JoTT 3(7): 1885-1960 26 July 201 by ZOO-WILD

July 2011 | Vol. 3 | No. 7 | Pages 1885â&#x20AC;&#x201C;1960 Date of Publication 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

Indian Robin Saxicoloides fulicata

Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of articles in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Journal of Threatened Taxa Published by Wildlife Information Liaison Development Society

Typeset and printed at Zoo Outreach Organisation

9A, Lal Bahadur Colony, Peelamedu, Coimbatore, Tamil Nadu 641004, India Phone: +91 422 2561087, 2561743; Fax: +91 422 2563269 Email: threatenedtaxa@gmail.com, articlesubmission@threatenedtaxa.org Website: www.theatenedtaxa.org EDITORS Founder & Chief Editor Dr. Sanjay Molur, Coimbatore, India Managing Editor Mr. B. Ravichandran, Coimbatore, India Associate Editors Dr. B.A. Daniel, Coimbatore, India Dr. Manju Siliwal, Dehra Dun, India Dr. Meena Venkataraman, Mumbai, India Editorial Advisors Ms. Sally Walker, Coimbatore, India Dr. Robert C. Lacy, Minnesota, USA Dr. Russel Mittermeier, Virginia, USA Dr. Thomas Husband, Rhode Island, USA Dr. Jacob V. Cheeran, Thrissur, India Prof. Dr. Mewa Singh, Mysuru, India Dr. Ulrich Streicher, Oudomsouk, Laos Mr. Stephen D. Nash, Stony Brook, USA Dr. Fred Pluthero, Toronto, Canada Dr. Martin Fisher, Cambridge, UK Dr. Ulf Gärdenfors, Uppsala, Sweden Dr. John Fellowes, Hong Kong Dr. Philip S. Miller, Minnesota, USA Prof. Dr. Mirco Solé, Brazil Editorial Board / Subject Editors Dr. M. Zornitza Aguilar, Ecuador Prof. Wasim Ahmad, Aligarh, India Dr. Giovanni Amori, Rome, Italy Mr. Deepak Apte, Mumbai, India Dr. M. Arunachalam, Alwarkurichi, India Dr. Aziz Aslan, Antalya, Turkey Prof. R.K. Avasthi, Rohtak, India Dr. N.P. Balakrishnan, Coimbatore, India Dr. Hari Balasubramanian, Arlington, USA Dr. Maan Barua, Oxford OX , UK Dr. Aaron M. Bauer, Villanova, USA Dr. Gopalakrishna K. Bhat, Udupi, India Dr. S. Bhupathy, Coimbatore, India Dr. Anwar L. Bilgrami, New Jersey, USA Dr. Renee M. Borges, Bengaluru, India Dr. Gill Braulik, Fife, UK Dr. Prem B. Budha, Kathmandu, Nepal Mr. Ashok Captain, Pune, India Dr. Cleofas R. Cervancia, Laguna , Philippines Dr. Apurba Chakraborty, Guwahati, India Dr. Kailash Chandra, Jabalpur, India

Dr. Anwaruddin Choudhury, Guwahati, India Dr. Richard Thomas Corlett, Singapore Dr. Gabor Csorba, Budapest, Hungary Dr. Paula E. Cushing, Denver, USA Dr. Neelesh Naresh Dahanukar, Pune, India Dr. R.J. Ranjit Daniels, Chennai, India Dr. A.K. Das, Kolkata, India Dr. Indraneil Das, Sarawak, Malaysia Dr. Rema Devi, Chennai, India Dr. Nishith Dharaiya, Patan, India Dr. Ansie Dippenaar-Schoeman, Queenswood, South Africa Dr. William Dundon, Legnaro, Italy Dr. J.L. Ellis, Bengaluru, India Dr. Susie Ellis, Florida, USA Dr. Zdenek Faltynek Fric, Czech Republic Dr. Hemant Ghate, Pune, India Dr. Dipankar Ghose, New Delhi, India Dr. Gary A.P. Gibson, Ontario, USA Dr. M. Gobi, Madurai, India Dr. Stephan Gollasch, Hamburg, Germany Dr. Michael J.B. Green, Norwich, UK Dr. K. Gunathilagaraj, Coimbatore, India Dr. Mohammad Hayat, Aligarh, India Dr. V.B. Hosagoudar, Thiruvananthapuram, India Prof. Fritz Huchermeyer, Onderstepoort, South Africa Dr. V. Irudayaraj, Tirunelveli, India Dr. Rajah Jayapal, Bengaluru, India Dr. Weihong Ji, Auckland, New Zealand Prof. R. Jindal, Chandigarh, India Dr. Pierre Jolivet, Bd Soult, France Dr. Werner Kaumanns, Eschenweg, Germany Dr. P.B. Khare, Lucknow, India Dr. Vinod Khanna, Dehra Dun, India Dr. Cecilia Kierulff, São Paulo, Brazil Dr. Ignacy Kitowski, Lublin, Poland Dr. Krushnamegh Kunte, Cambridge, USA Prof. Dr. Adriano Brilhante Kury, Rio de Janeiro, Brazil Dr. Carlos Alberto S de Lucena, Porto Alegre, Brazil Dr. Glauco Machado, São Paulo, Brazil Dr. Gowri Mallapur, Mamallapuram, India Dr. George Mathew, Peechi, India Prof. Richard Kiprono Mibey, Eldoret, Kenya Dr. Shomen Mukherjee, Jamshedpur, India Dr. P.O. Nameer, Thrissur, India Dr. D. Narasimhan, Chennai, India Dr. T.C. Narendran, Kozhikode, India Stephen D. Nash, Stony Brook, USA Dr. K.A.I. Nekaris, Oxford, UK Dr. Heok Hee Ng, Singapore Dr. Boris P. Nikolov, Sofia, Bulgaria continued on the back inside cover

JoTT Paper

3(7): 1885–1898

Western Ghats Special Series

Rediscovery of the threatened Western Ghats endemic sisorid catfish Glyptothorax poonaensis (Teleostei: Siluriformes: Sisoridae) Neelesh Dahanukar 1, Manawa Diwekar 2 & Mandar Paingankar 3 Indian Institute of Science Education and Research, Sai Trinity, Garware Circle, Pune, Maharashtra 411021, India Department of Zoology, University of Pune, Ganeshkhind, Pune, Maharashtra 411007, India Email: 1 n.dahanukar@iiserpune.ac.in (corresponding author), 2 manawa.d@iiserpune.ac.in, 3 mandarpaingankar@gmail.com

1,2 3

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Heok Hee Ng Manuscript details: Ms # o2663 Received 30 December 2010 Final received 08 July 2011 Finally accepted 11 July 2011 Citation: Dahanukar, N., M. Diwekar & M. Paingankar (2011). Rediscovery of the threatened Western Ghats endemic sisorid catfish Glyptothorax poonaensis (Teleostei: Siluriformes: Sisoridae). Journal of Threatened Taxa 3(7): 1885–1898. Copyright: © Neelesh Dahanukar, Manawa Diwekar & Mandar Paingankar 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Detail: see end of this article Author Contribution: ND and MP designed the research and performed morphometry; MD performed molecular biology work; ND and MP analyzed the data and wrote the paper. Acknowledgements: We are thankful to Prof. L.S. Shashidhara, Prof. Milind Watve and Dr. Sanjay Molur for continuous support and encouragement. We are thankful to Dr. R.M. Sharma, Officer-in-charge, and Shrikant Jadhav, Zoological Survey of India, Western Regional Centre, Akurdi, Pune, for encouragement and helpful discussion. We thank two anonymous referees for comments on an earlier draft of the manuscript. The CEPF-funded freshwater assessment of the Western Ghats encouraged us to publish this work. We duly acknowledge the help from CEPF for publication of this article.

OPEN ACCESS | FREE DOWNLOAD

Abstract: Glyptothorax poonaensis Hora is an endemic sisorid catfish of the Western Ghats of India known only from its type locality in Mula-Mutha River, a tributary of Bhima River, at Pune. This fish has not been recorded from its type locality for more than 70 years and it was thought to be extinct. Here we report a recently discovered population of G. poonaensis from Indrayani River, a tributary of Bhima River. Based on 11 specimens, we have redescribed this species along with some comments on its taxonomy, length-weight relationship, feeding and breeding habits. We also performed molecular phylogeny of the fish by sequencing three mitochondrial genes encoding 16S ribosomal DNA, cytochrome b and cytochrome oxidase subunit I. Molecular analysis suggests that G. poonaensis is nested within a lineage of Glyptothorax species from northern and northeastern India and China. Further, our analysis reveals that southern Indian species of Glyptothorax do not form a monophyletic group. Molecular dating of divergence times indicates that G. poonaensis diverged from other northern Indian species 1.9 to 2.5 million years ago. Current knowledge suggests that the species could be found in two river basins with total extent of around 6100km2; however, the species is already suspected to be locally extinct from half of its known extent of occurrence. Furthermore, the habitat of the species may be threatened by increasing pollution, deforestation leading to siltation, halting of flow by damming, sandmining and introduced fish species. In the light of biodiversity conservation, especially in an important biodiversity hotspot like Western Ghats, such rare and endemic species needs prioritization. Keywords: Conservation, Glyptothorax poonaensis, molecular phylogeny, northern Western Ghats.

INTRODUCTION The Western Ghats of India harbor a rich diversity of freshwater fish with many species endemic to this region (Shaji et al. 2000; Dahanukar et al. 2004). However, a major part of this diversity is threatened by various anthropogenic activities (Dahanukar et al. 2004), and unless serious efforts are taken to conserve natural resources, it is possible that rare and endemic species in this biodiversity hotspot may go extinct in the near future. This is especially true for stenotopic fish species like the

This article forms part of a special series on the Western Ghats of India, disseminating the results of work supported by the Critical Ecosystem Partnership Fund (CEPF), a joint initiative of l’Agence Française de Développement, Conservation International, the Global Environment Facility, the Government of Japan, the MacArthur Foundation and the World Bank. A fundamental goal of CEPF is to ensure civil society is engaged in biodiversity conservation. Implementation of the CEPF investment program in the Western Ghats is led and coordinated by the Ashoka Trust for Research in Ecology and the Environment (ATREE).

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

1885

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

ones in the genus Glyptothorax, which prefer clear hill streams with rapid currents. Globally, Glyptothorax is represented by more than 70 species (Anganthoibi & Vishwanath 2010). In the Western Ghats, Glyptothorax is currently represented by 10 species (Gopi 2010), namely G. anamalaiensis Silas, G. annandalei Hora, G. davissinghi Manimekalan & Das, G. housei Herre, G. kudremukhensis Gopi, G. lonah (Sykes), G. madraspatanum (Day), G. malabarensis Gopi, G. poonaensis Hora, and G. trewavasae Hora. Out of these species, G. poonaensis is considered to be extinct from its type locality (Kharat et al. 2003). Hora (1938) described G. poonaensis as a subspecies of G. conirostre, from the Mula-Mutha River, a tributary of Bhima River in the northern Western Ghats, India. The description was based on five specimens, one of which was collected by A.G.L. Fraser during 1936–1937 from Kharadigaon area of Mula-Mutha River (Hora 1938; Fraser 1942). Since then at least three independent studies were carried out on the freshwater fish fauna of Mula-Mutha Rivers by Tonapi & Mulherkar (1963), Wagh & Ghate (2003; this work was actually carried out during 1992–1995) and Kharat et al. (2003) and this species has never been encountered. Studies on other nearby rivers, namely Pavana River (Chandanshive et al. 2007) and Indrayani River (Yazdani & Mahabal 1976), which are tributaries of Mula-Mutha and Bhima rivers respectively, did not record this species either. In an extensive survey of Krishna River system, Jayaram (1995) did not record this species but noted that it had been recently recorded by Ghate et al. (1992). However, Ghate et al. (1992) did not base their record on material they collected, but on records in earlier literature. Glyptothorax poonaensis is also mentioned in the checklist of fish from Pune District by Tilak & Tiwari (1976) but it remains unclear whether this record is based on actual collection or the existing literature. Similarly, Yadav (2003) recorded this species from the collection of Western Regional Station, Zoological Survey of India, Pune, during 1960–1995, without mentioning collection localities or dates of collection. As a result, there are no reliable records of G. poonaensis since its original description in 1938. This is the reason Kharat et al. (2003) considered G. poonaensis to be possibly extinct in the Mula-Mutha River after a detailed survey of the river drainage. In a resent survey of Indrayani River, also a 1886

tributary of Bhima River (and very close to the MulaMutha River of Pune; approximately 18km by land but around 120km river stretch from the type locality of the fish) we discovered a population of G. poonaensis. In this paper we redescribe the species with further details on its morphomety, molecular phylogeny, current distribution, length-weight relationship, feeding habits, breeding habit and threats to the species. This data will be helpful while designing and implementing conservation strategies.

METHODS Study area and specimen collection The Indrayani River is a tributary of Bhima River, which is itself a major tributary of the Krishna River system. In our study on the fish diversity of Indrayani River, specimens of Glyptothorax were collected at Markal (18.6710N, & 73.9810E) from June to August 2010 from the local fishermen. The specimens were preserved in 4% formaldehyde and were identified based on available literature (Hora 1938; Silas 1951; Talwar & Jhingran 1991; Jayaram 2010). Four specimens from our study are deposited in the collection of Wildlife Information Liaison Development, Coimbatore under the accession numbers WILD-11-PIS-004, WILD-11PIS-005, WILD-11-PIS-006 and WILD-11-PIS-018. Three specimens from our collection are deposited in the Zoological Survey of India, Western Regional Centre, Akurdi, Pune under the accession numbers ZSI Pune P/2431, P/2432 and P/2433. Biological and morphological data collection and analysis Morphometric and meristic data were collected following Vishwanath & Linthoingambi (2005), Ng & Kottelat (2008) and Jayaram (2010). Wherever there was discrepancy in the definition of a morphometric character, for example body depth at anus (Ng & Kottelat 2008) versus body depth at dorsal origin (Jayaram 2010), we took both the measurements and recorded them appropriately. In all 40 morphometric characters and four meristic characters were considered. Morphometry was performed using dial calipers with a least count of 0.0254mm. We also extracted morphometric data for G. poonaensis, G. conirostre, G. lonah and G. trewavasae from Hora (1938) for

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

Rediscovery of Glyptothorax poonaensis

comparison. To avoid personal measurement biases while comparing Hora’s (1938) data and ours we performed cluster analysis based on the mean values of size adjusted morphometric data. We calculated Euclidian distances and we used Ward’s method of clustering. Weight of each individual was measured on an electronic weighing balance with a least count of 0.01g. We plotted log-log plot of length and weight of the fish to determine the exponent of the length-weight relationship given by the equation W = a Lb, where ‘W’ is the weight, ‘a’ is the normalization constant, ‘L’ is the length and ‘b’ is the scaling exponent. The null hypothesis that ‘b=3’ was tested by comparing the 95% confidence interval of calculated value of ‘b’ (Quinn II & Deriso 1999, pp.131). We dissected three specimens in our collection to extract their gut contents and analyzed their feeding habits. DNA isolation and molecular phylogeny Muscle tissues were harvested from two fresh specimens (WILD-11-PIS-018 and ZSI Pune P/2431) and were preserved in absolute ethanol. The tissue was digested at 500C for two hours using the STE buffer (0.1M NaCl, 0.05 M Tris-HCl, 0.01M EDTA, 1%SDS) with 15µl proteinase K (20mg/ml) per 500µl of STE buffer. DNA was extracted using conventional phenol-chloroform method and re-suspended in nuclease free water. Polymerase chain reaction was performed to amplify three fragments of mitochondrial genes namely cytochrome b (cyt-b), cytochrome oxidase subunit I (cox1) and 16S ribosomal DNA (16S rDNA). Primers used for the amplification are given in the Table 1. PCR was performed in a 50µl reaction volume containing 5µl of template DNA (~200ng), 5µl of 10x reaction buffer (100mM Tris pH 9.0, 500mM KCl, 15mM MgCl2, 0.1% gelatin), 2µl of 25mM MgCl2, 2µl of 10mM dNTPs, 1µl of each primer, 1µl

N. Dahanukar et al.

taq polymerase and 33µl distilled water. The genes were amplified using gene-specific primers. For 16S rDNA thermal profile was 5min at 950C, and 40 cycles of 30 seconds at 940C, 30 seconds at 610C and 2min at 720C followed by extension of 10min at 720C. For cyt-b and cox1 thermal profile was 5min at 95°C, and 40 cycles of 30 seconds at 940C, 30 seconds at 510C and 2min at 720C, followed by extension of 10min at 720C. Amplified DNA fragments were purified using the ‘Promega Wizard Gel and PCR clean up’ system and sequenced. The purified PCR products were sequenced using ABI prism 3730 sequencer (Applied Biosystems, USA) and big dye terminator sequencing kit (ABI Prism, USA). Sequences were analyzed by BLAST tool (Altschul et al. 1990). These sequences have been deposited in Genbank. We retrieved additional sequences of other species of Glyptothorax from NCBI GenBank (http://www. ncbi.nlm.nih.gov/). We used Gagata cenia and Bagarius yarrelli as out-groups following Peng et al. (2006). All the sequences used for the analysis, along with their GenBank accession number, are given in Table 2. Our total data matrix encompasses fragments of three mitochondrial genes namely 16S rDNA, cyt-b and cox1 with a total sequence length of 2120 bp after alignment. Sequences were aligned using ClustalW (Thompson et al. 1994). Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 5 (Tamura et al. 2011). Best fit model for nucleotide substitution was selected based on minimum Akaike Information Criterion (AIC) value (Posada & Crandall 2001). We constructed phylogenetic trees based on maximum parsimony, minimum evolution, neighbour joining and maximum likelihood. Reliability of the phylogenetic tree was estimated using bootstrap values run for 1000 iterations. Based on the calibration points available

Table 1. Primer sequences used in this study Gene amplified cyt-b

cox1

16S rDNA

Primer

Sequence (5’ –> 3’)

L14724 (F)

GACTTGAAAAACCACCGTTG

H15915 (R)

CTCCGATCTCCGGATTACAAGAC

FishF1

TCAACCAACCACAAAGACATTGGCAC

FishR1

TAGACTTCTGGGTGGCCAAAGAATCA

16Sar-F

CGCCTGTTTATCAAAAACAT

16Sbr-R

CCGGTCTGAACTCAGATCACGT

Approximate size of amplification (bp)

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

Reference

1118

Chen et al. (2007)

655

Sharina & Kartavtsev (2010)

573

Ivanova et al. (2007)

1887

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Table 2. GenBank details of gene sequences used for phylogenetic analysis Species Glyptothorax brevipinnis

GenBank accession numbers

Voucher specimen number

16S rDNA

Cytochrome b

Cytochrome oxidase-1

FJ357193

FJ208934

FJ208927

NBFGR:GB1

Glyptothorax cavia

AY445906

AF477830*

DQ514343

IHB200106243 (for 16S rDNA) UMMZ 247440 (for Co-1)

Glyptothorax dakpathari

FJ357197

EU637440

EU637832

NBFGR:GP3

Glyptothorax davissinghi

FJ357212

FJ423582

FJ347795

NBFGR:GD8318G

Glyptothorax fokiensis

AY574359

AF416884*

DQ514346

IHB3811 (for 16S rDNA) UMMZ 245065 (for Co-1)

Glyptothorax garhwali

FJ357186

EU637428

EU637803

NBFGR:GG1

Glyptothorax granulus

FJ357181

FJ349168

FJ347865

NBFGR:GR8413X

Glyptothorax ngapang

FJ357173

FJ349120

FJ347817

NBFGR:GN8412K

Glyptothorax poonaensis

JN092395

JN092396

JN092397

WILD-11-PIS-018

Glyptothorax poonaensis

HQ833462

HQ833463

HQ833464

ZSI, Pune, P/2431

Glyptothorax sinensis

AY574357

AY601764

DQ514360

IHB0305147 (for 16S rDNA) IHB0305147 (for Cyt-b) UMMZ 246438 (for Co-1)

Glyptothorax ventrolineatus

FJ357203

FJ349177

FJ347797

NBFGR:GV8417A

DQ846700

IHB9907005 (for 16S rDNA) UMMZ 247439 (for Co-1)

Gagata cenia

AY445905

AF499599*

* Voucher specimen not specified

on the molecular dating of Gagata cenia and Bagarius yarrelli (Peng et al. 2006) we performed molecular dating using maximum likelyhood analysis based on cyt-b gene sequence. A molecular clock test was performed to find out whether the substitution rates were uniform (Tamura et al. 2011).

RESULTS AND DISCUSSION In spite of several extensive surveys in the MulaMutha River and other rivers in the vicinity of Pune (Tonapi & Mulherkar 1963; Yazdani & Mahabal 1976; Kharat et al. 2003; Wagh & Ghate 2003; Chandanshive et al. 2007), G. poonaensis has not been recorded after its description by Hora (1938). The only other records of the fish by Tilak & Tiwari (1976) and Yadav (2003) could be based only on existing literature (see Introduction). As a result our report of G. poonaensis is the first verifiable record since its original description. Taxonomic comments We compared the specimens in our collection with the original description in Hora (1938) and confirmed their conspecificity. We further confirmed the identity of G. poonaensis by comparing our morphological 1888

data with the data for G. poonaensis, G. conirostre, G. lonah and G. trewavasae from Hora (1938). Size adjusted morphometric data from Hora (1938) and our specimens (Table 3) agree closely, further verifying their conspecificity. The only disagreement between our data and that in Hora (1938) is the length of caudal peduncle. Our measurements (19.3–22.7 % SL) are higher than those reported by Hora (16.6–17.5 % SL), however, we cannot comment on the reasons behind this difference because of the small sample sizes in both cases. The dendrogram (Fig. 1) based on the morphometrical comparisons (Table 3) suggests that

Figure 1. Comparison of morphometric data of present collection with Hora’s (1938) data. Dendrogram is plotted using Euclidian distances and Ward’s method. (Species names shown in blue are based on Hora’s (1938) data, while red corresponds to present study). Dashed line is the significance line.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Table 3. Comparison among the morphometry of Glyptothorax given by Hora (1938) and present study. All characters are expressed as average of percentage of standard length with their standard deviations in the parenthesis. Characters % of standard length

Data from Hora (1938)

Present study

G. poonaensis

G. conirostre

G. lonah

G. trewavasae

G. poonaensis

Length of head

23.6 (0.36)

22.7 (0.73)

23.8 (0.66)

25.7 (0.68)

23.8 (1.40)

Width of head

20.2 (1.44)

16.7 (0.22)

20.1 (0.33)

20.8 (0.43)

19.1 (1.32)

Height of head

13.0 (1.03)

12.1 (0.05)

14.2 (0.52)

12.8 (1.16)

13.3 (1.08)

Length of snout

11.5 (1.08)

11.6 (0.52)

11.8 (0.86)

13.5 (1.51)

12.3 (0.36)

Inter-orbital width

6.4 (0.32)

5.4 (0.97)

8.0 (0.67)

7.4 (0.52)

7.1 (0.59)

Depth of body

15.5 (1.83)

15.1 (1.17)

18.2 (1.04)

15.5 (1.42)

17.1 (1.12)

Height of dorsal fin

16.8 (0.97)

19.9 (0.36)

18.5 (1.41)

19.4 (2.11)

16.8 (0.86)

Length of pectoral fin

21.6 (1.30)

24.2 (0.10)

23.5 (0.57)

22.1 (3.37)

20.6 (1.40)

Length of ventral fin

15.8 (1.48)

17.8 (1.39)

19.0 (0.58)

16.9 (0.97)

14.8 (0.72)

Longest ray of anal fin

14.2 (1.91)

18.9 (0.26)

18.5 (1.40)

17.5 (2.68)

15.8 (1.28)

Length of dorsal spine

12.5 (0.16)

14.2 (0.86)

13.1 (0.95)

13.4 (0.86)

12.4 (0.63)

Length of caudal peduncle

17.1 (0.46)

21.3 (1.25)

17.6 (1.06)

17.8 (0.83)

20.7 (0.88)

Least height of caudal peduncle

8.2 (0.33)

9.1 (0.02)

11.1 (0.74)

8.6 (1.52)

8.5 (1.35)

not only our specimens are similar to G. poonaensis sensu stricto but G. poonaensis is significantly different from its closely related northern Indian species G. conirostre and other species, namely G. lonah and G. trewavasae, described from the northern Western Ghats of India. Glyptothorax poonaensis was originally described as a valid subspecies of G. conirostre. Menon (1999) elevated its status to the species level without giving any rationale and the trend was followed by Thomson & Page (2006). Jayaram (2009, 2010) however still considers the species as a valid subspecies of G. conirostre, while, Ferraris (2007) has considered the species as species inquirendae owing to the fact that the species has either been treated as valid or as a synonym of G. conirostre. Our analysis based on the data available on G. conirostre in Hora (1938) and comparison of our material of G. poonaesis with the original description of G. conirostre given by Steindachner (1867) indicates that G. poonaensis is a valid species markedly distinct from G. conirostre. Comparison of standardized characters given in (Table 3) suggests that G. conirostre is different from G. poonaensis in the head width and lengths of different fins. As compared to Glyptothorax conirostre, G. poonensis has lesser height of dorsal fin (15.1–18.1 % SL vs. 19.6–20.1 % SL), length of pectoral fin (18.6– 22.8 % SL vs. 24.2–24.3 % SL), length of ventral fin (13.7–15.8 % SL vs. 16.8–18.8 % SL), length of

longest anal fin ray (13.8–18.4 % SL vs. 18.7–19.1 % SL) and length of dorsal spine (11.1–13.4 % SL vs. 13.6–14.8 % SL). However, as compared to G. conirostre, G. poonaensis has larger head width (17.0– 21.2 % SL vs. 16.5–16.8 % SL) and inter orbital width (6.2–8.3 % SL vs. 4.7–6.0 % SL). Jayaram (2009) has separated G. poonaensis from G. conirostre based on having broader head, shorter dorsal fin and posterior insertion of pelvic fins. We therefore suggest that G. poonaensis should be considered as a valid species distinct from G. conirostre. Glyptothorax poonaensis can be differentiated from nine other species of Glyptothorax known from the Western Ghats using a combination of characters (Hora 1938; Silas 1951; Talwar & Jhingran 1991; Jayaram 2009; Gopi 2010). Glyptothorax poonaensis differs from other species known from the Western Ghats, namely G. anamalaiensis, G. annandalei, G. davissinghi, G. kudremukhensis, G. lonah, G. trewavasae and G. madraspatanum, in having smooth skin as oppose to tuberculated or granulated skins in all other species. Apart from the difference in the skin character, G. poonaensis can be easily differentiated from G. anamalaiensis in lacking (vs. having) three broad white bands on the body. Glyptothorax annandalei and G. davissinghi can be separated from G poonaensis in having plaited (vs. smooth) ventral surfaces of the paired fins. Glyptothorax poonaensis can be differentiated from G. annandalei,

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

1889

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

G. davissinghi, G. lonah, G. trewavasae and G. madraspatanum in having poorly developed (vs. well developed) adhesive apparatus. Here, poorly developed adhesive thoracic apparatus can be defined as consisting of ridges of skin with only 16 prominent striae and only anterior striae well defined while posterior striae indistinct, as oppose to well developed adhesive thoracic apparatus with more then 20 striae and both anterior and posterior striae distinctly visible. Other Glyptothorax species found in the Western Ghats, which have smooth skin, are G. housei and G.

malabarensis. Glyptothorax poonaensis differs from G. housei by a poorly developed (vs. well developed) adhesive thoracic apparatus, smooth (vs. plaited) ventral surfaces of the paired fins, shorter (vs. longer) maxillary and nasal barbels and dorsal fin origin nearer to adipose fin than to tip of snout (vs. nearer to tip of snout than adipose fin base). Glyptothorax poonaensis differs from G. malabarensis in having the thoracic adhesive apparatus poorly developed and longer than broad (vs. moderately developed, pentagonal in shape and as long as broad).

Image 1. Details of Glyptothorax poonaensis (WILD-11-PIS-004). a - Lateral; b - dorsal; c - ventral view. 1890

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885â&#x20AC;&#x201C;1898

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Image 2. Details of the head and adhesive thoracic apparatus of Glyptothorax poonaensis (ZSI Pune P/2431) a - Dorsal profile of head; b - ventral profile of head; c - details of adhesive thoracic apparatus.

Image 3. (a) Smooth (WILD-11-PIS-004), and (b) wrinkled (WILD-11-PIS-018) skin of Glyptothorax poonaensis and its comparison with (c) tuberculated skin of G. lonah (unregistered specimen collected from Koyna River).

Redescription of Glyptothorax poonaensis Detailed morphometry of G. poonaensis is given in Table 4 and details of the body structure, head structure and details of skin are presented in Images 1, 2 and 3 respectively. The redescription is based on the freshly collected specimens as indicated in Table 4. The specimens deposited in WILD match exactly in morphology the types (4 specimens bearing the registration number F12126/1) deposited at the Zoological Survey of India, Kolkata. Head depressed, body subcylindrical. Dorsal profile rises evenly from tip of snout to origin of dorsal fin then slopes gently ventrally from origin of dorsal fin to end of caudal peduncle. Ventral profile flat from snout tip to anal fin base, then slopes gently dorsally from anal fin base to end of caudal peduncle. Anus and urogenital openings located at vertical through middle of adpressed pelvic fin. Skin smooth on body and head but could be wrinkled in some specimens occurring

either as a preservation artifact or molting (Image 3). Lateral line complete, mid-lateral in position. Head depressed and broad. Snout prominent. Anterior and posterior nares large and separated only by base of nasal barbels. Gill opening broad, extending from immediately ventral to post-temporal to isthmus. Bony elements of dorsal surface of head covered with thick, smooth skin. Occipital process does not reach base of dorsal fin. On either side of supraoccipital process, supracleithrum forms two finger like projections separated by large interspace as shown by Hora (1938: fig. 1c). Eye ovoid, located entirely on dorsal half of head, its horizontal axis longest, its diameter 9.8-13.5% HL. Barbels four pairs, maxillary barbel long and slender extending to middle of pectoral fin base. Nasal barbels slender, barely reaching eye. Inner mandibular barbel origin close to midline extending up to gill opening on ventral surface. Outer mandibular barbel

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885â&#x20AC;&#x201C;1898

1891

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Table 4. Raw data of morphometric (mm) and meristic characters of Glyptothorax poonaensis Character

GP1a, b

GP2 a, c

GP3

GP4 c

GP5 b

Total length

128.14

112.98

111.13

110.08

108.38

Standard length

105.56

91.95

90.96

91.67

89.71

GP6

GP7 c

GP8

GP9 b

GP10 b

GP11

144.55

124.46

111.30

108.97

109.27

104.60

120.50

102.24

94.23

89.46

90.55

87.12

Length of caudal

24.38

19.56

19.05

19.38

19.76

24.87

21.95

19.00

21.46

19.81

17.68

Pedorsal length

37.34

31.12

31.50

32.84

32.69

40.51

35.94

35.97

31.80

31.88

30.45

Pre anal length

63.27

54.79

53.34

52.98

54.97

70.99

61.75

56.87

52.73

55.85

52.91

Prepelvic length

53.01

44.60

43.38

43.33

44.04

57.56

49.66

48.90

43.36

46.28

42.34

Pre pectoral length

18.75

17.27

16.64

17.40

16.81

20.88

17.50

16.89

16.51

17.07

16.71

Length of head

25.96

19.00

20.70

22.20

22.58

28.50

22.61

23.04

21.89

22.61

21.59

Depth of head at occiput

11.56

11.38

11.56

11.99

12.40

17.15

14.10

12.27

13.18

13.08

11.56

Depth of head at eye

9.65

8.81

8.48

9.19

9.45

12.78

10.36

8.59

9.35

8.76

8.46

Width of head

17.96

15.80

16.64

18.14

25.53

20.02

18.92

17.17

17.37

17.53

Width of head near nares

11.13

10.16

11.38

10.77

12.19

15.60

11.99

10.80

10.72

10.16

9.86

Length of snout

12.58

11.45

11.36

11.42

11.26

13.82

12.3

11.64

11.24

11.33

11.05

Eye diameter

2.69

2.57

2.54

2.57

2.79

2.67

2.41

2.59

2.92

2.69

Interorbital width

6.63

6.48

6.81

6.35

5.59

8.59

7.01

7.11

7.44

6.60

5.92

Internarial space

2.67

2.57

3.00

3.05

2.90

4.17

3.51

3.43

3.71

3.81

3.18

Gape width

10.34

8.76

8.69

8.53

9.63

11.07

8.74

9.91

8.86

9.27

8.38

Nasal barbel length

8.92

6.48

6.76

6.58

7.21

9.14

6.96

7.95

8.08

8.20

Maxillary barbel length

23.57

19.69

21.62

18.39

20.47

30.78

27.05

22.28

21.34

19.10

18.67

Innermandibular barbel length

10.26

9.63

7.34

7.62

7.92

9.02

7.24

8.36

8.79

7.75

8.38

Outer mandibular barbel length

15.57

13.67

11.89

12.50

12.75

15.93

13.16

12.70

13.34

11.53

12.01

Depth of body at dorsal origin

18.14

15.80

16.51

14.27

16.74

22.38

18.26

15.72

15.04

14.68

13.41

Depth of body at anus

15.24

13.82

14.12

13.08

14.43

21.03

17.22

13.13

13.67

13.26

12.83

Width of body at dorsal origin

16.94

15.54

14.78

14.76

17.30

19.46

16.05

17.53

15.37

16.38

14.88

Width of body at anal origin

11.23

12.24

10.72

11.07

12.32

14.83

12.45

10.97

11.51

11.13

10.21

Height of dorsal fin

17.58

15.11

13.69

15.29

15.77

21.03

18.47

14.86

15.24

14.86

15.04

Length of dorsal fin base

12.24

11.05

11.48

11.02

10.95

13.26

10.21

10.54

11.25

10.39

10.41

Dorsal spine length

11.76

11.68

10.87

11.33

11.40

15.88

12.70

11.18

11.00

11.53

11.68

Length of adipose fin base

10.97

10.36

9.68

9.53

13.54

9.93

9.19

10.54

9.65

10.67

Post adipose distance

20.98

19.38

17.83

17.91

17.40

23.11

21.21

18.82

17.78

17.58

16.89

Dorsal to adipose distance

25.02

21.84

21.39

22.73

22.15

32.64

29.46

23.37

21.26

24.26

20.88

Length of pectoral fin

21.46

19.46

16.89

17.58

19.33

27.13

23.32

17.65

18.69

18.85

17.73

Length of pectoral spine

15.09

15.11

12.45

14.61

14.35

22.86

20.83

14.35

13.54

13.77

14.20

Length of ventral fin

16.66

13.79

12.47

13.16

18.62

16.13

12.95

13.41

13.46

12.45

Length of anal fin base

11.40

9.91

8.33

9.65

7.90

12.50

11.73

10.62

10.03

11.28

9.83

Length of largest anal fin ray

16.66

15.11

13.41

14.02

13.61

16.64

16.99

14.10

15.47

16.64

13.54 17.53

Length of caudal peduncle

22.00

18.97

19.33

18.42

18.67

27.31

21.44

18.21

18.75

17.91

Least height of caudal peduncle

8.33

7.11

7.01

7.44

6.88

13.34

11.53

7.16

7.11

7.16

7.75

Length of adhesive apparatus

14.12

13.67

13.56

12.65

12.60

16.97

15.72

11.94

15.06

14.10

12.90

Width of adhesive apparatus

13.34

12.70

11.99

10.36

11.46

11.56

12.34

10.52

11.94

10.67

10.72

Dorsal fin rays

Pectoral fin rays

Ventral fin rays

ii 8

ii 9

Anal fin rays

- specimens used for DNA isolation; - deposited at Wildlife Information Liaison Development, Coimbatore, Accession numbers: GP1 = WILD-11PIS-018, GP5 = WILD-11-PIS-004, GP9 = WILD-11-PIS-005, GP10 = WILD-11-PIS-006; c - deposited at Zoological Survey of India, Western Regional Centre, Pune, Accession numbers: GP2 = P/2431, GP4 = P/2432, GP7 = P/2433 a

1892

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885â&#x20AC;&#x201C;1898

Rediscovery of Glyptothorax poonaensis

originating posteriolateral of inner mandibular barbel extending to origin of pectoral fin. Mouth inferior, premaxillary tooth band partially exposed when mouth is closed. Oral teeth small and villiform in irregular rows, premaxillary teeth in single broad semilunate band. Dentary teeth in two narrow crescentic bands separated at midline. Dorsal fin located above anterior third of body with I,5 (N=1) or I,6 (N=10) rays; fin margin convex; spine short and gently curved. Adipose fin with anterior margin concave. Caudal fin strongly forked with lower lobes slightly longer than upper lobes. Procurrent rays symmetrical, extending slightly anterior on fin base. Anal fin base ventral to adipose fin origin. Anal fin with concave anterior margin and straight posterior margin with ii,8 (N=8) or ii,9 (N=3) rays. Pelvic fin origin slightly behind the posterior end of dorsal fin base. Pelvic fin with slightly convex margin and i,5 rays. Tip of adpressed fin not reaching anal fin origin but covers anus and urogenital area. Pectoral fin with I,7 (N=1) or I,8 (N=7) or I,9 (N=3) fin rays posterior fin margin slightly convex. Anterior spine margin smooth, posterior margin with 17–21 serrations. Thoracic adhesive apparatus present, weakly developed, forming a narrow band and somewhat V shaped appearance (Image 2c), with median depression present on posterior half and extending from isthmus to level of middle of pectoral fin. Median ridges oriented longitudinally, ridges uninterrupted. In 4% formaldehyde dorsal and lateral surfaces of head grayish with yellow tinge. A dark gray patch on the dorsal profile extending from occipital process to posterior base of adipose fin. Ventral surface yellow to pale yellow. Dorsal fin gray with white band in middle, pectoral, ventral and anal fins with yellow base and gray tips. Caudal fin with black or dark gray base followed by gray tips. Head and body studded with randomly-distributed minute black dots. On the lateral surfaces of the body gray with yellow tinge sometimes give rise to brownish coloration. Molecular phylogeny ModelTest in MEGA 5 (Tamura et al. 2011) suggested that General Time Reversible + Gamma + Proportion Invariant (GTR+G+I) model was the best fit model for nucleotide substitution for our data and thus it was applied to generate phylogenetic hypothesis. The results for phylogenetic analysis

N. Dahanukar et al.

based on maximum likelihood, maximum parsimony, minimum evolution and neighbor joining are shown in Fig. 2. The phylogeny based on a combined analysis of all three data partitions (16S rDNA, cyt-b and cox1) suggests that G. poonaensis is nested within a clade consisting of species from the northern part of the Indian subcontinent and China (Fig. 2). Interestingly, G. poonaensis and G. davissinghi, both Western Ghats species, were separated by a larger distance suggesting that southern Indian Glyptothorax do not form a monophyletic group. Molecular dating of divergence times between G. poonaensis and other northern Indian species suggests that G. poonaensis diverged from other northern Indian species between 1.9 to 2.5 million years ago (Fig. 3). We used only cyt-b gene for molecular dating because (Peng et al. 2006) have considered cyt-b gene for their analysis and we are using same reference for the calibaration. Further, our total data matrix consisting of 16S rDNA, cyt-b and cox1 had non uniform substitution rates. Also, we could not use 16S rDNA and cox1 genes individually as their sequence length was small for statistical analysis. However, for cyt-b the sequence length was adequate for analysis and the null hypothesis of equal evolutionary rate throughout the tree was not rejected (p=0.2065) making the molecular dating more reliable. Distribution and population status The collection locality of one paratype of G. poonaensis is Kharadigaon (18.5450N & 73.9490E), Pune (Hora 1938; Fraser 1942), while the type locality (where three paratypes were also collected) is more vague, being merely given as “near Poona [=Pune]”. We collected the species from the Village Markal (18.6710N & 73.9810E) situated on the right bank of Indrayani River, Pune. The two collection sites are numbered 1 and 2 respectively in Fig. 4 and the associated river basins are highlighted in blue. The total area drained by the two river basins is 6105.4km2. However, it is suspected that the species could be locally extinct from the Mula-Mutha River (Kharat et al. 2003), indicating that the current extent of occurrence (IUCN 2001) of this fish could be reduced by at least half. We lack estimates of the population size of this species, but it is possible that it is relatively rare. This is based on the fact that in the extensive survey of Mula-Mutha River by Fraser (1942) only one specimen was collected.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

1893

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Figure 2. Phylogenetic position of Glyptothorax poonaensis. Phylogenetic tree constructed using (a) maximum likelihood, (b) maximum parsimony, (c) minimum evolution and (d) neighbor joining analysis using 2120 base pairs of partial 16S rDNA, cyt-b and cox1 gene sequences. Values at each node are Bootstrap values for 1000 iterations. Gagata cenia and Bagarius yarrelli are used as out groups. Species names in blue indicate northern Indian and northeastern Indian species, species names in green indicate Chinese species and species name in red are Western Ghats species.

Further, previous study on Indrayani River (Yazdani & Mahabal 1976) failed to collect this species. Our discussions with the fishermen revealed that this species, locally called as Patthar-chatu, is found only during summer and early rainy season when the water level is low and even during this period the fish is very rare. However, since directed fishing efforts for this particular species are not done, we do not have exact estimates for the species abundance. Biology The length weight relation of unsexed G. poonaensis can be described by the equation W=0.0087L3.2436 (Fig. 5, R2 = 0.933, p < 0.001). Since, the 95% confidence interval of scaling exponent was in the range 2.58821894

3.8989, the null hypothesis, stated as the found value of the exponent is not significantly different from the predicted value of 3 by isometry, could not be rejected. Thus the fish grows isometrically. Gut content of three specimens of G. poonaensis suggested that the fish feeds on benthic macroinvertebrates such as freshwater prawns (Image 4A), maxillopod crustacean (Branchiura) (Image 4B) and Odonata nymph (Image 4C). Our collection of gravid females suggests that this species probably breeds during June to August (the monsoon season). Similar observations are also made on other species of Glyptothorax (Dobriyal & Singh 1993; Nath 1994; Kaul 1994). Based on the fact that Glyptothorax are known to migrate downstream for breeding (Kaul 1994), we suspect that Markal could

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885â&#x20AC;&#x201C;1898

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Figure 3. Molecular dating of Glyptothorax poonaensis based on maximum likelyhood analysis of cyt-b gene and the molecular calibrations available for divergence time between Gagata cenia and Bagarius yarrelli and between Bagarius yarrelli and Glyptothorax fokiensis (Peng et al. 2006). White bars on each node represent the 95% confidence interval of divergence time. Color code for species names as per Figure 2.

Figure 4. Distribution of Glyptothorax poonaensis. Speceis is known only from two localities: (1) Kharadigaon (18.5450N & 73.9490E) (2) Markal (18.6710N & 73.9810E).

be the breeding ground for G. poonaensis. This is because Markal is located on the main river and there are no hill streams in its immediate vicinity. Further, according to the local fishermen, the species is found in Markal area only during June to August, which is thought to be the breeding period of the fish.

Figure 5. Length weight relationship of Glyptothorax poonaensis. Dashed lines indicate 95% confidence interval.

Threats and conservation measures There are several threats to G. poonaensis in its known range. Important threats to hill stream species like G. poonaensis include alteration of hydrological regimes because of damming, increasing pollution, deforestation leading to siltation, and introduced fish species. Dams cut the flow of water and lessen the speed of water creating semi-lacustrine conditions. These conditions may be highly disliked by hill

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

1895

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

Image 4. Food items from the gut of Glyptothorax poonaensis - (a) freshwater prawn, (b) maxillopod crustacean (Branchiura) and (c) Odonata nymph.

stream fishes like Glyptothorax, which are specialized fro living in torrent streams (Hora 1930). Also, Glyptothorax utilize gravel bed areas for spawning which are lost in rivers immediately below the dams (Kaul 1994; Nath 1994). Further, impeded water flow (both upstream and downstream of the dam) can lead to eutrophication and the creation of oxygen-poor habitats. As species of genus Glyptothorax require large amounts of oxygen in water (Hora 1930) such habitat alterations are unsuitable for the species. Similar habitat alterations can also result from urbanization leading to organic pollution in rivers. Such changes in the rivers near the study area and their possible effects on the fish fauna are already documented (Kharat et al. 2003; Wagh & Ghate 2003). As stated before, we suspect that Indrayani River at Markal could be the breeding ground for G. poonaensis as Glyptothorax species are known to migrate downstream for breeding (Kaul 1994). If this is true then pollution in this area, which is an ongoing threat, is of major concern. An ongoing threat in terms of deforestation, leading to siltation, can also affect the breeding grounds of the fish. Recently we also observed sandmining on large scale at Markal (Image 5), which is likely to affect the habitat of G. poonaensis. Another major threat to the species could be the presence of introduced exotic fish. Introduced exotic fishes have been documented as major threats to fishes in the peninsular India (Kharat et al. 2003; Daniels 2006; Raghavan et al. 2008; Knight 2010). Kharat et al. (2003) have argued that introduced fish like Oreochromis mossambica, Poecilia reticulata, Gambusia affinis, Heteropneustes fossilis, etc. in Mula-Mutha River, are threatening the existence of many native fishes and might have caused even local extinction of some species including G. poonaensis. 1896

Image 5. Sandmining in Indrayani River at (a) Markal and (b) downstream of Markal is a potential threat to G. poonaensis habitat.

Even in Indrayani River at Markal we recorded alien species such as Oreochromis mossambica and Clarias gariepinus. Although direct evidence is lacking we suspect that at least Clarias gariepinus is a potential threat to the current population of G. poonaensis as it is a voracious predator (Krishnakumar et al. 2011). Restricted distribution of the speceis, decline in the

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885â&#x20AC;&#x201C;1898

Rediscovery of Glyptothorax poonaensis

extent of occurance, ongoing threats to the habitats and possible threats to the speceis justifies the IUCN Red list threat catagory of this species as Endangered under the criteria B2ab(i,ii,iii,iv) as assessed by Dahanukar (2010). The potential breeding grounds of the fish at Markal and the upstreams of Indrayani River, especially hill streams in the adjoining hilly areas need protection. Halting of siltation by re-plantations and avoidance of pollution could be helpful in saving the breeding grounds. Management of the introduced fishes, especially Clarias gariepinus, by controlled eradication of escaped stock and increasing public awareness for avoiding further introductions (Sato et al. 2010), could also be helpful.

REFERENCES Anganthoibi, N. & W. Vishwanath (2010). Two new species of Glyptothorax from the Koladyne basin, Mizoram, India (Teleostei: Sisoridae). Ichthyological Explorations of the Freshwaters 21(4): 323–330 Altschul, S.F., W. Gish, W. Miller, E.W. Myers & D.J. Lipman (1990). Basic local alignment search tool. Journal of Molecular Biology 215(3): 403–410. Chandanshive, E.N., S.M. Kamble & B.E. Yadav (2007). Fish fauna of Pavana river of Pune, Maharashtra. Zoos’ Print Journal 22(5): 2693–2694. Chen, X.L., T.Y. Chiang, H.D. Lin, H.S. Zheng, K.T. Shao, Q. Zhang & K.C. Hsu (2007). Mitochondrial DNA phylogeography of Glyptothorax fokiensis and Glyptothorax hainanensis in Asia. Journal of Fish Biology 70: 75–93. Dahanukar, N. (2010). Glyptothorax poonaensis. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.1. <www.iucnredlist.org>. Downloaded on 13 July 2011. Dahanukar, N., R. Raut & A. Bhat (2004). Distribution, endemism and threat status of freshwater fishes in the Western Ghats of India. Journal of Biogeography 31: 123– 136. Daniels, R.J.R. (2006). Introduced fishes: a potential threat to the native freshwater fishes of peninsular India. Journal of the Bombay Natural History Society 103(2–3): 346–348. Dobriyal, A.K. & H.R. Singh (1993). Reproductive biology of a hill stream catfish, Glyptothorax madraspatanum (Day), from the Garhwal, Central Himalaya, India. Aquaculture Research 24(6): 699–706. Ferraris, C.J. Jr. (2007). Checklist of catfishes, recent and fossil (Osteichthyes: Siluriformes), and catalogue of siluriform primary types. Zootaxa 1418: 1–628. Fraser, A.G.L. (1942). Fish of Poona. Part I. Journal of the Bombay Natural History Society 43(1): 79–91.

N. Dahanukar et al.

Ghate, H.V., G.K. Wagh & S.L. Lokhande (1992). Fish fauna of the rivers Mula and Mutha, Pune, pp.105–115. In: Procedings of First National Symposium on Environmental Hydraulics, Central Water and Power Research Station, Pune. Gopi, K.C. (2010). Glyptothorax malabarensis, a new catfish (Teleostei: Sisoridae) from the Western Ghats of Kerala, India. Zootaxa 2528: 53–60. Hora, S.L. (1930). Ecology, bionomics and evolution of torrential fauna, with special reference to the organs of attachment. Philosophical Transactions of the Royal Society of London, Series B, 218: 171–282. Hora, S.L. (1938). Notes on fishes in the Indian Museum. XXXVIII. On the systematic position of Bagrus lonah Sykes, with descriptions of and remarks on other Glyptosternoid fishes from the Deccan. Records of the Indian Museum 40(4): 363–375. IUCN (2001). IUCN Red List Categories and Criteria: Version 3.1. IUCN Species Survival Commission. IUCN, Gland, Switzerland and Cambridge, UK, ii+30pp. Ivanova, N.V., T.S. Zemlak, R.H. Hanner & P.N. Hebert (2007). Universal primer cocktails for fish DNA barcoding. Molecular Ecology Notes 7(4): 544–548. Jayaram, K.C. (1995). The Krishna river System: A Bioresources Study. Occasional Paper No. 160. Records of Zoological Society of India, 167pp. Jayaram, K.C. (2009). Catfishes of India. Narendra Publishing House, New Delhi, 383pp. Jayaram, K.C. (2010). The Freshwater Fishes of the Indian Region. Second Edition. Narendra Publishing House, Delhi, 616pp. Kaul, B.L. (1994). Comparative fecundity of some Kashmir teleosts, pp.71–78. In: Nath, S. (ed.). Recent Advances in Fish Ecology, Limnology and Eco-conservation, volume 3, Daya Publishing House, Delhi. Kharat, S., N. Dahanukar, R. Raut & M. Mahabaleshwarkar (2003). Long-term changes in freshwater fish species composition in northern Western Ghats, Pune District. Current Science 84(6): 816–820. Knight, J.D.M. (2010). Invasive ornamental fish: a potential threat to aquatic biodiversity in peninsular India. Journal of Threatened Taxa 2(2): 700–704. Krishnakumar, K., A. Ali, B. Pereira & R. Raghavan (2011). Unregulated aquaculture and invasive alien species: a case study of the African Catfish Clarias gariepinus in Vembanad Lake (Ramsar Wetland), Kerala, India. Journal of Threatened Taxa 3(5): 1737–1744. Menon, A.G.K. (1999). Check List - Fresh Water Fishes of India. Occasional Paper No. 175. Records of the Zoological Survey of India, Kolkata, 366pp. Nath, S. (1994). Studies on bioecology of fishes of Jammu Province (Jammu and Kashmir State) India, Part III. Spawning ecology, pp.79–82. In: Nath, S. (ed.). Recent Advances in Fish Ecology, Limnology and Eco-conservation. Volume 3. Daya Publishing House, Delhi. Ng, H.H. & M. Kottelat (2008). Glyptothorax rugimentum, a

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

1897

Rediscovery of Glyptothorax poonaensis

N. Dahanukar et al.

new species of catfish from Myanmar and Western Thiland (Teleostei: Sisoridae). The Raffles Bulletin of Zoology 56(1): 129–134. Peng, Z., S.Y.W. Ho, Y. Zhang & S. He (2006). Uplift of the Tibetan plateau: Evidence from divergence times of glyptosternoid catfishes. Molecular Phylogenetics and Evolution 39: 568–572. Posada, D. & K.A. Crandall (2001). Selecting the best-fit model of nucleotide substitution. Systems Biology 50(4): 580–601. Quinn II, T.J. & R.B. Deriso (1999). Quantitative Fish Dynamics. Qxford University Press, New York, 542pp. Raghavan, R., G. Prasad, P.H. Anvar-Ali & B. Pereira (2008). Exotic fish species in a global biodiversity hotspot: observations from river Chalakudy, part of Western Ghats, Kerala, India. Biological Invasions 10(1): 37–40. Sato, M., Y. Kawaguchi, J. Nakajima, T. Mukai, Y. Shimatani & N. Onikura (2010). A review of research on introduced freshwater fishes: new prospectives, the need for research, and management implications. Landscape Ecology and Engineering 6: 99–108. Shaji, C.P., P.S. Easa & A. Gopalakrishnan (2000). Freshwater fish diversity of Western Ghats, pp. 35–35. In: Ponniah, A.G. & A. Gopalakrishnan (eds.). Endemic Fish Diversity of Western Ghats. NBFGR-NATP publication, National Bureau of Fish Genetic Resources, Lucknow, India, 347pp. Sharina, S.N. & Yu. P. Kartavtsev (2010). Phylogenetic and taxonomic analysis of flatfish species (Teleostei, Pleuronectiformes) Inferred from the primary nucleotide sequence of cytochrome oxidase 1 gene (Co-1). Russian Journal of Genetics 46 (3): 356–361. Silas, E.G. (1951). Notes on fishes of the genus Glyptothorax Blyth from peninsular India, with description of a new species. Journal of the Bombay Natural History Society 50(2): 367–370. Steindachner, F. (1867). Ichthyologische Notizen (IV). Sitzungsberichte der Mathematisch-Naturwissenschaftlichen Classe der Kaiserlichen Akademie der Wissenschaften 55(1): 517–534. Talwar, P.K. & A.G. Jhingran (1991). Inland Fishes of India and Adjacent Countries. Oxford-IBH Publishing Co. Pvt. Ltd., New Delhi, 1158pp. Tamura, K., D. Peterson, N. Peterson, G. Stecher, M. Nei & S. Kumar (2011). MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, doi:10.1093/molbev/msr121. Thomson, A.W. & L.M. Page (2006). Genera of the Asian catfish families Sisoridae and Erethistidae (Teleostei: Siluriformes). Zootaxa 1345: 1–96. Thompson, J.D., D.G. Higgins & T.J. Gibson (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673–4680. Tilak, R. & D.N. Tiwari (1976). On the fish fauna of Poona District (Maharashtra). Newsletter Zoological Survey of India 2: 193–199. Tonapi, G.T. & L. Mulherkar (1963). Notes on the freshwater fauna of Poona, Part:1, Fishes. Proceedings of the Indian Academy of Sciences 58: 187–197. Vishwanath, W. & I. Linthoingambi (2005). A new sisorid catfish of the genus Glyptothorax Blyth from Manipur, India. Journal of the Bombay Natural History Society 102(2): 201–203. Wagh, G.K & H.V. Ghate (2003). Freshwater fish fauna of the rivers Mula and Mutha, Pune, Maharashtra. Zoos’ Print Journal 18(1): 977–981. Yadav, B.E. (2003). Ichthyofauna of Northern Part of Western Ghats. Records of the Zoological Survey of India, Occasional Paper No. 215, 40pp. Yazdani, G.M. & A. Mahabal (1976). Fishes of Indrayani river. Biovigyanam 2: 119–121. 1898

Author Detail: Neelesh Dahanukar works in ecology and evolutionary biology with an emphasis on statistical and mathematical Manawa Diwekar is a molecular analysis. biologist with special interests in understanding molecular evolution. Mandar Paingankar is a molecular biologist and works on vector biology with an emphasis on host parasite interactions. He works on animal ecology as a hobby.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1885–1898

JoTT Communication

3(7): 1899–1908

Some aspects of the ecology of the Indian Giant Squirrel Ratufa indica (Erxleben, 1777) in the tropical forests of Mudumalai Wildlife Sanctuary, southern India and their conservation implications Nagarajan Baskaran 1, S. Venkatesan 2, J. Mani 3, Sanjay K. Srivastava 4 & Ajay A. Desai 5 Bombay Natural History Society, Bear Bungalow, Kargudi, The Nilgiris, Tamil Nadu 643211, India Present Address: Asian Nature Conservation Foundation, Innovation Centre, Indian Institute of Science, Bengaluru, Karnataka 560012, India 4 Tamil Nadu Forest Department, Panagal Building, No. 1 Geenis Road, Saidapet, Chennai, Tamil Nadu 600015, India 5 Present Address: BC 84 Camp, Belgaum, Karnataka 590001, India Email: 1 baskar@ces.iisc.ernet.in (corresponding author), 4 sks2700@yahoo.co.in, 5 ajayadesai.1@gmail.com 1,2,3,5 1

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Renee Borges Manuscript details: Ms # o2593 Received 01 October 2010 Final received 29 January 2011 Finally accepted 09 July 2011 Citation: Baskaran, N., S. Venkatesan, J. Mani, S.K. Srivastava & A.A. Desai (2011). Some aspects of the ecology of the Indian Giant Squirrel Ratufa indica (Erxleben, 1777) in the tropical forests of Mudumalai Wildlife Sanctuary, southern India and their conservation implications. Journal of Threatened Taxa 3(7): 1899–1908. Copyright: © Nagarajan Baskaran, S. Venkatesan, J. Mani, Sanjay K. Srivastava & Ajay A. Desai 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication.

Keywords: Breeding, diet, ecology, feeding, population, ranging, Ratufa indica.

INTRODUCTION

Author Detail: see end of this article. Author contribution: The first author designed and conducted the present study with technical support from the fourth and fifth authors. The second and third authors helped the first author partly in field data collection. Acknowledgement: We acknowledge the Forest Department of Tamil Nadu for suggesting and funding the study. We thank Mr. J.C Daniel, Honorary Secretary, Bombay Natural History Society for his encouragement and support during the project.

OPEN ACCESS | FREE DOWNLOAD

Abstract: The Indian Giant Squirrel Ratufa indica, an endemic species to India, is widely distributed from the evergreen to moist and dry deciduous forests of Western and Eastern Ghats and the central Indian hills. We studied its population distribution, activity, feeding, ranging and nesting behaviour across three major habitats in the tropical forests of Mudumalai Wildlife Sanctuary, southern India, during 1998–2000 to manage the species effectively. Extensive survey of the three major habitats—tropical moist, dry deciduous and dry thorn—in the sanctuary shows that its distribution is continuous in moist and dry deciduous forests with good canopy contiguity and patchy along riverine areas in dry thorn and dry deciduous forests with sparse trees and broken canopy. Density estimates using 55 direct sightings from 199 km line transects show a mean of 2.9 (± 0.313) squirrels/km2. Daylight activity and feeding patterns assessed through 24,098 minutes of focal sampling reveal that animals feed and rest equal amounts of time. The diet constitutes seeds, bark, petioles, leaves and fruits from 25 plants, with Tectona grandis as the principal food source (41%). Its home range size varied from 0.8–1.7 ha with a mean of 1.3ha. Nesting characteristics assessed through 83 nests surveyed along 54km transects showed that the squirrel uses 15 of the 33 tree species found, with higher preference to Schleichera oleosa and Mangifera indica. Nest trees are significantly larger in height, gbh and canopy contiguity than nearest non-nest trees, which are attributed to better protection and escape from predators. Maintenance of diverse natural habitats and reduction in anthropogenic pressure are measures suggested for the conservation of giant squirrel populations in the study area.

The Indian Giant Squirrel Ratufa indica is a large arboreal squirrel endemic to India (Image 1). The species is widely distributed in peninsular India (Abdulali & Daniel 1952; Corbet & Hill 1992) from the evergreen to moist and dry deciduous forests of Western (Ramachandran 1988, 1992; Rout & Swain 2005), and Eastern Ghats (Kumara & Singh 2006) and central Indian Hills (Agarwal & Chakraborty 1979). The species is listed as Least Concern in Red List of IUCN (Rajamani et al. 2009) and of Schedule I (Part I) of the Indian Wildlife Act (1972). The species, like many other squirrels of its genus, is a top canopy dweller, which occasionally comes to the ground (Ramachandran 1988), mostly to overcome breaks in canopy continuity. The species mostly feeds on seeds, leaves, flowers and bark from trees. It is a solitary living species, constructs globular nests or dreys with leaves and twigs (Borges 1989; Thorington & Cifelli 1989; Ramachandran 1992). Considering its arboreal nature and dependence on

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

1899

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Image 1. The Indian Giant Squirrel Ratufa indica

trees for food, shelter and movement, it is apparent that the composition of tree species and structural attributes of the forests play a major role in the use of the habitat by the giant squirrel (Borges 1989; Ramachandran 1992; Datta & Goyal 1996). Understanding the species distribution and its resource requirements are essential for its long-term conservation plans. Ratufa indica centralis is very common in parts of Nilgiri Biosphere Reserve; yet no published ecological data essential for the management of the species is available from this region. This paper addresses the basic ecological aspects such as population, factors influencing its distribution, foraging, nesting and ranging behaviour of the Indian Giant Squirrel in the tropical forests of Mudumalai Wildlife Sanctuary, which is part of the Nilgiri Biosphere Reserve.

METHODS Study area: The study was carried out in Mudumalai Wildlife Sanctuary (presently a Tiger Reserve) during 1998–2000. The sanctuary lies between 11032’–11045’N and 76020’–76045’E, and is a part of the Nilgiri Biosphere Reserve. It is bounded on the north by Bandipur Tiger Reserve, to the west by Wayanad Wildlife Sanctuary and to the south and east by Nilgiri North Forest Division. The terrain is undulating with an average elevation of 900–1000 m. Only the Moyar River and a few bigger streams that drain into it are perennial. Additionally, several large manmade water holes act as water sources during the dry season for wild animals. The study area has two 1900

wet seasons (the southwest monsoon: May–August and northeast monsoon: September–December) and a dry season (January–April). The rainfall has a marked east-west gradient with eastern areas receiving 600– 800 mm of precipitation annually and the western regions 1800–2000 mm. Temperature ranges from 80C in December to 350C in April (Baskaran 1998). The vegetation follows a gradient similar to the rainfall, with dry thorn forests dominating the eastern side of the sanctuary followed by dry deciduous short grass and dry deciduous tall grass forests in the middle, and moist deciduous forests to the western side. There are also a few patches of semievergreen forest along the western side of the sanctuary. We selected four sites for detailed behavioural data collection on giant squirrels in four different habitats, which include moist deciduous forest, a dry stream in the dry deciduous forest, a riverine habitat and a teak plantation. Distribution pattern: We mapped the distribution of giant squirrel based on the presence and absence of squirrel direct sightings and their nests walking along 65 transects laid across the sanctuary covering all major and microhabitats used for density estimation of squirrel and their nests. In all the major habitats, an effort was made to sample the riverine (along river and stream) microhabitats as they are distinct from surrounding areas in terms of tree species composition and canopy contiguity, especially in the dry deciduous and dry thorn forest. Population density: We used the line transect method (Burnham et al. 1980) to estimate population density. In total, 65 transects with length varying from 2–4 km, laid systematically covering all the habitats and microhabitats across the sanctuary were sampled once partly (16 transects) during May 1998 and rest in May 1999. The transects were walked during morning (0600–1000 hr) or evening (1600–1800 hr) and at every sighting of squirrel we recorded the perpendicular distance, using range finders and group size of the squirrel. In total, 55 sightings were recorded from 199.3km line transect walk. Mean group (cluster) size (G) and its standard error (SE) was estimated based on data where complete counts of individuals were obtained on transects. Population density was estimated using distance-sampling techniques following the software DISTANCE version 6.0 (Buckland et al. 2004; Thomas et al. 2005). Grouping the data into 10-m perpendicular intervals,

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

Ecology of the Indian Giant Squirrel

squirrel cluster density (C) and its SE was estimated evaluating different models of detection probability, viz. uniform, half-normal and hazard-rate with three series adjustment terms and used the minimum Akaike Information Criteria (AIC) as the standard model selection procedure to select the best model for estimating density. Individual squirrel density (D) was arrived at multiplying the mean group size (G) by the squirrel cluster density (C). Standard error of individual squirrel density (seD) was calculated using standard error of cluster density (seC) and standard error of mean group size (seG) using Goodman’s (1960) formula: (seD) = C (seG) + G (seC) – (seC) (seG) and used the same to work out the 95% confidence limit of individual squirrel density. Activity pattern and feeding: Data on activity and feeding were recorded through direct observation using the focal animal sampling method (Altmann 1974). Observations were made for a period of two days (six hours per day: either 0600–1200 hr or 1200–1800 hr) per month from each site. Daylight hours from 0600 to 1800 hr were divided into 12 one-hour blocks for sampling and an attempt was made to sample each one-hour block at least once a month. Focal sampling was made at 15min interval (of 10min observations and 5min break). Thus, observations started at nearest 1st or 15th or 30th or 45th minute of any hour of sighting time. At every focal sampling, the subject was continuously observed for a period of one minute and recorded its activity (feeding, resting, moving and others: inter and intraspecific activities, drinking/ water licking (from tree holes and leaf surfaces), urination, defecation and nest construction) at every minute interval for a period of 10 minute; in case of feeding, plant species and parts consumed. While on feeding, the squirrel often goes to the tip of branches and collects (cuts) the food items (fruits, seeds, leaves etc) with its mouth and moves to the thick horizontal branches by holding the food items mostly in the mouth and some time in the forelimb, where branch is stronger and it is convenient for the squirrel to sit and feed. In the present study, such movements over small distances within the same tree while on feeding (with the food materials in mouth or forelimb) were clubbed with feeding activity. Time spent on various activities and feeding of different plant species was computed season-wise for each habitat separately from the 12 month observations.

N. Baskaran et al.

Nesting characteristics: Nest site characteristic features were collected along 25 transects covering three major habitats in the sanctuary. For each nest located along the transect, we have recorded variables such as tree species used for nesting, their height, girth at breast height (GBH), number of main branches, canopy heights, canopy contiguity on all four directions, height of nest from ground. Squirrels jump from one tree to another and gaps between trees of <10 foot and with larger branches at the edge, which the squirrel use to jump, were also considered as continuous canopy. In addition, to compare the characteristic features of nest trees with non-nest trees, data on tree species composition, presence or absence of giant squirrel nest in each tree and variables recorded for nesting trees were collected along the transect at 100m interval using ‘point center quadrat’ method. Home range size: Data on ranging behaviour was collected for four squirrels observed for feeding observations from three habitats over a period of 5–8 months. The sighting location and maximum distance moved from nesting trees on the day when the squirrel was followed for feeding observation were marked on the topo sheet. The home (annual) range was estimated connecting the outermost locations following minimum polygon method (Jennrich & Turner 1969).

RESULTS AND DISCUSSION Distribution pattern: Direct sighting of giant squirrel and its nesting across three major habitats showed its distribution to be continuous in moist deciduous forest on the western side of the sanctuary (Fig. 1) and patchy in dry thorn forest on the eastern side, where it is largely restricted to the streams representing riverine habitat supported by large trees with better canopy contiguity. On the other hand, in the dry deciduous forest with large trees and good canopy contiguity (around the central areas of the sanctuary), its distribution is more widespread, but in areas of sparse/stunted trees with broken canopy interspersed with savanna grasslands or extensive Shorea talura regeneration, it is restricted to stream microhabitat similar to that of dry thorn forest. In general, Indian giant squirrel appears to be adapted to evergreen and moist deciduous habitats, while extending into closed canopy areas of dry deciduous forest. Its use

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

1901

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Figure 1. Map showing the distribution of Indian Giant Squirrel Rattufa indica in Mudumalai Wildlife Sanctuary, India

of closed canopy dry deciduous forest appears to the limit of its ecological range. However, it can extend beyond this into more open dry deciduous and dry thorn forests using riverine habitats or riverine type of microhabitats that exist along the streams. The riverine/stream microhabitats also act as corridors between two patches of optimal habitats besides being habitats at some places. However, anthropogenic pressure and developmental activities have cut-off such corridors resulting in isolation of squirrel population like the one found along the Avarahalla stream in Mudumalai. Overall, the distribution patterns of the species observed in the sanctuary suggest that canopy contiguity is the major factor influencing the giant squirrel distribution as reported elsewhere (Hall 1991; Ramachandran 1992; Rout & Swain 2005). Population density: A total of 55 sightings were made, with a mean group size of 1.16 squirrels/ 1902

sighting across 199.3km, amounting to a mean density of 2.9 individuals/km2 (LCL 2.5 squirrels/km2 and UCL 3.2 squirrels/km2) (Table 1). Sampling covered large areas like dry thorn forests along the eastern side of the sanctuary and semi-open canopied woodlands in parts of the northern side of the sanctuary, which do not have squirrels or support low density, resulting in lower overall densities. The density of giant squirrel estimated (2.9 squirrels/ 2 km ) in Mudumalai Sanctuary is comparable to that of Bandipur Tiger Reserve (2.4 giant squirrels/km2) (Jathana et al. 2008), an adjoining park in the landscape with similar habitat conditions. However, our estimate is lower than the ecological densities estimated for the parts of Bhadra Tiger Reserve (Muthodi: 10.2 squirrels/ km2 and Lakkavalli: 12.3 squirrels/km2) (Jathana et al. 2008) with deciduous habitats dominating the sampling areas. Borges et al. (1998) report densities as high as

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899â&#x20AC;&#x201C;1908

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Table 1. Density of Indian Giant Squirrel estimated in Mudumalai Wildlife Sanctuary using line transect method and DISTANCE software Values

Effort (distance in km)

199.3

Number of cluster (group) detections (n)

Encounter rate (squirrel clusters/km)

0.28

Cluster density/ km2 ± SE

2.58±0.171

Cluster density % co-efficient of variation

6.97

Cluster density 95% CI lower-upper

2.14–2.83

Model selected

Uniform

Adjustment

Cosine 1

Minimum AIC

487.9

Mean cluster size ± SE

1.16±0.050

Squirrel density / km2 ± SE

2.9±0.313

Squirrel density 95% CI lower-upper

2.5–3.2

12–66/km², respectively, in the semievergreen and evergreen habitats of Bimashankar Wildlife Sanctuary, Maharashtra. These are, however, ecological densities and a true comparison cannot be made with the present study. The findings of the present study and the earlier studies suggest that habitat with primary forests (semievergreen and evergreen) with better canopy cover and more tree species density and diversity is likely to support higher density of giant squirrels than secondary forests (deciduous and dry thorn). Activity pattern: A total of 24,098 minutes of observation were made using focal animal sampling to study the activity budget of the giant squirrel (Fig. 2). Feeding (47%) and resting (47%) together accounted for 94% of the squirrel’s daily activity. Time spent on movement (other than while feeding) accounted for 5.1% of the time and all other activities together accounted for just 1.2% of the squirrel’s daily activity. Similarly, giant squirrels in the deciduous forests of Parambikulam Wildlife Sanctuary spend major part of their day time on feeding (49.6%) and resting (28.2%) (Ramachandran 1992). Borges et al. (1998) also recorded feeding and resting as the major activities accounting for over 75% of the squirrel’s daily activity. The lower time on feeding and resting reported by Borges et al. (1998) compared to the present study could be due to (i) differences in scoring (defining) movement during observation, as we have treated movements within a tree while feeding as feeding as well as (ii) spatial difference in quality of food sources

60 60

Time Time spent spent(%) (%)

Parameters

70 70

50 50 40 40 30 30 20 20 10 10

Feeding

Resting

Moving

Others

Figure 2. Percent of time spent on different activities by Indian Giant Squirrel in Mudumalai Wildlife Sanctuary (error bar = standard deviation, in activities others include inter- and intra-specific behaviours, drinking, urination, defecation and nest building)

available on which the squirrels mostly feeds on. Feeding Diet species composition: Data on feeding on various food plants and their parts eaten were arrived from 24,098 focal sampling observations. The squirrel in the sanctuary was observed to use 25 species of plants, mostly tree, except Lantana camara and Loranthus sp. (Appendix I). The contribution of various plant species to the diet of squirrel varied from more than 41% to less than 0.1%. Despite feeding on 25 species, the bulk of the diet (83.45%) came from only five species while another seven species contributed 11.72% (Table 2). The remaining 14 species (4.83% of diet) contributed only marginally to the overall diet of giant squirrels. Teak was the most significant contributor to the diet of squirrel and formed 40.9% of the overall diet. Terminalia tomentosa, Grewia tillifolia and Lagerstoemia lanceolata accounted for 16.5, 14.5 and 5.7% of the squirrel’s diet respectively. The parasitic epiphyte Loranthus sp. was the only major non-tree species, which accounted for 5.9% of its diet. All other species individually contributed less than 3% of the squirrel’s diet. R. indica are known to feed intensively (around 80%) on few species over a large variety of food plants, both in the deciduous (Ramachandran 1992) and evergreen (Borges et al. 1998) forests of southern India. Plant part selection: The giant squirrel feeds on seeds, fruits, flowers, bark, petiole and leaves from different plants (Table 2). Seeds (31.3%) and tree bark (30.4%) are two major components of its diet accounting together for 61% of the diet. Flowers and fruits contributed nearly 20%, while leaves and

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

1903

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Table 2. Percent contribution of various plant species and their parts to the diet of Indian Giant Squirrel in Mudumalai Wildlife Sanctuary Plant species

Parts eaten (%) Seed

Bark

Petiole

Leaf

Flower

Fruit

Total

Tectona grandis

31.12

4.8

2.47

0.63

1.86

40.88

Terminalia tomentosa

0.13

6.73

4.65

3.13

0.92

0.93

16.49

Grewia tiliifolia

8.38

0.45

1.75

1.08

2.84

14.5

Loranthus sp.

0.24

0.91

0.39

2.97

1.38

5.89

Lagerstroemia lanceolata

2.85

1.1

0.89

0.85

5.69

Bombax ceiba

0.88

0.35

1.1

2.33

Anogiessus latifolia

2.0

Randia dumetorum

1.6

Oogina oginensis

0.88

0.68

1.56

Mangifera indica

0.51

0.15

0.79

1.45

Terminalia bellerica

1.29

0.15

1.44

Ficus sp.

1.26

Others (13 spp.)

2.34

0.46

1.02

0.57

0.44

4.83

31.25

30.39

10.04

8.67

10.18

9.39

99.92

Total

petiole accounted for nearly 19%. Seeds and bark are generally available almost round the year and therefore they form the bulk of the squirrelâ&#x20AC;&#x2122;s diet and these could also be due to the high calorific content in these plant parts as reported elsewhere for the same species (Borges 1989) and North American tree squirrel Tamiasciurus hudsonicus and T. douglassi (Smith 1968). Flowers and fruits are however very seasonal and are consumed intensively when available. However, their restricted seasonal availability results in lower contribution to the annual (overall) diet even when their seasonal contribution is extremely high. Leaves and petioles, on the other hand, are available for much longer duration but their contribution to the overall diet is lower depending on the growth stage at which squirrels prefer them and also the seasonality of some deciduous species. Similar to the present results, seeds and barks form the major part of the giant squirrels diet reported earlier for Mudumalai: the present study area (Thorington & Cifelli 1989) and elsewhere in southern India (Ramachandran 1992). Ramachandran (1992) states that the species is basically a seed feeder, switching to leaves and bark when seeds are not available. In contrast to the present study, Borges et al. (1998) report that leaves (immature and mature) formed over 62% of the diet in an evergreen forest. As mentioned above, in the present study, the deciduous nature of the habitat would make 1904

the availability of leaves seasonal and thereby reduce their overall contribution to the diet. In the evergreen habitat, bark formed only 6.5% of the diet (Borges et al. 1998), and fruits and flowers over 31%. This could be due to the extended availability of flowers and fruits in evergreen forests (Borges et al. 1998) than deciduous forest. This allows squirrels to increase the intake of these food items and reduce that of bark, which may not be nutritionally as rich as flower and fruits. The higher dependence on bark indicates the squirrelâ&#x20AC;&#x2122;s adaptation to survive in a habitat that does not provide the most preferred resources throughout the year. Higher dependence of R. indica on low quality fibrous food have been reported elsewhere in southern India (Borges 1992, 1993) Further, data on the seasonal feeding and use of plant parts, as shown in Desai et al. (1999), give a better insight into these aspects. Nesting behaviour and abundance: The giant squirrel constructs globular nests or dreys using leaves and twigs, multiple in numbers within their home range. In total, 83 nests were located along 54.2km transects, giving an encounter rate of 1.5 nests/km of transects and the encounter rate varied in different habitats (1.8, 1.5 and 1.0 nests/km, respectively, in the moist, and dry deciduous and dry thorn forests). The higher abundance of nest in moist deciduous forest compared to dry deciduous and thorn dry forest could

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899â&#x20AC;&#x201C;1908

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Table 3. Mean measures of various parameters studied for nest and non-nest trees and their statistical significance Parameters studied

Nesting tree species (n = 83)

Non-nesting tree species (n = 280)

Man-Whitney U test

Girth at breast height (cm)

233.1

170.2

u = 6697, p = < 0.001

Tree height (m)

18.8

16.5

u = 9079, p = < 0.001

Canopy height (m)

10.6

8.7

u = 8452, p = < 0.001

Number of branches

4.0

3.1

u = 8483, p = < 0.01

Canopy contiguity (%)

88.2

77.7

u = 8721, p = < 0.001

be attributed to better canopy contiguity in the former habitat than the latter as reported elsewhere (Srinivas et al. 2008). Nest tree selection: Of the 33 tree species recorded along transects, the squirrel preferred only 15 species for nest building (Appendix I). A statistical analysis performed to see whether the selection of nest trees was in proportion to their availability (in the same habitat) showed a significant difference (χ2 = 39.26, df =14, p < 0.001), as some species were selected more often than expected, while others were selected less indicating preference for a few species. Schliechera oleosa was the most preferred tree species for nesting followed by Mangifera indica. Although T. grandis had 15 nests, its use was in proportion to its abundance or availability in the forest. The high preference for M. indica and S. oleosa, which are found mostly along rivers and streams, could be due to their dense canopy cover, and higher canopy height and contiguity that could offer better protection and escape from predators. Nest tree characters: Squirrels prefer trees with large gbh and taller height classes (both tree and its canopy) and number of branches (Table 3) for nest building. The nesting trees were significantly larger in all characteristics than the non-nesting ones sampled in the population. Such biased selection towards mature trees with greater canopy contiguity could facilitate easy movement to and from the nest in all directions, a major advantage to escape from predators and to move to other parts of the home range for foraging and other activities as reported by Ramachandran (1992). Nest characters: Nests are not built on trees randomly but mostly at the highest point on the tree that offered a good location including cover that provide maximum security. Majority of the nests (68.7%) were located at greater than 15m of the tree height, while another 26.5% were between 10 and 15m of the tree height. Only 4.8% nests were located at between 5

and 10m of the tree height and in all the cases over 70% of the tree height. These results coupled with the results of nest tree characters show that the squirrels prefer the largest trees available and highest locations on the trees within their home range to build their nests. The selection is however strongly influenced by tree species and their physical characteristics including canopy contiguity as reported elsewhere (Datta & Goyal 1996) for the species. Home range: The duration of sampling was not equal among all the four squirrels observed in four habitats. Data on the home range size of squirrels in the dry deciduous stream, teak plantation and riverine habitats were based on eight months duration each. While data for the squirrels in moist deciduous forest represents five months, as we had to change the focal animal in this habitat due to difficulty of accessing the location from our base camp during rainy season. The home range size varied from 0.8 to 1.7 ha, with squirrels in the moist deciduous (1.7ha) and teak plantation (1.6ha) having larger home range than those in the riverine (1.1ha) and dry deciduous streams (0.8 ha). The mean home range size was 1.3ha (SD = 0.415, n = 4). Considering the 5–8 months of observation and just 1–2 days of ranging data per month, the range size estimated should be considered as minimum. However, the mean home range size estimated in this study is comparable to that reported by Borges (1989) (approximately 1ha), Borges et al. (1998) (1.91ha n = 11), but much smaller than that reported by Ramachandran (1988) (13.4ha). Though the squirrel is considered territorial, there have been instances of squirrels from the adjoining areas intruding into the home ranges of the focal study animals observed during direct observations indicating some degree of overlap in space among neighbouring individuals. In addition, many squirrels sharing a single food resource (i.e. M. indica tree while in fruiting stage) was also observed, even though there were also signs of aggression.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

1905

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Conservation implications The data on feeding showed that the giant squirrel is largely dependent on a few species of trees for the bulk of its diet. This could be due to the paucity of suitable food species (diversity and richness). There is a need to recognize the fact that a diverse natural habitat with mature tree is important for giant squirrel not only for feeding but also for nesting and movement. Modification of habitat through monoculture plantation and or selective felling of mature trees for timber would lead to a decline in habitat quality. However, at present, these do not apply to protected areas in India; such practices in the past to some extent depleted the quality of habitats for the giant squirrels in the sanctuary. Supplementing or enriching the habitat through planting of preferred tree species is not suggested, as this may not be cost effective but fire protection may be strengthened as frequent fires can retard the regeneration of many natural species depleted by past exploitation of these forests. The importance of riverine habitats and similar microhabitats associated with streams for facilitating giant squirrel distribution and movement in marginal, patchy and fragmented habitats has been highlighted. It must also be recognized that the plant species associated within these macro/microhabitats are more similar to evergreen/moist deciduous species and they may not be as fire resistant as dry deciduous species. Such species when continuously exposed to annual fire will not be able to regenerate successfully resulting in depletion of the riverine species and breaks in canopy continuity due to gradual change in vegetation composition. Therefore, it is essential to recognize the vital role of such small habitats and extend special protection to them. Similarly, there is a need to ensure the canopy continuity of the Moyar riverine habitats between Kargudy and Teppakadu with adjoining habitats, where interstate highway has broken the canopy contiguity, which is impeding the squirrels’ access to the optimal resource patches.

1906

REFERENCES Abdulali, H. & J.C. Daniel (1952). Race of the Giant Squirrel (Ratufa indica). Journal of the Bombay Natural History Society 50: 467–474 Agarwal, V.C. & S. Chakraborty (1979). Catalogue of mammals in the Zoological Survey of India, Rodentia, Part I - Sciuridae. Records of Zoological Survey of India 74: 333–481. Altmann, J. (1974). Observational study of behaviour sampling method. Behaviour 49: 227–265 Baskaran, N. (1998). Ranging and resource utilization by Asian Elephants (Elephas maximus) in Nilgiri Biosphere Reserve, South India. PhD Thesis, Bharathidasan University, Tiruchirappalli, India, iii+138pp. Borges, R. (1989). Resource heterogeneity and the foraging ecology of the Malabar Giant Squirrel (Ratufa indica). PhD Thesis, University of Miami, Florida. Borges, R.M. (1992). A nutritional analysis of foraging in the Malabar Giant Squirrel (Ratufa indica). Biological Journal of the Linnean Society 47: 1–21. Borges, R.M. (1993). Figs and Malabar Giant Squirrels in two tropical forests in India. Biotropica 25: 183–190. Borges, R., R.S. Mali & H. Somanathan (1998). The status, ecology and conservation of the Malabar Giant Squirrel Ratufa indica. Final report, Wildlife Institute of India. Buckland, S.T., D.R. Anderson, K.P. Burnham, J.L. Laake, D.L. Borchers & L. Thomas (2004). Advanced Distance Sampling. Oxford University Press, Oxford, United Kingdom, 414pp. Burnham, K.P., D.R. Anderson & J.L. Lake (1980). Estimation of density from line transects sampling of biological populations. Wildlife Monograph 72: 1–72 Corbet, G.B. & J.E. Hill (1992). The mammals of the IndoMalayan region. Natural History Museum Publications, Oxford University Press, Oxford, England, vii+488pp. Datta, A. & S.P. Goyal. (1996). Comparison of forest structure and use by the Indian Giant Squirrel (Ratufa indica) in two riverine forests of Central India. Biotropica 28(3): 394– 399. Desai A.A., N. Baskaran, S. Venkatesan & J. Mani (1999). Ecology of the Malabar Giant Squirrel (Ratufa indica) in Mudumalai Wildlife Sanctuary and National Parks. Technical Report. Bombay Natural History Society and Tamil Nadu Forest Department. Goodman, L. (1960). On the Exact Variance of Products. Journal of the American Statistical Association 55: 708– 713. Hall, J.H. (1991). A field study of the Kaibab Squirrel in Grand Canyon Park. Wildlife Monograph 75: 54pp. Indian Wildlife Act (1972). The Indian Wildlife Protection Act, 1972, (as amended up to 1993). <http://envfor.nic. in/legis/wildlife/wildlife1.html> Downloaded on 27 May 2010. Jathana, D., N.S. Kumar & K.U. Karanth (2008). Measuring Indian giant squirrel (Ratufa indica) abundance in southern

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

Appendix 1. Number of plant species eaten by squirrel recorded during feeding observations and tree species recorded in transect during nest survey (Y indicates the species eaten by squirrel)

Plant species

Plant species eaten (n = 25)

Number of tree species recorded in transect during nest survey (n = 31) # of individual recorded (n = 412)

% of individuals with nest (n = 83)

Aleodendron glocum

Anogiessus latifolia

4.4

Bambusa arundinacae

Bauhinia recemosa

Bombax ceiba

Butea monosperma

Cassia fistula

Cordia domestica

Dalbergia latifolia

Erthroxylon monogynum

Ficus sp.

Garuga pinnata

Gmelina arborea

Grewia tillifolia

22.2

Hymenodictylon sp.

Kydia calycina

Lagerstroemia lanceolata

Lantana camera

Loranthus sp.

Mangifera indica

35.2

Mitragyna parvifolia

25.0

Oogina oginensis

Ouginia oojeinensis

Phyllanthus emblica

Pterocarpus marsupium

100

Pungamia pinnata

Radermachera xylocarpa

Randia dumetorum

50.0

Schelichera oleosa

65.4

Stereospermum chelonoides

18.2

Syzygium cumini

24.0

Tamarindus indica

33.3

Tectona grandis

25.0

Terminala tomentosa

11.1

Terminalia bellerica

18.2

Terminalia chebula

Terminalia paniculata

11.1

Vitex sp.

Unidentified sp.

100

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899â&#x20AC;&#x201C;1908

1907

Ecology of the Indian Giant Squirrel

N. Baskaran et al.

India using distance sampling. Special editing: Arboreal squirrel. Current Science 95(7): 885–888. Jennrich, R.I. & F.B. Turner (1969).Measurements of non-circular home ranges. Journal of Theoretical Biology 22: 227–237. Kumara H.N. & M. Singh (2006). Distribution and relative abundance of giant squirrels and flying squirrels in Karnataka, India. Mammalia 70: 40–47. Rajamani, N., S. Molur & P.O. Nameer (2009). Ratufa indica. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.1. <www.iucnredlist.org>. Downloaded on 12 July 2011. Ramachandran, K.K. (1988). Ecology and behaviour of Malabar Giant Squirrel Ratufa indica maxima (Schreber) 1788. Report of the Project Wild 04/83. Division of Wildlife Biology, Kerala Forest Research Institute, Peechi, Kerala, 47pp. Ramachandran, K.K. (1992). Certain aspects of ecology and behaviour of Malabar Giant Squirrel Ratufa indica (Schreber). PhD Thesis. Department of Zoology, University of Kerala, 191pp. Rout, S.D. & D. Swain (2005). Status of Giant Squirrel (Ratfa indica) in Similipal Tiger Reserve, Orissa, India. Indian Forester 131(10): 1363–1372. Smith, C.C. (1968). The adaptive nature if the social organization in the genus of tree squirrels, Tamiasciurus. Ecological Monograph 38: 31–63. Srinivas, V., P.D. Venugopal & S. Ram (2008). Site occupancy of the Indian Giant Squirrel Ratufa indica (Erxleben) in Kalakad-Mundanthurai Tiger Reserve, Tamil Nadu, India. Special editing: Arboreal squirrel. Current Science 95(7): 889–894. Thomas, L., J.L. Laake, S. Strindberg, F.F.C. Marques, S.T. Buckland, D.L. Borchers, D.R. Anderson, K.P. Burnham, S.L. Hedley, J.H. Pollard, J.R.B. Bishop, & T.A. Marques (2005). DISTANCE, version 5.0, beta 5. Research Unit for Wildlife Population Assessment, University of St. Andrews, United Kingdom. [Online] Available at www.ruwpa.st-and.ac.uk/distance/. Thorington, R.W. Jr. & R.L. Cifelli (1989). The usual significance of the giant squirrels (Ratufa), pp. 212–219. In: Daniel, J.C. & J.S. Serrao (eds.). Conservation in Developing Countries: Problem and Prospects. Proceeding of the Centenary Seminar of the Bombay Natural History Society. Oxford University Press.

1908

Author Detail: N. Baskaran is presently a senior scientist at the Asian Nature Conservation Foundation, Indian Institute of Science, Bangalore. He has two decades of research experience in studying behavioural ecology of an umbrella species ‘the Asian elephant’ across Eastern, and Western Ghats and Eastern Himalayas. In addition, experienced in assessing biodiversity, habitats and behavioural ecology of mammalian species such as Sloth Bear, Grizzled Giant Squirrel and Four-horned Antelope. S. Venkatesan is a wildlife biologist, completed his PhD in Marine Biology and continue working on marine organism research and conservation. J. Mani is a wildlife biologist but has shifted to non-wildlife field since 1999. Sanjay K. Srivastava is presently a Cheif Conservator of Forests in Tamil Nadu. He has been specilizing on Geographical Information System and Remote Sensing for the past ten years. Ajay A. Desai is a wildlife biologist specialized on Asian Elephants through studies on behaviour, ecology and conservation over the past three decades. He consults for the conservation projects in Asian Elephant range counties. He is the co-chair of the IUCN SSC Asian Elephant Specialist Group, and Steering Committee Member of Project Elephant Govt. of India. Justification for delayed publication: Though the data was collected over a decade back (1998–2000), the findings are still important, as there exist no detailed published data on the ecology and behaviour of the species from Nilgiri Biosphere Reserve, which are essential for the conservation planning of the species -N. Baskaran.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1899–1908

JoTT Communication

3(7): 1909–1918

Physical characteristics, categories and functions of song in the Indian Robin Saxicoloides fulicata (Aves: Muscicapidae) Anil Kumar High Altitude Regional Centre, Zoological Survey of India, Solan, Himachal Pradesh 173211, India Email: anil_rathi@yahoo.com, anilsonta@gmail.com

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Aziz Aslan Manuscript details: Ms # o2630 Received 19 November 2010 Final received 31 May 2011 Finally accepted 30 June 2011 Citation: Kumar, A. (2011). Physical characteristics, categories and functions of song in the Indian Robin Saxicoloides fulicata (Aves: Muscicapidae). Journal of Threatened Taxa 3(7): 1909–1918 Copyright: © Anil Kumar 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details: Dr. Anil Kumar is a scientist in ZSI, Solan. Over the years his research work is focused on communication of birds. So for, he has recorded over 200 avian species mainly from Himalaya and contributed over 30 research papers/ articles. For ZSI, he has worked on some departmental research projects pertaining to mainly faunal studies. Acknowledgements: I am grateful to Director, ZSI, Kolkata for his kind encouragement and support. I am grateful to Director, Wildlife Institute of India, Dehradun, for encouraging and extending me institutional facilities during the course of study. I am thankful to Dr. Ajeet Singh (Haridwar), Dr. Romesh Kumar Sharma (Haridwar), Dr. Himmat Singh (Jodhpur), and Dr. Rajah Jayapal (WII) for their cooperation at various levels during the study. Financial support from DST under SERC Fast Track scheme (Project no. SR/FTP/LS-166/2000) is also gratefully acknowledged. Special thanks are due to Shri Anand Arya (Noida) for providing a nice image of Indian Robin.

OPEN ACCESS | FREE DOWNLOAD

Abstract: The physical characteristics and biological significance of song in the endemic Indian Robin Saxicoloides fulicata are described. Songs are discrete and composed of strophes (structural units) with frequency ranging from 1.03 to 8.00 kHz, preceded and followed by temporal intervals from 0.21 to 21.25 sec. Occasional, monosyllabic whistles are also identified. In a song bout usually the same type of strophe is repeated several times in a stereotyped manner with minor structural variations of elements before switching to another type of strophe. Most strophes are composed of two to five elements, having both simple and complex structure. Two categories of songs have been identified on the basis of their acoustical features and context of production. Type-A songs are simple, stereotyped, spontaneous and common, while type-B songs are rare, female-oriented and more complex than type-A. Song is used in both inter- and intrasexual contexts. It seems that type-A songs are driven by male-male competition for territory and mates. Males also shorten the length of strophes and reduce gaps between strophes (in type-B songs) on the arrival of females in the vicinity, most probably to increase the song rate, suggesting it to be an indicator of male quality. Key words: Indian Robin, Saxicoloides fulicata, song organisation, song characteristics, song function. Hindi Abstract: LFkkuh; dyfpfM+ esa xk;u dh fo”ks’krkvksa rFkk mlds tSfod egRo dk mYys[k fd;k x;k gSA xk;u

Nanks ¼lajpukRed bZdkbZ½ ls cuk] 0-21 ls 21-25 lsdasM ds dkykUrjks ls foHkDr] vfujarj izdkj dk Fkk ftldh /ouh vko`fÙk 1-03 ls 8-00 fdyks gRtZ ds e/; FkhA ,dy “kCnka”kh;] vkdfLed flfV;kWa Hkh ik;h x;hA ,d xk;u vof/k esa] ,d Nan ls nwljs Nan ij tkus ls igys] va”kks es fufgr NksVs&NksVs varjks ds lkFk] lk/kkj.kRk~;k ,d izdkj ds Nan dks ckjEckj iz;ksx fd;k x;kA vf/kdka”k Nan nks ls ysdj ikWap va”kksa ls cus Fks] rFkk ljy ,aoe~ tfVy nksuksa izdkj dh lajpuk okys FksA /ouh fo”ks’krkvksa rFkk mi;ksx ds lanHkZ esa] xk;u dks nks oxksZ esa foHkDr fd;k x;kA oxZ ^v^ dk xk;u ljy] :f<+c)] Lor~ LQwfVr rFkk lgt Fkk tcfd oxZ ^c^ dk xk;u nqyZHk] eknk mUeq[k rFkk vf/kd tfVy FkkA bl “kks/k esa] dyfpfM+ us xk;u dks vUrZtkfr; rFkk ltkfr; nksukas lanHkkZs esa iz;ksx fd;kA ,slk izrhr gksrk gS fd oxZ ^d^ dk xk;u {ks+= j{k.k rFkk eknk izkfIr gsrw] uj uj izfr)fUnrk ds ifj.kke Lo:i mRiUu gqvkA ujks us eknk ds fudV vkus ij] laHkor~;k xk;u dh rhoZrk dks c<+kus ds fy;s] xk;u esa Nanks dh yEckbZ dks y?kq dj fn;k rFkk muds e?; dkykUrj dks Hkh ladqfpr dj fn;k ¼oxZ ^c^ dk xk;u½ tks fd uj mRd`’Vrk dk |ksrd gks ldrk gSaA

INTRODUCTION Mate acquisition and male-male competition are responsible for the evolution of song in passerine birds (Catchpole & Slater 1995). Song characteristics such as acoustical features, mode of production, temporal patterns and structural complexity (variability of elements) are highly diverse among oscine birds (Marler & Slabbekoorn 2004). Many passerine species sing two categories of songs that differ in their patterns of temporal, spatial and contextual use (Spector 1992). The first category songs are often simple and highly stereotyped, sung at relatively low rates. In contrast, second category songs are usually more complex and variable, and sung at higher rates (Highsmith 1989; Kroodsma et al. 1989; Staicer 1989; Bolsinger 2000). Studies on the functions of song (with some exceptions) suggest that type-A songs (more stereotyped) are used as intersexual signals, while type-B (more variable) are used

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

1909

Song in Indian Robin

A. Kumar

intrasexually (Kroodsma 1981; Spector 1992; Bay 1999). Mode of singing also varies in birds. Mostly oscine birds use two types of singing mode i.e., ‘repeat’ or ‘eventual variety’ (singer produces one song type/ strophe repeatedly before switching to another type of strophe), and ‘serial’ or ‘immediate variety’ mode (singer produces a variety of song strophes/ phrases without any apparent rule) (Molles & Vehrencamp 1999). In many species song repertoire is organised around a limited number of strophes or song types, such as in the White-crowned Sparrow Zonotrichia leucophrys, where each male uses only a single, simple, monotonous song in stereotyped manner (Baptista 1975). Some other species, namely European Redwing Turdus iliacus (Bjerke & Bjerke 1981), Splendid Sunbird Necterina coccinigastra (Grimes 1974) and Ovenbird Seiurus aurocapillus (Falls 1978) are also known for their small repertoire size. While in others, such as in Mokingbird Mimus polyglottos (Howard 1974) and Sedge Warbler Acrocephalus schoenobaenus (Kroodsma & Parker 1977; Catchpole 1976), the songs composed of a large number of dissimilar structured song elements with an unrestricted number of combinations (Catchpole & Slater 1995). Robins belong to old world Chats-Flycatchers (Muscicapidae) with some exceptions; the American Robin Turdus migratorius and Mountain Robin T. plebejus belong to family Turdidae, the Scarlet Robin Petroica multicolor belongs to the family Petroicidae (del Hoyo et al. 2006). Robins use both simple and complex vocalisations for communication (Bhatt et al. 2000; Kumar & Bhatt 2001). For example, European Robin Erithacus rubecula use a complex, melodious song (made up of prolonged notes, short warbles and trills) for territory defence, almost throughout the year (Hoelzel 1986, 1989; Scriba & Goymann 2010). African Forest Robins (Stiphrornis) have been reported to use two types of vocalisations (Beresford & Cracraft 1999). However, functions of these categories remain unclear. Similar patterns of vocalisations were also reported in a recently discovered species of African Robin, the Olive-backed Forest Robin Stiphrornis pyrrholaemus (Schmidt et al. 2008). Oriental Magpie Robin Copsychus saularis also use two distinct categories of songs, which differ in structure and functions (Bhatt et al. 2000; Kumar 2003). The Indian Robin Saxicoloides fulicata 1910

Image 1. Indian Robin Saxicoloides fulicata

(Muscicapidae) is an endemic, small-sized (19cm), passerine species, distributed throughout the Indian subcontinent except northeastern, higher Himalaya and Thar Desert, and is divided into a few races. It is a common, resident, territorial and sexually dimorphic bird. Males have glossy black under parts and a white shoulder patch (Image 1), while females have grayishbrown upperparts and grayish under parts and lack white shoulder patch. It prefers dry, stony areas with sparse scrub, arid stony ridges, low rocky hills outcrops, edges of cultivation and deserted buildings, gardens and groves (Ali & Ripley 1983; Grimmett et al. 1998). Information is scanty on the singing behaviour & sociobiology of the species (Nirmala & Vijayan 2003). In this article, I describe and quantify the organisation of song in terms of physical characteristics, categories and context of production in the Indian Robin for the first time.

METHODS Field recordings Songs of 23 male Indian Robin were recorded in their natural habitat from four different places in northern India. Recordings on 11 individuals were made in Dehradun (30026’N & 78006’E) during May 2002 to February 2005; during the same period, five

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

A. Kumar

Frequency (kHz)

Song in Indian Robin

Time (sec)

Figure 1. Song components and terminology used in the present study.

birds were recorded at Srinagar, Garhwal (30 21’N & 78077’E); two at Haridwar (29055’N & 78008’E); and five recordings in and around Jodhpur (26021’N &73006’E) during March–April 2001. All birds recorded were unbanded. To avoid recording the same individual twice, each bird was recorded only when it was within view and recordings were made in each area only once. A total of 183 recordings (2–9 per individual) were made ranging 2–14 minutes duration. Signals were recorded using Sony CFS 1030S or Sony PCM-M1 or Marantz PMD 222 sound recorders and JVC MZ-500 or Sennheiser ME-66 microphones. Behavioural correlates were used to infer the possible meaning of the song. 0

Data analysis Recordings were digitised using M-Audiophile 2496 (sound card) at the sampling rate 48kHz and 16 bit resolution. After editing, cuts of high quality recordings (excluding recordings of five individuals due to poor quality) were analyzed with the help of windows based sound analysis software, Avisoft SAS Lab Pro (version 4.1). Spectrograms were displayed on a computer monitor and measurements of variables were made using frequency and time courser. Dominant frequency of given strophe was analysed generating power spectrum. The frequency of highest peak was recorded. For the sequential analysis of strophes, spectrograms were printed using several line mode. In this mode, about 40sec long recording was printed in seven lines on A4 size paper in landscape page setup. All spectrograms were calculated using following setting of SAS Lab: 512 FFT-length, 75% Frame, Hanning window and 87.5% time window overlap. In the present study, minimum and maximum frequency, frequency bandwidth, dominant frequency (frequency of maximal amplitude), duration and

intervals in song strophes were measured. Number and types of elements per strophe, song rate (strophes per minute) and complexity level (types of elements per min.) were calculated to define the acoustical features of songs. Results were expressed as mean±SE. Nonparametric statistics was used to measure the level of significance in differences, since most data were not normally distributed. Windows based software SPSS was used for the analysis. Song terminology Study of literature reveals that there is no standardization of terminology for the songs of different species. Indeed, different authors used different terms for the same songs features (Spector 1992). I labeled structural units of song on the basis of morphological features, using terminology partly adopted from literature (Staicer 1989; Bay 1999). The song in Indian Robin consists of a number of distinct sections, called strophes or phrases and each strophe consists of several smaller units known as elements (Fig. 1). An element is a short tracing on the spectrogram. On the basis of frequency modulations the elements can further be classified into simple (constant pitch, un-modulated or slightly modulated frequency) and complex (varied pitch, rapidly modulated or multi harmonic frequency) elements. In a song bout, in different phrases, often bird use a combination of one to three elements together and is named as a syllable (Catchpole & Slater 1995).

RESULTS Physical characteristics Males sang during the breeding season mostly in the morning (0500–0900 hrs) and evening (1700–1730 hrs). Individuals were observed singing from exposed branches of trees, rocks, walls, electric wires and on the ground. The song of Indian Robin was composed of strophes with occasional whistles (Fig. 2). The strophes were made up of one to nine elements, with dissimilar structure and occasional repetition of elements. The frequency of song ranged from 1.03 to 8.00 kHz. Dominant frequency of most songs was 4.2 kHz (2.3–6.5 kHz). Average duration of strophes was 0.68±0.03 to 0.21±0.02 sec. preceded and followed by temporal intervals ranging 6.34±0.46 to 0.61±0.03

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

1911

Song in Indian Robin

A. Kumar

Table 1. Physical characteristics and temporal variations in two categories of songs in the Indian Robin. Song type-A (Mean±SE)

Song type-B (Mean±SE)

Mann-Whitney U-test

Z-Score

Probability P

Minimum frequency (kHz)

2.48±0.05 (1.87-3.53, N=18, n=64)

2.19±0.11 (1.03-4.34, N=8, n=48)

1169.00

-2.16

0.031

Maximum frequency (kHz)

6.96±0.07 (5.43-8.00, N=18, n=64,)

6.22±0.14 (4.31-7.65, N=8, n=48)

900.00

-3.74

0.001

Frequency Bandwidth (kHz)

4.48±0.08 (2.87-6.00, N=18, n=64)

4.03±0.09 (2.88-5.87, N=8, n=48)

955.50

-3.41

0.001

Dominant frequency (kHz)

4.21±0.08 (3.44-6.50, N=18, n=64)

4.20±0.15 (2.30-6.35, N=8, n=48)

1502.50

-0.20

0.844*

Strophe duration (sec)

0.68±0.03 (0.24-2.16, N=18, n=64)

0.21±0.02 (0.05-0.64, N=8, n=48)

125

-8.30

0.001

Inter-strophe interval (sec)

6.34±0.46 (2.17-21.25, N=18, n=64)

0.61±0.03 (0.21-1.29, N=8, n=48)

0.00

-9.00

0.001

Song Rate (Strophes per min)

9.33±0.67 (6.00-14.00, N=12, n=15)

70.56±3.71 (54.00-84.00, N=6, n=9)

0.00

-4.04

0.001

No. of elements per strophe

5.81±0.22 (1.00-9.00, N=18, n=64)

2.17±0.11 (1.00-4.00, N=8, n=48)

67.00

-8.75

0.001

Types of elements per strophe

4.73±0.18 (1.00-9.00, N=18, n=64)

1.47±0.11 (1.00-3.00, N=8, n=48)

93.00

-8.66

0.001

Song complexity (Types of elements per min)

9.18±1.22 (4.00-24.00, N=9 n=16)

21.36±1.31 (16.00-29.00, N=5, n=11)

8.50

-3.93

0.001

Variables

* Not significant; Ranges are given in parenthesis with number of individuals (N) and number of song/strophe samples (n).

Table 2. Some examples of sequence of phrases in song bouts in the Indian Robin. For example, bird D1 used two types of phrases i.e. a and b, alternatively in 5 minutes long bout, and bird J1 used six types of phrases almost randomly. Locations of the recordings Dehradun (30026’N & 78006’E)

Srinagar, Garhwal (30021’N & 78077’E) Jodhpur (26021’N & 73006’E)

Bird ID

Sequence of phrases in 5 min. song duration 1

Types of phrases

aabababbbbabaaaaabbbbbaaaaaabbabababaaaaaabbbb►..bbbbbb►aaaaa

D1*

abccdefcgcdhaaeddiddaeaadddiddaaeddiaadejdaakddekddialadedmnlddm

aaaaaaaaaaaaaaaaa…aaaaaaaaaa…aaaa►►bbbbbbbbbbbb►►aaaabbbb

aa ►►► b ►► bbbbbb…►►…►►...aaaaacaaa…bbb ►► aaaaa…bbbc

aaaaaaaaaaaaaaaaaaaaaaaa…aaaaaa…bbbbbbb…aaaaa..bbaabbbbaaaaa

aabac…bbb…abbbbbb…acadacacacdacaacacacef ► caacacbbbb ►►►►

aaaaaaa ► aaaa►aaaaabbbbbbbbbbbb►►►►aaaaaaaaaaaaaa ►►bbbb

► Whistle; … Longer intervals; * Song type-B (given time duration is not actual)

sec. Songs were produced at variable rate; 9.33±0.67 strophes per minute in song type-A and 70.56±3.71 strophes per minute in song type-B (Table 1). Indian Robin sang in moderate sized song bouts ranging one to six minutes duration (sometimes <1 or >6 min). Different types of temporal patterns were identified. On the basis of sequence of strophes, three categories were observed. However, distinction is purely temporary and individuals do not follow strict rule in sequencing. Two to nine types of phrases with modulated frequency were identified in song bouts. However in most cases (74%) males used two 1912

to three types of phrases. Occasional whistles were also observed. These were monosyllabic in structure and uttered 1–5 times between any two consequent phrases of a song bout. Stereotyped mode In many cases (58%), the bird repeated a particular strophe in stereotyped order with minor structural variations of elements (Fig. 2A, element g in P1 is replaced by f in P2 and elements c, d & e showed variations in their minimum and maximum frequencies, respectively, and adding or deleting of an

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

Song in Indian Robin

A. Kumar

Frequency (kHz)

Time (sec)

Figure 2. Temporal variations in the song of Indian Robin. A - Stereotyped mode with minor structural variations in elements; B - Alternative mode with adding/ deleting of elements, such as element f of P1 is omitted in P3 phrase; C - Use of three different types of phrases in a given song bout; D - Use of whistles between phrases.

element, such as in Fig. 2B, element f of P1 is omitted in P3). This mode was observed mainly in isolated birds (N=9) with no conspecific neighbor. Alternative mode In this mode individuals produced two or three types of phrases in alternative manner (Fig. 2C). For instance, bird D1 (Table 2) produced a and b phrases alternatively and bird J1 produced a, b, c and d phrases alternatively without fixed number and sequence and new phrases such as e and f, in a recording. In some recordings occasional whistles were also used between phrases (Fig. 2D). This mode of singing was observed

only in birds (N=3) having conspecific neighbours. Complex mode Contrary to type-A songs in stereotyped mode (Fig. 3A), in some cases (16 %) such as type-B songs, birds produced large number of phrases randomly with out any strict order in sequence (Fig. 3B, C). However, repetition of phrases (such as in Fig. 3B and C, Type 1 repeated as P1, P5 and P7) and re-assortment of elements/ phrases (such as Type 2 as P2, P8 and P12 in Fig. 3B and C) were identified, for example type-B (Table 2) songs of bird D1.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

1913

Song in Indian Robin

A. Kumar

Frequency (kHz)

Time (sec)

Figure 3. Song categories in the Indian Robin. A - Type-A song in stereotyped mode; B & C - Type-B song with 7 types of phrases with repetition of some phrases, such as type-1.

Song categories and functions Syntactically two categories of songs were identified (Fig. 3). Type-A songs were common (84% of total songs recorded) in breeding season and consisted repeated strophes having 0.68±0.03 sec duration and followed by 6.34±0.46 sec gap. Usually, the bird repeated a particular strophe several times before switching to another strophe. These songs usually uttered during territory advertisement and to maintain pair-bond. However, territorial conflicts were not obvious (n=5). This could be the result of low population densities of this species in northern India (pers. obs.; unpub. data). Mostly solitary pairs were observed in a particular area. Type-B songs were more complex (Mann-Whitney U-test; U=8.5, p<0.001) and rare (only 16% of songs recorded) as compared to type-A songs. Most acoustical characteristics significantly differ (Table 1) from type-A songs except dominant frequency (P=0.844). Type-B songs were consisted of short strophes having 1–4 elements. The duration and gap of strophes were significantly lower (p<0.001) then type-A songs. The 1914

males produced 70.56±3.71 strophes per minute. These songs were observed only in the presence of females and during courtship. Courtship displays were also associated with these songs. During these displays male birds were observed running on the ground or on a wall 0.65 to 2.15 m towards a female with splayed and erected tail, forwarded beak and lowered head while emitting a complex song. Within a few seconds the male mounted the female for insemination.

DISCUSSION Physical characteristics In the present study, the Indian Robin used stereotyped songs, organised around a limited number of strophes (except type-B songs). Studies on temperate song birds provide some insights on how song output is organised. Like the Indian Robin, Chaffinch Fringilla coelebs use three or four song types (phrases) in its song, with a sequence of each in turn before returning to the first (Slater 1983). Sequence of song types is not

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

Song in Indian Robin

always the same and the phrases are not necessarily sung with equal frequency. It is quite common in many species for one song to comprise a much larger part of the bird’s output than another (Catchpole & Slater 1995). Degree of song variability is highly diverse in birds and song characteristics may also vary temporally and spatially (Catchpole & Slater 1995). Tawny Pipit Anthus campestris use short and simple songs (Osiejuk et al. 2007) and males are known to have single song type repertoire (Neuschultz 1986). In contrast, Chaffinch Fringilla coelebs, Great Tit Parus major, Ring Ousel Turdus torquatus and Dark-eyed Junco Junco hyemalis use several song types (Krebs et al. 1978; Slater 1981; Ince & Slater 1985; Williams & MacRoberts 1977), while others, like Red-eyed Vireo Vireo olivaceus and Marsh Wren Cistothorus palustris use 12 to >100 song types in their repertoire (Borror 1981; Kroodsma & Verner 1987). Common Nightingale Luscinia megarhynchos have a large repertoire (up to 260 different song types) divided into whistle songs and nonwhistle songs (Kipper et al. 2004; Kunc et al. 2005). In most oscine birds, song complexity serves as an honest signal of male quality (Hesler et al. 2011), and selection may also favour song parameters such as song rate and song length (Garamszegi & Møller 2004; Kunc et al. 2005). In species with large repertoire, sexual selection might favour the evolution of structural song traits such as whistle songs in nightingales (Kunc et al. 2005), thought to be evolved to attract migrating females at night (as structurally simple whistles suffer less from spectral degradation during propagation over long distance; Slabbekoorn et al. 2002). While, in species with a small repertoire, it may favour song length and song rate, as reported in some species such as Willow Tit Parus montanus (Welling et al. 1997) and Hoopoe Upupa epops (Martiu-Vivaldi et al. 2002). In the present study, Indian Robin used song in both inter- and intra-sexual contexts. When inferred with the behavioral observations, type-A songs were driven by male-male competition for territory and mate acquisition. Males also shortened the length of strophes and reduced gap between strophes (in type-B songs) on the arrival of females in close vicinity, most probably to increase song rate, which could also be an indicator of male quality as suggested for other species. The songs of Indian Robin range from 2.19 to 6.96

A. Kumar

kHz frequencies. The dominant frequency (i.e. 4.2 kHz) of songs was considerably higher then expected for its body weight. Wallschlager’s regression function (Wallschlager 1980) of ‘central frequency’ on body weight predicts a frequency of 3.6 kHz for birds having body weight (i.e. 18–19 g) like Indian Robin (Ali & Ripley 1983). Similar trends have also been reported in some South American passerines (Ryan & Brenowitz 1985). Lambrechts (1996) suggested that birds should have greater performance at about onefourth of their frequency range. Indian Robin produced its song in three different modes. In stereotyped mode, in a song bout bird produced same phrase again and again (like … AAAAA….), while, in alternative mode bird used two or three types of phrases (like ….AAA…BBBB… AAAA….BB….CCCC…). Third mode of production was complex and observed only in type-B songs. In the literature, singing mode refers to the sequential pattern of song type (strophes/ phrases) production (Molles & Vehrencamp 1999). It is classified as ‘repeat/ eventual variety’ such as ‘stereotyped/ alternative mode’ of singing in Indian Robin, and ‘serial/ immediate variety’ analogue to ‘complex mode’ of singing in present study. Previous studies showed that in some species singers increase their switching rate among song types during agonistic conflicts and on the arrival of female (Kramer et al. 1985; Langmore 1997). In the present study it seems that Indian Robin used the stereotyped mode of singing in low territorial pressure situations (where conspecific territorial neighbors were absent) and the alternative mode in relatively high territorial pressure situations (when the singing male had a conspecific neighbour). Although not substantiated conclusively in the present study, it opens scope to test this hypothesis in future studies. In the present study, it was observed that the Indian Robin mostly sing in morning and evening hours, like many other passerines (Catchpole & Slater 1995). Catchpole (1973) studied the diurnal rhythms of song production in two European Acrocephalus species, the Reed (A. scirpaceus) and Sedge (A. schoenobaenus) warblers. He observed a marked peak of singing activity around dawn and dusk in these species. The acoustic transmission hypothesis (ATH) predicts that birds sing their full songs most intensively at dawn because this is the time of the day when these songs propagate most effectively and hence should be most

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

1915

Song in Indian Robin

A. Kumar

effective for long-range communication (Henwood & Fabrik 1979). However, experiments made by Dabelsteen & Mathevan (2002) on Blackcap Sylvia atricapilla in temperate deciduous forests, indicate that the dawn singing can’t be understood only by ATH, some other factors such as feeding and social conditions may also be responsible for dawn singing. I am unable to contribute to these ideas but the Indian Robin can be a suitable model to test the ATH in tropical habitats in future studies. Song categories and functions On the basis of acoustical features and context of production, two categories of songs were emerged in Indian Robin. Type-A songs were simple, stereotyped, spontaneous and common, while type-B songs were rare, female oriented and more complex (MannWhitney U-test; U=8.5, p<0.001) than type-A. In such a manner, two or more acoustically distinct song classes have been reported for some passerine birds (namely Dark-eyed Juncos, Titus 1998; Field Sparrow Spizella pusilla, Nelson & Croner 1991; Yellow-throated Vireo Vireo flavifrons, Smith et al. 1978; Yellow-rumped Caciques Cacicus cela, Trainer 1987; Red-vented Bulbul Pycnonotus cafer, Kumar 2004; Oriental Magpie Robin, Kumar 2003). In some species, such as European Blackbird Turdus merula (Dabelsteen & Pedersen 1990), European Robin (Dabelsteen et al. 1997), Lesser Whitethroat Sylvia communis (Balsby 2000) and Song Sparrow Melospiza melodia (Anderson et al. 2008), songs are described as ‘broadcast songs’ (type-A songs of Indian Robin) and ‘soft songs’ (type-B songs of Indian Robin) also termed as ‘quiet song’, ‘twitter song’ or ‘whisper song’ in previous studies (Anderson et al. 2008). Like the Indian Robin, the first category songs of these species were loud and conspicuous and second category songs were soft, low amplitude and rare, used in different contexts such as female courtship, male-male aggression or both (Dabelsteen et al. 1998; Titus 1998; Anderson et al. 2008). However, in Indian Robin, type-B songs were used only for mating/ courtship purpose but the scope of present study limits us from discounting this feature for other functions in other seasons. Some species of North American wood-warblers (Parulidae) also sing two categories of songs. The first category songs of these species were often simple and highly stereotyped, sung at relatively low rates and near 1916

females. While, second category songs were usually more complex and variable, sung at higher rates and in male-male interactions (Spector 1992; Bolsinger 2000). In contrast with wood-warblers song system, in the present study, Indian Robin used simple and stereotyped songs for territory/pair-bond maintenance and, complex and varied songs for mating. Some hypotheses have been proposed to explain the proliferation of song categories in birds (Nelson & Croner 1991). It is hypothesized that all song types (phrases) within the vocal repertoire of a species may have the same purpose. Evolution of large numbers of song types in a species may be favored by both inter- and intra-sexual selection. Large repertoires may effectively repel the rival males by appearing to represent the presence of several singing males. Large repertoires might also be favored by females during mate selection (Catchpole 1980). Another hypothesis assumes that different song categories/ song types within a repertoire contain different information (Smith et al. 1978; Trainer 1987). Different song types are sung in different behavioural contexts, and thus appear to provide different information to listeners. In the present study, the Indian Robin used two categories of songs in different behavioural contexts; it seems that second class hypothesis may fit to understand the evolution of song in this species.

CONCLUSION Studies carried out during the last five decades on the quantification of complexity and variability in bird song provides deep insights in understanding the evolution of song and sexual selection in temperate birds. It is now well-understood that the complexity of songs in passerines play an important conceptual, theoretical and empirical role. Studies on the singing behaviour of Indian birds are restricted to comparatively few species. It is believed that most tropical birds exhibit quite different social systems than temperate species. Communication systems of most Indian birds cannot be properly understood based only on the information available from temperate birds. So, extensive long-term investigations are needed for the characterisation and documentation of the vocal repertoire of Indian birds to understand the evolution of song in these species. The present study is a base-

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

Song in Indian Robin

line effort in this direction and may possibly enable more detailed studies to be carried out in the future, especially on repertoire size, individual variations, regional dialects, and ecological and behavioural constrains on the evolution of song in Indian birds. REFERENCES Ali, S. & S.D. Ripley (1983). Handbook of the Birds of India and Pakistan. Oxford University Press, Delhi, xiii+737pp. Anderson, R.C., W.A. Searcy, S. Peters & S. Nowicki (2008). Soft song in Song Sparrows: acoustic structure and implications for signal function. Ethology 114: 662–676. Balsby, T.J.S. (2000). The function of song in Lesser Whitethroats Sylvia communis. Bioacoustics 11: 17–30. Baptista, L.F. (1975). Song dialects and demes in sedentary populations of the White-crowned Sparrow (Zonotrichia leucophrys nuttalli). University of California Publications in Zoology 105: 1–52. Bay, M.D. (1999). The type B song of the Northern Parula: structure and geographic variation along proposed subspecies boundaries. Wilson Bulletin 111(4): 505–514. Beresford, P. & J. Cracraft (1999). Speciation in African Forest Robins (Stiphrornis): species limits, phylogenetic relationships, and molecular biogeography. American Museum Novitates 3270: 1–22. Bhatt, D., A. Kumar, Y. Singh & R.B. Payne (2000). Territorial songs and calls in Oriental Magpie Robin Copsychus saularis. Current Science 78(6): 722–728. Bjerke, T.K. & T.H. Bjerke (1981). Song dialects in the Redwing Turdus iliacus. Ornis Scandinavica (Scandinavian Journal of Ornithology) 12: 40–50. Bolsinger, J.S. (2000). Use of two song categories by Goldencheeked Warblers. Condor 102: 539–552. Borror, D.J. (1981). The songs and singing behaviour of the Red-eyed Vireo. Condor 83: 217–228. Catchpole, C.K. (1973). The functions of advertising song in the Sedge Warbler (Acrocephalus schoenobaenus) and Reed Warbler (A. scirpaceus). Behaviour 46: 300–320. Catchpole, C.K. (1976). Temporal and sequential organization of song in the Sedge Warbler (Acrocephalus schoenobaenus). Behaviour 59: 226–246. Catchpole, C.K. (1980). Sexual selection and the evolution of complex songs among European warblers of the genus Acrocephalus. Behaviour 74: 149–166. Catchpole, C.K. & P.J.B. Slater (1995). Bird Song: Biological Themes and Variations. Cambridge University Press, Cambridge, viii+248pp. Dabelsteen, T., P.K. McGregor, J. Holland, J.A. Tobias & S.B. Pedersen (1997). The signal function of overlapping singing in male robins. Animal Behaviour 53: 249–256. Dabelsteen, T., P.K. McGregor, H.M. Lampe, N.E. Langmore & J. Holland (1998). Quiet song in song birds: an overlooked phenomenon. Bioacoustics 9: 89–105.

A. Kumar

Dabelsteen, T. & S.B. Pedersen (1990). Song and information about aggressive responses of blackbirds Turdus merula - evidence from interactive playback experiments with territory owners. Animal Behaviour 40: 1158–1168. Dabelsteen, T. & N. Mathevan (2002). Why do songbirds sing intensively at dawn? A test of the acoustic transmission hypothesis. Acta ethologica 4: 65–72. del Hoyo, J., A. Elliot & D. Christie (2006). Handbook of the Birds of the World. Volume 11: Old World Flycatchers to Old World Warblers. Lynx Edicions, Barcelona, Spain, 798pp. Falls, J.B. (1978). Bird song and territorial behaviour, pp. 61– 69. In: Krames, L., P. Plinet & T. Alloway (eds). Advances in the Study of Communication and Affect: Aggression, Dominance and Individual Spacing. Vol. 4, Plenum Press, New York, 173pp. Garamszegi, L.Z. & A.P. Møller (2004). Extrapair paternity and evolution of bird song. Behavioural Ecology 15: 508– 519. Grimes, L.G. (1974). Dialects and geographical variation in the song of the Splendid Sunbird Nectarinia coccinigaster. Ibis 116: 314–329. Grimmett, R., C. Inskipp & T. Inskipp (1998). Birds of the Indian Subcontinent. Oxford University Press, Mumbai, 888pp. Henwood, K. & A. Fabrick (1979). A quantitative analysis of the dawn chorus: temporal selection for communicatory optimization. American Naturalist 114: 260–274. Hesler, N., R. Mundry & T. Dabelsteen (2011). Does song repertoire size in Common Blackbirds play a role in an intra-sexual context? Journal of Ornithology 152(3): 591– 601. Highsmith, R.T. (1989). The singing behaviour of Goldenwinged Warblers. Wilson Bulletin 101: 36–50. Hoelzel, A.R. (1986). Song characteristics and response to playback of male and female robins (Erithacus rubecula). Ibis 128: 115–127. Hoelzel, A.R. (1989). Territorial behaviour of the robin, Erithacus rubecula: the importance of vegetation density. Ibis 131: 432–436. Howard, R.D. (1974). The influence of sexual selection and interspecific competition on Mockingbird song (Mimus polyglottos). Evolution 28: 428–438. Ince, A.S. & P.J.B. Slater (1985). Versatility and continuity in the songs of thrushes Turdus spp. Ibis 127: 355–364. Kramer, H.G., R.E. Lemon & M.J. Morris (1985). Song switching and agonistic stimulation in the Song Sparrow (Melospiza melodia): Five tests. Animal Behaviour 33: 135–149. Krebs, J., R. Ashcroft & M. Webber (1978). Song repertoires and territory defense in the Great Tit. Nature 271: 539– 542. Kroodsma, D.E. (1981). Geographical variation and functions of song types in warblers (Parulidae). Auk 98: 743–751. Kroodsma, D.E. & J. Verner (1987). Use of song repertoires among Marsh Wren populations. Auk 104: 63–72.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

1917

Song in Indian Robin

A. Kumar

Kroodsma, D.E. & L.D. Parker (1977). Vocal virtuosity in the Brown Thrasher. Auk 94: 783–785. Kroodsma, D.E., R.C. Bereson, B.E. Byers & E. Minear (1989). Use of song types by the Chestnut-sided Warbler: Evidence for both intra- and inter-sexual functions. Canadian Journal of Zoology 67: 447–456. Kumar, A. (2003). Acoustic communication in birds: Differences in songs and calls, their production and biological significance. Resonance 8(6): 44–55. Kumar, A. (2004). Acoustic communication in the Red-vented Bulbul Pycnonotus cafer. Anais de Academia Brasileira de Ciencias (Annals of the Brazilian Academy of Sciences) 76(2): 350–358. Kumar, A. & D. Bhatt (2001). Characteristics and significance of calls in Oriental Magpie Robin. Current Science 80(1): 77–82. Kunc, H.P., V. Amrhein & M. Naguib (2005). Acoustic features of song categories and their possible implications for communication in the Common Nightingale (Luscinia megarhynchos). Behaviour 142: 1083–1097. Kipper, S., R. Mundry, H. Hultsch & D. Todt (2004). Longterm persistence of song performance rules in nightingales (Luscinia megarhynchos): a longitudinal field study on repertoire size and composition. Behaviour 141: 371–390. Lambrechts, M.M. (1996). Organisation of birdsong and constraints on performance, pp. 305–319. In: Kroodsma, D.E. & E.H. Miller (eds). Ecology and Evolution of Acoustic Communication in Birds. Cornell University Press, New York, 587pp. Langmore, N.E. (1997). Song switching in monandrous and polyandrous Dunnocks Prunella modularis. Animal Behaviour 53: 757–766. Marler, P. & H. Slabbekoorn (2004). Nature’s Music: The Science of Birdsong. Elsevier Academic Press, San Diego, USA, xvi+497pp. Martin-Vivaldi, M., J.G. Martinez, J.J. Palomino & M. Soler (2002). Extrapair paternity in the Hoopoe Upupa epops: an exploration of the influence of interactions between breeding pairs, non-pair males and strophe length. Ibis 144: 236–247. Molles, L.E. & S.L. Vehrencamp (1999). Repertoire size, repertoire overlap, and singing modes in the Banded Wren (Thryothorus pleurostictus). Auk 116(3): 677–689. Nelson, D.A. & L.J. Croner (1991). Song categories and their functions in the Field Sparrow (Spizella pusilla). Auk 108: 42–52. Neuschulz, F. (1986). Zum Gesang des männlinchen un weiblichen Brachpiepers Anthus campestris. Journal of Ornithology 127: 514–515. Nirmala, Sr.T. & L. Vijayan (2003). Breeding behaviour of the Indian Robin Saxicoloides fulicata in the Anaikatty hills, Coimbatore, pp. 43–46. In: Proceedings of 28th ESI Conference, Feb. 7–8, 2003, KMTR, Tirunelveli, India. Osiejuk, T.S., J. Grzybek & P. Tryjanowski (2007). Song structure and repertoire sharing in the Tawny Pipit Anthus campestris in Poland. Acta Ornithologica 42(2): 157–165. 1918

Ryan, M.J. & E.A. Brenowitz (1985). The role of body size, phylogeny, and ambient noise in the evolution of bird song. American Naturalist 126: 87–100. Schmidt, B.K., J.T. Foster, G.R. Angehr, K.L. Durrant & R.C. Fleischer (2008). A new species of African Forest Robin from Gabon (Passeriformes: Muscicapidae: Stiphrornis). Zootaxa 1850: 27–42. Scriba, M.F. & W. Goymann, (2010). European robins (Erithacus rubecula) lack an increase in testosterone during simulated territorial intrusions. Journal of Ornithology 151: 607–614. Slabbekoorn, H., J. Ellers & T.B. Smith (2002). Birdsong and sound transmission: The benefits of reverberations. Condor 104: 564–573. Slater, P.J.B. (1981). Chaffinch song repertoires: observations, experiments and a discussion of their significance. Zeitschrift fur Tierzuchtung und Zuchtungsbiologie (Journal of Animal Breeding and Genetics) 56: 1–24. Slater, P.J.B. (1983). Sequences of song in chaffinches. Animal Behaviour 31: 272–281. Smith, W.J., J. Pawlukiewicz & S.T. Smith (1978). Kinds of activities correlated with singing patterns of the Yellowthroated Vireo. Animal Behaviour 26: 862–885. Spector, D.A. (1992). Wood-warbler song systems. A review of paruline singing behaviours, pp. 199–238. In: Power, M.D. (ed). Current Ornithology. Plenum Press, New York, 238pp. Staicer, C.A. (1989). Characteristics, use and significance of two singing behaviours in Grace’s Warbler (Dendroica graciae). Auk 106: 49–63. Titus, R.C. (1998). Short-range and long-range songs: Use of two acoustically distinct song classes by Dark-eyed Juncos. Auk 115(2): 386–393. Trainer, J.M. (1987). Behavioural associations of song types during aggressive interactions among male Yellow-rumped Caciques. Condor 89: 731–738. Wallschlager, D. (1980). Correlation of song frequency and body weight in passerine birds. Experientia 36: 412. Welling, P.P., S.O. Rytkonen, K.T. Koivula & M.I. Orell (1997). Song rate correlates with parental care and survival in Willow Tits: advertisement of male quality? Behaviour 134: 891–904. Williams, L. & M.H. MacRoberts (1977). Individual variation in the songs of Dark-eyed Juncos. Condor 79: 106–112.

Justification for delayed publication: During 2005, I was selected as a scientist in the ZSI and posted at Itanagar, Arunachal Pradesh for about five years. The lack of bio-acoustic facilities and relevant literature in the early phase of my posting, and prolonged illness of two family members led to the delay in publication -- Anil Kumar (author). The song characteristics and functions of the species do not change in ten years. There are no new studies on this topic and therfore the findings are informative and provide a base line for the song features of the species -- Aziz Aslan (subject editor).

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1909–1918

JoTT Communication

3(7): 1919–1928

Ex situ conservation of two threatened ferns of the Western Ghats through in vitro spore culture Johnson Marimuthu 1 & Visuvasam Soosai Manickam 2 Department of Plant Biology and Biotechnology, 2 Centre for Biodiversity and Biotechnology, St. Xavier’s college (Autonomous), Palayamkottai, Tamil Nadu 627002, India Email: 1 ptcjohnson@gmail.com (corresponding author), 2 vsmanickam@gmail.com 1

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: V. Irudayaraj Manuscript details: Ms # o2687 Received 28 January 2011 Final received 08 June 2011 Finally accepted 27 June 2011 Citation: Marimuthu, J. & V.S. Manickam (2011). Ex situ conservation of two threatened ferns of the Western Ghats through in vitro spore culture. Journal of Threatened Taxa 3(7): 1919–1928. Copyright: © Johnson Marimuthu & Visuvassam Soosai Manickam 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Author Details: see end of this article Author Contribution: JM executed the work and contributed for paper writing; VSM was the prinicpal investigator of the project and he only suggested the problem, given guidelines and contributed for paper writing. Acknowledgements: The authors acknowledge the financial assistance from Ministry of Environment and Forests, Government of India, New Delhi, India.

OPEN ACCESS | FREE DOWNLOAD

Abstract: The present study was intended to produce a protocol for the conservation of two endangered ferns of southern Western Ghats of India using in vitro spore culture. In addition this study reports spore germination, gametophyte development, changes in the reproductive phases and sporophytes formation of the medicinally important ferns Pronephrium triphyllum (Sw.) Holttum and Sphaerostephanos unitus (L.) (Holttum). Matured spores of the two selected ferns were harvested, filtered through 40μM nylon membrane and sterilized with 0.1% mercuric chloride for 3 to 5 min and rinsed with sterile distilled water for 15 min showed less frequency of mortality and a high percentage of spore germinations. For Pronephrium triphyllum, the spores sown on the Knop’s basal agar medium showed the highest percentage (38.3±1.13) of germination. Highest percentage (52.3±1.43) of sporophyte formation was observed in Knop’s liquid medium. For Sphaerostephanos unitus, the highest percentage (36.8±1.31) of spore germination was observed in the Knop’s basal agar. The highest percentage of sporophyte formation was observed only in Knop’s medium (76.8±1.41), other media failed to induce sporophyte formation. The in vitro raised plantlets were hardened and established in the natural habitat and distributed to various botanic gardens as a part of ex situ conservation. Cytological and isoperoxidase analysis confirmed the genetic uniformity between mother plants and in vitro raised sporophytes / plants. The established protocol of the present study will be useful for the multiplication and conservation of the two threatened ferns of the Western Ghats. The same protocol may also be applicable to similar threatened ferns. Keywords: Conservation, ex situ, ferns, isoperoxidase, Pronephrium triphyllum, Sphaerostephanos unitus, spore.

Introduction The Western Ghats is one of the hotspots of the world and also one of the significant geographical regions. Around 233 species of ferns occur in southern India (Manickam & Irudayaraj 1992). In China, South Africa, USA, Europe and Canada, the ferns are used as medicines to cure diseases such as chest complaints, cancer, rheumatism, bowel disorder, ulcer, cough, fever and Alzheimer disease. In China alone, 401 kinds of pteridophytic medicines have been used for various ailments (Luo 1998). The economic value of the ferns has been enumerated by various authors from time to time (Kaur 1989). Today, the diversity of plant life is facing serious threats, largely due to habitat loss, habitat degradation and increasing exploitation of natural resources. It has been estimated that globally 30% of the flora is threatened (Raven 1999). The decline in the number and quality of the habitats is attributed to encroaching urbanization, growing industrialization, intensive farming and unsustainable harvesting of wild species. According to the World Resource Institute, India figures among 28 countries that are facing severe effects of increasing ecological imbalance if preservation is not taken on a war footing. The IUCN report says that in India 7.7% of the plants are under threat. In Western Ghats, a number

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

1919

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam

of epiphytic and lithophytic ferns are destroyed due to various deforestation activities. In the Western Ghats, 44 threatened ferns are facing extinction and the conservation of these species is a major concern of biologists (Manickam 1995). The establishment of plantations of cash crops like cardamom, coffee, rubber and tea is the main reason for the destruction of the evergreen forests and consequent demise of the ferns in the Western Ghats. A reduction in the anthropogenic pressure on natural populations would contribute to their conservation in nature. Among the various biotechnological options, also reported in other agri–horticultural crops, micropropagation through tissue culture and in vitro spore germination are best applied and commercially exploited in fern species (Fay 1994). Application of this technology (in vitro spore germination) for large–scale multiplication of certain species of ferns from the Western Ghats has been demonstrated (Sara et al. 1998; Manickam et al. 2003; Johnson et al. 2005; Sara & Manickam 2005; Johnson & Manickam 2006; Sara & Manickam 2007; Johnson & Manickam 2007; Johnson et al. 2008). The plant tissue culture as an effective tool to conserve plant genes and guarantee the survival of the endemic, endangered and over exploited genotypes is derived from the fact that it makes use of small units (cells and tissues) without losing the mother plant, takes pressure off the waning wild populations and makes available large numbers of plants for reintroduction and commercial delivery. Endangered ferns such as Diplazium cognatum, Histiopteris incisa, Hypodematium crenatum, Thelypteris confluens, Athyrium nigripes, Pteris vittata, Metathelypteris flaccida, Pteris gongalensis, Pteris confusa, Cyathea crinita, Cheilanthes viridis, Pronephrium articulatum, and Nephrolepis multiflora have been multiplied through in vitro spore culture as a part of ex situ conservation (Sara 2001; Johnson 2003; Manickam et al. 2003; Irudayaraj et al. 2003; Vallinayagam 2003). Based on this background, the present investigation was initiated to extend the good work already done in our laboratory to a few other equally endangered species. In the present study in vitro spore culture has been attempted as part of our continued efforts to conserve species of conservation importance and prospective economic value. Reintroduction of the plants so multiplied through spore culture in selected forest habitats hitherto untested in our centre has also been attempted. 1920

Materials and Methods Two rare and endangered ferns from the Western Ghats were selected for the present study viz., Pronephrium triphyllum (Sw.) Holttum (Thelypteridaceae) and Sphaerostephanos unitus (L.) (Holttum) (Theylpteridaceae). Matured fertile fronds of the selected species were collected from the wild of the Western Ghats and established in the green house attached to the Centre for Biodiversity and Biotechnology, St. Xavier’s College, Palayamkottai, India. The fronds were washed in running tap water for a few minutes. The fronds were cut into small pieces and dried over white absorbent paper at room temperature (250C). After drying the fronds over the absorbent paper at room temperature for 24hr, the liberated spores were passed through 40mm nylon mesh to remove the sporangial wall materials and the clean spores were collected and stored in a refrigerator at 50C (Images 1a & 2a). The spores were surface sterilized with 0.1% HgCl2 solution for 5min and washed with sterile distilled water for 15min. The surface sterilized spores were inoculated onto different media viz., Knops (1906), Knudson (1946), Mitra et al. (1976), Moore’s (1903), and Murashige & Skoog’s medium (1962) devoid of sugar and plant growth regulators using sterile Pasteur pipettes and incubated at 250C ± 20C under 12hr photoperiod (1500 lux). The pH of the media was adjusted to 5.8 before adding agar 0.5% (w/v) and autoclaved at 1210C for 15min. Both liquid and agar nutrient media were used for spore germination and sporophyte formation. Gametophytes regenerated from spores were sub– cultured on different basal media (Knops, Knudson C, Mitra et al., Moore’s and Murashige and Skoog’s medium) for sporophyte formation. Germination percentage of the spores, growth area of the prothalli, and their development pattern were analyzed. Photomicrographs were taken with a labotriumph microscope. The culture tubes containing spore raised micropropagated plants of the two selected species were kept at room temperature (30–32 0C) for a week before transplantation. For acclimatization, the plants with well developed roots (5–8 cm) were removed from culture tubes, washed in running tap water to remove the remnants of agar and each group was planted separately onto a 10cm diameter polycup filled with different potting mixtures: river sand, garden soil

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam a

Image 1. In vitro spore culture: Different developmental stages of Pronephrium triphyllum a - Spore (bar 1cm = 4µm); b - Filamentous stage (bar 1cm = 250µm); c - Different stages of prothalli - Camera view (bar 1cm = 250mm); d - Cordate prothallus (bar 1cm = 250mm); e - Different stages of prothalli - microscopic view (bar 1cm = 400µm); f - Matured prothalli (bar 1cm = 4mm); g - Cordate prothallus with male sex organs (bar 1cm = 400µm); h - Cordate prothallus with female sex organs (bar 1cm = 400µm)

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

1921

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam a

Image 2. In vitro spore culture: Different developmental stages of Spherostephanous unitus a - Spore (bar 1cm = 4µm); b - Filamentous stage (bar 1cm = 200µm); c - Different stages of spore germination (bar 1cm = 200µm); d - Gametophyte - filamentous stage; e - Gametophyte with rhizoids (bar 1cm = 250µm); f - Origin of the prothalli (spore - prothalli) (bar 1cm = 250µm); g - Surface view of gametophytes (bar 1cm = 600µm).; h - Cordate prothalli with rhizoids (bar 1cm = 600µm) 1922

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

Ex situ conservation of two threatened ferns

and farm yard manures (1:1:1) and sand and soil (2:1). The plants were kept in a mist chamber with a relative humidity of 70%. Plants were irrigated at 8hr intervals for 3–4 weeks and establishment rate was recorded. The plantlets established in community pots were transferred to a shade net house for 3–4 weeks and then repotted in larger pots (20cm diameter) with one plant in each pot. For cytological analysis, the in vitro raised young sporophytes (croziers) and immature sporangia in fertile fronds were squashed in acetocarmine after being fixed in a 1:3:6 mixture of glacial acetic acid, chloroform and 100% ethyl alcohol for 24 hours and then preserved in 95% ethyl alcohol. Mitotic and Meiotic chromosomes were observed in several cells for establishing the correct counts. For Peroxidase analysis, the explants were ground well in a mortar and pestle with phosphate buffer (pH 7.0) under ice cool condition. The resultant slurry was centrifuged at 10,000rpm for 10min at 40C in a mikro 22R centrifuge and the supernatant was used as the enzyme source and stored in a 700C deep freezer. Vertical discontinuous poly acrylamide gel electrophoresis (PAGE) was carried out for separation of isozyme. After the gel running, the gels were incubated in the dark with acetate buffer (pH 4.6) 85ml + Ethanol (10ml), O–Dianisidine (100mg) + 3% H2O2 (1ml) + 4ml distilled water for 30min for staining, 7% acetic acid was used to stop the reaction and fixed the gel (Smila et al. 2007). The Isoperoxidase profiles were documented using the Vilber Loubermet Gel Documentation system and the similarity between the mother plants and in vitro spore derived plants were calculated using the Biogene software (Vilber Loubermet, Germany).

Results Pronephrium triphyllum Spores collected from the mature fronds showed a variety of contamination and survival rates. On treatment with 0.1% (w/v) HgCl2 for 5min followed by washing with sterile distilled water for 15min showed 75–80 % of the spores free from the microbial contamination. The young spores showed a high percentage of mortality, even with a short duration of exposure to the sterilants. Spores were cultured

J. Marimuthu & V.S. Manickam

in liquid and solid basal media (Knudson, Knop’s, Mitra, Moore’s and Murashige and Skoog’s). Microbial contamination was more in the liquid media compared to the solid media. Spore germination time and germination percentages were dependent on the composition of the media. The spores sown on the Knop’s basal agar medium showed the highest percentage (38.3±1.13) of germination, followed in order, by the Moore’s, Mitra and Knudson C media respectively (22.3±0.81, 21.3±0.83 and 15.3±1.21). The time taken for spore germination also varied. In Knop’s medium spores germinated after 38 days, while in other media they took a much longer time for germination. The pattern of germination is of Vittaria type. After 3–4 weeks, repeated longitudinal and transverse division of the anterior cells of protonema and expansion of the resultant daughter cells formed the prothallial plate. The prothallus was cordate type. The prothallus development was Drynaria type. Highest percentage of prothallus (81.3±1.34) formation was observed in Mitra medium. The thallus was dioecious, dorsiventrally flattened which developed a midrib region with a cushion like structure and notched apical region. The glandular hairs were present along the margin and the midrib regions. The sex organs and rhizoids originated from the midrib region. After 120 days, the male sex organs, antheridias were formed on the posterior end. After 160 days, the female sex organs, archegonias were formed on the anterior end (Images 1b–h). For sporophyte proliferation, the 180 day – old gametophytes were transferred to Knudson C, Knop’s and Mitra liquid media. After 30 days, the sporophyte emerged from the midrib region on Knops liquid medium. After 15 days, the sporophytes were transferred to agar medium for sporophyte elongation. The highest percentage (52.3±1.43) of sporophyte formation was observed in Knop’s liquid medium compared to the other two media [Knudson C (16.5±1.31) and Mitra (11.3±0.81)] (Table 1). After 15 days of rooting, the in vitro derived plantlets were washed thoroughly in running tap water to remove the pieces of agar adhering to the roots and implanted in the pots containing a mixture of (1:2:1) sterile soil: sand: farmyard manure irrigated with 10 x diluted Murashige and Skoog’s / Knudson C liquid medium once a week. The pots were covered with poly bags to maintain the humidity. The plantlets were kept in a culture room

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

1923

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam

Table 1. Effect of medium on spore germination, development of gametophyte and sporophyte and field establishment in Pronephrium triphyllum

Medium & pH

% of Germination ± S.D.

% of Prothalli formation ± S.D.

% of Sporophyte formation ± S.D.

Mean no. of croziers/ prothallus ± S.D.

Mean length of Sporophyte ± S.D.

% of % of % of establishment establishment establishment in polycups ± in Pots ± S.D. in field ± S.D. S.D.

KC Solid 5.8

15.3±1.27

67.3±1.31

KN Solid 5.8

38.3±1.13

72.3±1.08

Mi Solid 5.5

21.3±0.83

81.3±1.31

MO Solid 5.5

22.3±0.81

68.4±1.34

KC Liquid

16.5±1.31

1.78±0.34

1.12±0.16

73.5±1.24

78.4±1.31

69.3±1.21

KN Liquid

52.3±1.43

4.0±1.63

1.38±0.74

82.3±1.31

79.3±1.31

72.3±1.24

Table 2. Effect of medium on spore germination, gametophyte, sporophyte formation and field establishment of Sphaerostephanos unitus

Medium

% of Germination ± S.D.

% of Prothalli formation ±_S.D.

% of Sporophyte formation ±_S.D.

Mean no. of croziers/ prothallus ± S.D.

Mean length of Sporophyte ±_S.D.

% of % of % of establishment establishment establishment in polycups ± in Pots ± S.D. in field ± S.D. S.D.

KN Solid

36.8±1.31

73.8±1.31

76.8±1.41

3.2±1.13

6.3±1.38

79.8±1.34

83.1±1.21

74.8±1.31

KC Solid

26.3±1.30

74.8±1.28

MS Solid

Mitra

34.8±1.21

66.3±1.21

for 15 days. After that, they were transferred to a green house (R.H. 80%) under constant misting. After three weeks the plants were transferred to the field. The micropropagated plants showed 73.5±1.24% establishment during hardening and 72.3±1.24% establishment in the field at KBG. Subsequently the micropropagated plants were distributed to various botanic gardens for ex situ conservation. (Table 1) (Image 4c,d). Sphaerostephanos unitus Matured spores were used for culture initiation. The percentage of microbial contamination was less when the spores were treated with 0.1% HgCl2 (w/v) for 5min and washed thoroughly using sterile distilled water for 15min. The survival of explants depended on the duration of the treatment with sterilants and the prolonged exposure (6–10 min) to 0.1% HgCl2 resulted in high percentage mortality. The spores were cultured in hormone free liquid and solid media (Knudson C, Knop’s, Murahige & Skoog’s and Mitra). In the liquid media, the inoculated spores failed to germinate due to the high incidence of microbial contamination. After 35 days, the spores started to germinate in knops 1924

agar medium. The germination pattern was Vittaria type. The prothallial plate was formed after 30 days of culture, due to the repeated divisions of the cells. The prothallus development was Drynaria type. The thallus was dorsiventrally flat with an apical notch. The prothalli were cordate type. A high percentage of prothalli formation (74.8±1.21) was observed in Knudson C medium. Glandular hairs were present on the margin and central areas of the gametophyte. The male and female sex organs formed on the midrib region. The male and female sex organs formed after 120 and 150 days respectively. The sporophyte emergence was noticed in the midrib regions after 180 days with the formation of sporophyte and root initials (Image 2b–h). The highest percentage (36.8±1.31) of spore germination was observed in the Knop’s basal agar. Germination was not observed on the Murashige and Skoog’s basal medium. The highest frequency of gametophyte formation and multiplication (74.8±1.28) were observed in Knudson C basal medium. The sporophyte formation was observed only in Knop’s medium, that too at a high (76.8±1.41) percentage; there was no formation of sporophyte in other media (Table 2). Knop’s medium also promoted the formation and

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam a

Image 3. Isoperoxidase profile and cytological studies on in vitro raised sporophytes and mother plants of P. triphyllum and S. unitus a - P. triphyllum (Mitosis); b - P. triphyllum - Isoperoxidase Profile; c - S. unitus - Isoperoxidase d- Profile; S. unitus (Mitosis)

Image 4. Hardening and field establishment of in vitro raised plantlets of P. triphyllum, S. unitus a - S. unitus - hardened plants; b - Micropropagated & hardened plants of S. unitus - reintroduced into KBG; c - P. triphyllum - hardened plants; d - Micropropagated & hardened plants of P. triphyllum - reintroduced into KBG

elongation of rhizoids. After 30 days of rooting, rooted plants were hardened in polycups containing a mixture (1:2:1) of sand: garden soil: farmyard manure, covered with unperforated poly bags and irrigated with 10 x diluted MS liquid medium once a week. The plants

were kept in the culture room for 15 days. Seventy eight percentage of the plants were successfully established in poly cups. After 15 days, the hardened plants were transferred to 15cm diameter pots and kept in the green house. Eightyâ&#x20AC;&#x201C;five percentage of plants

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919â&#x20AC;&#x201C;1928

1925

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam

Table 3. Growth of micropropagated plants of P. triphyllum and S. unitus re-established into Kodaikannal Botanic Garden at Kodaikanal, Tamil Nadu, India Plant species

No. of plants transferred to polycups

% of establishing in polycup

No. of plants transferred to pots

% of establishment in pots

No. of plants transferred to field

% of establishment

P. triphyllum

375

73.5

275

120

S. unitus

300

235

120

were well established in the green house. After six months, the plants, 34cm in height, having 10 to 12 croziers were repotted, for distribution to various Botanic Gardens, such as the Calicut University Botanic Garden, Kozhikode; TBGRI, Trivandrum; Gurukula Botanic Garden, Wyanad and Genepool Garden, Gudalur for ex situ conservation. Many plants were also transferred to their natural settings in the Kodaikanal Botanic Garden, Kodaikanal for field establishment (Table 3) (Images 4aâ&#x20AC;&#x201C;d). Isoperoxidase analysis revealed the genetic uniformity between the mother plants and in vitro spore raised sporophytes. The MW â&#x20AC;&#x201C; Rf values and banding positions confirmed 100% genetic uniformity. In addition they provided the biochemical marker for the two selected species. P. triphyllum (Image 3b) showed three different bands in three different active regions (0.510, 0.664 and 0.764). S. unitus (Image 3c) showed only two bands in two different active regions (0.478 and 0.536). Cytological studies on root tips of ten randomly selected plants established in KBG revealed the presence of 144 chromosomes in P. triphyllum (Image 3a) and 72 chromosomes in S. unitus (Image 3d) confirming the mother plants chromosomes.

Discussions Spores are tiny objects which are used liberally by ferns for reproduction. A spore contains only half the normal chromosome number and no embryo. The single celled spores are excellent experimental material on par with pollen grains and isolated cells of higher plant species. Observations over the past twenty years reveal that spores are produced in huge numbers by nature, but the percentage of spore germination and their developmental physiology rate is very poor due to unfavourable conditions. Each and every species requires their unique environment for their growth and development; most of the rare and endangered 1926

ferns failed to obtain the optimal growth condition for their development. The present study also confirmed the previous observations. However, there are a few published reports on successful germination of spores in vivo (Theuerkauf 1994). Under natural conditions, the percentage of spore germination is low due to the prevalence of unfavourable factors, both biotic and abiotic. It is not unusual that the spores are dispersed by wind to places unfavourable for their germination. The spores otherwise having little stored food materials, seldom germinate in the wild. The spores can germinate under in vitro conditions easily. The in vitro spore culture methods have advantages over soil based conventional methods. The in vitro culture techniques have been used to study different aspects of spore germination, growth and development of gametophytes and sporophytes in ferns (Nester & Coolbaugh 1986; Hickok et al. 1987; Miller & Wagner 1987; Melan & Whittier 1990). However there are number of factors such as temperature, humidity, light, and nutrient compositions (Raghavan 1989) which need to be addressed for successful in vitro spore culture. Tissue culture which tends to be more sophisticated than spore culture is also advocated and successfully explored for horticulture propagation of selected ferns (Hennen & Sheehan 1978; Padhya & Mehta 1981; Higuchi et al. 1986). Successful culture initiation, be it spore culture or tissue culture, depends on a number of physical and chemical factors. A number of workers have studied spore germination under the influence of various physiological and chemical parameters (Mehra & Palta 1971; Sharma & Vangani 1988; Sharma & Sharma 1991). In the present investigation also, the spores of all the selected species were cultured under varied conditions with the object of developing viable protocols for mass multiplication and conservation. In a comparative perspective, spore cultures are more desirable for rare species conservation than tissue culture as it retains the genetic variability inherent in the genetic make up of a species. Nowadays, accurate

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919â&#x20AC;&#x201C;1928

Ex situ conservation of two threatened ferns

recordings of the genetic uniformity and chemical characterization of the plants are needed to be verified before conservation. Analysis of isoenzyme banding profile is considered to be one of the best and cheapest system for the analysis of population structure, genetic uniformity and developmental pattern, due to its role in the metabolic pathway. It functions in harmony with other enzymes within the organizational framework of cells and Isoenzyme often exhibits tissue or cell specificity (Zeidler 2000). These banding profiles are useful in differentiating the selected species and the induced variants. In the present study also, Isoperoxidase studies revealed the biochemical uniformity between the mother plants and the in vitro spore raised plants. The earlier reports are directly consonant with the present study and strengthen the role of isoperoxidase in the study of genetic uniformity (Nair 2000; Johnson 2003; Nikhat 2004; Sonali 2004). Since the 1960s, Electrophoresis coupled with isoenzyme has been the tool of choice for studies of heritable variation by geneticist, systematist and population biologist (Zeidler 2000). The isoperoxidase profiles will be used as a taxonomic tool for the characterization of the two important ferns in the future. The present study completely demonstrated the life cycle and reproductive biology of the two rare and endangered ferns of the Western Ghats, India. The established protocol of the present study will be useful for the multiplication and conservation of the two threatened ferns of the Western Ghats. The same protocol may also be applied to similarly threatened conserved ferns.

Reference Fay, M.F. (1994). In what situations is in vitro culture appropriate to plant conservation? Biodiversity and Conservation 3: 176–183. Hennen, G.R. & T.J. Sheehan (1978). In vitro propagation of Platycerium stemaria (Beauvois) Desv. Hortscience 13: 245. Hickok, L.G., T.R. Warne & M.K. Slocum (1987). Ceratopteris richardii: Applications for experimental plant biology. American Journal of Botany 59: 458–465. Higuchi, H., W. Amaki & S. Suzuki (1986). In vitro propagation of Nephrolepis cordifolia (L.) Presl. Scientia Horticulturae 32: 105–113. Irudayaraj, V., V.S. Manickam & M. Johnson (2003). Incidence of Apospory in Pteris confusa T. G. Walker.

J. Marimuthu & V.S. Manickam

Phytomorphology 53(1): 73–77. Johnson, M. (2003). In vitro studies on some rare and endangered ferns of Western Ghats, south India. PhD Thesis. Manonmanium Sundarnar University, Tamil Nadu, India. Johnson, M., V.S. Manickam & V. Irudayaraj (2005). In vitro studies on the agamsporous fern (Pteris gongalensis T. G. Walker). Ethiopian Journal of Science and Technology 3(1): 1–8. Johnson, M. & V.S. Manickam (2006). Adventitious Proliferation of secondary and tertiary prothalli from the primary prothalli of Pronephrium articulatum (Houlst. & Moore) Holt. Ethiopian Journal of Science and Technology 3(2): 93–96. Johnson, M. & V.S. Manickam (2006). In vitro studies on normal and abnormal life cycle of Metathelypteris flaccida (Bl.) Ching. Ethiopian Journal of Science and Technology 4(1): 37–44. Johnson, M., V.S. Manickam, A. Benniamin & V. Irudayaraj (2008). Conservation of endangered ferns of Western Ghats through micropropagation, pp. 183–191. In: Verma, S.C., S.P. Khuller & H.K. Cheema (eds.). Perspective in Pteridophytes. Bishen Singh Mahendra Pal Singh, Dahradun, India. Kaur, S. (1989). Economic exploitation and conservation emerging areas in the study. Indian Fern Journal 6: 23–29. Knops, N. (1885). Quantitative Untersuchungan uber die Ernahrungsprozesse der pflangen Land wirtsch Vers, stn. 7: 93–107. Knudson, L. (1946). A nutrient solution for the germination of orchid seed. Bulletin of American Orchid Society15: 214– 217. Luo, G.H. (1988). Medicinal pteridophytes in China. pp. 309– 312. In Singh, K.H. & K.C. Kramer (eds.). Proceedings of the International symposium on systematic pteridology China Science and Technology Press, Beijing China. Manickam, V.S. (1995). Rare and endangered ferns of the Western Ghats of South India. Fern Gazette 15: 1–10. Manickam, V.S. & V. Irudayaraj (1992). Pteridophyte flora of the Western Ghats - south India, B.I. Publications New Delhi, India. Manickam, V.S., S. Vallinayagam & M. Johnson. (2003). Micropropagation and Conservation of rare and endangered ferns of Western Ghats through in vitro culture. pp: 497– 504. In: Chandra, S. & M. Srivastava (eds.). Pteridology in the New Millennium. Kluwer Academic Publishers, Netherlands. Medina, R., M. Faloci, M.A. Marassi & L.A. Mroginski (2004). Genetic stability in rice micropropagation. Biocell 28(1): 13–20. Mehra, P.N. & H.K. Palta (1971). In vitro controlled differentiation of the root callus of Cyclosorus dentatus. Phytomorphology 21: 367–375. Melan, M.A. & D.P. Whittier (1990). Effects of in organic nitrogen sources in spore germination and gametophyte growth in Botrychium dissectum. Plant cell and environment 13: 477–482. Miller, J.H. & M.P. Wagner (1987). Co–requirement for

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

1927

Ex situ conservation of two threatened ferns

J. Marimuthu & V.S. Manickam

Calcium and Potassium in the germination of spores of the fern Onoclea sensibilis. American Journal of Botany 74: 1585–1589. Mitra, G.C., R. N. Prasad. & R. Chowdhury (1976). An inorganic salts and differentiation of protocornes, in seed callus of an orchid and correlated changes in free amino acids content. Indian Journal of Experimental Biology 14: 350–351. Moore, G.T. (1903). Methods of growing pure cultures of algae. Journal of Applied Microscopy 6: 2309–2314. Murashige, T. & F. Skoog. (1962). A revised medium for rapid growth and bioassay with tobacco tissue culture. Physiologia Plantarum15: 473–497. Nair, L.G. (2000). Conservation through micropropagation restoration of selected woody medicinal plants. PhD Thesis. Kerala University, Thiruvananthapuram, Kerala, India Nester, J.F. & R.C. Coolbaugh (1986). Factors influencing spore germination and early gametophyte development in Anemia mexicanum and Anemia phyllitidis. Plant physiology 82: 230–235. Nikhat, Y. (2004). In vitro multiplication and electrophoretic studies on Passiflora mollissima H.B. K. Bailey. MPhil Thesis. Periyar University, India. Padhya, M.A. & A. R. Mehta. (1981). Propagations of fern (Nephrolepis) through tissue culture. Plant cell Reports. 1: 261–263. Raghavan, V. (1989). Developmental biology of fern gametophytes. Cambridge University press Cambridge, 27–53pp. Raven, P.H. (1999). World’s biodiversity becoming extinct at levels rivaling earth’s past “mass extinctions”. Botanic Garden Conservation News 3: 31–32. Sabu, K.K., P. Padmesh & S. Seeni (2001). Estimation of active principle content and isozymes of Andrographis paniculata Nees (Kalmegh): An important medicinal plant of India. Journal of Medicinal Aromatic Plant Science 23: 637–647. Sara, S.C. (2001). Conservation of selected rare and endangered ferns of the Western Ghats through micropropagation and restoration. PhD Thesis. Manonmaniam Sundaranar University, Tirunelveli, India. Sara, C.S. & V.S. Manickam (2005). In vitro propagation of the critically endangered fern Cyathea crinita (Hook.) Copel. Asian Journal of the Microbiology Biotechnology Environmental Science 7: 527–536. Sara, C.S. & V.S. Manickam (2007). In vitro developmental ontogeny and life cycle of a are fern species - Thelypteris confluens (Thunb.) Morton. Indian Journal of Biotechnology 6: 372–380. Sara, S.C., V.S. Manickam & R. Antonisamy (1998). Regeneration in kinetin treated gametophytes of Nephrolepis multiflora (Roxb.) Jarret in Morton. Current Science 75: 503–508. Sharma, A. & B.D. Sharma. (1991). Hitherto unreported methods for the multiplication of ferns. Phytomorphology 41: 271–274. Sharma, B.D. & P. Vangani (1988). Effects of gibberllin (GA3) on development and sex expression in the gametophytes of Cheilanthes farinos (Forssk.) Klf. Indian Fern Journal 5: 1–4. Smila, H., M. Johnson & M. Rajasekarapandian (2007). Studies on varietal difference, tissue specificity and developmental variation of esterase and peroxidase isozymes in pearl millet (Pennisetum glacum (L.) R. Br.). Indian Journal of Biotechnology 6: 91–99. Sonali, D. (2004). Micropropagation and Intra specific variation studies on Vitex negundo L. MPhil Thesis, Periyar University, India. Theuerkauf, W.D. (1994). Preserving southern Indian pteridophytes. Botanic Garden Conservation News 2: 54–55. Vallinayagam, S. (2003). Micropropagation of rare and endangered ferns of Western Ghats. PhD Thesis.Manonmaniam Sundaranar University, Tirunelveli, India. Zeidler, M. (2000). Electrophoretic analysis of plant isozymes. Acta Universitatis Palackianae Olomucensis, Facultas Rerum Naturalium Biology 38: 7–16. 1928

Author Details: Dr. M. Johnson standardized the large scale multiplication protocol for thirteen rare and endangered ferns of the Western Ghats under the Ministry of Environment and Forest, New Delhi sponsored project. He has also published about 66 papers in national and international journals on large scale propagation, phytochemical, antimicrobial activity and isozymic profile of Indian medicinally important plants. Rev. Dr. V.S. Manickam carried out several projects sponsored by DST, DBT, Moen, UGC. During the last twenty five years he has surveyed Pteridophytes of the Western Ghats and Angiosperms of Tirunelveli Hills. He coordinated the All India Coordinated Project on Taxonomy for Pteridophytes and Gymnosperms. He has completed several projects on ex situ conservation of several rare and endangered ferns and angiopserms. He has published six books and more than 300 research papers.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1919–1928

JoTT Communication

3(7): 1929–1935

Prevalence of Listeria species including L. monocytogenes from apparently healthy animals at Baroda Zoo, Gujarat State, India Mahendra Mohan Yadav 1, Ashish Roy 2, Bharat Bhanderi 3 & R.G. Jani 4 Assistant Professor, Mahatma Phule Krishi Vidyapeeth, Rahuri, Maharashtra 413722, India Professor, 3 M.V.Sc Scholar, Department of Veterinary Microbiology, 4 Professor, Department of Veterinary Medicine, College of Veterinary Science & Animal Husbandry, Anand, Gujarat 388001, India Email: 1 drmahendrayadav@rediffmail.com (corresponding author), 2 aroyvet@yahoo.co.in, 3 bbbhanderi@yahoo.co.in, 4 rgjani@aau.in 1

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Ulrike Streicher Manuscript details: Ms # o2094 Received 06 November 2008 Final received 25 May 2011 Finally accepted 01 June 2011 Citation: Yadav, M.M., A. Roy, B. Bhanderi & R.G. Jani (2011). Prevalence of Listeria species including L. monocytogenes from apparently healthy animals at Baroda Zoo, Gujarat State, India. Journal of Threatened Taxa 3(7): 1929– 1935. Copyright: © Mahendra Mohan Yadav, Ashish Roy, Bharat Bhanderi & R.G. Jani 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. For Author Details and Author Contribution see end of this article Acknowledgements: We thank Dean/Principal, College of Veterinary Science and Animal Husbandry, Anand for providing necessary facilities to carry out the research work. We also thank Dr. C.G. Joshi, Professor, Animal Biotechnology Laboratory, College of Veterinary Science and Animal Husbandry, Anand for technical assistance in molecular work.

Anand Agricultural University

OPEN ACCESS | FREE DOWNLOAD

Abstract: Listeriosis is a infectious bacterial disease of domestic and wild animals and humans. A total of 56 faecal samples were collected from mammals and birds at Baroda Zoo, Vadodara, Gujarat State, India. Confirmation of the isolates was based on biochemical tests followed by phenotypic characterization by hemolysis on sheep blood agar, Christie Atkins Munch-Petersen (CAMP) test, phosphatidylinositol-specific phospholipase C (PI-PLC) assay and phosphatidylcholine-specific phospholipase C (PC-PLC) assay. The isolates were subjected to genotypic characterization with the help of polymerase chain reaction (PCR) assay for five virulence-associated genes, plcA, prfA, hlyA, actA and iap. Listeria monocytogenes isolates were further subjected to multiplex-PCR based serotyping. From 56 samples three (5.36%) were found positive for Listeria spp. of which one (1.79%) was identified as L. monocytogenes and two (3.57%) were identified as L. innocua. The isolate of L. monocytogenes was hemolytic, CAMP positive, PI-PLC positive, hlyA, pclA and prfA positive by PCR and turned out to be PC-PLC positive and was serotyped as 4b. Keywords: CAMP, Listeria monocytogenes, PCR, serotyping, serovar, zoo animals.

Introduction Listeriosis is an important bacterial disease of animals and a zoonosis with a broad distribution; Listeria monocytogenes is the major pathogen causing listeriosis and is of significant economic and health concern as it causes disease in a wide variety of animals including sheep, goats, cattle, buffaloes, dogs, horses, chickens, rabbits and also human beings (Katiyar 1960). Information on the serovar allows discrimination between isolates belonging to an outbreak and those that are not part of the outbreak. All major outbreaks of listeriosis are caused by serovar 4b, which is primarily responsible for ruminant listeriosis (Rocourt & Seeliger 1985; Radostits et al. 1994). This strain is infrequent in foods compared to 1/2a strains (Buchrieser et al. 1993; Farber & Peterkin 1991). The procedure adopted to investigate outbreaks relies on serovar characterization for isolated strains. Although 13 serovars are described for L. monocytogenes, at least 95% of the strains isolated from foods and patients belong to the serovars 1/2a, 1/2b and 4b (Seeliger & Hohne 1979; Tappero et al. 1995; Graves et al. 1999). In Gujarat State, India, there has been no report of Listeria sp. from wild animals; although L. monocytogenes has been isolated from wild animals in Nagpur City in the neighbouring Maharasthra by Kalorey et

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

1929

Listeria species at Baroda Zoo

M.M. Yadav et al.

al. (2006). It is very important for public health to understand the prevalence of Listeria in wild animals, since wild animals whether captive or free-ranging may act as a reservoir for the disease. The purpose of this study was to determine the prevalence of Listeria sp. in apparently healthy zoo animals and to characterize the isolates phenotypically and genotypically.

Materials and Methods Bacteria: Strains of L. monocytogenes 4b (MTCC 1143), Staphylococcus aureus (MTCC 1144), Rhodococcus equi (MTCC 1135), Escherichia coli (MTCC 443) were obtained from the Microbial Type Culture Collection and Gene Bank, Institute of Microbial Technology, Chandigarh, India. Different strains of Staphylococcus aureus (ATCC 25923), Streptococcus agalactiae (NCIM 2401), Bacillus spp. (ATCC 6638) and Pseudomonas aeruginosa (ATCC 27853) were obtained from the Department of Veterinary Microbiology, College of Veterinary Science & Animal Husbandry, Anand, India. Samples: A total of 56 faecal samples were collected from mammals (9) and birds (47) of Baroda Zoo. The animals screened were Sambar (2), Chital (3), Black Buck (3) Nilgai (1) and that of birds were Love birds (5), Cockatoo (5), Rosella (2), Macaw (3), Dove (10), Emu (5), Conur (4), Koel (2), Cockatiel (5), Lori (6). Isolation of Listeria: Isolation of listeriae from the faecal samples of the animals followed the method of the US Department of Agriculture (USDA) described by McClain & Lee (1998) with some modifications. Samples were enriched by two-step enrichment in University of Vermont (UVM) medium -I and II. Each of the faecal swabs was aseptically transferred into 10ml UVM-I. In UVM-I medium the samples were incubated at 30oC for 24hr. Then the samples were incubated in the UVM -II medium at 300C for up to seven days. After 24hr, 48hr and seven days of incubation samples were simultaneously streaked onto Dominguez-Rodriguez isolation agar (DRIA), PALCAM agar, and Oxford agar. Confirmation of the isolates: Morphologically typical colonies were verified by Gram’s staining, catalase reaction, tumbling motility at 20–25 0C, Methyl Red–Voges Proskauer (MR–VP) reactions, 1930

nitrate reduction and fermentation of sugars (rhamnose, xylose, mannitol and α-methylD - mannopyranoside). Phenotypic characterization Haemolysis on sheep blood agar (SBA): All the Listeria isolates were tested for the type (α or β) and the degree (narrow or wider) of hemolysis on SBA. The isolates were streaked onto 7% SBA plates and incubated at 370C in a humidified chamber for 24hr. After that they were examined for haemolytic zones around the colonies. Interpretation of the haemolytic reaction was based on the formation of a typical wide and clear zone of haemolysis (β-haemolysis) representing L. ivanovii and formation of a narrow zone of haemolysis (α-haemolysis) representing L. monocytogenes or L. seeligeri. Christie, Atkins, Munch-Petersen (CAMP) test: The standard strains of Staphylococcus aureus and Rhodococcus equi were grown overnight on SBA plates at 370C in a humidified chamber. The colonies were then also streaked onto freshly prepared 7 % SBA plates in a manner that the streaks were wide apart and parallel to each other. In between the parallel streaks of S. aureus and R. equi the Listeria isolates were streaked at 900 angles and 3mm apart before incubating them at 370C for 24hr. In case of a CAMP positive reaction the synergistic effect of the haemolysins would lead to a wider zone of complete haemolysis between a Listeria strain and the S. aureus or R. equi strain. The Listeria isolates with CAMP-positivity against S. aureus were characterized as L. monocytogenes and those with CAMP positivity against R. equi were characterized as L. ivanovii . Phosphatidylinositol-specific phospholipase C (PI-PLC) assay: All the phenotypically characterized Listeria isolates were assayed for PI-PLC activity following the method of Leclercq (2004) with certain modifications. Listeria isolates were incubated overnight on 7% SBA plates at 370C in a humidified chamber. All L. monocytogenes isolates were streaked on L. mono differential agar (Hi Media Ltd, Mumbai, India) in order to assess PI-PLC activity. The inoculated plates were incubated at 370C in a humidified chamber for 24hr. Light blue colonies showing formation of a halo around the inoculation site were considered positive. Phosphatidylcholine-specific phospholipase C (PC-PLC) Assay: an egg-yolk opacity test was

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

Listeria species at Baroda Zoo

M.M. Yadav et al.

Table 1. Details of primers for amplification of virulence marker associated genes of L. monocytogenes Target gene plc A

prf A

hly A

iap A

act A

prs

Product size (bp)

Primer Sequence Forward

5'- CTG CTT GAG CGT TCA TGT CTC ATC CCC C - 3'

Reverse

5'- CAT GGG TTT CAC TCT CCT TCT AC - 3'

Forward

5'- CTG TTG GAG CTC TTC TTG GTG AAG CAA TCG - 3'

Reverse

5'- AGC AAC CTC GGT ACC ATA TAC TAA CTC - 3'

Forward

5'- GCA GTT GCA AGC GCT TGG AGT GAA - 3'

Reverse

5'- GCA ACG TAT CCT CCA GAG TGA TCG - 3'

Forward

5'- ACA AGC TGC ACC TGT TGC AG - 3'

Reverse

5'- TGA CAG CGT GTG TAG TAG CA -3'

Forward

5'- CGC CGC GGA AAT TAA AAA AAG A - 3'

Reverse

5'- ACG AAG GAA CCG GGC TGC TAG - 3'

Forward

5’- GCT GAA GAG ATT GCG AAA GAA G-3’

Reverse

5’- CAA AGA AAC CTT GGA TTT GCG G -3’

conducted to examine the PC-PLC activity of the isolates. Tryptic soy agar (Hi Media Ltd. Mumbai, India) plates were prepared with 2.5% egg-yolk emulsion (Hi Media Ltd. Mumbai, India) and 2.5 % NaCl and a pH of 6.5–7. Listeria isolates were streaked onto the agar surfaces and incubated at 370C for 36–72 hr. Formation of opaque zones surrounding the colonies was considered positive (Coffey et al. 1996). Genotypic Characterization Polymerase chain reaction (PCR) based detection of virulence-associated genes: The standard strain of L. monocytogenes (MTCC 1143) was incubated overnight in brain heart infusion at 370C. About 0.5ml of the culture was then centrifuged in a microcentrifuge (Sigma, USA) at 6000×g for 10 min. The recovered pellet was resuspended in 100μl of sterilized DNAse and RNAse-free milliQ water (Millipore, USA), heated in a boiling water bath for 10 min and then shock chilled in crushed ice. The obtained lysate (5μl) was used as a DNA template in PCR reaction mixture. For the amplification of the virulence associated genes of L. monocytogenes, hemolysin gene (hlyA), regulatory gene (prfA), Phosphatidylinositol phospholipase C gene (plcA), Actin gene (actA) and p60 gene (iap), primers synthesized by Sigma Aldrich, USA were used. Details about primers and PCR product sizes are shown in Table 1. PCR conditions followed methods described by multiple authors (Furrer et al. 1991; Notermans

Reference

1484

Notermans et al. 1991a

1060

Notermans et al. 1991a

456

Paziak-Domanska et al. 1999

131

Furrer et al. 1991

839

Suarez et al.2001

370

Doumith et al. 2004

et al. 1991a; Paziak-Domanska et al. 1999; Suarez & Vazquez-Boland 2001) with some modifications. Conditions affecting the sensitivity and specificity of the reaction were optimized. Such conditions are for example the concentrations of MgCl2, primers and Taq DNA polymerase, the annealing temperatures (50–600C) and the number of cycles for amplification of the target gene. Based on optimization trials, the standard PCR protocol for a 50μl reaction mixture included 5.0μl of 10×PCR buffer (100mm Tris–HCl buffer with pH 8.3 containing 500mM KCl, 15 mM MgCl2 and 0.01% gelatin), 1μl of 10mM dNTP mix (a final concentration of 0.2mM; Sigma, USA), 4μl of 25mM MgCl2 (a final concentration of 2 mM) and 10μM of a primer set containing forward and reverse primers at a concentration of 0.1μM of each primer, 1 U of Taq DNA polymerase (Sigma, USA), 5μl of cell lysate and sterilized milliQ water to make up the reaction volume. The 0.2ml PCR tube containing the reaction mixture was tapped thoroughly with a finger and then flash spun in a micro centrifuge. The DNA amplification was performed in a Master Cycler Gradient Thermocycler with a preheated lid (Eppendorf, Hamburg, Germany). The cycling conditions for PCR included an initial denaturation at 950C for two minutes followed by 35 cycles each of 15s denaturation at 950C, 30s annealing at 600C and 90s extension at 720C, followed by a final extension of 10min at 720C and kept at 40C. All the five sets of primers for virulence-associated genes

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

1931

Listeria species at Baroda Zoo

M.M. Yadav et al.

Table 2. Details of primers for amplification of target genes of Listeria monocytogenes employed in serotyping PCR Gene target lmo0737

ORF2819

ORF2110

prs

Primer Sequence F

5'- AGG GCT TCA AGG ACT TAC CC- 3'

5'- ACG ATT TCT GCT TGC CAT TC - 3'

5'- AGC AAA ATG CCA AAA CTC GT - 3'

5'- CAT CAC TAA AGC CTC CCA TTG - 3'

5'- AGT GGA CAA TTG ATT GGT GAA - 3'

5'- CAT CCA TCC CTT ACT TTG GAC- 3'

5'- GCT GAA GAG ATT GCG AAA GAA G- 3'

5'- CAA AGA AAC CTT GGA TTT GCG G -3'

were amplified under similar PCR conditions and amplification cycles. The resulting PCR products were analyzed by agarose gel electrophoresis (1.5%; low melting temperature agarose L), stained with ethidium bromide (0.5μg/ml) and visualized by a UV transilluminator (UVP Gel Seq Software, England). Multiplex PCR based serotype detection of Listeria monocytogenes isolates: The multiplex PCR assay was standardized for the detection of serovars 1/2a, 1/2b and 4b of L. monocytogenes following the methodology described by Doumith et al. (2004). The primers for detection of L. monocytogenes 0737 gene (lmo0737), transcriptional regulator gene (ORF2819), secreted protein gene (ORF2110) and phosphoribosyl pyrophosphate synthetase gene (prs) of L. monocytogenes used in this study were synthesized from Sigma Aldrich. Details of the primer sequences are shown in Table 2. The PCR was set for 50µl reaction volume. For the detection of L. monocytogenes serotypes concentrations of molecular biologicals, annealing temperature and number of cycles for amplification of the target genes were varied until optimal conditions were determined. The optimal reaction mixture for PCR contained 5.0µl of 10x PCR buffer (), 1.5µl dNTP mix, 4µl of 25mM MgCl2 and 100µM of forward and reverse primers for each serovar 1/2a, 1/2b and 4b (final concentration 0.1µM each) and 10µM of forward and reverse primers for each Listeria spp. (final concentration 0.1µM each), 2 units of Taq DNA Polymerase, 5µl of cell lysate and sterilized milliQ water to make up the reaction volume. The 0.2ml PCR tube containing the reaction mixture was flash spun in a micro centrifuge. The reaction was performed in a Px2 Thermal cycler with a pre-heated 1932

Product Size (bp)

Serovar specificity

Protein encoded by the target gene

691

1/2a

Unknown, no similarity

471

1/2b and 4b

Putative transcriptional regulator

597

Putative secreted protein

370

All Listeria species

Putative phosphoribosyl pyrophosphate synthetase

lid (Thermo electronic corporation, USA). The cycling conditions included an initial denaturation for five minutes at 940C followed by 35 cycles of denaturation for 30 seconds at 940C, 75 seconds of annealing at 540C and 75 seconds of extension at 720C. It was followed by 10 minutes of extension at 720C and was finally held for 30 minutes at 40C. After the reaction, PCR products were kept at –200C until further analysis by agarose gel electrophoresis.

Results Isolation of Listeria monocytogenes: From 56 samples, 3 (5.36%) were found positive for Listeria spp., of which 1 (1.79%) was identified as L. monocytogenes and 2 (3.57%) as L. innocua. Phenotypic characters: One of the Listeria isolates was CAMP positive and showed the characteristic enhancement of haemolytic zone with S. aureus. Two of the isolates did not show enhancement of the hemolytic zone either with S. aureus or R. equi. The CAMP positive isolate was also found to be positive for PI-PLC and PC-PLC assay and was confirmed to be L. monocytogenes. Genotypic characters: The standardized PCR allowed amplification of virulence associated genes of L. monocytogenes plcA, prfA, actA, hlyA and iap to their respective base pairs, 1484 bp, 1060 bp, 839 bp, 456 bp and 131 bp, and allowed visualization of each virulence associated gene, each gene represented by a single band in the corresponding region of the DNA ladder. The primers used in the PCR were specific to the target genes and all the five genes were detected in standard strains of L. monocytogenes, whereas none

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

Listeria species at Baroda Zoo

of the genes was detected in the cultures of the other bacterial species cultures (Staphylococcus aureus, Rhodococcus equi, Escherichia coli, Streptococcus agalactiae, Bacillus spp. and Pseudomonas. aeruginosa). All three Listeria isolates were subjected to standardized PCR for detection of five virulenceassociated genes. Only one isolate, which has been confirmed as L. monocytogenes, showed amplification for four of the virulence-associated genes (hlyA, plcA, prfA and actA), the fifth gene (iap) was not detected. The isolates confirmed as L. innocua failed to amplify any of the five virulence-associated genes. The multiplex PCR was standardized for detection of three major serotypes of L. monocytogenes 1/2a, 1/2b and 4b by targeting various genes like Imo0737, ORF2819, ORF2110 and prs which were coding unknown protein, putative transcriptional regulator, putative secreted protein and putative phosphoribosyl pyrophosphate. The isolate showed amplification of three molecular size bands 471 bp, 597 bp and 370 bp corresponding to the genes, ORF2819, ORF2110 and prs, respectively. All the isolates biochemically identified as Listeria, including the two isolates identified as L. inocua, amplified 370 bp product corresponding to gene prs. This was used as an internal amplification control. The single L. monocytogenes isolate was serotyped as 4b by multiplex PCR assay.

Discussion Prevalence of Listeria spp. and L. monocytogenes from zoo animals: In a zoo setting infectious diseases are the main cause for animal losses as well as a concern for public health. Infectious diseases are caused by bacteria, fungi, parasites, or viruses. Control of such infections is difficult because of the design and purpose of the zoo itself. In a modern zoo we strive to show the animal under natural conditions and it is impossible to provide pathogen free soil, water or air. However, infectious diseases can be minimized with appropriate recognition of the problem and training of personnel to limit the spread of infectious organisms. In the present study 5.36% of the animals checked were found positive for Listeria spp, of which 1.79%

M.M. Yadav et al.

was L. monocytogenes and 3.57% were L. innocua. This is a fairly low infection rate compared to the results of Arumugaswamy & Gibson (1999), who reported 18.6% of the animals excreting L. monocytogenes in Taronga Zoological Garden, New South Wales, Australia, and Bauwens et al. (2003), who reported 7.5% of all wild animals in zoos were carrying pathogenic Listeria. Faeces of healthy animals have often been reported to contain L. monocytogenes (Skovgaard & Morgen, 1988). In India, Kalorey et al. (2006) isolated L. monocytogenes from eight (16.0%) of 50 faecal samples of healthy captive wild animals. The presence of Listeria sp. including L. monocytogenes without clinical signs in zoo animals may reflect that these animals were in the incubation period of a disease or they are not susceptible to the organism. Listeria sp. are ubiquitous in nature and are commonly found in the intestines of animals and humans without necessarily causing disease. In a zoo setting, the keeping of many species of animals in a restricted area could lead to an increased number of clinically healthy carriers posing an infection risk to susceptible animals, personnel and visitors. In domestic cattle the reported rate of Listeria spp. identified in the faeces was in the range of 3.1â&#x20AC;&#x201C;45.8 % (Gronstel 1979; Loken et al. 1982). In comparison to farm animals the prevalence of Listeria sp. and L. monocytogenes in zoo animals found in our study is very low. This might be a result of individual care, isolation and better hygienic measures. For domestic cattle the usual route of infection is via contaminated food. However, silage was not fed to the herbivores at the zoo. All Listeria in our study were found in samples from carnivores and here the raw meat products fed to the animals may be the source of infection. The rate of isolation of Listeria sp., L. monocytogenes and L. innocua in the present study, was very low; this was probably due to several factors that were compounded by an already low incidence of the organism. One of the major factors was the extremely high microbial load of feces. Our findings thus were consistent with that of Siragusa et al. (1993) who reported that L. innocua was the most frequent species of Listeria isolated from cattle. The PCR assay in for detection of virulence associated genes, the iap gene from the L.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929â&#x20AC;&#x201C;1935

1933

Listeria species at Baroda Zoo

M.M. Yadav et al.

monocytogenes isolate was not amplified whereas the other four virulence-associated genes showed specific amplification. The iap gene might be absent or there is mutation in primer binding region. However, this did not reflect in any of the biochemical or phenotypical reactions of the isolate. Nishibori et al. (1995) has shown that the PCR detection of only one virulence associated gene is not always sufficient to identify L. monocytogenes. We have shown that at least one of the virulence associated genes can miss without an alteration of the isolate. The minimal number of virulence associated genes, which allow for exact identification of L. monocytogenes, must therefore still be determined. Geographic differences in the global distribution of serotypes apparently exist, but our data is not sufficient to allow for major conclusions. Serotype 4b however, the serotype identified in our study, has been found to be the serotype predominantly responsible for the animal listeriosis and Listeria associated foodborne outbreaks. So this result is of critical importance for the further epidemiological investigations. In conclusion, it is clear that wild animals can act as reservoirs or carriers of L. monocytogenes. Listeria species were detected in wild animals that moved broadly and that had homeranges overlapping with areas inhabited by humans. For public health, it is important to clarify the epidemiological relationship between L. monocytogenes in wild animals and L. monocytogenes in human cases of listeriosis and food contamination. In a zoo setting, infection risks need to be considered not only among the various zoo animal populations, but also with regard to human contacts.

REFERENCES Arumugaswamy, R. & L.F. Gibson (1999). Listeriosis in zoo animals and rivers. Australian Veterinary Journal 77: 819–820. Bauwens, L., F. Vercammmen & A. Hertsens (2003). Detection of pathogenic Listeria spp. in zoo animal faeces: use of chromogenic separation and a chromogenic isolation medium. Veterinary Microbiology 91: 115–123. Buchrieser, C., R. Brosch, B. Catimel & J. Rocourt (1993). Pulsed-field gel electrophoresis applied for comparing Listeria monocytogenes strains involved in outbreaks. Canadian Journal of Microbiology 39: 395–401. Coffey, A., F.M. Rombouts & T. Abee (1996). Influence 1934

of environmental parameters on phosphatidylcholine phospholipase C production in Listeria monocytogenes: a convenient method to differentiate L. monocytogenes from other Listeria species. Applied and Environmental Microbiology 62: 1252–1256. Doumith, M., C. Buchrieser, P. Glaser, C. Jacquet & P. Martin (2004). Differentiation of the major Listeria monocytogenes Serovars by Multiplex PCR. Journal of Clinical Microbiology 42: 3819–3822. Farber, J.M. & P.I. Peterkin (1991). Listeria monocytogenes, a food-borne pathogen. Microbiological Reviews 55: 476– 511. Furrer, B., U. Candrian, C. Hoefelein & J. Luethy (1991). Detection and identification of Listeria monocytogenes in cooked sausage products and in milk by in-vitro amplification of haemolysin gene fragments. Journal of Applied Bacteriology 70: 372–379. Graves, L.M., B. Swaminathan & S.B. Hunter (1999). Subtyping Listeria monocytogenes, pp. 251–297. In: Ryser, E.T. & E.H. Marth (ed.). Listeria, Listeriosis and Food Safety. Marcel Dekker Inc., New York, N.Y. Gronstel, H. (1979). Listeriosis in sheep: Listeria monocytogenes excretion and immunological state in sheep in flock with clinical listeriosis. Acta Veterinaria Scandinavica 20 : 417–428. Kalorey, D.R., N.V. Kurkure, S.R. Warke, D.B. Rawool, S.V.S. Malik & S.B. Barbuddhe (2006). Isolation of pathogenic Listeria monocytogenes in faeces of wild animals in captivity. Comparative Immunology, Microbiology & Infectious Diseases 29: 295–300. Katiyar, R.D. (1960). Listeriosis amongst sheep and goats in Utter Pradesh. Indian Veterinary Journal 37: 620–623. Leclercq, A. (2004). A typical colonial morphology and low recoveries of Listeria monocytogenes strains on Oxford, PALCAM, Rapid’L.mono and ALOA solid media. Journal of Microbiological Methods 57: 251– 258. Loken, T., E. Aspoy & H. Gronstol (1982). Listeria monocytogenes excretion and humoral immunity in goats in a healthy herd. Acta Veterinaria Scandinavica 23: 392– 399. McClain, D., & W.H. Lee (1988). Devepolment of USDAFSIS method for isolation of Listeria monocytogenes from raw meat and poultry. Journal of the Association of Official Analytical Chemists 71: 660–663. Notermans, S. H. W., J. Dufrenne, M. Leimeister-Wachter, E. Domann, & T. Chakraborty (1991). Phosphatidylinositolspecific phospholipase C activity as a marker to distinguish between pathogenic and non-pathogenic Listeria species. Applied and Environmental Microbiology 57: 2666–2670. Paziak-Domanska, B., E. Bogulawska, M. WiekowskaSzakiel, R. Kotlowski, B. Rozalska, M. Chmiela, J. Kur, W. Dabrowski & W. Rudnicka (1999). Evaluation of the API test, phosphatidylinositol-specific phospholipase C activity and PCR method in identification of Listeria monocytogenes in meat foods. Federation of European Microbiological Society Microbiology Letters 171: 209–

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

Listeria species at Baroda Zoo

214. Radostits O.M., D.C. Blood & C.C. Gay (1994). Disease caused by Listeria spp. pp. 660–666. In: Veterinary Medicine. 8th Edition. ELB509 Bailliere Tindall, London. Rocourt, J. & H.P.R. Seeliger (1985). Distribution des especesdu genre Listeria. Zentralblatt Fur Bakteriologie Mikrobiologie Und Hygiene 259: 317–330. Seeliger, H.P.R. & K. Hohne (1979). Serotyping of Listeria monocytogenes and related species. Methods in Microbiology 13: 31–49. Skovgaard, N. & C.A. Morgen (1988). Detection of Listeria spp. In faeces from animals, in feeds and in raw foods of animal origin. International Journal of Food Micobiology 6: 229–242. Siragusa, G.R., J.S. Dickson & E.K. Daniels (1993). Isolation of Listeria spp. from feces of feedlot Catte. Journal of Food Protection 56: 102–105. Suarez, M. & J.A. Vazquez-Boland (2001). The bacterial actin nucleter protein ActA is involved in epithelial cell invasion by Listeria monocytogenes. PUBMED [Accession No. AF103807]. Tappero, J.W., A. Schuchat, K.A. Deaver, L. Mascola & J.D. Wenger (1995). Reduction in the incidence of human listeriosis in the United States. Effectiveness of prevention efforts? Journal of the American Medical Association 273: 1118– 1122.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1929–1935

M.M. Yadav et al. Author Details: Mahendra Mohan Yadav is currently working as a Assistant Professor at Research Cum Development Project on Cattle, Mahatma Phule Krishi Vidyapeeth, Rahuri, Maharashtra State and engaged in Diagnostic and Treatment aspect of Ruminants Ashish Roy is currently working as a Professor at Department of Veterinary Microbiology, College of Veterinary Science, Anand, and involved in teaching and research activities of Veterinary Microbiology at Anand, Gujarat State. Bharat Bhanderi is currently working as a Veterinary Officer in Gujarat State. He completed his Ph.D in Veterinary Microbiology at Anand, Gujarat State. R.G. Jani is currently working as a Professor in Department of Veterinary Medicine at College of Veterinary Science, Anand, and involved in teaching and research activities of Veterinary Medicine at Anand, Gujarat State. He is also Wildlife co-ordinator of West Zone of India. Author Contribution: MMY Involved in biochemical and molecular characterization of Listeria spp. Especially the work on DNA extraction from Listeria Colonies, five virulence associated gene identification by PCR. AR involved in molecular characterization of Listeria Spp especially on identification of serovars. by multiplex PCR. BB Involved in isolation of Listeria spp. Using enrichment and selective media. RJJ Involved in sample collection from wildlife and its further transport and processing at lab.

1935

JoTT Short Communication

3(7): 1936–1941

Western Ghats Special Series

Checklist of the fishes of the Achankovil forests, Kerala, India with notes on the range extension of an endemic cyprinid Puntius chalakkudiensis Fibin Baby 1, Josin Tharian 2, Siby Philip 3, Anvar Ali 4 & Rajeev Raghavan 5 Conservation Research Group (CRG), St. Albert’s College, Kochi, Kerala 682018, India Department of Zoology and Environmental Sciences, St. John’s College, Anchal, Kerala 691306, India 3 Centro Interdisciplinar de Investigação Marinha e Ambiental, University of Porto, Portugal 5 Durrell Institute of Conservation and Ecology (DICE), School of Anthropology and Conservation, University of Kent, Canterbury CT2 7NZ, United Kingdom Email: 1 fibinaqua@gmail.com, 2 josinc@gmail.com, 3 philipsiby@gmail.com, 4 anvaraliif@gmail.com, 5 rajeevraq@hotmail.com (corresponding author) 1,2,4,5 2

Located in the Periyar-Agasthyamalai corridor (CEPF 2007), the Achankovil Reserve Forests (ARF) (269km2), comprising of dry deciduous, moist deciduous and evergreen forests is a priority site for conservation in the southern Western Ghats (CEPF 2007). The area is bounded by Tamil Nadu State in the east, Ranni forest division in the northeast, Konni forest division in the west, Punalur forest division in the

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print)

Keywords: Achankovil forests, chalakkudiensis, range extension

Editor: K. Rema Devi Manuscript details: Ms # o2674 Received 12 January 2011 Final received 23 June 2011 Finally accepted 06 July 2011 Citation: Baby, F., J. Tharian, S. Philip, A. Ali & R. Raghavan (2011). Checklist of the fishes of the Achankovil forests, Kerala, India with notes on the range extension of an endemic cyprinid Puntius chalakkudiensis. Journal of Threatened Taxa 3(7): 1936–1941 Copyright: © Fibin Baby, Josin Tharian, Siby Philip, Anvar Ali & Rajeev Raghavan 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: Funding for the study came from the Critical Ecosystem Partnership Fund (CEPF) Western Ghats Program through the Ashoka Trust for Research in Ecology and Environment (ATREE), Bengaluru, India. The authors thank the Principal Chief Conservator of Forests and Chief Wildlife Warden, Government of Kerala for permits; Rateesh and Prasobh for their assistance in the field, and M.R. Ramprasanth for his support in the laboratory. Thanks are also due to Ralf Britz (British Museum of Natural History, London) and Rema Devi (Zoological Survey of India, Chennai) for their help during the examination of the types. OPEN ACCESS | FREE DOWNLOAD

1936

Abstract: We report the results of an ichthyofaunal inventory carried out in the Achankovil Reserve Forest in the southern Western Ghats as part of a Critical Ecosystem Partnership Fund Project on lesser known freshwater fishes of Kerala . Forty-six species of freshwater fish, belonging to 17 families and 31 genera were collected from 11 sites inside the Achankovil Reserve Forest. Family Cyprinidae dominated with 21 species, followed by Bagridae, Balitoridae and Channidae (three species each). Out of the 46 species, 14 were endemic to the Western Ghats, three were endemic to Kerala region and one was exotic to the country. In this paper, we also report the range extension of an endemic cyprinid, Puntius chalakkudiensis to the Achankovil River and the Achankovil Reserve Forest. The fish diversity of this region is higher than many protected areas within southern Western Ghats, and stresses the need for immediate protection and monitoring programs. freshwater

fish,

Puntius

southwest, and Thenmala forest division in the south (Hosagoudar et al. 2010). Achankovil RF is drained by the river Achankovil and its major tributaries Kanayar, Kallar, Chittar and Kakkadyaar. Preliminary studies have revealed that this region harbours around 96 species of birds, 13 species of mammals, 12 species of reptiles and four species of amphibians (Kalesh et al. 2010). Although a few studies are available on the fish This article forms part of a special series on the Western Ghats of India, disseminating the results of work supported by the Critical Ecosystem Partnership Fund (CEPF), a joint initiative of l’Agence Française de Développement, Conservation International, the Global Environment Facility, the Government of Japan, the MacArthur Foundation and the World Bank. A fundamental goal of CEPF is to ensure civil society is engaged in biodiversity conservation. Implementation of the CEPF investment program in the Western Ghats is led and coordinated by the Ashoka Trust for Research in Ecology and the Environment (ATREE).

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

Fishes of the Achankovil forests

F. Baby et al.

Image 1. Map of Achankovil Reserve Forest showing sampling sites

Table 1. Details of sampling sites in Achankovil Reserve Forest No

Site

Latitude N

Longitude E

Altitude (m)

Mukkada

9.118

77.065

Chittar

9.106

77.082

Mlaankuzhi

9.098

77.104

Achankovil

9.090

77.128

Pallivasal

9.086

77.155

110

Madandachappath

9.076

77.172

122

Manalar

9.075

77.190

146

Kumbaratty

9.085

77.174

166

Kadakkola

9.133

77.080

104

Panamthoppu

9.137

77.115

134

Kallar

9.125

77.171

208

diversity of Achankovil River system (Varghese 1994; Swapna 2009), micro-level species distribution data are restricted to sites in the midland and lowland areas. To the best of our knowledge, there is detailed information on the ichthyodiversity of only one location inside the Achankovil forests i.e. Achankovil (Varghese 1994). As part of a larger project that is aimed at generating baseline data on the fish fauna of lesser known areas in

the southern Western Ghats (CEPF-ATREE 2010), we carried out an ichthyofaunal inventory at various sites inside the ARF, at multiple intervals in 2010. This contribution provides a checklist of the freshwater fish fauna of this region, with notes on the range extension of an endemic species Puntius chalakkudiensis. Taking into consideration, the costs and logistics, we used a rapid assessment approach (Abd et al. 2009). Dawn (0500–0800 hr), daytime (0800–1730 hr), dusk (1730–1930 hr) and night (1930–0500 hr) sampling were carried out at 11 sites in the various tributaries draining the Achankovil forests (Image 1 and Table 1). Although electrofishing (using a backpack electroshocker) was the primary technique used for fish collection, we also employed a diverse array of active as well as passive gear including cast net, scoop net, drag net, gill net and traps. This was because of the fact that electrofishing is considered to be the most effective sampling method for stream fishes, especially when sampling species that are at risk (Poos et al. 2007). The other gears were used so as to avoid sampling bias in specific habitats (for example, torrential stream reaches and large cascades) where electrofishing was not possible. The use of an electroshocker also meant that we only collected the minimum number of specimens as required for

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

1937

Fishes of the Achankovil forests

F. Baby et al.

Table 2. List of species and their micro level distribution in Achankovil Forests Species

Locations

Cyprinidae

Amblypharyngodon microlepis (Bleeker, 1854)

Barbodes carnaticus (Jerdon, 1849) EWG

Barilius bakeri Day, 1865 EWG

1, 2, 3, 4, 5, 6, 8, 9, 10, 11

Barilius gatensis (Valenciennes, 1844) EWG

1, 2, 3, 4, 5, 6, 8, 9, 10, 11

Devario malabaricus (Jerdon, 1849)

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Garra mullya (Sykes, 1839)

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Garra surendranathanii Shaji, Arun & Easa, 1996 EK

1, 9

Hypselobarbus curmuca (Hamilton, 1807) EWG

Laubuca fasciata (Silas, 1958) EK

2, 3, 4, 5

Puntius amphibius (Valenciennes, 1842)

Puntius bimaculatus (Bleeker, 1863)

Species

Locations

Mystus malabaricus (Jerdon, 1849) EWG

4, 5, 6

Siluridae 29

Ompok bimaculatus (Bloch, 1794)

Sisoridae 30

Glyptothorax cf. anamalaiensis (Silas, 1952) EWG

Heteropneustidae 31

Heteropneustes fossilis (Bloch, 1794)

2, 3

Belonidae 32

Xenentodon cancila (Hamilton, 1822)

1, 9

Aplocheilidae 33

Aplocheilus lineatus (Valenciennes, 1846)

4, 5, 6, 11

Ambassidae

8, 9

Parambassis dayi (Bleeker, 1874) EWG

Pseudambassis baculis (Hamilton, 1822)

1, 9, 10

Puntius chalakkudiensis Menon et al., 1999 EK

1, 9

Puntius denisonii (Day, 1865) EWG

1, 9

Nandus nandus (Hamilton, 1822)

Puntius fasciatus (Jerdon, 1849)

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Pristolepis marginata Jerdon, 1849

4, 5

Puntius filamentosus (Valenciennes, 1844)

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Puntius sarana (Hamilton, 1822)

1, 9

Puntius ticto (Hamilton, 1822)

1, 9, 10

Puntius vittatus Day, 1865

1, 10

Rasbora daniconius (HamiltonBuchanan)

1, 2, 3, 4, 5, 6, 7, 8, 9, 10

Salmophasia boopis (Day, 1874)

1, 2, 3, 4, 9

Tor khudree (Sykes, 1839)

Nandidae

Cichlidae 38

Etroplus maculatus (Bloch, 1795)

1, 9, 10

Oreochromis mossambicus, (Peters 1852) EX

Gobiidae 40

Bhavania australis (Jerdon, 1849) EWG

1, 6, 11

Nemacheilus triangularis Day, 1865 EWG

Nemacheilus guentheri Day, 1867 EWG

1, 10

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Channa marulius (Hamilton, 1822)

Channa striatus (Bloch, 1793)

6, 7, 9, 10

Channa gachua (Hamilton, 1822)

Osphronemidae

Cobitidae 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11

Pseudosphromenus cupanus (Cuvier, 1831)

1, 10

Mastacembelidae

Bagridae 26

Mystus armatus (Day, 1865)

Mystus cavasius (Hamilton, 1822)

1, 10

1938

Anabas testudineus (Bloch, 1792) Channidae

Lepidocephalichthys thermalis (Valenciennes, 1846)

2, 3, 10

Anabantidae

Balitoridae

Glossogobius giuris (Hamilton, 1822)

Mastacembelus armatus (Lacepède, 1800)

1, 2, 4, 5, 9

- Endemic to Western Ghats; EK - Endemic to Kerala; - Exotic to the country

EWG EX

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

Fishes of the Achankovil forests

F. Baby et al.

2cm

Image 2. Puntius chalakkudiensis (Menon, Devi & Thobias 1999)

our study (especially threatened and restricted range endemics). Species level identification was carried out following Jayaram (1999) and Talwar & Jhingran (1991) and species names adhere to the CAS—Catalog of Fishes (Eschemeyer 2010). Forty-six species (S=46) belonging to 17 families and 31 genera were collected from various sites inside the ARF (Table 2). Family Cyprinidae dominated with 21 species (S=21) followed by Bagridae (S=3), Balitoridae (S=3) and Channidae (S=3). Out of the 46 species, 14 are endemic to the Western Ghats, of which three species (Garra surendranathanii, Laubuca fasciata and Puntius chalakkudiensis) are endemic to the Kerala region. One species (Oreochromis mossambicus) is exotic to the country. Swapna (2009) recorded 52 species including 39 typical freshwater and three typical marine fish species from four sites spread across the upstream-downstream gradient of river Achankovil, while Varghese (1994) recorded 64 species from the Achankovil drainage, including a dozen marine and brackish water forms. Surprisingly, Neelakandan et al. (2006) indicated that only 10 fish species are found in the Achankovil river basin. Our results of the occurrence of 46 species inside the ARF could only mean that the overall ichthyodiversity of the Achankovil river system is much more than what has been recorded by earlier workers including Swapna (2009) and Varghese (1994). Within the ARF, two sites, Mukkada and Kadakkola had the highest species richness with the presence of 30 and 24 species respectively, while the lowest richness of nine species was found at Manalar. Johnson & Arunachalam (2009) recorded 17 species from a site which they named as Achankovil (with

the coordinates 9010’12”N & 76050’28”E / 9.17N & 76.481E). However, this site (according to the Survey of India Toposheet 58C 16 and 58G 4, Scale 1:50,000 and Google Earth) falls far from Achankovil town (and also out of the Achankovil RF). Therefore, we have not compared the fish diversity of Achankovil town obtained in our study with that of Johnson & Arunachalam (2009). The presence of the alien invasive Oreochromis mossambicus at Mukkada, the site with the highest species richness, is a plausible threat to the endemic species of the region. Taking into consideration the trophic status of O. mossambicus, we believe that an immediate threat to a native species would be to the orange chromide Etroplus maculatus, a sizeable population of which occurs at Mukkada. An important native ornamental fish, as well as a popular food fish with low income groups, E. maculatus shares more or less the same resources as that of O. mossambicus and so the proliferation of the former will invariably harm the native stocks of the orange chromide (Raghavan et al. 2008a). The present study has also resulted in the range extension of an endemic fish species of Kerala, P. chalakkudiensis (Image 2) to the ARF (and the Achankovil river system). Puntius chalakkudiensis, a look alike of the popular aquarium fish, P. denisonii was previously thought to be endemic to the Chalakudy River (Menon et al. 1999; Kurup et al. 2004). Our surveys in Achankovil RF indicated that the streams harbour good populations of P. chalakkudiensis, which are consumed as a food fish by the local tribes. We recorded more than 380 individuals of P. chalakkudiensis over a one year period (2009– 2010) from two sites, Mukkada and Kadakkola as

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

1939

Fishes of the Achankovil forests

F. Baby et al.

part of another study on the population status of this species in the Achankovil River. All individuals were collected using a backpack electroshocker and were released after taking the length and weight. We also compared in detail 10 specimens (40–104 mm SL) of P. chalakkudiensis from Achankovil, to those collected by us from the type locality of the species (Athirapally in Chalakudy River) and currently stored at the Museum of the Department of Aquaculture, St. Albert’s College, Kochi, India (CRG-SAC-897.1 and 897.2) and found that all of them matched the original description of P. chalakkudiensis (Menon et al. 1999), in its morphology, including the distinct black blotch on the dorsal fin and inferior mouth. The specimens of P. denisonii recorded from Achankovil were also compared to the type material of P. denisonii at the British Museum of Natural History, London (BMNH 1864.7.9.6 and BMNH 1866.5.2.211). Many authors including Kurup et al. (2004), Johnson & Arunachalam (2009) and Swapna (2009) have recorded only P. denisonii from Achankovil River. However, our study has revealed that both P. denisonii and P. chalakkudiensis are found in the Achankovil River and that they co-exist in the same habitat. We collected one specimen of a sisorid catfish that resembled Glyptothorax anamalaiensis in its appearance but had some minor differences. The biometrics of this specimen was compared with that of another specimen of G. anamalaiensis collected from the Anamalai Hills near Valparai and deposited at the Museum of the Conservation Research Group, St. Albert’s College, Kochi (CRG-SAC 167). As a comprehensive and reliable taxonomical key is not available for the species within the genus Glyptothorax found in the Western Ghats, we have retained the species as Glyptothorax cf. anamalaiensis in the current checklist, and it is being subjected to detailed taxonomical investigation. Kalesh et al. (2010) observed that the major threats to the Achankovil RF are logging for softwood industry, harvesting of endemic reeds and indiscriminate fishing. We found that dynamiting is one of the major threats to the fishes of the ARF. Members of the local community residing in the settlements in and around Achankovil visit the deep pools in and around Mukkada and Kadakkola, as well as various other locations in the Kallar tributary to catch fish using dynamite purchased from quarries. Dynamite fishing has been documented 1940

from the southern WG since the early 1940s (Jones 1946) and continues to be one of the most widely used destructive fishing techniques practiced in the region (Kurup et al. 2004; Raghavan et al. 2008b). Although dynamite fishing has been banned vide the Travancore Cochin Fisheries Act of 1950 (Government of Kerala, India) there is very little or no enforcement from the concerned authorities, and the practice continues to exist even inside reserve forests and protected areas of the region. The fact that the fish diversity of Achankovil RF (S=46) is higher than many protected areas in the region including the Neyyar (S=38) and Idukki (S=40) wildlife sanctuaries (Thomas et al. 2000) stresses the need for increased protection and monitoring programs in this area. The Western Ghats Ecosystem Profile prepared as part of the Critical Ecosystem Partnership Fund Program (CEPF 2007) suggested that ARF is a site that warrants immediate attention in terms of setting up mechanisms for their incorporation into the protected area network. Our results on the fish fauna of the region further confirm this need. References Abd, I.M., C. Rubec & B.W. Coad (2009). Key Biodiversity Areas: rapid assessment of fish fauna in southern Iraq. BioRisk 3: 161–171. CEPF-ATREE (2010). http://www.atree.org/cepf_small_ grants. Accessed on 21st June 2010 CEPF (2007). Critical Ecosystem Partnership Fund Ecosystem Profile: Western Ghats and Sri Lanka Biodiversity Hotspot - Western Ghats region, 95pp Eschmeyer, W.N. (ed.) (2010). Catalog of fishes electronicversion. http://research.calacademy.org/ ichthyology/catalog/fishcatmain.asp. Accessed on 24 June 2010 Jayaram, K.C. (1999). The Freshwater Fishes of The Indian Region. Narendra Publishing House, New Delhi, 396pp. Hosagoudar, V.B., P.J. Robin & B. Shivaraju (2010). Foliicolous fungi from the Achankovil forests in Kollam District of Kerala State, India. Journal of Threatened Taxa 2(3): 760–761. Johnson, J & M. Arunachalam (2009). Diversity, distribution and assemblage structure of fishes in streams of southern Western Ghats, India. Journal of Threatened Taxa 1(10): 507–513. Jones, S. (1946). Destructive methods of fishing in the rivers of the hill ranges of Travancore. Journal of the Bombay Natural History Society 46: 437–445. Kalesh, S., K.B. Sanjayan, K. Jayakumar, M. Ramesh, C.G.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

Fishes of the Achankovil forests

Kiran, H. Charan & K. Baiju (2010). The faunal diversity of Achankovil Reserve forests: a preliminary study report. Travancore Natural History Society. http://info-tnhs. blogspot.com/2010/09/faunal-diversity-of-achankovilreserve.html Kurup B.M, K.V. Radhakrishnan & T.G. Manojkumar (2004). Biodiversity status of fishes inhabiting rivers of Kerala (s. India) with special reference to endemism, threats and conservation measures, pp. 163–182. In: Welcome, R.L. & T. Petr (eds.). Proceedings of LARS2. 2nd Large Rivers Symposium. Mekong River Commission and Food and Agricultural Organization. Menon, A.G.K., K.R. Devi & M.P. Thobias (1999). Puntius chalakkudiensis, a new colourful species of Puntius (family: Cyprinidae) fish from Kerala, south India. Records of the Zoological Survey of India 97(4): 61–63. Neelakandan, V.N., C.N. Mohanan & B. Sukumar (2006). Development of a biogeographical information system for conservation monitoring of biodiversity. Current Science 90(3): 444–450. Poos, M.S., N.E. Mandrak & R.L. McLaughlin (2007). The effectiveness of two sampling methods for assessing imperiled freshwater fishes. Journal of Fish Biology 70: 691–708.

F. Baby et al.

Raghavan, R., G. Prasad, P.H.A. Ali & B. Pereira (2008a). Exotic fish species in a Biodiversity Hotspot: observations from the River Chalakudy, part of Western Ghats, Kerala, India. Biological Invasions 10: 37-40. Raghavan R., G. Prasad, P.H.A. Ali & B. Pereira (2008b). Fish fauna of River Chalakudy part of Western Ghats biodiversity hotspot (south India) – patterns of distribution, threats and conservation needs Biodiversity and Conservation 17: 3119–3131. Talwar, P.K. & A.G. Jhingran (1991). Inland Fishes of India and Adjacent Countries, Vol I & II. Oxford & IBH Publishing Co. Pvt. Ltd., New Delhi, 1158pp. Thomas, K.R., C.R. Biju, C.R. Ajithkumar & M.J. George (2000). Fish fauna of Idukki and Neyyar Wildlife Sanctuaries, Southern Kerala, India. Journal of the Bombay Natural History Society 97(3): 443-446. Swapna, S. (2009). Fish diversity in Achankovil River, Kerala, India. Journal of the Bombay Natural History Society 106(1): 104–106. Varghese, J.G (1994). Studies on fish assemblages in the Achankovil river system with special reference to their niche segregation and habitat usage. PhD Thesis. Mahatma Gandhi University, Kottayam, India (unpublished).

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1936–1941

1941

JoTT Note

3(7): 1942–1946

Two new Asterina species on Michelia champaca from Kerala, India V.B. Hosagoudar 1 & M.C. Riju 2 Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram, Kerala 695562, India. Email: 1 vbhosagoudar@rediffmail.com (corresponding author), 2 rcmakkiyil@gmail.com 1,2

The genus Michelia comprises 50 species, of which four are in India. Michelia champaca L. and M. nilagirica Zenk are known from Kerala State (Santapau & Henry 1984; Sasidharan 2004; Nayar et al. 2006). The former species is endemic to South and South East Asia, while the latter is endemic to the southern Western Ghats and Sri Lanka. Hansford (1947) and Hosagoudar & Goos (1996) have described Asterina micheliae and Asterostomella micheliae on the latter host from Sri Lanka and the southern Western Ghats (Idukki forest region) of peninsular India, respectively. Our recent collections of Michelia champaca from the Wyanad region of Kerala State revealed two undescribed species of the genus Asterina and they are described and illustrated here in detail. Key to the Asterina species known on the host genus Michelia has been provided.

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: R.K. Verma Manuscript details: Ms # o2746 Received 05 April 2011 Final received 26 May 2011 Finally accepted 06 June 2011 Citation: Hosagoudar, V.B. & M.C. Riju (2011). Two new Asterina species on Michelia champaca from Kerala, India. Journal of Threatened Taxa 3(7): 1942–1946. Copyright: © V.B. Hosagoudar & M.C. Riju 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: We thank Dr. A. Subramoniam, Director, TBGRI, Palode for the facilities.

Asterina michelifolia sp. nov. (Images 1–5, Fig. 1) Materials examined: 20.ix.2008, on leaves of Michelia champaca L. (Magnoliaceae), Chennalode, Padinharathara, Wyanad, Kerala, India, coll. M.C. Riju, HCIO 49111a (holotype), TBGT 3366a (isotype). MycoBank No. (MB 561622). Coloniae hypophyllae, tenues, ad 2mm diam., confluentes. Hyphae flexuosae vel anfractuae, irregulariter acuteque vel laxe ramosae, formans retes arte reticulatae, cellulae 12–40 x 3–5 µm. Appressoria dispersa, unicellularis, opposita, alternata, unilateralis, antrorsa vel retrorsa, globosa vel cylindracea, integra, 5–18 x 5–8 µm. Pycnothyria dispersa, orbicularis, ad 58µm diam., stellatim dehiscentes et perlate orificium ad centro; pycnothyriosporae globosae, clavatae, 15–20 µm, parietus glabrus. Thyriothecia dispersa, orbicularis, ad 85µm diam., stellatim dehiscentes et perlate orificium ad centro et asci distinctum; asci globosi vel ovati, 37–45 µm diam.; ascosporae brunnneae, uniseptatae, constrictus ad septatum, 22– 25 x 10–13 µm, parietus glabrus. Colonies hypophyllous, thin, up to 2mm in diameter, confluent. Hyphae flexuous to crooked, branching irregular at acute to wide angles, forming closely reticulated rings, cells 12–40 x 3–5 µm. Appressoria scattered, unicellular, opposite, alternate, unilateral, antrorse to retrorse, globose to cylindrical, entire, 5–18 x 5–8 µm. Pycnothyria scattered, orbicular, up to 58µm in diameter, stellately dehisced and widely opened at the centre; pycnothyriospores globose, clavate, 15–20 µm, wall smooth. Thyriothecia scattered, orbicular, up to 85µm in diameter, stellately dehisced and widely opened at the centre by exposing asci; asci globose to ovate, 37–45 µm in diameter; ascospores brown, uniseptate, constricted at the septum, 22–25 x 10–13 µm, wall smooth. Etymology: Specific epithet based on the host genus. This species differs from Asterina micheliae Hansf. reported on Michelia nilagirica from Sri Lanka (Hansford 1947) in having typical thyriothecium and differs from A. micheligena in having straight mycelium and larger ascospores.

OPEN ACCESS | FREE DOWNLOAD

1942

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1942–1946

Two new Asterina species from Kerala

V.B. Hosagoudar & M.C. Riju

8.5µm

Figure 1. Asterina michelifolia sp. nov. a - apprassoriate mycelium; b - thyriothecium; c - ascus; d - ascospores; e - pycnothyriospores

d e

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1942–1946

Images 1–5. Asterina michelifolia sp. nov. 1 - infected leaf; 2 - colony with thyriothecia; 3 - thyriothecium; 4 - asci; 5 - germinating ascospore 1943

Two new Asterina species from Kerala

V.B. Hosagoudar & M.C. Riju

Asterina micheligena sp. nov. (Images 6–11, Fig. 2) Materials examined: 20.ix.2008, on leaves of Michelia champaca L. (Magnoliaceae), Chennalode, Padinharathara, Wyanad, Kerala, India, coll. M.C. Riju HCIO 49111b (holotype), TBGT 3366b (isotype). MycoBank No. (MB 561623). Coloniae epiphyllae, densae, ad 3mm diam., confluentes et saepe et nervicolae. Hyphae flexuosae vel anfractuae, irregulariter acuteque vel laxe ramosae, formans retes arte reticulatae, cellulae 12–40 x 3–5 µm. Appressoria dispersa, unicellularis, opposita, alternata, unilateralis, antrorsa vel retrorsa, globosa, integra, mammiformes, 4–7 x 4–9 µm. Pycnothyria dispersa, orbicularis, ad 75µm diam., stellatim dehiscentes et perlate orificium ad centro; pycnothyriosporae

globosae vel leniter ovatae, 17–25 µm diam., parietus glabrus. Thyriothecia dispersa, orbicularis, ad 188µm diam., stellatim dehiscentes et perlate orificium ad centro et asci distinctum; asci globosi vel ovati, ad 63µm diam.; ascosporae brunneae, uniseptatae, constrictus ad septatum, 25–33 x15–18 µm, parietus glabrus. Colonies epiphyllous, dense, up to 3mm in diameter, confluent and often trait along the major veins of the upper surface of the leaves. Hyphae substraight to flexuous, branching opposite, alternate to irregular at acute to wide angles, loosely to closely reticulate, cells 9–24 x 4–6 µm. Appressoria scattered, unicellular, opposite, alternate, unilateral, globose, entire, mammiform, 4–7 x 4–9 µm. Pycnothyria scattered, orbicular, up to 75µm in diameter, stellately dehisced and widely opened at the centre; pycnothyriospores

Images 6–11. Asterina micheligena sp. nov. 6 - infected leaves; 7 - colony with apressoriate mycelium; 8 - thyriotheca; 9 - asci; 10 - germinating ascospore; 11 - germinating pycnothyriospore 1944

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1942–1946

Two new Asterina species from Kerala

V.B. Hosagoudar & M.C. Riju

12µm

9µm e

Figure 2. Asterina micheligena sp. nov. a - apprassoriate mycelium; b - thyriothecium; c - ascus; d - ascospores; e - pycnothyriospores

1 1

Key to the Asterina species on the genus Michelia Only anamorph known ............................................................................................... Asteostomella micheliae Teleomorph known .......................................................................................................................................... 2

2 2

Mature fruiting body resembles perithecia ........................................................................... Asterina micheliae Mature fruiting body resembles thyriothecia ................................................................................................... 3

3 3

Ascospores less than 28µm long ..................................................................... Asterina michelifolia sp. nov. Ascospores more than 28µm long .................................................................................................................. 4

4 4

Ascospores more than 15µm broad ............................................................... Asterina micheligena sp. nov. Ascospores less than 15µm broad .................................................................................................................. 5

5 5

On Manglietia .............................................................................................................................. A. manglietiae On Michelia ................................................................................................................................. A. micheliicola

globose to slightly ovate, 17–25 µm in diameter, wall smooth. Thyriothecia scattered, orbicular, up to 188µm in diameter, stellately dehisced and widely opened at the centre by exposing asci; asci globose to ovate, up to 63µm in diameter; ascospores brown, uniseptate,

constricted at the septum, 25–33 x 15–18µm, wall smooth. Etymology: Specific epithet based on the host genus.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1942–1946

1945

Two new Asterina species from Kerala

V.B. Hosagoudar & M.C. Riju

REFERENCES Hosagoudar, V.B. & R.D. Goos (1996). Some foliicolous fungi from southern India. Mycotaxon 59: 149–166. Hansford, G.C. (1947). New or interesting tropical fungi I. Proceedings of the Linnaean Society of London 158: 28–50. Nayar, T.S., A.R. Beegam, N. Mohanan & G.R. Kumar (2006). Flowering Plants of Kerala. Tropical Botanic Garden and Research Institute, Palode, Thiruvananthapuram, Kerala, India, 1069pp.

1946

Santapau, H. & A.N. Henry (1984). A Dictionary of Flowering Plants in India. CSIR New Delhi, 198pp. Sasidharan, N. (2004). Biodiversity Documentation for Kerala - Part 6: Flowering Plants. Kerala Forest Research Institute, Peechi, Kerala, 437pp. Song, B., T.H. Li & Y.H. Shen (2001). Two new taxa of Asterina on Magnoliaceae from China. Mycosystema 20(4): 461–463.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1942–1946

JoTT Note

Testate amoebae (Protozoa: Rhizopoda) of Deepor Beel (a Ramsar site), Assam, northeastern India B.K. Sharma 1 & Sumita Sharma 2 Freshwater Biology Laboratory, Department of Zoology, North-Eastern Hill University, Permanent Campus, Shillong, Meghalaya 793022, India Email: 1 probksharma@gmail.com (corresponding author), 2 sumitasharma.nehu@gmail.com 1,2

Testate amoebae or testaceans, a group of freeliving Protozoa belonging to the superclass Rhizopoda, form an important micro-faunal component of aquatic, semi-aquatic and soil communities and provide integral links of the food chain in their respective environments. Taxonomic studies on Indian freshwater Rhizopoda were initiated by Naidu (1966) and followed by Mahajan (1971), Nair et al. (1971) and Mishra et al. (1977). In addition, certain contributions under the state fauna series (Das et al. 1993, 1995, 2000, 2003, 2004) dealt with limited freshwater collections. In spite of these studies freshwater Rhizopoda from different states of India are poorly documented, while their ecosystem diversity is practically neglected except for the works of Sharma & Sharma (2008), Bindu (2010) and Bindu & Das (2010). Our study on the Rhizopoda

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Humphrey Smith Manuscript details: Ms # o2664 Received 31 December 2010 Final received 25 May 2011 Finally accepted 21 June 2011 Citation: Sharma, B.K. & S. Sharma (2011). Testate amoebae (Protozoa: Rhizopoda) of Deepor Beel (a Ramsar site), Assam, northeastern India. Journal of Threatened Taxa 3(7): 1947–1950. Copyright: © B.K. Sharma & Sumita Sharma 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The senior author is thankful to the Coordinator, UPE (Biosciences) and the Head, Department of Zoology, North-Eastern Hill University, Shillong for necessary facilities. One of the authors (SS) is also thankful to the Director, Zoological Survey of India, Kolkata and the Officer-in-charge, North Eastern Regional Centre, Zoological Survey of India, Shillong. OPEN ACCESS | FREE DOWNLOAD

3(7): 1947–1950

of Deepor Beel, a Ramsar site and an important floodplain lake of the Brahmaputra River basin of Assam, merits biodiversity interest in view of the stated lacunae. The listed species are briefly diagnosed and comments are made on the nature and composition of the Rhizopoda fauna. Material and Methods: Qualitative samples were collected (August 2008–July 2010) by towing a nylobolt plankton net (No. 25) from the littoral and limnetic regions of Deepor Beel (91035’–91043’E & 26005’–26011’N; area 40km2; altitude 42m), Assam and were preserved in 5% formalin. Special attention was paid to disturb aquatic macrophytes before sampling. Different species were sorted with a wild stereoscopic binocular microscope and permanent mount specimens were prepared in polyvinyl alcohollactophenol. Rhizopoda species were identified with a Leica DM 1000 image analyzer following the works of Cash et al. (1919), Deflandre (1929, 1959), Decloitre (1962), Ogden & Hedley (1980), and Chattopadhyay & Das (2003). Systematic account Sub Kingdom: Protozoa Phylum: Sarcomastigophora Sub Phylum: Sarcodina Super Class: Rhizopoda Class: Lobosea Order: Arcellinida Arcellidae 1. Arcella discoides Ehrenberg, 1843 Characters: Test yellow, smooth, flattened, circular in front view and plano-convex in lateral view; height about 1/3 to 1/4 of its diameter. Oral aperture large and circular. Distribution: India - Assam, Meghalaya, Mizoram, Arunachal Pradesh, Tripura, Nagaland, Sikkim and West Bengal. 2. Arcella hemispherica Perty, 1809 Characters: Test yellow, distinctly hemispherical and circular in lateral and front views. Surface of test with more or less fine areoles. Distribution: India - Assam, Manipur, West Bengal, Odisha and Andhra Pradesh.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1947–1950

1947

Testate amoebae of Deepor Beel

B.K. Sharma & S. Sharma

3. Arcella vulgaris Ehrenberg, 1830 Characters: Test light yellow, discoid or hemispherical in front or lateral views; height about half of its diameter; test surface with large areoles. Mouth circular and central. Distribution: India - Assam, Meghalaya, Manipur, Arunachal Pradesh, Nagaland, Sikkim, Himachal Pradesh and West Bengal. Centropyxidae 4. Centropyxis aculeata (Ehrenberg, 1830) Characters: Test brownish, cap-shaped; encrusted with quartz crystals and sometimes with admixture of diatoms and sand particles. Fundus obtusely rounded and usually with 4-6 divergent spines at the border, arranged in a single and somewhat regular row. Distribution: India - Assam, Arunachal Pradesh, Meghalaya, Mizoram, Manipur, Nagaland, West Bengal, Andhra Pradesh and Himachal Pradesh. 5. Centropyxis ecornis (Ehrenberg, 1843) Characters: Test large, discoid or elliptical; without any spine and covered with quartz grains. Dorsal surface slightly arched and more elevated at posterior part. Oral aperture circular and much eccentric. Distribution: India - Assam, Arunachal Pradesh, Meghalaya, Manipur, Mizoram, Sikkim, Himachal Pradesh, Uttarakhand and West Bengal. 6. Centropyxis oblonga (Deflandre, 1929) Characters: Test grayish, oblong-elliptical or oval; with 3-6 divergent spines located in the distal part. Fundus of the test more elevated. Oral aperture elliptical and eccentric. Distribution: India - Assam, Meghalaya, Manipur, Sikkim and Andhra Pradesh. 7. Centropyxis orbicularis Deflandre, 1929 Characters: Test almost circular in ventral view and semi-circular in lateral view, ventral surface flat; oral aperture semi-circular, plagiostomic; test with large stony particles. Distribution: India - Assam, Uttarakhand and Andhra Pradesh. 8. Cyclopyxis eurystoma (Deflandre, 1929) Characters: Test brownish, encrusted with quartz particles; hemispherical in lateral view. Oral aperture 1948

central, circular and slightly invaginated with regular smooth edge. Distribution: India - Assam, Arunachal Pradesh and Odisha. Difflugidae 9. Difflugia acuminata Ehrenberg, 1838 Characters: Test cylindrical, with pointed ‘horn’ like extension; horn straight and differentiated from the base. Quartz crystals big; some even projecting out of the margin. Distribution: India - Assam, Meghalaya, Manipur, West Bengal and Andhra Pradesh. 10. Difflugia corona Wallich, 1864 Characters: Test broadly spherical, slightly narrow near oral aperture; with 5–10 smooth test spines formed by quartz crystals. Oral aperture wide and crenulated. Distribution: India - Assam, Manipur and West Bengal. 11. Difflugia oblonga Ehrenberg, 1838 Characters: Test typically oblong, with smooth margins and rounded base; composed of big angular quartz crystals. Oral aperture circular and without any lobe. Distribution: India - Assam, Meghalaya, Manipur, West Bengal and Andhra Pradesh. 12. Difflugia tuberculata (Wallich, 1864) Characters: Test ovoid, with wide base; oral aperture hexagonal and surrounded by a short collar; test covered with tubercles and small platelets uniting the tubercles. Distribution: India - Assam and Meghalaya. 13. Difflugia urceolata Carter, 1864 Characters: Test ovoid-spherical, composed of angular quartz crystals and diatoms. Oral aperture circular; its collar around re-curved or rolled towards exterior. Distribution: India - Assam, Manipur and West Bengal. Nebelidae 14. Lesquereusia spiralis (Ehrenberg, 1830) Characters: Test transparent, semi-spiral and composed of closely arranged vermiform pellets;

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1947–1950

Testate amoebae of Deepor Beel

neck continued in a straight line down to mouth. Oral aperture circular. Distribution: India - Assam, Meghalaya, Manipur, West Bengal and Andhra Pradesh. Class: Filosea Order: Gromiida Cyphoderiidae 15. Cyphoderia ampulla (Ehrenberg. 1840) Characters: Test yellowish or brownish, covered with distinct circular or oval scales or plates; oral aperture circular, terminal, with a curved neck; fundus obtusely rounded. Distribution: India - Assam, Uttarakhand and Maharashtra. Euglyphidae 16. Assulina muscorum Greef, 1888 Characters: Test yellowish, oval, compressed and truncate anteriorly; composed of imbricate oval platelets usually arranged in alternating diagonal rows. Terminal, elliptical aperture bordered by a thin chitinous membrane with undulate margin. Distribution: India - Arunachal Pradesh, Manipur, Mizoram, Sikkim, Tripura West Bengal and Himachal Pradesh. 17. Assulina seminulum (Ehrenberg, 1848) Leidy, 1879 Characters: Test yellow or brown, pyriform or ovoid, compressed and composed of imbricate oval or elliptical siliceous platelets. Aperture terminal, oval and bordered by a thin chitinous membrane with irregularly dentate margin. Distribution: India - Manipur, Sikkim, Nagaland, West Bengal and Andhra Pradesh. 18. Euglypha acanthophora Dujardin, 1841 Characters: Test ovoid; aperture circular, bordered by finely serrated platelets. Test platelets elliptical, posterior half and at the base of fundus prolonged into 4-7 spines. Distribution: India - Assam, Mizoram, Meghalaya, Nagaland, West Bengal and Andhra Pradesh. 19. Euglypha laevis (Ehrenberg, 1845) Characters: Test oviform, glabrous and elliptical or sub-circular; aperture elliptical or sub-circular,

B.K. Sharma & S. Sharma

bordered by a single row or platelets pointed terminally. Test platelets oval. Distribution: India - Assam, Meghalaya, Tripura, Sikkim, Uttarakhand, West Bengal and Andhra Pradesh. 20. Euglypha tuberculata Dujardin, 1841 Characters: Test elongate-oviform, glabrous; test platelets round or oval, imbricating and forming a hexagonal pattern. Aperture circular, bordered by 8–12 finely serrated platelets. Distribution: India - Assam, Arunachal Pradesh, Meghalaya, Mizoram, Nagaland, Tripura, Jammu and Kashmir, Himachal Pradesh, Sikkim, West Bengal and Andhra Pradesh. 21. Trinema lineare Penard, 1840 Characters: Test small, hyaline, elongate, composed of small circular platelets. Oral aperture circular, oblique, invaginated and bordered by toothed platelets. Distribution: India - Assam, Arunachal Pradesh, Meghalaya, Manipur, Mizoram, Nagaland, Tripura, Himachal Pradesh, Sikkim and West Bengal. Discussion Our collections show 14 species of Lobosea and seven species of Filosea, the L/F ratio of 2 is close to the 3.0 reported by Sharma & Sharma (2008) from various floodplain lakes of Assam but exceeds the range of 0.5–1.4 reported for moss-dwelling rhizopods (Chattopadhyay & Das 2003). Euglyphidae > Centropyxidae = Difflugidae, three speciose families, comprise the dominant fraction (76.2%) of the reported species. Cyphoderiidae and Nebelidae, the least species-rich families, include one species each. Further, Difflugia > Centropyxis are relatively diverse genera (42.9%) while Arcella = Euglypha also form a notable fraction (28.6 %) in this study. The total Rhizopoda richness of Deepor Beel is higher than the 16, 12, 7 and 19 species examined from the freshwater biotopes of Meghalaya (Das et al. 1995), Tripura (Das et al. 2000), Sikkim (Das et al. 2003) and Manipur (Das et al. 2004) respectively. Further, the richness is higher than the reports of 16 species from Loktak Lake - a Ramsar site ( refer Das et al. 2004); 10 species from Melghat Wildlife Sanctuary (Bindu 2010), Maharashtra; 13 species from Pench National

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1947–1950

1949

Testate amoebae of Deepor Beel

B.K. Sharma & S. Sharma

Park, Maharashtra and also 7–16 species listed from 15 floodplain lakes of the Brahmaputra river basin of Assam (Sharma & Sharma 2008). However, we caution against over-emphasizing the importance of these comparisons without considering sampling intensity and the nature of different ecosystems. In analyzing the comparative species-richness of our and other communities, it also needs to be emphasized that the number of species recorded to date are yet provisional and these may well be revised in light of future research. Whilst Centropyxis orbicularis and Cyphoderia ampulla currently exhibit restricted occurrence in India with reports from Sikkim and Uttarakhand respectively, their distribution ranges were extended recently to Assam (Sharma & Sharma 2008). The mossdwelling Cyphoderia ampulla was recently observed in freshwater from Assam (Sharma & Sharma 2008) and Maharashtra (Bindu 2010); the present report re-affirming its occurrence in freshwater environs merits ecological interest. Our report also endorses an identical report (Sharma & Sharma 2008) of Cyclopyxis eurystoma which was known from soil and mosses in India (Chattopadhyay & Das 2003). Arcella hemispherica, Centropyxis cassis, Difflugia corona, D. tuberculata, D. urceolata, Cyclopyxis eurystoma, and Euglypha laevis comprise examples of local or regional distributional interest. Further, these species exhibit rare occurrence in our collections. On the other hand, Arcella discoides, A vulgaris, Centropyxis aculeata, C. ecornis, Difflugia acuminata, D. oblonga, Euglypha acanthophora and E. tuberculata exhibit relatively frequent occurrence. The present report raises the total number of Rhizopoda so far known from different ecosystems of Assam to 49 species, affirming the biodiversity value of this Ramsar site. The observed association of Rhizopoda with different aquatic macrophytes merits future interest, and studies of this and other ecological aspects have been initiated by the authors.

REFERENCES Bindu, L. (2010). On some testacids (Protozoa) of Melghat Wildlife Sanctuary, Maharashtra, India. Journal of Threatened Taxa 2(4): 827–830.

1950

Bindu, L. & A.K. Das (2010). On some new records of Testacids (Protozoa) from Pench National Park, Maharashtra, India. Records of the Zoological Survey of India 110(1): 31–34. Cash, J., G.H. Wailes & J. Hopkinson (1919). The British Freshwater Rhizopoda and Heliozoa. Vol. IV, Ray Society, London. Chattopadhyay, P. & A.K. Das (2003). Morphology, morphopmetry and ecology of moss dwelling testate amoebae (Protozoa: Rhizopoda) of north and north-east India. Memoirs of the Zoological Survey of India 19(4): 1–116. Das, A.K., A.K. Mondal & N.C. Sarkar (1993). Free living Protozoa. In: State Fauna Series: Fauna of West Bengal 3(12): 1–134. (Zoological Survey of India, Calcutta). Das, A.K., A.K. Mondal, D.N. Tiwari & N.C. Sarkar (1995). Protozoa. In: State Fauna Series: Fauna of Meghalaya 4(10): 1–107. (Zoological Survey of India, Calcutta). Das, A.K., D. N. Tiwari & N. C. Sarkar (2000). Protozoa. In: State Fauna Series: Fauna of Tripura 7(4): 1–52. (Zoological Survey of India, Calcutta). Das, A.K., D.N. Tiwari & N.C. Sarkar (2003). Protozoa. In: State Fauna Series: Fauna of Sikkim 9(5): 1–43. (Zoological Survey of India, Calcutta). Das, A.K., R. Nandi, N.C. Sarkar & D. Saha (2004). Protozoa. In: State Fauna Series: Fauna of Manipur 10: 1–44. (Zoological Survey of India, Calcutta). Decloitre, L. (1962). Le genre Euglypha Dujardin. Archiv Protistenkunde 106: 51–100. Deflandre, G. (1929). Le genre Centropyxis Stein. Archiv Protistenkunde 67: 322–375. Deflandre, G. (1959). Rhizopoda and Actinopoda, pp. 232– 264. In: Ward, H.B. & G.C Whipple (eds.). Freshwater Biology. John Wiley & Sons. Inc. New York. Mahajan, K.K. (1971). Fauna of Rajasthan, India. Part 10. Protozoa (No. 2). Records of the Zoological Survey of India 63: 45–76. Mishra, A.B., B.C. Guru & M.C. Dash (1977). Observations on the distribution of Testacea (Protozoa) in some aquatic habitats of Berhampur, Orissa, India. Comparative Physiology and Ecology 2(2): 42–44. Naidu, K.V. (1966). Some thecamobae (Rhizopoda: Protozoa) from India. Hydrobiologia 27: 465–478. Nair, K.N., A.K. Das & R.N Mukherjee (1971). On some freshwater Rhizopoda and Heliozoa (Protozoa) from Calcutta and its environs. Part I. Records of the Zoological Survey of India 65: 1–16. Ogden, C.G. & R.H. Hedley (1980). An Atlas of Freshwater Testate Amoebae. British Museum (Natural History), Oxford University Press, Oxford, 222pp. Sharma, S. & B.K. Sharma (2008). Zooplankton diversity in floodplain lakes of Assam. Records of the Zoological Survey of India, Occasional Paper No. 290: 1–307.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1947–1950

JoTT Note

3(7): 1951–1954

Record of Phyllidiella zeylanica (Mollusca: Gastropoda: Opisthobranchia) after 42 years from Gujarat, India

2011), Raghunathan (2010), Ramakrishna et al. (2010), Sreeraj et al. (2010) and Apte & Salahuddin (2011) studied opisthobranch fauna of India. Work on marine fauna of Gujarat, specifically the Gulf of Kutch and its adjoining areas, was first initiated by Hornell (1909a,b) and was continued by Eliot (1909), Gideon et al. (1957), Kundu (1965), Narayanan (1968, 1969, 1970, 1971a,b), Burn (1970), Menon et al. (1970), Rudman (1980) and Deomurari (2006). The most comprehensive work on ophisthobranchs of the Gulf of Kutch was that by Narayanan (1968, 1969, 1970, 1971a,b) after that, for a long time no such focused studies were conducted and the only recent information from this area about nudibranchs comes from the checklist prepared by Apte et al. (2010). Two specimens of Phyllidiella zeylanica (Kelaart, 1859) measuring 20 and 22 mm were first reported at Pirotan Island, Gulf of Kutch by Narayanan (1968). Since then this species was never reported in any study or research work done on the marine fauna of Gujarat. Location: This interesting sighting occurred on 03 April 2010 during a regular coral monitoring survey under “Coral reef restoration programme” by the Wildlife Trust of India at Mithapur reef” (22025.672’N & 68059.510’E), at a depth of 1.5m on dead corals substrate (Images 1 & 2). Description: Presently reported (23–24 mm) individual has identical external morphological features which typify P. zeylanica. The dorsal surface of the mantle has five longitudinal rows of pink

Manoj Matwal 1 & Dhiresh Joshi 2 Wildlife Trust of India F-13, Sector -8, Noida, Uttar Pradesh 201301, India 1 Deepkamal Apartments II floor, Opp. KCC Cricket Ground, Veraval, Gujarat 362265 2 4 Akar Apartments, 12 New Brahmashastria Society, Paldi, Gujarat, India Email: 1 manojmatwal@gmail.com (corresponding author); 2 dhiresh@wti.org.in 1,2

Nudibranchs belonging to the subclass Opisthobranchia are among the least studied molluscs in India. The work done on opisthobranchs in India is sparse and patchy. The earlier works date back to the 1880s by Alder & Hancock (1864), Kelaart (1858a,b; 1859a,b,c; 1883) and Bergh (1877). Notable works on Indian Opisthobranchia are by Gardiner (1903), Eliot (1905, 1906a,b,c, 1909a,b, 1910a,b, 1916), Farran (1905), Hornell (1909a,b, 1949, 1951), O’Donoghue (1932), Rao (1936, 1952, 1961), Satyamurthi (1952), Rao & Alagarswami (1960), Burn (1970), Rao et al. (1974), Rao & Rao (1980), Valdés et al. (1999) and Fontana et al. (2001). In recent times Apte (2009), Apte & Bhave (2010,

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Deepak Apte Manuscript details: Ms # o2769 Received 22 April 2011 Final received 20 May 2011 Finally accepted 13 June 2011 Citation: Matwal, M. & D. Joshi (2011). Record of Phyllidiella zeylanica (Mollusca: Gastropoda: Opisthobranchia) after 42 years from Gujarat, India. Journal of Threatened Taxa 3(7): 1951–1954.

Copyright: © Manoj Matwal & Dhiresh Joshi 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The Authors wish to acknowledge the constant support and encouragement received from our partners TATA CHEMICALS Ltd. We are also thankful to Deepak Apte and Vishal Bhave of the Bombay Natural History Society for providing necessary information, literature and identification review. OPEN ACCESS | FREE DOWNLOAD

Image 1. The reported individual (Phyllidiella zeylanica)

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1951–1954

1951

M. Matwal & D. Joshi

Arabian Sea

Record of Phyllidiella zeylanica from Gujarat

Gulf of Kachchh

Image 2. Area of sighting (Source: Sen Gupta et al. 2003 and Google Earth)

tubercles which are arranged in a semicircular fashion along the anterior and posterior margins except the median one. Irregular tubercles are arranged in a group of two or three. Median ridge forms a canal like structure at the centre which is filled in by black lines. These lines, excepting the median one are all along the posterior and anterior margins in a semicircular fashion (Narayanan 1969). The reported individual also possessed the same rough ridges which are the typical features for this species (Brunckhorst 1993). Rhinophores are black with colourless stalks. The foot sole is white. Discussion: Though Phyllidiella zeylanica is a common nudibranch species in Lakshadweep and Andaman and Nicobar Islands (Apte 2009; Ramakrishna et al. 2010; Sreeraj et al. 2010), its occurrence in Gujarat and particularly in the Gulf of Kutch is rare. This probably is due to the lack of studies on the opisthobranchs in this region. It is important to have conservation based systematic and comprehensive studies on these animals so that base line information may be generated on these animals and their habitat. References Alder, J. & A. Hancock (1864). Notice on the collection of Nudibranchiate mollusca made in India by Walter Eliot 1952

Esq. with descriptions of several new genera and species. Transactions of the Zoological Society of London 5: 117– 147. Apte, D.A. (2009). Opisthobranch fauna of Lakshadweep Islands, India with 52 new records to Lakshadweep and 40 new records to India. Journal of the Bombay Natural History Society 106(2): 162–175. Apte, D.A., V. Bhave & D. Parasharya (2010). An annotated and illustrated checklist of the opisthobranch fauna of Gulf of Kutch, Gujarat, India with 20 new records for Gujarat and 14 new records for India—Part 1. Journal of the Bombay Natural History Society 107(1): 14–23. Apte, D.A. & V. Bhave (2011). Fourteen new records of opisthobranchs from Lakshadweep, India—Part 2. Journal of the Bombay Natural History Society. (in press) Apte, D.A. & V. K. Salahuddin (2011). Record of Hexabranchus sanguineus (Rüppell & Leuckart 1828) from Lakshadweep Archipelago, India. Journal of the Bombay Natural History Society. (in press) Bergh, L.S.R. (1877). Malacologische Untersuchungen. In: Semper, C.G. (ed.). Reisen im Archipel der Philippinen, Wissenschaftliche Resultate Band 2, Heft 12: 495–546, pls. 58–61. Brunckhorst, D.J. (1993). The systematics and phylogeny of Phyllidiid Nudibranchs (Doridoidea). Records of the Australian Museum, Supplement 16: 1–107. Burn, R. (1970). Phyllidia (Phyllidiella zeylanica) Kelaart, a rare nudibranch from the Indian subcontinent. Momoirs of National Museum of Victoria 31: 37–40. Deomurari, A. (2006). Berthellina citrina from the Gulf of Kutch, India. In: Sea Slug Forum. Australian Museum, Sydney. <http://www.seaslugforum.net/find/1718>. Downloaded on 29 July 2006.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1951–1954

Record of Phyllidiella zeylanica from Gujarat

Eliot, C. (1905). Nudibranchs of the Indo-Pacific Islands. Notes on a collection dredged near Karachi and Maskat. Journal of Conchology 11(8): 237–256 Eliot, C.N.E. (1906a). On the nudibranchs of southern India and Ceylon, with special reference to the drawings by Kelaart and the collections belonging to Alder and Hancock preserved in the Hancock Museum at Newcastle-on-Tyne. Proceedings of the Zoological Society of London, 636– 691pp. Eliot, C.N.E. (1906b). On the nudibranchs of southern India and Ceylon, with special reference to the drawings by Kelaart and the collections belonging to Alder and Hancock preserved in the Hancock Museum at Newcastle-on-Tyne. No. 2. Proceedings of the Zoological Society of London, 999–1008pp. Eliot, C.N.E. (1906c). Nudibranchiata, with some remarks on the families and genera and description of a new genus, Doridomorpha, pp. 540–573, pl. 32. In: Gardiner, J.S. (ed.). The fauna and geography of the Maldive and Laccadive Archipelagoes, being the account of the work carried on and of the collections made by an expedition during the years 1899 and 1900, Vol. 2. Eliot, C.N.E. (1909a). Report on the nudibranchs collected by Mr. James Hornell at Okhamandal in Kattiawar in 190506. In: Report to the government of Baroda on the marine zoology of Okhamandal, 137–145pp. Eliot, C.N.E. (1909b). Notes on a collection of nudibranchs from Ceylon. Spolia Zeylanica, Colombo 6(23): 79–95. Eliot, C.N.E. (1910a). Nudibranchs collected by Mr. Stanley Gardiner from the Indian Ocean in H.M.S. Sealark. In: Reports of the Percy Sladen Trust Expedition to the Indian Ocean in 1905, under the leadership of Mr. J. Stanley Gardiner, M.A. Transactions of the Linnaean Society, Zoology (Series 2), 13(2): 411–439. Eliot, C.N.E. (1910b). Notes on nudibranchs from the Indian museum. Records of the Indian Museum 5(4): 247–252. Eliot, C.N.E. (1916). Mollusca Nudibranchiata. In: Fauna of the Chilka Lake. Memoirs of the Indian Museum 5: 375– 380. Eliot, C. (1909). Report on the Nudibranchs collected by Mr. James Hornell at Okhamandal in Kattiawar in 1905–06. James Hornell’s report to the Government of Baroda on the marine zoology of the Okhamandal in Kattiawar, Williams and Norgate, London, 137–145pp. Farran, G.P. (1905). Report on the Opisthobranchiate Mollusca collected by Prof. Herdman. In: W.A. Herdman’s report on the pearl oyster fisheries of the Gulf of Mannar. The Ray Society, London, 29–364pp. Fontana, A., M.L. Ciavatta, L. D’Souza, E.Mollo, C.G. Naik, P.S. Parameswaran, S. Wahidulla & G. Cimino (2001). Selected chemo-ecological studies of marine opisthobranchs from Indian coasts. Journal of the Indian Institute of Science 81(4): 403–415. Gardiner, J.S. (1903). The Fauna and Geography of The Maldives and Laccadive Archipelagoes—Vol. 2. Cambridge University Press, 1080pp.

M. Matwal & D. Joshi

Gideon, P.W, K.B. Menon, S.R.V. Rao & K.V. Jose (1957). On the marine fauna of the Gulf of Kutch a preliminary survey. Journal of the Bombay Natural History Society 54(3): 690–706. Hornell, J. (1909a). Report to the Government of Baroda on the marine zoology of Okhamandal in Kattiawar, Williams and Norgate, London, 1pp. Hornell, J. (1909b). A note on the presence of symbiotic algae in the integuments of nudibranchs of the genus Melibe. In: Report to the government of Baroda on the marine zoology of Okhamandal, 1, 145–148pp. Hornell, J. (1949). The study of Indian molluscs (part II). Journal of the Bombay Natural History Society 48(3): 543–569. Hornell, J. (1951). Indian molluscs. Journal of the Bombay Natural History Society 1–96, pl+1. Kelaart, E.F. (1858a). Descriptions of new and little known species of Ceylon nudibranchiate molluscs and zoophytes. Journal of the Ceylon Branch of the Royal Asiatic Society 3(1): 84–139. Kelaart, E.F. (1858b). Description of a new Ceylonese nudibranch. Annals and Magazine of Natural History (Series 3), 1(4): 257–258. Kelaart, E.F. (1859a). Descriptions of new and little-known species of Ceylonese nudibranchiate molluscs. Annals and Magazine of Natural History (Series 3), 3: 291–304. Kelaart, E.F. (1859b). Descriptions of new and little-known species of Ceylonese nudibranchiate molluscs. Annals and Magazine of Natural History (Series 3), 3: 488–496. Kelaart, E.F. (1859c). On some additional species of nudibranchiate molluscs from Ceylon. Annals and Magazine of Natural History (Series 3), 4: 267–270. Kelaart, E.F. (1883). New and little known species of Ceylon nudibranchiate molluscs, and zoophytes. Journal of the Ceylon Branch of the Royal Asiatic Society 3(9): 76–125. Kundu, H.L. (1965). On the marine fauna of the Gulf of Kutch: Part 3 - Pelecypods. Journal of the Bombay Natural History Society 62(2): 84–103. Menon, P.K.B., A.K. Dattagupta & D. Dasgupta (1970). On the marine fauna of the Gulf of Kutch. Journal of the Bombay Natural History Society 58(2): 475–494, pls. 1–10. Narayanan, K.R. (1968). On three opisthobranchs from the south-west coast of India. Journal of Madras Biological Association of India 10(2): 377–380; figs. 1–2. Narayanan, K.R. (1969). On the opisthobranchiate fauna of the Gulf of Kutch. Proceedings of the Symposium on Mollusca held at Cochin from January 12 to 16, 1968, Symposium Series 3, pt. 1, pp. 189–213; figs. 1–20. Marine Biological Association of India, Mandapam Camp, India. Narayanan, K.R. (1970). On a species of the genus Berthellina (Opisthobranchia: Notaspidea) of the Gulf of Kutch. Journal of the Marine Biological Association of India 12: 210–213. Narayanan, K.R. (1971a). On two doridacean nudibranchs (Mollusca: Gastropoda), from the Gulf of Kutch, new to the

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1951–1954

1953

Record of Phyllidiella zeylanica from Gujarat

M. Matwal & D. Joshi

Indian coast. Journal of Bombay Natural History Society 68(1): 280–281. Narayanan, K.R. (1971b). On a species of the genus Berthellina (Opisthobranchia: Notaspidea) of the Gulf of Kutch. Journal Madras Biological Association of India 12(1–2): 210–212. O’Donoghue, C.H. (1932). Notes on Nudibranchata from southern India. Proceedings of the Malacological Society of London ( 20): 141–166. Raghunathan, C., C. Sivaperuman and Ramakrishna (2010). An account of newly recorded five species of nudibranchs (Opisthobranchia, Gastropoda) in Andaman and Nicobar Islands, pp 283–288. In: Ramakrishna, C. Raghunathan & C. Sivaperuman (eds.). Recent Trends in Biodiversity of Andaman and Nicobar Islands, Zoological Survey of India, Kolkata, xxiv+542pp. Ramakrishna, C.R. Sreeraj, C. Raghunathan, C. Sivaperuman, J.S. Yogesh Kumar, R. Raghuraman, Titus Immanuel and P.T. Rajan (2010). Guide to opisthobranchs of Andaman and Nicobar Islands, Zoological Survey of India, Kolkata, 196pp. Rao, K.V. (1936). Morphology of the Kalinga ornata (Alder and Hancock). Records of the Indian Musesum (38): 41– 79. Rao, K.V. (1952). Cuthona adayarensis, A new Nudibranch (Mollusca: Gastropoda) from Madras. Journal of the Zoological Society of India, Calcutta (3): 229–238. Rao, K.V. (1961). On the two opisthobranchiate molluscs, Placobranchus ocellatus Hasselt and Discodoris boholiensis Bergh from Indian waters not hitherto been recorded. Journal of the Marine Biological Association of India 3(1&2): 253–259.

1954

Rao, K.V. & K. Alagarswami (1960). An account and the structure of early development of a new species of nudibranchiate gastropod, Eolidina (Eolidina) mannarensis. Journal of the Marine Biological Association of India 2(1): 6–16. Rao, N.V. & K.V.S. Rao (1980). On a rare nudibranch, Thordisa crosslandi Eliot (Mollusca: Dorididae) from the west coast of India. Bulletin Zoological Survey of India 2(2–3): 219, pl. IV. Rao, K.V., P. Sivadas & L.K. Kumary (1974). On three rare doridiform nudibranch molluscs from Kavaratti Lagoon, Laccadive Islands. Journal of the Marine Biological Association of India 16(1): 113–125. Rudman, W.B. (1980). Aeolid opisthobranch molluscs (Glaucidae) from the Indian Ocean and the south-west Pacific. Zoological Journal of the Linnean Society (68): 139–172. Satyamurthi, S.T. (1952). The mollusca of Krusadai Island. 1. Amphineura and Gastropoda. Bulletin of Madras Government Museum (Natural History) 1(2): 216–251. Sreeraj, C.R., P.T. Rajan, R. Raghukumaran, C. Raghunathan, R. Rajkumar Rajan, Titus Immanuel and Ramakrishna (2010). On some new records of sea slugs (Class Gastropoda, Sub Class Opisthobranchia) from Andaman and Nicobar Islands, pp. 289–298. In: Ramakrishna, C. Raghunathan & C. Sivaperuman (eds.). Recent Trends in Biodiversity of Andaman and Nicobar Islands, Zoological Survey of India, Kolkata, xxiv+542pp Valdés, A., E. Mollo & J.A. Ortea (1999). Two new species of Chromodoris (Mollusca, Nudibranchia, Chromodorodidae) from southern India, with a re-description of Chromodoris trimarginata (Winckworth, 1946). Proceedings of the California Academy of Sciences 51(13): 461–472.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1951–1954

JoTT Note

Endoparasites in wild animals at the zoological garden in Skopje, Macedonia Elena Atanaskova 1, Zoran Kochevski 2, Jovana Stefanovska 3 & Goran Nikolovski 4 Department of Health Preventive for Pets and Ungulates, Department of Parasitology and Parasitic Diseases, Faculty of Veterinary Medicine, LazarPop-Trajkov 5-7, 1000 Skopje, Republic of Macedonia Email: 1 eatanaskova@fvm.ukim.edu.mk (corresponding author), 2 zkochevski@fvm.ukim.edu.mk, 3 jstefanovska@fvm. ukim.edu.mk, 4 gnikolovski@fvm.ukim.edu.mk 1,4 2,3

Parasitic diseases play an important role for wild animals in captivity. In captivity the health status of the animals depends on many factors, like feeding, keeping conditions, animal management and environmental conditions such as temperature and humidity. The staff plays an important role in the transmission of parasites amongst animals in a zoo, through their shoes, clothes, hands, food or with working tools. Another possibility of parasite transmission is the animals themselves, when they are moved from one enclosure to another, without proper parasite treatment. Mixing different species brings additional risks of parasitic infections. In the wild, animals might have a natural resistance against parasitic infections or live in a balanced system with their parasites. But the change in environment and

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Ulrike Streicher Manuscript details: Ms # o2440 Received 08 April 2010 Final received 14 April 2011 Finally accepted 23 April 2011 Citation: Atanaskova, E., Z. Kochevski, J. Stefanovska & G. Nikolovski (2011). Endoparasites in wild animals at the zoological garden in Skopje, Macedonia. Journal of Threatened Taxa 3(7): 1955–1958. Copyright: © Elena Atanaskova, Zoran Kochevski, Jovana Stefanovska & Goran Nikolovski 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: We would like to thank Vesna Levajkovic, DVM from the zoological garden in Skopje, Macedonia for helping in the sample collection. OPEN ACCESS | FREE DOWNLOAD

3(7): 1955–1958

living conditions from freedom to captivity influences the animals’ ecology and might increase the sensitivity for parasitic infections (Goossensa et al. 2005). Parasitic diseases are one of the main causes of death in wild animals in captivity (Rao & Acharjyo 1984). In addition, some parasites are zoonotic and are a risk to human health (Maske et al. 1990; Chakraborty et al. 1994; Kashid et al. 2003). For these reasons we consider it very important to conduct preventive measures, to regularly control the presence of parasites in the animals and to undertake adequate therapy when required. Skopje Zoological Garden, Macedonia implements a regular deworming program at least once a year. For several years they have used different antiparasitic drugs for different groups of animals such as ivermectin, piperazine citrate, fenbendazol (Panacur), praziquantel, and pyrantel (Biheldon). The goal of our study was to evaluate the presence of gastrointestinal parasites in the animals in the Zoological Garden in Skopje, Macedonia. Materials and methods: The study was conducted at the Zoological Garden in Skopje, established in 1926 on an area of 12 acres with a collection of 300 animals from 56 different species. On several occasions animals were treated in November and then samples were taken in the following April. Fecal samples were taken over a period of three years from 28 different species of animals (Table 1). The samples were always collected in April. The samples were brought to the laboratory for parasitology and parasitic diseases at the faculty of veterinary medicine in Skopje, in portable refrigerators. Fecal examination was performed by flotation method using ZnSO4 with a specific gravity of 1.18–1.20 (371g zinc sulfate in 1000ml water). From every animal 2–5g of feces were mixed with 10ml ZnSO4, then the sample was centrifuged at 1200 rpm for 5 minutes. Every sample was checked under the microscope at 40X enlargement (Dryden et al. 2005). We divided the examined animals into three groups according to the type of enclosure they were kept in. These groups did not consider the animals’ age and there was no control group. The first group consisted of animals that were kept in indoor enclosures - such as the menagerie for

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1955–1958

1955

Endoparasites in Skopje Zoo

E. Atanaskova et al.

Table 1. Results of examination of the first, second and third group. Presence of parasitic eggs in the first group Species

2007

2008

2009

Panthera tigris (Tiger)

Toxocara sp.

Toxascaris leonina

Panthera leo (Lion, couple)

Toxocara sp.

Toxascaris leonina

Panthera leo (Lion, group)

Panthera pardus nigra (Leopard)

Toxascaris leonina

Panthera onca (Jaguar)

Macaca sylvanus (Berberian Monkey)

Oesophagostomum sp.

Pan troglodytes (Chimpanzee)

Papio hamadryas ursinus (Chacma Baboon)

Panthera onca (Jaguar)

Presence of parasitic eggs in the second group Muntjacus muntjac (Muntjac) Capreolus capreolus (Deer)

Strongyloides sp.

Strongyloides sp. Trichostrongylus sp.

Trichuris sp..

Lama lama (Llama)

Moniezia sp.

Equus sp. (Pony Horse)

Trichostrongylus sp.

Capra ibex (Ibex)

Bos (Zebu)

Antilope cervicapra (Black Anthelope) Taurotragus oryx (Eland) Bos indicus (Zebu) Camelus dromedarius (Camel)

Nematodirus sp.

Eimeria sp. Nemathodirus sp.

Trichuris sp..

Strihurio camelus (Ostrich)

Bos grunniens (Yak)

Trichostrongylus sp.

Dama dama (Fallow Deer)

Ovis sp. (Sheep)

Trichuris sp.

Eimeria sp.

Capra ibex (Alpine Ibex)

Presence of parasitic eggs in the third group Canis lupus (Wolf)

Toxocara sp.

Taenia sp.

Canis lupus (Wolf)

Toxocara sp.

Hippopotamus amphibius (Hippopotamus)

Ursus arctos (Bear)

Baylisascaris transfuga

wild cats and the ape enclosure. The second group comprised animals like camel, ostrich and ibex that were held in outdoor enclosures with open soil. The third group included animals held in semi-open enclosures: bears, wolves and hippopotamus. In the semi-open enclosures animals were closed in cages during the cold season in winter and were free to go outside in the other periods of the year. In the first group parasite treatment was performed in May using piperazine citrate (2.5mg/kg) (Jacobs 1987) in all investigated years. 1956

Animals in the second group were treated with ivermectin (0.2mg/kg) (Bowman 1995), twice in 2007 (May and November), and once in 2008 (May). In 2009 animals were treated twice with piperazine citrate (110mg/kg) at an intervall of four weeks (May and June) (Gibson 1957). The third group was treated once in May in 2007 with ivermectin (0.2mg/kg) (Bowman 1995). In 2008 the treatment was applied again twice, in May and November, also using ivermectin. In 2009, two treatments were applied, first a praziquantel (5mg/kg)

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1955â&#x20AC;&#x201C;1958

Endoparasites in Skopje Zoo

and pyrantel (5mg/kg) combination was used (Bowman 1995) in May, and after six months fenbendazol (50mg/ kg) was applied (Bowman 1992). Results: Eggs of the following parasites were identified: Baylisascaris transfuga, Eimeria sp., Moniezia sp., Nemathodirus sp., Oesophagostomum sp., Strongyloides sp., Taenia sp., Toxocara sp., Toxascaris leonina, Trichuris sp., Trichostrongylus sp. Within the first group we found parasite eggs in Panthera tigris and Panthera leo in all three years consecutively. Panthera pardus nigra and Macaca sylvanus were parasite free in 2007 and 2008 but showed parasitic infection in 2009. In the second group most of the animals were found parasite positive in 2008, but in 2009 most of the animals were free of parasites. In the third group, Canis lupus was found positive for Toxocara spp. In the following years the animals were found free of this parasite. The infection of Ursus arctos with Baylisascaris transfuga which was found in 2009 was probably a result of the introduction of a new bear from the wild and insufficient cleaning measures. Discussion: Helminthoses are a big problem in zoo animals. In captivity animals appear to be less resistant to parasitic infections than in their natural habitats. Our study shows that the number of infected animals in the whole zoological garden in Skopje is fairly high with an infection rate of 21.4%, 32.1% and 28.6% in the years 2007, 2008 and 2009. A comparable study by Lalošević et al. (2007) found an infection rate of 17.2% in 75 samples of animals kept at Palic Zoo in Serbia, which is considerably lower. Some parasites (geohelminths) potentially accumulate in a captive environment, in particular in open soil enclosures, which cannot be easily disinfected. Their survival in the soil is strongly impacted by climatic factors. Other parasites require an intermediate host and are less likely to accumulate in a captive environment, because their intermediate host might not occur in the enclosure (Lalošević et al. 2007). Our results confirmed this finding: all parasites found during the examinations are geohelminths, which do not require an intermediate host. This has a very important epidemiological meaning and our results are similar with the results of other studies. In 2007 and 2008 the percentage of infected animals was identical in animals kept in indoor enclosures all year

E. Atanaskova et al.

round (group 1) , while in 2009 it was double despite the parasite treatment. Though it is possible that the animals were parasite free immediately after the treatment there is obviously a high rate of reinfection (Table 2). Animals living in outdoor open soil enclosures (group 2) were treated twice in 2007 while in 2008 only once. However the infection rate increased from 2007 to 2008, while it decreased from 2008 to 2009. The change in infection rate cannot be explained by the parasite treatment. We do not know if the animals were parasite free immediately after our treatment. Whatever effect there might have been the reinfection rate under this keeping conditions is very high. Within this group we found eggs of Toxocara spp. and Toxascaris leonina in tigers. The tigers were treated both in 2007 and 2008 with piperazine citrate, but the same parasites were still found in 2009. Toxocara and Toxascaris have very high tenacity and their presence during the 3-year research is a sign that the preventive measures applied during this period are not sufficient or that there is a high rate of reinfection. In 2009 the tigers were treated for three consequent days with fenbendazol (10mg/kg) hoping that this will be a more efficient medication. Animals living part time in indoor enclosures and part time in outdoor enclosures (group 3) received two treatments every year during our study and showed the lowest rate of infection. However looking at results from group 1, two treatments alone are not necessarily sufficient to reduce the parasites. It is likely that the management of shifting enclosures every few months contributes to the reduction of parasites. It is difficult to draw detailed conclusions from our study for various reasons. Firstly the time between the deworming and the fecal sampling is very long and ranges between 6 and 11 months. Even if the treatment was initially effective, in such a long time there is a high risk of reinfection via above mentioned vectors as personal or tools. In addition due to the reconstruction

Table 2. Percent of infected animals by groups. Group

2007

2008

2009

22.2%

44.4%

13.3%

40%

20%

40%

25%

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1955–1958

1957

Endoparasites in Skopje Zoo

E. Atanaskova et al.

of the enclosures during the past three years, many animals were transferred from one enclosure to another and were mixed with other species of animals. This might be the reason why despite antiparasitic treatment in some species of animals, different species of parasites were found each year. To control parasitic infections it is necessary to undertake appropriate antiparasitic therapy, to increase cage hygiene and to introduce good animal and staff management. It should also be kept in mind that every antiparasitic therapy might potentially cause additional stress in the animal and increase the possibility of infection. Regular parasite controls of food and water should also be conducted; quality food and appropriate addition of vitamins and minerals is an additional measure to reduce the risk of parasitic infections (Borghare et al. 2009).

REFERENCES Borghare, A.T., V.P. Bagde, A.D. Jaulkar, D.D. Katre, P.D. Jumde, D.K. Maske & G.N. Bhangale (2009). Incidence of gasrointestinal helminthiasis in captive deers at Nagpur. Veterinary World 2(9): 337–338. Bowman, D.D. (1992). Anthelmintics for dogs and cats effective against nematodes and cestodes. The compendium on continuing education for the practicing veterinarian 14(5): 597–601. Bowman, D.D. (1995). Georgis’ Parasitology for Veterinarians—6th Edition. W.B. Saunders Company, USA, 265pp.

1958

Chakraborty, A., A.R. Gogoi & B. Choudhary (1994). Prevalence of parasitic infection in captive wild herbivores in a zoo in Assam, India. Indian Journal of Animal Science 9: 149–152. Dryden, M.W., A. Payne & S. Ridley (2005). Comparison of common fecal flotation techniques for the recovery of parasite eggs and oocysts. Veterinary Therapeutics 6(1): 14–28. Gibson, T.E. (1957). Critical test of piperazine adipate as an equine anthelmintic. British Veterinary Journal 113: 990– 92. Goossensa, E., P. Dornya, J. Boomkerd, F. Vercammen & Vercruysse (2005). A 12-month survey of the gastrointestinal helminths of antelopes, gazelles and giraffes kept at two zoos in Belgium. Veterinary Parasitology 127: 303–312. Jacobs, D.E. (1987). Antehlminitcs for dogs and cats. International Journal for Parasitology17(2): 511–518. Kashid, K.P., G.B. Shrikhande & G.R. Bojne (2003). Incidence of gastro-intestinal helminths captive wild animals at different locations. Zoos’ Print Journal 18(3): 1053–1054. Lalošević, V., D. Lalošević, S. Boboš, M. Šinković & L. Spasojević (2007). Nalaz crevnih parazita kod životinja u zoološkom vrtu ‘Palić’, Savremena poljoprivreda 56 (3–4): 98–102. Maske, D.K., N.C. Bhilegaonkar & M.R. Sardey (1990). Helminth parasites in zoo animals of Maharajbagh, Nagpur, Maharashtra State. Indian Journal of Animal Science 5: 277–278. Rao, A.T. & L.N. Acharjyo (1984). Diagnosis and classification of common diseases of captive animals at Nandankanan Zoo in Orissa (India). Indian Journal of Animal Health 33: 147–152.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1955–1958

JoTT Note

Organochlorine insecticide poisoning in Golden Langurs Trachypithecus geei D.C. Pathak Department of Pathology, College of Veterinary Science, Assam Agricultural University, Khanapara, Guwahati, Assam 781022, India Email: dcp55@sify.com

The Golden Langur Trachypithecus geei, an old world monkey, is found on the Indian subcontinent mainly in the foothills of the Himalaya, along the Assam-Bhutan border inhabiting mainly areas with high trees. The species is classified as endangered (IUCN 2011). The herbivorous animal’s diet consists of ripe and unripe fruit, mature and young leaves, seeds, buds and flowers. In one area of Kokrajhar District of Assam the animals have also adapted to feeding on dry rubber seeds (Medhi et al. 2004). Srivastava (2006) found in a census a total of 943 individuals of Golden Langur in 96 groups in Assam. This population had also adapted to feeding on dry rubber seeds (Medhi et al. 2004). Chakrashila Wildlife Sanctuary (CWS) is one of the 14 fragmented habitat pockets, where Golden Langurs occur in Assam and is located in the districts of Dhubri and Kokrajhar covering an area of 45.58km2. At present 474 Golden Langurs in 66

Date of publication (online): 26 July 2011 Date of publication (print): 26 July 2011 ISSN 0974-7907 (online) | 0974-7893 (print) Editor: Ulrike Streicher Manuscript details: Ms # o2412 Received 24 February 2010 Final received 21 April 2011 Finally accepted 27 April 2011 Citation: Pathak, D.C. (2011). Organochlorine insecticide poisoning in Golden Langurs Trachypithecus geei. Journal of Threatened Taxa 3(7): 1959–1960. Copyright: © D.C. Pathak 2011. Creative Commons Attribution 3.0 Unported License. JoTT allows unrestricted use of this article in any medium for non-profit purposes, reproduction and distribution by providing adequate credit to the authors and the source of publication. Acknowledgements: The author is thankful to Dr. Prabhat Basumatary (ex veterinary officer) and Dr. Panjit Basumatary (veterinary officer) WTI, Chakrashila Wildlife Sanctuary, Assam for providing the specimen, clinical samples and necessary information, and the Head, Department of Pathology, College of Veterinary Science, Khanapara for providing necessary facilities for conducting histopathology and clinical pathology. OPEN ACCESS | FREE DOWNLOAD

3(7): 1959–1960

families are present in CWS (Chetry et al. 2010). In Kokrajhar District there is a rubber plantation covering about 750 bighas (100ha approx.) of land bordering CWS on the north eastern side. A strip of agricultural land of about 100m wide separates the CWS from the rubber plantation. Golden Langurs frequently visit the plantation area in search of food. The present report is a record of organochlorine insecticide poisoning in three Golden Langurs in CWS. Materials and Methods: The staff of CWS spotted an adult Golden Langur in moribund condition in the forest in the early part of December 2008. It had lacerations on the head and face as if it had fallen from the tree. The animal was emaciated and unable to walk on its own. The veterinary officer of the Wildlife Trust of India (WTI) entrusted to CWS, Assam, treated the animal by dressing the wounds and injecting antibiotics, dexamethazones, DNS drip and vitamin B complex. But the animal died two days later. Blood and urine samples were collected for routine examination before the death of the animal. Within the month two adult other Golden Langur carcasses were recovered in the same forest. All three carcasses were thoroughly necropsied. Heart blood and tissue samples were collected aseptically and sent for bacterial culture. Intestinal loops and pieces of liver and kidney in saturated salt solution were sent to the Forensic Science Laboratory, Guwahati for identification of any toxic insecticides. Representative tissue samples were preserved in 10% formol saline. Paraffin embedded tissue sections were stained with routine haematoxylin and eosin staining method for histopathology. Local WTI personnel reported that the rubber plants were regularly sprayed with some insecticides. The Golden Langurs were reported to eat the tender leaves of the plants. Results: On postmortem examination all three animals were found to be dehydrated. No specific gross lesions were found in the visceral organs, except congestion in the liver, kidneys and intestine. The blood picture showed lower levels of haemoglobin (7.2g%), packed cell volume (29%) and total leucocyte count (5.15x103µl-1). Urinanalysis showed moderate amounts of protein and bile pigment. Histopathiologically, there was massive haemorrhage

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1959–1960

1959

Poisoning in Golden Langurs

D.C. Pathak

in the liver with necrosis of the hepatocytes, which was centrilobular to diffuse (Image 1). The kidneys showed congestion in the intertubular spaces with mild degeneration of the tubular epithelial cells. The mucosal epithelium of the small intestine was necrotic and sloughed away. The lungs showed capillary congestion and alveolar haemorrhages. In the cerebrum there was mild leptomeningitis with congestion and infiltration of mononuclear cells in the piamater. Neuronal degeneration and neuronophagia were also evident in the cerebrum. The forensic science laboratory results confirmed the case as organochlorine insecticide poisoning, as all the tissues (liver and kidney) and intestinal contents of the three animals were found positive for the insecticide. Discussion: Organochlorine insecticide intoxication does not cause any diagnostically useful lesions. Though hepatocellular degeneration and renal tubular degeneration had been occasionally reported with certain organochlorine intoxications, such lesions were more frequently associated with prolonged exposure than acute poisoning (Peterson & Talcott 2006). Jones et al. (1997) also described Nissl’s degeneration, neuronal necrosis, centrilobular necrosis of liver and enteritis in case of oral poisoning. In the present case the lesions along with the general health of the animals suggested prolonged exposure to organochlorine insecticides by ingestion of contaminated leaves of the rubber plants over a long period of time. This was later confirmed by the findings of the forensic science laboratory. It is specifically interesting to consider that the population observed by Medhi (2004) in the same district did utilize rubber seeds as food souce without shoiwng any health problems. A comparison of organochlorine insecticide levels in different plant parts could bring more information.

1960

Image 1. Hepatic necrosis in a Golden Langur from Chakrashila Wildlife Sanctuary.

REFERENCES Chetry, D., R. Chetry, K. Ghosh & P.C. Bhattacharjee (2010). Status and Conservation of Golden Langur in Chakrashila Wildlife Sanctuary, Assam, India. Primate Conservation (25): 81–86. Das, J., R. Medhi & S. Molur (2008). Trachypithecus geei. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2010.4. <www.iucnredlist.org>. Downloaded on 06 July 2011. Jones, T.C., R.D. Hunt & N.W. King (1997). Veterinary Pathology—6th Edition. Williams and Wilkins, A Wavery Publishing, Baltimore, USA, 238pp. Medhi, R., D. Chetri, P.C. Bhattacharjee & B.N. Patyri (2004). Status of Trachypithecus gee in a rubber plantation in western Assam; India. International Journal of Primatology 25(6): 1331–1337. Peterson, M.E. & P.A. Talcott (2006). Small Animal Toxicology. Second Edition. Saunders Publisher, 1232pp. Srivastava, A. (2006). Ecology and conservation of the Golden Langur Trachypithecus geei. Primate Conservation (21): 163–170.

Journal of Threatened Taxa | www.threatenedtaxa.org | July 2011 | 3(7): 1959–1960

Dr. Shinsuki Okawara, Kanazawa, Japan Dr. Albert Orr, Nathan, Australia Dr. Geeta S. Padate, Vadodara, India Dr. Larry M. Page, Gainesville, USA Dr. Malcolm Pearch, Kent, UK Dr. Richard S. Peigler, San Antonio, USA Dr. Rohan Pethiyagoda, Sydney, Australia Mr. J. Praveen, Bengaluru, India Dr. Robert Michael Pyle, Washington, USA Dr. Muhammad Ather Rafi, Islamabad, Pakistan Dr. H. Raghuram, Bengaluru, India Dr. Dwi Listyo Rahayu, Pemenang, Indonesia Dr. Sekar Raju, Suzhou, China Dr. Vatsavaya S. Raju, Warangal, India Dr. V.V. Ramamurthy, New Delhi, India Dr (Mrs). R. Ramanibai, Chennai, India Dr. M.K. Vasudeva Rao, Pune, India Dr. Robert Raven, Queensland, Australia Dr. K. Ravikumar, Bengaluru, India Dr. Luke Rendell, St. Andrews, UK Dr. Anjum N. Rizvi, Dehra Dun, India Dr. Leif Ryvarden, Oslo, Norway Dr. Yves Samyn, Brussels, Belgium Dr. K.R. Sasidharan, Coimbatore, India Dr. Kumaran Sathasivam, India Dr. S. Sathyakumar, Dehradun, India Dr. M.M. Saxena, Bikaner, India Dr. Hendrik Segers, Vautierstraat, Belgium

Dr. Subodh Sharma, Towson, USA Prof. B.K. Sharma, Shillong, India Prof. K.K. Sharma, Jammu, India Dr. R.M. Sharma, Jabalpur, India Dr. Arun P. Singh, Jorhat, India Dr. Lala A.K. Singh, Bhubaneswar, India Prof. Willem H. De Smet, Wilrijk, Belgium Mr. Peter Smetacek, Nainital, India Dr. Humphrey Smith, Coventry, UK Dr. Hema Somanathan, Trivandrum, India Dr. C. Srinivasulu, Hyderabad, India Dr. Ulrike Streicher, Danang, Vietnam Dr. K.A. Subramanian, Pune, India Mr. K.S. Gopi Sundar, New Delhi, India Dr. P.M. Sureshan, Patna, India Dr. Karthikeyan Vasudevan, Dehradun, India Dr. R.K. Verma, Jabalpur, India Dr. W. Vishwanath, Manipur, India Dr. Gernot Vogel, Heidelberg, Germany Dr. Ted J. Wassenberg, Cleveland, Australia Dr. Stephen C. Weeks, Akron, USA Prof. Yehudah L. Werner, Jerusalem, Israel Dr. Hui Xiao, Chaoyang, China Dr. April Yoder, Little Rock, USA English Editors Mrs. Mira Bhojwani, Pune, India Dr. Fred Pluthero, Toronto, Canada

Journal of Threatened Taxa is indexed/abstracted in Zoological Records, BIOSIS, CAB Abstracts, Index Fungorum, Bibliography of Systematic Mycology, EBSCO and Google Scholar.

Journal of Threatened Taxa ISSN 0974-7907 (online) | 0974-7893 (print)

July 2011 | Vol. 3 | No. 7 | Pages 1885–1960 Date of Publication 26 July 2011 (online & print) Paper

Short Communication

CEPF Western Ghats Special Series Rediscovery of the threatened Western Ghats endemic sisorid catfish Glyptothorax poonaensis (Teleostei: Siluriformes: Sisoridae) -- Neelesh Dahanukar, Manawa Diwekar & Mandar Paingankar, Pp. 1885–1898

CEPF Western Ghats Special Series Checklist of the fishes of the Achankovil forests, Kerala, India with notes on the range extension of an endemic cyprinid Puntius chalakkudiensis -- Fibin Baby, Josin Tharian, Siby Philip, Anvar Ali & Rajeev Raghavan, Pp. 1936–1941

Communications

Notes

Two new Asterina species on Michelia champaca from Kerala, India -- V.B. Hosagoudar & M.C. Riju, Pp. 1942-1946

Physical characteristics, categories and functions of song in the Indian Robin Saxicoloides fulicata (Aves: Muscicapidae) -- Anil Kumar, Pp. 1909–1918 Ex situ conservation of two threatened ferns of the Western Ghats through in vitro spore culture -- Johnson Marimuthu & Visuvasam Soosai Manickam, Pp. 1919–1928 Prevalence of Listeria species including L. monocytogenes from apparently healthy animals at Baroda Zoo, Gujarat State, India -- Mahendra Mohan Yadav, Ashish Roy, Bharat Bhanderi & R.G. Jani, Pp. 1929-1935

Testate amoebae (Protozoa: Rhizopoda) of Deepor Beel (a Ramsar site), Assam, northeastern India -- B.K. Sharma & Sumita Sharma, Pp. 1947-1950 Record of Phyllidiella zeylanica (Mollusca: Gastropoda: Opisthobranchia) after 42 years from Gujarat, India -- Manoj Matwal & Dhiresh Joshi, Pp. 1951–1954 Endoparasites in wild animals at the zoological garden in Skopje, Macedonia -- Elena Atanaskova, Zoran Kochevski, Jovana Stefanovska & Goran Nikolovski, Pp. 1955–1958 Organochlorine insecticide poisoning in Golden Langurs Trachypithecus geei -- D.C. Pathak, Pp. 1959–1960