AFAB-Volume2-Issue2

ISSN: 2159-8967 www.AFABjournal.com

Volume 2, Issue 2 2012

78

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

EDITORIAL BOARD Sooyoun Ahn

W.K. Kim

University of Florida, USA

University of Manitoba, Canada

Walid Q. Alali

M.B. Kirkham

University of Georgia, USA

Kansas State University, USA

Kenneth M. Bischoff

Todd Kostman

NCAUR, USDA-ARS, USA

University of Wisconsin, Oshkosh, USA

Claudia S. Dunkley

Y.M. Kwon

University of Georgia, USA

University of Arkansas, USA

Lawrence Goodridge

Maria Luz Sanz

Colorado State University, USA

MuriasInstituto de Quimica Organic General, Spain

Leluo Guan

Melanie R. Mormile

University of Alberta, Canada

Missouri University of Science and Tech., USA

Joshua Gurtler

Rama Nannapaneni

ERRC, USDA-ARS, USA

Mississippi State University, USA

Yong D. Hang

Jack A. Neal, Jr.

Cornell University, USA

University of Houston, USA

Divya Jaroni

Benedict Okeke

Oklahoma State University, USA

Auburn University at Montgomery, USA

Weihong Jiang Shanghai

John Patterson

Institute for Biol. Sciences, P.R. China

Purdue University, USA

Michael Johnson

Toni Poole

University of Arkansas, USA

FFSRU, USDA-ARS, USA

Timothy Kelly

Marcos Rostagno

East Carolina University, USA

LBRU, USDA-ARS, USA

William R. Kenealy

Roni Shapira

Mascoma Corporation, USA

Hebrew University of Jerusalem, Israel

Hae-Yeong Kim

Kalidas Shetty

Kyung Hee University, South Korea

University of Massachusetts, USA

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

79

EDITORIAL STAFF EDITOR-IN-CHIEF Steven C. Ricke University of Arkansas, USA

EDITORS Todd R. Callaway FFSRU, USADA-ARS, USA Cesar Compadre University of Arkansas for Medical Sciences, USA Philip G. Crandall University of Arkansas, USA

MANAGING EDITOR Dave Edmark Fayetteville, AR

LAYOUT EDITOR Ellen J. Van Loo Ghent, Belgium

TECHNICAL EDITOR Jessica C. Shabatura Eureka Springs Arkansas, USA

ONLINE EDITION EDITOR C.S. Shabatura Eureka Springs Arkansas, USA

ABOUT THIS PUBLICATION Mailing Address: 2138 Revere Place . Fayetteville, AR . 72701

Website: www.AFABjournal.com

Agriculture, Food & Analytical Bacteriology (ISSN 2159-8967) is published quarterly, beginning with this inaugural issue.

Advertising: If you are interested in advertising with our journal, please contact us at advertising@afabjournal.com for a media kit and current rates.

Instructions for Authors may be obtained at the back of this issue, or online via our website at www.afabjournal.com

Reprint Permission: Correspondence regarding reprints should be addressed Ellen Van Loo, Managing Editor, Agriculture, Food & Analytical Bacteriology ellen@afabjournal.com

Manuscripts: All correspondence regarding pending manuscripts should be addressed Ellen Van Loo, Managing Editor, Agriculture, Food & Analytical Bacteriology: ellen@afabjournal.com

Ordering Print Copies: print editions of this journal may be purchased and shipped internationally from our website order form at www.afabjournal.com

Information for Potential Editors: If you are interested in becoming a part of our editorial board, please contact Editor-in-chef, Steven Ricke, Agriculture, Food & Analytical Bacteriology: editor@afabjournal.com

Subscription Rates: Subscriptions are not available at this time. To be advised when subscriptions plans are made available, please join our newsletter at www.afabjournal.com

80

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

TABLE OF CONTENTS BRIEF COMMUNICATIONS 82

Evaluation of an Experimental Sodium Chlorate Product, With and Without Nitroethane, on Salmonella in Cull Dairy Cattle N. A. Krueger, T. S. Edrington, R. L. Farrow, R. Hagevoort, R. C. Anderson, G. H. Loneragan, T. R. Callaway, and D. J. Nisbet

88

A Membrane Filtration Method for Determining Minimum Inhibitory Concentrations of Essential Oils S. J. Pendleton, R. Story, C. A. O’Bryan, P. G. Crandall, S. C. Ricke, and L. Goodridge

ARTICLES 94

Influence on Growth Conditions and Sugar Substrate on Sugar Phosphorylation Activity in Acetogenic Bacteria W. Jiang, R.S. Pinder, and J.A. Patterson

103 Effect of Fertilization on Phytase and Acid Phosphatase Activities in Wheat and Barley Cultivated in Bulgaria

V. I. Chalova, I. Manolov, M. Nikolova, and L. Koleva

111 Transfer of Tylosin Resistance Between Enterococcus spp. During Continuous-Flow Culture of Feral or Domestic Porcine Gut Microbes

N. Ramlachan, R.C. Anderson, K. Andrews, R.B. Harvey, and D.J. Nisbet

121 Sugar Recovery from the Pretreatment/Enzymatic Hydrolysis of High and Low Specific Gravity Poplar Clones

A. C. Djioleu, A. Arora, E. M. Martin, J. A. Smith, M. H. Pelkki, and D. J. Carrier

132 Culture dependent molecular analysis of bacterial community of Hazaribagh tannery exposed area in Bangladesh

A. A. Maruf, M. M. Moosa, S. M. M. Rashid, H. Khan, and S. Yeasmin

139 Impact of By-product Feedstuffs on Escherichia coli O157:H7 and Salmonella Typhimurium in Pure and Mixed Ruminal and Fecal Culture in Vitro

T. R. Callaway, S. Block, K. J. Genovese, R. C. Anderson, R. B. Harvey, and D. J. Nisbet

Introduction to Authors 149 Instructions for Authors The publishers do not warrant the accuracy of the articles in this journal, nor any views or opinions by their authors.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

81

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

BRIEF COMMUNICATIONS Evaluation of an Experimental Sodium Chlorate Product, With and Without Nitroethane, on Salmonella in Cull Dairy Cattle † N. A. Krueger1, T. S. Edrington1, R. L. Farrow1, R. Hagevoort2, R. C. Anderson1, G. H. Loneragan3, T. R. Callaway1 and D. J. Nisbet1 1

United States Department of Agriculture, Agriculture Research Service, Southern Plains Agriculture Research Center, Food and Feed Safety Research Unit, 2881 F&B Road, College Station, TX 77845 USA. 2 Agriculture Experiment Station, New Mexico State University, Clovis, NM 88101-9998 USA. 3 Department of Animal and Food Sciences, Texas Tech University, PO Box 42141, Lubbock, Texas 79409-2141 USA.

†

Mention of trade name, proprietary product, or specific equipment does not constitute a guarantee or warrenty by the USDA and does not imply its approval to the exclusion of other products that may be suitable.

ABSTRACT Ruminant animals are natural reservoirs for Salmonella. These bacteria can reduce nitrate to nitrite through the membrane bound enzyme nitrate reductase which also has the ability to reduce chlorate to the cytotoxic end-product chlorite. An experimental product containing sodium chlorate (ECP) has been investigated in recent years as a pre-harvest food safety strategy to reduce Salmonella. The addition of nitroethane has been shown to enhance the effectiveness of ECP. The objective of this research was to determine if feeding ECP, with and without nitroethane, is effective in reducing naturally occurring populations of Salmonella in cull dairy cattle on a commercial dairy prior to slaughter. Twelve cull dairy cows, dosed for two consecutive days with either 140 mg of ECP containing 30% sodium chlorate /kg BW/d or with 70 mg of the ECP plus 160 mg nitroethane /kg BW/d, were sampled 48 h post initial dose at 12 h intervals for Salmonella via fecal samples. Upon completion of the 48 h sampling animals were necropsied and gastro intestinal tissue and luminal content samples taken for bacterial enumeration. The data presented herein support the use of chlorate as a pre-harvest intervention strategy for reducing Salmonella in cull dairy cows prior to entering the food chain can serve as an effective means of reducing these bacteria.

Keywords: Sodium Chlorate product, Salmonella, nitroethane, cull dairy cattle Agric. Food Anal. Bacteriol. 2:82-87, 2012

Introduction According to the Centers for Disease Control and Correspondence:Thomas S. Edrington tom.edrington@ars.usda.gov Tel: +1 979-260-3757 Fax: +1 979-260-9332

82

Prevention, approximately 48 million people get sick each year from foodborne diseases in the United States (CDC 2010). The bovine gastrointestinal tract is a well recognized reservoir for bacterial pathogens like Escherichia coli O157:H7, Salmonella and Campylobacter. In the United States these bacterial

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

pathogens are responsible for more than 3.5 million human infections annually at an estimated annual cost of more than $3.5 billion a year (ERS/USDA, 2009). According to Wells and others (Wells et al., 2001), as many as 66% of the cull dairy cows have detectable amounts of Salmonella shedding, and these cull cows contribute substantially to the beef supply, especially ground beef. Thus, pre-harvest intervention strategies that reduce the shedding of food-borne pathogens in cull dairy cattle are essential to reducing the amount of pathogenic bacteria entering slaughter facilities and contributing to contamination of food products and potentially human infections.

Certain bacteria, such as Salmonella have the ability to reduce nitrate to nitrite through the intracellular enzymes nitrate reductases (NarA and NarZ) (Alaboudi 1982; Moreno-Vivia et al., 1999). It has been suggested that the NarA enzyme, which is expressed under anaerobic conditions, is primary a contributor to the reduction of nitrate to nitrite (Anderson et al., 2006a). However, the NarZ enzyme can account for approximately 10% the nitrate reductase activity (Anderson et al., 2006a). Furthermore, these reductase enzymes have the ability to also reduce chlorate to the cytotoxic end-product chlorite (Stewart 1988, Fox et al., 2005 and Moreno-Vivia et al., 1999). In recent years, chlorate supplementation has been investigated as a pre-harvest food safety strategy to reduce Salmonella and E. coli O157:H7 in vitro and in food producing animals (Anderson et al., 2000). Research also has demonstrated effects against Salmonella in swine and poultry (Anderson et al., 2001; Anderson et al., 2004; Burkey et al., 2004) but to date the effect on Salmonella in cattle has not been evaluated. Research has shown that the addition of short chained nitro compounds like nitroethane can enhance the ability of sodium chlorate to reduce Salmonella as much as ten-fold in vitro and in vivo (Anderson et al., 2006a & 2006b). The objectives of the current research was to determine if feeding an experimental sodium chlorate product, with and without nitroethane, is effective in reducing populations of Salmonella, in cull dairy cattle on a commercial dairy prior to slaughter.

Materials and Methods All cattle were obtained from a conventional commercial dairy in the Southern High Plains of the United States and were cared for according to guidelines pre-approved for by the Southern Plains Agriculture Research Center’s Animal Care and Use Committee (ACUC no. 2010005). Dairy cows that were sent to the hospital pen per the dairy’s standard operating procedures were prescreened for Salmonella. The dairy’s hospital pens are used to house animals that were truly “sick” animals as well as animals that were needing to be separated from the rest of the herd, due to significant loss in milk production, laminitis, mobility issues, etc., which classified them as potential candidates to be culled from the herd per the discretion of the herd manager and standard operating procedures. Cows were restrained in self-locking head stalls and approximately 30 g of fecal material was obtained via rectal palpation. Fecal samples were shipped on ice to the Food and Feed Safety Research Unit in College Station, TX, USA (FFSRU) for culture of Salmonella the following day. Five days post-pre screen sampling, animals confirmed as Salmonella positive were enrolled. Twelve lactating Holstein dairy cows (average BW 545 kg) testing positive for Salmonella were purchased from the dairy and six animals were randomly assigned to each treatment (chlorate or chlorate + nitroethane). All experimental animals remained on the dairy and were housed in a pen separate from the rest of the herd; otherwise all feeding and management schemes were as normal for the dairy. As all experimental animals were housed together in the same pen, cross contamination among animals was a possibility. However, in the production setting, culled animals are exposed to other potential carriers throughout their time up to slaughter. Therefore we felt that co-mingling in a pen would give a more “real-world” test of the experimental treatment.

Salmonella positive animals received either 140 mg of an experimental sodium chlorate product (ECP)/kg BW/d or 70mg ECP plus 160 mg nitroethane/kg BW/d. Based on previous research (Anderson et al., 2006a), a sub optimal dose of ECP with added

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

83

nitroethane enhanced the bactericidal effects of the ECP against Salmonella. The ECP was a proprietary product provided by EKA Chemicals Inc. (Marrietta, GA) and contained 30% sodium chlorate by weight.

Nitroethane was administered in the form of nitroethane salt (Majak et al., 1986). Treatments were administered 4 times at 12 h intervals via stomach tube.

Animals were restrained in headstalls in the A.M. according to the dairy’s standard operation, and for the P.M. dose animals were moved to a chute for proper head restraint. Treatments were mixed with approximately 100 mL of water just prior to dosing to allow for adequate volume and fluidity for passage through the stomach tube. Each treatment was then followed with approximately 100 mL of water, prior to removal of the stomach tube, to remove any treatment that might have adhered to the stomach tube during dosing. Fecal grab samples were collected immediately prior to first dosing and subsequently every 12 h for the next 48 h post initial dosing. Following the last fecal collection animals were euthanized according to the American Veterinary Medical Association

guidelines on euthanasia. Luminal contents and tissues from the rumen, small intestine, cecum, spiral colon and rectum were aseptically collected upon necropsy. All samples were shipped daily on ice to the FFSRU for quantitative and qualitative bacterial culture.

Fecal and luminal contents were processed upon arrival for qualitative and quantitative analysis of Salmonella (Edrington et al., 2009). Serogrouping of Salmonella-positive samples was conducted using slide agglutination with Salmonella antiserum (Becton, Dickinson, Sparks, ND). Sample Salmonella populations were quantified by direct plating of the TSB phosphate ⁄ sample mixture (10 g sample + 90 mL TSB; prior to enrichment) onto XLD agar (Oxoid, LTD, Basingstoke, Hampshire, England) using a commercially available spiral plater (Spiral Biotech Autoplate 4000; Advanced Instruments, Inc., Norwood, MA), with a limit of detection of 1.99X102 CFU/g. Plates were incubated overnight at 37°C. Colonies were counted and concentrations calculated. Morphologically typical (black) colonies were confirmed as Sal-

Table 1. Effect of ECP on Salmonella presence in enriched and direct plated feces over time and tissues at necropsy. A number represents the results of the direct plating (quantitative culture) expressed as cfu (log10/g feces), whereas a positive or negative symbol indicates a negative result from spiral plating and either a positive or negative result following enrichment and culture of the sample (qualitative culture).

Animal ID 10310

11875

11271

4705

4630

5773

pre-screen, d -5

+

+

+

+

4.96

6.20

Time, (h) 0 12 24 36 48

+ + -

+ + +

+ + -

+ + -

+ + +

+ + + + +

+ -

-

-

-

4.88 -

+ + +

Tissue site Cecum Spiral colon Small intestine Rumen Rectum

84

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

monella as described above and counted.

Results and Discussion The scope of this experiment was to evaluate the effects of ECP with and without nitroethane on fecal shedding of Salmonella in cull dairy cows. The experiment was performed on the farm to ensure that daily farm practices and feeding regimes were employed in an effort to accurately simulate onfarm application of the ECP and ECP + nitroethane products. Two animals in the ECP treatment group were shedding Salmonella at high concentrations at the time of pre-screening (Table 1). Figure 1 demonstrates the ability of ECP to effectively reduce (5 log10 cfu/g feces) Salmonella fecal shedding concentration in animals colonized with high concentrations of Salmonella. The remaining animals were positive for Salmonella following enrichment at pre-screening (Tables 1 and 2). Forty-eight hours post initial treatment with ECP all animals were negative for Salmonella via spiral plating and only 50% of the animals had any detectable amount of Salmonella from enriched samples (Table 1). The ECP + nitroethane treatment resulted in all animals testing negative for Salmonella via spiral plating and only 33% of the animals had any detectable amount of Salmonella

from enriched samples (Table 2). Luminal contents yielded no detectable Salmonella via direct plating for all animals regardless of treatment except animal 4630, which had 4.88 log10 CFU’s present in the small intestine. All other sites for this animal were negative via spiral plating. One colony from each positive sample was serogrouped, of which 32, 25, 18, 17, 5, and 3 % were K, E1, C1, poly A-I, C2, and I respectively.

We recognize that there are potential criticisms associated with the current research. The lack of control animals in this study can beg the question as to whether there was an effect due to the ECP or a natural response in cattle that have been shedding for several days. As with any experimental research product, federal approval must be obtained before animals can enter the food chain or rendering process, and since ECP is still awaiting federal approval all animals were required to be purchased from the dairy. Upon termination of the study, animals were composted on the dairy to prevent entrance to the food or rendering chain. Additionally, due to the associated cost and welfare issues we did not utilize control animals. The authors recognize this is a weakness of the study but did not have funding required to euthanize six perfectly healthy animals that could otherwise be sold by the dairy. By selecting animals that were persistently and consistently shedding Salmonella for five days prior to initial dosing with the

Figure 1. Effect of ECP supplementation on Salmonella concentrations in feces over time through direct plating.

6

Log

10

CFU g-1

5 4 3

Cow 4630 Cow 5773

2 1 0 0

12

24

36

48

Time, h

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

85

Table 2. Effect of ECP with added nitroethane on Salmonella presence in feces over time and for luminal tissues at necropsy following enrichment and culture (qualitative culture).

16487 +

86 +

7986 +

+ + -

+ -

+ + +

Cecum Spiral colon Small intestine Rumen

+

-

Rectum

+

-

pre-screen, d -5 Time, (h) 0 12 24 36 48

Animal ID 4907 +

6415 +

5538 +

+ + -

+ + -

+ + +

+ -

+

+

+

+

+

-

-

Tissue site

experimental treatments, there was a high likelihood that the response seen once experimental treatments were imposed would be due to the effects of the experimental treatments. Granted, in hindsight it would have been beneficial to have control animals that provided fecal samples even if they were not necropsied. However, extensive research by the authors has repeatedly demonstrated the sporadic nature of fecal shedding of Salmonella in dairy cattle.

Therefore we felt that luminal populations throughout the digestive tract would be a better indication of the actual “Salmonella status” of the animal and be a better determinant of the effectiveness of the treatments examined in this research. While we recognize that further experimentation is needed, the data presented herein while not conclusive does support the idea of using chlorate as a pre-harvest intervention in cull dairy cattle.

of the cultured Salmonella, it did appear to reduce populations in the high shedders to levels that are effectively controlled by modern processing intervention strategies. It is unknown why the nitroethane did not enhance the bactericidal effect of chlorate in this research as has been observed previously.

Further investigation is needed and research should examine the effectiveness of on-farm ECP administration by following cull animals through the harvest process.

Acknowledgements This project was funded in part, by beef and veal producers and importers through their $1-per-head checkoff and was produced for the Cattlemen’s Beef Board and state beef councils by the National Cattlemen’s Beef Association.

CONCLUSIONs References Administration of ECP on farm immediately following the decision to cull and prior to shipping should allow adequate time for the chlorate to exert its lethal effect on Salmonella prior to the animal entering the abattoir. While the ECP did not kill 100% 86

Alaboudi, A. R. 1982. Microbiological studies of nitrate and nitrite reduction in the ovine rumen.

Ph.D. dissertation. University of Saskatchewan, SK, Canada.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Anderson, R. C., S. A. Buckley, L. F. Kubena, L. H. Stanker, R. B. Harvey, and D. J. Nisbet. 2000. Bactericidal effect of sodium chlorate on Escherichia coli O157:H7 and Salmonella typhimurium DT104 in rumen contents in vitro. J. Food Prot. 63:1038-1042.

Anderson, R. C., S. A. Buckley, T. R. Callaway, K. J. Genovese, L. F. Kubena, R. B. Harvey, and D. J. Nisbet. 2001. Effect of sodium chlorate on Salmonella Typhimurium concentrations in the weaned pig gut. J. Food Prot. 64:255-258.

Anderson, R. C., M. E. Hume, K. J. Genovese, T. R. Callaway, Y. S. Jung, T. S. Edrington, T. L. Poole, R. B. Harvey, K. M. Bishoff, and D. J. Nisbet. 2004. Effect of drinking-water administration of experimental chlorate ion preparations on Salmonella enterica serovar Typhimurium colonization in weaned and finished pigs. Vet. Res. Comm. 28:179-189.

Anderson, R. C., Y. S. Jung, K. J. Genovese, J. L. McReynolds, T. R. Callaway, T. S. Edrington, R. B. Harvey, and D. J. Nisbet. 2006a. Low level nitrate or nitroethane preconditioning enhances the bactericidal effect of suboptimal experimental chlorate treatment against Escherichia coli and Salmonella Typhimurium but not Campylobacter in swine. Foodborne Path. Dis. 3:461-465.

Anderson, R. C., Y. S. Jung, C. E. Oliver, S. M. Horrocks, K. J. Genovese, R. B. Harvey, T. R. Callaway, T. S. Edrington, and D. J. Nisbet. 2006b. Effects of nitrate or nitro supplementation on Salmonella enteric serovar Typhimurium and Escherichia coli in swine feces. J. Food Prot. 70:308-315.

Burkey, T. E., S. S. Dritz, J. C. Nietfeld, B. J. Johnson, J. E. Minton. 2004. Effect of dietary mannanoligosaccharide and sodium chlorate on the growth performance, acute-phase response, and bacterial shedding of weaned pigs challenged with Salmonella enterica serotype Typhimurium. J. Anim. Sci. 82:397-404.

Center for Disease Control and Prevention. 2010.

CDC Reports 1 in 6 Get Sick from Foodborne Illnesses Each Year. http://cdc.gov/media/pressrel/2010/r101215.html, accessed October 4, 2011.

Edrington, T. S., B. H. Carter, T. H. Friend, G. R. Hagevoort, T. L. Poole, T. R. Callaway, R. C. Anderson, D. J. Nisbet. 2009. Influence of sprinklers, used to

alleviate heat stress, on faecal shedding of E. coli O157:H7 and Salmonella and antimicrobial susceptibility of Salmonella and Enterococcus in lactating dairy cattle. Lett Appl Microbiol. 48:738–743.

ERS/USDA data foodborne illness cost calculator.

Available at: http://www.ers.usda.gov/data/foodborneillness. Accessed 23 June 2009.

Fox, J. T., R. C. Anderson, G. E. Carstens, R. K. Miller, Y. S. Jung, J. L. McReynolds, T. R. Callaway, T. S. Edrington, and D. J. Nisbet. 2005. Effect of nitrate adaption on the bactericidal activity of an experimental chlorate product against Escherichia coli in cattle. Int. J. Appl. Res.Vet. Med. 3:76-80.

Majak, W., K.-J. Cheng, J. W. Hall. 1986. Enhanced degradation of 3-nitropropanol by ruminal microorganisms. J. Anim. Sci. 62:1072-1080.

Moreno-Vivia´n C., P. Cabello, M. Martı´nez-Luque, R. Blasco, F. Castillo. 1999. Prokaryoticnitrate reduction: molecular properties and functional distinction among bacterial nitrate reductases. J. Bacteriol. 181:6573–84.

Stewart, V. 1988. Nitrate respiration in relation to facultative metabolism in enterobacteria. Microbiol.

Rev. 52:190-232.

Wells, S. J., P. J. Fedorka-Cray, D. A. Dargatz, K. Ferris, A. Green. 2001. Fecal shedding of Salmonella spp. by dairy cows on farm and cull cow markets. J. Food. Prot. 64:3-11.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

87

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

BRIEF COMMUNICATION A Membrane Filtration Method for Determining Minimum Inhibitory Concentrations of Essential Oils S. J. Pendleton1,3, R. Story1, C. A. O’Bryan1, P. G. Crandall1, S. C. Ricke1, L. Goodridge2 Center for Food Safety-IFSE and Food Science Department, 2650 Young Ave., University of Arkansas, Fayetteville, AR 72704 2 Department of Animal Sciences, Colorado State University, Fort Collins, CO 80523-1171 3 Current address: Food Science and Technology, University of Tennessee, Knoxville, Tennessee 37996 1

ABSTRACT Minimum inhibitory concentrations (MICs) of essential oils are commonly determined via broth dilution method. These methods very rarely include a neutralization step, due to the complex nature of essential oils and thus difficulties in finding an adequate neutralizer, which leads to the potential for continued action of the oil on the bacteria during growth analysis. This study was devised to evaluate filtration as a means to remove an essential oil, cold pressed terpeneless Valencia orange oil, from several species of bacteria, and thus prevent further antibacterial action by the oil. A ninety-six well microtiter plate method was used, followed by transfer of well contents to a ninety-six well filter plate. The contents of the filter plate were washed twice to separate the oil from the bacteria. The bacteria were resuspended in a medium containing a growth indicator and transferred to a sterile 96 well microtiter plate to determine MICs. Escherichia coli O157:H7 was inhibited at a concentration of 0.5±0.0%, Listeria monocytogenes at 0.5±0.0%, Staphylococcus aureus at 0.31±0.13%, Salmonella Typhimurium at 0.31±0.13%, Shigella sonnei at 0.75±0.29%, Yersinia enterocolitica at 0.31±0.13%, Enterococcus faecalis at 0.63±0.25%, Bacillus cereus at 0.44±0.13%, and Pseudomonas aeruginosa exhibited complete resistance to the oil.

Keywords: Escherichia coli, Salmonella, Shigella, Yersinia, Enterococcus, Bacillus, Pseudomonas, minimal inhibitory concentration, essential oil, membrane filtration Agric. Food Anal. Bacteriol. 2:88-93, 2012

Introduction The main methods for determining minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) of essential oils and Correspondence: P. G. Crandall, crandal@uark.edu Tel: +1-479-575-7686

88

essential oil components are broth dilution, agar diffusion, and disc diffusion (Fernandez-Lopez et al., 2005; Friedly et al., 2009; Kim et al., 1995a,b; Kubo et al., 2004; Nannapaneni et al., 2008; Tassou et al., 2000). These methods for determining MICs or MBCs do not commonly employ a neutralization step.

However, if no neutralization step is used when conducting antimicrobial studies on surfaces or in food

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

matrices, the compounds being tested are still acting on the bacteria when initial dilutions are made. In order to determine the real effect of an antimicrobial on a bacterium, neutralizers are frequently used to inactivate the antimicrobial compound (Atwal et al., 2010; Dey and Engley, 1983; Meers and Churcher, 1974). Essential oils are complex mixtures of different compounds (Burt et al., 2005; Kubo et al., 2004; O’Bryan et al., 2008), and currently used neutralizing broths may not be suitable for use with these essential oils.

Meers and Churcher (1974) and Prince et al. (1975), investigated the use of membrane filters to remove antimicrobial compounds. Meers and Churcher (1974) used a membrane to filter volumes of treated cells in order to separate out the cells from antimicrobial drug treatments. The filters were washed, then placed on agar, and incubated for 24 hours. Plates were then counted to determine viable cells. Prince et al. (1975) used a different approach. Cells were first placed on the membrane and then exposed to a disinfectant treatment for two and half or eight minutes. The disinfectant was then filtered away and the membrane was washed. The membrane was then transferred to agar and incubated for 24 to 48 hours, after which counts were made to determine antibacterial activity. Both techniques found that the antimicrobial compounds were able to be effectively removed from the cells via membrane filtration.

Membrane filtration offers the ability to remove antibacterial compounds without the need for neutralizers, especially when an adequate neutralizer is not available (1). This aspect of membrane filtration indicates its promise for the use of studying essential oil antimicrobial activity. Therefore, the aim of this study was to evaluate the efficacy of membrane filtration in the determination of minimum inhibitory concentrations for cold pressed terpeneless Valencia orange oil against several species of bacteria.

Materials and Methods Essential oil

Commercially available cold pressed terpeneless Valencia orange oil was obtained from Firmenich (Lakeland, FL). Composition of this oil can be found in Nannapaneni et al. (2009). The initial oil suspension was made by adding 0.2 mL of cold pressed terpeneless Valencia orange oil to 10 ml of tryptic soy broth with 0.5% yeast extract (TSBYE) and 50 µL of Tween 20 (Griffin et al., 2000; Kim et al., 1995a,b; Lin et al., 2010) in a 10 ml centrifuge tube, giving 2% oil and 0.5% (v/v) Tween 20 concentration.

Bacterial strains and growth Nine bacterial strains from the culture collection of the University of Arkansas Center for Food Safety were used for this study: Escherichia coli O157:H7 (ATCC 43888), Listeria monocytogenes (USFDA), Staphylococcus aureus (ATCC 25923), Salmonella Typhimurium (ATCC 14028), Shigella sonnei (ATCC 25931), Yersinia enterocolitica (ATCC 23715), Enterococcus faecalis (ATCC 29212), Bacillus cereus (ATCC 11778), and Pseudomonas aeruginosa (ATCC 27853).

Cultures were grown in 10 mL of TSBYE in a 15 ml centrifuge tube and incubated (GCA/Precision Scientific, model 6M) at 37°C without shaking for 24 hours.

The cultures were then centrifuged (Damon,IEC Division, Needham, MA) at Relative Centrifugal Force (RCF) = 4700 to 8500 x g for 10 min. The supernatant was poured off and the pellet was resuspended in 10 ml of 20 mM PBS. A second wash was performed and the final pellet was resuspended in TSBYE + 0.5% Tween 20 and diluted to give resulting bacterial concentrations of approximately 106 CFU/mL.

Minimal inhibitory concentration Two hundred µL of the oil suspension was added into the first wells (column 1) of a sterile, 96 well tissue culture plate. In the following wells (columns 2 through 6) 100 µL of TSBYE and 0.5% Tween 20 was added to each well. With a multichannel pipette, 100 µL of oil in the first wells was transferred into the second wells for a 1:2 dilution and followed by additional 1:2 dilutions. The final oil concentrations were 1%, 0.5, 0.25, 0.13, 0.063, and 0.03 (v/v). For nega-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

89

tive controls, 100 µL of TSBYE and 0.5% Tween 20 was added to row G, to bring final volumes up to 200 µL. In triplicate, 100 µL of each 106 culture was added to the various concentrations of oil (Figure 1.). An adhesive plate film (PlateMax: Axyseal Sealing Film, pre-sterilized cat# PCR-SP) was placed over the wells, and pressed down by hand. The plate was incubated (New Brunswick Scientific, model # G-25) for 24 hrs at 37°C with shaking at 200 rpm.

tetrazolium chloride (TTC) were added to each well of the filter plate. With a multichannel pipette, the contents of each well were gently mixed and transferred to a matching sterile 96 well plate. The plate was statically incubated at 37°C for 48 hrs. The wells were then visually checked for growth via development of red pigment. Wells with the lowest oil concentration having no red pigment were considered the MIC. The experiment was repeated four times.

Filtration method Results and Discussion After incubation, 25 µL from each well was transferred into a matching sterile, 96 well filter plate (0.2 um PVDF membrane, Corning, prod.# 3504). To each well in the filter plate, 100 µL of TSBYE + 0.5% Tween 20 was added. A sterile 96 well plate lid was placed on the filter plate. The filter plate was then placed on the collection plate (Corning, 0.5 ml, prod. #3956) and centrifuged (Beckman TJ-6 centrifuge) at RCF = 739 x g for 10 min. After centrifugation, 100 µL of TSBYE + 0.5% Tween 20 was added to each well of the filter plate and then centrifuged again.

After centrifugation, 200 µL of TSBYE + 1% triphenyl

The results of the minimum inhibitory concentration determinations can be found in Table 1. Cold pressed terpeneless Valencia orange oil exacted MICs of 0.5%, 0.5%, 0.31%, and 0.31% against E. coli O157:H7, L. monocytogenes, S. aureus, and S.Typhimurium, respectively. MICs of 0.75%, 0.31%, 0.63%, and 0.44% were exacted against S. sonnei, Y. enterocolitica, E. faecalis, and B. cereus, respectively. P. aeruginosa exhibited complete resistance to the highest concentration of the oil.

Prior studies have evaluated the effects of cold

Figure 1. 96-well microtiter plate design for MICs with cold pressed terpeneless Valencia orange oil concentrations in percentages.

90

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Table 1. Minimum inhibitory concentrations of cold pressed Valencia orange oil for 9 bacterial strains at 37°C. Bacterial Strain

MIC (%)

E. coli O157:H7

0.5

L. monocytogenes

0.5

S. aureus

0.31

S. Typhimurium

0.31

S. sonnei

0.75

Y. enterocolitica

0.31

E. faecalis

0.63

B. cereus

0.44

P. aeruginosa

>10

pressed terpeneless Valencia orange oil against different bacteria using non-membrane filtration techniques (Friedly et al., 2009; Nannapeneni et al., 2008; O’Bryan et al., 2008). Friedly et al. (2009) examined the effect of the essential oil on strains of L. monocytogenes and Listeria innocua. It was determined that the oil exhibited a MIC of 0.55% against both L. monocytogenes and L. innocua after 18 hours of incubation at 37°C. This result is very similar to the result found in the current study, indicating that the antibacterial inhibition of L. monocytogenes by the oil does not continue after 18 hours of incubation at 37°C. O’Bryan et al. (2008) determined the antibacterial effect of the oil against strains of Salmonella, including a strain of S. Typhimurium (Copenhagen).

Cold pressed terpeneless Valencia orange oil exhibited little effect on the strain of S. Typhimurium tested. The zone of inhibition determined by disc diffusion was only 7.3±1.2 mm, which included the 6 mm paper disc. The results of the current study do not agree with this lack of antibacterial activity against S. Typhimurium. This could possibly be due to differences between strains of Typhimurium, although further research is needed to confirm this hypothesis. Nannapaneni et al. (2008) examined the

ability of cold pressed terpeneless Valencia orange oil to inhibit the growth of E. coli O157:H7 strains.

The oil, tested by disc diffusion, produced a zone of inhibition against E. coli O157:H7 (ATCC 43888) of 11.5±0.7 mm. It is not stated in the study if the inhibition zone includes the paper disc, but even if it does, the oil exhibited a much higher inhibition of E. coli O157:H7 (ATCC 43888) than S. Typhimurium (Copenhagen). This result is contradicted by the current study, in which both E. coli O157:H7 (ATCC 43888) and S. Typhimurium were found to be inhibited at the same concentration. The contrast in results could be due to the difference in methods used to determine antibacterial susceptibility, as well as a difference in strains of S. Typhimurium. The current study used a micro-broth dilution method, while the other studies used disc diffusion methods. The activity of cold pressed terpeneless Valencia orange oil possibly could be increased in a broth medium, although further study is needed to elicit an answer.

The responses of the other bacteria to cold pressed terpeneless Valencia orange oil have not been previously determined. Therefore, it is not possible to compare the results of this study to others. It can be said that the current method was able to elicit

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

91

MICs for all other bacteria tested, except P. aeruginosa. The inability to determine an MIC for P. aeruginosa is most likely due to its inherent resistance to essential oil components (Cox and Markham, 2007).

Cox and Markham (2007), found that P. aeruginosa NCTC 9027 and 6749 were tolerant of 6 of 8 essential oil components. Only cinnamaldehyde and carvacrol showed any inhibition of the bacteria. It was determined that these bacteria contained an active efflux mechanism, which allows them to resist the antibacterial effects of many essential oil components.

CONCLUSIONs The current method tested was able to produce reliable MICs, but was unable to indicate the need for membrane filtration in the MIC determinations of essential oils. The MICs determined in this study were either similar to those found by traditional methods, or lower than those found by traditional methods. These results are contrary to that of the original hypothesis: MICs should be lower in traditional methods due to residual inhibition by essential oils. Replication of these results, as well as side by side comparison of methods is needed to confirm this conclusion.

References Atwal, R., S. John, and S. Turcios. 2010. In vitro antimicrobial activity assessment of Zymox® topical cream against methicillin resistant Staphylococcus aureus (MRSA). Int. J. Appl. Res. Vet. Med. 8: 51-52.

Bergan, T., and A. Lystad. 1972. Evaluation of disinfectant inactivators. Acta Path. Microbiol. Scand.

Sect. B 80:507-510.

Burt, S.A., R. Vlielander, H. P. Haagsman, and E.J.A. Veldhuizen. 2005. Increase in activity of essential oil components carvacrol and thymol against Escherichia coli O157:H7 by addition of food stabilizers. J. Food Prot. 68:919-926.

Cox, S.D., and J.L. Markham. 2007. Susceptibility and intrinsic tolerance of Pseudomonas aeruginosa to 92

selected plant volatile compounds. J. Appl. Microbiol. 103:930-936.

Dey, B.P., and F.B. Engley. 1983. Methodology for recovery of chemically treated Staphylococcus aureus with neutralizing medium. Appl. Environ. Microbiol. 45: 1533-1537.

Fernandez-Lopez, J., N. Zhi, L. Aleson-Carbonell, J.A. Perez-Alvarez, and V. Kuri. 2005. Antioxidant and antibacterial activities of natural extracts: application in beef meatballs. Meat Sci. 69:371-380.

Friedly, E.C., P.G. Crandall, S.C. Ricke, M. Roman, C.A. O’Bryan, and V.I. Chalova. 2009. In vitro antilisterial effects of citrus oil fractions in combination with organic acids. J. Food Sci. 74:M67-72.

Griffin, S. G., J. L. Markham, and D. N. Leach. 2010.

An agar dilution method for the determination of the minimum inhibitory concentration of essential oils. J. Essential Oil Res. 12: 249-255.

Kim, J. M., M. R. Marshall, J. A. Cornell, J. F. Preston, and C. I. Wei. 1995a. Antibacterial activity of carvacrol, citral, and geraniol against Salmonella typhimurium in culture medium and on fish cubes.

J. Food Sci. 60: 1364-1368, 1374.

Kim, J., M.R. Marshall, and C. Wei. 1995b. Antibacterial activity of some essential oil components against five foodborne pathogens. J. Agric. Food Chem. 43:2839-2845.

Kubo, I., K.I. Fujita, A. Kubo, K.I. Nihel, and T. Ogura.

2004. Antibacterial activity of coriander volatile compounds against Salmonella choleraesuis. J. Agric. Food Chem. 52:3329-3332.

Lin, C. M., S. R. Sheu, S. C., and Y. H. Tsai. 2010. Determination of bactericidal efficacy of essential oil extracted from orange peel on the food contact surfaces. Food Control. 21: 1710-1715.

Meers, P. D., and G.M. Churcher. 1974. Membrane filtration in the study of antimicrobial drugs. J. Clin.

Path. 27: 288-291.

Nannapaneni, R., A. Muthaiyan, P.G. Crandall, M.G. Johnson, C.A. O’Bryan, V.I. Chalova, T.R. Callaway, J.A. Carroll, J.D. Arthington, D.J. Nisbet, and S.C. Ricke. 2008. Antimicrobial activity of commercial citrus-based natural extracts against Escherichia coli O157:H7 isolates and mutant strains.

Foodborne Path. Dis. 5:695-699.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Nannapaneni, R., V. I. Chalova, P. G. Crandall, S. C. Ricke, M. G. Johnson, and C. A. O’Bryan. 2009.

Campylobacter and Arcobacter species sensitivity to commercial orange oil fractions. Int. J. Food Microbiol. 129: 43-49.

O’Bryan, C.A., P.G. Crandall, V.I. Chalova, and S.C. Ricke. 2008. Orange essential oils antimicrobial activities against Salmonella spp. J. Food Sci. 73:M264-267.

Prince, J., C.E.A. Deverill, and G.A.J. Ayliffe. 1975. A membrane filter method for testing disinfectants.

J. Clin. Path. 28:71-76.

Tassou, C., K. Koutsoumanis, and G.J.E. Nychas.

2000. Inhibition of Salmonella enteritidis and Staphylococcus aureus in nutrient broth by mint essential oil. Food Res. Int. 33:273-280.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

93

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Influence on Growth Conditions and Sugar Substrate on Sugar Phosphorylation Activity in Acetogenic Bacteria W. Jiang1, 2, R.S. Pinder2 ,3, and J.A. Patterson2* Current address: Laboratory of Synthetic Biology, Institute of Plant Physiology and Ecology Shanghai Institutes for Biological Sciences Chinese Academy of Sciences 2 Department of Animal Sciences, Purdue University. West Lafayette, IN 47907 3 Current address: 7855 South 600 East, Brownsburg, IN 46112

1

ABSTRACT Four acetogenic bacteria isolates (designated as A2, A4, A10 and H3HH) were tested for phosphoenolpyruvate (PEP) and ATP-dependent phosphorylation of glucose and 2-deoxy-glucose. Although all organisms had detectable phosphorylation activity, substantial variation existed in the rates of both PEP- and ATP-dependent phosphorylation. Isolate A10 had the highest rate of PEP- dependent phosphorylation (net rate of 11.62 nM per mg protein per min). Isolate A10 as well as isolates A2 and H3HH most likely have a glucose phosphotransferase system (PTS). In contrast, isolate A4 had PEP-dependent glucose phosphorylation rates very similar to control rates, suggesting the lack of PTS activity. These results were confirmed by PEP dependent 2-deoxyglucose phosphorylation data. The rates of ATP-dependent glucose phosphorylation were higher than PEP-dependent glucose dependent in all organisms surveyed. However, substantial variation existed for ATP-dependent glucose phosphorylation rates. The glucose PTS of isolates A10 and H3HH were induced by the presence of extracellular glucose. Moreover, the specific activity of the glucose PTS of both isolates increased as cultures progressed from the early log to late log phase of growth. ATP- and PEP-dependent maltose and sucrose phosphorylation was detected in isolates A10 and H3HH. Although activity was detected in both isolates (A10 and H3HH), the rate of activity varied considerably, depending on the sugar and organism tested.

Keywords: Acetogenic bacteria, phosphoenolpyruvate (PEP), ATP-dependent phosphorylation, glucose, 2-deoxy-glucose, rumen, acetate Agric. Food Anal. Bacteriol. 2:94-102, 2012

Introduction The key to survival in a particular ecosystem (such as the rumen) is the ability to adapt to changes of the Correspondence: John Patterson jpatters@purdue.edu Tel: +1 -765-494-4826 Fax: +1-765-494-9347

94

ecosystem. Uptake of nutrients is a determinant of the success of bacteria in the natural environments (Matin and Veldkamp, 1978). Therefore, the ability of an organism to adapt its sugar transport systems to the prevailing conditions of its environment is essential for its survival. The second objective was to determine the effects of growth conditions (i.e en-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

ergy source, stage of growth and presence of other sugars) on the phosphorylating activity of acetogenic bacteria. These PTS are capable of translocating glucose, maltose and sucrose and are induced by the presence of carbohydrates.

Because of the uniqueness and potential for utilization of the Wood pathway (Ragsdale, 1991), much of the attention focused on acetogens has concentrated on characteristics of this pathway. Consequently, relatively little information is known about other metabolic systems in these organisms. Although acetogenic organisms are capable of utilizing sugars, the mechanisms responsible for uptake and utilization of these compounds remain largely unknown. Another motive for examining the sugar transport system of acetogenic bacteria was to explore the possibility that H2 utilization could be

Acetogen medium (20 mL) was dispensed into 120 ml volume serum tubes and sealed with butyl rubber stoppers. All of the gases used in the study were passed through a copper furnace to remove residual oxygen and unless mentioned otherwise consisted of 100% CO2.

Cells in 20 mL of acetogen medium were harvested by centrifugation (10,000 x g, 10 min, 4°C) washed twice with NAKP buffer (50 mM sodium phosphate, 50 mM potassium phosphate, 5 mM MgCl2, and 1 mM dithiotreitol; pH 7.2), suspended in a tolueneethanol mixture (1:9) followed by vortexing for 1 min and kept on ice before being used as described by Martin and Russell (1986).

regulated by the presence of sugars through the activities of a PTS. Because bacterial PTS are known to affect the metabolic activity of other energy systems in bacterial cells, in part through the action of cAMP and its receptor protein (CPR) on gene transcription (Saier, 1991), our hypothesis was that some acetogens do utilize the PTS system. Therefore, the first objective for the research reported herein was to determine the presence of PTS activity in acetogenic ruminal isolates.

Cell samples were treated with 0.2 N NaOH (100°C, 15 min) prior to protein determination and protein concentration was estimated with a Bio-Rad protein assay (Richmond, CA) with bovine serum albumin used as the protein standard. For the rate of sugar phosphorylation measurement in toluene-treated acetogenic cells the reaction mixture (1 mL) contained NAKP buffer supplemented with 10 mM PEP or 10 mM ATP and 0.1 mL of toluene-treated cells as described by Martin and Russell (1986) as modified by Jiang et al. (2012). The reaction for phosphorylation was begun by the addition of the respective (1mM) sugar containing either 0.2 µCi of D-[U-14C]-glucose, 2-deoxy-D-[U-14C]-glucose, [U-14C]-maltose or [U-14C]sucrose. ATP, PEP, [14C]-labeled and unlabeled glucose, 2-deoxyglucose, maltose, and sucrose as well as dithiohthreitol and BaBr2 were purchased commercially (Sigma Chemical Co., St Louis, MO). After incubation (39° C for 30 minutes) BaBr2 (10 mL of 30 mM in 90% ethanol) was combined with the reaction mixture followed by further incubation (20 minutes on ice). Precipitated phosphorylation products from the reaction mixture were retrieved with a 0.45 µm pore membrane filter (Millipore Corp., Bedford, Mass), rinsed with 80% ethanol, air dried and counted in a 1600-R liquid scintillation counter. Finally, influences of unlabeled glucose, maltose, or sucrose on PEP- or ATP-dependent phosphorylation influences

Materials and Methods Organisms, growth conditions and cell treatment Several ruminal acetogenic bacteria were isolated from dairy cattle and were characterized (Boccazzi and Patterson, 2011; Pinder and Patterson, 2011).

Acetogenic medium (Boccazzi and Patterson, 2011) was supplemented with sugars (glucose, maltose or sucrose) as indicated in the results and discussion section. Stock solutions of sugars were prepared separately as anaerobic solutions (5% w/v), autoclaved separately and aseptically added to the acetogen medium once both the sugar solution and acetogen medium had reached room temperature.

Phosphorylation assays

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

95

Table 1. Specific activities of glucose and 2-deoxyglucose phosphorylation with PEP or ATP as phosphoryl donors in acetogenic bacteria1

acetogens

none

Glucose PEP

A2 A4

1.38±0.10 1.05±0.18

2.18±0.08 1.20±0.13

20.45±0.99 3.27±0.11

ND2 ND

ND ND

ND ND

A10 H3HH

0.29±0.02 1.39±0.09

11.62±0.06 7.07±0.19

14.01±0.52 9.99±0.43

0.31±0.03 1.25±0.05

11.14±0.32 4.25±0.36

0.35±0.01 1.40±0.03

ATP

none

2-deoxyglucose PEP ATP

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. Values are mean ± standard deviation (n=3).

2 ND=not determined.

1

were determined by adding each respective sugar (10 mM) the reaction mixtures. Sugar phosphorylation by endogenous sources of PEP and ATP was assessed in control assays without exogenous PEP or ATP. All experiments were conducted is triplicates and estimates of variation are presented as standard deviations.

Results and Discussion PEP- and ATP-dependent glucose phosphorylation ATP conservation is critical to anaerobic bacteria because they lack of a complete TCA cycle severely curtails the yield of ATP from glycolysis (Thauer et al., 1977). PEP-dependent glucose phosphorylation was detected in all four acetogenic bacteria tested (Table 1). Among the organisms tested, isolate A10 had the highest rate of PEP-dependent glucose phosphorylation (net rate of 11.33 nM of glucose phosphorylated per min) While isolate A4 had the lowest net rate of PEP-dependent glucose phosphorylation (0.15 nM of glucose phosphorylated per mg of cell protein per min). These phosphorylation rates are comparable to those of other ruminal bacteria (e.g Prevotella ruminicola, Selenomonas ruminantium, and Streptococcus bovis) surveyed by Martin and 96

Russell (1986, 1987). The rates of PEP-dependent glucose phosphorylation determined with cells of isolate A4 were so low that this organism most likely does not possess a glucose PTS. In all the organisms tested, the rate of ATP-dependant phosphorylation was greater than that of PEP-dependent phosphorylation. This pattern is consistent to that observed in nonacetogenic bacteria as well as acetogens (Jiang et al., 2012; Martin and Russell, 1986; Moore and Martin, 1991). Nevertheless, as observed with PEPdependent phosphorylation, isolate A4 did not possess relevant glucose transport systems dependent on either PEP or ATP. Neither A2 or A4 grows vigorously using glucose as the growth substrate, which reinforces our conclusions.

The rates of 2-deoxyglucose phosphorylation were slightly lower than those of glucose phosphorylation in all the acetogenic organisms tested (Table 1). In contrast, isolate A10 had a rate of PEP-dependent 2-deoxyglucose phosphorylation approximately 20 fold greater than control, strongly suggesting the presence of a PTS in this organism. The other organism tested (isolate H3HH) had PEP-dependent 2-deoxyglucose phosphorylation rates that were between 10 and 20 times greater than ATP-dependent 2-deoxyglucose phosphorylation, suggesting that these two organisms most likely contain a PTS as well.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Table 2. Effect of growth substrate on the specific activity PEP- and ATP- dependent phosphorylation of glucose and 2-deoxyglucose by isolates H3HH and A101 Glucose

2-deoxyglucose

none

PEP

ATP

none

PEP

ATP

glucose

1.39±0.09

7.07±0.19

9.99±0.43

1.25±0.05

4.25±0.36

1.4±0.03

H2/CO2

0.48±0.05

0.83±0.16

9.20±0.26

0.25±0.02

0.42±0.07

0.42±0.1

glucose

0.29±0.02

11.62±0.06 14.01±0.52

0.31±0.03

11.14±0.32 0.35±0.01

H2/CO2

0.96±0.08

3.57±0.13

0.56±0.1

2.86±0.02

H3HH

A10 13.05±0.23

0.71±0.06

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.

1

Values are mean ± standard deviation (n=3).

Effect of growth on glucose phosphorylating activity of acetogenic cells The specific activity of the glucose PTS in isolates H3HH and A10 was not constant. Cells of isolate H3HH and A10 grown on glucose had 9- and 4- fold greater activity, respectively, then cells grown solely on H2 + CO2 (Table 2). Conversely, the rate of ATP dependant phosphorylation was unchaged regardless of whether the cells of either isolate A10 or H3HH were grown on glucose or H2 + CO2. These results suggest that ATP dependent glucose phosphorylation activity is constitutive while PEP-dependent glucose phosphorylation is induced by the presence of carbohydrates in cultures of acetogenic organisms.

Regulation of PTS activity by the presence of extracellular carbohydrates is a well-documented phenomenon (Saier, 1985). For example, Rephaeli and Saier (1980) reported induction of several proteins of the PTS (i.e. enzyme I, HPr, and the glucose specific enzyme II) in response to the presence of extracellular carbohydrates. Similar to glucose phosphorylation, the PEP-dependent 2-deoxy-glucose phosphorylation activity was induced in cells (of either isolate A10 or H3HH) growing on glucose.

The specific activity of the PTS in cells grown solely on glucose was not constant (Table 3). The specific activity of the PTS increased as the cultures of both

isolate A10 and H3HH progressed from early log to late log growth phase. However, once the cultures entered the stationary phase, glucose phosphorylation rates declined precipitously to levels lower than those observed in cultures in early log growth phase.

A similar pattern was observed for ATP-dependent phosphorylation. Feedback inhibition of the transport systems by intracellular glucose-6-phosphate is a plausible explanation for these events because inhibition of several enzyme II’s (the carbohydrate-specific permeases of the PTS) by glucose-6-phosphate has been reported previously (Postma and Lengeler, 1985). During the early to mid log growth phase the intracellular concentration of glucose-6-phosphate would be relatively high because extracellular glucose was in excess of the needs of the cells. However, once the glucose supply was exhausted, the amount of glucose entering the cells would decrease, causing the cells to enter the late log phase and begin to slow down the growth rate. Additionally the intracellular concentrations of glucose-6-phosphate would decrease as well.

Effect of carbohydrate growth substrate on rates of glucose, maltose, and sucrose phosphorylation Isolates H3HH and A10 are capable of grow-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

97

Table 3. Effect of growth stage on the specific activity of PEP- and ATP-dependent phosphorylation of glucose by isolates H3HH and A101 Growth period

OD

none

PEP

ATP

Early log

0.5

0.73±.151

1.42±0.08

6.98±0.13

Mid log

1

0.56±0.06

3.30±0.05

9.91±0.5

Late log

1.5

1.09±0.16

10.33±0.74

20.32±0.55

Stationary

2.5

0.79±0.09

1.71±0.17

4.58±0.13

Early log

0.3

0.57±0.02

3.18±0.13

6.55±0.33

Mid log

0.6

0.56±0.06

5.45±0.18

7.16±.09

Late log

1

0.46±0.11

15.58±0.06

16.94±.24

Stationary

1.2

0.66±0.08

0.91±0.04

2.91±0.04

H3HH

A10

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.

Values are mean ± standard deviation (n=3).

1

Table 4. Net specific activity of PEP- and ATP- dependent sugar phosphorylation of isolate H3HH growing on different growth substrates1 Glucose

Maltose

Growth substrate

PEP

ATP

glucose

2.98±0.01

28.14±0.36

maltose

1.77±.20

sucrose

1.63±0.02

PEP

Sucrose ATP

PEP

ATP

1.43±0.09

0.56±0.34

0.19±0.1

ND2

12.61±0.27

1.34±0.07

0.22±0.14

0.26±0.01

0.14±0.1

23.8±0.36

1.57±0.3

0.3±.04

1.3±0.04

5.09±1.26

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.

Values are mean ± standard deviation (n=3).

2 ND=No ATP-dependent phosphorylating activity was detected after subtracting the control values.

1

ing on maltose and sucrose at rates similar to the rate observed with growth on glucose ( Pinder and Patterson, unpublished observations). Therefore, we expanded our examination to encompass the maltose and sucrose phosphorylation performed by these isolates to gain addition information regarding the sugar transports of these organisms. PEPand ATP- dependent phosphorylation of glucose, maltose and sucrose was detected in both isolate 98

H3HH and isolate A10, regardless of the sugar (glucose, maltose, or sucrose) used for growth (Tables 4 and 5). ATP- dependent glucose phosphorylation was the highest phosphorylation activity detected in both isolates, regardless of the growth substrate.

The rate of PEP- dependent glucose phosphorylation was higher than PEP- dependent maltose and glucose phosphorylation in both isolates. Similarly, S. ruminantium and S. bovis have higher rates of

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Table 5. Net specific activity of PEP- and ATP-dependent sugar phosphorylation of isolate A10 growing on different growth substrates1 Glucose

1

Maltose

Sucrose

Growth substrate

PEP

ATP

PEP

ATP

PEP

ATP

glucose

7.19±0.641

13.1±0.46

1.31±0.13

0.15±0.09

0.44±0.01

0.04±0.01

maltose

4.21±0.77

11.93±0.46

1.85±0.86

0.92±0.55

0.09±0.01

0.17±0.14

sucrose

7.59±0.47

8.56±0.52

1.95±0.02

0.64±0.03

1.12±0.03

0.34±0.03

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute.

Values are mean ± standard deviation (n=3).

PEP-dependent glucose phosphorylation as compared to either maltose or sucrose phosphorylation dependent on PEP (Martin and Russell, 1987, 1988).

ATP-dependent maltose phosphorylating activities were detected in both isolate A10 and H3HH. However, the rates of these activates were so low in both isolates (less than 1.3 fold greater than control rates without exogenous PEP or ATP), that ATP- dependent maltose phosphorylation probably does not play a major role in maltose utilization by these organisms. Neither glucokinases nor hexokinases are able to phosphorylate maltose (Barman, 1969), therefore it is not clear at present what enzymes were responsible for the ATP-dependent maltose phosphorylation activity detected in these isolates.

Possible candidates include maltose phosphorylase or maltase. The two isolates (A10 and H3HH) differed in the rates of ATP-dependent maltose phosphorylation when grown on maltose or sucrose than when grown on glucose, while isolate H3HH was opposite. Nevertheless, both isolates had similar rates of PEP-dependent maltose phosphorylation, regardless of the sugar substrate for growth.

Sucrose activities (regardless of the phosphoryl donor) were highest when the organisms were grown on sucrose, suggesting induction of a sucrose PTS as well as sucrose kinase activity. Similar induction of PEP-dependent sucrose phosphorylation was detected in Streptococcus bovis (Martin and Russell,

1987). The relative rates of ATP-and PEP-dependent glucose phosphorylation of the two organisms suggest that isolate H3HH phosphorylates sucrose primarily through a sucrose kinase while isolate A10 uses primarily sucrose PTS. Nevertheless, the rates of PEP-dependent sucrose phosphorylation in both isolate A10 and H3HH were the lowest of all three sugars tested.

Competition by other sugars To determine whether uptake of glucose, maltose, and sucrose was performed by the same or different subsystems of the PTS in isolate A10 and H3HH, the rate of phosphorylation of 14C-labeled sugar was determined in the presence of a large (10mM) excess of unlabeled sugar (Tables 6 and 7). The glucose and maltose PEP-dependent phosphorylation activities appear to originate from closely linked enzymes in isolate H3HH, due to the relatively high amount of reciprocal inhibition observed with these two sugars.

An excess of maltose inhibited 60% of 14C-glucose phosphorylation, while and excess of glucose inhibited 14C-maltose phosphorylation by 79%. A similar pattern was observed in isolate A10, although the degree of reciprocal inhibition was lesser. An excess of maltose inhibited 51% of 14C-glucose phosphorylation, while an excess of glucose only inhibited 21% of 14C-maltose phosphorylation. Furthermore, an

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

99

Table 6. Inhibition by unlabeled sugars of PEP- and ATP- dependent [14C]-sugar phosphorylation in isolate H3HH % inhibition of phosphorylation1 Glucose

Maltose

Sucrose

Radiolabeled sugar2

PEP

ATP

PEP

ATP

PEP

ATP

glucose

87.1

72.6

60.5

NA3

39.1

NA

maltose

79

16.3

94.1

96

75.2

93.4

sucrose

59.1

79.2

51

85.3

84.3

NA

Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. % Inhibition was calculated as ((PTS activity with 10 mM unlabeled sugar/PTS activity without excess unlabeled sugar) x 100).

2 Cell were grown in excess of the same unlabeled sugar.

3 NA = No activity, experimental values were not greater than control values.

1

Table 7. Inhibition by unlabeled sugars of PEP- and ATP-dependent [14C]-sugar phosphorylation in isolate A10 % inhibition of phosphorylation1 Glucose

Maltose

Sucrose

Radiolabeled sugar2

PEP

ATP

PEP

ATP

PEP

ATP

glucose

87.5

87.5

51.6

13.4

50.2

3.9

maltose

21.1

69.6

44.3

29.3

11.9

NA3

sucrose 24.1 73.5 29.5 35.3 50.9 79.4 Nanomoles of glucose or 2-deoxyglucose phosphorylated per milligram of protein per minute. % Inhibition was calculated as ((PTS activity with 10 mM unlabeled sugar/PTS activity without excess unlabeled sugar) x 100).

2 Cell were grown in excess of the same unlabeled sugar.

3 NA = No activity, experimental values were not greater than control values.

1

excess of maltose only inhibited 14C-maltose phosphorylation by 44% in isolate A10 (compared to 94% inhibition in isolate H3HH) which suggests that the capacity for uptake and phosphorylation of maltose is greater in isolate A10 than isolate H3HH. Reciprocal inhibition of PEP-dependent phosphorylation was observed with combinations of glucose and 100

sucrose as well as maltose and sucrose in both isolates. However, in isolate A10 the reciprocal inhibition between maltose and sucrose was relatively low (12 to 51% inhibition). Because the degree of inhibition between the three sugars tested was not always near the theoretical dilution (91% inhibition), it appears that more than one subsystem (i.e. the

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

carbohydrate specific enzyme II and III) of the PTS transports glucose, maltose and sucrose in the isolates. Transport of glucose, maltose and sucrose by different carbohydrate specific enzymes of the PTS has been reported in other bacteria such as E. coli (Meadow et al., 1990).

A much different picture emerged with ATP-dependent phosphorylation of glucose, maltose and sucrose in both isolate A10 and H3HH. Glucose and maltose are phosphorylated by different ATPdependent systems in isolate H3HH. However, the same relationship is less clear in isolate A10. Maltose inhibited glucose phosphorylation by only 13% while glucose inhibited maltose phosphorylation by 70% in isolate A10. This type if inhibition suggested a feedback-type of inhibition by glucose upon ATPdependent maltose phosphorylation. A similar pattern of feedback inhibition by glucose on sucrose phosphorylation was observed in isolate A10.

Interestingly, an excess of unlabeled sucrose did not reduce the rate of ATP-dependent 14C-sucrose phosphorylation in isolate H3HH. Maltose and sucrose are phosphorylated by the same enzyme system in isolate H3HH in light of the relatively strong reciprocal inhibition displayed between these two sugars. The relationship between maltose and sucrose ATP-dependent phosphorylation is less clear in isolate A10. Sucrose did not inhibit maltose phosphorylation while maltose only achieved 29% inhibition on 14C-maltose phosphorylation and 35% inhibition on 14C-sucrose phosphorylation.

CONCLUSION The constitutive nature of the ATP-dependent glucose phosphorylating activities suggests that this system is used as the initial system for uptake of glucose in to the cell, and that the PTS serves as a secondary system, in the same fashion as the ammonia uptake systems of glutamate dehydrogenase: glutamine synthetase. Further experiments will be needed to determine the minimum concentration of sugar needed to induce the PTS in these bacteria as well as the mechanism how glucose uptake repress-

es activity of the Wood pathway.

References Barman, T. E. 1969. Enzyme handbook. Springer-Verlag, New York, NY. Boccazzi, P. and J. A. Patterson. 2011. Using hydrogen-limited continuous culture to isolate low hydrogen threshold ruminal acetogenic bacteria.

Agric. Food Anal. Bacteriol. 1:33-44.

Drake, H. L. 1992. Acetogenesis and Acetogenic bacteria. In: Lederberg, J. Ed. Encyclopedia of Microbiology. Academic Press, Inc. San Diego CA Eden, G. and G. Fuchs. 1983. Autotrophic CO2 fixation in Acetobacterium woodii. II. demonstration of enzymes involved. Arch. Microbiol. 135:68-73.

Genthner, B. R. S. and M. P. Bryant. 1987. Additional characteristics of one-carbon compound utilization by Eubacterium limosum and Acetobacterium woodii. Appl. Environ. Microbiol. 53:471-476.

Jiang, W., R. S. Pinder, J.A. Patterson, and S. C. Ricke.

2012. Sugar phophorylation activity in ruminal acetogens. J. Environ. Sci. and Health, Part B. 47:843846.

Leedle, J. A. Z, M. P. Bryant and R. B. Respell. 1982.

Diurnal variations in bacterial numbers and fluid parameters in ruminal contents of animals fed lowor high-forage diets. Appl. Environ. Microbiol.

44:402-412.

Leedle, J. A. Z., K. Barsuhn, and R. B. Respell. 1986.

Postprandial trends in estimated ruminal digesta polysaccharides and their relation to changes in bacterial groups and ruminal fluid characteristics.

J. Anim. Sci. 62:789-803.

Martin S. A. and J. B. Russell. 1986. Phosphoenolpyruvate-dependent phosphorylation of hexoses by ruminal bacteria: Evidence for the phosphotransferase system. Appl. Environ. Microbiol. 52:13481352.

Martin S. A. and J. B. Russell. 1987. Transport and Phosphorylation of disaccharides by the ruminal bacterium Streptococcus bovis. Appl. Environ. Microbiol. 53:2388-2393.

Martin S. A. and J. B. Russell. 1988. Mechanisms of

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

101

sugar transport in the rumen bacterium Selenomonas ruminantium. J. Gen. Microbiol. 134:819-827.

Matin, A. and H. Veldcamp. 1978. Physiological basis of the selective advantage ofa Spirillum sp. in a carbon limited environment. J. Gen Microbiol. 105: 187-197.

Meadow, N. D., D. K. Fox, and S. Roseman. 1990.

The bacterial phosphoenolpyruvate: glycose phosphotransferase system. Annu. Rev. Biochem.

59:497-542.

Moore, G. A. and S. A. Martin. 1991. Effect of growth conditions on the Streptococcus bovis phosphoenolpyruvate glucose phosphotransferase system.

J. Anim. Sci. 69:4967-4973.

Pinder, R. S. and J. A. Patterson. 2011. Isolation and initial characterization of plasmids in an acetogenic ruminal isolate. Agric. Food Anal. Bacteriol.

1:186-192.

Postma, P. W. and J. W. Lengeler. 1985. Phosphoen olpyruvate:carbohydrate phosphotransferase system of bacteria. Microbio. Rev. 49:232-269.

Postma, P. W., J. W. Lengeler and G. R. Jacobson.

1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbio. Rev. 5:543-594.

Ragsdale, S. W. 1991. Enzymology of the acetyl-CoA pathway of CO2 fixation. Crit. Rev. Biochem. Mol.

later. Mol. Microbiol. 13:755-764.

Saier, M. H., Jr. 1991. A multiplicity of potential carbon catabolite repression mechanisms in prokaryotic and eukaryotic microorganisms. New Biologist 3: 1137 -1147.

Thauer, R. K., K. Jungermann, K. Decker. 1977. Energy conservation in chemotrophic anaerobic bacteria. Bact. Revs. 41:100-180.

Vadeboncoeur, C. 1984. Structure and properties of the phosphoenolpyruvate: glucose phosphotransferase system of oral streptococci. Can. J. Microbiol. 30:495.

BioI. 26:261-300.

Rephaeli, A. W. and M. H. Saier, Jr. 1980. Regulation of genes coding for enzyme constituents of the bacterial phosphotransferase system. J. Bacteriol.

141:658-663.

Romano, A. H., S. J. Eberhard, S. L. Dingle, and T. D. McDowell. 1970. Distribution 0 the phosphoenolpyruvate: glucose phosphotransferase system in bacteria. J. Bacteriol. 104:808-813.

Romano, A. H., J. D. Trifone and M. Brustolon. 1979.

Distribution of the phosphoenolpyruvate:glucose phosphotransferase system in fermentative bacteria. J. Bacteriol. 139-93 :97.

Saier, M. H., Jr. 1985. Mechanisms and regulation of carbohydrate transport in bacteria. Academic Press, Inc. Orlando, FL. Saier, M. H., Jr, and J. Reizer. 1994. The bacterial phosphotransferase system: new frontiers 30 years 102

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Effect of Fertilization on Phytase and Acid Phosphatase Activities in Wheat and Barley Cultivated in Bulgaria V. I. Chalova1, I. Manolov2, M. Nikolova3, L. Koleva1 Department of Biochemistry and Molecular Biology, University of Food Technology, Plovdiv, Bulgaria 2 Department of Agrochemistry and Soil Science, Agricultural University, Plovdiv Bulgaria 3 Department of Agriculture, University of Forestry, Sofia Bulgaria

1

ABSTRACT Phytase and acid phosphatases in wheat and barley are the major enzymes which catalyze the release of orthophosphate from phosphorylated substrates. Their activities may be influenced by numerous factors including variety differences, growth conditions, and fertilization. The purpose of this study was to evaluate the effect of nitrogen (N), phosphorus (P), and potassium (K) fertilization on phytase and acid phosphatase activities in wheat and barley varieties which are developed and cultivated in Bulgaria. A randomized block design method was applied to a field experiment to study eight treatments which included the application of N, P, K and the combinations of N x P, N x K, P x K and N x P x K. It was established that increased N contents of both wheat and barley grains stimulated phytase activities. The accumulation of P in the grains resulted in decreases of the enzyme activities. Acid phosphatase activities in wheat and barley were less impacted by the applied fertilizers as evidenced by small statistical differences that were established.

No specific trend of K-dependent influence on both enzymes was observed. The application of N- and Pcontaining fertilizers may be used to modulate phytase activities in wheat and barley. If yielding a crop with increased intrinsic phytase activities is needed, utilization of N-rich fertilizer is recommended.

Keywords: wheat, barley, fertilization, phytase, acid phosphatase, animal nutrition Agric. Food Anal. Bacteriol. 2:103-110, 2012

Introduction Phytase and acid phosphatases in wheat and barley are the major enzymes which catalyze the release of orthophosphate from phosphorylated substrates (Viveros et al., 2000; Centeno et al., 2001). Inorganic Correspondence:Vesela Chalova, veselachalova@gmail.com Tel: 032-603-855 Fax: 032-644-102

phosphate is necessary for seed germination and embryo growth (Brinch-Pedersen et al., 2002). The levels of bioavailable phosphate are also important when wheat and barley are used as feed ingredients for monogastric animals (Pointillart et al., 1987). Nonruminants are incapable of utilizing phytate-bound phosphorus (P) which may reach up to 80% of total P content (Kirby and Nelson, 1988; Reddy et al., 1989; Perney et al., 1993). Due to the importance of P to

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

103

animal health and the uncertainties of P bioavailability in feed ration, farmers and animal producers are inclined to over-supplement P containing sources to create a margin of safety (Sutton et al., 2001). However, in countries with highly regulated animal waste management, P overload is strictly monitored to prevent pollution of soil and groundwater. In addition, microbial phytase supplementation of animal diets, which is meant to reduce the amount of excreted P by making more of it bioavailable to animals, is very often constrained by expenditure associated with production and application of the enzyme (Afinah et al., 2010). To more precisely formulate P levels in animal diets and avoid elevated feed cost and environmental pollution, while achieving optimal animal performance, more information about the capacity of the intrinsic orthophosphate releasing enzymes in feed ingredients is necessary.

By studying phytate-degrading enzyme activities in legume seeds, cereals, and cereal by-products, Steiner et al. (2007) and Viveros et al. (2000) estimated intermediate phytase activities in cereals which, however, varied over a wide range. Even for one plant species, data for phytase and acid phosphatase activities reported by different authors varied considerably (Viveros et al., 2000, Greiner and Egli, 2003; Steiner et al., 2007; Zarei, 2007). The variations could be explained by differences in the varieties used for the studies, growth conditions, and fertilization (Liu et al., 2006; Steiner et al., 2007; 2008; Kaya et al., 2009). Although information on phytase and acid phosphatase activities in wheat and barley has been published, little is known about their modulation by nitrogen (N), P, and potassium (K) which are major fertilizing agents used in agriculture to improve soil quality and crop yields. The purpose of this study was to evaluate the effect of N, P and K fertilization on respective seed mineral contents as related to phytase and acid phosphatase activities in wheat and barley cultivated in Bulgaria. Although Ca2+ and Mg2+ were not included in our fertilization experiment, their contents in seeds were also evaluated and discussed as potential determinants of the enzyme activities (Igamnazarov et al., 1998).

104

Materials and Methods Experimental field design and fertilization A field experiment was carried out in 2009/10 near village Sadievo (42° 31’ 1.2” N, 26° 4’ 58.8” E), region of Stara Zagora, Southern Bulgaria. Bulgarian varieties wheat (Aglika) and barley (Aheloj 2) were grown in soil type “vertisols” (pH(kcl) 5.3) which contained 16.3 mg NH4-N /kg, 14.0 mg NO3-N /kg, 2 mg P2O5/100g, and 24 mg K2O /100g before the experiment. A randomized block design method was used to study eight treatments which included the application of N, P, K, and combinations of N x P, N x K, P x K, and N x P x K. The cereals grown in non-fertilized soil were used as a control. Each treatment consisted of four replications which were performed on plots sizing 5 x 5 m (25 m2). Ammonium nitrate, triple superphosphate and potassium chloride were applied to field to supply N, P2O5 and K2O at the rates of 100 kg/ha, 120 kg/ha, and 80 kg/ha for the wheat, and 80 kg/ha, 120 kg/ha, 80 kg/ha for the barley respectively.

Cereals (wheat and barley) were field collected and air dried. Representative samples (100 g) were taken, ground to pass a 1 mm sieve and stored in sealed containers. All reagents used throughout the experiments were of analytical grade and bought from Sigma (Buchs, Switzerland).

Determination of N, P, K, Ca, and Mg in cereal grains Seed samples were digested with concentrated HNO3 and heated in a MarsXpress microwave digestion system (CEM GmbH, Germany) to determine P, K, Ca, and Mg contents. Concentration levels of K, P, Ca, and Mg were established by using an Optical Emission Spectrometry with Inductively Coupled Plasma (ICP OES), Liberty Series II at 769.896 nm, 213.618 nm, 315.887 nm, and 279.079 nm respectively. N was determined by Kjeldahl method (Bremner, 1996).

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Enzyme activity measurements Intrinsic phytase activities in wheat and barley were determined by the extraction procedure of Grainer and Egli (2003) with some modifications. The method is based on the quantification of inorganic phosphate released by phytase from phytate which was used as a substrate. The liberated phosphate was measured according to the ammonium-molybdate method (James, 1999). Briefly, samples (3 g) were extracted for 30 min with 100 ml 0.25 M acetate buffer solution (pH 5) at constant stirring and room temperature (22ºC). Solid particles were removed by centrifugation for 15 min at 6000 g (MPW Med. Instruments, Warsaw, Polska) and supernatants were analyzed for phytase and acid phosphatase enzyme activities. For the phytase evaluation, the reaction mixture consisted of 0.9 ml acetate buffer (0.25 M, pH 5), 2 ml 7.5 mM sodium phytate (Sigma-Aldrich P8810), and 0.1 ml test solution was incubated for 30 min at 37ºC. The enzyme reaction was stopped by adding a stop solution (2:1:1 v/v/v) consisted of nitric acid (1:2 v/v nitric acid:water), ammonium molybdate (5%), and ammonium metavanadate (0.235%). The yellow complex, formed after the reaction between the liberated inorganic phosphate and the acidic molybdate/vanadate reagent, was measured with a spectrophotometer (Carl Zeiss, Jena, Germany) at 415 nm. Phytase activity was calculated against a standard curve constructed with potassium dihydrogen phosphate and expressed as unit/kg (U/kg) on a dry matter (DM) basis. One phytase unit was defined as the amount of the enzyme which liberates 1 μmol of inorganic phosphorus per minute from 5 mmol of sodium phytate at pH 5 and 37ºC. Acid phosphatase activity was determined as described by Zyla et al. (1989). The method is based on the quantification of the p-nitrophenol released from p-nitrophenyl phosphate by the catalytic action of the enzyme. Reaction mixture contained 1 ml 10 mM substrate (p-nitrophenyl phosphate) dissolved in 0.25 M acetate buffer (pH 5) and 0.2 ml extracted enzyme. After incubation for 30 min at 37 ºC, the reaction was stopped by the addition of 5 ml 50 mM NaOH. The intensity of yellow color was measured

with a spectrophotometer and the enzyme activity was calculated against a standard curve constructed with graded concentrations of p-nitrophenol. One unit acid phosphatase activity was defined as the amount of the enzyme which liberates 1 μmol of pnitrophenol per minute under above conditions.

Variability, replication, and statistical analysis Statistical analysis was performed using the Statistical Package for the Social Sciences (SPSS) program (IBM SPSS Stattistics 17, Somers, NY, USA).

Presented results are averaged means of at least two independent experiments ± standard deviations.

Mean differences and between-subject effect were established by one-way analysis of variance (ANOVA) using the general linear model procedure and Duncan’s multiple comparison test. Statistical differences were considered significant at p < 0.05.

Results and Discussion Effect of fertilization on mineral contents of wheat and barley grains Plant fertilization is one of the most important intensifying factors of wheat and barley crop production. In addition to crop yield, it influences the quality of harvested product which may include mineral and protein contents, chlorophyll and carotenoides, amino acid composition and enzyme activities (Koszanski et al., 1997; Manolov et al., 1999; Černý et al., 2010). N, P and K are macronutrients which are required by plants in relatively large amounts. They are commonly included in agricultural practices as fertilizing agents to improve soil fertility and modulate plant enzyme activities towards desired crop characteristics (Stewart et al., 2004; Kaya et al., 2009; Balabanli et al., 2010).

In our study, the application of N-containing fertilizers in all cases (N, NP, NK and NPK) resulted in increases of N contents of both wheat and barley grains compared to controls (Tables 1 and 2). Av-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

105

Table 1. Effect of fertilization differences on mineral content of wheat grains Fertilization, kg/ha

N, %

P, %

K, %

Ca, %

Mg, %

control

1.78 ± 0.15bc

0.24 ± 0.08b

0.41 ± 0.03

0.046 ± 0.008b

0.105 ± 0.009

N100

2.14 ± 0.12a

0.21 ± 0.02c

0.39 ± 0.03

0.048 ± 0.004b

0.093 ± 0.006

P120

1.65 ± 0.12c

0.29 ± 0.03a

0.38 ± 0.05

0.043 ± 0.001b

0.97 ± 0.004

K80

1.75 ± 0.17

b

0.24 ± 0.07

0.35 ± 0.02

b

0.042 ± 0.009

0.107 ± 0.002

N100P120

2.16 ± 0.20a

0.25 ± 0.02b

0.39 ± 0.04

0.039 ± 0.004b

0.110 ± 0.002

N100K80

2.04 ± 0.09

b

0.24 ± 0.09

0.38 ± 0.02

b

0.045 ± 0.006

0.105 ± 0.001

P120K80

1.63 ± 0.10c

0.29 ± 0.03a

0.42 ± 0.09

0.083 ± 0.006a

0.104 ± 0.004

N100P120K80

2.16 ± 0.11a

0.32 ± 0.04a

0.38 ± 0.04

0.043 ± 0.002b

0.101 ± 0.003

bc

ab

Data represent average means of at least two independent experiments ± standard deviations.

Means in a column with different superscripts differ significantly (p<0.05). Data for K and Mg were not found significantly different (p>0.05).

a-c

Table 2. Effect of fertilization differences on mineral content of barley grains Fertilization, kg/ha

N, %

P, %

K, %

Ca, %

Mg, %

control

1.51 ± 0.13b

0.23 ± 0.10cd

0.32 ± 0.03d

0.049 ± 0.004c

0.107 ± 0.009

N80

1.78 ± 0.15a

0.22 ± 0.03cd

0.39 ± 0.02ab

0.047 ± 0.003c

0.115 ± 0.001

P120

1.44 ± 0.18

0.28 ± 0.04

0.40 ± 0.02

c

0.055 ± 0.002

0.124 ± 0.001

K80

1.39 ± 0.11c

0.24 ± 0.02c

0.37 ± 0.03bc

0.051 ± 0.002c

0.107 ± 0.003

N80P120

1.90 ± 0.26a

0.24 ± 0.09c

0.34 ± 0.04bc

0.039 ± 0.004d

0.109 ± 0.002

N80K80

1.91 ± 0.11

0.20 ± 0.02

0.35 ± 0.03

cd

0.045 ± 0.006

0.100 ± 0.001

P120K80

1.31 ± 0.07c

0.30 ± 0.09a

0.43 ± 0.02a

0.072 ± 0.001b

0.116 ± 0.002

N80P120K80

1.63 ± 0.30a

0.26 ± 0.07b

0.39 ± 0.02ab

0.131 ± 0.002ab

0.118 ± 0.006

bc

a

ab

d

a

c

Data represent average means of at least two independent experiments ± standard deviations.

Means in a column with different superscripts differ significantly (p<0.05). Data for Mg were not found significantly different (p>0.05). a-d

erage increments of 19.38% and 19.53% in grain N concentrations in response to N fertilization were established for wheat and barley respectively. Our data agreed with Bettaieb-Ben Kaab et al. (2006) who reported increased concentrations of N in barley grains compared to control in response to all levels of N fertilization which included 40, 80, and 120 kg/ha.

106

Albrizio et al. (2010) reported up to 15.8% average increases in N contents of wheat and barley grains as consequence of N fertilization which is close to our findings. Our results were not unexpected because of plant capabilities to accumulate N upon excessive N soil availability (Golik et al., 2005). According to Przulj and Momčilović (2003), N is accumulated in

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

wheat and barley during vegetation period to provide optimal protein and nucleic acid syntheses and is translocated to kernel during reproductive phase.

Positive response of N content of wheat and barley grains to N fertilization was also reported by Koszanski et al. (1997), and Małecka and Blecharczyk (2008).

Phosphate-based fertilization exhibited similar trend of increase in P concentrations in both wheat and barley (Tables 1 and 2). Except for the combined fertilization with P and N, the grains, collected from plots enriched with P, PK and NPK, contained significantly higher P concentrations than non-fertilized grains (p< 0.05). Our data agreed with Syltie and Dahnke (1983) who also observed increased P-content responses of two hard red spring wheat cultivars to incremented application of a P-rich fertilizer to soil.

Fertilization of wheat with K80 did not influenced K contents of grains. No significant differences in K grain concentrations (p< 0.05) among all treatments were observed (Table 1). This is probably due to relatively high initial content of K in soil (24 mg K2O /100g) before starting the experiment. When wheat is grown in soil containing optimal K concentrations, further increase of K availability may not affect K plant content (Slaton et al., 2008). In barley, significant differences among K contents of grains were established but they were ambiguously related to K dose applied to soil. They were rather due to interrelationships of macronutrients where P (P, NP, PK, and NPK) exerted the most stimulating effect on K accumulation in barley grains (Table 2).

Although Ca and Mg ions were not included in our field experiment as fertilizers, they were quantitatively measured because of possible inter-element relationships (Markert, 1993; Li et al., 2010) and potential influence on phytase and acid phosphatase activities. Indeed, Ca contents of both wheat and barley subjected to the experimental fertilization design were found significantly different with PK and NPK contributing the most. None of the fertilizers or their combinations influenced Mg contents of wheat and barley grains.

Effect of fertilization on phytase and acid phosphatase activities in wheat and barley grains In our study, nitrogen fertilization (N and NK) and the respective high N contents in seeds (Table 1 and 2) stimulated phytase activities in both wheat and barley (Table 3 and 4). Similarly, Kaya et al. (2009) established positive effect of N fertilization on phytase activity in chickpea (Akcin 91) as evidenced by the increased activity of the enzyme (4.3 U/g) compared to control (3.8 U/g) in a response to soil fertilization with N at the level of 60 kg N/ha. According to Eastwood and Laidman (1971), the increased phytase levels at higher N availability is mediated by certain nitrogencontaining compounds including glutamine, purine and pyrimidine nucleotides. Although significantly not different from the controls, highest acid phosphatase activities (absolute values) were estimated in wheat (6 529 ± 130 U/kg) and barley (4189 ± 254 U/kg) seeds containing highest N concentrations.

Increasing acid phosphatase activities from 5.27 to 7.87 mmol/kg in wheat leaves which corresponded to increasing N levels ranging from 13.1 to 45.4 mg N-NO3/kg were observed by Koszanski et al. (1997).

In contrast to N, the wheat and barley seeds containing highest P concentrations (P, PK, NPK; Table 1 and 2) exhibited the lowest levels of phytase activities (Table 3 and 4). Although the biological function of phytase is to liberate inorganic P to provide sufficient amounts for germinating seeds and growing plants, it looks that excessive P availability may inhibit the enzyme. By studying the control mechanisms of the phytin-phytase system in wheat embryos, Sartirana and Bianchetti (1967) established that the rate of phytin breakdown was controlled in vivo by the concentration of inorganic phosphate, through the inhibition of phytase activity. Statistical decrease of acid phosphatase activity caused by enhanced P concentrations was established only for barley fertilized with P120K80 (Table 4).

In addition to P concentrations, Ca ions may also contribute to phytase inhibition. In fact, wheat seeds fertilized with P120K80 resulted in highest accumulation of Ca (0.083 ± 0.006%) and one of the lowest lev-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

107

Table 3. Effect of fertilization differences on phytase and acid phosphatase activities in wheat Phytase Activity, U/kg

Acid Phosphatase Activity, U/kg

control

1759 ± 73c

5381 ± 327 ab

N100

2349 ± 75b

P120 K80

Table 4. Effect of fertilization differences on phytase and acid phosphatase activities in barley Phytase Activity, U/kg

Acid Phosphatase Activity, U/kg

control

2570 ± 125c

4288 ± 283a

6529 ± 130 a

N80

3038 ± 216ab

4189 ± 254ab

1160 ± 93f

5243 ± 292 b

P120

1410 ± 85d

3664 ± 40abc

1691 ± 137cd

5283 ± 322 ab

K80

3442 ± 316a

3778 ± 106abc

N100P120

2168 ± 90b

5317 ± 253 ab

N80P120

2536 ± 204c

3722 ± 228abc

N100K80

3455 ± 184a

5331 ± 224 ab

N80K80

3372 ± 227ab

3583 ± 170bc

P120K80

1593 ± 112cd

5246 ± 139 b

P120K80

1564 ± 42d

3509 ± 35c

N100P120K80

1478 ± 34de

6565 ± 311 a

N80P120K80

2763 ± 235bc

3849 ± 205abc

Fertilization, kg/ha

Fertilization, kg/ha

Data represent average means of at least two independent experiments ± standard deviations a-f Means in a column with different superscripts differ significantly (p<0.05).

Data represent average means of at least two independent experiments ± standard deviations. a-d Means in a column with different superscripts differ significantly (p<0.05).

els phytase- and acid phosphatae activities (Table 3).

Similarly, the barley seeds containing 0.072 ± 0.001% Ca (Table 2) exhibited phytase- and acid phosphatae activities significantly lower than the control (Table 4).

According to Igamnazarov et al. (1998), the influence of Ca ions on phytase activity is dose-dependent.

Low Ca concentrations (1x10-5 M) did not influence phytase activity in cotton plants. However, higher Ca concentrations (5x10-5 M) reduced phytase activity by 12%.

lished. Therefore, the application of N- and P-containing fertilizers may be used to modulate phytase activities in wheat (Aglika) and barley (Aheloj 2). If yielding a crop with increased intrinsic phytase activities is needed, utilization of N-rich fertilizer may be the choice.

CONCLUSIONs Overall mineral soil fertilization influenced phytase and acid phosphatase activities in both wheat and barley grains. Acid phosphatase activities were less impacted as evidenced by small statistical differences that were established. While the increased N contents of seeds stimulated phytase activities, the abundance of P negatively controlled the liberation of phytine-bound P caused by phytase. No specific trend of K influence on both enzymes was estab108

Acknowledgements This research was supported by project “Best Management Practices for Sustainable Crop Production in Bulgaria” financed by International Plant Nutrition Institute (IPNI) USA and K+S KALI GmbH Germany.

References Afinah, S., A. M. Yazid, M. H. Anis Shobirin, and M. Shuhaimi. 2010. Phytase: application in food industry. Int. Food Res. J. 17:13-21.

Albrizio,R., M. Todorovic, T. Matic, A. M. Stellacci.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

2010. Comparing the interactive effects of water and nitrogen on durum wheat and barley grown in a Mediterranean environment. Field Crops Res. 115:179-190.

Balabanli, C., S. Albayrak, and O. Yüksel. 2010. Effects of nitrogen, phosphorus and potassium fertilization on the quality and yield of native rangeland. Turk. J. Field Crops 15:164-168.

Bettaieb-Ben Kaab, L., C. Rahmoune, M. Lauriere, and M. Ben Naceur. 2006. Effect of N fertilization on storage protein and some amino acid quantities of two Tunisian barley varieties differing in their degrees of adaptation to environmental conditions. Sci. Technol. C 24:7-12.

Bremner, J. M. 1996. Nitrogen - total. In: D. L. Sparks, A. L. Page, P. A. Helmke, R. H. Loeppert, P. N. Soltanpour, M. A. Tabatabai, C. T. Johnston, and M. E. Sumner. Eds. Methods of Soil Analysis. Part 3-Chemical Methods. American Society of Agronomy-Soil Science Society of America, Madison, WI. p 1085-1121.

Brinch-Pedersen, H., L. D. Sørensen, and P. B. Holm.

2002. Engineering crop plants: getting a handle on phosphate. Trends Plant Sci. 7:118-125.

Centeno, C., A. Viveros, A. Brenes, R. Canales, A. Lozano, and C. de la Cuadra. 2001. Effect of several germination conditions on total P, phytate P, phytase, and acid phosphatase activities and inositol phosphate esters in rye and barle. J. Agric. Food Chem. 49:3208-3215. Černý, J., J. Balík, M. Kulhánek, K. Čásová, and V. Nedvěd. 2010. Mineral and organic fertilization efficiency in long-term stationary experiments. Plant Soil Environ. 56:28-36.

Eastwood, D., and D. L. Laidman. 1971. The mobilization of macronutrient elements in the germinating wheat grain. Phytochemistry 10:1275-1284.

Golik, S. I., H. O. Chidichimo, and S. J. Sarandón.

2005. Biomass production, nitrogen accumulation and yield in wheat under two tillage systems and nitrogen supply in the Argentine rolling pampa.

World J. Agric. Sci. 1:36-41.

Greiner, R., and I. Egli. 2003. Determination of the activity of acidic phytate-degrading enzymes in cereal seeds. J. Agric. Food Chem. 51:847-850.

Igamnazarov, R. P., B. O. Beknazarov, and M. M. Abdullaeva. 1998. Influence of some ions on the activity of cottonplant phytase. Chem. Nat. Comp.

34:307-308.

James, C. S. 1999. Analytical chemistry of foods. Aspen Publishers, Inc., Gaithersburg, MD. 178 p.

Kaya, M., Z. Küçükyumuk, and I. Erdal. 2009. Phytase activity, phytic acid, zinc, phosphorus andprotein contents in different chickpea genotypes inrelation to nitrogen and zinc fertilization. African J. Biotech. 8:4508-4513.

Kirby, L., and T. Nelson. 1988. Total and phytate phosphorus content of some feed ingredients derived from grains. Nutr. Report Intl. 37:277-280.

Koszanski, Z., S. Karczmarczyk, D. Sciazko, E. Koszanska, and U. Tyrakowska. 1997. Effect of irrigation and mineral fertilization on spring cereals cultivated on a sandy soil. Part II. Activity of some physiological processes and chemical composition of grain. Rom. Agric. Res. 7-8:25-34.

Li, B., S. Huang, M. Wei, H. L. Zhang, A. Shen, J. Xu, and X. Ruan. 2010. Dynamics of soil and grain micronutrients as affected by long-term fertilization in an aquic inceptisol. Pedosphere 20:725-735.

Liu, Z. H., H. Y. Wang, X. E. Wang, G. P. Zhang, P. D. Chen, and D. J. Liu. 2006. Genotypic and spike positional difference in grain phytase activity, phytate, inorganic phosphorus, iron, and zinc contents in wheat (Triticum aestivum L.). J. Cereal Sci. 44:212-219.

Małecka, I., and A. Blecharczyk. 2008. Effect of tillage systems, mulches and nitrogen fertilization on spring barley (Hordeum vulgare). Agron. Res. 6:517-529.

Manolov, I., V. Chalova, and S. Kostadinova. 1999. Effect of nitrogen fertilization and variety differences on nitrate reductase activity of wheat (Triticum aestivum). Bulg. J. Agric. Sci. 5:599-604.

Markert, B. 1993. Interelement correlations detectable in plant samples based on data from reference materials and highly accurate research samples. Fresenius’ J. Anal. Chem. 345:318-322.

Perney, K. M., A. H. Cantor, M. L. Straw, and K. L. Herkelman. 1993. The effect of dietary phytase on growth performance and phosphorus utilization of

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

109

broiler chicks. Poult. Sci. 72:2106-2114.

Pointillart, A., A. Fourdin, and N. Fontaine. 1987.

Importance of cereal phytase activity for phytate phosphorus utilization by growing pigs fed diets containing triticale or corn. J. Nutr. 117:907-913.

Przulj, N., and V. Momčilović. 2003. Dry matter and nitrogen accumulation and use in spring barley.

Plant Soil Environ. 49:36-47.

Reddy, N. R., M. D. Pierson, S. K. Sathe, and D. K. Salunkhe. 1989. Phytates in cereals and legumes.

CRC Press Inc., Boca Raton, FL. 152 p.

Sartirana, M. L., and R. Bianchetti. 1967. The effects of phosphate on the development of phytase in the wheat embryo. Physiol. Plantarum 20:10661075.

Slaton, N. A., R. E. DeLong, M. Mozaffari, S. Clark, C. Allen, and R. Thompson. 2008. Wheat grain yield response to phosphorus and potassium fertilizer rate. Pages 69-71 In: N. A. Slaton. Ed. Arkansas Soil Fertility Studies 2007. Research Series 558. University of Arkansas Press, Fayettevill, AR. Steiner, T., R. Mosenthin, B. Zimmermann, R. Greiner, and S. Roth. 2007. Distribution of phytase activity, total phosphorus and phytate phosphorus in legume seeds, cereals and cereal by-products as influenced by harvest year and cultivar. Anim. Feed Sci. Technol. 133:320-334.

Stewart, W. M., D. W. Dibbb, A. E. Johnstonc, and T. J. Smyth. 2005. The contribution of commercial fertilizer nutrients to food production. Agron. J. 97:1-6.

Sutton, A., T. Applegate, S. Hankins, B. Hill, G. Alle, W. Greene, R. Kohn, D. Meyer, W. Powers, and T. van Kempen. 2001. Manipulation of animal diets to affect manure production, composition and odors: State of the science. National Center for Manure and Animal Waste Management.

Syltie, P. W., and W. C. Dahnke. 1983. Mineral and protein content, test weight, and yield variations of hard red spring wheat grain as influenced by fertilization and cultivar. Plant Foods Hum. Nutr.

32:37-49.

Viveros, A., C. Centeno, A. Brenes, R. Canales, and A. Lozano. 2000. Phytase and acid phosphatase activities in plant feedstuffs. J Agric. Food Chem.

110

48:4009-4013.

Zarei, M. A. 2007. Phytase activity in the grain of 6 varieties of wheat cultivated in Kurdistan province.

Int. J. Poult. Sci. 6:634-636.

Zyla, K., M. Kujawski, and J. Koreleski. 1989. Dephosphorylation of phytate compounds by means of acid phosphatase from Aspergillus niger. J. Sci. Food Agric. 49:315-324.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Transfer of tylosin resistance between Enterococcus spp. during continuous-flow culture of feral or domestic porcine gut microbes† N. Ramlachan1,2, R.C. Anderson1, K. Andrews1, R.B. Harvey1 and D.J. Nisbet1 United States Department of Agriculture/Agricultural Research Service, Food & Feed Safety Research Unit, College Station, Texas, USA 2 Current address: Department of Biosciences, Agriculture and Food Technology, University of Trinidad and Tobago, Piarco, Trinidad, WI 1

†

Mention of trade name, proprietary product, or specific equipment does not constitute a guarantee or warrenty by the USDA and does not imply its approval to the exclusion of other products that may be suitable.

ABSTRACT Mixed populations of domesticated and feral pig gut microorganisms (Recombined Porcine-Derived Continuous Flow culture; RPCF and Feral Culture; FC, respectively) were grown in continuous culture to investigate the effects of tylosin on antimicrobial resistance. Cultures established in steady state were inoculated with 9.7 log10 colony forming units (CFU) of a tylosin-resistant Enterococcus faecium and allowed 7 days to re-establish equilibrium before administration of 100 µg tylosin mL-1. Total culturable anaerobes recovered on non-antibiotic supplemented medium, thus inclusive of tylosin-sensitive and -insensitive bacteria, ranged from 7.15 to 9.20 log10 CFU mL-1 throughout 8 days of tylosin administration and 6 subsequent days without tylosin administration. Recovery of total anaerobes on tylosin-supplemented medium revealed that populations of total tylosin-insensitive anaerobes ranged from 6.30 to 9.02 log10 CFU mL-1 during the experiment. Concentrations of the introduced tylosin-resistant E. faecium decreased to near minimum detectable levels (1.3 log10 CFU mL-1) in the cultures before initiation of tylosin administration and then increased to 6.80 ± 0.28 and 8.30 ± 0.43 log10 CFU mL-1 in RPCF and FC cultures, respectively, and remained higher than day 0 concentrations for the remainder of the experiment. Endogenous tylosininsensitive Enterococcus were undetectable before administration of tylosin but tylosin-resistant E. faecalis and E. hirea found to have acquired an ermB gene of expected size and sequence of that contained in the introduced E. faecium were enriched to 7.74 ± 0.37 and 3.85 ± 4.03 after initiation of tylosin administration. These results demonstrate the acquisition, propagation and persistence of tylosin-resistance in mixed populations of domestic and feral swine gut microflora.

Keywords: Anaerobic bacteria, antimicrobial resistance, antimicrobial resistance transfer, continuous flow culture, domestic swine, Enterococcus, feral swine, gut microflora, macrolide, tylosin. bacterial activity Agric. Food Anal. Bacteriol. 2:111-120, 2012

Correspondence: Robin C. Anderson, Robin.Anderson@ars.usda.gov Tel: +1 -979-260-9317 Fax: +1-979-260-9332

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

111

Introduction Macrolide antibiotics are commonly used in human and veterinary medicine, primarily to treat infections caused by Gram-positive bacteria (Gaynor and Mankin, 2003). In the swine industry, the macrolide antibiotic tylosin is also used as a feed additive to improve production efficiency (Gaynor and Mankin, 2003). Concern exists, however, that the continued agricultural use of antibiotics, especially their sub-therapeutic use for growth promotion, is contributing to the emergence and proliferation of microbial populations resistant to many antibiotics used to treat medically important diseases (Aarestrup, 2005). For macrolide antibiotics, resistance can occur via acquisition of erm methyltransferases, which catalytically inactivate the macrolide’s targeted binding site, via acquisition of multidrug efflux pumps or even, albeit infrequently, via point mutations in the microorganism’s genome or inactivation of the macrolide (Chopra and Roberts, 2001; Gaynor and Mankin, 2003; Karlsson et al., 2004; Poole, 2005).

Recovery of bacteria harbouring erm genes from domestic conventionally-raised and non-antibioticraised swine as well as from swine production habitats has been reported (Chee-Sanford et al., 2001; Jackson et al., 2004; Wang et al., 2005). Likewise, macrolide resistance in gut bacteria from undomesticated swine has also been reported (Ramlachan et al., 2007; Stanton and Stoffregen, 2004). However, it is still not clear just how easily that native populations of gut bacteria may acquire macrolide resistance and how long acquired resistance may persist within affected populations once the selective pressure of the antibiotic is removed. For instance, an immediate increase in proportions of macrolideresistant enterococci was observed in pigs following initiation of subtheapeutic feeding of tylosin to pigs (Aarestrup and Carstensen, 1998).

More recently, continuous flow cultures established with mixed populations of gut bacteria originating from domesticated and feral swine were used to assess the effects of low (25 µg mL-1) and high (100 µg mL-1) amounts of tylosin administration on select populations of resident bacteria (Ramlachan et al., 112

2008). Results from that study indicated numbers of an exogenously introduced macrolide-resistant Enterococcus faecium were rapidly enriched in continuous flow cultures during treatment with 100 µg tylosin mL-1 but high numbers of the resistant bacterium were maintained only during tylosin administration.

Moreover, results revealed that tylosin administration differentially selected for tylosin resistant bacteria from within the autochthonous populations, with acquisition of tylosin resistance appearing within endogenous Enterococcus spp. in the population from the domestic pig but not in the population from the feral pig. However, the source of this resistance acquisition by the endogenous Enterococcus spp. in the domestic pig culture was not determined. Consequently, the present experiment was conducted to further investigate the potential development, propagation, persistence and transfer of resistance elements within the enterococcal community in the respective continuous flow cultures.

Materials and Methods Continuous flow culture establishment The two separate mixed populations of porcine gut bacteria had been used and characterized in earlier studies and were established in continuous flow culture as previously described (Harvey et al., 2002; Hume et al., 2001; Ramlachan et al., 2008). The culture defined as Recombined Porcine-Derived Continuous Flow (RPCF) culture had been previously established with cecal contents obtained from a traditionally reared domestic pig and the culture defined as our Feral culture (FC) was established under similar conditions with cecal contents from an adolescent feral boar. Both cultures were established and maintained as parent cultures in BioFlo chemostats (New Brunswick Scientific Company, Edison, NJ) with culture volumes of 550 ml. The culture medium was Viande Levure broth (Barnes et al., 1979) which was prepared and maintained anaerobically under a stream of carbon dioxide and infused at 0.40 ml/min which corresponds to a 24 h vessel turnover.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Cultures were incubated at 39°C and agitated at 100 rpm. Once established in steady state, these respective parent cultures contained representative species of genera common to the pig gut (Robinson et al., 1981) including but not limited to Bacteroides, Clostridium, Enterococcus and Streptococcus (Harvey et al., 2002; Ramlachan et al., 2008). Of these, B. uniformis (possessing ermG) from culture RPCF and C. hathewayi (possessing ermF) from culture FC showed resistance to tylosin at MIC >512 µg mL-1; with B. uniformis being prominent within culture RPCF and C. hathewayi being the predominant anaerobe recovered from culture FC (Ramlachan et al., 2007; 2008).

Neither culture contained endogenous Enterococcus spp. with measurable tylosin resistance.

Both parent cultures were used to provide inocula (10% vol/vol) to establish separate RPCF and FC test cultures, in duplicate, which after 7 days were each inoculated with 5 x 109 colony forming units (CFU) of a multi-drug resistance E. faecium strain so as to provide an exogenous gene donor exhibiting resistance to tylosin. The E. faecium strain used here, which was phenotypically distinguishable from Enterococcus spp. endogenous to the mixed populations in the test cultures, as described previously (Ramlachan et al., 2008). The respective cultures were each allowed another 7 days culture to re-establish equilibrium as evidenced by the gradual decline of the inoculated E. faecium strain, which was present below our limit of detection (10 CFU mL-1 by day 0). The cultures were then continually infused with culture medium containing 100 µg tylosin mL-1 for 8 days, which was immediately followed by 6 days of infusion of medium lacking tylosin. Collection of fluid samples from the test cultures began on day -3 relative to tylosin treatment and continued during 8 days of tylosin administration and 6 days of tylosin withdrawal. Collected samples were quantitatively cultured, via plating of 10-fold serial dilutions, to recovery media that had been prepared with or without 100 µg tylosin mL-1. Recovery media were anaerobic Brucella blood

media were incubated 48 to 72 h at 37°C in a Bactron Anaerobic Chamber (Sheldon Labs Manufacturing Inc., Cornelius, OR) and colonies enumerated on agar medium without tylosin selection include those in the population that are both sensitive and insensitive to tylosin; colonies enumerated on agar medium with 100 µg tylosin mL-1 are only those in the population that are tylosin-insensitive. For confirmation of tylosin resistance, 10 tylosin-insensitive colonies per population were subsequently selected and tested as previously described (Ramlachan et al., 2008). Specific identification of bacteria from select colonies was achieved using rapid ID 32 STREP, rapid 20E, 20NE, 20A, and rapid ID 32 A identification strips (bioMérieux, Hazelwood, MO). Indole spot tests (Anaerobe Systems, Morgan Hill, CA), E-testTM (AB Biodisk, Piscataway, NJ) and fermentation acid production determined via gas chromatography (Hinton et al., 1990) were also used in this analysis.

PCR to confirm transfer of resistance genes Bacteria were lysed with equal volume of 0.2% (w/v) of Triton X-100 and heated to boiling at 100°C for 5 min in water bath, allowed to cool and subsequently used as templates for PCR. Specific primers for the following genes: ermB, ermC, ermF, ermG and ermQ (see Table 1) were used for amplifications as previously published (Bendle et al., 2004; Frye et al., 2006; Löfmark et al., 2006; Perrin-Guyomard et al., 2005). Amplification was carried out on a MJ thermocycler Model PTC200 (Fisher Scientific, Hampton, NH) using the following conditions: 5 min at 94°C; 35 cycles of 94°C for 1 min, 55 °C for 1 min and 72 °C for 2 min. All PCR products were analyzed by gel electrophoresis (1% agarose in 1x TAE buffer), stained with ethidium bromide and visualized by UV light.

Sizes of products were determined by comparing them with a 100 bp ladder (New England Biolabs, Ipswich, MA).

agar (Anaerobe Systems, Morgan Hill, CA), for detection of total anaerobes and M Enterococcus (ME) agar (Becton Dickinson and Company, Sparks, MD) for detection of Enterococcus spp. Inoculated agar Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

113

Table 1. Oligonucleotide primers used in PCR amplification of Enterococcus spp. isolate.

Gene

Primer Sequence (5’-3’)

ermB

F: TAACGACGAACCTGGCTAAAAT R: ATCTGTGGTATGGCGGGTAAG

ermC

F: AGTACAGAGGTGTAATTTCG R: AATTCCTGCATGTTTTAAGG

ermF

F: GCCAACAATGTTGTTGTT R: CGAAATTGTCCTGACCTG

ermG

F: ACTGCTGAATTGGTAAAGAGATG R:TGTGCTTATGTTGTAAGGTATGC

ermQ

F: CACCAACTGATATGTGGC R: CAATCTACACTAGGCATG

vatA

F: ATAATGAATGGAGCAAACCATAGGATG R: ACCAATCCAAACATCATTACC

Statistical analysis Log10 transformations of bacterial concentrations obtained from duplicate cultures were analyzed for main effects of culture type (RPCF versus FC culture) and day of cultivation on days 0 through the end of the experiment using a repeated measures analysis of variance (Statistix 9 Analytical Software, Tallahassee, FL). Samples yielding no detectable colonies of bacteria were assigned a limit of detection value of 1.3 log10 CFU mL-1 which was our limit of detection.

Comparison of means to values observed on day 0 for each of the respective cultures was accomplished using a Two Sided Dunnett’s Multiple Comparison procedure with P < 0.05.

Results and Discussion Continuous flow culture of intestinal microorganisms has been used to study competitive interactions between commensal and pathogenic microflora (Harvey et al., 2002; Hume et al., 2001; Nisbet et al., 2000) as well as to investigate potential fac114

Accession Number

Reference

AJ243541

Frye et al., 2006

NC001386

Frye et al., 2006

N/A

Bendle et al., 2004

N/A

Löfmark et al., 2006

N/A

Bendle et al., 2004

N/A

Perrin-Guyomard et al., 2005

tors affecting spontaneous acquisition of antibiotic resistance (Kim et al., 2005). In the present experiment, populations of total culturable anaerobes recovered on non-antibiotic supplemented Brucella blood agar, thus representing numbers of both tylosin-sensitive and –insensitive populations, did not differ (P = 0.30; SEM = 0.13) between the RPCF or FC cultures, ranging from 7.15 to 9.20 log10 CFU mL-1 throughout the experiment (Figure 1). When tested for main effects of day, concentrations of total culturable anaerobes were affected only marginally within the RPCF cultures (P = 0.041) and were not affected in the FC cultures (P = 0.058) (Figures 1). Moreover, effects of tylosin on total culturable anaerobes in the mixed populations were not readily apparent as viable cell counts observed after initiation of tylosin administration did not differ from those populations measured on day 0. Populations of total culturable tylosin-insensitive anaerobes were recovered on tylosin-supplemented Brucella blood agar and were observed in both RPCF and FC cultures even before administration of tylosin administration (Figure 1), likely due to the presence of the ermG-containing B. uniformis and the ermF-containing C. hathewayi en-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Figure 1. Recovery of total culturable anaerobes (A; containing both tylosin-sensitive and -insensitive bacteria) and of tylosin-insentive anaerobes (B) during continuous flow culture of mixed populations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine. Cultures were experimentally innoculated on day -7 with an exogenous tylosin-resistant Enterococcus faecium. Tylosin administration (100 µg mL-1) began after sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow). Bacteria were quantitatively recovered on Brucella blood agar supplemented without (A) or with 100 µg tylosin mL-1 (B). Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.29 and 0.30 for total anaerobes in RPCF and FC cultures, respectively; SEM = 0.43 and 0.35 for tylosin-insensitive anaerobes in RPCF and FC cultures, respectively).

12

Total anaerobes RPCF culture

A

Total anaerobes FC culture

Log10 CFU ml-1

10 8 6 4 2 0 12 -3

Log10 CFU ml-1

10

0

3

6

9

12

15

6

9

12

15

Tylosin-insensitive anaerobes RPCF culture Day of incubation Tylosin-insensitive anaerobes FC culture

*

B

*

8 6 4 2 0

-3

0

3

Day of incubation Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

115

Figure 2. Recovery of an experimentally introduced (on day -7) exogenous tylosin-resistant Enterococcus faecium during continuous flow culture of mixed populations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine.

Tylosin administration (100 µg mL-1) began after sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow). Bacteria were quantitatively recovered on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.60 and 0.58 for RPCF and FC cultures, respectively).

12

Tylosin-resistant Enterococcus faecium RPCF culture Tylosin-resistant Enterococcus faecium FC culture

Log10 CFU ml-1

10

*

8

*

*

*

6

*

*

*

*

*

* *

4

*

*

* *

*

*

*

* *

2 0

-3

0

3

6

9

12

15

Day of incubation

dogenous to the RPCF and FC cultures, respectively.

Concentrations of total culturable tylosin-insensitive anaerobes ranged from 6.30 to 9.02 log10 CFU mL-1 and exhibited similar concentration curves as those observed for total culturable anaerobes (Figure 1).

Consequently, a main effect due to the different cultures was not observed (P = 0.20; SEM = 0.17). Main effects of day of cultivation were observed on populations of total culturable tylosin-insensitive anaerobes recovered from the RPCF (P = 0.049) and the FC cultures (P = 0.027) but when compared to numbers measured on day 0, the total culturable tylosininsensitive anaerobes differed only on days 3 and 4 of tylosin treatment in the RPCF culture (Figure 1).

Populations of the exogenous tylosin-resistant 116

E. faecium, which characteristically developed into small, light pink colonies, were inoculated to achieve 6.95 log10 CFU mL-1 in the RPCF and FC cultures 7 days before initiation of tylosin administration. Numbers of the exogenous tylosin-resistant E. faecium declined rapidly soon after inoculation to near or below our level of detection (1.3 log10 CFU mL-1) by day 0 (Figure 2). A main effect of culture on numbers of exogenous tylosin-resistant E. faecium recovered on days 0 through 14 was not observed (P = 0.065; SEM = 0.26) although a main effect of day was observed for both cultures (P = 0.0001 and < 0.0001 for RPCF and FC cultures, respectively). In both cases, numbers of tylosin-resistant E. faecium began increasing soon after initiation of tylosin administration

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Figure 3. Recovery of an endogenous tylosin-resistant Enterococcus during continuous flow culture of mixed populations (in duplicate) of porcine gut bacteria obtained from a domestic (culture RPCF, circles) or a feral (culture FC, squares) swine. Cultures were experimentally innoculated on day -7 with an exogenous tylosin-resistant Enterococcus faecium. Tylosin administration (100 µg mL-1) began after sampling on day 0 and ceased after sampling on day 8 (as indicated by arrow).

Bacteria were quantitatively recovered on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Tests for differences in bacterial concentrations on days 0 through 14 were accomplished using a repeated measures analysis of variance; asterisks indicate daily concentrations that differ from concentrations observed on day 0 for the respective cultures (SEM = 0.73 and 0.95 for RPCF and FC cultures, respectively).

12

Tylosin-resistant endogenous Enterococcus spp. RPCF culture Tylosin-resistant endogenous Enterococcus spp. FC culture

Log10 CFU ml-1

10

*

8

* *

6

* *

*

* * *

*

*

4 2 0

-3

0

3

6

9

12

15

Day of incubation

and although numbers began to decline gradually after day 6 of treatment they remained higher than numbers recovered on day 0 for the duration of this experiment (Figure 2). These findings are consistent with those observed in our earlier study (Ramlachan et al., 2008) which, except for a 2 log10 lower inoculation of the tylosin-resistant E. faecium, was conducted similarly to this study. Thus, it appears that the tylosin resistance in this E. faecium may have been inducible only in the presence of the antibiotic or that in the absence of the selective pressure of tylosin; this tylosin-resistant E. faecium may be less competitive in the mixed populations.

At the beginning of the present experiment, populations of endogenous tylosin sensitive Enterococcus spp., which developed into large and deep red colonies, achieved concentrations of 7.63 ± 1.0 and 5.65 ± 1.85 log10 CFU mL-1 in the RPCF and FC cultures. Endogenous tylosin-insensitive Enterococcus spp., were not detected from among these populations prior to administration of tylosin. Beginning as soon as 2 days after the start of tylosin administration, however, numbers of tylosin-insensitive Enterococcus colonies exhibiting morphological characteristics indistinguishable from the endogenous Enterococcus spp. yet clearly distinguishable from

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

117

the exogenous tylosin-resistant E. faecium began increasing in both of the duplicate RPCF cultures and in one of the FC cultures. Although numbers of tylosin-insensitive Enterococcus recovered on days 0 through 14 did not differ between the RPCF and FC cultures (P = 0.067, SEM = 0.65), a significant effect of day of cultivation was observed for the RPCF cultures (P < 0.0001) but not for the FC cultures (P = 0.500) (Figure 3). These populations, which we suspected were derived from the endogenous population, achieved a maximum concentration in the RPCF cultures after 7 days of treatment and persisted at > 6.00 log10 CFU mL-1 even during withdrawal (Figure 3). Populations of tylosin-insensitive Enterococcus spp. similarly indistinguishable from the endogenous Enterococcus spp. emerged in the FC culture but not until after 7 days of tylosin administration (Figure 3). The population in the FC culture persisted during the tylosin withdrawal period but at a much lower density than those in the RPCF cultures (Figure

3). Further tests of representative isolates confirmed that these Enterococcus spp. identified as E. faecalis from the RPCF cultures and as E. hirea from the FC culture, were indeed tylosin-resistant. Moreover, PCR amplification of DNA extracted from the endogenous tylosin-resistant Enterococcus spp. from both RPCF and FC cultures produced PCR products of the expected size and sequence of the ermB gene amplicon obtained for the exogenous E. faecium (Figure 4). However, PCR products for ermC, ermF, ermG and ermQ were not detected from these endogenous tylosin-resistant Enterococcus spp. These results suggest that the endogenous enterococci had acquired resistance to tylosin via acquisition of the ermB gene from E. faecium. Whereas it is attractive to speculate that this acquisition occurred most simply via direct genetic exchange between these Gram-positive bacteria, we cannot exclude the possibility of other bacterial hosts may have served as intermediaries in this transfer.

Figure 4. A PCR product was obtained for ermB (311bp) at the expected size for select colonies of Enterococcus faecium (lane 2), Enterococcus hirea from FC (lane 4) and Enterococcus faecalis from RPCF (lane 5). All colonies were grown on M Enterococcus agar supplemented with 100 µg tylosin mL-1. Colonies tested at the start of the experiment showed no evidence that Enterococcus spp. from the FC (lane 1) or the RPCF (lane 7) possessed the ermB gene. Lanes 3 and 6 are the marker lanes illustrating the product obtained to be approximately 311 bp.

1 118

2

3

4

5

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

6

7

In conclusion, results from this study showed that tylosin administration differentially promoted enrichment of tylosin-insensitive bacterial populations within continuous flow cultures of mixed populations of gut bacteria derived from gut contents of a traditionally reared domesticated pig (RPCF) and a feral pig (FC). In the initial absence of the selective pressure of 100 µg tylosin mL-1, populations of an introduced exogenous tylosin-resistant E. faecium declined and did not reappear at substantial numbers until after the initiation of tylosin administration. Conversely, populations of endogenous tylosin-resistant Enterococcus spp., while initially absent or at undetectable concentrations in the mixed culture populations, were enriched in cultures derived from both the domestic and feral pig. However, once enriched the endogenous tylosin-resistant Enterococcus populations persisted even during withdrawal of the selective pressure of tylosin. Results from our study also provided evidence that at 100 µg tylosin mL-1, genetic transfer of the tylosin resistance occurred between the exogenous E. faecium introduced to the cultures and the endogenous Enterococcus spp., as the resistance gene, known as ermB, was found in the newly-resistant endogenous Enterococcus spp. These findings have implications for transfer of antibiotic resistance in other species, showing that even in feral populations which can be assumed to have low levels of previous antibiotic exposure; resistance can be obtained in endogenous bacterial populations after exposure to bacterial strains with transferrable resistant genes.

Acknowledgements We thank Matthew Quattrini for his expert technical assistance.

References Aarestup, F. M. 2005. Veterinary drug usage and antimicrobial resistance in bacteria of animal origin.

Basic Clin. Pharmacol. Toxicol. 96:271-281.

Aarestup, F. M., and B. Carstensen. 1998. Effect of tylosin used as a growth promoter on the occurrence of macrolide-resistant enterococci and staphylococci in pigs. Microb. Drug Resist. 4:307-312.

Barnes, E. M., C. S. Impey, and B. J. H. Stevens. 1979.

Factors affecting the incidence of and anti-salmonella activity of the anaerobic cecal flora of the young chick. J. Hygiene 82:263-283.

Bendle, J. S., P. A. James, P. M. Bennett, M. B. Avison, A. P. MacGowan, and K. M. Al-Shafi. 2004. Resistance determinants in strains of Clostridium difficile from two geographically distinct populations.

Int. J. Antimicrob. Agents 24:619-621.

Chee-Sanford, J. C., R. I. Aminovm, I. J. Krapac, N. Garrigues-Jeanjean, and R. I. Mackie. 2001. Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities. Appl. Environ. Microbiol.

67:1494-1502.

Chopra, I., and M. Roberts. 2001. Tetracycline resistance: mode of action, applications, molecular biology, and epidemiology of resistance. Microbiol.

Mol. Biol. Rev. 65:232-260.

Frye, G. J., T. Jesse, F. Long, G. Rondeau, S. Porwollik, M. McClelland, C. R. Jackson, M. Englen, and P. J. Fedorka-Cray. 2006. DNA microarray detection of antimicrobial resistance genes in diverse bacteria. Int. J. Antimicrob. Agents 27:138-151.

Gaynor, M., and A.S. Mankin. 2003. Macrolide antibiotics: binding site, mechanism of action, resistance. Curr. Top. Med. Chem. 3:949-961.

Harvey, R. B., R. E. Droleskey, M. E. Hume, R. C. Anderson, K. J. Genovese, K. Andrews, and D.J. Nisbet. 2002. In vitro inhibition of Salmonella enterica serovars Choleraesuis and Typhimurium, Escherichia coli F-18, and Escherichia coli O157:H7 by a porcine continuous-flow competitive exclusion culture. Curr. Microbiol. 45:226-229.

Hume, M. E., D. J. Nisbet, S. A. Buckley, R. L. Ziprin, R. C. Anderson, and L. H. Stanker. 2001. Inhibition of in vitro Salmonella Typhimurium colonization in porcine cecal bacteria continuous-flow competitive exclusion cultures. J. Food Prot. 64:17-22.

Jackson, C. R., P. J. Fedorka-Cray, J. B. Barrett, and S. R. Ladely. 2004. Effects of tylosin use on erythromy-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

119

cin resistance in enterococci isolated from swine.

Appl. Environ. Microbiol. 70:4205-4210.

Karlsson, M., C. Fellström, K.-E. Johansson, and A. Franklin. 2004. Antimicrobial resistance in Brachyspira pilosicoli with special reference to point mutations in the 23S rRNA gene associated with macrolide and lincosamide resistance. Microbial Drug Resist. 10:204-208.

Kim, W. K., N. Karabasil, S. Bulajic, K. D. Dunkley, T. R. Callaway, T. L. Poole, S. C. Ricke, R. C. Anderson, and D. J. Nisbet. 2005. Comparison of spontaneous antibiotic frequency of Salmonella Typhimurium growth in glucose amended continuous culture at slow and fast dilution rates. J. Environ. Sci. Health, Part B 40:475-484.

Löfmark, S., C. Jernberg, J. K. Jansson, and C. Edlund. 2006. Clindamycin-induced enrichment and long-term persistence of resistant Bacteroides spp. and resistance genes. J. Antimicrob. Chemother.

58:1160-1167.

Nisbet, D. J., R. C. Anderson, D. E. Corrier, R. B. Harvey, and L. H. Stanker. 2000. Modeling the survivability of Salmonella typhimurium in the chicken cecae using an anaerobic continuous-culture of chicken cecal bacteria. Microb. Ecol. Health Dis. 12:42-47.

Perrin-Guyomard, A., C. Soumet, R. Leclercq, F. Doucet-Populaire, and P. Sanders. 2005. Antibiotic susceptibility of bacteria isolated from pasteurized milk and characterization of macrolide-lincosamide-streptogramin resistance genes. J. Food Prot. 68:347-52.

Poole, K. 2005. Efflux-mediated antimicrobial resistance. J. Antimicrob. Chemother. 56:20-51.

Ramlachan, N., R. C. Anderson, K. Andrews, R. B. Harvey, and D. J. Nisbet. 2008. A comparative study on the effects of tylosin on select bacteria during continuous flow culture of mixed populations of gut microflora derived from a feral and a domestic pig. Foodborne Path. Dis. 5:21-31.

Ramlachan, N., R. C. Anderson, K. Andrews, G. Laban, and D. J Nisbet. 2007. Characterization of an antibiotic resistant Clostridium hathewayi strain from a continuous flow exclusion chemostat culture derived from the cecal contents of a feral pig.

120

Anaerobe 13:153-160.

Robinson, I. M., M. J. Allison, and J. A. Bucklin. 1981.

Characterization of the cecal bacteria of normal pigs. Appl. Environ. Microbiol. 41:950-955.

Stanton, T. B., and W. C. Stoffregen. 2004. Tetracycline resistant bacteria in organically raised and feral swine. 104th American Society for Microbiology General Meeting. (Abstr.# Z-029).

Wang, Y., G. R. Wang, N. B. Shoemaker, T. R. Whitehead, and A. A. Salyers. 2005. Distribution of the ermG gene among bacterial isolates from porcine intestinal contents. Appl. Environ. Microbiol.

71:4930-4934.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Sugar Recovery from the Pretreatment/Enzymatic Hydrolysis of High and Low Specific Gravity Poplar Clones A. C. Djioleu1, A. Arora2, E. M. Martin1, J. A. Smith1, M. H. Pelkki3, and D. J. Carrier1 Department of Biological and Agricultural Engineering, University of Arkansas, 203 Engineering Hall, Fayetteville, AR 72701 2 Division of Microbiology, Indian Agricultural Research Institute, New Delhi, India 110012 3 School of Forest Resources, University of Arkansas at Monticello, Monticello, AR 71656 1

ABSTRACT The objective of this study was to compare the bark and wood of low, non-irrigated, and high, irrigated, specific gravity poplar clones for overall sugar recovery and sugar-degradation inhibitory byproducts production when pretreated with dilute acid (160°C for 60 min in unstirred batch stainless steel reactors), coupled to enzymatic hydrolysis. Overall, the combined xylose and glucose recoveries for low and high specific gravity bark were 18.65 and 24.82 (g of sugar per 100 g of biomass), respectively, and 37.04 and 35.53 (g of sugar per 100 g of biomass) for low and high specific gravity wood, respectively. Total sugar yields of 62 and 57% were calculated for low and high specific gravity wood, while sugar yields of 49 and 71% were obtained for low and high specific gravity bark. The glucose recovery was 48% for high specific gravity wood and 55% for low specific gravity wood. The combined glucose and xylose content of low and high specific gravity poplar wood was similar; yet, the glucose recovery in low specific gravity wood was higher by 7%. The average ratio of sugar-derived inhibitory byproducts to potential sugars in high and low specific gravity wood was 0.34; a similar value for bark was 0.66. Given the negative effects of inhibitory byproducts on the bioprocessing chain, it may be prudent to omit bark when saccharifying poplar. The low specific gravity clone displayed two advantages: 1) higher glucose recovery; and, 2) the ability to be cultivated under dry land conditions. In summary, low specific gravity poplar clones, with rainfall as the sole water supply, could prove to be viable feedstock sources.

Keywords: Poplar, dilute acid pretreatment, enzymatic hydrolysis, xylose, glucose, furfural, hydroxymethylfurfural, formic acid, and acetic acid.

Agric. Food Anal. Bacteriol. 2:121-131, 2012

Correspondence: D. J. Carrier carrier@uark.edu Phone: 479-575-2542; Fax: 479-575-2689

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

121

Introduction The development of second generation bioethanol from lignocellulosic biomass shows significant promise for the conservation of petroleum crude and movement toward energy security. Cellulose and hemicellulose, the most abundant constituents of lignocellulosic biomass can be converted into fermentable sugars for the production of ethanol. Different forestry products and residues, agricultural byproducts, grasses, food processing and municipal solid wastes can serve as lignocellulosic feedstock. Eastern cottonwood (Populus deltoides) is a prevalent understory species in the southeast United States. It is fast-growing, drought resistant, and has the potential for becoming an economically valuable feedstock for the production of cellulosic biofuels (Kim et al., 2009; Sannigrahi and Ragauskas, 2010).

Sannigrahi and Ragauskas (2010) report that poplar wood contains 39 to 49% (average 44%) glucan, 13 to 19% (average 15%) xylan and 17 to 29% (average 24%) lignin, on a dry weight basis. The pretreatment of lignocellulosic biomass and subsequent enzymatic hydrolysis of cellulose to fermentable sugars are the most cost intensive steps in converting biomass to ethanol. Among the existing pretreatment technologies, dilute acid pretreatment is preferred since it removes a large fraction of the xylan and opens pores for subsequent enzymatic hydrolysis of the cellulose (Sannigrahi et al., 2011).

Martin et al. (2011) reported on the recovery of xylose, the main component of hemicellulose, from dilute acid pretreated high and low specific gravity poplar clones. Pretreating in 1% dilute acid for 100 min in non-stirred reactors resulted in xylose recoveries of 55 and 50% for low and high-density poplar clones. The low specific gravity clone was cultivated under dry land conditions. These findings are important both environmentally and economically because not only would the omission of irrigation save water, but a lack of irrigation would also reduce the cost of transporting and/or pumping water to planting locations. This study is a continuation of past research to further evaluate the saccharification efficiency of high and low specific gravity hybrid pop122

lar wood. The goal of this work is to maximize the yield of hemicellulosic sugar, xylose, from dilute acid pretreatment, and to link pretreatment to enzymatic hydrolysis to yield the cellulosic sugar, glucose. In addition, a mass balance of the monomeric sugars, including sugar-degraded inhibitory byproducts, was prepared. An analysis of these data was used to determine differences in sugar recovery from the high and low specific gravity clones, and to couple the information with the decrease in sugar recovery due to the production of degradation compounds caused by the detrimental effects of dilute acid pretreatment.

Materials and Methods Poplar feedstock The cottonwood clones were from Eastern Texas.

The clones were grown at the University of Arkansas Pine Tree Branch Station; the 14 year-old mid-rotation stands were harvested and used for this study.

The high specific gravity clones, S13C20, were irrigated during the first 10 yr growth and had a specific gravity of 0.48. The low specific gravity clones, S7C15, were not irrigated and had a specific gravity of 0.40.

Percent moisture/solid determination Wood chips were ground to a 20 mesh particle size using a Wiley Mini Mill (Torget et al., 1988). Ground samples (approximately 0.5 g) were analyzed for percent moisture/solid content using an Ohaus MB45 Moisture Analyzer (Parsippany, NJ).

Pretreatment In preparing the biomass, one gram of 20 mesh material and 20 mL of 0.98% H2SO4 were added to thick-walled stainless steel reactors, (interior diameter 14.22 mm, wall thickness 5.59 mm, length 200 mm, for a total chamber volume capacity of 32 ml) and then placed in a fluidized sand bath (Techne In-

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

corporated, Burlington, NJ) at 160 °C for 60 min with an air flow of 3.0 cubic foot per min.

The volume of the resulting hydrolysate was measured and recorded for quantification. Samples were filtered through #1 Whatman filter paper, using a Buchner funnel. Liquid fractions were analyzed by high pressure liquid chromatography (HPLC) for the presence of degradation compounds such as: furfural, hydroxmethylfurfural (HMF), formic acid and acetic acid prior to neutralizing. After neutralizing with calcium carbonate, an aliquot of the liquid fraction was analyzed by HPLC for carbohydrates. To aid the enzymatic hydrolysis, the recovered solids were washed with 30 mL of Millipore water, stirred for 30 min, and filtered (Balan et al., 2009; Kumar and Wyman, 2009). Liquid fractions from filtration were analyzed by HPLC for both carbohydrates and inhibitory compounds.

Enzymatic hydrolysis

tered through a 0.2 μm syringe filter, and analyzed for carbohydrate content with a Waters 2695 HPLC equipped with a Shodex SP-G pre-column and SP0810 column (heated to 85 ºC) with water as the eluent at a flow rate of 0.2 mL/min. Carbohydrates were detected with a Waters 2414 Refractive Index Detector. This method was adapted from National Renewable Energy Laboratory (Sluiter et al., 2009a).

In detecting inhibitory compounds, liquid fractions (that had not been neutralized) were filtered through a 0.2 μm syringe filter and analyzed by Waters Alliance 2695 Separation Module, equipped with an Aminex HPX-87H ion exchange column (300 mm X 7.8 mm), heated at 55 °C. Samples were run at a flow rate of 0.6 mL/min and compounds were detected

by Waters 2996 Photodiode Array Detector at 280 nm for furfural and HMF and 210 nm for formic acid and acetic acid.

Statistical Analysis

To prepare for enzymatic hydrolysis, one gram of solids, 500 μL of Accellerase ®1500 (Genencor) as specified by the manufacturer, 5 mL of citrate buffer, pH 4.8, and up to 10 mL of Millipore water were added to 50 mL amber bottles. The bottles were placed in a 55 °C shaking water bath for 48 h. After completion of enzymatic hydrolysis, the samples were boiled to denature the enzymes; the pH was adjusted to neutral, and the samples were analyzed for carbohydrate content.

Compositional Analysis Procedure for compositional analysis of the biomass followed those established in the technical reports from the National Renewable Energy Laboratory (NREL) (Sluiter et al., 2008ab; Sluiter et al., 2011).

Poplar biomass, either wood or bark, was dried in a 120°C oven overnight prior to analysis.

HPLC analysis Liquid aliquots from pretreatment, enzymatic hydrolysis, and compositional analysis were fil-

Calculations of carbohydrate and degradation compounds (HMF, furfural, formic acid, and acetic acid) were obtained using Microsoft Office Excel 2007. Analysis of the variance (ANOVA) was determined using JMP 9.0, LSMeans Differences Student’s t, with α= 0.050.

Results and Discussion The compositional analysis of oven-dried high and low specific gravity bark and wood is presented in Table 1. The percent solids for the compositional analysis were 96% and 97%, respectively, for high and low gravity poplar wood. Extractive concentrations were similar for low and high specific gravity bark; and for low and high specific gravity wood. The average xylose content was 12.3% for high specific gravity wood and 13.3% for low specific gravity wood.

The average content was not significantly different for the two wood densities. The average glucose content was 46.3% for low specific gravity wood, and 49.7% for high specific gravity wood. Overall, these values are similar to values previously reported by

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

123

Table 1. Compositional analysis of wood and bark from low and high specific gravity poplar Compositional Analysis, g per 100 g of Biomass Biomass

Glucose

Xylose

Extractives

Lignin/Ash

Ash

Low wood

46.3 ± 2.57

13.3 ± 1.08

1.24 ± 0.26

18.48 ± 1.37

0.58 ± 0.13

High wood

49.7 ± 0.95

12.3 ± 0.26

1.48 ± 0.27

16.44 ± 1.73

0.37 ± 0.06

Low bark

25.8 ± 1.07

12.3 ± 0.87

8.58 ± 0.00

34.71 ± 2.46

4.20 ± 0.06

High bark

20.8 ± 2.44

14.2 ± 2.89

6.60 ± 0.00

37.89 ± 2.49

4.64 ± 0.39

Figure 1. Glucose and xylose recovery based on compositional analysis of low and high specific gravity wood (A) and low and high specific gravity bark (B) after dilute acid pretreatment and enzymatic hydrolysis 120

A

Percent Recovery

100 80 Low wood

60

High wood 40 20 0 Glucose

Xylose

120

B Percent Recovery

100 80 Low bark

60

High bark 40 20 0 Glucose

124

Xylose

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Table 2. Carbohydrate recovery from wood and bark in low and high specific gravity poplar Recovery of Sugars, g per 100 g of Biomass Pretreatment/Wash Glucose

Xylose

Enzymatic Hydrolysis Glucose

Xylose

Total

Low Wood

3.53±0.20

11.35±1.85

21.95±1.42

0.21±0.02

37.04

High Wood

4.01±0.22

11.73±0.31

19.72±0.98

0.07±0.03

35.53

Low Bark

6.21±1.00

7.18±2.26

3.43±0.83

1.83±1.00

18.65

High Bark

6.57±0.73

8.94±3.02

6.40±0.55

2.91±0.89

24.82

Kim et al. (2009), Min et al. (2011), Sannigrahi et al.

(2010), and the United States Department of Energy (2010). The bark composition was very different than the composition of wood. Bark had on average approximately 25 g per 100 g of biomass less glucose than that of wood. The low specific gravity clone’s bark was thick and rough, in comparison to the high specific gravity clone’s bark that was thinner and smooth.

Martin et al. (2011) reported that dilute acid pretreatment of wood at 140ºC from the lower specific gravity clone yielded the highest average xylose recovery of 56%. In this work, dilute acid pretreatment of high specific gravity and of low specific gravity clones at 140ºC and 160ºC resulted in xylose recoveries of 49 and 45%, respectively, which is lower than previously reported. Martin et al. (2011) did not integrate pretreatment and enzymatic hydrolysis, and overall carbohydrate recoveries were not calculated.

Moreover, carbohydrate yields were based on baseline composition data provided by Kim et al. (2009).

In the present study, the pretreatment and hydrolysis steps were integrated and calculations were based on composition values presented in Table 1.

Of the pretreatment conditions explored by Martin et al. (2011), it was determined that the optimum time/temperature parameters for dilute acid pretreatment, allowing for maximum glucose recovery in subsequent enzymatic hydrolysis of poplar wood, were 160°C for 60 min in 1% dilute acid. Xylose and glucose recoveries from low and high specific grav-

ity poplar wood and bark are presented in Figure 1.

Monomeric sugar recovery was based on dry weight percentages of the theoretical compositional analysis (average percent solid of high specific gravity wood and low specific gravity wood prior to pretreatment was taken as 90%). Relating this to the percent recovery after dilute acid pretreatment and enzymatic hydrolysis, the xylose recovery was approximately 96% for high specific gravity and 87% for low specific gravity wood. The glucose recovery was 48% for high specific gravity wood, and 55% for low specific gravity wood. Results from this work indicated that glucose yields from low specific gravity wood were significantly higher than from high specific gravity wood. Glucose recovery was adversely affected by the high percentages of degradation products, particularly formic acid. Formic acid composition in low specific gravity wood pretreatment hydrolysates was as high as 15%, and approximately 14% in high specific gravity wood pretreatment hydrolysates.

Martin et al. (2011) also reported that the highest xylose recovery from the dilute acid pretreatment of low specific gravity bark was 31%, observed at 160°C for 60 min. In varying the pretreatment temperatures between 140°C and 200°C resulted in recoveries between 10 and 28%. The present work reports that dilute acid pretreatment at 160°C for 60 min, coupled to enzymatic hydrolysis, resulted in higher overall xylose and glucose recoveries. Specifically, the overall glucose and xylose recoveries were 37 and 73%, respectively, for low specific gravity bark and 62 and

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

125

84%, respectively, for high specific gravity bark. Thus, as presented in Table 2, the combined xylose and glucose recoveries for low specific gravity and high specific gravity bark were 18.65 and 24.82 (g of sugars per 100 g of biomass), respectively; and, 37.04 and 35.53 (g of sugars per 100 g of biomass) for low and high specific gravity wood, respectively.

Poplar is touted as a potentially important woody energy crop, and many groups have reported sugar recovery from this feedstock. Negro et al. (2003), using steam explosion pretreatment at 210°C for 4 min coupled to enzymatic hydrolysis, reported recoveries of 60 and 41% for glucose and xylose, respectively. Pan et al. (2006, 2007) investigated the conversion of a commercially available poplar clone NM-6, Populus nigra X Populus maximowiczii, using ethanol organosolv pretreatment with hot aqueous ethanol. This process was implemented to not only recover usable sugars for fermentation to ethanol, but also to obtain a range of valuable lignin based co-products. At 60 min 180°C pretreatment with 1.25% sulfuric acid and 60% ethanol, the reported yields were 82% for glucose and 72% for xylose, based on initial biomass composition. The effect of various pretreatment technologies combined with different plant cell wall hydrolyzing enzyme concentrations was reported by the Consortium for Applied Fundamentals and Innovation (CAFI), sharing identical characterized poplar feedstock, thus, enabling the comparison of processing technologies. The series of papers were reported in one single 2009 issue of Biotechnology Progress. Balan et al. (2009) reported glucan recoveries of 93% and xylan recoveries of 65%, when using ammonia fiber expansion (AFEX) pretreatment coupled to enzymatic hydrolysis. Pretreatment conditions for optimum results were a temperature of 180°C, 2:1 ammonia to biomass loading, 23% moisture for a 30 min treatment, with biomass milled to 50 mm. Using steam pretreatment at 200°C, for 5 min with 3% SO2, Bura et al.

(2009) recovered 100% of the glucose and 89% of the xylan. Kumar and Wyman (2009) compared a number of the saccharification conditions and maximum xylose recoveries using AFEX, ammonia recycled percolation (ARP), dilute acid, lime, controlled pH, and 126

sulfur dioxide (SO2) pretreatments also, linked to enzymatic hydrolysis. The maximum xylose recoveries were 72.3, 94.6, 70.9, 72.9, 105.5 and 85.3 %, respectively for the listed pretreatment techniques. Similarly, Kumar and Wyman (2009) reported maximum glucose recoveries of 61.1, 77.0, 89.8, 73.1, 65.9 and 90.8 %, respectively for AFEX, ammonia recycled percolation (ARP), dilute acid, lime, controlled pH and sulfur dioxide (SO2) pretreatments linked to enzymatic hydrolysis. Importantly, the work of Kumar and Wyman (2009) reported that for the above list of leading pretreatments, the maximum sugar yields were 64.0, 79.6, 84.9, 71.9, 76.1 and 89.4 %, respectively, indicating that SO2 pretreatment maximized sugar recovery. In this work, total sugar yields of 62 and 57% were calculated for low and high specific gravity wood, while sugar yields of 49 and 71% were determined for low and high specific gravity bark.

Results reported in this work showed that the calculated recovery is similar to what was obtained with AFEX, but lower than what can be derived from dilute acid and SO2 pretreatments (Kumar and Wyman, 2009). However, this work shows that more sugars are recovered from low specific gravity poplar.

As illustrated by the CAFI work, there are a number of available pretreatment technologies; however, the dilute acid pretreatment, although it contains many drawbacks, is more than likely to be adopted at the deployment scale because of its low cost and ease of use (Sannigrahi et al., 2011). Dilute acid pretreatment has been used for hardwoods (Esteghlalian et al., 1997; Jung et al., 2010; Lloyd and Wyman, 2005; Lu et al., 2009; Martin et al., 2010; Martin et al., 2011; Schell et al., 2003; Torget et al. 1998; Wyman et al., 2005; Wyman et al., 2008). However, dilute acid pretreatment, which involves the use of high temperatures, is a harsh treatment that produces inhibitory byproducts, including acetic acid, furfural, hydroxymethylfurfural (HMF), and formic acid (Palmqvist and Hahn-Hagerdal, 2000). These degradation chemicals reduce the sugar yields as well as ethanol yields by 50 to 60% (Du et al., 2010). Shuai, et al. (2010) compared dilute acid pretreatment to sulfur dioxide-catalyzed steam explosion (SPROL), using the softwood, spruce, as the biomass feedstock. Known inhibitors

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Figure 2. Pretreatment hydrolysate from low specific gravity wood (A) and low specific gravity bark (B). UV Chromatogram was acquired at 210 nm. The retention times of formic acid, acetic acid, HMF and furfural were approximately 13, 15, 30 and 44 min, respectively A

B

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

127

Table 3. Inhibitory products detected in low and high specific gravity poplar wood and bark dilute acid pre-hydrolysates

Inhibitors in Prehydrolysates, g per 100 g of Biomass Biomass

HMF

Furfural

Formic acid

Acetic acid

Low wood

0.13±0.24

1.90±0.21

15.01±2.67

4.46±0.92

High wood

0.12±0.00

1.72±0.06

13.59±0.18

4.88±0.05

Low bark

0.46±0.11

2.66±0.64

14.08±1.62

5.21±0.76

High bark

0.54±0.12

2.49±0.51

16.71±1.86

6.17±0.60

were 35% lower with SPORL treatment compared to dilute acid treatment. However, SPORL pretreatments are costly and difficult to scale-up, further promoting the use of dilute acid pretreatment.

Xylose is degraded into furfural, and further into formic acid, while glucose is degraded into HMF, and further degraded into formic acid and levulinic acid (Palmqvist and Hahn-Hagerdal, 2000). In addition, mannose and galactose go through similar degradation pathways as glucose (Palmqvist and HahnHagerdal, 2000). Therefore, the yields of formic acid during dilute acid pretreatment would increase not only from degradation of xylose and glucose, but also from the degradation of mannose and galactose. Figure 2 presents a typical chromatogram from wood and bark dilute acid hydrolysates, where formic acid, acetic acid, HMF and furfural had retention times of 13, 15, 30 and 44 min, respectively. Unfortunately, many of the compounds seen in the UV trace in Figure 2 remain unidentified. The intensity of the unidentified 6.1 min peak in the bark UV trace is over 1 absorbance units, dwarfing all of the other peaks in the chromatogram. Moreover, the work of Du et al.

(2010) illustrates that a UV trace does not detect all of the compounds that are present. While comparing the chromatograms of dilute acid pretreatment corn stover prehydrolysates, Du et al. (2010) detected 38 compounds when using mass spectrometry and only two compounds with UV detection. Thus, the chromatograms presented in Figure 2 may not 128

fully illustrate the entire slate of compounds present in poplar dilute acid hydrolysates.

Table 3 represents the calculated yields, of inhibitory products (g per 100 g of biomass) that were generated from wood and bark when pretreating with dilute acid. The values in Table 3 values were calculated by tying the concentrations of inhibitors in the prehydrolysates (determined by HPLC) to the volume of hydrolysate and masses of the pretreated feedstock. Of the four monitored inhibitory products, formic acid displayed the highest concentration, ranging from 14 to 15 g per 100 g of hydrolyzed biomass. Formic acid is a known enzymatic hydrolysis inhibitor (Cantarella et al., 2004). Hodge et al. (2008) illustrated unequivocally that if inhibitory products, such as formic acid, were not removed from the pretreated biomass, the reactor could not be loaded with more than 15% (v/v). By washing the pretreated biomass with three volumes of water, to remove the inhibitory products from the pretreated corn stover biomass, Hodge et al. (2008) showed that the reactor could be loaded to 30% (v/v), illustrating the importance of removing or minimizing inhibitory products.

Similarly, Kumar and Wyman (2009) reported that the enzymatic hydrolysis step could be enhanced by 10% when washing the dilute acid pretreated biomass prior to treatment with enzymes. In this work, the ratio of inhibitory compounds (Table 3) to potential sugars in wood and bark (Table 2) was 0.34 and 0.66 (g per g), respectively. Given the negative

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

effects of the inhibitory compounds on the bioprocessing chain, as highlighted by Hodge et al. (2008) and Kumar and Wyman (2009), it may be prudent to omit bark when saccharifying poplar.

From a sustainability perspective, growing feedstock with minimum amounts of water can be a substantial advantage. The low specific gravity poplar was cultivated in southern Arkansas for 15 years, using rainfall as the sole water supply. The data presented in this study highlight, in fact, that the low specific gravity clone yields 4% more carbohydrates than its high density irrigated counterpart. This increased carbohydrate yield could offset the greater growth observed in irrigated clones and will play a role in determining the total cost of carbohydrate production from poplar plantations. Data from this present study illustrate that non-irrigated low specific gravity clones displayed comparable feedstock characteristics to those of irrigated high specific gravity clones. The study presented by Negro et al.

(2003) was also concerned with water usage, and stated that Populus nigra is promising for south and central Europe, due to the high yield and drought resistance of this species.

Conclusions This study reports that non-irrigated 15 year-old low specific gravity poplar wood yielded comparable percentages of xylose, but significantly higher glucose percentage recovery, when pretreated with dilute acid coupled to enzymatic hydrolysis than its irrigated high specific gravity counterpart. Although this is a preliminary study, specific gravity may be an important property to predict the saccharification potential of poplar biomass.

Acknowledgements The authors would like to thank the University of Arkansas, Division of Agriculture, and the Department of Biological and Agricultural Engineering, for financial assistance. The authors would also like to

acknowledge National Science Foundation award no. 0828875; Department of Energy award no.

08GO88035 for the pretreatment equipment and support of EMM; and CRREES National Research Initiative award no. 2008-01499 for the HPLC instrument. The authors are very grateful to Dr. Ed Clausen for critically reviewing this manuscript.

References Balan, V., L. da Costa Sousa, S. P. S. Chundawat, D. Marshall, L. N. Sharma, C. K. Chambliss, and B. E. Dale. 2009. Enzymatic digestibility and pretreatment degradation products of AFEX-treated hardwoods (Populus nigra). Biotechnol. Prog. 25:365375.

Bura, R., R. Chandra, and J. Saddler. 2009. Influence of xylan on the enzymatic hydrolysis of steam-pretreated corn stover and hybrid poplar. Biotechnol.

Prog. 25:315-322.

Cantarella, M., L. Cantarella, A. Gallifuoco, A. Spera, and F. Alfani. 2004. Effect of inhibitors released during steam-explosion treatment of poplar wood on subsequent enzymatic hydrolysis and SSF. Biotechnol. Prog. 20:200-206.

Du, B., L. Sharma, C. Becker, S. Chen, R. Mowery, P. van Walsum P and K. Chambliss. 2010. Effect of varying feedstock-pretreatment chemistry combinations on the formation and accumulation of potentially inhibitory degradation produces in biomass hydrolysates. Biotechnol. Bioeng. 107:430440.

Esteghlalian, A., A. G. Hashimoto, J. J. Fenske, and M. H. Penner. 1997. Modeling and optimization of the dilute-sulfuric acid pretreatment of corn stover, poplar and switchgrass. Bioresour. Technol.

59:129-136.

Hodge, D., N. Karim, D. Schell and J. Macmillan.

2008. Soluble and insoluble solids contributions to high-solids enzymatic hydrolysis of lignocellulose.

Bioresour. Technol. 99:8940-8948.

Jung, S., M. Foston, M. C. Sullards, and A. J. Ragauskas. 2010. Surface characterization of dilute acid pretreated Populus deltoides by ToF-SIM. Energy

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

129

Fuels 24:1347-1357.

Kim, Y., N. S. Mosier, and M. R. Ladisch. 2009. Enzymatic digestion of liquid hot water pretreated hybrid poplar. Biotechnol. Prog. 25:340-348.

Kumar, R., and C. E. Wyman. 2009. Effects of cellulose and xylanases enzymes on the deconstruction of solids from pretreatment of poplar by leading technologies. Biotechnol. Prog. 25:302-314.

Lloyd, T. A., and C. Wyman. 2005. Combined sugar yields for dilute sulfuric acid pretreatment of corn stover followed by enzymatic hydrolysis of the remaining solids. Bioresour. Technol. 96:1967-1977.

Lu, Y., R. Warner, M. Sedlak, N. Ho, and N. S. Mosier.

2009. Comparison of glucose/xylose cofermentation of poplar hydrolysates processed by different pretreatment technologies. Biotechnol. Prog.

25:349-356.

Martin, E. M., J. Duke, M. Pelkki, E. Clausen, and D. J. Carrier. 2010. Sweetgum (Liquidambar styraciflua L.): Extraction of shikimic acid coupled to dilute acid pretreatment. Appl. Biochem. Biotechnol. 162:1660-1668.

Martin, E., K. Bunnell, C. Lau, M. Pelkki, D. Patterson, E. Clausen, J. Smith, and D. J. Carrier. 2011. Hot water and dilute acid pretreatment of high and low specific gravity Populus deltoides clones. J. Ind. Microbiol. Biotechnol. 38:355-361.

Min, D., L. Quanzi, H. Jameel, V. Chiang, and H. Chang. 2011. Comparison of pretreatment protocols for cellulase-mediated saccharification of wood derived from transgenic low-xylan lines of cottonwood (P. trihocarpa). Biomass Bioenergy 35: 3514-3521.

Negro, M. J., P. Manzanares, I. Ballesteros, J. M. Oliva, A. Cabanas, and M. Ballesteros. 2003. Hydrothermal pretreatment conditions to enhance ethanol production from poplar biomass. Appl.

Biochem. Biotechnol. 105-108:87-100.

Palmqvist, E.and B. Hahn-Hagerdal. 2000. Fermentation of lignocellulosic hydrolysates. II: inhibitors and mechanisms of inhibition. Bioresour. Technol.

74:25-33.

Pan, X., N. Gilkes, J. Kadla, K. Pye, S. Saka, D. Gregg, K. Ehara, D. Xie, D. Lam, and J. Saddler. 2006. Bioconversion of hybrid poplar to ethanol and co130

products using an organosolv fractionations process: Optimization of process yields. Biotechnol.

Bioeng. 94:851-861.

Pan, X., D. Xie, K-Y Kang, S-LYoon, and J. N. Saddler. 2007. Effect of organosolv ethanol pretreatment variables on physical characteristics of hybrid poplar substrates. App. Biochem. Biotechnol.

137-140:367-377.

Sannigrahi, P., and A. J. Ragauskas. 2010. Poplar as a feedstock for biofuels: A review of compositional characteristics. Biofuels, Bioprod Biorefin. 4:209226.

Sannigrahi, P., D. H. Kim, S. Jung, and A. J. Ragauskas. 2011. Pseudo-lignin and pretreatment chemistry. Energy Environ. Sci. 4:1306-1310.

Schell, D. J., J. Farmer, M. Newman, and J. D. McMillan. 2003. Dilute-sulfuric acid pretreatment of corn stover in pilot-scale reactor – investigation of yields, kinetics, and enzymatic digestibilities of solids. Appl. Biochem. Biotechnol. 105:69-85.

Shuai, L., Q. Yang, J. Y. Zhu, F-C Lu, P. J. Weimer, J. Ralph, and X-J Pan. 2010. Comparative study of SPORL and dilute-acid pretreatments of spruce for cellulosic ethanol production. Bioresour. Technol.

101:3106-3114.

Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter, and D. Templeton. 2008a. Determination of sugars, byproducts, and degradation products in liquid fraction process samples. Laboratory Analytical Procedure, Technical Report NREL/TP-510-42623.

National Renewable Energy Laboratory, Golden, CO. Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter, and D. Templeton. 2008b. Determination of extractives in biomass. Laboratory Analytical Procedure, Technical Report NREL/TP-510-42619. National Renewable Energy Laboratory, Golden, CO. Sluiter, A., B. Hames, R. Ruiz, C. Scarlata, J. Sluiter, and D. Templeton. 2011. Determination of structural carbohydrates and lignin in biomass. Laboratory Analytical Procedure, Technical Report NREL/ TP-510-42618. National Renewable Energy Laboratory, Golden, CO. Torget, R., M. Himmel, K. Grohmann, and J. D. Wright. 1988. Initial design of a dilute sulfuric acid

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

pretreatment process for aspen wood chips. Appl.

Biochem. Biotechnol. 17:89-104.

United States Department of Energy. Energy Efficiency & Renewable Energy Biomass Program: Feedstock Composition and Property Database http:// www.afdc.energy.gov/progs/search3.cgi?14904.

Accessed June, 2010.

Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, and Y. Y. Lee. 2005. Coordinated development of leading biomass pretreatment technologies. Bioresour. Technol. 96:1959-1966.

Wyman, C. E., B. E. Dale, R. T. Elander, M. Holtzapple, M. R. Ladisch, Y. Y. Lee, C. Mitchinson, and J. N. Saddler. 2008. Comparative sugar recovery and fermentation data following pretreatment of poplar woody leading technologies. Biotechnol. Prog.

25:333-339.

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

131

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Culture dependent molecular analysis of bacterial community of Hazaribagh tannery exposed area in Bangladesh A. A. Maruf 1, 3, 5, M. M. Moosa1, 4, 5, S. M. M. Rashid 1,5, H. Khan2, S. Yeasmin1 Department of Genetic Engineering and Biotechnology, University of Dhaka, Dhaka 1000, Bangladesh.

2 Department of Biochemistry and Molecular Biology, University of Dhaka, Dhaka 1000, Bangladesh.

3 Present address: UChicago Research Bangladesh Ltd., House 338, Road 24, New DHOS, Mohakhali, Dhaka 1206, Bangladesh.

4 Present address: Department of Biochemistry and Molecular Biology, University of Dhaka, Dhaka 1000, Bangladesh.

5 Contributed equally to the study.

1

ABSTRACT Microbial diversity in tannery waste disposal sites was characterized in this research. The research work consisted of isolation and cultivation of microbes on laboratory media and the subsequent characterization of pure isolates. The 16S rRNA gene of isolated bacteria was analyzed for molecular characterization of bacterial diversity at those areas. 16S rRNA gene amplification was successful for sixteen isolates.

Restriction digestion of these amplified 16S rRNA genes by two different restriction enzymes, HinP1I and MspI, revealed six different restriction patterns of the 16S rRNA gene. Representative 16S rRNA genes of these six different patterns were selected for DNA sequencing to characterize these bacteria further. 16S rRNA genes of five of the representative bacterial colonies of the six selected patterns were successfully sequenced. The identified bacterial species included both gram positive and gram negative bacteria from the groups γ-proteobacteria and Firmicutes.

Keywords: Hazaribagh, Tannery, Bangladesh, Molecular diversity Agric. Food Anal. Bacteriol. 2:132-138, 2012

Introduction Leather, a traditional export item in Bangladesh, enjoys a good reputation worldwide for its quality (Sharif and Mainuddin, 2003). This sector plays a significant role in the economy of Bangladesh in terms of its contribution to export and domestic market (Sharif and Mainuddin, 2003). In Bangladesh, tanning Correspondence: S. Yeasmin, ysabina@univdhaka.edu; yeasmin. du@gmail.com Tel: +1 -229-386-3363 Fax: +1-229-86-3239

132

or the process of making leather is mostly carried out in the south-western region of Dhaka city, occupying 25 hectares of land at Hazaribagh, where about 90% of tannery industries of Bangladesh are located. Due to lack of appropriate waste management practices, both solid wastes and liquid effluents from these industries are deposited at different low-lying locations of Hazaribag without proper treatments (Zahid et al., 2006). Components of these wastes include rotten flesh, fat, blood and skin, toxic chemicals, dissolved lime, chromium sulfate, alkali, hydrogen

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

sulfide, sulfuric acid, bleach, dyes, oil, formic acid, heavy metals, suspended solids, organic matters and so on (Bhuiyan et al., 2011; Zahid et al., 2006).

Consequently, soil sediment, groundwater and surface water of nearby rivers (Buriganga and Turag) are polluted heavily through percolation of the leachate from these dumping sites (Zahid et al., 2006).

Despite the toxic chemical load, a number of bacterial species are found to be abundant in the microflora of tannery effluents (Lefebvre et al., 2006; Tripathi et al., 2011). While the details of the mechanism of resistance of this microflora to toxic chemicals are yet to be deciphered, three possible mechanisms are likely to operate separately or in combination: a) efflux systems can reduce toxic chemical loads (Mosqueda and Ramos, 2000; Nies and Silver, 1989; Nies and Silver, 1995); b) toxic chemicals can be degraded (Franco et al., 2005) or converted to less toxic forms (Basu et al., 1997; Fakruddin et al., 2009; Ilias et al., 2011; Masood and Malik, 2011; Rafiqullah et al., 2009); c) toxic chemicals can be sequestered into complex compounds (Nies, 1999) or compartments (Avery, 1995; Cooksey, 1993). The study of these microorganisms and/or their mode of resistance can lead to the development of novel biological methods of remediation of these toxic chemicals which can be less expensive compared to physicochemical remedial strategies (Farabegoli et al., 2004; Hasegawa et al., 2010; Sivaprakasam et al., 2008; Tripathi et al., 2011; Yan et al., 2011). This study aimed to characterize microbial contents of tannery effluent enriched environment of Hazaribagh region of Dhaka.

Materials and Methods Sample collection Samples were collected both from long-term and short time tannery waste disposal sites of Hazaribag tannery area to ensure proper representation of microbial community diversity. The sites of sample collection was categorized into four broad categories: a) short term tannery waste disposal site; b) long term tannery waste disposal site; c) submerged tannery

waste disposal site and d) edges of tannery waste disposal pond.

Sample preparation A 5 g waste sample was mixed with 30 mL distilled water. It was divided into two 15 mL test tube and centrifuged at 2000 rpm for five minutes. A volume of 100 μL supernatant from each sample was inoculated on lysogeny broth (LB) agar plate and incubated at 37°C.

Pure culture isolation Pure cultures were isolated from the mixed cultures of microorganisms. The pure cultures were prepared by streak plate method and preserved at 4°C in a refrigerator. Sampling was done twice from the sites in January, 2009 and March, 2009. A total of 28 colonies were selected based on colony morphology and labeled as SY-1 to SY-28. These 28 isolates were studied further.

Isolation of genomic DNA from bacteria Colonies from pure cultures were inoculated into LB media. The cultures were incubated overnight at 37°C temperature at 120 rpm. A 1.5 mL bacterial culture aliquot was placed into a sterile Eppendorf.

It was spun in a centrifuge at 10,000 rpm for 2 minutes. Later the supernatants were discarded and bacterial cells were harvested. Genomic DNA was isolated from these bacterial cells according to the CTAB (Cetyl Trimethyl Ammonium Bromide) method (Chen and Kuo, 1993) with slight modifications. Solutions of 567µL TE (Tris EDTA), 3 µL 10% SDS and 3µL of 20 mg/ml proteinase K were added with the cell pellets and thoroughly mixed. The suspension was then incubated for 1 hour at 37°C in water bath. A 5M NaCl (100µL) solution was added to this suspension and mixed thoroughly. An 80µL CTAB/NaCl solution was added, mixed thoroughly and the resulting suspension was incubated at 65°C. Equal volumes of chloroform: Isoamyl Alcohol (IAA) equivalent to 24:1 were added to the suspension and shaken vigorously

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

133

for 15 minutes. The resulting suspension was spun at 14000 rpm for 10 minutes. The aqueous phase from the Eppendorf tube was transferred to a new sterilized Eppendorf tube.

Equal volumes of Phenol: Chloroform: IAA (Isoamyl Alcohol) = 25: 24: 1 were added to it and mixed thoroughly by inverting the tube for five minutes.

The resulting suspension was spun at 14,000 rpm for 10 minutes. The aqueous phase (above the white interface layer) was transferred carefully by a 200 µL micropipette to a clean tube and the remainder was discarded. DNA was precipitated with double volume of absolute ethanol. It was spun for 15 minutes at 14,000 rpm at 4°C to pellet the DNA. The pellet was collected and washed once or twice with ice cold EtOH. It was done once with 70% EtOH or 76% EtOH/10 mM AcNH4 (ammonium acetate). A second wash with 70% EtOH was subsequently performed.

It was spun 15 min at 14,000 rpm, 4°C. The supernatant was removed and the pellet was dried by leaving tube open at room temperature for an hour. The pellet was resuspended in TE (pH of TE was maintained 8.0). The aliquot of pellet was stored at -20°C.

PCR amplification of 16s rRNA gene Isolated bacterial genomic DNA was used as template to amplify 16S Small-subunit (SSU) rRNA genes by PCR using the primers 8F (5’-AGAGTTTGATCCTGGCTCAG) and 805R (5’-GACTACCAGGGTATCTAAT) as described by Lane and coworkers (Lane et al., 1985). Each 25µL PCR mixture included 2.5 µL of 10X PCR buffer, 2 µL of deoxynucleoside triphosphate mix, 1.5 µL of MgCl2, 0.5µL of each primer, 0.3 µL of Taq polymerase (Takara Taq™, Otsu, Japan), 1 µL of genomic DNA lysate and 16.7 µL of PCR H2O (following the manufacturers’ protocols). Thirty cycles of amplification (92°C for 30 s, 58°C for 40 s, and 72°C for 90 s) usually were sufficient to obtain a product of the appropriate length that was visible in ethidium bromide-stained agarose gels.

134

Restriction Fragment Length Polymorphism and sequencing The PCR product was digested with 2 U each of MspI (Takara, Japan) and HinP1I (Takara, Japan) restriction enzymes for 1 h at 37°C. Each restriction digestion mixture contained 7 µL PCR product, 2 µL 10x T Buffer, 2 µL 0.1% BSA, 2 µL respective restriction enzyme and the final volume was brought to 23 µL by adding 10 µL nuclease free H2O. Besides, PCR product was digested with both these restriction enzymes. The restriction fragments were separated by gel electrophoresis on 2% Gene-Pure agarose (Sigma). Restriction fragment length polymorphism (RFLP) types were sorted by visual inspection of digitized gel images. Representative RFLP types were sequenced from Macrogen Inc. (Seoul, Republic of Korea) using the reverse primer 805R.

Phylogenetic analysis The evolutionary history was inferred using the Minimum Evolution method (Rzhetsky and Nei, 1992). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (10000 replicates) is shown next to the branches (Felsenstein, 1985). The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method (Tamura et al., 2004) and were in the units of the number of base substitutions per site. The ME tree was searched using the Close-Neighbor-Interchange (CNI) algorithm (Nei and Tamura, 2000) at a search level of 3. The Neighbor-joining algorithm (Saitou and Nei, 1987) was used to generate the initial tree.

All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). There were a total of 556 positions in the final dataset. Phylogenetic analyses were conducted using the software MEGA4 (Tamura et al., 2007).

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Results

between different colonies and respective restriction pattern is given in Table 1.

Isolation of pure culture A total of 28 pure cultures were isolated from four different sampling categories based on unique morphological appearance of the initial mixed culture.

They were labelled from SY-1 to SY-28. Three different colonies (SY-12, SY-17 and SY-18) were collected from long term waste disposal site, 5 different colonies (SY-4, SY-5, SY-7, SY-8 and SY-21) from short term waste disposal site, 9 different colonies (SY-2, SY-3, SY-9, SY-15, SY-16, SY-22, SY-26, SY-27 and SY-28) from submerged waste and 11 other colonies (SY-1, SY-6, SY-10, SY-11, SY-13, SY-14, SY-19, SY-20, SY-23, SY-24 and SY-25) from the edges of the waste disposal pond. Of these 28 pure colonies PCR amplification of 16S SSU rRNA was successful for the recovered genomic DNA from 16 colonies. Of them, 4 colonies failed to show any banding pattern upon restriction digestion (SY-7, SY-12, SY-16 and SY-17). RFLP based

Table 1. The relationship between different colonies and respective restriction pattern.

Strains marked with bold numbers were selected for sequencing. SY-9 could not be sequenced.

Pattern

Bacterial Strains

I

SY-23

II

SY-26

III

SY-9

IV

SY-24,1, 25

V

SY-27, 28, 2

VI

SY-14, 15, 4

screening (MspI, HinP1I and MspI+HinP1I) of the remainder of the 12 colonies identified six different restriction patterns. Representative colonies from each pattern were selected (SY-9, SY-14, SY-23, SY-24, SY26 and SY-27) for DNA sequencing. The relationship

Identification of Bactria by 16S rRNA gene sequence comparison Sequencing of the 16S ribosomal RNA gene was successful for five bacterial strains (SY-14, SY-23, SY24, SY-26 and SY-27). Sequences were deposited at the DDBJ/EMBL/GenBank nucleotide sequence databases with accession numbers AB622992 to AB622996. Sequencing of 16S rRNA gene of SY-9 was not successful. Nucleotide blast suggested close homology of these sequences with different soil bacterial species (Table 2). Phylogenetic analysis suggested a close relationship between the identified microorganisms (Figure 1).

discussion Bioremediation by microorganisms is one of the efficient and economical ways to decontaminate sites of pollution. Exploring the microbial diversity is the key to develop this effective and environmentally friendly technology (Paul et al., 2005). Due to lack of proper waste management practices, Hazaribag has become heavily polluted with effluents from nearby tannery industries (Arias-Barreiro et al., 2010; Bhuiyan et al., 2011; Zahid et al., 2006). However, little is known about the microbial flora of this region and their interaction with the ecosystem. The current study aimed to explore microbial diversity of this area.

To ensure proper representation, samples were collected from four different types of waste disposal sites of Hazaribagh tanning area (short term tannery waste disposal site; long term tannery waste disposal site; submerged tannery waste disposal site; and the edges of tannery waste disposal pond) as discussed in the Materials and Methods section. Twenty eight different pure culture colonies (SY-1 to SY-28) were isolated from the collected samples.

Pure culture technique was followed to isolate the differing colonies so that all of the individuals in a

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

135

Table 2. Identification of Bacteria by 16S rRNA gene sequence comparison Bacteria strain

Accession

The best BLASTn match

Group

SY-14

AB622992

Providencia vermicola strain AR_PSBH1

γ-proteobacteria

Gram negative

SY-23

AB622993

Providencia sp. FD32

γ-proteobacteria

Gram negative

SY-24

AB622994

Bacillus subtilis strain Bio AAS1

Firmicutes

Gram positive

SY-26

AB622995

Bacillus sp. FRC_Z41

Firmicutes

Gram positive

SY-27

AB622996

Proteus penneri strain Z2

γ-proteobacteria

Gram negative

Figure 1. Analysis of evolutionary relationship between the 5 taxa. Previously classified Providencia rettgeri (GenBank accession: FJ151630) and Bacillus tequilensis (GenBank accession: FR865173) was added to the tree to show γ- proteobacteria and Firmicutes specific clustering of the clades.

γ-proteobacteria

Firmicutes

culture have originated from a single individual. This allowed the characterization of microorganisms without confounding presence of other different types of microorganisms. While isolating microorganisms from complex mixtures, the isolation procedure was repeated at least once to make sure that an isolated colony was single cell derived. These microbial colonies were isolated by observation of colony morphology. Samples collected from long term waste disposal site showed the highest microbial diversity.

Genomic DNA was isolated from the pure cultures.

The amount of genomic DNA isolated was minimal for some colonies but still sufficient to carry out amplification of the 16S rRNA gene.

Isolated genomic DNA was amplified with primers specific for bacterial 16S rRNA gene (8F and 805R).

PCR was successful for 16 pure cultures (SY-1, SY-2, SY-4, SY-7, SY-9, SY-12, SY-14 to 17, and SY-23 to 28).

136

16S rRNA genes of other 12 microbial colonies were not amplified by polymerase chain reaction. Later, six different restriction patterns were observed in these 16 PCR products by digesting the PCR products with two different restriction enzymes HinP1I and MspI, both alone and in combination. One colony from each pattern was selected for 16S rRNA gene sequencing.

Sequencing was successful for five bacterial strains. After 16S rRNA gene sequence analysis bacterial strains SY-14, SY-23, SY-24, SY-26 and SY-27 exhibited the best nucleotide blast match with Providencia vermicola strain AR_PSBH1, Providencia sp.

FD32, Bacillus subtilis strain Bio AAS1, Bacillus sp.

FRC_Z41 and Proteus penneri strain Z2 respectively.

The identified bacterial species included both gram positive and gram negative bacteria from the groups γ-proteobacteria and Firmicutes (Table 2).

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

A literature survey revealed that similar bacterial species were previously identified in different studies on tannery effluent and soil microflora. Members of Providencia genus are known to reside in different soil habitats (Rani et al., 2008; Thacker et al., 2006).

Different species of Proteus (Usha and Kalaiselvi, 2009) and Bacillus (Chaturvedi, 2011; Megharaj et al., 2003) genus were found in tannery effluents. Thus, results of the study are in harmony with those of previous studies.

Considerable research has been performed throughout the world to determine the microbial diversity of different communities. Nevertheless, to our knowledge, no study was carried out to evaluate molecular microbial diversity of tannery exposed area in Bangladesh. The current study was performed with a view to shed light on this important aspect. The study identified five different bacterial species which were present in the tannery effluent exposed area. Further biochemical characterization of individual bacterial species could elucidate details of their mechanism of survival which can later be used for bioremediation purposes.

References Arias-Barreiro, C. R., H. Nishizaki, K. Okubo, I. Aoyama, and I. C. Mori. 2010. Ecotoxicological characterization of tannery wastewater in Dhaka, Bangladesh. J. Environ. Biol. 31:471-475.

Avery, S. V. 1995. Caesium accumulation by microorganisms: uptake mechanisms, cation competition, compartmentalization and toxicity. J. Ind. Microbiol. Biotechnol. 14: 76-84.

Basu, M., S. Bhattacharya, and A. K. Paul. 1997. Isolation and characterization of chromium-resistant bacteria from tannery effluents. Bull. Environ. Contam. Toxicol. 58:535-542.

Bhuiyan, M., N. Suruvi, S. Dampare, M. Islam, S. Quraishi, S. Ganyaglo, and S. Suzuki. 2011. Investigation of the possible sources of heavy metal contamination in lagoon and canal water in the tannery industrial area in Dhaka, Bangladesh. Environ.

Monit. Assess. 175:633-649.

Chaturvedi, M. K. 2011. Studies on chromate removal by chromium-resistant Bacillus sp. isolated from tannery effluent. J. Environ. Prot. (Irvine, Calif). 2:76-82.

Chen, W., and T. Kuo. 1993. A simple and rapid method for the preparation of gram-negative bacterial genomic DNA. Nucleic Acids Res. 21:2260.

Cooksey, D. A. 1993. Copper uptake and resistance in bacteria. Mol. Microbiol. 7:1-5.

Fakruddin, M., R. M. Mazumdar, T. K. Tania, S. Islam, M. N. Nipa, A. Iqbal, and H. R. Bhuiyan. 2009. Isolation and characterization of chromate resistant and reducing bacteria from tannery effluent of Chittagong, Bangladesh. J. of Bio-Science. 17:7176.

Farabegoli, G., A. Carucci, M. Majone, and E. Rolle.

2004. Biological treatment of tannery wastewater in the presence of chromium. J. Environ. Manage.

71:345-349.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution.

39:783-791.

Franco, A., C. Calheiros, C. Pacheco, P. De Marco, C. Manaia, and P. Castro. 2005. Isolation and characterization of polymeric galloyl-ester-degrading bacteria from a tannery discharge place. Microb.

Ecol. 50:550-556.

Hasegawa, C. M., A. M. Barbosa, and K. Takashima.

2011. Biotreatment of industrial tannery wastewater using Botryosphaeria rhodina. J. Serb. Chem.

Soc.76:439-446.

Ilias, M., I. Rafiqullah, B. Debnath, K. Mannan, and M. M. Hoq. 2011. Isolation and characterization of chromium(VI)-reducing bacteria from tannery effluents. Indian J. Microbiol. 51:76-81.

Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. U.S.A. 82:69556959.

Lefebvre, O., N. Vasudevan, K. Thanasekaran, R. Moletta, and J. J. Godon. 2006. Microbial diversity in hypersaline wastewater: the example of tanneries.

Extremophiles. 10:505-513.

Masood, F., and A. Malik. 2011. Hexavalent chro-

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

137

mium reduction by Bacillus sp. strain FM1 isolated from heavy-metal contaminated soil. Bull. Environ.

Contam. Toxicol. 86:114-119.

Megharaj, M., S. Avudainayagam, and R. Naidu.

2003. Toxicity of hexavalent chromium and its reduction by bacteria isolated from soil contaminated with tannery waste. Curr. Microbiol. 47:51-54.

Mosqueda, G., and J.-L. Ramos. 2000. A set of genes encoding a second toluene efflux system in Pseudomonas putida DOT-T1E is linked to the tod genes for toluene metabolism. J. Bacteriol.

182:937-943.

Nei, M., and K. Tamura. 2000. Molecular Phylogenetics and Evolution, Oxford University Press, New York.

Nies, D. H. 1999. Microbial heavy-metal resistance.

Appl. Microbiol. Biotechnol. 51:730-750.

Nies, D. H., and S. Silver. 1989. Plasmid-determined inducible efflux is responsible for resistance to cadmium, zinc, and cobalt in Alcaligenes eutrophus. J. Bacteriol. 171:896-900.

Nies, D. H., and S. Silver. 1995. Ion efflux systems involved in bacterial metal resistances. J. Ind. Microbiol. Biotechnol. 14:186-199.

Paul, D., G. Pandey, J. Pandey, and R. K. Jain. 2005.

Accessing microbial diversity for bioremediation and environmental restoration. Trends Biotechnol.

23:135-142.

Rafiqullah, I. M., A. Hossain, M. Ilias, and M. M. Hoq. 2009. Chromium (VI) reducing native microorganisms for remediation of chromium eco-toxicity in environment of Bangladesh. Banglad. J. Sci.Ind. Res. 43:455-466.

Rani, M. S., K. V. Lakshmi, P. S. Devi, R. J. Madhuri, S. Aruna, K. Jyothi, G. Narasimha, and K. Venkateswarlu. 2008. Isolation and characterization of a chlorpyrifos-degrading bacterium from agricultural soil and its growth response. Afr. J. Microbiol.

Res. 2:026-031.

Rzhetsky, A., and M. Nei. 1992. A Simple Method for Estimating and Testing Minimum-Evolution Trees.

Mol. Biol. Evol. 9: 945.

Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.

138

Sharif, M. I., and K. Mainuddin. 2003. Country case study on environmental requirements for leather and footwear export from Bangladesh, edited, Bangladesh Centre for Advanced Studies, Dhaka.

Sivaprakasam, S., S. Mahadevan, S. Sekar, and S. Rajakumar. 2008. Biological treatment of tannery wastewater by using salt-tolerant bacterial strains.

Microb. Cell Fact. 7:15.

Tamura, K., M. Nei, and S. Kumar. 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. U. S. A. 101:11030-11035.

Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007.

MEGA4: Molecular evolutionary genetics analysis (MEGA) Software Version 4.0. Mol. Biol. Evol.

24:1596-1599.

Thacker, U., R. Parikh, Y. Shouche, and D. Madamwar. 2006. Hexavalent chromium reduction by Providencia sp. Process Biochem. 41:1332-1337.

Tripathi, M., S. Vikram, R. K. Jain, and S. K. Garg.

2011. Isolation and growth characteristics of chromium(VI) and pentachlorophenol tolerant bacterial isolate from treated tannery effluent for its possible use in simultaneous bioremediation.

Indian J. Microbiol. 51:61-69.

Usha, K., and K. Kalaiselvi. 2009. Physico-chemical analysis and microbial characterization of tannery effluent. J. Ecobiol. 25:163-166.

Yan, B. H., H. J. Yang, J. H. Wei, and L. Luo. 2011.

Isolation from tannery wastewater and characterization of bacterial strain involved in nonionic surfactant degradation. Adv Mat Res. 183-85:22-26.

Zahid, A., K. Balke, M. Hassan, and M. Flegr. 2006.

Evaluation of aquifer environment under Hazaribagh leather processing zone of Dhaka city. Environ.

Geol. 50:495-504.

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

www.afabjournal.com Copyright © 2012 Agriculture, Food and Analytical Bacteriology

Impact of By-product Feedstuffs on Escherichia coli O157:H7 and Salmonella Typhimurium in Pure and Mixed Ruminal and Fecal Culture in Vitro† T. R. Callaway1, S. Block2, K. J. Genovese1, R. C. Anderson1, R. B. Harvey1, D. J. Nisbet1 USDA/ARS, Food and Feed Safety Research Unit, College Station, TX 77845 2 Archer Daniels Midland Company, Decatur, IL

1

Proprietary or brand names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and the use of the name by the USDA implies neither approval of the product, nor exclusion of others that may be suitable. USDA is an equal opportunity provider and employer. †

ABSTRACT The use of by-product feedstuffs and prebiotics in animal diets has increased in recent years. The present study was undertaken to determine what effects novel by-product feedstuffs, including prebiotics, have on survival of the important foodborne pathogenic bacteria Escherichia coli O157:H7 and Salmonella enterica Typhimurium in pure and mixed ruminal and fecal culture fermentations from cattle and swine. Byproduct feedstuffs utilized in this study included: hyperimmunized whole egg, lysine biomass, lysine biomass (spray dried), threonine biomass (drum dried), threonine biomass (spray dried), beer well yeast (drum dried), beer well yeast (spray dried), ethanol yeast (pan dried) and corn meal as a control to simulate normal dietary conditions. Prebiotics examined included: PremiDex ™, CitriStim™, a CitriStim:PremiDex blend (50%:50%), and a commercial oligosaccharide source feedstuff. Pure culture populations of E. coli O157:H7 were reduced (P < 0.05) by 2% w/v of each of spray dried threonine, drum-dried threonine, ethanol yeast, hyper-immunized whole egg, and a blend of CitriStim:PremiDex. No effects on Salmonella populations were observed in pure cultures. Fermentations of mixed ruminal microorganisms from cattle fed a forage based diet demonstrated that 2% PremiDex reduced (P < 0.05) E. coli O157:H7 populations compared to controls i and the CitriStim:PremiDex blend reduced E. coli O157:H7 and Salmonella populations (P < 0.05) in fermentations from cattle fed high grain diets. The anti-foodborne pathogen effects appear to be an indirect effect mediated by the microbial population of the intestinal tract, such as has been reported previously for prebiotics.

Keywords: by-products, prebiotics, probiotic, feedstuff, E. coli O157:H7, Salmonella, food safety Agric. Food Anal. Bacteriol. 2:139-148, 2012

Correspondence: T. R. Callaway, todd.callaway@ars.usda.gov Tel: +1-979-260-9374 Fax: +1-979-260-9332

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

139

Introduction Enterohemorrhagic Escherichia coli (EHEC), such as E. coli O157:H7, and Salmonella enterica are two of the most critical foodborne pathogenic bacteria and are often found asymptomatically in the gastrointestinal tract of farm animals (Ferens and Hovde, 2011; Scallan, et al., 2011). Both pathogens can survive undetected within the gastrointestinal microbial population of cattle (Berg, et al., 2004; Callaway, et al., 2006; Kunze, et al., 2008), and Salmonella is often found in cattle, swine and poultry (Borland, 1975; Davies, et al., 1999). When these pathogens are transmitted to a human they cause severe illness or even death, the combined yearly cost of these pathogens to the U.S. economy is in excess of $15 billion (Scharff, 2010).

Dietary effects on gastrointestinal pathogen populations have been examined extensively, and the effects have been extremely variable depending on the specific feedstuff utilized and the production situation (Callaway, et al., 2009; Diez-Gonzalez, et al., 1998; Kudva, et al., 1995). In recent years there has been a dramatic increase in the use of corn based by-product feedstuffs in food animal diets (Richman, 2007). This growth has been especially notable in the ethanol fermentation by products, such as distillers grains (DG). However, research has shown that the inclusion of DG in cattle diets can increase fecal prevalence and shedding of E. coli O157:H7 (Jacob, et al., 2009; Jacob, et al., 2010; Jacob, et al., 2008c; Wells, et al., 2009). The present study was designed to examine a variety of novel corn-derived feedstuffs and selected commercially available prebiotic products (PremiDex, commercial oligosaccharide, CitriStim) in regard to their ability to provide a selective effect on E. coli O157:H7 and Salmonella Typhimurium populations in pure and mixed culture in vitro.

Materials and Methods

was originally isolated from a human hemorrhagic colitis outbreak, and the Salmonella enterica Typhimurium isolates that were used in this study were originally isolated from cattle and swine. All isolates were obtained from the Food and Feed Safety Research Unit (USDA/ARS, College Station, TX) culture collection. Both E. coli O157:H7 strain 933 and S. Typhimurium were selected for resistance to novobiocin (No) and nalidixic acid (NA; 20 and 25 µg/ mL, respectively) by repeated transfer and selection in the presence of sub-lethal concentrations of each antibiotic. This resistant phenotype was stable through multiple unselected transfers in batch culture and through repeated culture vessel turnovers in continuous culture (data not shown).

Pure culture studies Feedstuffs were added to 16 x 100 mm tubes containing anoxic Trypic Soy Broth (TSB, (cooled after autoclaving under anoxic conditions [90% N2, 5% H2, 5% CO2]; Difco Laboratories; Detroit, MI) to reach final concentrations of 2% wt/vol. Feedstuffs utilized in this study were: PremiDex, CitriStim, a CitriStim:PremiDex, commercial oligosaccharide, hyperimmunized whole egg, lysine biomass (drum dried), lysine biomass (spray dried), threonine biomass (drum dried), threonine biomass (spray dried), beer well yeast (drum dried), beer well yeast (spray dried), ethanol yeast (pan dried) and corn meal as a control. Corn meal was used as a control to simulate the typical ingredients in a ruminant diet that would be replaced by the by-product feedstuffs.

Feedstuffs were added into tubes immediately before the pathogens were inoculated. Escherichia coli O157:H7 strain 933 (ATCC 43895) or S. Typhimurium were grown anaerobically and aseptically inoculated into feedstuff containing tubes at approximately 6 x 105 CFU/mL of E. coli O157:H7 or 3 x 105 CFU/mL of S. Typhimurium at t = 0. Tubes in triplicate (n = 3) were incubated at 39 °C for 24 h, when 1 mL aliquots were removed for enumeration (described below).

Bacterial strains and culture conditions Escherichia coli O157:H7 strain 933 (ATCC 43895) 140

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Animal diets All animals were maintained in accordance with a protocol approved by the Southern Plains Agricultural Research Center Animal Care and Use Committee (ACUC No 06002). Holstein cattle (n = 4) were provided ad libitum access to water and minerals at all times. Ruminal fluid was collected from cattle grazing bermudagrass pasture (n=2) and a highgrain diet (n=2). Cattle in the pasture-fed group were grazed on an early vegetative stage ryegrass pasture at the time of ruminal fluid collection. The grain-fed cattle were fed a commercial feedlot ration (corn soybean mix; Producer’s Co-op, Bryan, TX) and was maintained on this feedlot diet for 10 d prior to ruminal or fecal collection. Crossbred pigs (n=4) were provided ad libitum access to water and minerals at all times. Pigs were fed a commercial finishing diet (Producer’s Co-op, Bryan, TX ) comprised of soybean meal and corn twice daily. Animals were maintained on this diet for 14 d prior to fecal fluid collection.

Ruminal and fecal fluid collection Ruminal contents were collected by hand from the ventral sac of two ruminally cannulated Holstein cows on each diet (n = 2/diet group). The ruminal contents were collected from all cattle at approximately the same time (between 0800 and 0900 h).

Immediately after removal from the rumen, the contents from each cow were strained via a fine mesh nylon strainer (Reaves and Co., Durham, NC) and pooled. Ruminal fluid was transported to the laboratory and incubated for 30 min at 39 °C to allow gas production to buoy large particles to the top of the flasks. Fresh ruminal fluid contained approximately 1010 cells/ml of total culturable anaerobes, as determined by serial dilution in anaerobic reinforced clostridial broth in triplicate tubes.

Fecal samples from cattle were collected directly per rectum by digital grab. Feces were collected from all cattle at the same time. Immediately upon collection, the feces were strained via a fine mesh nylon strainer to obtain a fecal fluid which was then

pooled. Fecal fluid was transported to the laboratory as described above. Fresh fecal fluid contained approximately 1010 cells/ml of total culturable anaerobic bacteria as determined by serial dilution as described above.

Swine feces were collected directly per rectum by digital grab from all pigs at the same time, pooled equally by weight, and was added directly to the fecal fermentation media (described below) at a 33% w/v final concentration. Fresh swine feces contained approximately 109 cells/g of total culturable anaerobic bacteria.

In vitro mixed ruminal microbial fermentations Incubations of cattle ruminal and fecal fluids were performed by combining the gastrointestinal fluid (33% vol/vol) with an anoxic basal medium containing (per liter): 292 mg K2HPO4, 202 mg KH2PO4, 436 mg NH4SO4, 480 mg NaCl, 100 mg MgSO4•7H2O, 64 mg CaCl2•H2O, 4,000 mg Na2CO3, 600 mg cysteine hydrochloride (Cotta and Russell, 1982) supplemented with 1 g/L glucose. Swine feces was added to the same basal medium in a 33% w/v concentration.

Approximately 104-5 CFU/mL E. coli O157:H7 strain 933 or S. Typhimurium were added to the buffered gastrointestinal fluid fermentations in all experiments. The resultant suspensions were anaerobically transferred to 18 × 150 mm Balch tubes (Bellco Glass, Vineland, NJ; 10 ml per tube). Feedstuffs described above were added to each tube to reach final concentrations of 2 % wt/vol under an anoxic gas phase. Tubes in triplicate (n = 3) were then sealed using rubber stoppers with aluminum crimps and incubated for 24 h at 39°C under a N2, CO2, H2 (90:5:5 v/v) gas phase. Samples were removed after 24 h of incubation and centrifuged (10,000 × g, 5 min, 24°C) to remove particulate matter.

Bacterial enumeration Samples were taken from all pure and mixed culture in vitro fermentations at 24 h to determine the effect of feedstuffs on populations of E. coli O157:H7

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

141

and S. Typhimurium. Samples were serially diluted (in 10-fold increments) in phosphate buffered saline (PBS, pH 7.0), and subsequently plated on MacConkey’s agar (supplemented with 25 µg/mL NO and 20 µg/mL NA) and incubated at 37°C overnight for direct counting of E. coli O157:H7 CFU/ml. To determine populations of S. Typhimurium, samples were serially diluted as described above and plated on Brilliant Green Agar (supplemented with 25 µg/mL NO and 20 µg/mL NA) and incubated at 37°C overnight for direct counting.

Statistical analysis Pure culture experiments were performed with (n=3) tubes on consecutive days. Mixed ruminal bacteria experiments were performed in duplicate

tubes (n=2) on consecutive days, and the values presented are means. Students’ t-test was used to determine significance of differences between means of each treatment.

Results In pure culture studies, none of the feedstuffs used in this study affected Salmonella Typhimurium populations (Figure 1) compared to controls using corn meal. However, populations of E. coli O157:H7 in pure cultures were reduced (P < 0.05) when: spray dried threonine biomass, drum-dried threonine biomass, ethanol yeast, hyper-immunized whole egg, and a blend of CitriStim:PremiDex were included; although it must be noted that this statistically sig-

Figure 1. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Typhimurium (dark bars) in pure cultures. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.

142

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

nificant reduction was less than a 10-fold decrease in E. coli O157:H7 populations (Figure 1).

When pathogens were added to in vitro mixed ruminal microorganism fermentations of cows fed high forage diets, the inclusion of 2% Premidex reduced (P < 0.05) E. coli O157:H7 and reduced (P < 0.06) Salmonella Typhimurium populations compared to controls (Figure 2). However, when cows were fed high grain diets (data not shown) there was no effect of feedstuff addition on pathogen populations in ruminal fluid fermentations. In in vitro mixed fecal microorganism fermentations of cattle fed high grain diets (Figure 3), E. coli O157:H7 populations were numerically reduced in hyperimmunized whole egg and beer well yeast (spray dried) and was sig-

nificantly reduced (P < 0.05) in fermentations containing the CitriStim:PremiDex blend. Salmonella Typhimurium populations in these in vitro fermentations were also reduced (P < 0.05) by addition of the CitriStim:PremiDex blend.

When these by-product feedstuffs were included in in vitro pig fecal fermentations, PremiDex and the CitriStim:PremiDex blend reduced (P < 0.05) E. coli O157:H7 populations more than 10-fold compared to corn meal controls (Figure 4). However, the addition of the commercial oligosaccharide product and hyperimmunized whole egg increased (P < 0.05) populations of Salmonella Typhimurium more than 1 log10 CFU/ml compared to corn meal controls.

Figure 2. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Typhimurium when inoculated into mixed ruminal microorganism fermentations from cattle fed a forage-based diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

143

Discussion In recent years, food safety has become an increasingly important issue to animal producers (Davies, 2011; Sargeant, et al., 2007) and to the national economy as a whole (Scharff, 2010). Research has shown that diet composition and feeding methods can affect intestinal microbial populations of cattle, including populations of foodborne pathogenic bacteria, such as E. coli O157:H7 and Salmonella (Buchko, et al., 2000; Diez-Gonzalez, et al., 1998; Fox, et al., 2007; Jacob, et al., 2008b). Distillers grains (DG) have seen a rapid increase in inclusion in animal diets (Klopfenstein, et al., 2008; Richman, 2007),

following the increase in the production of ethanol from corn fermentation (Richman, 2007). Distillers grains as well as other by-products have some broad impacts on some members of the microbial ecosystem (Callaway, et al., 2010; Fron, et al., 1996; Williams, et al., 2010). Recently, the inclusion of DG in cattle diets was shown to increase fecal shedding of E. coli O157:H7 (Jacob, et al., 2008b; Jacob, et al., 2008c; Wells, et al., 2009). In in vitro studies, it was found that ruminal fluid from cattle fed DG supported a higher level of E. coli O157:H7 growth, and that the inclusion of DG in fermentations also increased E. coli O157:H7 populations (Jacob, et al., 2008a). However, results were variable based largely

Figure 3. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Typhimurium when inoculated into mixed fecal microorganism fermentations from cattle fed a grainbased diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.

144

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

upon source of DG (Jacob, et al., 2009; Jacob, et al., 2010; Wells, et al., 2009). Other researchers found that inclusion of high levels of corn or wheat DDGS in feedlot diets of cattle may allow E. coli O157:H7 improved survival in feces (Yang, et al., 2010).

Emerging microbial diversity data indicates that different gastrointestinal microbial populations are selected for by different feedstuffs, possibly due to the presence (or absence) of some limiting component in the diet, such as is found in prebiotic feedstuffs (Patra and Saxena, 2009; Tajima, et al., 2001).

In the present study, a variety of novel by-product feedstuffs and prebiotic compounds were examined to determine their impact on foodborne pathogenic

bacterial populations in pure and mixed cultures of bacteria from cattle and swine. In general, the novel by-product feedstuffs did not affect populations of E. coli O157:H7 or Salmonella in pure or mixed culture fermentations. In pure cultures, the direct effects of the different by-products were negligible, with no feedstuff causing as much as a 10-fold decrease in pathogen populations, though a blend of CitriStim:PremiDex (a prebiotic source of oligosaccharides such as maltooligosaccharides) did cause a significant reduction in E. coli O157:H7 populations.

When the prebiotic PremiDex was included in ruminal fluid fermentations from a cow fed a high forage diet, populations of both E. coli O157:H7 and

Figure 4. Effects of feedstuffs on populations of E. coli O157:H7 (light bars) and Salmonella Typhimurium when inoculated into mixed fecal microorganism fermentations from growing swine fed a commercial finishing diet. Feedstuffs were included at 2% w/v, and bars represent the mean of 3 fermentations, and error bars indicate standard deviation. Bars marked with superscript a indicate differences from control of P < 0.05.

Agric. Food Anal. Bacteriol. â&#x20AC;˘ AFABjournal.com â&#x20AC;˘ Vol. 2, Issue 2 - 2012

145

Salmonella populations were decreased significantly; but this effect disappeared in ruminal fluid from cattle fed a high grain diet. However, when fecal bacteria from cattle fed high grain diets were fermented with by-products feeds, the CitriStim:PremiDex prebiotic blend reduced E. coli O157:H7 populations.

Collectively, these results indicate that CitriStim and/ or PremiDex reduced E. coli O157:H7 populations and could be an effective dietary additive to reduce foodborne pathogenic bacteria prior to harvest in ruminant animals, although further research is needed to clarify the magnitude of the effect in further in vitro studies and in live animals during feeding trials.

In swine fecal fermentations, prebiotic addition had a greater impact than in the cattle ruminal or fecal fermentations. PremiDex and the CitriStim:PremiDex blend significantly decreased E. coli O157:H7 populations in swine fecal fermentations, while no novel by-product feedstuff affected E. coli O157:H7 populations. However, residual biomass and hyperimmunized whole egg increased S. Typhimurium populations more than 20-fold in these in vitro fecal fermentations. The difference in effects of these feedstuffs between the two pathogenic species is likely due to indirect effects on other members of the microbial population who either outcompete the pathogen (possibly mediated via a prebiotictype effect), or alternatively creation of a competitive “vacuum” in the fecal microbial ecosystem that is consequently exploited by Salmonella. Further research is needed to understand the mechanism behind this impact on pathogen populations.

Conclusions Collectively, it appears that PremiDex, and the CitriStim:PremiDex blend had the greatest impact on foodborne pathogenic bacterial populations in mixed gastrointestinal microbial fermentations in the feedstuffs examined presently. Populations of E. coli O157:H7 in fecal fermentations from cows fed high grain diets and swine fecal fermentations were most strongly affected by the CitriStim:PremiDex blend inclusion. The anti-foodborne pathogen effect ap146

pears to be indirectly mediated by prebiotic effects on the mixed gastrointestinal microbial consortium rather than by direct effects against the pathogens.

Further research is needed to clarify the mode of action of these and other by-product feedstuffs and how much impact they have on the mixed microbial ecosystem when fed to live animals.

References Berg, J. L., T. A. McAllister, S. J. Bach, R. P. Stillborn, D. D. Hancock, and J. T. LeJeune. 2004. Escherichia coli O157:H7 excretion by commerical feedlot cattle fed either barley- or corn-based finishing diets. J. Food Prot. 67:666-671.

Borland, E. D. 1975. Salmonella infection in poultry.

Vet. Rec. 97:406-408.

Buchko, S. J., R. A. Holley, W. O. Olson, V. P. J. Gannon, and D. M. Veira. 2000. The effect of different grain diets on fecal shedding of Escherichia coli O157:H7 by steers. J. Food Prot. 63:1467-1474.

Callaway, T. R., M. A. Carr, T. S. Edrington, R. C. Anderson, and D. J. Nisbet. 2009. Diet, Escherichia coli O157:H7, and cattle: A review after 10 years.

Curr. Iss. Mol. Biol. 11:67-80.

Callaway, T. R., S. E. Dowd, T. S. Edrington, R. C. Anderson, N. Krueger, N. Bauer, P. J. Kononoff,and D. J. Nisbet. 2010. Evaluation of bacterial diversity in the rumen and feces of cattle fed different levels of dried distillers grains plus solubles using bacterial tag-encoded FLX amplicon pyrosequencing. J. Anim. Sci. 88:3977-3983.

Callaway, T. R., T. S. Edrington, A. D. Brabban, J. E. Keen, R. C. Anderson, M. L. Rossman, M. J. Engler, K. J. Genovese, B. L. Gwartney, J. O. Reagan, T. L. Poole, R. B. Harvey, E. M. Kutter, and D. J. Nisbet.

2006. Fecal prevalence of Escherichia coli O157, Salmonella, Listeria, and bacteriophage infecting E. coli O157:H7 in feedlot cattle in the southern plains region of the United States. Foodborne Path. Dis. 3:234-244.

Cotta, M. A., and J. B. Russell. 1982. Effect of peptides and amino acids on efficiency of rumen bacterial protein synthesis in continuous culture. J.

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Dairy Sci. 65:226-234.

Davies, P., J. Funk, and M. Morrow. 1999. Fecal shedding of Salmonella by a cohort of finishing pigs in North Carolina. Swine Health Prod. 7:231-234.

Davies, P. R. 2011. Intensive swine production and pork safety. Foodborne Path. Dis. 8:189-201.

Diez-Gonzalez, F., T. R. Callaway, M. G. Kizoulis, and J. B. Russell. 1998. Grain feeding and the dissemination of acid-resistant Escherichia coli from cattle.

Science. 281:1666-1668.

Ferens, W. A., and C. J. Hovde. 2011. Escherichia coli O157:H7: Animal reservoir and sources of human infection. Foodborne Path. Dis. 8:465-487.

Fox, J. T., B. E. Depenbusch, J. S. Drouillard, and T. G. Nagaraja. 2007. Dry-rolled or steam-flaked grainbased diets and fecal shedding of Escherichia coli O157 in feedlot cattle. J. Anim. Sci. 85:1207-1212.

Fron, M., H. Madeira, C. Richards, and M. Morrison.

1996. The impact of feeding condensed distillers byproducts on rumen microbiology and metabolism. Anim. Feed Sci. Technol. 61:235-245.

Jacob, M. E., J. T. Fox, J. S. Drouillard, D. G. Renter, and T. G. Nagaraja. 2008a. Effects of dried distillers’ grain on fecal prevalence and growth of Escherichia coli O157 in batch culture fermentations from cattle. Appl. Environ. Microbiol. 74:38-43.

Jacob, M. E., J. T. Fox, J. S. Drouillard, D. G. Renter, and T. G. Nagaraja. 2009. Evaluation of feeding dried distiller’s grains with solubles and dry-rolled corn on the fecal prevalence of Escherichia coli O157:H7 and Salmonella spp. in cattle. Foodborne Path. Dis. 6:145-153.

Jacob, M. E., J. T. Fox, S. K. Narayanan, J. S. Drouillard, D. G. Renter, and T. G. Nagaraja. 2008b. Effects of feeding wet corn distiller’s grains with solubles with or without monensin and tylosin on the prevalence and antimicrobial susceptibilities of fecal food-borne pathogenic and commensal bacteria in feedlot cattle. J. Anim Sci. 86:1182-1190.

Jacob, M. E., Z. D. Paddock, D. G. Renter, K. F. Lechtenberg, and T. G. Nagaraja. 2010. Inclusion of dried or wet distillers’ grains at different levels in diets of feedlot cattle affects fecal shedding of Escherichia coli O157:H7. Appl. Environ. Microbiol. 76:7238-7242.

Jacob, M. E., G. L. Parsons, M. K. Shelor, J. T. Fox, J. S. Drouillard, D. U. Thomson, D. G. Renter, and T. G. Nagaraja. 2008c. Feeding supplemental dried distiller’s grains increases faecal shedding of Escherichia coli O157 in experimentally inoculated calves. Zoon. Pub. Health. 55:125-132.

Klopfenstein, T. J., G. E. Erickson, and V. R. Bremer.

2008. Board invited review: Use of distillers byproducts in the beef cattle feeding industry. J. Anim Sci. 86:1223-1231.

Kudva, I. T., P. G. Hatfield, and C. J. Hovde. 1995.

Effect of diet on the shedding of Escherichia coli O157:H7 in a sheep model. Appl. Environ. Microbiol. 61:1363-1370.

Kunze, D. J., G. H. Loneragan, T. M. Platt, M. F. Miller, T. E. Besser, M. Koohmaraie, T. Stephens, and M. M. Brashears. 2008. Salmonella enterica burden in harvest-ready cattle populations from the southern high plains of the United States. Appl. Environ. Microbiol. 74:345-351.

Patra, A. K., and J. Saxena.

2009.

Dietary phyto,chemicals as rumen modifiers: a review of the effects on microbial populations. Antonie van Leeuwenhoek. 39:1-13.

Richman, S. 2007. Ethanol and distillers grains: Situation and outlook In: Procs. 2007 International Distillers Grains Conference, Schaumburg, IL. 2008: 25-39.

Sargeant, J. M., M. R. Amezcua, A. Rajic, and L. Waddell. 2007. Pre-harvest interventions to reduce the shedding of E. coli O157 in the faeces of weaned domestic ruminants: a systematic review. Zoonos.

Pub. Health. 54:260-277.

Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe, M.-A. Widdowson, S. L. Roy, J. L. Jones, and P. L. Griffin. 2011. Foodborne illness acquired in the United States—major pathogens. Emerg. Infect.

Dis. 17:7-15.

Scharff, R. L. 2010. Health-related costs from foodborne illness in the United States. http:// www.producesafetyproject.org/admin/assets/ files/Health-Related-Foodborne-Illness-Costs-Report.pdf-1.pdf. 3 May, Accessed 2010.

Tajima, K., R. I. Aminov, T. Nagamine, H. Matsui, M. Nakamura, and Y. Benno. 2001. Diet-dependent

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

147

shifts in the bacterial population of the rumen revealed with real-time PCR. Appl. Environ. Microbiol. 67:2766-2774.

Wells, J. E., S. D. Shackelford, E. D. Berry, N. Kalchayan, M. N. Guerini, V. H. Varel, T. M. Arthur, J. M. Bosilevac, H. C. Freetly, T. L. Wheeler, C. L. Ferrell, and M. Koohmaraie. 2009. Prevalence and level of Escherichia coli O157:H7 in feces and on hides of feed lot steers fed diets with or without wet distillers grains with solubles. J. Food Prot.

72:1624-1633.

Williams, W. L., L. O. Tedeschi, P. J. Kononoff, T. R. Callaway, S. E. Dowd, K. Karges, and M. L. Gibson.

2010. Evaluation of in vitro gas production and rumen bacterial populations fermenting corn milling (co)products. J. Dairy Sci. 93:4735-4743.

Yang, H. E., W. Z. Yang, J. J. McKinnon, T. W. Alexander, Y. L. Li, and T. A. McAllister. 2010. Survival of Escherichia coli O157:H7 in ruminal or fecal contents incubated with corn or wheat dried distillers’ grains with solubles. Can. J. Microbiol. 56:890895.

148

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

INSTRUCTIONS TO AUTHORS MANUSCRIPT SUBMISSION

CONTENT OF MANUSCRIPT

Authors must submit their papers electronically (submit@afabjournal.com). According to instructions provided online at our site: www.afabjournal. com. Authors who are unable to submit electronically should contact the editorial office for assistance by email at editor@afabjournal.com.

We invite you to consider submitting your research and review manuscripts to AFAB. The journal serves as a peer reviewed scientific forum for to the latest advancements in bacteriology research on Agricultural and Food Systems which includes the following fields:

• • • • • • • • • • • • • • • • • • •

Aerobic microbiology Aerobiology Anaerobic microbiology Analytical microbiology Animal microbiology Antibiotics Antimicrobials Bacteriophage Bioremediation Biotechnology Detection Environmental microbiology Feed microbiology Fermentation Food bacteriology Food control Food microbiology Food quality Food Safety

• • • • • • • • • • • • • • • • • • •

Foodborne pathogens Gastrointestinal microbiology Microbial education Microbial genetics Microbial physiology Modeling and microbial kinetics Natural products Phytoceuticals Quantitative microbiology Plant microbiology Plant pathogens Prebiotics Probiotics Rumen microbiology Rapid methods Toxins Veterinary microbiology Waste microbiology Water microbiology

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

149

With an open access publication model of this journal, all interested readers around the world can freely access articles online. AFAB publishes original papers including, but not limited to the types of manuscripts described in the following sections.

Papers that have been, or are scheduled to be, published elsewhere should not be submitted and will not be reviewed. Opinions or views expressed in papers published by AFAB are those of the author(s) and do not necessarily represent the opinion of the AFAB or the editorial board.

MANUSCRIPT TYPES Full-Length Research Manuscripts AFAB accepts full-length research articles containing four (4) figures and/or tables or more. AFAB emphasizes the importance of sound scientific experimentation on any of the topics listed in the focus areas followed by clear concise writing that describes the research in its entirety. The results of experiments published in AFAB must be replicated, with appropriate statistical assessment of experimental variation and assignment of significant difference.

Major headings to include are: Abstract, Introduction, Materials and Methods, Results, Discussion (or Results and Discussion), Conclusion, Acknowledgements (optional), Appendix for abbreviations (optional), and References.

Manuscripts clearly lacking in language will be returned to author without review, with a suggestion that English editing be sought before the paper is reconsidered. AFAB offers a fee based language service upon request. Please contact language@afabjournal.com for more information about our fees and services.

Rapid Communications Under normal circumstances, AFAB aims for receipt-to-decision times of approximately one month or less. Accepted papers will have priority for publication in the next available issue of AFAB. However, if an author chooses or requires a much more rapid 150

peer review, the journal editorial office has the capability to shorten the review timing to one week or less.

Any type of manuscript whether it be a full length manuscript, brief communication or review paper can be submitted as a rapid communication. There will be additional costs for processing and page charges will be double the normal rate. Authors who choose this option must select Rapid Communications as the paper type when submitting the paper and the editors will judge whether a rapid review is possible and let the author know immediately.

Brief Communications Brief communications are short research notes giving the results of complete experiments but are considered less comprehensive than full-length articles with three (3) figures and/or tables or less. Manuscripts should be prepared with the same subheadings as full length research papers. The running head above the title of the paper is “Brief Communications.”

Unsolicited Review Papers Review papers are welcome on any topic listed in the focus section and have no page limits. Reviews are assessed the same pages charges as all other manuscripts. All AFAB guidelines for style and form apply. Major headings to include are: Abstract, Introduction, Main discussion topics and appropriate subheadings, Conclusions, Acknowledgements (optional) and References. Review papers shorter than 20 pages of double spaced text and references will be considered mini-reviews with the subheading above the title on the first page. The running head above the title of the paper is either “Review” or “Mini-review”.

Solicited Review Papers Solicited reviews will have no page limits. The editor-in-chief will send invitations to the authors and then review these contributions when they are submitted. Nominations or suggestions for potential timely reviews are welcomed by the editors or edito-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

rial board members and should be sent to submit@ afabjournal.com. There will be no page charges for solicited review papers but the solicitation must originate from the editor-in-chief or one of the editors. Requests from authors will automatically be classified as unsolicited review papers. The running head above the title of the paper will be “Invited Review.”

Conference and Special Issues Reviews AFAB welcomes opportunities to publish papers from symposia, scientific conference, and/or meetings in their entirety. Conference organizers need simply to contact AFAB at submit@afabjournal.com and a rapid decision is guaranteed. If in agreement, the conference organizers must guarantee delivery of a set number of peer reviewed manuscripts within a specified time and submitted in the same format as that described for unsolicited review papers. Conference papers must be prepared in accordance with the guidelines for review articles and are subject to peer review. The conference chair must decide whether or not they wish to serve as Special Issue Editor and conduct the editorial review process. If the conference chair/organizer chooses to serve as special issue editor, this will involve review of the papers and, if necessary, returning them to the authors for revision. The conference organizer then submits the revised manuscripts to the journal editorial office for further editorial examination. Final revisions by the author and recommendations for acceptance or rejection by the chair must be completed by a mutually agreed upon date between the editor and the conference organizer. Manuscripts not meeting this deadline will not be included in the published symposium proceedings but if submitted later can still be considered as unsolicited review papers. Although offprints and costs of pages are the same as for all other papers, the symposium chair may be asked to guarantee an agreed upon number of hard copies to be purchased by conference attendees. If the decision is not to publish the symposium as a special issue, the individual authors retain the right to submit their papers for consideration for the journal as ordinary unsolicited review manuscripts.

Book Reviews AFAB publishes reviews of books considered to be of interest to the readers. The editor-in-chief ordinarily solicits reviews. Book reviews shall be prepared in accordance to the style and form requirements of the journal, and they are subject to editorial revision.

No page charges will be assessed solicited reviews while unsolicited book reviews will be assigned the regular page charge rate.

Opinions and Current Viewpoints The purpose of this section will be to discuss, critique, or expand on scientific points made in articles recently published in AFAB. Drafts must be received within 6 months of an article’s publication. Opinions and current perspectives do not have page limits.

They shall have a title followed by the body of the text and references. Author name(s) and affiliation(s) shall be placed between the end of the text and list of references. If this document pertains to a particular manuscript then the author(s) of the original paper(s) will be provided a copy of the letter and offered the opportunity to submit for consideration a reply within 30 days. Responses will have the same page restrictions and format as the original opinion and current viewpoint, and the titles shall end with “Opinions.” They will be published together. Letters and replies shall follow appropriate AFAB format and may be edited by the editor-in-chief and a technical editor. If multiple letters on the same topic are received, a representative set of opinions concerning a specific article will be published. A disclaimer will be added by the editorial staff that the opinion expressed in this viewpoint is the authors alone and does not necessarily represent the opinion of AFAB or the editorial board.

COPYRIGHT AGREEMENT The copyright form is published in AFAB as space permits and is available online (www.afabjournal.com).

AFAB grants to the author the right of re-publication

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

151

in any book of which he or she is the author or editor, subject only to giving proper credit to the original journal publication of the article by AFAB. AFAB retains the copyright to all materials accepted for publication in the journal. If an author desires to reprint a table or figure published from a non-AFAB source, written evidence of copyright permission from an authority representing that source must be obtained by the author and forwarded to the AFAB editorial office.

PEER REVIEW PROCESS Authors will be requested to provide the names and complete addresses including emails of five (5) potential reviewers who have expertise in the research area and no conflict of interest with any of the authors.

Except for manuscripts designated as Rapid Communication each reviewer has two (2) weeks to review the manuscript, and submit comments electronically to the editorial office. Authors have three (3) weeks to complete the revision, which shall be returned to the editorial office within six (6) weeks after which the authors risk having their manuscript removed from AFAB files if they fail to ask the editorial office for an extension by email. Deleted manuscripts will be reconsidered, but they will have to be processed as new manuscripts with an additional processing fee assessed upon submission. Once reviewed, the author will be notified of the outcome and advised accordingly. Editors handle all initial correspondence with authors during the review process. The editor-in chief will notify the author of the final decision to accept or reject. Rejected manuscripts can be resubmitted only with an invitation from the editor or editor-in chief. Revised versions of previously rejected manuscripts are treated as new submissions.

PRODUCTION OF PROOFS Accepted manuscripts are forwarded to the editorial office for technical editing and layout. The manuscript is then formatted, figures are reproduced, and author proofs are prepared as PDFs. Author proofs of all manuscripts will be provided to the corresponding author. Author proofs should be read carefully and 152

checked against the typed manuscript, because the responsibility for proofreading is with the author(s).

Corrections must be returned by e-mail. Changes sent by e-mail to the technical editor must indicate page, column, and line numbers for each correction to be made on the proof. Corrections can also be marked using “track changes” in Microsoft Word or using e-annotation tools for electronic proof correction in Adobe Acrobat to indicate necessary changes. Author alterations to proofs exceeding 5% of the original proof content will be charged to the author. All correspondence of proofs must be agreed to by the editorial office and the author within 48 hours or proof will be published as is and AFAB will assume no responsibility for errors that result in the final publication.

PUBLICATION CHARGES AFAB has two publication charge options: conventional page charges and rapid communication. The current charge for conventional publication is $25 per printed page in the journal. There is no additional charge for the publication of pages containing color images, micrographs or pictures. For authors who wish to have their papers processed as a rapid communication, authors will pay the rapid communication fee when proofs are returned to the editorial office in addition to twice the conventional page charges.

Charges for rapid communications are $1000 per manuscript for guaranteed peer review within one week and $100 per journal page.

HARD COPY OFFPRINTS If you are wishing to obtain a physical hard copy of the AFAB journal, offprints are available in any quantity at an additional charge: $100/page for black-white and $150/page for color prints. You may order your offprints at any time after publication on our website.

Scientific conference organizers may be expected to agree to a set number of offprints as a part of their agreement with AFAB.

MANUSCRIPT CONTENT REQUIREMENTS

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Preparing the Manuscript File Manuscripts must be written in grammatically correct English. AFAB offers a fee based language service upon request (language@afabjournal.com).

Manuscripts should be typed double-spaced, with lines and pages numbered consecutively. All documents must be submitted in Microsoft Word (.doc or .docx, PC or Mac). All special characters (e.g., Greek, math, symbols) should be inserted using the symbols palette available in this font. Tables and figures should be placed in separate sections at the end of the manuscript (not placed in the text). Failure to follow these instructions will cause delays of the processing and review of the manuscript.

Title Page At the very top of the title page, include a title of not more than 100 characters. Format the title with the first letter of each word capitalized. No abbreviations should be used. Under the title, the authors names are listed. Use the author’s initials for both first and middle names with a period (full-stop) between initials (e.g., W. A. Afab). Underneath the authors, a list affiliations must be listed. Please use numerical superscripts after the author’s names to designate affiliation. If an authors address has changed since the research was completed, this new information must be designated as “Current address:”. The corresponding author should be indicated with an asterisk e.g., * Corresponding author. The title page shall include the name and full address of the corresponding author. Telephone and e-mail address must also be provided for the corresponding author, and emailaddresses must be provided for all authors.

Authors must avoid single sentence paragraphs and merge such paragraphs appropriately. Authors must not begin sentences with “Figure or Table shows…” as these are inanimate objects and cannot “show” anything. When number are reported in text or in tables, always put a zero in front of decimal numbers: “0.10” instead of “.10”.

Manuscript Sections Abstract The abstract provides an abridged version of the manuscript. Please submit your abstract on a separate page after the title page. The abstract should provide a justification of your work, objectives, methods, results, discussion and implications of study or review findings . Your abstract must consist of complete sentences without references to other work or footnotes and must not exceed 250 words. On the same page as your abstract, please provide at least ten (10) keywords to be used for linking and indexing. Ideally, these keywords should include significant words from the title.

Introduction The introduction should clearly present the foundation of the manuscript topic and what makes the research or the review unique. The introduction should validate why this topic is important based on previously published literature, and the relevance of the current research. Overall goals and project objectives must be clearly stated in the final sentence of the last paragraphs of the introduction.

Materials and Methods Editing Author-derived abbreviations should be defined at first use in the abstract and again in the body of the manuscript. If abbreviations are extensive authors may need to provide a list of abbreviations at the beginning of the manuscript. In vivo, in vitro and bacterial names must be italicized (obligatory).

Information on equipment and chemicals used must include the full company name, city, and state (country if outside the United States or Province if in Canada) [i.e., (Model 123, ACME Inc., Afab, AR)].

Variability, Replication, and Statistical Analysis To properly assess biological systems indepen-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

153

dent replication of experiments and quantification of variation among replicates is required by AFAB. Reviewers and/or editors may request additional statistical analysis depending on the nature of the data and it will be the responsibility of the authors to respond appropriately. Statistical methods commonly used in the bacteriology do not need to be described in detail, but an adequate description and/or appropriate references should be provided.

The statistical model and experimental unit must be designated when appropriate. The experimental unit is the smallest unit to which an individual treatment is imposed. For bacterial growth studies, the average of replicate tubes per single study per treatment is the experimental unit; therefore, individual studies must be replicated. Repeated time analyses of the same sample usually do not constitute independent experimental units. Measurements on the same experimental unit over time are also not independent and must not be considered as independent experimental units. For analysis of time effects, assess as a rate of change over time. Standard deviation refers to the variability in the biological response being measured and is presented as standard deviation or standard error according to the definitions described in statistical references or textbooks.

Results Results represent the presentation of data in words and all data should be described in same fashion. No discussion of literature is included in the results section.

Discussion The discussion section involves comparing the current data outcomes with previously published work in this area without repeating the text in the results section. Critical and in-depth dialogue is encouraged.

Results and Discussion

154

Results and discussion can be under combined or separate headings.

Conclusions State conclusions (not a summary) briefly in one paragraph.

Acknowledgments Acknowledgments of individuals should include institution, city, and state; city and country if not U.S.; and City or Province if in Canada. Copies being reviewed shall have authors’ institutions omitted to retain anonymity.

References a) Citing References In Text Authors of cited papers in the text are to be presented as follows: Adams and Harry (1992) or Smith and Jones (1990, 1992). If more than two authors of one article, the first author’s name is followed by the abbreviation et al. in italics. If the sentence structure requires that the authors’ names be included in parentheses, the proper format is (Adams and Harry, 1982; Harry, 1988a,b; Harry et al., 1993). Citations to a group of references should be listed first alphabetically then chronologically. Work that has not been submitted or accepted for publication shall be listed in the text as: “G.C. Jay (institution, city, and state, personal communication).” The author’s own unpublished work should be listed in the text as “(J. Adams, unpublished data).” Personal communications and unsubmitted unpublished data must not be included in the References section. Two or more publications by the same authors in the same year must be made distinct with lowercase letters after the year (2010a,b). Likewise when multiple author citations designated by et al. in the text have the same first author, then even if the other authors are different these references in the text and the references section must be identified by a letter. For example “(James et al., 2010a,b)” in text, refers to “James, Smith, and Elliot. 2010a” and “James, West, and Ad-

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Book Chapter: Examples:

ams. 2010b” in the reference section. b) Citing References In Reference Section In the References section, references are listed in alphabetical order by authors’ last names, and then chronologically. List only those references cited in the text. Manuscripts submitted for publication, accepted for publication or in press can be given in the reference section followed by the designation: “(submitted)”, “(accepted)’, or “(In Press), respectively. If the DOI number of unpublished references is available, you must give the number. The year of publication follows the authors’ names. All authors’ names must be included in the citation in the Reference section. Journals must be abbreviated. First and last page numbers must be provided. Sample references are given below. Consult recent issues of AFAB for examples not included in the following section.

Author(s) of the chapter. Year. Title of the chapter. In: author(s) or editor(s). Title of the book. Edition or volume, if relevant. Publisher name, Place of publication.

Inclusive pages of chapter.

O’Bryan, C. A., P. G. Crandall, and C. Bruhn. 2010.

Assessing consumer concerns and perceptions of food safety risks and practices: Methodologies and outcomes. In: S. C. Ricke and F. T. Jones. Eds. Perspectives on Food Safety Issues of Food Animal Derived Foods. Univ. Arkansas Press, Fayetteville, AR. p 273-288.

Dissertation and thesis: Author. Date of degree. Title. Type of publication, such as Ph.D. Diss or M.S. thesis. Institution, Place of institu-

Journal manuscript:

tion. Total number of pages.

Author(s). Year. Article title. Journal title [abbreviated].

Volume number:inclusive pages.

Examples: Chase, G., and L. Erlandsen. 1976. Evidence for a complex life cycle and endospore formation in the attached, filamentous, segmented bacterium from murine ileum. J. Bacteriol. 127:572-583.

Jiang, B., A.-M. Henstra, L. Paulo, M. Balk, W. van Doesburg, and A. J. M. Stams. 2009. A typical one-carbon metabolism of an acetogenic and hydrogenogenic Moorella thermioacetica strain.

Arch. Microbiol. 191:123-131.

Maciorowski, K. G. 2000. Rapid detection of Salmonella spp. and indicators of fecal contamination in animal feed. Ph.D. Diss. Texas A&M University, College Station, TX. Donalson, L. M. 2005. The in vivo and in vitro effect of a fructooligosacharide prebiotic combined with alfalfa molt diets on egg production and Salmonella in laying hens. M.S. thesis. Texas A&M University, College Station, TX. Van Loo, E. 2009. Consumer perception of ready-toeat deli foods and organic meat. M.S. thesis. University of Arkansas, Fayetteville, AR. 202 p.

Book: Author(s) [or editor(s)]. Year. Title. Edition or volume (if relevant). Publisher name, Place of publication. Number of pages.

Examples: Hungate, R. E. 1966. The rumen and its microbes.

Academic Press, Inc., New York, NY. 533 p.

Web sites, patents: Examples: Davis, C. 2010.

Salmonella. Medicinenet.com. http://www.medicinenet.com/salmonella /article. htm. Accessed July, 2010.

Afab, F. 2010, Development of a novel process. U.S. Patent #_____

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

155

Abstracts and Symposia Proceedings: Fischer, J. R. 2007. Building a prosperous future in which agriculture uses and produces energy efficiently and effectively. NABC report 19, Agricultural Biofuels: Tech., Sustainability, and Profitability. p.27 Musgrove, M. T., and M. E. Berrang. 2008. Presence of aerobic microorganisms, Enterobacteriaceae and Salmonella in the shell egg processing environment.

IAFP 95th Annual Meeting. p. 47 (Abstr. #T6-10) Vianna, M. E., H. P. Horz, and G. Conrads. 2006. Options and risks by using diagnostic gene chips. Program and abstracts book , The 8th Biennieal Congress of the Anaerobe Society of the Americas. p.

86 (Abstr.)

Data Presentation in Tables and Figures Figures and tables to be published in AFAB must be constructed in such a fashion that they are able to “stand alone” in the published manuscript. This

means that the reader should be able to look at the figure or table independently of the rest of the manuscript and be able to comprehend the experimental approach sufficiently to interpret the data.

Consequently, all statistical analyses should be very carefully presented along with variation estimates and what constitutes an independent replication and the number of replicates used to calculate the averages presented in the table or figure.

Each table and figure must be on a separate page in the submitted paper. In addition, you will need to submit all data for charts, tables and figures in native format when possible (e.g., Microsoft Excel, Powerpoint). Photographs should be submitted as high-resolution (600 dpi) .jpg or tif. files. All figures should be clearly presented with well defined axis and units of measurement. Symbols, lines, and bars must be made distinct as “stand alone” black and white presentations. Stippling, dashed lines etc. are encouraged for multiple comparison but shades of gray are discouraged. Color images, micrographs, pictures are recommended and there is no additional fee for their submission.

AFAB Online Edition is Now Available!

• Free Access • Print PDFs • Flip Through Issues • Search Article Archives • Order Reprints • Submit a Paper

www.AFABjournal.com 156

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

Agric. Food Anal. Bacteriol. • AFABjournal.com • Vol. 2, Issue 2 - 2012

157

Online Publication: www.AFABjournal.com