Katie Holten: Paths of Desire by Contemporary Art Museum St. Louis

Katie Holten

Paths of Desire

Katie Holten

Paths of Desire

Contents 07

Foreword Paul Ha

Paths of Desire Lia Gangitano

Watermark: Can southern Louisiana be saved? Elizabeth Kolbert

Thoughts on Urban Prairies Scott F. Woodbury in conversation with Katie Holten

Growing Natives Andrea Zittel in conversation with Katie Holten

Edible Estates Fritz Haeg in conversation with Katie Holten

A Reﬂection on Cities of the Future James Howard Kunstler

The Language of Landscape Anne Whiston Spirn

The Bullet Catcher A.M. Homes

My Favorite Plant Chris Somerville

A Different Kind of Practice Regina Gleeson in conversation with Katie Holten

A Field Guide to Getting Lost Rebecca Solnit

105 Having a Wonderful Time J.G. Ballard 110 Sources 111 Notes on Contributors 114 Biography 116 List of Works

opposite and preceding pages: The Black Tree, 2005–2007, cardboard, wood, wire, and duct tape, approx. 10.5 x 11.3 x 10.8 feet. Originally installed at VAN HORN, Düsseldorf. Installation views at Schürmann Berlin, January 19-March 24, 2007. Image courtesy Heins Schürmann Collection, Herzogenrath.

Paths of Desire (erised fo shtap), 2006, ink on paper, 11 x 8.5 inches.

Foreword Paul Ha The Contemporary Art Museum St. Louis is delighted to present Paths of Desire, the first solo museum exhibition and installation by Irish artist Katie Holten in the United States. The exhibition reaffirms the Contemporary’s commitment to presenting groundbreaking exhibitions and to commissioning new work by living artists. Katie’s work is particularly relevant at this time of renewed focus on the challenges facing our global environment, and I am deeply grateful to her for creating such extraordinary work for us during her residency in St. Louis. As a museum of contemporary art, one of the most important things we do is support and exhibit the work of living artists and I am proud to once again do so with the work of this exciting young artist. I am enormously grateful to those whose generosity made this project possible. My thanks to Katharine DeShaw and the Nimoy Foundation, Leonard and Susan Nimoy, the Elizabeth Firestone Graham Foundation, the Arts Council of Ireland, and Culture Ireland for their support of the exhibition, artist residency and artist’s book. I am also thankful to Deborah Patterson and the Monsanto Fund for supporting the related community outreach programming. In addition, I am very thankful to Christy Gray and the Whitaker Foundation, the William E. Weiss Foundation, Jill McGuire and the Regional Arts Commission, Jim Weidman and the Arts and Education Council, the Missouri Arts Council, and all of the members of the Contemporary for their ongoing support of our exhibitions and educational programs. I am deeply grateful to my long time colleague Lia Gangitano for contributing her thoughtful essay to this publication. As director of PARTICIPANT INC, one of New York’s newest and most innovative non-profit gallery spaces, Lia’s take on Katie’s work is appreciated. I also want to acknowledge Bruce Burton, our in-house graphic designer, for the extra thought and effort he put in to design this artist’s book so that it fulfilled Katie’s vision. On behalf of the Contemporary and its Board of Directors, I would like to thank everyone who helped organize and present this exhibition—especially our dedicated staff members. My appreciation is extended to Shannon Fitzgerald who first brought Katie’s work to the Contemporary’s attention and contributed much initial work on the project. I want to especially thank Shane Simmons and Mike Schuh for the skill and creativity they used to make the complicated installation go so smoothly. I thank Rebecca Walsh for her assistance coordinating the many details of the exhibition, residency and artist’s book. And, I want to thank our Grand Center neighbor Stan Jones for opening the doors of his home and inviting Katie to be his guest during her long residency in our community. I am grateful to our Board of Directors and especially to the leadership provided by Board Chairman John Ferring. John’s oversight of the Contemporary enables us to create an atmosphere where cultural and artistic risks are encouraged so we can continue to achieve our bold mission. I am also particularly indebted to Emily Rauh Pulitzer for her ongoing support of the Contemporary and for continuing to be my valued colleague. Presenting contemporary art is both an exhilarating and daunting undertaking. Exhibiting work without the reassurances offered by historical perspective requires a leap of faith and a conviction in the importance of contemporary creativity. I am deeply thankful to all our supporters who allow the Contemporary to play a role in our cultural development. Paul Ha Director 8

Excavated Tree (photograph of an excavated Cox’s Pippen tree re–erected in a shed), 2005, Lambda-Print, 11.8 x 15.7 inches, Edition of 15 + 2 AP. Edition printed by the artist and VAN HORN, Düsseldorf. Original photograph (1952) courtesy of David Johnson, East Malling Research, UK. Image courtesy the artist and VAN HORN, Düsseldorf.

Paths of Desire Lia Gangitano A found photograph titled Excavated Tree1(opposite) shows an uprooted tree suspended in space within a large shed, revealing its roots and branches for examination. It seems, as well, to be suspended in time. From this black and white archival document, originally intended for scientific use, Katie Holten draws a myriad of resonant references—fast-forwarding this image, perhaps previously frozen, into an increasingly resolute present. She does so through direct means, namely, by emulating the tree’s color as it appears in the photograph: black; as well as its form: roots elevated and displaced from the possibility of holding ground. As the centerpiece of her site-responsive exhibition at the Contemporary Art Museum St. Louis, Holten constructs, to scale, the entire structure of a Flowering Dogwood, a native Missouri tree, made from materials gathered from refuse generated by the museum, including recycled cardboard, wire, PVC, paper, and tape. Designed to draw one in, much like the extreme gravitational pull of a black hole in space, Holten’s tree also shares some of the black hole’s more abstract properties, such as inescapability (particularly as it pertains to the obliteration of light); an ability to warp paths towards its center; and certain loss due to inevitable collapse, if encountered. In Stanley Kubrick’s landmark sci-fi film of 1968, 2001: A Space Odyssey, what appears to be a black rectangle in space, “a shrieking monolith,” is the catalyst for the end of one evolutionary cycle and the beginning of another. When touched, this void gives way to new forms of life but is, perhaps, a cautionary vehicle as well—a warning symbol that points to the possible dissolution of the present. Within the wilderness of outer space, Kubrick mined more localized fears, positioning advanced technologies as a sinister influence, forcing the advancement of human evolution at the hands of an overly sensitive robot (HAL-9000), leading humanity to the verge of a black hole. . . However eclipsed in time, Kubrick’s vision of the future, as expressed through the perils of space travel and fear of alien intelligence, also referenced the untamed wildernesses of the past and remains a prescient implication as progress threatens to annihilate what was previously considered a boundless reserve, nature. In America, Ralph Waldo Emerson confronted the abhorrence of wilderness within frontier culture, asserting both the beauty and the goodness of the wild. Henry David Thoreau is associated with discourses of nature as unspoiled, wild, and distinct from the built environment of the urban. Changing urban imperatives continue to shift the construction of nature. In recent times, nature is more than ever being commoditized, either for resource extraction (logging, privatized water) or as recreation (ecotourism). These views are firmly rooted in a modern dualism in which nature is seen as external to society: its other.2 An interest in black holes and society’s other (its absence) may also point to their opposite, a concern for “the mathematics of presence,”3 that Holten intuitively maps in the research, notes, and drawings that proliferate her installations and accompany largescale works. Considered by the artist to be a ‘‘drawn object,’’ like much of her recent work that deploys various reconfigurations of recycled material, Excavated Tree: Missouri Native (Flowering Dogwood) (pages 26-27), manifests Holten’s belief that our experience of ‘‘nature’’ is inherently social and equally defined by the detritus, networks, and boundaries of the urban environment. “Desire Paths,” the architectural term that provides the title of her

This photograph was taken in 1952 at East Malling Research, UK and was appropriated by Holten in 2005 and titled Excavated Tree.

Peggy Bartlett, “Introduction,” Urban Place: Reconnecting with the Natural World, ed. Peggy Bartlett (Cambridge, MA: MIT Press, 2005): 13.

“the mathematics of presence” is taken from Holten’s notes (see page 56)

Walk in St. Louis (desire path on Lindell Boulevard), 2007.

exhibition, emphasizes the fact that in rural and urban spaces, informal human patterns against the grain of “official” or planned pathways can alter pavement, sidewalks, and fields of grass alike. As well, Holten’s approach to site-specificity is informed by an understanding that the demarcation of sanctioned routes can be rendered invisible even when one’s daily choices are influenced, if not engineered, by such spatial margins. Meaning, that paths of desire can also designate possibilities beyond, or resistance to, the formal separations indicated by ubiquitous fences, trees, or planters that delineate neighborhoods along lines of segregation, for example. Like ‘identity,’ definitions of ‘nature’ and ‘the natural environment’ are complex and contested. The predominant meaning has traditionally been ‘our nonhuman surroundings,’ with an understood dichotomy between what is a result of the human influence and what remains untouched. The dichotomy between the natural and the manufactured is, of course, artificial. Nature has long been subject to human influence through what is planted, supported, or tolerated. . . 4 Holten’s initial proposal for the Contemporary in 2005—to plant an urban prairie in a vacant lot in the city center of St.Louis—resides, like many examples of persistent utopian models, in the form of documentation. The unrealized proposal and subsequent conversations about the transgressive potential of the obsolete, the unfamiliar, the unrecognizable, also become integral parts of her work, taking forms such as research, plans, and imaginative sketches that, when collected, certify this potential. Holten’s methodology insists that nothing is wasted. Her longstanding practice of transplanting weeds is similarly pro-active, constituting an “ephemeral action” that questions “the direction life has taken”5 by particularly humble means, such as moving weeds from outside to inside, to neglected spaces, or to places soon to be uprooted by high-end development. These small gestures may redirect one’s attention, or inspire the taking of a walk. While in residence in St. Louis, Holten plans to take walks around the city, using the museum, which is located in Grand Center, as the starting point for excursions north, south, east, and west, charting modest paths to instigate questions regarding a larger history of place, for example, the locus of Lewis and Clark’s journey toward the Pacific. Part social investigation in the Situationist

Susan Clayton, “Introduction,” Identity and the Natural Environment, ed. Susan Clayton, (Cambridge, MA: MIT Press, 2003): 6.

Katie Holten: Paths of Desire, press release, Contemporary Art Museum St. Louis, 2007.

tradition of the “derive,” and part homage to historic works such as Richard Long’s Path Made While Walking, Holten’s walks insist on the importance of social engagement in the natural world, that is, the urban environment. Holten’s social engagement, as evidenced by public works, cross-disciplinary collaborations, and community organizing, is also manifested in various printed matter, ranging from handmade zines and flyers to publications incorporating the work of herself and others. In the spirit of such publications as Avalanche (1970-‘76), a magazine that sought to provide a platform for evolving art forms (Earthworks, Conceptual art, performance, video, etc. . .) and their social imperatives, Holten’s publications serve as subtle agents of a defiant worldview. It has been said of Avalanche that “ . . .the studied informality of the interviews [. . .] corresponded to the countercultural politics and grassroots ethos embodied by the publication, with its ad hoc feel and modest circulation. Its frank presentation of artists and their words—not to mention their art—was vital to the politicization of the alternative art scene in the ‘70s.”6 In its first issue, co-editor (with Liza Béar) Willoughby Sharp asked Robert Smithson to comment on his notion of documentation, which the artist referred to as “non-site,” and he noted: There’s a central focus point which is the non-site; the site is the unfocused fringe where your mind loses its boundaries and a sense of the oceanic pervades. . . The interesting thing about the site is that, unlike the non-site, it throws you out on the fringes. . . One might even say that the place is absconded or been lost. . . This is a map that will take you somewhere, but when you get there you won’t really know where you are. In a sense the non-site is the center of the system, and the site itself is the fringe or the edge.7 With a proliferation of research, documentation, correspondence, and books traveling with her, Holten’s working methodology is cumulative and expanding, and seeks to restructure “non-sites” that respond to specific, local concerns and, like her drawn and crocheted works that radiate outwards, spread from there. Such practices are mirrored, as well, in related curatorial enterprises, such as her ongoing traveling exhibition, CLUSTER (pages 82-83), which has grown from a one-night event at a pub in Dublin, to a flyer distributed at the Institute of Contemporary Art in London, to its present residence in a FreshDirect8 box that recently traveled from New York to Mexico City. It’s still growing. Containing works by over sixty artists, writers, small publishers, environmental activists, as well as an astrophysicist, an architect, and a horticulturalist, it represents a range of research, concerns, and thoughts shared by Holten and her myriad colleagues and friends. Occasions to unpack the box are inevitably social, and, like the gathering of works themselves (via emails, special delivery packages, and correspondence sent in the mail), they tend to encourage digressions, unexpected arrivals, and the continuing proliferation of contents. As is the case with Holten’s diversity of work, certain logics become legible amid seeming disarray—an interconnectedness shaped by the artist’s embrace of the fragmented, the tangential, and the communal. A founding member of several interdisciplinary art collectives, perhaps Holten’s Laboratorio della Vigna, a project for the 50th Venice Biennale in 2003 (pages 76-81), provides a microcosm of her evolving process-based anthropologies. Amid the prescribed hierarchy of nationalities, pavilions, and disciplines, Holten structured a temporary headquarters for a variety of collaborative and individual research, spawning works (and non-works) in sound, performance, and the accumulated proposals of others, showing “the whole process of the researched failures and successes like the detritus of a frenzied stream of thought positioned beside its distilled, crystal-clear idea.”9

Gwen Allen, “In on the Ground Floor: Avalanche and the SoHo Art Scene, 1970-1976,” ARTFORUM, XLIV, No.3, November 2005: 216.

Ibid.

FreshDirect is an online grocery store serving the New York metropolitan area.

Regina Gleeson, “Art Practice on the Move: Katie Holten’s Work Unplugged,” Visual Artists’ News Sheet, Dublin, January 2004.

Tree, 2006, cardboard, wood, newspaper, and wire, approx. 16.4 x 12.5 x 9.8 feet. Private collection.

Like a transient footnote that continues to take temporary residence, the migration of CLUSTER and the format of Laboratorio della Vigna in Venice reflect the artist’s travels and find shape through Holten’s research in the natural world. From botany to the science of networks, her work touches upon notions of displacement and transplantation—issues that she considers in forms ranging from the re-location of indigenous plant-life to various diagrams for parallel universes, drawn on paper or in space. Holten’s “forceful collapsing of distinctions between nature and culture, between ‘high’ art and lowly plant life, between aesthetic beauty and the botanically unbeautiful, between timeless art object and the transient weed, between the elevated and the everyday, is as salutary as it is momentarily disconcerting.”10 Drawing equally from the ubiquitous and the remote, the minute and the infinite, Holten’s practice renders connections via models of scientific as well as social networking. Traveling with her, CLUSTER is a project that is at once transient and at home. Its contents represent a long study—alone and together with others—of mounting ecological concerns through such lenses as recycling, collectivity, and sociability. Living in the US for a while, it has been noted that Holten’s “current investigations incorporate scientific theories of parallel universes and place her practice in polemical opposition to prevailing US policies increasingly underpinned by notions of ‘intelligent design’ and creationism.”11 Linking political imperatives with strategies associated with Nicolas Bourriaud’s Relational Aesthetics, Holten has perhaps adapted what could be described as “strategies of existence.”12 Like her walks, CLUSTER, spreads through acquaintances, stories, and sites that become available. Readings, performances, radio broadcasts, and a tiny sculpture living in an interior corner of the box—solicited and collected by Holten over time—all come out at

Caoimhin Mac Giolla Leith, “Related Matters,” Katie Holten and others: Drawings, Instances, Collaborations + Texts, Temple Bar Gallery & Studios and Tûp Institute, Dublin 2002: 20.

Denna Jones, “Doodling in Super Space,” exhibition booklet, A New Universe, March 12 – April 10, 2005, LMAKprojects, Brooklyn, New York: unpaginated.

Nicola Bourriaud, Relational Aesthetics, (translated by Simon Pleasance & Fronza Woods with the participation of Mathieu Copeland), les Presses du Reel, Dijon, France, 2002: 100.

the opening. A number of pieces employ the form of books, zines, and documentation of collaborative projects taking place in numerous cities. “Works included can expand and grow over the long-term, and the resemblance to an organic, living structure is intentional. [. . .] Some works are invisible, or inhabit other spaces such as rumors, posters, rooftops, holes, instructions, stories, objects, t-shirts, pubs, and gardens.”13 With her relocation to a temporary studio in New York in 2004, Holten inherited hundreds of FreshDirect boxes. “FreshDirect delivers [. . .] keeps the house and officebound fed and watered. The left over boxes pile up.”14 Holten made use of one box to house this special collection that she intended to deploy as instigation for a winter gathering. “It is no coincidence that CLUSTER resembles the refuge of a ramshackle community. . . ”15 In addition, she began re-fashioning the boxes into numerous receptacles for plants, which led to the making of other objects from discarded materials. As the artist has noted in a recent interview: “I’ve been using the word ‘object’ while thinking of it as a noun, referring to material ‘things,’ things that cast shadows. But it’s nice that you’ve thrown in this question, as the first objects I started making (containers for plants made from FreshDirect cardboard boxes) were definitely ‘objecting to’ something. I was interested in questioning the ideology, the waste, the state of things, the piles and piles of boxes accumulating. . . ”16 Similarly, her repetitive renderings of maps of the world drawn from memory have since taken shape on globes made from shredded newspapers—a transformative practice the artist quietly enjoys. Holten continues to note: “. . . the ‘globes’ are useless. The maps of the world are drawn from memory—whole countries are forgotten, obliterated, while others are drawn too large, or too small. For me personally these globes object to lots of things.”17 In Holten’s work, such objections form and mount quietly, and may emanate from mundane everyday experiences: yarn webs crocheted on the subway or on airplanes; a topographic drawing instigated by a phrase heard on the radio, Trembling on the Edge of Reprisal (pages 62-63); or her numerous drawings of Found Continents (pages 102-104) and Reconstituted Lands (pages 108 and 109) that began from observations of the shapes formed by her chipped black fingernail polish. At times resembling bruises or stains, the process of these markings, as well, starts small and, over time, begins to cast a certain darkness, which is more formally outlined in botanic renderings such as Bush (shadow) (page 60), or Ghost Forest (page 20) showing the spread of roots, branches, and shadows. And, like all her trees and objects, these drawings are black, existing in states of potential obsolescence. Holten’s persistence, however, as demonstrated in these drawn works, sketches, and texts, also seems to imply that systems and connections exist, even when they go unnoticed. Through her social manifestations of these ideas (such as CLUSTER), Holten instigates real life engagements that incorporate disparate interests, follow lines of tangents, and insist upon presence. Like her unrelenting weeds, such unexpected gatherings demonstrate the mutability and tenacity of ideas, and sometimes, as is the case with Excavated Tree: Missouri Tree (Flowering Dogwood), unite to transform the seemingly insignificant and redundant into necessary, monumental action. 13

CLUSTER, press release, PARTICIPANT INC, New York, January 27, 2006.

Katie Holten, email correspondence with the author, June 2006.

CLUSTER, press release.

Sally O’Reilly and Katie Holten, “A Discussion of Substance,” GRAN BAZAAR, Tûp Institute and m o s t r a, Mexico City, 2006: unpaginated.

Ibid.: unpaginated.

following pages: New York Trees, 2006, ink on paper, 30 x 22 inches. Private collections.

WATERMARK: Can southern Louisiana be saved? Elizabeth Kolbert Once the Mississippi River’s main outlet, Bayou Lafourche—pronounced “la-foosh”—is now a channel barely wide enough to accommodate two shrimp boats heading in opposite directions. Its waters are slack and brown and salty, so much so that people who drink them—and many who live along the bayou do—complain that they sometimes taste like baking soda. The bayou wends its way south and east from Donaldsonville, Louisiana, through Thibodaux and Lockport and Cut Off, past citrus groves and shotgun houses and subdivisions eating into the sugarcane fields. Eventually, it empties into the Gulf of Mexico. Follow it almost to the end and you get to Leeville, a town that has spent most of the past century disappearing. Leeville was settled by refugees, or, to use a less contested term, flood victims. On October 1, 1893, a hurricane wiped out the area’s main settlement, Caminadaville, which sat on a spit of land bordered on three sides by the Gulf and on the fourth by swamp. Nearly half of Caminadaville’s inhabitants perished in the storm, most by drowning, some when the buildings they had taken refuge in collapsed. Father Pierre Grimaux, the local parish priest, who rode out the disaster in the upper story of the presbytery, reported that “out of two hundred and fifty houses, only four remained.” Survivors sailed up the bayou in their damaged canots and began buying land from an orange-grower named Peter Lee, who was selling plots for $12.50 each. For sixteen years, they fished, planted rice, and held fais do-do dancing parties in homes with covered verandas. Then, in 1909, the Leeville Hurricane struck. (A contemporary newspaper account described survivors of that storm subsisting on drowned rabbit.) Six years later, a third hurricane forced residents to flee north once more. According to local legend, the storm surge carried one house from Leeville nine miles inland. The owner simply bought the plot underneath it and moved back in. In the nineteen-thirties, Leeville rebounded briefly. Oil was discovered in the area, and by the end of the decade there were ninety-eight producing wells in town. The pay was good and regulation nonexistent. Blowouts routinely rained sulfur and brine onto the houses, into the cisterns, over the trees. Tin roofs corroded and vegetable gardens shrivelled up. When the wells ran dry, oil production moved offshore and Leeville was again deserted. There were no more jobs, and the town itself had begun to wash away. Where once men in straw hats picked oranges and harvested rice, today there is mostly open water. A few months ago, I went to visit the remains of Leeville with Windell Curole, the director of the South Lafourche Levee District. Curole, as it happens, is a descendant of Peter Lee, and also a member of a swamp pop group that calls itself the Hurricane Levee Band. He is a trim man of fifty-four, with thick gray hair and dark, deep-set eyes. Seven of his eight great-grandparents grew up in Caminadaville, and three of his four grandparents lived in Leeville. Curole and his wife are raising their two children in Cut Off, thirty-five miles from the coast. “That movement of my family reflects the communities of southern Louisiana,” he told me. It was a dull autumn day, threatening rain that never came. “We have retreated, and we continue to retreat.” As we made our way south along the bayou, Curole kept pointing out landmarks from his childhood. “That’s where my grandfather’s trapping camp was,” he said, gesturing toward a stretch of boggy marsh. “When I was a baby, I could sit down in the front yard and not get my pants wet. When my mama was a kid, you had oak trees.” 20

Ghost Forest, 2007, ink on paper, 8.5 x 11 inches.

Curole receives checks for an oil lease on a plot that he inherited from his grandparents. The plot is now submerged. In Leeville, we passed a bait shop, a gas station, and a cluster of mobile homes perched, like birds’ nests, on narrow wooden pilings. We wandered down to a dock, which had a view of one of the last remnants of the old town—a cemetery. Leeville’s dead had not been buried but entombed in vaults. Waves lapped at the caved-in bricks. A porpoise jumped out of the water, then slipped back in. Five thousand years ago, much of southern Louisiana did not exist. A hundred years from now, it is unclear how much of it will remain. The region, it is often observed, is losing land at the rate of a football field every thirty-eight minutes. Alternatively, it is said, the area is shrinking by a large desktop’s worth of ground every second, or a tennis court’s worth every thirteen seconds, or twenty-five square miles a year. Between 1930 and 2000, some 1.2 million acres, an area roughly the size of Delaware, disappeared. Hurricanes Katrina and Rita stripped away an estimated seventy-five thousand acres—a loss as big as Manhattan and Brooklyn combined. The US Geological Survey has published a map illustrating the process. Areas that have already vanished appear in red, and areas that are expected to vanish by 2050 in yellow. On the map, the southern coast looks as if it were on fire. According to the U.S. Army Corps of Engineers, “The rate at which Louisiana’s land is converting to water is probably the fastest in the world.” The signs of this impermanence are most obvious at the ends of the bayous, where the border between land and sea is changing so quickly that no one really bothers to keep track of it anymore. But, once you start looking, those signs can be found just about everywhere. All across southern Louisiana, there are groves of dead cypress trees, known as ghost forests, which have been killed off by encroaching salt water. On the eastern edge of New Orleans, the Mississippi River-Gulf Outlet Canal—MR-GO (“Mister Go”) for short— provides a shortcut for shipping. When it was completed, in 1965, it was five hundred feet across; now it is more than three times as wide. Then, of course, there’s the city itself. Those neighborhoods, like Lakeview and the Lower Ninth Ward, which lie several feet below sea level are still essentially deserted.

Over the years, a great many plans have been drawn up to protect the Louisiana coast; these range from building up barrier islands with pumped sand to digging an alternative route for the Mississippi River—the so-called Third Delta Conveyance Channel. Katrina and Rita have inspired a whole new generation of proposals. Curole, who since the hurricanes has made several trips to Washington to testify before Congress, has, for example, been advocating a series of thirteen-foot levees that would loop around from the Lake Pontchartrain basin through Lafourche and Terrebonne Parishes to Morgan City, stretching more than a hundred miles. All of these plans rest on the same assumption, which is that something can be done to halt, or at least dramatically slow, land loss. If this can be accomplished, there are many possible futures for southern Louisiana. If it can’t, there is only one. Roy Dokka is a professor at Louisiana State University in Baton Rouge. He is a large man, with a wide face and wavy dark hair. By training, he is a structural geologist, and in the early part of his career, at the University of Southern California, he spent a lot of time mapping earthquake faults, including the ones that run near Yucca Mountain, in Nevada, where the federal government would later propose storing high-level nuclear waste. About ten years ago, Dokka became interested in using G.P.S. technology to study how the earth’s surface is moving. This project led him to undertake a study of elevations in southern Louisiana, which yielded some unexpected—and, in many circles, unwelcome—results. On a hot, bright-blue day a few weeks after Katrina, I went with Dokka to attend a meeting with officials in Plaquemines Parish, just southeast of New Orleans. There was heavy traffic—since the hurricanes, the roads that are still functioning have been carrying nearly twice as many cars—so we were late getting to the parish-council office, in the town of Belle Chasse. As we arrived, helicopters carrying sandbags were thumping overhead. In the parking lot, we met the parish president, Benny Rousselle, who was walking in the opposite direction. He pulled Dokka aside. “Let me ask you, this is not going to affect my rebuilding by more than a foot?” he said. His tone suggested that he was not so much asking as telling. “I can live with a foot or so.” Dokka nodded silently, then, when Rousselle was out of earshot, muttered, “You wouldn’t have to live with it, but your people might die from it.” We headed into the building, which was faced with wooden planks, like a Western saloon. A half-dozen people were sitting at computers in a makeshift command center. Water was dripping from the ceiling into an orange plastic bowl. A six-hundred-and-sixty-six-pound blue marlin was mounted on the wall, next to a satellite photograph of the parish: a long, skinny leg of land twisting out into the Gulf of Mexico. The photograph was pasted with fifteen little red triangles marking the spots where the parish’s levees had been breached. After Katrina, many of the breaches had been sealed, only to be reopened by Rita. Dokka’s study, which he published in July, 2004, under the title “Rates of Vertical Displacement at Benchmarks in the Lower Mississippi Valley and the Northern Gulf Coast,” showed that for decades elevations in coastal Louisiana had been systematically overstated. Heights had been calculated on the basis of “benchmarks” that were supposedly stable but which, it turned out, were themselves subsiding. Dokka’s calculations showed that the fastest-sinking areas, among them the southern part of Plaquemines Parish, were losing elevation at the rate of more than an inch a year. Official elevation figures are issued by the National Oceanic and Atmospheric Administration, through its National Geodetic Survey office. At first, NOAA resisted Dokka’s findings; then it embraced them. Since elevation is a crucial factor in construction in southern Louisiana—among other things, it determines whether a home or a business qualifies for federally backed flood insurance—this shift is likely to affect practically every rebuilding project in the area. In the weeks after Katrina, NOAA officials raced around the state, trying to get out the message that the old elevation numbers were invalid. Several 22

of them met us at the command center. We all trooped into the parish engineer’s office, where some local public-works officials were waiting. A NOAA official named Ronnie Taylor handed out a two-page Xerox. On one page was a map of the parish, marked at intervals with codes, like D 194 and C 195. Each represented a benchmark. On the other, there were columns for the benchmarks’ “old” elevations, the “new” elevations, and the difference between the two. All of the benchmarks had lost elevation, and while none had been lowered by more than a foot, some had come close: C 195, near the town of Port Sulphur, had lost nearly nine inches; A 152, near the town of Myrtle Grove, had lost eight. The revisions had brought several of the benchmarks down to sea level, or lower. EMPIRE AZMK 2 was now listed at minus half an inch. J 370, in the southernmost reaches of the parish, was now minus four feet. “These heights that we’re providing, we would recommend very highly that those would be the only ones that you would use for reconstruction or rebuilding,” Taylor told the men around the table. They looked glum. “You need to specify, ‘Thou shalt only use these numbers,’ ” Dokka emphasized. Taylor went on to note that the new elevations, which were based on 2004 data, were probably themselves already out of date, as most of the benchmarks had continued to subside. Dokka suggested that the figures be thought of as having expiration dates, like milk cartons. In a few years, new “new” elevations would be issued. “I don’t want to be the person who pulled the rug out from under southern Louisiana,” Dokka said later, as we walked back to the car. “But ultimately it’s going to get so bad over here—in fifty to a hundred years, maybe sooner—that this is going to go under water.” . . . Plaquemines Parish is one of the youngest parts of Louisiana, and has sections that are so new they do not show up on nineteenth-century maps. The parish is bisected by the Mississippi, and at its tip the river finally ends its 2,350-mile journey, splaying out into a formation that resembles the toes of a chicken and is called the Birdfoot. Highway 23 follows the contours of the river along its west bank. The road is protected by levees on both sides, but during Katrina water came in from all directions. Just beyond Myrtle Grove, we came to a spot where two barges that had been lifted by the storm surge were sitting on top of a river levee. Piles of dead fish lay on the grass. We passed a grove of citrus trees, which were turning brown from saltwater exposure, and a mobile home that had been deposited on top of a minivan. . . In some spots, the floodwaters had receded, or been pumped out, but in others back yards and pastureland were still submerged, and water lapped at the shoulder of the highway. As we continued south, the destruction grew more complete. In Port Sulphur, so named for its now abandoned sulfur mines, most houses had been reduced to construction debris. The few buildings still standing had lost their outer walls, so that you could look right through, into what had once been kitchens and living rooms and dens. The trees were draped with an astonishing assortment of household goods: jackets, tires, chairs, bicycles. It became something of a contest to see who could find the most amazing item in the branches. Except for an occasional Humvee full of National Guard members and some Spanishspeaking workers, we were the only people in the area. It was eerily still. . . Near the town of Empire, two fishing boats, the Sea Falcon and the Sea Wolf, both a hundred and fifty feet long, had landed across all four lanes of Highway 23. . . “This area is living on borrowed time,” Dokka said. “I mean, it is.” . . . Start to dig in Plaquemines Parish, or almost anywhere in southern Louisiana, and you will pull up peaty mud; the consistency of the region’s soil has been compared to warm jello. Pretty soon, your hole will fill with water. (This makes it hard to keep things like caskets underground, which is why the dead are, as a rule, stored in vaults.) If you keep digging, eventually you will reach sand and clay. If you go on, you will reach more clay and 23

more sand, and this process will repeat for hundreds—in some places thousands—of feet. There are no rocks in southern Louisiana, except for those that have been imported to, for example, shore up the sinking roads. The clay is imported, too, only on a different time scale. In some form or another, the Mississippi has been flowing for tens of millions of years, and all the while it has been carrying great loads of sediment—in the eighteen-hundreds, some four hundred million tons per year—which tended to settle out where the river, slowing, emptied into the sea. In this way, what is now the Louisiana Gulf Coast was formed out of bits and pieces of Missouri and Arkansas and Kentucky and Iowa and Illinois and Minnesota. The buildup of southern Louisiana and its wasting away are flip sides of the same deltaic process. Over time, sediments naturally compact and consolidate—or dewater—with recent layers, which are wetter, losing volume more rapidly. Once enough sediment has been deposited, the load begins to depress the earth’s crust, a process known as down-warping. (Down-warping occurs so gradually that the earth is still responding to sediment deposited tens of thousands of years ago.) In areas where accretion exceeds subsidence, new land is created. But the process works against itself. When too much sediment builds up at its mouth, the river, seeking a faster route to the sea, switches course, like a hose flopping around in the grass. A new bulge of land, or delta lobe, starts to form, while the old one slowly continues to sink and compact under its own weight. In the past eight thousand years, the river has built five major lobes, some of them overlapping. Western Terrebonne Parish is what remains of the delta lobe built during the time of the Assyrians; Lafourche Parish is what’s left of the lobe laid down during the Roman Empire. Many still more ancient delta lobes are now submerged. The Mississippi fan, an enormous cone of sediment that was laid down during the ice ages, now lies under the Gulf of Mexico; it is larger than the entire state of Louisiana and in some places ten thousand feet thick. . . The fundamental problem of southern Louisiana—the fact that making the area suitable for permanent settlement also tends to make it that much more impermanent—has been understood for many decades. In the nineteen-twenties, Percy Viosca, a Louisiana naturalist, warned that flood-control and land-reclamation efforts were “killing the goose that laid the golden egg”; he advocated that the state adopt policies to re-establish the “natural conditions” conducive to healthy marshes. Instead, though, virtually all the practices that exacerbate land loss were allowed to continue and, in some cases, even encouraged. Swamps were drained to create agricultural fields and housing developments; this caused the peaty marsh soils to oxidize and shrink, like a drying sponge, resulting, in many instances, in new expanses of open water. Navigational channels like the Mississippi RiverGulf Outlet were dug; these carried salt water into what had been freshwater marshes, killing trees and grasses and inviting erosion. Thousands of miles of canals were cut into the wetlands to facilitate oil and natural gas exploration; much like the navigation channels, these canals wreaked havoc on the local hydrology. Where oil was found, the process of extraction caused some areas to slump—Louisiana “floats on oil like a drunkard’s teeth on whiskey,” A. J. Liebling once wrote—further contributing to subsidence. Meanwhile, efforts to reverse or merely forestall wetland loss have been halting. The history of the Caernarvon project illustrates the difficulties encountered even by what is, compared with the magnitude of the problem, a relatively modest endeavor. The project was approved by Congress beginning in 1965; owing to bureaucratic inertia and state budget cuts, it was not completed until 1991. Almost as soon as it began to operate, a new set of problems arose. Although almost no one lives in the wetlands affected by Caernarvon, some areas are leased to oyster farmers, who pay two dollars an acre for a claim that lasts fifteen years, and other areas are popular with shrimpers. In 1994, oyster farmers in the area filed a class-action suit against the state, alleging that the project had reduced the value of their leases. While the litigation dragged on, Caernarvon was operated at only a fraction of its capacity. In December, 2000, a Plaquemines Parish jury awarded five of the farmers damages 24

of forty-eight million dollars, a verdict that, applied across the entire class, added up to more than a billion dollars. This verdict was later overturned by Louisiana’s highest court, and then, with the help of Alan Dershowitz and his brother, Nathan, the reversal was appealed to the US Supreme Court, which last year finally put an end to the case by refusing to hear it. At the same time that the oyster-lease case was in litigation, shrimpers were complaining, often vociferously and to their representatives in Baton Rouge, that, because of the changes in salinity, the shrimp had stopped showing up. Chuck Villarrubia is the Louisiana Department of Natural Resources official who oversees Caernarvon’s day-to-day operations. I happened to be sharing an airboat with him. “We are trying as best we can to mitigate the conflicts,” he told me. “But there’s a lot of people yelling at us.” On more than one occasion, Villarrubia said, he has received Caernarvon-related death threats. There are many ways to go about wetland restoration. An area can be replanted, or built up, or enclosed to retain soil that would otherwise be washed away. New sediment can be brought in by barge, or pumped in through pipes. The Caernarvon project follows the simplest possible model: at times of high flow, the gates are opened and water floods the wetlands much as it would have before the river was contained. In addition to dumping sediment, the influx from the Mississippi pushes back salt water that is pressing up from Breton Sound. This, in turn, encourages the growth of reeds and marsh grasses, which, by dying and decaying, help build up the soil, allowing still more plants to grow, and so on. As we skittered along, Villarrubia pointed out stands of trees, mostly young willows, that hadn’t been there when he first began working on the project. . . The wetlands in the Caernarvon outfall district are dotted with monitoring stations. On our way to the first, we passed through a large, perfectly rectilinear lake, known as Big Mar. For a short time, it had been a farm; now it was an object lesson in futility. At the station—a white plastic tube sticking up out of the muck—we all clambered off the boats and onto the nearest semi-dry land. Greg Steyer, an ecologist with the U.S.G.S., grabbed hold of an auger that looked like a skinny torpedo and plunged it into the ground. It had a hollow chamber in the middle, and, when he twisted it, it gouged out a core. He pulled the auger up and opened the chamber. There was a layer of dirt, which had the consistency of gruel, and, beneath that, a six-inch layer of clay. Steyer tossed away that core and took a new one. The same clay layer appeared again. It had been laid down, he explained, during the great Mississippi flood of 1927. For the people who lived in and around Caernarvon—at that time a sleepy hamlet—the 1927 flood was an unprecedented disaster. During the spring of that year, extraordinarily heavy rainfall inundated some sixteen million acres of land in more than a half-dozen states. As the flood crest moved south, influential New Orleanians decided that the best way for the city to avoid catastrophe was to blow up the levee downriver—a decision that made little sense in terms of hydraulics but was nevertheless carried out. (The spot chosen for the dynamiting was just a few hundred yards from where the diversion project now stands.) In the ensuing rush of water, several thousand people—mostly trappers—lost their homes. By the perverse logic of the delta, this wholesale destruction of the human landscape sustained the natural one. Had the flood not occurred, the six-inch layer of clay would never have been deposited, in which case the land we were standing on might well no longer be there. . .

Plan for the installation of Excavated Tree: Missouri Native (Flowering Dogwood), 2007, at the Contemporary Art Museum St. Louis, ink on paper, 8.5 x 11 inches.

this page and opposite: Construction of Excavated Tree: Missouri Native (Flowering Dogwood), 2007, cardboard, newspaper, paper, wire, steel, PVC, and duct tape, approx. 18 x 14.75 x 14.5 feet.

opposite and above: The Black Tree, 2005-2007, cardboard, wood, wire, and duct tape, approx. 10.5 x 11.3 x 10.8 feet. Originally installed at VAN HORN, D端sseldorf, 2005. Installation views at Sch端rmann Berlin, January 19-March 24, 2007. Image courtesy Heins Sch端rmann Collection, Herzogenrath.

Work in progress, newspaper and glue, 2006-2007.

Holtenâ&#x20AC;&#x2122;s studio in Paris, 2006-2007.

Paris Trees, 2006-2007, newspaper, glue, and acrylic, approx. 126 x 6 x 5 inches. Installation view of Re-trait at Fondation dâ&#x20AC;&#x2122;entreprise Ricard, Paris, March 6-April 13, 2007. Paris Trees in foreground, other works by Detanico & Lain, Benoit Maire, Bojan Sarvecic, and Rainier Lericolais.

A Rare Psychedelic, 2005, acrylic on windows and walls with shadows, dimensions variable. Installation views at LOTS gallery, Bristol, UK, July 30-August 27, 2005.

Thoughts on Urban Prairies Scott F. Woodbury in conversation with Katie Holten via email. Katie Holten: hi Scott, I’m working with the Contemporary Art Museum St. Louis on the prairie project. Unfortunately we’re unable to go ahead with it. So many great people, such as yourself, were working with us on it and we were all excited to make it happen. I’d like to talk with you about why the prairie failed. Would you have the time to discuss what happened and what the implications are? Scott F. Woodbury: Sure Katie, I’d be happy to help explain what I can. KH: First of all I’d like to ask you about your previous experience with planting prairies. Can you tell me a little about that? Have they all been in St. Louis and what kind of areas have you planted? You mentioned that we should be aware that we would probably receive some negative feedback from locals—what has your experience been? SW: Well, long story short. I’ve been seeding and consulting on prairie seedings for 15 years, mostly in the St. Louis region and in particular at Shaw Nature Reserve. I’ve been directly involved recently with college and corporate campuses, public schools, highway intersections, churches, municipal parks, private homes, and larger agricultural areas. I recently wrote a landscape manual on prairie reconstruction. You can see it on our website at www.shawnature.org. My primary work however is at Shaw Nature Reserve where I’ve conducted over a dozen seedings. I’ve seen projects fail for a number of reasons. . . drought, debilitating weeds, poor maintenance, and the perception that prairie landscapes are weedy. They are weedy in the first two years. This is where the pressure builds. Boards get nervous, staff are questioned, the public complains, tempers rise, hasty measures are taken, prairie fails, etc. The two most important ingredients are patience and more patience and most people have difficulty with this. People prefer instant gratification. KH: The main reason that my prairie was stopped was because an individual in charge of the public grounds decided that it was ‘dangerous’. He told us that he felt ‘threatened’ by it. As I’m essentially a country girl, having grown up in rural Ireland, I find this horrifying—a fully-grown man feeling threatened by plants—wild flowers. You must have had to deal with this reaction before—do you have a standard response? I can understand that while it’s maturing the prairie could look weedy, but why should this cause fear? Manicured lawns and GM grass is scary (in my opinion), but indigenous plants—the most natural thing in the world. Is this what he’s scared of—the fact that they are natural and take over, without maintenance, without control? His fear implies that ‘bad things’ will happen in the prairie— in fact he told us that people would get mugged. Have you ever come across scenarios like this before? SW: Katie, there seems to be a lot of unwarranted fear in the US right now, especially in St. Louis. Our city was recently deemed the most dangerous city in the nation. I’ve only come across the fear thing once before on a college campus but it wasn’t grasses and flowers in that case but trees and shrubs. That is certainly a minority opinion and not worthy of much more comment. Sorry it had to end this way. July 29, 2006

opposite: Delightful Isolation (detail), 2005, mixed media on paper, 19 x 24 inches.

Ugress Studie, 2002, transplanted weeds, approx. 10 x 10 x 4 feet. Public art project commissioned by the Kunstbanken Hedmark in Hamar, Norway for Under Ă&#x2026;pon Himmel, August 18â&#x20AC;&#x201C;September 29, 2002.

Lament, 2006, a performance by Martha McDonald at Bartram’s Garden in Philadelphia, July 29, 2006. Lament was a collaboration between McDonald and Holten as part of Holten’s project for the Soft Sites exhibition at the Institute of Contemporary Art in Philadelphia, April 21–July 30, 2006.

The Seed Collection, 2005-2006, replicas of native and non-native plant seeds made from clay and acrylic, dimensions variable. Installation views at Bartramâ&#x20AC;&#x2122;s Garden as part of the Soft Sites exhibition at the Institute of Contemporary Art, Philadelphia, April 21â&#x20AC;&#x201C;July 30, 2006.

Growing Natives Andrea Zittel in conversation with Katie Holten in Andrea’s garden at A–Z West in Joshua Tree, California. Katie Holten: Can you show me around the garden? Andrea Zittel: Sure. . . I just planted all of these, so the orange ﬂags are so I’ll know what to water ‘cause they’re so little. And then the rabbits. . . that’s what this wire is for. . . the plants are still pretty vulnerable. KH: What are they? AZ: All kinds of different things—they’re all natives. I think that’s an Indigo bush. These are Smoke trees. They’re really beautiful, but they’re hard to grow. They don’t normally grow here— they usually grow 500 or 1,000 feet below this—so they don’t like the cold. And these are Jojoba, they grow naturally up in the hills, but in the seventies people planted a lot of Jojoba out here for oil. . . they’ll be nice when they ﬁll out.

A–Z West in Joshua Tree, with Mesquite trees.

KH: So you came out here a lot when you were growing up? AZ: My grandparents lived just south of here. I went out there a lot to visit them and we would just drive through here. And then I started coming out here when I was twenty I came out here to take photographs. . . and these are Mesquite trees. They’re really beautiful in the summer—super bright and they get really full. They’ll create shade and cool things down. . . hopefully! KH: The shadows are fantastic.

Andrea Zittel’s Regeneration Field in Joshua Tree.

AZ: Yeah, but I’m having a hard time to get the trees to grow up and I almost wonder if it’s because it’s so reﬂective in here [patio outside the studio] that they’re kind of confused. These seem to be growing down more than the ones up on the hill. March 17, 2006

View of the path leading to A–Z West.

following pages: River Delta, 2005, ink on paper, 22 x 30 inches.

Bog Grappa, 2002, water, bog plant, cork, and bottle, 13 x 2.5 x 2.5 inches. Private collection.

Edible Estates Fritz Haeg in conversation with Katie Holten over lunch in New York. Fritz Haeg: Control—it’s about absolute domination of the landscape and repressing anything that’s unfamiliar or unexpected—the same reason people want McDonalds and chain retail stores. Katie Holten: Yeah, a lot of people seem to feel threatened by the unfamiliar and it seems that that’s why my prairie failed to happen in St. Louis. What about your Edible Estates project—isn’t that imposing an unfamiliar landscape on suburban front lawns? FH: The Edible Estates project isn’t about convincing anyone of anything. We’re working with people and families who want to do it. The owners of the gardens are meant to be avid gardeners already—it’s not about converting those people. The garden becomes a spectacle. It’s propaganda to encourage other people to do it. A public spectacle of defiance. Demonstrating to people where their food comes from. It becomes a demonstration of how you have a choice about how you use your private land. The most basic thing as humans is growing our own food. Once we stop being nomadic the first symbol of that is to grow our own food. But it’s not just a political act, some eco-green, save-the-planet project. A lot of people assume it is, but it isn’t. It might sound really tired, but it’s true—I think the idea of it is beautiful. The very notion of that act is really beautiful and to me that’s enough. And that’s all I really need to see happen. And whatever spills out from that could be some revelation of the truth of the world that we’re living in, good or bad. And if nobody else does it because nobody has time—that’s a truth that we should look at, “oh, isn’t that interesting that we don’t have time to grow our own food but we have time to sit on the freeway for an hour, watch TV for 3 hours. . . ” KH: When did you start the Edible Estates project? FH: Well, you know the interesting story about it is that it all started with the presidential elections in 2004. I’d been doing a lot of ecology projects since 2001 and at the end of 2004 I shut down my life and I went to Australia to take some time off. And then after those elections—after looking at the red and blue states—I really felt very deeply that I wanted to do a project that wasn’t so insular. In the art and design world we’re so focused on these little worlds in New York and L.A. and we’re only talking to ourselves. I wanted to do a project that was for mainstream, middle America—the red states. I wanted to do a project for them. A project that would leap over conventional art audiences. So, I put out the word. I said that I wanted to do my next project in the geographic center of the country. A curator invited me to go do the project in an art center in Salina, Kansas, which is the center of the country, geographically. That’s also where the Land Institute is. And then I landed on the idea of the front lawn being the territory to work in. The first garden was done in 2005, right when I met you. KH: That’s interesting—I thought the ‘lawn’ was the starting point—I didn’t realise that it came from the elections. FH: The garden and the lawn were just vehicles to have a conversation that went outside these little, hermetic, art and design world settings. I think we both have the same feelings about that. We’re both drawn to scrappy, little spaces and places outside this highly commercial art-fair world. I’m really just interested in that basic idea of taking a space that was polluting, toxic, fake, isolating, useless, and hostile, and replacing it with something that’s the opposite of all those words. It’s gracious, welcoming, productive, healthy. . . KH: Sounds great! That’s why I wanted to include Edible Estates in CLUSTER—it’s such an optimistic and hands-on project. It seems to be more about just getting stuck in and doing what you and the people you end up working with want to do, rather than worrying 42

left and right: Fritz Haeg’s garden overlooking Eagle Rock, Los Angeles, 2006.

about it being an ‘art project’. Same thing applies to the Sundown Salons that you organized in your home. I was sad that we didn’t have time to have CLUSTER Salon. FH: Edible Estates was a wonderful experience. The first one we did was in Salina, the second was in Lakewood, California, and the next one will be planted in New York. That’s going to be at the end of May. ABC news productions is really interested and they’re pitching it to cable networks. It’s interesting because the whole project grew out of wanting to do a profundly rigorous project that was for the broadstream American public. So, it’s actually. . . KH: Made for TV. . . FH: Yeah, in a way. It plays into a lot of TV models. I’ve come ‘round to the idea and ABC is really behind it. If the TV thing doesn’t happen then I’ll just produce it myself. KH: Do you think the TV show will really work—aren’t you worried that you could be misrepresented? FH: The TV show is a weird incarnation of the project. I can imagine that with some projects the TV show could ruin the whole premise. But with this I hope the TV show will make it more pronounced. Who knows? I hope so! Have you seen the documentary The Future of Food? It was an exposé on industrial food production, Monsanto in particular. KH: No. But it sounds like the Omnivore’s Dilemma, which I’m going to read with the book club in St. Louis. I heard Michael Pollan on NPR when the book came out. He was so coherent. FH: Yeah, I’m such a Michael Pollan fan. I’ve written him a fan email! I want him to contribute to the Edible Estates book. I think the interesting thing about him is that he’s a writer first. I think that’s really important. There are a lot of people interested in these issues but they can’t communicate them. . . Do you spend much time in Ireland? KH: Everytime I travel I pass through my mum’s house. It’s my base, I suppose—all my banking’s done from there! I love my mum’s garden and living on the edge of the bog, surrounded by fields. FH: That’s what I’ve enjoyed about L.A.—it’s a very watered-down suburban version of the ideal—having a garden, a quiet, productive life connected to the outdoor world while being a part of everything. I’m craving a life that’s much simpler, that doesn’t involve cars at all, which you can’t have in L.A. Or you can, but it takes a lot of work. There are people who don’t have cars in L.A. They bike everywhere. It’s a beautiful idea, but I’m super-efficient and I need to do everything super-speedy. There’s too much I want to do in a day and I couldn’t do it on a bike! 43

Fritz Haeg’s Edible Estates in Lakewood, California, 2006.

KH: Yeah, I heard about cyclists when I was in L.A. but I never saw any! Okay, so as you don’t cycle, do you have time for your garden? FH: No—Katie you would be so depressed if you saw my garden! The irony is that the more time I spend on Edible Estates and everything else, the more my own garden just languishes. When I moved into my house I wanted to plant everything—so I planted a lot of things that need water and a lot of looking after. But now everything that needs help I’m letting go. I’m only going to plant natives and edibles. The fruit trees are staying. KH: Weeds, what do you think about weeds? FH: [Chuckle!], I guess I discriminate. Grass is my problem—not wild grasses, but lawn grass seed—that’s the one thing. My ideal garden would have some profound underlying structure in terms of organization and geometry and paths and spaces—highly structured with basic perennials, woody things, fruit trees, vines and things like that—that then is allowed to fall apart. So you can have wildflower seeds pop up in unexpected places. KH: Like an English wildflower garden? FH: I like a fusion of both—of hyper-controlled French and Italian lineal paths—that you then let fall apart in places! You’ve seen my garden—it has some of those things already. KH: Yeah—paths, pond, trees, and the view—the grand vista with the mountains on the horizon. It’s almost a classical garden. A fabulous location to hold your funky gatherings —the Sundown Salons and Sundown Schoolhouse—bringing a wild mixture of people to hang out up on the hill overlooking the city of Los Angeles. . . FH: The idea that always sticks with me is that 150 years ago, with the industrial revolution at the turn of the century, there was a period of 50-100 years where, basically, we threw out millenia of development in terms of how to build, how to plan, how to just be connected to where we are. With plate glass, air conditioning, steel, cars, cheap energy, we were given this little bubble of time where we felt like research possibilities were endless. We had the luxury, if you can call it a luxury, of not having to pay attention to specificity of place anymore. And that’s going to be a very short window as we realize that we can’t do it anymore. We just threw away thousands of years of understanding of place. It’s like a break in the line of communication in development. You look at animals developing over millenia, like termite towers—so much smarter than anything we could do. We’re starting all over again, in some ways. February 20. 2007 44

Containers, 2005. Installaton view of Bucolica at Wallspace, New York.

Weeding in New York, 2005.

Container, 2005, reconstituted cardboard box, plastic bag, duct tape, soil, transplanted weeds and other plants, approx. 21 x 21 x 6 inches (without plants). Installation view at a private residence in New York. Private collection.

Weeding in New York, 2007.

Walking What would become of us if we walked only in a garden or a mall? When we walk we naturally go to the fields and woods. . . I have met with but one or two persons in the course of my life who understood the art of Walking, that is, of taking walks, who had a genius, so to speak, for sauntering; which word is beautifully derived “from idle people who roved about the country, in the middle ages, and asked charity, under pretence of going à la sainte terre” — to the holy land, till the children exclaimed, “There goes a sainte-terrer”, a saunterer — a holy-lander. They who never go to the holy land in their walks, as they pretend, are indeed mere idlers and vagabonds, but they who do go there are saunterers in the good sense, such as I mean. Some, however, would derive the word from sans terre, without land or a home, which, therefore, in the good sense, will mean, having no particular home, but equally at home everywhere. For this is the secret of successful sauntering. He who sits still in a house all the time may be the greatest vagrant of all, but the Saunterer, in the good sense, is no more vagrant than the meandering river, which is all the while sedulously seeking the shortest course to the sea. But I prefer the first, which indeed is the most probable derivation. For every walk is a sort of crusade, preached by some Peter the Hermit in us, to go forth and reconquer this holy land from the hands of the Infidels.

Walk in New York (street pumpkins), 2005.

Walk in Accra (wood), 2005.

Walk in New York (snow tree), 2006.

Walk in Accra (oranges), 2005.

Plan for the failed urban prairie, Washington Boulevard, Grand Center, St. Louis.

A Reﬂection on Cities of the Future James Howard Kunstler

Back in the early 20th century, when the cheap oil fiesta was just getting underway, and some major new technological innovation made its debut every month—cars, radio, movies, airplanes—there was no practical limit to what men of vision could imagine about the future city, though often their imaginings were ridiculous. The representative case is Le Corbusier (Charles-Edouard Jeanneret; 1887–1965), the leading architectural hoodoomeister of Early High Modernism, whose 1925 Plan Voisin for Paris proposed to knock down the entire Marais district on the Right Bank and replace it with rows of identical towers set between freeways. Luckily for Paris, the city officials laughed at him every time he came back with the scheme over the next forty years—and Corb was nothing if not a relentless self-promoter. Ironically and tragically, though, the Plan Voisin model was later adopted gleefully by post World War Two American planners, and resulted in such urban monstrosities as the infamous Cabrini Green housing projects of Chicago and scores of things like it around the country. Other visions of that early period involved Tom Swiftian scenes of Everest-size skyscrapers with Zeppelin moorings on top, linked to zooming air trams, while various types of personal helicopters swooped between things. Virtually all these schemes had one thing in common: the city of the future they depicted was vibrant. We know now, here in the USA anyway, that this was the one thing they got most wrong. By 1970, many American cities were stone dead at their centers, especially the industrial giants of the Midwest. Ten years later, the American city of the future was the nightmare vision of Blade Runner, an acid rain-dripping ruin fit only for androids. These days, a new generation of mojo architect savants such as Daniel Libeskind and Rem Koolhaas are retailing an urban futurism that is basically warmed-over Corbu with an expressionist horror movie spin, featuring torqued and tortured skyscrapers, made possible by computer-aided design, clad in Darth Vadar glass or other sheer surfaces, with grim public spaces exquisitely engineered to induce agoraphobia. There’s more than a tinge of sadism in all this, though Koolhaas is much more explicit in his many writings than the less-voluble Libeskind about consciously surrendering to a zeitgeist of cruel alienation. But these are also very rarified exercises among a tiny group of mutually-referential fashionista narcissists, while the general public itself—at least the fraction that thinks about anything—only grudgingly goes along with it as a sort of drear obeisance to the religion of art. An alternate awful urban vision of the future, advanced by public intellectuals such as author Mike Davis (The Ecology of Fear), is actually more about the city of the present: the third world mega-slum as embodied by such ghastly organisms as present-day Lagos, Lima, and Karachi. This is a vision of plain toxic hypertrophy with no particular artistic or architectural overlay to it. These cities have organized according to a simple logarithmic progression of horrible conditions—more people, more pollution, more poverty—nourished by cheap energy globalism, with the expectation that they will only continue along that path and get worse.

opposite: A Rare Psychedelic I, 2005, ink on paper, 22 x 30 inches.

Yet another vision of the future is supplied by the New Urbanists, who have campaigned for a return to the body of principle and methodology drawn from successful historic practice rather than science fiction, politics, or metaphysics. That is, they rely on urban design that has proven to work well in the past and is worth emulating—by which I mean the relations of buildings to public space and with each other, not the deployment of sewer lines and other infrastructure. The New Urbanists are marginalized because their reliance on tradition is considered sentimental and nostalgic. Their work is viewed by the mandarins of architecture through the lens of Modernist ideology, which, going back a hundred years to Adolf Loos’s declaration that ornament is crime, has worked to decouple contemporary practice from what they regard as the filthy claptrap of history. Of course, Modernism itself has self-evidently become historical in its own right, and the more this is true, paradoxically, the more its defenders insist that history does not matter. Whatever else this represents in the form of intellectual imprudence, it at least promotes a discontinuity of human experience which cannot be healthy. The New Urbanists are also disdained for their modesty of ambition. They are not interested in the biggest this or that. Their plans are typically scaled to the quarter-mile walk and rarely include super-sized buildings. The cutting edge holds no attractions for them in and of itself. They want to create neighborhoods and quarters, not intergalactic space ports. They want the streets, squares, and building facades to provide decorum, legibility, and even beauty, while the latest crop of Modernists seek to confound our expectations about the urban environment as much as possible, in the service of generating anxiety rather than pleasure. The Modernists use the lame adjective edgy to describe their methods. It is supposed to signify excitement, novelty, and especially innovation, but mostly they have managed to innovate only new ways to make people feel bad about where they are. . . The future direction of urban experience depends a great deal on an understanding of history, and of recent history in particular, because the hyper development of the past two hundred years has followed the arc of increasing energy resources and, above all, we are now facing the world-wide depletion of energy resources. As the industrial age gained traction in the early 19th century, so did the demographic trend of people increasingly moving from the farms and villages to the big cities. Industrial production was centralized in the cities and recruited armies of workers insatiably. Meanwhile, mechanized farming required fewer farmers to feed more people. The railroad, by its nature, favored centralization. By 1900, cities such as London and New York had evolved into mega-urbanisms of multiple millions of people. Around the same time, electrification was generally complete and with it came skyscrapers serviced by elevators. Over the next twenty years, oil moved ahead of coal as the primary fuel for transport and, especially in the US, where oil was cheap and abundant, led to mass automobile ownership. That, in turn, sparked the decanting of households into massive new suburban hinterlands, and to the extreme separation of activities by zoning law there, which climaxed—with interruptions for depression and war—in the evolution of the late 20th century cardependent metroplexes like Los Angeles, Houston, Phoenix, and Atlanta. That is where things stand now. Now my own view is that we face severe energy problems in the decades ahead and they will not be ameliorated by any combination of alternative fuels or schemes for running them. This permanent global energy crisis will have all kinds of consequences, most particularly on our cities. These looming circumstances imply several major trends which contradict conventional expectations, especially of continued urban growth. One certain impact will be the contraction of industrial activity per se and of the financial sector whose instruments and certificates represent the expectation of growth in accumulated wealth. This alone will comprise a basic challenge to industrial capitalism— apart from the sociopolitical strife that such financial catastrophe is apt to generate. 53

I hasten to add it is a mistake to suppose that the US industrial economy has already been replaced by a so-called “information” economy or a consumer economy. In reality, manufacturing activities have been insidiously replaced over the past twenty years by a suburban-sprawl-building economy—and the mass production of suburban houses, highways, strip malls and big box stores is just a different sort of manufacturing than making hair driers and TV sets. The sprawl industry also drove a reckless debt creation racket and multiple layers of traffic in mortgages and spinoffs of mortgages (such as the derivatives trade based on bundled, securitized debt) which represents, at bottom, hallucinated wealth that in turn has spread false liquidity through the equity markets and is certain to affect them badly sooner or later. All this is what we have been calling the “housing bubble” and it is now beginning to fly apart with deadly effect. Much of the suburban real estate produced by this process is destined to lose its supposed value, both in practical and monetary terms as energy scarcities get traction. So, on top of the sheer distortions and perversities of the glut in bad mortgage paper, America will be faced with the accelerating worthlessness of the collateral—the houses, Jiffy Lubes, and office parks—as gasoline prices go up, and long commutes become untenable, and jobs along with incomes are lost, and the cost of heating houses larger than 1,500 square feet becomes an insuperable burden. All this is to say that the suburban rings of our cities have poor prospects in the future. They therefore represent a massive tragic misinvestment, perhaps the greatest misallocation of resources in the history of the world. It is hard to say how this stuff might be reused or retrofitted, if at all, but some of it, perhaps a lot, may end up as a combined salvage yard and sheer ruin. Another major impact of the coming energy scarcity will be the end of industrial agriculture. Without abundant and cheap oil and gas-based fertilizers, pesticides, herbicides, and fuels for running huge machines and irrigation systems, we will have to make other arrangements for feeding ourselves. Crop yields will go down—a big reason, by the way, to be skeptical of ethanol and bio-diesel alternative fuel schemes based on corn or soybean crops. We will have to grow food closer to home, on a smaller scale, probably requiring more human and even animal labor, and agriculture is likely to come closer to the center of economic life than it has within memory—at the same time that mass production homebuilding, tourism based on mass aviation, easy motoring, and a host of other obsolete activities fade into history. I think this will lead to an epochal demographic shift, a reversal of the 200-year-long trend of people moving from the farms and rural places to the big cities. Instead, I believe we will see a substantial contraction of our cities at the same time that they densify at their cores and along their waterfronts. A preview of this can be seen in Baltimore today. The remaining viable fabric of the pre-automobile city is relatively tiny and concentrated in the old center around a complex harbor system. With little need for industrial workers, vast neighborhoods of row housing built for them are either abandoned or inhabited now only by such economically distressed people that abandonment is inevitable. The pattern of contraction may not be identical in all American cities. In some it will be a lot worse. Phoenix, Tuscon, and Las Vegas will just dry up and blow away, since local agriculture will not be possible, and they will be afflicted with severe water problems on top of all the other problems growing out of energy scarcity and an extreme car-dependent development pattern. Cities in the “wet” sunbelt such as Houston, Orlando, and Atlanta, will probably still be there but revert to insignificance for the additional simple reason that a lack of cheap air conditioning will make them unbearable. It is worth keeping in mind that cities generally are located on important geographical sites—harbors, rivers, railroad junctions—and some kind of urban settlement is likely to persist in many of these places, unless climate change drowns them. In recent years, 54

Walk in St. Louis (planters), 2005.

most waterfront property has been reassigned from industrial and commercial uses to condominium sites, and greenways. This will not continue. If we are going to have any kind of commerce between one place and another, we will have to reactivate our waterfronts for shipping—and not necessarily of the automated steel container variety. Like virtually everything else in the coming energy scarce world, maritime trade will have to be rescaled. It may even have to rely on wind power again to some extent. These operations will require wharves, warehouses, cheap quarters for sailors and all the other furnishings typically required through history. Those who are infatuated with skyscrapers are going to be disappointed. I do not think we will be building many more of them further along in this century. We will have trouble running the ones we have, since most of the glass towers built after 1965 have inoperable windows, and even the ones that have them would have to be retrofitted for coal furnaces, and a less than absolutely reliable electric power grid may make life in a twenty-fifth floor apartment impossible when the elevators go out. In short, I think we will discover that the skyscraper was purely a product of the cheap oil and gas age. Exciting as they may be, we might have to live without them.

The process I have described will probably be messy. Social turbulence should be expected. For instance, the urban underclass will be squeezed even harder than the suffering middle classes, and they already have a nascent warrior culture that could easily redirect its energies from hip hop entertainments to real guerrilla warfare if the competition for resources became desperate. Economic distress in the US is also likely to only aggravate unfavorable conditions in Mexico, sending increased streams of impoverished migrants north. Meanwhile, the faltering US middle classes may be so inﬂamed by the loss of their entitlements to an easy motoring existence that they will vote for maniacs and venture into scapegoating. I certainly expect the American public and their leaders to mount a vigorous defense of suburbia, even if it proves to be a gigantic exercise in futility and a waste of precious resources.

We will be lucky if we can make the transition from our current circumstances to a future of re-sized, re-scaled cities and a reactivated productive rural landscape outside them, with a hierarchy of hamlets, villages, and towns in between, and some ability to conduct commerce and manufacturing. This would, in effect, be a reversion to prior living arrangements, and to some extent it is a model proposed by the New Urbanists—or at least a template they would understand as fundamental. Many things might stand in the way of this. The physical disaggregation of civic life in our small towns is now so extreme that nothing might avail to repair it, especially since we will have far less capital to work with. The suburbs running from Boston through New Jersey to Washington have paved over some of the best farmland in the nation’s most populous region and it may be centuries before it is restored to productivity, if ever. We don’t know how any of these things may actually play out. I have not even mentioned the potential for geopolitical mischief, which could skew the picture a lot more. But the urban future isn’t what it was cracked up to be when we were riding high, surﬁng the big waves of cheap energy in the seemingly endless summer of oil. It won’t be fun fun fun ‘til Daddy takes the T-bird away. It won’t be a Herbert Muschamp smorgasbord of delicious, rariﬁed architectural irony. The Koolhaas celebration of alienation will not seem worth partying for. The metaphysics of Libeskind and Peter Eisenman will stand naked in the transparency of their phoniness. By and by, even the mega slums of the third world will contract as the surplus grain supplies of the formerly-developed nations are reduced to nothing and export ceases. . .

following pages: Sketches from Holten’s notebooks (details), 2006-2007, ink on paper, dimensions variable.

Once A Yellowwood Stood Leaﬁng Anne Whiston Spirn

Once a yellowwood stood leafing, flowering, fruiting, setting seed; roots grabbed hold, sucked air and water from earth beneath a plaza of brick, by an old library. Its smooth silver trunk bore knobby limbs. Floppy leaves clung to long stems, catching wind, moving green shadows across red bricks. Students sat each spring under the yellowwood, listening to names named, glad for green shade, walked under it to the library, breathed musky June flowers, kicked yellow leaves of October across red bricks. For many years the yellowwood grew, red stone blackened, the building decayed. Then men came one day to fix the library, piled stacks of tools, tiles, and sacks around the tree, sealing soil under bricks. Two years later, the library reopened, leaded glass gleaming, blackened stone brightened, furnace fixed. How elegant, people said. That fall the tree lost its leaves in September. Next May, the yellowwood flowered early and profusely. Thousands of fragrant white blooms hung in long clusters. Petals covered bricks, blew across grass. How beautiful, people said. How sad, though. Several years’ bud scars bunched up against each twig’s growing tip. Abundant flowers signaled a dying, and seeds found no purchase in the plaza. People admired the tree and walked on; they had lost the language that gives tongue to its tale. Once a yellowwood stood. No more. And few knew why.

opposite: Fallen Twigs, 2006, newspaper, glue, and acrylic, approx. 12 x .5 x .8 inches.

Model for a Tree, 2005, cardboard, wire, and duct tape, approx. 12 x 8 x 6 inches.

Model for a Root, 2006, cardboard, wire, and duct tape, approx. 9 x 8 x 7 inches.

opposite: Bush (shadow), 2005, ink on paper, 30 x 22 inches.

following pages: Trembling on the Edge of Reprisal, 2006, ink on paper, 18 x 24 inches.

The Bullet Catcher A.M. Homes

. . . The next evening he waited until Mary left for her meeting, then said good-bye to the kids and took off for the mall. He drove fast, imagining that if he didn’t get there soon, he would begin to shrivel like a helium balloon, slowly dropping down, sinking lower and lower, until he hovered six inches above the floor. By morning he’d be airless, dead, on the bucket seats. The Pyramid Mall floated in a sea of parking spaces, laid out thirty deep so that on any given day or evening, with the exception of Saturdays, a person could find a place within ten spaces of the end and enter the mall feeling somehow lucky. The only thing pryamid-like about the place were the pyramid-shaped planters filled with half-dead geraniums. He pulled into a good space near Sears feeling what he called the guilt of necessary purpose. He had come here for a real reason. Tires. Before he could do anything, he had to go directly into Sears. He had to accomplish something so that he could tell Mary how wonderful he was. There were no salespeople in the tire department and Frank was too distracted to hunt one down. Frank had a certain pale nonexistence to him, like Caspar the Ghost. He could fight it if he wanted to. He could summon his energy and make himself a kind of lifelike pinkish-purple that could get a fair amount of attention, but he couldn’t sustain it. In Sears, he couldn’t even bring himself up to a kind of light flesh tone. He just didn’t have it in him. He took heart in knowing it was highly unlikely he’d ever be taken hostage in a bank robbery or hijacking. He left Sears promising himself he’d deal with the tires later; if necessary he’d go directly to a tire store where salesmen waited day and night for guys like Frank to walk in. He went into the mall charged by the prospect of a new project—an unexpected surprise, like a bonus—finding something to buy, to bring home to Mary like show and tell. Just outside Sears, two women from the local Red Cross sat at a folding table with a blood pressure cuff between them waiting for a victim. The atmosphere was festive. Diet experts in workout clothing mingled freely. Stop Smoking Now. Lungs like giant latex condoms expanded and collapsed. Mental Illness: The Hidden Symptoms. He reviewed the list without intending to. Bad news. According to Frank’s own evaluation he had all the signs of Chronic Untreated Disturbance. According to the description he was a time bomb that could go at any minute. No warning. Health Fair ’90 ended in front of Woolworth’s. Two candy-striped cardboard poles marked the beginning and the end. Frank spotted Adam—the kid who tripped over his laces the day before—in the record store. He went directly to him and slapped his hand down on the counter, stinging his palm. “Hey, Adam,” Frank said. Adam was startled. He looked down at his shirt to see if he was wearing a name tag. He wasn’t. “Adam, talk to me.” “What?” “Tell me about CD’s—are there different kinds? Different sizes? Do they all play on the same machine?” For the past two years, everything Frank saw or read nagged him about CD’s.

Adam looked at Frank like Frank was an extraterrestrial, an undercover cop, or some new brand of idiot. He didn’t say anything. The silence made Frank uncomfortable. He wanted to be friends. “I’m serious, Adam. I’m very serious.” Adam kept staring, checking out Frank. He wanted to be sure he didn’t end up on the wrong end of a joke. “They’re all the same,” Adam finally said, tentatively. “You get a player and plug it into your stereo, or you can get a portable.” “What do you have?” “Portable. I plug it into my car stereo. That’s really cool.” “I bet.” Adam looked at Frank like he was still waiting for something to happen. Maybe Frank was someone’s father coming to tell Adam he didn’t want his daughter riding around in Adam’s car with Adam blasting her eardrums anymore. “What do you listen to?” “I dunno,” Adam said, suddenly shy. “Well, what do your friends listen to?” “All kinds of stuff.” “If I wanted to buy something, what would you recommend?” “New Poizon Boiz just came in,” Adam said happily. “I’ll take one. Do you sell the players here?” he asked, handing Adam his American Express card. “You get them in Wire Wizard, upstairs, just across from King Pin.” As Adam was ringing Frank up, a big-haired girl, identical to Julie, Tina, and Nails, came up to Adam, wrapped her arms around his neck, and pushed her tongue down Adam’s throat. Every organ in Frank’s body jumped. His insides rose up. He signed the charge slip, turned around, and went straight to the Wire Wizard. “I need a CD player,” he said desperately to the salesman. “What kind?” “A good one. A very good one. I have to be able to plug it into my stereo or my car.” He felt flushed and out of breath. He thought of the freshness of a fifteen-year-old body. “We have a few like that.” “I want the best. I have to have the best,” Frank said, excitedly. “The best is not necessarily the most expensive.” “I know that,” Frank said. What kind of guy did this kid take him for? He tapped his fingers on the counter. “Give me what you’ve got,” Frank said to the guy. He felt like he had to hurry. He had to finish this soon. He had to go back and see what Adam was doing. “This is a very good model,” the guy said, taking something out of the case.

“Great,” Frank said, without looking at the player. He laid his charge card on the counter, sure that this was how people did it. Credit was free, easy, there was always someone giving it away, asking you to take more. “Do you want to hear it?” “I trust you. I really do,” Frank said, looking the guy in the eye for half a second. When Frank got out of the Wire Wizard, Adam was gone. Lunch break, his manager said, winking. On the down escalator Frank pulled the receipt out of the Wire Wizard bag. A hundred and eighty-nine dollars. He couldn’t believe it. He’d figured it would cost fifty or sixty bucks, seventy-five at most. What had he done? What would Mary say? He quickly shifted his attitude to a more adaptive one. I’m allowed. I am absolutely allowed. I deserve it. He wouldn’t tell Mary. He would find something else to bring home, something smaller, perhaps something specifically for her, like a present. From the escalator he saw the crowd around the jeep. He counted the number of contestants left. Since yesterday eleven had walked away. According to the woman on the escalator in front of Frank, they’d thrown up their hands and asked to be let out. One had to be taken by ambulance when, for no apparent reason, she started vomiting. “How’re you doing?” he asked Julie’s mother. She smiled and nodded her head. “It’s nothing yet,” Julie’s mother said. “Tomorrow it’ll start getting good.” “I’ll be here,” Frank said. “So will I.” Frank felt his presence did something to the contest. He had the idea that the way he looked at the contestants either gave them what they needed to go on or broke them right there on the spot. He felt powerful and necessary. They were down to nine. They all looked willing to call it a day. An incredible assortment of junk food was scattered half-eaten among the lounge chairs and coolers; fast food from every carry-out in the mall had been supplemented by special-request items like DingDongs and cream soda. It surprised Frank that no one thought of the nutrition edge. No one seemed to think eating right during the five-minute breaks might make all the difference. There were no Tiger’s Milk bars, no bowls of pasta salad, not even any goddamn Gatorade. Who were these people? Frank wanted to know. He really wanted to know. He imagined interviewing them during their breaks, like Geraldo Rivera, asking what it felt like to touch the car, why they chose to spend their break standing, talking on a pay phone, instead of lying down? He wanted to know why no one was wearing support stockings or using heating pads on long extension cords. As he stood trying to figure out how he could become an official consultant, a girl right in front of him was disqualified. Her knee buckled and her hip banged against the car. “You’re out,” the judge called like an umpire in a baseball game. With a completely bewildered look on her face she stepped away from the car. Frank saw the sweaty prints her hands left on the hood. Instead of looking at the girl he looked at the other contestants. They were taking inventory, checking each other out, placing unspoken bets on the order in which they would fall. Frank stayed until the mall closed. Store lights blinked on and off, warning customers that the end was coming soon. Assistant managers started pulling metal security gates down and fiddling with their keys. Frank thought of the people left overnight, locked in. He started walking back in the direction of Sears and then turned around and took a last look 67

at the contestants. He imagined them all changing into their pajamas during the eleven o’clock break. Frank silently said good night to the reamaining eight players and barely made it through Sears before they locked the doors. He had nothing for Mary. On the way home he stopped at the all-night Super Pharmacy and bought Mary a Dustbuster. As he pulled into the driveway, he stuffed the bags from Wire Wizard and the record store under the car seat. That night, waiting to fall asleep, Frank thought of contests he’d seen on the evening news. National coverage for three people out there somewhere, sitting on a billboard scaffold. His heart swelled. The Pyramid Mall was his own, he’d been there from the start. No matter who eventually drove away with the car, part of it belonged to Frank. The next day, he fought the urge to call the mall from his office, a cubbyhole in an overdeveloped industrial park, and ask for an update. After work, when all the accounts were reconciled, he hurried home and found his neighbor, Julie’s father, sitting at his dining room table, waiting for dinner. “My whole damn family’s living out there at the mall,” he said between chicken legs. Frank didn’t answer. He waited until Julie’s father went home and then told Mary he was leaving. “I have to go see about those tires,” he said to Mary. “I thought you did that last night?” “Didn’t get what I needed. I have to go back and get it over with.” On his way to the contest, he stopped by the sporting goods store. He slipped a baseball glove on and pounded his fist into the mitt a couple of times. It could heal him, he thought. It could be just the thing. With the exception of what he’d seen two days ago at the Cheezy Dog, the mitt reminded him of the better things in life. He used to have a mitt until his son had taken it to school one day and lost it. With his free hand Frank started pulling bats out of the rack, turning them over and over, awkwardly tossing them slightly into the air, spinning and catching them, bending and flexing the glove on his left hand. The glove was fifty-six dollars. He couldn’t do it. He’d already done it last night. There was no way. He took it off and put it tenderly down on the pile, hiding it near the back, leaving room for his dreams. . .

following pages: A Rare Psychedelic (embracing), 2005, ink on paper, 30 x 22 inches. Image courtesy VAN HORN, Düsseldorf. Private collection.

My Favorite Plant Chris Somerville

My interest in plants derives from my concern about human population growth. It is obvious to me that as the demand of humans for food and other goods and services derived from plants expands, the amount of undomesticated land will continue to shrink and will eventually disappear. The only long-term solution to the shrinking world is to stabilize population—presumably through education and cultural change. However, since this cannot be accomplished anytime soon, I have devoted myself to buying the world some time. My strategy is to minimize the need for expansion of agricultural land by maximizing the productivity of the land that we currently use. This has been a very successful strategy during the past 50 years. Because of the improvements in cereal yield created by plant breeders, we currently use about 1.2 billion acres less land for cereal production than we would if we were growing the same cereal seeds that we used in the 1950s. That represents about one third of the total land on earth that will support agriculture. However, the gains realized from traditional plant breeding have been declining and new approaches are needed in order to continue increasing plant productivity. About 20 years ago my wife and I began recruiting other scientists to the idea that the best way to improve plant productivity was to understand one plant in great detail. Since all flowering plants evolved from a common ancestor about 150 million years ago, they are all quite similar to one another in many fundamental respects. Thus, when we understand something about one plant we can usually generalize it to many other plants with a minor additional investment of effort. The plant that we and several other young biologists proposed as the model plant was Arabidopsis thaliana, a small weed in the mustard family. The reasons that we were attracted by Arabidopsis is that it is small, so large populations can be grown in the laboratory; it progresses through its life cycle quickly and produces thousands of seeds per plant, so we can carry out genetic experiments relatively rapidly (i.e., it goes from seed to seed in about seven weeks); it is a diploid (i.e., it has two copies of each gene) so we can observe the effects of mutations. In addition, the amount of DNA in each cell of the plant is very small compared to other plants. For instance, Arabidopsis only has about 1% as much DNA per cell as wheat. Thus, it is much easier to find a particular gene in Arabidopsis than in most other plants because we have less DNA to sift through. Arabidopsis proved to be a popular model and today there are about 10,000 scientists studying the plant. An international collaboration by a large group of scientists recently determined the complete sequence of all the DNA in the plant. Each cell contains two sets of five chromosomes—long strands of DNA that collectively contain about 126,000,000 nucleotides. This DNA encodes about 26,000 genes. The sequence of one gene is shown opposite in a four-letter code in which each letter represents one of the four nucleotides that comprise DNA in all organisms. This particular gene encodes an enzyme that makes cellulose—the main component of paper and cotton. One line of evidence that this sequence encodes the enzyme cellulose synthase is that a mutation that changes a single nucleotide from A to G results in a defective enzyme that cannot synthesize cellulose. We currently do not know the function of about 60% of the genes in Arabidopsis. However, the community of scientists studying the plant expect to know something about the function of each gene by 2010. One strategy for accomplishing this is to make a mutation in each gene and then to analyze the effect on the plant. In addition, it is frequently possible to understand the function of genes by determining where in the plant and under what circumstances the gene is turned on or off, where the gene Arabidopsis thaliana product is located within cells, and many other aspects of ‘gene behavior’.

I believe that by 2010 we will know the basic information about the complete set of instructions required to make Arabidopsis. Work is already beginning on translating the information about Arabidopsis into comparable information about the approximately 100 other plant species that humans use in agriculture, horticulture and forestry. By 2020 we will understand the generic set of instructions so completely that we will be able to design changes in any aspect of plant growth and development so that we can design completely new plants in much the way that engineers design new bridges or integrated circuits. The biologists of that era will use the knowledge to create improved plants with increased productivity and with many improved functionalities such as enhanced nutritional qualities or insect resistance. By 2020 we will have about 1.6 billion more people on the planet than we have today. I will probably be gone but the knowledge that we are creating today by studying Arabidopsis will remain and will enable plant biologists to produce plants that can sustain those people, their animals and hopefully, some small vestige of the natural world. atggaggccagtgccggcttggttgctggatcctaccggagaaacgagctcgttcggatccgacatgaatctgatggcgggnnnaccaaacc tttgaagaatatgaatggccagatatgtcagatctgtggtgatgatgttggactcgctgaaactggagatgtctttgtcgcgtgtaatgaatgtgcc ttccctgtgtgtcggccttgctatgagtacgagaggaaagatggaactcagtgttgccctcaatgcaagactagattcagacgacacagggnnn ggagtcctcgtgttgaaggagatgaagatgaggatgatgttgatgatatcgagaatgagttcaattacgcccagggagctaacaaggcgaga caccaacgccatggcgaagagttttcttcttcctctagacatgaatctcaaccaattcctcttctcacccatggccatacgnnngtttctggagagat tcgcacgcctgatacacaatctgtgcgaactacatcaggtcctttgggtccttctgacaggaatgctatttcatctccatatattgatccacggcaac ctgnnntccctgtaagaatcgtggacccgtcaaaagacttgaactcttatgggcttggtaatgttgactggaaagaaagagttgaaggctggaa gctgaagcaggagaaaaatatgttacagatgactggtaaataccatgaagggaaaggaggagaaattgaagggactggttccaatggcgaa gaactccaaatnnnggctgatgatacacgtcttcctatgagtcgtgtggtgcctatcccatcttctcgcctaaccccttatcgggttgtgattattctc cggcttatcatcttgtgtttcttcttgcaatatcgtacaactcaccctgtgaaaaatgcatatcctttgtggttgacctcggttatctgtgagatctggttt gcattttcttggcttcttgatcagtttcccaaatggtaccccattaacagggagacttatcttgaccgtctcgctataagnnnatatgatcgagacgg tgaaccatcacagctcgttcctgttgatgtgtttgttagtacagtggacccattgaaagagcctccccttgttacagcaaacacagttctctcgattctt tctgtggactacccggtagataaagtagcctgttatgtttcagatgatggttcagctatgcttacctttgaatccctttctgaaaccgctgagtttgcaa agaaatgggtaccattttgcaagaaattcaacattgaacctagggcccctgaattctattttgcccagaagatagattacttgaaggacaagatcc aaccgtcttttgttaaagagcgacgagctatgaagnnnagagagtatgaagagtttaaagtgaggataaatgctcttgttgccaaagcacaga aaatccctgaagaaggctggacaatgcaggatggtactccctggcctggtaacaacactagagatcatcctggaatgatacagnnngtgttctt aggccatagtgggggtctggataccgatggaaatgagctgcctagactcatctatgtttctcgtgaaaagcggcctggatttcaacaccacaaaa aggctggagctatgaatgcattgnnnatccgtgtatctgctgttcttaccaatggagcatatcttttgaacgtggattgtgatcattactttaataaca gtaaggctattaaagaagctatgtgtttcatgatggacccggctattggaaagaagtgctgctatgtccagttccctcaacgttttgacggtattga tttgcacgatcgatatgccaacaggaatatagtctttttcgatnnnattaacatgaaggggttggatggtatccagggtccagtatatgtgggtact ggttgttgttttaataggcaggctctatatgggtatgatcctgttttgacggaagaagatttagaaccaaatattattgtcaagagctgttgcgggtc aaggaagaaaggtaaaagtagcaagaagtataactacgaaaagaggagaggcatcaacagaagtgactccaatgctccacttttcaatatgg aggacatcgatgagggttttgaagnnngttatgatgatgagaggtctattctaatgtcccagaggagtgtagagaagcgttttggtcagtcgcc ggtatttattgcggcaaccttcatggaacaaggcggcattccaccaacaaccaatcccgctactcttctgaaggaggctattcatgttataagctgt ggttacgaagacaagactgaatggggcaaagagnnnattggttggatctatggttccgtgacggaagatattcttactgggttcaagatgcatg cccggggttggatatcgatctactgcaatcctccacgccctgcgttcaagggatctgcaccaatcaatctttctgatcgtttgaaccaagttcttcgat gggctttgggatctatcgagattcttcttagcagacattgtcctatctggtatggttaccatggaaggttgagacttttggagaggatcgcttatatc aacaccatcgtctatcctattacatccatccctcttattgcgtattgtattcttcccgctttttgtctcatcaccgacagattcatcatacccgagnnnata agcaactacgcgagtatttggttcattctactcttcatctcaattgctgtgactggaatcctggagctgagatggagcggtgtgagcattgaggatt ggtggaggaacgagcagttctgggtcattggtggcacatccgcccatctttttgctgtcttccaaggtctacttaaggttcttgctggtatcgacacc aacttcaccgttacatctaaagccacagacgaagatggggattttgcagaactctacatcttcaaatggacagctcttctcattccaccaaccaccg tcctacttgtgaacctcataggcattgtggctggtgtctcttatgctgtaaacagtggctaccagtcgtggggtccgcttttcgggaagctcttcttcg ccttatgggttattgcccatctctaccctttcttgaaaggtctgttgggaagacaaaaccgaacaccaaccatcgtcattgtctggtctgttcttctcgc ctccatcttctcgttgctttgggtcaggatcaatccctttgtggacgccaatcccaatgccaacaacttcaatggcaaaggaggtgtcttttag

The sequence of one gene of Arabidopsis thaliana is shown above in a four-letter code in which each letter represents one of the four nucleotides that comprise DNA in all organisms.

PLOT, 2000, transplanted weeds, soil, stones, and plastic. Installation view at the Sirius Arts Centre, Cobh, Ireland.

Up the Garden Path An irregular arrangement of stones and compost on plastic sheeting, placed within the pristine confines of a gallery setting, plays temporary host to a collection of weeds transplanted from a County Council dumping site. But to what effect? . . . Holten’s art acknowledges the inevitability of entropy, but counters it with an irrepressible energy drawn from a highly combustible mixture of idealism and absurdism. Her artistic persona is that of both dreamer and doer. Her proliferating floor and wall drawings, which oscillate between crudeness and delicacy, the slapdash and the finely honed, resemble quasi-scientific schemata. These enigmatic annotations and diagrams are highly suggestive but ultimately indecipherable. They resolutely resist translation into any meaningful system, be it botanical, electrical, architectural, sociogeographical, or an improbable mélange of all four. They are graphic reminders of the purposeless, focusfree exhilaration of the act of imagining for its own sake. They recall the childhood pleasures of mapping out imaginary territories, of dreaming up impossible schemes, of escaping, however briefly, into a world of delicious fantasy.

opposite: New York Weed (Longspine sandbur), 2005, ink on paper, 30 x 22 inches.

Warmoesstraat 131 in Amsterdam before the renovations.

Beta vulgaris, after the renovations in November 2003.

Beta vulgaris (front room), garden with transplanted weeds.

Visitors to Beta vulgaris were offered a bowl of vegatable soup.

Beta vulgaris Beta vulgaris was a public art project commissioned by W139 in Amsterdam, November 22-December 21, 2003. A condemned building on the bustling Warmoesstraat was transformed into Beta vulgaris—offering visitors a calm oasis combining garden, museum and soup kitchen. The Warmoesstraat, located in the heart of Amsterdam’s city center, serves as the main thoroughfare for tourists searching for the red-light district and for coffee bars. The street is named after the Warmoes plant (Beta vulgaris), as a reminder that it used to function as the city’s vegetable garden. Holten’s Beta vulgaris provided alternative sustenance. Visitors were offered a bowl of home-made vegetable soup and invited to wander through the garden, which was planted with weeds transplanted from public spaces in the city. The back room contained a museum of artifacts and drawings which detailed the history of the site from the discovery of the plot of land to its imminent destruction. 75

Beta vulgaris Soup Ingredients: 8 ounces cooked beets, 2 teaspoons grated ginger, 1 cup vegetable broth, 4 teaspoons lemon juice, salt and freshly ground black pepper Directions: Chop cooked beets roughly, add ginger, hot broth and lemon juice, and cook for 10 minutes. Season with salt and pepper to taste. Serve immediately.

top and bottom right: On Loan, 2003, archive of objects made in plasticine, dimensions variable. Installation views of A Recent History of Whatâ&#x20AC;&#x2122;s Possible at the Butler Gallery, Kilkenny, Ireland, October 20-November 30, 2003. middle and bottom left: On Loan, 2003, archive of objects made in clay and drawings, dimensions variable. Installation views of the museum room in Beta vulgaris at Warmoesstraat 131, Amsterdam, November 22-December 21, 2003.

Io e Devil (detail), performed by Marco Mancassola (above), djb, and Stefania Rossi at Laboratorio della Vigna, June 6, 2003.

Laboratorio della Vigna Holten represented Ireland at the Venice Biennale with Laboratorio della Vigna, June 13-November 2, 2003. This project transformed the Irish pavilion into an alternative cultural venue for the city of Venice. Laboratorio della Vignafacilitated local musicians, squatters, writers and artists as they produced and presented new work. As there is a lack of such open facilities in the city of Venice, this collaborative project developed directly out of Holtenâ&#x20AC;&#x2122;s time spent living there in the months prior to the opening of the Biennale. Laboratorio della Vigna provided a much-needed resource for locals who typically regard the Biennale as an inconvenience and self-satisfying event that excludes them.

opposite: Visitors to Laboratorio della Vigna were invited to sit and read. Refreshments were served.

Hloten studied weeds found growing in public spaces in Venice with botanist Ulrike Gamper of the Università degli Studi di Venezia.

A Different Kind of Practice Regina Gleeson in conversation with Katie Holten The Laboratorio della Vigna at the Venice Biennale functioned on confidence in serendipity which allowed [Holten’s] work, and that of her collaborators, to be free from any prohibitive constraints of disciplinary boundaries. Anyone who should happen upon some of Holten’s work could be forgiven for looking at the clutter and asking where is the art amongst the randomness! However, her work does not function on a strictly visual dynamic and the randomness is, in fact, the art itself. Laboratorio della Vigna expressed wonder in the most insignificant things which took pride of place with obviously important ideas such as the mechanics of flight and patterns of movement in water. On a visual level this show was disparate and intentionally distracted but in an interdisciplinary exchange of knowledge and perspective oblivious to boundaries, it excelled beyond quantification.

Regina Gleeson: What do you think about not giving the audience a visually dynamic object that would contain all of the questions, implications and answers but instead, giving them a starting point from which to generate their own process of engagement? For instance, Laboratorio della Vigna operates on a set of clues to a multi-directional/ dimensional map rather than functioning on the principle of creating a visual impact. Katie Holten: This was something that Valerie Connor [Irish commissioner] and I discussed from the beginning. Val wanted to work with me as she was speciﬁcally interested in this aspect of my work—the fact that an ‘art bauble’ isn’t necessarily going to be produced as a ‘ﬁnished piece’ to dazzle the masses (although it could be—but not in this case!). Also, in the context of the Venice Biennale—where I feel more and more artists are presenting their work in a similar way to an art fair—we were both excited by the possibility to push the dynamics of the event further. Surely there should be more to the largest visual-arts show on earth than merely presenting pretty things to glitter for the people? And as my work was being placed in a building that is supposed to be for the local people—the Scuola di San Pasquale (a confraternity building that continued to be used by

above and left: Laboratorio della Vigna (details), 2003.

local residents once a month during the Biennale, I would have been embarrassed to impose something on the locals. That would have seemed degrading. RG: What do you think makes the process more valuable than the object for the artist and then for the viewer—perhaps it’s the same for both? KH: For me, as the artist, the process of working is valuable not only as a way to enter, engage and become part of the local Venetian community, but also the ongoing process is of great importance. The work developed before the Biennale, continued during the Biennale, and will continue to grow after the Biennale has closed in November. This is a work that is more organic, honest and sincere than, I think, plonking an object in Venice from June - November could be. The location of the Irish pavilion—in a residential part of town—also played a role in the development of the project. RG: There is a sense of serendipity in your art practice and a kind of randomness that is like a stream of consciousness, ﬂowing regardless of the apparent disconnected bits of information. Do you wish for the viewer to assimilate the information with which you present them into their own grid of references or do you intend for them to be conscious of the ﬂow of information without needing to interpret or re-interpret it? 80

KH: There is an order. Everyone knows about The Butterfly Effect—a butterfly flaps its wings in Thailand and there’s a tidal wave in Europe. Randomness is essential to my work. But so is failure. So is research. The booklets in Venice contain disparate material—but there are many ways to connect it all. It’s open—people can join the dots for themselves. I’d hate to ever be didactic or pedantic. The viewer knows just as much as I know, probably even more, so their conclusions could often be more valuable than mine. I have always been aware that some of my installations can, potentially, be quite difficult for a viewer to enter. If they’re presented with a pile of clutter and someone else’s hand-scribbled notes, how can they ‘enter’ this conversation? But this has always been a fundamental aspect of the work—the fact that today it is virtually impossible to make sense of things. Also, as I’ve mentioned, failure is important. The moment of clarity always appears, for me anyway, on a scrap of paper, rather than on an art surface. The serendipity that surrounds my work reflects how my life is. And my work is very tied-up with my life. My art practice is fluid, organic and flexible, like any good conversation—it follows tangents, it backtracks, it wanders off down a cul-de-sac and touches on many disparate things, but it’s all connected.

Laboratorio della Vigna (detail), 2003, booklets and desk, dimensions variable. A series of 13 booklets were available for browsing or to take away.

NOTHING (detail), 2003. From a series of booklets produced for Laboratorio della Vigna.

opposite: Installation view of Laboratorio della Vigna at the Venice Biennale, 2003.

View of CLUSTER at PARTICIPANT INC, in New York.

Visitors browsing.

Chloe Piene reading extracts from her private writings, 1993-2006.

Terry Berkowitz and Katie Holten reading a text by Betsy Aaron.

Lisa Kirk creating a Revolution on Rivington Street.

A Revolution spritzer, with Fia Backstromâ&#x20AC;&#x2122;s Feel Free behind.

CLUSTER at PARTICIPANT INC in New York, February 10-18, 2006.

PLATFORM members Ben Diss (left) and James Marriott (right) lead an Unravelling The Carbon Web tour through the streets of London in October 2005. PLATFORM participated in CLUSTER.

CLUSTER CLUSTER was organized by Holten. The first CLUSTER took place at Bowes pub in Dublin (2002). CLUSTER’s followed at the Institute of Contemporary Art in London (2005), PARTICIPANT INC in New York (2006) and El Particular in Mexico City (2006). “The sporadic, loosely curated venture brought together an ever-expanding network of contributors, most for the first time. All the participants, artists or otherwise, are friends or acquaintances of Holten’s, who is herself an artist and a neighbor of PARTICIPANT INC director Lia Gangitano. [This installment of ]CLUSTER was organized around the premise that the show’s contents will fit in a small FreshDirect box.” PARTICIPANTS: Betsy Aaron (US), Jan Albers (GER), Domenick Ammirati (US), Fia Backström

(SWE/US), Jane Benson (UK/US), Terry Berkowitz (US), Sarah Browne and Gareth Kennedy (IRE), Horacio Cadzco (MEX), Paul Chidester and Helen O’Leary (US/IRE), Coracle (IRE), Ann Craven (US), Clémentine Deliss (UK), John Duncan (N.IRE), Jacob Dyrenforth (US), Matias Faldbakken (NOR), Bonnie Fortune (US), Maxi Geil! (US), Rodney Graham (CAN), Tue Greenfort (DEN/GER), Fritz Haeg (US), Ellen Harvey (UK/US), David Hatcher (NZ/US), Geka Heinke (GER), Matt Keegan (US), Lisa Kirk (US), Elizabeth Kolbert (US), Atta Kwami (GH), Lasse Lau (DEN), Thomas Legge (IRE), Miranda Lichtenstein (US), Polonca Lovsin (SLO), Robert Melee (US), My Barbarian (US), Priya Natarajan (IN/US), Aisling O’Beirn (IRE), William J. O’Brien (US), Ani O’Neill (NZ), Sally O’Reilly (UK), Sean O’Reilly (N.IRE), Mark Orange (N.IRE/US), Gary Phelan (IRE), Chloe Piene (US), Amy Plant (UK), PLATFORM (UK), Wilfredo Prieto (CUB), Ale de la Puente (MEX), Sara Greenberger Rafferty (US), Kirstine Roepstorff (DEN/GER), Sebastian Romo (MEX), Michael Sailstorfer (GER), Stefan Saffer (GER), Joe Scanlan (US), Taketo Shimada (US), Greg Smith (US), Daniela Steinfeld (GER), Tercerunquinto (MEX), Sergio Vega (ARG/US), Mariana Viegas (POR), Public Works (UK), James Yamada (US), and others.

GRAN BAZAAR (exterior view), at Uruguay # 40, Centro Hist贸rico, Mexico City, 2006.

Esculptera for sale at GRAN BAZAAR, 2006.

Bracelet for sale at GRAN BAZAAR, 2006.

GRAN BAZAAR GRAN BAZAAR was a public art project commissioned by the Fondation Centro Hist贸rico in Mexico City, June 10-August 1, 2006. Holten lived in the Centro Hist贸rico and produced thousands of hand-made objects that were sold from a temporary store (GRAN BAZAAR).

Installation view of GRAN BAZAAR, temporary store in the Centro Hist贸rico, Mexico City, 2006.

Installation view of hand-made objects for sale at GRAN BAZAAR, 2006.

The Museum of Things, 2004, objects made from clay, dimensions variable. Work in progress during a resiency at the Sanskriti Kendra Foundation in New Delhi, India.

Archives Different areas of artistic expression are fused together in Holten’s installations; the linguistic, pictorial, artifactual, and aural. Her artistic actions are similiar to the work of an anthropologist or a social scientist. Many of her art projects incorporate a quasi-scientiﬁc aspect of study by investigating and contrasting various phenomena of everyday life and the present. In her work, she makes use of a number of different disciplines, such as geography, urban sociology and botany. She often assumes the role of a reporter who collects and documents various kinds of information about her surroundings, such as the National Development Plan in Ireland. However, Holten’s attitude towards the material she gathers more closely resembles that of a researcher than a reporter; her method of collecting and mediating information is akin to the analysis made by a scientist. The difference between Holten’s approach to the subject matter at hand and that of a scientist is that with Holten’s work the outcome of her research often seems to remain a mystery. Again distancing her art from the rigidity of science, Holten’s work usually involves a certain element of humor, albeit often sinister by nature. . .

preceding pages: ¿Qué Pasará Mañana?, 2006, ink on paper, 22 x 30 inches.

Installation view of A Work of Fever, Delirium and Discovery, 2004 at the Akademie der K端nste, Berlin.

A Work of Fever, Delirium and Discovery (detail), 2004, graphite on gallery wall, approx. 16 x 9 feet.

137.5째, 2002, crocheted yarn and tacks, approx. 10.5 x 24 x 4 feet. Installation view at Temple Bar Gallery, Dublin, September-October, 2002.

The Best’s To Come, 2007, wood, wire, glue, and newspaper, 10 x 10 x 10 feet. Installed at VAN HORN, Düsseldorf, January13-March 3, 2007.

left and right: Construction of The Best’s To Come.

Installation view of The Best’s To Come.

Work in progress, The Best’s To Come.

Installation view of The Best’s To Come.

War of the Worlds, 2006, acrylic and ink on chestnuts, approx. 1.5 x 1.5 x 1 inches (each). Installation view at Galerie Alexandra Saheb in Berlin as part of the group exhibition the space between, November 11, 2006-January 20, 2007.

left and right: En Upassende Sandhed, 2006, acrylic, glue, ink, newspaper and monoďŹ lament, approx. 3.25 x 3.2 x 3 feet. Installation view at KBH Kunsthal in Copenhagen as part of the 700% PLUS (KBH Centenniale) celebrations, October 20-November 1, 2006. Private collection.

above: Found Continents (ďŹ nger nails), 2006-2007.

page 96: Globe III, 2006, acrylic and ink on molded newspaper, approx. 12 x 9 x 8 inches. Private collection. page 97: Antarctica, 2007, ink on paper, 11 x 8.5 inches.

A Field Guide to Getting Lost Rebecca Solnit

. . . A plate of Waldseemüller’s 1513 atlas depicts the central Atlantic, Spain, and the western bulge of Africa recognisable, but the upper right-hand shoulder of South America is nothing but a coastline full of small names and mouths of rivers and, in far bolder letters, across what is now Venezuela and Brazil, “Terra Incognita,” unknown land. The phrase was common on old maps—even a 1900 atlas of mine marks out a part of the Amazon as “unexplored” —and is seldom found now. Between words is silence, around ink whiteness, behind every map’s information is what’s left out, the unmapped and the unmappable. One of those in-depth local or state atlases that map ethnicity and education and principal crops and percentage foreign-born makes it clear that any place can be mapped infinite ways, that maps are deeply selective. A new map of the city of Las Vegas appears every month, because the place grows so fast that delivery people need constant updates on the streets, and this too is a reminder that maps cannot be commensurate with their subject, that even a map accurate down to blades of grass would fall out of accuracy as soon as the grass was grazed or trampled. The Great Salt Lake cannot be mapped with any degree of accuracy, because it lies in a shallow basin without drainage: any slight change in water level becomes an extensive change in shoreline. Jorge Luis Borges wrote a parable about some cartographers who eventually created a map that was 1:1 scale and covered much of a nameless empire. Even at 1:1 scale, the twodimensional map would be inadequate to depict the layers of being in a place, its many versions. Thus the map of languages spoken and the map of soil types canvas the same area differently, just as Freudianism and shamanism describe the same psyche differently. No representation is complete. Borges has a less-well-known story in which a poet so perfectly describes the emperor’s vast and intricate palace that the emperor becomes enraged and regards him as a thief. In another version the palace disappears when the poem replaces it. The descriptive poem is a perfect map, the map that is the territory, and the story recalls another old one about a captive painter who at the Chinese emperor’s dictate paints so wonderful a landscape that he is able to escape into its depths. These parables say that representation is always partial, else it would not be representation, but some kind of haunting double. But the terra incognita spaces on maps say that knowledge also is an island surrounded by oceans of the unknown. They signify that the cartographers knew they did not know, and awareness of ignorance is not just ignorance; it’s awareness of knowledge’s limits. The eighteenth-century mapmaker Jean Baptiste Bourguignon d’Anville pronounced, “To destroy false notions, without even going any further, is one of the ways to advance knowledge.” To acknowledge the unknown is part of knowledge, and the unknown is visible as terra incognita but invisible as selection—the map showing agricultural lands and principal cities does not show earthquake faults and aquifers, and vice versa. About a hundred and fifty years after Christ, a Roman named Crates made a globe based on the theory that the earth had four continents, three of them unknown. Around the same time Ptolemy drew up the atlas that was for the next millenium and a half the standard source on the geography of the world. Says one map historian, “Ptolemy departed from the standard Greek conception of the inhabited world. He abandoned the idea of a world encompassed by water (in the restricted sense employed by Homer), of a circumfluent ‘oceanus’ relatively

opposite: The World, remembered (let’s try to forget about US for a moment), 2007, ink on paper, 19 x 24 inches..

100

left and right: Globe IV and Globe I, 2007, acrylic and ink on molded newspaper, approx. 9 x 7 x 6 (each). Private collection.

close by. Instead, he recognized the possibiltiy and probablity of Terra Incognita beyond the limits of his arbitrary boundary lines. In other words, he left the matter open to further investigation.” Before Crates and Ptolemy, maps depicted a known world surrounded by water, and the complacency that must have gone with this sense that the world was, as the navigational term has it, encompassed must be our smugness now that maps of earth are so unlikely to say “Terra Incognita.” On Sebastian Cabot’s 1544 map of the Americas, the whole of South America is drawn in, and so is Central America and the eastern coast. It’s a beautiful map in the mode of the time: dark people as tall as provinces walk across the southern continent, a pair of white bears far larger than Cuba and Haiti walk in the opposite direction, west, across the northern continent, and clumps of grass that would dwarf mountain ranges dot the landmasses. But the west coast begins to dissolve where California starts. Beyond Baja California the line simply stops as though the world there was not yet made, as though it were neither land nor water, as through the Creator had not yet finished this part of earth, as though substance and certainty together dissolved there, and the phrase “Terra Incognita” spreads across this unmarked expanse. On a map drawn up by Gastaldi two years later, Asia is fit like a puzzle piece into the blankness of the North American west, so that it looks as though you could walk from Tibet to Nevada (which is not yet named or marked) without any detour to the north. Strange wooly shapes like caterpillars or clouds dot the continent, and more clouds boil off the edge of the round earth. The Pacific proper appears on later maps, but a mythical island of Java sometimes appears on it, far larger than the island that would finally be saddled with the name. Brazil, the Amazon, and California are also real places named after imaginary ones. In that Pacific, California was long portrayed as a huge island just off the west coast of North America, and the northwest coast of that continent remained undrawn, one of the last expanses of Terra Incognita to the Europeans mapping the world. To imagine that you know, to populate the unknown with projections, is very different from knowing that you don’t, and the old maps depict both states of mind, the Shangri-las and terra incognitas, the unknown northwest coast and the imagined island of California 101

(whose west coast was nevertheless drawn in with some accurate details and names). When someone doesn’t show up, the people who wait sometimes tell stories about what might have happened and come to half believe the desertion, the abduction, the accident. Worry is a way to pretend that you have knowledge or control over what you don’t—and it surprises me, even in myself, how much we prefer ugly scenarios to the pure unknown. Perhaps fantasy is what you fill up maps with rather than saying that they too contain the unknown. . . Into the nineteenth century, people continued to seek places that had been made up out of imagination and desire. It had already been discovered that the magical Cibola, whose name appears above New Mexico in the old maps, was only Kansas, that Paradise was not located in Central America as Columbus thought, once he admitted that the topographies he had bumped into were not Asia. But even in the 1840s John C. Fremont claimed to be looking for the Buenaventura River that led from the Great Salt Lake into the Pacific. A water route across or, as the long fantasy of the Northwest Passage had it, above the continent, was long desired and grudgingly abandoned, and the Donner Party died in part of a bad description of a shortcut across the salty western stretches of Utah in the uncharted region long called the Great American Desert. Long afterward, south-central Nevada remained unmapped and unexplored, one of the last parts of the lower forty-eight states to be filled in by surveyors, and into the early twentieth century it is strangely blank, though in 1900 the state was full of mining towns that no longer exist, Manse and Montgomery and Midas, Belleville and Reveille and Candelaria. Afterward, when a great swath of it the size of Wales became Nellis Air Force Base with the Nevada Test Site inside, the place where a thousand nuclear bombs like small incendiary suns were detonated over the decades, civilian maps often left the region entirely blank, as though it had gone back into the unknown. The last map of California as an island was probably drawn up after Captain Cook’s voyages, though the theory that the Sea of Cortez continued on up to rejoin with the Pacific, rather than being the strait that ends when Mexico’s Baja California becomes the US’s Alta California, had been dispelled earlier. Strange it is to look at the old maps of the world and see my part of the continent as island and a void: Nicholas d’Abbeville’s 1650 map shows California as an island off a coast that becomes neither land nor water; Henrious Seile’s 1652 map shades in more of the northwestern coast, but refrains from drawing the sharp line of certainty. “Terra Borealis Incognita” say the black letters across a vast expanse. Even Pedro Font’s 1777 map of the San Francisco Bay Area leaves the inland area north of the Golden Gate (as Fremont would later name it) blank, so that the territory of my childhood is terra incognita there. During the buildup to the recent war in Iraq, whose two great central rivers come as close as anything on earth to the biblical paradise with four rivers flowing out of it, one of the vultures making the case for bombing Baghdad’s civilians said, “There are known knowns. There are things we know we know. We also know there are known unknowns. That is to say, we know there are some things we do not know. But there are also unknown unknowns, the ones we don’t know we don’t know.” This third category would prove crucial in the spasms and catastrophes of the war. And the philosopher Slavoj Žižek added that he had left out a fourth term, “the ‘unknown knowns,’ things we don’t know that we know, which is precisely the Freudian unconscious, the ‘knowledge that doesn’t know itself,’ as Lacan used to say,” and he went on to say that “the real dangers are in the disavowed beliefs, suppositions, and obscene practices we pretend not to know about.” The terra incognita spaces on maps say that knowledge too is an island surrounded by oceans of the unknown, but whether we are on land or water is another story.

following pages: Found Continents (October 2006), 2006, ink on paper, 39.75 x 55.5 inches.

102

103

104

105

Having a Wonderful Time J.G. Ballard

3 JULY 1985 Hotel Imperial, Playa Inglaterra, Las Palmas We arrived an hour ago after an amazing flight. For some reason of its own the Gatwick computer assigned us to first class seats, along with a startled dentist from Bristol, her husband and three children. Richard, as ever fearful of flying, took full advantage of the free champagne and was five miles high before the wheels left the ground. I’ve marked our balcony on the twenty-seventh floor. It’s an extraordinary place, about twenty miles down the coast from Las Palmas, a brand-new resort complex with every entertainment conceiveable, all arranged by bedside push-button. I’m just about to dial an hour’s waterskiing, followed by Swedish massage and the hairdresser! Diana. 10 JULY Hotel Imperial An unbelieveable week! I’ve never crammed so much excitement into a few days—tennis, scuba-diving, water-skiing, rounds of cocktail parties. Every evening a group of us heads for the boîtes and cabarets along the beach, ending up at one or more of the five nightclubs in the hotel. I’ve hardly seen Richard. The handsome cavalier in the picture is the so-called Beach Counsellor, a highly intelligent ex-public relations man who threw it all in two years ago and has been here ever since. This afternoon he’s teaching me to hang-glide. Wish me happy landings! Diana. 17 JULY Hotel Imperial The times of sand are running out. Sitting here on the balcony, watching Richard skichute across the bay, it’s hard to believe we’ll be in Exeter tomorrow. Richard swears the first thing he’ll do is book next year’s holiday. It really has been an amazing success—heaven knows how they do it at the price, there’s talk of a Spanish government subsidy. In part it’s the unobtrusive but highly sophisticated organization—not a hint of Butlins, though it’s British-run and we’re all, curiously, from the West Country. Do you realise that Richard and I have been so busy we haven’t once bothered to visit Las Palmas? (Late news-flash: Mark Hastings, the Beach Counsellor, has just sent orchids to the room!) I’ll tell you all about him tomorrow. Diana. 18 JULY Hotel Imperial Surprise! That computer again. Apparently there’s been some muddle at the Gatwick end, our aircraft won’t be here until tomorrow at the earliest. Richard is rather worried about not getting to the office today. We blew the last of our traveller’s cheques, but luckily the hotel have been marvelous, thanks largely to Mark. Not only will there be no surcharge, but the desk-clerk said they would happily advance us any cash we need. Hey-ho. . . A slight let-down, all the same. We walked along the beach this afternoon, together for the first time. I hadn’t realized how vast this resort complex actually is—it stretches for miles along the coast and half of it’s still being built. Everywhere people were coming in on the airport buses from Sheffield and Manchester and Birmingham, within half an hour they’re swimming and water-skiing, lounging around the hundreds of pools with their duty-free Camparis. Seeing them from the outside, as it were, it’s all rather strange. Diana.

opposite: Found Continents (November 2006) (detail), 2006, ink on paper, 39.75 x 55.5 inches.

106

25 JULY Hotel Imperial Still here. The sky’s full of aircraft flying in from Gatwick and Heathrow, but none of them, apparently, is ours. Each morning we’ve waited in the lobby with our suitcases packed, but the airport bus never arrives. After an hour or so the desk-clerk rings through that there’s been a postponement and we trudge back to another day by the pool, drinks and water-skiing on the house. For the first few days it was rather amusing, though Richard was angry and depressed. The company is a major Leyland supplier, and if the axe falls, middlemanagement is the first to feel it. But the hotel have given us unrestricted credit, and Mark says that as long as we don’t go over the top they’ll probably never bother to collect. Good news: the company have just cabled Richard telling him not to worry. Apparently hordes of people have been caught the same way. An immense relief—I wanted to phone you, but for days now all the lines have been blocked. Diana. 15 AUGUST Hotel Imperial Three more weeks! Hysterical laughter in paradise. . . the English papers flown in here are full of it, no doubt you’ve heard that there’s going to be a government inquiry. Apparently, instead of flying people back from the Canaries the airlines have been sending their planes on to the Caribbean to pick up the American holiday traffic. So the poor British are stuck here indefinitely. There are literally hundreds of us in the same boat. The amazing thing is that one gets used to it. The hotel people are charm itself, they’ve pulled out all the stops, organizing extra entertainments of every kind. There’s a very political cabaret, and an underwater archaeology team are going to raise a Spanish caravel from the sea floor. To fill in the time I’m joining an amateur theatrical group, we’re thinking of putting on The Importance of Being Earnest. Richard takes it all with surprising calm. I wanted to post this from Las Palmas, but there are no buses running, and when we set out on foot Richard and I lost ourselves in a maze of building sites. Diana. 5 SEPTEMBER Hotel Imperial No news yet. Time moves like a dream. Every morning a crowd of bewildered people jam the lobby, trying to find news of their flights back. On the whole, everyone’s taking it surprisingly well, showing that true British spirit. Most of them, like Richard, are management people in industry, but the firms, thank heavens, have been absolutely marvellous and cabled us all to get back when we can. Richard comments cynically that with present levels of industrial stagnation, and with the Government footing the bill, they’re probably glad to see us here. Frankly, I’m too busy with a hundred and one activities to worry—there’s a sort of mini-Renaissance of the arts going on. Mixed saunas, cordonbleu classes, encounter groups, the theatre, of course, and marine biology. Incidentally, we never did manage to get into Las Palmas. Richard hired a pedalo yesterday and set off up the coast. Apparently the entire island is being divided into a series of huge selfcontained holiday complexes—human reserves, Richard called them. He estimates that there are a million people here already, mostly English working class from the north and midlands. Some of them have apparently been here for a year, living quite happily, though their facilities are nowhere as good as ours. Dress rehearsal tonight. Think of me as Lady Bracknell—it’s mortifying that there’s no one else quite mature enough to play the part, they’re all in their twenties and thirties, but Tony Johnson, the director, an ex-ICI statistian, is being awfully sweet about it. Diana. 6 OCTOBER Hotel Imperial Just a brief card. There was a crisis this morning when Richard, who’s been very moody recently, finally came into collision with the hotel management. When I went into the lobby after my French conversation class a huge crowd had gathered, listening to him rant away at the desk clerks. He was very excited but extremely logical in a mad way, demanding a taxi (there are none here, no one ever goes anywhere) to take him into Las Palmas. Balked, he 107

insisted on being allowed to phone the Governor of the Islands, or the Swiss Consul. Mark and Tony Johnson then arrived with a doctor. There was a nasty struggle for a moment, and then they took him up to our room. I thought he was completely out, but half an hour later, when I left the shower, he’d vanished. I hope he’s cooling off somewhere. The hotel management have been awfully good, but it did surprise me that no one tried to intervene. They just watched everything in a glazed way and wandered back to the pool. Sometimes I think they’re in no hurry to get home. Diana. 12 NOVEMBER Hotel Imperial An extraordinary thing happened today—I saw Richard for the first time since he left. I was out on the beach for my morning jog when there he was, sitting by himself under an umbrella. He looked very tanned and healthy, but much slimmer. He calmly told me a preposterous story about the entire Canaries being developed by the governments of Western Europe, in collusion with the Spanish authorities, as a kind of permanent holiday camp for their unemployables, not just the factory workers but most of the management people too. According to Richard there is a beach being built for the French on the other side of the island, and another for the Germans. And the Canaries are only one of many sites around the Mediterranean and Caribbean. Once there, the holiday-makers will never be allowed to return home, for fear of starting revolutions. I tried to argue with him, but he casually stood up and said he was going to form a resistance group, then strode away along the beach. The trouble is that he’s found nothing with which to occupy his mind—I wish he’d join our theatre group, we’re now rehearsing Pinter’s The Birthday Party. Diana. 10 JANUARY 1986 Hotel Imperial A sad day. I meant to send you a cable, but there’s been too much to do. Richard was buried this morning, in the new international cemetery in the hills overlooking the bay. I’ve marked his place with an X. I’d last seen him two months ago, but I gather he’d been moving around the island, living in the half-constructed hotels and trying unsuccessfully to set up his resistance group. A few days ago he apparently stole an unseaworthy motorboat and set off for the African coast. His body washed ashore yesterday on one of the French beaches. Sadly, we’d completely lost touch, though I feel the experience has given me a degree of insight and maturity which I can put to good use when I play Clytemnestra in Tony’s new production of Electra. He and Mark Hastings have been pillars of strength. Diana. 3 JULY 1986 Hotel Imperial Have I really been here a year? I’m so out of touch with England that I can hardly remember when I last sent a postcard to you. It’s been a year of the most wonderful theatre, of parts I would once never have dreamed of playing, and of audiences so loyal that I can hardly bear the thought of leaving them. The hotels are full now, and we play to a packed house every night. There’s so much to do here, and everyone is so fulfilled, that I rarely find the time to think of Richard. I very much wish you were here, with Charles and the children—but you probably are, at one of the thousand hotels along the beach. The mails are so erratic, I sometimes think that all my cards to you have never been delivered, but lie unsorted with a million others in the vaults of the shabby post office behind the hotel. Love to all of you. Diana.

page 108: Reconstituted Land I, 2006-2007, fragments of photocopied drawings, glue, and ink on paper, 22 x 30 inches. page 109: Reconstituted Land III, 2006-2007, fragments of photocopied drawings, glue, and ink on paper, 22 x 30 inches.

108

109

110

Sources pages 19-24: From the essay “Watermark: Can southern Louisiana be Saved?”, originally published in The New Yorker, February 27, 2006 Reprinted by permission of the author. All rights reserved. Copyright © Elizabeth Kolbert, 2006 page 33: Extracts from an e-mail conversation between Scott F.Woodbury and Katie Holten, 2006. All rights reserved. Copyright © the authors, 2006 page 37: From a conversation between Andrea Zittel and Katie Holten. Printed by permission of Andrea Zittel. All rights reserved. Copyright © the authors, 2007 pages 41-43: From a conversation between Fritz Haeg and Katie Holten, 2007. Printed by permission of Fritz Haeg. All rights reserved. Copyright © the authors, 2007 page 45: First line taken from Wanderlust: A History of Walking by Rebecca Solnit. First published by Penguin. Copyright © Rececca Solnit 2001. The remaining text extracted from “Walking” by Henry David Thoreau. “Walking” began as a lecture, ﬁrst delivered at the Concord Lyceum on April 23, 1851, and many other times, until it evolved into the essay published in the Atlantic Monthly, after his death in 1862. Copyright © Henry David Thoreau, 1862 pages 51-54: “A Reﬂection on Cities of the Future”, originally published online at http: //www.kunstler.com. Reprinted by permission of the author. All rights reserved. Copyright © James Howard Kunstler, 2006 page 59: From The Language of Landscape by Anne Whiston Spirn, originally published by Yale University Press, New Haven. Reprinted by permission of the author. All rights reserved. Copyright © Anne Whiston Spirn, 1998 pages 64-67: From the short story “The Bullet Catcher”, from The Safety of Objects by A.M. Homes. Reprinted by permission of the author and W.W. Norton & Company, Inc. All rights reserved. Copyright © A.M. Homes, 1990 pages 70-71: “My Favorite Plant”, originally published in Katie Holten’s PAPERS for the 50th Venice Biennale. Reprinted by permission of the author. All rights reserved. Copyright © Chris Somerville, 2003 page 73: From Caoimhín MacGiolla Léith’s essay “Up the Garden Path,” originally published in Katie Holten: In Context, Context Gallery, Derry, Northern Ireland. Copyright © Caoimhín MacGiolla Léith, 2001 pages 78-79: From an interview conducted via a series of e-mailed conversations between Regina Gleeson and Katie Holten in Autumn 2003. Originally published online at http:// www.recirca.com/articles/katieholten/index.shtml. Reprinted by permission of Regina Gleeson and CIRCA. All rights reserved. Copyright © Regina Gleeson, 2003 page 83: From Michael Wang’s report for ARTFORUM. Originally appeared online at http: //artforum.com/diary/id=10444. Copyright © ARTFORUM, 2006 page 88: From a text by Kati Kivinen. Originally published in Germinations 13, Antwerp. Copyright © Kati Kivinen, 2001 pages 99-101: From A Field Guide to Getting Lost by Rebecca Solnit. First published by Viking Penguin. Reprinted by permission of the author and Viking Penguin, a division of Penguin Group (USA) Inc. All rights reserved. Copyright © Rebecca Solnit, 2005 pages 105-107: “Having a Wonderful Time” originally published in Myths of the Near Future by J.G. Ballard. Reprinted by permission of the author and Harper Collins. All rights reserved. Copyright © J.G. Ballard, 1982 111

Notes on Contributors J.G. Ballard was born in Shanghai in 1930. His internment during the war inspired his most famous novel, Empire of the Sun. Returning to England in 1946, he spent two years reading medicine at Cambridge University. Keen to write, he took various jobs from Covent Garden porter to trainee RAF pilot in Canada. He began by writing science fiction short stories and in 1962 published his first major work, The Drowned World. Many novels have followed including The Atrocity Exhibition, Crash, High Rise, Cocaine Nights, and Super-Cannes. In 2001, Lia Gangitano founded PARTICIPANT INC, a not-for-profit art space on the Lower East Side of New York. As former curator of Thread Waxing Space, New York, her exhibitions, screenings, and performances include Spectacular Optical (1998), Luther Price: Imitation of Life (1999), The Life Casts of Cynthia Plaster Caster: 1968-2000 (2000), and Sigalit Landau (2001). She is editor of the forthcoming anthology, The Alternative to What? Thread Waxing Space and the ‘90s. As an associate curator, she co-curated Dress Codes (1993) and Boston School (1995) for The Institute of Contemporary Art, Boston, and edited the publications New Histories (with Steven Nelson, ICA Boston, 1997) and Boston School (ICA Boston, 1995). She has contributed to publications including TRANS>arts.cultures.media, The Sharpest Point: Animation at the End of Cinema, Lovett/Codagnone, and Whitney Biennial 2006-Day for Night. Regina Gleeson is an Irish art critic and member of Association Internationale des Critiques d’Arts. As well as working closely with Visual Artists Ireland on a number of advisory cultural projects she is an international representative for the organisation and participated in the 2004 Amsterdam congress of The European Council of Artists and the 2005 Budapest congress of The European Forum for the Arts and Heritage. After winning awards from The Arts Council of Ireland for her critical writing in 2003 and 2004, she engaged in research on globalisation’s impact on art practice and focused on the shifts between location and dislocation, collaborative practice across fluid borders and Home from Homelessness. She is a contributor for Irish Arts Review, CIRCA, Visual Artists News Sheet, and NY Arts. In 2006 she curated the interdisciplinary collaborative project Better Than the Real Thing? at Four Gallery, Dublin. Like a system of crop rotation, Fritz Haeg works between his architecture and design practice, Fritz Haeg Studio, the happenings and gatherings of Sundown Salon, the ecology initiatives of Gardenlab, and his work as a college educator. Collectively they seek to support innovative art and design, cultivate and nurture communities, improve the natural-human environment and make connections and relationships between people and places that have been isolated or ignored by contemporary society. Recent projects have included the Edible Estates initiative, the Bernardi Residence in Los Angeles, and Sundown Schoolhouse, the nondisciplinary educational environment initiated in 2006 in Haeg’s geodesic dome residence. He studied architecture at the Istituto Universitario di Architettura di Venezia and Carnegie Mellon University. His work has been presented at the MAK Center, Los Angeles; the ICA, Philadelphia; the Whitney Museum of American Art, New York; and the Wattis Institute, San Fancisco. A.M. Homes is the author of several novels including, The Mistress’s Daughter, This Book Will Save Your Life, Music For Torching, The End of Alice, In a Country of Mothers, and Jack, as well as the short-story collections, Things You Should Know and The Safety of Objects. Her work has been translated into twelve languages and appears frequently in ARTFORUM, Harpers, Granta, McSweeney’s, The New Yorker, The New York Times, and Zoetrope. She is a contributing editor to Vanity Fair, Bomb, and Blind Spot. She has been the recipient of numerous awards 112

112

including fellowships from the John Simon Guggenheim Foundation, the National Endowment for the Arts, The Cullman Center for Scholars and Writers at The New York Public Library, the Benjamin Franklin Award, and the Deutscher Jugendliteraturpreis. Elizabeth Kolbert was a reporter for The New York Times for fourteen years before becoming a staff writer covering politics for The New Yorker. She has written dozens of pieces for the magazine, including profiles of Senator Hillary Clinton and former Mayor Rudolph Giuliani. Her series on global warming, “The Climate of Man,” which appeared in The New Yorker in the spring of 2005, was awarded the American Association for the Advancement of Science’s magazine writing award. Her stories have also appeared in The New York Times Magazine, Vogue, and Mother Jones, and have been anthologized in The Best American Science and Nature Writing and The Best American Political Writing. A collection of her work, The Prophet of Love and Other Tales of Power and Deceit, was published in 2004 and Field Notes From a Catastrophe: Man, Nature and Climate Change was published in 2006. James Howard Kunstler was born in New York City in 1948. His most recent book, The Long Emergency powerfully explores the global oil predicament, climate change, and other shocks to the system, with implications for how we will live in the decades ahead. Kunstler eloquently guides his readers to a future when oil runs out, economies crash, and society breaks down. He is the author of three other nonfiction books, The Geography of Nowhere, Home from Nowhere, The City in Mind: Notes on the Urban Condition, and nine novels, including Maggie Darling, The Halloween Ball, and An Embarrassment of Riches. He has been an editor with Rolling Stone and his articles have appeared in The Atlantic Monthly and The New York Times Magazine. Rebecca Solnit is an activist, historian, and writer in San Francisco. Her work deals in particular with landscape, cityscapes, cultural geographies, the environment, place, memory, photography, counter–narratives, and the uses of story. Solnit’s books include Savage Dreams: A Journey into the Landscape Wars of the American West, Wanderlust: A History of Walking, River of Shadows: Eadweard Muybridge and the Technological Wild West, and Yosemite in Time: Ice Ages, Tree Clocks, Ghost Rivers. Among her awards are a Guggenheim, the Lannan, and the National Book Critics Circle Award in criticism. Chris Somerville, Ph.D. is Director of the Department of Plant Biology at the Carnegie Institution of Washington and Professor of Biological Sciences, Stanford University. Somerville has pioneered the use of the small mustard plant, Arabidopsis thaliana, as a model species for plant molecular genetics. The areas of his research contributions include plant genomics, embryo development, and the synthesis of structural and storage components of plant cells. He has served on various advisory panels for the National Science Foundation, the National Institute of Health, and the US Department of Agriculture. He has served as a consultant to many companies including Unilever, DuPont, Monsanto, Eli Lilly, Pioneer, and Dow. Anne Whiston Spirn’s path-breaking scholarly research and writing applies ecological principles to urban settings. Spirn has an international reputation as the preeminent scholar working at the intersection of landscape architecture and environmental planning. Her first book, The Granite Garden: Urban Nature and Human Design, won the President’s Award of Excellence from the American Society of Landscape Architects (ASLA) in 1984, has been translated into two other languages, and remains a standard university text. Her

113

latest book, The Language of Landscape, sets out a theory of landscape and aesthetics that takes account of both human interpretive frameworks and natural process. Since 1991, Scott F. Woodbury has been Horticulture supervisor of the Shaw Arboretum. Now the Shaw Nature Reserve, the site is an extension of the Missouri Botanical Gardens and boasts 2,500 acres of natural Ozark landscape and managed plant collections. Two highlights of Woodbury’s career include his work maintaining the garden on the grounds of the Castello di Uzzano, Greve, in Chianti, Italy and his work at the Tudor Place Foundation, Washington D.C. where he cared for the 19th century garden while also overseeing the development and installation of a new native wildflower garden. Beyond his initiatives to transform landscapes back to their native state and his direct work in various ecological environments, Woodbury has also led numerous community workshops teaching native plant education and professional landscaping. In conjunction with his work at Shaw, he is presently conducting several ongoing collaborative field research projects involving the restoration and propagation of native plant life. Andrea Zittel currently divides her time between A–Z West (located in Joshua Tree, California) and Los Angeles where she teaches at the University of Southern California. Her practice entails all facets of personal explorations and experimentation; from living “without time” for a week in a Berlin basement, to building a habitable 54 ton concrete floating island in the Øresund, a strait of water between Sweden and Denmark. Zittel’s sculptures and installations transform everything necessary for life—such as eating, sleeping, bathing, and socializing—into artful experiments in living. Blurring the lines between life and art, Zittel’s projects extend to her own home and wardrobe as she continually reinvents her relationship to her domestic and social environment. Zittel is a co-organizer of the High Desert Test Sites, and will soon be founding two new projects: the A-Z Smock Shop in Los Angeles, and an as of yet unnamed campsite in the High Desert.

114

Katie Holten Born

1975 in Dublin, Ireland Lives in New York City and elsewhere

Education 2004 - 2006

Cornell University, New York, US (Fulbright Scholarship)

1994 - 1998

National College of Art and Design, Dublin, Ireland (B.A. in History of Art and Fine Art)

1997

Hochschule der Künste, Berlin, Germany (Erasmus Scholarship)

Selected Solo Exhibitions 2007

Paths of Desire, Contemporary Art Museum St. Louis, US The Best’s To Come, VAN HORN, Düsseldorf, Germany Heins Schürmann presents Katie Holten, Schürmann Berlin, Germany

2006

Pause, 65 Rue Rebéval, Paris, France 700% PLUS, KBH Kunsthal, Copenhagen, Denmark GRAN BAZAAR, Uruguay #40, Centro Histórico, Mexico City, Mexico

2005

One Fine Day, VAN HORN, Düsseldorf, Germany A New Universe, LMAKprojects, Brooklyn, New York, US

2003

Laboratorio della Vigna, Representing Ireland, Venice Biennale, Venice, Italy Beta vulgaris, W139, Amsterdam, The Netherlands A Recent History of What’s Possible, Butler Gallery, Kilkenny, Ireland Drawings, Irish Museum of Modern Art, Process Room, Dublin, Ireland

2002

137.5°, Temple Bar Gallery, Dublin, Ireland a drawing, Prima Kunst, Stadtgalerie Kiel, Germany

2001

…and other failed projects, Context Gallery, Derry, Northern Ireland

1999

Some Grand Plans, The Basement Gallery, Dundalk, Ireland

1998

Documenta Archive II, Quer Galerie, Berlin, Germany

Selected Group Exhibitions

115

2007

Re-trait, Fondation d’Entreprise Ricard, Paris, France Art is Flowering, Schmuckmuseum / Kunstverein, Pforzheim, Germany Inter Changes, Farmleigh House, Dublin, Ireland

2006

the space between, Galerie Alexandra Saheb, Berlin, Germany ZOO: Logical Garden, Familie Park, Ghent, Belgium Soft Sites, Institute of Contemporary Art, Philadelphia, US Eigenheim, Göttingen Kunstverein, Göttingen, Germany Summer School for Self Improvement, Space Station 65, London, UK Let’s Remake the World, Ydre Nørrebro Kultur Bureau, Copenhagen, Denmark Among the Trees, Visual Arts Center of New Jersey, US

2005

Editionen, Wiener Secession, Vienna, Austria Bucolica, Wallspace Gallery, New York, US I.D.E.A.London, ICA, London, UK Remote, LOT, Bristol, UK Dreamland Artist Club, A CREATIVE TIME project for Coney Island, New York, US Red White Blue, Spencer Brownstone Gallery, New York, US vinyl, Christian Brothers School, Cork, Ireland

2004

Junge Akademie, Akademie der Künste, Berlin, Germany Remote Control, Angel Row Gallery, Nottingham, UK In India, Sanskriti Kendra, New Delhi, India Para Sites, Bridport Arts Centre, Dorset, UK

2003

Prague Biennale, National Gallery, Prague, Czech Republic Book Trade, Centre d’édition Contemporaine, Geneva, Switzerland Necessary Journeys, Temple Bar Gallery, Dublin, Ireland Appendiks, Thiemers Magasin, Copenhagen, Denmark The National Gallery, The Return, Dublin, Ireland

2002

Archipelago, Museum of Contemporary Art, Denver, US Under Åpen Himmel, Kunstbanken Hedmark, Hamar, Norway retur, Copenhagen, Denmark (offsite project) Bloomsday#1:Dedalus, Context Gallery, Derry, Northern Ireland Germinations 13, Crawford Municipal Art Gallery, Cork, Ireland

2001

Drawn Out, London Print Studio Gallery, London, UK Perspective 2001, Ormeau Baths Gallery, Belfast, Northern Ireland

2000

Drawing Show, Galerie Paul Andriesse, Amsterdam, The Netherlands PLOT, Sirius Arts Centre, Cobh, Cork, Ireland Multiples x4, Temple Bar Gallery, Dublin, Ireland EV+A, Limerick City Gallery of Art, Limerick, Ireland Bog Garden, ACNI and The Women’s Centre, Derry, N. Ireland (permanent)

1999

Utopias, The Douglas Hyde Gallery, Dublin, Ireland

Selected Residencies 2006

Samuel Beckett Centennial Residency, Centre Culturel Irlandais, Paris, France Hotel Virreyes/Fondation Centro, Centro Histórico, Mexico City, Mexico

2004

Sanskriti Kendra Foundation, New Delhi, India (with Helen O’Leary)

2003

W139, Amsterdam, The Netherlands

2002

Irish Museum of Modern Art, Dublin, Ireland

2001

Pat Finn Foundation, St. Ives, Cornwall, UK Tyrone Guthrie Centre, Annaghmakerrig, Ireland Heinrich Böll Cottage, Achill Island, Ireland

2000

Sirius Arts Centre, Cobh, Co. Cork, Ireland

Selected Awards 2007

The Arts Council / An Chomhairle Ealaíon, Ireland Culture Ireland, Department of Arts, Ireland

2006

Nimoy Foundation Award, US

2005

The Pollock-Krasner Foundation, US Lower Manhattan Cultural Council, US

2004

The Irish Fulbright Commission, Ireland Contemporary Initiatives, Wellcome Trust, UK

2002

Allied Irish Bank Ltd., Ireland

Selected Bibliography

116

2006

A.D. Amorosi, “Garden State,” Philadelphia Citypaper, Philadelphia, US, July 27-August 2: 35-36 Angelique Campens, “Zoo: Logical Garden,” Ghent, Belgium (exhibition catalog) Patricia Cordero, “Cambian desechos a objetos artísticos,” REFORMA, Mexico City, Mexico, July 25, 2006: 6 Sue Hubbard, “The New Romantics,” New Statesman, London, UK, December 4 Caroline MacKinnon, “Recycled Art for Sale,” Herald, Mexico City, Mexico, July 25: 4 Sally O’Reilly, “Discussion of Substance,” GRAN BAZAAR, Mexico City, Mexico (artist book)

2004

Regina Gleeson, “Globalisation’s Impact on Art Practice” CIRCA 108, Dublin, Ireland, Summer: 61-63 Denna Jones, “Divine Doodling,” Katie Holten, LMAKprojects, New York, US (artist book)

2003

James Gleick, Katie Holten/Procumbent Notions, Pork Salad Press, Copenhagen, Denmark (artist book) Gemma Tipton, “Irish Arts Review” Irish Arts Review, Dublin, Ireland (EU Presidency Issue)

116

List of Works* WORKS IN THE EXHIBITION: Excavated Tree: Missouri Native (Flowering Dogwood), 2007, cardboard, newspaper, paper, wire, steel, PVC, and duct tape, approx. 18 x 14.75 x 14.5 feet Trees of the U.S.A. I, 2006, ink on paper, 47 x 31.5 inches Trees of the U.S.A. II, 2006-2007, ink on paper, 47 x 31.5 inches Trees of the U.S.A. III, 2007, ink on paper, 47 x 31.5 inches Found Continents, October 2006, 2006, ink on paper, 39.75 x 55.5 inches Found Continents, November 2006, 2006, ink on paper, 39.75 x 55.5 inches Found Continents, December 2006, 2006, ink on paper, 39.75 x 55.5 inches The World, remembered (letâ&#x20AC;&#x2122;s forget about US for a moment), 2006, ink on paper, 19 x 24 inches The World, remembered (Poor Water), 2007, ink and acrylic on pages from The New York Times, 22 x 26 inches The World, remembered (Nuclear Weapons), 2007, ink and acrylic on pages from The New York Times, 22 x 26 inches WORKS RELATED TO THE EXHIBITION: Discussion on Art, Food and the Environment, with Katie Holten, Dave Owens, and Jean Ponzi. Venue: Contemporary Art Museum St. Louis. Date: May 19, 2007 Walks. A series of random walks started at the Contemporary Art Museum St. Louis. April-May 2007. Failed Prairie. Plans for an urban prairie in a vacant lot on Washington Boulevard in Grand Center, St. Louis, 2005-2007.

* Checklist accurate at time of going to print.

117

Acknowledgements I would like to thank Shannon Fitzgerald for inviting me to undertake a project for the Contemporary Art Museum St. Louis and for her efforts in helping me realize Paths of Desire. Thanks also to all of the contributors, Bruce Burton, Rebecca Walsh, Dillon Cohen, Louky Keijsers, Shane Simmons, B.J. Vogt, Caitlin Boyle, Stan Jones, Daniela Steinfeld, Mariely Lopez, David Johnson, John Holten, Candy Holten, Edwin Cohen, Martha McDonald, Laurie deChiara, Ingrid Blekastad, Sam Durant, Andrea Bowers, Claire Staebler, Angelique Campens, Eamon O’Kane, Kathleen Madden, Eric Shaub, Kerry Hardie, Chippy Holmes, Elizabeth Clementson, Helen O’Leary, Elyse Gonzales, Jacob Fabricius, Bryan Starr, Chris Fox, Paul Slovak, Sonya Cheuse, Wilhelm Schürman, Michael Heins, Rüdiger Schlömer, Christoph Balzar, Jan Albers, Paul Rickert, Victoria Shaw, Louise Duggan, Christine Sisk, Shelly Holten, Terry Berkowitz, Marie Debat, Helen Carey, Sheila Pratschke, the staff at the Centre Culturel Irlandais in Paris, Steve Spezia, Jon Wingo, Brandon Anschultz, Emily Rauh Pulitzer, Steve Morby, The Pulitzer Foundation for the Arts, Shaw Nature Reserve, Earthways Center, Jean Ponzi, Missouri Botanical Garden, and all the staff at the Contemporary Art Museum St. Louis. I would also like to thank my galleries for their support: VAN HORN in Düsseldorf, LMAKprojects in New York and Punto Gris in Puerto Rico.

Photo Credits All works in this publication are by Katie Holten, unless stated otherwise. East Malling Research, UK, courtesy David Johnson (cover, 8) / Fico, Paris (endsheets) / Christoph Balzar, courtesy Heins Schürmann Collection, Herzogenrath, Germany (pages 2, 3, 4, 28, 29) / Katie Holten (pages 10, 12, 30, 34, 36, 37, 40, 42, 44, 46, 47, 54, 58, 61, 66, 74, 75, 76, 78, 79, 80, 82, 83, 84, 90, 91, 92, 93, 94, 95) / Tom Powell (pages 14, 15, 16, 17, 18, 50, 72) / Bruce Burton (pages 26, 27) / Marc Domage, courtesy Fondation d’Entreprise Ricard, Paris, France (page 30) / Eamon O’Kane (page 31) / Farzad Owrang (pages 32, 38, 39, 60, 62, 63, 86, 98, 102, 103, 104) / Bjørnar Steivang, courtesy Kunstbanken, Hamar, Norway (page 34) / Aaron Igler, courtesy Institute of Contemporary Art, Philadelphia, US (pages 35, 36) / Andrea Zittel (page 37) / Fritz Haeg (page 43) / Candy Holten (page 44) / Dillon Cohen (page 45) / Daniela Steinfeld, courtesy VAN HORN, Düsseldorf, Germany (pages 68, 69, 92, 93, 108, 109) / Jorg Köster (page 73) / Jeroen de Swaaf, courtesy W139, Amsterdam, The Netherlands (page 74) / Ros Kavanagh (pages 77, 79, 80, 81) / Louky Keijsers (page 82) / Pablo Aguinaco (pages 84, 85, 96, 100) / Helen O’Leary (page 88) / Courtesy Akademie der Künste, Berlin, Germany (page 89).

118

Colophon This book was designed by Bruce Burton and Katie Holten. Type is set in Linotype Didot and ITC American Typewriter. For about 100 years in the eighteenth and nineteenth centuries, several members of the Didot family were active in Paris as designers. They were also printers, publishers, typefounders, inventors, writers and intellectuals. Around 1800, the Didot family owned the most important print shop and font foundry in France. Pierre Didot published books and prints set in typefaces designed and punchcut by his brother, Firmin Didot. Linotype Didot was drawn by Adrian Frutiger in 1991, and is based on the fonts cut by Firmin Didot between 1799 and 1811. Frutiger also studied the Didot types in a book printed by the Didots in 1818, “La Henriade” by Voltaire. ITC American Typewriter font was designed by Joel Kaden and Tony Stan in 1974. It is an ode to the invention that shaped reading habits and the idea of legibility, the typewriter. This book was printed on Rolland Enviro100 paper. This paper contains 100% postconsumer ﬁbre, certiﬁed EcoLogo and processed chlorine free, FSC recycled, and manufactured using biogas energy. Nine trees, 546 lbs of solid waste, 5,149 gallons of water, 1,198 lbs of air emissions, and 1,248 ft3 of natural gas were saved in using this paper.

119

This publication accompanies Katie Holten: Paths of Desire May 18–August 5, 2007 The exhibition was originally conceived by Shannon Fitzgerald. Published by Contemporary Art Museum St. Louis 3750 Washington Boulevard, St. Louis, Missouri 63108 www.contemporarystl.org © 2007 Katie Holten www.katieholten.com © 2007 the authors, photographers, and Contemporary Art Museum St. Louis All Rights Reserved Edition: 1,000 ISBN: 978-0-9777528-3-6 Designed by Bruce Burton and Katie Holten Edited by Katie Holten Printed by Stolze Printing, Inc. Printed and bound in St. Louis, Missouri Distributed by D.A.P. / Distributed Art Publishers 155 Sixth Avenue, 2nd ﬂoor New York, NY 10013 Tel: (212) 627.1999 Fax: (212) 627-9484 This publication is supported in part by the Elizabeth Firestone Graham Foundation and the Arts Council of Ireland. Additional exhibition support provided by the Nimoy Foundation, Whitaker Foundation, William E. Weiss Foundation, Regional Arts Commission, Arts and Education Council, the Missouri Arts Council, a state agency and Culture Ireland. In-kind support provided by LMAKprojects, New York.

Cover: Excavated Tree (photograph of an excavated Cox’s Pippen tree re–erected in a shed), 2005, Lambda-Print, 11.8 x 15.7 inches, Edition of 15 + 2 AP. Edition printed by the artist and VAN HORN, Düsseldorf. Original photograph (1952) courtesy of David Johnson, East Malling Research, UK. Image courtesy the artist and VAN HORN, Düsseldorf. Endsheets: The Times 22.09.06 p.22, 2006, ink and acrylic on pages from Le Monde, 23 x 28 inches. Courtesy the artist and VAN HORN, Düsseldorf.

120

121