather than skill.

“I think [when people talk about good genes] they are generally referring to alleles, or forms of a gene that differ among individuals in a population, when they admire an attractive person or curse the male pattern baldness they got from their grandfather or often a set of alleles that combined for a polygenic effect for some phenotype

like long legs,” Dr. Criscitiello said.

Some examples of good genes, Dr. Criscitiello said, include a variant of the CCR5-delta 32 gene, which protects against HIV and the bubonic plague. He also noted there are ups and downs associated with most genes. If an allele comes with no negative cost over generations, it usually evolves to be nearly 100 percent prevalent in a population. When this happens, said allele is no longer considered a good gene; it is just the most frequent allele for the gene in question.

Individuals who have a twin are often familiar with the idea of frequent alleles, as twins, triplets and even quadruplets can have identical DNA. Freshman Erin Koller, a fraternal quadruplet, said she and her siblings are not that similar despite common misconceptions. Like Snyder’s perfect pitch, being a quadruplet garners attention; people Koller tells usually think she and her siblings are two sets of twins. Despite being part of a genetic rarity, Koller feels as if the opposite were true.

“We aren’t all that similar. We have different personalities and look different, however I sometimes find others treating me like I am the same person as my siblings,” Koller said. “We are not more genetically similar than other siblings. We do share a lot of the same interests and abilities, just like other siblings.”

Dr. Criscitiello disputed the assumption that with modern technology and genetic engineering, bad traits will eventually disappear because, as previously mentioned, “bad” alleles often come with an upside. In addition to that, the environment will never cease to change — this not only refers to

climate but also toxins, resources, pathogens and competition. Lastly, mutations occur randomly and consistently, which means they can eliminate any potential of inheriting a good gene.

Despite his opinion that the term “good genes” refers mostly to alleles that promote survival, Dr. Criscitiello acknowledges the fact that humans are programmed to be attracted to other humans with desirable qualities, visible or not.

“Sexual selection is always working whether we admit it or not. For example, my eyes are arrested by a shapely woman with a pretty face at the beach because unbeknownst to my consciousness, my genetic program is assessing clear skin suggesting low pathogen burden, facial symmetry suggesting no congenital developmental abnormalities, curves suggesting a wide pelvis facilitating childbirth and breasts for nurturing young,” Dr. Criscitiello said.

Though there is no certainty as to if perfect pitch pertains to physical attraction, it has definitely brought Snyder attention and advantages. One of those advantages has included the opportunity to perform around Columbia with a band called the Blue Hearts Club. He said he enjoyed getting to know other musicians and doesn’t think they would have let him perform with them if he wasn’t able to play by ear. “[Having perfect pitch] is awesome, but it’s a little overrated. I can know exactly what I’m supposed to play, but I’m definitely limited by my technical ability,” Snyder said. “But I love music, and having perfect pitch has made it really easy for me to express myself. I feel really lucky and grateful to have it.”

Match the trait to its heritability 1. Eye color is

A. established by genes and practice

2. Having a good sense of humor is

B. determined by fibrous protein genes

3. Most preferred foods are

C. decided by a blend of genes and environment.

4. A pleasing singing voice is

D. caused by factors in upbringing and genetics

5. Height is

E. decided by nurturing and surroundings

6. Double jointedness is

F. determined by two genes Answers: 1 F, 2 E, 3D, 4A, 5C, 6B

MOY ZHONG / source: Wonderopolis.com, Scientific American, Smithsonian magazine, NBC News, Archives of Disease in Childhood

features | B7

The Rock | www.bearingnews.org | february 2, 2017

Highlight perfections, conceal flaws Social media sets foundation for new age of makeup Skyler Froese

E

g

on

oy

zh

M

kris tin e ch

o

u so

veryone has something to say about makeup. From a sixth grader asking her mom to let her abuse eyeliner for the first time, to the old woman powdering her face, and all the way up to the highest echelons of industry and stardom, people are constantly spreading messages about cosmetics.

No place is as prolific in promotion of makeup as Instagram, which has more than 100 million makeup related posts.

Instagram has turned an industry on its head, giving way to a rise in vegan makeup products, black-owned makeup companies and has even helped popularize male makeup artists to the extent that Manny Gutierrez is the new face of Maybelline. The social media app has even changed the style in which people wear cosmetics.

Local makeup artist Marisa Burgett describes the look of Instagram makeup as “full glam,” and features bold brows, winged eyeliner and heavy contouring, according to Glamour Magazine. These aesthetics have affected Burgett professionally, as they dictate her clients’ desired looks.

“The mainstream Instagram beauty looks affect what my clients come to expect. I am expected [to be] — and pride myself on being — up-to-date with all the newest trends and techniques,” Burgett said. “I still put my own spin on every makeup application. Each and every look I create is unique in its own way. I tailor their ideas to suit their complexion and one-of-a kind personality.”

Social media has also helped Burgett obtain these clients, as she can easily advertise the looks she creates. She feels this is an fast way to connect with people. Whenever a new trend comes around, it makes a big splash on Instagram. For example, the ever-coveted Kylie Lip Kit sold out in less than 20 minutes in 2016 after being restocked.

Senior Katie Topouria works at ULTA and has seen the craze that trends generate on more than one occasion.

“I think social media plays a huge role in how people wear their makeup,” Topouria said. “Every time a famous YouTuber mentions a product in a video, within a week or so we sell out of the product. When people see attractive girls on social media with a really bright highlight and a brown lipstick, chances are they’ll try it out for themselves. It’s all about establishing trends and people following it.”

Burgett said this availability of makeup and inspiration has allowed more people to explore makeup and try to sharpen their skillset with the looks they love from their news feed.

More than following trends, senior Lauren Brummet sees social media as a good way to learn the skills to look best, especially for newcomers to makeup.

“I think a lot of people don’t know quite how to wear

makeup,” she said. “Social media can be a great guideline to find what they like best or what works for them personally.”

Though Burgett agrees with Brummet that social media helps cultivate creativity, she also acknowledges drawbacks. Instagram has also opened floodgates for criticism and hate, causing Burgett to balance her presence so as not to incur the wrath of Instagram commenters. Topouria sees another downside that leaves cyberspace to affect the feelings of people all around.

“No one on social media actually has a perfect life or looks perfect all the time,” Topouria said. “They only display themselves when they have a full face of makeup on and look glamorous, which makes normal people feel rather insecure about themselves.”

Even with these risks, makeup continues to boom. All in all, Burgett reckons the trends are exciting to her clients, and they are always interested in what new techniques she uses.

Ultimately, many of these patron’s consider what Burgett does as art. The creativity of makeup eclipses some issues it causes, Burgett said, because in the end it is made for already perfect people to flex their creativity.

“I think the widespread popularity of makeup affects teens immensely.

Teens think they are expected to look a certain way like the women on the news feed,” Burgett said. “There is a ton of pressure on girls to wear makeup and be put together at all times. It’s important to remember that you don’t have to wear makeup every day, and you’re already gorgeous before putting on the makeup. Makeup is an outlet to showcase your creativity and magnify the beauty that already exists.”

rc e:

lu xu ry

society

Lying to oneself boosts demeanor, self-esteem Emily Oba

L

ooking down at her test, sophomore Zainab Ibitoye did not like what she saw: a B glaring back at her from the top of the paper. Although she always expects more than an average grade from herself, she decides the B will suffice and convinces herself that she will try to do better next time.

Telling a lie is a way for Ibitoye to keep her confidence up even though she knows she is capable of accomplishing more.

Ibitoye will sometimes lie to herself when she feels it’s necessary, but she tries to deal with the truth in order to be motivated to improve.

“I feel like if you go with the truth, then you can build up upon that,” Ibitoye said. “If you get a 70 percent on a test, then you can use that as motivation to get a 100 percent on the next test.

It’s better to be truthful.”

Coaches often preach the mantra “fake it ‘till you make it,” meaning feign confidence and a positive attitude until a person begins to actually feel that way.

This phrase is not only used in sports, but also in school and everyday life.

Boys’ tennis coach Ben Loeb believes in using this expression to improve his tennis players’ performances. Loeb says there are times when athletes have to fake courage when dealing with self-doubt.

“Through adjusting your selftalk and your body language, you can start the change before you truly feel it,” Loeb said.

“You may need to fake the appropriate thoughts before you truly believe [them].”

Using the same strategy as Loeb suggests, freshman Leslie Barner relied on faking confidence in pole vaulting until

she became more relaxed. As a vaulter who is less experienced than others who have been in the sport longer, she felt nervous and initially thought the upperclassmen were intimidating.

“Especially in attitude, even if you think you are going to fail, fake your confidence, and it will eventually become real,” Barner said. “Now I’m more comfortable, and [pretending to have a positive frame of mind] has helped me get better in pole vault.”

There are multiple ways to “fake it ‘till you make it.” A study conducted by Psychological Science trained 169 college students to hold chopsticks in their mouths to simulate either a fake or a genuine smile, while others did not smile. Psychological Science concluded that the people smiling were less stressed when they performed more stressful multitasking exercises.

Lying to oneself proves to be effective as well. The Quarterly Journal of Experimental Psychology administered a study that looked at two groups of people. Each one answered questions.

Psychologists Ulrich Weger and Stephen Loughnan, who administered the test, told one group that before they received a question, the answer would appear briefly on the screen.

The psychologists told the other group that the brief flashes were a signal to go on to the next question. But instead of the answers flashing across the screen, random letters in no particular order appeared.

The study found that the group of people who were told answers would flash on the screen did better on the test. The psychologists concluded that when people expect to know the answers, they are more likely to

get the correct answer.

Ibitoye often pretends to know what she’s doing even though she is not entirely sure.

When she played the flute in band last year, she did not practice as much as she needed. Because of her unpreparedness, when she was performing in a concert she relied on “faking it.”

“Sometimes I would not know the notes or the rhythms or how loud or soft to play,” Ibitoye said. “I would just have to act like I knew what I was doing, but I really didn’t because people won’t notice you, and it makes you look the best [when you fake confidence].”

Not only does Ibitoye use the strategy of lying to herself in band but in school, as well. For class presentations, Ibitoye will act like she knows the information even if she doesn’t. She’ll does this by acting knowledgeable with facts that may not be true.

“People will believe me when I act confident, but I don’t know what I’m saying a lot of the times,” Ibitoye said. “[I do this because] it makes me look the best and it works for me.”

While pretending to be more knowledgeable and experienced is a way to become more self-assured, Loeb says faking attitudes is a step for a positive mindset to become real. He teaches his athletes to be aware of their thoughts and feelings. Loeb believes faking the right attitude improves their emotional state.

Although it does not guarantee winning a match, it can lead to a better performance.

“If these thoughts and feelings are counterproductive to maximizing performance, they need change their thought process,” Loeb said. “They also need to realize they need to take the risk of believing in themselves.”

b8 | advertisements

The Rock | www.bearingnews.org | february 2, 2017

SPORTS

jeff city battle

Swimming at state

Girls basketball looks to beat rival JCHS, C3

Girls’ swimming gears up for state competition, C3

Wrestlers prep for postseason Ji-Ho Lee

F

yousuf el-jayyousi / the rock

get’cha head in the game: Junior Donell McGloson encourages the boys’ basketball team in its Friday game against Hogan Pre-

peratory. McGloson and senior Mason Chandler help the team as student coach and manager, respectively. Whether they get water for players, film games or pick up shooting shirts, the Bruin’s student assistants take care of tasks behind the scenes.

Students assist teams Managers benefit athletics in multiple ways Ji-Ho Lee

T

he flashy passes, deep threes and rimrattling dunks bring attention to the athletes on the hardwood. Behind the players, however, are different groups and individuals in pursuit of supporting and encouraging the team to succeed.

Senior Mason Chandler is one of the basketball team’s managers. A former Bruin basketball player, his passion for the game pushed him to his position, allowing him to assist the team in any way possible.

“My role is to take stats during games, practice with JV if need be and assist in little things to prepare for games,” Chandler said. “Being able to see the team’s stats after games really defines what can be done the next practice to get better.”

The team appreciates Chandler’s role. Senior forward Jacob Lambert understands the thankless nature of the challenging, time-consuming role.

“The managers like Mason are a huge help to our team. They are some of the most selfless people out there,” Lambert said. “Whether it be handing water to players during the game or filming our games to help us learn from our mistakes, the managers are an enormous help to us. It takes a lot of commitment and time to be a manager, and we are fortunate enough to have them.”

Along with Chandler, other students, such as junior Donell McGloson, do what they can to help the Bruins. McGloson acts as an assistant coach for the Bruins, a role that is a dream turned reality for him.

“I have been coaching basketball since I was a freshman in high school,” McGloson said. “I started at Oakland for two years, then the Oakland basketball coach had got an administrative

role, and [RBHS head coach Jim] Scanlon had plays,” Lambert said. “As a team, we always offered me a coaching job at RBHS. I always play better when we have a crowd that supports wanted to be a high school coach, and this is us. Without the fans, we could not be the team we are today.” right where I wanted to be.”

Scanlon agrees with his senior forward, McGloson exhibits a passion for the sport of basketball, as well as a desire to coach and explaining that without the students fans, the improve the Bruin team, motivating him in his game of basketball would simply not be the same. duties.

“Fans make a big difference. It gets the kid’s “My job is to go scout games with the rest of the coaches or by myself and take notes. adrenaline going and we play some of our best Then I come back to school and go over what games at home because we have a great crowd the opponent does and put together a scouting with great student support. We have some big report for the players before our game so the games coming up, so if all the students come to the games, it players know what’s gives a big lift to going on,” McGlothe team,” Scanlon son said. “One of said. “The guys my other jobs is to We can impact the game by like to hear noise. go look at middle giving our players energy and Basketball games school basketball a home court advantage, and are best when they games and see what are loud and fun, type of players we distract the other team...” and that’s what have coming in.”

— Alex Hake, senior the students do for Scanlon believes us.” the team would not Most students who attend home games sit in be as fluid or cohesive if it were not for managers and individuals such as Chandler and Mc- the BruCrew, the student cheering section for Gloson. While their tasks may not be noticed the Bruins. BruCrew leader, senior Alex Hake, from the outside, their roles are vital for the believes it is a duty of students to support their team. team’s success.

“We can impact the game by giving our “They’re there at every practice. They’re helping us with stats, with practices, with game players energy and a homecourt advantage, preparations. We couldn’t do what we do with- and distract the other team to make it harder for out them,” Scanlon said. “They’re as important them to play,” Hake said. “It’s our job to make as the coaches themselves. They do so many RBHS a hard place to play at and we take pride different things I couldn’t mention all of them. in making it a difficult environment.”

While different students have different jobs They are very important to the whole program ... They do what coaches fail to do and what to help the Bruin basketball team, the opportunity to assist the program is a great privilege. coaches can’t do.”

“I am very blessed and humbled to be a part Along with the assistants on the bench and in the rafters, the students in the stands have a of a great basketball family and program,” McGloson said. “I love all of our coaches and playtremendous impact on the team, as well.

“Fans are part of the reason that the team ers. I couldn’t imagine being anywhere else.”

or the past four years, senior wrestler Brock Davis (120) has dedicated his time and energy to winning a state title.

With the postseason beginning in early February, the last few weeks of the regular season will be bittersweet for the grappler.

“I’m really committed to making [RBHS wrestling] better for the future, but this is also my last shot to accomplish my high school goal, and I have to make sure I’m doing what I need to do,” Davis said. “My goal is obviously to win a state title, and I know I have what it takes to do that.”

While wrestlers such as Davis started their grappling careers at young ages, senior Isaac Lage (152) began relatively recently. Nevertheless, this year is his last opportunity to have success in the state tournament.

“My goal is to make it to state and fight my way through as much as I can,” Lage said. “I plan to put in work at practice and going the extra mile outside of practice.”

While the high school careers of Davis and Lage are winding down, this season is just beginning for freshman Evan Diehls (106). Despite his youth, Diehls hopes to find success in his rookie campaign.

“My four year goal [is] that I want to achieve a state title,” Diehls said. “This year, I expect to qualify for state. To do that, I just need to keep grinding and keep wrestling hard.”

Despite the lofty objectives of individual wrestlers, achieving the same goals as a team will be more difficult because of the inability to fill an entire team. Because the Bruins use only 11 of the 14 different weight classes, every absence counts as a forfeit in that match.

“If we could fill a lineup with guys that work as hard as the guys we have now, I think we could really make an impact in state in a few years,” Davis said.

The determined and persevering work ethic of the current team, however, has brought success for individual wrestlers, especially junior Don Hammers (220).

“Our strength [as a team] is how we practice,” Hammers said. “We practice hard everyday, nobody lets anybody slack off.”

For Hammers, the senior leadership of Davis has pushed him in his efforts to improve on the mat.

“Don and I have become brothers in this whole process, and to see him succeed is like seeing myself succeed,” Davis said. “I know I can [win state], so finally accomplishing that goal of mine would give me some closure … [and] I know he can do great things, and it would be awesome to see those things happen for him.”

yousuf el-jayyousi / the rock

Cradle to pin: Senior Brock Davis brings his opponent to the ground as he tries to score back points. Davis will wrestle at the state meet on Feb. 16-18 at Mizzou arena as he goes for a second state title in his final season as a Bruin.

Crosstown rivalry excites students, community Cam Fuller

K

nicks and Lakers, Kansas and Missouri and Duke and North Carolina. Some of the most intense rivalries in the history of sports have been played on the court, pitting communities, colleges and fan bases against each other.

Although it doesn’t garner the same national attention, games between RBHS and crosstown rival Hickman High School (HHS) exhibit the same energy and emotion.

On top of the fiery rivalry between the schools, the game between the two teams has postseason implications as well. In addition to bragging rights, the winner adds a district win to its résumé.

During the past 10 years, the Bruins have dominated the rivalry, winning 19 of 23 matches. In the past five years, however, every game be-

tween the schools has been decided by single digits. For RBHS head basketball coach Jim Scanlon, the competitive nature of the rivalry makes it all the more rewarding when his team achieves victory.

“It can be really hard to control the guys’ emotions when we’re playing HHS,” Scanlon said. “You have to play more consistently and control yourself better than your opponent.”

Both schools being planted on

dzung nguyen

Providence only adds to the drama, Athletic Director David Egan says.

The road rivalry is one of the most important rivalries in the state because RBHS and HHS are always playing in the same district for basketball. With both teams fighting for a district title, the game can go either way with RBHS winning districts twice.

“RBHS and HHS [is] the most important rivalry game in the state in my opinion,” Egan said. “The games won’t always decide a state champion, but they almost always decide key district seeding.”

With the potential postseason implications and heated emotion exhibited by both parties, the rivalry occasionally sees certain extracurriculars.

In 2013, for example, HHS students stormed the court at RBHS and a parent assaulted a Bruin player.

Incidents of that sort, senior Justin

Hajicek explains, are exceptions to the rule. Despite the contention between the schools, the rivalry is usually respectful and professional.

“I really don’t think anyone is ever trying to start something, from my point of view,” Hajicek said. “I’m friends with guys on [HHS], and I would say it stays that way even when we play each other.”

Just like last year, RBHS comes into the 2017 bout on Valentine’s Day with a superior record, but Scanlon recognizes that wins and losses go out the door against the Kewpies.

Last year’s Bruin team was the better team on paper, but the game was an even affair until the Bruins pulled away in overtime.

“Each team’s record doesn’t mean anything when it comes time to play one another,” Scanlon said. “But whatever is going on we will still play our game just like they play theirs.”

c2 | advertisements

The Rock | www.bearingnews.org | february 2, 2017

Sports | c3

The Rock | www.bearingnews.org | february 2, 2017

Armed with talent, small in numbers Swimmers aim for title with small, skilled roster Skyler Froese

A

cross the board, the Lady Bruins are unstoppable when it comes to three-peats. Whether it be tennis or basketball, RBHS knows which championship is a charm.

On Feb. 17-18 at the St. Peter’s Rec Plex, the girls’ swim team will try to defend its title with its smallest roster yet: only eight individual qualifiers. Though small, the team plans to dominate events like the 100-yard breastroke, in which five swimmers have qualified.

“Currently, Ellie Zweifel and Nicole Williams — both juniors — are ranked No. 1 and 4, respectively, in the state,” head coach Zach Mertens said. “They are joined by two freshmen that have also put up state-qualifying times in Reagan Richards and Ellie Peery. The snowball has begun rolling downhill quickly in Columbia, and the faster the breaststrokers, the faster

State Qualifiers

the group behind them must go.”

This tradition of excellence has allowed for confidence in the swimmers.

Zweifel and senior Ellie Flanagan agree that the results of the 100-yard breastroke will look good for the Lady Bruins.

“I am very confident about the 100 breast. I have no doubt that Nicole and I will go one, two again,” Zweifel said.

“Nobody has come close to our times, and by training, we can definitely go faster.”

Several past state and consolation finalists will return this year. Junior Bettie Logan returns after scoring 33 points at last year’s championship, and Flanagan will most likely try for top eight finishes in the 500-yard freestyle and 100-yard butterfly, where she is seeded second in the state. Beyond her breastroke prowess, Zweifel is ranked fourth for the 100-yard backstroke. In total, there are predicted to be seven A final swimmers for the Bruins.

Despite the veteran talent, Flanagan still worries about the depth of the team in some events. The 100-yard freestyle will have no swimmers, as there are no qualifiers for the team in it, according to direc-

Qualified Jan. 21 at City of Roses Invite

State record, returning champion in breaststroke

Season best time: 1:08.61

Nicole Williams, junior

200 Individual Medley, 100 breaststroke

IM time: 2:12.84, Marquette Relays (Dec. 3-4)

100 Breaststroke: 1:05.13, COMO Invite (Jan. 8)

Ellie Zweifel, junior

tathletics.com. This deficiency will demand stellar results from each swimmer.

“We only have four people in scoring range as of now and seven total qualifiers,” Flanagan said. “We have multiple events that no one will score in. Winning relays and individual events are the best ways to score points with a small team.”

The team is poised to win in the 200yard medley relay and is seeded seventh in the 200-yard free relay. The bulk of the Bruins’ swims will come from the freshmen and junior classes. The freshmen talent is particularly crucial, as schools such as Hickman High School (HHS) have bulked up with high performing recruits like Lena Coon and Camille Lease.

“RBHS will be facing intense competition, with other teams making dramatic improvements to their lineups,” Mertens said. “RBHS, however, is faster across their core of returning scorers, looking to integrate new freshmen to add to a seemingly top-end based squad.”

While the wealth of youth from HHS is apparent, there is more competition lurking. Although the long time rivals of Glen-

50 Free, 100 Backstroke

dale High School have disappeared from meet results, Marquette and last year’s runner-up Lafayette High School will be the fiercest competition. Even with that, Mertens said, Lafayette was playing its cards close to their chest. Zweifel is also keeping an eye out for competition and every advantage they have over RBHS. “Our biggest rivals are Marquette and Lafayette. The biggest thing they have on us is size,” Zweifel said. “The competition will be the toughest we’ve ever had, but we are ready to bring another state title.”

Even with a smaller team and new head coach, the team is performing well. In the past three years, the number of All-Americans who are Lady Bruin swimmers has almost tripled, and the team’s fastest girls show strong upward trends.

“The season has been rocky. Between meets cancelled for weather, illness and college visits, RBHS hasn’t yet gone to a meet as a full team yet,” Mertens said.

“Springfield looks to be the first place where RBHS ‘A’ relays will be in full force and we hope to make quite an impression in the final few weeks.”

500 Free, 100 Butterfly

50 Free time: 24.25, placed at COMO Invite (Jan. 8) 100 Backstroke: 57.64, COMO Invite (Jan. 8)

Bettie Logan, junior

500 Free: 5:12.05, City of Roses Invite (Jan. 7)

2016 2017

100 Butterfly: 56.98, COMO Invite, (Jan. 7-8)

Ellie Flanagan, senior source: Direct Athletics photo illustration by grace Vance and Devesh Kumar / the rock

Lady Bruins to face Jays in annual matchup Faaris Khan

J

efferson City High School (JCHS) has always been a fiery opponent for the Bruin basketball team. To put into perspective, regular season matchups between the two rivals were decided in single-digits in the 2014-15 and 201516 seasons. As a result, every game is highly anticipated, watched and analyzed.

On Feb. 9, another episode of the rivalry will unfold when the girls’ basketball team will play the Jays in the RBHS main gym, with the freshman team tipping off at 4:30 p.m. The game will highlight a RBHS team which has been rebuilding from significant roster changes in the past two years.

After the graduation of Sophie Cunningham and Cierra Porter in 2015 and 2016, respectively, the Lady Bruins struggled last year.

The team went 11-15 in the regular season and were eliminated in the

first round of the district tournament. This year, however, RBHS has bounced back, currently holding a 15-3 record.

Under the direction of head coach Brad Conway, JCHS has also maintained a respectable 14-5 season record, establishing themselves as legitimate competitors for the Lady Bruins.

“Conway is an excellent coach and always has his team wellprepared. JCHS has a quick point guard who makes great plays; they have shooters on the outside too, as well as strong post players,” RBHS head coach Jill Nagel said. “In a nutshell, they have all the pieces needed to be successful.”

The effort and planning from both coaches, combined with the talent on both teams, has resulted in exciting matchups in the past. In last season’s matchup, for example, JCHS managed to clinch a 40-36 victory against the Lady Bruins in a hard-fought battle filled with gritty defense.

“In the past, it’s always been a close game,” junior guard Katey Klucking said. “Last year we lost by four, so I’d say that it’s always been an awesome match up and that pattern will continue this year.”

Keeping this in mind, Nagel realizes that the matchup could potentially be a tough one for the Bruins. As a result, she believes that a strategy centered around defense will work best come time to step on the hardwood.

“We will look to do what we always try to do: have great defense, and have our offense come from our stingy defense,” Nagel said.

Senior Madison Treece agrees with Nagel. She also believes that RBHS’s newly-acquired offensive talent in senior Elle Brown will also be one of the Lady Bruins’ biggest strengths in the matchup. Brown, a 5-foot-11 guard, has proved to be an exciting addition to the Lady Bruins’ roster, boosting RBHS’s offense to a much higher level this season.

“Our addition of Elle Brown this year will give JCHS challenges,” Treece said. “I don’t know if they have someone quick enough and tall enough to match up with her.”

While Brown’s addition to the roster was undoubtedly an exciting one, individual matchups against the Jays could be troublesome for RBHS with a combination of gritty defense and size.

“They have really good defense which we really haven’t faced this year,” Brown said. “As usual, we will prepare for this game and make sure we are the greatest we can be.”

As her time as a Lady Bruin begins to reach an end, Treece, who will attend Duke next year to continue her basketball career, remains excited for the upcoming matchup.

“It will be great to play them for the last time on our home floor,” Treece said. “Playing them at home is different because you have an edge of wanting to protect your territory and [there are] also more fans cheering you on.”

Cassidy Viox / the rock

Elle Brown, senior

An electrifying addition to the roster, Brown has been integral to the team’s success this season. Her blazing quickness, combined with her vast offensive skillset, has been a force on the hardwood.

Cassidy Viox / the rock

Madison Treece, senior

Ranked #1 in Missouri for 2016, the 6-foot-4 inch Duke commit is a dominant force in the post. Her strength near the basket is an element which tends to trouble opponents.

Cassidy Viox / the rock

Payton McCallister, junior A guard with a lethal ability to shoot beyond the arc and create opportunites in transition, McCallister uses tyson jamieson / the rock score some more: Junior guard Katey Klucking (24) maneuvers her way down the court as she prepares to make a basket against her quick speed to blaze her opponents on both sides of the court.

Waynesville High School on Dec. 2. The Lady Bruins (15-3) played at Columbia College and ended the game with a 74-51 victory.

c4 | advertisements

The Rock | www.bearingnews.org | february 2, 2017

arts & Entertainment | c5

The Rock | www.bearingnews.org | february 2, 2017

yousuf el-jayyousi / the rock

checking the books: Kelsey Hammond, co-owner of Yellow Dog Bookstore, peers through the mountains of books at her shop. She and her husband, Joe Chevalier, have owned the place for four years, and renovated the 145-year-old building to fit their theme. Located on the corner of East Broadway and 9th Street.

The coolest shop in town Kat Sarafianos

D

own the corner of East Broadway and 9th St. and across the way from Sparky’s Homemade Ice Cream there is a small, turquoisepainted book shop with constantly changing whimsical window displays.

Walk in and hear National Public Radio softly playing in the background, see entranced customers browsing the high shelves and find co-owner Joe Chevalier sitting by the register with a book in his lap, ready to leap into action and help as soon as he’s asked.

This is Yellow Dog Bookshop.

Chevalier and his wife, coowner Kelsey Hammond, bought the bookshop in the summer of 2013 after the previous owners of Get Lost! Book Store were closing.

“We walked in one day near the end of June to do some shopping, only to be told we’d better use up our store credit fast because the shop would be closing at the end of July unless the owner found the right buyer,” Chevalier said.

“Kelsey and I looked at each other with the same thought. ‘Maybe we’re the right buyers.’ We set up a meeting with the owner, had a

long discussion about what buying the shop would mean for us and for our family and jumped in. Just a month later we had financing, we had all our licenses, and we had a bookshop.”

The building itself is one of the oldest in downtown Columbia with 145 years to its name. Chevalier loves the space as it is in the heart of downtown but with more and more books being brought in, the space gets smaller and smaller.

Sophomore Piper Page is familiar with the bookshop’s setup and loves the quiet environment it offers.

“What I like most about Yellow Dog bookshop is that it tends to not be very cluttered with people. Cluttered with books, yes, but there’s never a ton of people,” Page said. “You’d think, ‘Oh, what a cute little vintage shop I want to take Polaroids in,’ and a lot of people do, but the genuineness of the shop still stays no matter how many times girls on Instagram use it as a prop.”

Page’s summary of the store would make Chevalier proud. He and Hammond are careful in their book selection in order to draw people from all over Columbia and Missouri. From installing the Kids’ Nook so families could en-

joy a day together to their creative art centered window displays designed to showcase books relating to a monthly theme.

“I hope people leave the shop feeling like they’ve just been in a really cool place — not trendy or fashionable, but someplace unique and useful,” Chevalier said. “I want them to say, ‘That was a good bookstore.’ We’re small but choose our stock very carefully for that reason; my favorite compliment is to hear that we have a great selection, that everything in the shop is good.”

It’s Yellow Dog’s unique and all-inclusive atmosphere that makes it one of the cultural centers of downtown Columbia. Students such as junior Dalton Nunamaker see the value of Yellow Dog Bookshop as a local business that plays a crucial role in the culture of the Columbia community.

“Yellow Dog Book Shop is a favorite and provides an excellent place for connections within our community. We simply have to keep financially and emotionally supporting these businesses,” Nunamaker said. “Whenever given the option, we need to buy local and participate in city campaigns to aid these businesses. As members of this community, it is

important to support our fellow Columbians in their aspirations and boost the local economy at the same time. Keeping money local is crucial to create jobs, stimulate growth and provide opportunities for everyone.”

Chevalier hopes their variety of books with characters and authors from different backgrounds adds to their ability to create an open exchange of ideas. The store strives to stock books by authors from many different countries and ethnic groups.

“At Yellow Dog you can find a book by Ernest Hemingway about hunting in Africa and a book by Chinua Achebe about the destruction of African culture by European missionaries,” Chevalier said. “You can find novels by Ayn Rand and Upton Sinclair in the same bookcase. We have F. Scott Fitzgerald writing about wealthy urban Americans and Willa Cather writing about poor rural Americans. We aspire to be a meeting place for people from different backgrounds as well, and we see a little of everything in the shop.

Bookstores can truly be centers of a community; we’re physically located in the center of Columbia, so we might as well be a cultural center as well.” joy park

Students find trouble chasing their dreams

Aspiring adolescents experience difficulty pursing their passions

Elad Gov-Ari

A

s kids grow up, aspirations of being a rock star or actress are common. As students progress through school, these ambitious, creative fields of career opportunity seem to shrink as students focus on more ‘secure’ or reasonable jobs.

This search for security, however, was not the case with 2013 alumna Kayla Doolady. Aspiring from a young age to work in the world of fashion, Doolady was determined to make her dream a reality. When reflecting over her journeys to her relative success, she found that college was the experience that allowed her to enter the business.

“I definitely think that it comes down to making a lot of sacrifices,” Doolady said. “I moved to New York for school, which was very challenging both emotionally and financially. I had to work two part-time jobs if an internship wasn’t paid in order to get by. This meant I had no free time but I made it work because it was what I love. Hard work has always paid off for me.”

Having worked personally with some of the biggest names in the industry, Doolady feels that she has found success by all definitions.

“One of my favorite internships was at Diane von Furstenberg, and I was able to work closely with her on several occasions,” Doolady said. “Those were the moments where I truly felt that I had, in a sense, ‘made it’ and that my hard work was paying off.”

For particular people, the sensation of “making it” differs wildly.

For Doolady, it meant working with big names. For junior Finn Kisida, working in the arts, in any shape or form, would have filled him with energy. Music, art and performance have always been intertwined with his personality.

“My most ‘far-fetched’ goal is to make music. Music is what I want. To be in a band, go on tours, the w h o l e thing,”

Kisida said. “Anytime I see a show the only thing I can think is that I want to be on that stage. I think that musicians are able to offer people an escape during a concert. I want to give that to people.”

Taking this yearning to perform, Kisida dedicated his life to music. As a guitarist, bass player and drummer, Kisida hopes to be able to make music professionally, no matter how minor.

RBHS counselor Leslie Kersha encourages students to do exactly that: hold on to their hopes and chase their dreams.

“I think students should definitely pursue their passions and do as much as they can to reach their goals, no matter how difficult it is to achieve,” Kersha said.

Doolady agrees with Kersha and encourages students to chase their passion. “[In order to be successful] make as many connections as possible. It really is all about who you know,” Doolady said. “Always be willing to lend a hand and help others within,

and outside of, your industry, because it will come back to you in amazing ways.”

With Doolady’s story being that of success, studies show that not many experience what Doolady did. According to the New York Times, becoming a professional musician is one of the smallest possibilities of success.

This fact, however, will not stop Kisida, who would find solace in any art related career.

“If the music scene doesn’t work out, I want to go into art management, which could mean running art galleries or a music venue or recording studio,” Kisida said. “Really working with any form of arts would do.”

Kisida’s back-up plan of art management allows for both ambitious and safe career chasing to be done simultaneously. This, in Kersha’s opinion, is the safest route towards stardome.

“With any student that has goals of either being a musician or a doctor, it’s always good to have a backup plan,” Kersha said. “It’s so important to listen to passion and know what gets you excited about work. I think it’s important to not dissuade anyone from their goals, but having that backup plan is always essential.”

joanna yu/ moy zhong

c6 | commentaries

The Rock | www.bearingnews.org | february 2, 2017

A senior and his money are soo

Ka t Sa ra fia no s Most kids don’t know where they the time their senior year sta want to go to college by rts, or even by the time applications are finished in Jan uary. The College Board recommends students apply at five to eight colleges in order to give them some choice when they find out where they are admitted.

W

hile some RBHS students onl y apply to a few schools or even jus t Mizzou, the reality is that most kids spend a lot more time and money tha n that — money being the key word.

Given the recent debate reg arding college debt and the sky high prices of college tuition, one rarely stops to think abo ut how much it simply costs to apply to colleg e. The fees to send an application to a college admissions board can be extrem ely expensive.

While some schools have no fee, according to marketplace. org, most colleges have an admission fee of $50-$75.

If a student is applying to at least five schools, that’s already severa l hundred dollars down the dra in.

As if to add insult to the fina ncial injury, it costs $12 to send a single ACT score to a single college so sch ools can view it in an application. This may see m minor, but some colleges require every ACT a student has ever taken and if you take into account the ave rage of five college that students apply to and must send ACT scores to, it’s already ano ther hundred bucks spent.

n par ted

On top of all this comes the mo ney people spent on college adm out high school. These costs issions throughinclude the $90 for each AP exam, ACT tutoring, college prep and résumé buildin g workshops, membership fee s for honor organizations and more.

In the end, applying to even just five colleges, which is on the low end of the average recommendation, a person can easily spend alm ost $1,000 on college applications alone.

Applying to college is stressfu l enough, but the added financial pressure that app lcations costs is overwhelming.

Our culture puts so much em phasis on the undergraduate degree when the reality is that where students go for their bachelor’ s degree (pause for effect) has little meaning.

With a few exceptions for specialized fields, most people will find a bac helor’s degree is the same everywhere. It’s how well they do during their studies and at their inte rnships and starter jobs that define where they get into for graduate school and eventually define their career success.

A part of the reason many you ng Americans have massive amounts of student loan debt is because many went to expensive schools for their undergraduate degree wh ere the school’s price tag did not match their end job salaries.

I don’t mean to undercut the role that colleges and the fina ncial market themselves have to play in the pro blem of student debt; I want to emphasize how our culture forces high schoolers to look at college through a financially problematic lense.

With such extraordinary and unfortunate tales of student deb t and the crippling financial future it leaves so many people with, one wo uld think we would learn early to look at the cost of something like col lege admissions and see a trojan horse filled wit h unpaid bills and regret.

Too many high schoolers for get what should be the most obv ious thing when looking at secondary education: first and foremost , colleges are businesses.

They are there to make money just as much as they are the re to educate you, if not more. For getting that is a naive and fina ncially irresponsible mistake.

Photo illustration by ÉlÉa-marie gilles, dzung nguyen

commentaries | c7

The Rock | www.bearingnews.org | february 2, 2017

Faking low self-esteem isn’t necessary Ann Fitzmaurice

S

ocial media is a beautiful thing. It allows people to interact with friends they haven’t seen in years, post pictures or messages to remember their favorite experiences and even get in contact with friends in class to ask for homework answers.

Social media and Instagram, however, are especially a vortex of attention-seeking self-hatred. People falsely accusing themselves of being “too fat” or “ugly” plague my feed. The line between those who are reaching out for help and searching for compliments is almost invisible, leaving me to decide if I should give a compliment, or leave it to the person’s other 200 followers to do so. I rarely give the compliment, as I remember when I had low self-esteem.

I absolutely refused to show my flaws, especially on the internet.

It’s not the captions themselves, of course, that stop me from commenting. If the person would’ve beckoned for help under a black screen I wouldn’t have hesitated to try to help. The issue is the self inflicted insults are captioned under a selfie.

In fact, because the self-disrespecting caption is under a selfie it makes me not believe the person actually has low self-esteem. Their self-deprecating posts make me think they just want compliments.

Although there are different ways to deal with not taking pride in oneself, I don’t understand why publishing low thoughts on the internet is necessary. It won’t accomplish anything and rarely helps long-term.

People should reach out to friends one on one instead of yelling into an empty online void.

Those who fish for admiration have found a way to feel good with-

photo illustration by yousuf el-jayyousi and joy park / the rock

out working for it. They can quickly snap a selfie, draw the name of a bodily feature from a hat and put that as a caption in order to obtain flattery in a time span of five minutes.

Fake, self-inflicted insults to themselves are an insult to others.

A few years back I struggled with actual low self-esteem. I refused to be in pictures without covering my face and I would never dare think of posting a selfie on social media. See-

ing people pretend to have low-self esteem in order to receive admiration makes me feel neglected for all those years I spent hiding my face with nobody caring to help me.

Why should someone earn unnecessary praises when there are people really struggling with self image?

Nonetheless, I didn’t tell anyone about my issues because I was afraid of looking like I just wanted attention. Had I told someone, I might

have gotten the care I needed in order to be happier sooner.

People complaining about their face then posting picture after picture of just that is hypocritical. If someone really had low self-esteem, I would expect them to avoid showing themselves to the public at all times.

Posting a good selfie every so often to celebrate a time they felt confident is justified, but when every picture is a selfie with the same caption of, “My

face is shaped so weird,” or “I’m so ugly smh,” doesn’t seem real.

If self-esteem really is low, talk to a close friend, parent or counselor.

Temporary compliments that don’t actually mean anything don’t help with low self-esteem. People don’t need an excuse to post a selfie, and followers will not misjudge confidence for vanity as long as the intentions are pure. Change the caption and hold humbleness, not neediness.

Grades aren’t everything

Take time to have a life with adventure Siena Juhlin

M ÉlÉa-marie gilles / the rock

Stop stigmatizing antidepressants Rochita Ghosh

thinking about the multitudes of work I was missing and commitments I was breaking. ’m an open book. Anyone who knows me is aware Deciding enough was enough, my mom took me to of my struggles with mental health. I don’t hide the see a psychiatrist for my episodes and the nausea alike. fact that I have depression and anxiety, nor that I’ve He prescribed me another round of drugs: fluoxetine, attempted suicide four separate times in the past six an antidepressant, and clonazepam, an anti-anxiety years. medication.

My battle with depression is a significant part of Despite being open about my mental health, I who I am, and to hide that wouldn’t be telling my couldn’t help but feel nervous swallowing these pills. whole story.

I knew a large portion of the population took medicine I thought I had a handle on my mental health. It had to cope with their mental illness — I just never exbeen weeks since I last fell back into depression’s hate- pected to join them. In addition to the stigma of simply ful clutches — Heck, it felt like it had left me com- having the condition, now I had to face criticism for pletely. I got my work done and I joked regularly with trying to deal with the condition through pills. There’s friends. I had no problems getting up in the mornings. a certain societal image of people on such medication, Life was pretty good. depicting us as drug addicts and unstable.

Then, one day in early November. I woke up, and Needless to say, antidepressants and cocaine do not my stomach seemed to protest its own existence. The lie on the same spectrum. most I could eat that day was a couple of crackers. I People don’t feel shame to take ibuprofen when didn’t exactly care for my health, so I figured that sleep they have aches and pains because they know the deprivation was finally doing me in or that I had got- medicine will alleviate it. I felt no shame taking ranititen sick, but none of that matdine to treat the nausea. tered. I had a test that day and Suddenly, just because it I had plans to go out of town was an antidepressant, I I knew a large portion of the popthe following week — I had should be ashamed of reulation took antidepressants to to go to school. lying on such medication Or not. My mother forbade cope with their mental illness — I to improve my health? me from going when she reRegardless, I took the just never expected to join them.” alized I wasn’t faking it and antidepressants the day really couldn’t eat anything and persuaded me to take a I received them, grasping for any straws that would nap. I ended up sleeping the whole day away and woke suck the nausea out of my system. The medicine cerup at 5 p.m. with a hungry stomach and a worried mind. tainly functioned as such; I woke up the next morning I was still heavily nauseated, but now I was massively nausea-free and able to eat breakfast and go to school. anxious wondering what the future held for me now Were it not for those two medicines, the problems that I missed an entire day of school. Would I fail all would’ve remained. my classes? Would my section in journalism crumble Why does our society create such a hostile environunderneath my neglect? ment around mental health? According to the National After weeks of waiting for the nausea to disappear, I Institute of Mental Health, 9.8 million adults in the told my mom my worst fears: there may be something United States reported to suffer from a serious mental wrong with me. With haste, we paid the doctor a visit illness in 2014. The chances are high that everyone, and left with ranitidine, a medicine meant to treat con- most likely, either knows someone who has such a conditions that produce too much stomach acid, according dition or suffers from a mental illness themselves. to healthline.com. I felt better walking out of the office, Why shame the people we know and love for trying as I no longer had reason to worry that the nausea was to live a life free of health troubles? secretly a precursor to cancer or some other terrible disAntidepressants haven’t transformed me into a ease. It doesn’t mean I wasn’t concerned, though. completely new person, but they have given me the I was prescribed to take ranitidine for 30 days, but strength to pull myself out of depression and anxiety as those days passed, the nausea never left and invit- dug me into. It allowed me to be the person I always ed anxiety with it. And, of course, anxiety brought its dreamed of being — a strong, independent, dependbest friend, depression. I collapsed into nervous break- able and kindhearted woman. I have no shame in takdowns nearly every day, wreaking havoc within myself ing medicine to be healthy; nor should anyone else.

I

y whole life I’ve been taught to believe that getting impressive grades is the key to success. I’ve been told to get outstanding grades, get into college and then have a steady job so I can have a “good life.”

Although I believe school is important and grades matter, I know they are not the key to a prosperous life.

Teachers and parents continuously brainwash students into thinking good grades are necessary for living a wealthy life, and this has detrimental effects on kids.

An NYU study reported 49 percent of high school students felt considerable pressure on a daily basis.

Trapped in the mindset of choosing the path of security, students convince themselves if they get good grades and a high-paying job they will be happy.

Unfortunately, this mindset does not seem to work for most adults.

NY Daily News found 70 percent of adults are not content with their jobs.

This unhappiness proves that even studying for hours on end won’t secure a life of satisfaction.

Primarily, I see my mom as an example of misery, even with her fulfilling job. All her life she worked extremely hard in school. She finished high school with an almost steady 4.0 grade point average. After graduation she studied at UCLA and became a nurse anesthetist.

Studying consumed her whole life. I remember going to the beach at a young age and feeling like she loved her nursing books more than she loved me. She sat in the sand

reading and taking notes rather than playing with me.

After all of my mother’s hard work in school, she now has a job at the University Hospital with a strong paycheck, yet she still isn’t happy.

My mom works almost every day for 12 hours. She arrives home tired and stressed. I’m certain this isn’t what she had in mind when she was sacrificing practically everything to receive straight As in school.

Although I’m not devoting my whole life to achieving impressive grades, the effects totally surround me.

My friends struggle — both mentally and physically — from the pressure to get good grades. It’s hard seeing the people I’m close to have breakdowns and question their worth when they come home with Bs. While I go out and do fun things, I watch as my friends stay inside studying in fear of not succeeding.

Students aren’t sleeping or socializing all because they want to see an A on a grade card. My friends can’t hang out because of their work load and they never take a break just to enjoy their high school years.

Unlike my friends, I have learned that grades don’t determine my life and my worth. I have decent grades, but I definitely put experiences first and enjoy my young life rather than wasting it away studying.

I’d much rather be making wild memories that I’ll never forget than trying to memorize useless information that I’ll forget right after the test.

The grades we receive should not determine our life and happiness. You determine your life and happiness.

Enjoy your high school years. You have your whole life to work, so make the best of the time you have now.

Photo illustration by yousuf el-jayyousi and Joy Park / the rock

c8 | advertisements

The Rock | www.bearingnews.org | february 2, 2017