Cancer Therapy Volume 2 Issue A

CANCER THERAPY

Volume 2A 2004

CANCER THERAPY FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! !

Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd.

Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!! !

Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!! !

Editorial Board

Ablin, Richard J., Ph.D., Arizona Cancer Center, University of Arizona, USA Armand, Jean Pierre, M.D. Ph.D., European Organization for Research and Treatment of Cancer (EORTC), Belgium Aurelian, Laure, Ph.D., University of Maryland School of Medicine, USA Berdel, Wolfgang E, M.D., University Hospitals, Germany Bertino, Joseph R., M.D., Cancer Institute of New Jersey, USA Beyan Cengiz, M.D., Gulhane Military Medical Academy, Turkey Bottomley, Andrew, Ph.D., European Organization for Research and Treatment of Cancer Data Center (EORTC), Belgium Bouros, Demosthenes, M.D., University Hospital of Alexandroupolis. Greece Cabanillas, Fernando, M.D, The University of Texas M. D. Anderson Cancer Center, USA Castiglione, Monica, MHA, SIAK/IBCSG Coordinating Center, Switzerland Chou, Kuo-Chen, Ph.D., D.Sc., Pharmacia Upjohn, USA Chu, Kent-Man, M.D., University of Hong Kong Medical Center, Queen Mary Hospital, Hong Kong, China Chung, Leland W.K, Ph.D., Winship Cancer Institute,

USA Coukos, George, M.D., Ph.D., Hospital of the University of Pennsylvania, USA Darzynkiewicz, Zbigniew, M.D., Ph.D., New York Medical College, USA Devarajan, Prasad M.D., Cincinnati Children's Hospital, USA Der Channing, J. Ph.D, Lineberger Comprehensive Cancer Center, USA Dritschilo, Anatoly, M.D., Georgetown University Hospital, USA Duesberg, Peter H., Ph.D, University of California at Berkeley, USA El-Deiry, Wafik S. M.D., Ph.D., Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, USA Federico, Massimo, M.D. Università di Modena e Reggio Emilia, Italy Fiebig, Heiner H, Albert-Ludwigs-Universität, Germany Fine, Howard A., M.D., National Cancer Institute, USA Frustaci, Sergio, M.D., Centro di Riferimento Oncologico di Aviano, Italy Georgoulias, Vassilis, M.D., Ph.D., University General Hospital of Heraklion, Greece Giordano, Antonio, M.D., Ph.D., Sbarro Institute for Cancer Research and Molecular Medicine, Temple University, USA Greene, Frederick Leslie, M.D., Carolinas Medical

Center, USA Gridelli, Cesare M.D., Azienda Ospedaliera, "S.G.Moscati", Italy Hengge, Ulrich, M.D., Heinrich-Heine-University Duesseldorf, Germany Huber, Christian M.D., Johannes-GutenbergUniversity, Germany Hunt, Kelly, M.D., The University of Texas M. D. Anderson Cancer Center, USA Kamen, Barton A., M.D. Ph.D, Cancer Institute of New Jersey, USA Kaptan, Kürsat, M.D., Gülhane Military Medicine Academy, Turkey Kazuma, Ohyashiki, M.D., Ph.D., Tokyo Medical University, Japan Kinsella, Timothy J. M.D., The research Institute of University Hospitals in Cleveland, USA Kmiec, Eric B, Ph.D., University of Delaware, USA Kosmidis Paris, M.D., "Hygeia" Hospital, Athens, Greece Koukourakis Michael, M.D., Democritus University of Thrace, Greece Kroemer, Guido, M.D. Ph.D., Institut Gustave Roussy, France Kurzrock, Razelle, M.D., F.A.C.P., M. D. Anderson Cancer Center, USA Leung, Thomas Wai-Tong M.D., Chinese University of Hong Kong, China Levin, Mark M.D., Sister Regina Lynch Regional Cancer Center, Holy Name Hospital, USA Lichtor, Terry M.D., Ph.D., Rush Medical College, USA Liebermann, Dan A., Ph.D., Temple Univ. School of Medicine, USA Lipps, Hans J, Ph.D., Universität Witten/Herdecke, Germany Lokeshwar, Balakrishna L., Ph.D., University of Miami School of Medicine, USA Mackiewicz, Andrzej, M.D., Ph.D., University School of Medical Sciences (USOMS) at Great Poland Cancer Center, Poland Marin, Jose J. G., Ph.D., University of Salamanca, Spain McMasters, Kelly M., M.D., Ph.D., University of Louisville, J. Graham Brown Cancer Center, USA Morishita, Ryuichi, M.D., Ph.D., Osaka University, Japan Mukhtar, Hasan Ph.D., University of Wisconsin, USA Norris, James Scott, Ph.D., Medical University of South Carolina, USA Palu, Giorgio, M.D., University of Padova, Medical School, Italy

Park, Jae-Gahb, M.D., Ph.D., Seoul National University College of Medicine, Korea Perez-Soler, Roman M.D., The Albert Einstein Cancer Center, USA Peters, Godefridus J., Ph.D., VU University Medical Center (VUMC), The Netherlands Poon, Ronnie Tung-Ping, M.D., Queen Mary Hospital, Hong Kong, China Possinger, Kurt-Werner, M.D., Humboldt University, Germany Rainov G Nikolai M.D., D.Sc., The University of Liverpool. UK Randall, E Harris, M.D., Ph.D., The Ohio State University, USA Ravaioli Alberto, M.D. Ospedale Infermi, Italy Remick, Scot, C. M.D., University Hospitals of Cleveland, USA Rhim, Johng S M.D., Uniformed Services University of Health Sciences, USA Schadendorf, Dirk, M.D., Universitäts-Hautklinik Mannheim, Germany Schmitt, Manfred, Ph.D., Universität München, Klinikum rechts der Isar, Germany Schuller, Hildegard M., D.V.M., Ph.D., University of Tennessee, USA Slaga, Thomas J., Ph.D., AMC Cancer Research Center (UICC International Directory of Cancer Institutes and Organisations), USA Soloway, Mark S., M.D., University of Miami School of Medicine, USA Srivastava, Sudhir, Ph.D., MPH, MS, Division of Cancer Prevention, National Cancer Institute, USA Stefanadis, Christodoulos, M.D., University of Athens, Medical School, Greece, Stein, Gary S Ph.D., University Of Massachusetts, USA Tirelli, Umberto, National Cancer Institute, Italy Todo, Tomoki, M.D., Ph.D., The University of Tokyo, Japan van der Burg, Sjoerd H, Leiden University Medical Center, The Netherlands Wadhwa Renu, Ph. D., Nat. Inst. of Advan. Indust. Sci. and Technol. (AIST), Japan Waldman, Scott A. M.D., Ph.D., USA Walker, Todd Ph.D., Charles Sturt University, Australia Watson, Dennis K. Ph.D., Medical University of South Carolina, Hollings Cancer Center, USA Waxman, David J., Ph.D., Boston University, USA Weinstein, Bernard I., M.D., D.Sci (Hon.), Columbia University, USA

!!!!!!!!!!!!!!!!!!!!!!!! !

Associate Board Members

Chen, Zhong, M.D, Ph.D, National Institute of Deafness and other Communication Disorders, National Institutes of Health, USA Dietrich Pierre Yves, Hopitaux Universitaires de GenFve Switzerland Jeschke Marc G, M.D., Ph.D. Universität Erlangen-Nürnberg. Germany Limacher Jean-Marc, MD Hôpitaux Universitaires de Strasbourg, France Los Marek J, M.D., Ph.D. University of Manitoba, USA Mazda Osam, M.D., Ph.D. Kyoto Prefectural University of Medicine, Japan Merlin Jean-Louis, Ph.D Centre Alexis Vautrin, National Cancer Institute University Henri Poincaré France Okada Takashi, M.D., Ph.D. Jichi Medical School Japan Pisa Pavel, M.D, Ph.D. Karolinska Hospital, Sweden

Squiban Patrick, MD Transgene SA France Tsuchida Masanori, M.D, Ph.D Niigata University Graduate School of Medical and Dental Sciences Japan Ulutin, Cuneyt, M.D., Gulhane Military Medicine Academy, Turkey Xu Ruian, Ph.D., The University of Hong Kong, Hong Kong

!!!!!!!!!!!!!!!!!!!!!!!! !

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Instructions to authors: Cancer Therapy FREE ACCESS www.cancer-therapy.org

Scope This journal, bridging various fields is one of the most rapid with free access at www.cancer-therapy.org.

The scope of Cancer Therapy is to rapidly publish original and in-depth review articles on cancer embracing all fields from molecular mechanisms to results on clinical trials. Articles (both invited and submitted) review or report novel findings of importance to a general audience in cancer therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms and clinical applications. The journal will accept papers on all aspects of cancer, at the clinical, preclinical or cell culture stage on chemotherapy and new experimental drugs, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and drug discovery related to cancer therapy. The authors are encouraged to elaborate on the molecular mechanisms that govern a cancer therapy approach. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is 12-60 manuscript pages (approximately 420 printed pages) plus Figures and Tables.

Free of Charge publication, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication.

Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and Email), Summary, and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) and subdivided into A, B, C, etc. You can further subdivide into 1, 2, 3, etc.

Research articles are divided into Summary; I. Introduction; II. Results; III Discussion; Acknowledgments IV. Materials and Methods and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as:

Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321.

Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures (optional).

Corresponding authors are kindly requested to provide a color (or black/white) head photo of themselves (preferably 4x5 cm or any size), as we shall include these in the publication.

Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are being sent page proofs.

Cancer Therapy (Volume 1, 2003) is published on high quality paper with excellent reproduction of color figures and electronically.

Reviewing is completed within 5-15 days from receiving the manuscript.

Articles accepted without revisions (i.e., review articles) will be published online (www.cancertherapy.org) in approximately 1 month following submission.

Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office.

Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "Cancer Therapy" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Table of contents Cancer Therapy Vol 2A, July 2004

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-12

Review Article

Physical activity in cancer survivors: implications for recurrence and mortality

Kerry S. Courneya, Lee W. Jones, Adrian S. Fairey, Kristin L. Campbell, Aliya B. Ladha, Christine M. Friedenreich, and John R. Mackey

13-20

Review Article

Ceramide in malignant tumors

Bettina Gunawardena, Volker Teichgräber, Gabriele Hessler, Erich Gulbins

21-26

Review Article

Cancer vaccine for brain tumors and brain tumor antigens

Masahiro Toda

27-28

Case report

Burkitt’s lymphoma presenting with vestibulo-cochlear nerve involvement

Ismail Zaidan and Anas Mugharbil

29-38

Review Article

Matrix metalloproteinases in multiple myeloma

Els Van Valckenborgh, Kewal Asosingh, Ivan Van Riet, Ben Van Camp and Karin Vanderkerken

39-46

Research Article

Anti-metastatic activity of an apple polyphenol crude fraction against human Ha ras-transformed metastatic mouse tumor (r/m HM-SFME-1) cells

Kazuo Ryoyama, Yoshitaka Shimotai, Taichi Higurashi, Tomomi Kokufuta, Yumi Kidachi, Hideaki Yamaguchi, and Ichiro Hatayama

47-53

Research Article

Expression of XRCC 1 and ERCC 1 proteins in radioresistant and radiosensitive laryngeal cancer

Paul Nix, John Greenman, Nicholas Stafford, Lynn Cawkwell

55-60

Research Article

Substrate dependent genomic heterogeneity in cancers of the lung

Shamim A. Faruqi, Leslie Krueger

61-68

Research Article

The application of MRI complexity analysis for pre-treatment prediction of brain tumor response to radiation therapy and radiosurgery- feasibility

Yael Mardor, Yiftach Roth, Dianne Daniels, Aharon Ochershvilli, Raphael Pfeffer, Arie Orenstein, Ouzi Nissim, Jacob Baram, Doron Dinstein, Goren Gordon, Thomas Tichler, and Roberto

demonstration

Spiegelmann

69-78

Review Article

Lung cancer chemotherapy practices in French specialized institutions: results of a national survey

Alain Vergnenègre, Laurent Molinier, Christophe Combescure, Jean Pierre Daurès, Bruno Housset, Christos Chouaïd

79-84

Review Article

New prospects for the control of peritoneal surface dissemination of gastric cancer using perioperative intraperitoneal chemotherapy

Kaiumarz S. Sethna, Paul H. Sugarbaker

85-98

Review Article

Tumor induction by simian and human polyomaviruses

Ilker Kudret Sariyer, Ilhan Akan, Luis Del Valle, Kamel Khalili and Mahmut Safak

99-106

Research Article

Comparison between hypopharyngeal and laryngeal cancers: I-role of tobacco smoking and alcohol drinking

Eduardo De Stefani, Paul Brennan, Paolo Boffetta, Alvaro L. Ronco, Hugo Deneo-Pellegrini, Pelayo Correa, Fernando Oreggia and Mar£a Mendilaharsu

107-114

Research Article

Comparison between hypopharyngeal and laryngeal cancers: II-the role of foods and nutrients

Eduardo De Stefani, Paolo Boffetta, Alvaro L. Ronco, Hugo DeneoPellegrini, Pelayo Correa, Fernando Oreggia and Mar£a Mendilaharsu

115-120

Research Article

Telomerase activity in circulating colorectal tumour cells

Ruth L. Loveday, Liviu Titu, Daniel Beral, Victoria L. Jordison, John R. T. Monson, John Greenman

121-129

Review Article

Antiangiogenesis in prostate cancer

Michael C. Cox, Yinong Liu, William D. Figg

131-148

Review Article

TNF and cancer: good or bad?

Ashita Waterston and Mark Bower

149-151

Case Report

Vincristine induced severe SIADH: potentiation with itraconazole

Cecile Taflin, Hassane Izzedine, Vincent Launay-Vacher, Olivier Rixe, David Khayat, Gilbert Deray

153-166

Research Article

COX-2 independent induction of apoptosis by etodolac in leukemia cells in vitro and growth inhibition of leukemia cells in vivo

Satoki Nakamura, Miki Kobayashi, Kiyoshi Shibata Naohi Sahara, Kazuyuki Shigeno, Kaori Shinjo, Kensuke Naito, Kazunori Ohnishi

167-172

Research Article

Variation between independently cultured strains of the MDA-MB-231

Mark B. Watson, John Greenman, Phil J. Drew, Michael J. Lind, Lynn Cawkwell

breast cancer cell line identified by multicolour fluorescence in situ hybridisation 173-176

Research Article

Prostate cancer patients with Maspinnegative tumors can live over a decadeยง

Aminah Jatoi, Neil Ellison, Patrick A. Burch, James Quesenberry, Kristen Shogren, Jeff A. Sloan, Phuong L. Nguyen, Charles Y.F. Young

177-186

Review Article

Extracorporeal photoimmune therapy: A therapeutic alternative treatment of cutaneous T-cell lymphoma and immunological diseases

Massimo Martino, Giuseppe Console, Giulia Pucci, Giuseppe Irrera, Giuseppe Messina, Giuseppe Bresolin, Fortunato Morabito, Pasquale Iacopino

187-194

Research Article

Methylation analysis of cell cycle M. Josefa Bello, Pilar Gonzalez-Gomez, control genes RB1, p14ARF and p16INK4a M. Eva Alonso, Nilson P. Anselmo, Dolores Arjona, Cinthia Amiโ ขoso, Isabel in human gliomas Lopez-Marin, Jose M. de Campos, Alberto Isla, Jesus Vaquero, Cacilda Casartelli and Juan A. Rey

195-200

Review Article

Epithelial-mesenchymal transition and Kazushi Imai, Toshiyuki Okuse, Tadashige Chiba, Masako Morikawa, progression of oral carcinomas Kazuo Sanada

201-216

Review Article

Hyaluronan: a suitable carrier for an Danila Coradini and Alberto Perbellini histone deacetylase inhibitor in the treatment of human solid tumors

217-226

Research Article

Oxaliplatin in the management of advanced colorectal cancer: Different associations and schedules

227-238

Review Article

AKT: A novel target in pancreatic Melinda M. Mortenson, Joseph M. Galante, Michael G. Schlieman, Richard cancer therapy

Francesco Recchia, Alisia Cesta, Gaetano Saggio, Giampiero Candeloro, Silvio Rea,

J. Bold

Cancer Therapy Vol 2, page 1 Cancer Therapy Vol 2, 1-12, 2004.

Physical activity in cancer survivors: implications for recurrence and mortality Review Article

Kerry S. Courneya, Lee W. Jones, Adrian S. Fairey, Kristin L. Campbell, Aliya B. Ladha, Christine M. Friedenreich, and John R. Mackey University of Alberta, E-424 Van Vliet Center, Edmonton, Alberta, T6G 2H9, Canada.

__________________________________________________________________________________ *Correspondence: Kerry S. Courneya, Ph.D., Faculty of Physical Education, University of Alberta, E-424 Van Vliet Center, Edmonton, Alberta, T6G 2H9, Canada. Tel: (780) 492-1031, Fax: (780) 492-8003, e-mail: kerry.courneya@ualberta.ca Key Words: Cancer survivors, Mortality, Treatment efficacy, Immune function, Quality of life, Peptide hormones, Sex steroid hormones, Cardiovascular risk factors, Prostaglandins Abbreviations: Women’s Healthy Eating and Living, (WHEL); randomized controlled trial, (RCT); The Health, Eating, Activity, and Lifestyle, (HEAL); left ventricular ejection fraction, (LVEF); tumor necrosis factor, (TNF); Received: 19 January 2004; Accepted: 28 January 2004; electronically published: January 2004

Summary Advances in cancer detection and treatments have resulted in improved survival rates for cancer survivors. These advances have created an opportunity to examine the potential role of lifestyle factors in further reducing the risk of recurrence and extending overall survival. The purpose of the present paper is to review the literature on physical exercise and clinical endpoints in cancer survivors. Our review found that there is very limited research on this topic. Evidence from other populations on cancer incidence, cancer-specific mortality, and all-cause mortality, however, suggests that exercise could potentially affect these endpoints in cancer survivors. Moreover, evidence on the effects of exercise on the purported biological mechanisms for the clinical endpoints also suggests that a relationship is plausible. Despite the limited evidence for a role of exercise in cancer survival, however, we still recommend exercise to cancer survivors based on preliminary evidence for a quality of life benefit. We conclude by suggesting some future research directions that will begin to answer the question of whether or not exercise can affect clinical endpoints in cancer survivors.

A. Definitions of physical activity, exercise, physical fitness, and cancer survivor

I. Introduction The prospects for surviving cancer have improved dramatically over the past several decades due to earlier detection and improved medical treatments. The most recent estimate of the five year relative survival rate across all cancers and all disease stages is 62% (2003). This figure soars to over 90% for some of the most common cancers if they are detected early (e.g., prostate, breast, and colon). The high incidence rates and improved survival rates have resulted in over nine million cancer survivors in the United States. These improved survival rates have generated interest in behavioral strategies that might further reduce the risk of recurrence and early mortality in this population. Physical activity is one lifestyle factor that has been postulated to affect cancer survival. The purpose of the present paper is to review the literature on the possible association between physical activity and clinical endpoints in cancer survivors.

Physical activity is defined as any bodily movement produced by the skeletal muscles that results in a substantial increase in energy expenditure over resting levels (Bouchard and Shephard, 1994). Although the term “substantial” is open to interpretation, it is often operationalized as an intensity of at least moderate (e.g., !

50% of maximal exercise capacity). Leisure-time physical activity is defined as physical activity undertaken during discretionary time, with the key element being personal choice (Bouchard and Shephard, 1994). This form of physical activity is often contrasted with occupational and household physical activity. Exercise is defined as a form of leisure-time physical activity that is usually performed on a repeated basis over an extended period of time (exercise training) with the intention of improving fitness, performance, or health (Bouchard and Shephard, 1994).

An exercise training prescription usually includes activity mode (e.g., walking, swimming), volume (i.e., frequency, 1

Courneya et al: Physical activity in cancer survivors intensity, and duration), progression, and context (i.e., physical and social environment). Physical fitness is defined as the ability to perform muscular work satisfactorily and commonly includes the components of body composition, cardiorespiratory fitness, muscular fitness, flexibility, and agility/balance. The National Coalition for Cancer Survivorship defines a cancer survivor as any individual diagnosed with cancer, from the time of discovery and for the balance of life.

a possible explanation for the association between physical activity and cancer-specific mortality that has been reported in healthy cohorts. We view treatment effectiveness as a possible mechanism by which physical activity may influence clinical endpoints in cancer survivors. We discuss this issue in more detail later in the paper. The three primary clinical endpoints in cancer survivors, therefore, are recurrence (or disease free survival), cancer-specific mortality (or disease progression), and all-cause mortality (or overall survival).

All-cause mortality is particularly important because of the growing number of cancer survivors who are dying from causes other than their primary cancer (Louwman et al, 2001).

We begin by reviewing the evidence for a link between physical activity and these three clinical endpoints in cancer survivors. Given the paucity of research in cancer survivors, however, we draw heavily from studies in other populations. We then review research on physical activity and treatment effectiveness and the purported mechanisms for the clinical endpoints such as energy balance, cardiovascular fitness, sex hormones, and peptide hormones. We recognize that some of these mechanisms may be cancer-site specific whereas others may apply to cancer more generally. Lastly, we conclude with a discussion of practical implications and future directions for the emerging field of physical activity in cancer survivors.

B. A framework for examining physical activity and clinical cancer endpoints We have previously proposed a framework on physical activity and cancer control that predominantly focused on quality of life issues with some attention to clinical endpoints (Courneya and Friedenreich, 2001). In the present paper, we modify this framework to focus explicitly on clinical cancer endpoints (Figure 1). The framework depicts the major cancer-related time periods and the key clinical cancer endpoints that physical activity may influence during each time period.

The first clinical endpoint is cancer incidence. This endpoint cannot be changed for cancer survivors but we review it later because it may provide indirect evidence for the potential role of physical activity in cancer recurrence.

Physical activity may also influence the stage of disease at diagnosis. Again, however, this clinical endpoint cannot be changed in cancer survivors. Moreover, we do not review this endpoint because there are no studies on this topic. We do mention disease stage, however, because it is

Figure 1. Organizational Framework of Physical Activity and Clinical Endpoints in Cancer Survivors. Adpated with permission of Lawrence Erlbaum Associates from Courneya, K.S. & Friedenreich, C.M. (2001). Framework PEACE: An organizational model for examining physical exercise across the cancer experience. Annals of Behavioral Medicine, 23, 263-272.

2

Cancer Therapy Vol 2, page 3

II. Physical recurrence

activity

and

were exercising prediagnosis) suggests it may not be effective against a possible recurrence.

cancer

No studies have examined the association between physical activity and cancer recurrence in cancer survivors. We are currently following two cancer survivor cohorts for this outcome. One sample consists of over 1,200 breast cancer survivors who participated in one of our case-control studies between 1995 and 1998 (Friedenreich et al, 2001; Friedenreich et al, 2001; Friedenreich et al, 2001; Friedenreich et al, 2002). The second sample consists of almost 1,000 prostate cancer survivors who participated in another of our case-control studies between 1997 and 2000 (Friedenreich et al, in press; Friedenreich et al, in press). Two additional studies that we are aware of are also following cancer survivor cohorts for physical activity and clinical cancer endpoints.

The Women’s Healthy Eating and Living (WHEL) study is a multisite randomized controlled trial (RCT) examining the effects of a high-vegetable and low-fat diet on cancer recurrence and survival in over 3,000 early-stage invasive breast cancer survivors (Pierce et al, 2002). The Health, Eating, Activity, and Lifestyle (HEAL) study is a prospective cohort study examining the associations between body weight, physical activity, diet, hormone receptor status and prognosis in over 1,000 women with breast cancer (Irwin et al, 2003).

Given the absence of research on physical activity and cancer recurrence, we turn our attention to the cancer incidence literature. Approximately 150 studies have examined the association between physical activity and cancer incidence (Thune and Furberg, 2001; Lee, 2003).

The general conclusion from these comprehensive reviews is that there is “convincing” evidence that physical activity reduces the primary risk of breast and colon cancers. The evidence for a link between physical activity and prostate cancer risk is characterized as “probable”. The evidence for lung and endometrial cancers is rated as “possible” based on early promising findings. All other cancers are rated as “insufficient” because of the limited number of studies at this time.

It is unclear, however, if research on physical activity and cancer incidence can be extrapolated to cancer recurrence. There are several extenuating circumstances that make us cautious about generalizing the research.

First, the biological mechanisms for cancer recurrence may be different than the biological mechanisms for cancer incidence. Second, physical activity may affect the biologic mechanisms differently after a cancer diagnosis because of the effects of the cancer and/or its treatments.

Third, the biological mechanisms may no longer be altered by an exercise intervention because of effective standard medical interventions (e.g., antiestrogens). Fourth, exercise may interact with adjuvant therapies in a manner that either potentiates or negates the efficacy of such therapies. Fifth, the older age of most cancer survivors may mitigate against the effects of exercise on the biologic mechanisms because these effects may take years to materialize. Finally, the fact that physical activity did not prevent the primary incidence of cancer in these individuals in the first place (at least for the people who

III. Physical activity and cancerspecific mortality One study has examined the association between physical activity and cancer-specific mortality in a cancer survivor cohort (Rohan et al, 1995). The study assessed physical activity in 412 breast cancer survivors who had participated in a case-control study. The women were subsequently followed for 5.5 years and 112 breast cancer deaths were documented. The results showed that there was no association between prediagnosis physical activity and breast cancer-specific mortality. There were several important limitations in this study, however, including the assessment of only prediagnosis recreational physical activity over the past year. Logically, it would seem that postdiagnosis physical activity would be most relevant to cancer survival. The breast and prostate studies noted earlier that are examining physical activity and cancer recurrence will also be able to provide data on cancerspecific mortality.

Given the limited data on physical activity and cancer-specific mortality in cancer survivor cohorts, we once again turn our attention to research in other cohorts.

To date, 18 studies have examined the association between physical activity and cancer-specific mortality in other cohorts (Polednak, 1976; Garfinkel et al, 1988; Leon and Connett, 1991; Chang-Claude and Frentzel-Beyme, 1993; Wannamethee et al, 1993; Fujita et al, 1995; Kampert et al, 1996; Kushi et al, 1997; Rosengren and Wilhelmsen, 1997; Hakim et al, 1998; Davey Smith et al, 2000; KristalBoneh et al, 2000; Batty et al, 2001; Kilander et al, 2001; Rockhill et al, 2001; Farahmand et al, 2003; Gregg et al, 2003; Yu et al, 2003). Of these 18 studies, a statistically significant decreased risk among those most physically active was found in eight studies (Wannamethee et al, 1993; Kampert et al, 1996; Rosengren and Wilhelmsen, 1997; Hakim et al, 1998; Davey Smith et al, 2000; Kilander et al, 2001; Farahmand et al, 2003; Gregg et al, 2003) and a non-significant inverse association was observed in an additional two studies ((Kushi et al, 1997; Rockhill et al, 2001). No association between physical activity and cancer death was found in six studies (Garfinkel and Stellman, 1988; Leon and Connett, 1991; Chang-Claude and Frentzel-Beyme, 1993; Fujita et al, 1995; Batty et al, 2001; Yu et al, 2003) and an increased risk of cancer mortality was found in two studies ((Polednak, 1976; Kristal-Boneh et al, 2000). It is important to note, however, that these last two studies have methodologic limitations that differ markedly from the remaining studies.

The associations between physical activity and cancer mortality are most evident in the studies that examined recreational, rather than occupational activity.

No studies to date have examined all types of activity (including occupational, household and recreational activity). Hence, the majority of studies conducted thus far have found either no association or a decreased risk of cancer mortality among the cohort members who were the

3

Courneya et al: Physical activity in cancer survivors most physically active, particularly when the activity examined was recreational.

Generalizing from studies of physical activity and cancer-specific mortality in other cohorts to cancer survivor cohorts is even more problematic than generalizing from studies on cancer incidence to cancer recurrence. In addition to the problems mentioned for the cancer incidence findings, the cancer-specific mortality studies are also confounded by the fact that physical activity is known to reduce the risk of cancer incidence and may also be associated with an earlier stage at diagnosis. Consequently, the lower cancer-specific mortality in highly active individuals from these cohorts may be attributed entirely to a lower incidence of the disease or earlier stage at diagnosis, rather than to a longer survival after the diagnosis.

A. Treatment effectiveness Exercise could affect cancer recurrence and mortality through modulation of treatment effectiveness. The key factors may include: (a) treatment decisions; both by the physician and the patient, (b) treatment completion; in terms of discontinuation, dose reductions, or treatment delays (i.e., dose density), and (c) treatment efficacy; based on exercise-treatment interactions.

1. Treatment decisions Treatment decisions are influenced by the general health and performance status of the survivor. Poor functional status may increase the risk of morbidity and mortality from treatments and may also reduce the chances of successful rehabilitation after treatments. For example, the mortality rate from lung resection surgery is reported to range from 7-11% (Datta and Lahiri, 2003). Maximal oxygen consumption (VO2max) can generally stratify the risk for perioperative complications. Patients with preoperative VO 2max > 20 mL/kg/min are not at increased risk of complications or death. VO2max < 15 mL/kg/min indicates an increased risk of perioperative complications and patients with VO2max < 10 mL/kg/min have a very high risk for postoperative complications (Beckles et al, 2003). As a second example, decreased left ventricular ejection fraction (LVEF) is a relative contraindication for the use of potentially cardiotoxic chemotherapy (Peng et al, 1997). A resting LVEF of 50% is usually used as the lower limit of normal values, and may change chemotherapy protocol (Peng et al, 1997).

No studies to date have examined the effects of exercise training on VO2max and LVEF in cancer survivors pretreatment. However, in a RCT in patients with stable chronic heart failure, a supervised exercise training program elicited an increase in ejection fraction in the training group by 16% and an increase in peak oxygen uptake of 2.1 mL/kg/min (Giannuzzi et al, 2003). These results may be of clinical importance for cancer survivors awaiting treatment decisions regarding potentially cardiotoxic chemotherapies or surgical resections. If clinical indices such as LVEF or VO2max are slightly below or near normal cut-off range, an exercise training intervention may be implemented to improve function and allow for potentially lifesaving medical treatments to go forward.

IV. Physical activity and all-cause mortality One study has examined the association between physical activity and all-cause mortality in a cancer survivor cohort, however, it was not the primary purpose of the study (Cunningham et al, 1998). The RCT by Cunningham et al. (1998) was originally designed to examine the effects of a psychosocial intervention on survival in a sample of 66 metastatic breast cancer survivors. In an unplanned ancillary analysis the authors found that self-reported regular exercise was the only nonmedical variable to independently predict survival in this sample. Again, the breast and prostate studies noted earlier will be able to examine the association between physical activity and all-cause mortality.

Numerous studies have examined the association between physical activity and all-cause mortality in cohorts without cancer. Lee & Skerret (2001) reviewed 44 observational studies that examined the dose-response association between physical activity and all-cause mortality. They concluded that there is a clear inverse linear dose-response relationship between physical activity and all-cause mortality in both men and women. More specifically, adherence to current public health guidelines was associated with a 20-30% reduction in all-cause mortality (Lee and Skerrett, 2001). Again, the generalizability of these findings to cancer survivor cohorts may be questioned on the grounds noted earlier.

V. Physical activity and potential biological mechanisms of clinical cancer endpoints

2. Treatment completion Substantial proportions of survivors have reductions or delays in the dosage of chemotherapeutic drugs.

Perhaps as many as 30% of survivors have a reduction of the planned dosage to less than 85% (Frasci, 2002). Such reductions are believed to effect clinical endpoints (Wood et al, 1994). There are many factors that influence a cancer survivorâ&#x20AC;&#x2122;s ability and/or willingness to complete treatments including the severity of the physical side effects, fatigue, and depression (DiMatteo et al, 2000; Hershman et al, 2003). To the extent that exercise is related to these factors, completion rates may be affected.

Physical activity may influence cancer recurrence, cancer-specific mortality, and all-cause mortality in cancer survivors through several plausible biological mechanisms. We acknowledge that these mechanisms may overlap and/or be interrelated in a complex causal pathway. Our purpose here, however, is not to discuss how these mechanisms may be interrelated but rather to simply outline the biological pausibility of how exercise may influence clinical cancer endpoints.

4

Cancer Therapy Vol 2, page 5 To date, however, there are no studies examining the association between exercise and treatment completion rates.

acknowledged that a multimodal intervention combining physical exercise to stimulate protein synthesis with nutritional strategies that provide the necessary amino acids may be an effective therapy (Ardies, 2002; MacDonald et al, 2003). To date, no studies have examined the efficacy of exercise training in the treatment of cachexia in cancer survivors. In animal studies, exercised rats bearing transplanted tumors experienced a delayed development of cachexia (Deuster et al, 1985; Baracos, 1989). Exercise training in other clinical populations (e.g., persons diagnosed with sarcopenia, chronic renal insufficiency, rheumatoid arthritis, osteoarthritis, and HIV/AIDS) has also been shown to mitigate muscle wasting (Zinna and Yarasheski, 2003).

3. Treatment efficacy Anticancer therapies have multiple mechanisms of action including the generation of free radicals, intercalation between DNA base pairs, and inhibition of topoisomerases. The ultimate effect of these therapies is to induce cellular death via apoptosis. Exercise may potentially activate and/or inhibit a multitude of biologic mechanisms that are important modulators of certain antineoplastic therapies such as the generation of reactive oxygen species and changes in peripheral blood flow. To date, however, there is no research on exercise-cancer treatment interactions. Nevertheless, interactions between exercise and cancer therapies are biologically plausible.

Research in pharmacokinetics has shown that exercise can influence drug distribution, absorption, metabolism, and clearance (Persky et al, 2003).

C. Physical fitness Over the past two decades exercise capacity has become a well established predictor of cardiovascular and overall mortality in healthy and clinical populations. For example, Blair and colleagues (Blair et al, 1989) found age-adjusted all-cause mortality rates declined significantly across increasing physical fitness quintiles in both men and women after statistical adjustment for additional known risk factors of survival (e.g., age, smoking status, cholesterol level, systolic blood pressure, fasting blood glucose level, etc.). Further investigations have confirmed these observations (Blair et al, 1995; Lee et al, 1999). More recently, Myers et al, (2002) examined mortality rates in over 6,000 men referred for treadmill exercise testing. After adjustment for age, exercise capacity was the strongest predictor of risk of death among both normal subjects and those with cardiovascular disease. Moreover, in several subanalyses it was shown that this association held for persons with diabetes, high blood pressure, high cholesterol, chronic obstructive pulmonary disease, and for persons who were smokers and obese. No subanalysis was performed for cancer survivors.

Lastly, Gulati and associates replicated Myersâ&#x20AC;&#x2122;s findings in over 5,000 asymptomatic women and found that exercise capacity is an independent predictor of death (Gulati et al, 2003).

Two studies have found a significant inverse association between physical fitness and cancer-specific mortality (Lee and Blair, 2002; Sawada et al, 2003). These two studies measured cardiorespiratory fitness in cohorts of Japanese men (Sawada et al, 2003) and men participating in the Aerobics Center Longitudinal Study (Lee and Blair, 2002). Follow-up for cancer deaths was on average 10 years in the United States cohort and 16 years in the Japanese cohort. In the Japanese cohort, men whose physical fitness was in the highest quartile as compared to those in the lowest quartile experienced a nearly 60% reduction in risk of cancer death. The risk reductions were not as strong in the American cohort, nonetheless, men who had moderate versus low fitness had a risk decrease of 38%. Hence, from these two studies, there is some evidence that having high physical fitness decreases the risk of cancer-specific mortality in males.

Exercise has been shown to improve physical fitness in cancer survivors. An early RCT of breast cancer

B. Energy balance Epidemiological data suggest that overweight and obesity at diagnosis, and weight gain after diagnosis, are independent predictors of clinical endpoints in cancer survivors (Chlebowski et al, 2002). A recent review found statistically significant associations between overweight or obesity at diagnosis (body weight, BMI) and increased risk of recurrence or decreased survival in early stage breast cancer survivors in 26 of 34 studies (Chlebowski et al, 2002). Statistically significant associations between body weight gain after diagnosis and increased risk of recurrence or decreased survival were reported in 3 of 4 studies (Chlebowski et al, 2002).

Few studies have examined the effect of exercise on overweight, obesity, and body weight gain in cancer survivors (Courneya, 2003). There is, however, preliminary evidence of the efficacy of exercise as a method of body weight reduction in breast cancer survivors. Segal et al, (2001) randomized 121 early stage breast cancer survivors to supervised exercise, selfdirected exercise, or control. Secondary stratified analysis showed that body weight was reduced by 3.8 kg in a subset of women who did not receive chemotherapy in the supervised exercise group. Other data suggest that exercise may reduce body weight (Schwartz, 1999), prevent body weight gain (Schwartz, 2000), and improve body composition (Winningham et al, 1989; Courneya et al, 2003) in breast cancer survivors.

Cachexia is one of the most frequent side effects of malignancy, with up to 50% losing some weight and onethird losing more than 5% of their original body weight.

Moreover, cachexia accounts for approximately 20% of cancer deaths (Tisdale, 2002). Although anorexia-driven malnutrition seems to be at the core of the syndrome, the pathophysiology is complex and involves abnormalities in nutrient and energy metabolism resulting in the loss of skeletal and adipose tissue (Sutton et al, 2003). Overall, nutritional interventions have had limited efficacy in this setting (Vigano et al, 1994) and several researchers have

5

Courneya et al: Physical activity in cancer survivors survivors receiving chemotherapy (MacVicar et al, 1989) showed that a 10 week exercise training program improved VO2max by 40% compared to the control group.

A similar study of hospitalized bone marrow transplant survivors showed that exercise maintained fitness levels while the control group had a 27% decline in fitness (Dimeo et al, 1997). As a third example, Courneya et al.

(2003) showed that 15 weeks of exercise training in breast cancer survivors who had recently completed treatment resulted in a 17.7-% change in physical fitness in favor of the exercise group.

meaningful change of almost 9 points in quality of life favoring the exercise group. Segal et al. (Segal et al, 2003) examined a 12 week resistance training program in prostate cancer survivors receiving androgen deprivation therapy and also found statistically significant and clinically meaningful changes in quality of life favoring the exercise group.

F. Immune function Recent data suggest that immune function may be important in the clinical outcome of cancer survivors (Sephton et al, 2000; Demaria et al, 2001; Kay et al, 2001; Lowdell et al, 2002; Liljefors et al, 2003; Zhang et al, 2003). For example, Sephton et al. found that blood levels of CD3"CD56+ cells were positively associated with survival in metastatic breast cancer survivors (Sephton et al, 2000). Liljefors et al. (2003) found that pre-treatment natural killer cell cytotoxic activity was positively associated with progression-free and overall survival in colorectal carcinoma survivors. Kay et al. (2001) showed that blood levels of CD3+, CD4+, CD8+, and CD19+ cells were positively associated with overall survival in multiple myeloma patients. Lastly, Zhang et al. (2003) showed that the presence of CD3+ tumorâ&#x20AC;&#x201C;infiltrating T cells was positively associated with progression-free and overall survival in advanced ovarian carcinoma.

A recent systematic review found preliminary evidence that exercise can improve immune function in cancer survivors (Fairey et al, 2002). The improvements that have been shown include increased natural killer cell cytotoxic activity, monocyte function, and the proportion of circulating granulocytes (Fairey et al, 2002). However, several methodological limitations of this research were identified including nonrandomized experimental designs, heterogeneous samples, and inappropriate statistical analyses (Fairey et al, 2002).

D. Mechanical Bowel transit time is a primary explanation for the association of physical activity and primary colon cancer risk. A decreased bowel transit time would reduce carcinogen exposure time at the mucosa, lowering the risk of initiation or promotion of carcinogenesis by fecal carcinogens (McTiernan et al, 1998). Liu et al, (1993) examined the effect of two weeks of reduced activity on gastrointestinal transit time in healthy elderly subjects who had engaged in regular exercise for 10 years. The mean colonic transit time almost doubled from 10.9 + 2.7 hours to 19.5 + 2.9 hours during physical inactivity periods.

Similarly, Koffler et al, (1992) gave elderly men a 13week total body strength training program to examine its effect on gastrointestinal transit time. The training significantly accelerated whole bowel transit time relative to pretraining values from 41 + 11 hours to 20 + 7 hours.

E. Quality of life Quality of life at diagnosis appears to predict cancer survival although studies have focused primarily on cancer survivors with advanced disease (e.g., lung, breast). For example, Herndon et al, (1999) studied 206 cancer survivors with non-small cell lung cancer in a clinical trial.

Survival was predicted by baseline scores of a quality-oflife instrument for pain, appetite loss, fatigue, lung cancer symptoms, physical functioning and overall quality of life.

When clinical factors such as histology, weight loss, dyspnea, and other factors were taken into account, however, only one score from the quality of life instrument was still predictive, self-rated pain. In a cohort of 181 cancer survivors with advanced disease, self-rated health was observed to be the strongest predictor of survival from baseline (Shadbolt et al, 2002). The relative risk (RR) of dying was 3 times greater for fair ratings compared with consistent good or better ratings at 18 weeks (Shadbolt et al, 2002). Further, Wisloff and Hjorth, (1997) assessed the prognostic significance of quality of life scores and found a highly significant association with survival from the beginning of therapy for physical functioning as well as role and cognitive functioning, global quality of life, fatigue and pain.

Exercise has been shown to enhance quality of life in cancer survivors with early stage disease (Courneya, 2003). For example, Courneya et al. (Courneya et al, 2003) examined a 15 week exercise intervention in breast cancer survivors who had recently completed treatment.

They reported a statistically significant and clinically

G. Peptide hormones Insulin, insulin-like growth factors, and insulin-like growth factor binding proteins have been implicated in clinical endpoints in cancer survivors (Yu and Rohan, 2000). For example, Goodwin et al, (2002) showed that high fasting insulin levels were associated with distant recurrence and death in breast cancer survivors. Although the data are not consistent, several investigators have shown that high levels of IGF-I and/or low levels of IGFBP-3 have been associated with an increased risk of breast cancer and adverse prognostic factors (Yu and Rohan, 2000).

One study has examined the effects of exercise training on peptide hormones in cancer survivors. In an RCT, Fairey et al, (2003) found that exercise training had no significant physiologic effects on fasting insulin, glucose, insulin resistance, IGF-II, or IGFBP-1 in postmenopausal breast cancer survivors. These results are in contrast to previous observations in healthy older adults (Ross et al, 2000; Boule et al, 2001; Duncan et al, 2003).

The investigators did find, however, that exercise training had significant physiological effects on IGF-I, IGFBP-3, and IGF-I:IGFBP-3 molar ratio. Other trials of exercise training and IGF-I and IGFBP-3 in healthy older adults 6

Cancer Therapy Vol 2, page 7 have reported mixed results on these endpoints (Poehlman et al, 1994; Kohrt et al, 1995; Vitiello et al, 1997; Maddalozzo and Snow, 2000; Parkhouse et al, 2000; Hakkinen et al, 2001; Lange et al, 2001; Borst et al, 2002; Schmitz et al, 2002), making it difficult to draw definitive conclusions.

The effects of resistance training on male testosterone levels is reviewed by Kraemer (Kraemer, 1988). Overall, increased serum testosterone is seen with acute resistance training. However, it seems that a threshold exists, and that the resistance activity must be of sufficient intensity, volume, and muscle mass recruitment to cause a change. Chronic resistance training has not been shown to alter resting testosterone concentrations (Kraemer, 1988).

H. Sex steroid hormones The sex steroids-estrogen, progesterone, and androgens-regulate reproductive function, and have been linked to the development and progression of breast, ovarian, endometrial, and prostate cancer (Persson, 2000; Taplin and Ho, 2001; Modugno, 2003). For example, estrogen has been linked to primary breast etiology and recurrence (Clemons and Goss, 2001). A review of RCTs found that ovarian ablation to eliminate estrogen production results in a significant decrease in breast cancer recurrence and death (Group, 1996).

The contribution of estrogen to recurrence has led to attempts to block the activity of estrogen with pharmacologic agents such as tamoxifen. A meta-analysis confirmed that 5 years of adjuvant tamoxifen in women with node-positive disease improved 10 year survival by 11% (Group, 1998). In postmenopausal women, estrogen depletion with anastrozole (Baum et al, 2003) or letrozole (Goss et al, 2003) further reduces the risk of recurrence.

Similarly, androgen deprivation is the mainstay of prostate cancer treatment (Hellerstedt and Pienta, 2003) and induces remission in 80-90% of advanced cases.

To date, there is limited literature on the effect of exercise on sex steroid hormones in cancer survivors. The only study to report on this issue found that 12 weeks of resistance training in prostate cancer survivors on androgen deprivation therapy did not change resting testosterone levels (Segal et al, 2003), which is not surprising given the nature of the treatment.

Comprehensive reviews by DeCree (De Cree, 1998) and Consitt (Consitt et al, 2002) outline the effects of exercise on female sex steroid hormones in premenopausal women without cancer. Short-term increases in estrogen levels is seen with acute aerobic exercise, and appears to be dependent on intensity of the exercise and phase of the menstrual cycle (Consitt et al, 2002). Moreover, chronic aerobic exercise in normally cyclic premenopausal women lowers resting levels of estrogen, progesterone, and testosterone, and increases levels of SHBG (De Cree, 1998; Consitt et al, 2002).

A review by Hackney, (1996) outlines the effects of aerobic exercise training in men. Acute bouts of exercise cause an increase in testosterone levels, proportional to the intensity of the activity, while prolonged submaximal aerobic activity shows an initial increase in testosterone concentration, which then declines as the activity is continued. Reductions of 25% to 50% are typical if the activity lasts two hours or longer. The effects of chronic aerobic training have mainly been studied in runners, who show lower free and total testosterone concentrations at rest (15-30%) compared to aged matched, untrained men (Hackney, 1996). Prospective studies that have attempted to induce hormonal changes with an activity intervention have shown mixed results.

I. Cardiovascular risk factors Cardiovascular risk factors include traditional factors such as blood cholesterol and blood pressure and nontraditional or novel factors may include pro-inflammatory cytokines such as CRP and interleukin 1 and 6. There are no data, however, that have shown these risk factors to predict cardiovascular disease in cancer survivors. There are also no studies that have examined the effects of exercise on cardiovascular risk factors in cancer survivors.

A recent comprehensive review of 51 studies examining the effects of exercise training on blood lipid/cholesterol levels in other populations showed that exercise training increased HDL-C by 4.6% and reduced total cholesterol, LDL-C and TG by 1%, 5% and 3.7%, respectively in adult men and women (Leon and Sanchez, 2001). Moreover, in a meta-analysis of RCTs, Whelton and associates (2002) found that exercise reduced systolic and diastolic blood pressure by 3.8 mm Hg and 2.6 mm Hg, respectively.

These reductions were observed for all frequencies and intensities of aerobic exercise in both hypertensive and normotensive participants and overweight and normalweight individuals (Whelton et al, 2002). Lastly, observational studies from other populations have generally found that more frequent physical activity is independently associated with lower odds of having an elevated C-reactive protein (Abramson and Vaccarino, 2002).

Proinflammatory cytokines appear to have a significant role in cancer-associated wasting. Cachexia appears to be associated with elevated levels of interleukin-1-â&#x20AC;&#x161;, interleukin-6, tumor necrosis factor (TNF), C-reactive protein and interferon-# (Tisdale, 2002). Acute exercise is known to enhance production of cytokines, although repeated exercise is demonstrated to attenuate the cellular response to inflammatory stimuli and inflammatory cytokines (Ardies, 2002).

J. Prostaglandins Prostaglandins are unsaturated fatty acids synthesized from phospholipids and arachidonic acid by means of a cyclooxygenase enzyme (Zambraski et al, 1986). There are several types of prostaglandins which affect colonic function: PGE2, which increases the rate of colonic cell proliferation and decreases colonic motility and PGF, which is an antagonist of these actions (Colditz et al, 1997; McTiernan et al, 1998). Biopsy samples taken from patients with colon polyps and/or colon adenocarcinomas revealed synthesis of more PGE2 than controls (Pugh and Thomas, 1994). Physical activity may alter prostaglandin levels by producing high levels of Ca2+ and elevated levels of bradykinin during muscle 7

Courneya et al: Physical activity in cancer survivors contraction, thereby stimulating phospholipase A and leading to increases in arachidonic acid metabolites including PGE2 and PGI2. Exercise also causes high intracellular pressure and may facilitate the dialysis of PGE2 and PGI2 to skeletal muscle interstitial fluid (Karamouzis et al, 2001; Karamouzis et al, 2001).

Although experimental studies have found changes in prostaglandin levels in the blood with dynamic exercise, no study has been published on prostaglandin concentrations in the colonic mucosa following exercise (Quadrilatero and Hoffman-Goetz, 2003).

traditional prescription is to perform at least 20 minutes of continuous vigorous intensity exercise (i.e., !80% of maximal heart rate) on 3 days per week. The alternative prescription is to accumulate at least 30 minutes of moderate intensity exercise (i.e., 60%-80% of maximal heart rate) in durations of at least 10 minutes on most (i.e., at least 5), preferably all, days of the week. Exercise trials in cancer survivors have tended to follow the traditional prescription but both prescriptions should yield health benefits.

VII. Future research directions

VI. Clinical implications

Research on exercise and clinical endpoints in cancer survivors is in its infancy and much remains to be done.

To begin, we need good epidemiological research with valid measures of physical activity and complete control of potential confounders to examine the associations between physical activity and cancer recurrence, cancerspecific mortality, and all-cause mortality in various cancer survivor cohorts. We also need RCTs to examine the effects of exercise on the purported biologic mechanisms of recurrence and mortality in cancer survivors (e.g., immune function, sex steroid hormones, peptide hormones, energy balance). These first generation studies will provide the rationale and clarify the research priorities for large scale RCTs that will examine the effects of exercise on the clinical cancer endpoints. Lastly, we need studies to examine the potential interactions between exercise and cancer therapies.

Our review has shown that there is limited evidence for the efficacy of exercise in reducing the risk of recurrence or early mortality in cancer survivors.

Consequently, exercise should not be recommended to cancer survivors as a therapy to reduce their risk of recurrence or extend survival. Such recommendations will require compelling evidence from well-controlled observational studies and intervention trials. There is, however, good preliminary evidence that exercise may enhance QOL in cancer survivors, especially breast and prostate cancer survivors (Courneya, 2003). Based on this preliminary evidence, as well as our own clinical experience, we recommend exercise to otherwise healthy cancer survivors as does the American Cancer Society (Brown et al, 2003). There are several special precautions for cancer survivors, however, and the reader is referred to our previous published guidelines for these safety issues (Courneya et al, 2002; Courneya et al, 2002).

Exercise during adjuvant therapy is a major struggle for cancer survivors (e.g., Courneya and Friedenreich, 1997) but we still feel benefits can be realized (Courneya, 2003). We recommend low to moderate intensity exercise performed 3 to 5 days per week for 20-30 minutes each time, depending on baseline fitness levels and treatment toxicities. The exercise should be moderate intensity in the range of 55% to 75% of maximal heart rate.

Unfortunately, many cancer survivors receiving chemotherapy experience tachycardia, which makes heart rate alone an unreliable indicator of exercise intensity.

Consequently, we recommend that intensity also be monitored with a rating of perceived exertion scale (e.g., Borg, 1998) using the range of “somewhat hard” to “hard”. The preferred exercise choice in cancer survivors is walking (Jones and Courneya, 2002) and this activity will likely be sufficient to meet the recommended intensity for most cancer survivors on adjuvant therapy. Exercise progression in cancer survivors during adjuvant therapy is unpredictable and not always linear given the accumulating side effects of most cancer therapies. We recommend that cancer survivors exercise to tolerance including reducing intensity and performing exercise in shorter durations (e.g., 10 minutes) if needed.

Posttreatment, most cancer survivors can probably be recommended the public health guidelines from the American College of Sports Medicine and the United States Centers for Disease Control (Pate et al, 1995).

These organizations propose two different prescriptions for achieving health through physical activity. The more

VIII. Summary Advances in early detection and medical treatments have had a significant impact on cancer survival. These advances have paved the way for the examination of lifestyle factors, such as physical activity, as a further means for reducing recurrence rates and extending survival in this population. In this paper, we reviewed evidence for the potential role of exercise in affecting clinical endpoints in cancer survivors. Our review showed that research on this topic is extremely limited. Evidence from other populations, however, suggests that it is possible that exercise could positively affect clinical endpoints in cancer survivors. Moreover, the effects of exercise on the purported mechanisms of clinical benefit for cancer endpoints provide biological plausability.

Despite the limited evidence for a role of exercise in cancer survival, however, we still recommend exercise to cancer survivors based on preliminary evidence for a quality of life benefit. Future directions for research are such that the most basic questions on this topic need to be answered.

Acknowledgements KSC and CMF are supported by Investigator Awards from the Canadian Institutes of Health Research and a Research Team Grant from the National Cancer Institute of Canada (NCIC) with funds from the Canadian Cancer Society (CCS) and the CCS/NCIC Sociobehavioral Cancer Research Network. CMF is also supported by a Health

8

Cancer Therapy Vol 2, page 9 Consitt, L. A., J. L. Copeland, et al. (2002) Endogenous anabolic hormone responses to endurance versus resistance exercise and training in women. Sports Med 32, 1-22.

Courneya, K. S. (2003) Exercise in cancer survivors: an overview of research. Med Sci Sports Exerc 35, 1846-52.

Courneya, K. S. and C. M. Friedenreich (1997) Determinants of exercise during colorectal cancer treatment: an application of the theory of planned behavior. Oncol Nurs Forum 24, 1715-23.

Courneya, K. S. and C. M. Friedenreich (1997) Relationship between exercise pattern across the cancer experience and current quality of life in colorectal cancer survivors. J Altern Complement Med 3, 215-26.

Courneya, K. S. and C. M. Friedenreich (2001) Framework PEACE: an organizational model for examining physical exercise across the cancer experience. Ann Behav Med 23, 263-72.

Courneya, K. S., J. R. Mackey, et al. (2003) Randomized controlled trial of exercise training in postmenopausal breast cancer survivors: cardiopulmonary and quality of life outcomes. J Clin Oncol 21, 1660-8.

Courneya, K. S., J. R. Mackey, et al. (2002) Exercise for breast cancer survivors: Research evidence and clinical guidelines.

The Physician and Sportsmedicine 30, 33-42.

Courneya, K. S., J. R. Mackey, et al. (2002) Neoplasms. ACSM's Resources for Clinical Exercise Physiology: Musculoskeletal, Neuromuscular, Neoplastic, Immunologic, and Hematologic Conditions. J. N. Myers, W. G. Herbert and R. Humphrey. Baltimore, MD, Lippincott Williams & Wilkins.

Cunningham, A. J., C. V. Edmonds, et al. (1998) A randomized controlled trial of the effects of group psychological therapy on survival in women with metastatic breast cancer.

Psychooncology 7, 508-17.

Datta, D. and B. Lahiri (2003) Preoperative evaluation of patients undergoing lung resection surgery. Chest 123, 2096-103.

Davey Smith, G., M. J. Shipley, et al. (2000) Physical activity and cause-specific mortality in the Whitehall study. Public Health 114, 308-15.

De Cree, C. (1998) Sex steroid metabolism and menstrual irregularities in the exercising female. A review. Sports Medicine 25, 369-406.

Demaria, S., M. D. Volm, et al. (2001) Development of tumorinfiltrating lymphocytes in breast cancer after neoadjuvant paclitaxel chemotherapy. Clin Cancer Res 7, 3025-30.

Deuster, P. A., S. D. Morrison, et al. (1985) Endurance exercise modifies cachexia of tumor growth in rats. Med Sci Sports Exerc 17, 385-92.

DiMatteo, M. R., H. S. Lepper, et al. (2000) Depression is a risk factor for noncompliance with medical treatment: metaanalysis of the effects of anxiety and depression on patient adherence. Arch Intern Med 160, 2101-7.

Dimeo, F., S. Fetscher, et al. (1997) Effects of aerobic exercise on the physical performance and incidence of treatmentrelated complications after high-dose chemotherapy. Blood 90, 3390-4.

Duncan, G. E., M. G. Perri, et al. (2003) Exercise training, without weight loss, increases insulin sensitivity and postheparin plasma lipase activity in previously sedentary adults. Diabetes Care 26, 557-62.

Fairey, A. S., K. S. Courneya, et al. (2003) Effects of exercise training on fasting insulin, insulin resistance, insulin-like growth factors, and insulin-like growth factor binding proteins in postmenopausal breast cancer survivors: a randomized controlled trial. Cancer Epidemiol Biomarkers Prev 12, 721-7.

Fairey, A. S., K. S. Courneya, et al. (2002) Physical exercise and immune system function in cancer survivors: a

Scholar Award from the Alberta Heritage Foundation for Medical Research (AHFMR). KLC is supported by a Health Research - Full-Time Studentship Award from AHFMR.

References American Cancer Society. (2003) Cancer Facts & Figures.

Atlanta, Abramson, J. L. and V. Vaccarino (2002) Relationship between physical activity and inflammation among apparently healthy middle-aged and older US adults. Arch Intern Med 162, 1286-92.

Ardies, C. M. (2002) Exercise, cachexia, and cancer therapy: a molecular rationale. Nutr Cancer 42, 143-57.

Baracos, V. E. (1989) Exercise inhibits progressive growth of the Morris hepatoma 7777 in male and female rats. Can J Physiol Pharmacol 67, 864-70.

Batty, G. D., M. J. Shipley, et al. (2001) Physical activity and cause-specific mortality in men: further evidence from the Whitehall study. Eur J Epidemiol 17, 863-9.

Baum, M., A. Buzdar, et al. (2003) Anastrozole alone or in combination with tamoxifen versus tamoxifen alone for adjuvant treatment of postmenopausal women with earlystage breast cancer: results of the ATAC (Arimidex, Tamoxifen Alone or in Combination) trial efficacy and safety update analyses. Cancer 98, 1802-10.

Beckles, M. A., S. G. Spiro, et al. (2003) The physiologic evaluation of patients with lung cancer being considered for resectional surgery. Chest 123(1 Suppl, 105S-114S. Blair, S. N., H. W. Kohl, 3rd, et al. (1995) Changes in physical fitness and all-cause mortality. A prospective study of healthy and unhealthy men. Jama 273, 1093-8.

Blair, S. N., H. W. Kohl, 3rd, et al. (1989) Physical fitness and all-cause mortality. A prospective study of healthy men and women. Jama 262, 2395-401.

Borg, G. (1998) Perceived exertion and pain scales. Champaign, Human Kinetics.

Borst, S. E., K. R. Vincent, et al. (2002) Effects of resistance training on insulin-like growth factor and its binding proteins in men and women aged 60 to 85. J Am Geriatr Soc 50, 884-8.

Bouchard, C. and R. J. Shephard (1994) Physical activity, fitness, and health: The model and key concepts. Physical Activity, Fitness, and Health: International Proceedings and Consensus Statement. S. Bouchard C., R.J. & and T. Stephens. Champaign, IL, Human Kinetics: 77-88.

Boule, N. G., E. Haddad, et al. (2001) Effects of exercise on glycemic control and body mass in type 2 diabetes mellitus: a meta-analysis of controlled clinical trials. Jama 286, 121827.

Brown, J. K., T. Byers, et al. (2003) Nutrition and physical activity during and after cancer treatment: an American Cancer Society guide for informed choices. CA Cancer J Clin 53, 268-91.

Chang-Claude, J. and R. Frentzel-Beyme (1993) Dietary and lifestyle determinants of mortality among German vegetarians. Int J Epidemiol 22, 228-36.

Chlebowski, R. T., E. Aiello, et al. (2002) Weight loss in breast cancer patient management. J Clin Oncol 20, 1128-43.

Clemons, M. and P. Goss (2001) Estrogen and the risk of breast cancer. N Engl J Med 344, 276-85.

Colditz, G. A., C. C. Cannuscio, et al. (1997) Physical activity and reduced risk of colon cancer: implications for prevention. Cancer Causes Control 8, 649-67.

9

Courneya et al: Physical activity in cancer survivors comprehensive review and future directions. Cancer 94, 539-51.

Farahmand, B. Y., A. Ahlbom, et al. (2003) Mortality amongst participants in Vasaloppet: a classical long-distance ski race in Sweden. J Intern Med 253, 276-83.

Frasci, G. (2002) Treatment of breast cancer with chemotherapy in combination with filgrastim: approaches to improving therapeutic outcome. Drugs 62 Suppl 1: 17-31.

Friedenreich, C. M., H. E. Bryant, et al. (2001) Case-control study of lifetime physical activity and breast cancer risk. Am J Epidemiol 154, 336-47.

Friedenreich, C. M., K. S. Courneya, et al. (2001) Influence of physical activity in different age and life periods on the risk of breast cancer. Epidemiology 12, 604-12.

Friedenreich, C. M., K. S. Courneya, et al. (2001) Relation between intensity of physical activity and breast cancer risk reduction. Med Sci Sports Exerc 33, 1538-45.

Friedenreich, C. M., K. S. Courneya, et al. (2002) Case-control study of anthropometric measures and breast cancer risk. Int J Cancer 99, 445-52.

Friedenreich, C. M., S. E. McGregor, et al. (in press) Casecontrol study of anthropometric measures and prostate cancer risk. Intern J Cancer.

Friedenreich, C. M., S. E. McGregor, et al. (in press) Casecontrol study of lifetime total physical activity and prostate cancer risk. Am J Epidemiol Fujita, Y., Y. Nakamura, et al. (1995) Physical-strength tests and mortality among visitors to health-promotion centers in Japan. J Clin Epidemiol 48, 1349-59.

Garfinkel, L., P. Boffetta, et al. (1988) Alcohol and breast cancer: a cohort study. Prev Med 17, 686-93.

Garfinkel, L. and S. D. Stellman (1988) Mortality by relative weight and exercise. Cancer 62(8 Suppl), 1844-50.

Giannuzzi, P., P. L. Temporelli, et al. (2003) Antiremodeling effect of long-term exercise training in patients with stable chronic heart failure: results of the Exercise in Left Ventricular Dysfunction and Chronic Heart Failure (ELVDCHF) Trial. Circulation 108, 554-9.

Goodwin, P. J., M. Ennis, et al. (2002) Fasting insulin and outcome in early-stage breast cancer: results of a prospective cohort study. J Clin Oncol 20, 42-51.

Goss, P. E., J. N. Ingle, et al. (2003) A Randomized Trial of Letrozole in Postmenopausal Women after Five Years of Tamoxifen Therapy for Early-Stage Breast Cancer. N Engl J Med. 349: 1793-802 Gregg, E. W., J. A. Cauley, et al. (2003) Relationship of changes in physical activity and mortality among older women. Jama 289(18, 2379-86.

Group, E. B. C. T. C. (1996) Ovarian ablation in early breast cancer: an overview of the randomized trials. Lancet 348: 1189-96.

Group, E. B. C. T. C. (1998) Tamoxifen for early breast cancer: an overview of the randomised trials. Lancet 351, 1451-67.

Gulati, M., D. K. Pandey, et al. (2003) Exercise capacity and the risk of death in women: the St James Women Take Heart Project. Circulation 108, 1554-9.

Hackney, A. C. (1996) The male reproductive system and endurance exercise. Medicine & Science in Sports & Exercise 28, 180-189.

Hakim, A. A., H. Petrovitch, et al. (1998) Effects of walking on mortality among nonsmoking retired men. N Engl J Med 338, 94-9.

Hakkinen, K., A. Pakarinen, et al. (2001) Selective muscle hypertrophy, changes in EMG and force, and serum hormones during strength training in older women. J Appl Physiol 91, 569-80.

Hellerstedt, B. A. and K. J. Pienta (2003) The truth is out there: an overall perspective on androgen deprivation. Urol Oncol 21, 272-81.

Herndon, J. E., 2nd, S. Fleishman, et al. (1999) Is quality of life predictive of the survival of patients with advanced nonsmall cell lung carcinoma? Cancer 85, 333-40.

Hershman, D., M. Weinberg, et al. (2003) Ethnic neutropenia and treatment delay in African American women undergoing chemotherapy for early-stage breast cancer. J Natl Cancer Inst 95, 1545-8.

Irwin, M. L., D. Crumley, et al. (2003) Physical activity levels before and after a diagnosis of breast carcinoma: the Health, Eating, Activity, and Lifestyle (HEAL) study. Cancer 97, 1746-57.

Jones, L. W. and K. S. Courneya (2002) Exercise counseling and programming preferences of cancer survivors. Cancer Pract 10, 208-15.

Kampert, J. B., S. N. Blair, et al. (1996) Physical activity, physical fitness, and all-cause and cancer mortality: a prospective study of men and women. Ann Epidemiol 6, 452-7.

Karamouzis, M., I. Karamouzis, et al. (2001) The response of muscle interstitial prostaglandin E(2)(PGE(2)), prostacyclin I(2)(PGI(2)) and thromboxane A(2)(TXA(2)) levels during incremental dynamic exercise in humans determined by in vivo microdialysis. Prostaglandins Leukot Essent Fatty Acids 64, 259-63.

Karamouzis, M., H. Langberg, et al. (2001) In situ microdialysis of intramuscular prostaglandin and thromboxane in contracting skeletal muscle in humans. Acta Physiol Scand 171, 71-6.

Kay, N. E., T. L. Leong, et al. (2001) Blood levels of immune cells predict survival in myeloma patients: results of an Eastern Cooperative Oncology Group phase 3 trial for newly diagnosed multiple myeloma patients. Blood 98, 23-8.

Kilander, L., L. Berglund, et al. (2001) Education, lifestyle factors and mortality from cardiovascular disease and cancer.

A 25-year follow-up of Swedish 50-year-old men. Int J Epidemiol 30, 1119-26.

Koffler, K. H., A. Menkes, et al. (1992) Strength training accelerates gastrointestinal transit in middle-aged and older men. Med Sci Sports Exerc 24, 415-9.

Kohrt, W. M., D. B. Snead, et al. (1995) Additive effects of weight-bearing exercise and estrogen on bone mineral density in older women. J Bone Miner Res 10, 1303-11.

Kraemer, W. J. (1988) Endocrine responses to resistance exercise. Medicine & Science in Sports & Exercise 20(5 (Supplement), S152-S157.

Kristal-Boneh, E., G. Harari, et al. (2000) Association of physical activity at work with mortality in Israeli industrial employees: the CORDIS study. J Occup Environ Med 42, 127-35.

Kushi, L. H., R. M. Fee, et al. (1997) Physical activity and mortality in postmenopausal women. Jama 277, 1287-92.

Lange, K. H., J. Lorentsen, et al. (2001) Endurance training and GH administration in elderly women: effects on abdominal adipose tissue lipolysis. Am J Physiol Endocrinol Metab 280, E886-97.

Lee, C. D. and S. N. Blair (2002) Cardiorespiratory fitness and smoking-related and total cancer mortality in men. Med Sci Sports Exerc 34, 735-9.

Lee, C. D., S. N. Blair, et al. (1999) Cardiorespiratory fitness, body composition, and all-cause and cardiovascular disease mortality in men. Am J Clin Nutr 69, 373-80.

Lee, I. M. (2003) Physical activity and cancer prevention--data from epidemiologic studies. Med Sci Sports Exerc 35, 1823-7.

10

Cancer Therapy Vol 2, page 11 Lee, I. M. and P. J. Skerrett (2001) Physical activity and allcause mortality: what is the dose-response relation? Med Sci Sports Exerc 33(6 Suppl, S459-71; discussion S493-4.

Leon, A. S. and J. Connett (1991) Physical activity and 10.5 year mortality in the Multiple Risk Factor Intervention Trial (MRFIT) Int J Epidemiol 20, 690-7.

Leon, A. S. and O. A. Sanchez (2001) Response of blood lipids to exercise training alone or combined with dietary intervention. Med Sci Sports Exerc 33(6 Suppl, S502-15; discussion S528-9.

Liljefors, M., B. Nilsson, et al. (2003) Natural killer (NK) cell function is a strong prognostic factor in colorectal carcinoma patients treated with the monoclonal antibody 17-1A. Int J Cancer 105, 717-23.

Liu, F., T. Kondo, et al. (1993) Brief physical inactivity prolongs colonic transit time in elderly active men. Int J Sports Med 14, 465-7.

Louwman, W. J., W. J. Klokman, et al. (2001) Excess mortality from breast cancer 20 years after diagnosis when life expectancy is normal. Br J Cancer 84, 700-3.

Lowdell, M. W., R. Craston, et al. (2002) Evidence that continued remission in patients treated for acute leukaemia is dependent upon autologous natural killer cells. Br J Haematol 117, 821-7.

MacDonald, N., A. M. Easson, et al. (2003) Understanding and managing cancer cachexia. J Am Coll Surg 197, 143-61.

MacVicar, M. G., M. L. Winningham, et al. (1989) Effects of aerobic interval training on cancer patients' functional capacity. Nurs Res 38, 348-51.

Maddalozzo, G. F. and C. M. Snow (2000) High intensity resistance training: effects on bone in older men and women.

Calcif Tissue Int 66, 399-404.

McTiernan, A., C. Ulrich, et al. (1998) Physical activity and cancer etiology: associations and mechanisms. Cancer Causes Control 9, 487-509.

Modugno, F. (2003) Ovarian cancer and high-risk womenimplications for prevention, screening, and early detection.

Gynecol Oncol 91, 15-31.

Myers, J., M. Prakash, et al. (2002) Exercise capacity and mortality among men referred for exercise testing. N Engl J Med 346, 793-801.

Parkhouse, W. S., D. C. Coupland, et al. (2000) IGF-1 bioavailability is increased by resistance training in older women with low bone mineral density. Mech Ageing Dev 113, 75-83.

Pate, R. R., M. Pratt, et al. (1995) Physical activity and public health. A recommendation from the Centers for Disease Control and Prevention and the American College of Sports Medicine. Jama 273, 402-7.

Peng, N. J., R. Advani, et al. (1997) Clinical decision making based on radionuclide determined ejection fraction in oncology patients. J Nucl Med 38, 702-5.

Persky, A. M., N. D. Eddington, et al. (2003) A review of the effects of chronic exercise and physical fitness level on resting pharmacokinetics. Int J Clin Pharmacol Ther 41(11, 504-16.

Persson, I. (2000) Estrogens in the causation of breast, endometrial and ovarian cancers - evidence and hypotheses from epidemiological findings. Journal of Steroid Biochemistry & Molecular Biology 74: 357-364.

Pierce, J. P., S. Faerber, et al. (2002) A randomized trial of the effect of a plant-based dietary pattern on additional breast cancer events and survival: the Women's Healthy Eating and Living (WHEL) Study. Control Clin Trials 23, 728-56.

Poehlman, E. T., C. J. Rosen, et al. (1994) The influence of endurance training on insulin-like growth factor-1 in older individuals. Metabolism 43(11, 1401-5.

Polednak, A. P. (1976) College athletics, body size, and cancer mortality. Cancer 38, 382-7.

Pugh, S. and G. A. Thomas (1994) Patients with adenomatous polyps and carcinomas have increased colonic mucosal prostaglandin E2. Gut 35, 675-8.

Quadrilatero, J. and L. Hoffman-Goetz (2003) Physical activity and colon cancer. A systematic review of potential mechanisms. J Sports Med Phys Fitness 43, 121-38.

Rockhill, B., W. C. Willett, et al. (2001) Physical activity and mortality: a prospective study among women. Am J Public Health 91, 578-83.

Rohan, T. E., W. Fu, et al. (1995) Physical activity and survival from breast cancer. Eur J Cancer Prev 4, 419-24.

Rosengren, A. and L. Wilhelmsen (1997) Physical activity protects against coronary death and deaths from all causes in middle-aged men. Evidence from a 20-year follow-up of the primary prevention study in Goteborg. Ann Epidemiol 7, 69-75.

Ross, R., D. Dagnone, et al. (2000) Reduction in obesity and related comorbid conditions after diet-induced weight loss or exercise-induced weight loss in men. A randomized, controlled trial. Ann Intern Med 133, 92-103.

Sawada, S. S., T. Muto, et al. (2003) Cardiorespiratory fitness and cancer mortality in Japanese men: a prospective study.

Med Sci Sports Exerc 35, 1546-50.

Schmitz, K. H., R. L. Ahmed, et al. (2002) Effects of a 9-month strength training intervention on insulin, insulin-like growth factor (IGF)-I, IGF-binding protein (IGFBP)-1, and IGFBP-3 in 30-50-year-old women. Cancer Epidemiol Biomarkers Prev 11(12, 1597-604.

Schwartz, A. L. (1999) Fatigue mediates the effects of exercise on quality of life. Qual Life Res 8, 529-38.

Schwartz, A. L. (2000) Exercise and weight gain in breast cancer patients receiving chemotherapy. Cancer Pract 8, 231-7.

Segal, R., W. Evans, et al. (2001) Structured exercise improves physical functioning in women with stages I and II breast cancer: results of a randomized controlled trial. J Clin Oncol 19, 657-65.

Segal, R. J., R. D. Reid, et al. (2003) Resistance exercise in men receiving androgen deprivation therapy for prostate cancer. J Clin Oncol 21, 1653-9.

Sephton, S. E., R. M. Sapolsky, et al. (2000) Diurnal cortisol rhythm as a predictor of breast cancer survival. J Natl Cancer Inst 92, 994-1000.

Shadbolt, B., J. Barresi, et al. (2002) Self-rated health as a predictor of survival among patients with advanced cancer. J Clin Oncol 20, 2514-9.

Sutton, L. M., W. Demark-Wahnefried, et al. (2003) Management of terminal cancer in elderly patients. Lancet Oncol 4, 149-57.

Taplin, M. E. and S. M. Ho (2001) Clinical review 134: The endocrinology of prostate cancer. J Clin Endocrinol Metab 86, 3467-77.

Thune, I. and A. S. Furberg (2001) Physical activity and cancer risk: dose-response and cancer, all sites and site-specific.

Med Sci Sports Exerc 33(6 Suppl, S530-50; discussion S609-10.

Tisdale, M. J. (2002) Cachexia in cancer patients. Nat Rev Cancer 2, 862-71.

Vigano, A., S. Watanabe, et al. (1994) Anorexia and cachexia in advanced cancer patients. Cancer Surv 21: 99-115.

Vitiello, M. V., C. W. Wilkinson, et al. (1997) Successful 6month endurance training does not alter insulin-like growth factor-I in healthy older men and women. J Gerontol A Biol Sci Med Sci 52, M149-54.

Wannamethee, G., A. G. Shaper, et al. (1993) Heart rate, physical activity, and mortality from cancer and other noncardiovascular diseases. Am J Epidemiol 137, 735-48.

11

Courneya et al: Physical activity in cancer survivors Whelton, S. P., A. Chin, et al. (2002) Effect of aerobic exercise on blood pressure: a meta-analysis of randomized, controlled trials. Ann Intern Med 136, 493-503.

Winningham, M. L., M. G. MacVicar, et al. (1989) Effect of aerobic exercise on body weight and composition in patients with breast cancer on adjuvant chemotherapy. Oncol Nurs Forum 16, 683-9.

Wisloff, F. and M. Hjorth (1997) Health-related quality of life assessed before and during chemotherapy predicts for survival in multiple myeloma. Nordic Myeloma Study Group. Br J Haematol 97, 29-37.

Wood, W. C., D. R. Budman, et al. (1994) Dose and dose intensity of adjuvant chemotherapy for stage II, nodepositive breast carcinoma. N Engl J Med 330, 1253-9.

Yu, H. and T. Rohan (2000) Role of the insulin-like growth factor family in cancer development and progression. J Natl Cancer Inst 92, 1472-89.

Yu, S., J. W. Yarnell, et al. (2003) What level of physical activity protects against premature cardiovascular death? The Caerphilly study. Heart 89, 502-6.

Zambraski, E. J., R. Dodelson, et al. (1986) Renal prostaglandin E2 and F2 alpha synthesis during exercise: effects of indomethacin and sulindac. Med Sci Sports Exerc 18, 67884.

Zhang, L., J. R. Conejo-Garcia, et al. (2003) Intratumoral T cells, recurrence, and survival in epithelial ovarian cancer. N Engl J Med 348, 203-13.

Zinna, E. M. and K. E. Yarasheski (2003) Exercise treatment to counteract protein wasting of chronic diseases. Curr Opin Clin Nutr Metab Care 6, 87-93.

Dr. Kerry S. Courneya

12

Cancer Therapy Vol 2, page 13 Cancer Therapy Vol 2, 13-20, 2004

Ceramide in malignant tumors Review Article

Bettina Gunawardena, Volker Teichgräber, Gabriele Hessler, Erich Gulbins* Department of Molecular Biology, University of Duisburg-Essen, Hufelandstrasse 55, 45122 Essen, Germany

__________________________________________________________________________________ *Correspondence: Dr. Erich Gulbins, Dept. of Molecular Biology, University of Duisburg-Essen, Hufelandstrasse 55, 45122 Essen, Germany, Tel.: 49-201-723-3118, Fax: 49-201-723-5974, e-mail: erich.gulbins@uni-essen.de Key words: Ceramide, acid sphingomyelinase, receptor clustering, membrane platforms, tumor

Received: 13 February 2004; Accepted: 25 February 2004; electronically published: February 2004

Summary The lipid ceramide is widely recognized as being central for the mediation of the cellular stress response and the regulation of apoptosis in many cells. Ceramide has been demonstrated to be required for the cellular response to stress stimuli such as ionizing radiation, chemotherapy, UVA-light, heat, CD95 and TNF receptor ligation, reperfusion injury, infection with some pathogenic bacteria and viruses and developmental programmed cell death of oocytes. We recently proposed a comprehensive model for the molecular function of ceramide. This model suggests that ceramide self-associates to ceramide-enriched membrane microdomains that subsequently fuse to larger macrodomains and platforms. These ceramide-enriched platforms serve to transmit signals via receptors into the cell, e.g. by reorganizing and concentrating receptors and signaling molecules within a defined area of the cell membrane. Ceramide-enriched membrane platforms might also mediate the cellular effects of ionizing radiation, heat or cytostatic drugs, providing a rationale for the very high radio-resistance of cells lacking the acid sphingomyelinase, which endogenously generates ceramide from sphingomyelin. Translation of these concepts into tumor biology suggests that an inhibition of acid sphingomyelinase expression or function, confers resistance of the tumor against radiation and/or chemotherapy, while an increase of acid sphingomyelinase activity might open an avenue to novel therapy concepts. sphingosine-moiety of sphingolipids. The tight homophilic interaction of sphingolipids and the association with cholesterol results in a firm lateral organization of these lipids, leading to spontaneous segregation from other membrane lipids and the formation of discrete membrane domains. These domains are characterized by a liquidordered or even gel-like phase (Simons and Ikonen, 1997; Brown and London, 1998). The tight packing of lipids in these membrane domains renders them relatively resistant to detergents and thus, they were termed detergent insensitive glycosphingo-lipid-enriched membrane domains. Moreover, since one model suggested that these structures float in the ocean of other membrane lipids, they were shortly referred to as rafts (Simons and Ikonen, 1997). The term raft will be used in the current overview to describe small, distinct glycosphingolipid- and cholesterol-enriched membrane domains that are constitutively present in the cell membrane. Here, we provide a mechanistic model of how small rafts are transformed into large signaling units in the cell membrane that serve to transmit stress signals into the cell.

Furthermore, we discuss the function of distinct membrane domains in response to cellular stress, the induction of

I. Introduction The generation of ceramide by rapid sphingomyelinase-mediated hydrolysis of plasma membrane sphingomyelin was first shown by Kolesnick and Paley (1987) to play a role in cellular signaling.

Studies of the last years identified a comprehensive mechanism for the cellular functions of ceramide (GrassmĂŠ et al, 1997, 2001a, b, 2002, 2003a, b, Cremesti et al, 2003). Membranes of mammalian cells are mainly composed of glycophospholipids, (glyco-) sphingolipids, and cholesterol. Glycosphingolipids tightly associate with each other by hydrophilic interactions between their head groups resulting in a lateral organization of these lipids (for reviews see Simons and Ikonen, 1997; Brown and London, 1998). However, in order to separate from other phospholipids in the cell membrane and to form distinct domains, void spaces between the large and bulky sphingolipid molecules must be filled. This function is primarily performed by cholesterol (Simons and Ikonen, 1997). Cholesterol interacts with sphingolipids via hydrophilic interactions between its hydroxy-group and the headgroups of the sphingolipids, and via hydrophobic interactions between the cholesterol ring system and the 13

Gunawardena et al: Ceramide in cancer apoptosis, and the development and treatment of malignant tumors.

II. Ceramide-enriched platforms

Studies employing the CD95 receptor and the CD40 receptor indicated that stimulation of these receptors through physiological ligands or stimulatory antibodies results in an activation of the acid sphingomyelinase within seconds (Figure 1) (Kirschnek et al 2000, Paris et al 2000; GrassmĂŠ et al, 2001, 2002; Cremesti et al, 2001).

Activation of the acid sphingomyelinase is accompanied with translocation of the acid sphingomyelinase from an intracellular compartment onto the cell surface (Figures 2 and 3) (GrassmĂŠ et al, 2001a, b 2001). Although not proven at present, we assume that the acid sphingomyelinase is stored within small, intracellular vesicles that are mobilized and fuse with the cell membrane upon cellular stimulation. The fusion of these vesicles results in exposition of the acid sphingomyelinase on the outer leaflet of the cell membrane. Once on the surface acid sphingomyelinase seems to preferentially localize within rafts (Figure 3). There, it consumes sphingomyelin and generates ceramide in the outer leaflet of the cell membrane. The generation of ceramide is the critical event required to transform small rafts of resting cells into a large signaling unit. The driving force of this transformation is the endogenous tendency of ceramide to aggregate and to spontaneously fuse small rafts into large ceramide-enriched membrane platforms (for review see Kolesnick et al, 2000).

membrane

We have shown in the recent years that the generation of ceramide in the cell membrane is capable to transform small rafts into large membrane platforms that facilitate the transmission of signals into the cell (Figure 1) (GrassmĂŠ et al, 2001a, b, 2002, 2003a, b; Cremesti et al, 2001). Mammalian cells utilize three distinct types of sphingomyelinases to generate ceramide through hydrolysis of sphingomyelin. Sphingomyelinases are characterized by their pH optimum and thus, were termed acid, neutral and alkaline sphingomyelinases. Numerous studies revealed a signaling function of the acid and neutral sphingomyelinase (for review see Goni and Alonso, 2002), while a similar role of the alkaline sphingomyelinase remains to be defined.

In addition to ceramide generation by hydrolysis of sphingomyelin, ceramide can be also synthesized de novo via a pathway that is regulated by the enzymes serinepalmitoyl-transferase and ceramide synthase (for review see Goni and Alonso, 2002).

We have recently suggested a novel mechanism of how ceramide functions in cellular signal transduction.

Figure 1: Model of raft formation and function The model suggests that different stimuli including ionizing radiation, heat or chemotherapeutic drugs activate the acid sphingomyelinase and induce a translocation of the acid sphingomyelinase onto the extracellular leaflet of the cell membrane. The release of ceramide from sphingomyelin in the cell membrane results in the formation of small ceramide-enriched membrane microdomains that fuse to large, ceramide-enriched macrodomains. These platforms serve the transmission of the stress signal into the cell.

14

Cancer Therapy Vol 2, page 15

Figure 2: Acid sphingomyelinase translocates onto the surface of activated cells Stimulation of JY B cells via CD95 triggers a translocation of the acid sphingomyelinase onto the extracellular leaflet of the cell membrane. Acid sphingomyelinase was visualized with a gold-coupled antibody that appears in the scanning electron microscopy analysis as white dots. The data indicate a distinct distribution pattern of the acid sphingomyelinase on the cell surface upon stimulation.

Printed with permission of the J.B.C.

Figure 3: Acid sphingomyelinase mediates clustering of CD95 Lymphocytes were stimulated for 2 minutes via CD95, fixed and stained with FITC-coupled cholera toxin, that binds to the raft marker ganglioside GM1, Cy3-labelled CD95 and Cy5-coupled anti-acid sphingomyelinase antibodies. The results demonstrate clustering of CD95 and a co-localization of the clustered receptor with acid sphingomyelinase and cholera toxin. The latter suggests a clustering of CD95 and the acid sphingomyelinase in membrane rafts. Printed with permission of the J.B.C.

myelinase (Nurminen et al, 2002). The latter studies indicated that the generation of ceramide even in artificial membranes is sufficient to form large membrane platforms. In addition to triggering the fusion of rafts into large membrane platforms, ceramide also alters the composition of these membrane domains since the accumulation of ceramide results in an exclusion of

The formation of these large ceramide-enriched membrane platforms was shown in vivo for lymphocytes, fibroblasts, hepatocytes and epithelial cells (Kirschnek et al, 2000, Paris et al, 2000; GrassmĂŠ et al, 2001a, b, 2003). These findings were also confirmed on artificial, phosphatidylcholine /sphingomyelin-composed unilamellar membranes that were locally exposed to immobilized sphingo15

Gunawardena et al: Ceramide in cancer cholesterol from ceramide-enriched membrane platforms (Megha and London, 2003).

III. Ceramide-enriched platforms and apoptosis

previous in vitro and in vivo findings. It was demonstrated that ex vivo splenocytes or hepatocytes from acid sphingomyelinase knock-out mice were resistant to the induction of apoptosis by CD95 or TNF-receptor stimulation (Kirschnek et al, 2000; Paris et al, 2000; Garcia-Ruiz et al, 2003). Stimulation via the TNF-receptor has been previously shown to activate the acid sphingomyelinase and to release ceramide (Schütze et al, 1992). More important, in vivo data demonstrated that acidsphingomyelinase-deficient mice tolerated intravenous injection of agonistic anti-CD95 antibodies or TNF! that usually induce acute hepatic failure (Garcia-Ruiz et al, 2003). These studies emphasize the in vivo significance of the acid sphingomyelinase for CD95- and TNF-receptormediated apoptosis. Further, human B-lymphocytes or fibroblasts from Niemann-Pick disease type A patients that suffer from an inborne deficiency of ASM failed to undergo apoptosis upon ligation of the CD95 receptor (Gulbins et al, 1995; DeMaria et al, 1998, Grassmé et al, 2001a). The susceptibility of lymphocytes and hepatocytes to CD95-triggered apoptosis was restored by reexpression of the acid sphingomyelinase or addition of natural C16ceramide to acid sphingomyelinase-deficient cells.

In summary, ceramide-controlled platform formation might function as a sorting device for certain receptor molecules that finally mediates amplification of signaling.

However, we would like to point out that these data do not exclude an intracellular function of the acid sphingomyelinase and ceramide, e.g. by reorganization of intracellular membranes or direct binding to and stochiometric regulation of proteins.

membrane

Ceramide-enriched membrane platforms promote the aggregation/clustering of receptor molecules, a phenomenon that has been best studied for CD95 and CD40 (Grassmé et al, 2001a, b, 2002; Cremesti et al, 2001). Studies on CD95 indicated that clustering occurs in many different cell types including lymphocytes, phagocytic cells, granulosa cells of the ovary, epithelial cells, fibroblasts, hepatocytes, and thymocytes (Fanzo et al, 2003). Clustering of the receptor in ceramide-enriched membrane platforms was shown to function as a mechanism to amplify signaling of this receptor approximately 100-fold. These studies further indicated that stimulation of CD95 in cells lacking the acid sphingomyelinase, which is essentially required to form ceramide-enriched membrane platforms upon receptor stimulation, results in only a very weak recruitment of FADD to CD95 and in a very limited activation of caspase 8 to an extend of less than 1% compared with complete activation of caspase 8 (Grassmé et al, 2003b). Acid sphingomyelinase-deficient cells also failed to activate caspase 3 and to undergo apoptosis. Transfection of these cells with acid sphingomyelinase or supplementation with natural C 16-ceramide was sufficient to restore clustering of CD95 after activation. Consequently, significant recruitment of FADD to CD95 and complete activation of caspase 8 was recovered and permitted sufficient activation of caspase 3 and the induction of apoptosis (Grassmé et al, 2003b). Therefore, we suggest that CD95 engages the acid sphingomyelinase pathway through a primary very weak and transient activation of caspases that is sufficient to induce surface translocation and activation of the acid sphingomyelinase. Acid sphingomyelinase finally mediates the formation of ceramideenriched membrane platforms. At present it is unknown how other receptors, e.g. CD40, which are not coupled to caspases, are linked to the acid sphingomyelinase pathway.

These data indicate that clustering of CD95 in ceramide-enriched membrane platforms functions as an amplification mechanism that is most likely based on a high local density of receptor molecules in a small area of the cell membrane, permitting oligomerization of the receptor molecules. In addition, ceramide-enriched membrane platforms might serve to actively recruit signaling molecules and to bring these molecules in close contact to the activated receptor. This assumption is consistent with the recent findings that FADD and caspase 8 translocate into the detergent-insensitive membrane fraction upon cellular stimulation via CD95 (ScheelToellner et al, 2002). Moreover, the accumulation of ceramide might facilitate the exclusion of molecules from those platforms that may negatively interfere or even inhibit signaling via CD95.

The notion that the acid sphingomyelinase is central for the induction of apoptosis via CD95 is consistent with

A. Ceramide and ionizing radiation Most data on the function of the acid sphingomyelinase in tumor biology have been published for the cellular effects of ionizing radiation (Haimovitz-Friedman et al, 1994; Santana et al, 1996; Pena et al, 2000; Paris et al, 2001; Garcia-Barros et al, 2003). Ionizing radiation activates the ASM within seconds to minutes in the plasma membrane of irradiated cells, resulting in a rapid release of ceramide (Haimovitz-Friedman et al, 1994). Preliminary data from our laboratory on glioma cells indicate that ceramide generated upon radiation forms large membrane platforms (Figure 4), very similar to those observed upon stimulation via CD95. Activation of ASM, release of ceramide, and the formation of ceramide-enriched membrane platforms are central for the induction of apoptosis by radiation as evidenced by the following data: Mature B cells, endothelial and mesothelial cells, or embryonic fibroblasts of acid sphingomyelinase-deficient mice were resistant to the induction of apoptosis by ionizing radiation, whereas cells expressing the acid sphingomelianase rapidly died (Santana et al, 1996; Pena et al, 2000; Paris et al, 2001; Garcia-Barros et al, 2003).

Recent experiments on the effects of ionizing radiation to the central nervous system confirmed the resistance of acid sphingomyelinase-deficient endothelial cells in vivo (Pena et al, 2000; Li et al, 2003). These studies reported the remarkable finding that endothelial cells lacking acid

16

Cancer Therapy Vol 2, page 17

Figure 4: Radiation of glioma cells results in the formation of ceramide-enriched membrane platforms LN229 glioma cells were radiated with 12 Gy and fixed 10 min after radiation Ceramide on the cell surface was visualized by staining the cells with a Cy3-coupled anti-ceramide-antibody and analysed by fluorescence microscopy.

sphingomyelinase resisted radiation doses up to 40 Gy, while endothelial cells in normal C57Bl/6 or C3H/HN mice responded with apoptosis within the first 12 hours after radiation. Further studies on cells derived from Niemann-Pick Disease Type A patients proved the function of the acid sphingomyelinase for ionizing radiation-induced cell death. Retransfection of the acid sphingomyelinase into these cells or supplementation of natural C16-ceramide restored radiation-induced apoptosis demonstrating the central role of the acid sphingomyelinase and, even more important, the role of ceramide for the cellular effects of radiation.

The critical role of the acid sphingomyelinase in the cellular response to radiation is also very clearly evidenced in experiments on acid sphingomyelinaseexpressing and -deficient oocytes (Morita et al, 2000).

While oocytes of normal mice rapidly underwent apoptosis upon irradiation, those in acid sphingomyelinase-deficient mice survived.

Studies on normal and acid sphingomyelinasedeficient mice elaborated the cellular effects of radiation in detail. Whole body radiation of C57Bl/6 mice with doses less than 14 Gy resulted in predominant death of bone marrow cells and the mice died 12-14 days after radiation by deprivation of bone marrow cells (Paris et al, 2001).

Accordingly, mice were rescued by bone marrow transplantation. An increase in dose above 15 Gy resulted

in severe alterations of the gastrointestinal tract with the development of a gastrointestinal syndrome (Paris et al, 2001).

The gastrointestinal syndrome is caused by depletion of villous and cryptic gland cells and characterized by a loss of the barrier and resorptive functions of the GI tract, which is very often lethal. Experiments from Paris et al (2001) evidenced that endothelial cells in small gastrointestinal vessels died by apoptosis as early as one hour. Apoptosis peaked in those cells already at 4 hours after 8 to 15 Gy irradiation, while apoptosis in epithelial cells in the crypts and villi occurred much later and was detected 8-10 hrs after irradiation. Endothelial cell apoptosis was radiation dose-dependent and the extent of apoptosis in endothelial cells correlated closely with the development of a gastrointestinal syndrome with massive endothelial apoptosis at 15 Gy radiation. In this correlation the borderline irradiation dose for death by delayed bone marrow insufficiency or immediate GI syndrome is crossed at 15 Gy. In contrast, acid sphingomyelinase-deficient mice did not develop a gastrointestinal syndrome after whole body irradiation with 15 Gy and their endothelial cells did not undergo apoptosis. Moreover, intravenous injection of basic fibroblast growth factor that inhibits the acid sphingomyelinase protected normal mice from

17

Gunawardena et al: Ceramide in cancer development of a gastrointestinal syndrome even at doses as high as 17 Gy (Paris et al, 2001).

These studies employing a physiological stress response model indicated that irradiation primarily targets the acid sphingomyelinase in endothelial cells and proved that the acid sphingomyelinase is required for radiationinduced cell death in vivo.

Recent studies on a tumor model confirmed the notion that acid sphingomyelinase and ceramide play a central role for the induction of cell death (Garcia-Barros et al, 2003). Syngenic normal and acid sphingomyelinasedeficient mice were transplanted with the same tumors, i.e.

B16F1 melanoma or MCA/129 fibrosarcoma. Therefore, any difference of tumor growth or in response to treatment must be caused by the differential expression of the acid sphingomyelinase in the tumor-bearing host animals.

Radiation of tumors in normal mice resulted in a marked, more than 70% reduction of the tumor mass, while the same tumor was not affected by radiation in acid sphingomyelinase-deficient mice. The sensitivity of the tumor to radiation correlated with the induction of apoptosis in endothelial cells in tumor vessels of normal mice, while endothelial cells in tumor vessels of the acid sphingomyelinase-deficient mice failed to undergo apoptosis upon radiation. To illustrate the significance of acid sphingomyelinase in endothelial cells for the susceptibility of the tumor to radiation, Garcia-Barros et al. (2003) applied the finding that endothelial cells in tumor vessels are derived from two sources: The tumor requires the formation of novel blood vessels to extend a size of a few millimeters. Hence, tumor vessels are partly formed by proliferation of local endothelial cells and sprouting of preexisting vessels. However, a large proportion of endothelial cells in tumor vessels are derived from the bone marrow. Tumor cells release factors that mobilize and attract endothelial progenitor cells from the bone marrow that subsequently integrate in the newly formed tumor vessels.

Transplantation of acid sphingomyelinase-deficient mice with normal bone marrow resulted in the incorporation of acid sphingomyelinase-positive endothelial progenitor cells into tumor vessels and restored sensitivity of the tumor to radiation.

Vice versa, transplantation of normal mice with bone marrow cells derived from acid sphingomyelinasedeficient mice conferred resistance of the tumor to radiation. Finally, purification of endothelial cells from tumor vessels confirmed the in vivo data and showed that induction of cell death by radiation requires expression of the acid sphingomyelinase.

These data are not contradictory to the previous findings that tumors transplanted into SCID mice (Budach et al, 1993), which suffer from a defect in DNA-repair and are highly sensitive to radiation, did not show an increased radio-sensitivity. Since the acid sphingomyelinase has been shown to be activated by radiation in cellular membranes, the induction of apoptosis in endothelial cells by radiation via the acid sphingomyelinase might be independent of DNA damage and, thus, the sensitivity of the tumor might not be altered in SCID mice.

At present it is unknown how radiation-induced endothelial cell death in tumor blood vessels mediates

tumor reduction. Tumor cell death might be caused by tissue ischemia, leakage of humoral or cellular blood elements that might impact tumor cell viability and/or promotion of DNA double strand breaks within irradiated tumor cells.

Although the data evidence that endothelial cells are critically involved in the tumor's response to radiation, they do not exclude that the radiation response of other cells, e.g. tumor stroma cells (Sch端ler et al, 2003), is also determined by the acid sphingomyelinase. The integrity of tumor stroma cells has been shown to be required for tumor growth. If irradiation also affects these cells and alters the structural support provided by stroma cells to the tumor, the tumor cells might die. If the acid sphingomyelinase mediates the response of stroma cells to radiation, these cells might represent a second ceramidesensitive population that is required for tumor growth.

In summary, these data indicate that bone marrowderived cells, most likely endothelial precursor cells, are critical for the response of a tumor to radiation. The sensitivity or resistance of these cells is determined by expression and function of the acid sphingomyelinase. It is therefore of great interest to investigate, whether tumors are able to regulate the function of the acid sphingomyelinase in endothelial cells and to define the molecular basis of those mechanisms.

B. Ceramide and UV-A light Although much less is known about the regulation of the acid sphingomyelinase and the role of ceramide in the mediation of UV-A effects, several data indicated that UV-A light rapidly induces activation of the acid sphingomyelinase, a release of ceramide and stimulation of c-Jun N-terminal kinase, while acid sphingomyelinasedeficient cells failed to respond to UV-A light (Zhang et al, 2001). Most important, expression of the acid sphingomyelinase in this setting was also required for the induction of apoptosis. Cells deficient for the acid sphingomyelinase were resistant to the induction of apoptosis by UV-A light (Zhang et al, 2001).

C. Ceramide and chemotherapy Little is known about the role of the acid sphingomyelinase and ceramide in cytotoxic chemotherapy. It was shown that deficiency of the acid sphingomyelinase prevents induction of apoptosis in oocytes by the cytostatic drug doxorubicin, while acid sphingomyelinase-positive oocytes were sensitive to doxorubicin and died upon treatment (Morita et al, 2000).

Likewise, incubation of oocytes with sphingosine 1phosphate, which seems to antagonize many cellular effects of ceramide, prevented the induction of death in oocytes by doxorubicin (Morita et al, 2000; Paris et al, 2002). However, at present it is unknown, whether other cytostatic drugs also involve the acid sphingomyelinase pathway to trigger death in target cells and whether ceramide-enriched membrane platforms are important in this process.

18

Cancer Therapy Vol 2, page 19

D. Ceramide and development of tumors

IV. Perspectives

Several data indicate that ceramide functions as a regulator of developmental cell death, at least in some cells. Acid sphingomyelinase-deficient mice display a defect in the developmental death of oocytes resulting in a marked increase in the number of oocytes in the ovarium at birth of the animals (Morita et al, 2000). Even at menopause the number of oocytes in acid sphingomyelinase-deficient mice still exceeds that in normal mice by approximately 10-fold. Therefore, it is interesting to note that recent data report a decrease of acid sphingomyelinase expression in some tumors. In particular, it was demonstrated that increasing malignancy of astrocytoma correlates inversely with acid sphingomyelinase expression, which was lowest in malignant glioma, i.e. astrocytoma grade IV (Riboni et al, 2002). Therefore, it is tempting to speculate that acid sphingomyelinase and ceramide balance pro-survival/progrowth and apoptosis/death signals. A reduction in the expression of the acid sphingomyelinase might be part of the transition of a normal cell into a tumor cell. Whether this hypothesis can be applied in vivo has to be proven.

The cellular ceramide concentration seems to regulate the grade of malignancy of tumors as well as the sensitivity of many tumor cells to treatment through radiation or chemotherapy. Therefore, many tumors seem to have developed strategies to reduce cellular ceramide, e.g. by downregulation of acid sphingomyelinase, glycosylation of ceramide or its de-acylation. Therefore, novel pharmacological or genetic strategies to restore or even increase the formation of ceramide or to block the consumption of this lipid in tumor cells or endothelial cells of tumor vessels may provide an opportunity to eliminate tumors by induction of apoptosis or by resensitization of the tumor to irradiation or chemotherapy.

Acknowledgments The studies were supported by DFG Gu 335/13-1 to E.G.

References Brown DA, and London E (1998) Structure and origin of ordered lipid domains in biological membranes. J Membr Biol 164, 103-114.

Budach W, Taghian A, Freeman J, Gioioso D, and Suit HD (1993) Impact of stromal sensitivity on radiation response of tumors. J Natl Cancer Inst 85, 988-993.

Cremesti A, Paris F, Grassmé H, Holler N, Tschopp J, Fuks Z, Gulbins E, and Kolesnick R (2001) Ceramide enables Fas to cap and kill. J Biol Chem 276, 23954-23961.

De Maria R, Rippo MR, Schuchman EH, and Testi R. (1998) Acidic sphingomyelinase (ASM) is necessary for fas-induced GD3 ganglioside accumulation and efficient apoptosis of lymphoid cells. J Exp Med 187, 897-902.

Fanzo JC, Lynch MP, Phee H, Hyer M, Cremesti A, Grassmé H, Norris JS, Coggeshall KM, Rueda BR, Pernis AB, Kolesnick R, and Gulbins E (2003) CD95 rapidly clusters in cells of diverse origins. Cancer Biology and Therapy 2, 392-395.

Garcia-Barros M, Paris F, Cordon-Cardo C, Lyden D, Rafii S, Haimovitz-Friedman A, Fuks Z, and Kolesnick R (2003) Tumor response to radiotherapy regulated by endothelial cell apoptosis. Science 300, 1155-1159.

Garcia-Ruiz C, Colell A, Mari M, Morales A, Calvo M, Enrich C, and Fernandez-Checa JC (2003) Defective TNF-alphamediated hepatocellular apoptosis and liver damage in acidic sphingomyelinase knockout mice. J Clin Invest 111, 197208.

Goni FM, and Alonso A (2002) Sphingomyelinases: enzymology and membrane activity. FEBS Lett. 531, 38-46.

Grassmé H, Gulbins E, Brenner B, Ferlinz K, Sandhoff K, Harzer K, Lang F, and Meyer TF (1997) Acidic sphingomyelinase mediates entry of N. gonorrhoeae into nonphagocytic cells. Cell 91, 605-615.

Grassmé H, Jekle A, Riehle A, Schwarz H, Berger J, Sandhoff K, Kolesnick R, and Gulbins E (2001a) CD95 signaling via ceramide rich membrane rafts. J Biol Chem 276, 2058920596.

Grassmé H, Schwarz H, and Gulbins E (2001b) Surface ceramide mediates CD95 clustering. Biochem Biophys Res Commun 284, 1016-1030.

Grassmé H, Jendrossek V, Bock J, Riehle A, and Gulbins E (2002) Ceramide-rich membrane rafts mediate CD40 clustering. J Immunol 168, 298-307.

Grassmé H, Jendrossek V, Riehle A, von Kürthy G, Berger J,

E. Ceramide and manipulations of the ceramide metabolism as novel treatment strategies of malignant tumors Several drugs seem to mediate cell death via an activation of the acid sphingomyelinase, the release of ceramide, and the generation of ceramide-enriched membrane platforms.

It was demonstrated that many tumors are capable of reducing cellular ceramide concentrations by conversion of ceramide to glycosyl- or lactosylceramide (Lavie et al, 1996, Michael et al, 1997; Lucci et al, 1998; Liu et al, 2001). Inhibition of glucosyltransferases, which catalyze conversion of ceramide, increased the level of ceramide in the tumor cells and resulted in the induction of cell death.

Furthermore, the inhibition of ceramide conversion amplified the effects of other cytostatic drugs on tumor cells and restored sensitivity of tumor cells to chemotherapy (Spinedi et al, 1998; Maurer et al, 2000).

This demonstrates that tumor cells can actively decrease the cellular concentration of ceramide to prevent the accumulation of ceramide upon treatment with cytostatic drugs. However, whether an inhibition of ceramide consumption could improve treatment of tumors in vivo needs to be defined.

Finally, many tumor cells respond with cell death to ceramide analogues (Selzner et al, 2001). Short chain ceramides and ceramide analogues have been shown to regulate several molecules involved in apoptosis, including small G-proteins, protein kinase C, stress activated protein kinases, NF"B, pro-apoptotic Bcl-2-like proteins, etc. Although these reagents are clearly proapoptotic in vitro, it remains to be determined whether they can be also utilized in vivo to treat tumors.

19

Gunawardena et al: Ceramide in cancer Schwarz H, Weller M, Kolesnick R, and Gulbins E (2003a) Host defense against P. aeruginosa requires ceramide-rich membrane rafts. Nat Med 9, 322-330.

Grassmé H, Cremesti A, Kolesnick R, Gulbins E (2003b) Ceramide-mediated clustering is required for CD95-DISC formation. Oncogene 22, 5457-5470.

Gulbins E, Bissonette R, Mahboubi A, Martin S, Nishioka W, Brunner T, Baier G, Baier-Bitterlich G, Byrd C, Lang F, Kolesnick R, Altman A, and Green D (1995) FAS-induced apoptosis is mediated via a ceramide-initiated Ras signaling pathway. Immunity 2, 341-351.

Haimovitz-Friedman A, Kan CC, Ehleiter D, Persaud RS, McLoughlin M, Fuks Z, Kolesnick RN (1994) Ionizing radiation acts on cellular membranes to generate ceramide and initiate apoptosis. J Exp Med 180, 525-535.

Kirschnek S, Paris F, Weller M, Ferlinz K, Riehle A, Fuks Z, Kolesnick R and Gulbins E (2000) CD95-mediated apoptosis in vivo involves acid sphingomyelinase. J Biol Chem 275, 27316-27323.

Kolesnick RN and Paley AE (1987) 1,2-Diacylglycerols, but not phorbol esters stimulate sphingomyelin hydrolysis in GH3 pituitary cells. J Biol Chem 262, 9204-9210.

Kolesnick RN, Goni FM, and Alonso A (2000) Compartmentalization of ceramide signaling. Physical foundations and biololgical effects. J Cell Physiol 184, 285300.

Lavie Y, Cao H, Bursten SL, Giuliano AE and Cabot MC (1996) Accumulation of glucosylceramides in multidrug-resistant cancer cells. J Biol Chem 271, 19530-19536.

Li YQ, Chen P, Haimovitz-Friedman A, Reilly RM, and Wong CS (2003) Endothelial apoptosis initiates acute blood-brain barrier disruption after ionizing radiation. Cancer Res 63, 5950-5956.

Liu YY, Han TY, Giuliano AE and Cabot MC (2001) Ceramide glycosylation potentiates cellular multidrug resistance.

FASEB J 15, 785-791.

Lucci A, Cho WI, Han TY, Giuliano AE, Morton DL and Cabot MC (1998) Glucosylceramide: a marker for multiple-drug resistant cancers. Anticancer Res 18, 475-480.

Maurer BJ, Melton L, Billups C, Cabot MC and Reynolds CP (2000) Synergistic cytotoxicity in solid tumor cell lines between N-(4-hydroxyphenyl)retinamide and modulators of ceramide metabolism. J Natl Cancer Inst 92 1897-1909.

Michael JM, Lavin MF and Watters DJ (1997) Resistance to radiation-induced apoptosis in Burkitt_s lymphoma cells is associated with defective ceramide signaling. Cancer Res 57, 3600-3605.

Morita Y, Perez GI, Paris F, Miranda SR, Ehleiter D, HaimovitzFriedman A, Fuks Z, Xie Z, Reed JC, Schuchman EH, Kolesnick RN and Tilly JL. (2000) Oocyte apoptosis is suppressed by disruption of the acid sphingomyelinase gene or by sphingosine-1- phosphate therapy. Nat Med 6, 11091114.

Nurminen TA, Holopainen JM, Zhao H and Kinnunen PK (2002) Observation of topical catalysis by sphingomyelinase coupled to microspheres. J Am Chem Soc 124, 12129-

12134.

Paris F, Grassmé H, Cremesti A, Zager J, Fong Y, HaimovitzFriedman A, Fuks Z, Gulbins E and Kolesnick R (2000) Natural ceramide reverses Fas resistance of acid sphingomyelinase (-/-) hepatocytes. J Biol Chem 276, 82978305.

Paris F, Fuks Z, Kang A, Capodieci P, Juan G, Ehleiter D, Haimovitz-Friedman A, Cordon-Cardo C and Kolesnick R (2001) Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice. Science 293, 293-297.

Paris F, Perez GI, Fuks Z, Haimovitz-Friedman A, Nguyen H, Bose M, Ilagan A, Hunt PA, Morgan WF, Tilly JL and Kolesnick R (2002) Sphingosine 1-phosphate preserves fertility in irradiated female mice without propagating genomic damage in offspring. Nat Med 8, 1329.

Pena LA, Fuks Z and Kolesnick RN (2000) Radiation-induced apoptosis of endothelial cells in the murine central nervous system: protection by fibroblast growth factor and sphingomyelinase deficiency. Cancer Res 60, 321-327.

Riboni L, Campanella R, Bassi R, Villani R, Gaini SM, Martinelli-Boneschi F, Viani P, and Tettamanti G (2002) Ceramide levels are inversely associated with malignant progression of human glial tumors. Glia 39, 105-113.

Santana P, Pena LA, Haimovitz-Friedman A, Martin S, Green D, McLoughlin M, Cordon-Cardo C, Schuchman EH, Fuks Z and Kolesnick R (1996) Acid sphingomyelinase-deficient human lymphoblasts and mice are defective in radiationinduced apoptosis. Cell 86,189-199.

Scheel-Toellner D, Wang K, Sing R, Majeed S, Raza K, Curnow SJ, Salmon M, Lord JM (2002) The death-inducing signalling complex is recruited to lipid rafts in Fas-induced apoptosis. Biochem Biophys Res Commun 297, 876-879.

Schüler T, Körnig S, and Blankenstein T (2003) Tumor rejection by modulation of tumor stromal fibroblasts. J Exp Med 198, 1487-1493.

Schütze S, Potthoff K, Machleidt T, Berkovic D, Wiegmann K and Krönke M (1992) TNF activates NF-kappa B by phosphatidylcholine-specific phospholipase C-induced “acidic” sphingomyelin breakdown. Cell 71, 765-776.

Selzner M, Bielawska A, Morse MA, Rudiger HA, Sindram D, Hannun YA and Clavien PA (2001) Induction of apoptotic cell death and prevention of tumor growth by ceramide analogues in metastatic human colon cancer. Cancer Res 61, 1233-1240.

Simons K, and Ikonen E (1997) Functional rafts in cell membranes. Nature 387, 569-572.

Spinedi A, Bartolomeo SD and Piacentini M (1998) Apoptosis induced by N-hexanoylsphingosine in CHP-100 cells associates with accumulation of endogenous ceramide and is potentiated by inhibition of glucocerebroside synthesis. Cell Death Differ 5, 785-791.

Zhang Y, Mattjus P, Schmid PC, Dong Z, Zhong S, Ma WY, Brown RE, Bode AM, Schmid HH and Dong Z (2001) Involvement of the acid sphingomyelinase pathway in UVAinduced apoptosis. J Biol Chem 276, 11775-11782.

20

Cancer Therapy Vol 2, page 21 Cancer Therapy Vol 2, 21-26, 2004

Cancer vaccine for brain tumors and brain tumor antigens Review Article

Masahiro Toda Department of Neurosurgery and Neuro-immunology Research Group, Keio University School of Medicine, Tokyo, Japan

__________________________________________________________________________________ *Correspondence: Masahiro Toda, MD, PhD, Department of Neurosurgery and Neuro-immunology Research Group, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan; e-mail: todam@sc.itc.keio.ac.jp Key Words: glioma, CNS, HSV, G207, DC, tumor antigen Abbreviations: antigen-presenting cells, (APCs); blood-brain barrier, (BBB); Cancer-testis, (CT); central nervous system, (CNS); cytotoxic T lymphocytes, (CTLs); dendritic cells, (DCs); herpes simplex virus type-1, (HSV-1); high mobility group, (HMG); major histocompatibility complex, (MHC); natural killer, (NK); peripheral blood mononuclear cells, (PBMCs); PHD finger protein 3, (PHF3) Received: 27 February 2004; Accepted: 15 March 2004; electronically published: March 2004

Summary Although treatment modalities for malignant gliomas have advanced remarkably, the prognosis remains poor. This has led to an intensive search for effective treatment alternatives. Recently, T cells activated by antigens from brain tumors were shown to migrate across the blood-brain barrier into the central nervous system (CNS) and selectively attack brain tumors. Then, various vaccination strategies against cancer have been attempted to induce specific immune responses against gliomas in the body outside the CNS. Encouraging results of preclinical studies of cancer vaccines against CNS tumors have led to clinical trials of these vaccines for the treatment of patients with malignant gliomas. In this review, recent progress in the use of cancer vaccines for the treatment of malignant gliomas is described, followed by a description of brain tumor antigens recognized by the immune system.

The concept of the CNS being an â&#x20AC;&#x153;immune privileged siteâ&#x20AC;? was developed from classical studies, which showed that the brain is more permissive to transplantation of allografts than other organs of the body.

In fact, antigen-presenting cells (APCs), such as dendritic cells (DCs), do not work efficiently within the CNS. Therefore, it would be theoretically difficult to present antigens within the CNS to the immune system. However, it was demonstrated in some studies that activated T cells can migrate across the blood-brain barrier (BBB) and infiltrate the brain (Wekerle, 1993; Fabry et al, 1994).

Therefore, immunotherapy has been targeted at inducing specific immune responses against brain tumors within the body outside the CNS. Recently, clinical trials of a cancer vaccine containing DCs were performed in glioma patients and the vaccine was reported to be effective in some patients (Yu et al, 2001). Although the effectiveness of this DC therapy still needs to be evaluated in future clinical trials, including Phase II trials, it is considered significant that no marked adverse effects were recognized and the safety of the vaccine for the induction of tumorspecific immunity in glioma patients has been proven. In this review, the recent advances in cancer vaccine therapy

I. Introduction The gliomas are the most common malignant tumors of the brain, and extensive invasion into the surrounding normal brain tissue is often seen because of their infiltrating nature. Despite surgical and technological progress in the treatment of central nervous system (CNS) diseases, the prognosis of patients with malignant gliomas still remains poor. With the current treatment modalities for malignant gliomas, which consist of surgical resection followed by radiation therapy and/or chemotherapy, the median survival is still less than 1 year (Prados et al, 1992). Thus, the development of new therapeutic approaches for gliomas is essential.

Vaccination against cancer using either tumor cells or tumor antigens is an active immunotherapeutic strategy that induces and/or enhances anti-tumor immunity in the patientâ&#x20AC;&#x2122;s body. This therapeutic strategy differs from passive immunotherapy, in which immune cells having antitumor activity, such as cytotoxic T lymphocytes (CTLs) and natural killer (NK) cells, are prepared in vitro and administered to cancer patients. Furthermore, specific immune responses against tumor antigens induced by cancer vaccines have been shown to be effective in the treatment of cancer patients.

21

Toda: Cancer vaccine for brain tumors against gliomas are described, followed by a discussion on the glioma antigens.

metastasis was observed. These two reports showed the beneficial clinical effects of cytokine-based vaccines against CNS tumors. However, further study will be required to define the safety and efficacy of this therapeutic strategy.

II. Cancer vaccines using tumor cells One of the rational strategies for the treatment of cancer is the stimulation of specific immune responses against the tumor antigens in vivo. Successful cancer vaccination to induce immunity against tumor antigens could lead to tumor cell destruction and prolong the survival of cancer patients. A variety of strategies have been used to enhance the antigenicity of the tumor cells, including genetically modifying the cells to secrete cytokines involved in antitumor immunity, and initiating a viral infection for the â&#x20AC;&#x2DC;xenogenizationâ&#x20AC;&#x2122; of the tumor cells.

A major advantage of these methods is that identification of the tumor antigens is not required, and theoretically, immunization with multiple tumor antigens, including tumor antigens specific for individual tumors, is possible.

B. Cancer vaccines using viruses When a tumor was infected with a leukemia virus and transplanted into syngeneic rats, the tumor grew for a while but regressed subsequently (Pelner et al, 1958).

Furthermore, when native tumor cells were transplanted into rats that had rejected the tumor, these tumor cells were eliminated. Based on this experimental evidence, the concept of tumor xenogenization by viruses was proposed.

In fact, a number of clinical trials were performed between the 1950s and 1970s, in which patients with advanced malignancies were treated with lytic viruses (Moore, 1960; Asada, 1974). However, these trials were not well controlled and the results were highly variable. One critical problem that was observed in some cases was viral toxicity. In an attempt to overcome this problem, replication-conditional mutant viruses, such as the herpes simplex virus type-1 (HSV-1) mutant G207 (Mineta et al, 1995; Markert et al, 2000), and the adenovirus mutant ONYX-015 (Bischoff et al, 1996; Khuri et al, 2000; Nemunaitis et al, 2000), were developed. These viruses could replicate within the tumor and selectively destroy only the tumor cells, and had no local or systemic toxicity, because they failed to grow within normal tissues.

Using the conditionally replicating HSV-1 mutant G207, we developed an approach for the treatment of metastatic brain tumors using a combination of viral therapy with immunotherapy. G207 replicates selectively within tumor cells and causes tumor cell destruction without local or systemic toxicity (Toda et al, 1998).

Furthermore, inoculation with G207 into tumors outside the CNS induces systemic immune responses against not only HSV, but also against the tumor antigens (Toda et al, 1999). However, the antitumor effect of inoculation with G207 into s.c. tumors as a cancer vaccine has been shown to be less effective against brain tumors than against liver or skin tumors, even though systemic immune responses to the tumor antigen were induced (Endo et al, 2002).

Similarly, it has been reported that immunization with CT26 cells expressing the hemagglutination antigen of influenza virus produces systemic antitumor immunity in various tissues, but not in the brain (Schackert et al, 1989).

These observations suggest that modification of the brain tumor and/or the immunological environment in the CNS is needed for effective immunotherapy of brain tumors.

Thus, we developed an approach for the treatment of metastatic brain tumors using a combination of oncolytic viral therapy and a cancer vaccine using G207 (Toda, 2002, 2003).

An experimental model of brain metastasis was developed using immunocompetent mice harboring both intracranial (i.c.) and s.c. syngeneic tumors (Toda et al, 2002). Intratumoral injections of G207 into both the i.c. and s.c. tumors was associated with a significant antitumor effect on the metastatic brain tumors. This therapeutic effect was absent in athymic mice, indicating that it was

A. Cancer vaccines using cytokines Transduction of genes encoding cytokines into tumor cells has been shown to result in augmentation of the immunogenic properties of brain tumors. In a large preclinical study, irradiated B16 murine melanoma cells producing murine IL-2, IL-3, IL-4, IL-6, IFN-g, or GMCSF, were administered subcutaneously as a cancer vaccine against tumors of the brain (Sampson et al, 1996).

Of the cytokine-based vaccines examined, the GM-CSFproducing cells were found to be the most effective for increasing the survival of mice with established brain tumors. A major concern with cytokine-based vaccines for CNS tumors is that they can potentially induce cerebral edema, because a high dose of IL-2 administered systemically can cause an increase in the vascular permeability, which in turn, could lead to cerebral edema (Merchant et al, 1990). In fact, severe cerebral edema was reported in animals injected intracranially with syngeneic cytokine-secreting cells (Tjuvajev et al, 1995). These findings indicate that subcutaneously administered cancer vaccines containing cytokines can be safe and effective in the treatment of CNS tumors.

While the promising preclinical results mentioned above prompted several clinical trials, to date, only isolated case reports have been published. In one case report, a patient with malignant glioma received subcutaneous (s.c.) immunization with autologous tumor cells and fibroblasts transduced with IL-2 (Sobol et al, 1995). Enhanced CD8+ CTL responses against the autologous tumor in peripheral blood mononuclear cells (PBMCs) were seen after the vaccination. The patient survived for 10 months after the first vaccination. In another case report, a patient with metastatic melanoma with brain metastasis received a vaccine of autologous melanoma cells transduced with GM-CSF (Ellem et al, 1997). In this patient, both increased anti-melanoma delayed-type hypersensitivity reactions and increased CTL responses against the tumor were seen. After the vaccination, axillary lymph node metastases regressed and an increase in cerebral edema surrounding the brain 22

Cancer Therapy Vol 2, page 23 mediated by T cells. CTL responses against HSV as well as the tumor antigen were seen in mice given the combined treatment. These results suggest that with our strategy, in which both the metastatic brain tumor and the primary tumor outside the CNS are inoculated with G207, HSV-infected brain tumors may be eliminated by the combined effects of the direct oncolysis and the induced anti-HSV and anti-tumor T cells.

For the clinical application of this therapeutic approach, various host-virus interactions, particularly immune responses, need to first be considered. By adulthood, 60-90% of the human population is seropositive for HSV-1. Pre-existing and therapeutically elicited immune responses to the virus may cooperate to enhance the efficacy of the combined treatment. G207 is currently being used in a clinical trial for the treatment of recurrent glioma, and its safety has been proven (Martuza, 2000). This reassurance opens up the possibility of using G207 for the treatment of metastatic brain tumors.

have a memory mechanism, have been shown to be important in tumor rejection in not only mouse tumor models, but also in human cancer patients. Thus, T cells are considered to play a central role in cancer vaccine therapies. So far, mainly the major histocompatibility complex (MHC)-class I binding peptides that can activate CD8-positive CTLs have been identified as tumor antigens. However, it is also necessary to identify MHCclass II binding antigen peptides that activate helper T cells for the enhancement of antitumor immune responses.

For cancer vaccines using identified tumor antigens, various forms of antigens are available, including peptides, proteins, and genes, which are concurrently used with various adjuvants. The advantage of antigen peptides is the ease with which they can be synthesized and used.

However, identification of peptides binding to a variety of MHCs is necessary. Although immunization with recombinant antigenic proteins has also been considered, quality control for clinical applications is not easy. In addition, clinical trials of cancer vaccines containing virus vectors expressing antigenic genes have been performed, based on the potential for their preparation in large quantities and induction of strong antitumor immune responses. However, the results of clinical trials have revealed certain problems, including the finding that repeated administration induces anti-virus neutralizing antibodies, which attenuates the immune response to tumor antigens. Thus, it is necessary to further evaluate which forms of tumor antigens would be appropriate for the induction of antitumor immune responses for successful treatment of cancer patients.

Since the identification, for the first time, of the MAGE-1 gene as a human tumor antigen recognized by CTLs (van der Bruggen et al, 1991), numerous human melanoma antigen genes have been identified. These antigens can be grossly classified into the following categories.

C. Cancer vaccines using dendritic cells DCs are the most potent APCs and are the only cells capable of priming na誰ve T-cells. Cancer vaccines containing DCs can be applied to cases in which specific tumor antigens are not used, such as tumor cell lysate, acid-eluted peptides from tumor cells, tumor cell-derived RNA, or fused DCs and tumor cells (Gong et al, 1997), as well as to those in which identified tumor antigens are used. Since single large-scale isolation and expansion of DCs in culture has become feasible, DC-based therapy has been successfully employed in several clinical trials for cancer, including melanoma (Thurner et al, 1999), renal cell carcinoma (Kugler et al, 2000), and prostate cancer (Lodge et al, 2000).

The first clinical trial using a DC-based cancer vaccine for glioma patients was reported by Yu et al, (2001). DCs pulsed with acid-eluted peptides from cultured autologous tumor cells were injected intradermally into the deltoid region three times biweekly.

The DC vaccination was associated with significantly increased survival, and no significant side effects or autoimmune toxicity was observed. A clinical trial using fused DC and glioma cells also showed partial responses and no serious adverse effects (Kikuchi et al, 2001). To enhance the therapeutic efficacy, another clinical trial using these fused DC cells with recombinant human IL-12 is currently under way. So far, DC-based cancer vaccines have proved to be safe. However, it is difficult to precisely determine the efficacy of the DC vaccines, because of differences in the protocol design among studies. The efficacy of the vaccines, therefore, remains to be further evaluated in randomized and controlled clinical trials.

1. Cancer-testis (CT) antigens: Cancer-testis (CT) antigens are a group of antigens that are expressed in various cancer tissues, but not in normal tissues except for the testis. The most representative of these antigens is the MAGE gene family (Boon et al, 1994). Expression of MHC molecules is extremely limited in cells of the reproductive system.

Therefore, CTLs against CT antigens do not attack reproductive system cells and instead selectively attack cancer cells. Their expression patterns make them an ideal target, and in fact, a number of clinical trials are in progress.

2. Differentiation antigens Differentiation antigens, whose expression is enhanced in tumors, although they are also expressed in the normal tissue of origin of the tumor, are recognized by CTLs. Such antigens as tyrosinase, MART-1, and gp100 that are expressed in both normal melanocytes and melanomas have been identified (Kawakami and Rosenberg, 1997). Because they are autoantigens, normal tissue can also be a target for the CTLs. These antigens are used in tumor vaccine therapies for the treatment of

III. Cancer vaccines using identified tumor antigens Since human tumor antigens recognized by T cells were identified, manipulation of immune responses against a tumor target became possible. Furthermore, T cells, which are capable of antigen-specific propagation and

23

Toda: Cancer vaccine for brain tumors melanomas, and their potential usefulness has been reported (Rosenberg, 1999).

al, 1995). The expression level of the TEGT gene, which is controlled during the process of sperm development, has been found to be high in gliomas. Although the number of analyzed cases is small, IgG responses in the serum against the TEGT antigen have been detected only in glioma patients, and not in patients with other cancers or healthy donors. Another report showed positive IgG responses in the serum to PHD finger protein 3 (PHF3) in 24 of 39 glioma patients, but not in 14 healthy donors (Struss et al, 2001). However, the reasons for the more frequent positive IgG responses to the PHF3 antigen in glioma patients than in healthy donors still remain to be clarified, because neither expression specificity nor genetic mutations have been recognized in relation to the PHF3 antigen.

The SEREX method fundamentally uses a combination of a cDNA library constructed from tumor tissue and the serum of the same patient (autoserum).

However, in order to identify CT antigens, we performed a modified SEREX method using a testis cDNA library and the sera of multiple glioma patients (allosera) (Figure 1) and identified a glioma antigen, SOX6 (Ueda et al, 2004).

3. Mutated antigens: A multitude of gene mutations are accumulated within tumor cells. Mutant peptides derived from tumorspecific genetic mutations are recognized by CTLs as tumor antigens. The mutated peptides of CDK4 and !catenin have been identified as CTL-recognized antigens (Kawakami and Rosenberg, 1997).

IV. Glioma antigens Only a few reports have been published so far concerning glioma antigens that are recognized by the immune system. Until recently, cloning of tumor antigens was mainly performed using tumor-specific CTLs. However, an attempt has been made to identify glioma antigens by SEREX (serological identification of antigens by recombinant expression cloning) (Sahin et al, 1995, 1997, 2000; Fischer et al, 2001; Okada et al, 2001; Struss et al, 2001; Behrends et al, 2003; Ueda et al, 2004).

A. Human glioma antigens identified by the SEREX method The TEGT gene was the first gene to be identified as a human glioma antigen by the SEREX method (Sahin et

Figure 1. SEREX (serological identification of antigens by recombinant expression cloning) with multiple sera from glioma patients. A testis cDNA library was constructed with the Poly (A) + RNA of adult human testis. The cDNA fragments were directionally inserted into the bacteriophage expression vector and packaged into phage particles. The phage vector was expressed in E. coli, and the colonies were transferred to nitrocellulose membranes. Mixed sera from four glioma patients were preabsorbed with transformed E. coli lysates and E. coli infected with the lambda phage, and prepared to a final dilution of 1:400 for each serum. The membranes were incubated in the diluted sera, followed by incubation with antihuman IgG (Fc) antibody. Positive plaques were picked from the plates and purified through secondary and tertiary rounds of additional screening.

24

Cancer Therapy Vol 2, page 25 SOX6, a Sry-related HMG (high mobility group) boxcontaining gene, is specifically expressed in the developing central nervous system and in the early stages of chondrogenesis in mouse embryos. Our study revealed that IgG antibodies against SOX6 were present in the sera of 12 out of 36 glioma patients (33.3%), 0 out of 14 patients with other brain disease (0%), and 1 out of 54 patients with other cancer (1.9%). No IgG responses to SOX6 were identified in the sera of any of 37 healthy individuals, except in one elderly female. RT-PCR and Northern blot analysis showed that the SOX6 gene was more highly expressed in glioma tissues than in normal adult tissues, except the testis. Furthermore, immunohistochemical analysis with anti-SOX6 antibody showed that SOX6-positive cells were detected in all the glioma tissues analyzed, but only a few positive cells were detected in nonneoplastic tissue samples from the cerebral cortex. These results indicate that the developmentally regulated transcription factor SOX6 is aberrantly expressed in gliomas and is specifically recognized by the IgGs in the sera of glioma patients.

The fact that glioma antigens recognized by IgG were identified in the patientsâ&#x20AC;&#x2122; sera suggests antigen-specific activation of T cells. To apply them to tumor vaccine therapies in the future, it would be necessary to first determine whether these identified antigens can induce or enhance glioma-specific immunity.

trials of cancer vaccines for the treatment of malignant gliomas. So far, cancer vaccine strategies appear to be safe for the treatment of brain tumors and no severe side effects have been reported. Although further feasibility studies are required, the immunotherapeutic approach is a potent strategy for specifically targeting invasive malignant gliomas within normal brain tissue.

References Asada T. (1974) Treatment of human cancer with mumps virus.

Cancer 34, 1907-1928 Behrends U, Schneider I, Rossler S, et al. (2003) Novel tumor antigens identified by autologous antibody screening of childhood medulloblastoma cDNA libraries. Int J Cancer 106, 244-251 Bischoff JR, Kirn DH, Williams A, et al. (1996) An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-376 Boon T, Cerottini JC, Van den Eynde B, et al. (1994) Tumor antigens recognized by T lymphocytes. Annu Rev Immunol 12, 337-365 Ellem KA, O'Rourke MG, Johnson GR, et al. (1997) A case report: immune responses and clinical course of the first human use of granulocyte/macrophage-colony-stimulatingfactor-transduced autologous melanoma cells for immunotherapy. Cancer Immunol Immunother 44, 10-20 Endo T, Toda M, Watanabe M, et al. (2002) In situ cancer vaccination with a replication-conditional HSV for the treatment of liver metastasis of colon cancer. Cancer Gene Ther 9, 142-148 Fabry Z, Raine CS, Hart MN. (1994) Nervous tissue as an immune compartment: the dialect of the immune response in the CNS. Immunol Today 15, 218-224 Fischer U, Hemmer D, Heckel D, et al. (2001) KUB3 amplification and overexpression in human gliomas. Glia 36, 1-10 Gong J, Chen D, Kashiwaba M, et al. (1997) Induction of antitumor activity by immunization with fusions of dendritic and carcinoma cells. Nat Med 3, 558-561 Iizuka Y, Suzuki A, Kawakami Y, et al. (2004) Augmentation of Antitumor Immune Responses by Multiple Intratumoral Inoculations of Replication-Conditional HSV and Interleukin-12. J Immunother 27, 92-98 Imaizumi T, Kuramoto T, Matsunaga K, et al. (1999) Expression of the tumor-rejection antigen SART1 in brain tumors. Int J Cancer 83, 760-764 Kawakami Y, Rosenberg SA. (1997) Human tumor antigens recognized by T-cells. Immunol Res 16, 313-339 Khuri FR, Nemunaitis J, Ganly I, et al. (2000) a controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat Med 6, 879-885 Kikuchi T, Akasaki Y, Irie M, et al. (2001) Results of a phase I clinical trial of vaccination of glioma patients with fusions of dendritic and glioma cells. Cancer Immunol Immunother 50, 337-344 Kugler A, Stuhler G, Walden P, et al. (2000) Regression of human metastatic renal cell carcinoma after vaccination with tumor cell-dendritic cell hybrids. Nat Med 6, 332-336 Lodge PA, Jones LA, Bader RA, et al. (2000) Dendritic cellbased immunotherapy of prostate cancer: immune monitoring of a phase II clinical trial. Cancer Res 60, 829833 Markert JM, Medlock MD, Rabkin SD, et al. (2000) Conditionally replicating herpes simplex virus mutant, G207

B. Glioma antigens recognized by T lymphocytes So far, no glioma-specific antigen recognized by T lymphocytes has been identified. However, it has been reported that SART1 and SART3, tumor rejection antigens against epithelial cancers, are expressed in gliomas, and that CTLs specific for the SART1 and SART3 antigens destroyed glioma cells (Imaizumi et al, 1999; Murayama et al, 2000).

We have tried to identify glioma antigens recognized

by T lymphocytes by a method of induction of tumorspecific immune responses using HSV (Iizuka et al, 2004).

We transplanted a mouse glioma cell line in syngeneic mice and administered HSV into the tumor tissue to induce CTLs specific for the mouse glioma cells. We then screened for antigenic genes using the established CTLs that specifically destroy gliomas in a MHC-restrictive fashion and identified a new mouse glioma antigen (unpublished data). The function of this molecule is not yet known, but sequence analysis revealed that genetic mutations exist in the gene isolated from the mouse glioma. A mutated peptide including one of these gene mutations has been shown to be recognized by the CTLs as a T cell epitope of a glioma antigen. We propose to analyze whether this antigen peptide can induce specific immune responses useful for the treatment of gliomas.

V. Conclusion The encouraging results from preclinical studies of immunotherapy against brain tumors have led to clinical

25

Toda: Cancer vaccine for brain tumors for the treatment of malignant glioma: results of a phase I trial. Gene Ther 7, 867-874 Martuza RL. (2000) Conditionally replicating herpes vectors for cancer therapy. J Clin Invest 105, 841-846 Merchant RE, Ellison MD, Young HF. (1990) Immunotherapy for malignant glioma using human recombinant interleukin-2 and activated autologous lymphocytes. A review of preclinical and clinical investigations. J Neurooncol 8, 173-188 Mineta T, Rabkin SD, Yazaki T, et al. (1995) Attenuated multimutated herpes simplex virus-1 for the treatment of malignant gliomas. Nat Med 1, 938-943 Moore AE. (1960) The oncolytic viruses. Prog. Exp. Tumor Res. 1, 411-439 Murayama K, Kobayashi T, Imaizumi T, et al. (2000) Expression of the SART3 tumor-rejection antigen in brain tumors and induction of cytotoxic T lymphocytes by its peptides. J Immunother 23, 511-518 Nemunaitis J, Ganly I, Khuri F, et al. (2000) Selective replication and oncolysis in p53 mutant tumors with ONYX-015, an E1B-55kD gene-deleted adenovirus, in patients with advanced head and neck cancer: a phase II trial. Cancer Res 60, 6359-6366 Okada H, Attanucci J, Giezeman-Smits KM, et al. (2001) Immunization with an antigen identified by cytokine tumor vaccine-assisted SEREX (CAS) suppressed growth of the rat 9L glioma in vivo. Cancer Res 61, 2625-2631 Pelner L, Fowler GA, Hauts HC. (1958) Effects of concurrent infections and their toxins on the course of leukemia. Acta.

Med. Scand. 338 (suppl.), 1-47 Prados M, Gutin P, Philips T. (1992) Highly anaplastic astrocytoma: review of 357 patients treated between 1977 and 1989. Int J Radiat Oncol Biol Phys 23, 3-8 Rosenberg SA. (1999) A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 10, 281-287 Sahin U, Koslowski M, Tureci O, et al. (2000) Expression of cancer testis genes in human brain tumors. Clin Cancer Res 6, 3916-3922 Sahin U, Tureci O, Pfreundschuh M. (1997) Serological identification of human tumor antigens. Curr Opin Immunol 9, 709-716 Sahin U, Tureci O, Schmitt H, et al. (1995) Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci U S A 92, 11810-11813 Sampson JH, Archer GE, Ashley DM, et al. (1996) Subcutaneous vaccination with irradiated, cytokine-producing tumor cells stimulates CD8+ cell-mediated immunity against tumors

located in the "immunologically privileged" central nervous system. Proc Natl Acad Sci U S A 93, 10399-10404 Schackert HK, Itaya T, Schackert G, et al. (1989) Systemic immunity against a murine colon tumor (CT-26) produced by immunization with syngeneic cells expressing a transfected viral gene product. Int J Cancer 43, 823-827 Sobol RE, Fakhrai H, Shawler D, et al. (1995) Interleukin-2 gene therapy in a patient with glioblastoma. Gene Ther 2, 164167 Struss AK, Romeike BF, Munnia A, et al. (2001) PHF3-specific antibody responses in over 60% of patients with glioblastoma multiforme. Oncogene 20, 4107-4114 Thurner B, Haendle I, Roder C, et al. (1999) Vaccination with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J Exp Med 190, 1669-1678 Tjuvajev J, Gansbacher B, Desai R, et al. (1995) RG-2 glioma growth attenuation and severe brain edema caused by local production of interleukin-2 and interferon-gamma. Cancer Res 55, 1902-1910 Toda M, Rabkin SD, Martuza RL. (1998) Treatment of human breast cancer in a brain metastatic model by G207, a replication-competent multimutated herpes simplex virus 1.

Hum. Gene Ther. 9, 2177-2185 Toda M, Rabkin SD, Kojima H, et al. (1999) Herpes simplex virus as an in situ cancer vaccine for the induction of specific anti-tumor immunity. Hum. Gene Ther. 10, 385-393 Toda M, Iizuka Y, Kawase T, et al. (2002) Immuno-viral therapy of brain tumors by combination of viral therapy with cancer vaccination using a replication-conditional HSV. Cancer Gene Ther 9, 356-364 Toda M. (2003) Immuno-viral therapy as a new approach for the treatment of brain tumors. Drug News Perspect 16, 223-229 Ueda R, Iizuka Y, Yoshida K, et al. (2004) Identification of a human glioma antigen, SOX6, recognized by patients' sera.

Oncogene 23, 1420-1427 van der Bruggen P, Traversari C, Chomez P, et al. (1991) A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. Science 254, 1643-1647 Wekerle H. (1993) T-cell autoimmunity in the central nervous system. Intervirology 35, 95-100 Yu JS, Wheeler CJ, Zeltzer PM, et al. (2001) Vaccination of malignant glioma patients with peptide-pulsed dendritic cells elicits systemic cytotoxicity and intracranial T-cell infiltration. Cancer Res 61, 842-847

26

Cancer Therapy Vol 2, page 27 Cancer Therapy Vol 2, 27-28, 2004

Burkitt’s lymphoma presenting with vestibulocochlear nerve involvement Case Report

Ismail Zaidan* and Anas Mugharbil1 Oncology department at Makassed General Hospital , Beirut-Lebanon

__________________________________________________________________________________ *Correspondence: Ismail Zaidan, PharmD, From the Oncology department at Makassed General Hospital , Beirut-Lebanon e-mail: zaidanismael@hotmail.com 1 Anas Mugharbil, M.D., Chief of medical staff at Makassed General Hospital, Beirut-Lebanon Key Words: Burkitt’s lymphoma, vestibulo-cochlear, central nervous system Abbreviations: central nervous system, (CNS); magnetic resonance imaging, (MRI); white blood cells (WBC) Received: 1 March 2004; Accepted: 26 March 2004; electronically published: March 2004

Summary Most patients with Burkitt’s lymphoma present with peripheral lymphadenopathy or an intra-abdominal mass. The disease is rapidly progressive and has a propensity to metastasize to the central nervous system (CNS). In this article, we report a case of Burkitt’s lymphoma that presented with focal deficit involving the eighth cranial nerve.

To our knowledge, this is the first case of eighth cranial nerve involvement as the presenting sign of Burkitt’s lymphoma. apical dyskinesia with a left ventricular ejection fraction of 38%.

Two days after admission, the patient’s blood pressure was controlled. However, his hearing deteriorated dramatically and he became totally deaf. Also, his platelet count decreased precipitously to 11,000/mm3. Medical investigation was directed to explain the rapidly progressive changes in clinical and laboratory findings.

Initially, drug induced hearing damage was suspected, but none of his medications was found to cause hearing loss.

The laboratory findings of low platelet count, increased LDH and abnormal peripheral smear triggered his physician to recommend bone marrow aspirate and biopsy to rule out a malignant process. Biopsy showed diffuse infiltration of marrow spaces by monomorphous cell population with one or two conspicious nucleoli and deeply basophilic cytoplasm with abundant vacuolization; mitosis was frequent.

Morphology and immunohistochemical staining were consistent with Burkitt’s lymphoma. The diagnosis of Burkitt’s lymphoma with CNS (particularly vestibulo-cochlear cranial nerve) involvement was suspected. However, no lumbar puncture was done since the patient had severe thrombocytopenia and could develop epidural hemorhage. The patient was provided with supportive care and flew back home for further management of his malignant hematologic disorder. Two weeks later the patient passed away, after receiving an unknown chemotherapy.

I. Case report A 67-year-old male HIV (human immunodefficiency virus) negative ex-smoker patient was admitted with chief complaint of vertigo, uncontrolled blood pressure, dyspnea, and bilateral decreased hearing of few days duration. His past medical history included diabetes mellitus (type II), hypertension, and ischemic heart disease. His daily medication profile included: doxazocin 2 mg, losartan 50 mg, lansoprazole 30 mg, ticlopidine 250 mg, and chlorpropamide 125 mg combined with fenformin 30 mg.

The physical exam was significant for elevated blood pressure (190/100 mmHg), slurred and slow speech and bilateral markedly decreased hearing. There was no lymphadenopathy , hepatosplenomegaly , or neck stiffness. Laboratory studies showed thrombocytopenia (95,000/mm3;normal 150,000-400,000/mm3), elevated (white blood cells) WBC (13,750/ mm3 ;normal 5,00010,000/ mm3 ) , abnormal peripheral smear (nucleated red blood cells, metamyelocytes), hyperuricemia (16 mg/dl, normal levels 2.4-7.5 mg/dl), increased lactate dehydrogenase (9,430 U/L; normal levels 50-240 U/L) , and elevated serum creatinine (1.9 mg/dl; normal levels 0.8-1.2 mg/dl). CT–scan (computed tumography) and MRI (magnetic resonance imaging) of the brain, chest x-ray and ultrasound of abdomen were all normal. Echocardiography demonstrated mitral and aortic regurgitation along with

27

Zaidan and Mugharbil: Burkitt’s lymphoma with vestibulo-cochlear nerve involvement

II. Discussion

References Bomfim da paz R, Kolmel HW. (1992) Meningitis with Burkitt like B-cell lymphoma in HIV infection. J Neuroncol 13, 7379.

Grassi MA, Lee AG (2002) Lymphomatous meningitis of Burkitt type presenting with multiple cranial neuropathies.

Am J Ophthalmol 133, 424-425.

Magrath I. (1990) The pathogenesis of Burkitt’s lymphoma. Adv Cancer Res 55, 132-270.

Michael T,Grgory BK, Robert SH, Faramarz N (1980) Burkitt’s lymphoma with cranial nerve involvement. Arch Ophthalmol 98, 2015-2017.

Pal L,Valli ER, Santosh V, Menon A,Veerendrakumar M, Nagaraja D, Das S, Shankar SK. (1995) Disseminated Burkitt’s lymphoma presenting as multiple cranial nerve palsies. Indian J Cancer 32,116-120.

Ziegler JL, Miner RC, Rosenbaum E, et al (1982) Outbreak of Burkitt’s like lymphoma in homosexual men. Lancet 2, 631633.

In 1958, Burkitt described a mandibular malignancy in African children that later proved to be non-cleaved B cell lymphoma (Magrath, 1990). The increasing frequency of AIDS and immunosuppressive therapy has lead to increase incedence of nonendemic Burkitt’s lymphoma (Ziemler et al, 1982). In such cases, extranodal involvement with ultimate CNS involvement is common (Bomfim da paz and Kolmel, 1992).

Literature review showed that many cases of Burkitt’s lymphoma with optic nerve involvement were reported. In such cases, diplopia was found to be the initial manifestation (Grassi and Lee, 2002). In some cases, patients presented with multiple cranial nerve palsies (Pal et al, 1995). Bone marrow involvement, initial CNS manifestation and older age at diagnosis all speak for a poor prognosis (Michael et al, 1990). All these factors were present in our patient. Our case illustrates that abrupt change in cranial nerve function and other neurologic findings indicate the need for vigorous investigation.

To our knowledge, this is the first case of Burkitt’s lymphoma to be reported with suspected eighth cranial nerve involvement. The early diagnosis of Burkitt’s lymphoma is crucial since it is the most rapidly progressive human tumor and any delay in initiating therapy can adversely affect the patient’s outcome.

Dr. Ismail Zaidan

28

Cancer Therapy Vol 2, page 29 Cancer Therapy Vol 2, 29-38, 2004

Matrix metalloproteinases in multiple myeloma Review Article

Els Van Valckenborgh, Kewal Asosingh, Ivan Van Riet, Ben Van Camp and Karin Vanderkerken* Department of Hematology and Immunology, Vrije Universiteit Brussel (VUB), Brussels, Belgium

__________________________________________________________________________________ *Correspondence: Dr. Karin Vanderkerken, Vrije Universiteit Brussel, Department HEIM, Laarbeeklaan 103, B-1090 Brussels, Belgium; Phone: 0032 2 477 44 18; Fax: 0032 2 477 44 05; E-mail: Karin.Vanderkerken@vub.ac.be Key Words: matrix metalloproteinases, multiple myeloma, angiogenesis, homing, osteolytic bone disease Abbreviations: bone marrow (BM); bone marrow stromal cells (BMSCs); 1.25-dihydroxyvitamin D3, ([1.25(OH)2VitD3]); extracellular matrix (ECM); glycosylphosphatidylinositol (GPI); hepatocyte growth factor (HGF); human umbilical vein endothelial cells (HUVECs); insulin-like growth factor-1 (IGF-1); Interleukin-6 (IL-6); matrix metalloproteinases (MMPs); monoclonal gammopathy of unknown significance, (MGUS); Multiple myeloma (MM); Oncostatin M (OSM); tissue inhibitors of matrix metalloproteinases (TIMPs); transforming growth factor-!‚ (TGF-!); tumor necrosis factor-" (TNF-") Received: 30 March 2004; Accepted: 5 April 2004; electronically published: April 2004

Summary Multiple myeloma is a B-cell malignancy characterized by the monoclonal proliferation of plasma cells in the bone marrow, the presence of monoclonal immunoglobulins in the serum, the development of osteolytic lesions and the induction of angiogenesis. Matrix metalloproteinases are described as endopeptidases and are known to be involved in cancer development. Formerly, it was believed that the enzymes were only important in the degradation of extracellular matrix components. However, new substrates have been discovered making the functions of matrix metalloproteinases extended and complex. Here, an overview has been given about the expression and regulation of matrix metalloproteinases in multiple myeloma. With the literature we demonstrate that the enzymes are involved in tumor growth, angiogenesis, homing and the development of osteolytic lesions, all important events in the progression of multiple myeloma. approaches to therapy and better treatments of patients. An interesting target are the matrix metalloproteinases (MMPs). It has been suggested that matrix metalloproteinases are involved in a number of events underlying MM progression. This review focuses on the expression, regulation and the role of MMPs in MM disease.

I. Introduction Multiple myeloma (MM) is a B-cell malignancy with several specific characteristics. Our group has demonstrated the postgerminal origin of MM cells (Bakkus et al, 1992). These cells migrate from the intravascular to the extravascular compartment of the bone marrow (BM), a process called “homing”. In the BM, the myeloma cells receive signals from the microenvironment essential for survival and growth leading to the accumulation of the tumor cells in the BM. The malignant plasma cells produce a monoclonal immunoglobulin that can be detected in the serum of patients and can be used to follow the development of the disease. Osteoclastactivating factors and angiogenic factors, produced by MM cells and the BM environment, result in the induction of osteolytic lesions and the formation of new blood vessels (angiogenesis). In advanced stages of the disease, tumor cells can be observed in the peripheral blood and at extramedullary sites. Symptoms of MM are kidney problems, bone pain especially in the back or ribs, fatigue and recurrent infections. Despite a lot of research and progress in treatment, the disease remains incurable. More understanding of the biology of MM can lead to new

II. Matrix metalloproteinases Matrix metalloproteinases are a family of zincdependent endopeptidases involved in physiological (embryogenesis and wound healing) (Matrisian, 1990) and pathological (multiple sclerosis, rheumatoid arthritis and cancer) tissue degradation (Jackson et al, 2001; Lindberg et al, 2001; Vihinen and Kähäri, 2002). More than 20 members of the human MMP family are known. They are able to degrade structural components of the extracellular matrix (ECM) (reviewed by Sternlicht and Werb, 2001 and Vihinen and Kähäri, 2002). New substrates, like growth factors (GF), GF binding proteins, GF receptors, adhesion molecules, chemokines and inhibitors, have been discovered, making the functions of MMPs diverse and complex. They cannot only regulate migration and 29

Van Valckenborgh et al: Matrix metalloproteinases in multiple myeloma invasion, but also cell growth, differentiation, angiogenesis and metastasis (Chang and Werb, 2001; Egeblad and Werb, 2002). Formerly, the members of the family were divided into subgroups depending on their substrate specificity (collagenases, gelatinases,

stromelysines and membrane-type MMPs). Because of the growing list of substrates, all MMPs are given a number and can be classified according to their structure (Egeblad and Werb, 2002).

Table 1: The human MMP family and their new substrates Structural class Minimal domain

Enzyme names MMP-7 (matrilysin)

Simple hemopexin domain

MMP-26 (matrilysin-2) MMP-1 (collagenase-1)

New substrates "1-PI, "1-AT, !4 integrin, FasL, TNF-", plasminogen, TFPI, Ecadherin, OPN, IgG, CTGF, syndecan-1, fibrinogen IGFBP-1, "1-PI, fibrinogen "1-AT, TFPI, CTGF, MCP-1, -2, -3 and -4, SAA, IGFBP-3, IL1!, AFP, SDF-1, MBL, "1-AC, "2-M, "1-PI, C1q, fibrinogen, TNF-" "1-AT, OPN, E-cadherin, IgG, CTGF, MCP-1, -2, -3 and -4, SAA3, IGFBP-3, IL-1!, SDF-1, HB-EGF, FasL, MBL, uPA, plasminogen, PAI-1, " (2)-antiplasmin, fibrinogen, "1-AC, "2M, "1-PI, C1q, TNF-" "1-AT, TFPI, MBL, CXCL-6, CXCL-9, CXCL-10, fibrinogen, "2-M, "1-PI, C1q Fibrinogen Fibrinogen, factor XII, plasminogen, apolipoprotein, uPAR, MBP, "1-AT, pro-TNF, TFPI, "2-M, "1-PI CTGF, MCP-3, SDF-1, factor XII IGFBP-3 Amelogenin MCP-3, IGFBP-3, IL-1!, SAA, AFP, FGFR1, plasminogen, big endothelin-1, SDF-1, LTBP1, MBL, KiSS-1, "1-AC, "1-PI, C1q, fibrinogen, proTGF-!, proTNF-" "1-AT, plasminogen, TFPI, IL-1!, SDF-1, LTBP1, IL-8, CXCL6, CXCL-5, MBP, substance P, IGFBP-3, MBL, KiSS-1, "Bcrystallin, CXCL-9, CXCL-10, "2-M, "1-PI, C1q, fibrinogen, proTGF-!, proTNF-" "1-PI, IGFBP, "2-M

MMP-3 (stromelysin-1)

MMP-8 (collagenase-2) MMP-10 (stromelysin-2) MMP-12 (metalloelastase)

Gelatin-binding

MMP-13 (collagenase-3) MMP-19 MMP-20 (enamelysin) MMP-2 (gelatinase A)

MMP-9 (gelatinase B)

Furin-activated secreted Vitronectin-like insert Transmembrane

GPI-linked Type II transmembrane

MMP-11 (stromelysin-3) MMP-28 (epilysin) MMP-21 MMP-14 (MT1-MMP) MMP-15 MMP-16 MMP-24 MMP-17 MMP-25 MMP-23

"1-AT "2-M, "1-PI, SDF-1, MCP-3, KiSS, factor XII, MBL, pro-"v integrin, gC1qR, syndecan-1, CD44, tTG, fibrinogen, proTNF-" tTG KiSS-1, syndecan-1, tTG KiSS-1 pro-TNF-"

(MT2-MMP) (MT3-MMP) (MT5-MMP) (MT4-MMP) (MT6-MMP)

Based on Sternlicht and Werb, 2001; Egeblad and Werb, 2002 and additional references: Winyard et al, 1991; Michaelis et al, 1992; Mitchell et al, 1993; Proost et al, 1993; Fowlkes et al, 1994; Sires et al, 1994; Chandler et al, 1996; Levi et al, 1996; Llano et al, 1997; Suzuki et al, 1997; von Bredow et al, 1997; Ugwu et al, 1998; Edelstein et al, 1999; Ma単es et al, 1999; Fernandez-Patron et al, 1999; Powell et al, 1999; Belaaouaj et al, 2000; English et al, 2000; Lijnen et al, 2000, 2001; McQuibban et al, 2000, 2001, 2002; Van Den Steen et al, 2000, 2003a, 2003b; Agnihotri et al, 2001; Belkin et al, 2001; Matsuno et al, 2001; Stix et al, 2001; Andolfo et al, 2002; Butler et al, 2002; Cunningham et al, 2002; Dallas et al, 2002; Deryugina et al, 2002; Gearing et al, 2002; Hashimoto et al, 2002; Li et al, 2002; Park et al, 2002; Rozanov et al, 2002; Endo et al, 2003; Marchenko et al, 2003; Sadowski et al, 2003; Starckx et al, 2003; Takino et al, 2003; Nakamura et al, 2004.

Abbreviations: "1-PI: "1-protease inhibitor; "1-AT: "1-antitrypsin; TNF: tumor necrosis factor; TFPI: tissue factor pathway inhibitor; OPN: osteopontin; CTGF: connective tissue growth factor; IGFBP: insulin-like growth factor-binding protein; MCP: monocyte chemoattractant protein; SAA: serum amyloid A; IL: interleukin; AFP: amyloid fibril protein; SDF: stromal cell-derived factor; MBL: mannose-binding lectin; "1-AC: "1-antichymotrypsin; "2-M: "2-macroglobulin; HB-EGF: heparin-binding epidermal growth factorlike growth factor; uPA: urokinase-type plasminogen activator; PAI: plasminogen activator inhibitor; uPAR: urokinase plasminogen activator receptor; MBP: myelin basic protein; FGFR: fibroblast growth factor receptor; LTBP: latent TGF-beta-binding protein; TGF: transforming growth factor; tTG: tissue transglutaminase.

30

Cancer Therapy Vol 2, page 31 from the 5T33MM mouse model (Van Valckenborgh et al, 2002a). MMP-2 was not secreted by these cells. On the contrary, Vacca et al. were also able to detect MMP-2 in the human MM cell line U266 (1998) and bone marrow plasma cells from MM patients (1999). MMP-2 and -9 are gelatinases and belong to the gelatin-binding MMPs. MMP-7, a minimal domain MMP, has a large number of substrates and is produced by human MM cell lines and MM cells from patients (Barillé et al, 1999). Interestingly, MMP-2, -7 and -9 are involved in several processes in cancer, like tumor growth, angiogenesis, invasion and metastasis (Powell et al, 1993; Watanabe et al, 1993; Hua and Muschel, 1996; Deryugina et al, 1997; Wilson et al, 1997; Hasegawa et al, 1998; Itoh et al, 1998; Itoh et al, 1999; Nishizuka et al, 2001; Huang et al, 2002). The expression of MMP-8 and -13 has also been investigated and detected in the human MM cell line RPMI 8226 and malignant plasma cells from plasmacytomas (Wahlgren et al, 2001). Our group was able to detect MMP-8 and -13 by RT-PCR in 5T2MM-diseased bone marrow cells (Van Valckenborgh et al, 2003). MMP-8 and -13 are collagenases belonging to the structural group of the simple hemopexin-domain containing MMPs. The enzymes are expressed in several cancers and it is suggested that they are involved in invasion (Pendás et al, 2000; Kim et al, 2001; Ala-Aho et al, 2002; Moilanen et al, 2002). However, their possible role in the different processes in tumor progression is not yet defined. Since the bone marrow stromal microenvironment is involved in the development of MM, it appears important to investigate the production of MMPs in bone marrow stromal cells (BMSCs). BMSCs secrete MMP-2 and MMP-1 (Barillé et al, 1997). Endothelial cells (ECs) isolated from MM patients were compared with human umbilical vein endothelial cells (HUVECs). MMECs secreted more (3-4 times higher) active MMP-2 and -9 than HUVECs (Vacca et al, 2003). Figure 1 gives an overview of the expression of MMPs in MM.

The MMPs can be divided into 8 structural groups: minimal-domain MMPs, simple hemopexin-domaincontaining MMPs, gelatin-binding MMPs, furin-activated secreted MMPs, vitronectin-like insert MMPs, transmembrane MMPs, glycosylphosphatidylinositol (GPI)-anchored MMPs and type II transmembrane MMPs. Enzymes belonging to the first 5 groups are secreted, the others are membrane-type MMPs. Table 1 gives an overview of the human MMP family and their new substrates.

The production of MMPs can be regulated at different levels. The transcription is under control of several cytokines, growth factors and tumor promoters.

The enzymes are synthesized as inactive proenzymes and are activated by proteolytic cleavage of the propeptide domain, where the cysteine residue in the conserved sequence interacts with the zinc ion in the catalytic domain. Activation of MMPs can be achieved by interaction with other active MMPs or proteinases from the plasminogen/plasmin system. The activity of MMPs can be inhibited by endogenous inhibitors with the most important tissue inhibitors of matrix metalloproteinases (TIMPs). At this moment, four TIMPs have been described. The balance between active MMPs and TIMPs determines the net proteolytic activity of MMPs. This equilibrium is highly regulated in normal tissue remodeling, but is disturbed in pathological conditions.

III. Matrix metalloproteinases in multiple myeloma: expression, regulation and activation A. Expression of MMPs in MM Several groups reported the expression of MMPs in MM cells. The production of MMP-9 has been demonstrated in purified myeloma cells isolated from MM patients (Barillé et al, 1997) and 5T33MM cells isolated

Figure 1. The secretion of MMPs by multiple myeloma (MM) cells, bone marrow stromal cells (BMSCs) and endothelial cells (ECs) in multiple myeloma-diseased bone marrow.

31

Van Valckenborgh et al: Matrix metalloproteinases in multiple myeloma Expression of MMPs has also been investigated in other hematological malignancies. MMP-2 and -9 are the most studied and one or both enzymes seems to be produced by leukemia and lymphoma cells (Van Ranst et al, 1991; Ries et al, 1996, 1999; Devy et al, 1997; Kossakowska et al, 1998; Vacca et al, 1998).

upregulation can be inhibited by a neutralizing anti-"v!3 antibody (Ria et al, 2002).

3. Syndecan-1 It has been described that syndecan-1 is involved in the regulation of MMP-9. Syndecan-1 is a transmembrane heparan sulfate proteoglycan able to inhibit cell invasion, mediate cell-cell adhesion and regulate cell growth.

Expression of syndecan-1 on the surface of MM cells downregulates MMP-9 production (Kaushal et al, 1999).

Interestingly, syndecan-1 is shed from the surface of myeloma cells and it has been suggested that a nonmatrix-type metalloproteinase, like ADAM (a disintegrin and metalloproteinase) is responsible for this process (Holen et al, 2001). A recent report demonstrated that soluble syndecan-1 promotes MM growth in vivo and enhances invasion (Yang et al, 2002). Inhibition of the shedding of syndecan-1 might decrease MMP-9 production by MM cells and might decrease MM progression.

B. Regulation of MMPs in MM The expression of MMPs can be regulated by cytokines, hormones, growth factors, cell-matrix and cellcell interactions.

1. Cytokines and hormones Several cytokines are involved in the pathogenesis of MM. Therefore, it is interesting to investigate the role of these cytokines in the regulation of MMPs. Interleukin-6 (IL-6), Oncostatin M (OSM), IL-1, tumor necrosis factor" (TNF-"), transforming growth factor-!‚ (TGF-!) and IL-10 were not able to regulate MMP-2 and MMP-9 production in respectively BMSCs and MM cells (Barillé et al, 1997). Dexamethasone and 1.25(OH)2VitD3, which can inhibit myeloma cell growth, did not regulate MMP-2 and -9. MMP-1 on the other hand is upregulated by OSM, IL-1! and TNF-" and downregulated by dexamethasone (Barillé et al, 1997). The receptor for IL-6 consists of a signal-transducing molecule IL-6R! and a specific ligandbinding protein IL-6R". This molecule can be found on the membrane, but also exists in a soluble form, sIL-6R".

The latter molecule (sIL-6R") is able to significantly increase MMP-1 and MMP-2 production by BMSCs (Barillé et al, 2000).

C. Activation of MMPs in MM Most of the MMPs are secreted as inactive proenzymes and are activated extracellularly by proteolytic cleavage. Interaction of MMPs with each other can lead to their activation. MMP-7, secreted by MM cells, is responsible for the activation of MMP-2 produced

by BMSCs (Barillé et al, 1999). The uPA/plasmin system is also involved in MMP activation (Werb et al, 1977).

This was demonstrated with leukemia cells which produce significant amounts of proMMP-9. Activation was achieved by adding plasminogen to the leukemia cells (Devy et al, 1997). uPA converts plasminogen to plasmin which in turn can activate MMPs. Recent results indicate that uPA is expressed by myeloma cells (Hjertner et al, 2000; Asosingh et al, 2002). Addition of plasminogen to proMMP-9 secreting 5T33MMvivo cells resulted in the activation of proMMP-9 (unpublished observations).

2. Bone marrow microenvironment MM cells are in contact with the bone marrow microenvironment. Cocultures of MM cells with BMSCs is a way to investigate the role of the BM microenvironment in the regulation of MMPs. MMP-1 production by BMSCs is upregulated in response to MM cells and also MMP-9 production is slightly increased in cocultures (Barillé et al, 1997).

The BM microenvironment is a complex structure of various extracellular components and many cell types. BM endothelial cells are the first cells encountered by the MM cells upon entry into the BM environment from the blood circulation. Interaction of BMECs with MM cells induces MMP-9 expression in MM cells. This was demonstrated in the 5T33MM mouse model (Van Valckenborgh et al, 2002a) and in human MM cells (Vande Broek et al, 2004).

This is similar in T lymphoma where MMP-9 secretion was enhanced following coculture of lymphoma cells and ECs and where the role of ICAM-1/LFA-1 was evidenced in this upregulation (Aoudjit et al, 1998). However, in MM, it was demonstrated that hepatocyte growth factor (HGF) was involved in the induction of MMP-9 (Vande Broek et al, 2004).

MM cells express the integrin "v!3 which can bind to ECM proteins present in the BM, like vitronectin and fibronectin. MM cells incubated with VN and FN resulted in an increased release of MMP-2 and MMP-9. This

IV. The role of matrix metalloproteinases in multiple myeloma A. MMPs and tumor growth Several reports demonstrated that treatment with MMP inhibitors resulted in a significant decrease of tumor growth (Koivunen et al, 1999; Matsushita et al, 2001; Winding et al, 2002). This suggests that MMPs can generate growth-promoting signals. Two important growth factors in MM are IL-6 and insulin-like growth factor-1 (IGF-1). It has been described that the specific ligandbinding protein of the receptor for IL-6, IL-6R", is released from MM cells by proteolytic cleavage (Thabard et al, 1999). Soluble IL-6R" binds to IL-6 leading subsequently to an increased proliferation of MM cells.

IGFBPs regulate the bioavailability of IGF by binding the growth factor and are described, especially IGFBP-3, as one of the new substrates of MMPs (see Table 1). Serum levels of IGFBP-3 are decreased in MM patients, suggesting that the protein is cleaved (Standal et al, 2002).

32

Cancer Therapy Vol 2, page 33 Shedding of IGFBPs might increase the amount of bioavailable IGF-1 resulting in increased tumor growth. It is not yet known which enzyme is responsible for the shedding of IL-6R and IGFBP-3 in MM. It has been suggested that members of the ADAM family might be responsible for the cleavage of growth factors (Hargreaves et al, 1998; Standal et al, 2002). Interesting to investigate is whether inhibiting the process of shedding might result in the inhibition of MM progression. Treatment of 5T2MM-diseased mice with the broadspectrum MMP inhibitor SC-964 resulted in a decreased number of tumor cells in the BM compared to vehicle treated animals (Van Valckenborgh et al, 2003). A minor effect of SC-964 on the proliferation of tumor cells has been demonstrated by 3 H-thymidine incorporation (unpublished observations).

9 in invasion, the last step of homing. The upregulation of MMP-9 after interaction of MM cells with BMECs also indicates that MMP-9 might play a role in the homing process (Van Valckenborgh et al, 2002a; Vande Broek et al, 2004).

D. MMPs and osteolytic bone disease in MM An important characteristic of MM is the development of osteolytic lesions. MMPs play a role in normal bone remodeling. MMPs are involved in osteoclast recruitment to sites of bone remodeling (Sato et al, 1998) and the enzymes can degrade mineralized bone matrix (Holliday et al, 1997; Everts et al, 1998). In several cancers, the use of MMP inhibitors have clearly evidenced a role of MMPs in osteolytic bone disease. In the SCIDhuman model of prostate cancer metastasis, treatment with a broadspectrum MMP inhibitor batimastat prevented mineralized trabeculae degradation in vivo and reduced the number of osteoclasts on trabecular surfaces (Nemeth et al, 2002). Also in breast cancer, MMP inhibitors inhibited the development of osteolytic lesions in mice (Lee et al, 2001; Winding et al, 2002). Collagen I is a major constituent of the bone and can be degraded by collagenases like MMP-1, -8 and -13. The denatured collagen I becomes a substrate for MMP-2 and -9. Our group performed a study to investigate the role of MMPs in the development of osteolytic bone disease in MM. Treatment of 5T2MM-diseased mice with the MMP inhibitor SC-964 resulted in a significant decrease in the number of osteolytic lesions and the prevention of cancellous bone loss induced by the presence of 5T2MM cells (Van Valckenborgh et al, 2003). Other evidence suggesting the role of MMPs in osteolytic bone disease is the inhibition of MMPs by biphosphonates. These are used as therapy in MM for preventing bone resorption.

Zoledronate significantly inhibits MMP-1 secretion by BMSCs, but strongly upregulates MMP-2 production (Derenne et al, 1999). Clodronate can inhibit in vitro the activities of several MMPs, like MMP-2, -9, -13 and MT1MMP (Teronen et al, 2000).

B. MMPs and angiogenesis Angiogenesis is the formation of new blood vessels and in solid tumors it has been demonstrated that it is required for tumor growth. Like in solid tumors, it has been demonstrated that neovascularization is enhanced in MM (Vacca et al, 1994; Van Valckenborgh et al, 2002b).

MMPs are involved in the different processes of angiogenesis, like proteolysis of the ECM, migration of ECs and the release of angiogenic factors from the ECM (Moses, 1997). Vacca et al (1999) demonstrated a larger microvessel area and a higher secretion of MMP-2 and -9 in patients with active MM than in those with nonactive MM, MGUS (monoclonal gammopathy of unknown significance) of or control subjects. ECs isolated from the bone marrow of MM patients produce a higher level of MMP-2 and -9 compared to HUVECs (Vacca et al, 2003).

Treatment of MM-diseased mice with the broadspectrum MMP inhibitor SC-964 resulted in an almost complete inhibition of angiogenesis (Van Valckenborgh et al, 2003).

This was confirmed in the rat aortic ring assay where the outgrowth of blood vessels was significantly decreased with the MMP inhibitor SC-964 (unpublished observations). It has to be elucidated whether selective targeting of the enhanced neovascularisation in MM results in a protective effect against MM disease.

C. MMPs and homing of MM cells

V. Natural inhibitors in multiple myeloma

MM cells home from the intravascular to the extravascular compartment of the bone marrow. This is a multistep process consisting of adhesion of myeloma cells to the ECs followed by chemoattraction and migration through the endothelium and invasion through the basement membrane into the BM. In a recent report, the differential homing capacity of CD45- and CD45+ MM cells was investigated in the 5TMM mouse model (Asosingh et al, 2002). CD45- MM cells have a decreased homing capacity compared to CD45+ MM cells. This could be due to the higher MMP-9 secretion by CD45+ compared to CD45- cells which secrete little or no MMP9. Further experiments revealed a significant lower invasive capacity of CD45- MM cells compared to CD45+ MM cells. Treatment of the 5TMM cells with the gelatinase inhibitor EGCG resulted in the inhibition of invasion and thus demonstrated the involvement of MMP-

TIMPs are the natural inhibitors of MMPs, but it has been suggested that they are multifunctional. There have been 4 TIMPs described and they are called TIMP-1, -2, 3 and -4. There is some controversy on the functions of TIMPs in cancer development. Because they are able to inhibit MMPs, it was believed that they could inhibit tumor growth, invasion, angiogenesis and metastasis.

Several studies confirm this hypothesis (Ahonen et al, 1998; Hajitou et al, 2001; Bloomston et al, 2002; Spurbeck et al, 2002; Ikenaka et al, 2003). However, it has also been demonstrated that high TIMP levels in certain types of malignant tumors in humans are associated with poor outcome (Curran and Murray, 1999; McCarthy et al, 1999). This could be due to the multifunctional role of TIMPs. TIMP-1 and -2 are able to stimulate the growth of

33

Van Valckenborgh et al: Matrix metalloproteinases in multiple myeloma several cells (Docherty et al, 1985; Hayakawa et al, 1992, 1994; Gomez et al, 1997) and TIMP-2 has been described to be involved in the activation of proMMP-2 (HernandezBarrantes et al, 2000). TIMP-3 possesses pro-apoptotic capacity (Ahonen et al, 1998; Baker et al, 1999), whereas TIMP-1 have anti-apoptotic effects on certain cell types (Guedez et al, 1998; Li et al, 1999). Recently, DNA array demonstrated a higher level of TIMP-1 and the same level of TIMP-2 in the MMECs compared to the HUVECs (Vacca et al, 2003). This is the only report where TIMPs were investigated in MM. More research is necessary to find out more about the expression and role of TIMPs in MM disease.

Neovastat is an orally bioavailable extract from shark cartilage able to inhibit the activity of MMP-2, -9, 12 and -13 and has also been described to be antiangiogenic. A phase II clinical trial is going on to evaluate the efficacy of neovastat as monotherapy treatment for patients with MM not responding to standard therapies (Vihinen and Kähäri, 2002).

References Agnihotri R, Crawford HC, Haro H, Matrisian LM, Havrda MC, Liaw L (2001) Osteopontin, a novel substrate for matrix metalloproteinase-3 (stromelysin-1) and matrix metalloproteinase-7 (matrilysin). J Biol Chem. 276, 28261-7 Ahonen M, Baker AH, Khähäri VM (1998) Adenovirusmediated gene delivery of tissue inhibitor of metalloproteinases-3 inhibits invasion and induces apoptosis in melanoma cells. Cancer Res. 58, 2310-5 Ala-Aho R, Johansson N, Baker AH, Kähäri VM (2002) Expression of collagenase-3 (MMP-13) enhances invasion of human fibrosarcoma HT-1080 cells. Int J Cancer 97, 283-9 Andolfo A, English WR, Resnati M, Murphy G, Blasi F, Sidenius N (2002) Metalloproteases cleave the urokinasetype plasminogen activator receptor in the D1-D2 linker region and expose epitopes not present in the intact soluble receptor. Thromb Haemost. 88, 298-306 Aoudjit F, Potworowski EF, St-Pierre Y (1998) Bi-directional induction of matrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1 during T lymphoma/endothelial cell contact: implication of ICAM-1.

J Immunol. 160,2967-73 Arlt M, Kopitz C, Pennington C, Watson KL, Krell HW, Bode W, Gansbacher B, Khokha R, Edwards DR, Krüger A (2002) Increase in gelatinase-specificity of matrix metalloproteinase inhibitors correlates with antimetastatic efficacy in a T-cell lymphoma model. Cancer Res. 62, 5543-50 Asosingh K, Menu E, Van Valckenborgh E, Vande Broek I, Van Riet I, Van Camp B, Vanderkerken K (2002) Mechanisms involved in the differential bone marrow homing of CD45 subsets in 5T murine models of myeloma. Clin Exp Metastasis 19, 583-91 Baker AH, George SJ, Zaltsman AB, Murphy G, Newby AC (1999) Inhibition of invasion and induction of apoptotic cell death of cancer cell lines by overexpression of TIMP-3. Br J Cancer 79, 1347-55 Bakkus MHC, Heirman C, Van Riet I, Van Camp B, Thielemans K (1992) Evidence that multiple myeloma Ig heavy chain VDJ genes contain somatic mutations but show no intraclonal variation. Blood 80, 2326-35 Barillé S, Akhoundi C, Collette M, Mellerin MP, Rapp MJ, Harousseau JL, Bataille R, Amiot M (1997) Metalloproteinases in multiple myeloma: production of matrix metalloproteinase-9 (MMP-9), activation of proMMP2, and induction of MMP-1 by myeloma cells. Blood 90, 1649-55 Barillé S, Bataille R, Rapp MJ, Harousseau JL, Amiot M (1999) Production of metalloproteinase-7 (matrilysin) by human myeloma cells and its potential involvement in metalloproteinase-2 activation. J Immunol. 163, 5723-8 Barillé S, Collette M, Thabard W, Bleunven C, Bataille R, Amiot M (2000) Soluble IL-6R alpha upregulated IL-6, MMP-1 and MMP-2 secretion in bone marrow stromal cells. Cytokine 12, 1426-9 Belaaouaj AA, Li A, Wun TC, Welgus HG, Shapiro SD (2000) Matrix metalloproteinases cleave tissue factor pathway inhibitor. Effects on coagulation. J Biol Chem. 275, 27123-8 Belkin AM, Akimov SS, Zaritskaya LS, Ratnikov BI, Deryugina EI, Strongin AY (2001) Matrix-dependent proteolysis of surface transglutaminase by membrane-type metalloproteinase regulates cancer cell adhesion and locomotion. J Biol Chem. 276, 18415-22 Bloomston M, Shafii A, Zervos EE, Rosemurgy AS (2002) TIMP-1 overexpression in pancreatic cancer attenuates tumor growth, decreases implantation and metastasis, and inhibits angiogenesis. J Surg Res. 102, 39-44 Butler GS, Sim D, Tam E, Devine D, Overall CM (2002) Mannose-binding lectin (MBL) mutants are susceptible to

VI. Conclusion Research on MMPs in MM demonstrated that certain enzymes are expressed in the tumor cells and the BM microenvironment and that they are involved in certain processes important for the development of MM. Formerly, it was believed that MMPs were only necessary for the degradation of several components of the ECM. Recently, it has been described that the enzymes are also able to cleave growth factors, cytokines and adhesion molecules resulting in a more complex role of MMPs. The multifunctional role of MMPs suggests further investigations for the recently discovered MMPs in their expression and role in MM. Although clinical trials with MMP inhibitors have not been promising, MMPs are still interesting targets for therapy. More knowledge about the function of the specific MMPs is needed for the beginning of new clinical trials. Recently, it has been demonstrated in a T-cell lymphoma model that an inhibitor with greater selectivity/specificity for MMP-9 in vitro showed greater efficacy against liver metastasis in vivo (Arlt et al, 2002).

The development of specific inhibitors for the different MMPs makes it possible to investigate the role of each MMP in MM disease. TIMPs, the natural inhibitors of MMPs and also described as multifunctional molecules, have not yet been described in MM. It is interesting to know whether they are expressed in MM cells and what impact the molecules will have on MM development when they are overexpressed.

Acknowledgements This work was financially supported by the Onderzoeksraad-Vrije Universiteit Brussel (OZR-VUB), Fonds voor Wetenschappelijk Onderzoek-Vlaanderen, Belgische Federatie tegen Kanker, Fortis. Karin Vanderkerken and Kewal Asosingh are postdoctoral fellows of the “Fonds voor Wetenschappelijk OnderzoekVlaanderen” (FWO-Vl).

34

Cancer Therapy Vol 2, page 35 matrix metalloproteinase proteolysis: potential role in human MBL deficiency. J Biol Chem. 277, 17511-9 Chandler S, Cossins J, Lury J, Wells G (1996) Macrophage metalloelastase degrades matrix and myelin proteins and processes a tumour necrosis factor-alpha fusion protein.

Biochem Biophys Res Commun. 228, 421-9 Chang C, Werb Z (2001) The many faces of metalloproteases: cell growth, invasion, angiogenesis and metastasis. Trends Cell Biol. 11, S37-43 Cunningham AC, Hasty KA, Enghild JJ, Mast AE (2002) Structural and functional characterization of tissue factor pathway inhibitor following degradation by matrix metalloproteinase-8. Biochem J. 367, 451-8 Curran S, Murray GI (1999) Matrix metalloproteinases in tumour invasion and metastasis. J Pathol. 189, 300-8 Dallas SL, Rosser JL, Mundy GR, Bonewald LF (2002) Proteolysis of latent transforming growth factor-beta (TGFbeta )-binding protein-1 by osteoclasts. A cellular mechanism for release of TGF-beta from bone matrix. J Biol Chem.

277, 21352-60 Derenne S, Amiot M, Barillé S, Collette M, Robillard N, Berthaud P, Harousseau JL, Bataille R (1999) Zoledronate is a potent inhibitor of myeloma cell growth and secretion of IL-6 and MMP-1 by the tumoral environment. J Bone Miner Res. 14, 2048-56 Deryugina EI, Luo GX, Reisfeld RA, Bourdon MA, Strongin A (1997) Tumor cell invasion through matrigel is regulated by activated matrix metalloproteinase-2. Anticancer Res. 17, 3201-10 Deryugina EI, Ratnikov BI, Postnova TI, Rozanov DV, Strongin AY (2002) Processing of integrin alpha(v) subunit by membrane type 1 matrix metalloproteinase stimulates migration of breast carcinoma cells on vitronectin and enhances tyrosine phosphorylation of focal adhesion kinase.

J Biol Chem. 277, 9749-56 Devy L, Noël A, Baramova E, Bajou K, Trentesaux C, Jardillier JC, Foidart JM, Jeannesson P (1997) Production and activation of matrix metalloprotease-9 (MMP-9) by HL-60 promyelocytic leukemia cells. Biochem Biophys Res Commun. 238, 842-6 Docherty AJ, Lyons A, Smith BJ, Wright EM, Stephens PE, Harris TJ, Murphy G, Reynolds JJ. (1985) Sequence of human tissue inhibitor of metalloproteinases and its identity to erythroid-potentiating activity. Nature 318, 66-9 Edelstein C, Shapiro SD, Klezovitch O, Scanu AM (1999) Macrophage metalloelastase, MMP-12, cleaves human apolipoprotein(a) in the linker region between kringles IV-4 and IV-5. Potential relevance to lipoprotein(a) biology. J Biol Chem. 274, 10019-23 Egeblad, M., and Werb, Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2, 161-174 Endo K, Takino T, Miyamori H, Kinsen H, Yoshizaki T, Furukawa M, Sato H (2003) Cleavage of syndecan-1 by membrane type matrix metalloproteinase-1 stimulates cell migration. J Biol Chem. 278, 40764-70 English WR, Puente XS, Freije JM, Knauper V, Amour A, Merryweather A, Lopez-Otin C, Murphy G (2000) Membrane type 4 matrix metalloproteinase (MMP17) has tumor necrosis factor-alpha convertase activity but does not activate pro-MMP2. J Biol Chem. 275, 14046-55 Everts V, Delaisse JM, Korper W, Beertsen W (1998) Cysteine proteinases and matrix metalloproteinases play distinct roles in the subosteoclastic resorption zone. J Bone Miner Res. 13, 1420-30 Fernandez-Patron C, Radomski MW, Davidge ST (1999) Vascular matrix metalloproteinase-2 cleaves big endothelin-1 yielding a novel vasoconstrictor. Circ Res. 82,906-11

Fowlkes JL, Enghild JJ, Suzuki K, Nagase H (1994) Matrix metalloproteinases degrade insulin-like growth factorbinding protein-3 in dermal fibroblast cultures. J Biol Chem.

269, 25742-6 Gearing AJ, Thorpe SJ, Miller K, Mangan M, Varley PG, Dudgeon T, Ward G, Turner C, Thorpe R (2002) Selective cleavage of human IgG by the matrix metalloproteinases, matrilysin and stromelysin. Immunol Lett. 81, 41-8 Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP (1997) Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol. 74, 111-22 Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A, Stetler-Stevenson M (1998) In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1. J Clin Invest. 102, 200210 Hajitou A, Sounni NE, Devy L, Grignet-Debrus C, Lewalle JM, Li H, Deroanne CF, Lu H, Colige A, Nusgens BV, Frankenne F, Maron A, Yeh P, Perricaudet M, Chang Y, Soria C, Calberg-Bacq CM, Foidart JM, Noël A (2001) Down-regulation of vascular endothelial growth factor by tissue inhibitor of metalloproteinase-2: effect on in vivo mammary tumor growth and angiogenesis. Cancer Res. 61,3450-7 Hargreaves PG, Wang F, Antcliff J, Murphy G, Lawry J, Russell RG, Croucher PI (1998) Human myeloma cells shed the interleukin-6 receptor: inhibition by tissue inhibitor of metalloproteinase-3 and a hydroxamate-based metalloproteinase inhibitor. Br J Haematol. 101, 694-702 Hasegawa S, Koshikawa N, Momiyama N, Moriyama K, Ichikawa Y, Ishikawa T, Mitsuhashi M, Shimada H, Miyazaki K (1998) Matrilysin-specific antisense oligonucleotide inhibits liver metastasis of human colon cancer cells in a nude mouse model. Int J Cancer 76, 812-6 Hashimoto G, Inoki I, Fujii Y, Aoki T, Ikeda E, Okada Y (2002) Matrix metalloproteinases cleave connective tissue growth factor and reactivate angiogenic activity of vascular endothelial growth factor 165. J Biol Chem. 277, 36288-95 Hayakawa T, Yamashita K, Tanzawa K, Uchijima E, Iwata K (1992) Growth-promoting activity of tissue inhibitor of metalloproteinases-1 (TIMP-1) for a wide range of cells. A possible new growth factor in serum. FEBS Lett. 298, 29-32 Hayakawa T, Yamashita K, Ohuchi E, Shinagawa A (1994) Cell growth-promoting activity of tissue inhibitor of metalloproteinases-2 (TIMP-2). J Cell Sci. 107, 2373-9 Hernandez-Barrantes S, Toth M, Bernardo MM, Yurkova M, Gervasi DC, Raz Y, Sang QA, Fridman R (2000) Binding of active (57 kDa) membrane type 1-matrix metalloproteinase (MT1-MMP) to tissue inhibitor of metalloproteinase (TIMP)2 regulates MT1-MMP processing and pro-MMP-2 activation. J Biol Chem. 275, 12080-9 Hjertner O, Qvigstad G, Hjorth-Hansen H, Seidel C, Woodliff J, Epstein J, Waage A, Sundan A, Börset M (2000) Expression of urokinase plasminogen activator and the urokinase plasminogen activator receptor in myeloma cells. Br J Haematol. 109, 815-22 Holen I, Drury NL, Hargreaves PG, Croucher PI (2001) Evidence of a role for a non-matrix-type metalloproteinase activity in the shedding of syndecan-1 from human myeloma cells. Br J Haematol. 114, 414-21 Holliday LS, Welgus HG, Fliszar CJ, Veith GM, Jeffrey JJ, Gluck SL (1997) Initiation of osteoclast bone resorption by interstitial collagenase. J Biol Chem. 272, 22053-8 Hua J, Muschel RJ (1996) Inhibition of matrix metalloproteinase 9 expression by a ribozyme blocks metastasis in a rat sarcoma model system. Cancer Res. 56, 5279-84 Huang S, Van Arsdall M, Tedjarati S, McCarty M, Wu W, Langley R, Fidler IJ (2002) Contributions of stromal

35

Van Valckenborgh et al: Matrix metalloproteinases in multiple myeloma metalloproteinase-9 to angiogenesis and growth of human ovarian carcinoma in mice. J Natl Cancer Inst. 94, 1134-42 Ikenaka Y, Yoshiji H, Kuriyama S, Yoshii J, Noguchi R, Tsujinoue H, Yanase K, Namisaki T, Imazu H, Masaki T, Fukui H (2003) Tissue inhibitor of metalloproteinases-1 (TIMP-1) inhibits tumor growth and angiogenesis in the TIMP-1 transgenic mouse model. Int J Cancer 105, 340-6 Itoh T, Tanioka M, Yoshida H, Yoshioka T, Nishimoto H, Itohara S (1998) Reduced angiogenesis and tumor progression in gelatinase A-deficient mice. Cancer Res. 58, 1048-51 Itoh T, Tanioka M, Matsuda H, Nishimoto H, Yoshioka T, Suzuki R, Uehira M (1999) Experimental metastasis is suppressed in MMP-9-deficient mice. Clin Exp Metastasis 17, 177-81 Jackson C, Nguyen M, Arkell J, Sambrook P (2001) Selective matrix metalloproteinase (MMP) inhibition in rheumatoid arthritis--targetting gelatinase A activation. Inflamm Res. 50, 183-6 Kaushal GP, Xiong X, Athota AB, Rozypal TL, Sanderson RD, Kelly T (1999) Syndecan-1 expression suppresses the level of myeloma matrix metalloproteinase-9. Br J Haematol.

104, 365-73 Kim MH, Albertsson P, Xue Y, Nannmark U, Kitson RP, Goldfarb RH (2001) Expression of neutrophil collagenase (MMP-8) in Jurkat T leukemia cells and its role in invasion.

Anticancer Res. 21, 45-50 Koivunen E, Arap W, Valtanen H, Rainisalo A, Medina OP, Heikkilä P, Kantor C, Gahmberg CG, Salo T, Konttinen YT, Sorsa T, Ruoslahti E, Pasqualini R (1999) Tumor targeting with a selective gelatinase inhibitor. Nat Biotechnol. 17, 768-74 Kossakowska AE, Hinek A, Edwards DR, Lim MS, Zhang CL, Breitman DR, Prusinkiewicz C, Stabbler AL, Urbanski LS, Urbanski SJ (1998) Proteolytic activity of human nonHodgkin's lymphomas. Am J Pathol. 152, 565-76 Lee J, Weber M, Mejia S, Bone E, Watson P, Orr W (2001) A matrix metalloproteinase inhibitor, batimastat, retards the development of osteolytic bone metastases by MDA-MB-231 human breast cancer cells in Balb C nu/nu mice. Eur J Cancer 37, 106-13 Levi E, Fridman R, Miao HQ, Ma YS, Yayon A, Vlodavsky I (1996) Matrix metalloproteinase 2 releases active soluble ectodomain of fibroblast growth factor receptor 1. Proc Natl Acad Sci U S A. 93, 7069-74 Li G, Fridman R, Kim HR (1999) Tissue inhibitor of metalloproteinase-1 inhibits apoptosis of human breast epithelial cells. Cancer Res. 59, 6267-75 Lijnen HR, Arza B, Van Hoef B, Collen D, Declerck PJ. (2000) Inactivation of plasminogen activator inhibitor-1 by specific proteolysis with stromelysin-1 (MMP-3). J Biol Chem . 275, 37645-50 Lijnen HR, Van Hoef B, Collen D (2001) Inactivation of the serpin alpha(2)-antiplasmin by stromelysin-1. Biochim Biophys Acta 1547, 206-13 Lindberg RL, De Groot CJ, Montagne L, Freitag P, van der Valk P, Kappos L, Leppert D (2001) The expression profile of matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) in lesions and normal appearing white matter of multiple sclerosis. Brain 124, 1743-53 Li Q, Park PW, Wilson CL, Parks WC (2002) Matrilysin shedding of syndecan-1 regulates chemokine mobilization and transepithelial efflux of neutrophils in acute lung injury.

Cell 111, 635-46 Llano E, Pendas AM, Knauper V, Sorsa T, Salo T, Salido E, Murphy G, Simmer JP, Bartlett JD, Lopez-Otin C (1997) Identification and structural and functional characterization of human enamelysin (MMP-20). Biochemistry 36, 15101-8

MaĂąes S, Llorente M, Lacalle RA, Gomez-Mouton C, Kremer L, Mira E, Martinez-A C (1999) The matrix metalloproteinase-9 regulates the insulin-like growth factor-triggered autocrine response in DU-145 carcinoma cells. J Biol Chem. 274, 6935-45 Marchenko GN, Marchenko ND, Strongin AY (2003) The structure and regulation of the human and mouse matrix metalloproteinase-21 gene and protein. Biochem J. 372, 50315 Matrisian LM (1990) Metalloproteinases and their inhibitors in matrix remodeling. Trends Genet. 6, 121-5 Matsuno H, Yudoh K, Watanabe Y, Nakazawa F, Aono H, Kimura T (2001) Stromelysin-1 (MMP-3) in synovial fluid of patients with rheumatoid arthritis has potential to cleave membrane bound Fas ligand. J Rheumatol. 28, 22-8 Matsushita A, Onda M, Uchida E, Maekawa R, Yoshioka T (2001) Antitumor effect of a new selective matrix metalloproteinase inhibitor, MMI-166, on experimental pancreatic cancer. Int J Cancer 92, 434-40 McCarthy K, Maguire T, McGreal G, McDermott E, O'Higgins N, Duffy MJ (1999) High levels of tissue inhibitor of metalloproteinase-1 predict poor outcome in patients with breast cancer. Int J Cancer 84, 44-8 McQuibban GA, Gong JH, Tam EM, McCulloch CA, ClarkLewis I, Overall CM (2000) Inflammation dampened by gelatinase A cleavage of monocyte chemoattractant protein3. Science 289, 1202-6 McQuibban GA, Butler GS, Gong JH, Bendall L, Power C, Clark-Lewis I, Overall CM (2001) Matrix metalloproteinase activity inactivates the CXC chemokine stromal cell-derived factor-1. J Biol Chem. 276, 43503-8 McQuibban GA, Gong JH, Wong JP, Wallace JL, Clark-Lewis I, Overall CM (2002) Matrix metalloproteinase processing of monocyte chemoattractant proteins generates CC chemokine receptor antagonists with anti-inflammatory properties in vivo. Blood 100, 1160-7 Michaelis J, Vissers MC, Winterbourn CC (1992) Cleavage of alpha 1-antitrypsin by human neutrophil collagenase. Matrix Suppl. 1,80-1 Mitchell TI, Jeffrey JJ, Palmiter RD, Brinckerhoff CE (1993) The acute phase reactant serum amyloid A (SAA3) is a novel substrate for degradation by the metalloproteinases collagenase and stromelysin. Biochim Biophys Acta 1156, 245-54 Moilanen M, Pirila E, Grenman R, Sorsa T, Salo T (2002) Expression and regulation of collagenase-2 (MMP-8) in head and neck squamous cell carcinomas. J Pathol. 197, 72-81 Moses MA (1997) The regulation of neovascularization of matrix metalloproteinases and their inhibitors. Stem Cells 15, 180-9 Nakamura H, Suenaga N, Taniwaki K, Matsuki H, Yonezawa K, Fujii M, Okada Y, Seiki M (2004) Constitutive and induced CD44 shedding by ADAM-like proteases and membranetype 1 matrix metalloproteinase. Cancer Res. 64, 876-82 Nemeth JA, Yousif R, Herzog M, Che M, Upadhyay J, Shekarriz B, Bhagat S, Mullins C, Fridman R, Cher ML (2002) Matrix metalloproteinase activity, bone matrix turnover, and tumor cell proliferation in prostate cancer bone metastasis. J Natl Cancer Inst. 94, 17-25 Nishizuka I, Ichikawa Y, Ishikawa T, Kamiyama M, Hasegawa S, Momiyama N, Miyazaki K, Shimada H (2001) Matrilysin stimulates DNA synthesis of cultured vascular endothelial cells and induces angiogenesis in vivo. Cancer Lett. 173, 175-82 Park HI, Turk BE, Gerkema FE, Cantley LC, Sang QX (2002) Peptide substrate specificities and protein cleavage sites of human endometase/matrilysin-2/matrix metalloproteinase26. J Biol Chem. 277, 35168-75

36

Cancer Therapy Vol 2, page 37 Pendás AM, Uría JA, Jiménez MG, Balbín M, Freije JP, LópezOtín C (2000) An overview of collagenase-3 expression in malignant tumors and analysis of its potential value as a target in antitumor therapies. Clin Chim Acta 291, 137-55 Powell WC, Knox JD, Navre M, Grogan TM, Kittelson J, Nagle RB, Bowden GT (1993) Expression of the metalloproteinase matrilysin in DU-145 cells increases their invasive potential in severe combined immunodeficient mice. Cancer Res. 53, 417-22 Powell WC, Fingleton B, Wilson CL, Boothby M, Matrisian LM (1999) The metalloproteinase matrilysin proteolytically generates active soluble Fas ligand and potentiates epithelial cell apoptosis. Curr Biol. 9, 1441-7 Proost P, Van Damme J, Opdenakker G (1993) Leukocyte gelatinase B cleavage releases encephalitogens from human myelin basic protein. Biochem Biophys Res Commun. 192, 1175-81 Ria R, Vacca A, Ribatti D, Di Raimondo F, Merchionne F, Dammacco F (2002) Alpha(v)beta(3) integrin engagement enhances cell invasiveness in human multiple myeloma.

Haematologica 87, 836-45 Ries C, Lottspeich F, Dittmann KH, Petrides PE (1996) HL-60 leukemia cells produce an autocatalytically truncated form of matrix metalloproteinase-9 with impaired sensitivity to inhibition by tissue inhibitors of metalloproteinases.

Leukemia 10,1520-6 Ries C, Loher F, Zang C, Ismair MG, Petrides PE (1999) Matrix metalloproteinase production by bone marrow mononuclear cells from normal individuals and patients with acute and chronic myeloid leukemia or myelodysplastic syndromes.

Clin Cancer Res. 5, 1115-24 Rozanov DV, Ghebrehiwet B, Postnova TI, Eichinger A, Deryugina EI, Strongin AY (2002) The hemopexin-like Cterminal domain of membrane type 1 matrix metalloproteinase regulates proteolysis of a multifunctional protein, gC1qR. J Biol Chem. 277, 9318-25 Sadowski T, Dietrich S, Koschinsky F, Sedlacek R (2003) Matrix metalloproteinase 19 regulates insulin-like growth factormediated proliferation, migration, and adhesion in human keratinocytes through proteolysis of insulin-like growth factor binding protein-3. Mol Biol Cell. 14, 4569-80 Sato T, Foged NT, Delaissé JM (1998) The migration of purified osteoclasts through collagen is inhibited by matrix metalloproteinase inhibitors. J Bone Miner Res. 13, 59-66 Sires UI, Murphy G, Baragi VM, Fliszar CJ, Welgus HG, Senior RM (1994) Matrilysin is much more efficient than other matrix metalloproteinases in the proteolytic inactivation of alpha 1-antitrypsin. Biochem Biophys Res Commun. 204, 613-20 Spurbeck WW, Ng CY, Strom TS, Vanin EF, Davidoff AM (2002) Enforced expression of tissue inhibitor of matrix metalloproteinase-3 affects functional capillary morphogenesis and inhibits tumor growth in a murine tumor model. Blood 100, 3361-8 Standal T, Borset M, Lenhoff S, Wisloff F, Stordal B, Sundan A, Waage A, Seidel C (2002) Serum insulinlike growth factor is not elevated in patients with multiple myeloma but is still a prognostic factor. Blood 100, 3925-9 Starckx S, Van den Steen PE, Verbeek R, van Noort JM, Opdenakker G (2003) A novel rationale for inhibition of gelatinase B in multiple sclerosis: MMP-9 destroys alpha Bcrystallin and generates a promiscuous T cell epitope. J Neuroimmunol. 141, 47-57 Sternlicht MD, Werb Z (2001) How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 17, 463-516 Stix B, Kahne T, Sletten K, Raynes J, Roessner A, Rocken C (2001) Proteolysis of AA amyloid fibril proteins by matrix metalloproteinases-1, -2, and -3. Am J Pathol. 159, 561-70

Suzuki M, Raab G, Moses MA, Fernandez CA, Klagsbrun M (1997) Matrix metalloproteinase-3 releases active heparinbinding EGF-like growth factor by cleavage at a specific juxtamembrane site. J Biol Chem. 272, 31730-7 Takino T, Koshikawa N, Miyamori H, Tanaka M, Sasaki T, Okada Y, Seiki M, Sato H (2003) Cleavage of metastasis suppressor gene product KiSS-1 protein/metastin by matrix metalloproteinases. Oncogene 22, 4617-26 Teronen O, Laitinen M, Salo T, Hanemaaijer R, Heikkila P, Konttinen YT, Sorsa T (2000) Inhibition of matrix metalloproteinases by bisphosphonates may in part explain their effects in the treatment of multiple myeloma. Blood 96, 4006-7 Thabard W, Barillé S, Collette M, Harousseau JL, Rapp MJ, Bataille R, Amiot M (1999) Myeloma cells release soluble interleukin-6Ralpha in relation to disease progression by two distinct mechanisms: alternative splicing and proteolytic cleavage. Clin Cancer Res. 5, 2693-7 Ugwu F, Van Hoef B, Bini A, Collen D, Lijnen HR (1998) Proteolytic cleavage of urokinase-type plasminogen activator by stromelysin-1 (MMP-3). Biochemistry 37, 7231-6 Vacca A, Ribatti D, Roncali L, Ranieri G, Serio G, Silvestris F, Dammacco F (1994) Bone marrow angiogenesis and progression in multiple myeloma. Br J Haematol. 87, 503-8 Vacca A, Ribatti D, Iurlaro M, Albini A, Minischetti M, Bussolino F, Pellegrino A, Ria R, Rusnati M, Presta M, Vincenti V, Persico MG, Dammacco F (1998) Human lymphoblastoid cells produce extracellular matrix-degrading enzymes and induce endothelial cell proliferation, migration, morphogenesis, and angiogenesis. Int J Clin Lab Res. 28, 55-68 Vacca A, Ribatti D, Presta M, Minischetti M, Iurlaro M, Ria R, Albini A, Bussolino F, Dammacco F (1999) Bone marrow neovascularization, plasma cell angiogenic potential, and matrix metalloproteinase-2 secretion parallel progression of human multiple myeloma. Blood 93, 3064-73 Vacca A, Ria R, Semeraro F, Merchionne F, Coluccia M, Boccarelli A, Scavelli C, Nico B, Gernone A, Battelli F, Tabilio A, Guidolin D, Petrucci MT, Ribatti D, Dammacco F (2003) Endothelial cells in the bone marrow of patients with multiple myeloma. Blood 102, 3340-8 Vande Broek I, Asosingh K, Allegaert V, Leleu X, Facon T, Vanderkerken K, Camp BV, Van Riet I (2004) Bone marrow endothelial cells increase the invasiveness of human multiple myeloma cells through upregulation of MMP-9: evidence for a role of hepatocyte growth factor. Leukemia 4 [Epub ahead of print] Van den Steen PE, Proost P, Wuyts A, Van Damme J, Opdenakker G. (2000) Neutrophil gelatinase B potentiates interleukin-8 tenfold by aminoterminal processing, whereas it degrades CTAP-III, PF-4, and GRO-alpha and leaves RANTES and MCP-2 intact. Blood 96, 2673-81 Van Den Steen PE, Wuyts A, Husson SJ, Proost P, Van Damme J, Opdenakker G (2003a) Gelatinase B/MMP-9 and neutrophil collagenase/MMP-8 process the chemokines human GCP-2/CXCL6, ENA-78/CXCL5 and mouse GCP2/LIX and modulate their physiological activities. Eur J Biochem. 270, 3739-49 Van den Steen PE, Husson SJ, Proost P, Van Damme J, Opdenakker G (2003b) Carboxyterminal cleavage of the chemokines MIG and IP-10 by gelatinase B and neutrophil collagenase. Biochem Biophys Res Commun. 310, 889-96 Van Ranst M, Norga K, Masure S, Proost P, Vandekerckhove F, Auwerx J, Van Damme J, Opdenakker G. (1991) The cytokine-protease connection: identification of a 96-kD THP1 gelatinase and regulation by interleukin-1 and cytokine inducers. Cytokine. 3, 231-9

37

Van Valckenborgh et al: Matrix metalloproteinases in multiple myeloma Van Valckenborgh E, Bakkus M, Munaut C, Noel A, St Pierre Y, Asosingh K, Van Riet I, Van Camp B, Vanderkerken K (2002a) Upregulation of matrix metalloproteinase-9 in murine 5T33 multiple myeloma cells by interaction with bone marrow endothelial cells. Int J Cancer 101, 512-8 Van Valckenborgh E, De Raeve H, Devy L, Blacher S, Munaut C, Noel A, Van Marck E, Van Riet I, Van Camp B, Vanderkerken K ( 2002b) Murine 5T multiple myeloma cells induce angiogenesis in vitro and in vivo. Br J Cancer 86, 796-802 Van Valckenborgh, P. I. Croucher, H. De Raeve, C. Carron, K. Asosingh, I. Van Riet, B. Van Camp and K. Vanderkerken (2003) The effect of the broad_spectrum matrix metalloproteinase inhibitor SC-964 on tumor growth, development of osteolytic lesions and angiogenesis in multiple myeloma: A study in the 5T2MM model. Hematol J. 4 (Suppl. 1), S186 Vihinen P, Kähäri VM (2002) Matrix metalloproteinases in cancer: prognostic markers and therapeutic targets. Int J Cancer 99, 157-66 von Bredow DC, Nagle RB, Bowden GT, Cress AE (1997) Cleavage of beta 4 integrin by matrilysin. Exp Cell Res. 236, 341-5 Wahlgren J, Maisi P, Sorsa T, Sutinen M, Tervahartiala T, Pirilä E, Teronen O, Hietanen J, Tjäderhane L, Salo T (2001) Expression and induction of collagenases (MMP-8 and -13) in plasma cells associated with bone-destructive lesions. J Pathol. 194, 217-24 Watanabe H, Nakanishi I, Yamashita K, Hayakawa T, Okada Y (1993) Matrix metalloproteinase-9 (92 kDa gelatinase/type IV collagenase) from U937 monoblastoid cells: correlation with cellular invasion. J Cell Sci. 104, 991-9 Werb Z, Mainardi CL, Vater CA, Harris ED Jr. (1977) Endogenous activiation of latent collagenase by rheumatoid synovial cells. Evidence for a role of plasminogen activator.

N Engl J Med. 296, 1017-23 Wilson CL, Heppner KJ, Labosky PA, Hogan BL, Matrisian LM (1997) Intestinal tumorigenesis is suppressed in mice lacking

the metalloproteinase matrilysin. Proc Natl Acad Sci U S A 94, 1402-7 Winding B, NicAmhlaoibh R, Misander H, Hoegh-Andersen P, Andersen TL, Holst-Hansen C, Heegaard AM, Foged NT, Brünner N, Delaissé JM (2002) Synthetic matrix metalloproteinase inhibitors inhibit growth of established breast cancer osteolytic lesions and prolong survival in mice.

Clin Cancer Res. 8, 1932-9 Winyard PG, Zhang Z, Chidwick K, Blake DR, Carrell RW, Murphy G (1991) Proteolytic inactivation of human alpha 1 antitrypsin by human stromelysin. FEBS Lett. 279, 91-4 Yang Y, Yaccoby S, Liu W, Langford JK, Pumphrey CY, Theus A, Epstein J, Sanderson RD (2002) Soluble syndecan-1 promotes growth of myeloma tumors in vivo. Blood 100, 610-7

Els Van Valckenborgh

38

Cancer Therapy Vol 2, page 39 Cancer Therapy Vol 2, 39-46, 2004

Anti-metastatic activity of an apple polyphenol crude fraction against human Ha ras-transformed metastatic mouse tumor (r/m HM-SFME-1) cells Research Article

Kazuo Ryoyama*, Yoshitaka Shimotai, Taichi Higurashi, Tomomi Kokufuta, Yumi Kidachi, Hideaki Yamaguchi#, and Ichiro Hatayamaยง Department of Bioscience and Biotechnology, Faculty of Engineering; #Graduate School of Environmental Sciences, Aomori University, Aomori 030-0943, Japan ยง Aomori Prefectural Institute of Public Health and Environment, Aomori 030-8566, Japan

__________________________________________________________________________________ *Correspondence: Kazuo Ryoyama; Tel: +81 177 38 2004; Fax: +81 177 38 2030; e-mail: ryoyama@aomori-u.ac.jp Key Words: apple polyphenol crude fraction, Gelatin zymography, r/m HM-SFME-1, Abbreviations: MMP, matrix metalloproteinase; TIMP, tissue inhibitor of matrix metalloproteinase; NO, nitric oxide; VEGF, vascular endothelial growth factor Received: 2 February 2004; Revised: 8 April 2004; Accepted: 13 April 2004; electronically published: April 2004

Summary Oral administration of a 0.5% crude fraction of an apple polyphenol significantly inhibited the spontaneous lung metastasis of r/m HM-SFME-1 tumor cells, but did not significantly inhibit tumor growth at the site of transplantation. This fraction dose-dependently inhibited the in vitro invasion and migration of the tumor, and inhibited slightly the MMP-9 production and IFN-! plus LPS-augmented VEGF gene expression of the tumor, although non-augmented VEGF gene expression was stimulated in a dose-dependent fashion by the fraction. In addition, the polyphenol fraction inhibited the MMP-9 production of the fibroblast cell line NIH3T3, but not that of the macrophage cell line J774.1, and inhibited the VEGF gene expression of both stromal cell types. NO production

by J774.1 cells was also inhibited significantly. These findings indicate that the anti-metastatic activity of the crude polyphenol fraction occurs via the inhibition of both tumor and stromal cell activities. It is noteworthy that the antimetastatic activity of the polyphenol fraction occurs in the absence of any direct inhibition of tumor growth.

1998). The polyphenol content and composition are affected by various factors, such as the plant variety, growth conditions, and manufacturing processes (Graham, 1992; Astill et al, 2001; van der Sluis et al, 2001). In this respect, green tea is rich in catechins, whereas black tea is rich in theaflavins (Graham, 1992).

The most studied of these compounds are the tea polyphenols, particularly catechins, and there are many reports regarding the antitumor activities of epigallocatechin-3-gallate (Blanko et al 2003; Gupta et al, 2003). Other polyphenols, such as curcumin, rutin, quercetin, and trans-reveratrol, have also been reported to be chemopreventive through their anti-proliferative, antimetastatic, and/or anti-invasive properties (Menon et al, 1995; Maeda-Yamamoto et al, 1999; Menon et al, 1999; Caltagirone et al, 2000; Mouria et al, 2002).

Immature apples have been reported to contain large amounts of several types of polyphenol, which include

I. Introduction Increasing interest in the health benefits of plants (tea, grapes, etc.) that are rich in polyphenols has led to the inclusion of plant extracts in dietary supplements and functional foods (Kelloff et al, 2000). Animal studies have shown that a polyphenol-rich diet is associated with a lower incidence of cancer, and epidemiological evidence, although inconclusive, suggests that consuming food and beverages that are rich in polyphenols may reduce the risk of some cancers in humans (Kelloff et al, 2000; Lin, 2002; Mouria et al, 2002).

Polyphenols are distributed widely in the plant kingdom, and are structurally diverse (Freidman and Jugens, 2000). They are plentiful in certain plants but not in others (Paganqa et al, 1999; Leontowicz et al, 2002; Mouria et al, 2002). For example, tannic acid is not found in tea but is found in apples (Graham, 1992; Kanda et al, 39

Ryoyama et al: Anti-metastatic activity of an apple polyphenol chlorogenic acid, catechin, epicatechin, rutin, and condensed tannins (Kanda et al, 1998). Although the biological activities of these apple-derived compounds, especially as they pertain to the control of tumor progression, remain to be determined, a crude polyphenol fraction has been reported to inhibit histamine release from RBL-2H3 cells and rat mast cells (Kanda et al, 1998).

Therefore, we examined the effects of a crude fraction of the apple polyphenol on the growth, metastasis, and invasion of tumor cells both in vivo and in vitro.

D. Evaluation of r/m HM-SFME-1 cell metastasis in the lungs The degree of r/m HM-SFME-1 cell metastasis in the lungs was estimated by quantifying the levels of the human c-Ha-ras 1 gene in the cells, as described previously (Matano et al, 1995), with minor modifications. In brief, the DNA samples were amplified for 35 cycles of 94oC for 30 s, 60oC for 30 s, and 72oC for 1min. The 72oC incubation period was extended to 10 min in the last cycle. The PCR products were electrophoresed in a 3% agarose-LE gel, and transferred to a positively charged nylon membrane (Roche Diagnostics). The transferred PCR products were hybridized with probes that had been labeled with the DIG Oligonucleotide Tailing Kit. The membrane was washed and exposed in the Luminescence Image Analyzer (Fujifilm LAS1000; Fuji Photo Film Co. Ltd., Tokyo, Japan), and the intensities of the PCR products were measured. The 123-bp PCR product of the human c-Ha-ras 1 gene was used as a probe for this gene, since the total region rather than partial regions of the gene was required to detect the PCR products. In the case of the human c-Ha-ras 1 gene, the upstream (sense) and downstream (antisense) primers were 5'-ATgACggAATATAAgCTggT-3' and 5'-CgCTAggCTCACCTCTATA-3', which correspond to nucleotide positions 1670-1689 and 1773-1792, respectively. The standard used for estimation of the metastasized tumor cell numbers was derived from the DNA samples from normal lungs that contained 102 to 106 r/m HM-SFME-1 cells.

II. Materials and methods A. Reagents The apple polyphenol crude fraction (5% in solution) was kindly supplied by Nikka Whisky Distilling Co. Ltd. (Chiba, Japan). Dulbecco’s modified Eagle’s medium mixture F-12 Ham (DME/F-12), RPMI-1640, insulin, transferrin, and gelatin were obtained from Sigma Chemical Co. (St. Louis, MO, USA).

Trypsin and LPS (E. coli 055:B5) were obtained from DIFCO Laboratories (Detroit, MI, USA). Fetal bovine serum (FBS), bovine fibronectin, gelatinase zymography standards (human MMP-2 and -9), recombinant mouse IFN-!, Perfect ProteinTM Markers, ISOGEN®, RNA PCR kit, AmpliTaq Gold with Gene Amp 10" PCR Gold Buffer, agarose-LE, and the DIG Oligonucleotide Tailing Kit were purchased from JRH Biosciences (Lenaxa, KS, USA), Biomedical Technologies Inc. (Stoughton, MA, USA), Chemicon International Inc. (Temecula, CA, USA), Novagen Inc. (Madison, WI, USA), Genzyme Corp.

(Cambridge, MA, USA), Nippon Gene (Tokyo, Japan), Takara Biochemicals, Inc. (Tokyo, Japan), Applied Biosystems (Tokyo, Japan), Nacalai Tesque (Kyoto, Japan), and Roche Diagnostics Co. Ltd. (Tokyo, Japan), respectively. All of the other reagents were purchased from Wako Pure Chemical Industries Ltd. (Osaka, Japan).

E. Chemoinvasion and migration assays The invasiveness of r/m HM-SFME-1 cells was assayed using 8.0- µm pore size polyvinylpyrrolidone-free polycarbonate filter chambers (Chemotaxicell®, Kurabo Industries, Ltd. Osaka, Japan). The filter had been previously coated on the reverse side with fibronectin (10 µg/filter) and dried at 37oC for 2 days.

Gelatin (25 µg/filter) was applied to the front side of the filter, which was then dried at 37oC for 1 day. The gelatin coating was applied twice, and fibronectin (10 µg/filter) was applied subsequently. The cell suspension (100 µl of 1 " 10 6 cells/ml) in F/D medium containing 5% FBS and 100 µl apple polyphenol solution (0-50 µg/ml) was plated onto the Chemotaxicells, which were placed in 24-well microplates, and 0.6 ml of F/D medium containing 5% FBS and the apple polyphenol solution (0-50 µg/ml) was immediately added to the outer well of the microplates. The chambers were incubated at 37oC. The culture medium was removed after 3 days, and the cells on the gelatincoated (front) side of the filter were removed by wiping with a cotton swab. The cells on the fibronectin-coated (reverse) side of the filter were collected by rinsing with phosphate-buffered saline that contained 0.1% trypsin, and were counted with a Coulter counter (model ZBI; Coulter Electronics Inc., Hialeah, FL, USA).

The migration assay for the r/m HM-SFME-1 cells was similar to the invasion assay, with the following modifications: fibronectin and gelatin were not applied to the reverse and front sides of the filters in the Chemotaxicell, and fibronectin (3 µg in 0.6 ml) was added to the outer well of the 24-well microplate.

B. Cell lines and culture conditions The r/m HM-SFME-1 cells were maintained in a humidified 5-7% CO2 atmosphere at 37°C under serum-free culture conditions, as described previously (Matano et al, 1995), and passaged every four days. The culture medium (F/D medium) was DME/F-12 that was supplemented with sodium bicarbonate (1.2 g/l), sodium selenite (10 nM), and gentamicin sulfate (10 µg/ml). The NIH3T3 cells were maintained under similar conditions, with the following modifications: EGF (50 ng/ml) was added to the culture medium, and the culture dishes and plates were pre-coated with type I collagen (0.3 mg/6-cmdiameter dish; coated twice). The J774.1 cells were cultured in RPMI 1640 that contained 5% FBS.

C. Mouse strains and in vivo antitumor experiments Female BALB/c mice were obtained from Charles River (Japan) Inc. (Kanagawa, Japan) or from our own colony, and used in the experiments at 7-10 weeks of age. The r/m HMSFME-1 cells (2 " 105) were injected subcutaneously into the right footpad of each mouse. Every other week, some of the injected mice were sacrificed and their lungs were removed. The mice had free access to drinking water that contained the apple polyphenol crude fraction from two weeks before tumor implantation to the end of the experiment.

F. Gelatin zymography After a 2 h pre-incubation of the cells (106) in 6-cmdiameter culture dishes that contained 2 ml of culture medium, 10 µl of the apple polyphenol crude fraction (0.1-10 mg/ml) was added, and the dishes were incubated for 24 h at 37oC. Cell-free culture supernatants were prepared. The culture supernatants of the r/m HM-SFME-1 cells, but not those of the NIH3T3 and J774.1 cells, were concentrated 30-fold using an Ultrafree-CL concentrator (Amicon, UFC4LCC25; Millipore Corp., Bedford,

40

Cancer Therapy Vol 2, page 41 MA, USA). Aliquots of the culture supernatants were electrophoresed in a 10% polyacrylamide gel that contained sodium dodecyl sulfate and 0.1% gelatin. After electrophoresis, the gel was washed with 2.5% Triton-X100 and incubated at 37oC for 20 h in 100 mM Tris-HCl (pH 8.0) that contained 5 mM CaCl2, 0.005% polyoxyethylene lauryl, and 0.001% sodium azide. The gel was then stained with Quick-CBB® that contained 1% Coomassie brilliant blue R. PerfectTM Protein Markers were used as the molecular mass standards, and gelatinase zymography standards for human MMP-2 and MMP-9 were used as the positive controls for MMP-2 and MMP-9, respectively.

III. Results and Discussion A. Effect of the apple polyphenol crude fraction on the spontaneous metastasis of r/m HM-SFME-1 cells in the lung The effects of the crude fraction of the apple polyphenol on spontaneous metastasis of r/m HM-SFME1 cells in the lung were assayed according to the method of Matano et al. (Matano et al, 1995) with minor modifications. At 39 days after tumor implantation, the number of tumor cells in the lungs was estimated to be between 1.5 " 104 and 3.0 " 106 cells/lung (Figure 1A).

Oral administration of the apple polyphenol fraction significantly inhibited tumor metastasis; the estimated number of tumor cells after treatment was between 1.0 " 102 and 3.9 " 10 5 cells/lung. A lower dose of the fraction (0.05%) also tended to inhibit lung metastasis, although this level of inhibition was not statistically significant (data not shown). In addition, since the mice drank 4.4 ± 0.5 ml/day of fluid, each mouse had an approximate intake of 22 ± 2.5 mg/day of the apple polyphenol crude fraction.

Figure 1B shows the effects of the crude fraction on the subcutaneous growth of the r/m HM-SFME-1 cells.

Cell growth appeared 14 days after implantation, and the size of the tumor-transplanted footpads increased thereafter in a time-dependent manner. In the mice that were fed the apple polyphenol fraction, the increases in footpad thickness were smaller than those of the control, but were not significant between the controls and treated mice for each timepoint. In addition, within the concentration range of 0.5-500 µg/ml, the crude fraction did not inhibit the in vitro growth of the r/m HM-SFME-1 cells (data not shown).

G. RT-PCR The cDNA was prepared as described previously (Ryoyama et al, 2003). Aliquots of the cDNA samples were subjected to PCR using AmpliTaq Gold with the Gene Amp 10" PCR Gold Buffer that contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 µM of each primer (sense and antisense), 0.2 mM of each dNTP, and 25 units/ml Taq polymerase.

The primers for mouse MMP-2, MMP-9, TIMP-1, and VEGF were synthesized according to the GenBank sequences.

The primers for MMP-2 were derived from the sequence with accession no.

M84324: forward primer, 5'ggCCATgCCATggggCTg-3' (nucleotides 1259-1276) and reverse primer, 5'-CCAgTCTgATTTgATgCTTC-3' (nucleotides 2001-2020). The MMP-9 primers were derived from the sequence with accession no. D12712: forward primer, 5'gggCAACTCggCAggAgAgC-3' (nucleotides 1044-1063) and reverse primer, 5'-CCAggTgACgggCTgCTTgT-3' (nucleotides 1513-1532). The TIMP-1 primers were derived from the sequence with accession no. X04684: forward primer, 5'CTgTgCCCCACCCCACCCAC-3' (nucleotides 184-203) and reverse primer, 5'-AAggCTTCAggTCATCgggC-3' (nucleotides 716-735). The VEGF primers were derived from the sequence with accession no. NM009505: forward primer, 5'CACgACAgAAggAgAgCAgAAgTC-3' (nucleotides 79-119) and reverse primer, 5'-gCCATCATCgTCACCgTTgA-3' (nucleotides 742-761). The mouse beta-actin gene was used as the internal control with the forward primer, 5'gTgggCCgCTCTAggCACCAA-3' (nucleotides 25-45) and the reverse primer, 5'-CTCTTTgATgTCACgCACgATTTC-3' (nucleotides 541-564).

The PCR was initiated at 95oC for 10 min, and then performed for 30 cycles of 94oC for 45 s, 60oC (65oC for VEGF) for 45 s, and 72oC for 45 s. The reaction was terminated by heating to 70oC for 10 min, followed by chilling on ice. The PCR products were electrophoresed, and transferred to a nylon membrane, as described above. The expected PCR products for the mouse MMP-2, MMP-9, TIMP-1, and beta actin gene were 762 bp, 489 bp, 552 bp, and 540 bp, respectively.

B. Effects of the apple polyphenol crude fraction on the in vitro invasion and migration of r/m HM-SFME-1 cells Since the apple polyphenol fraction scarcely affected the growth of r/m HM-SFME-1 cells, its effect on the in vitro invasion and migration of these cells was examined.

It has been reported that r/m HM-SFME-1 cells are highly metastatic in the lungs of mice (Matano et al, 1995).

Indeed, r/m HM-SFME-1 cells could be detected in the lungs seven days after the injection of 105 to106 cells into the footpad (unpublished data). This result suggests that these cells are highly invasive in the in vitro invasion model. Thus, we attempted to clarify the invasive activities of the r/m HM-SFME-1 cells. A preliminary experiment showed that 10% to 50% of the input cells had invaded three days after incubation. Since the rates of invasion varied from experiment to experiment, the effects of the apple polyphenol crude fraction on invasion are expressed as percentages of the mean number of invading cells in the control group for each experiment. Figure 2A shows the effect of the crude fraction on r/m HM-SFME-1 invasion. The fraction dose-dependently inhibited cell invasion, and the level of inhibition at 50 µg/ml crude fraction was significant, at 40-50% of the control level of invasion. This inhibition was not due to cytotoxicity, since the fraction was not cytotoxic at these concentrations (data

H. Determination of NO levels The levels of NO in the culture supernatants were determined with the Griess reagent, as described previously (Ryoyama et al, 1993).

I. Data presentation and statistical analysis All of the experiments were repeated two to five times, with similar results. The statistical significance of the differences between the groups was determined as described previously (Ryoyama et al, 2003).

41

Ryoyama et al: Anti-metastatic activity of an apple polyphenol

Figure 1. Effects of the crude fraction of the apple polyphenol on spontaneous lung metastasis and the in situ growth of r/m HM-SFME1 cells.

The r/m HM-SFME-1cells (2 " 105) were injected subcutaneously into the right footpad of each BALB/c mouse. The crude fraction (0.5%) of the apple polyphenol was provided freely to the mice in the drinking water, from two weeks before tumor implantation to the end of each experiment. At 39 days after tumor implantation, the numbers of lung tumor cells that had metastasized spontaneously were estimated (A). The method of estimating the numbers of tumor cells is described in the Materials and Methods section. Footpad thickness, which was taken as an indicator of tumor growth, was measured with a caliper (B). In (B), there were no statistically significant differences between the controls and treated mice for each timepoint.

Figure 2. Effects of the crude fraction of the apple polyphenol on in vitro invasion (A) and in vitro migration (B) of the r/m HM-SFME1 cells.

The r/m HM-SFME-1 cells (105/ChemotaxicellÂŽ) were incubated for three days with various concentrations of the crude fraction.

Invasion and migration of the tumor cells were determined as described in the Materials and Methods section. The results are represented as percentages of the control values: [invaded (migrated) cells with treatment / mean invaded (migrated) cells without treatment]. The values shown are means Âą SD of 5-7 independent experiments (each consisting of six Chemotaxicells). The letter below each treatment indicates the results of the statistical analysis (P<0.05).

42

Cancer Therapy Vol 2, page 43 significantly the increase in thickness of the footpads into which r/m HM-SFME-1 cells had been implanted (Figure 1B), and did not inhibit in vitro tumor growth (data not shown). Furthermore, the fraction inhibited the augmentation of MMP-9 gene expression caused by the addition of fibroblast-conditioned medium (Figure 3B).

These results suggest that the apple polyphenol crude fraction inhibits inflammation.

Therefore, we examined the effects of the crude fraction on the MMP-9 and MMP-2 activities of NIH3T3 cells and on the MMP-9 activity of J774.1 cells. Figure 3C shows that the crude fraction dose-dependently inhibited the MMP-9 activity of NIH3T3 cells, and also tended to inhibit MMP-2 activity. However, the fraction did not inhibit the MMP-9 activity of the J774.1 cells (data not shown). The production of NO by J774.1 cells, which was induced by treatment with IFN-! and LPS, was inhibited slightly but significantly by 50 µg/ml of the crude fraction (data not shown).

Plasminogen activation systems have been implicated in extracellular matrix degradation (Sidenius and Blasi, 2003). One of these systems, the urokinase-type plasminogen activator (uPA), has been clearly implicated in cancer progression, particularly invasion and metastasis (Andreasen et al, 2000; Rabbani and Mazar, 2001).

Therefore, we examined the effect of the apple polyphenol crude fraction on uPA production by the r/m HM-SFME-1 cells. The addition of 0.5-50 µg/ml of the fraction did not affect uPA production (data not shown). On the other hand, the crude fraction augmented significantly the uPA activity of J774.1 cells, whereas that of the NIH 3T3 cells was scarcely affected (data not shown).

These results show that the stromal cell responses of tumor tissues to apple polyphenols may affect tumor growth in either a positive or a negative fashion. It remains to be seen which constituents of the apple polyphenol are responsible for the individual responses.

not shown).

Since the inhibition of invasion by the apple polyphenol crude fraction might be due to the inhibition of cell migration in vitro, we examined the effect of the fraction on the migration activity of the r/m HM-SFME-1 cells. Initially, the migrating activities of the cells were assayed, and found to be 1% to 6% of the input cells after the three-day incubation. Since the rates of migration varied from experiment to experiment, the effects of the crude fraction on migration are expressed as described above for the invasion assays. Figure 2B shows the effect of the apple polyphenol crude fraction on the migration of r/m HM-SFME-1 cells. The fraction inhibited migration in a dose-dependent manner, and the level of inhibition at 50 µg/ml of the crude fraction was significant, at about 30% of the control level of migration.

C. Effects of the apple polyphenol crude fraction on the activities and gene expression of MMP, and on NO production Our preliminary experiments showed that r/m HMSFME-1 cells produced MMP-9 at low levels, but did not produce MMP-2, and that LPS augmented MMP-9 gene expression. Moreover, Wang et al. (Wang et al, 2002) have reported that fibroblasts promote breast cancer cell invasion by stimulating MMP-9 synthesis. Therefore, we examined the effects of the apple polyphenol crude fraction on MMP-9 activity and mRNA expression in r/m HM-SFME-1 cells, in the presence and absence of LPS and in the conditioned medium from a culture of the fibroblast cell line NIH3T3. Figure 3A shows that the fraction scarcely affected the MMP-9 activities of the tumor cells. The MMP-9 activity in the presence of the conditioned medium was not tested because the conditioned medium itself had potent MMP-9 activity.

Both LPS and the conditioned medium augmented MMP-9 gene expression, which was inhibited in a dosedependent fashion by the fraction (Figure 3B), whereas MMP-9 gene expression in the absence of stimulation was not affected by the fraction. Furthermore, TIMP-1 gene expression in the presence of the conditioned medium was apparently inhibited at 50 µg/ml (Figure 3B).

Since tumor growth sites appear to consist of both tumor cells and inflammatory cells, increases in footpad thickness reflect not only tumor growth but also inflammation. Many reports have indicated a close correlation between tumor progression and in situ inflammation; tumor invasion and metastasis appear to be affected by soluble factors and free radicals that are produced locally by host tissue cells (fibroblasts, endothelial cells, macrophages) (Lala and Chakraborty, 2001; Coussens and Werb, 2002; Wang et al, 2002).

Furthermore, in the majority of human and experimental tumors, NO appears to stimulate tumor growth and metastasis by enhancing the invasive, angiogenic, and migratory capacities of the tumor cells (Lala and Chakraborty, 2001). In fact, the spontaneous metastasis of r/m HM-SFME-1 in the lung is blocked by inhibitors of NO production (manuscript in preparation). The apple polyphenol crude fraction inhibited slightly but not

D. Effect of the apple polyphenol crude fraction on VEGF gene expression Neovascularization is widely accepted as being a crucial step in tumor progression (Folkman, 1995). Tumor cells and various host cells, such as macrophages, fibroblasts, and epithelial cells, secrete various angiogenic factors, the most important of these being vascular endothelial growth factor (VEGF). Thus, we examined the effect of the crude fraction on VEGF gene expression. Our preliminary experiments showed that r/m HM-SFME-1, NIH3T3, and J774.1 cells express VEGF 188 (666 bp) and VEGF 120 (462 bp). Figure 4A shows that 0.5-50 µg/ml of the crude fraction dose-dependently augmented VEGF 188 and VEGF 120 gene expression in r/m HM-SFME-1 cells. Moreover, treatment with INF-! plus LPS augmented the expression of both forms of VEGF; this augmentation was slightly increased at 0.5 µg/ml and inhibited at 50 µg/ml of the crude fraction (Figure 4A).

The expression levels of the two forms of VEGF in the NIH3T3 cells were inhibited by 50 µg/ml of the crude fraction (Figure 4B). On the other hand, the expression

43

Ryoyama et al: Anti-metastatic activity of an apple polyphenol

Figure 3. Effects of the crude fraction of the apple polyphenol on the activity and gene expression of MMP-9 in r/m HM-SFME-1 (A, B) and NIH3T3 (C) cells.

The cells (106) were treated for 24 h with various concentrations of the crude fraction. The culture supernatants and cells were processed to determine the MMP-9 activity and the expression of the MMP-9 and TIMP-1 genes, respectively, as described in the Materials and Methods section.

44

Cancer Therapy Vol 2, page 45

Figure 4. Effects of the crude fraction of the apple polyphenol on VEGF gene expression in r/mHM-SFME-1 (A), NIH3T3 (B) and J774.1 (C) cells.

The cells (106) were treated for 24 h with various concentrations of the crude fraction, and were then processed to determine VEGF gene expression, as described in the Materials and Methods section. VEGF 188 and 120 correspond to 666 bp and 462 bp, respectively.

levels of both VEGFs in J774.1 cells were much weaker than in r/mHM-SFME-1 cells, and treatment with IFN-! plus LPS augmented their expression (data not shown). As shown in Figure 4C, the crude fraction dose-dependently inhibited the augmented expression, and the expression of both VEGF forms was abrogated by 50 Âľg/ml of the crude fraction. These results suggest that the apple polyphenolinhibits neovasculalization, resulting in the inhibition of tumor metastasis.

Acknowledgements We thank Toshiya Okamura, Hanako Maekawa, and Tomoko Urushidate for technical assistance. This study was supported, in part, by a grant-in-aid from the Promotion and Mutual Aid Corporation for Private Schools of Japan.

45

Ryoyama et al: Anti-metastatic activity of an apple polyphenol fibrosarcoma HT1080 cells. J Agric Food Chem 47, 23502354.

Matano S, Ryoyama K, Nakamura S, Okada G, and Nomura T (1995) Application of the polymerase chain reaction (PCR) to quantify micro-metastasis in an experimental animal.

Cancer Lett 91, 93-99.

Menon LG, Kuttan R, and Kuttan G (1995) Inhibition of lung metastasis in mice induced by B16F10 melanoma cells by polyphenolic compounds. Cancer Lett 95, 221-225.

Menon LG, Kuttan R, and Kuttan G (1999) Anti-metastatic activity of curcumin and catechin. Cancer Lett 141, 159165.

Mouria MA, Gukovskaya S, Jung Y, Buechler P, Hines OJ, Reber HA, and Pandol SJ (2002) Food-derived polyphenols inhibit pancreatic cancer growth through mitochondrial cytochrome C release and apoptosis. Int J Cancer 98, 761769.

Paganqa G, Miller N, and Rice-Evans CA (1999) The polyphenolic content of fruit and vegetables and their antioxidant activities. What does a serving constitute? Free Radic Res 30, 153-162.

Rabbani SA, and Mazar AP (2001) The role of the plasminogen activation system in angiogenesis and metastasis. Surg Oncol Clin N Am 10, 393-415.

Ryoyama K, Mori N, Nara M, Kidachi Y, Yamaguchi H, Umetsu H, and Fuke Y (2003) Augmented gene expression of quinone reductase by 6-(methylsulfinyl)hexyl isothiocyanate through avoiding its cytotoxicity. Anticancer Res 23, 37413748.

Ryoyama K, Nomura T, and Nakamura S (1993) Inhibition of macrophage nitric oxide production by arachidonate-cascade inhibitors. Cancer Immunol Immunother 37, 385-391.

Sidenius N, and Blasi F (2003) The urokinase plasminogen activator system in cancer: Recent advances and implication for prognosis and therapy. Cancer Metastasis Rev 22, 205222. van der Sluis AA, Dekker M, de Jager A, and Jongen WM (2001) Activity and concentration of polyphenolic antioxidants in apple: effect of cultivar, harvest year, and storage conditions. J Agric Food Chem 49, 3606-3613.

Wang TN, Albo D, and Tusznski GP (2002) Fibroblasts promote breast cancer cell invasion by upregulating tumor matrix metalloproteinase-9 production. Surgery 132, 220-225.

References Andreasen PA, Egelund R, and Petersen HH (2000) The plasminogen activation systemin tumor growth, invasion, and metastasis. Cell Mol Life Sci 57, 25-40.

Astill C, Birch MR, Dacombe C, Humphrey PG, and Martin PT (2001) Factors affecting the caffeine and polyphenol contents of black and green tea infusions. J Agric Food Chem 49, 5340-5347.

Blanko AR, La Terra Mule S, Babini G, Garbisa S, Enea V, and Rusciano D (2003) (-) Epigallocatechin-3-gallate inhibits gelatinase activity of some bacterial isolates from ocular infection, and limits their invasion through gelatin. Biochem Biophys Acta 1620, 273-281.

Caltagirone S, Rossi C, Roggi A, Ranelletti FO, Natali PG, Brunetti M, Aiello FB, and Oiantelli M (2000) Flavonoids apigenin and quercetin inhibit melanoma growth and metastatic potential. Int J Cancer 87, 595-600.

Coussens LM, and Werb Z (2002) Inflammation and cancer.

Nature 420, 860-867.

Folkman I (1995) Tumor angiogenesis. In â&#x20AC;&#x153;The Molecular Basis of Cancerâ&#x20AC;?, eds. Mendelson J, Howley P, Israel M, and Liotta L, W. B. Saunders Company, Philadelphia, pp.206232.

Freidman M, and Jugens HS (2000) Effect of pH on the stability of plant phenolic compounds. J Agric Food Chem 48, 21012110.

Graham HN (1992) Green tea composition, consumption, and polyphenol chemistry. Prev Med 21, 334-350.

Gupta S, Hussain T, and Mukhtar H (2003) Molecular pathway for (-)epigallocatechin- 3-gallate-induced cell cycle arrest and apoptosis of human prostate carcinoma cells. Arch Biochem Biophys 410, 177-185.

Kanda T, Akiyama H, Yanagida A, Tanabe M, Goda Y, Toyoda M, Teshima R, and Saito Y (1998) Inhibitory effects of apple polyphenol on induced histamine release from RBL-2H3 cells and rat mast cells. Biosci Biotechnol Biochem 62, 1284-1289.

Kelloff G.J, Crowell J.A, Steele VE, Lubet RA, Malone WA, Boone CW, Kopelovich L, Hawk ET, Lieberman R, Lawrence JA, Ali I, Viner JL, and Sigman CC (2000) Progress in cancer chemoprevention: development of dietderived chemopreventive agents. J Nutr 130, 467S-471S. Lala PK, and Chakraborty C (2001) Role of nitric oxide in carcinogenesis and tumour progression., Lancet Oncol 2, 149-56.

Leontowicz H, Gorinstein S, Lojek A, Leontowicz M, Ciz M, Solvia-Fortuny R, Park YS, Jung ST, Trakhtenberg S, and Martin-Belloso O (2002) Comparative content of some bioactive compounds in apples, peaches and pears and their influence on lipids and antioxidant capacity in rats. J Nutr Biochem 13, 603-610.

Lin JK, (2002) Cancer chemoprevention by tea polyphenols through modulating signal transduction pathways. Arch Pharm Res 25, 561-571.

Maeda-Yamamoto M, Kawahara H, Tahara N, Tsuji K, Hara Y, and Isemura M (1999) Effects of tea polyphenols on the invasion and matrix metalloproteinases activities of human

Dr. Kazuo Ryoyama

46

Cancer Therapy Vol 2, page 47 Cancer Therapy Vol 2, 47-53, 2004

Expression of XRCC 1 and ERCC 1 proteins in radioresistant and radiosensitive laryngeal cancer Research Article

Paul Nix, John Greenman, Nicholas Stafford, Lynn Cawkwell Postgraduate Medical Institute of the University of Hull in association with Hull York Medical School, University of Hull, Hull, HU6 7RX, UK

__________________________________________________________________________________ *Correspondence: Dr Lynn Cawkwell, R+D Building, Castle Hill Hospital, Hull, HU16 5JQ, England; UK, Tel: +44 -1482 875875 ext3617; Fax: +44 -1482 622398; e-mail: l.cawkwell@hull.ac.uk Key Words: radioresistant laryngeal cancer, XRCC1 and ERCC 1 proteins Abbreviations: X-ray repair cross complementing gene, (XRCC 1); Chinese hamster ovary, (CHO); Excision repair complementing defective repair in Chinese hamster, (ERCC 1) Received: 15 March 2004; Accepted: 13 April 2004; electronically published: April 2004

Summary Radiotherapy is the principal modality used to treat early stage laryngeal cancer in the UK. Unfortunately treatment failures occur in up to 25% of patients. Subsequent salvage surgery is technically more difficult with the consequences of increased complication and failure rates. The ability to predict radioresistance would significantly improve the poor survival associated with this disease. The efficiency of DNA repair is one of the critical determinants of cell fate following radiotherapy. Using immunohistochemical techniques we examined the expression of DNA repair proteins XRCC 1 and ERCC 1 in 108 pre-treatment laryngeal biopsy samples. All tumours were treated with single modality radiotherapy with curative intent. The group comprised 54 radioresistant and 54 radiosensitive tumours matched for T stage and smoking history. ‘Normal’ expression of both XRCC 1 and ERCC 1 was significantly associated with radioresistant tumours (p<0.001), with an accuracy of 69% in predicting radiotherapy treatment failure and a low false positive rate of 12%. Patients with predicted radioresistant tumours could be offered conservative laryngeal surgery as a first line treatment instead of radiotherapy. This treatment option is widely used in the USA and is equally as effective as radiotherapy for early stage laryngeal tumours. predict radiotherapy response at an early stage would improve morbidity and mortality associated with laryngeal cancer.

Due to the essential nature of DNA for genetic inheritance all organisms have evolved mechanisms to recognise and respond to DNA damage. Following radiation-induced DNA damage, cells either undergo cell cycle arrest, to facilitate DNA damage repair, or apoptosis (Shiloh 2003). The efficiency of DNA repair is one of the critical determinants of cell fate following radiotherapy (Polischouk et al, 2001). Base and nucleotide excision repair mechanisms are particularly important in the repair of DNA strand breaks caused by radiotherapy. The DNA repair capacity varies between individuals as a result of inheritance, environmental factors and physiological factors (Scully et al, 2000).

X-ray repair cross complementing gene (XRCC 1) is a key factor involved with DNA strand repair following ionising irradiation. The Chinese hamster ovary (CHO) mutant cell line EM9 has no detectable levels of XRCC 1

I. Introduction Radiotherapy used as a single treatment modality can be an effective cure for early stage (T1 and T2) laryngeal tumours. Unfortunately radiotherapy treatment failures do occur: approximately 10% of patients with stage I disease (Klintenberg et al, 1996) and 25% of patients with stage II disease (Fernberg et al, 1989) do not respond to radiotherapy. These observations demonstrate that the TNM system, although widely used as the basis for patient cancer management, cannot always predict an individual tumour’s response to radiotherapy.

If a patient fails radiotherapy, a total laryngectomy is the only treatment option that can offer a cure. However, tumour progression may well have occurred adversely affecting patient prognosis still further. The subsequent loss of the larynx will have a significant psychological impact upon the patient and operating in a previously irradiated field results in increased surgical failure and complication rates (McLaughlin et al, 1996). The ability to

47

Nix et al: Radioresistant laryngeal cancer and is highly sensitive to ionising irradiation. The molecular basis for this sensitivity was characterised by decreased single stranded DNA break repair (vanAnkeren et al, 1988), reduced recombination repair (Hoy et al, 1987) and increased double stranded DNA breaks (Green et al, 1992). Subsequent expression of XRCC 1 complements the deficiency of the radiosensitive mutant CHO cell line EM9, implicating its involvement with the cells radiation response (Jeggo et al, 1991).

Excision repair complementing defective repair in Chinese hamster (ERCC 1) is essential for nucleotide excision repair in mammalian cells (Westerveld et al, 1984). The CHO mutant cell line 43-3B that has lost ERCC 1 expression is sensitive to UV irradiation. When ERCC 1 was stably transfected into the 43-3B cell line the radiation repair defect in the CHO mutant cells was corrected (Bohr et al, 1988).

Loss of expression of DNA repair proteins that fix the damage caused by ionising radiation may be associated with radiosensitive laryngeal cancer. On the basis of the above observations, the protein expression of XRCC 1 and ERCC 1 was investigated in radioresistant and radiosensitive cohorts of laryngeal cancer patients. It is hypothesised that tumour cells with reduced expression of XRCC 1 or ERCC 1 are radiosensitive at the beginning of radiotherapy treatment and that subsequent fractionated radiotherapy selects out radioresistant clones resulting in the observed clinical tumour recurrence.

Tissue sections (4µm) were cut from pre-treatment archival tissue blocks of all tumours. Immunohistochemistry as previously described was used to detect XRCC 1 and ERCC 1 on the tissue sections (Cawkwell et al, 1999). Both monoclonal antibodies localised to the nuclear compartment of the cell. In brief, antigen retrieval was performed using pressurised heat retrieval. XRCC 1 was detected using a mouse monoclonal antibody (100µl) anti XRCC 1 (Neomarkers, Fremont, USA, clone 33-2-5) at a dilution of 1:40 with 0.2x casein and ERCC 1 was detected using a mouse monoclonal antibody (Neomarkers clone 8F1) at a dilution of 1:100. The antibodies were added to each tissue section and incubated at room temperature for two hours. A negative control was included using 100µl of 0.2x casein instead of the primary antibody. The Duet kit (DAKO, Denmark) was used as the secondary detection system and 3,3’diaminobenzidine tetrachloride as the chromogen.

B. Marker assessment No recognised scoring systems for XRCC 1 or ERCC 1, detected by immunohistochemistry, have been published. A proposed marking scheme based on the staining pattern of XRCC 1 and ERCC 1 in ‘normal’ squamous epithelium, from a test series of stage T3/T4 laryngeal tumours, has been used here.

‘Normal’ squamous epithelium uniformly stained for both markers. Reduced expression of a marker was deemed to occur if 50% or less of the tumour stained. The 50% cut off was decided upon after assessing the level of ERCC 1 marker expression by one observer in 108 tumour sections using cut off points of, 50%, 25% and 5% and 1%, for a negative result (Table 2). A 50% cut off for a reduced marker expression was chosen due to its significant discrimination between the radioresistant and radiosensitive tumours as well achieving a high level of concordance between observers. A similar subjective 50% cut off scoring system for reduced expression of proteins involved in DNA repair has also been reported for laryngeal cancer (Condon et al, 2002). Intensity of tumour staining was not used as a basis for scoring due to potential variations in clinical specimen fixation that affect intensity (Fisher et al, 1994).

Two independent assessors blinded to the final outcome scored XRCC 1 and ERCC 1 throughout the whole biopsy section. If 50% or less of the tumour stained throughout the whole tissue section, reduced expression was recorded. As the whole biopsy section was assessed, in order to reduce a further sampling error of the whole tumour, the scoring was subjective.

The two independent assessors had complete agreement in 73% of the XRCC 1 cases and reached consensus agreement after consultation in the remaining cases. For ERCC 1 the two assessors had complete agreement in 77% of the cases and consensus agreement in the remaining cases. In an attempt to validate the consensus results one of the assessors re-scored the markers, once again in a blinded manner and achieved a 94% accuracy when compared with the consensus result. This suggests that a reproducible marking system has been used.

II. Materials and methods A. Samples Local Research Ethics Committee approval for obtaining data and archival biopsy material for the study was obtained.

Patients diagnosed with laryngeal carcinoma and treated with single modality radiotherapy with curative intent (either 55Gy in 20 fractions or 60Gy in 25 fractions) were identified from databases held in ENT departments in England. Patients were identified as having radioresistant or radiosensitive tumours depending upon their response to radiotherapy. In order to reduce confounding variables, the radioresistant and radiosensitive groups were matched with regards to T stage and smoking history. The groups were very similar, with no significant difference with regards to laryngeal sub site, tumour differentiation and gender. Tumours were staged according to the TNM classification (Greene & Sobin 2002) and all were clinically N0 and M0 at the time of treatment.

The radioresistant group consisted of 54 patients: 37 stage T1 and 17 stage T2 laryngeal squamous cell carcinomas (Table 1). The criteria for a radioresistant tumour were: 1) The radiotherapy had to be given as a single modality treatment with curative intent for a biopsy-proven squamous cell carcinoma of the larynx and 2) Biopsy-proven recurrent squamous cell carcinoma, the recurrence occurring at the original anatomical site, within 12 months of finishing a course of radiotherapy.

The radiosensitive group of tumours consisted of 54 patients: 37 stage T1 and 17 stage T2 squamous cell carcinomas of the larynx. The criteria for a radiosensitive tumour were: 1) The radiotherapy had to be given as a single modality treatment with curative intent for a biopsy proven squamous cell carcinoma of the larynx and 2) Post treatment, patients had a minimum follow up of 3 years with no evidence of a recurrent laryngeal tumour.

C. Statistics Chi-Squared and McNemar statistical analysis using SPSS version 11.5 (SPSS Inc, Chicago, USA) was used throughout. All P values quoted are for two-sided significance, between the radioresistant and radiosensitive groups. Values less than 0.05 were considered significant. Marker accuracy, sensitivity and specificity were calculated as previously described (Greenhalgh, 1997).

III. Results Representative immunohistochemical staining of

48

Cancer Therapy Vol 2, page 49 Table 1: Laryngeal cancer patient characteristics

Mean Age, years (SD) Patient gender: -Male -Female Mean time to recurrence (months) T Stage: -T1 -T2 Laryngeal sub site: -Glottic tumours -Supraglottic tumours Tumour differentiation: -Well -Moderate -Poor

Radioresistant (n=54)

Radiosensitive (n=54)

64 (9.5)

64 (9.8)

46 8 6 (2-12)

42 12 -

37 17

37 17

50 4

48 6

16 32 6

17 27 10

Table 2: ERCC1 expression in 108 laryngeal cancers using different positive cut off points % of positively Stained tumour cells

Radioresistant (n=54)

!50% <25% <5% <1% *Chi Squared 95% two-sided significance

17% 11% 7% 0%

Radiosensitive (n=54)

p value*

41% 33% 11% 4%

0.005 0.02 0.9 0.7

Figure 1: Immunolocalisation of XRCC 1 on a laryngeal biopsy tissue section. A â&#x20AC;&#x201C; Radioresistant sample demonstrating >50% of tumour cells staining for XRCC 1. Nuclear staining of squamous cell carcinoma radioresistant tumour cells with XRCC 1. Staining of the normal squamous epithelium acts as an internal positive control. B. Radiosensitive tumour demonstrating < 50% of the tumour nuclei have stained with XRCC 1. Magnification x100

49

Nix et al: Radioresistant laryngeal cancer

Figure 2: Immunolocalisation of ERCC 1 on a laryngeal biopsy tissue section A. Radioresistant tumour biopsy demonstrating nuclear staining of squamous cell carcinoma cells with ERCC 1. The majority of tumour nuclei have stained. B. Radiosensitive tumour demonstrating that < 50% of the tumour nuclei have stained with ERCC 1. Magnification x100

ERCC 1 and XRCC 1 proteins is shown in Figures 1 and 2.

XRCC 1 and ERCC 1 were both localised to the nucleus of tumour and the normal squamous epithelial cells. The staining of the â&#x20AC;&#x2DC;normalâ&#x20AC;&#x2122; squamous epithelium served as an internal positive control implying that the tissue antigens under investigation had been preserved in a detectable form during the fixation process. Reduced XRCC 1 expression was observed in 37% of radioresistant compared with 57% of radiosensitive tumours (Table 3).

Reduced ERCC 1 expression was exhibited in 18% of radioresistant compared with 46% of radiosensitive tumours. These results were significant, p=0.034 and p= 0.002 respectively.

In the radioresistant cohort (n=54) 61% of the tumours had normal expression of both XRCC 1 and ERCC 1 (p=0.006) compared with only 24% of the tumours in the radiosensitive cohort (Table 4).

If expression, in >50% of tumour cells, of both XRCC 1 and ERCC 1 is used as a predictive marker for radiotherapy outcome in early stage laryngeal cancer, it has an accuracy of 69% and a low false positive rate of 12% (Table 5).

50

Cancer Therapy Vol 2, page 51 partial laryngeal surgery with equal effect. Our results demonstrate that 57% of radiosensitive tumours had reduced expression of XRCC 1 compared with 37% in the radioresistant group. For ERCC 1 46% had reduced expression compared with only 18% in the radioresistant group. These results suggest that reduced tumour DNA repair capacity is associated with radiosensitivity in early stage laryngeal cancer, an observation that has been reported in the N10 radioresistant cell line (Yanagisawa et al, 1998). The human DNA repair gene XRCC 1 was over expressed in a human radiosensitive cell line, KB. Compared with its radiosensitive counterpart, as determined by Northern blot analysis, constitutively N10 KB cells showed higher expression of XRCC 1 mRNA than did the parental KB cells. After irradiation of both cell lines with 4 Gy the N10KB cell line showed enhanced survival and increased XRCC 1 mRNA compared with the KB cell line.

Labudova et al (1997) characterised the expression of XRCC 1 mRNA in two genetically well-defined animal systems differing in their known sensitivity to ionising radiation. The radioresistant C3H He/Him mice had higher levels of XRCC 1 mRNA than the radiosensitive BALB/c/J Him mice before any radiation.

IV. Discussion At present there are no studies evaluating DNA repair protein expression in radioresistant head and neck cancer. We report that loss of XRCC 1 and ERCC 1 expression correlates with radiotherapy outcome in laryngeal cancer. In order to reduce confounding variables we have limited the study to the larynx, the largest head and neck region affected by cancer in the UK and applied a strict definition of radioresistance. By stipulating that recurrences had to occur at the original anatomical site following radiotherapy occult metastasis that occur in regional lymph nodes will not be erroneously counted as a recurrence. Also the recurrence had to be of a similar histology and occur within 12 months of finishing the course of radiotherapy. This will exclude the majority of second primary tumours, that are common in the head and neck region (Holland et al, 2002). If these second primary tumours were not excluded they would be erroneously interpreted as a radiotherapy recurrence.

By close matching of the tumour groups, variables such as TNM stage and smoking history were removed as possible confounding variables in the reported results. The analysis was limited to early stage laryngeal tumours (T1 or T2 N0 and M0) that are widely recognised as tumours that can be treated with single modality radiotherapy or

Table 3 XRCC1 and ERCC 1 expression in 54 radioresistant and 54 radiosensitive T1 and T2 laryngeal cancers Radioresistant ( n=54)

Radiosensitive (n=54)

p value*

XRCC 1 expression !50% 20 (37%) 31 (57%) >50% 34 (63%) 23 (43%) 0.034 _____________________________________________________________________________________________________________ ERCC 1 expression !50% 10 (18%) 25 (46%) >50% 44 (82%) 29 (54%) 0.002 *Chi Squared 95% two-sided significance

Table 4 Co-expression of XRCC 1 and ERCC 1 in 54 Radioresistant and 54 Radiosensitive T1 and T2 laryngeal cancers Radioresistant tumours (n=54) ERCC 1 expression !50% >50% Radiosensitive tumours (n=54) ERCC 1 expression !50% >50% *McNemar test, two sided significance

XRCC 1 expression !50%

>50%

p value*

9 11

1 33

0.006

XRCC 1 expression !50%

>50%

p value*

15 16

10 13

0.327

51

Nix et al: Radioresistant laryngeal cancer Table 5 Predictive value of both XRCC 1 and ERCC 1 expression as a marker of radiotherapy outcome in 108 patients with early stage laryngeal cancers XRCC 1 and ERCC 1 >50% expression Positive =46 Negative =64 Sensitivity Specificity Positive predictive value Negative predictive value Accuracy False positive True positive

Final outcome of therapy Tumour recurrence =54 Tumour free =54 True +ve =33 False â&#x20AC;&#x201C;ve =21

False +ve =13 True -ve =41

61% 76% 61% 66% 69% 12% 31%

Following 4Gy the radioresistant mice significantly increased the levels of XRCC 1 mRNA compared with the radiosensitive mice. In summary XRCC 1 appears to be associated with cellular radioresistant in both animal and human systems. XRCC 1 and ERCC 1 have been chosen as possible discriminators of radiation sensitivity based upon the observations stated above and in the introduction.

The fact that both DNA repair proteins had a significantly reduced expression in the radiosensitive tumours may suggest that there is a global decrease in DNA repair.

Intuitively this would be expected with tumours that are sensitive to radiation damage. It may be that there is an upstream regulator of DNA strand breaks following radiation damage that better correlates with radiation response.

The association of both XRCC1 and ERCC 1 expression in the nuclei of at least 50% of tumour cells in the pre-treatment biopsy material may be used as a prognostic marker predicting radiotherapy treatment failure with an accuracy of 69%. The 31% of patients with radioresistant T1 or T2 laryngeal cancer and are XRCC 1 and ERCC 1 positive could be offered conservative laryngeal surgery as a first line treatment instead of radiotherapy. This treatment option is widely used in the USA and is equally as effective as radiotherapy for early stage laryngeal tumours (Wilson 2002). Consequently such patients will not require salvage surgery and will benefit from improved survival and quality of life as their larynx will be preserved and they will not receive unnecessary radiotherapy. Equally there will be no detrimental effect to the 12% of patients with a false positive result who would be offered partial laryngeal surgery instead of radiotherapy.

Predicting radiotherapy treatment failure using pretreatment biopsy material would be a significant clinical advance in the treatment of laryngeal cancer. At present radioresistant laryngeal T1 or T2 tumours cannot be predicted. Using XRCC 1 in combination with ERCC 1 can predict 31% of the radioresistant cases.

Acknowledgements Paul Nix was funded by a Cazenove & Co. Research Fellowship, The Royal College of Surgeons of England.

References Bohr VA, Chu EH, van Duin M, Hanawalt PC, and Okumoto DS (1988) Human repair gene restores normal pattern of preferential DNA repair in repair defective CHO cells.

Nucleic Acids Res 16, 7397-7403.

Cawkwell L, Gray S, Murgatroyd H, Sutherland F, Haine L, Longfellow M, O'Loughlin S, Cross D, Kronborg O, Fenger C, Mapstone N, Dixon M, and Quirke P (1999) Choice of management strategy for colorectal cancer based on a diagnostic immunohistochemical test for defective mismatch repair. Gut 45, 409-415.

Condon LT, Ashman JN, Ell SR, Stafford ND, Greenman J, and Cawkwell L (2002) Overexpression of Bcl-2 in squamous cell carcinoma of the larynx: a marker of radioresistance. Int J Cancer 100, 472-475.

Fernberg JO, Ringborg U, Silfversward C, Ewert G, Haglund S, Schiratzki H, and Strander H (1989) Radiation therapy in early glottic cancer. Analysis of 177 consecutive cases. Acta Otolaryngol 108, 478-481.

Fisher CJ, Gillett CE, Vojtesek B, Barnes DM, and Millis RR (1994) Problems with p53 immunohistochemical staining: the effect of fixation and variation in the methods of evaluation. Br J Cancer 69, 26-31.

Green A, Prager A, Stoudt PM, and Murray D (1992) Relationships between DNA damage and the survival of radiosensitive mutant Chinese hamster cell lines exposed to gamma-radiation. Part 1: Intrinsic radiosensitivity. Int J Radiat Biol 61, 465-472.

Greene FL, and Sobin LH (2002) The TNM system: our language for cancer care. J Surg Oncol 80, 119-120.

Greenhalgh T (1997) How to read a paper. Papers that report diagnostic or screening tests. BMJ 315, 540-543.

Holland JM, Arsanjani A, Liem BJ, Hoffelt SC, Cohen JI, and Stevens KR, Jr (2002) Second malignancies in early stage laryngeal carcinoma patients treated with radiotherapy. J Laryngol Otol 116,190-193.

Hoy CA, Fuscoe JC, and Thompson LH (1987) Recombination and ligation of transfected DNA in CHO mutant EM9, which has high levels of sister chromatid exchange. Mol Cell Biol 7, 2007-2011.

52

Cancer Therapy Vol 2, page 53 Jeggo PA, Tesmer J, and Chen DJ (1991) Genetic analysis of ionising radiation sensitive mutants of cultured mammalian cell lines. Mutat Res 254, 125-133.

Klintenberg C, Lundgren J, Adell G, Tytor M, Norberg-Spaak L, Edelman R, and Carstensen JM (1996) Primary radiotherapy of T1 and T2 glottic carcinoma--analysis of treatment results and prognostic factors in 223 patients. Acta Oncol 35, 81-86 (suppl 8).

Labudova O, Hardmeier R, Rink H, and Lubec G (1997) The transcription of the XRCC1 gene in the heart of radiationresistant and radiation-sensitive mice after ionizing irradiation. Pediatr Res 41, 435-439.

McLaughlin MP, Parsons JT, Fein DA, Stringer SP, Cassisi NJ, Mendenhall WM, and Million RR (1996) Salvage surgery after radiotherapy failure in T1-T2 squamous cell carcinoma of the glottic larynx. Head Neck 18, 229-235.

Polischouk AG, Grenman R, Granath F, and Lewensohn R (2001) Radiosensitivity of human squamous carcinoma cell lines is associated with amount of spontaneous DNA strand breaks. Int J Cancer 96, 43-53 (suppl).

Scully C, Field JK, and Tanzawa H (2000) Genetic aberrations in oral or head and neck squamous cell carcinoma (SCCHN): 1.

Carcinogen metabolism, DNA repair and cell cycle control.

Oral Oncol 36, 256-263.

Shiloh Y (2003) ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer 3, 155-168. vanAnkeren SC, Murray D, Stafford PM, and Meyn RE (1988) Cell survival and recovery processes in Chinese hamster

AA8 cells and in two radiosensitive clones. Radiat Res 115, 223-237.

Westerveld A, Hoeijmakers JH, van Duin M, de Wit J, Odijk H, Pastink A, Wood RD, and Bootsma D (1984) Molecular cloning of a human DNA repair gene. Nature 310, 425-429.

Wilson JA (2002) Effective Head and Neck Cancer Management, British Association Of Otorhinolaryngologists Head and Neck Surgeons, London.

Yanagisawa T, Urade M, Yamamoto Y, and Furuyama J (1998) Increased expression of human DNA repair genes, XRCC1, XRCC3 and RAD51, in radioresistant human KB carcinoma cell line N10. Oral Oncol 34, 524-528.

Dr. Lynn Cawkwell

53

Nix et al: Radioresistant laryngeal cancer

54

Cancer Therapy Vol 2, page 55 Cancer Therapy Vol 2, 55-60, 2004

Substrate dependent genomic heterogeneity in cancers of the lung Research Article

Shamim A. Faruqi*, Leslie Krueger1 Hahnemann University, Department of Neoplastic Diseases, Philadelphia, PA, USA. 19102

__________________________________________________________________________________ *Correspondence: Shamim A. Faruqi, Ph.D., Gynecologic Oncology Research Laboratory, Department of OB/GYN, Crozer-Chester Medical Center, Upland, PA 19013, USA; Tel: 610-447-2775; Fax: 610-447-2939; e-mail:gynoncob@aol.com 1.

Current address: Molecular Genetics, Cellular and Tissue Transplantation, Nemours Biomedical Research, Alfred I. duPont Hospital for Children, Wilmington, DE 19803, USA. Key Words: Lung cancer, Tumor biopsy, Cell culture, Chromosomes, Clonal cells, PrimariaTM Abbreviations: diaminobenzedine, (DAB); double minute, (dm); fetal calf serum, (FCS); geimsa-tripsin-geimsa, (GTG); normal tissue culture plastic, (NTCP); Roswell Park Memorial Institute tissue culture media 1640, (RPMI-1640); variant small cell lung cancer, (vSCLC) Received: 06 February 2004; Accepted: 19 April 2004; electronically published: April 2004

Summary Split samples from an adenocarcinoma of the lung, an embryonal testicular carcinoma metastasized to lung, and a variant-small cell lung carcinoma (v-SCLC) were cultured on two different plastic substrates, i.e. normal tissue culture plastic (NTCP) and PrimariaTM flasks. Cells were cultured in identical media. Upon harvesting of the cultures, chromosomal analyses were begun to investigate clonal differences found between the substrates. For each tumor, chromosomal abnormalities were encountered in one plastic, but absent in the other. The greatest differences were noted in v-SCLC. Some cells attached while the others remained suspended in the medium. Both suspension and attached cultures grew. These populations, when subjected to GTG banding or immunohistochemical staining with a panel of eight antibodies demonstrated differences in chromosomal constitution and specific differentiation markers. The universal use of a single combination of substrate and media in tumor cytogenetics may result in an incomplete catalogue of chromosomal anomalies. Classical SCLC is known to evolve rapidly into atypical, chemo- and radiation-resistant SCLC, these changes may reflect the underlying biological progression occurring in vivo. We recognize the limited nature of this study and await subsequent studies demonstrating the utility of multiple support substrates in modeling in vivo tumor progression. This may offer a starting point for the development of a new diagnostic tool especially for v-SCLC. (NTCP and PrimariaTM), an adenocarcinoma of the lung, an embryonal testicular carcinoma metastasized in lung and a variant-small cell carcinoma of the lung (v-SCLC).

We analyzed these for genomic differences on the two dissimilar plastic substrates. The highly variable v-SCLC was also examined using a panel of antibodies to differentiation antigens. We investigated whether the differences were associated with corresponding changes in the biology of the cells.

I. Introduction Cancer cells in general and solid tumors in particular are predominantly multi-clonal. Successful culture of tumor cells is contingent upon the process of cell adhesion. Although normal tissue culture plastic (NTCP) is the gold standard for cell culture, others have modified this system and incorporated or developed new systems to improve cell culture growth. These included agar (Trent and Salmon, 1980), fibronectin (Kleinman et al, 1981; Klebe and Mock, 1982) and ECMâ&#x20AC;&#x2122;s (Siegal et al, 1993).

Malignant ovarian tumors cultured on these same two plastics, i.e. normal tissue culture plastic (NTCP) and PrimariaTM (Becton and Dickinson Labware, Franklin Lakes, NJ, USA) showed an increased rate of establishment in culture from biopsy material. The success rate was higher than had been shown (Deger, 1997).

Presently, we have grown in these same two substrates

II. Materials and methods Tumor materials were aseptically excised, placed in transport serum free RPMI - 1640 in 10 mM Hepes buffered media and transported directly to the laboratory. The tumor tissue was placed in a sterile petri dish in a laminar flow hood where the necrotic and other extraneous material e.g., fat was dissected and removed. The resultant tissue was mechanically disrupted into fine slivers using two sterile scalpels and washed with sterile

55

Faruqi and Krueger: Substrate dependent genomic heterogeneity in cancers of the lung media. A minimum amount of media that contained 10% fetal bovine serum (FBS) in RPMI - 1640 fortified with 2% penicillin and streptomycin and supplemented with 2 mM L-glutamine was used to keep the tissue moist. The resultant cell slurry was then overlayed with a solution containing 16mg of collagenase-II in 10 ml of media with 15% FBS in RPMI - 1640 fortified with 2% penicillin and streptomycin and supplemented with 2 mM Lglutamine at 37C. Disaggregation of the slurry into single cells was monitored by direct visualization by microscopy. The time of incubation varied from 4 hrs to overnight. After the undigested tissue settled, the cells were harvested by centrifugation; washed in RPMI - 1640 fortified with 2% penicillin and streptomycin and supplemented with 2 mM L-glutamine; and incubated at room temperature in RBC lysing buffer (Sigma, St Louis, MO, USA) for 10 min. Cells were washed again, counted, split into the appropriate numbers of flasks. Each culture was plated on PrimariaTM and NTCP in media containing 10% fetal bovine serum (FBS) in RPMI - 1640 fortified with 2% penicillin and streptomycin and supplemented with 2 mM L-glutamine.

Cytogenetic analysis was carried out using linear growing, sub-confluent cultures. These cultures were exposed to 0.5 ug/ml colchemidTM for 1-15 hours to increase the number of cells undergoing mitosis; the attached cells were then harvested using 0.06 % trypsin-EDTA. The cells were washed and centrifuged to eliminate the residual trypsin. Suspension cultures were harvested by centrifugation. Cells were exposed to hypotonic sodium citrate solution (1:1 mixture of 0.4% solution containing (potassium chloride and sodium citrate). Hypotonic exposure and several steps of harvesting, washing and exposure were carried out by repeated centrifugation and suspension of each of the pellets. This was performed five-times over a twenty-minute period. The cells were then denatured in Carnoyâ&#x20AC;&#x2122;s fixative. Each culture of v-SCLC cells, whether growing in unattached suspended cultures in the media above the plastic flask or attached to the plastic substrate, was initially separated, cultured independently from the line competing cell line and harvested.

The fixed and swollen cells were then dropped onto slides in a high humidity environment to both spread and maximize the removal of cytoplasm from the metaphase spreads. Prepared slides were then stained using standard trypsin-geimsa staining method for GTG banding (G-bands obtained by trypsin using Giemsa stain). Comparison of chromosome markers of v-SCLC PrimariaTM was obtained using an Olympus microscope system.

Approximately 20 cells from each culture were examined and 10 individual cells were scored for chromosomal anomalies by direct examination and photographed. In this manner, clonal lines were then identified and evaluated using ISCN 1995 nomenclature.

Cells were appropriately harvested and prepared for immunohistochemical staining as described by the suppliers. A cytospin preparation of each of the cultures was obtained and the slides air dried and stored at -70o C. Antibodies for CEA, Keratin, NSE, EMA and SCLC specific antibodies TFS2, TFS4 (Okabe et al, 1985) and antibodies MY4 and MY9 (Yamashita et al, 1989) were used in this study. MY4 and MY9 antibodies detected granulocyte macrophage colony-stimulating factor on v-SCLC, as well as leukemic cells. For each experiment, antibody blocking and optimization were performed as described by the manufacturer. In general, frozen slides containing the cells previously concentrated by cytospin centrifugation, were brought to room temperature and prefixed with 3% hydrogen peroxide methanol for 30 min. After a PBS wash, the slides were treated with 1% bovine serum albumin in PBS for 30 min followed by an exposure of 1:20 dilution of normal serum albumin in PBS for 30 min followed by, for example, 1:100 rabbit antihuman keratin (primary antibody) in PBS for 30 min and a 10min wash. The slide was then exposed to PAP (1:50 in PBS) for 45 min and a PBS wash. Diaminobenzedine was prepared as follows: first a

solution was made by mixing 10 ml of 0.5 M Tris-HCl buffer to 90 ml of dH2O from which 12 ml of solution was discarded. A second solution of 1 ml 30% H2O2 was added to 90 ml dH2O. Finally a third mixture was made by mixing 0.75ml of each of the three solutions with the final addition of 0.11gm of diaminobenzedine. Stain was filtered and each slide was stained for 5 min. The slides stained for antibodies CEA, NSE and EMA were processed the same way as the slide for keratin. For TFS2 prior to the exposure to primary antibody, the slide was exposed for 8 min in 10% normal goat serum and then exposed to 1:100 monoclonal mouse antihuman TFS2 for an additional 40 min.

After a10 min PBS wash, the slide was exposed to goat antimouse-biotin, the secondary antibody. A PBS wash was followed by exposure to ABC complex for 30 min. DAB staining was the same as explained earlier. The staining procedure for TFS4,MY4 and MY9 was the same as explained for TFS2. Slides were counter-stained with toluidine blue. Reaction to the cell by the antibody was graded both based on intensity (graded from 1-3), as well as percentage of the stained cells.

III. Results Tumor biopsies were brought into the laboratory, processed and cultured as described. Cellular harvests of the cultures enriched for mitotic cells were accomplished using standard techniques. Ten cells from each substrate were analyzed. This included analyzing cells that were attached to the plastic (stickers) and those cells that remained growing in suspension (floaters). The suspension cells were separated from the attached cultures and grown separately. The suspension cultures did not attach even after longer periods of growth.

In the adenocarcinoma of the lung grown on NTCP, two abnormal clones, i.e. one showing 45 chromosomes with the loss of the Y chromosome was found in three cells (45,X,-Y[3]) and the other clone showed two cells with 47 chromosomes with the addition of a marker chromosome (47,XY,+mar[2]). These two abnormal tumor clones were found in addition to the normal karyotype that was found in five cells (46,XY[5]). On PrimariaTM, a normal clone of five cells (46,XY[5]) was also found with only a single abnormal clone 45,X,-Y[4].

In addition to chromosomal variation found in the adenocarcinoma, NTCP and PrimariaTM showed distinct culture properties. The variant SCLC tumor differed in the ability to adhere to the two plastics. The tumor cells in NTCP did not attach to the plastic, but remained floating in the media. Nonetheless, these cells continued to grow.

Cells cultured on PrimariaTM showed two distinct populations. The first, the cells remained suspended in the medium while remaining active. The other, as expected, attached to the surface of the flask. Chromosomes of NTCP ranged from hypodiploid to hypotriploid with a hypotriploid mode. In PrimariaTM however, the attached cells ranged from hyperdiploid to hypertriploid. However, chromosomal distribution showed hypertriploidy as the most common outcome in both plastics. Strikingly, cells growing in suspension on PrimariaTM showed a single abnormal clone, 45XX,-16, (see Table 1). The attached cell population cultured on Primaria TM and cells suspended in the medium contained in NTCP showed 24 chromosomal anomalies each. Sixteen of the twenty-four were common while, eight were unique clones (Figure 1).

56

Cancer Therapy Vol 2, page 57

Figure 1. Chromosomal analysis of v-SCLC biopsies split and established on different tissue culture plastics. Disaggregated cells were split and established. The resultant cells were cultured on normal tissue culture plastic (NTCP) or PrimariaTM. Abnormal chromosome numbers are plotted as black bars above the axis representing chromosome gains and below the axis representing chromosomal losses. The grey bars represent the presence of structurally modified chromosomes called markers.

57

Faruqi and Krueger: Substrate dependent genomic heterogeneity in cancers of the lung Figure 2.

Immunohistochemical evaluation in v-SCLC cultures and adenocarcinoma of the lung cultures grown on normal tissue culture plastic or PrimariaTM. Each of the cell lines established under the different conditions were reacted to each of the antibodies as described. Immunohistochemical reactions were graded and the scores represented by the height of the vertical bars (percentage of cells reacted positively), while the width of bars represents the cellular intensity of the staining process.

Figure 3.

Immunohistochemical analyses of v-SCLC and adenocarcinoma of the lung grown on normal tissue culture plastic or PrimariaTM. Immunohistochemical reactions were graded and the scores represented by the height of the vertical bars (percentage of cells reacted positively), while the width of bars represents the cellular intensity of the staining process.

58

Cancer Therapy Vol 2, page 59 To further investigate the biological impact of these differences the cultures were characterized for expression levels of eight specific differentiation markers. Each of the three cultures was immunohistochemically stained for each marker and the intensity scored on a scale (0-5). The attached cells to PrimariaTM showed intense reaction to CEA and keratin in 100% of the cells. NSE staining was also positive in 50% of the cells. Conversely, the cells suspended in the medium grown in NTCP and PrimariaTM showed no reaction to CEA and little or no staining to keratin and NSE. EMA staining was absent in all the populations studied (Figure 2 and 3).

Three of the monoclonal antibodies specific to SCLC showed reaction to the cells suspended in medium when cultured in the PrimariaTM flasks. The reactions of MY4 and MY9 antibodies showed moderately and highly intense staining, respectively. In cells cultured on NTCP however, only a very sparse number of cells showed any reaction to these same mononclonal antibodies. None of the scored cells showed an intense staining reaction (Figure 3). Original biopsy cells recovered by culturing on the these two chemically diverse tissue culture plastics not only showed chromosomal clonal differences, but these difference were mirrored by expression of specific differentiation antigens. This demonstrated that cells in these two plastics did not only differ in their genome but also biologically. The cell populations from the two substrates of adenocarcinoma of the lung showed similar reaction to the antibodies.

Tattersall, 1987; Crickard et al, 1989; Satyaswarup and Tabibzadeh, 1991). Differential growth of cells on different substrates was previously documented.

Chemically or spatially distinct substrates can interfere with the biology of cells in varied ways (Westphal et al, 1990; Vadlamuri et al, 2003). Specific examples of mutated genes also interfered with cell adhesion (Hesketh 1994). To our knowledge, a comparative study with respect to the biology or cytogenetics of the same tumor derived from cultures on normal and modified surfaces has never been described. Neither of these culture methods were previously used to evaluate the genetic status or evolution of neoplastic diseases.

In the present study, we find differences in the clonal distribution of cells of lung cancers when simultaneous split cultures were established on either NTCP or PrimariaTM (Figure 1). For example, in adenocarcinoma of the lung, clones obtained from cells cultured on NTCP showed two unique markers while only one was recovered from cells grown on PrimariaTM. In paradox, v-SCLC demonstrated greater heterogeneity within the PrimariaTM cell population when compared to NTCP clones. On PrimariaTM two kinds of cell populations were recovered.

One attached to the plastic while the other remained in suspension in the media. For NCTP, only cells suspended in the media were found. The two populations of PrimariaTM differed from each other in their genomic constitution and in their immunohistochemical responses (Table 1, Figure 1-3).

PrimariaTM floating cells were either diploid or hypodiploid, while the stickers were hypotriploid with a total of 23 chromosomal anomalies. Although the cells of NTCP were hypotriploid and had 23 chromosomal anomalies, the two populations differed from each other by eight unique chromosomal abnormalities.

IV. Discussion Cytogenetic studies of cells grown on surfaces other than normal tissue culture plastic started more than a decade ago (Trent and Salmon, 1980; Roberts and

Table 1. Karyotypic differences in three tumors of the lung when grown either on Normal Tissue Culture plastic (NTCP) or PrimariaTM Tumor Type Substrate Karyotype Adenocarcinoma of the lung

NTCP

45,X,-Y[3]/47,XY,+mar[2]/46, XY[5]

Adenocarcinoma of the lung

Primaria

45X,-Y[4]/46,XY[5]

Testicular germ-cell tumor from the lung

NTCP

46,XY,+6mar[5]/46,XY+mar[2]/ 46,XY[4]

Testicular germ-cell tumor from the lung

Primaria

46,XY,2mar[2]/46,XY[7]

v-SCLC floating cells

NTCP

44-46,X/XX,-1,+2,+3,+4,+5,+6,+7, +8,+9,+10,+14,-15,+16,+17,+20, -21,-22,+4mar,dmin[cp11]

v-SCLC attached cells

Primaria

48-65,X/XX,+1,+2,+3,+5,+7,+8, +11,+12,-14,-15,+16,+17,+20,-21, -22,,+7mar,dmin[cp7]

v-SCLC floating cells

Primaria

45,XX,-16{3]/46,XX[5]

.

59

Faruqi and Krueger: Substrate dependent genomic heterogeneity in cancers of the lung Bepler G, Jaques G, Havemann K, Koehler A, Johnson B, Gazdar AF (1987) Characterization of two cell lines with distinct phenotypes established from a patient with small cell lung cancer. Cancer Res 47, 1883-1891.

Crickard K, Niedbala MJ, Crickard U, Yoonessi M, Sandberg AA, Okuyama K, Bernaki RJ, Satchidanand SK (1989) Characterization of human ovarian and endometrial cell lines established on extracellular matrix. Gynecol Oncol 32, 163173.

Deger RB, Faruqi SA, Noumoff JS. (1997) Karyotypic analysis of 32 malignant epithelial ovarian tumors. Cancer Genet Cytogenet 96,166-173.

Hesketh R (1994) The Oncogene Handbook. Academic Press.

Johnen G, Krismann M, Jaworska M, Muller KM (2003) CGH findings in neuroendocrine tumours of the lung. Pathologe E Pub 24, 303-307.

Klebe RJ, Mock PJ (1982) Effect of glycosaminoglycans on fibronectin mediated cell attachment. J Cellular Physiol 112, 5-9.

Kleinman HK, Klebe RJ, Martin GR (1981) Role of collagenous matrices in the adhesion and growth of cells. J Cell Biol 88, 473-485.

Leij L de, Postmus PE, Buys CHCM, Elema JD, Ramaekars F, Poppema S, Brouwer M, Van der Veen AY, Mesander G, The TH ( 1985) Characterization of three new variant type of cell lines derived from small cell carcinoma of the lung.

Cancer Res 45, 6024- 6033.

Okabe T, Kaizu T, Fujisawa M, Watanabe J, Takaku F (1985) Clinical application of monoclonal antibodies to small cell lung cancer. Jap J Med 24, 250-256.

Roberts CG, Tattersall MHN (1987) High quality metaphases from solid ovarian tumors. Cancer Genet Cytogenet 27, 913.

Satyaswarup PG, Tabibzadeh SS (1991) Extarcellular matrix and the patterns of differentiation of human endometrial carcinomas in vitro and invivo. Cancer Res 51, 5661-5666 Siegal GP, Wang MH, Rienhart Jr CA, Kennedy JW, Goodly LJ, Miller Y, Kaufman DG, Singh RK (1993) Development of novel human extracellular matrix for quantitation of the invasiveness of human cells. Cancer Letters 69, 123-132.

Trent JM, Salmon SE (1980) Human tumor karyology: Marked analytic improvement by short term agar culture. Br J Cancer 41, 867-874.

Vadlamuri SV, Media J, Sankey SS, Nakeff A, Divine G, Rempel SA (2003) SPARC effects glioma cell growth differently when grown on brain ECM proteins in vitro under standard verses reduced serum stress conditions. Neurooncol 5, 244-254.

Westphal M, Hansel M, Naush H, Rohde E, Herrmann H-D (1990) Culture of human brain tumors on an extracellular matrix derived from bovine corneal endothelial cells and cultured human glioma cells. In: Pollard JW and Walker JM (ed) Methods in Molecular Biology vol V.Animal Cell Culture 113-131.

Yamashita Y, Nara N, Aoki N (1989) Antiproliferative and differentiative effect of granulocyte-macrophage colony stimulating factor on a variant human small cell lung cancer cell line. Cancer Res 49, 5334-5338.

Immunological results further support differences between these two populations (Figure 2 and 3). It is of note that similar reactivity to all the antibodies tested was demonstrated between the unattached, floating cell populations from PrimariaTM and those from NTCP. Genomic differences between the two floaters were far greater than the differences between the NTCP floaters and PrimariaTM stickers. Genomic and differences in biology of v-SCLC point out that the tumor is heterogeneous demonstrating distinct clones.

Distinguishing clones were not found in either of the other two lung malignancies.

Small cell lung cancer progresses into a chemo- and radiation resistant variant with altered prognosis (Leij et al, 1985; Bepler et al, 1987). There are unbiased approaches to investigating genetic and chromosomal quantitative changes. Pioneered by comparative genomic hybridization, new genome complete and high resolution contigs on microarrays exist as well as the newer application of oligo microarrays for chromosomal analysis. These techniques do not have the requirement for growing cells, but may be biased both by the purity of the original sample as well as by the presence of DNA isolated from non-mitogenically active tumor cells.

CGH have also shown differences between SCLC and atypical-SCLC. Using both NTCP and PrimariaTM substrates to culture v-SCLC, we were able to recognize cell populations with different genomes and biology.

These findings will need future study to clarify the significance and mechanisms of the difference found. It is encouraging that the chromosomal differences were mirrored by the expression of specific differentiation antigens. This culture technique in combination of techniques such as CGH and FISH (Ashman et al, 2002; Johnen et al, 2003) may provide new insights into the initiation and progression of this high mortality cancer. In the future, multiple techniques will provide new tools for studying the etiology and evolution of classical SCLC into v-SCLC.

Acknowledgements The authors are appreciative for useful suggestions of Professor Joel S. Noumoff, Chairman Department of OB/GYN, Crozer-Chester Medical Center, Upland PA.

References Ashman JN, Brigham J, Cowen ME, Bahia H, Greenman J, Lind M, Cawkwell L (2002) Chromosomal alterations in small cell lung cancer revealed by multicolour fluorescence in situ hybridization. Int. J. Cancer 102, 230-236.

60

Cancer Therapy Vol 2, page 61 Cancer Therapy Vol 2, 61-68, 2004

The application of MRI complexity analysis for pretreatment prediction of brain tumor response to radiation therapy and radiosurgery- feasibility demonstration Research Article

Yael Mardor1,5*, Yiftach Roth1,6, Dianne Daniels1, Aharon Ochershvilli1, Raphael Pfeffer2,5, Arie Orenstein1,7, Ouzi Nissim3, Jacob Baram2, Doron Dinstein4, Goren Gordon4, Thomas Tichler2, and Roberto Spiegelmann3,7 1

The Advanced Technology Center, 2Oncology Inst., and 3Department of Neurosurgery and Stereotactic Radiosurgery Unit, Sheba Cancer Research Center, Sheba Medical Center, Tel-Hashomer 52621, Israel; 4Magnolia Medical Technologies Ltd., Israel; 6 School of Physics and Astronomy and 7Sackler School of Medicine, Tel-Aviv University; Israel; 4Magnolia Medical Technologies Ltd., Israel 5

__________________________________________________________________________________ *Correspondence: Yael Mardor, PhD, The Advanced Technology Center, Sheba Medical Center, Tel-Hashomer, Ramat-Gan 52621, Israel. Tel: 972-3-5302993, 972-58-547274, Fax: 972-3-5303146, E-mail: yael@tauphy.tau.ac.il Key Words: MRI; Complexity analysis; prediction of response to therapy; Brain tumors; Radiation; Radiosurgery Abbreviations: Magnetic resonance imaging, (MRI); Supported by the Israel Science Foundation, the Israel Cancer Research Fund, Adams Super Center for Brain Studies at Tel-Aviv University, the Izmel program of the Israel Ministry of Industry and Commerce and NIH R01 NS39335.

Received: 4 March 2004; Revised: 25 April 2004 Accepted: 26 April 2004; electronically published: April 2004

Summary Linguistic complexity is a methodology used for calculating the complexity of strings of data. It is based on the concept that the greater the vocabulary one uses, the more complex the data. Linguistic complexity is commonly applied to studying various human language texts. In biology it has been used for analyzing one-dimensional data such as genomic DNA and protein sequence analysis due to their similarity to spoken/artificial languages on one hand and their high repetitiveness on the other. We have recently shown that the basic definition can be extended to higher dimensions, allowing the linguistic complexity analysis of multi-dimensional data. In the current study we applied linguistic complexity analysis to conventional T2-weighted MRI and demonstrated the potential of this methodology to predict brain tumor response to therapy. Eighteen patients with twenty three malignant brain lesions undergoing conventional fractionated radiation therapy or high-dose single fraction radiosurgery were studied. Magnetic resonance images were acquired on a 0.5 T interventional MRI. Response to therapy was determined from changes in tumor volumes calculated from contrast-enhanced T1-weighted MRI, acquired before and 50 days on average after initiation of therapy. Linguistic complexity analysis was performed using the MRITA software and a homogeneity index, Hi, reflecting intensity homogeneity within the tumor, was calculated. The homogeneity index, Hi, for the pre-treatment tumors was found to correlate significantly with later tumor response or lack of response (r=0.57, p<0.004). This correlation implies that tumors with high pre-treatment Hi values, indicating tissue homogeneity, will respond better to therapy than tumors with low Hi values, indicating tissue heterogeneity. These results demonstrate the feasibility of applying complexity analysis of T2-weighted MRI for pre-treatment prediction of response to therapy in brain tumor patients undergoing radiation therapy and radiosurgery.

61

Mardor et al: Prediction of response using tissue complexity analysis may be used clinically to optimize decisions concerning the appropriate treatment for individual patients, thereby preventing unnecessary toxicity or prolonged ineffective therapy in non-responding patients.

I. Introduction Several magnetic resonance (MR) methods have been suggested recently as having potential for prediction of tumor response to treatment. Contrast-enhanced MRI has been shown to be able to reveal distinct tumor patterns that can serve as a predictor of response to chemotherapy in human breast cancer (Esserman et al, 2001). Dynamic contrast MRI has been shown to be useful in characterizing the microvasculature of tumors and has shown potential in predicting response to antiangiogenic treatments (Neeman et al, 2003). P-31 MR spectroscopy was shown in a preliminary study to be a feasible method in predicting response of head and neck cancers to radiation therapy (Shukla-Dave el al, 2002). This method, however, has a low sensitivity and is generally limited to large and superficial tumors. Recent diffusion-weighted MR studies suggested that the initial apparent diffusion coefficient could serve as a predictive parameter for primary rat mammary tumor sensitivity to chemotherapy (Lemaire et al, 1999) and chemoradiation/chemotherapy response (Dzik-Jurasz et al, 2002; Hein et al, 2003) in patients with rectal cancer. Our group has shown the feasibility of applying diffusion-weighted MRI for pretreatment prediction of treatment outcome in brain tumor patients undergoing radiation therapy (Mardor et al, 2004).

Complexity is a multifaceted concept formally implemented in many disciplines. A need to numerically quantify it has arisen since complexity can categorize a system or data. The classical definitions of complexity (Shannon and Weaver, 1959; Kolmogorov, 1983) are broadly used, though these are not practical for multidimensional ensembles. Linguistic complexity introduced a decade ago (Trifonov, 1990), is a highly intuitive notion.

The calculation of the complexity is an arithmetic procedure. It is based on the idea that the larger the vocabulary used in a text, the greater its complexity. The complexity of a sequence then is the product of vocabulary usage for each word length, or in other words, it measures the entire range of possible words. Many such calculations were successfully performed on human language texts and DNA sequences (Trifonov, 1991; Popov et al, 1996; Bolshoy et al, 1997). The limitation of the above definition is that it is restricted to one-dimensional data. We have recently shown (Gordon, 2003) that a simple extension of this definition to multi-dimensional data ensembles can be made. The extended methodology is based on representing a multi-dimensional ensemble as a linear array, thus returning to the initial one-dimensional definition, where vocabulary usage for each word size is defined in the same way.

In this study we used the MRITA software package to analyze conventional, T2-weighted MR images with no contrast-enhancement, and to determine the homogeneity index of brain tumors. High values of the homogeneity index, Hi, imply homogenous tissue, while low Hi values imply heterogeneity. We studied the correlation between pre-treatment tumor homogeneity and later tumor response to therapy in patients with brain tumors undergoing radiation therapy and radiosurgery. The results suggest that complexity calculations may be used for non-invasive prediction of treatment outcome. This new information

II. Materials and methods A. Patients and treatment Eighteen patients with twenty three brain lesions were included in the study. Four patients had gliomas (grades III-IV), one acoustic neuroma, one meningial sarcoma and twelve patients had brain metastasis (four breast, one renal, three melanoma and four lung cancer). Ten patients received conventional fractionated radiation therapy of 30-60 Gy. Eight patients underwent radiosurgery of 16-20 Gy. All patients underwent MR scans before treatment and at regular intervals thereafter.

B. Equipment and software Data were acquired using a General Electric 0.5 T interventional MRI system (Signa SP/i (special proceeding/interventional)) at the Chaim Sheba Medical Center.

The standard GE head-coil was used for data acquisition. Image analysis was performed using the MRITA, version 1.3, of Magnolia Medical Technologies, Ltd. Statistical analysis was preformed with InStat GraphPad version 3.05 software package.

C. Tissue complexity analysis method Complexity is a multifaceted concept implemented in many disciplines. Linguistic complexity was first defined in a textual connotation and is based on the idea that the larger the vocabulary used in a text, the greater its complexity. The data set is composed of letters (e.g. Latin letters in text). Any combination of a specific number of letters is defined as a word (e.g. AB is a two-letter word). The complexity is measured by counting the number of different occurring words (of a given size), divided by the maximal possible different words (of the same size) within a data set. Thus the linguistic complexity is a number between 0.0 for the simplest data set and 1.0 for the most complex data set:

Linguistic Complexity =

(# of occurring words) (maximum # of possible words )

[1]

Such calculations were successfully performed on DNA sequences and human language texts. The extension of the linguistic complexity calculation to a two-dimensional data set, such as a MR image, is carried out in the following way: The equivalent of an alphabet in an image is the color scale (e.g. 256 letters for gray scale) and the equivalent of a word is any specific combination of pixel intensities. An example is shown in Figure 1.

In order to perform a complexity calculation on any given data set, one has to determine two parameters: the word size (i.e. number of letters within the word) and the number of letters (i.e. the alphabet). The goals are to maximize the sensitivity of the complexity calculation and lower the required calculation power.

The considerations for choosing the optimal parameters are discussed in the Appendix.

The linguistic complexity in most cases is proportional to the region of interest (ROI) size. This is not true in the extreme cases of completely homogenous ROIs, or in cases where the ROI is large in relation to the vocabulary size. Except for these

62

Cancer Therapy Vol 2, page 63 extreme cases, linguistic complexity depends on the ROI size in the following manner:

F. Tissue complexity analysis of data ROIs were plotted on the contrast-enhanced T1-weighted images to define the area of the tumor. ROIs were then copied to the T2-weighted images, and a homogeneity index, Hi, was calculated for each slice of the lesion. These values were averaged over the slices to become the average homogeneity index, Hi, reflecting the intensity variation within the tumor in the T2-weighted MR images. Relative errors due to imaging noise were determined by calculating the ratio between the homogeneity index in a ROI chosen in the ventricles (the most homogenous/high-signal region in the image) and the homogeneity index of a totally homogeneous ROI of the same size (Hihomogeneous = #Letters4 / ROI-size). The error in choosing the ROIs was determined by having three researchers choose ROIs for the same tumor independently. The standard deviation of the calculated Hi values was 4%. Since these errors are not correlated, the total relative error was defined as:

Linguistic Complexity = 1 . 0 â&#x20AC;&#x201C; H i * R O I _ s i z[2] e Thus, large ROIs or high resolution ROIs (more pixels in a given ROI) will have smaller linguistic complexity than smaller or lower resolution ROIs. Hi, on the other hand, does not depend on the ROI size, and reflects the homogeneity of the ROI. Therefore, the output parameter of the complexity calculation was chosen to be the homogeneity index: Hi=(1- Linguistic Complexity)/ROI_size[3] where high values of Hi imply homogenous ROIs and low values of Hi imply heterogeneous ROIs.

D. Data acquisition

2

! Hi ventricles $ 2 Err = # & +4 % Hi " homogenous %

Gadolinium contrast-enhanced spin-echo T1-weighted MR images and fast spin-echo T2-weighted MR images were used to monitor the patients before and at regular intervals following treatment. All images were acquired with 5 mm slices, 2 signal averages, and a 22x16.5 cm field of view. T2-weighted MR images were acquired with a 256x128 matrix, TR=3000 ms, and TE=95 ms. T1-weighted MR images were acquired with a 256x128 matrix, TR=500 ms, and TE=14.5 ms.

III. Results A. Determination of complexity parameters Linguistic complexity depends on interplay between ROI size, word size and alphabet size.

The grayscale in a T2-weighted MR image is divided into 256 shades (letters) ranging from 0 (black) to 255 (white). This number of letters is too large relative to the selected ROI sizes, resulting in a complexity value of 1.0.

On the other hand, choosing an extremely small alphabet, for example a two color alphabet (black and white), will result in complexity values near 0. The optimal number of shades (letters) was found to be 12, i.e. instead of a grayscale of 256 shades, they were divided to 12 equal groups.

Since the linguistic complexity depends on the ROI size, the ROIs had to be limited to a certain range. The lower limit was determined by studying the correlation between linguistic complexity and ROI-size (Figure 2).

The two parameters were linearly correlated down to a certain ROI size (ca 100 pixels). Below this ROI size, the combination of the chosen word size (2x2) and the number of letters (12 shades) resulted in the maximal value for the linguistic complexity, i.e. 1.

Following these considerations, tumor ROIs were limited to a size range of above 100 pixels.

The word size was chosen to be a 2x2 pixel combination. Due to the sizes of the ROIs, this is the only logical choice, because choosing a smaller size (e.g. a word of only one pixel) would not have given a proper indication of the complexity, but only the statistical variation of the intensity. Choosing a larger word size (e.g.

3x3 pixel combinations) would have produced a complexity of 1.0 for all tumors.

Figure 3 shows examples of linguistic complexity maps of homogenous and complex tumors. Low complexity regions appear dark and high complexity regions appear bright.

E. Assessment of tumor response Tumor volumes were calculated from the contrastenhanced T1-weighted images. A ROI was defined over the entire apparent tumor in each slice and the number of pixels was counted. Tumor volumes in cm3 were calculated prior to treatment and 50 days on average post-treatment. The change in tumor volume was defined as the ratio between the final volume and the initial volume.

Responding tumors were defined as tumors which decreased to 50% or less of their original volume. The rest were defined as stable/non-responding tumors.

Figure 1. An example of a two-dimensional linguistic complexity calculation. The ROI image is composed of two letters (i.e. a binary image). Only two 2x2 words appear in the ROI. Since the ROI size is 4x4 pixels, the number of different possible words of size 2x2 is 9. Therefore, the linguistic complexity of this ROI is 2/9.

63

Mardor et al: Prediction of response using tissue complexity analysis

Figure 2: Linguistic complexity as a function of ROI size (in pixels). The two parameters are linearly correlated down to a certain ROI size (ca 100 pixels). Below this ROI size, the combination of the chosen word size (2x2) and the number of letters (12 shades) become too large relative to such a small ROI size, resulting in saturation of the complexity value.

Figure 3. Examples of Complexity maps calculated from T2-weighted MRI. (A) and (B) are the linguistic complexity maps of (C) and (D), respectively. Note that the homogenous tumor (C) has low complexity, appearing dark in (A). In contrast, the complex tumor (D), appears brighter in (B).

volumes: 0.11-1.60). The pre-treatment values of the homogeneity index, Hi, as well as the changes in tumor volumes 50 days on average after initiation of treatment, are listed in Table 1 for all 23 tumors.

The feasibility of using pre-treatment complexity

B. Correlation between complexity parameters and later tumor response The tumors included in the study covered a wide range in tumor response (post-treatment/pre-treatment

64

Cancer Therapy Vol 2, page 65 parameters for predicting tumor response to therapy was studied by correlating the tumor heterogeneity index, Hi, measured prior to initiation of treatment, with the change in tumor volume, measured on average 50 days after initiation of treatment.

The positive correlation between pre-treatment values of Hi and later tumor response was found to be significant (p<0.004, r=0.57, Pearson correlation), as presented in Figure 4.

A comparison between the homogeneity index values of responding and stable/non-responding tumors using a one-tail unpaired t-test resulted in p<0.026 for Hi, considered significant.

IV. Discussion The radiological parameters of brain tumors vary significantly within any group of brain tumors, including well defined cancer phenotypes. Moreover, the radiological parameters of a single brain tumor may change dramatically in a short time scale. It has been suggested (Esserman et al, 2001; Shukla-Dave et al, 2002; Mardor et al, 2004; Roth et al, 2004) that the response pattern of brain tumors depend significantly on specific radiological parameters at a given time and not necessarily on their disease group.

Figure 4. The correlation between the pre-treatment values of the homogeneity index, Hi, as calculated from T2-weighted MR images, and later tumor response for the 23 lesions included in the study.

Table 1. Pre-treatment homogeneity and later tumor response for the 23 lesions included in the study.

Change in Tumor Homogeneity Index Error Volume* (Hi) 1 0.33 0.52 0.03 2 0.52 0.74 0.08 3 0.11 0.81 0.08 4 1.07 0.60 0.03 5 0.30 0.64 0.05 6 1.01 0.34 0.02 7 1.08 0.45 0.07 8 0.52 0.55 0.03 9 0.52 0.53 0.03 10 0.51 0.67 0.04 11 0.99 0.55 0.03 12 1.00 0.25 0.02 13 0.76 0.56 0.02 14 0.39 0.52 0.02 15 0.65 0.39 0.02 16 0.30 0.59 0.02 17 0.46 0.53 0.03 18 1.25 0.40 0.03 19 1.60 0.31 0.02 20 1.49 0.32 0.02 21 0.92 0.58 0.02 22 0.78 0.38 0.02 23 0.64 0.37 0.02 *changes in tumor volumes 50 days on average after initiation of treatment

65

ROI Size(pixels#) 344 357 412 429 340 1133 392 180 100 163 675 2108 492 285 260 133 843 220 196 214 506 284 1144

Mardor et al: Prediction of response using tissue complexity analysis systems, will enable sufficient signal to noise ratio for other tissue sensitive sequences as well, such as T2 FLAIR and diffusion-weighted MRI. Applying the complexity analysis to these types of images may add prediction power to the methodology demonstrated in this study.

Therefore, in order to demonstrate the ability of the complexity methodology to predict response, it is necessary to study a radiologically heterogeneous group of tumors. The tumors included in this study covered a wide range in tissue heterogeneity and in tumor response enabling us to study the correlation between pre-treatment values of the homogeneity index and treatment outcome over a wide range of tumors.

On the other hand it is our experience (Roth et al, accepted for publication, 2004) that the radiological prediction pattern does depend on the treatment type. The data sample presented in this study includes tumors treated by radiation therapy or radiosurgery. It is not large enough to study each treatment type separately. This study is ongoing, and once the data base will be large enough, the tumors will be divided to subgroups according to the treatment type.

C. Biological model The biological explanation for the correlation between the pre-treatment homogeneity index and treatment outcome has not yet been determined. It may be related to the fact that cancer cells near necrotic regions may experience hypoxic conditions and therefore are less sensitive to treatment. Necrosis spread over several regions in the tumor increases its heterogeneity and will have a larger surface area than a single necrotic core. The larger surface area will consist of a larger number of slow metabolizing cells. Therefore complex tumors might be less sensitive to treatment. Another explanation might be due to the fact that the outcome of anti-cancer therapies such as radiation is determined by the most resistant clones which survive and repopulate if they are not destroyed. The heterogeneity observed in the T2-weighted images may reflect diversity of clones which may be correlated with higher probability for the existence of clones resistant to treatment (Suit et al, 1992; Brown, 2002; Knisely and Rockwell, 2002).

The correlation between the pre-treatment homogeneity index and later tumor response to therapy indicates that the complexity information may be used prior to initiation of treatment, to non-invasively predict the outcome of certain anti-tumor therapies, thus enabling optimization of the treatment plan.

In summary, this study presents for the first time the possibility of applying two-dimensional linguistic complexity calculations for medical use. This preliminary study demonstrates the feasibility of applying the complexity calculation for pre-treatment prediction of response to radiation therapy and radiosurgery in brain tumor patients. We are currently extending this study to a larger group of patients and to images acquired with higher magnetic field MR systems in order to asses the application of this method for clinical use.

A. Complexity parameters The choice of the color scale can strongly affect the sensitivity to tissue characterization within the tumor. On one hand, too large a color scale will be too sensitive to noise and will not represent the true complexity of the tumor itself. On the other hand, a small color scale will include too little information about the tumor and will produce a misleading complexity index. The choice of a 12-color alphabet was found to be optimal for these types of images. For higher resolution images and a better filtering technology (i.e. reduced noise in the images) a different color scale may be more adequate.

The ROI size may also affect the results. Too small ROIs have too little information in them to correctly categorize them according to their complexity. According to Figure 2, the minimal ROI size was determined to be 100 pixels.

Using higher magnetic field MR systems will enable the acquisition of high resolution (more pixels) images without compromising the signal to noise ratio. As a result the number of pixels in the chosen ROIs will be larger, enabling both higher sensitivity of the complexity calculation to fine tissue inhomogeneities as well as inclusion of smaller tumors in the study.

Acknowledgements

B. MR acquisition sequence

We thank Prof. Gotsmann and Prof. Ram for many fruitful discussions. We thank Cipora Podhorzer and Avishai Goldblat for their dedicated help in scanning the patients. We thank Dina Mauer for coordinating the MRI and treatment schedule.

This research was supported by the Israel Science Foundation, the Israel Cancer Research Fund, Adams Super Center for Brain Studies at Tel-Aviv University and the Izmel program of the Israel Ministry of Industry and Commerce.

In the presented study we demonstrate the application of complexity analysis to T2-weighted MR images. Applying this methodology to other types of sequences may be beneficial as well. We preferred not to perform this study on contrast-enhanced images, since absolute intensities of contrast-enhancement in T1weighted images are not reliably reproducible. They vary with time post injection and may depend on other variables as well. Non-contrast-enhanced T1-weighted images do not confer significant tissue contrast. T2weighted MR images, on the other hand, convey significant tissue contrast as well as good signal to noise ratio and were therefore our first choice for complexity analysis. We hope that in the future higher field MR

Appendix Tissue complexity analysis method Complexity is a multifaceted concept implemented 66

Cancer Therapy Vol 2, page 67 in many disciplines. Linguistic complexity was first defined in a textual connotation and is based on the idea that the larger the vocabulary used in a text, the greater its complexity. The data set is composed of letters (e.g. Latin letters in text). Any combination of a specific number of letters is defined as a word (e.g. AB is a two-letter word).

The complexity is measured by counting the number of different occurring words (of a given size), divided by the maximal possible different words (of the same size) within a data set. Thus the linguistic complexity numerical result is between 0.0 for the simplest data set and 1.0 for the most complex data set: (# of occurring words) Linguistic Complexity= (maximum # of possible words )

consisting of these letters will be large, as well as the number of possible such words, resulting in complexity 1.0

References Bolshoy A, Shapiro K, Trifonov EN and Ioshikhes I (1997), Enhancement of the nucleosomal pattern in sequences of lower complexity, Nucleic Acid Res. 25 , 3248-3254.

Brown JM (2002), Tumor microenvironment and the response to anticancer therapy, Cancer Biol Ther. 1, 453-8.

Dzik-Jurasz A, Domenig C, George M, Wolber J, Pedhani A, Brown G, and Doran S (2002). Diffusion MRI for prediction of response of rectal cancer to chemoradiation. Lancet 360, 307-308.

Esserman LJ, Kaplan E, Partridge S, Tripathy D, Rugo H, Park J, Hwang S, Kuerer H, Sudilovsky D, Lu Y, and Hylton N (2001). MRI phenotype is associated with response to doxorubicin and cyclophosphamide neoadjuvant chemotherapy in stage III breast cancer. Ann Surg Oncol 8, 549-559.

Gordon G (2003), Multi-dimensional linguistic complexity, J. of Biomolecular Structure and Dynamics 20, 747-750.

Hein PA, Kremser C, Judmaier W, Griebel J, Rudisch A, Pfeiffer KP, Hug EB, Lukas P, and De Vries AF (2003). Diffusionweighted MRI--a new parameter for advanced rectal carcinoma? Rofo Fortschr Geb Rontgenstr Neuen Bildgeb Verfahr 175, 381-6.

Knisely JP and Rockwell S (2002), Importance of hypoxia in the biology and treatment of brain tumors, Neuroimaging Clin N Am. 12, 525-36.

Kolmogorov AN (1983), Combinatorial foundations of information theory and the calculus of probabilities, Russ.

Math. Surv. 4, 29-39.

Lemaire L, Howe FA, Rodrigues LM, and Griffiths JR (1999).

Assessment of induced rat mammary tumor response to chemotherapy using the apparent diffusion coefficient of tissue water as determined by diffusion-weighted 1H-NMR spectroscopy in vivo. Magn Res Materials in Phys Biol Med 8, 20-26.

Mardor Y, Roth Y, Ochershvilli Y, Spiegelmann R, Tichler T, Daniels D, Maier SE, Nissim O, Ram Z, Baram J, Orenstein A and Pfeffer R (2004), Pre-treatment Prediction of Brain Tumors Response to Radiation Therapy Using High-b Value Diffusion-Weighted MRI, accepted for publication, Neoplasia.

Neeman M and Dafni H (2003) Structural, functional, and molecular MR imaging of the microvasculature, Annu Rev Biomed Eng 5, 29-56.

Popov O, Segal DM and Trifonov EN (1996), Linguistic complexity of protein sequences as compared to texts of human languages, BioSystems 38, 65-74.

Roth Y, Orenstein A, Kostenich G, Ruiz-Cabello J, Maier SE, Cohen JS and Mardor Y (2004), Pre-treatment Prediction and Early Monitoring of Tumor Response to Therapy Using High-b Value Diffusion-Weighted MRI, accepted for publication, Radiology.

Shannon CE and Weaver W (1959), The Mathematical Theory of Communication. University of Illinois Press, Urbana, Ill. Shukla-Dave A, Poptani H, Loevner LA, Mancuso A, Serrai H, Rosenthal DI, Kilger A, Nelson DS, Zakian K, AriasMendoza F, Rijpkema M, Koutcher JA, Brown TR, Heershcap A, and Glickson JD (2002). Prediction of treatment response of head and neck cancers with P-31 MR spectroscopy from pretreatment relative phosphomonoester levels. Acad Radiol 9, 688-694.

For example, the string ABABA in Latin alphabet has a vocabulary of two different two-letter words (AB and BA) while the maximal possible vocabulary for the string of that size would be four words (AB, BA, AA and BB), resulting in a linguistic complexity of 2/4=0.5. For the string AAAAAA, there is only one two-letter word (AA), thus the complexity is 1/5=0.2. Theoretically, for an infinite string of a repeating word, the complexity will approach 0.

Such calculations were successfully performed on DNA sequences and human language texts. The extension of the linguistic complexity calculation to a twodimensional data set, such as a MR image, is carried out in the following way: A letter in an image is the color scale (e.g. 256 letters for gray scale) and a word is any specific combination of pixels intensities. For example a four pixel word is defined as a 2x2 array of pixels. To calculate the two-dimensional linguistic complexity of an image, one has to count the number of different 2x2 pixel intensity combinations and divide it by the maximal number of different 2x2 pixel intensity combinations possible in the given image. Figure 1 shows an example of a binary image linguistic complexity calculation.

In order to calculate the complexity of any given data set, one has to determine two parameters: the word size (i.e. number of letters within the word) and the number of letters. In the case of two dimensional images, the letters are the color shades (256 letters in the gray scale images) and the words are combinations of pixels, such as the 2x2 words in Figure 1. The goals are to maximize the sensitivity of the complexity calculation and lower the required calculation power. This can be obtained by optimizing the limiting factors of the maximal possible words. Thus we will gain the maximal variance of words possible within the given data size.

The considerations for choosing the optimal word size are the following: Assume a given data set with a fixed (alphabet) number of letters. If the chosen word size is too small, only a few letters, there will only be few possible words and the probability that all of them will appear within the data set will be high, resulting in complexity 1.0.

Similar considerations should apply for choosing the optimal number of letters: If the number of letters used is too large, the number of different occurring words

67

Mardor et al: Prediction of response using tissue complexity analysis Suit H, Skates S, Taghian A, Okunieff P and Efird JT (1992), Clinical implications of heterogeneity of tumor response to radiation therapy, Radiother Oncol. 25, 251-60.

Trifonov EN (1990), Making sense of the human genome. In: "Structures and Methods, vol. 1, Human Genome, Initiative and DNA recombinations", (Eds. R.H. Sarma and M.H. Sarma), Adenine Press, New York, 69-77.

Trifonov EN (1991), Informational structure of genetic sequences and nature of gene splicing, In: "AIP Conference Proceedings 239: Advances in Biomolecular Simulations" (Eds. R. Lavery, J.-L. Rivail and J. Smith), American Institute of Physics, New York, NY, 329-338.

Dr. Yael Mardor

68

Cancer Therapy Vol 2, page 69 Cancer Therapy Vol 2, 69-78, 2004

Lung cancer chemotherapy practices in French specialized institutions: results of a national survey Review Article

Alain Vergnenègre1*, Laurent Molinier2, Christophe Combescure3, Jean Pierre Daurès3, Bruno Housset4, Christos Chouaïd5 1

Service de l'Information Médicale et de l'Evaluation, Service de Pneumologie, Hôpital Universitaire du Cluzeau, 87042 Limoges cedex, 2 Departement d'information medicale, CHU Hotel Dieu, 2 rue Viguerie, 31052 Toulouse, 3 Institut Universitaire de recherche clinique, Faculté de Médecine, Montpellier, 4 Service de Pneumologie, centre hospitalier Intercommunal de Créteil, 10 avenue de Verdun, 94010, Créteil, 5 Service de Pneumologie, CHU Saint Antoine, 184 rue du Faubourg Saint Antoine, 75012,Paris, France

__________________________________________________________________________________ *Correspondence: Alain Vergnenègre, Service de l'Information Médicale et de l'Evaluation, Service de Pneumologie, Hôpital Universitaire du Cluzeau, 87042 Limoges cedex, Tel 0033 5 55056629; fax 0033 5 55056815; e-mail: avergne@unilim.fr Key words: lung cancer, clinical management, guidelines Abbreviations: Diagnosis Related Groups, (DRGs); lung cancer (LC); non small-cell lung cancer, (NSCLC); prophylactic cerebral irradiation, (PCI); small-cell lung cancer, (SCLC) Received: 7 April 2004; Accepted: 15 April 2004; electronically published: April 2004

Summary Background: Few data on lung cancer (LC) management practices have been reported in southern European countries such as France. We studied management practices (particularly chemotherapy) in specialized LC treatment centers in France, in comparison with published practice guidelines. Methods: We analyzed patterns of care, during the first 18 months, of all new patients diagnosed with LC between 1 July 1998 and 30 June 1999, in specialized LC treatment centers. Results: Of the 430 patients included in this study, 95.6% received active first-line treatments, consisting of chemotherapy, surgery and/or radiotherapy (97.7% for small-cell lung LC, 95% for non small-cell LC). Chemotherapy was mainly based on platinum salts (77.9% for SCLC, 76.3% for NSCLC).

Treatments were in keeping with international guidelines, although certain strategies tended to be reserved for clinical trials. Respectively 39.8% and 6% of patients received second- and third-line treatments, on which there is currently no international consensus. Conclusion: In French specialized LC centers, the proportion of patients who receive active treatment is relatively high. Further guidelines are required, especially for second- and third-line treatment strategies.

(American Society of Clinical Ongology, 2004; Federation Nationale des Centres de Lutte Contre le Cancer, 2001) have been published on the management of patients with non small-cell lung cancer (NSCLC). For stages I and II NSCLC the standard therapy is surgical resection (British Thoracic Society, 2001), or radiotherapy for medically inoperable patients (Adjei et al, 1999; Cameron et al, 1996a). The use of radiotherapy (PORT Meta-analyis Trialists Group, 1998) and/or chemotherapy after complete surgical resection is controversial (Ginsberg et al, 1997), whatever a recent phase III trial has given a positive result (Arriagada et al, 2004). Preoperative chemotherapy for stage II disease is under discussion, and clinical trials are in progress (Depierre et al, 2002). There are several therapeutic options for locally advanced NSCLC, some of which have yet to be validated in clinical trials (American Society of Clinical Ongology, 2004; Royal College of radiologists Clinical Oncology Information Network,

I. Introduction Lung cancer is a major public health problem in industrialized countries, in terms of both morbidity/mortality and cost (Hansen, 2000). Although treatment has improved in recent years, progress has been slower than in other malignancies (Huisman et al, 2000; Shepherd, 2000). Clinical practice guidelines on lung cancer management have been drawn up by health professionals and authorities in many countries. For localized small-cell lung cancer (SCLC) (Adjei et al, 1999; Cameron et al, 1996b), the standard treatment is combination chemo-radiotherapy, followed by prophylactic cerebral irradiation (PCI) for patients with complete response (Auperin et al, 1999). Chemotherapy is also generally recommended for disseminated SCLC (Adjei et al, 1999; Cameron et al, 1996b), despite its limited efficacy. There is no consensus on second- and third-line treatments. Numerous recommendations

69

Vergnenègre et al: Lung cancer management in French institutions 1999). For stage IIIA NSCLC, there is an increasing tendency to use combination therapy (chemotherapy or chemotherapy-radiotherapy followed by surgery, with postoperative radiotherapy or chemotherapy); for stage IIIB NSCLC the standard treatment is combination chemotherapy-radiotherapy. Finally, chemotherapy is recommended for stage IV NSCLC when performance status is adequate (Adjei et al, 1999; Shepherd, 2000).

Best supportive care is recommended for patients with disseminated or locally advanced disease who are in poor general condition. There is no consensus on second- or third-line treatment. Recently, American food and drug administration has approuved gefitinib as third line treatment for NSCLC. The impact of existing guidelines on actual practice is difficult to measure, although some authors have reported a positive effect on quality of care (Ford et al, 1987; Evans et al, 1997). Declared practices have been reported (Crook et al, 1997; Choy et al, 2000), but few studies have focused on actual practices (Gregor et al, 2001; Sambrook and Girling, 2001).

We studied actual management practices (particularly chemotherapy) in specialized lung cancer treatment centers in France, in comparison with published national and international practice guidelines.

the care center, the specialty of the physician who coordinated the patient's management, and the histological type and stage of LC at diagnosis. All events related to LC and requiring treatment were also recorded to determine the number of patients who received active first-, secondand third-line treatment. The type of chemotherapy, the use of radiotherapy and surgery, and their combinations were noted. Terminal care was defined as the various treatments used for symptom control, including palliative radiotherapy, antibiotics, corticosteroids, and pain relief.

The type of center providing the palliative treatment was recorded. Data for this analysis were collected by specially trained clinical research technicians. The physicians in charge of each patient were contacted to obtain data missing from the files. The exhaustive nature of patient enrollments and data collection in each center was verified by two of the authors (LM and AV). The clinical teams involved were informed of the study after it had been completed, in order to avoid influencing their practices.

III. Results A. Descriptive data Eleven centers were selected. Only 430 patient files (Table 1) were assessable (i.e. contained all relevant data).

The M/F sex ratio was 4.66. Mean age at diagnosis was 61.7 ± 11.3 years.

In keeping with current international guidelines, patients were categorized into six homogeneous subgroups, two for SCLC (localized and diffuse forms), and four for NSCLC (diffuse, locally advanced, surgical and non surgical localized forms).

The subtype distribution was as follows: 20.5% SCLC (59% disseminated) and 79.5% NSCLC (n=342); NSCLC was divided into four subgroups, namely metastatic (40.9%), locally advanced (35%), surgical (17.1%), and non surgical stages I and II (6.5%). The responsible physician was a chest physician in 56% of cases, a medical oncologist in 26%, and a radiotherapist in 18%. Sixty per cent of the patients died within 18 months of diagnosis. The mean follow-up period was 9.2 ± 4.7 months.

II. Methods A. Center selection Health care centers (10% of all French centers treating more than 100 cases of lung cancer annually) were randomly selected, after stratification according to the type of center (in France, 30% of patients with lung cancer are treated in public university hospitals, 25% in non university public hospitals, 20% in specialist cancer treatment centers, and 25% in private establishments (Panel Louis Harris, 1998)). The sample size was calculated to obtain at least 20 patients per subgroup. The need for a retrospective on-site analysis (in order to avoid affecting practices) led us to study a sample of 440 cases, which provided acceptable subgroup sizes of disease stages in the two principal histologic types.

B. Patient’s inclusion and non inclusion criteria

B. Types of treatments Active treatment was given to 95% of patients with NSCLC and 97.7% of patients with SCLC. Second-line treatment was given to 39.8% of patients overall, and third-line treatment to 6% of patients. First-line treatment included platinum salts in 77.9% of cases of SCLC and 76.3% of cases of NSCLC. The reasons for treatment discontinuation are listed Table 1.

Two patients with extensive SCLC (3.8%) were given palliative treatment only, while the remainder (96.2%) received chemotherapy, consisting of a platinumcontaining combination in 76% of cases (Table 2). Three patients received oral single-agent therapy. The mean number of cycles was 4 ± 1.8. Forty patients were considered responders, and 10 (25%) of these patients received thoracic radiotherapy. Although there are no recommendations for such patients in France, second-line chemotherapy (containing a platinum salt in 33% of cases)

In each center the first 40 new cases treated after the observation date (1 July 1998) were studied. Patients enrolled in clinical trials and patients managed for a relapse disease were not selected. Patients managed in each institution were identified from individual medical data management systems (Diagnosis Related Groups, DRGs), by searching for all patients who consulted or were admitted to a medical or surgical ward with a principal diagnosis of lung cancer or suspected lung cancer, and by analyzing all new radiotherapy-based treatments started during the study period. Each patient was studied for 18 months after diagnosis, or until death if death occurred less than 18 months after diagnosis.

C. Recording data For each patient we recorded sociodemographic data,

70

Cancer Therapy Vol 2, page 71

Table 1: Population sample LC

Number Mean age (years) Sex ratio M/F Mean follow-up (months) Deaths (at 18 months) Terminal care Cause of treatment cessation Toxic death¨ Post-operative death Toxicity End of sequence Progression Loss to follow-up

SCLC Extensive Localized

NSCLC Surgical Locally localized advanced 58 120 59.8 61.3 ± 1.5 ± 1.4 4.8 7.57 7.1 10.3 ±3 ± 4.5 10 54

430 61.7 ± 11.3 4.66 9.2 ± 4.7 245

52 62.7 ± 9.5 2.79 7.5 ±4 45

36 63.4 ± 10.9 5 10.5 ± 4,4 22

Non surgical localized 24 70.4 ± 11.2 10.5 10.7 ± 3.6 14

IV

19

2

0

2

0

1

14

19 5 9 152 243 2

4 / 2 9 37 0

4 / 0 11 21 0

2 / 0 7 15 0

0 1 2 39 14 2

5 3 1 56 55 0

4 1* 4 30 101 0

140 61.0 ± 11.2 3.6 7.9 ± 4.9 100

LC: lung cancer; SCLC: small-cell lung cancer, NSCLC: non small-cell lung cancer, * death after metastatic surgery., ¨ for toxic deaths, all chemotherapeutic lines are included.

Table 2: Management of extensive small-cell lung cancer (n = 52)

Table 3: Management of localized small-cell lung cancer (n = 36)

Best supportive care First-line therapy Chemotherapy Cisp-E Carb-E C-E-D C-E-A E/os Carb-Pacli Cisp-I-E Radiotherapy* Second-line therapy Chemotherapy CCNU-C-E Carb-E Cisp-E Cisp-Pacli C-E-D Others Radiotherapy*

First-line therapy Chemotherapy Cisp-E Carb-E C-E-D Cisp-C-E C-E-A Cisp-C-E-D C-V-D Radiotherapy Second-line therapy Chemotherapy Cisp-E Carb-E C-D Cisp-C-D C-V-D CCNU-C-E Cisp-Vino Radiotherapy* Third line therapy Chemotherapy CCNU-C-E C-E-A E/os

2 50 50 28 7 6 3 3 2 1 10 18 18 3 2 2 2 2 7 5

3.8% 96.2%

34.6%

* palliative radiotherapy See annex for abbreviations

36 36 20 5 4 2 2 2 1 27 13 13 3 2 2 2 2 1 1 4 3 3 1 1 1

See annex for abbreviations

71

100%

36.1%

8.3%

Vergnenègre et al: Lung cancer management in French institutions was administered in 18 cases (34.6%), combined, in five responder patients, with thoracic radiotherapy.

2. Among the patients with localized NSCLC who were inoperable for medical reasons (generally respiratory failure), 91.6% received a first-line treatment (Table 5) and 27.3% a second-line treatment.

3. Although active treatment was recommended only for patients with inoperable stage-III NSCLC who are in good general condition, all but one of these patients were actively treated (Table 6). Some patients (21/119, 17.6%) received neoadjuvant treatment (18 chemotherapy, 3 chemotherapy-radiotherapy). Surgery was performed in 11/21 cases (52.3%) and was followed by complementary treatment. Patients who did not receive neoadjuvant treatment (98/119) were distributed as follows: 66/98 (67.3%) received chemotherapy alone, 22/98 (22.5%) received chemotherapy-radiotherapy, and 10/98 (10.2%) received radiotherapy alone. Although there were no guidelines for these situations, second- and third-line treatment was given to respectively 46/98 (46.9%) and 7/98 (7.1%) of patients. Two patients received fourth-line chemotherapy. First-line chemotherapy included a platinum salt in 80.7% of cases. The platinum-vinorelbine combination was used as first-line treatment in 45% of cases. Taxane derivatives tended to be reserved for second-line treatment, and were given to 39% of patients who received second-line chemotherapy.

4. Although chemotherapy is only recommended for stage-IV NSCLC patients with good performance status, all but 14 (10%) of the 140 patients concerned received first-line treatment (Table 7): 114/126 (90.5%) received

C. Small cell lung cancers All the patients with localized SCLC received multidrug chemotherapy (including a platinum salt in 80% of cases), combined with thoracic radiotherapy in 75% of cases (Table 3). The mean number of chemotherapy cycles was 4.5 Âą 1.4. Prophylactic cerebral radiotherapy (PCI) was administered to 13 (56%) of 26 responders and to none of the non responders. Although there were no recommendations for these situations in France, 13 patients (36.1%) received second-line chemotherapy (either after a lack of initial response, or for early relapse).

It consisted of platinum-containing multidrug regimens in 8 cases. Four patients responded to this second line of treatment and then received thoracic radiotherapy. Three patients received third-line chemotherapy.

D. Non small cell lung cancers 1. Among the NSCLC patients who underwent initial surgical resection (Table 4), 32.7% had no further treatment. The other 39 patients received chemotherapy (46.1%), radiotherapy (33.4%) or combined radiotherapychemotherapy (20.5%) after surgery. (Contemporary French guidelines recommended radiotherapy alone for such patients.) A second-line treatment was administered to 17 (43.6%) patients (chemotherapy-radiotherapy in 2 cases, and chemotherapy alone in 15 cases).

Table 4. Post-surgical management of initially operated non small-cell lung cancer (n = 58)

Table 5: Management of non surgical localized non small-cell lung cancer (n = 24)

No other therapy Adjuvant therapy* Radiotherapy Chemotherapy Cisp-Vino Cisp-I-M Cisp-G Carb-Vino Chemotherapy-radiotherapy Cisp-E Cisp-Vino Cisp Carb-E Second-line therapy Chemotherapy Cisp-E Cisp-Vino Cisp-G Carb-5FU Cisp-I-M Doce G Chemotherapy-radiotherapy Carb

Best supportive care First-line therapy Radiotherapy Chemotherapy-radiotherapy Cisp-E Carb Cisp-5FU Chemotherapy Cisp-Vino Cisp-Pacli Vino Radiotherapy then chemotherapy Cisp-5FU Carb-Vino Endobrachytherapy Second-line therapy Chemotherapy Carbo-Vino Carbo-E Carbo-G G Pacli Vino See annex for abbreviations

19 39 18 13 9 2 1 1 8 4 2 1 1 17 15 5 3 2 2 1 1 1 2 2

32.7% 67.3%

29.3%

* for incomplete resections or node extensions

See annex for abbreviations

72

N=2 8.4% N = 22 91.6% 9 3 1 1 1 5 3 1 1 2 1 1 3 6 27.3% 6 1 1 1 1 1 1

Cancer Therapy Vol 2, page 73 Table 6. Management of locally advanced non small-cell lung cancer (n = 120) Best supportive care First-line therapy Chemotherapy Cisp-Vino Cisp-I-M Carb-Vino Cisp-G Others Chemotherapyradiotherapy Cisp-E Cisp-I-Vino Others Radiotherapy Second-line therapy Chemotherapy Cisp-Vino Pacli G Doce Carb-Vino Others Chemotherapyradiotherapy Carb Doce Cisp-E Others Third line therapy Radiotherapy* Chemotherapy

1 (0.8%) 98 (81.6%) 66 30 12 6 5 13 22

Neo adjuvant therapy Chemotherapy Cisp-Vino Cisp-I-M Carb-Vino Cisp-G Cisp-E Chemotherapyradiotherapy Carb-E Second-line treatment Surgery followed by Radiotherapy Chemotherapy-radiotherapy Chemotherapy No surgery Radiotherapy Chemotherapyradiotherapy Chemotherapy

15 2 5 10 46 (49.9.3%) 16 4 2 2 2

21 (17.6%) 18 10 5 1 1 1 3 3 11 2 6 3 10 4 4 2

4 30 10 6 5 9 7 (7.1%) 2 5

* palliative radiotherapy , See annex for abbreviations

chemotherapy alone and 12/126 (9.5%) received chemotherapy-radiotherapy. A platinum salt was used in 85% of these chemotherapy regimens; platinumvinorelbine and platinum-taxane combinations were prescribed to respectively 41.2% and 13.1% of patients.

The mean number of cycles was 2.53 Âą 1.77. Although there were no guidelines for these situations, second- and third-line treatments were administered to respectively 47/126 (37.3%) and 15/126 (10.7%) of patients; the chemotherapy included a taxane in 32% of second-line treatments and 33% of third-line treatments. Two patients were given a fourth line of chemotherapy.

received active first-line treatment was high (97.7% for SCLC, 95% for NSCLC), and many also received active second- or third-line treatments. A platinum salt was administered to 77.9% of the SCLC patients and to 76.3% of the NSCLC patients who received first-line chemotherapy. The platinum-vinorelbine combination was most frequently used to treat NSCLC (45% of cases).

Few studies have examined actual LC management practices. Most reports have concerned declared practices (Sambrook and Girling, 2001), and data in review articles come mainly from therapeutic trials (Shepherd, 2000).

However, a study (Cottin et al, 1999) showed that patients with SCLC who were included in clinical trials were not representative of the normal patient population, stressing the need for studies of actual practices.

IV. Discussion We studied actual lung cancer management practices in French institutions dealing with large numbers of new patients each year. The networking of cancer centers in France means that the majority of new patientsâ&#x20AC;&#x2122; files are examined in such institutions, although treatment may take place elsewhere. To our knowledge, this is the first study to take into account the entire spectrum of French institutions in which lung cancer is treated, i.e. private clinics, general hospitals, university hospitals, and specialized cancer centers. The proportion of patients who

A. Patient management Regarding NSCLC, our results are in keeping with those of a population-based study conducted between 1995 and 1998 on a sample taken from a single French region (Blanchon B, 2000), in which the authors noted initial recourse to palliative treatment in only 7.5% of cases.

Thus, on the basis of declared or observed practices, lung

73

Vergnenègre et al: Lung cancer management in French institutions Table 7: Management of metastatic non small-cell lung cancer (n = 140) Best supportive care First-line treatment Chemotherapy-radiotherapy* Cisp-E Cisp-Vino Carb Cisp Chemotherapy Cisp-Vino Cisp-I-M Cisp-E Vino Pacli-G Cisp-G G Others Second-line therapy Chemotherapy Doce Vino Cisp-Vino G Others Chemotherapy-radiotherapy* Third line treatment Chemotherapy

14 (10%) 126 (90%) 12 5 5 1 1 114 44 15 11 9 7 7 5 16 47 (37.3%) 42 10 8 6 6 12 5 15 (11.9.7%) 15

* palliative radiotherapy See annex for abbreviations

cancer patients are more likely to receive active treatment in France than in other countries. In the United Kingdom in 1993, only 7% of physicians recommended combined chemotherapy-radiotherapy for stage IIIB NSCLC and only 11% prescribed chemotherapy to patients with metastases (Crook et al, 1997). In a Scottish study (Gregor et al, 2001) of management of lung cancer patients diagnosed in 1995, only 56.8% received active treatment (surgery 10.7%, radiotherapy 35.8%, chemotherapy 16.1%). The use of active treatments tends to be more frequent in the United States (American Society of Clinical Ongology, 2004; Kesson et al, 1998) In a 1997 practice survey (Choy et al, 2000), 76% of respondents stated that they did not offer active treatment to patients in poor general condition (PS = 2). However, three-quarters of respondents proposed chemotherapy to asymptomatic patients with disseminated disease. In contrast, a study conducted by American care-paying organizations found that only about 25% of such patients received active treatment (Winn et al, 1999).

There is international consensus on NSCLC patient management. When resection seems possible, existing guidelines (Royal College of radiologists Clinical Oncology Information Network, 1999; British Thoracic Society, 2001) do not recommend neoadjuvant or adjuvant therapy, except in clinical trials. When resection is incomplete, they recommend post-operative radiotherapy alone, and also recommend radiotherapy for locally advanced forms, noting the high toxicity of chemotherapy in patients with stage IIIB or IV disease (they recommend

including such patients in clinical trials). Some authors (O'Brien and Cullen, 2000; National Institute for Clinical Excellence, 2001) have expressed concerns over the absence of active treatment, and recommend more widespread use of chemotherapy in NSCLC. On the basis of a recent trial with encouraging results (Depierre et al, 2002), new studies are evaluating the place of neoadjuvant chemotherapy in some forms of NSCLC. Adjuvant therapy is still controversial, IALT study (Arriagada et al, 2004) showed an advantage in terms of survival for adjuvant chemotherapy but the others studies are negative.

Furthermore, certain physician characteristics may influence the strategy adopted, such as the interval since initial training and the number of patients in their care. For example, chest physicians and thoracic surgeons do not have the same degree of confidence in the benefits of chemotherapy and post-surgical radiotherapy for stages IIIIA NSCLC (Schroen et al, 2000). Similarly, chemotherapy followed by radiotherapy for unresectable stage III NSCLC was viewed as less beneficial, in terms of survival, than radiotherapy alone by physicians seeing fewer than 10 lung cancer patients a year than by physicians who managed more than 25 patients (57% vs 77%). In France, the existence of universal health coverage and the fact that LC is generally managed by specialists tend to favor more aggressive therapy.

Patientâ&#x20AC;&#x2122;s characteristics may influence clinicianâ&#x20AC;&#x2122;s decision. For example, among 1706 NSCLC patients managed between 1989 and 1991, Hillner et al. (Hillner et al, 1998) showed that younger patients with stage IV 74

Cancer Therapy Vol 2, page 75 diseases received more frequently chemotherapic treatment than older patients.

Management of tends to be more uniform in SCLC than in NSCLC. For example, a recent study of 109 SCLC patients in two Newcastle hospitals (England) between 1994 and 1997 (Oliver et al, 2001) showed that respectively 91.7% and 17.4% received first- and secondline treatments, compared to 97.7% and 35.2% in our survey. In contrast, a study of declared practices found that only 61% of patients with disseminated or localized SCLC were treated with multidrug regimens (Sambrook and Girling, 2001). Disease-free and overall survival rates are increased by use of PCI after a complete response to induction therapy (Auperin et al, 1999; Kotalik et al, 2001). Yet, in our study, none of the responder patients with disseminated SCLC and only 56% of responders with localized SCLC received PCI. These figures are in keeping with data from a national US survey involving 1231 responder patients with localized SCLC (Cmelak et al, 1999): only 74% of health professionals recommended PCI. Interestingly, radiotherapists were more likely than medical oncologists to recommend PCI. Only 30% of respondents recommended PCI after an objective response in patients with extensive SCLC.

Annex 1: Abbreviations used in the tables Carboplatin-Etoposide Carboplatin Docetaxol-Carboplatin Carboplatin-Paclitaxel Carboplatin-Vinorelbine CCNU-Cyclophosphamide-Etoposide Doxorubicin-Cyclophosphamide-Vincristine Cyclophosphamide-Etoposide-Epirubicine Doxorubicin-Cyclophosphamide-Etoposide Cisplatin Cisplatin-Etoposide-CyclophosphamideCisplatin-Etoposide Cisplatin-Ifosfamide Cisplatin-Ifosfamide-Etoposide Cisplatin-Ifosfamide-Mitomycin Cisplatin-Ifosfamide-Vinorelbine Cisplatin-Gemcitabine Cisplatin-Vinorelbine Cyclophosphamide-Vincristine Cyclophosphamide-Vincristine-Epirubicine Docetaxel Doxorubicin Etoposide Etoposide (oral) Doxorubicin-Ifosfamide Gemcitabine Paclitaxel Paclitaxel-Epirubicin Paclitaxel-Gemcitabine Topotecan Vinorelbine

B. Chemotherapy regimens As in previous studies (American Society of Clinical Ongology, 2004; Shepherd, 2000) we found that platinumbased regimens were most frequently used. The platinumvinorelbine combination was most widely used for NSCLC. Taxanes, which were introduced in France in July 1998, were used relatively infrequently in first-line treatments for SCLC or NSCLC; in contrast, they were used in 39% of second-line treatments for locally advanced forms and in 32% of second-line treatments for stage IV disease. The development of platinum-free combinations may increase the use of taxanes (Huisman et al, 2000). In the future, the place of target molecules therapies had to be define and validated in international guidelines.

A wide variety of chemotherapy regimens were used for SCLC, confirming the results of a 1998-1999 English survey of declared practices among all clinicians treating lung cancer patients (Sambrook and Girling, 2001). The main decisional factors were the patient's general state, local practices, the patient's choice, quality of life, clinical trial results, and cost. The authors did not survey secondline treatments, radiotherapy, or PCI. In contrast to our findings, platinum salts were not the most commonly used anti-tumor agent. A meta-analysis of 19 randomized trials (4054 patients) comparing platinum-including and excluding combinations (Pujol et al, 2000) showed a higher response rate to platinum-containing regimens and no excess of toxic deaths.

Carb-E Carb Carb-Doce Carb-Pacli Carb-Vino CCNU-C-E C-D-V CEA CED Cisp Cisp-CED Cisp-E Cisp-I Cisp-I-E Cisp-I-M Cisp-I-V Cisp-G Cisp-Vino C-V C-V-A Doce D E E/os I-D G Pacli Pacli-A Pacli-G T Vino

managed in centers treating large numbers of such patients. It is possible that elderly subjects and patients with poor performance status are not referred to these centers. However, this lack of representation is offset by a number of factors. The patients' mean age was close to that found in French national cancer registers (Menegoz and Cherié-Chaline, 1998) (63.7 ± 11.4 years, compared to 61.7 ± 11.3 years in our study). It was also close to that found in a recent exhaustive survey of lung cancer patients managed in non university hospitals (Blanchon et al, 2002).In this prospective study of 5667 patients, Blanchon et al. found a mean age was 64.3 ± 11.5 years, and 17.7% of patients has a PS of 3 or 4. Such patients were no doubt lacking from our sample, but probably, some patients with a PS of 2 were aggressively treated.

In conclusion, this study shows that routine management of lung cancer in French specialized institutions is characterized by a high frequency of active first-, second- and third-line treatment. Further guidelines are required in this setting, especially on second- and third-line treatments.

Acknowledgements

C. Limitations of the study

We thank the following specialists whose patients were included in this study: JM Bachaud, P Bombaron, JY Douillard, A Monnier, G Ozenne, R Poirier, E Quoix, F Reboul, O Rixe, G Robinet, and T Urban. We are indebted to MP Schuller-Lebeau for her help during the study.

The method used to select LC treatment centers for this survey was obviously a source of bias, even though our sample represented 4% of all new cases of LC diagnosed in France during the study period. However, the care structure in France ensures that most LC patients are 75

Vergnenègre et al: Lung cancer management in French institutions Federation Nationale des Centres de Lutte Contre le Cancer, (2001) Standards Options Recommandations pour la prise en charge thérapeutique des patients atteints d'un cancer broncho-pulmonaire non à petites cellules localement avancé. Bull Cancer, Paris Vol 88 pp 369-87 Ford LG, Hunter CP, Diehr P, Frelick RW, and Yates J, (1987) Effects of patient management guidelines on physician practice patterns: the Community Hospital Oncology Program experience J Clin Oncol, 5 504-11 Ginsberg R, Roth J, and Fergusson M, (1997) Lung cancer surgical practice guidelines Society of Surgical Oncology practice guidelines Oncology, (Huntingt) 11 889-92 895 Gregor A, Thomson CS, Brewster DH, Stroner PL, Davidson J, Fergusson RJ, Milroy R, and on behalf the Scottish Cancer Trials Lung Group and the Scottish Cancer Therapy Network, (2001) Management and survival of patients with lung cancer in Scotland diagnosed in 1995: results of a national population survey Thorax, 56 212-7 Hansen HH, (2000) Textbook of lung cancer M Dunitz ed: London Hillner BE, McDonald MK, Desch CE, Smith TJ, Penberthy LT, and Retchin SM, (1998) A comparison of patterns of care of nonsmall cell lung carcinoma patients in a younger and Medigap commercially insured cohort Cancer, 83 1930-7 Huisman C, Smit ET, Giaccone G, and Postmus PE, (2000) Second-line chemotherapy in relapsing or refractory nonsmall cell lung cancer J Clin Oncol, 18 3722-30 Kesson E, Bucknall CE, McAlpine LG, Milroy R, Hole D, Vernon DR, Macbeth F, and Gillis CR, (1998) Lung cancer-management and outcome in Glasgow 1991-92 Br J Cancer, 78 1391-5 Kotalik J Yu E Markman BR and Evans WK, (2001) Practice guideline on prophylactic cranial irradiation in small-cell lung cancer Int J Radiat Oncol Biol Phys, 50 309-16 Menegoz F, and Cherié-Chaline L, (1998) Le cancer en France : incidence et mortalité situation en 1995 évolution entre 1975 et 1995 National Institute for Clinical Excellence, (2001) Nice issues guidance on drugs of lung cancer Vol 2001-20: Nice O'Brien ME, and Cullen M, (2000) Managing patients with lung cancer Guidelines must help bring us in line with European standards BMJ, 320 1604-5 Oliver E, Killen J, Kiebert G, Hutton J, Hall R, Higgins B, Bourke S, and Paschen B, (2001) Treatment pathways resource use and costs in the management of small cell lung cancer Thorax, 56 785-90 Panel Louis Harris, (1998) Etude cancérologie 1997 pp 135p Harris Medical International: PAris PORT Meta-analyis Trialists Group, (1998) Postoperative radiotherapy in non-small-cell lung cancer: systematic review and meta-analysis of individual patient data from nine randomised controlled trials PORT Meta-analysis Trialists Group Lancet, 352 257-63 Pujol JL, Carestia L, and Daures JP, (2000) Is there a case for cisplatin in the treatment of small-cell lung cancer? A metaanalysis of randomized trials of a cisplatin-containing regimen versus a regimen without this alkylating agent Br J Cancer, 83 8-15 Royal College of radiologists Clinical Oncology Information Network, (1999) Guidelines on the non-surgical management of lung cancer Clin Oncol, 11 S1-S53 Sambrook RJ, and Girling DJ, (2001) A national survey of the chemotherapy regimens used to treat small cell lung cancer, (SCLC) in the United Kingdom Br J Cancer, 84 1447-52 Schroen AT, Detterbeck FC, Crawford R, Rivera MP, and Socinski MA, (2000) Beliefs among pulmonologists and thoracic surgeons in the therapeutic approach to non-small cell lung cancer Chest, 118 129-37

This study was supported by an unrestricted educational grant from Aventis Pharmaceuticals (France).

References Adjei AA, Marks RS, and Bonner JA, (1999) Current guidelines for the management of small cell lung cancer Mayo Clin Proc, 74 809-16 American Society of Clinical Oncology, (2004) Treatment of unresectable non-small-cell lung cancer guideline: update 2003 J Clin Oncol, 22 330-353 Arriagada R, Bergman B, Dunant A, Le Chevalier T, Pignon JP, Vansteenkiste J, International Adjuvant Lung Cancer Trial Collaborative Group, (2004) Cisplatin-based adjuvant chemotherapy in patients with completely resected nonsmall-cell lung cancer. N Engl J Med, 350 351-60 Auperin A, Arriagada R, Pignon JP, Le Pechoux C, Gregor A, Stephens RJ, Kristjansen PE, Johnson BE, Ueoka H, Wagner H, and Aisner J, (1999) Prophylactic cranial irradiation for patients with small-cell lung cancer in complete remission Prophylactic Cranial Irradiation Overview Collaborative Group N Engl J Med, 341 476-84 Blanchon B, Charvier M, Dupont-Zacot E, Parmentier M, (2000) Prise en charge des cancers bronchiques en Ile-de-France Rev Mal Respir, 17 839-46 Blanchon F, Grivaux M, Collon T, Zureik M, Barbieux H, Benichou-Flurin M, Breton JL, Coetmeur D, Delclaux B, Asselain B, and Piquet J, (2002) Epidemiologie du cancer bronchique primitif pris en charge dans les centres hospitaliers generaux francais Rev Mal Respir, 19 727-34 British Thoracic Society, (2001) Guidelines on the selection of patients with lung cancer for surgery Thorax, 56 89-108 Cameron R, Fringer J, Taylor C, Gilden R, and Figlin RA, (1996a) Practice Guidelines For Non-Small Cell Lung Cancer Cancer J Sci Am, 2 S61 Cameron R, Smith NG, Taylor C, Gilden R, and Figlin RA, (1996b) Practice Guidelines for Small Cell Lung Cancer Cancer J Sci Am, 2 S69 Choy H, Shyr Y, Cmelak AJ, Mohr PJ, and Johnson DH, (2000) Patterns of practice survey for nonsmall cell lung carcinoma in the US Cancer, 88 1336-46 Cmelak AJ, Choy H, Shyr Y, Mohr P, Glantz MJ, and Johnson DH, (1999) National survey on prophylactic cranial irradiation: differences in practice patterns between medical and radiation oncologists Int J Radiat Oncol Biol Phys, 44 157-62 Cottin V, Arpin D, Lasset C, Cordier JF, Brune J, Chauvin F, and Trillet-Lenoir V, (1999) Small-cell lung cancer: patients included in clinical trials are not representative of the patient population as a whole Ann Oncol, 10 809-15 Crook A, Duffy A, Girling DJ, Souhami RL, and Parmar MK, (1997) Survey on the treatment of non-small cell lung cancer, (NSCLC) in England and Wales Eur Respir J, 10 1552-8 Depierre A, Milleron B, Moro-Sibilot D, Chevret S, Quoix E, Lebeau B, Braun D, Breton JL, Lemarie E, Gouva S, Paillot N, Brechot JM, Janicot H, Lebas FX, Terrioux P, Clavier J, Foucher P, Monchatre M, Coetmeur D, Level MC, Leclerc P, Blanchon F, Rodier JM, Thiberville L, Villeneuve A, Westeel V, and Chastang C, (2002) Preoperative chemotherapy followed by surgery compared with primary surgery in resectable stage I, (except T1N0) II and IIIa nonsmall- cell lung cancer J Clin Oncol, 20 247-53 Evans WK, Newman T, Graham I, Rusthoven JJ, Logan D, Shepherd FA, and Chamberlain D, (1997) Lung cancer practice guidelines: lessons learned and issues addressed by the Ontario Lung Cancer Disease Site Group J Clin Oncol, 15 3049-59

76

Cancer Therapy Vol 2, page 77 Shepherd FA, (2000) Chemotherapy for advanced non-small cell lung cancer: modest progress many choices J Clin Oncol, 18 S35-S38 Winn RJ, Brown NH, and Botnick WZ, (1999) A comparison of the NCCN and ASCO guidelines Oncology, 13 35-9

Dr. Alain Vergnenègre

77

Vergnenègre et al: Lung cancer management in French institutions

78

Cancer Therapy Vol 2, page 79 Cancer Therapy Vol 2, 79-84, 2004

New prospects for the control of peritoneal surface dissemination of gastric cancer using perioperative intraperitoneal chemotherapy Review Article

Kaiumarz S. Sethna1, Paul H. Sugarbaker2 1

LTMG Hospital, Sion, Mumbai, India, 2Washington Cancer Institute, Washington, DC, USA

__________________________________________________________________________________ *Correspondence: Paul H. Sugarbaker, MD, Washington Cancer Institute, 110 Irving Street, NW, Washington, DC 20010, USA; Phone: 202 877 3908; Fax: 202 877 8602; E-mail: Paul.Sugarbaker@medstar.net Key Words: Gastrectomy, carcinomatosis, induction chemotherapy, mitomycin C, cisplatin, doxorubicin Received: 5 April 2004; Accepted: 15 April 2004; electronically published: May 2004

Summary Background: Gastric cancer is a disease whose sites of surgical treatment failure have been well defined.

Recurrence at the resection site and peritoneal dissemination is a prominent cause of patient demise. Methods: The natural history of surgically treated gastric cancer was reviewed and the mechanisms for local-regional treatment failure studied. The publications regarding perioperative intraperitoneal chemotherapy to reduce the incidence of local-regional treatment failure were reviewed and the results summarized. Results: Eight clinical trials that used chemotherapy as part of the surgical intervention showed a statistically significant or a trend towards improved survival. Two trials that used multiple cycles of intraperitoneal chemotherapy initiated weeks after the gastric cancer surgery showed no benefit. Morbidity and mortality are acceptable. Conclusions: Lymph node positive and serosal invasive gastric cancer have a high incidence of microscopic residual disease following gastrectomy. This results in local and peritoneal surface recurrence. This failure of surgical treatment can be reduced by perioperative intraperitoneal chemotherapy. observed in 403 patients and 83 had recurrence at two or more sites. Isolated peritoneal recurrence was noted in 172 patients and was the most frequent single pattern (33.9%).

Hematogenous recurrence, the second pattern observed, was seen in 133 cases (26%) of which 75 cases had hepatic metastases. Local-regional recurrence involving the gastric stump, anastomoses, lymph nodes or an adjacent organ, the third observed pattern, was seen in 19.3% of cases. The length of time to recurrence was 27.3 months for local-regional recurrence, 18.1 months for peritoneal recurrence and 14.6 months for haematogenous recurrence. Serosal invasion and lymph node metastases were common risk factors for all patterns of recurrence.

These data demonstrate the need for achieving better local-regional control and for prevention of peritoneal seeding.

The rationale for integrating perioperative intraperitoneal chemotherapy into the surgical treatment of gastric cancer was presented by Sugarbaker and coworkers (Sugarbaker et al, 1989). They suggested that three sources of microscopic residual disease could occur after gastrectomy (Figure 1). The first and most obvious cause

I. Introduction Gastric cancers that extend to the serosal surface or that involve lymph nodes are at high risk for resection site recurrence and for peritoneal carcinomatosis. The incidence varies from 20-50% (Gunderson and Sosin, 1982; Wisbek et al, 1986; Landry et al, 1990; Yoo et al, 2000). Systemic chemotherapy has not been found to be effective as an adjuvant treatment to reduce the incidence of local-regional recurrence for patients with peritoneal carcinomatosis. Intraperitoneal chemotherapy in the perioperative period has shown benefit in clinical trials. In this review the theoretical basis for local-regional recurrence.

II. Analysis of failure of gastrectomy alone as a treatment for gastric cancer Yoo et al, (2000) reviewed 2328 patients with gastric cancer who underwent curative resection between 19871995. In 508 patients there was documented evidence of recurrence. A single anatomic site for recurrence was

79

Sethna and Sugarbaker: Peritoneal surface dissemination of gastric cancer using chemotherapy

*Occurs at resection site, on abraided bowel surfaces and beneath abdominal incision.

Figure 1. The tumor cell entrapment hypothesis suggests three mechanisms for microscopic residual cancer cells in patients having an R-0 gastrectomy.

of contamination of the peritoneal cavity by the cancer cells is serosal invasion by T3 or T4 malignancy. The surgical trauma of cancer resection combined with the natural tendency of the cells to exfoliate result in a positive cytology in these patients (Boku et al, 1990; Bando et al, 1999; Kodera et al, 1999).

A second prominent cause of cancer cell spillage with surgery occurs as a result of transection of lymphatic channels in patients with positive lymph nodes. This is more an issue with multiple nodes involved rather than a few positive perigastric lymph nodes. Fujimura and colleagues, (1997) documented the ability of the reverse transcriptase polymerase chain reaction to identify free gastric cancer cells in the peritoneal cavity. Marutsuka and coworkers established that lymph node positive patients have a high likelihood of cancer cells in the peritoneal cavity after gastrectomy. They concluded that lymph node dissection opened lymphatic channels and spread viable cancer cells into the free peritoneal cavity (Koga et al, 1988).

A third source of cancer cell contamination is blood lost from the cancer specimen into the peritoneal space.

Perhaps this is a contributor to the poor prognosis seen when cancer patients require large blood transfusion.

result of surgical trauma and are then implanted onto traumatized peritoneal surfaces. Here the implants are entrapped by blood clots and enmeshed in fibrin deposits.

They are presumably nourished by the growth factors released during the inflammatory phase of healing. To prevent this sequence of events chemotherapy is given intraoperatively and in the early postoperative phase.

In the operating room the chemotherapy solution is heated to a temperature of 41 째C at the point of delivery. The effects of hyperthermia are: 1) Heat greater than 43째C affects cancerous tissues more than the normal tissues.

2) Heat softens the tissues and decreases the interstitial pressure thereby facilitating drug penetration into the tumour.

3) Heat increases the cytotoxicity of selected chemotherapeutic agents.

A temperature profile observed in the operating room with hyperthermic intraoperative intraperitoneal chemotherapy is shown in Figure 2.

The pharmacology of intraperitoneal drug delivery provides strong theoretical support for these treatments. The local exposure of tissues to chemotherapy solution fare greater and the systemic toxicities lower if the drug delivery is intraperitoneal (Figure 3).

These studies of the natural history of gastric cancer suggest that patients with primary disease could be specially selected for adjuvant intraperitoneal chemotherapy.

III. Rationale for perioperative intraperitoneal chemotherapy Tumor cells are dislodged at the time of surgery as a 80

Cancer Therapy Vol 2, page 81

Figure 2. Temperature profile for heated intraoperative intraperitoneal chemotherapy drugs. Mitomycin C, cisplatin, doxorubicin have been used.

Figure 3. Pharmacokinetic study of intraperitoneal 5-fluorouracil 1000 mg in 2 liters 1.5% dextrose peritoneal dialysis solution. The intraperitoneal concentration is shown as circles and the plasma concentration as squares. The concentration difference over time peritoneal fluid to plasma is 250:1.

Patients for treatment must have complete (R0) resection. If persistent disease exists at any site, the intraperitoneal chemotherapy treatment cannot confer a survival advantage. As a result of radical surgery there must be complete clearance of the primary tumor and involved lymph nodes for proper use of these treatments.

Incomplete containment of the cancer as a result of microscopic residual disease may be unavoidable as a result of the surgical event. Patients with this small volume of cancer recently seeded on peritoneal surfaces may be the ideal patients for perioperative intraperitoneal chemotherapy. However, the timing of the chemotherapy

(perioperative) and the route of administration (intraperitoneal) are absolute requirements for benefit in this group of patients. Multiple cycles of intraperitoneal chemotherapy initiated weeks after the gastric cancer surgery showed no benefit.

IV. Clinical studies to date Clinical studies to support the use of perioperative intraperitoneal chemotherapy as an adjuvant to gastric cancer have steadily accumulated over a decade. The published information is shown in Table 1. Eight studies 81

Sethna and Sugarbaker: Peritoneal surface dissemination of gastric cancer using chemotherapy show a significant advantage or an advantageous trend for patients treated with perioperative intraperitoneal chemotherapy (Figure 4). Most of these studies used hyperthermic intraperitoneal chemotherapy (Koga et al, 1988; Hamazoe et al, 1994; Yonemura et al, 1995; 2001; Ikeguchi et al, 1995; Fujimoto et al, 1999; Hirose et al, 1999). A single study used early postoperative intraperitoneal chemotherapy (Yu et al, 1998). Two studies of intraperitoneal chemotherapy for gastric cancer

did not show benefit as an adjuvant treatment. Schiessel and coworkers used adjuvant intraperitoneal cisplatin in a multicenter trial in 64 randomized patients. The treatment was initiated within 4 weeks of surgery; none of the patients had perioperative treatment. There were no survival advantages (Schiessel et al, 1989). Sautner and colleagues reported a similar negative study (Sautner et al, 1994).

Figure 4. A statistical summary of 8 trials testing perioperative intraperitoneal chemotherapy.

Table 1. Eight reports of adjuvant treatment with perioperative intraperitoneal chemotherapy in gastric cancer patients having an R-0 resection (negative margins of excision and absence of disseminated disease).

Year

Authors

1988

Koga et al.

Yonago

Number of patients study/control 26/21

1994

Hamazoe et al.

Yonemura et al.

Ikeguchi et al.

Yu et al.

Yonago

42/40

Kanazawa

79/81

Yonago

78/96

Taegu

125/123

Fujimoto et al.

Hirose et al.

Chiba

71/70

Fukui

15/40

Yonemura et al.

Kanazawa

48/47

1995 1995 1999 1999 1999 2001

Location

Survival rates % study/control 5-year 63/43 5-year 61.3/52.5 3-year 55/38 5-year 51/46 5-year 54.1/38.1 5-year 69/55 5-year 39/17 5-year 61/42

NA = not available; NS = not significant.

82

p 0.04

Study/control morbidity % 8.5/12

Study/control mortality % NA

0.02

4.8/7.7

0

0.052

3/2.5

3/2.5

NS

1.2/2.08

1.2/2.08

0.0278

28.8/20.3

6.4/1.6

0.0362

2.81/2.85

0

0.0142

60/42.5

0/5

0.019

19/19

4/4

Cancer Therapy Vol 2, page 83

References

V. Future prospects

Bando E, Yonemura Y, Takeshita Y, Taniguchi K, Yasui T, Yoshimitsu Y, Fushida S, Fujimura T, Nishimura G Miwa K (1999) Intraoperative lavage for cytological examination in 1,297 patients with gastric carcinoma. Am J Surg 178, 256262.

Boku T, Nakane Y, Minoura T, Takada H, Yamamura M, Hioki K, Yamamoto M (1990) Prognostic significance of serosal invasion and free intraperitoneal cancer cells in gastric cancer. Br J Surg 77, 436-439.

Fujimoto S, Takahashi M, Mutou T, Kobayashi K, Toyosawa T (1999) Successful intraperitoneal hyperthermic chemoperfusion for the prevention of postoperative peritoneal recurrence in patients with advanced gastric carcinoma. Cancer 85, 529-534.

Fujimura T, Yonemura Y, Ninomiya I, et al. (1997) Early detection of peritoneal dissemination of gastrointestinal cancers by reverse-transcriptase polymerase chain reaction.

Oncology Reports 4, 1015-1019.

Gunderson LL, Sosin H (1982) Adenocarcinoma of the stomach: Areas of failure in a reoperation series (second or symptomatic look), clinico-pathologic correlation and implications for adjuvant therapy. Int J Radiat Biol Phys 8, 1-11.

Hamazoe R, Maeta M, Kaibara N (1994) Intraperitoneal thermochemotherapy for prevention of peritoneal recurrence of gastric cancer. Final results of a randomized controlled study. Cancer 73, 2048-2052.

Hirose K, Katayama K, Iida A, Yamaguchi A, Nakagawara G, Umeda S, Kusaka Y (1999) Efficacy of continuous hyperthermic peritoneal perfusion for the prophylaxis and treatment of peritoneal metastasis of advanced gastric cancer: evaluation by multivariate regression analysis. Oncology 57, 106-114.

Ikeguchi M, Kondou A, Oka A, Tsujitani S, Maeta M, Kaibara N (1995) Effects of continuous hyperthermic peritoneal perfusion on prognosis of gastric cancer with serosal invasion. Eur J Surg 161, 581-586.

Kodera Y, Yamamura Y, Shimizu Y, Torii A, Hirai T, Yasui K, Morimoto T, Kato T (1999) Peritoneal washing cytology: prognostic value of positive findings in patients with gastric carcinoma undergoing a potentially curative resection. J Surg Oncol 72, 60-65.

Koga S, Hamazoe R, Maeta M, Shimizu N, Murakami A, Wakatsuki T (1988) Prophylactic therapy for peritoneal recurrence of gastric cancer by continuous hyperthermic peritoneal perfusion with mitomycin C. Cancer 61, 232-237.

Landry J, Tepper JE, Wood WC, Moulton EO, Koerner F, Sullinger J (1990) Patterns of failure following curative resection of gastric carcinoma. Int J Radiat Biol Phys 19, 1357-1362.

Sautner T, Hofbauer F, Depisch D, Schiessel R, Jakesz R (1994) Adjuvant intraperitoneal cisplatin chemotherapy does not improve long-term survival after surgery for advanced gastric cancer. J Clin Oncol 12, 970-974.

Schiessel R, Funovics J, Schick B, Bohmig HJ, Depisch D, Hofbauer F, Jakesz R (1989) Adjuvant intraperitoneal cisplatin therapy in patients with operated gastric carcinoma: results of a randomized trial. Acta Med Austriaca 16, 68-69.

Sugarbaker PH, Cunliffe WJ, Belliveau J, de Bruijn EA, Graves T, Mullins RD, Schlag P (1989) Rationale for integrating early postoperative intraperitoneal chemotherapy into the surgical treatment of gastrointestinal cancer. Semin Oncol 16 (Suppl 6), 83-97.

Wisbeck WM, Beecher EM, Russell AH (1986) Adenocarcinoma of the stomach: Autopsy observations with therapeutic implications for the radiation oncologist. Radiother Oncol 7, 13-18.

Currently, there is a large theoretical basis and a moderate support from clinical studies to suggest that perioperative intraperitoneal chemotherapy is an important part of a program in management of gastric cancer.

However, to date this innovation in patient management has only been adopted at a small number of institutions in the United States, Korea, and Japan. Certainly, it does not represent a standard of practice. It may emerge as a standard of practice if further clinical data can be obtained in the future that shows similar benefit to that presented in this manuscript.

The need is further phase III trials in patients with gastric cancer. Also, a trial must be performed in Western patients with gastric malignancy. Before this can occur as a multi-institutional effort with adequate number of randomized patients, standardization of these perioperative treatments must occur. The group conducting the trial will need to agree on the timing (between 30 and 120 minutes), the heat (between 39 and 43째C), the drugs (mitomycin C, cisplatin, doxorubicin, VP16), open versus closed technology, heated intraoperative chemotherapy versus early postoperative intraperitoneal chemotherapy versus both, and drugs for early postoperative intraperitoneal treatments if used (5-fluorouracil or taxol). A great deal of thought and some further pharmacokinetic and dose escalation studies may be necessary. Also, the patient eligibility requirements will be controversial. Should only stage III patients be entered? Should patients be entered prior to an exploration of the abdomen or would the randomization be intraoperatively after the completion of the gastrectomy? Should patients with early carcinomatosis such as P1 or P2 peritoneal seeding receive treatment? What about patients that have ovarian involvement; should these patients enter the trial? Should cytology, both before and after gastric cancer resection, be required? Should patients with positive cytology be included or excluded from the adjuvant study?

Not only should the perioperative chemotherapy treatments and eligibility treatments be definitely determined, the surgical procedure needs to be well defined too. Most likely, on the basis of the positive result of Yu and colleagues, a D2 gastrectomy should be recommended (Yu et al, 1998).

All these and many other questions will need to be resolved before a multi-institutional trial of perioperative intraperitoneal chemotherapy in patients with resectable gastric cancer can proceed. A workshop to define these parameters and to produce a workable protocol needs to be a high priority goal for the future.

VI. Conclusions Lymph node positive and serosal invasive gastric cancer have a high incidence of microscopic residual disease following gastrectomy. This results in local and peritoneal surface recurrence. This surgical treatment failure can be reduced by perioperative intraperitoneal chemotherapy. Further studies are necessary to confirm these benefits.

83

Sethna and Sugarbaker: Peritoneal surface dissemination of gastric cancer using chemotherapy Yonemura Y, de Aretxabala X, Fujimura T, Fushida S, Katayama K, Bandou E, Sugiyama K, Kawamura T, Kinoshita K, Endou Y, Sasaki T (2001) Intraoperative chemohyperthermic peritoneal perfusion as an adjuvant to gastric cancer: final results of a randomized controlled study.

Hepato-gastroenterology 48, 1776-1782.

Yonemura Y, Ninomiya I, Kaji M, Sugiyama K, Fujimura K, Sawa T, Katayama K, Tanaka S, Hirono Y, Miwa K, et al.

(1995) Prophylaxis with intraoperative chemohyperthermia against peritoneal recurrence of serosal invasion-positive gastric cancer. World J Surg 19, 450-455.

Yoo CH, Noh SH, Shin DW, Choi SH, Min JS (2000) Recurrence following curative resection for gastric carcinoma. Br J Surg 87, 236-242.

Yu W, Whang I, Suh I, Averbach A, Chang D, Sugarbaker PH (1998) Prospective randomized trial of early postoperative intraperitoneal chemotherapy as an adjuvant to resectable gastric cancer. Ann Surg 228, 347-354.

Paul H. Sugarbaker

84

Cancer Therapy Vol 2, page 85 Cancer Therapy Vol 2, 85-98, 2004

Tumor induction by simian and human polyomaviruses Review Article

Ilker Kudret Sariyer, Ilhan Akan, Luis Del Valle, Kamel Khalili and Mahmut Safak* Center for Neurovirology and Cancer Biology, Laboratory of Molecular Neurovirology, Temple University, College of Science and Technology, 1900 North 12th Street, 015-96, Room 204A, Philadelphia, PA 19122

__________________________________________________________________________________ *Correspondence: Mahmut Safak, Laboratory of Molecular Neurovirology, Center for Neurovirology and Cancer Biology, College of Science and Technology, Temple University, 1900 N. 12th St., 015-96, Room 204A, Philadelphia, PA 19122. Phone: (215) 204-6340.

Fax: (215) 204-0679. E-mail: msafak@temple.edu Key Words: Polyomaviruses, JCV, BKV, SV40, T antigen Abbreviations: BK virus, (BKV); central nervous system, (CNS); CREB-binding protein, (CBP); human immunodeficiency virus, (HIV); insulin-like growth factor receptor, (IGF-IR); JC virus, (JCV); Jun N-terminal kinase, (JNK); Kaposiâ&#x20AC;&#x2122;s sarcoma, (KS); myelin basic protein, (MBP); nuclear localization signal, (NLS); polymerase !-primase, (Pol!); progressive multifocal encephalopathy, (PML); proteolipid protein, (PLP); simian virus 40, (SV40) Received: 20 April 2004; Accepted: 30 April 2004; electronically published: May 2004

Summary Human [(JC virus, JCV) and BK virus, BKV)] and simian virus 40 (SV40) polyomaviruses induce numerous of tumors in experimental animals. In addition, the detection of viral genomes belonging to this group of viruses in a variety of human tumors raises the possibility of the association of the viral oncogenic proteins, large T and small t antigens, in the induction of such tumors. It has been already demonstrated that large T antigen primarily targets two major tumor suppressor proteins, p53 and retinablostoma gene product, Rb, but there appears to be much more to uncover with respect to the molecular targets of these two oncogenic proteins at the cellular level. It has been suggested that in the absence of productive replication, the expression of the early genomes of these viruses leads to the production of tumor antigens, deregulation of cellular growth mechanisms due to the inactivation of tumors suppressors by tumor antigens, and possibly the selection of transformed phenotype. Studying the molecular targets of tumor antigens of polymoviruses may help us to trace the molecular pathways induced by these viruses and perhaps such findings might in turn enable us to treat tumor-related cases in an effective way. study the mechanisms of tumor induction by these viruses.

In this short review, we focused our attention to recent developments with respect to polyomavirus-induced tumors in experimental animals and the detection of viral genomes in a variety of human malignancies.

I. Introduction The genome structure and gene products of polyomaviruses have been under intense investigation in recent years for several reasons. First, their small, circular genomes serve as miniature model systems to study many aspects of DNA structure for more complex eukaryotic genomes. Second, their oncogenic proteins can transform cells under certain conditions in both tissue culture and experimental animals in a manner resembling malignancies seen in humans. Particularly, recent findings regarding the detection of the genomes of both human (JCV and BKV) and simian virus 40 (SV40) polyomaviruses in a variety of human tumors suggest that this group of viruses may play a role in the induction of certain human tumors, although controversy still remains as to whether these viruses indeed induce such tumors.

Such observations have led to investigators to further

II. JC Virus (JCV) JCV is a small human DNA virus with a doublestranded, covalently linked circular genome, 5130 base pair in size. It is classified in the Papovaviridae family within the polyomavirus genus (Frisque, Bream, and Cannella, 1984). JCV genome is composed of bidirectional regulatory elements and coding regions (Figure 1). The regulatory region contains the origin of DNA replication and promoter/enhancer elements for viral early and late genes. The coding regions can be divided

85

Sariyer et al: Tumor induction by polyomaviruses

Figure 1. Genomic organization of JCV. JCV genome is composed of regulatory and coding regions. The regulatory region contains the origin of DNA replication and promoter/enhancer elements. The coding regions are divided into an early and late region. The early region encodes regulatory proteins, small and large T antigen. The late coding region encodes viral structural proteins (VP-1, VP-2 and VP-3) and a short regulatory peptide, agnoprotein.

into early and late regions. The early coding region primarily encodes two regulatory proteins, small and large T antigen although recent findings indicate that this region also encodes three additional small peptides called Tâ&#x20AC;&#x2122;s (Bollag et al, 2000). The late coding region encodes structural capsid proteins (VP-1, VP-2 and VP-3) and a small regulatory agnoprotein. Structural and antigenic studies demonstrated that JCV is related to other polyomaviruses such as human BK virus, and a primate virus, simian virus 40 in the genus. Serological data indicate that, unlike SV40, JCV and BKV share the property of hemagglutination of human type O erythrocytes. It should also be noted here that there is lack of convincing sera conversion data for wide infectivity of SV40 in human population as seen for JCV and BKV. Seroepidomological data shows that overwhelming majority of the world's population is infected by JCV (Frisque, 1992; Major et al, 1992; Berger and Concha, 1995) and the virus establishes a persistent infection in the kidneys (latent infection) after a subclinical primary infection. Recent reports indicate that peripheral blood B lymphocytes, hematopoietic progenitor cells, and tonsillar

stromal cells could also harbor JCV. These sites, therefore, can be considered additional potential sites for JCV infection and latency (Atwood et al, 1992; Monaco et al, 1996, 1998a,b, 2001; Frisque, 1998).

JCV was first isolated from brain tissue of a PML patient by Padgett et al, in 1971. The brain tissue was used as a source of inoculum to infect primary cultures derived from human fetal brain and the virus was successfully isolated from long-term cultures mainly consisting of glial cells (Padgett, 1971). This was the first direct evidence suggesting that a neurotropic viral agent was associated with the occurrence of PML. Shortly after its isolation, the oncogenic potential of the virus was tested both in tissue culture and experimental animals. Particularly, recent findings regarding the detection of JCV genome in a variety of human tumors indicate that JCV may be associated with the induction of human tumors.

JCV is a neurotropic virus that lytically infects oligodendrocytes in the central nerves system and causes a neurodegenerative disease of the white matter in the human brain, progressive multifocal encephalopathy (PML). The disease develops mostly in patients with 86

Cancer Therapy Vol 2, page 87 underlying immunosuppressive conditions, including Hodgkinâ&#x20AC;&#x2122;s lymphoma, lymphoproliferative diseases, and AIDS (Major, 1992; Berger and Concha, 1995; Berger and Major, 1999). In a small number of cases, however, PML was also found to affect individuals with no underlying disease (Major, 1992; Berger and Concha, 1995). While PML was previously considered a rare complication of middle-aged and elderly patients with lymphoproliferative diseases, due to the AIDS epidemic in recent years, it is now a commonly encountered disease of the CNS in patients of different age groups. This suggests that human immunodeficiency virus (HIV) infection may directly or indirectly participate in this process. Recent estimates indicate that the incidence of PML in HIV-seropositive patients reached up to 5%, compared to that 0.8% before the AIDS epidemic (Aksamit et al, 1990; Aksamit, 1995; Berger and Concha, 1995; Berger et al, 2001).

A. Tumor induction experimental animals

by

JCV

Mechanistically, the tumorigenic potential of JCV T antigen appears to be, at least in part, mediated by its interaction with tumor suppresser genes including p53 and retinoblastoma gene products, pRb and p130. Upon binding, T antigen appears to interfere with the cell cycle progression properties of these proteins.

Coimmunoprecipitation assays using cellular extracts from JCV-transformed glial cells show T antigen complex formation with pRb, p53 and p107 (Monier, 1986). A report by Rencic et al, (1996) also suggests a role for T antigen in the induction of oligoastrocytomas in an immunocompetent patient. JC virus large T antigen has also been shown to interact with cellular and viral proteins including YB-1, Pur!, JCV agnoprotein, and insulin receptor substrate 1 (IRS-1) (Gallia, 1998; Safak et al, 1999, 2002; Lassak et al, 2002). IRS-1 is the major signaling molecule for the type I insulin-like growth factor receptor (IGF-IR) (Baserga, 1999). In addition, recent reports also indicate a possible communication between JCV T antigen and the Wnt signaling pathway in induction of tumor formation because T antigen expressing cells express higher levels of "-catenin and its partner LEF-1 (Gan et al, 2001).

Our group also described the formation of different tumors in tissues that derived from neural origin in transgenic mice models (Franks et al, 1996; Krynska et al, 1999; Gordon et al, 2000). JCV early coding region, driven by its own promoter, was utilized to create these transgenic animal models. Histological and histochemical analysis of the tumor masses demonstrated the expression of JCV large T antigen in tumors versus control tissues. In contrast to previous observations by Small et al (Small et al, 1986a,b), transgenic animals created with the early region of JCV archetype strain (Krynska et al, 1999) did not show any sign of hypomyelination in the central nervous system which was a feature observed in transgenic mouse models. On the contrary, cerebellar tumors that resemble human medullablastomas appeared in the transgenic animals (Krynska et al, 1999). In another line of transgenic mouse, half of the animals developed large, solid masses within the base of the skull by one year of age. Histological evaluation of the tumors by location and by histochemical studies demonstrated that these tumors arose from the pituitary gland (Gordon et al, 2000).

Figure 2 exemplifies a variety of tumors induced by JCV in an experimental animal model system.

in

Following its isolation, JCV has not only been shown to cause a variety of tumors in experimental animals (Walker et al, 1973; Varakis et al, 1978; London et al, 1978, 1983; Krynska et al, 1999) but also shown to have the ability to induce neoplastic cell transformation in tissue culture. Since JCV induced tumors arise in tissues of neural origin (Walker et al, 1973; Varakis et al, 1978), tissue-specific expression of JCV regulatory region is thought to play a major role in this process. Inoculation of JCV into several experimental animal models, including hamsters, nonhuman primates, and transgenic mice, resulted in variety of tumors depending on the animal type, age and site of inoculation. For instance, more than 80% of newborn Syrian hamsters when inoculated intracerebrally and subcutaneously with the Mad-1 strain of JCV developed glioblastomas, neuroblastomas and medullablastomas (Walker et al, 1973; Varakis et al, 1978). Even the presence of an entire biologically active JCV genome was demonstrated when cells from these tumors were co-cultivated with permissive glial cells (Walker et al, 1973). JCV was also inoculated intraoccularly into newborn hamsters and resulted in abdominal neuroblastomas developing in several locations of the body (Walker et al, 1973).

Unlike the other members of the polyomavirus family (BKV and SV40), JCV is the only polyomavirus shown to induce tumors in nonhuman primates, such as monkeys. When owl squirrel monkeys were inoculated with live JCV subcutanously, intraperitoneally, and intracerebraly (London et al, 1978, 1983), the animals developed tumors at different time intervals. One owl monkey developed a malignant cerebral tumor similar to an astrocytoma seen in humans after 16 months of inoculation. Another one developed a malignant neuroblastoma 25 months after inoculation. Further analysis of the tumors for the expression of JCV large tumor antigen which is the main viral regulatory protein involved in tumor induction revealed both the presence of large T antigen and complex formation with tumor suppressor protein p53 (Dyson, 1990).

In addition to the evaluation of tumorogenic activity of JCV in mice, transgenic mice were also used to study the process of the acute demyelination occurring in PMLaffected brain tissue. Some of the offsprings of a transgenic mouse created with the regulatory and coding sequences of JCV T-Ag (Small et al, 1986a; Small et al, 1986b) exhibited mild to severe tremor phenotypes with hypo and dysmyelination occurring in the central nervous system (CNS). In addition, dysmyelination was further characterized in transgenic animals by Trapp et al, (Trapp et al, 1988) by examining the expression of the JCV and myelin-specific genes. Initial examination of brain tissue from transgenic mice revealed relatively low expression levels of proteolipid protein (PLP), myelin basic protein 87

Sariyer et al: Tumor induction by polyomaviruses

Figure 2. JCV transgenic animal models. Transgenic mice containing the full sequence of the JCV genome (archetype), develop primitive neuroectodermal tumors in the brain, characterized by numerous packed cells with an elongated nuclei and scanted cytoplasm (Panel A, Hematoxilin & Eosin). Immunohistochemistry against the early gene product T-antigen, demonstrates the nuclear localization of the protein (Panel B), and in the same group of cells there is intense immunoreactivity for p53 (Panel C). Transgenic animals containing only the early sequence of JCV, develop a variety of neural-origin tumors, including adrenal neuroblastomas, characterized by rounded homogeneous cells with a perinuclear halo of cytoplasm (Panel D, Hematoxilin & Eosin), which also express nuclear Tantigen when tested by immunohistochemistry (Panel E). In the same cellular compartment there is strong immunoreactivity for p53 (Panel F). Another tumor developed by a line of JCV early transgenic mice is pituitary adenomas, characterized by numerous pleomorphic cells of different sizes and abundant eosinophilic cytoplasm (Panel G, Hematoxilin & Eosin). The neoplastic cells demonstrate intense nuclear positivity for T-antigen (Panel H), as well as p53 (Panel I). All panels original magnification x1000.

(MBP) and myelin associated glycoprotein which collectively make up the axonal myelin sheet although the mRNA message levels for those proteins appeared to be normal. The mechanism by which T antigen plays a critical role in the reduction of these respective protein levels in the brains of transgenic mice remains unknown, however, it is suggested that T antigen may alter the expression levels of both proteolipid and myelin basic protein at the protein levels or may inhibit the maturation process of oligodentrocytes thereby altering the level of myelin around the axons.

(Richardson, 1961), reported the incidental detection of an oligodendroglioma in a patient with concomitant occurrences of chronic lymphatic leukemia and PML. Following this report, concomitant occurrences of PML with different human tumors was described in several more cases. Sima et al, reported the association of PML with multiple astrocytomas in 1983 (Sima, 1983).

Similarly, Casteigne et al, (1974) described a case where a patient with long history of immunodeficiency syndrome, in addition to PML, showed numerous foci of anaplastic astrocytes. Microscopic analysis of the demyelinating lesions demonstrated the presence of viral particles in both oligodendrocytes and astrocytes within PML foci, but not in the neoplastic astrocytes (Casteigne, 1974). A more recent report by Shintaku and colleagues showed dysplastic ganglian-like cells in a patient with PML (Shintaku et al, 2000). A large number of dysplastic or dysmorphic ganglian-like cells were found in the cerebral

B. Detection of JCV in human tumors In recent years, a widespread detection of JCV genome in variety of human tumors raised the possibility that JCV may induce tumors in humans. In fact, Richardson, who first described PML in 1961

88

Cancer Therapy Vol 2, page 89 cortex that showed properties of neurons. Expression of JCV large T antigen was demonstrated in the infected neurons, however, the late gene products were not.

In addition to the cases described above, JCV genome has also been detected in human brain tumors in the absence of PML lesions. Boldorini et al, reported the detection of JCV DNA in the brain tumors of an immunocompetent patient with a pleomorphic xantoastrocytoma (Boldorini et al, 1998). An earlier study

by Rencic et al, demonstrated the presence of JCV viral DNA and expression of large T antigen in tumor tissue from an immunocompetent HIV-negative patient with oligoastrocytoma (Rencic et al, 1996). These two cases presented the experimental evidence for a possible association of JCV in brain tumors of immunocompetent

non-PML patients. Such findings further prompted the attempts to establish the association of JCV with different types of brain tumors in humans. In fact, Del Valle et al, (Del Valle et al., 2002; Del Valle et al., 2001) recently analyzed multiple brain tumors for the detection of JCV genome and showed that 62.5% of oligoastrocytomas, 83.3% of ependymomas, 80% of pilocytic astrocytomas, 57.1% of oligodendrogliomas, 76.9% of astrocytomas and 66% of anaplastic oligodendrogliomas contained JCV early gene sequence. Figure 3 illustrates the detection of JCV early oncogenic protein, large T antigen, and cellular tumor suppressor protein, p53, in a variety of human tumors JCV genomic DNA has also been shown to be present in tumor tissue which is not neural origin. Recent reports indicate that the JCV genome was detected in.

Figure 3. Detection of JCV proteins in human brain tumors. Expression of JCV early protein has been found in a wide variety of brain neoplasms, including low grade glial tumors, such as oligodendrogliomas (Panel A, Hematoxilin & Eosin), characterized by homogeneous cells with a clear halo surrounding their nuclei. Immunohistochemistry from T-antigen is positive in the nuclei of the majority of the neoplastic cells (Panel B), where the cell cycle regulator protein p53 is also found (Panel C). High-grade glial tumors such as glioblastoma multiforme (Panel D) characterized by extensive areas of necrosis and pleomorphic, atypical cells expressing Tantigen in their nuclei (Panel E). p53 is also present in the nuclei of the neoplastic cells (Panel F ). Tumors of neural origin, such as medulloblastomas, characterized by numerous sheaths of homogeneous cells, with scanted cytoplasm (Panel G, Hematoxilin & Eosin), demonstrate nuclear expression of the early JCV protein, T-antigen (Panel H), and also nuclear immunoreactivity for p53 (Panel I). All panels original magnification x1000.

89

Sariyer et al: Tumor induction by polyomaviruses

A. BKV genome is oncogenic in animal models

gastrointestinal tract and solid non-neural tumors including colorectal cancers (Laghi et al, 1999; Ricciardiello et al, 2000, 2001; Enam et al, 2002). It should be however noted here that such studies explored the possibility of whether JCV genome or its expressed proteins could be detected by certain molecular biology techniques but does not provide information about the mechanism by which JCV could possibly induce tumors in humans

Like JCV, the oncogenic potential of BKV has been tested in experimental animals including young and newborn mice, rats, and hamsters by inoculation of live virus. (Chenciner et al, 1980; Corallini et al, 1982; Corallini et al, 1978; Corallini et al, 1977). The type of tumors induced by BKV was strictly dependent on the route of inoculation. It was observed that BKV is weakly oncogenic when inoculated subcutaneously (Nase et al, 1975; Shah et al, 1975) but induced tumors in high proportions when inoculated intracerebrally or intravenously (Uchida et al, 1976, 1979; Corallini et al, 1977, 1978, 1982). Tumors induced by BKV belong to a variety of histotypes including ependymoma, neuroblastoma, pineal gland tumors, fibrosarcoma, osteosarcoma and tumors of pancreatic islets (Nase et al, 1975; Dougherty, 1976; Uchida et al, 1976, 1979; van der Noordaa, 1976; Corallini et al, 1977, 1978, 1982; Greenlee et al, 1977; Watanabe et al, 1979; Noss and Stauch, 1981, 1984; Watanabe and Yoshiike, 1982). Rats inoculated with BKV developed fibrosarcoma, liposarcoma, osteosarcoma, nephroblastoma, and glioma. Mice, however, developed only choroids plexus papilloma in a similar setting (Noss et al, 1981; Noss and Stauch, 1984).

Transgenic mice were also used to test the oncogenicity of BKV large T antigen (T-Ag). Transgenic mice with BKV T-Ag developed renal tumors, hepatocellular carcinoma, and lymphoproliferative disease (Small et al, 1986a; Dalrymple and Beemon, 1990). In such studies, there appears to be differences among the strains of BKV in terms of oncogenicity. For example, Gardnerâ&#x20AC;&#x2122;s BKV strain seems to be more potent to induce tumors in transgenic mice than other isolates such as MM, BKV-IR or RF (Dougherty, 1976; Caputo et al, 1983).

The mechanism by which BKV causes tumors in experimental animals and cell transformation in tissue culture remains elusive. It was shown that like JCV and SV40 T-Ag, BKV T-Ag interacts with several key cell cycle regulatory proteins, including tumor suppressor proteins p53 and the family members of retinoblastoma proteins, pRb105 and Rb130. BKV T-Ag perhaps inactivates the function of these proteins and thereby contributes to the cell transformation (Dyson, 1990; Harris et al, 1996; Shivakumar and Das, 1996; Eggers et al, 1999). It was recently shown that the complex formation of SV40 T-Ag with mouse p53 completely blocks the transactivation function of p53 protein (Sheppard et al, 1999). Due to the high homology between BKV T-Ag and SV40 T-Ag, a similar mechanism may hold for the BKV T-Ag as well.

It is proposed that BKV T-Ag may also transform cells through a â&#x20AC;&#x153;hit and runâ&#x20AC;? mechanism. In a study by Brunner et al, (1989) it was observed that although transfection of BKV DNA into human cells resulted in a transformed phenotype, viral DNA was absent in most of the clones. This suggested that transformed cells no longer require the expression of T-Ag after a certain stages in the transformation process.

BKV T-Ag was also shown to induce a number of structural chromosomal alterations characterized by

III. BK virus (BKV) Another human polyomavirus which is classified within the Papovaviridae family is BK virus. This virus was first isolated in 1971 from the urine of a renal allograft recipient who developed ureteric stenosis (Gardner, 1971). Like JCV and SV40, the BKV early and late genomes code for six viral proteins, two from the early genome and four from the late genome. Early proteins are nonstructural regulatory proteins (small t and large T antigens), of which large T antigen is involved in regulation of the viral DNA replication and late gene expression. The function of small t antigen in this regard is not known. The viral late genome, in addition to encoding the structural proteins VP-1, VP2 and VP3, also encodes a small regulatory peptide, agnoprotein, whose function largely remains unclear in the viral lytic cycle. Recent evidence from JCV virus agnoprotein work, however, suggests that it plays a role in viral DNA replication, transcription (Safak et al, 2001, 2002), and cell cycle regulation (Darbinyan et al, 2002).

Like JCV, BKV has also a worldwide distribution in the human population. Primary infection by BKV takes place during early childhood and is subclinical although a mild respiratory illness or urinary track disease may occur (Goudsmit et al, 1982; Padgett et al, 1983). Little is known about the route of BKV transmission although induction of upper respiratory disease by BKV and detection of latent BKV DNA in tonsils suggests a possible oral or respiratory route of transmission (Goudsmit et al, 1982).

During primary infection, viremia occurs and the virus spreads to a number of organs in the infected individuals including kidneys, bladder, prostate, uterine cervix, lips and tongue (Monini et al, 1995) where it remains in a latent state. Reactivation of the virus from latent state is mostly associated with the immunocompromised state of individuals. Reactivated virus was detected in the urine of renal and bone marrow transplant recipients undergoing immunosuppressive therapy (Gardner et al, 1984) as well as in the urine of pregnant women (Coleman et al, 1977).

Upon reactivation, BKV may cause interstitial nephritis and ureteral obstruction in patients receiving renal transplants, and in some cases, it can cause viral-infectioninduced transplant dysfunction and graft rejection (Howell et al, 1999). In addition, an association between hemorrhagic cystitis and BKV was shown in bone marrow transplant recipients (Azzi et al, 1994).

90

Cancer Therapy Vol 2, page 91 breaks, gabs, dicentric and ring chromosomes, deletions, duplications and translocations (Tognon et al, 1996).

While the molecular mechanism of this clastogenic effect of BKV on host DNA is unknown, it is thought to reside in its ability to bind to topoisomerase I or in its helicase activity in which it may induce chromosome damage when unwinding the strands of cellular DNA. Moreover, since BKV binds to tumor suppressor protein p53 and inactivates its function, this may lead to survival of DNAdamaged cells and increase their probability to transform and acquire immortality. As a result, the clastogenic and mutagenic activities of BKV may disturb the crucial function of the genes that are important for the maintenance of genomic stability such as oncogenes, tumor suppressor genes and DNA repair genes.

and genital tracks and of the oral cavity were similar to that detected in the corresponding normal tissues (Monini et al, 1996). BKV DNA was shown to be present in Kaposi’s sarcoma (KS) cases in high percentages suggesting that BKV may be an important co-factor in KS (Peterman et al, 1993).

IV. Simian virus 40 (SV40) SV40 is the most extensively studied polyomavirus.

Its small genome size was exploited as a model system to study transcription and replication for more complex eukaryotic systems.

Characteristic cytopathic vacuolization effects caused by SV40 in African green monkey cells led to the recognition and isolation of the virus in 1960 by Sweet and Hilleman, (1960). Apparently SV40 was introduced into the human population through widespread use of contaminated poliovaccines.

Contamination occurred during the vaccine preparation process because the early poliovaccines were prepared in primary cultures of kidney cells derived from rhesus monkeys, which are often naturally infected with SV40.

As described above, SV40 genome is very similar to the other polyomaviruses, BKV and JCV, in structure containing regulatory and coding regions. Coding regions encode regulatory (small t and large T antigens, agnoprotein) and structural capsid proteins (VP-1, VP-2 and VP-3). The regulatory region of SV40, like JCV and BKV, contains the origin of DNA replication and promoter/enhancer elements which are targets for transcription factors. SV40’s genome shows significant sequence homology to BKV and JCV at the coding regions, however, more divergent sequences lie within its regulatory region.

B. Human tumors harbor BKV genome Detection of BKV DNA in a variety of human tumors and tumor cell lines during the late 1970’s prompted researchers to further investigate the possible association of BKV with the induction of a variety of human tumors (Fiori and Di Mayorca, 1976). Since BKV exhibits a specific oncogenic tropism for the ependymal tissue, endocrine pancreas, and osteosarcomas in rodents (Corallini et al, 1977, 1978, 1982; Uchida et al, 1979; Chenciner et al, 1980), investigators primarily focused on the characterization of such tumors in humans for the detection of BKV genome. Southern blot hybridization studies showed that 4 out of 9 (44%) human tumors of the pancreatic islets and 19 out of 74 (26%) of human brain tumors contained BKV DNA in a free, episomal state (Corallini et al, 1987). BKV was even rescued from some of the tumors by transfection of human embryonic fibroblasts with tumor DNA. The detection of BKV DNA was also reported by Dorries et al, in 46% of brain tumors of the most common histotypes (Dorries et al, 1987). In this particular study, BKV DNA was found to be integrated into the chromosomal DNA. Human tumors associated with immunocompromised conditions were also analyzed by Southern blotting and it was shown that BKV DNA was associated with Kaposi’s sarcoma with low frequencies (20%) (Barbanti-Brodano et al, 1987).

Recently, tumor cell lines, normal and neoplastic human tissues were investigated for the detection of BKV

by PCR methods utilizing specific primers for the early region of BKV DNA. The nucleotide sequence analysis of PCR products from these studies revealed the presence of BKV specific sequences in several brain tumor samples: one osteocarcinoma, two glioblastoma cell lines, one normal brain tissue and one normal bone tissue specimen (De Mattei et al, 1995). Even the expression of the early region of the BKV was demonstrated by Northern blotting of RT-PCR studies in some of the samples in those studies. The presence of BKV DNA was also investigated in several different tumors including urinary track tumors, in carcinomas of the uterine cervix, vulva, lips and tongue (Monini et al, 1995, 1996). However, data obtained from such studies were inconclusive because the percentage of positive samples in these neoplastic tissues of the urinary

A. Cell transformation induction by SV40

and

tumor

Following its discovery, SV40 was tested for its ability to induce tumors in experimental animals and to transform a variety of cell types from different species in tissue culture. Particularly, studies with Syrian hamsters showed the ability of SV40 to induce a variety of tumors in experimental animals (Eddy et al, 1962; Girardi et al, 1962; Butel et al, 1972). Such observations raised a question whether SV40 is involved in human carcinogenesis because SV40 was shown to establish infections in humans (Melnick and Stinebaugh, 1962).

Injection of SV40 DNA into hamsters resulted in a variety of tumors depending on the site of injection. For example, injection of SV40-infected rhesus monkey kidney cells into newborn hamsters induced sarcomas at the site of inoculation (Eddy et al, 1962). Intravenous injection of SV40 into weanling hamsters resulted in lymphocytic leukemia, soft tissue sarcoma, osteosarcoma and lymphoma (Diamandopoulos, 1972). Intracranial injection of SV40 into both newborn hamsters and Mastomys produced ependymomas (Rabson et al, 1962).

Mesontheliomas were induced upon injection of SV40 into the intrapleural region of weanling hamsters (Cicala et al, 1993).

A variety of cell types have been used to characterize 91

Sariyer et al: Tumor induction by polyomaviruses the transforming properties of SV40 including humans, hamsters, mice, rats, guinea pigs and cattle (Butel, 1972, 2000; Butel and Lednicky, 1999). It turned out that not every cell is permissive to infection of SV40. Monkey cells are considered to be permissive to SV40 infection.

Mouse cells are nonpermissive, and human cells are considered to be â&#x20AC;&#x153;semipermissiveâ&#x20AC;? to SV40 infection. It was observed that in nonpermissive cells, the viral genome is often found to be integrated into the host genome and the integration is not directed to any specific site (Grodzicker and Hopkins, 1980). The cellular transformation and immortalization are the consequence of nonlytic infection of the host cells. Viral oncogenic proteins are generally expressed continuously during that period perhaps to maintain the cells in the transformed state. The exact mechanism of cell transformation and immortalization is unknown. However, it appears that viral onco-protein, T-Ag, targets primarily tumor suppressor and key cell cycle regulator proteins, such as p53 and pRb, which inactivates their function and results in deregulation of cell cycle progression.

SV40 T-Ag is a multifunctional oncoprotein that possesses several defined functional domains and has been shown to play a critical role in cell transformation and tumor induction (Butel and Lednicky, 1999). Figure 4 schematically illustrates different functional domains of SV40 large T antigen. The amino terminus of the T-Ag contains two distinct domains important in cell transformation. The far amino terminus of T-Ag includes the J domain involved in proper folding of protein complexes. This region shares 82 amino acid residues with small t antigen. The second region of the amino terminus of T-Ag mediates the binding to pRb and the pRb family members p107 and p130 (Fanning, 1992; Fanning and Knippers, 1992). Although the function of p107 and p130 in cell cycle regulation remains unclear, the mechanism of action of tumor suppressor protein pRb at the G1 checkpoint has been well demonstrated. It forms an inactive complex with a transcription factor E2F and arrests cells at the G1 phase of cell cycle. When specific cyclin dependent kinases phosphorylate Rb, it releases transcription factor E2F which in turn transactivates S phase specific gene promoters and causes the cell to progress into S phase. When bound to Rb, T-Ag

inactivates the regulatory function of pRb which allows unscheduled S-phase entry thereby establishing favorable conditions for cellular transformation (Butel, 2000). T-Ag also targets another tumor suppressor protein, p53, which plays a critical role in cell cycle progression at the G1 checkpoint and induces apoptosis when overexpressed in cultured cells (Shaw et al, 1992; Amundson et al, 1998). A possible mechanism by which p53 regulates the genomic stability is through the induction of apoptosis in DNA damaged cells before potentially oncogenic events deregulate cell cycle progression. p53 is found mutated or lost in up to 50% of all human cancers which emphasizes the importance of its functional loss in carcinogenesis (Hollstein et al, 1996; Levine, 1997). SV40 T-Ag possesses two p53 binding sites near its carboxy-terminal end. By binding to p53 at these sites, T-Ag inhibits p53mediated activities including arresting cells that have mild DNA damage in G1 or G2/M phases of the cell cycle for DNA repair and eliminating the cells that has extensive DNA damage by apoptosis. Under these circumstances, the cells with damaged DNA go through the cells cycle stages without DNA repair which results in accumulation of cellular mutation and increased genomic instability that can lead to cancer.

T-Ag, in addition to targeting cellular tumor suppressor proteins, also targets nuclear acetylases including CREB-binding protein (CBP), P/CAF and p300.

These regulatory proteins function as cofactors and play important roles in transcription and posttranslational modification of cellular tumor suppressor proteins. T-Ag interacts with these proteins through multiple regions (Eckner et al, 1996; Srinivasan et al, 1997) and inactivates their important cellular functions. This is also thought to contribute to deregulation of cell cycle progression.

Small t antigen of SV40, which is produced by alternative splicing of early transcripts, was shown to form complexes with the regulatory subunit of PP2A. This association appears to inhibit the function PP2A (Pallas et al, 1990; Yang et al, 1991) which inturn leads to more phosphorylated and increased kinase activity of several cellular kinases including MAP kinase and its kinase ERK, Jun N-terminal kinase (JNK) and a key ion transporter, the Na/H antiporter (Sontag et al, 1993; Frost et al, 1994).

Figure 4. Schematic representation of functional domains of SV40 large T-antigen. Approximate minimal regions of T-antigen that retain binding activity to polymerase !-primase (Pol!), tumor suppressor proteins Rb and p53, human heat shock protein 70 (hsc70) and coactivators p300 and CBP are illustrated. DNA binding domain, ATPase activity domain, nuclear localization signal (NLS) domain, helicase domain, host range domain, Zn finger domain, and J domain are also depicted.

92

Cancer Therapy Vol 2, page 93 It is also believed that small t antigen antagonizes TAg-induced cellular apoptosis and thereby contributes to more efficient transformation of rat embryo fibroblasts (Kolzau et al, 1999). Transgenic animals created with a small t antigen deletion mutant of SV40 genome consistently developed tumors in highly mitotic tissues relative to wild-type virus (Carbone et al, 1989; Choi et al, 1988) indicating that small t antigen contributes to large TAg-mediated transformation of resting cells.

SV40 infection than human fibroblast cells. This may partially offer an explanation for the relationship between SV40 and human mesotheliomas.

There are also now a number of studies describing the association of SV40 with human brain tumors.

Experimental animal studies showed that SV40 is oncogenic in neural tissues when injected, for example, into the newborn hamsters (Eddy et al, 1962; Girardi et al, 1962) and SV40 was shown to be capable of transforming primary human astrocytes in culture (Shein, 1967). SV40 genome and its gene products were detected by PCR or Western blotting in a variety of brain tumors including glioblastomas, gliomas, gliosarcomas, medullablastomas, meningiomas, pituitary adenomas and oligodendromas (Weiss et al, 1975; Krieg et al, 1981; Bergsagel et al, 1992; Lednicky et al, 1995; Martini et al, 1996). Even a complex formation of T-Ag with p53 and T-Ag with pRb was demonstrated by co-immunoprecipitation assays (Zhen et al, 1999) suggesting that T-Ag targets common pathways in different tumors.

B. Human tumors and SV40 The detection of SV40 in a metastatic melanoma patient by Soriano et al, (1974) in 1974 was the first observation that links the association of SV40 with human cancers. The virus was isolated from a lung metastasis and viral T-Ag and capsid proteins were detected in lung, liver and muscle metastasis but not in normal tissue. Since then, numerous reports have been published regarding a possible link between SV40 and human tumors. SV40 genome and the expression of T-Ag were detected by PCR, DNA hybridization, DNA sequencing and immunofluorescence techniques in a variety of human tumors and nontumor tissues including mesotheliomas (Carbone et al, 1994; Griffiths, Nicholson, and Weiss, 1998; Rizzo et al, 1998, 1999; Testa et al, 1998; Shivapurkar et al, 2000), brain tumors (Weiss et al, 1975; Krieg et al, 1981; Bergsagel et al, 1992; Lednicky et al, 1995; Martini et al, 1996), and other human tumors and nontumor tissues including osteosarcomas, AIDS-related lymphomas, peripheral blood cells, kidney tissue from pediatric renal transplant patients and non-Hodgkinâ&#x20AC;&#x2122;s lymphomas (Carbone et al, 1996; Lednicky and Butel, 1997; Butel et al, 1999; Rizzo et al, 1999; David et al, 2001).

A large number of reports have described the association of SV40 with malignant mesothelioma and yet asbestos, an environmental carcinogen is believed to be the predominant cause of mesotheliomas. Development of malignant mesotheliomas (up to 20%) in patients with no known asbestos exposure raised a controversial case of whether asbestos can be considered as the only causative agent of fatal mesotheliomas or there are other factors or co-factor, such as SV40, that play a role in the development of such tumors. Many studies have repeatedly linked the association of SV40 with mesothelioma. A recent multi-laboratory study by Testa et al, confirmed the presence of SV40 sequences in frozen mesothelioma samples by PCR, DNA hybridization and/or DNA sequencing (Testa et al, 1998). The complex formation between T-Ag with p53 and T-Ag (Carbone et al, 1997) with retinoblastoma family members, including pRb, p107 and p130, was also demonstrated by coimmunoprecipitation assays (De Luca et al, 1997). Some studies suggested that a relatively higher susceptibility of mesothelial cells to SV40 infection maybe a part of the determining factor in development of mesotheliomas.

Bochetta et al, (2000) compared the rate of transformation of SV40-infected mesothelial cells with that of human fibroblasts in a tissue culture system and the results were striking (Ozer et al, 1996). Mesothelial cells were found to be 1000 times more susceptible to transformation upon

V. Concluding remarks We have briefly reviewed recent developments regarding the tumor inducing aspects of polyomaviruses JCV, BKV and SV40. We have learned much about the molecular mechanisms underlying the cell transformation process induced by the oncogenic protein of each virus, large T antigen. However, many questions still remain unanswered as to how large T antigen can perturb the normal cell cycle progression and eventually cause cell transformation and immortalization. Further research is required to understand the molecular mechanism(s) of cell transformation, and polyomaviruses offer an excellent model system to study many aspects of this process. This in turn may help us to understand the foundation of human cancers.

Acknowledgements We would like to thank past and present members of the Center for Neurovirology and Cancer Biology for their insightful discussion and sharing of ideas. We particularly appreciate Jessica Otteâ&#x20AC;&#x2122;s operational efforts in our laboratory. She is the technical manager of the Center for Neurovirology and Cancer Biology. This work was supported by National Institutes of Health grants to M. S. and K. K.

References Aksamit AJ, Gendelman HE, Orenstein JM, and Pezeshkpour GH (1990) AIDS-associated progressive multifocal leukoencephalopathy (PML): comparison to non-AIDS PML with in situ hybridization and immunohistochemistry.

Neurology 40, 1073-8.

Aksamit AJ, Jr (1995) Progressive multifocal leukoencephalopathy: a review of the pathology and pathogenesis. Microsc Res Tech 32, 302-11.

Amundson SA, Myers TG, and Fornace AJ, Jr (1998) Roles for p53 in growth arrest and apoptosis: putting on the brakes after genotoxic stress. Oncogene 17, 3287-99.

93

Sariyer et al: Tumor induction by polyomaviruses Atwood WJ, Amemiya K, Traub R, Harms J, and Major EO (1992) Interaction of the human polyomavirus JCV with human B-lymphocytes. Virology 190, 716-23.

Azzi A, Fanci R, Bosi A, Ciappi S, Zakrzewska K, de Santis R, Laszlo D, Guidi S, Saccardi R, Vannucchi AM, and et al (1994) Monitoring of polyomavirus BK viruria in bone marrow transplantation patients by DNA hybridization assay and by polymerase chain reaction: an approach to assess the relationship between BK viruria and hemorrhagic cystitis.

Bone Marrow Transplant 14, 235-40.

Barbanti-Brodano G, Pagnani M, Viadana P, Beth-Giraldo E, Giraldo G, and Corallini A (1987) BK virus DNA in Kaposi's sarcoma. Antibiot Chemother 38, 113-20.

Baserga R (1999) The IGF-I receptor in cancer research. Exp Cell Res 253, 1-6.

Berger JR, and Concha M (1995) Progressive multifocal leukoencephalopathy: the evolution of a disease once considered rare. J Neurovirol 1, 5-18.

Berger JR, and Major EO (1999) Progressive multifocal leukoencephalopathy. Semin Neurol 19, 193-200.

Berger JR, Chauhan A, Galey D, and Nath A (2001) Epidemiological evidence and molecular basis of interactions between HIV and JC virus. J Neurovirol 7, 329-38.

Bergsagel DJ, Finegold MJ, Butel JS, Kupsky WJ, and Garcea RL (1992) DNA sequences similar to those of simian virus 40 in ependymomas and choroid plexus tumors of childhood.

N Engl J Med 326, 988-93.

Bocchetta M, Di Resta I, Powers A, Fresco R, Tosolini A, Testa JR, Pass HI, Rizzo P, and Carbone M (2000) Human mesothelial cells are unusually susceptible to simian virus 40-mediated transformation and asbestos cocarcinogenicity.

Proc Natl Acad Sci USA 97, 10214-9.

Boldorini R, Caldarelli-Stefano R, Monga G, Zocchi M, Mediati M, Tosoni A, and Ferrante P (1998) PCR detection of JC virus DNA in the brain tissue of a 9-year-old child with pleomorphic xanthoastrocytoma. J Neurovirol 4, 242-5.

Bollag B, Prins C, Snyder EL, and Frisque RJ (2000) Purified JC virus T and T' proteins differentially interact with the retinoblastoma family of tumor suppressor proteins.

Virology 274, 165-78.

Brunner M, di Mayorca G, and Goldman E (1989) Absence of BK virus sequences in transformed hamster cells transfected by human tumor DNA. Virus Res 12, 315-30.

Butel JS, Tevethia SS, and Melnick JL (1972) Oncogenicity and cell transformation by papovavirus SV40: the role of the viral genome. Adv Cancer Res 15, 1-55.

Butel JS, Arrington AS, Wong C, Lednicky JA, and Finegold MJ (1999) Molecular evidence of simian virus 40 infections in children. J Infect Dis 180, 884-7.

Butel JS, and Lednicky JA (1999) Cell and molecular biology of simian virus 40: implications for human infections and disease. J Natl Cancer Inst 91, 119-34.

Butel JS (2000) Viral carcinogenesis: revelation of molecular mechanisms and etiology of human disease. Carcinogenesis 21, 405-26.

Caputo A, Corallini A, Grossi MP, Carra L, Balboni PG, Negrini M, Milanesi G, Federspil G, and Barbanti-Brodano G (1983) Episomal DNA of a BK virus variant in a human insulinoma.

J Med Virol 12, 37-49.

Carbone M, Lewis AM, Jr, Matthews BJ, Levine AS, and Dixon K (1989) Characterization of hamster tumors induced by simian virus 40 small t deletion mutants as true histiocytic lymphomas. Cancer Res 49, 1565-71.

Carbone M, Pass HI, Rizzo P, Marinetti M, Di Muzio M, Mew DJ, Levine AS, and Procopio A (1994) Simian virus 40-like DNA sequences in human pleural mesothelioma. Oncogene 9, 1781-90.

Carbone M, Rizzo P, Procopio A, Giuliano M, Pass HI, Gebhardt MC, Mangham C, Hansen M, Malkin DF, Bushart G, Pompetti F, Picci P, Levine AS, Bergsagel JD, and Garcea RL (1996) SV40-like sequences in human bone tumors.

Oncogene 13, 527-35.

Carbone M, Rizzo P, Grimley PM, Procopio A, Mew DJ, Shridhar V, de Bartolomeis A, Esposito V, Giuliano MT, Steinberg SM, Levine AS, Giordano A, and Pass HI (1997) Simian virus-40 large-T antigen binds p53 in human mesotheliomas. Nat Med 3, 908-12.

Casteigne PR, Escourolle P, Ribadeau R, Cathala DJL, Hauw JJF (1974) Progressive multifocal leukoencephalopathy and multiple gliomas. Rev Neuro Paris 9-10 379-392.

Chenciner N, Grossi MP, Meneguzzi G, Corallini A, Manservigi R, Barbanti-Brodano G, and Milanesi G (1980) State of viral DNA in BK virus-transformed rabbit cells. Virology 103, 138-48.

Choi YW, Lee IC, and Ross SR (1988) Requirement for the simian virus 40 small tumor antigen in tumorigenesis in transgenic mice. Mol Cell Biol 8, 3382-90.

Cicala C, Pompetti F, and Carbone M (1993) SV40 induces mesotheliomas in hamsters. Am J Pathol 142, 1524-33.

Coleman DV, Daniel RA, Gardner SD, Field AM, and Gibson PE ( 1977) Polyomavirus in urine during pregnancy. Lancet 2, 709-710.

Corallini A, Barbanti-Brodano G, Bortoloni W, Nenci I, Cassai E, Tampieri M, Portolani M, and Borgatti M (1977) High incidence of ependymomas induced by BK virus a human papovavirus: brief communication. J Natl Cancer Inst 59, 1561-4.

Corallini A, Altavilla G, Cecchetti MG, Fabris G, Grossi MP, Balboni PG, Lanza G, and Barbanti-Brodano G (1978) Ependymomas malignant tumors of pancreatic islets and osteosarcomas induced in hamsters by BK virus a human papovavirus. J Natl Cancer Inst 61, 875-83.

Corallini A, Altavilla G, Carra L, Grossi MP, Federspil G, Caputo A, Negrini M, and Barbanti-Brodano G (1982) Oncogenity of BK virus for immunosuppressed hamsters.

Arch Virol 73, 243-53.

Corallini A, Pagnani M, Viadana P, Silini E, Mottes M, Milanesi G, Gerna G, Vettor R, Trapella G, Silvani V, and et al (1987) Association of BK virus with human brain tumors and tumors of pancreatic islets. Int J Cancer 39, 60-7.

Dalrymple SA, and Beemon KL (1990) BK virus T antigens induce kidney carcinomas and thymoproliferative disorders in transgenic mice. J Virol 64, 1182-91.

Darbinyan A, Darbinian N, Safak M, Radhakrishnan S, Giordano A, and Khalili K (2002) Evidence for dysregulation of cell cycle by human polyomavirus JCV late auxiliary protein.

Oncogene 21, 5574-81.

David H, Mendoza S, Konishi T, and Miller CW (2001) Simian virus 40 is present in human lymphomas and normal blood.

Cancer Lett 162, 57-64.

De Luca A, Baldi A, Esposito V, Howard CM, Bagella L, Rizzo P, Caputi M, Pass HI, Giordano GG, Baldi F, Carbone M, and Giordano A (1997) The retinoblastoma gene family pRb/p105 p107 pRb2/p130 and simian virus-40 large Tantigen in human mesotheliomas. Nat Med 3, 913-6.

De Mattei M, Martini F, Corallini A, Gerosa M, Scotlandi K, Carinci P, Barbanti-Brodano G, and Tognon M (1995) High incidence of BK virus large-T-antigen-coding sequences in normal human tissues and tumors of different histotypes. Int J Cancer 61, 756-60.

Del Valle L, Gordon J, Assimakopoulou M, Enam S, Geddes JF, Varakis JN, Katsetos CD, Croul S, and Khalili K (2001) Detection of JC virus DNA sequences and expression of the viral regulatory protein T-antigen in tumors of the central nervous system. Cancer Res 61, 4287-93.

94

Cancer Therapy Vol 2, page 95 Del Valle L, Delbue S, Gordon J, Enam S, Croul S, Ferrante P, and Khalili K (2002) Expression of JC virus T-antigen in a patient with MS and glioblastoma multiforme. Neurology 58, 895-900.

Diamandopoulos GT (1972) Leukemia lymphoma and osteosarcoma induced in the Syrian golden hamster by simian virus 40. Science 176, 173-5.

Dorries K, Loeber G, and Meixensberger J (1987) Association of polyomaviruses JC SV40 and BK with human brain tumors.

Virology 160, 268-70.

Dougherty RM (1976) A comparison of human papovavirus T antigens. J Gen Virol 33, 61-70.

Dyson NB, RFriend SHGooding LRHassell JAMajor EO (1990) Large T antigens of many polyomaviruses are able to form complexes with the retinoblastoma protein. J Virol 64, 13536.

Eckner R, Ludlow JW, Lill NL, Oldread E, Arany Z, Modjtahedi N, DeCaprio JA, Livingston DM, and Morgan JA (1996) Association of p300 and CBP with simian virus 40 large T antigen. Mol Cell Biol 16, 3454-64.

Eddy BE, Borman GS, Grubbs GE, and Young RD (1962) Identification of the oncogenic substance in rhesus monkey cell cultures as simian virus 40. Virology 17, 65-75.

Eggers C, Stellbrink HJ, Buhk T, and Dorries K (1999) Quantification of JC virus DNA in the cerebrospinal fluid of patients with human immunodeficiency virus-associated progressive multifocal leukoencephalopathy--a longitudinal study. J Infect Dis 180, 1690-4.

Enam S, Del Valle L, Lara C, Gan DD, Ortiz-Hidalgo C, Palazzo JP, and Khalili K (2002) Association of Human Polyomavirus JCV with Colon Cancer: Evidence for Interaction of Viral T-Antigen and beta-Catenin. Cancer Res 62, 7093-101.

Fanning E (1992) Simian virus 40 large T antigen: the puzzle the pieces and the emerging picture. J Virol 66, 1289-93.

Fanning E, and Knippers R (1992) Structure and function of simian virus 40 large tumor antigen. Annu Rev Biochem 61, 55-85.

Fiori M, and Di Mayorca G (1976) Occurrence of BK virus DNA in DNA obtained from certain human tumors. Proc Natl Acad Sci U S A 73, 4662-6.

Franks RR, Rencic A, Gordon J, Zoltick PW, Curtis M, Knobler RL, and Khalili K (1996) Formation of undifferentiated mesenteric tumors in transgenic mice expressing human neurotropic polymavirus early protein. Oncogene 12, 25738.

Frisque RJ, Bream GL, and Cannella MT (1984) Human polyomavirus JC virus genome. J Virol 51, 458-69.

Frisque RJ, and FAWhite (1992) "The molecular biology of JC virus causative agent of progressive multifocal leukoencephalopathy." (ERPR (ed. Ed.) Humana Press Inc, Totowa NJ. Frisque RJ (1998) Rearranged and chimaeric primate polyomavirus genomes. Dev Biol Stand, 103-13.

Frost JA, Alberts AS, Sontag E, Guan K, Mumby MC, and Feramisco JR (1994) Simian virus 40 small t antigen cooperates with mitogen-activated kinases to stimulate AP-1 activity. Mol Cell Biol 14, 6244-52.

Gallia GL, Safak M, and Khalili K (1998) Interaction of the single-stranded DNA-binding protein Puralpha with the human polyomavirus JC virus early protein T-antigen. J Biol Chem 273, 32662-9.

Gan DD, Reiss K, Carrill T, Del Valle L, Croul S, Giordano A, Fishman P, and Khalili K (2001) Involvement of Wnt signaling pathway in murine medulloblastoma induced by human neurotropic JC virus. Oncogene 20, 4864-70.

Gardner SD, AMFeild DVColleman and BHulme (1971) New human papovavirus (BK) isolated from urine after renal transplantation. Lancet, 1253-1257.

Gardner SD, MacKenzie EF, Smith C, and Porter AA (1984) Prospective study of the human polyomaviruses BK and JC and cytomegalovirus in renal transplant recipients. J Clin Pathol 37, 578-86.

Girardi AJ, Sweet BH, Sotnick VB, and Hilleman MR (1962) Development of tumors in hamsters inoculated in the neonatal period with vacuolating virus SV40. Proc Soc Exp Biol Med 109, 649-660.

Gordon J, Del Valle L, Otte J, and Khalili K (2000) Pituitary neoplasia induced by expression of human neurotropic polyomavirus JCV early genome in transgenic mice.

Oncogene 19, 4840-6.

Goudsmit J, Wetheim-van Dillen P, van Strien A, and van der Noordaa J (1982) The role of BK virus in acute respiratory tract disease and the presence of BKV DNA in tonsils. J Med Virol 10, 91-99.

Greenlee JE, Narayan O, Johnson RT, and Herndon RM (1977) Induction of brain tumors in hamsters with BK virus a human papovavirus. Lab Invest 36, 636-41.

Griffiths DJ, Nicholson AG, and Weiss RA (1998) Detection of SV40 sequences in human mesothelioma. Dev Biol Stand 94, 127-36.

Grodzicker T, and Hopkins N, Eds (1980) Origins of contemporary DNA tumor virus research2nd edDNA tumor virusesEdited by JToozeCold Spring Harbor: Cold Spring Harbor Laboratory.

Harris KF, Christensen JB, and Imperiale MJ (1996) BK virus large T antigen: interactions with the retinoblastoma family of tumor suppressor proteins and effects on cellular growth control. J Virol 70, 2378-86.

Hollstein M, Shomer B, Greenblatt M, Soussi T, Hovig E, Montesano R, and Harris CC (1996) Somatic point mutations in the p53 gene of human tumors and cell lines: updated compilation. Nucleic Acids Res 24, 141-6.

Howell DN, Smith SR, Butterly DW, Klassen PS, Krigman HR, Burchette JL, Jr, and Miller SE (1999) Diagnosis and management of BK polyomavirus interstitial nephritis in renal transplant recipients. Transplantation 68, 1279-88.

Kolzau T, Hansen RS, Zahra D, Reddel RR, and Braithwaite AW (1999) Inhibition of SV40 large T antigen induced apoptosis by small T antigen. Oncogene 18, 5598-603.

Krieg P, Amtmann E, Jonas D, Fischer H, Zang K, and Sauer G (1981) Episomal simian virus 40 genomes in human brain tumors. Proc Natl Acad Sci U S A 78, 6446-50.

Krynska B, Otte J, Franks R, Khalili K, and Croul S (1999) Human ubiquitous JCV(CY) T-antigen gene induces brain tumors in experimental animals. Oncogene 18, 39-46.

Laghi L, Randolph AE, Chauhan DP, Marra G, Major EO, Neel JV, and Boland CR (1999) JC virus DNA is present in the mucosa of the human colon and in colorectal cancers. Proc Natl Acad Sci U S A 96, 7484-9.

Lassak A, Del Valle L, Peruzzi F, Wang JY, Enam S, Croul S, Khalili K, and Reiss K (2002) Insulin receptor substrate 1 translocation to the nucleus by the human JC virus T-antigen.

J Biol Chem 277, 17231-8.

Lednicky JA, Garcea RL, Bergsagel DJ, and Butel JS (1995) Natural simian virus 40 strains are present in human choroid plexus and ependymoma tumors. Virology 212, 710-7.

Lednicky JA, and Butel JS (1997) A coupled PCR and restriction digest method for the detection and analysis of the SV40 regulatory region in infected-cell lysates and clinical samples. J Virol Methods 64, 1-9.

Levine AJ (1997) p53 the cellular gatekeeper for growth and division. Cell 88, 323-331.

95

Sariyer et al: Tumor induction by polyomaviruses London WT, Houff SA, Madden DL, Fuccillo DA, Gravell M, Wallen WC, Palmer AE, Sever JL, Padgett BL, Walker DL, ZuRhein GM, and Ohashi T (1978) Brain tumors in owl monkeys inoculated with a human polyomavirus (JC virus).

Science 201, 1246-9.

London WT, Houff SA, McKeever PE, Wallen WC, Sever JL, Padgett BL, and Walker DL (1983) Viral-induced astrocytomas in squirrel monkeys. Prog Clin Biol Res 105, 227-37.

Major EO, Amemiya K, Tornatore CS, Houff SA, and Berger JR (1992) Pathogenesis and molecular biology of progressive multifocal leukoencephalopathy the JC virus-induced demyelinating disease of the human brain. Clin Microbiol Rev 5, 49-73.

Major OM, Amemiya K, Tornatore CS, Houff SA, and Berger JR, (1992) Pathogenesis and molecular biology of progressive multifocal encephalophathyThe JC virus-induced demyelinating disease of the human brain. Clin Microbiol Rew 5, 49-73.

Martini F, Iaccheri L, Lazzarin L, Carinci P, Corallini A, Gerosa M, Iuzzolino P, Barbanti-Brodano G, and Tognon M (1996) SV40 early region and large T antigen in human brain tumors peripheral blood cells and sperm fluids from healthy individuals. Cancer Res 56, 4820-5.

Melnick JL, and Stinebaugh S (1962) Excretion of vacuolating SV-40 virus (papova virus group) after ingestion as a contaminant of oral poliovaccine. Proc Soc Exp Biol Med 109, 965-968.

Monaco MC, Atwood WJ, Gravell M, Tornatore CS, and Major EO (1996) JC virus infection of hematopoietic progenitor cells primary B lymphocytes and tonsillar stromal cells: implications for viral latency. J Virol 70, 7004-12.

Monaco MC, Jensen PN, Hou J, Durham LC, and Major EO (1998a) Detection of JC virus DNA in human tonsil tissue: evidence for site of initial viral infection. J Virol 72, 991823.

Monaco MC, Shin J, and Major EO (1998b) JC virus infection in cells from lymphoid tissue. Dev Biol Stand 94, 115-22.

Monaco MC, Sabath BF, Durham LC, and Major EO (2001) JC virus multiplication in human hematopoietic progenitor cells requires the NF-1 class D transcription factor. J Virol 75, 9687-95.

Monier R (1986) Transformation by SV40 and polyomavirusesIn "The polyomaviruses" (NPSalzman Ed. Vol1Plenum Press New York.

Monini P, De Lellis L, and Barbanti-Brodano G (1995) Association of BK and JC human polyomaviruses and SV40 with human tumorsIIn "DNA tumor viruses: Oncogenic mechanisms" (GBarbanti-Brodano Bendinelli MFriedman H, Ed. pp51-73Plenum Press: New York.

Monini P, Rotola A, de Lellis L, Corallini A, Secchiero P, Albini A, Benelli R, Parravicini C, Barbanti-Brodano G, and Cassai E (1996) Latent BK virus infection and Kaposi's sarcoma pathogenesis. Int J Cancer 66, 717-22.

Nase LM, Karkkainen M, and Mantyjarvi RA (1975) Transplantable hamster tumors induced with the BK virus.

Acta Pathol Microbiol Scand [B] 83, 347-52.

Noss G, Stauch G, Mehraein P, and Georgii A (1981) Oncogenic activity of the BK type of human papova virus in newborn Wistar rats. Arch Virol 69, 239-51.

Noss G, and Stauch G (1984) Oncogenic activity of the BK type of human papova virus in inbred rat strains. Arch Virol 81, 2 41-51.

Ozer HL, Banga SS, Dasgupta T, Houghton J, Hubbard K, Jha KK, Kim SH, Lenahan M, Pang Z, Pardinas JR, and Patsalis PC (1996) SV40-mediated immortalization of human fibroblasts. Exp Gerontol 31, 303-10.

Padgett BL, Walker DL, ZuRhein GM, Eckroade RJ, Dessel BH. (1971) Cultivation of papova-like virus from human brain with progressive multifocal leukoencephalopathy. Lancet 1,1257-1260.

Padgett BL, Walker DL, Desquitado MM, and Kim DU (1983) BK virus and non-haemorrhagic cystitis in a child. Lancet 1, 770.

Pallas DC, Shahrik LK, Martin BL, Jaspers S, Miller TB, Brautigan DL, and Roberts TM (1990) Polyoma small and middle T antigens and SV40 small t antigen form stable complexes with protein phosphatase 2A. Cell 60, 167-76.

Peterman TA, Jaffe HW, and Beral V (1993) Epidemiologic clues to the etiology of Kaposi's sarcoma. Aids 7, 605-11.

Rabson AS, O'Conor GT, Kirschstein RL, and Branigan WJ (1962) Papillary ependymomas produced in Rattus (Mastomys) natalensis inoculated with vacuolating virus (SV40). J Natl Cancer Inst 29, 765-787.

Rencic A, Gordon J, Otte J, Curtis M, Kovatich A, Zoltick P, Khalili K, and Andrews D (1996) Detection of JC virus DNA sequence and expression of the viral oncoprotein tumor antigen in brain of immunocompetent patient with oligoastrocytoma. Proc Natl Acad Sci U S A 93, 7352-7.

Ricciardiello L, Chang DK, Laghi L, Goel A, Chang CL, and Boland CR (2001) Mad-1 is the exclusive JC virus strain present in the human colon and its transcriptional control region has a deleted 98-base-pair sequence in colon cancer tissues. J Virol 75, 1996-2001.

Ricciardiello L, Laghi L, Ramamirtham P, Chang CL, Chang DK, Randolph AE, and Boland CR (2000) JC virus DNA sequences are frequently present in the human upper and lower gastrointestinal tract. Gastroenterology 119, 1228-35.

Richardson EP (1961) Progressive multifocal encephalopathy.

New Engl J Med 265, 815-823.

Rizzo P, Di Resta I, Powers A, Matker CM, Zhang A, Mutti L, Kast WM, Pass H, and Carbone M (1998) The detection of simian virus 40 in human tumors by polymerase chain reaction. Monaldi Arch Chest Dis 53, 202-10.

Rizzo P, Carbone M, Fisher SG, Matker C, Swinnen LJ, Powers A, Di Resta I, Alkan S, Pass HI, and Fisher RI ( 1999) Simian virus 40 is present in most United States human mesotheliomas but it is rarely present in non-Hodgkin's lymphoma. Chest 116, 470S-473S. Safak M, Gallia GL, Ansari SA, and Khalili K (1999) Physical and functional interaction between the Y-box binding protein YB-1 and human polyomavirus JC virus large T antigen. J Virol 73, 10146-57.

Safak M, Barrucco R, Darbinyan A, Okada Y, Nagashima K, and Khalili K (2001) Interaction of JC virus agno protein with T antigen modulates transcription and replication of the viral genome in glial cells. J Virol 75, 1476-86.

Safak M, Sadowska B, Barrucco R, and Khalili K (2002) Functional interaction between JC virus late regulatory agnoprotein and cellular Y-box binding transcription factor YB-1. J Virol 76, 3828-38.

Shah KV, Daniel RW, and Strandberg JD (1975) Sarcoma in a hamster inoculated with BK virus a human papovavirus. J Natl Cancer Inst 54, 945-50.

Shaw P, Bovey R, Tardy S, Sahli R, Sodat B, and Costa J (1992) Induction of apoptosis by wild-type p53 in a human colon tumor-derived cell line. Proc Natl Acad Sci U S A 89, 44954499.

Shein HM (1967) Transformation of astrocytes and destruction of spongioblasts induced by a simian tumor virus (SV40) in cultures of human fetal neuroglia. J Neuropathol Exp Neurol 26, 60-76.

Sheppard HM, Corneillie SI, Espiritu C, Gatti A, and Liu X (1999) New insights into the mechanism of inhibition of p53

96

Cancer Therapy Vol 2, page 97 by simian virus 40 large T antigen. Mol Cell Biol 19, 274653.

Shintaku M, Matsumoto R, Sawa H, and Nagashima K (2000) Infection with JC virus and possible dysplastic ganglion-like transformation of the cerebral cortical neurons in a case of progressive multifocal leukoencephalopathy. J Neuropathol Exp Neurol 59, 921-9.

Shivakumar CV, and Das GC (1996) Interaction of human polyomavirus BK with the tumor-suppressor protein p53.

Oncogene 13, 323-32.

Shivapurkar N, Wiethege T, Wistuba II Milchgrub S, Muller KM, and Gazdar AF (2000) Presence of simian virus 40 sequences in malignant pleural peritoneal and noninvasive mesotheliomas. Int J Cancer 85, 743-5.

Sima AAFF, SDMcLachlan DR (1983) Multiple malignant astrocytomas in a patient with spontanous progressive multifocal leukoencephalopathy. Ann Neurol 14, 183-188.

Small JA, Khoury G, Jay G, Howley PM, and Scangos GA (1986a) Early regions of JC virus and BK virus induce distinct and tissue- specific tumors in transgenic mice. Proc Natl Acad Sci U S A 83, 8288-92.

Small JA, Scangos GA, Cork L, Jay G, and Khoury G (1986b) The early region of human papovavirus JC induces dysmyelination in transgenic mice. Cell 46, 13-8.

Sontag E, Fedorov S, Kamibayashi C, Robbins D, Cobb M, and Mumby M (1993) The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75, 88797.

Soriano F, Shelburne CE, and Gokcen M (1974) Simian virus 40 in a human cancer. Nature 249, 421-4.

Srinivasan A, McClellan AJ, Vartikar J, Marks I, Cantalupo P, Li Y, Whyte P, Rundell K, Brodsky JL, and Pipas JM (1997) The amino-terminal transforming region of simian virus 40 large T and small t antigens functions as a J domain. Mol Cell Biol 17, 4761-73.

Sweet BH, and Hilleman MR (1960) The vacuolating virus S.V.40. Proc Soc Exp Biol Med 105, 420-427.

Testa JR, Carbone M, Hirvonen A, Khalili K, Krynska B, Linnainmaa K, Pooley FD, Rizzo P, Rusch V, and Xiao GH (1998) A multi-institutional study confirms the presence and expression of simian virus 40 in human malignant mesotheliomas. Cancer Res 58, 4505-9.

Tognon M, Casalone R, Martini F, De Mattei M, Granata P, Minelli E, Arcuri C, Collini P, and Bocchini V (1996) Large T antigen coding sequences of two DNA tumor viruses BK and SV40 and nonrandom chromosome changes in two glioblastoma cell lines. Cancer Genet Cytogenet 90, 17-23.

Trapp BD, Small JA, Pulley M, Khoury G, and Scangos GA (1988) Dysmyelination in transgenic mice containing JC virus early region. Ann Neurol 23, 38-48.

Uchida S, Watanabe S, Aizawa T, Furuno A, and Muto T (1979) Polyoncogenicity and insulinoma-inducing ability of BK Virus a human Papovavirus in Syrian golden hamsters. J Natl Cancer Inst 63, 119-26.

Uchida S, Watanabe S, Aizawa T, Kato K, and Furuno A (1976) Induction of papillary ependymomas and insulinomas in the Syrian golden hamster by BK virus a human papovavirus.

Gann 67, 857-65. van der Noordaa J (1976) Infectivity oncogenicity and transforming ability of BK virus and BK virus DNA. J Gen Virol 30, 371-3.

Varakis J, ZuRhein GM, Padgett BL, and Walker DL (1978) Induction of peripheral neuroblastomas in Syrian hamsters after injection as neonates with JC virus a human polyoma virus. Cancer Res 38, 1718-22.

Walker DL, Padgett BL, ZuRhein GM, Albert AE, and Marsh RF (1973) Human papovavirus (JC): induction of brain tumors in hamsters. Science 181, 674-6.

Watanabe S, Yoshiike K, Nozawa A, Yuasa Y, and Uchida S (1979) Viable deletion mutant of human papovavirus BK that induces insulinomas in hamsters. J Virol 32, 934-42.

Watanabe S, and Yoshiike K (1982) Change of DNA near the origin of replication enhances the transforming capacity of human papovavirus BK. J Virol 42, 978-85.

Weiss AF, Portmann R, Fischer H, Simon J, and Zang KD (1975) Simian virus 40-related antigens in three human meningiomas with defined chromosome loss. Proc Natl Acad Sci U S A 72, 609-13.

Yang SI, Lickteig RL, Estes R, Rundell K, Walter G, and Mumby MC (1991) Control of protein phosphatase 2A by simian virus 40 small-t antigen. Mol Cell Biol 11, 1988-95.

Zhen HN, Zhang X, Bu XY, Zhang ZW, Huang WJ, Zhang P, Liang JW, and Wang XL (1999) Expression of the simian virus 40 large tumor antigen (Tag) and formation of Tag-p53 and Tag-pRb complexes in human brain tumors. Cancer 86, 2124-32.

Dr. Mahmut Safak

97

Sariyer et al: Tumor induction by polyomaviruses

98

Cancer Therapy Vol 2, page 99 Cancer Therapy Vol 2, 99-106, 2004

Comparison between hypopharyngeal and laryngeal cancers: I-role of tobacco smoking and alcohol drinking Research Article

Eduardo De Stefani1*, Paul Brennan2, Paolo Boffetta2,3, Alvaro L. Ronco1, Hugo Deneo-Pellegrini1, Pelayo Correa4, Fernando Oreggia5 and María Mendilaharsu1 1

Registro Nacional de Cáncer, Montevideo, Uruguay.

Unit of Environmental Cancer Epidemiology, International Agency for Research on Cancer, Lyon, France.

3 Division of Clinical Epidemiology, German Cancer Research Center (DKFZ), Heidelberg, Germany.

4 Department of Pathology, Louisiana State University Medical Center, New Orleans, Louisiana, USA. 5 Academia Nacional de Medicina, Montevideo, Uruguay.

2

__________________________________________________________________________________ *Correspondence: Dr. Eduardo De Stefani, Avenida Brasil 3080 dep. 402, Montevideo, Uruguay; Tel.: (598) 2 708 23 14; Fax: (598) 2 402 08 10; E-Mail: estefani@adinet.com.uy Key Words: hypopharyngeal and laryngeal cancers, tobacco smoking and alcohol drinking, Abbreviations: Age-standardized (World Population) incidence rates, (ASR’s); food frequency questionnaire, (FFQ); International Classification of Diseases for Oncology, (ICD-O); odds ratios, (OR’s); tobacco-specific nitrosamines, (TSNA) Received: 20 April 2004; Accepted: 30 April 2004; electronically published: May 2004

Summary In the period 1997-2003, a case-control study on risk factors for hypopharyngeal and laryngeal cancers was conducted in Montevideo, Uruguay. The study included 320 cases and 640 controls and was restricted to males. The main objectives of the study was to compare the relative risks by tumor site for tobacco smoking, alcohol drinking and diet. In this first report, the role of smoking and drinking will be examined by tumor site. Tobacco smoking was a strong risk factor for hypopharyngeal and laryngeal cancers. Nevertheless, odds ratios (OR’s) for laryngeal carcinomas were much higher in comparison with hypopharyngeal lesions. On the contrary, alcohol drinking displayed a stronger effect among cancer of the hypopharynx in comparison with larynx carcinomas. The differences by tumor site were statistically significant. These findings suggest that, concerning the effect of tobacco and alcohol, hypopharyngeal and laryngeal cancers could be different epidemiologic entities.

Hypopharyngeal and laryngeal cancers are very frequent among Uruguayan men (Parkin et al, 1997).

According to international comparisons between registries in the Americas, both sites are in first place, followed by Blacks in United States (Parkin et al, 1997). Agestandardized (World Population) incidence rates (ASR’s) were of 3.3 per 100,000 men for hypopharyngeal carcinomas, whereas the rate for laryngeal cancer were of 12.2 per 100, 000 men (Parkin et al, 1997).

Tobacco smoking and alcohol drinking are the major risk factors for both sites (Wynder et al, 1976; Tuyns et al, 1988; Austin and Reynolds, 1996; Cattaruzza et al, 1996).

Also diet has received particular attention in recent studies (Estève et al, 1996; Riboli et al, 1996; World Cancer Research Fund, 1997). Therefore, we decided to conduct a case-control study in order to compare the risks for smoking and drinking by tumor site in the high-risk population of Uruguay. The a priori hypothesis was that

I. Introduction Cancers of the hypopharynx and larynx has been analized as a sigle entity in several studies (Tuyns et al, 1988; Cattaruzza et al, 1996). According to the International Classification of Diseases for Oncology (ICD-O) (WHO, 1976), hypopharyngeal lesions includes tumors of sinus pyriform, postcricoid region, aryepiglottic fold, posterior wall of hypopharynx and cancers of hypopharynx not elsewhere classified. Accordind to the same classification, laryngeal tumors are divided in glottis lesions, supraglottis tumors, subglottic tumors and lesions of larynx not elsewhere classified (WHO, 1976). Previous studies divided laryngeal cancers in extrinsic and intrinsic (Wynder et al, 1976; Tuyns et al, 1988). Most of the tumors (99.5 %) arising in both sites are squamous cell carcinomas (Austin and Reynolds, 1996).

99

De Stefani et al: Tobacco and alcohol in hypopharyngeal and pharyngeal cancers before the date of the interview or before the date of the first symptom.

hypopharyngeal and laryngeal are different epidemiological entities. The role of diet will be analyzed in a companion report.

D. Definitions variables

II. Materials and methods

of

tobacco

and

alcohol

Patients who smoked less than 100 cigarettes in their lifetime were considered never smokers. Smokers who used cigarettes at the time of the interview or who had quitted one year before the interview were defined as current smokers. The remaining patients were defined as former smokers. Regarding type of tobacco, patients were divided into pure smokers of blond or black tobacco when they had smoked each type of tobacco during more than 85 % of their lifetimes. The remaining patients were defined as mixed smokers. Patients who had drunk occasionally or less than monthly were considered never drinkers. Participants who drunk alcohol beverages at the date of the interview or who quitted one year before the interview were defined as current drinkers. The remaining patients were included in the category of former drinkers. Binge drinkers, that is periodic heavy drinkers, were not identified according to the questionnaire. The amount of alcohol drunk was expressed as mililiters of ethanol per day, according to the following calculations: beer-6 % of ethanol per liter, wine-12 % of ethanol per liter and hard liquor-46 % of ethanol per liter. Among types of wine, red wine is almost exclusively consumed by Uruguayan population, in particular the low socioeconomical population (Comisión Honoraria de Lucha contra el Cáncer, 1993).

Regarding hard liquor, Uruguayan population consumes grappa (hard liquor derived fron grapes) and caña (hard liquor from sugarcane) (Comisión Honoraria de Lucha contra el Cáncer, 1993).

A. Selection of cases In the time period 1997-2003 all newly diagnosed and microscopically verified squamous cell carcinomas of the hypopharynx and larynx which occurred in men, were considered eligible for this study. Three-hundred and twenty eight (328) of cases were identified in the four major hospitals in Montevideo.

Eight patients were excluded from the cases due to phonation problems, leaving a final number of 320 patients (response rate 97.5 %). After careful endoscopic examination by one of the authors (F.O.), the cases we classified as follows: A. hypopharyngeal carcinomas (85 cases, 26.6 %) and B. laryngeal carcinomas (235, 73.4 %). Most of hypopharyngeal tumors were located in the sinus pyriform (78 patients), whereas laryngeal cancers were distributed as follows: glottic lesions (49 cases), supraglottis lesions (67 cases) and transglottis lesions (119 cases). The term transglottis refers to lesions which involved both supraglottis and glottis.

B. Selection of controls In the same time period and in the same hospitals, 1235 men which were hospitalized for diseases not related with tobacco smoking, alcohol drinking and without recent changes in their diets were considered eligibles for the study. Thirty five patients refused the interview, leaving a final number of 1200 potential controls (response rate 97.2 %). From this pool of patients, 640 men were frequency matched with cases on age (in ten year intervals) and residence (Montevideo, other counties).

The resulting case-control ratio was 1:2. Controls presented the following diseases: abdominal hernia (146 patients, 22.8 %), eye disorders (135, 21.1 %), fractures (70, 10.9 %), injuries (62, 9.7 %), skin diseases (56, 8.8 %), acute appendicitis (52, 8.1 %), hydatid cyst (32, 5.0 %), varicose veins (32, 5.0 %), urinary stones (27, 4.2 %), blood disorders (19, 3.0 %) and osteoarticular diseases (9, 1.4 %).

E. Statistical analysis Relative risk, approximated by the odds ratio (OR) and corresponding ninety five per cent confidence intervals (95 % CI) were estimated by unconditional multiple logistic regression (Breslow and Day, 1980). Comparisons between hypopharyngeal and laryngeal cancers were carried out using multinomial (polytomous) regression (Hosmer and Lemeshow, 1989; Rothman and Greenland, 1998). Comparisons between hypopharyngeal and laryngeal cancers were carried out using multinomial (polytomous) regression (Hosmer and Lemeshow, 1989; Rothman and Greenland, 1998). OR’s for tobacco smoking variables were obtained after fitting the following model: age (categorical, 6 strata), residence (ordinal, 2 strata), urban/rural status (ordinal, 2 strata), education (categorical, 3 strata), body mass index (categorical, 4 strata) and alcohol drinking (categorical, 5 strata). The model fitted for alcohol variables was similar, replacing alcohol drinking by tobacco smoking (pack years, categorical, 5 strata).

Test for trend were performed after entering categorical variables as ordinal (continuous) in the same model. Departure from the multiplicative model was determined by assessing the likelihood ratio test statistic. An alpha of 0.05 was used as the indicator of statistical significance and, accordingly 95 % Ci s were reported. All Ps were derived from two-sided statistical tests. All the calculations were done with the STATA programme (Stata Reference Manual, 1999).

C. Interviews and questionnaire Both series of participants (cases and controls) were interviewed in the hospitals by two trained social workers. The interviews were performed shortly after admittance to the hospitals. No proxy interviews were accepted. The patients were administered with a questionnaire which included the following sections: (A) sociodemographics, (B) a complete occupational section based in job titles and its duration, (C) history of cancer among first degree relatives, (D) self-reported height and weigh five years before the date of the interview, (E) a complete history of tobacco smoking (age at start, age at quit, number of cigarettes smoked per day, type of tobacco, type of cigarette, inhalation), (F) a complete history of alcohol drinking (age at star, age of quit, number of glasses drunked per day; this was repeated for the main alcoholic beverages consumed in Uruguay: beer, wine and hard liquor), (G) a complete history of maté drinking (maté is the folk name of a local tea prepared by infusion of the herb Ilex paraguariensis; this beverage is usually drunk hot or very hot) and (H) a food frequency questionnaire (FFQ) on 64 food items. This FFQ is considered as representative of the usual diet of Uruguayan population and, although it was not validated, it was tested for reproducibility with reasonably good results.

Furthermore, the FFQ allowed the consumption of total energy.

All queries on foods referred to the consumption two years

III. Results Distribution of cases and controls by sociodemographic variables, body mass index and total calories are shown in Table 1 . As result of the frequency matched design, age, residence and urban/rural status were rather similar. Also education and monthly income were similar. High body mass index was associated with a 100

Cancer Therapy Vol 2, page 101 Table 1. Distribution of controls and cases by sociodemographic variables and selected risk factors.

Variable Age (years)

Residence Urban/rural Education (yrs)

Income (Dollars)

Body mass index

Total energy

Nยบ patients

Cases Controls Category 30-39 40-49 50-59 60-69 70-79 80-89 Montevideo Other counties Urban Rural 0-2 3-5 6+ <=142 143+ Missing <=23.0 23.1-24.9 25.0-27.2 27.3+ <=1835 1836-2164 2165-2580 2581+

Nยบ 2 31 97 115 65 10 103 217 251 69 87 123 110 182 130 68 125 97 56 42 39 54 88 139 320

% 0.6 9.7 30.3 35.9 20.3 3.1 32.2 67.8 78.4 21.6 27.2 38.4 34.4 38.1 40.6 21.3 39.1 30.3 17.5 13.1 12.2 16.9 27.5 43.4 100.0

Nยบ 4 66 187 233 130 20 248 392 493 147 168 216 256 250 241 149 160 162 156 162 250 250 250 250 640

% 0.6 10.3 29.2 36.4 20.3 3.1 38.7 61.3 77.0 23.0 26.3 33.7 40.0 39.0 37.7 23.3 25.0 25.3 24.4 25.3 25.0 25.0 25.0 25.0 100.0

OR 95 % CI

Not applicable Not applicable Not applicable 1.0 1.1 0.7-1.6 0.9 0.6-1.3 1.0 1.1 0.8-1.6 1.0 0.8 0.5-1.1 0.4 0.3-0.6 0.3 0.2-0.5 1.0 1.3 0.8-2.0 2.2 1.4-3.5 3.5 2.3-5.4

1-Education, income, body mass index and total calories are adjusted for each other. significant reduction in risk (OR 0.3, 95 % CI 0.2-0.5). On the contrary, cases consumed significant higher amounts of energy compared with controls (OR 3.6, 95 % CI 2.35.5). It should be taken into account that this estimation includes alcohol energy plus non-alcoholic sources of energy.

Odds ratios of hypopharyngeal and laryngeal carcinomas for tobacco smoking are shown in Table 2.

Although the smoking pattern was characterized by higher risks among laryngeal cancers compared with hypopharyngeal carcinomas, the differences between both sites were non significant. Current smokers were associated with an increased risk among laryngeal carcinomas (OR 10.7, 95 % CI 4.3-26.4), whereas the same category of smokers displayed an OR of 6.7 (95 % CI 1.5-30.9, p-value for heterogeneity=0.96). Ex-smokers showed a higher reduction in risk among hypopharyngeal cancers (OR 3.2, 95 % CI 0.6-15.6) compared with laryngeal carcinomas (OR 6.2, 95 % CI 2.5-15.7).

Variables which measured the smoking intensity (number of cigarettes/day and number of cigarettes/day among current smokers) were associated with much higher increase in risk among laryngeal tumors compared with hypopharyngeal carcinomas (p-value for heterogeneity=0.12). The same fact was observed for variables which measured smoking duration (years of smoking and years since quit). It should be pointed out that smoking intensity was associated with higher risks

compared with smoking duration. This was observed both for hypopharyngeal and laryngeal carcinomas. Cumulative exposure to tobacco smoking (pack years) was associated with an elevated risk in laryngeal carcinomas (OR for heavy smokers 21.3, 95 % CI 8.4-54.3). On the other hand, hypopharyngeal cancers displayed less impressive risk (OR for heavy smokers 9.2, 95 % CI 1.9-44.2). The differences between both locations were close to statistical significance (p-value for heterogeneity=0.07). The effect of type of tobacco yielded non-significant results. More precisely, smokers of black tobacco were associated with a modest increase in risk, more evident in carcinomas of the hypoharynx (reference category: smokers of blond tobacco). On the other hand, smokers of hand-rolled cigarettes were associated with a significant increase of risk of 1.9 (95 % CI 1.3-2.8) among carcinomas of the larynx (reference category: smokers of manufactured cigarettes). The effect of hand-rolling was less marked and not formally significant in squamous cell carcinomas of the hypopharynx. Lifelong users of filter cigarettes were associated with a reduction in risk of 0.6 in both sites and the differences were not significant. Finally, inhalers displayed an increase in risk in hypopharynx and larynx, being the effect higher in laryngeal carcinomas.

Odds ratios of hypopharyngeal and laryngeal carcinomas for alcohol drinking variable are shown in Table 3. Current drinkers displayed an OR of 6.0 (95 % CI 2.0-18.0) for hypoharyngeal cancers, whereas the risk 101

De Stefani et al: Tobacco and alcohol in hypopharyngeal and pharyngeal cancers Table 2. Odds ratios of hypopharyngeal and laryngeal cancers for tobacco smoking variables (1) Hypopharynx Larynx Variable Controls Cases Smoking status Never smokers 132 2 Former smokers 193 18 Current smokers 315 65 Ever smokers 508 83 p-value for trend Heterogeneity Number of cigarettes/day Never smokers 132 2 1-9 92 5 10-19 153 9 20-29 133 33 30+ 130 36 p-value for trend Heterogeneity Years smoked Never smokers 132 2 1-29 96 9 30-39 118 19 40-49 169 34 50+ 125 21 p-value for trend Heterogeneity Years since quit Current smokers 315 65 1-9 80 13 10-19 64 2 20+ 49 3 Never smokers 132 2 p-value for trend Heterogeneity Pack years Never smokers 132 2 1-26 183 8 27-45 130 25 46-67 108 24 68+ 87 26 p-value for trend Heterogeneity Type of tobacco Blond 375 55 Black 133 28 Heterogeneity Type of cigarette Manufactured 246 29 Hand-rolled 160 54 Heterogeneity Filter use Plain 248 54 Mixed 195 21 Filter 65 8 Never smokers 132 2 p-value for trend Heterogeneity

OR 95 % CI

Cases

OR 95 % CI

1.0 3.2 0.6-15.6 6.7 1.5-30.9 5.4 1.2-24.5 0.0006 0.96

6 67 162 229

1.0 6.2 2.5-15.7 10.7 4.3-26.4 8.7 3.6-21.2 <0.0001

1.0 1.9 0.3-11.1 1.7 0.3-8.9 7.1 1.5-33.8 7.7 1.6-36.8 <0.0001 0.12

6 7 29 78 115

1.0 1.8 0.5-5.7 3.7 1.4-9.8 12.5 4.9-31.9 19.3 7.6-49.4 <0.0001

1.0 2.6 0.5-13.9 4.0 0.8-19.9 5.3 1.1-25.7 5.9 1.2-29.5 0.009 0.51

6 23 50 75 81

1.0 4.5 1.7-12.3 7.4 2.8-19.0 7.8 3.1-19.7 11.6 4.6-29.5 <0.0001

1.0 0.75 0.37-1.49 0.19 0.04-0.82 0.43 0.12-1.55 0.15 0.03-0.73 0.0009 0.93

162 45 11 11 6

1.0 0.98 0.63-1.54 0.34 0.17-0.69 0.43 0.20-0.90 0.10 0.04-0.25 <0.0001

1.0 1.6 0.3-8.3 5.4 1.1-25.6 6.9 1.4-33.8 9.2 1.9-44.2 <0.0001 0.07

6 17 50 70 92

1.0 2.0 0.7-5.5 7.1 2.8-18.1 12.8 5.0-32.6 21.3 8.4-54.3 <0.0001

1.0 1.4 0.8-2.4 0.51

157 72

1.0 1.2 0.8-1.7

1.0 1.6 0.9-2.8 0.55

74 155

1.0 1.9 1.3-2.8

1.0 0.47 0.26-0.84 0.61 0.25-1.50 0.17 0.04-0.77 0.001 0.62

129 83 17 6

1.0 0.84 0.58-1.21 0.67 0.35-1.28 0.13 0.05-0.31 <0.0001

102

Cancer Therapy Vol 2, page 103 Inhalation Never smokers No Yes

132 2 107 7 401 76 p-value for trend Heterogeneity

1.0 1.8 0.3-9.6 4.9 1.1-21.6 0.007 0.95

6 18 211

1.0 2.7 0.9-7.2 8.1 3.4-19.3 <0.0001

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), and total ml. of ethanol of alcohol drinking (categorical).

Table 3. Odds ratios (and 95 % CI) of hypopharyngeal and laryngeal cancers for alcohol drinking

Variable Alcohol status (1) Never drinkers Former drinkers Current drinkers Ever drinkers

Beer (2) Beer abstainers 1-60 61+

Red wine (3) Wine abstainers 1-60 61-120 121+

Hard liquor (4) Liquor abstainers 1-60 61-120 121+

Total alcohol (1) Never drinkers 1-60 61-120 121-240 241+

Years of drinking (1) Never drinkers 1-29 30-39 40-49 50+

Alcohol cessation (1) Current drinkers

Controls Cases

Hypopharynx OR 95 % CI

191 4 88 15 361 66 449 81 p-value for trend Heterogeneity

1.0 5.8 1.7-19.3 6.0 2.0-18.0 6.0 2.0-17.7 0.002 0.02

32 44 159 203

1.0 1.8 1.0-3.3 1.6 0.9-2.5 1.6 1.0-2.6 0.15

560 75 45 8 35 2 p-value for trend Heterogeneity

1.0 0.8 0.3-1.9 0.2 0.1-1.1 0.08 0.31

205 14 16

1.0 0.6 0.3-1.2 0.8 0.4-1.6 0.26

234 212 104

1.0 2.3 0.9-5.5 5.2 2.2-12.4

44 45 80

1.0 0.9 0.5-1.6 2.8 1.7-4.7

90 27 p-value for trend Heterogeneity

4.5 1.9-10.8 0.0001 0.35

66

2.3 1.4-3.9 <0.0001

468 45 102 12 31 10 39 18 p-value for trend Heterogeneity

1.0 0.9 0.4-1.9 2.2 0.9-5.2 3.3 1.6-6.8 0.0008 0.03

145 35 24 31

1.0 0.9 0.5-1.4 1.5 0.8-2.8 1.5 0.8-2.6 0.14

191 4 175 10 116 23 88 17 70 31 p-value for trend Heterogeneity

1.0 2.3 0.7-8.1 7.6 2.3-24.4 5.6 1.7-18.6 12.8 4.0-41.2 <0.0001 0.03

32 31 45 68 59

1.0 0.8 0.4-1.5 1.5 0.8-2.7 2.4 1.4-4.2 2.5 1.4-4.5 <0.0001

191 4 107 17 131 19 127 27 84 18 p-value for trend Heterogeneity

1.0 5.1 1.5-17.4 3.9 1.2-12.9 8.2 2.5-26.5 7.9 2.3-27.8 0.0005 0.02

32 36 51 66 50

1.0 1.5 1.4 1.9 1.6 0.06

361

1.0

159

1.0

9 20 29

66

103

Larynx Cases

OR 95 % CI

0.8-2.9 0.8-2.5 1.1-3.4 0.9-3.0

De Stefani et al: Tobacco and alcohol in hypopharyngeal and pharyngeal cancers 1-4 5-9 10+ Never drinkers

Alcohol years (1) Never drinkers 1-37 38-80 81-145 146+

Alcohol pattern (1) Never drinkers Pure beer Pure wine Pure liquor Mixed drinkers

34 8 19 4 35 3 191 4 p-value for trend Heterogeneity

1.35 0.57-3.22 1.30 0.40-4.30 0.43 0.12-1.53 0.16 0.05-0.49 0.0007 0.03

27 9 8 32

1.94 1.06-3.57 1.19 0.48-2.94 0.47 0.20-1.13 0.64 0.39-1.04 0.04

191 4 159 3 118 24 94 26 78 28 p-value for trend Heterogeneity

1.0 0.7 0.1-3.6 7.7 2.4-24.9 8.8 2.8-28.4 10.8 3.3-35.0 <0.0001 0.03

32 21 43 62 77

1.0 0.6 0.3-1.2 1.4 0.8-2.6 2.2 1.2-3.8 2.8 1.6-4.9 <0.0001

191 4 7 1 233 37 31 4 178 39 p-value for trend Heterogeneity

1.0 4.3 0.4-49.0 5.6 1.8-17.1 4.8 1.0-22.0 6.9 2.2-21.3 0.001 0.05

32 1 96 10 96

1.0 0.5 1.6 1.2 1.7 0.06

0.1-4.8 0.9-2.7 0.5-2.9 1.0-2.9

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), and tobacco smoking (pack years categorical).

2-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years categorical), wine (categorical) and hard liquor (categorical).

3-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years categorical), beer (categorical) and hard liquor (categorical).

4-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years categorical), beer (categorical) and wine (categorical) .

among laryngeal carcinomas was only of 1.6 (95 % CI 0.9-2.5, p-value for heterogeneity 0.02). The number of beer drinkers among Uruguayan males is extremelly low (10 cases among hypopharynx lesions and 30 among laryngeal cancers). Thus, it is not surprising that resulting ORâ&#x20AC;&#x2122;s were non-significant. On the other hand, red wine is the preferred alcoholic beverage in Uruguay. Although red wine intake was associated with higher OR´s among patients with hypopharyngeal cancers compared with cancers of the larynx, the differences were non-significant.

Hard liquor consumption displayed an increased risk among hypopharyngeal carcinomas (OR 3.3, 95 % CI 1.66.8), whereas laryngeal cancers showed a modest elevation in risk of 1.5. The test for heterogeneity was statistical significant (p-value=0.03). Total alcohol consumption, years of drinking alcohol, years of cessation alcohol drinking and lifelong consumption of alcohol (alcohol years) were directly associated with elevated risk for patients with hypopharyngeal carcinomas (OR for heavy drinkers of alcohol 12.8, 95 % CI 4.0-41.2, p-value for trend <0.0001). On the other hand, cancers of the larynx displayed less impressive effects (OR for heavy drinkers of alcohol 2.5, 95 % CI 1.4-4.5). All the variables above mentioned showed significant differences between both sites (p-value for heterogeneity=0.03 for total alcohol drinking). Finally, pattern of consumption of alcoholic beverages displayed an OR of 6.9 for mixed drinkers (95 % CI 2.2-21.3) among hypopharyngeal lesions compared with 1.7 (95 % CI 1.0-2.9, p-value for heterogeneity=0.05)

in the same category among laryngeal carcinomas.

Joint effects of tobacco smoking (cigarettes/day) and alcohol drinking for hypopharyngeal and laryngeal cancers are shown in Table 4. Both sites displayed independent effect for tobacco smoking and alcohol drinking (see marginals). Whereas the effect of alcohol drinking was much higher in patients with hypopharyngeal lesions, tobacco smoking displayed higher effect in laryngeal cancer. These differences by site were statistical significant (p-value for heterogeneity=0.04 for tobacco and 0.02 for alcohol drinking). Curiously joint effects for heavy smokers and heavy drinkers were rather similar in both sites (OR ~43). Whereas this high risk was due to alcohol in hypopharyngeal cancers, joint ORâ&#x20AC;&#x2122;s should be attributed to tobacco smoking in laryngeal lesions. The results followed a multiplicative model.

IV. Discussion According to our results, tobacco smoking is a major risk factor for laryngeal cancer, whereas alcohol drinking displayed significant increases in risk among hypopharyngeal carcinomas. Moreover, whereas the effect of tobacco smoking is not significant different between both tumor sites (although cigarettes per day and pack years were much higher in laryngeal carcinoma compared with hypopharyngeal lesions), alcohol drinking displayed significant heterogeneity. These results replicates the findings of Tuyns et al. in the large multicenter study of

104

Cancer Therapy Vol 2, page 105 IARC (Tuyns et al, 1988). In this study, results for hypopharynx and epilarynx carcinomas are compared with endolaryngeal lesions (Tuyns et al, 1988). These authors strongly suggested that 68 % of the hypopharyngeal cancers versus 28 % of the endolaryngeal cancers are attributable to alcohol drinking. Other studies (Brugere et al, 1986; Barón et al, 1993) reported an elevated risk of hypopharyngeal carcinomas for alcohol drinking, after controlling for tobacco smoking.

Concerning the mechanisms of tobacco smoking, it is clear that this risk factor is a rich source of carcinogens (IARC, 1986). In particular, tobacco contains high amounts of tobacco-specific nitrosamines (TSNA). These compounds have been implicated in the carcinogenesis of lung, oral cavity, pharynx, larynx, esophagus and urinary bladder (Hecht, 2002). In particular, air-cured tobacco (black tobacco) has greater concentrations of TSNA compared with flue-cured tobacco (blond tobacco). In discordance with previous studies (Benhamou et al, 1985; De Stefani et al, 1987; De Stefani et al, 1988, 1993; Boffetta, 1993; Sancho-Garnier and Theobald, 1993), the present study failed to show a significant increase in risk among smokers of black tobacco. This could be the results of the decline in the sales of black tobacco in the Uruguayan market (De Stefani et al, 1994). On the other hand, in the present study, hand-rolled cigarettes were associated with a significant increase in risk for squamous cell laryngeal carcinomas, and, in a lesser degree for hypopharyngeal carcinoma. Our results replicates findings from previous studies (De Stefani et al, 1992, 1993; Launoy et al, 2000). Since hand-made cigarettes are also filled with blond tobacco, there is uncertaintly concerning about the chemical composition of the blond tobacco used for fill hand-rolled cigarettes. More precisely, hand-made blond tobacco could contain higher amounts of carcinogenic chemicals compared with the flue-cured

tobacco used for manufactured cigarettes. Further studies are needed in order to clarify this issue.

At difference with the mechanisms of action of tobacco, alcohol drinking has been the subject of considerable debate (IARC, 1988; Blot, 1999). Recent reviews suggested that alcohol drinking acts through ethanol or its major metabolite (acetaldehyde) (World Cancer Research Fund, 1997, Blot, 1999). On the other hand, beer, wine and hard liquor could contain carcinogenic substances (Schlecht et al, 2001). Also, it is possible that alcohol could be a solvent for tobacco carcinogens or facilitate the action of these carcinogens inducing injury of the mucosa (Blot, 1999). Since hypopharyngeal mucosa is in direct contact with alcohol, this mechanism could fit with our findings. On the other hand, laryngeal mucosa is mainly related with the inhaled tobacco.

As other case-control studies, our study has a several limitations. Perhaps the most important drawback is the potential for selection bias. This bias is almost impossible to exclude. We tried to minimize selection bias by frequency matching cases and controls on age, residence and urban/rural status. Another important bias is classification bias. Since is widely known that tobacco smoking and alcohol drinking are the main determinants of these malignancies, both patients and interviewers could induce differential reponse of the cases. This could result in results close to the null. Our study has also strengths. The precise validation of the lesion by an expert endoscopist is a strength. Also, the high response rate (both for cases and controls) is another important strength.

In summary, we conducted a case-control study in Uruguay in order to compare OR’s for hypopharyngeal and laryngeal carcinomas. Tobacco smoking was associated with higher risks in lesions of the larynx, but

Table 4. Joint effects of tobacco smoking and alcohol drinking in hypopharyngeal and laryngeal cancers (1)

Cigarettes/day 0-14 15-24 25+ Total

Hypopharynx Alcohol drinking 0-60 OR 95 % CI 1.0 1.9 0.3-12.8 4.3 0.8-23.5 1.0

61-120 OR 95 % CI 5.1 1.1-23.3 16.3 4.2-62.9 21.3 5.3-85.0 5.6 2.4-13.1

121+ OR 95 % CI 4.6 0.8-25.6 22.3 5.8-86.3 43.9 11.5-116.8 9.4 4.1-21.6

Total OR 95 % CI 1.0 3.3 1.5-6.9 5.2 2.4-11.0

61-120 OR 95 % CI 5.1 1.1-23.3 15.0 6.8-33.0 20.7 9.1-47.3 2.2 1.4-3.5

121+ OR 95 % CI 2.5 0.7-9.0 13.7 5.8-32.3 42.2 18.9-94.6 3.0 1.9-4.8

Total OR 95 % CI 1.0 5.9 3.4-10.3 13.0 7.4-22.6

Larynx Alcohol drinking Cigarettes/day 0-14 15-24 25+ Total

0-60 OR 95 % CI 1.0 4.3 1.7-11.0 12.8 5.4-30.2 1.0

1-Adjusted for age, residence, urban/rural status, education, body mass index and for each other.

105

De Stefani et al: Tobacco and alcohol in hypopharyngeal and pharyngeal cancers oropharyngeal cancer. A case-control study from Uruguay.

Rev Epidém et Santé Publ 36, 389-394 De Stefani E, Fierro L, Barrios E and Ronco A (1994) Cancer mortality trends in Uruguay 1953-1991. Int J Cancer 56, 634-639 De Stefani E, Oreggia F, Rivero S and Fierro L (1992) Handrolled cigarette smoking and risk of cancer of the mouth pharynx and larynx. Cancer, 70 679-682 Estève J, Riboli E, Péquignot G, Terracini B, Merletti F, Crosignani P, Ascunce N, Zubiri L, Blanchet F, Raymond L, Repetto F and Tuyns AJ (1996) Diet and cancers of the larynx and hypopharynx: the IARC multi-center study in southeastern. Europe Cancer Causes Control 7, 240-252 Hecht SS (2002) Cigarette smoking and lung cancer: chemical mechanisms and approaches to prevention. Lancet Oncol 3, 461-469 Hosmer DW Jr and Lemeshow S (1989) Applied logistic regression New York: John Wiley & Sons, IARC monographs on the evaluation of the carcinogenic risk of chemicals to humans Tobacco smoking Volume 38 IARC Lyon France 1986 IARC monographs on the evaluation of the carcinogenic risk of chemicals to humans. Alcohol drinking. Volume 44, IARC, Lyon, France, 1988 Launoy G, Milan C, Faivre J, Pienkowski P and Gignoux M (2000) Tobacco type and risk of squamous cell cancer of the oesophagus in males: a French multicentre case-control study. Int J Epidemiol 29, 36-42 Parkin DM, Whelan SL, Ferlay J, Raymond L and Young J (eds) (1997) Cancer Incidence in Five Continents Vol VII IARC Scientific Publications nº 148 Lyon IARC Riboli E, Kaaks R and Estève J (1996) Nutrition and laryngeal cancer. Cancer Causes Control 7, 147-156 Rothman KJ and Greenland S (1998) Modern Epidemiology.

Second Edition, Lippincott-Raven Publishers Sancho-Garnier H and Theobald S (1993) Black (air-cured) and blond (flue-cured) tobacco and cancer riskII: Pharynx and larynx cancer. Eur J Cancer 29A, 273-276 Schlecht NF, Pintos J, Kowalski LP and Franco EL ( 2001) Effect of type of alcoholic beverage on the risks of upper aerodigestive tract cancers in Brazil. Cancer Causes Control 12, 579-587 Stata Reference Manual. Release 6. Stata Press. College Station, Texas 1999.

Tuyns AJ, Estève JRaymond L et al (1988) Cancer of the larynx hypopharynx tobacco and alcohol: IARC international casecontrol study in Turin and Varese (Italy), Zaragoza and Navarra (Spain), Geneva (Switzerland) and Calvados (France). Int J Cancer 41, 483-491 World Cancer Research Fund (1997) Food nutrition and the prevention of cancer: a global perspective. American Institute for Cancer Research, Washington DC World Health Organization International Classification of Diseases for Oncology. (ICD-O), 1976 Wynder EL, Covey LS, Mabuchi K and Mushinski M (1976) Environmental factors in cancer of the larynx A second look.

Cancer 38, 1591-1601

the differences with hypopharyngeal squamous cell carcinomas of the hypopharynx did not reach statistical significance. Most of the variables related with alcohol drinking displayed significantly higher OR’s among hypopharyngeal carcinomas compared with laryngeal cancers. These results suggest that, concerning smoking and drinking, hypopharyngeal and laryngeal could be distinct epidemiological entities. Therefore, these tumors sites should not be joined as a single disease in future diseases.

Acknowledgements Supported by a grant from International Agency for Research on Cancer.

References Austin DF and Reynolds P (1996) Laryngeal cancer In D Schottenfeld and JF Fraumeni Jr (eds): Cancer epidemiology and prevention. Second Edition pp 619-636 Oxford University Press New York Barón AE, Franceschi S, Barra S, Talamini R and La Vecchia C (1993) A comparison of the joint effects of alcohol and smoking on the risk of cancer across sites in the upper aerodigestive tract. Cancer Epidemiol Biomarkers Prev 2, 519-523 Benhamou S, Benhamou E, Tirmarche M and Flamant R (1985) Lung cancer and use of cigarettes: a French case-control study. J Natl Cancer Inst 74, 1169-1175 Blot WJ (1999) Invited commentary: More evidence of increased risks of cancer among alcohol drinkers. Am J Epidemiol 150, 1138-1140 Boffetta P (1993) Black (air-cured) and blond (flue-cured) tobacco and cancer risk III: Oral cavity. Eur J Cancer 29A, 284-287 Breslow NE and Day NE (1980) Statistical methods of cancer research. Volume 1-The analysis of case-control studies.

IARC Scientific Publications Nº 32. Lyon, IARC Brugere J, Guenel P, Leclerc A and Rodriguez J (1986) Differential effects of tobacco and alcohol in cancer of the larynx pharynx and mouth. Cancer 57 391-395 Cattaruzza MS, Maisonneuve P and Boyle P (1996) Epidemiology of laryngeal cancer. Oral Oncol 32B, 293-305 Comisión Honoraria de Lucha contra el Cáncer (1993) Conocimientos, creencias, actitud y prácticas sobre cáncer.

Encuesta de población.

Cooperación técnica OPP/BID/PNUD. Comisión Honoraria de Lucha contra el Cáncer, (In Spanish) De Stefani De Stefani E, Barrios E and Fierro L (1993) Black (air-cured) and blond (flue-cured) tobacco and cancer risk III: Oesophageal cancer. Eur J Cancer 29A, 763-766 De Stefani E, Correa P, Oreggia F et al (1987) Risk factors for laryngeal cancer. Cancer 60, 3087-3091 De Stefani E, Correa P, Oreggia F, Deneo-Pellegrini H, Fernández G, Zavala D, Carzoglio J Leiva J, Fontham E and Rivero S (1988) Black tobacco wine and mate in

106

Cancer Therapy Vol 2, page 107 Cancer Therapy Vol 2, 107-114, 2004

Comparison between hypopharyngeal and laryngeal cancers: II-the role of foods and nutrients Research Article

Eduardo De Stefani1*, Paolo Boffetta2,3, Alvaro L. Ronco1, Hugo Deneo-Pellegrini1, Pelayo Correa4, Fernando Oreggia5 and María Mendilaharsu1 1

Registro Nacional de Cáncer, Montevideo, Uruguay.

Unit of Environmental Cancer Epidemiology, International Agency for Research on Cancer, Lyon, France.

3 Division of Clinical Epidemiology, German Cancer Research Center (DKFZ), Heidelberg, Germany.

4 Department of Pathology, Louisiana State University Medical Center, New Orleans, Louisiana, USA. 5 Academia Nacional de Medicina, Montevideo, Uruguay.

2

__________________________________________________________________________________ *Correspondence: Dr. Eduardo De Stefani, Avenida Brasil 3080 dep. 402, Montevideo, Uruguay; Tel.: (598) 2 708 23 14; Fax: (598) 2 402 08 10; E-Mail: estefani@adinet.com.uy Key Words: hypopharyngeal and laryngeal cancers, foods and nutrients Abbreviations: monounsaturated fat, (MUFA); odds ratios, (OR’s); polyunsaturated fat, (PUFA) Received: 20 April 2004; Accepted: 30 April 2004; electronically published: May 2004

Summary A case-control study involving 320 cases with hypopharyngeal/laryngeal cancer and 640 controls with nonneoplastic diseases was conducted in Montevideo, Uruguay. This study was designed in order to compare the effects of tobacco, alcohol and diet in both tumor sites. In this second report, the role of food groups and nutrients will be examined in detail. Significant heterogeneity between tumors of the hypopharynx and larynx was found for high-fat foods and total grains. Whereas laryngeal carcinomas displayed a much higher risk for fatty foods compared with hypopharyngeal lesions, the last mentioned cancers displayed an elevated odds ratio (OR=2.2) for total grains, compared with a null effect in laryngeal cancers. When nutrients were examined by tumor site, fats (particularly saturated fat) displayed an OR of 2.7 for laryngeal carcinomas, whereas hypopharyngeal cancers were not associated with fat intake. These findings strongly suggest that hypopharyngeal and laryngeal carcinomas could be different epidemiological entities.

A. Definition of food groups

I. Introduction

The following food groups were created: red meat (beef, lamb), white meat (poultry, fish), processed meat (bacon, sausage, blood pudding, mortadella, salami, saucisson, hot dog, ham, salted meat), total meat (red meat, white meat, processed meat, liver), dairy foods (cheese, butter, whole milk, ice cream), eggs (boiled eggs, fried eggs, mayonnaise), desserts (milk with sugar, rice pudding, custard, marmalade, cake), high-fat foods (red meat, processed meat, dairy foods, eggs, desserts), total grains (white rice, maize, polenta, pasta, white bread), raw vegetables (carrot, tomato, lettuce, onion), cooked vegetables (garlic, swiss chard, spinach, winter squash, cabbage, cauliflower, beetroot, zucchini, red pepper), total vegetables (raw vegetables, cooked vegetables), citrus fruits (orange, tangerine), other fruits (apple, pear, grape, peach, banana, fig, plum, fruit cocktail), total fruits (citrus fruits, other fruits), total vegetables and fruits (total vegetables, total fruits), all tubers (potato, sweet potato), pulses (chickpea, kidney bean, lentil) and total plant foods (total vegetables, total fruits, all tubers, pulses). All foods and food groups were recorded in units representing frequency of

Hypopharyngeal and laryngeal cancers were strongly associated with increasing exposure to tobacco smoking and alcohol drinking (see companion report). This article examined the role of food and nutrients in these malignancies.

Previous reports on diet and hypopharyngeal/laryngeal cancers (La Vecchia et al, 1990; Freudenheim et al, 1992; Graham et al, 1992; Cattaruzza et al, 1996; Estève et al, 1996; Riboli et al, 1996; World Cancer Research Fund, 1997) suggested a protective effect of vegetable and fruit consumption.

In the present report, we presented a detailed analysis of the effect of foods and nutrients in hypopharyngeal and larygeal carcinomas.

II. Materials and methods Selection of cases, controls, details of the interviews, structure of the questionnaire and statistical analysis employed were presented in detail in the companion report.

107

De Stefani et al: Foods and nutrients in hypopharyngeal and pharyngeal cancers consumption in servings per year. Food groups were distributed in approximated tertiles, following the controls distribution.

III. Results Odds ratios of hypopharyngeal and laryngeal cancers combined for food groups are shown in Table 1. Only red meat and stewed meat consumptions were significantly and directly associated with risk (OR for high consumption of stewed meat 2.19, 95 % CI 1,45-3.32, pvalue for trend=0.0002). On the other hand, consumption of raw vegetables, total vegetables, citrus fruits, total fruits, total vegetables and fruits, pulses and total plant foods displayed strong inverse associations with hypopharyngeal/laryngeal cancers risk. All these associations were statistically significant. The highest reductions in risk were observed for high intake of raw vegetables (OR 0.33, 95 % CI 0.22-0.50, p-value for trend <0.0001) and for high consumption of citrus fruits (OR 0.40, 95 % CI 0.27-0.61, p-value for trend <0.0001).

White meat (poultry plus fish), processed meat, total meat, dairy foods, eggs, desserts, grains, cooked vegetables, non-citrus fruits and tubers were not associated with risk of hypopharyngeal/laryngeal carcinomas.

The comparison between hypopharyngeal and laryngeal cancers for food groups are shown in Table 2.

Hypopharyngeal cancers displayed significant increases in risk for the following food groups: barbecued meat (OR 1.84, 95 % CI 1.01-3.36) and grains (OR 2.19, 95 % CI 1.14-4.18). Inverse associations were observed for raw vegetables (OR 0.35, 95 % CI 0.18-0.68), citrus fruits (OR 0.26, 95 % CI 0.13-0.53), total vegetables and fruits (OR 0.46, 95 % CI 0.23-0.92) and legumes (OR 0.32, 95 % CI 0.16-0.65).

B. Nutrients Nutrients were calculated in units per day (grams, miligrams or micrograms). The values for nutrients were estimated by a local table of chemical composition of foods (Mazzei et al, 1995). The following nutrients were included in the analysis: protein, carbohydrates, total fat, saturated fat, monounsaturated fat (MUFA), polyunsaturated fat (PUFA), linoleic acid, alpha-linolenic acid, cholesterol, total vitamin A, beta-carotene, alpha-carotene, lutein, lycopene, betacryptoxanthin, vitamin C, vitamin E, fiber, total phytosterols and total flavonols. All nutrients (macro- and micronutrients) were energy-adjusted by the residuals method of Willett and Stampfer (Willett and Stampfer, 1986).

C. Statistical analysis Odds ratios for food groups were estimated after fitting a model which included the following terms: age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (categorical), alcohol drinking (categorical) and total energy intake (continuous).

Similarly, ORâ&#x20AC;&#x2122;s for nutrients were estimated after fitting the same model. Both food groups and nutrients were introduced into the model one per time. Joint effects for red meat and vegetables, high-fat foods and raw vegetables and saturated fat and vitamin C were analized. All calculations were performed with the STATA software programme (Stata Reference Manual 1999).

Table 1. Odds ratios (and 95 % CI) of hypopharyngeal and laryngel cancers for food groups. Both sites together (1).

Tertiles Food groups Red meat White meat Processed meat Stewed meat Total meat Dairy foods Eggs Desserts Fat-rich foods Grains Raw vegetables Cooked vegetables Total vegetables Citrus fruits Other fruits Total fruits Total vegetables and fruits All tubers Pulses Total plant foods

OR 1.27 0.73 1.44 1.51 0.90 1.31 0.67 1.21 1.64 1.34 0.48 0.89 0.78 0.60 0.73 0.68 0.64 1.19 0.84 0.73

II 95 % CI 0.84-1.93 0.50-1.08 0.96-2.16 0.99-2.32 0.60-1.36 0.90-1.92 0.46-0.99 0.83-1.78 1.10-2.43 0.91-1.99 0.32-0.71 0.61-1.31 0.54-1.14 0.41-0.87 0.50-1.08 0.47-1.00 0.44-0.93 0.81-1.76 0.57-1.22 0.50-1.06

OR 1.75 0.84 1.20 2.19 1.21 1.03 0.86 1.24 1.43 1.15 0.33 0.86 0.51 0.40 0.83 0.54 0.46 1.07 0.48 0.47

III 95 % CI 1.16-2.64 0.56-1.25 0.80-1.79 1.45-3.32 0.81-1.80 0.67-1.58 0.58-1.27 0.83-1.87 0.95-2.16 0.76-1.73 0.22-0.50 0.57-1.29 0.34-0.77 0.27-0.61 0.56-1.22 0.36-0.81 0.31-0.70 0.71-1.62 0.32-0.73 0.31-0.71

p-value for trend 0.007 0.36 0.42 0.0002 0.31 0.76 0.38 0.28 0.09 0.49 <0.0001 0.46 0.002 <0.0001 0.31 0.002 0.0002 0.71 0.0006 0.0003

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

108

Cancer Therapy Vol 2, page 109 Table 2. Comparison between hypopharyngeal and laryngeal carcinomas for food groups (1,2).

Food groups Red meat White meat Processed meat Barbecued meat Stewed meat Total meat Dairy foods Eggs Desserts Fat-rich foods Grains Raw vegetables Cooked vegetables Total vegetables Citrus fruits Other fruits Total fruits Total vegetables and fruits All tubers Pulses Total plant foods

Hypopharynx OR 95 % CI 1.11 0.59-2.08 0.81 0.44-1.52 0.86 0.45-1.63 1.84 1.01-3.36 1.82 0.94-3.52 0.86 0.46-1.61 0.88 0.44-1.78 1.11 0.62-2.02 1.02 0.51-2.02 0.56 0.28-1.13 2.19 1.14-4.18 0.35 0.18-0.68 0.80 0.42-1.53 0.54 0.28-1.03 0.26 0.13-0.53 0.99 0.54-1.80 0.63 0.34-1.17 0.46 0.23-0.92 1.38 0.71-2.69 0.32 0.16-0.65 0.54 0.28-1.07

OR 2.02 0.84 1.34 1.18 2.33 1.33 1.06 0.77 1.33 1.93 0.90 0.32 0.87 0.50 0.45 0.78 0.51 0.46 1.00 0.54 0.45

Larynx 95 % CI 1.28-3.18 0.54-1.29 0.86-2.08 0.77-1.80 1.48-3.66 0.86-2.05 0.67-1.69 0.50-1.19 0.86-2.06 1.22-3.04 0.57-1.42 0.20-0.50 0.56-1.35 0.32-0.79 0.29-0.71 0.51-1.19 0.33-0.79 0.29-0.71 0.64-1.56 0.35-0.84 0.29-0.70

p-value for heterogeneity 0.07 0.92 0.19 0.11 0.45 0.15 0.74 0.25 0.52 0.001 0.01 0.68 0.82 0.84 0.15 0.46 0.53 0.66 0.37 0.19 0.41

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

2-Each cell correspond the the upper tertile of consumption (reference category: lower tertile).

Total vegetables and total plant foods also displayed important reductions in risk which were marginally significant. On the other hand, laryngeal cancers showed significant positive associations for high intakes of red meat (OR 2.02, 95 % CI 1.28-3.18), stewed meat (OR 2.33, 95 % CI 1.28-3.18) and fat-rich foods (OR 1.93, 95 % CI 1.22-3.04). Raw vegetables, total vegetables, citrus fruits, total fruits, total vegetables and fruits, legumes and total plant foods were inversely associated with laryngeal carcinomas risk. All these negative associations were highly significant. Three food groups were significantly heterogeneous between hypopharyngeal and laryngeal tumors: red meat (p-value for heterogeneity=0.07), fat-rich foods (p-value for heterogeneity=0.001) and total grains (p-value for heterogeneity=0.01).

Odds ratios of both tumor sites combined for nutrient intake are shown in Table 3. Protein, total fat, saturated fat, monounsaturated fat and alpha-linolenic acid were positively associated with risk of hypopharyngeal/laryngeal carcinomas. All these nutrients were significant and saturated fat was associated with the higher risk (OR 2.08, 95 % CI 1.37-3.15, p-value for trend=0.0006). Total carbohydrates, alpha-carotene, lycopene, beta-cryptoxanthin, vitamin C, vitamin E, total phytosterols and flavonols were negatively associated with hypopharyngeal/laryngeal carcinomas risk. The strongest reduction in risk was observed for the higher tertile of consumption of beta-cryptoxanthin (OR 0.32, 95 % CI 0.21-0.49, p-value for trend <0.0001). Polyunsaturated

fat, linoleic acid, vitamin A, beta-carotene, lutein and fiber were not associated with risk.

Comparisons between hypopharyngeal and laryngeal cancers are shown in Table 4 . No nutrients increased the risk of hypopharyngeal carcinomas. Alpha-carotene, lycopene, beta-cryptoxanthin, vitamin C and total phytosterols were inversely associated with risk of these lesions. The strongest reduction in risk was observed for the highest tertile of beta-cryptoxanthin (OR 0.21, 95 % CI 0.10-0.44), followed by total phytosterols (OR 0.28, 95 % CI 0.14-0.58). On the contrary, protein, total fat, saturated fat, monounsaturated fat, polyunsaturated fat and alphalinolenic acid displayed significant positive associations with laryngeal cancers. The highest increase in risk was observed for high consumption of saturated fat (OR 2.67, 95 % CI 1.67-4.27). Total carbohydrates, alpha-carotene, lycopene, beta-cryptoxanthin, vitamin C, vitamin E, total phytosterols and flavonols were negatively associated with laryngeal cancers risk. The strongest reduction in risk was shown by lycopene (OR 0.34, 95 % CI 0.21-0.54). There was significant heterogeneity for the following nutrients: total carbohydrates, total fat, saturated fat, monounsaturated fat, alpha-linolenic acid and dietary fiber.

Joint effects of red meat and raw vegetables by tumor site are shown in Table 5. ORâ&#x20AC;&#x2122;s of hypopharyngeal cancers displayed moderate elevations, with the exception of the last row (high consumption of red meat and low intake of raw vegetables) (OR 2.98, 95 % CI 1.05-8.52).

On the other hand, laryngeal cancers displayed elevated

109

De Stefani et al: Foods and nutrients in hypopharyngeal and pharyngeal cancers Table 3. Odds ratios (and 95 % CI) of hypopharyngeal/laryngeal carcinomas for nutrients (1).

Tertiles Nutrient Protein Carbohydrates Total fat Saturated fat MUFA (2) PUFA (3) Linoleic acid Alpha-linolenic acid Colesterol Vitamin A Beta-carotene Alpha-carotene Lycopene Lutein Beta-cryptoxanthin Vitamin C Vitamin E Dietary fiber Total phytosterols Flavonols

OR 1.33 0.75 1.06 1.55 0.98 1.26 1.03 1.10 0.91 1.07 1.10 0.56 0.60 0.90 0.54 0.55 0.61 1.22 0.57 0.83

II 95 % CI 0.89-2.00 0.52-1.10 0.70-1.63 1.02-2.36 0.64-1.50 0.84-1.88 0.69-1.53 0.73-1.67 0.61-1.35 0.73-1.58 0.74-1.64 0.38-0.82 0.41-0.88 0.61-1.33 0.38-0.80 0.37-0.80 0.41-0.89 0.83-1.80 0.39-0.83 0.57-1.21

OR 1.59 0.54 1.99 2.08 1.88 1.45 1.29 1.87 1.08 0.74 1.01 0.36 0.35 1.08 0.32 0.41 0.52 0.89 0.37 0.61

III 95 % CI 1.07-2.38 0.36-0.82 1.31-3.00 1.37-3.15 1.24-2.83 0.96-2.18 0.86-1.94 1.24-2.80 0.73-1.60 0.49-1.11 0.67-1.52 0.24-0.55 0.23-0.54 0.73-1.60 0.21-0.49 0.27-0.62 0.35-0.78 0.59-1.35 0.24-0.55 0.41-0.92

p-value for trend 0.02 0.003 0.0006 0.0006 0.001 0.07 0.21 0.002 0.70 0.16 0.94 <0.0001 <0.0001 0.70 <0.0001 <0.0001 0.0009 0.63 <0.0001 0.02

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

2-Monounsaturated fat.

3-Polyunsaturated fat.

Table 4. Comparisons between hypopharyngeal and laryngeal cancers for nutrients (1,2,3,4).

Nutrient Protein Carbohydrates Total fat Saturated fat MUFA (3) PUFA (4) Linoleic acid Alpha-linolenic acid Cholesterol Vitamin A Beta-carotene Alpha-carotene Lycopene Lutein Beta-cryptoxanthin Vitamin C Vitamin E Dietary fiber Total phytosterols Flavonols

Hypopharynx OR 95 % CI 1.44 0.79-2.62 0.92 0.47-1.78 1.08 0.58-2.00 1.08 0.58-2.01 1.00 0.54-1.85 1.06 0.57-1.99 1.07 0.58-1.96 1.13 0.61-2.11 1.03 0.57-1.87 0.72 0.38-1.38 1.36 0.70-2.63 0.35 0.18-0.70 0.40 0.20-0.78 1.04 0.55-1.99 0.21 0.10-0.44 0.53 0.28-0.98 0.60 0.32-1.11 1.79 0.88-3.63 0.28 0.14-0.58 0.56 0.30-1.04

OR 1.65 0.47 2.47 2.67 2.36 1.62 1.38 2.19 1.07 0.75 0.94 0.36 0.34 1.08 0.36 0.37 0.50 0.73 0.39 0.63

Larynx 95 % CI 1.06-2.55 0.30-0.73 1.56-3.91 1.67-4.27 1.49-3.73 1.04-2.54 0.88-2.16 1.40-3.43 0.70-1.65 0.48-1.17 0.60-1.45 0.23-0.58 0.21-0.54 0.71-1.65 0.23-0.57 0.23-0.58 0.32-0.78 0.46-1.15 0.25-0.61 0.41-0.99

p-value for heterogeneity 0.71 0.02 0.01 0.01 0.01 0.21 0.43 0.04 0.92 0.90 0.29 0.87 0.67 0.93 0.13 0.33 0.57 0.02 0.54 0.57

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

2-Each cell correspond the the upper tertile of consumption (reference category: lower tertile).

3-Monounsaturated fat.

4-Polyunsaturated fat.

110

Cancer Therapy Vol 2, page 111 Table 5. Joint effects of red meat and raw vegetables by tumor site (1).

Meat Low Low Low Medium Medium Medium High High High

Vegetables High Medium Low High Medium Low High Medium Low

Hypopharynx OR 95 % CI 1.0 0.67 0.18-2.43 1.88 0.62-5.69 0.94 0.29-3.11 1.38 0.43-4.42 1.32 0.46-3.82 0.20 0.04-1.08 1.35 0.44-4.16 2.98 0.57-1.87

OR 1.0 1.65 5.46 2.11 3.42 4.53 2.78 3.63 10.1

Larynx 95 % CI 0.58-4.71 2.10-14.2 0.78-5.74 1.27-9.21 1.83-11.2 1.07-7.25 1.36-9.67 4.04-25.5

p-value for heterogeneity 0.22 0.09 0.24 0.18 0.04 0.004 0.13 0.04

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

risk in most combinations of the variables of study. There was a well-defined gradient for increased exposure of red meat and decreased exposure of raw vegetables and the last row (high consumption of red meat and low intake of vegetables) OR showed an of 10.1. Three rows showed significant heterogeneity between both tumor sites.

In Table 6, joint effects of high fat foods (red meat, processed meat, dairy foods, eggs and desserts) and raw vegetables are shown. Hyopopharyngeal cancers displayed a somehow inconsistent trend of OR’s, with several risks below the unity. The effect of high consumption of high fat foods and low intake of raw vegetables was associated with a risk of 0.78 (95 % CI 0.23-2.62). On the contrary, laryngeal carcinomas showed a fairly well-defined gradient associated with increased consumption of fatty foods and decreased intake of raw vegetables. The combinarion of high consumption of fat-rich foods and low intake of fresh vegetables was directly associated with a six-fold increase in risk. The differences between hypopharyngeal and laryngeal carcinomas were statistically significant (p-value for heterogeneity=0.002).

The interaction between saturated fat and vitamin C is shown in Table 7. Both nutrients displayed independent effects, after adjusting for each other and major confounders (results not shown). Also, the effect of saturated fat was much higher among laryngeal cancers compared with hypopharyngeal lesions (p-value for heterogeneity=0.02). Finally, the combined effect of high intake of saturated fat and low intake of vitamin C was associated with an increased risk of 15.4 for laryngeal carcinomas, whereas the OR’s for hypopharyngeal cancers was of 3.23 (95 % CI 1.06-9.83, p-value for heterogeneity=0.02).

Freudenheim et al, 1992; Graham et al, 1992; Cattaruzza et al, 1996; Estève et al, 1996; Riboli et al, 1996; World Cancer Research Fund, 1997). When both tumor sites were compared for food groups, fat-rich foods displayed significant higher risks for laryngeal cancer. On the contrary, grains were associated with increased risk for hypopharyngeal carcinomas, whereas there was no effect of this food group in the laryngeal cancers. To our knowledge, these results are new findings.

Grains could increase the risk of hypopharyngeal cancer by direct contact with the mucosa. This could result in injury of the epithelium, allowing the carcinogenic activity of tobacco and alcohol. The effect of high-fat foods in laryngeal mucosa is more difficult to explain.

Further studies are needed in order to elucidate this effect.

Concerning nutrients, protein, total fat, saturated fat, monounsaturated fat and alpha-linolenic acid were directly associated with risk of hypopharyngeal/laryngeal carcinomas. On the other hand, alpha-carotene, lycopene, beta-cryptoxanthin, vitamin C, vitamin E, total phytosterols and flavonols were inversely associated with risk. These findings replicate those reported in previous studies (Freudenheim et al, 1992; Cattaruzza et al, 1996).

When both sites were compared by nutrient intake, protein, fats and alpha-linolenic acid displayed significantly higher risk among laryngeal carcinomas, compared with hypopharyngeal lesions. A previous study on laryngeal cancer (Freudenheim et al, 1992), reported similar findings. The mechanism of fat in laryngeal carcinogenesis is presently unknown. Franceschi et al, have suggested that heavy alcohol consumption is associated with lower intake of vegetables and fruits and high consumption of fat (Franceschi et al, 1994). This was also was suggested by La Vecchia et al, (1992). Further studies on this complex relationship are needed.

Our study has limitations. Aside from selection bias, already discussed in the companion paper, recall bias could be a difficult problem. This bias usually result in non-differential misclassification bias. This bias result in null results. Thus, the risks observed in the study could have been even greater. Since both interviewers and patients were unawere of the role of diet in cancer of the upper aerodigestive cancers, it is unlikely that interviewer

IV. Discussion According our study red and boiled meat were directly associated with risk of hypopharyngeal/laryngeal cancers. On the other hand, raw vegetables, total vegetables, citrus fruits, total fruits, total vegetables and fruits, legumes and total plant foods. Previous studies reported similar findings, particularly concerning the protective effect of plant foods (De Stefani et al, 1987; Mackerras et al, 1988; La Vecchia et al, 1990;

111

De Stefani et al: Foods and nutrients in hypopharyngeal and pharyngeal cancers Table 6. Joint effects of fatty foods and raw vegetables by tumor site (1).

Fatty Low Low Low Medium Medium Medium High High High

Vegetables High Medium Low High Medium Low High Medium Low

Hypopharynx OR 95 % CI 1.0 0.56 0.15-2.05 2.76 0.99-7.64 1.04 0.32-3.34 1.60 0.55-4.69 2.67 0.99-7.19 0.24 0.04-1.26 1.59 0.50-5.04 0.78 0.23-2.62

OR 1.0 1.52 2.95 1.53 2.98 4.95 2.05 1.74 5.95

Larynx 95 % CI 0.60-3.81 1.25-6.98 0.63-3.72 1.27-6.97 2.24-10.9 0.84-5.02 0.67-4.55 2.67-13.3

p-value for heterogeneity 0.17 0.91 0.56 0.30 0.26 0.01 0.88 0.002

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

Table 7. Joint effects of saturated fat and vitamin C by tumor site (1).

S.fat Low Low Low Medium Medium Medium High High High

Vitamin C High Medium Low High Medium Low High Medium Low

Hypopharynx OR 95 % CI 1.0 1.47 0.45-4.77 4.59 1.47-14.3 1.85 0.54-6.40 1.55 0.47-5.13 1.32 0.38-4.53 1.68 0.51-5.54 1.45 0.43-4.89 3.23 1.06-9.83

OR 1.0 2.92 8.46 4.96 7.85 6.49 6.07 5.60 15.4

Larynx 95 % CI 0.98-8.65 2.91-24.6 1.66-14.8 2.85-21.6 2.36-17.8 2.13-17.2 1.99-15.8 5.68-41.7

p-value for heterogeneity 0.35 0.38 0.19 0.02 0.03 0.07 0.06 0.02

1-Adjusted for age (categorical), residence, urban/rural status, education (categorical), body mass index (categorical), tobacco smoking (pack years, categorical), alcohol drinking (categorical) and total energy intake (continuous).

larynx and hypopharynx: the IARC multi-center study in southeastern. Europe Cancer Causes Control 7, 240-252 Franceschi S, Bidoli E, Negri E, Barbone F, La Vecchia C (1994) Alcohol and cancers of the upper aerodigestive tract in men and women. Cancer Epidemiol Biomarkers Prev 3, 299304 Freudenheim JL, Graham S, Byers TE, Marshall JR, Haughey BP, Swanson MK, Wilkinson G (1992) Diet, smoking, and alcohol in cancer of the larynx: a case-control study.. Nutr Cancer 17, 33-45.

Graham S, Zielezny M, Marshall J, Priore R, Freudenheim J, Brasure J, Haughey B, Nasca P, Zdeb M (1992) Diet in the epidemiology of postmenopausal breast cancer in the New York State Cohort. Am J Epidemiol 136, 1327-37 La Vecchia C, Negri E, D'Avanzo B, Franceschi S, Decarli A, Boyle P (1990) Dietary indicators of laryngeal cancer risk.

Cancer Res 50, 4497-500.

La Vecchia C, Negri E, Franceschi S, Parazzini F, Decarli A (1992) Differences in dietary intake with smoking, alcohol, and education. Nutr Cancer 17, 297-304.

Mackerras D, Buffler PA, Randall DE, Nichaman MZ, Pickle LW, Mason TJ (1988) Carotene intake and the risk of laryngeal cancer in coastal Texas. Am J Epidemiol 128, 980-8 Mazzei ME, Puchulu MR, and Rochaix MA (1995) Tabla de composición química de alimentos. Segunda Edición.

CENEXA, (In spanish).

Riboli E, Kaaks R, Esteve J (1996) Nutrition and laryngeal cancer. Cancer Causes Control 7, 147-56

bias could have existed. Our study also has strengths.

Perhaps the major strenght is the high response rate, both for cases and controls.

In summary, this study on diet and hypopharyngeal/laryngeal cancers showed interesting findings. In particular, the role of high-fat foods and saturated fat increased the the risk of laryngeal cancer. The only important risk factor for hypopharyngeal cancer was grain consumption. These dietary differences between both tumor sites, together with those differences for smoking and drinking (see companion report), further support the possibility that hypopharyngeal and laryngeal carcinomas could be different epidemiological entities.

Acknowledgements Supported by a grant from International Agency for Research on Cancer.

References Cattaruzza MS, Maisonneuve P, Boyle P (1996) Epidemiology of laryngeal cancer. Eur J Cancer B Oral Oncol 32B, 293-305 De Stefani E, Correa P, Oreggia F et al (1987) Risk factors for laryngeal cancer. Cancer 60, 3087-3091 Estève J, Riboli E, Péquignot G, Terracini B, Merletti F, Crosignani P, Ascunce N, Zubiri L, Blanchet F, Raymond L, Repetto F and Tuyns AJ (1996) Diet and cancers of the

112

Cancer Therapy Vol 2, page 113 Stata Reference Manual (1999) Release 6. Stata Press. College Station, Texas.

Willett W, Stampfer MJ ( 1986) Total energy intake: implications for epidemiologic analyses. Am J Epidemiol 124, 17-27.

World Cancer Research Fund (1997) Food, nutrition and the prevention of cancer: a global perspective. American Institute for Cancer Research, Washington DC.

113

De Stefani et al: Foods and nutrients in hypopharyngeal and pharyngeal cancers

114

Cancer Therapy Vol 2, page 115 Cancer Therapy Vol 2, 115-120, 2004

Telomerase activity in circulating colorectal tumour cells Research Article

Ruth L. Loveday, Liviu Titu, Daniel Beral, Victoria L. Jordison, John R. T. Monson, John Greenman* University of Hull, Department of Surgery, Postgraduate Medical Institute, Hull, HU6 7RX, UK

__________________________________________________________________________________ *Correspondence: Dr J. Greenman, Medical Research Laboratory, Wolfson Building, University of Hull, Cottingham Road, Hull HU6 7RX; Tel: 00 44 1482 466032; Fax: 00 44 1482 466996; Email: j.greenman@hull.ac.uk Key Words: Telomerase, colorectal tumour, PCR, Hybridisation and ELISA, epithelial cells Abbreviations: carcinoembryonic antigen, (CEA); circulating tumour cells, (CTC); colorectal cancer, (CRC); Dihydropyrimidine dehydrogenase, (DPD) Received: 19 April 2004; Accepted: 26 April 2004; electronically published: May 2004

Summary The detection of viable circulating tumour cells (CTC) in colorectal cancer (CRC) patients may be useful in devising new prognostic / diagnostic strategies and in understanding the metastatic process. This study used telomerase as a marker for CTC which has the advantage over most previous CTC studies in that it is both highly cancer-specific and only detectable in viable cells. Blood samples were taken from 35 CRC patients pre-operatively and 7 days postoperatively and from 10 healthy normal controls. Peripheral blood mononuclear cells were isolated using density gradient centrifugation and epithelial cells separated using BerEP4-conjugated magnetic beads. Telomerase activity was assessed using the TeloTAGGGì PCR-ELISA assay. CTC were detected in 11/35 pre-operative, 19/35 postoperative and 0/10 control samples. 11/35 patients who were negative pre-operatively showed CTC post-operatively.

CTC did not correlate with any clinical markers, however gender was a significant factor in CTC status with females most likely to be CTC positive pre-operatively (p<0.01). The current study describes novel methodology to detect viable CTC in CRC patients. The methodology may be valuable in conjunction with established methods in the diagnosis of symptomatic patients. Interesting differences in the biology of colorectal cancer between genders has also been described.

Colorectal cancer is the second most common cancer in the UK and accounts for more than 18,000 deaths annually. Surgical resection is the mainstay of treatment for colorectal cancer but nearly half of all patients who undergo a potentially curative resection will relapse, principally because of undetected metastases at the time of surgery (Midgley and Kerr, 2000). This indicates that the metastatic process is already underway prior to surgical resection.

The detection of tumour cells in the circulation of cancer patients is not new. As early as 1869 Ashworth described a cancer case in which cells similar to those in the tumour were found in the blood after death (Ashworth, 1869; Ghossein and Bhattacharya, 2000). However inadequate detection strategies and conflicting reports on the significance of such cells hindered development in this field. In recent years many studies have used RT-PCR directed against epithelial specific antigens to detect circulating tumour cells (CTC). The field with respect to breast cancer has recently been reviewed by Ring et al,

(2004) with the potential clinical value being highlighted.

Cytokeratin 20 detected by RT-PCR is one of the most common approaches in colorectal cancer (Wyld et al, 1998; Wharton et al, 1999; Weitz et al, 1999; Hardingham et al, 2000); however the detection of this marker in some samples from healthy individuals questions the specificity (Wyld et al, 1998). Other authors have used RT-PCR against carcinoembryonic antigen (CEA) mRNA (Castells et al, 1998). This group also detected CEA mRNA in patients with inflammatory bowel disease suggesting the presence of circulating, non-neoplastic, colonic epithelial cells. Zippelius et al, (1997) state that the limiting factors in the detection of micrometastatic tumour cells by RT–PCR are ‘the illegitimate transcription of tumour associated or epithelial specific genes in haematopoietic cells and the deficient expression of the marker gene in micrometastatic tumour cells’.. Furthermore, there are problems with such PCR-based studies in that they do not necessarily prove the epithelial cells are either viable or malignant.

115

Loveday et al: Telomerase activity in circulating colorectal tumour cells Recently many authors have developed alternative methods for the detection of CTC. The method that has gained most popularity is the use of immunomagnetic separation technology. The epithelial cell specific antibody, BerEP4, is the most frequently chosen reagent to be coupled to magnetic beads (Soria et al, 1999; Hardingham et al, 2000; Gauthier et al, 2001). The cells collected after incubation with the antibody-conjugated magnetic beads after positive or negative selection strategies are removed for further analysis; in this case telomerase activity. Measuring telomerase activity has two principal advantages: firstly, with few exceptions, telomerase is a highly cancer-specific marker and secondly, only viable cells are detected as the assay requires active telomerase. Previous studies using magnetic beads have shown telomerase being detected in 15/17 (88%) of hepatocellular carcinoma patients (Tatsuma et al, 2000), 21/25 (84%) of metastatic breast cancer patients (Soria et al, 1999), 11/15 (73%) of stage IIIB or IV non-small cell lung cancer and 8/11 (72%) of Dukes stage C or D colon cancer patients (Gauthier et al, 2001). All of these studies have relied on a single blood sample. To date telomerase has not been detected by this method in any healthy normal controls.

The aim of this study therefore was to assess colorectal cancer patients for telomerase activity in CTC, both pre-operatively to assess possible use of this method as a prognostic tool, and post-operatively to identify how surgery affects the release of CTC.

1.Preparation of cell lysates Cells were thawed on ice, resuspended in 100µl Lysis buffer and incubated on ice for 30min. Cells were then centrifuged (13000g, 20min, 4°C), supernatants removed, and aliquoted prior to storage at -80°C. The protein concentration of lysates was determined using the Bio-Rad Protein Assay (Bio Rad Labs, Hemel Hempstead, UK) and all assays standardised to 0.2µg/µl.

2. PCR conditions As telomerase is an RNA dependent enzyme, negative controls were prepared by incubating 5µl lysate (1 µg protein) with 1µl RNAse (Sigma) for 20min at 37°C, then 10min at 65°C. For all samples a PCR master mix was prepared consisting of reaction mixture (25µl) and internal standard (IS; 5µl) per tube.

Cell lysate, RNAse-treated lysate or control template (3µl) was added to the relevant tubes and these were subjected to thermal cycling (Techne Progene, SLS, Nottingham, UK) according to the following protocol: Primer elongation 30min 25°C, telomerase inactivation 5min 94°C, amplification (30sec 94°C, 30sec 50°C, 90sec 72°C) x 30 cycles, 10min 72°C.

D. Hybridisation and ELISA Following PCR, two aliquots of amplification product (2.5µl) were denatured at room temperature for 10min with denaturation reagent (10µl). The denatured hybridisation products were then hybridised separately to one of two digoxigenin labelled detection probes either specific for telomeric repeats (hybridisation buffer T) or the internal standard (IS buffer), mixed briefly and then added to a streptavidin coated microtitre plate. The plate was covered and incubated at 37°C on a shaker (300rpm) for 2 hr. Hybridisation solutions were removed and the wells washed three times with Washing buffer.

Anti-DIG-HRP working solution (100µl) was added and incubated with shaking at room temperature for 30min. The solution was then removed and wells washed five times. TMB substrate (100µl) was added and incubated with shaking (300 rpm) at room temperature for approximately 10min (until colour development). Stop reagent (100µl) was added and the absorbance of samples measured (450nm - 690nm) on an Anthos plate reader (Lab Tech International, East Sussex, UK). The mean of the absorbance readings of the negative controls were subtracted from the absorbance readings of the samples. Samples were regarded as telomerase positive if the difference in absorbance was higher than the two-fold background activity as recommended by the manufacturer’s protocol.

In initial optimisation experiments analysis of a subset of both normal (n=5) and tumour (n=7) lysates were repeated 6 times to ensure the reproducibility and reliability of the assay, in subsequent experiments the analysis of all cell lysates was performed twice. PCR amplification and subsequent analysis of RNase pre-treated negative control lysates were performed at each analysis alongside experimental lysates, again to ensure the specificity of the assay.

II. Materials and Methods A. Blood samples Blood samples (10ml) were collected in Potassium/EDTA vacutainers from 35 patients undergoing surgery for primary colorectal cancer at Castle Hill Hospital, Hull, UK and 10 healthy age-matched normal controls. Samples were obtained from patients 1 day pre-operatively and 7 days post-operatively and all were processed within 2 hr of collection. Local Research Ethics Committee approval was granted and written consent obtained from all subjects.

B. Isolation of epithelial cells Blood samples were diluted with 10ml PBS, mixed gently and peripheral blood mononuclear cells (PBMC) obtained by standard Hypaque (Sigma, Poole, UK) differential centrifugation.

The PBMC were resuspended in 500µl PBS-1% v/v Bovine Serum Albumin (BSA) and 5x106 pre-washed immunomagnetic beads (Dynal, Merseyside, UK) covalently coated with the epithelial specific antibody BerEP4 (Dako, Cambridgeshire, UK) were added. The mixture was rotated at 4°C for 30min and the beads plus epithelial cells harvested using a magnet (Dynal). The cells were washed 3 times in PBS-0.1% BSA, resuspended in FBS with 10% v/v Dimethyl Sulphoxide and stored at –80°C overnight before transfer to liquid nitrogen for storage until assay.

E. Statistical analysis All statistical analyses were carried out using Fisher’s exact test (for differences between 2 variables) or Chi squared test (for 3 or more variables) utilising ArcusTM PRO-11.

C. Telomerase PCR ELISA

III. Results

Telomerase activity was assessed using the TeloTAGGG Telomerase PCR ELISA PLUSì kit (Roche, Sussex, UK), all reagents were supplied in the kit unless otherwise stated. The manufacturer’s protocol was followed throughout.

Patients were considered to have CTC if a positive telomerase result was obtained. The CTC status for each individual patient and their clinicopathological data are shown in Table 1. Telomerase was not detected in circulating epithelial cells from any of the healthy normal 116

Cancer Therapy Vol 2, page 117 Table 1: Detection of circulating tumour cells (CTC) in 35 colorectal cancer patients Patient

Age Sex Dukesâ&#x20AC;&#x2122; (years) stage 1 30 F A 2 76 F A 3 62 M A 4 66 M A 5 64 M A 6 69 F B 7 68 F B 8 63 F B 9 73 F B 10 66 F B 11 61 M B 12 66 M B 13 68 M B 14 65 M B 15 68 M B 16 61 M B 17 70 M B 18 80 F C 19 71 F C 20 64 F C 21 55 F C 22 78 F C 23 50 F C 24 70 M C 25 55 M C 26 81 M C 27 47 M C 28 55 M C 29 57 M D 30 54 M D 31 72 M D 32 61 M D 33 49 M D 34 80 M D 35 80 M D a (+/- denotes positive/negative status)

Tumour site Rectum Rectum Rectum Sigmoid Rectum Rectum Transverse Rectum Sigmoid Descending Sigmoid Rectum Sigmoid Sigmoid Sigmoid Sigmoid Sigmoid Rectum Sigmoid Rectum Rectum Sigmoid Sigmoid Sigmoid Rectum Rectum Rectum Rectum Rectum Rectum Sigmoid Sigmoid Rectum Transverse Sigmoid

Recurrence N N Y N N N N Y Y N Y N N N N N N N N N N Y Y N Y Y Y N Y Y Y Y Y Y Y

Follow-up (months) 29 27 26 21 21 29 28 9 24 21 26 24 20 16 25 19 25 27 25 26 25 18 27 25 26 28 26 23 6 25 20 20 5 7 20

CTC status Pre + + + + + + + + + + +

Post + + + + + + + + + + + + + + + + + + +

Table 2: Patients categorised according to CTC status Category 1 2 3 4

Patients (n) 13 11 8 3

CTC status Pre-operatively Negative Negative Positive Positive

controls. These were an age matched population and their consistent negativity demonstrates the reliability and reproducibility of the assay, as did the analysis in duplicate of all samples.

Each patient was placed into 1 of 4 categories (Table 2): category 1 patients were CTC negative at both samplings (n=13), category 2 patients were CTC negative pre-operatively but CTC positive post-operatively (n=11), category 3 patients were positive at both samplings (n=8) and category 4 patients were CTC positive pre-operatively

Post-operatively Negative Positive Positive Negative

but negative post-operatively (n=3).

CTC status was not found to correlate with Dukesâ&#x20AC;&#x2122; stage, recurrence, tumour location or survival. Gender was identified to be a significant factor in CTC status (Table 3). In comparing each CTC category between males and females, males were significantly more likely than females to be in category 2 (p=0.03) and females were significantly more likely to be in category 3 than males (p=0.03). Further analysis grouping categories 1 and 2 together, i.e. negative pre-operative categories) and 117

Loveday et al: Telomerase activity in circulating colorectal tumour cells Table 3: CTC status and gender Category 1 2 3 4 Total p= 3

Female 4 (31%1) 1 (9%) 6 (75%) 2 (67%) 13 NS

Male 9 (69%) 10 (91%) 2 (25%) 1 (33%) 22 0.001

Total 13 11 8 3 35

P= 2 NS 0.03 0.03 NS

The distribution of patients according to gender for each category is shown.

1 Indicates % of total patients in category which were female 2 Statistical analyses were performed between gender within each category 3 Statistical analyses were performed for each gender across category NS: Not Significant

categories 3 and 4 (positive pre-operative categories) revealed that females were significantly more likely to be CTC positive pre-operatively than males (p=0.007).

However, when the distribution in females alone was compared between each category there was no significant difference. In contrast when the distribution of males alone were compared between categories they were significantly more likely to be in category 1 or 2, i.e. CTC negative preoperatively, than category 3 or 4 (p=0.001).

Further analysis to investigate whether the gender of this cohort of patients was associated with age, Dukes stage, recurrence, tumour location or survival did not identify any correlation.

mesentery vessels by this technique but only 2 patients had tumour cells in the blood. These authors suggest that lymphogenic tumour cell dissemination is a very common and early event in colorectal cancer preceding hematogenous tumour cell dissemination, however it must be noted that RT-PCR is not specific for viable cells.

An interesting recent study by Nozawa et al (2003) assessed telomerase activity in blood samples from mesenteric (tumor-drainage) vein and peripheral vessels of 41 colon cancer patients in relation to liver metastases.

The authors identified high telomerase activity of mesenteric samples reflecting the existence of liver metastasis of colorectal cancer.

Many studies have shown that surgical manipulation can provoke cell dissemination (Van der Pompe et al, 1998; Weitz et al, 1998; Crisan et al, 2000) and this is supported by the 11 Category 2 patients patients who were CTC negative pre-operatively and CTC positive postoperatively. However, as statistical analysis of the results did not identify any significance between the presence of CTC and clinicopathological factors it indicates that CTC may not be an important prognostic factor in overall patient survival. This conclusion is supported by Bessa et al, (2003) who, using RT-PCR based methodology, concluded that postoperative detection of CTC had no prognostic significance in patients with colorectal cancer undergoing surgical resection with curative intent.

The observation that gender was a highly significant factor in relation to the presence of CTC with females generally being more likely to have CTC pre-operatively than males is an extremely interesting finding. This supports the idea that there may be differences in the biology of the same cancer between genders. Such an observation has been made by a number of other studies in colorectal and other cancers, and a number of hormones and other factors implicated to behave differently between genders. Aberrant hypermethylation of promoter CpG islands is an important mechanism for the inactivation of tumour suppressor genes and in gastric cancer, Kang et al, (2003) identified that male patients showed higher numbers of methylated genes than females. In colorectal cancer, a large study (n=867) revealed loss of hMLH1 expression is more likely (p<0.0001) to occur in females than males (Kakar et al, 2003). Similarly, studies of Apolipoprotein E gene polymorphism in 206 colorectal cancer patients and 353 healthy controls revealed a strong

IV. Discussion This study has described the highly specific detection of viable tumour cells in the peripheral blood of colorectal cancer patients in a technique demonstrated to be both reproducible and reliable. CTC were detected preoperatively in 11/35 (31%) of the patients. For 8 of these patients the CTC remain detectable at 7 days, however the remaining 3 patients were CTC negative indicating that live CTC were no longer present. 13/35 (37%) of the patients fell into Category 1 with CTC not being detected either pre or post-operatively. It may be expected that lower Dukes stage tumours would be less likely to have CTC. It is a reasonable assumption that the presence of CTC would be an indicative factor for the presence of metastases and consequently CTC would be more common in higher Dukes stage tumours. However, the present study demonstrates that the metastatic process is not this simple as the category 1 patients consisted of 1 Dukes A, 5 Dukes B, 3 Dukes C and 4 Dukes D patients.

The cancer biology of this category of tumours may intrinsically differ from tumours that are disseminated into the circulation. It is important to remember that this study only addresses the phenomenon of blood borne metastases as other studies have shown that lymphogenic tumour cell dissemination may be equally as important. Weitz et al, (1998) using Cytokeratin 20 mRNA RT-PCR studied 279 lymph node, blood and bone marrow samples from 20 colorectal cancer patients. A high proportion of patients with histopathologically tumour-free lymph nodes were found to have tumour cells in these nodes and/or the

118

Cancer Therapy Vol 2, page 119 association with both colorectal cancer risk and prognosis in a gender dependent manner (Watson et al, 2002).

In patient treatment, gender has also been implicated to be a predictive factor in response to treatment with 5Fluorouracil (Yamashita et al, 2002). The authors studied the expression of Dihydropyrimidine dehydrogenase (DPD), the initial rate limiting enzyme in the catabolism of 5-fluorouracil. DPD expression levels are believed to correlate with the 5-FU sensitivity of malignant tumours.

DPD expression was quantitated in 97 tumour specimens and 92 adjacent normal tissue specimens from 97 patients.

The DPD expression in the tumour tissues was significantly lower in females than males although in the normal tissues there was no significant difference between the genders. The authors conclude that CRC patients who will benefit most, because of lowered DPD expression, must be given priority and female gender is a predictive factor for a better response to chemotherapy with 5-FU. From this study it would appear that there is a factor(s) specific to males which means they are less likely to have CTC pre-operatively than females. Not only is the incidence of pre-operative CTC significantly less for males than females, but also when considering the male group alone, males are significantly more likely to be in a CTC negative pre-operative group. However it is important to remember that the group sizes are small and the study therefore needs to be expanded to fully elucidate such differences.

It is a very interesting phenomenon that the biology of cancer differs between genders and as evidence for such a difference accumulates it is becoming increasingly important to consider gender in future cancer studies. This is supported by a recent study by McArdle et al, (2003) who showed that following apparent curative resection for colorectal cancer and after adjusting for case-mix, male gender adversely affected 5-year survival. The data presented in our study supports the fact that gender differences must be considered when designing an individual patientâ&#x20AC;&#x2122;s treatment.

In conclusion, this study has demonstrated methodology to determine the presence of viable CTC in colorectal cancer patients. The ability to study the presence of viable CTC is of paramount importance in further understanding the metastatic process and this study has described a highly reproducible and reliable assay which may be applied to a wide range of cancer studies.

This methodology has previously been found valuable in studies of metastatic breast cancer patients (Soria et al, 1999), hepatocellular carcinoma patients (Tatsuma et al, 2000), non small cell lung carcinoma patients and Dukes stage C or D colon cancer patients (Gauthier et al, 2001).

For colorectal cancer patients the technique could have an important role to play, in conjunction with faecal occult blood testing and lower GI endoscopy, in the diagnosis of symptomatic patients. The technique may also be very valuable in monitoring patients during chemo- or radiotherapy.

The study has indicated that although the presence of CTC is not clinically significant in this cohort size they are strongly associated with gender. This association, implicating differences in the biology of colorectal cancer

between gender, should be assessed in other cancers and indicates an important new avenue for cancer research.

References Ashworth TR (1869) A case of cancer in which cells similar to those in the tumours were seen in the blood after death. Aust Med J 14, 146.

Bessa X, Pinol V, Castellvi-Bel S, Piazuelo E, Lacy AM, Elizzalde JI, Pique JM, Castells A (2003) Prognostic value of postoperative detection of blood circulating tumour cells in patients with colorectal cancer operated for cure. Clin Sci 104, 537-545.

Castells A, Boix L, Bessa X, Gargallo L, Pique JM (1998) Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction. Brit J Cancer 78, 1368-1372.

Crisan D, Ruark DS, Decker DA, Drevon AM, Dicarlo RG (2000) Detection of circulating epithelial cells after surgery for benign breast disease. Mol Diagnosis 5, 33-38.

Gauthier LR, Granotier C, Soria JC, Faivre S, Boige V, Raymond E, Boussin FD (2001) Detection of circulating carcinoma cells by telomerase activity. British J Cancer 84, 631-635.

Ghossein RA and Bhattacharya S (2000) Molecular detection and characterisation of circulating tumour cells and micrometastases in solid tumours. Eur J Cancer 36, 16821694.

Hardingham JE, Hewett PJ, Sage RE, Finch JL, Nuttall JD, Kotasek D, Dobrovic A (2000) Molecular detection of bloodborne epithelial cells in colorectal cancer patients and in patients with benign bowel disease. Int J Cancer 89, 8-13.

Kakar S, Burgart LJ, Thibodeau SN, Rabe KG, Petersen GM, Goldberg RM, Lindor NM (2003) Frequency of loss of hMLH1 expression in colorectal carcinoma increases with advancing age. Ann Surg 237, 368-375.

Kang GH, Lee HJ, Hwang KS et al (2003) Aberrant CpG island hypermethylation of chronic gastritis, in realtion to aging, gender, intestinal metaplasia, and chronic inflammation. Am J Pathol 163, 1551-1556.

McArdle CS, McMillan DC, Hole DJ (2003) Male gender adversely affects survival following surgery for colorectal cancer. Br J Surg 90,711-715.

Midgley R. and Kerr D (2000) Immunotherapy for colorectal cancer; a challenge to clinical trial design. Lancet Oncol 1, 159-168.

Nozawa H, Watanabe T, Ohnishi T, Tada T, Tsurita G, Sasaki S, Kitayam J, Nagawa H (2003) Detection of cancer cells in mesenteric vein and peripheral vessels by measuring telomerase activity in patients with colorectal cancer.

Surgery 134, 791_798.

Ring A, Smith IE, Dowsett M (2004) Circulating tumour cells in breast cancer. Lancet Oncology 50, 79-88.

Soria JC, Gauthier LR, Raymond E, Granotier C, Morat L, Armand JP, Boussin FD, Sabatier L (1999) Molecular detection of telomerase-positive circulating epithelial cells in metastatic breast cancer patients. Clin Cancer Res 5, 971975.

Tatsuma T, Goto S, Kitano S, Lin YC, Lee CM, Chen CL (2000) Telomerase activity in peripheral blood for diagnosis of hepatoma. J Gastroenterology and Hepatology 15, 10641070.

Van der Pompe G, Antoni MH, Heijnen CJ (1998) The effects of surgical stress and psychological stress on the immune function of operative cancer patients. Psychology and Health 13, 1015-1026.

Watson MA, Gay L, Stebbings WS, Speakman CT, Bingham SA,

119

Loveday et al: Telomerase activity in circulating colorectal tumour cells Loktionov A (2002) Apolipoprotein E gene polymorphism and colorectal cancer; gender-specific modulation of risk and prognosis. Cancer Lett 188, 231-236.

Weitz J, Kienle P, Lacroix J, Willeke F, Benner A, Lehnert T, Herfarth C, Doeberitz MV (1998) Dissemination of tumor cells in patients undergoing surgery for colorectal cancer.

Clin Can Res 4, 343-348.

Weitz J, Kienle P, Magener A, Koch M, Schrodel A, Willeke F, Autschbach F, Lacroix J, Lehnert T, Herfart C, Doeberitz MV (1999) Detection of disseminated colorectal cancer cells in lymph nodes, blood and bone marrow. Clin Cancer Res 5, 1830-1836.

Wharton RQ, Jones SK, Glover C, Khan ZAJ, Klokouzas A, Quinn H, Henry M, Allen-Mersh TG (1999) Increased detection of circulating tumor cells in the blood of colorectal carcinoma patients using two reverse transcription-PCR assays and multiple blood samples. Clin Cancer Res 5, 4158-4163.

Wyld DK, Selby P, Perren TJ, Jonas SK, Allen-Mersh TG(1998) Detection of colorectal cancer cells in peripheral blood by reverse-transcriptase polymerase chain reaction for cytokeratin 20. Int J Cancer 79, 288-293.

Yamashita K, Mikami Y, Ikeda M, Yamamura M, Kubozoe T, Urakami A, Yoshida K, Kimoto M, Tsunoda T (2002) Gender differences in the dihydropyrimidine dehydrogenase

expression of colorectal cancers. Cancer 95, 1834-1839.

Zippelius A, Kufer P, Honold G, Kollerman MW, Oberneder R, Schlimok G, Riethmuller G, Pantel K (1997) Limitations of reverse-transcriptase polymerase chain reaction analyses for detection of micrometastatic epithelial cancer cells in bone marrow. J Clin Oncol 15, 2701-2708.

Dr. John Greenman

120

Cancer Therapy Vol 2, page 121 Cancer Therapy Vol 2, 121-129, 2004

Antiangiogenesis in prostate cancer Review Article

Michael C. Cox1, Yinong Liu2, William D. Figg1,2 1

Clinical Pharmacology Research Core, Medical Oncology Clinical Research Unit and 2Molecular Pharmacology Section, Cancer Therapeutics Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892

__________________________________________________________________________________ *Correspondence: William D. Figg, PharmD, National Cancer Institute, 10 Center Dr, Bldg 10, Room 5A-01, Bethesda, Maryland 20892. Phone: (301)-402-3622, Fax: (301) 402-8606. Email: wdfigg@helix.nih.gov Key Words: Antiangiogenesis, prostate cancer, Abbreviations: 2-methoxyestradiol, (2ME); androgen independent prostate cancer, (AIPC); Cyclooxygenases, (COXs); luteinizinghormone-releasing hormone, (LHRH); Matrix metalloproteinases, (MMPs); multiple myeloma, (MM); National Cancer Institute, (NCI); prostate specific antigen, (PSA); prostatic intraepithelial neoplasia, (PIN); Recombinant humanized anti-VEGF, (RhuMAb VEGF); specific cyclin-dependent kinase, (cdk); Vascular endothelial growth factor, (VEGF) Received: 15 April 2004; Accepted: 26 April 2004; electronically published: May 2004

Summary Metastatic prostate cancer is the second leading cause of cancer related death. While androgen ablation is an effective initial modality, progression of disease is eventually occurred in majority patients. The benefit of chemotherapy in overall survival is still unclear. Angiogenesis plays a pivotal role for the growth, invasion, and metastasis of prostate cancer. Therefore, antiangiogenesis is a promising new therapeutic modality. Currently, there are more than 20 antiangiogenic agents in various stages of clinical trials. We will discuss current knowledge on controlling tumor angiogenesis and advances in the development of antiangiogenic agents with promising antitumor activity in prostate cancer. responses are generally short duration and have no documented survival benefit.

Chemotherapies have been extensively evaluated in patients with metastatic androgen independent prostate cancer (AIPC) since the 1970s. The initial studies showed low response rates and high toxicities. Recently, however, with the development of new agents targeting prostate cancer both on the cellular and molecular level, promising results have been emerged. The agents, including docetaxel, mitoxantrone, estramustine, vinblastine and etoposide, either as a single agent or as a combination therapy, have showed benefit in clinical response, pain control, and/or quality of life, with estramustine/docetaxel combination showing the most promise (Beedassy et al, 1999; Oh, 2000). However, the benefit in overall survival is still unknown. Therefore, new therapeutic modalities are needed to prevent progression from early-stage to advanced metastatic disease and to improve survival outcomes in patients with advanced APIC.

I. Introduction Prostate cancer is the most common malignancy in American men and the second leading cause of cancer related deaths (29,900 deaths estimated in 2004) (Rini et al, 2001; Jemal et al, 2004). It has been estimated that approximately 20% of men will be diagnosed with prostate cancer. Since the advent of prostate specific antigen (PSA) screening, most patients are found with localized disease. While prostatectomy or radiation treatment is the standard therapy for early-stage prostate cancer, 30-40% of patients will develop recurrent and/or metastatic disease. Androgen ablation with either surgical orchiectomy or the use of luteinizing-hormone-releasing hormone (LHRH) agonists with or without antiandrogens is an effective initial modality for advanced metastatic disease (Figg et al, 1997; Rini et al, 2001). Although a majority of patients with advanced metastatic prostate cancer respond to hormonal therapy for a median of 18-36 months, disease eventually progresses in most patients (Figg et al, 1997; Crawford et al, 1989). The utilization of second line hormonal agents such as corticosteroids, ketoconazole, megestrol acetate, and bicalutamide is generally associated with low response rates in this setting (Goktas et al, 1999; Klotz, 2000). Furthermore, such

II. Regulation of angiogenesis Angiogenesis is the formation of new blood vessels from the pre-existing vascular bed. It is normally suppressed and is activated only transiently during

121

Cox et al: Antiangiogenesis in prostate cancer menstrual cycles and wound healing process (Folkman, 2001). Uncontrolled angiogenesis also occurs in rheumatoid arthritis, diabetic retinopathy, as well as neoplastic process. Angiogenesis is a very complicated process requiring extensive interactions between cells, cytokines, and extracellular matrix components (Folkman, 2001; Liekens et al, 2001). Angiogenic vessel growth is normally regulated by a balance of endogenous stimulators and inhibitors (Table 1). The angiogenesis regulators are primarily peptide growth factors, proteinases, or cell adhesion molecules. During angiogenesis, the cooperation and interaction of these regulators leads to endothelial cell proliferation, migration, invasion of the basement membrane, differentiation and capillary-tube formation.

Vascular endothelial growth factor (VEGF) plays a key role in normal and abnormal angiogenesis since it stimulates almost every step in the angiogenesic process (Folkman, 2001; Liekens et al, 2001). Other factors that have been shown to stimulate angiogenesis include acidic and basic fibroblast growth factor, angiogenin, angiopoietin, E-selectrin, fibroblast growth factor-4, hepatocyte growth factor/scatter factor, interleukin-8, placental growth factor, platelet-derived endothelial cell growth factor, platelet-derived growth factor, pleiotropin, proliferin, tumor necrosis factor-! and transforming growth factor-!,". These endogenous angiogenic stimulators induce new blood vessel formation by either acting on endothelial cells or activating a broad range of other target cells and cell-cell interactions. Endogenous angiogenesis inhibitors include angiostatin, endostatin, thrombospondin-1,-2, antithrombin III, fibronectin, and many others (Table 1). The function of these inhibitors is to suppress new vessel formation or to turn off the transient process during physiological angiogenesis.

because these materials ordinarily serve as a supportive matrix and a barrier to endothelial cell migration (Liekens et al, 2001). This process is usually accomplished by the proteolytic activity with different enzymes. Matrix metalloproteinases (MMPs), a family of zinc- and calcium-containing proteolytic enzymes, are the most important enzymes in maintaining extracellular matrix tissue homeostasis and initiating new blood vessel formation (Wojtowicz-Praga et al, 1996; Brown, 1997).

MMPs are secreted as precursor zymogens and activated in the extracellular matrix. More than a dozen MMPs have been identified, with MMP2 and MMP9 being particularly important in primary and metastatic tumor growth. These are critical factors in basement membrane degradation to facilitate invasion of malignant cells and angiogenesis (Brown, 1996; Nemeth et al, 2002). Studies have demonstrated that excessive MMP activity and/or overexpression occur in colorectal, lung, gastric, malignant glioblastoma, prostate and many other solid tumors (Curran et al, 1999; Liekens et al, 2001). It also has been shown that there is a good correlation between the level of MMPs and the aggressiveness of the tumors (Parsons et al, 1997).

IV. Angiogenesis and prostate cancer Angiogenesis plays a pivotal role for the growth, invasion, and metastasis of solid malignant tumors (Folkman, 1990). Since a growing tumor requires an extensive capillary network to provide nutrients, a tumor will not grow beyond a few cubic millimeters without the development of new vessels. These newly formed vessels also provide a disseminating and metastatic route for cancer cells. In 1971, Folkman first proposed that tumor growth and metastasis are an angiogenesis-dependent processes and that inhibition of angiogenesis can be a novel anticancer strategy (Folkman, 1971). This hypothesis has been confirmed by a large body of preclinical and clinical evidence. To initiate new vessel formation, a tumor must acquire an angiogenic phenotype.

III. Matrix metalloproteinase and angiogenesis Angiogenesis ultimately is the culmination of a cascade of many events. Before new blood vessels form, the basement membrane and matrix must be broken down

Table 1. Some of the most well-known endogenous regulators of angiogenesis Angiogenesis Stimulators Acidic fibroblast growth factor Angiogenin Angiopoietin Basic fibroblast growth factor E-Selectrin Fibroblast growth factor (FGF)-4 Hepatocyte growth factor/scatter factor Interleukin-8 Placental growth factor Platelet-derived endothelial cell growth factor Platelet-derived growth factor (PDGF) Pleiotropin Proliferin (TGF)-!," Tumor necrosis factor (TNF)-!

Vascular endothelial growth factor (VEGF)

Angiogenesis Inhibitors Angiostatin Antithrombin III (fragment) Canstatin Endostatin Fibronectin Interferon ! and " Maspin Pigment epithelium derived factor (PEDF) Platelet factor-4 (fragment) Prolactin (fragment) Thrombospondin-1, 2 Tumstatin Vascular endothelial growth inhibitor Transforming growth factor Vasostatin

122

Cancer Therapy Vol 2, page 123 in early phases of clinical trials, a few of them appear to be clinically effective (Figg et al, 2001a; Liekens et al, 2001; Ellis et al, 2002; Giles, 2002). Antiangiogenic therapy has advantages over conventional chemotherapy, such as ease of access of drugs to the endothelial cells. Because endothelial cells in a tumor are usually genetically stable, drug resistance is less like to develop with antiangiogenesis therapy. Furthermore, side effects of antiangiogenic agents should be negligible since angiogenesis in adults is restricted. However, because antiangiogenic agents usually simply halt tumor expansion, it is unlikely that angiogenesis inhibitors will work with the same rapidity as cytotoxic agents. In addition, since maximal formation of new blood vessels occurs when minimal tumor burden is present, the best opportunity for antiangiogenic agents to have a therapeutic impact is when there is minimal tumor burden.

Minimizing tumor burden can be achieved with concurrent with radiation therapy, hormonal therapy and/or chemotherapy.

The following sections discuss recent advances in the development of antiangiogenic agents that have shown promising antitumor activity in patients with prostate cancer.

Once changed to an angiogenic phenotype, the tumor becomes vascularized and can start to grow exponentially.

The transformation to an angiogenic phenotype depends on a net imbalance of positive and negative angiogenic factors in tumor cells (10). New capillary formation can result from the overproduction of stimulators and/or downregulation of negative modulators. Importantly, data from animal as well as human tissue studies suggest that the acquisition of angiogenic phenotype occurs early in tumor development. For instance, Brem et al, (1978) reported that angiogenic activity is significantly higher in transplanted hyperplastic breast tissues compared with normal breast counterparts in a rabbit model.

Prostate cancer, like other solid tumors, is also angiogenesis dependent. The development of prostate cancer is a multi-step process, advancing from high-grade prostatic intraepithelial neoplasia (PIN) to focal carcinoma, then to invasive carcinoma, and finally to metastatic disease. It is therefore important to target the molecular events that accompany progression of each step.

Studies have demonstrated that the expression of angiogenesis stimulating factors such as VEGF, PDGF, and TGF in prostate carcinoma is increased (Bostwick et al, 1998; Jones et al, 1999; Lissbrant et al, 2001).

Moreover, it has been shown that there is a progressive increase in angiogenesis as prostate cancer advances through various pathologic stages. Siegal et al reported that microvessel density (MVD) was higher in prostate cancer tissue than in adjacent hyperplastic or benign tissue (Siegal et al, 1995). Also, tumor specimens from patients with clinical prostate cancer have been found to have a remarkably high degree of vascularization compared with autopsy-identified prostate tumors from men without clinical disease (Wakui et al, 1992). Furthermore, studies have demonstrated that the intensity of angiogenesis as measured by MVD is a useful prognostic indicator in prostate cancer. Weidner et al showed that the mean microvessel count among patients with metastatic disease was 76.8 microvessels/field, as compared with 39.2 microvessels/field for those without metastases (P<0.0001) (Weidner et al, 1993). Taken together, these reports indicate that angiogenesis measurement in prostate cancer can be used in predicting both the potential for development of metastatic disease and patient outcome.

A. Thalidomide and its analog Thalidomide, a glutamic acid derivative, is a potent teratogen that causes dysmelia (stunted limb growth) in humans (Stirling, 2001). It was marketed in Europe as a nonbarbiturate sedative but was withdrawn 30 years ago because of its teratogenic effects. It has been postulated that thalidomide-induced limb defects were secondary to an inhibition of blood vessel growth in the developing fetal limb bugs. In 1994, Dâ&#x20AC;&#x2122;Amato et al demonstrated that thalidomide inhibited bFGF-induced angiogenesis (Dâ&#x20AC;&#x2122;Amato, 1994). Bauer et al subsequently determined that a metabolite of thalidomide was responsible for this antiangiogenic activity (Bauer et al, 1998). Thalidomide was later shown to inhibit the growth of V2 carcinoma and Lewis lung carcinoma in animal models by antiangiogenic mechanisms.

These preclinical findings led to clinical testing of thalidomide as an anticancer drug. In recently years, thalidomide has been shown to produce clinical activity in patients with multiple myeloma (MM), glioblastoma multiforme, and prostate cancer (Figg et al, 2001a,b; Stirling, 2001). In our phase II trial conducted at the National Cancer Institute (NCI), 63 metastatic AIPC patients who were heavily pretreated with hormonal and/or chemotherapy were treated with thalidomide. Twentyseven percent of patients achieved a PSA response (Figg et al, 2001a), and the inhibition of PSA was associated with an improvement of clinical symptoms in majority cases.

However, there was no apparent correlation between microvessel counts in pretreatment tissue biopsies and responses to thalidomide in this clinical trial. Similarly, a clear correlation between VEGF and bFGF expression and responses could not be made via assessment of pretreatment biopsy specimens.

V. Antiangiogenesis The inhibition of angiogenesis, or antiangiogenesis is a promising new therapeutic anticancer modality.

Currently, there are more than 20 antiangiogenic agents in various stages of phase I, II, and III clinical trials, and the list of drugs is growing. These agents act at the different steps of the angiogenesis regulatory pathway, and lead to modulation of the process and inhibition of tumor growth (Ellis et al, 2002; Giles 2002). Mechanistically, angiogenesis inhibitors can be subdivided into antagonists of angiogenic stimulators such as VEGF and their receptors, inhibitors of endothelial cell proliferation and/or survival, blockers of extracellular matrix degradation (MMP inhibitors), and drugs with undefined mechanisms (Table 2). Even though most of antiangiogenic agents are 123

Cox et al: Antiangiogenesis in prostate cancer Table 2. Angiogenesis inhibitors in prostate cancer.

Drug

Mode of action

Sponsor

Phase

Results

Anti-VEGF ABX CC-5013 Celecoxib Marimastat

Anti-VEGF # TNF-!

COX2-I MMP-I

NCI, Genetech Celgene Pharmacia British Biotech

II in AIPC patients I in solid tumor (including prostate cancer) Phase I trial I in stage III/IV

No effects Pending Pending Decrease the rate of rise of PSA 2-ME ?

EntreMed I in solid tumor (including prostate cancer) Pending Prinomastat MMP-I Agouron III in AIPC patients with mitoxantrone/prednisone.No benefit SU6416 Anti-VEGF SUGEN II in AIPC patients No effects Thalidomide multiple Celgene II in AIPC with or without docetexel Promising proposed Phase III in D0 patients Pending TNP-470 CDK-I TAP I in solid tumor (including prostate cancer) No effects VEGF = vascular endothelial growth factor; TNF-! = tissue necrosis factor-!; COX2-I = cyclooxygenase-2 inhibitor; MMP-I = matrix metalloproteinase inhibitor; CDK-I = cyclin dependent kinase inhibitor

In another recent phase II trial of weekly docetaxel with thalidomide in 75 patients with metastatic AIPC (Figg et al, 2001b), 50% of patients receiving docetaxel/thalidomide and 35% of those receiving docetaxel alone had a PSA decrease of at least 50%. While the median overall survival and 18-month survival in docetaxel group were 15.9 months and 47.2%, respectively, the 18-month survival in combination group was 69.3%, and the median overall survival has not been reached in this group (Dahut et al, 2004). This result strongly suggests that the combination of a cytotoxic agent with an angiogenesis inhibitor is a promising area of investigation for prostate cancer management.

Thalidomide was well tolerated in vast majority of patients. Constipation, dizziness, edema, fatigue and rebound insomnolence after coming off study were the most common side effects. Thrombotic events occurred in the thalidomide/docetaxel combination treatment that can be prevented by prophylactic low molecular weight heparin (Horne et al, 2003).

Thalidomide is now undergoing many clinical trials for the treatment of a wide variety of tumors. At the NCI, a double-blinded randomized phase III study of thalidomide versus placebo in patients with stage D0 androgen dependent prostate cancer was recently initiated.

The goal of this study is to determine if thalidomide can improve the efficacy of the LHRH agonist in hormoneresponsive patients with a rising PSA after primary definitive therapy (surgery or radiation) for prostate cancer.

CC-5013, !-(3-aminophthalimido) glutarimide, is an analogue of thalidomide. In vitro studies have shown that CC-5013 is more potent than thalidomide in inhibiting TNF-! production and MM cell proliferation (Celgene Corporation, Inc, unpublished data). In the rat aortic ring angiogenesis assay, CC-5013 demonstrated a potent inhibitory effect on microvessel outgrowth (Figg et al, 2002). In vivo, CC-5013 showed the inhibitory effects on growth of MM cell line (HS-Sultan). Furthermore, according to preliminary non-clinical and clinical studies conducted to date, CC-5013 appears to lack the sedative and teratogenic activity of thalidomide.

In two phase I studies in MM, a total of 39 patients with relapsed or refractory disease have been treated with CC-5013. Patients received doses ranging from 5 mg to 50 mg daily of CC-5013. It was well tolerated with principal side effects being bone marrow suppression, myalgia, fatigue, headache, constipation, diarrhea, ringing in ears, lightheadedness, and mild elevated LFT and creatinine. In one study conducted at the University of Arkansas, myeloma response was seen at the higher dosages of CC5013. Four of 15 patients had a greater than 25% reduction (1 patient > 75%) in paraprotein level. Ten of 14 evaluable patients treated at the Dana Farber Cancer Center responded to the drug, including 3 patients with > 50% and 7 patients with 25-50% reduction in paraprotein level.

At the NCI, a phase I trial of CC-5013 is currently conducting in patients with solid tumors, including metastatic AIPC, to further study its clinical antitumor activity.

B. Matrix metalloproteinase inhibitors (MMPs) In recently years, several MMPs inhibitors, such as batimastat, marimastat, prinomastat, and COL-3, have been developed as anticancer drugs and are being actively evaluated in preclinical studies and ongoing clinical trials (Nemunaitis et al, 1998; Macaulay et al, 1999; Heath et al, 2001; Rudek et al, 2001; Ahmann et al, 2002). Batimastat is almost completely insoluble, and consequently, has a very poor bioavailability with oral route. Therefore, the clinical usage of batimastat is limited.

Marimastat has a broad-spectrum inhibitory activity against most of the major MMPs; including MMP2 and MMP9 (Nemunaitis et al, 1998). Marimastat is almost completely absorbed after oral administration with a halflife of approximately 15 hours. It has been evaluated extensively in clinical trials in different solid tumors with promising activity in patients with pancreatic and colorectal cancer. A total of 88 patients with advanced metastatic prostate cancer were evaluated in 6 phase I trials. Marimastat was administrated orally for 4 weeks.

The therapeutic response was measured by decrease in the rate of rise of serum PSA. In these studies Marimastat was 124

Cancer Therapy Vol 2, page 125 demonstrated to reduce the rate of rise of serum PSA in a dose-dependent manner (Nemunaitis et al 1998 However, the significance in the change of the PSA slope is unclear.

Marimastat has been well tolerated. The principal side effect was dose-related joint pain and stiffness.

Prinomastat is a selective inhibitor of MMP2/MMP3/MMP9. It has been demonstrated that prinomastat inhibits the growth of PC-3 cells in an animal model (Shalinsky et al, 1999). Prinomastat was well tolerated with principal side effect being mild musculoskeletal toxicity in early clinical trials. In a recent phase III trial, 406 patients with chemotherapy-naive AIPC were randomized into mitoxantrone/prednisone with or without prinomastat. No significant difference in PSA response rate, progression-free survival, or overall survival in two groups was observed (Ahmann et al, 2002). While this result showed no benefit by addition of prinomastat to chemotherapy in AIPC, it does not preclude the use of Prinomastat in the treatment of early stage of prostate cancer.

Alendronate, a bisphosphonate and an inhibitor of osteoclastic bone resorption, has been shown to decrease MMP2 and MMP9 secretion in animal models (39). Also, recent studies demonstrated that bisphosphonates have antitumor effect in vivo animal systems and promoting apoptosis of tumor cells in vitro (Diel et al, 1998; Powles et al, 1998). Stearns et al evaluated the combination of alendronate and paclitaxol on human PC3ML cell bone metastases in SCID mice (Stearns et al, 1996). The pretreatment of SCID mice with alendronate partially blocked the establishment of bone metastases by PC3ML cells and resulted in tumor formation in the peritoneum and other soft tissues. When used separately, alendronate and paclitaxel partially inhibited MMP2 production, but the combination totally blocked protease production and release. Based on these preclinical results, the NCI recently completed a randomized phase II trial of ketoconazole (KT) and alendronate (AL) versus KT in 72 patients with progressive AIPC metastatic to bone. The proportion of patients with a > 50% decline in PSA was similar in the 2 groups (47.2% in KT/AL group vs 44.4% in KT group). However, there was a strong trend toward a prolonged duration of response in KT/AL group compared to ketoconazole group (median, 8.9months vs 6.3 months, respective; p=0.055), and more patients in KT/AL group have not progressed (Liu et al, 2002). This result suggests that alendronate, a potential antiangiogenic agent, improves duration of response in patients with AIPC treated with ketoconazole.

profound weight loss in animal studies. Therefore, several synthetic analogues were developed, and among these, TNP-470 has shown the least toxicity with the greatest antiangiogenic activity (Ingber et al 1990; Kusaka et al, 1991). In vitro studies revealed that TNP-470 inhibited endothelial cell proliferation in a very low concentration (Kusaka et al, 1994). In vivo, TNP-470 has been demonstrated to be a potent antiangiogenic agent in the chick chorioallantoic assay, rat corneal micropocket assay, and in the rat blood vessel organ culture assay (Ingber et al, 1990; Kusaka et al, 1991; Kruger et al, 2000).

Furthermore, TNP-470 inhibited the growth of Lewis lung carcinoma, B16 melanoma, and other tumors in animal models (Ingber et al, 1990; Kusaka et al, 1991; Oâ&#x20AC;&#x2122;Reilly et al, 1995). The molecular target of TNP-470 appears to involve transcription inhibition of specific cyclindependent kinase (cdk) and cyclin gene family members (Koyama et al, 1996). It might also inhibit cdc2 and cdk2 kinase activation in endothelial cells (Kato et al, 1994).

Several phase I studies of TNP-470 have been completed in patients with Kaposiâ&#x20AC;&#x2122;s sarcoma, renal cell carcinoma, brain cancer, breast cancer, cervical cancer and prostate cancer (Figg et al, 1997; Bhargava et al, 1999; Stadler et al, 1999; Logothetis et al, 2001). These phase I trials often showed that TNP-470 resulted in minor objective responses and was well tolerated. The major dose-limiting toxicities were reversible neurotoxicities, including fatigue, asthenia, nystagmus, diplopia, ataxia, depression and loss of concentration. Interestingly, although antitumor activity was not documented in patients with AIPC, TNP-470 caused a transient increase of serum PSA. It was subsequently found that TNP-470 enhances PSA transcription in vitro culture systems (Horti er al, 1999).

D. 2-methoxyestradiol 2-methoxyestradiol (2ME) is a natural metabolite of the endogenous estrogens estradiol-17" and 17ethynylestradiol (Seegers et al, 1989). In contrast to most estrogens, 2-ME has been shown in preclinical studies to be potentially efficacious in the treatment of cancer. In vitro, 2ME has potent antiproliferative activity in many human cancer cell lines, including Hela cells, Jurkat leukemia cells, and neuroblastoma cells (Seegers et al, 1989, Cushman et al, 1995, and Nakagawa-Yagi et al, 1996). Human breast cancer cell lines are particular sensitive to the cytotoxic effect of 2-ME irrespective of the estrogen receptor status. In vivo, 2-ME has potent activity in primary and metastatic tumor models. Its activity was evident in xenograft models derived from a non-estrogendependent human breast tumor cell line (MDA MB-435), MethA sarcoma, B16 melanoma, neuroblastoma, and myeloma (Fotsis et al, 1994, Klauber et al, 1997; Arbiser et al, 1999; Schumacher et al, 2001).

The mechanism of action of 2-ME has not yet been determined, but studies have shown that 2-ME has a potent inhibitory effect on the proliferation of blood-vessel endothelial cells in vitro (Fotsis et al, 1994). Additional studies have demonstrated that 2-ME causes apoptosis in cultured arterial endothelial cells and inhibits the

C. TNP-470 TNP-470, a semi-synthetic derivative of fumagillin, was one of the first antiangiogenic compounds to undergo clinical testing (Kruger et al, 2000). Fumagillin is an antibiotic secreted by Aspergillus fumigatus fresenius (Ingber et al, 1990). It was subsequently found that fumagillin is a very potent inhibitor of endothelial cell proliferation in vitro and tumor-induced angiogenesis in vivo (Ingber et al, 1990; Kruger et al, 2000). However, the clinical utility of fumagillin was limited because it caused 125

Cox et al: Antiangiogenesis in prostate cancer migration of these vascular endothelial cells (Yue et al, 1997). In vivo, 2-ME has been shown to be a potent antiangiogenic agent in tumor vasculature studies and many other models (Fotsis et al, 1994, Klauber et al, 1994; Zhu et al, 1998). A phase I clinical trial of 2-ME in metastatic breast cancer patients was recently initiated (Miller et al, 2001). To date 2-ME has been well tolerated, and no dose-limiting toxicity noted. 2-ME treatment did not alter hormonal status in these patients. Ten out fifteen patients had stable disease. At the NCI, we are currently conducting a phase I trial of 2-ME in patients with solid tumors, including metastatic AIPC, to further explore its clinical benefit, biological as well as molecular activities.

trials.

A. Cyclooxygenases inhibitors Prostaglandins and their derivatives are signaling lipophilic molecules that regulate many physiologic processes including the inflammatory response, platelet aggression, clot formation, and gastric cyto-protection (Dang et al, 2002). Cyclooxygenases (COXs) are key enzymes in the conversion of arachidonic acid to prostagladins. There are two isoforms of the COXs. COX1 is a constitutive enzyme that is present in most normal tissues and is responsible for local prostaglandin synthesis.

In contrast, COX-2 is an inducible form that is normally only expressed at a low level in some tissues, such as brain and kidney. COX-2 synthesis is induced by a variety of stimuli, including inflammatory cytokines, growth factors, oncogenes (HER2/neu and Src), tumor promoters and carcinogens (Kosaka et al, 1994; Vadlamudi et al, 1999; Dang et al, 2002). Studies showed that excessive COX-2 overexpression occurs in colorectal, lung, gastric, breast, prostate and many other solid tumors (Eberhart et al, 1994; Ristimaki et al, 1997; Hida et al, 1998; Hwang et al, 1998; Gupta et al, 2000; Dang et al, 2002). Also, accumulating evidence suggests that elevated prostaglandin expression is associated with tumor growth, metastatic potential and recurrence in a variety spectrum of tumor types. Uotila et al showed that the expression of COX-2 in prostate cancer cells is higher compared with normal glandular epithelial of control prostates (Uotila et al, 2001). Although the mechanism is unclear, overexpression of COX-2 may affect different steps in the process of carcinogenesis, such as immune regulation, cell invasion and proliferation, or apoptosis. Recently, studies demonstrated that there is a strong link between COX-2 expression and hypoxiainduced tumor angiogenesis (Liu et al, 1998). Therefore, COX-2 overexpression may increase tumor blood supply and contribute to tumor growth.

In prostate cancer, studies have shown that COX-2 inhibitors could induce apoptosis in prostate cancer cells in vitro (Liu et al, 1998). In addition, Celecoxib, an elective COX-2 inhibitor, has been shown to be a potent antitumor and a chemoprevention agent in a DMBAinduced rat mammary tumor model (Alshafie et al, 2000).

Furthermore, Kirschenbaum et al reported that the COX-2 inhibitors decrease MVD and angiogenesis in prostate cancer tumor models (Liu et al, 2000). Based upon these preclinical observations, COX-2 inhibitors, the potential antiangiogenesis agents, have been tested as chemoprevention as well as treatment modalities. Several clinical trials reported that Celecoxib and other NSAIDs have chemoprevention effects on intestinal adenomas in patients with familial adenomatous polyposis (FAP) (Waddell, et al, 1983, Hawk et al, 1999; Steinbach et al, 2000). Currently, exisulind, a COX-1/COX-2 inhibitor, is being evaluated in phase I/II trials in prostate cancer patients, either as a single agent or in combination with docetaxel. Also, a neoadjuvant trial is currently conducting in prostate cancer, in which patients are randomized to receive either celecoxib or placebo prior to radical prostatectomy. The results of these trials will help to

VI. VEGF antibody and inhibitors VEGF and its receptors play a pivotal role in the regulation of angiogenesis (Folkman et al, 2001 and Liekens, 2001). Therefore, inhibition of VEGF and /or its receptor activity can have a potential benefit in cancer treatment. Recombinant humanized anti-VEGF (RhuMAb VEGF, bevacizumab, Avastin (Genetech)) is a monoclonal IgG antibody. In vivo animal models, it has potent antiVEGF activity, and suppresses the growth of a broad spectrum of human cancer cell lines (Kim et al, 1993; Warren et al, 1995; Mordenti et al, 1999). Several phase I trials showed that bevacizumab was well tolerated with minimal toxicity. A phase II trial of bevacizumab was conducted in patients with AIPC (Bok et al, 1999).

Bevacizumab showed no significant effects on PSA or clinical benefits. Therefore, further studies of this antibody likely will focus on early stage disease, adjuvant treatment, or in combination with other treatment modalities. Dr. Picus reported that a phase II trial combining docetaxel, estramustine and bevacizumab resulted in 79% of patients having a > 50% decrease in PSA and 42% had a partial response. Survival and disease progression have not yet been assessed. (Picus, 2004) Cetuximab (IMC-C225, anti-EGFR MAb, Erbitux (Imclone, Bristol-Meyers Squibb Oncology)) was studied alone and in combination with paclitaxel in a murine model. Cetuximab alone and in combination significantly decreased growth of the PC-3M-LN4, in vivo. A decreased serum concentration of interleukin-8 as well as a decrease in MVD, and tumor cell proliferation and an enhanced of apoptosis were all enhanced by coadministration of paclitaxel (Karahima, 2002).

Semaxanib (SU5416) is a potent VEGF receptor inhibitor. It inhibits VEGF-mediated FLK1 signaling and endothelial cell proliferation in vitro culture systems (Millauer et al, 1993). In vivo, SU5416 has been demonstrated to inhibit the growth of several type of tumors in animal models (millauer et al, 1996). SU5416 has been tested in phase I studies, in combination with androgen ablation and radiation therapy, and in a phase II study with dexamethasone combination in patients with AIPC. Dose-limiting toxicities in phase I studies consisted headache, fatigue, change in voice, nausea and vomiting, as well as allergic reactions (Cropp et al, 1999). Although SU5416 had promising results in preclinical models, it was withdrawn recently due to its lack of efficacy in clinical

126

Cancer Therapy Vol 2, page 127 Bostwick DG, Iczkowski KA (1998). Microvessel assay in prostate cancer: prognostic and therapeutic utility. Semin Urol Oncol 16, 118-23.

Brem SS, Jensen HM, Gullino PM (1978). Angiogenesis as a marker of preneoplastic lesions of the human breast. Cancer 41, 239-44.

Brown PD (1997). Matrix metalloproteinase inhibitors in the treatment of cancer. Med Oncol 14, 1-10.

Crawford ED, Eisenberger MA, McCleod DG, et al (1989). A controlled trial of leuprolide with and without flutamide in prostate carcinoma. N Engl J Med 321, 419-24.

Cropp G, Hannah A, Kabbinavar F, et al (1999). Phase I doseescalating trial of SU5416, a novel angiogenesis inhibitor in patients with advanced malignancies. Pros ASCO 18, 618.

Curran S, Murray GI (1999). Matrix metalloproteinases in tumour invasion and metastasis. J Pathol 189, 300-8.

Cushman M, He HM, Katzenellenbogen JA, et al (1995).

Synthesis, antitubulin and antimitotic activity, and cytotoxicity of analogs of 2-methoxyestradiol, an endogenous mammalian metabolite of estradiol that inhibits tubulin polymerization by binding to the colchicine binding site. J Med Chem 38, 2041-9.

D'Amato RJ, Loughnan MS, Flynn E, et al (1994). Thalidomide is an inhibitor of angiogenesis. Proc Natl Acad Sci U S A 91, 4082-5.

Dahut WL, Gulley JL, Arlen PM, Liu Y, et al. (2004) A randomized phase II trial of docetaxel plus thalidomide in androgen-independent prostate cancer. J Clin Oncol. In press.

Dang CT, Shapiro CL, Hudis CA (2002). Potential role of selective COX-2 inhibitors in cancer management. Oncology 16, 30-36.

Diel IJ, Solomayer EF, Costa SD, et al (1998). Reduction in new metastases in breast cancer with adjuvant clodronate treatment. N Engl J Med 339, 357-63.

Eberhart CE, Coffey RJ, Radhika A, et al (1994). Up-regulation of cyclooxygenase 2 gene expression in human colorectal adenomas and adenocarcinomas. Gastroenterology 107, 1183-8.

Ellis LM, Liu W, Fan F, et al (2002). Synopsis of angiogenesis inhibitors in oncology. Oncology 16, 14-22.

Figg WD, Feuer J, Bauer KS (1997). Management of hormonesensative metastatic prostate cancer. Cancer Practice 5, 258263.

Figg WD, Pluda JM, Lush RM, et al (1997). The pharmacokinetics of TNP-470, a new angiogenesis inhibitor.

Pharmacotherapy 17, 91-7.

Figg WD, Dahut W, Duray P, et al (2001). A randomized phase II trial of thalidomide, an angiogenesis inhibitor, in patients with androgen-independent prostate cancer. Clin Cancer Res 7, 1888-93.

Figg WD, Arlen P, Gulley J, et al (2001). A randomized phase II trial of docetaxel (taxotere) plus thalidomide in androgenindependent prostate cancer. Semin Oncol 28(4S15), 62-6.

Figg WD, Kruger EA, Price DK, et al (2002). Inhibition of angiogenesis: treatment options for patients with metastatic prostate cancer. Invest New Drugs 20, 183-94.

Folkman J (1971). Tumor angiogenesis: therapeutic implications.

N Engl J Med 285, 1182-6.

Folkman J (1990). What is the evidence that tumors are angiogenesis dependent? J Natl Cancer Inst. 82, 4-6.

Folkman J (2001). Angiogenesis-dependent diseases. Semin Oncol 28: 36-42.

Fotsis T, Zhang Y, Pepper MS, et al (1994). The endogenous oestrogen metabolite 2-methoxyoestradiol inhibits angiogenesis and suppresses tumour growth. Nature 368, 237-9.

Giles FJ (2002). The emerging role of angiogenesis inhibitors in

determine the future role of COX-2 inhibitors in the treatment and chemoprevention of prostate cancer.

VII. Conclusion Antiangiogenesis, a new treatment and prevention strategy in patients with prostate cancer and other tumors, is being developed as either monotherapy or a combination therapy. While preclinical models appeared very promising, with the exception of a few agents, early clinical studies of angiogenesis inhibitors in patients with prostate cancer exhibited disappointed results. Most clinical studies reported that no complete angiosuppression or clinical benefit can be obtained.

However, it is too early to conclude that they are ineffective since they have been used only in late stage metastatic prostate cancer. In addition, lack of effectiveness is these trials is not surprising since multiple steps and a variety of factors required for angiogenesis, and by inhibiting one factor is insufficient. Therefore, it is possible that synergistic anti-tumor effects can be obtained by targeting of multiple points in the angiogenic cascade, or by combining angiogenesis inhibitors with radiation therapy, hormonal ablation or cytotoxic therapies. It is expected that within the next decade, these combinations will provide new modalities in the treatment of prostate cancer.

Acknowledgements This work is supported by the intramural program of the National Cancer Institute.

This is a US government work. There are no restrictions on its use.

References Ahmann, FR, Saad F, Mercier R, et al (2002). Interim results of a phase III study of the matrix metalloprotease inhibotr Prinomastat in patients having metastatic, hormone refractory prostate cancer (HRPC). Proc Am Soc Clin Oncol; abstract 692.

Alshafie GA, Abou-Issa HM, Seibert K, et al (2000).

Chemotherapeutic evaluation of Celecoxib, a cyclooxygenase-2 inhibitor, in a rat mammary tumor model.

Oncol Rep 7,1377-81.

Arbiser JL, Panigrathy D, Klauber N, et al (1999). The antiangiogenic agents TNP-470 and 2-methoxyestradiol inhibit the growth of angiosarcoma in mice. J Am Acad Dermatol 40, 925-9.

Bauer KS, Dixon SC, Figg WD (1998). Inhibition of angiogenesis by thalidomide requires metabolic activation, which is species-dependent. Biochem Pharmacol 55, 182734.

Beedassy A, Cardi G (1999). Chemotherapy in advanced prostate cancer. Semin Oncol 26, 428-38.

Bhargava P, Marshall JL, Rizvi N, et al (1999). A phase I and pharmacokinetic study of TNP-470 administered weekly to patients with advanced cancer. Clin Cancer Res 5, 1989-95.

Bok R, Corry M, Frohlich M, et al (1999). A phase II trial of humanized monoclonal anti-vascular endothelial growth factor antibody (rhuMAb VEGF) in hormone refractory prostate cancer (HRPC). Proc Am Soc Clin Oncol 18, 351a.

127

Cox et al: Antiangiogenesis in prostate cancer hematologic malignancies. Oncology 16, 22-29.

Goktas S, Crawford ED (1999). Optimal hormonal therapy for advanced prostatic carcinoma. Semin Oncol 26, 162-73.

Kusaka M, Sudo K, Fujita T, et al (1991). Potent anti-angiogenic action of AGM-1470: comparison to the fumagillin parent.

Biochem Biophys Res Commun 174:1070-6.

Kusaka M, Sudo K, Matsutani E, et al (1994). Cytostatic inhibition of endothelial cell growth by the angiogenesis inhibitor TNP-470 (AGM-1470). Br J Cancer 69, 212-6.

Liekens S, De Clercq E, Neyts J (2001). Angiogenesis: regulators and clinical applications. Biochem Pharmacol 61, 253-70.

Lissbrant IF, Lissbrant E, Damber J, et al (2001). Blood vessels are regulators of growth, diagnostic markers and therapeutic targets in prostate cancer. Scan J Urol Nephrol 35, 437-52.

Liu XH, Yao S, Kirschenbaum A, et al (1998). NS398, a selective cyclooxygenase-2 inhibitor, induces apoptosis and down-regulates bcl-2 expression in LNCaP cells.

Cancer Res 58, 4245-9.

Liu XH, Kirschenbaum A, Yao S, et al (1999). Upregulation of vascular endothelial growth factor by cobalt chloridesimulated hypoxia is mediated by persistent induction of cyclooxygenase-2 in a metastatic human prostate cancer cell line. Clin Exp Metastasis 17, 687-94.

Liu XH, Kirschenbaum A, Yao S, et al (2000). Inhibition of cyclooxygenase-2 suppresses angiogenesis and the growth of prostate cancer in vivo. J Urol 164, 820-5.

Liu Y, Figg WD, Arlen P, et al (2002). A randomized phase II trial of ketoconazole (KT) and alendronate (AL) versus ketoconazole in androgen independent prostate cancer (AIPC). Proc the third North American symposium on skeletal complications of malignancy. Abstract D4.

Logothetis CJ, Wu KK, Finn LD, et al (2001). Phase I trial of the angiogenesis inhibitor TNP-470 for progressive androgenindependent prostate cancer. Clin Cancer Res 7, 1198-203.

Macaulay VM, O'Byrne KJ, Saunders MP, et al (1999). Phase I study of intrapleural batimastat (BB-94), a matrix metalloproteinase inhibitor, in the treatment of malignant pleural effusions. Clin Cancer Res 5:513-20.

Millauer B, Wizigmann-Voos S, Schnurch H, et al (1993). High affinity VEGF binding and developmental expression suggest Flk-1 as a major regulator of vasculogenesis and angiogenesis.

Cell 72, 835-46.

Millauer B, Longhi MP, Plate KH, et al (1996). Dominantnegative inhibition of Flk-1 suppresses the growth of many tumor types in vivo. Cancer Res 56, 1615-20.

Miller KD, Haney LG, Pribluda VS, et al (2001). A phase I safety, pharmacokinetic and pharmacodynamic study of 2methoxyestradiol (2ME2) in patients (Pts) with refractory metastatic breast cancer (MBC). Proc Am Soc Clin Oncol 20, Abstract 170.

Mordenti J, Thomsen K, Licko V, et al (1997). Efficacy and concentration-response of murine anti-VEGF monoclonal antibody in tumor-bearing mice and extrapolation to humans.

Toxicol Pathol 27, 14-21.

Nakagawa-Yagi Y, Ogane N, Inoki Y, et al (1996). The endogenous estrogen metabolite 2-methoxyestradiol induces apoptotic neuronal cell death in vitro. Life Sci 58, 1461-7.

Nemeth JA, Yousif R, Herzog M, et al (2002). Matrix metalloproteinase activity, bone matrix turnover, and tumor cell proliferation in prostate cancer bone metastasis. J Natl Cancer Inst 94, 17-25.

Nemunaitis J, Poole C, Primrose J, et al (1998). Combined analysis of studies of the effects of the matrix metalloproteinase inhibitor marimastat on serum tumor markers in advanced cancer: selection of a biologically active and tolerable dose for longer-term studies. Clin Cancer Res 4, 1101-1109.

Oh WK (2000). Chemotherapy for patients with advanced prostate carcinoma: a new option for therapy. Cancer 88, 3015-21.

Gupta S, Srivastava M, Ahmad N, et al (2000). Over-expression of cyclooxygenase-2 in human prostate adenocarcinoma.

Prostate 42, 73-8.

Hawk E, Lubet R, Limburg P (1999). Chemoprevention in hereditary colorectal cancer syndromes. Cancer 86, 2551-63.

Heath EI, O'Reilly S, Humphrey R, et al (2001). Phase I trial of the matrix metalloproteinase inhibitor BAY12-9566 in patients with advanced solid tumors. Cancer Chemother Pharmacol 48, 269-74.

Hida T, Yatabe Y, Achiwa H, et al (1998). Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res 58, 3761-4.

Horne ME 3rd, Figg WD, Arlen P, et al (2003). Increased frequency of venous thromboembolism with the combination of docetaxel and thalidomide in patients with metastatic androgen-independent prostate cancer. Pharmacotherapy 23, 315-8.

Horti J, Dixon SC, Logothetis CJ, et al (1999). Increased transcriptional activity of prostate-specific antigen in the presence of TNP-470, an angiogenesis inhibitor. Br J Cancer 79, 1588-93.

Hwang D, Scollard D, Byrne J, et al (1998). Expression of cyclooxygenase-1 and cyclooxygenase-2 in human breast cancer. J Natl Cancer Inst 90:455-60.

Ingber D, Fujita T, Kishimoto S, et al (1990). Synthetic analogues of fumagillin that inhibit angiogenesis and suppress tumour growth. Nature 348, 555-7.

Jemal A, Thomas A, Murray T, et al (2004). Cancer statistics, 2004. CA Cancer J Clin 54, 8-29.

Jones A, Fujiyama C (1999). Angiogenesis in urological malignancy: prognostic indicator and therapeutic target. BJU Int 83, 535-55.

Karashima T, Sweeney P, Slaton, JW et al (2002). Inhibition of angiogenesis by the antiepidermal growth factor receptor antibody ImClone C225 in androgen-independent prostate cancer growing orthotopically in nude mice. Clin Cancer Res 8. 1253-1264.

Kato T, Sato K, Kakinuma H, et al (1994). Enhanced suppression of tumor growth by combination of angiogenesis inhibitor O(chloroacetyl-carbamoyl)fumagillol (TNP-470) and cytotoxic agents in mice. Cancer Res 54, 5143-7.

Kim KJ, Li B, Winer J, at al (1993). Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362, 841-4.

Klauber N, Parangi S, Flynn E, et al (1997). Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and taxol. Cancer Res 57(1), 81-6.

Klotz L (2000). Hormone therapy for patients with prostate carcinoma. Cancer 88: 3009-14.

Kosaka T, Miyata A, Ihara H, et al (1994). Characterization of the human gene (PTGS2) encoding prostaglandinendoperoxide synthase 2. Eur J Biochem 221, 889-97.

Koyama H, Nishizawa Y, Hosoi M, et al (1996). The fumagillin analogue TNP-470 inhibits DNA synthesis of vascular smooth muscle cells stimulated by platelet-derived growth factor and insulin-like growth factor-I. Possible involvement of cyclin-dependent kinase 2. Circ Res 79, 757-64.

Kruger EA, Figg WD (2000). TNP-470: an angiogenesis inhibitor in clinical development for cancer. Expert Opin Investig Drugs 9, 1383-96.

128

Cancer Therapy Vol 2, page 129 O'Reilly MS, Brem H, Folkman J (1995). Treatment of murine hemangioendotheliomas with the angiogenesis inhibitor AGM-1470. J Pediatr Surg 30:325-9.

Parsons SL, Watson SA, Brown PD, et al (1997). Matrix metalloproteinases. Br J Surg 84, 160-6.

Picus J (2004). Docetaxel/bevacizumab (Avastin) in prostate cancer. Chemotherapy Foundation Symposium XXI, 2004, New York City. Cancer Investigation 22 (In press).

Archieved on-line at www.mssm.edu/ctf (Accessed April 2, 2004).

Powles TJ, McCloskey E, Paterson AH, et al (1998). Oral clodronate and reduction in loss of bone mineral density in women with operable primary breast cancer. J Natl Cancer Inst 90, 704-8.

Rini BI, Small EJ (2001). An update on prostate cancer. Curr Opin Oncol 13, 204-11.

Ristimaki A, Honkanen N, Jankala H, et al (1997). Expression of cyclooxygenase-2 in human gastric carcinoma. Cancer Res 57, 1276-80.

Rudek MA, Figg WD, Dyer V, et al (2001). Phase I clinical trial of oral COL-3, a matrix metalloproteinase inhibitor, in patients with refractory metastatic cancer. J Clin Oncol 19, 584-92.

Schumacher G, Neuhaus P (2001). The physiological estrogen metabolite 2-methoxyestradiol reduces tumor growth and induces apoptosis in human solid tumors. J Cancer Res Clin Oncol 127(7), 405-10.

Seegers JC, Aveling LM, Can Aswegen CH, et al (1989). The cytotoxic effects of estradiol-17 beta, catecholestradiols and methoxyestradiols on dividing MCF-7 and HeLa cells. J Steroid Biochem 32, 797-809.

Shalinsky DR, Brekken J, Zou H, et al (1999). Broad antitumor and antiangiogenic activities of AG3340, a potent and selective MMP inhibitor undergoing advanced oncology clinical trials. Ann N Y Acad Sci 878:236-70.

Siegal JA, Yu E, Brawer MK (1995). Topography of neovascularity in human prostate carcinoma. Cancer 75, 2545-51.

Stadler WM, Kuzel T, Shapiro C, et al (1999). Multi-institutional study of the angiogenesis inhibitor TNP-470 in metastatic renal carcinoma. J Clin Oncol 17, 2541-5.

Stearns ME, Wang M (1996). Effects of alendronate and taxol on PC-3 ML cell bone metastases in SCID mice. Invasion

Metastasis 16, 116-31.

Stearns ME, Wang M (1998). Alendronate blocks metalloproteinase secretion and bone collagen I release by PC-3 ML cells in SCID mice. Clin Exp Metastasis 16, 693702.

Steinbach G, Lynch PM, Phillips RK, et al (2000). The effect of celecoxib, a cyclooxygenase-2 inhibitor, in familial adenomatous polyposis. N Engl J Med 342, 1946-52.

Stirling D (2001). Thalidomide: a novel template for anticancer drugs. Semin Oncol 28, 602-6.

Uotila P, Valve E, Martikainen P, et al (2001). Increased expression of cyclooxygenase-2 and nitric oxide synthase-2 in human prostate cancer. Urol Res 29, 23-8.

Vadlamudi R, Mandal M, Adam L, et al (1999). Regulation of cyclooxygenase-2 pathway by HER2 receptor. Oncogene 18, 305-14.

Waddell WR, Loughry RW ( 1983). Sulindac for polyposis of the colon. J Surg Oncol 24, 83-7.

Wakui S, Furusato M, Itoh T, et al (1992). Tumour angiogenesis in prostatic carcinoma with and without bone marrow metastasis: a morphometric study. J Pathol 168, 257-62.

Warren RS, Yuan H, Matli MR, et al (1995). Regulation by vascular endothelial growth factor of human colon cancer tumorigenesis in a mouse model of experimental liver metastasis.

J Clin Invest 95, 1789-97.

Weidner N, Carroll PR, Flax J, et al (1993). Tumor angiogenesis correlates with metastasis in invasive prostate carcinoma.

Am J Pathol 143, 401-9.

Wojtowicz-Praga S, Low J, Marshall J, et al (1996). Phase I trial of a novel matrix metalloproteinase inhibitor batimistat (BB94) in patients with advanced cancer. Invest New Drug 14, 193-202.

Yue TL, Wang X, Louden CS, et al (1997). 2-Methoxyestradiol, an endogenous estrogen metabolite, induces apoptosis in endothelial cells and inhibits angiogenesis: possible role for stress-activated protein kinase signaling pathway and Fas expression. Mol Pharmacol 51(6), 951-62.

Zhu BT, Conney AH (1998). Is 2-methoxyestradiol an endogenous estrogen metabolite that inhibits mammary carcinogenesis? Cancer Res 58(11), 2269-77.

129

Cox et al: Antiangiogenesis in prostate cancer

130

Cancer Therapy Vol 2, page 131 Cancer Therapy Vol 2, 131-148, 2004

TNF and cancer: good or bad?

Review Article

Ashita Waterston and Mark Bower* Department of Oncology, The Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, UK

__________________________________________________________________________________ *Correspondence: Dr Mark Bower PhD FRCP, Department of Oncology, The Chelsea and Westminster Hospital, 369 Fulham Road, London SW10 9NH, United Kingdom; Tel 011 44 208 237 5054; Fax 011 44 208 746 8863; E mail m.bower@imperial.ac.uk Key Words: TNF, cancer, Apoptosis, Activation, anti-cancer therapy, gene polymorphism, carcinogenesis, neovascularisation, angiogenesis, extra cellular matrix, vasculature, lymphatics Abbreviations: bacillus Calmette-GuĂŠrin, (BCG); basal cell carcinoma, (BCC); cervical intraepithelial neoplasia, (CIN); containing recombinant human TNF, (rhTNF); Death receptor 3, (DR3); epidermal growth factor, (EGF); germinal centres kinase, (GCK); IkB kinase, (IKK); inducible nitric oxide synthase, (iNOS); MAPK activate protein kinase, (MAPKAP); MAPK kinases, (MKK); matrix metalloproteinases, (MMP); monoclonal antibody, (mAb); TNF converting enzyme, (TACE); natural killer, (NK); osteoprotegerin, (OPG); reactive oxygen species, (ROS); Tissue inhibitors of MMP, (TIMP); TNF receptor associated Death domain protein,, (TRADD) Received: 27 April 2004; Accepted: 4 May 2004; electronically published: May 2004

Summary Tumour necrosis factor (TNF) is a pro inflammatory cytokine whose role is established in the pathogenesis of chronic inflammatory diseases such as rheumatoid arthritis and Crohnâ&#x20AC;&#x2122;s disease. It is a 17KD molecule that exists as a trimer, dimer and monomer in equilibrium and as a membrane bound 26KD molecule. It binds to two receptors the 55KD and 75KD proteins. These receptors on binding aggregate and set up a number of signal transducing mechanisms that lead to cell apoptosis or gene upregulation. The latter often occurs via the MAPKinase and NF!B pathways. TNF in large amounts can induce haemorraghic necrosis of tumours. This anticancer effect is multi-factorial as TNF can cause vascular necrosis, a direct apoptotic effect on the cells and also free radical induced cell death. A number of studies have examined the anticancer effects of TNF in combination with other cytokines or chemotherapy agents. However the only use of TNF alone in clinical trials has been in limb perfusion studies for sarcoma and melanoma. More recently, TNF has been found to have a pro-cancerous effect. In a mouse skin model TNF induces carcinogenesis. Furthermore, gene polymorphisms that increase or decrease TNF production confer either an increased risk or protective effect on a number of different cancers and precancerous diseases including gastric cancer, lymphoma and cervical cancer as well as cervical intraepithelial neoplasia.

Moreover, in murine models TNF promotes metastasis, tumour angiogenesis and cachexia. Trials with anti-TNF therapies are awaited to see the effects of blocking this cytokine in patients with cancer.

However the role of TNF in cancer is less clear with both anti-cancer and pro-cancerous effects.

I. Introduction TNF was initially identified in two laboratories and alternatively named cachectin, for the wasting effect induced in mice (Beutler et al, 1985), and tumour necrosis factor, because it caused haemorrhagic necrosis of various murine tumours in vivo (Carswell et al, 1975). TNF has been identified as a key mediator in the pathogenesis of both acute and chronic diseases. Successful strategies have been developed to block its action in animal models of shock (Beutler et al, 1985; Tracey et al, 1987), collagen induced arthritis (Thorbecke et al, 1992; Williams et al, 1992) and experimental autoimmune encephalomyelitis (Baker et al, 1994). Anti-TNF monoclonal antibody (mAb) therapy in human clinical trials has had success in some but not all diseases. (Elliot et al, 1994, Abraham et al, 1995, D'Haens et al, 1999, 2001; Lipsky et al, 2000). AntiTNF mAbs are licensed in the USA and Europe for the treatment of rheumatoid arthritis and Crohn's disease.

A. TNF structure TNF is found as a 26kd membrane bound molecule which, when cleaved by the TNF converting enzyme (TACE), forms soluble TNF consisting of the 76 aminoterminal residues with a molecular weight of 17kd (Black et al, 1997). Under native conditions bound and soluble TNF exist as a monomer, dimer and trimer in equilibrium, with the trimer being the biologically active form. TNF belongs to the TNF superfamily, which includes Lymphotoxin " and #, Fas ligand, CD40 ligand, and two apoptosis inducing ligands, TRAIL/Apo-2 ligand (Wiley et al, 1995; Pitti et al, 1996) and LIGHT, which is also involved in T cell activation (Mauri et al, 1998; Zhai et al, 1998). These proteins are all ligands for the TNF receptor superfamily.

131

Waterston and Bower: TNF and cancer: good or bad? of TNF and enhancing clearance by the kidneys (Olsson et al, 1989; Porteu and Nathan, 1990; Bemelmans et al, 1993).

B. TNF receptors TNF binds with high affinity to two cell surface receptors, a 55kd protein (p55TNF-R) and a 75kd protein (p75TNF-R), both are expressed by most cell lines and primary tissues. However, the level of receptor expression varies with cell type. The p55TNF-R expression is dominant on most cells, except for haemopoetic cells, and is relatively constant, while the p75TNF-R expression fluctuates. The binding of trimeric TNF to membrane anchored receptors causes cross-linking and aggregation of the homologous receptors. The cytoplasmic portion of the receptors interacts with signal transducing molecules initiating down stream intracellular signalling events. It is thought that p55TNF-R is the major signal transducer of soluble TNF responses, due to the abundance and binding avidity of this receptor; while p75TNF-R is preferentially activated by membrane bound TNF (Grell et al, 1995).

Both receptors belong to the TNF receptor superfamily, which include among others Fas, CD40, (Smith et al, 1994), the Death receptor 3 (DR3) (Chinnaiyan et al, 1996), the TRAIL receptors DR4 (Pan et al, 1997b), DR5 (Pan et al, 1997a), TRID (Sheridan et al, 1997), the LIGHT receptor TR2/HVEM (Kwon et al, 1997; Montgomery et al, 1996) and osteoprotegerin (OPG) which inhibits osteoclastic bone resorption (Simonet et al, 1997). All these receptors are membrane glycoproteins with sequence homology in the extra-cellular cysteine rich region. The p75TNF-R expression is controlled by extra cellular stimuli acting at the transcriptional and posttranscriptional level (Brockhaus et al, 1990; Thoma et al, 1990), and by receptor shedding. The extra cellular portion of both the p55 and p75 TNF receptors can be cleaved and released into serum as soluble forms. Soluble TNF receptors bind to soluble TNF, inhibiting systemic effects

C. TNF function The major sources of TNF are macrophages and to a lesser extent T lymphocytes, proliferating B cells, natural killer (NK) cells, mast cells and stimulated neutrophils (Gemlo et al, 1988; Sung et al, 1988; Djeu et al, 1990; Dubravec et al, 1990; Gordon and Gallis, 1990; Kinkhabwala et al, 1990; English et al, 1991; Stein and Gordan, 1991). Non-immune cells such as keratinocytes, smooth muscle cells, astrocytes and microglial cells have all been shown to produce TNF upon LPS stimulation in vitro (Sawada et al, 1989; Warner and Libby, 1989; Kock et al, 1990). TNF is a pleiotropic cytokine, which acts on a large variety of cells with wide ranging effects on individual cells (Table 1). Amongst the haemopoetic actions of TNF, are the activation of macrophages/monocytes (Trinchieri et al, 1986; Drapier et al, 1987; Kirchheimaer et al, 1988; Wang et al, 1990), lymphocytes (Jerlinek and Lipsky, 1987; Scheurich et al, 1987; Yokota et al, 1988), neutrophils (Schleiffenbaum and Fehr, 1990) and the promotion of coagulation (Lentz et al, 1991). It has a dual role in NK cells depending on the target cell. A subset of NK cells, lacking CD16, undergo TNF-induced apoptosis (Jewett et al, 1997), while IL-2 with TNF causes activation and increases NK cytolytic function (Ostensen et al, 1987). TNF induces bone resorption, important in bone metastasis formation (Bertolini et al, 1986; Johnson et al, 1989) and inhibits adipocyte proliferation which may contribute to cachexia (Kawakami et al, 1989).

Table 1. A list of TNF target cells TARGET CELL ACTION Macrophages/ Activation, differentiation, chemotaxis Monocytes Neutrophils T lymphocytes

Activation, chemotaxis Proliferation, activation

B Lymphocytes NK and LAK lymphocytes Endothelial cells Adipocytes Myocytes Fibroblasts Cartilage

Proliferation, differentiation, activation Proliferation, activation, apoptosis Promotes clotting, haemopoetic growth factors and cytokine production Inhibition Inhibition Proliferation, cytokine production Inhibits proteoglycan synthesis, resorption

Osteoclasts

Activation

Oligodendrocytes Astrocytes Keratinocytes

Cytotoxic Proliferation Differentiation, inhibits proliferation, cytokine production

132

REFERENCE (Trinchieri et al, 1986; Drapier et al, 1987; Kirchheimaer et al, 1988; Wang et al, 1990) (Schleiffenbaum and Fehr, 1990) (Scheurich et al, 1987; Yokota et al, 1988) (Jerlinek and Lipsky, 1987) (Ostensen et al, 1987, Jewett et al, 1997) (Seelentag et al, 1987; Gimbrone et al, 1989; Osborn, 1990) (Kawakami et al, 1989) (Miller et al, 1988) (Butler et al, 1988) (Saklatvala et al, 1985; Saklatvala, 1986;) (Bertolini et al, 1986; Johnson et al, 1989) (Selmaj et al, 1990) (Selmaj et al, 1990) (Nickoloff et al, 1991)

Cancer Therapy Vol 2, page 133 TNF has multiple effects on endothelial cells in vitro, such as promoting cytokine production that increases angiogenesis in vivo (Yoshida et al, 1997). TNF promotes the pro-inflammatory cascade, by inducing the release of pro-inflammatory cytokines such as the chemokine IL-8 (Gimbrone et al, 1989; Schroder et al, 1990; Nickoloff et al, 1991), IL-6 (Jirik et al, 1989), Gro" (Dong et al, 1999), haemopoetic growth factors including G-CSF (Seelentag et al, 1987) and adhesion molecules such as VCAM important in metastasis (Osborn, 1990).

TNF also induces increased matrix metalloproteinase expression in a number of cell types and integrin expression. As shown by TNF knockout mice studies, this cytokine is necessary for normal splenic organisation in foetal growth (Keffer et al, 1991). In general, TNF exerts a similar range of effects as IL-1, except that it is able to induce apoptosis (Wallach et al, 1998) and is less efficient in inducing cartilage resorption (Saklatvala, 1986; Saklatvala et al, 1985). The cellular effects of TNF occur through binding to its receptor, which leads to secondary signalling events. These signalling events cause either apoptosis or gene regulation.

2. Activation TNF proliferative and stimulatory responses occur by induction of a number of genes such as other cytokines as well as cell cycling mechanisms. For this to occur the ligation and aggregation of p55TNF-R recruits TRADD and RIP, as previously described. However, TRADD and RIP can also act via alternative signalling pathways by recruiting TRAFs. To date six TRAF molecules have been identified that all have a conserved C terminal proteinprotein interacting domain known as the TRAF domain, which interacts with members of the TNF-R superfamily (Hu et al, 1994; Rothe et al, 1994; Cheng et al, 1995; Mosialos et al, 1995; Regnier et al, 1995; Sato et al, 1995; Cao et al, 1996; Ishida et al, 1996; Nakano et al, 1996).

TRAF 1, 2, 5 and 6 activate the NF-!B and JNK pathways, and TRAF 1 and 2 are associated with TNF signalling (Rothe et al, 1995; Song et al, 1997). TRAF 2 recruits TRAF 1, which then interacts with MAPK (Mitogen Activated Phosphorylation Kinase) pathways, proteins belonging to the MAPKKK superfamily that phosphorylates I!B kinase (IKK). This kinase then degrades cytoplasmic I-!B (Regnier et al, 1997), which releases NF-!B to translocate into the nucleus. This prevents apoptosis and activates other cellular responses.

TRAF 2 is recruited directly via the p75TNF-R to activate the NF-!B and JNK pathways, explaining the overlapping actions of both receptors (Natoli et al, 1998). The best studied of the signalling pathways is the MAPKinase pathway (Figure 2). It involves a signalling cascade, which upon TRAF 2 recruitment, leads to phosphorylation of a serine/threonine kinase known as MAPK kinase kinase (MKKK). The process by which TRAF 2 leads to activation of MKKKs remains unclear but may involve small Gâ&#x20AC;&#x201C;proteins and further MKKKs. The MKKKs in turn phosphorylate other serine/threonine kinases known as MAPK kinases (MKK). There are a number of MKKs activated by cytokines and other environmental factors.

The TNF receptor is thought to activate MKK3 leading to p38 MAPK phosphorylation (Winston et al, 1997). Other kinases such as ASK 1 and MEKK, a MKKK, may also phophorylate MKK3, although they have been implicated to have a major role in the phosphorylation of p54 MAPK (JNK/SAPK) (Nishitoh et al, 1998; Yujiri et al, 1998). p38 MAPK phosphorylates targets downstream that affect the transcription factor ATF2 and cytosolic proteins cPLA2 and Hsp27. cPLA2 and MAPK activate protein kinase (MAPKAP), another cytosolic protein, along with the transcription factor Elk1 can also be activated by TNF via p42/44 MAPK (ERK). In murine macrophages this involves phosphorylation of MEKK (Winston et al, 1997) and in HL-60 and Cos cells this involves cRaf1 (Berra et al, 1995; Yao et al, 1995). Upon TNF receptor ligation, TRAF2 can also activate p54 MAPK, via a number of pathways involving ASK1, that in turn activates MKK7 (Ichijo et al, 1997) or MEKK-1 that interacts with germinal centres kinase (GCK), a MAP4K (Shi and Kehrl, 1997). p54 MAPK activation can also occur via the tyrosine protein kinase Pyk2 and the small G proteins PAK, Rac and cdc42 (Tokiwa et al, 1996).

D. TNF receptor signalling 1. Apoptosis In recent years, there has been significant progress in unravelling the TNF cell signalling pathways following receptor ligation, although this complex area is still under investigation (Figure 1). Upon TNF binding and aggregation of p55TNF-R, a portion of the intracellular domain of the receptor, known as the death domain, binds to an intracellular signalling moiety TRADD (TNF receptor associated Death domain protein) (Hsu et al, 1995). The death domains consist of six-amphipathic "helices, in an anti-parallel arrangement that can interact with other death domains. TRADD, in turn, through its own death domain-like region interacts with MORT 1/FADD (Varfolomeev et al, 1997), RIP and RAIDD, sequentially. This complex then recruits caspases 8 and 10, which belong to a family of enzymes essential in apoptosis (Boldin et al, 1996; Muzio et al, 1996). Caspase 2 is also recruited by the p55TNF-R via its N-terminal recruitment domain CARD that interacts with the CARD domain on RAIDD/CRADD using the RIP-RAIDD axis instead of MORT-1/FADD, to induce apoptosis (Ahmad et al, 1997; Duan and Dixit, 1997). The caspase cascade leads to the cleavage and disruption of proteins such as ICAD, which acts as an inhibitor of CAD, a DNAse that degrades nuclear DNA into fragments characteristic of apoptosis (Enari et al, 1998). Apoptosis, however, only occurs when a cell is stressed, for example, by exposure to UV radiation or a protein /RNAse synthesis inhibitor, such as actinomycin D. Normally apoptosis is prevented from occurring through the recruitment of TRAF molecules (TNF receptor associated factor) (Rothe et al, 1995; Kelliher et al, 1998). The recruitment of TRAF molecules

by TNF leads to up-regulation of genes and cellular activation.

133

Waterston and Bower: TNF and cancer: good or bad?

Figure 1. TNF signalling through the p75 and p55 TNF receptor. This is a simplified diagram to show the main components of TNF signalling through its aggregated receptors.

This process can either lead to apoptosis via the death effecter molecules, such as TRADD, and the caspases or cell activation via the TRAF molecules to protein kinases such as MAPK and NF!B..

Figure 2. Schematic diagram to show the anti-cancer effects of TNF. TNF causes haemorrhagic necrosis in vivo with destruction of tumour vasculature and ischaemia. It also promotes tumour lysis by activating the anti-tumour immune response and can lead to direct tumour lysis via hydroxyl radicals and lysosomal enzymes.

TNF can act synergistically with variety of other agents such as cytokines, chemotherapy and hyperthermia to induce tumour killing.

134

Cancer Therapy Vol 2, page 135 In summary, TNF on receptor ligation leads to activation of TRAF molecules which causes phosphorylation of a cascade of serine threonine kinases known as the MAP kinases pathway leading to activation of a number of cytosolic proteins which eventually lead to activation of transcription molecules and gene regulation.

perforin, while the infusion of recombinant TNF in the knockout mice restored TNF induced cytotoxicity by these cells, similar to wild type mice. In vivo the TNF knockout mice were unable to reject MC57X syngeneic fibrosarcomas but did so if injected with recombinant TNF. Clearly, this shows, both in vitro and in vivo, TNF is required for NK and LAK induced tumour killing and tumour rejection in vivo (Baxevanis et al, 2000). It is likely that the NK cells themselves produce TNF along with FasL and other cytokines to induce apoptosis of tumours (Kashii et al, 1999). CTL tumour elimination and immunity also appears to be TNF dependant. In a Lewis lung carcinoma model (A9) injection of tumour cells containing a CD8 T cell epitope transgene GP33 leads to tumour elimination. This immunity was also perforin, IFN$ and TNF dependant, providing evidence for the crucial role of TNF in CD8 directed tumour elimination in vivo (Prevost-Blondel et al, 2000). Conversely, tumours grown in T cell deficient mice had impaired tumour eradication, therefore, to achieve complete TNF-induced intra tumoural haemorrhagic necrosis an adequate host T cell immunity is required (Havell et al, 1988). Dendritic cells also have a potent anti-tumour effect against breast cancer cells in vitro, which is mediated by TNF and blocked by the addition of anti-TNF monoclonal antibodies (Manna and Mohanakumar, 2002).

Furthermore, immature dendritic cells induced apoptosis of tumour cells by TNF, FasL, lymphotoxin # and TRAIL through the corresponding death receptors in a range of cancer cells (Lu et al, 2002).

Finally, TNF can have a direct effect on the tumour cells. Using inhibitors to lysozymal enzymes, hydroxyl radicals and mitochondrial respiratory inhibitors Watanabe et al found that there was a reduction in TNF induced tumour death. This study indicates that for TNF induced cell destruction, lysozymal enzymes, hydroxyl radicals and ATP may be needed (Watanabe et al, 1988b). TNF also leads to tumour cell death by inducing cytochrome c release from mitochondria and mitochondrial membrane permeabilisation leading to apoptosis (Partheniou et al, 2001). One of the mechanisms tumours use to generate a growth advantage is reducing TNF induced apoptosis through mutations in p53. Mutations in p53 were found to reduce caspase 8 activation and mitochondrial membrane permeabilisation and infection with adenovirus containing wildtype p53 restored caspase cleavage and mitochondrial permeabilisation and apoptosis due to TNF (AmeyarZazoua et al, 2002). TNF induced apoptosis may not always be p53 dependant. In a non-small cell lung cancer cell line the combination of TNF and IFN$ induced apoptosis, without altering the expression levels of p53, indicating this was p53 independent. However, the addition of c-myc anti-sense oligonucleotides did reduce the combined TNF/IFN$ induced apoptosis indicating that c-myc may contribute to TNF induced apoptosis of this lung cancer cell. Another mechanism by which TNF induces tumour cell apoptosis or resistance to apoptosis, is via the inhibition or activation of NF-!B. In lung adenocarcinoma cells the constitutive activation of NF-!B leads to resistance to apoptosis, however, in the presence

II. TNF as an anti-cancer agent Initially TNF was isolated from the serum of mice infected with bacillus Calmette-GuĂŠrin (BCG) treated with endotoxin. It was found to mimic the action of endotoxin by inducing tumour necrosis in vivo when given directly to a range of transplanted tumours including Meth A sarcoma (Carswell et al, 1975). Furthermore, in vitro it was cytotoxic to L293 cells and cytostatic to Meth A sarcoma cells (Carswell et al, 1975). A number of studies using syngeneic cancer models, particularly the transplantable methylcholanthrene induced sarcoma model, have shown tumour regression with either direct intra-tumoural TNF injection or systemic intravenous TNF injections (Creasey et al, 1986; Watanabe et al, 1988). Animal xenograft models have also shown that intra-tumoural injection of recombinant TNF can lead to tumour regression (Balkwill et al, 1986; Creasey et al, 1986).

A. Mechanisms of anti-cancer action There appear to be a number of mechanisms by which TNF induces an anti-cancer effect (Figure 3). In vivo recombinant TNF directly injected into tumours destroys the tumour vasculature. It blocks blood flow, inducing congestion and haemorrhage of tumour vasculature (Watanabe et al, 1988a). On close examination of the tumours there are multiple petechial haemorrhages in the tumour-vascular bed causing ischaemia to the centre of the tumours due to the loss of blood supply (Havell et al, 1988). This however, only leads to 75% destruction of the tumour with a small rim of viable tissue remaining (Havell et al, 1988). TNF has also been shown to cause haemorrhagic necrosis in conjunction with IFN$, inducing vascular engorgement by erythrocytes and adhesion of platelets to tumour vascular endothelium. This then leads to destruction of the tumour vasculature with necrosis and apoptosis of tumour cells (de Kossodo et al, 1995). In isolated limb perfusion studies with TNF, within hours of TNF perfusion, the tumour endothelial cells appear swollen with increased VCAM and ELAM I adhesion molecules and tumour destruction due to a coagulative necrosis. Within 3 days there was significant polymorphonuclear cell colonisation of tumours, followed

by T cells and macrophages 4 days later and B cells in the second week (Renard et al, 1994).

TNF may induce killing of tumours by immune cells.

Genetically engineered tumour cells producing high levels of TNF have been implanted into tumours and, although they do not kill the tumours, they inhibit growth through the activation of macrophages and NK cells (Blankenstein et al, 1991). Using TNF knockout mice the ability of NK and LAK cells to induce cytotoxicity in a variety of tumour cell targets were found to be impaired. This cytotoxicity in the knockout mice required Fas-ligand and 135

Waterston and Bower: TNF and cancer: good or bad?

Figure 3. Schematic diagram to show the role of TNF in the upregulation of Cancer. TNF can induce cancer by affecting tumour proliferation, altering the cell structure and appears to act early to promote carcinogenesis.

Furthermore, TNF also helps tumours to metastasise by inducing extracellular matrix (ECM) adhesion and degradation as well as promoting adhesion of tumour cells to endothelial cells and neovascularisation.

TNF also contributes to cancer cachexia by increasing proteolysis and lipid metabolism. Polymorphisms in the TNF promoter region regulate TNF production and may affect prognosis.

of TNF the blocking of NF-!B by proteosome inhibitors induces apoptosis (Milligan and Nopajaroonsri, 2001).

Therefore, TNF induced apoptosis of tumour cells is very much dependant on which cell signalling pathways are constitutively active in tumour cells. IFN $ leads to sensitisation of ovarian tumour cells to TNF induced apoptosis by down regulating NF-!B. This occurs by IFN $ inducing inducible nitric oxide synthase (iNOS), which generates nitric oxide. The nitric oxide can then react with oxygen reducing the production of hydrogen peroxide an activator of NF-!B (Garban and Bonavida, 2001). Studies with MCF 7 breast cancer cells have shown that TNF alone also up-regulates iNOS, thereby leading to cell apoptosis (Binder et al, 1999). In Erlich ascitic tumours, TNF increased reactive oxygen species (ROS), which led to a reduction in mitochondrial glutathione and caused apoptosis in mice already depleted of glutathione by eating a glutamate-enriched diet. Glutamate is an inhibitor of glutathione (Obrador et al, 2001). A recent study has shown a direct link between increased ROS due to TNF and the reduction in mitochondrial ATPase protein subunits, cytochrome c oxidase subunit II and increased protein levels of phosphofructokinase; these changes were associated with an increase in L929 cell apoptosis (Sanchez-Alcazar et al, 2002). TNF induces tumour cell apoptosis by generating ROS at the mitochondrial

membrane. Oxidative substrates, electron-transport inhibitors, caspase inhibitors, glutathione and thiolreactive agents modulate the ROS production induced by TNF (Goossens et al, 1999).

B. TNF in combination with other anticancer therapies To enhance the ability of TNF to kill tumours, a number of studies have examined the synergistic effects of TNF in combination with chemotherapy agents. Using LM cells the addition of a number of commonly used chemotherapy agents to cultures containing recombinant human TNF (rhTNF) produced a 4-347-fold decrease in the IC50 (the concentration required for 50% inhibition of cell growth) compared to rhTNF alone (Watanabe et al, 1988c). A similar study examined the cytotoxicity of TNF with hyperthermia in L-M cells and found a 500-fold increase in toxicity at 40ยบC compared to 37ยบC. The combination of TNF and hyperthermia in vivo with transplantation of Meth A fibrosarcoma cells in mice also produced cures in 5 mice compared to a partial response with TNF alone (Watanabe et al, 1988c). However, due to the high toxicity profile of TNF, its systemic use is limited. To circumvent this problem Curnis et al have coupled TNF to CNGRC, a peptide that targets tumour neovasculature. This allows a 10-fold decrease in the dose 136

Cancer Therapy Vol 2, page 137 of TNF required. They have used TNF to alter the endothelial barrier within tumour vasculature and thereby increase the efficacy of doxorubicin by 8-10 fold without increasing toxicity (Curnis et al, 2002). The other way to reduce systemic toxicity of TNF has been by isolated limb perfusion of TNF; this has been used in rat models and patients (Eggermont et al, 1996; de Wilt et al, 1999).

these patients, raised serum TNF levels were associated with a reduction in body mass index and other factors associated with cachexia as well as a significantly increased mortality (Nakishima et al, 1998). In keeping with this, TNF has been shown to inhibit androgen receptor sensitivity, a poor prognostic indicator, and hence induce androgen independent proliferation in the LNCaP cell line (Mizokami et al, 2000). In chronic B cell lymphocytic leukaemia, increased TNF levels were found at all stages with a progressive increase in serum TNF levels in relation to the disease (Adami et al, 1994).

Patients with other haematological malignancies such as lymphoma have also been examined: correlating the production of TNF with histology revealed higher levels of TNF, p55TNFR, Lymphotoxin (LT)" and LT#-R mRNA in follicular NHL than other histological entities (Warzocha et al, 2000).

C. Clinical trials of recombinant TNF TNF has been administered intravenously to a wide range of tumours in Phase I and II clinical trials with none or limited tumour responses and was associated with severe toxicity particularly hypotension, rigors, fever and hepatotoxicity (Selby et al, 1987; Creagan et al, 1988; Brown et al, 1991; Furman et al, 1993). The use of TNF and IFN$, which had been shown in vitro to act synergistically, has also been evaluated in clinical trials, again the toxicity produced was unacceptable and the tumour responses disappointing (Abbruzzese et al, 1990; Fiedler et al, 1991). TNF however, has been shown to be useful in limb perfusion studies for patients with melanoma and soft tissue sarcomas. In these studies, the limb vasculature was isolated from the body and large amounts of systemically toxic TNF were infused into these tumour-bearing limbs to necrose the tumour (Eggermont et al, 1996). This strategy is licensed in Europe in combination with melphalan, since the addition of TNF to melphalan increased the response rates considerably.

The use of TNF as an anti-cancer agent has clear limitations due to its toxicity and may even be deleterious in the long term, as it can lead to re-growth of resistant tumours and, in the case of melanoma, more aggressive strains (Zouboulis et al, 1990). There is significant evidence pointing to TNF as an agent promoting different aspects of cancer (Figure 3).

B. TNF gene polymorphism and cancer A single gene polymorphism within the TNF locus (308) has been identified using an allele-specific polymerase chain reaction. This together with a polymorphism on the LT" locus has been measured in 273 lymphoma patients (Warzocha et al, 1997). The presence of the TNF allele involved in gene transcription was associated with higher plasma levels of TNF at the time of tumour diagnosis. Expression of the two alleles associated with increased TNF production were found to be a risk factor for failure of first-line chemotherapy, a shorter progression-free survival and a reduction in overall survival (Warzocha et al, 1997). A similar increase in risk of developing MGUS and myeloma has also been associated with high TNF producers (Davies et al, 2000).

TNF microsatellite polymorphisms have also been examined in gastrointestinal cancer. In 47 patients with gastric cancer there was an increase in frequency of TNFa3 allele and a decrease in frequency of TNFa10 allele compared to normal controls. In 77 patients with colorectal cancers there was an increase in frequency of TNFd7 allele compared to normal controls. No correlation with expression of the allele and TNF production were discussed in the paper (Saito et al 2001). Other studies have shown that the expression of the TNF-308A allele, which is known to up-regulate TNF did not increase the risk of gastric cancer but the expression of TNFâ&#x20AC;&#x201C;238A allele, which is known to down-regulate TNF transcription could be protective against gastric cancer, although the sample size was small (Gonzalez et al 2002).

Single nucleotide polymorphisms of the promoter region of TNF were examined in prostrate cancer. The 488 locus was associated with a 17 fold increased incidence of prostrate cancer and an increase in tumour staging was related to polymorphisms at theâ&#x20AC;&#x201C;308 locus (Oh et al, 2000). However, a more recent larger study looking at single nucleotide polymorphisms at the TNF-308 locus found no difference between patients and controls (MacCarron et al, 2000).

In two other cancers, microsatellite polymorphism studies have found a correlation with TNF polymorphism and the risk of cancer. In a study of Swedish women with

III. TNF as a carcinogen A. TNF in human tumours TNF has been detected in a number of different tumour types such as ovarian and breast tissue as well as haematological malignancies (Naylor et al, 1993; Miles et al, 1994; Sati et al, 1999; Warzocha et al, 2000). Both mRNA expression and TNF protein has been found in human epithelial ovarian tumour cells as well as within the infiltrating macrophages. The p55 TNFR has also been detected within ovarian tumour cells and infiltrating macrophages but not stromal macrophages whilst the p75 TNFR has only been found within the infiltrating macrophages (Naylor et al, 1993). In 49 biopsies taken from patients with breast cancer, 43 expressed TNF mRNA and protein compared to 4/11 biopsies from patients with benign breast disease. The TNF was localised to tumour stroma and infiltrating macrophages.

Furthermore, though the number of macrophages did not increase with tumour grade, the expression of TNF within the macrophages increased with tumour grade (Miles et al, 1994). A similar picture of increased production of TNF correlating with worse prognosis has been identified in patients with prostrate cancer (Nakashima et al, 1998). In

137

Waterston and Bower: TNF and cancer: good or bad? the HLA DR15-DQ6-haplotype there was an increased frequency of TNFa-11 polymorphism and an increase in HPV16 positivity. The TNF polymorphism was not associated with the pre-cancerous lesion cervical intraepithelial neoplasia (CIN) alone, however the relative risk of CIN conferred by the combination of TNFa-11, HLA-DQ6 and HPV 16 positivity was 15 (Ghaderi et al, 2001). In the same population, the risk of cervical cancer associated with the TNFa-11 polymorphism was also examined. The increased frequency of TNFa-11 was associated with HPV18 positivity but not HPV16 and TNFa-11 increased the risk of cancer in patients with the HLA DQ6 haplotype (Ghaderi et al, 2001). A further study in patients with cervical cancer has also shown under representation of the TNF-238 polymorphism, which is associated with a down regulation of TNF transcription (Calhoun et al, 2002). In cutaneous basal cell carcinoma (BCC), there was difference in the frequency of a1 and a7 polymorphisms in patients with BCC compared to controls. There was also an increase in the number of BCC in patients with alleles d4 and d6 alone or TNFa2-b4-d5 haplotype (Hajeer et al, 2000).

epidermal growth factor, TNF and oxidative stress. In this particular model, the effect of TNF was primarily in upregulating NF-!B (Dhar et al, 2002). Other groups, however, have shown that TNF, along with other proinflammatory cytokines, induces nitric oxide synthetase in a cholangiocarcinoma cell line (Jaiswal et al, 2000). This enzyme produces nitric oxide, which can increase DNA damage by inhibiting sensitive DNA repair enzymes, and thereby contributes to an increase in genetic mutations (Jaiswal et al 2000). Other studies have shown that the presence of iNOS in gynaecological tumours correlates with dedifferentiation (Thomsen et al, 1994). Therefore, the production of nitric oxide through TNF induction of iNOS may not only lead to tumour cell apoptosis, as described previously, but may also promote carcinogenesis. In a gastric carcinoma cell line the upregulation of WNT10A and WNT10B by TNF and Helicobacter pylori may be an important pathway in carcinogenesis (Kirikoshi et al, 2001). The WNT 10A and 10B genes are human orthologues of the mouse protooncogene Wnt-10b, which activates the # catenin-TCF signalling pathway. Deregulation of this pathway has been implicated in several forms of cancer such as colon cancer and melanoma (Brantjes et al, 2002). In liver tumour formation, Knight et al found that TNF was up-regulated by hepatic stem cells (oval cells) and contributed to their proliferation via p55 TNFR, as there was a reduction in proliferation and liver tumour formation in p55TNFR but not p75 TNFR knockout mice (Knight et al, 2000). TNF however, is not the only important cytokine in liver tumour formation, hepatocellular proliferation and tumour formation in rats exposed to a peroxisome proliferator can be induced via IL-1 and IL-6 (Anderson et al, 2001). It may be that different carcinogens require different cytokines to aid carcinogenesis. The signalling pathways induced by TNF have also been examined in rat mammary cells. TNF stimulated growth and morphogenesis of normal rat mammary epithelial cells as well as transformed mammary epithelial tumours. NF-!B/p50 DNA binding was present in the tumour cells but absent in normal mammary epithelium, however, TNF stimulation of normal epithelia leads to an induction of NF-!B/p50 DNA binding (Varela et al, 2001). Therefore, TNF may induce carcinogenesis by up-regulating NF-!B leading to the up-regulation of other proteins that cause cell proliferation and morphogenesis.

C. The role of TNF in carcinogenesis A number of studies attempted to establish a link between inflammation and carcinogenesis; including experiment to assess the ability of pro-inflammatory cytokines such as TNF, to induce tumours. TNF is a cytokine that is produced early in the inflammatory cascade and has been shown to promote carcinogenesis in murine skin tumours. Using TNF knockout mice the development of skin carcinomas by chemical carcinogen DMBA (7.12-dimethylbanz[a]-antracene) and tumour promoter TPA (12-0-tetradecanoyl-phorbol-13-acetate) were decreased compared to wildtype mice (Moore et al, 1999, Suganuma et al, 1999). Using pentoxifylline, which was shown to inhibit TNF and IL-1" gene expression, the growth of DMBA/TPA induced papillomas were inhibited (Robertson et al, 1996). Pentoxifylline was also able to inhibit the inflammatory response and TNF production induced by cutaneous UV-B light exposure. Indicating that TNF may be involved in the mechanism by which longterm UV-B light exposure, can contribute to skin cancer (Oberyszyn et al, 1998). Earlier studies have shown that TNF is able to induce growth of v-Ha-ras transfected BALB/3T3 cells though not the non-transfected BalB3/T3 cells and that the chemical carcinogen okadaic acid induces mouse TNF-" in the transfected and nontransfected tumours. These results suggest that a chemical tumour promoter can induce the secretion of TNF-" from various cells and that TNF can then act as an endogenous tumour promoter in vivo (Komori et al, 1993). The mechanism and signalling events associated with this carcinogenesis are still being elucidated. In basal cell keratinocytes, the chemical promoter TPA induces PKC " a process down-regulated in TNF knockout mice, as is the transcription factor AP-1. AP-1 induces GM-CSF, MMP 9 and MMP 3 proteins that are important in tumour development (Arnott et al, 2002). Using the epidermal JB6 murine model, AP-1, NF-!B and nitric oxide synthetase have all been implicated in tumour promotion by TPA,

D. The role of TNF in metastasis During inflammation, a number of proteins can be up-regulated to allow immune cells to migrate to sites of inflammation. Tumours use these same processes to invade adjacent structures. TNF is a potent proinflammatory cytokine that can be utilised by tumours to induce other downstream molecules involved in the metastatic process. Recombinant TNF injected into mice inoculated with a methylcholanthrene-induced fibrosarcoma increased the number of lung metastases (Orosz et al, 1993). Cells transfected with the TNF gene were also found to increase metastatic potential. In Chinese hamster ovarian cells transfected with TNF there 138

Cancer Therapy Vol 2, page 139 was increased intraperitoneal invasion, compared to cells infected with vector alone, and furthermore, antibodies to TNF abrogated this ability. (Malik et al, 1990). Similarly, ESB tumour cells infected with a retrovirus carrying the TNF gene were found to have augmented metastatic tumour activity and this metastatic process could be reversed with anti-TNF mAbs (Quin et al, 1993). Blocking TNF using the human p55-IgG fusion protein in a murine B16-BL6 melanoma model reduced the number of metastatic lung tumours indicating that some tumours may intrinsically use TNF within their microenvironment to aid metastasis (Cubillos et al, 1997). The administration of intraperitoneal TNF in human ovarian xenograft models had a paradoxical effect on the tumours. The intraperitoneal administration of rhTNF had anti-tumour activity in two out of three xenografts with tumour clumps in the peritoneum being surrounded by host inflammatory cells and necrosis of the tumours in 4-7 days. The third xenograft however, continued to grow and rhTNF promoted adhesion of the tumour cells to the peritoneum and the establishment of tumour nodules on the mesothelial surface, phenomena noted in the other two xenografts as well (Malik et al, 1989). This suggests that human TNF may also promote metastasis in human tissue.

Metastasis can be divided into a series of biological processes described below. TNF appears to be involved in the up-regulation of these pro-metastatic factors and hence contributes to the completion of each of these processes.

may contribute to angiogenesis (Shin et al, 2000).

Therefore, inhibition of TNF may have a role in preventing angiogenesis by inhibiting MMPs. It is thought that the anti-angiogenic mechanism of thalidomide is in part due to the inhibition of pro-inflammatory cytokines such as TNF. Thalidomide is in Phase II trials for a number of tumours including renal cancer and melanoma (Stebbing et al, 2001).

2. TNF increases detachment from the primary site Cells within a tissue are retained within the structure by their adhesion to neighbouring cells and by the extra cellular matrix. Therefore, in order for invasion to occur tumour cells need to detach and become mobile. There are four groups of adhesion molecules important in this process. The first are the cadherins, which interact with other cadherins to form cell-to-cell attachments. The down-regulation of E-Cadherin in particular has been implicated in cancer invasion in a number of human malignancies (Shiozaki et al, 1991; Tohma et al, 1992; Dorudi et al, 1993). Stimulation of intestinal cells with TNF reduced E-Cadherin levels enhanced invasion, via a Src kinase dependant mechanism (Kawai et al, 2002).

The second group of important adhesion molecules are the integrins, which are made up of differing combinations of " and # subunits. These molecules enable cells to adhere to components of the basement membrane and stroma such as collagen, vitronectin, laminin and fibronectin during migration (Hynes, 1992). In OST osteosarcoma cells, stimulation with TNF causes upregulation of "2#1 and "5#1 with increased adhesion and migration through the extra cellular matrix (Kawashima et al, 2001).

The third group of adhesion molecules are members of the immunoglobulin superfamily including ICAM 1, 2 and 3, and other immunoglobulin superfamily members such as VCAM, which bind integrins and are important in cell-to-cell interactions. These molecules are up-regulated by pro-inflammatory cytokines such as TNF, IFN$, and IL-1 and they have a major role in T cell and NK cells adhesion and migration. In a cancer setting, TNF appears to attenuate the basal expression of ICAM-1 in the presence of the extra cellular matrix in a thyroid cancer cell line (Miller et al, 2000).

The fourth major group of adhesion molecules are the selectins, which bind to carbohydrate groups on glycoproteins. E-selectin found on endothelial cells binds sialyl-Lewis X and G found on epithelial cells in colon and gastric carcinomas. TNF appeared to stimulate Eselectin expression on cultured human vascular endothelial cells to increase their adhesion to Sialyl-Lewis (a) on pancreatic cancer cells and thereby aid tumour entry into the vasculature (Nozawa et al, 2000).

1. Neovascularisation, angiogenesis and the role of TNF In order for a primary tumour to expand, it requires nutrition and oxygen. When tumours are less than 200Âľm in diameter this occurs by diffusion, however larger tumours require vasculature. Chemokines such as IL-8 and Gro" as well as other growth factors e.g. FGF, PDGF and thymidine phosphorylase are important in neovascularisation (Folkman, 1986, 1995; Folkman and Klagsbrun, 1987; Auerbach and Auerbach, 1994; Fidler and Ellis, 1994; Nagy et al, 1995; Leek et al, 1998). They attract endothelial cells and cause the migration of capillaries into the tumours. The endothelial cells proliferate and form vascular loops with new basement membranes with different cellular composition, permeability and stability as well as growth regulation compared to the host capillaries. TNF has been found to increase the expression of IL-8 and Gro" in a number of different cell types (Strieter et al, 1995). In histological samples of malignant breast cancer, increased TNF staining correlated with increased thymidine phosphorylase an important enzyme in angiogenesis (Leek et al, 1998).

There also needs to be down-regulation of various inhibitors in order for angiogenesis to occur. These include inhibitors of matrix metalloproteinases (MMP), as they prevent migratory endothelial cells degrading basement membrane. A number of artificial MMP inhibitors are being used in anti-angiogenic trials to inhibit endothelial invasion (Nemunaitis et al, 1998; Shalinsky et al, 1999).

TNF has been found to up-regulate MMP 9 and thereby

3. Increased motility and the possible role of TNF Tumour invasion requires the cells to be motile.

Autocrine motility factors and those due to stromal cytokine production are associated with changes in the 139

Waterston and Bower: TNF and cancer: good or bad? tumour cell cytoskeleton. TNF has been found to increase the motility of a number of cancer cells (Rosen et al, 1991; Dekker et al, 1994; Carpenter et al, 1997). In order for cells to move they undergo distinct events that are regulated by separate signalling pathways (Condeelis et al, 2001; Kassis et al, 2001; Price and Collard, 2001).

Dividing the process into separate entities, the initial event is the extension of the lamellipodia, which is then stabilised by adhesion to the substratum. This is followed by the generation of contractile forces causing translocation of the body of the cell and finally the detachment of the trailing edge. To produce the lamellipodia there needs to be reorganisation of the cytoskeleton and the cyclic polymerisation and depolymerisation of actin. The Rho family of GTPases affects these processes. Cdc42, Rho and Rac1 have all been shown in vitro to lead to the formation of actin stress fibres, lamellipodia and filopodia respectively, which are all involved in motility. In fibroblasts, TNF and IL-1 stimulate CdC42 causing filopodia formation (Puls et al, 1999) and via ceramide, increase stress fibre formation (Hanna et al, 2001). The effects of TNF on motility does, however, appear to be cell-dependant. In macrophages for example, TNF inhibits filopodia and reduces F-actin via the p55 TNFR death domain. Inhibition of the death domain by the synthetic compound D609 or TNFR mutants increases F actin with accumulation at the cell cortex and involves the FAN binding site of the receptor (Peppelenbosch et al, 1999). Therefore, the effect of TNF on cytoskeletal reorganisation may depend on the region of the TNFR that is activated. In tumour cells epidermal growth factor (EGF) has been shown to activate RhoGTPases and induce cytoskeletal reorganisation and tumour invasion in vitro. The effect of TNF on cytoskeletal reorganisation in tumour cells remains to be elucidated. The adhesion of the lamellipodia and deadhesion of the trailing edge involves the regulation of adhesion factors such as integrins. TNF has been shown to up-regulate integrins and aid invasion in vitro in specific tumour cells (Kawashima et al, 2001).

production by stromal cells induces MMP 9 production in human giant cell tumours of bone (Rao et al, 1999). MMP have natural inhibitors known as TIMP (Tissue inhibitors of MMP), which control their activity. Tumour invasion depends in part on the balance of MMP with TIMP and pro inflammatory cytokines such as TNF can tip the balance in favour of MMP (Hajitou et al, 2001).

Other proteases that degrade the extra cellular matrix include serine proteases, which have a serine in their active site. An example of this is urokinase-plasminogen activator that catalyses the conversion of plasminogen to plasmin, which degrades components of the extra cellular matrix. TNF has been found to up regulate urokinaseplasminogen and thereby increase invasiveness of tumours (Wu et al, 1999).

5. Entry into vasculature and lymphatics Once the tumour cells invade through the basement membrane they enter the lymphatic or vascular system and disseminate to the rest of the body. The lymphatics and blood stream are interlinked, so that tumours that pass into one system can readily pass into the other system. Due to the processes of neovascularisation the capillary vasculature lies close to the basement membrane, so that tumour cells, once they have invaded the basement membrane, are able to adhere to the endothelial cells and pass into the vasculature easily. The adhesion of tumour cells to endothelial cells occurs via endothelial adhesion molecules such as E-selectin and VCAM (Nozawa et al, 2000; Flugy et al, 2002; Simiantonaki et al, 2002) that bind to glycoproteins and integrins on the tumour cells (Voura et al, 2001). The capillaries tend to be more permeable than the normal physiological capillary vasculature, enabling tumour cells to squeeze between endothelial cells into the blood vessels.

6. Extravasation The circulating tumours are able to adhere to the endothelium and using pseudopodial projections invade the surrounding tissue (Morris et al, 1997). The tumours adhere to components of the extra cellular matrix using integrins in a similar process to invasion from the primary site (Renkonen et al, 1999; Tanaka, 1999). Once they have penetrated the organ parenchyma, their proliferation depends on the environment.

4. TNF increases invasion of the extra cellular matrix In order for cells to migrate they need to degrade the basement membrane. The membrane primarily consists of type IV collagen and stroma, the latter is composed of types I, II, III collagen, proteoglycan and glycoprotein. To degrade the membrane the cancer cells produce matrixdegrading enzymes. The major family of degrading enzymes are the MMP, which contain a zinc-binding domain at their catalytic site. They are secreted in their inactive form and are activated by other proteases. The MMP can be divided into different groups based on their properties and substrates. MMP 2 and 9 are up-regulated in breast (Davies et al, 1993b), prostate (Stearns and Wang, 1993) ovarian (Davis et al, 1993a) and bladder cancer (Davies et al, 1993c). TNF appears to up-regulate MMP 2 and 9 in some bladder cancer cell lines (Shin et al, 2000). Host stromal cells also produce MMP and cancer cells may utilise them to facilitate invasion. TNF

7. Proliferation of metastases Once tumours arrive at their sites of metastasis, they can manipulate the host environment to develop the tumour architecture. TNF may help in this by stimulating the proliferation of fibroblasts and collagen (Mauviel et al 1991, Battegay et al 1995). Tumours also use the host environment to aid proliferation by binding to growth factors released from the stroma. For example, in multiple myeloma, TNF induces bone marrow stromal cells to produce IL-6, a myeloma growth factor (Hideshima et al, 2001). Once metastatic tumours grow, they again need to develop a vasculature to increase beyond a certain size and do so in a similar way to the primary tumours. This in turn 140

Cancer Therapy Vol 2, page 141 randomized, controlled, double-blind, multicenter clinical trial. TNF-" Mab Sepsis Study Group. JAMA 273, 934-941.

Adami F, Guarini A, Pini M, Siviero F, Sancetta R, Massaia M, Trentin L, Foa R, and Semenzato G (1994) Serum levels of tumour necrosis factor-" in patients with B-cell chronic lymphocytic leukaemia. Eur J Cancer 30A, 1259-63.

Ahmad M, Srinivasula SM, Wang L, Talanian RV, Litwack G, Fernandes-Alnemri T, and Alnemri ES (1997) CRADD, a novel human apoptotic adaptor molecule for caspase-2, and FasL/tumor necrosis factor receptor-interacting protein RIP. Cancer Res 57, 615-9.

Ameyar-Zazoua M, Larochette N, Dorothee G, Daugas E, Haddad H, Gouloumet V, Metivier D, Stancou R, MamiChouaib F, Kroemer G, and Chouaib S (2002) Wild-type p53 induced sensitization of mutant p53 TNF-resistant cells: role of caspase-8 and mitochondria. Cancer Gene Ther 9, 21927.

Anderson SP, Dunn CS, Cattley RC, and Corton JC (2001) Hepatocellular proliferation in response to a peroxisome proliferator does not require TNF" signaling.

Carcinogenesis 22, 1843-51.

Arnott CH, Scott KA, Moore RJ, Hewer A, Phillips DH, Parker P, Balkwill FR, and Owens DM (2002) Tumour necrosis factor-" mediates tumour promotion via a PKC "- and AP-1dependent pathway. Oncogene 21, 4728-38.

Auerbach W, and Auerbach R (1994) Angiogenesis inhibition: a review. Pharmacol Ther 63, 265-311.

Baker D, Butler D, Scallon BJ, JK ON, Turk JL, and Feldmann M (1994) Control of established experimental allergic encephalomyelitis by inhibition of tumor necrosis factor (TNF) activity within the central nervous system using monoclonal antibodies and TNF receptor-immunoglobulin fusion proteins. Eur J Immunol 24, 2040-8.

Balkwill FR, Lee A, Aldam G, Moodie E, Thomas JA, Tavernier J, and Fiers W (1986) Human tumor xenografts treated with recombinant human tumor necrosis factor alone or in combination with interferons. Cancer Res 46, 3990-3.

Battegay EJ, Raines EW, Colbert T, and Ross R (1995) TNF- " stimulation of fibroblast proliferation. Dependence on platelet-derived growth factor (PDGF) secretion and alteration of PDGF receptor expression. J Immunol 154, 6040-7.

Bemelmans MH, Gouma DJ, and Buurman WA ( 1993) Influence of nephrectomy on tumor necrosis factor clearance in a murine model. J Immunol 150, 2007-17.

Berra E, Diaz-Meco MT, Lozano J, Frutos S, Municio MM, Sanchez P, Sanz L, and Moscat J (1995) Evidence for a role of MEK and MAPK during signal transduction by protein kinase C zeta. Embo J 14, 6157-63.

Bertolini DR, Nedwin GE, Bringman TS, Smith DD, and Mundy GR (1986) Stimulation of bone resorption and inhibition of bone formation in vitro by human tumour necrosis factors.

Nature 319, 516-8.

Beutler B, Mahoney J, Le Trang N, Pekela P, and Cerami A (1985a) Purification of cachectin, a lipoprotein lipasesuppressing hormone secreted by endotoxin induced RAW 264.7 cells. J Exp Med 161, 984-995.

Beutler B, Milsark BIW, and Cerami A (1985b) Passive immunisation against cachectin/tumor necrosis factor (TNF) protects mice from the lethatl effects of endotoxin. Science 229, 869-71.

Binder, C, Schulz, M, Hiddemann, W, and Oellerich, M (1999) Induction of inducible nitric oxide synthase is an essential part of tumor necrosis factor-"-induced apoptosis in MCF-7 and other epithelial tumor cells. Lab Invest, 79, 1703-12.

Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson, N Boiani N, Schooley KA, Gerhart M, Davi R,

aids metastasis, as they are then able to metastasise to other organs.

Since tumours are genetically unstable, often the metastatic tumours may have developed an advantage compared to the primary tumour aiding their survival.

Parratto et al, (1989) found an inverse correlation between a strong antibody response and metastatic ability, so that the hostâ&#x20AC;&#x2122;s immune response may be selecting out the poorly metastatic clones and allowing the highly metastatic clones to proliferate. The production of TNF by the host immune cells may thereby contribute to the development of metastatic clones.

IV. Conclusion TNF has a wide range of activities in cancer including cancer related cachexia that has not been covered in this review. It was initially thought that the majority of the effects of TNF on cancers were beneficial enhancing immunological rejection of cancers via NK and CTL responses. However, the clinical trials using TNF to treat cancer were disappointing due to the high toxicity caused by large amounts of cytokine. Indeed now the only therapeutic role that remains is for the treatment of melanoma in isolated limb perfusion. More recently, as is often seen with TNF, it has converse actions that induce a number of pro-inflammatory genes, which the tumours utilise to promote cancer such as cytokines, angiogenic factors and MMPs. These factors contribute to tumour formation, growth, invasion and metastasis to other sites.

Many of the actions of TNF may occur by the stimulation of stromal tissue, tumour-associated macrophages and fibroblasts. These cells may then produce inflammatory cytokines including TNF itself, as well as some of the angiogenic factors described above, contributing to tumour proliferation and invasion. Anti-TNF mAbs have now been licensed in the USA and Europe and are widely used for the treatment of rheumatoid arthritis and Crohn's disease. We await with interest the long term follow up of these clinical trials which have specifically blocked to TNF as they may provide an indication of the role of this cytokine in promoting cancer.

Acknowledgements This work was supported in part by a Vaekstfond grant from the Danish Government. The authors thank Prof. R. Kohnen, IMEREM GmbH for professional monitoring of this clinical trial.

References Abbruzzese JL, Levin B, Ajani JA, Faintuch JS, Pazdur R, Saks S, Edwards C, and Gutterman JU (1990) A phase II trial of recombinant human interferon-$ and recombinant tumor necrosis factor in patients with advanced gastrointestinal malignancies: results of a trial terminated by excessive toxicity. J Biol Response Mod 9, 522-7.

Abraham E, Wunderink R, Silverman H, Perl TM, Nasraway S, Levy H, Bone R, Wenzel RP, Balk R, Allred R et al, (1995) Efficacy and safty of monoclonal antibody to human tumor necrosis factor " in patients with sepsis syndrome. A

141

Waterston and Bower: TNF and cancer: good or bad?

Fitzner JN, Johnson RS, Paxton RJ, March CJ, and Cerretti DP (1997) A metalloproteinase disintegrin that releases tumour-necrosis factor-" from cells. Nature 385, 729-33.

Blankenstein T, Qin ZH, Uberla K, Muller W, Rosen H, Volk HD, and Diamantstein T (1991) Tumor suppression after tumor cell-targeted tumor necrosis factor " gene transfer. J Exp Med 173, 1047-52.

Boldin M, Goncharov T, Goltsev Y, and Wallach D (1996) Involvement of MACH, a novel MORT/FADD-interacting protease, in Fas/APO-1 and TNF receptor-induced cell death.

Cell 85, 803-815.

Brantjes H, Barker N, van EJ, and Clevers H (2002) TCF: Lady Justice casting the final verdict on the outcome of Wnt signalling. Biol Chem 383, 255-61.

Brockhaus M, Schoenfeld HJ, Schlaeger EJ, Hunziker W, Lesslauer W, and Loetscher H (1990) Identification of two types of tumor necrosis factor receptors on human cell lines by monoclonal antibodies. Proc Natl Acad Sci USA 87, 3127-3131.

Brown TD, Goodman P, Fleming T, Macdonald JS, Hersh EM, and Braun TJ, (1991) A, phase II trial of recombinant tumor necrosis factor in patients with adenocarcinoma of the pancreas: A, Southwest Oncology Group study. J Immunother 10, 376-8.

Butler DM, Piccoli DS, Hart PH, and Hamilton JA, (1988) Stimulation of human synovial fibroblast DNA synthesis by recombinant human cytokines. J Rheumatol 15, 1463-70.

Calhoun ES, McGovern RM, Janney CA, Cerhan JR, Iturria SJ, Smith DI, Gostout BS, and Persing DH (2002) Host genetic polymorphism analysis in cervical cancer. Clin Chem 48, 1218-24.

Cao Z, Xiong J, Takeuchi M, Kurama T, and Goeddel DV, (1996) TRAF6, is A, signal transducer for interleukin-1.

Nature 383, 443-6.

Carpenter PM, Gatanaga T, Nguyen HP, and Hiserodt JC, (1997) Lymphocyte and monocyte-induced motility of MCF-7, cells by tumor necrosis factor-". Int J Cancer 71, 64-70.

Carswell EA, Old LJ, Kassel RL, Green S, Fiore N, and Williamson B, (1975) An endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A, 72, 3666-70.

Cheng G, Cleary AM, Ye ZS, Hong DI, Lederman S, and Baltimore D, (1995) Involvement of CRAF1, A, relative of TRAF in CD40, signaling. Science 267, 1494-8.

Chinnaiyan AM, K OR, Yu GL, Lyons RH, Garg M, Duan DR, Xing L, Gentz R, Ni J, and Dixit VM, (1996) Signal transduction by DR3 A, death domain-containing receptor related to TNFR-1, and CD95. Science 274, 990-2.

Condeelis JS Wyckoff JB, Bailly M Pestell R, Lawrence D, Backer J, and Segall JE, (2001) Lamellipodia in invasion.

Semin Cancer Biol 11, 119-28.

Creagan ET, Kovach JS, Moertel CG, Frytak S, and Kvols LK, (1988) A, phase I clinical trial of recombinant human tumor necrosis factor. Cancer 62, 2467-71.

Creasey AA, Reynolds MT, and Laird W, (1986) Cures and partial regression of murine and human tumors by recombinant human tumor necrosis factor. Cancer Res 46, 5687-90.

Cubillos S, Scallon B, Feldmann M, and Taylor P, (1997) Effect of blocking TNF on IL-6, levels and Metastasis in A, B16BL6, melanoma mouse model. Anticancer Research 17, 2207-2212.

Curnis F, Sacchi A, and Corti A, (2002) Improving chemotherapeutic drug penetration in tumors by vascular targeting and barrier alteration. J Clin Invest 110, 475-82.

Davies B, Miles DW, Happerfield LC, Naylor MS, Bobrow LG, Rubens RD, and Balkwill FR, (1993a) Activity of type IV collagenases in benign and malignant breast disease. Br J

Cancer 67, 1126-31.

Davies B, Waxman J, Wasan H, Abel P, Williams G, Krausz T, Neal D, Thomas D, Hanby A, and Balkwill F, (1993b) Levels of matrix metalloproteases in bladder cancer correlate with tumor grade and invasion. Cancer Res 53 5365-9.

Davies FE, Rollinson SJ, Rawstron AC, Roman E, Richards S, Drayson M, Child JA, and Morgan GJ, (2000) High-producer haplotypes of tumor necrosis factor " and lymphotoxin " are associated with an increased risk of myeloma and have an improved progression-free survival after treatment. J Clin Oncol 18, 2843-51. de Kossodo S, Moore R, Gschmeissner S, East N, Upton C, and Balkwill FR, (1995) Changes in endogenous cytokines adhesion molecules and platelets during cytokine-induced tumour necrosis. Br J Cancer 72, 1165-72. de Wilt JH, Manusama ER, van Tiel ST, van Ijken MG, ten Hagen TL, and Eggermont AM, (1999) Prerequisites for effective isolated limb perfusion using tumour necrosis factor " and melphalan in rats. Br J Cancer 80, 161-6.

Dekker SK, Vink J, Vermeer BJ, Bruijn JA, Mihm MC Jr, and Byers HR, ( 1994) Differential effects of interleukin 1-" (IL1") or tumor necrosis factor-" (TNF-") on motility of human melanoma cell lines on fibronectin. J Invest Dermatol 102, 898-905.

D'Haens G, Swijsen C, Noman M, Lemmens L, Ceuppens J, Agbahiwe H, Geboes K, and Rutgeerts P, (2001) Etanercept in the treatment of active refractory Crohn's disease: A, single-center pilot trial. Am J Gastroenterol 96, 2564-8.

D'Haens G, Van Deventer S, Van Hogezand R, Chalmers D, Kothe C, Baert F, Braakman T, Schaible T, Geboes K, and Rutgeerts P, (1999) Endoscopic and histological healing with infliximab anti-tumor necrosis factor antibodies in Crohn's disease: A, European multicenter trial. Gastroenterology 116, 1029-34.

Dhar A, Young MR, and Colburn NH, (2002) The role of AP-1, NF-!B and ROS/NOS in skin carcinogenesis: the JB6, model is predictive. Mol Cell Biochem 234-235, 185-93.

Djeu JY, Serbousek D, and Blanchard DK, (1990) Release of tumor necrosis factor by human polymorphonuclear leukocytes. Blood 76, 1405-9.

Dorudi S, Sheffield JP, Poulsom R, Northover JM, and Hart IR (1993) E-cadherin expression in colorectal cancer. An immunocytochemical and in situ hybridization study. Am J Pathol 142, 981-6.

Drapier JC, Wietzerbin J, and Hibbs JB, (1987) Interferon-$ and tumour necrosis factor induce the L-arginine-dependent cytotoxic effector mechanism in murine macrophages. Eur J Immunol 18, 1587-92.

Duan H, and Dixit v (1997) RAIDD is A, new 'death' adaptor molecule. Nature 385, 86-89.

Dubravec DB, Spriggs DR, Mannick JA, and Rodrick ML, (1990) Circulatinghuman peripheral blood granulocytes synthesize and secrete tumor necrosis factor ". Proc Natl Acad Sci 87, 6758-61.

Eggermont AM, (1996) The success of TNF " in isolated limb perfusion for irresectable extremity soft tissue sarcomas melanoma and carcinomas: observations in patients and preclinical perfusion models. Gan To Kagaku Ryoho 23 1357-70.

Eggermont AM Schraffordt Koops H Klausner JM Lienard D, Kroon BB Schlag PM Ben-Ari G and Lejeune FJ (1997) Isolation limb perfusion with tumor necrosis factor " and chemotherapy for advanced extremity soft tissue sarcomas.

Semin Oncol 24, 547-55.

Elliot MJ, Maini RN, Feldmann M, Kalden JR, Antoni C, Smolen JS, Leeb B, Breedveld FC, Macfarlane JD, Bijl H, and Woody JN, (1994) Randomised double-blind comparison of chimeric monoclonal antibody to tumour

142

Cancer Therapy Vol 2, page 143 necrosis factor microsatellites with increased risk of multiple basal cell carcinomas. Br J Dermatol 142, 441-5.

Hajitou A, Sounni NE, Devy L, Grignet-Debrus C, Lewalle JM, Li H, Deroanne CF, Lu H Colige A, Nusgens BV Frankenne F, Maron A, Yeh P, Perricaudet M, Chang Y, Soria C, Calberg-Bacq CM, Foidart JM and Noel A, (2001) Downregulation of vascular endothelial growth factor by tissue inhibitor of metalloproteinase-2: effect on in vivo mammary tumor growth and angiogenesis. Cancer Res 61, 3450-7.

Hanna AN, Berthiaume LG, Kikuchi Y, Begg D, Bourgoin S, and Brindley DN (2001) Tumor necrosis factor-" induces stress fiber formation through ceramide production: role of sphingosine kinase. Mol Biol Cell 12, 3618-30.

Havell EA, Fiers W, and North RJ, (1988) The antitumor function of tumor necrosis factor (TNF) I. Therapeutic action of TNF against an established murine sarcoma is indirect immunologically dependent and limited by severe toxicity. J Exp Med 167, 1067-85.

Hideshima T, Nakamura N, Chauhan D, and Anderson KC, (2001) Biologic sequelae of interleukin-6, induced PI3K/Akt signaling in multiple myeloma. Oncogene 20, 59916000.

Hu HM, K OR, Boguski MS, and Dixit VM, (1994) A novel RING finger protein interacts with the cytoplasmic domain of CD40. J Biol Chem 269, 30069-72.

Hynes RO, (1992) Integrins: versatility modulation and signaling in cell adhesion. Cell 69, 11-25.

Ichijo H, Nishida E, Irie K, ten Dijke P, Saitoh M, Moriguchi T, Takagi M, Matsumoto K, Miyazono K, and Gotoh Y, (1997) Induction of apoptosis by ASK1, A mammalian MAPKKK that activates SAPK/JNK and p38, signaling pathways.

Science 275, 90-4.

Ishida TK, Tojo T, Aoki T, Kobayashi N, Ohishi T, Watanabe T, Yamamoto T, and Inoue J, (1996) TRAF5, A novel tumor necrosis factor receptor-associated factor family protein mediates CD40, signaling. Proc Natl Acad Sci U S A, 93 9437-42.

Jaiswal M, LaRusso NF, Burgart LJ, and Gores GJ, (2000) Inflammatory cytokines induce DNA damage and inhibit DNA repair in cholangiocarcinoma cells by A, nitric oxidedependent mechanism. Cancer Res 60, 184-90.

Jerlinek D, and Lipsky P, (1987) Enhancement of human B cell proliferation and differentiation by tumor necrosis factor-" and interleukin 1. J Immunol 139, 2970-76.

Jewett A, Cavalcanti M, and Bonavida B, (1997) Pivotal role of endogenous TNF-" in the induction of functional inactivation and apoptosis in NK cells. J Immunol 159, 4815-22.

Jirik FR, Podor TJ, Hirano T, Carson DA, and Lotz M, (1989) Bacterial lipopolysaccaride and inflammatory mediators augment IL-6, secretion by human endothelial cells. J Immunol 142, 144-47.

Johnson RA, Boyce BF, Mundy GR, and Roodman GD, (1989) Tumors producing human tumor necrosis factor induced hypercalcemia and osteoclastic bone resorption in nude mice.

Endocrinology 124, 1424-7.

Kashii Y, Giorda R, Herberman RB, Whiteside TL, and Vujanovic NL, (1999) Constitutive expression and role of the TNF family ligands in apoptotic killing of tumor cells by human NK cells. J Immunol 163 5358-66.

Kassis J, Lauffenburger DA, Turner T, and Wells A, (2001) Tumor invasion as dysregulated cell motility. Semin Cancer Biol 11, 105-17.

Kawai N, Tsuji S Tsujii M, Ito T, Yasumaru M, Kakiuchi Y, Kimura A, Komori M Sasaki Y Hayashi N Kawano S Dubois R, and Hori M, (2002) Tumor necrosis factor " stimulates invasion of Src-activated intestinal cells. Gastroenterology 122, 331-9.

necrosis factor " versus placebo in rheumatoid arthritis.

Lancet 344, 1105-10.

Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, and Nagata S, (1998) A, caspase-activated DNase that degrades DNA during apoptosis and its inhibitor ICAD [see comments] [published erratum appears in Nature 1998, May 28;393(6683):396]. Nature 391, 43-50.

English BK Weaver WM, and Wilson CB, (1991) Differential regulation of lymphotoxin and tumor necrosis factor genes in human T lymphocytes. J Biol Chem 266, 7108-13.

Fidler IJ, and Ellis LM, (1994) The implications of angiogenesis for the biology and therapy of cancer metastasis. Cell 79, 185-8.

Fiedler W Zeller W, Peimann CJ, Weh HJ, and Hossfeld DK, (1991) A, phase II combination trial with recombinant human tumor necrosis factor and $ interferon in patients with colorectal cancer. Klin Wochenschr 69, 261-8.

Flugy AM, D'Amato M, Russo D, Di Bella MA, Alaimo G, Kohn EC, De Leo G, and Alessandro R, (2002) E-selectin modulates the malignant properties of T84, colon carcinoma cells. Biochem Biophys Res Commun 293 1099-106.

Folkman J, (1986) How is blood vessel growth regulated in normal and neoplastic tissue? GHA. Clowes memorial Award lecture. Cancer Res 46, 467-73.

Folkman J, (1995) Angiogenesis in Cancer vascular rheumatoid and other disease. Nat Med 1, 27-31.

Folkman J, and Klagsbrun M, (1987) Angiogenic factors.

Science 235, 442-7.

Furman WL, Strother D, McClain K, Bell B, Leventhal B, and Pratt CB, ( 1993) Phase I clinical trial of recombinant human tumor necrosis factor in children with refractory solid tumors: A, Pediatric Oncology Group study. J Clin Oncol 11, 2205-10.

Garban HJ, and Bonavida B, (2001) Nitric oxide disrupts H2O2dependent activation of nuclear factor !B. Role in sensitization of human tumor cells to tumor necrosis factor-" -induced cytotoxicity. J Biol Chem 276, 8918-23.

Gemlo BT, Palladino MAJ, Jaffe HS, Espevik TP, and Rayner AA, (1988) Circulating cytokines in patients with metastatic cancer trated with recombinant interleukin 2, and lymphokine-activated killer cells. Cancer Res 48, 5864-67.

Ghaderi M, Nikitina Zake L, Wallin K, Wiklund F, Hallmans G, Lenner P, Dillner J, and Sanjeevi CB (2001) Tumor necrosis factor " and MHC class I chain related gene A, (MIC-A) polymorphisms in Swedish patients with cervical cancer.

Hum Immunol 62, 1153-8.

Gimbrone M, Obin M, Brock A, Luis E, Hass P, Hebert C, Yip Y, Leung D, Lowe D, Kohr W Darbonne W Bechtol K and Baker J, (1989) Endothelial interleukin-8: A, novel inhibitor of leukocyte-endothelial interactions. Science 246, 1601-03.

Gonzalez CA, Sala N, and Capella G, (2002) Genetic susceptibility and gastric cancer risk. Int J Cancer 100, 24960.

Goossens V, De Vos K, Vercammen D, Steemans M, Vancompernolle K, Fiers W Vandenabeele P and Grooten J (1999) Redox regulation of TNF signaling. Biofactors 10, 145-56.

Gordon JR and Gallis SJ, (1990) Mast cells as A, source of both preformed and immunologically inducible TNF-"/cachectin.

Nature 346, 274-76.

Grell M Douni E Wajant H Lohden M Clauss M Maxeiner B Georgopoulos S Lesslauer W Kollias G Pfizenmaier K and et al ( 1995) The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80, kDa tumor necrosis factor receptor. Cell 83 793-802.

Hajeer AH Lear JT Ollier WE Naves M Worthington J Bell DA Smith AG Bowers WP Jones PW Strange RC and Fryer AA (2000) Preliminary evidence of an association of tumour

143

Waterston and Bower: TNF and cancer: good or bad?

Kawakami M, Watanabe N, Ogawa H, Kato A, Sando H, Yamada N, Murase T, Takaku F, Shibata S, and Oda T, (1989) Cachectin/TNF kills or inhibits the differentiation of 3T3-L1, cells according to developmental stage. J Cell Physiol 138, 1-7.

Kawashima A, Kawahara E, Tokuda R, and Nakanishi I, (2001) Tumour necrosis factor-" provokes upregulation of "2#1, and "5#1, integrins and cell migration in OST osteosarcoma cells. Cell Biol Int 25, 319-29.

Keffer J, Probert L, Cazlaris H, Georgopoulos S, Kaslaris E, Kioussis D, and Kollias G, (1991) Transgenic mice expressing human tumour necrosis factor: A, predictive genetic model of arthritis. Embo J 10, 4025-31.

Kelliher MA, Grimm S, Ishida Y, Kuo F, Stanger BZ, and Leder P, (1998) The death domain kinase RIP mediates the TNFinduced NF-!B signal. Immunity 8, 297-303.

Kinkhabwala M, Sehajpal P, Skolnik E, Sharma V, Vlassara H, Cerami A, and Suthanthiran M, (1990) A, novel addition to the T cell repertory Cell surface expression of tumor necrosis factor/cachectin by activated normal human T cells. J Exp Med 171, 941-46.

Kirchheimaer J, Nong Y, and Remold H, (1988) IFN-$ tumor necrosis factor-" and urokinase regulate the expresssion of urokinase receptors on human monocytes. J Immunol 141, 4229-34.

Kirikoshi H, Sekihara H, and Katoh M, (2001) Up-regulation of WNT10A by tumor necrosis factor " and Helicobacter pylori in gastric cancer. Int J Oncol 19, 533-6.

Knight B, Yeoh GC, Husk KL, Ly T, Abraham LJ, Yu C, Rhim JA and Fausto N, ( 2000) Impaired preneoplastic changes and liver tumor formation in tumor necrosis factor receptor type 1, knockout mice. J Exp Med 192, 1809-18.

Kock A, Schwarz T, Kirnbauer R, Urbanski A, Perry P, Ansel JC, and Luger TA, (1990) Human keratinocytes are A, source of tumor necrosis factor " evidence for synthesis and release upon stimulation with endotoxin or ultraviolet light. J Exp Med 172, 1609-14.

Komori A, Yatsunami J, Suganuma M, Okabe S, Abe S, Sakai A, Sasaki K, and Fujiki H (1993) Tumor necrosis factor acts as A, tumor promoter in BALB/3T3 cell transformation.

Cancer Res 53 1982-5.

Kwon BS, Tan KB, Ni J, Oh KO, Lee ZH, Kim KK, Kim YJ, Wang S, Gentz R, Yu GL, Harrop J, Lyn SD, Silverman C, Porter TG, Truneh A, and Young PR, (1997) A, newly identified member of the tumor necrosis factor receptor superfamily with A, wide tissue distribution and involvement in lymphocyte activation. J Biol Chem 272, 14272-6.

Lentz SR, Tsiang M, and Sadler JE, (1991) Regulation of thrombomodulin by tumor necrosis factor-": comparison of transcriptional and posttranscriptional mechanisms. Blood 77, 542-50.

Lipsky PE, van der Heijde DM, St Clair EW, Furst DE, Breedveld FC, Kalden JR, Smolen JS, Weisman M, Emery P, Feldmann M, Harriman GR, and Maini RN, (2000) Infliximab and methotrexate in the treatment of rheumatoid arthritis. Anti-Tumor Necrosis Factor Trial in Rheumatoid Arthritis with Concomitant Therapy Study Group. N Engl J Med 343 1594-602.

Lu G, Janjic BM, Janjic J, Whiteside TL, Storkus WJ, and Vujanovic NL, (2002) Innate direct anticancer effector function of human immature dendritic cells. II. Role of TNF lymphotoxin-"(1)#(2) Fas ligand and TNF-related apoptosisinducing ligand. J Immunol 168, 1831-9.

Malik ST, Naylor MS, East N, Oliff A, and Balkwill FR, (1990) Cells secreting tumour necrosis factor show enhanced metastasis in nude mice. Eur J Cancer 26, 1031-4.

Malik STA, Griffin DB, Fiers A, and Ballwill FR, (1989) Paradoxical effects of tumour necrosis factor in experimental

ovarian cancer. Int J Cancer 44, 918.

Manna PP, and Mohanakumar T, (2002) Human dendritic cell mediated cytotoxicity against breast carcinoma cells in vitro.

J Leukoc Biol 72, 312-20.

Mauri DN, Ebner R, Montgomery RI, Kochel KD, Cheung TC, Yu GL, Ruben S, Murphy M, Eisenberg RJ, Cohen GH, Spear PG, and Ware CF, (1998) LIGHT A, new member of the TNF superfamily and lymphotoxin " are ligands for herpesvirus entry mediator. Immunity 8, 21-30.

Mauviel A, Heino J, Kahari VM, Hartmann DJ, Loyau G, Pujol JP, and Vuorio E, (1991) Comparative effects of interleukin1, and tumor necrosis factor-" on collagen production and corresponding procollagen mRNA levels in human dermal fibroblasts. J Invest Dermatol 96, 243-9.

McCarron SL, Edwards S, Evans PR, Gibbs R, Dearnaley DP, Dowe A, Southgate C, Easton DF, Eeles RA, and Howell WM, (2002) Influence of cytokine gene polymorphisms on the development of prostate cancer. Cancer Res 62, 336972.

Miles DW, Happerfield LC, Naylor MS, Bobrow LG, Rubens RD, and Balkwill FR, (1994) Expression of tumour necrosis factor (TNF") and its receptors in benign and malignant breast tissue. Int J Cancer 56, 777-82.

Miller A, Kraiem Z, Sobel E, Lider O, and Lahat N, (2000) Modulation of human leukocyte antigen and intracellular adhesion molecule-1, surface expression in malignant and nonmalignant human thyroid cells by cytokines in the context of extracellular matrix. Thyroid 10, 945-50.

Milligan SA, and Nopajaroonsri C, (2001) Inhibition of NF-!B with proteasome inhibitors enhances apoptosis in human lung adenocarcinoma cells in vitro. Anticancer Res 21, 3944.

Mizokami A, Gotoh A, Yamada H, Keller ET, and Matsumoto T, (2000) Tumor necrosis factor-" represses androgen sensitivity in the LNCaP prostate cancer cell line. J Urol 164, 800-5.

Montgomery RI, Warner MS, Lum BJ, and Spear PG, (1996) Herpes simplex virus-1, entry into cells mediated by A, novel member of the TNF/NGF receptor family. Cell 87, 427-36.

Moore RJ, Owens DM, Stamp G, Arnott C, Burke F, East N, Holdsworth H, Turner L, Rollins B, Pasparakis M, Kollias G, and Balkwill F, (1999) Mice deficient in tumor necrosis factor-" are resistant to skin carcinogenesis. Nat Med 5, 828-31.

Morris VL, Schmidt EE, MacDonald IC, Groom AC, and Chambers AF, (1997) Sequential steps in hematogenous metastasis of cancer cells studied by in vivo videomicroscopy. Invasion Metastasis 17, 281-96.

Mosialos G, Birkenbach M, Yalamanchili R, VanArsdale T, Ware C, and Kieff E, (1995) The Epstein-Barr virus transforming protein LMP1, engages signaling proteins for the tumor necrosis factor receptor family. Cell 80, 389-99.

Muzio M, Chinnaiyan A, Kischkel K, O'Rourke K, Shevchenko A, and Ni J, (1996) FLICE A, novel FADD homologous ICE/CED-3-like protease is recruited to the CD95, (Fas/APO-1) death-inducing signal complex. Cell 85, 817827.

Nagy JA, Masse EM, Herzberg KT, Meyers MS, Yeo KT, Yeo TK, Sioussat TM, and Dvorak HF, (1995) Pathogenesis of ascites tumor growth: vascular permeability factor vascular hyperpermeability and ascites fluid accumulation. Cancer Res 55, 360-8.

Nakano H, Oshima H, Chung W, Williams-Abbott L, Ware CF, Yagita H, and Okumura K, (1996) TRAF5, an activator of NF-!B and putative signal transducer for the lymphotoxin-# receptor. J Biol Chem 271, 14661-4.

Nakashima J, Tachibana M, Ueno M, Miyajima A, Baba S, and Murai M, (1998) Association between tumor necrosis factor

144

Cancer Therapy Vol 2, page 145 in serum and cachexia in patients with prostate cancer. Clin Cancer Res 4, 1743-8.

Natoli G, Costanzo A, Guido F, Moretti F, and Levrero M, (1998) Apoptotic non-apoptotic and anti-apoptotic pathways of tumor necrosis factor signalling. [49, refs]. Biochem Pharmacol 56, 915-20.

Naylor MS, Stamp GW, Foulkes WD, Eccles D, and Balkwill FR, (1993) Tumor necrosis factor and its receptors in human ovarian cancer. Potential role in disease progression. J Clin Invest 91, 2194-206.

Nickoloff BJ, Karabin GD, Barker JN, Griffiths CE, Sarma V, Mitra RS, Elder JT, Kunkel SL, and Dixit VM, (1991) Cellular localization of interleukin-8, and its inducer tumor necrosis factor-" in psoriasis. Am J Pathol 138, 129-40.

Nishitoh H, Saitoh M, Mochida Y, Takeda K, Nakano H, Rothe M, Miyazono K, and Ichijo H, (1998) ASK1, is essential for JNK/SAPK activation by TRAF2. Mol Cell 2, 389-95.

Nozawa F, Hirota M, Okabe A, Shibata M, Iwamura T, Haga Y, and Ogawa M, (2000) Tumor necrosis factor " acts on cultured human vascular endothelial cells to increase the adhesion of pancreatic cancer cells. Pancreas 21, 392-8.

Oberyszyn TM, Tober KL, Ross MS, and Robertson FM, (1998) Inhibitory effects of pentoxifylline on ultraviolet B lightinduced cutaneous inflammation. Mol Carcinog 22, 16-25.

Obrador E, Carretero J, Pellicer JA, and Estrela JM, (2001) Possible mechanisms for tumour cell sensitivity to TNF-" and potential therapeutic applications. Curr Pharm Biotechnol 2, 119-30.

Oh BR, Sasaki M, Perinchery G, Ryu SB, Park YI, Carroll P, and Dahiya R, (2000) Frequent genotype changes at -308, and 488, regions of the tumor necrosis factor-" (TNF-") gene in patients with prostate cancer. J Urol 163 1584-7.

Olsson I, Lantz M, Nilsson E, Peetrie C, Thysell H, Grubb A, and Adolf G, (1989) Isolation and Characterisation of A, TNF binding protein from Urine. Eur J Haematol 42, 270275.

Orosz P, Echtenacher B, Werner F, Ruschoff J, Weber D, and Mannel DN, (1993) Enhancement of experimental metastasis by tumor necrosis factor. J. Exp. Med 177, 1391-1398.

Osborn L, (1990) Leukocyte adhesion to endothelium in inflammation. Cell 62, 3-6.

Ostensen M, Thiele D, and Lipsky P, (1987) Tumor necrosis factor-" enhances cytolytic activity of human natural killer cells. J Immunol 138, 4185-91.

Pan G, K OR, Chinnaiyan AM, Gentz R, Ebner R, Ni J, and Dixit VM, (1997a) The receptor for the cytotoxic ligand TRAIL. Science 276, 111-3.

Pan G, Ni J, Wei YF, Yu G, Gentz R, and Dixit VM, (1997b) An antagonist decoy receptor and A, death domain-containing receptor for TRAIL [see comments]. Science 277, 815-8.

Parratto NP, Odebralski JM, and Kimura AK, (1989) Poorly metastatic tumor cell variants as primary targets of syngeneic antibody responses against murine melanoma. Cancer Res 49, 3722-8.

Partheniou F, Kelsey SM, Srinivasula SM, Newland AC, Alnemri ES, and Jia L, (2001) c-IAP1, blocks TNF"mediated cytotoxicity upstream of caspase-dependent and independent mitochondrial events in human leukemic cells.

Biochem Biophys Res Commun 287, 181-9.

Peppelenbosch M, Boone E, Jones GE, van Deventer S, Haegeman G, Fiers W, Grooten J, and Ridley AJ, (1999) Multiple signal transduction pathways regulate TNF-induced actin reorganization in macrophages: inhibition of Cdc42mediated filopodium formation by TNF. J Immunol 162, 837-45.

Pitti RM, Marsters SA, Ruppert S, Donahue CJ, Moore A, and Ashkenazi A, (1996) Induction of apoptosis by Apo-2, ligand A, new member of the tumor necrosis factor cytokine family.

J Biol Chem 271, 12687-90.

Porteu F, and Nathan CF, (1990) Shedding of tumor necrosis factor receptors by activated human neutrophils. J. Exp. Med 172, 599-607.

Prevost-Blondel A, Roth E, Rosenthal FM, and Pircher H (2000) Crucial role of TNF-" in CD8, T cell-mediated elimination of 3LL-A9, Lewis lung carcinoma cells in vivo. J Immunol 164, 3645-51.

Price LS, and Collard JG, (2001) Regulation of the cytoskeleton

by Rho-family GTPases: implications for tumour cell invasion. Semin Cancer Biol 11, 167-73.

Puls A, Eliopoulos AG, Nobes CD, Bridges T, Young LS, and Hall A, (1999) Activation of the small GTPase Cdc42, by the inflammatory cytokines TNF(") and IL-1, and by the Epstein-Barr virus transforming protein LMP1. J Cell Sci 112, 2983-92.

Quin Z, Kruger-Krasagakes S, Kunzendorf U, Hock H, Diamantstein T, and Blankenstein T, (1993) Expression of tumor necrosis factor by different tumor cell lines fesults either in tumor suppressoion or augmented metastasis. J Exp Med 178, 355-360.

Rao VH, Singh RK, Delimont DC, Finnell RH, Bridge JA, Neff JR, Garvin BP, Pickering DL, Sanger WG, Buehler BA, and Schaefer GB, (1999) Transcriptional regulation of MMP-9, expression in stromal cells of human giant cell tumor of bone by tumor necrosis factor-". Int J Oncol 14, 291-300.

Regnier CH, Song HY, Gao X, Goeddel DV, Cao Z, and Rothe M, (1997) Identification and characterization of an I!B kinase. Cell 90, 373-83.

Regnier CH, Tomasetto C, Moog-Lutz C, Chenard MP, Wendling C, Basset P, and Rio MC, (1995) Presence of A, new conserved domain in CART1, A, novel member of the tumor necrosis factor receptor-associated protein family which is expressed in breast carcinoma. J Biol Chem 270, 25715-21.

Renard N, Lienard D, Lespagnard L, Eggermont A, Heimann R, and Lejeune F, (1994) Early endothelium activation and polymorphonuclear cell invasion precede specific necrosis of human melanoma and sarcoma treated by intravascular highdose tumour necrosis factor " (rTNF ") Int J Cancer 57, 656-63.

Renkonen R, Mattila P, Majuri ML, Rabina J, Toppila S, Renkonen J, Hirvas L, Niittymaki J, Turunen JP, Renkonen O, and Paavonen T, (1997) In vitro experimental studies of sialyl Lewis x and sialyl Lewis A, on endothelial and carcinoma cells: crucial glycans on selectin ligands.

Glycoconj J 14, 593-600.

Robertson FM, Ross MS, Tober KL, Long BW, and Oberyszyn TM, (1996) Inhibition of pro-inflammatory cytokine gene expression and papilloma growth during murine multistage carcinogenesis by pentoxifylline. Carcinogenesis 17, 171928.

Rosen EM, Goldberg ID, Liu D, Setter E, Donovan MA, Bhargava M, Reiss M, and Kacinski BM, (1991) Tumor necrosis factor stimulates epithelial tumor cell motility.

Cancer Res 51, 5315-21.

Rothe M, Sarma V, Dixit VM, and Goeddel DV, (1995) TRAF2mediated activation of NF-!B by TNF receptor 2, and CD40.

Science 269, 1424-7.

Rothe M, Wong SC, Henzel WJ, and Goeddel DV, (1994) A, novel family of putative signal transducers associated with the cytoplasmic domain of the 75, kDa tumor necrosis factor receptor. Cell 78, 681-92.

Saito S, Kasai Y, Nomoto S, Fujiwara M, Akiyama S, Ito K, and Nakao A, (2001) Polymorphism of tumor necrosis factor in esophageal gastric or colorectal carcinoma.

Hepatogastroenterology 48, 468-70.

Saklatvala J, (1986) Tumour necrosis factor " stimulates

145

Waterston and Bower: TNF and cancer: good or bad? resorption and inhibits synthesis of proteoglycan in cartilage.

Nature 322, 547-9.

Saklatvala J, Sarsfield SJ, and Townsend Y, (1985) Pig interleukin 1. Purification of two immunologically different leukocyte proteins that cause cartilage resorption lymphocyte activation and fever. J Exp Med 162, 1208-22.

Sanchez-Alcazar JA, Schneider E, Hernandez-Munozz I, RuizCabello J, Siles-Rivas E, Borstein B, Brea G, Arenas J, Garesse R, Solis-Herruzo JA, Knox A, and Navas P, (2002) Reactive oxygen species mediate the down-regulation of mitochondrial transcripts and proteins by Tumor Necrosis Factor-" in L929, cells. Biochem J 6.

Sati HI, Greaves M, Apperley JF, Russell RG, and Croucher PI, (1999) Expression of interleukin-1# and tumour necrosis factor-" in plasma cells from patients with multiple myeloma. Br J Haematol 104, 350-7.

Sato T, Irie S, and Reed JC, (1995) A, novel member of the TRAF family of putative signal transducing proteins binds to the cytosolic domain of CD40. FEBS Lett 358, 113-8.

Sawada M, Kondo N, Suzumura A, and Marunouchi T, (1989) Production of tumor necrosis factor-" by microgle and astrocytes in culture. Brain Res 491, 394-97.

Scheurich P, Thoma B, Ucer U, and Pfizenmaier K, (1987) Immunoregulatory activity of recombinant human tumor necrosis factor (TNF)-": induction of TNF receptors on human Tcells and TNF-"-mediated enhancement of Tcell responses. J Immunol 138, 1786-90.

Schleiffenbaum B, and Fehr J, (1990) The tumor necrosis factor receptor and human neutrophil function. Deactrivation and cross-deactivation of tumor necrosis factor-induced neutrophil responses by receptor down-regulation. J Clin Invest 86, 184-95.

Schroder JM, Sticherling M, Heinneicke HH, Preissner WC, and Christophers E, (1990) IL-1" or tumor necrosis factor-" stimulate release of three NAP- 1/IL-8-related neutrophil chemotactic protiens in human dermal fibroblasts. J Immunol 144, 2223-32.

Seelentag WK, Mermod JJ, Montesano R, and Vassalli P, (1987) Additive effects of interleukin-1, and tumor necrosis factor-" on the accumulation of the three granulocyte and macrophage colony stimulating factor mRNA in human endothelial cells. EMBO J 6, 2261-65.

Selby P, Hobbs S, Viner C, Jackson E, Jones A, Newell D, Calvert AH, McElwain T, Fearon K, Humphreys J, and et al (1987) Tumour necrosis factor in man: clinical and biological observations. Br J Cancer 56, 803-8.

Selmaj KW, Farooq M, Norton WT, Raine CS, and Brosnan CF, (1990) Proliferation of astrocytes in vitro in response to cytokines. A, primary role for tumor necrosis factor. J Immunol 144, 129-35.

Shalinsky DR, Brekken J, Zou H, McDermott CD, Forsyth P, Edwards D, Margosiak S, Bender S, Truitt G, Wood A, Varki NM, and Appelt K, (1999) Broad antitumor and antiangiogenic activities of AG3340, A, potent and selective MMP inhibitor undergoing advanced oncology clinical trials.

Ann N Y Acad Sci 878, 236-70.

Sheridan JP, Marsters SA, Pitti RM, Gurney A, Skubatch M, Baldwin D, Ramakrishnan L, Gray CL, Baker K, Wood WI, Goddard AD, Godowski P, and Ashkenazi A, (1997) Control of TRAIL-induced apoptosis by A, family of signaling and decoy receptors [see comments]. Science 277, 818-21.

Shi CS, and Kehrl JH, (1997) Activation of stress-activated protein kinase/c-Jun N-terminal kinase but not NF-!B by the tumor necrosis factor (TNF) receptor 1, through A, TNF receptor-associated factor 2- and germinal center kinase related-dependent pathway. J Biol Chem 272, 32102-7.

Shin KY, Moon HS, Park HY, Lee TY, Woo YN, Kim HJ, Lee SJ, and Kong G, (2000) Effects of tumor necrosis factor-"

and interferon-$ on expressions of matrix metalloproteinase2, and -9, in human bladder cancer cells. Cancer Lett 159, 127-34.

Shiozaki H, Tahara H, Oka H, Miyata M, Kobayashi K, Tamura S, Iihara K, Doki Y, Hirano S, Takeichi M, and et al, (1991) Expression of immunoreactive E-cadherin adhesion molecules in human cancers. Am J Pathol 139, 17-23.

Simiantonaki N, Jayasinghe C, and Kirkpatrick CJ, (2002) Effect of pro-inflammatory stimuli on tumor cell-mediated induction of endothelial cell adhesion molecules in vitro.

Exp Mol Pathol 73 46-53.

Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L Hughes TM, Hill D, Pattison W, Campbell P, Boyle WJ, and et al, (1997) Osteoprotegerin: A, novel secreted protein involved in the regulation of bone density [see comments].

Cell 89, 309-19.

Smith CA, Farrah T, and Goodwin RG, (1994) The TNF receptor superfamily of cellular and viral proteins: activation costimulation and death. [26, refs]. Cell 76, 959-62.

Song HY, Regnier CH, Kirschning CJ, Goeddel DV, and Rothe M, (1997) Tumor necrosis factor (TNF)-mediated kinase cascades: bifurcation of nuclear factor-!B and c-jun Nterminal kinase (JNK/SAPK) pathways at TNF receptorassociated factor 2. Proc Natl Acad Sci U S A, 94, 9792-6.

Stearns ME, and Wang M, (1993) Type IV collagenase (M(r) 72000) expression in human prostate: benign and malignant tissue. Cancer Res 53 878-83.

Stebbing J, Benson C, Eisen T, Pyle L, Smalley K, Bridle H, Mak I, Sapunar F, Ahern R, and Gore ME, (2001) The treatment of advanced renal cell cancer with high-dose oral thalidomide. Br J Cancer 85, 953-8.

Stein M, and Gordan S, (1991) Regulation of tumor necrosis factor (TNF) release by murine macrophages: role of cell stimulation and specific phagocytic plasma membrane receptors. Eur J Immunol 21, 431-37.

Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick MD, Kasper J, Dzuiba J, Van Damme J, Walz A, Marriott D, and et al, (1995) The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J Biol Chem 270, 27348-57.

Suganuma M, Okabe S, Marino MW, Sakai A, Sueoka E, and Fujiki H, (1999) Essential role of tumor necrosis factor " (TNF-") in tumor promotion as revealed by TNF-"-deficient mice. Cancer Res 59, 4516-8.

Sung S, Jung L, Walters J, Chen W, Wang C, and Fu S, (1988) Production of tumor necrosis factor/cachectin by human Bcell lines and tonsillar B cells. J Exp Med 168, 1539-51.

Tanaka M, Fuentes ME, Yamaguchi K, Durnin MH, Dalrymple SA, Hardy KL, and Goeddel DV, ( 1999) Embryonic lethality liver degeneration and impaired NF-!B activation in IKK-#deficient mice. Immunity 10, 421-9.

Thoma B, Grell M, Pfizenmaier K, and Scheurich P, (1990) Identification of A, 60-kD tumor necrosis factor (TNF) receptor as the major signal transducing component in TNF responses. J Exp Med 172, 1019-23.

Thomsen LL, Lawton FG, Knowles RG, Beesley JE, RiverosMoreno V, and Moncada S, (1994) Nitric oxide synthase activity in human gynecological cancer. Cancer Res 54, 1352-4.

Thorbecke GJ, Shah R, Leu CH, Kuruvilla AP, Hardison AM, and Palladino MA, (1992) Involvement of endogenous tumor necrosis factor " and transforming growth factor # during induction of collagen type II arthritis in mice. Proc Natl Acad Sci U S A, 89, 7375-9.

Tohma Y, Yamashima T, and Yamashita J, (1992)

146

Cancer Therapy Vol 2, page 147 Immunohistochemical localization of cell adhesion molecule epithelial cadherin in human arachnoid villi and meningiomas. Cancer Res 52, 1981-7.

Tokiwa G, Dikic I, Lev S, and Schlessinger J, (1996) Activation of Pyk2, by stress signals and coupling with JNK signaling pathway. Science 273 792-4.

Tracey KJ, Fong Y, Hesse DG, Manogue KR, Lee AT, Kuo GC, Lowry SF, and Cerami A, (1987) Anti-cachectin/TNF monoclonal antibodies prevent septic shock during lethal bacteraemia. Nature 330, 662-4.

Trinchieri G, Kobayashi M, Rosen M, Loudon R, Murphy M, and Perussia B, (1986) Tumor necrosis factor and lymphotoxin induce differentiation of human myeloid cell lines in synergy with immune interferon. J Exp Med 164, 1206-25.

Varela LM, Stangle-Castor NC, Shoemaker SF, Shea-Eaton WK and Ip MM, (2001) TNF" induces NF!B/p50, in association with the growth and morphogenesis of normal and transformed rat mammary epithelial cells. J Cell Physiol 188, 120-31.

Varfolomeev E, Boldin M, Goncharov T, and Wallach D, (1996) A, Potential Mechanism of "Cross-Talking" between the p55, Tumor Necrosis Factor Receptor and Fas/APO1:Protein Binding to the Death Domains of the Two Receptors Also Bind Each Other. J. Exp. Med 183 1271-1275.

Voura EB, Ramjeesingh RA, Montgomery AM, and Siu CH, (2001) Involvement of integrin "(v)#(3) and cell adhesion molecule L1, in transendothelial migration of melanoma cells. Mol Biol Cell 12, 2699-710.

Wallach D, Kovalenko AV, Varfolomeev EE, and Mark PB, (1998) Death-inducing functions of lignads of the tumor necrosis factor faily: A, Sanhedrin verdict. Current opinion in Immunology 10, 279-288.

Wang JM, Walter S, and Mantovani A, (1990) Re-evaluation of the chemotactic activity of tumour necrosis factor for monocytes. Immunology 71, 364-7.

Warner SJC, and Libby P, (1989) Human vascular smooth muscle cells. Target for and source of tumor necrosis factor.

J Immunol 142, 100-9.

Warzocha K, Ribeiro P, Renard N, Bienvenu J, Charlot C, Coiffier B, and Salles G, (2000) Expression of genes coding for the tumor necrosis factor and lymphotoxin ligandreceptor system in non-Hodgkin's lymphomas. Cancer Immunol Immunother 49, 469-75.

Warzocha K, Salles G, Bienvenu J, Bastion Y, Dumontet C, Renard N, Neidhardt-Berard EM, and Coiffier B, (1997) Tumor necrosis factor ligand-receptor system can predict treatment outcome in lymphoma patients. J Clin Oncol 15, 499-508.

Watanabe N, Niitsu Y, Neda H, Sone H, Yamauchi N, Maeda M, and Urushizaki I, (1988a) Cytocidal mechanism of TNF: effects of lysosomal enzyme and hydroxyl radical inhibitors on cytotoxicity. Immunopharmacol Immunotoxicol 10, 10916.

Watanabe N, Niitsu Y, Umeno H, Kuriyama H, Neda H, Yamauchi N, Maeda M, and Urushizaki I, (1988b) Toxic effect of tumor necrosis factor on tumor vasculature in mice.

Cancer Res 48, 2179-83.

Watanabe N, Niitsu Y, Umeno H, Kuriyama H, Neda H,

Yamauchi N, Maeda M, and Urushizaki I (1988c) Synergistic cytotoxic and antitumor effects of recombinant human tumor necrosis factor and hyperthermia. Cancer Res 48, 650-3.

Watanabe N, Niitsu Y, Umeno H, Kuriyama H, Neda H, Yamauchi N, Maeda M, and Urushizaki I (1988d) Synergistic cytotoxicity of recombinant human TNF and various anti-cancer drugs.

Immunopharmacol Immunotoxicol 10, 117-27.

Wiley SR, Schooley K, Smolak PJ, Din WS, Huang CP, Nicholl JK, Sutherland GR, Smith TD, Rauch C, Smith CA, and et al, (1995) Identification and characterization of A, new member of the TNF family that induces apoptosis.

Immunity 3 673-82.

Williams RO, Feldmann M, and Maini RN, (1992) Anti-tumor necrosis factor ameliorates joint disease in murine collageninduced arthritis. Proc Natl Acad Sci U S A, 89, 9784-8.

Winston BW Chan ED Johnson GL and Riches DW (1997) Activation of p38mapk MKK3 and MKK4, by TNF-" in mouse bone marrow-derived macrophages. J Immunol 159, 4491-7.

Wu W, Yamaura T, Murakami K, Ogasawara M, Hayashi K, Murata J, and Saiki I, (1999) Involvement of TNF-" in enhancement of invasion and metastasis of colon 26-L5, carcinoma cells in mice by social isolation stress. Oncol Res 11, 461-9.

Yao B, Zhang Y, Delikat S, Mathias S, Basu S, and Kolesnick R, (1995) Phosphorylation of Raf by ceramide-activated protein kinase. Nature 378, 307-10.

Yokota S, Geppert T, and Lipsky P, (1988) Enhancement of antigen- and mitogen-induced human T lymphocyte proliferation by tumor necrosis factor-". J Immunol 140, 531-36.

Yoshida S, Ono M, Shono T, Izumi H, Ishibashi T, Suzuki H, and Kuwano M ,(1997) Involvement of interleukin-8, vascular endothelial growth factor and basic fibroblast growth factor in tumor necrosis factor "-dependent angiogenesis. Mol Cell Biol 17, 4015-23.

Yujiri T, Sather S, Fanger GR, and Johnson GL, (1998) Role of MEKK1, in cell survival and activation of JNK and ERK pathways defined by targeted gene disruption. Science 282, 1911-4.

Zhai Y, Guo R, Hsu TL, Yu GL, Ni J, Kwon BS, Jiang GW, Lu J, Tan J, Ugustus M, Carter K, Rojas L, Zhu F, Lincoln C, Endress G, Xing L, Wang S, Oh KO, Gentz R, Ruben S, Lippman ME, Hsieh SL, and Yang D, (1998) LIGHT A, novel ligand for lymphotoxin # receptor and TR2/HVEM induces apoptosis and suppresses in vivo tumor formation via gene transfer. J Clin Invest 102, 1142-51.

Zouboulis CC, Schroder K, Garbe C, Krasagakis K, Kruger S, and Orfanos CE, (1990) Cytostatic and cytotoxic effects of recombinant tumor necrosis factor-" on sensitive human melanoma cells in vitro may result in selection of cells with enhanced markers of malignancy. J Invest Dermatol 95, 223S-230S.

147

Waterston and Bower: TNF and cancer: good or bad?

148

Cancer Therapy Vol 2, page 149 Cancer Therapy Vol 2, 149-151, 2004

Vincristine induced severe SIADH: potentiation with itraconazole Case Report

Cecile Taflin1, Hassane Izzedine1*, Vincent Launay-Vacher1, Olivier Rixe2, David Khayat2, Gilbert Deray1 Departments of 1Nephrology and 2Clinical Oncology, Pitié-Salpêtrière Hospital, Paris, France

__________________________________________________________________________________ *Correspondence: Hassane Izzedine, M.D., Pitié Salpêtrière Hospital, 47-83 Boulevard de l’Hôpital, 75013 Paris; Telephone: +33 1.42.17.72.26; Fax: +33 1.42.17.72.32; E-mail: hassan.izzedine@psl.ap-hop-paris.fr Key Words: SIADH, Vincristine, itraconazole Abbreviations: multiple myeloma (MM); Syndrome of inappropriate antidiuretic hormone secretion, (SIADH); vincristine, (VCR) Received: 6 May 2004; Accepted: 14 May 2004; electronically published: May 2004

Summary This study reports on a 50 year-old woman with multiple myeloma who developed severe syndrome of inappropriate antidiuretic hormone secretion (SIADH) when antifungal drugs and vincristine (VCR) were concomitantly administered. Moderate hyponatremia was observed after a second course of VCR without clinical symptoms. Neuropathy, bone marrow toxicity, and severe SIADH appeared during the third chemotherapy course when VCR was administered with itraconazole. Therefore we suggest that itraconazole has potentiated the severity of VCR neurotoxicity. Some 20 cases of drug interaction with VCR enhancing SIADH severity have been reported in the literature. In those patients, a single dose of VCR could induce severe neurotoxicity, which was in contrast with common VCR toxicity features that are usually dose-dependent and correlated with administration frequency.

VCR metabolism involves the hepatic cytochrome P450 3A. Substrates and inhibitors of CYP3A enzymes may thus impair VCR metabolism.

(MM) which had been diagnosed in August 2003.

Chemotherapy with dexamethasone, VCR and adriamycin was started. The first course was held in September 2003 with a sodium level at 142 mmol/L before treatment. No complication was reported at that time. On the second course (October 2003), sodium level was 134 mmol/l and decreased to 129 mmol/l on November 17th (D22 after the second administration) without any symptom.

Normalisation at 136 mmol/l occurred on November 20th.

At that time, the patient presented as an emergency with fever, inflammatory syndrome and an interstitial syndrome of the lung. Triple antibiotic therapy was started with macrolide, trimethoprim-sulfamethoxazole and cephalosporin. An antifungal treatment with itraconazole was also initiated. Serum sodium level continued to increase until 145 mmol/L before the third VCR course was (November 25th). Seven days later, she developed paralytic ileus (abdominal distension and constipation) and fever. Chest and abdominal plain X-ray showed a pulmonary interstitial edema and apparent redistribution of pulmonary blood volume, normal heart size and gaseous distension of the large bowel loops. Blood examination showed sodium level at 126 mmol/l, potassium 2.7 mmo/l, bicarbonates 16 mmol/l, creatinine 60 µmol/l, blood urea nitrogen 3 mmol/l, hemoglobin 11.3 mmol/l, red blood

I. Introduction The first case of syndrome of inappropriate secretion of antidiuretic hormone (SIADH) was reported by Schwartz (1957) based on the following cardinal findings: (1) hyponatremia with corresponding hypoosmolality of the serum and extracellular fluid, (2) continued renal excretion of sodium, (3) absence of clinical evidence for fluid volume depletion, (4) increased urine osmolality as compared to concomitant osmolality of the plasma, and (5) normal function of the kidneys, suprarenal glands and thyroid glands. SIADH may be caused by various conditions including cytotoxic drugs such as vincristine (VCR). Around 76 cases of hyponatremia and/or SIADH associated with VCR have been reported. In addition, it has been recently reported that drug-drug interactions may also be responsible for VCR-induced hyponatremia and neurotoxicity. We report here the case of a 50 year-old woman with multiple myeloma who developed a severe SIADH when concomitantly administering an antifungal drug and VCR.

II. Case report A 50 year-old white woman was admitted for medullar compression secondary to multiple myeloma

149

Taflin et al: Vincristine induced severe SIADH cells 16000, C-reactive protein 5 mg/L. Electrocardiography was normal, echocardiography showed normal ejection fraction and wall motion. The pulmonary wedge pressure was below the normal. A gastric decompression by nasogastric tube insertion and parenteral nutrition with electrolytes supplementation was started. Abdominal discomfort and distension improved progressively within 15 days. At the same time, she developed generalised paresthesia, respiratory distress, headaches, nausea, agitation and somnolence without seizures or focal neurologic deficit. Laboratory values revealed: sodium 108 mmol/L, potassium 3.2 mmol/L, and bicarbonates 16 mmol/L. She was treated with 3% saline solution infusion and necessitated several days of mechanical ventilation. Serial blood, bronchoalveolar fluid and lumbar cerebrospinal fluid cultures were negative. She was then transferred to our department with a serum sodium level of 119 mmol/L. Clinically, there was no sign of edema or volume depletion. Blood pressure was 145/85 mmHg. Laboratory values revealed: serum sodium 117 mmol/L, potassium 3.7 mmol/L, blood urea nitrogen 1.7 mmol/L, creatinine 50 Âľmol/L, uric acid 84 Âľmol/L, glucose 4.94 mmol/L, protein 74 g/L, plasma osmolality 251.6 mOsm/L, urine osmolality 535 mOsm/L, urine sodium 209 mmol/24 h, urine potassium 8 mmol/24 h. no glycosuria. Thyroid, adrenal and hepatic function tests were normal.

Antidiuretic hormone level was in the normal range (2.2 pg/ml, N 2-3 pg/ml) but inappropriately high for the serum osmolality. The diagnosis of SIADH was made and total water intake was restricted. VCR and antimicrobial agents were stopped. The patient was discharged on day 10 with a serum sodium level at 138 mmol/L. Two months later, a fourth chemotherapy course excluding VCR was administered without any changes in serum sodium levels.

well as the doses (Kosmidis et al, 1991; Sathiapalan and El-Solh, 2001). Clinically, patients may complain for fatigue, anorexia, nausea, diarrhoea and headaches. When the serum sodium falls below 115, altered mental status, confusion, lethargy, psychosis, seizures, coma and occasionally death may occur. Rarely, focal neurologic signs are present. Some risk factors have been reported for the development of VCR-induced SIADH including Asian patients (Hammond et al, 2002), patients with liver disease (Nishihori et al, 2000), HIV patients (Othieno-Abinya and Nyabola, 2001) and old patients (Langfeldt and Cooley, 2003).

The pathogenesis of VCR-induced SIADH is not clear. It seems to be a multifactorial direct toxicity on central nervous system (inhibitory mechanism of the supraoptic nucleus neurosecretion) (Rufener et al, 1972; Tomiwa et al, 1983) and renal tubules (Philip et al, 1979).

Miller and Moses suggested that VCR may induce potentiation of vasopressin action in the kidney.

Furthermore, VCR interfere with cells microtubules assemblage and can disturb the transfer of H20 and blood urea nitrogen across distal and collecting tubules cells (Philip et al, 1979).

There have been approximately 20 cases reported in the literature of drug-drug interaction between azole antifungals and VCR enhancing severity of SIADH (Fine et al, 1966; Fedeli et al, 1989; Kivisto et al, 1995; Gillies et al, 1998; Jeng and Feusner, 2001; Kamaluddin et al, 2001; Sathiapalan and El-Solh, 2001; Sathiapalan et al, 2002). The first cases between VCR and itraconazole were reported in children by Murphy et al, in 1995 and then in adults by Bohme et al, the same year. In those patients, seizures, SIADH and severe paralytic ileus (with one case of bowel perforation) occurred more frequently with the association than when VCR administered alone (Kamaluddin et al, 2001). Furthermore, a single dose of VCR may also induce severe neurotoxicity, which contrasts with common toxicity features of VCR that are usually dose-dependent and correlate with administration frequency (Sathiapalan et al, 2002). Usually neurotoxicity occurs five days after administration of VCR and 2 to 4 weeks after starting itraconazole. SIADH persists for about 10 days after fluid restriction and discontinuation of itraconazole. No recurrence of SIADH after treatment with VCR without itraconazole and with concomitant fluid restriction is usually observed (Gillies et al, 1998; Sathiapalan and El-Solh, 2001). VCR metabolism involves hepatic cytochrome P450 3A subfamily (CYP3A). Indeed, all substrates and/or inhibitors or inducers of CYP3A such as azole antifungals (Gillies et al, 1998; Jeng and Feusner, 2001; Kamaluddin et al, 2001; Sathiapalan and El-Solh, 2001; Sathiapalan et al, 2002), nifedipine (Fedeli et al, 1989; Sathiapalan and El-Solh, 2001), cyclosporine (Kivisto et al, 1995), or isionazid may thus impair VCR metabolism. Another mechanism of interaction is by an inhibition of P-glycoprotein-mediated drug efflux, resulting in high intracellular VCR levels. Nifedipine, which inhibits P-glycoprotein, may thus block the efflux of VCR from intracellular sites, resulting in prolonged VCR half-life and increased area under the curve (Nishihori et al, 2000).

III. Discussion In our patient, hyponatremia appeared 7 days after VCR was started and improved after 10 days on fluid restriction. Furthermore, serum sodium level gradually improved to 140 mmol/l. There was no recurrence of hyponatremia with the reintroduction of chemotherapy excluding VCR. All the cardinals signs for SIADH were present: hyponatremia, serum hypo-osmolality, continued renal excretion of sodium, absence of clinical evidence of fluid volume depletion, osmolality of the urine greater than that appropriate for the concomitant osmolality of the plasma, normal function of kidneys, suprarenal and thyroid glands. For these reasons, hyponatremia was attributed to VCR. The overall reported rate of SIADH associated with VCR is very low, around 1.3/100 000 treated patients. The first case reported of SIADH in VCR therapy was reported

by Fine et al, in 1966. The average age of the patients who present this side effect is 35.6 +/- 28.3 years, 62% are males and racial distribution is predominantly Asians patients (Hammond et al, 2002). SIADH usually occurs between 4 to 10 days after VCR administration and improves 1 week after starting symptomatic treatment (Stuart et al, 1975). The severity and frequency of SIADH is correlated with the frequency of VCR administration as 150

Cancer Therapy Vol 2, page 151 Jeng MR, Feusner J (2001) Itraconazole-enhanced vincristine neurotoxicity in a child with acute lymphoblastic leukemia.

Pediatr Hematol Oncol 18, 137-42.

Kamaluddin M, McNally P, Breatnach F, O Marcaigh A, Webb D, O Dell E, Scanlon P, Butler K and O Meara A (2001) Potentiation of vincristine toxicity by itraconazole in children with lymphoid malignancies. Acta Paediatr 90, 1204-1207.

Kivisto KT, Kroemer HK, Eichelbaum M (1995) The role of human cytochrome P450 enzymes in the metabolism of anticancer agents: implications for drug interactions. Br J Clin Pharmacol 40, 523-30.

Kosmidis HV, Bouhoutsou DO, Varvoutsi MC, Papadatos J, Stefanidis CG, Vlachos P, Scardoutsou A, Kostakis A (1991) Vincristine overdose: experience with 3 patients. Pediatr Hematol Oncol 8, 171-8.

Langfeldt LA, Cooley ME (2003) Syndrome of innapropriate antidiuretic hormone secretion in malignancy: review and implications for nursing management. Clin J Oncol Nurs 7, 425-30.

Murphy JA, Ross LM, and Gibson BES (1995) Vincristine toxicity in five children with acute lymphoblastic leukaemia.

Lancet 346, 443.

Nishihori Y Yamauchi N, Kuribayashi K, Sato Y, Morii K, Hirayama Y, Sakamaki S Honma H, Suzuki N, Kudo T, Niitsu Y (2000) Severe hemolysis and SIADH- like symptoms induced by vincristine in an ALL patient with liver cirrhosis. Rinsho ketsueki 41, 1231-7.

Othieno-Abinya NA, Nyabola LO (2001) Experience with vincristine--associated neurotoxicity. East Afr Med J 78, 376-8.

Philip T, Souillet G, Gharib C, Geelen G, Allevard AM, Hartemann E, David M (1979) Inappropriate secretion of antiduiuretic hormone during acute leukaemia treated with vincristine. Two cases. Nouv Presse Med 8, 2181-5.

Pierga JY, Beuzeboc P, Dorval T, Palangie T, Pouillart P (1992) Favourable outcome after plasmapheresis for vincristine overdose. Lancet 340, 185.

Rufener C, Nordmann J, Rouiller C (1972) Effect of vincristine on the rat posterior pituitary in vitro] Neurochirurgie 18, 137-41.

Sathiapalan RK, Al-Nasser A, El-Solh H, Al-Mohsen I, AlJumaah S (2002) Vincristine-itraconazole interaction: cause for increasing concern. J Pediatr Hematol Oncol 24, 591.

Sathiapalan RK, El-Solh H. (2001) Enhanced vincristine neurotoxicity from drug interactions: case report and review of literature. Pediatr Hematol Oncol 18, 543-6.

Schwartz WB, Bennet W, Curelop S, Bartter FC (1957) A syndrome of renal sodium loss and yponatremia probably resulting from inappropriate secretion of antidiuretic hormone. Am. J Med 23, 529-542.

Stuart MJ, Cuaso C, Miller M, Oski FA (1975) Syndrome of recurrent increased secretion of antidiuretic hormone following multiple doses of vincristine. Blood 45, 315-20.

Tomiwa K, Mikawa H, Hazama F, Yazawa K, Hosoya R, Ohya T, Nishimura K (1983) Syndrome of inappropriate secretion of antidiuretic hormone caused by vincristine therapy: a case report of the neuropathology. J Neurol 229, 267-72.

In our case, neuropathy, bone marrow toxicity and hyponatremia appeared when VCR and an azole antifungal were administered together. Since only moderate hyponatremia with no clinical symptoms was observed after the second course when VCR was administered alone, we therefore suggest that itraconazole has potentiated the severity of VCR neurotoxicity.

Symptomatic treatment of SIADH associated with VCR is mainly based on fluid restriction that may be be associated with administration of hypertonic saline solution and intravenous furosemide diuresis.

There are no specific treatments of VCR neurotoxicity. However, an attempt of increased plasma clearance of the drug with exchange transfusions has been performed with favourable outcome in most cases. Pierga et al, also reported one case of favorable outcome with plasmapheresis for VCR overdose (Pierga et al, 1992).

Acid folinic was also shown to protect mice from a lethal dose of VCR. Glutamic acid, which was tried by Jackson et al, (Jackson et al, 1988), may decrease VCR-induced neurotoxicity without side effects. Trials with aminoacid, pyridoxine and B12 were unsuccessful.

In conclusion, this case outlines the importance of drug-drug interactions that may result in increased VCR neurotoxicity. Caution is mandatory when using drugs that potentially interact with CYP or P-glycoprotein pumps.

The occurrence of SIADH following VCR does not preclude a further safe usage of this drug if prevention by prophylactic rigorous fluid restriction and appropriate association of drugs are respected.

References Bohme A, Ganser A. and Hoelzer D (1995) Aggravation of Vincristine-induced neurotoxicity by itraconazole in the treatment of adult ALL. Ann Hematol 71, 311-312.

Fedeli L, Colozza M, Boschetti E, Sabalich I, Aristei C, Guerciolini R, Del Favero A, Rossetti R, Tonato M, Rambotti P, et al (1989) Pharmacokinetics of vincristine in cancer patients treated with nifedipine. Cancer 64, 1805-11.

Fine RN, Clarke RR, Shore NA (1966) Hyponatremia and vincristine therapy. Syndrome possibly resulting from inappropriate antidiuretic hormone secretion. Am J Dis Child 112, 256-9.

Gillies J, Hung KA, Fitzsimons E, Soutar R (1998) Severe vincristine toxicity in combination with itraconazole. Clin Lab Haematol 20, 123-4.

Hammond IW, Ferguson JA, Kwong K, Muniz E, Delisle F (2002) Hyponatremia and syndrome of inappropriate antidiuretic hormone reported with the use of Vincristine: an over-representation of Asians? Pharmacoepidemiol Drug Saf 11, 229-34.

Jackson DV, Wells HB, Atkins JN, Zekan PJ, White DR, Richards F 2nd, Cruz JM, Muss HB (1988) Amelioration of vincristine neurotoxicity by glutamic acid. Am J Med 84, 1016-22.

151

Taflin et al: Vincristine induced severe SIADH

152

Cancer Therapy Vol 2, page 153 Cancer Therapy Vol 2, 153-166, 2004

COX-2 independent induction of apoptosis by etodolac in leukemia cells in vitro and growth inhibition of leukemia cells in vivo Research Article 1*

1

2

1

Satoki Nakamura , Miki Kobayashi , Kiyoshi Shibata Naohi Sahara , Kazuyuki 1 1 1 1 Shigeno , Kaori Shinjo , Kensuke Naito , Kazunori Ohnishi 1

2

Department of Internal Medicine III, Research equipment center, Hamamatsu University School of Medicine, 1-20-1 Handayama, Hamamatsu city, Shizuoka 431-3192, Japan

__________________________________________________________________________________ *Correspondence: Dr. Satoki Nakamura, Department of Internal Medicine III, Hamamatsu University School of Medicine, 1-20-1 Handayama, Hamamatsu city, Shizuoka 431-3192, Japan; Tel: +81-53-435-2267; Fax: +81-53-434-2910; E-mail: satonaka@hamamed.ac.jp Key Words: COX-2, apoptosis, leukemia cells, growth inhibition, PGE2, NSAIDs Abbreviations: 3-(4,5-dimethylthiazol-2–yl) –2,5–diphenyltetrazolium bromide, (MTT); American Type Culture Collection, (ATCC); B-chronic lymphocytic leukemia, (CLL); cellular IAP-1, (cIAP-1); Cyclooxygenase-2, (COX-2); dimethyl sulfoxide, (DMSO); fetal calf serum, (FCS); inhibitor of apoptosis, (IAP); mouse monoclonal anti-caspase-3, (CPP32); multiple myeloma, (MM); Non-steroidal antiinflammatory drugs, (NSAIDs); propidium iodide, (PI); prostaglandin, (PG); Tris-buffered saline Tween, (TBS-T); X-linked IAP, (XIAP); Received: 19 March 2004; Accepted: 18 May 2004; Revised: 20 May 2004; electronically published: 21 May 2004

Summary Cyclooxygenase-2 (COX-2) has been reported to regulate apoptosis and influence the growth of malignancies. In this study, we demonstrated that etodolac, a COX-2 inhibitor, inhibited proliferation and induced apoptosis in leukemia K562, NB4, U937, HL60, and CEM cells via a COX-2 independent pathway. Etodolac induced apoptosis in a dose-dependent manner, which was associated with i) down-regulation of anti-apoptotic bcl-2, ii) activation of caspase –9, -7 and –3, iii) down-regulation of caspase inhibitors, c-IAP-1 and survivin, and iv) breakdown of the mitochondrial membrane potential. In vivo, etodolac also reduced the growth of K562 cells. Moreover, we found that 100 µM R- etodolac, S- etodolac, and the combination of R- and S- etodolac slightly inhibited the proliferation of leukemia cells, while 100 µM etodolac significantly inhibited the proliferation of leukemia cells. In conclusion, our findings further indicate that etodolac induce apoptosis in leukemia cells in vitro and inhibited tumor growth in a K562 nude mouse xenograft.

2002). COX-2 overexpression has been reported in cancers of the colon (Piazza et al, 1997; Yamazaki et al, 2002), pancreas (Molina et al, 1999), breast (Half et al, 2002), lung (Hida et al, 1998), and mucous membrane of the head and neck (Wilson et al, 1998; Liu et al, 2001).

The anti-proliferative and pro-apoptotic effects of selective COX-2 inhibitors have been reported recently for various cancers (Soslow et al, 2000; Nakanishi et al, 2001; Sun et al, 2002). Therefore, COX-2 might be a molecular target for cancer therapy. In the molecular mechanisms of COX-2 inhibitors, the pro-apoptotic effects of these might be exerted through down-regulation of anti-apoptotic molecules induced by COX-2. However, it was shown that some COX-2 inhibitors such as celecoxib induced

I. Introduction Non-steroidal anti-inflammatory drugs (NSAIDs) have been shown to exert anti-proliferative and proapoptotic effects on various cancer cell lines (Thun et al, 1991; Sun et al, 2002) and animal models of a variety of cancers, particularly colon cancer (Oshima et al, 1996; Kawamori et al, 1998). Cyclooxygenase (COX), a key enzyme was required for prostaglandin (PG) synthesis (Shattuck-Brandt et al, 2000). There are two different isoforms, that is, COX-1 is expressed constitutively in most tissues, whereas COX-2 is inducible through many pathological processes such as inflammation and in bearing cancers (Kujubu et al, 1991; Yamazaki et al,

153

Nakamura et al: COX-2 induction of apoptosis in leukemia cells apoptosis in tumor cells which did not express the COX-2 enzyme, and COX-2 was not required as the effects of COX-2 inhibitors on induction of apoptosis.

In a family of proteins regulating apoptosis, bcl-2 inactivates pro-apoptotic molecules such as bax, bak, Puma, Noxa, and BID by heterodimerization (Cheng et al, 2001), and acts on the release of cytochrome c by interference with the mitochondrial megapore complex (PT pore) (Shimizu et al, 1999, 2000). Apoptosis by triggering the loss of mitochondrial membrane integrity is the result of intracellular proteolysis mediated by intracellular proteases known as caspases (such as caspase-3, -7, and caspase-9) (Wolf and Green, 1999; Zou et al, 1999; Hengartner, 2000; Kroemer and Reed, 2000).

On the other hand, the inhibitor of apoptosis (IAP) family proteins, including cellular IAP-1 (cIAP-1), cIAP-2, Xlinked IAP (XIAP), and survivin, were characterized by the presence of the baculoviral IAP repeat, zinc ring finger, and caspase recruitment domain (Deveraux et al, 1997, 1998). These proteins have been shown to inhibit active caspase-3 and -7 directly and to inhibit activation of procaspase-9 (Deveraux and Reed, 1999).

Regarding apoptosis induced by specific COX-2 inhibitors such as celocoxib or NS398 on malignancies including leukemia, some apoptosis signaling pathways have been reported (Nakanishi et al, 2001; Waskewich et al, 2002; Zetterberg et al, 2003). However, the mechanisms of etodolac, COX-2 inhibitor, have not been analyzed in detail yet. In this report, we showed that etodolac were effective against leukemia cells, and it acted in an independent manner as well as other cancers (Sheng et al, 1997; Souza et al, 2000). We chose two COX-2 inhibitors, etodolac and meloxicam, clinically used in Japan. Generally, it has been reported that many COX-2 inhibitors having structures that exploit binding within the COX-2 side-pocket (via sulphonyl, sulphone, or sulphonamide groups) to achieve selectivity, results in inhibition of COX-2 effects (Hawkey, 1999). However, the mechanism of etodolac, which has no sulphonyl, sulphone, or sulphonamide groups, remains unclear. To gain insights into the molecular details of etodolacinduced apoptosis, the expression of anti-apoptotic proteins, the activation of caspases, and the influence of caspase inhibitors were investigated. In addition, relations between bcl-2 and the mitochondrial membrane potentials were investigated after treatment with etodolac in leukemia cells, K562, NB4, U937, HL60, and CEM cells.

We investigated the effects of etodolac on the growth of K562 leukemia cells in vivo. Moreover, we compared the anti-proliferation effects of etodolac with the stereoisomers of etodolac, R-etodolac and S-etodolac, in leukemia cells. Our data show that apoptosis induced by etodolac is mediated through down-regulation of antiapoptotic bcl-2 and caspase-9 dependent mitochondrial pathway, and growth inhibition by etodolac is observed in vivo. Furthermore, etodolac induced apoptosis more effectively than both R- and S-etodolac. These findings do support additional investigation for the use of etodolac as a therapeutic agent against leukemia.

II. Materials and methods A. Reagents and chemicals The highly selective COX-2 inhibitors, etodolac, Retodolac, and S- etodolac, were kindly provided by Nippon Shinyaku Co. Ltd. (Kyoto, Japan). The highly selective COX-2 inhibitor, meloxicam, was kindly provided by Boehringer Ingelheim (Germany). These drugs were dissolved in dimethyl sulfoxide (DMSO) (Sigma Chemical Company, St Louis, MO), and diluted in culture medium immediately before use. The final concentration of DMSO in all experiments was less than 0.01 %, and all treatment conditions were compared with vehicle controls. 3, 3’-dihexyloxacarbocyanine iodide (DiOC6) was purchased from Molecular Probes (Eugene, OR).

B. Cell lines and cell culture NB4 cells were donated by Dr M. Lanotte (Hospital SaintLouis, Paris, France). HL-60, K562, U937, and CEM cells were purchased from American Type Culture Collection (ATCC) (Rockville, MD). The cells were cultured in RPMI 1640 medium supplemented with 10 % heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 µg/ml streptomycin, and 200 U/ml penicillin (GIBCO-BRL, Gaithersburg, MD). All cells were maintained in a humidified 5 % CO2 atmosphere at 37 °C.

C. RT-PCR K562, NB4, U937, HL60, and CEM cells were cultured in 2 ml complete medium containing 1 x 10 6 cells in the presence of etodolac, or meloxicam at 100 µM and incubated at 37 °C. Total RNAs were extracted at 0, 12 h and 16 h after incubation using an RNeasy system (Quiagen, Tokyo, Japan), and 2 µg of total RNAs were reverse transcribed using a 1st strand cDNA synthesis kit (Roche, Indianapolis, IN). PCR was performed using a DNA thermal cycler (model PTC 200; MJ Research, Watertown, MA). Oligonucleotide sequences for each primer are as follows: COX-1, sense 5’-CTTGACCGCTACCAGTGTGA3’, antisense 5’-AGAGGGCAGAATACGAGTGT-3’; COX-2, sense 5’-AAGCCTTCTCTAACCTCTCC-3’, antisense 5’TAAGCACATCGCAT-ACTCTG-3’; bcl-2, sense 5’CGACGACTTCTCCCGCCGGCTACCGC-3’, antisense 5’CCGCATGCTGGGGCCGTACAGTTCC-3’; bcl-xL, sense 5’TTGGACAATGGACTGGTTG-3’, antisense 5’GTAGAGTGGATGGTCAGTG-3’; bax, sense 5’ATGGACGGGTCCGGGGAGCAGCCC-3’, antisense 5’GGTGAGCACTCCCGCCACAAAGAT-3’; bak, sense 5’TGAAAAATGGCTTCGGGGCAAGGC –3’, antisense 5’TCATGATTTGAAGAATCTTCGTACC –3’; and G3PDH; sense 5’-GAACGGGAAGCTCACTGGCATGGC-3’, antisense 5’-TGAGGTCCACCACCCTGTTGCTG-3’. PCR conditions of COX-1, COX-2, bcl-xL, and G3PDH were 28 cycles of denaturation at 94 ºC for 1 min, annealing at 55 ºC for 1 min, and extension at 72 ºC for 1 min. PCR conditions of bcl-2, bak and bax were 30 cycles of denaturation at 94 ºC for 1 min, annealing at 60 ºC for 1.5 min, and extension at 72 ºC for 1.5 min. PCR products were electrophoresed in a 1.5 % agarose gel containing 500 µg/l ethidium bromide and visualized with UV light. In each experiment, RT-PCR was performed in duplicate.

D. Assay of PGE2 production K562, NB4, U937, HL60, and CEM cells (2 x 10 4 per well) were preincubated with 50 or 100 µM etodolac or meloxicam in 24-well plates containing RPMI 1640 medium with 1 % (v/v) FCS at 37 °C in an atmosphere of 5 % CO2. After 2 h, the PGE2

154

Cancer Therapy Vol 2, page 155 level in the culture medium was measured using an ELISA kit (Cayman Chemical Co., Ann Arbor, MI) according to the manufacture’s instructions.

washed in Tris-buffered saline Tween (TBS-T), the membranes were incubated for 1 h at room temperature with an appropriate dilution of mouse monoclonal anti-bcl-2 antibody (Pharmingen, San Diego, CA), rabbit polyclonal anti-bcl-xL antibody (Pharmingen), mouse monoclonal anti-caspase-9 antibody (Pharmingen), mouse monoclonal anti-caspase-8 antibody (Pharmingen), mouse monoclonal anti-caspase-7 antibody (Pharmingen), mouse monoclonal anti-caspase-3 (CPP32) antibody (Pharmingen), mouse monoclonal anti-cIAP-1 antibody (Pharmingen), or rabbit polyclonal anti-survivin antibody (Alpha Diagnostic, San Antonio, TX). After being washed in TBS-T, the blots were incubated with horseradish peroxidase-conjugated goat anti-mouse IgG or anti-rabbit IgG (Amersham, Arlington Heights, IL) for 1 h and exposed to X-ray film at room temperature. The signal was detected by chemiluminescence using an ECL detection kit (Amersham).

E. MTT cell proliferation assay For the MTT assay, the cells were seeded in 96-well flatbottomed microplates at a density of 5 x 104 per well. Cells were incubated with or without etodolac, or meloxicam at 37 °C for 72 h, and then 10 µl 3-(4,5-dimethylthiazol-2–yl)–2,5–diphenyltetrazolium bromide (MTT) solution (Sigma Chemical Co., St. Louis, MO) was added to each well at a final concentration of 1 mg/ml/well. Cells grown in the presence of medium alone were used as controls. After incubation at 37 °C for 4 h, absorbance was measured at a wavelength of 560 nm using a microplate reader.

I. Detection of changes in the mitochondrial membrane potential ("#m)

F. Apoptosis analysis DNA content analysis was performed using propidium iodide (PI) staining. Cells were cultured in 2 ml complete medium containing 1 x 106 cells in the presence of etodolac, or meloxicam at the indicated concentrations and incubated at 37 °C. After 48 h of incubation, the cells were washed twice with cold PBS, fixed with 70 % ethanol overnight before treatment with 100 µg/ml RNase A, and then stained with 50 µg/ml PI. The relative DNA content per cell was measured by flow cytometry using an Epics Elite flow cytometer (Coulter Immunotech, Marseille, France).

Cells were cultured in 2 ml complete medium containing 1 x 106 cells in the presence of etodolac (100 µM), R-etodolac (100 µM), S-etodolac (100 µM), or R-etodolac (100 µM) and Setodolac (100 µM), and incubated at 37 °C. After 48 or 72 h of incubation, the cells were washed twice with cold PBS, fixed with 70 % ethanol overnight before treatment with 100 µg/ml RNase A, and then stained with 50 µg/ml PI. The relative DNA content per cell was measured by flow cytometry using an Epics Elite flow cytometer.

To detect "#m, the cells (1 x 104 cells/well) were incubated with 50 and 100 µM etodolac or meloxicam for 16 and 18 h in 24-well plates containing complete medium at 37 °C. After 16 h and 18 h, the cells were labeled with DiOC6 (40 nM in culture medium) at 37 °C for 20 min. After washing in PBS, cellular uptake of DiOC6 was analyzed by flow cytometry.

J. Flow cytometric evaluation of bcl-2 protein expression The cells (5 x 104 cells/well) were treated with etodolac or meloxicam at the indicated concentrations during incubation in 24-well plates containing complete medium at 37 °C. After 16 h and 18 h, the cells were fixed and permeabilized by the Fix and Perm Kit (AN DER GRUB, Kaumberg, Austria) according to the manufacturer’s instructions. For detection of bcl-2 expression, a FITC-conjugated monoclonal mouse anti-human bcl-2 antibody (DAKO, Glostrup, DK) was used. After washing in PBS, the cells were resuspended in 1.0 ml PBS containing 0.5 % formaldehyde and analyzed by flow cytometry.

G. Caspase 3 activation assay The cells (3 x 104 cells/well) were treated with etodolac or meloxicam at the indicated concentrations during incubation in 96-well plates containing complete medium at 37 °C. After 18 h, the level of caspase activity in the cells was measured using a CaspACE Assay System (Promega, Madison, WI) according to the manufacturer’s instructions using a microplate reader.

K. In vivo tumor growth model Nude female congenic athymic mice (Charles River, Wilmington MA) were used in human tumor model. They were 4-6 weeks old and weighed 18-20 g at the start of the experiments. Mice received proper care and maintenance in accordance with institutional guidelines. They were injected subcutaneously (s.c.) with 3 x 107 K562 cells. Tumors were allowed to grow and establish until they had reached a diameter of 6-8 mm (designated day 0). Animals were then randomized and etodolac (8.0 mg/kg per mouse), etodolac (16.0 mg/kg per mouse), meloxicam (16.0 mg/kg per mouse), or PBS was administered intravenously (i.v.) at day 4, 8, 12, 16, 20, 24. Each group contained three mice aged 5-6 weeks. Tumor growth was monitored by measuring with calipers every 4 days and tumor volume was calculated according to the formula:

H. Western blot analysis Western analyses of bcl-2, bcl-xL, caspase-9, caspase-8, caspase-7, caspase-3, cIAP-1, and survivin were performed using specific monoclonal antibodies. The leukemia cells were incubated with 50 or 100 µM etodolac or meloxicam for 18 and 24 h, then harvested, washed with cold PBS, and resuspended in lysis buffer containing 0.5 % Nonidet P-40, 50 mM Tris-HCl (pH 8.0), 0.1 mM EDTA, 150 mM NaCl, 1 mM sodium orthovanadate and 1 mM dithiothreitol supplemented with one Complete Mini protease inhibitor tablet (Boehringer Mannheim, Indianapolis, IN) per 20 ml lysis buffer immediately before use.

Samples containing 50 µg protein were added to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer with 5 % !-mercaptoethanol, heated to 100 °C for 2 minutes, and loaded onto 10 % polyacrylamide gels. Proteins were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with 0.5 % milk in PBS for 1 h at room temperature. After being

2 volume = L *W 2 , where L is the length (mm) and W is the width (mm).

155

Nakamura et al: COX-2 induction of apoptosis in leukemia cells affect COX-2 mRNA expression in K562, NB4, and U937 cells.

III. Results A. RT-PCR analysis of COX-1 and COX2 expression in leukemia cells

B. Effects of etodolac and meloxicam on PGE2 production in leukemia cells

As shown in Figure 1, the mRNA expression of COX-1 was not significantly different among K562, NB4, U937, HL60, and CEM cells because COX-1 is constitutively expressed in various cells. In contrast, the mRNA expression of COX-2 was detected in K562, NB4, and U937 cells but not in HL60 and CEM cells. K562, NB4, and U937 cells showed similar COX-2 mRNA expression levels. We next examined whether treatment with COX-2 inhibitors, etodolac or meloxicam, influenced COX-2 mRNA expression. Both COX-2 inhibitors did not

To examine the effects of COX-2 inhibitors on PGE2 production in K562, NB4, U937, HL60, and CEM cells, cells were treated with etodolac or meloxicam for 2 h. As shown in Figure 2, both of COX-2 inhibitors suppressed PGE2 production in a dose-dependent manner in all leukemia cell lines. No significant differences on inhibition of PGE2 production by COX-2 inhibitors were observed.

Figure 1. RT-PCR analysis of COX-1 and COX-2 mRNA expression in K562, NB4, U937, HL60, and CEM cells. K562, NB4, U937, HL60, and CEM cells were treated with or without etodolac (50 or 100 µM) and meloxicam (50 or 100 µM) for 16 h.

The PCR products were 311 bp in size for COX-1 (upper panel), 533 bp for COX-2 (middle panel), and 320 bp for G3PDH (bottom panel). (1) untreated, (2) treated with 50 µM etodolac, (3) treated with 100 µM etodolac, (4) treated with 50 µM meloxicam, and (5) treated with 100 µM meloxicam.

Figure 2. Effects of etodolac or meloxicam on the production of PGE2 in leukemia cells. Cells were treated with etodolac or meloxicam for 2 h and then the PGE2 level in the culture medium was measured by enzyme immunoassay. The PGE2 levels in the control cells (untreated K562, NB4, U937, HL60, and CEM cells) were 3.4 ± 0.07, 2.91 ± 0.06, 3.24 ± 0.04, 2.96 ± 0.05 and 3.59 ± 0.07 ng/ml, respectively. Data shown as mean ± S.D. in triplicate culture and are representative of three independent experiments. (1) untreated, (2) treated with etodolac (50 µM), (3) treated with etodolac (100 µM), (4) treated with meloxicam (50 µM), (5) treated with meloxicam (100 µM).

156

Cancer Therapy Vol 2, page 157 day 2 to 3. In contrast, the growth inhibitory effects of meloxicam were moderate on leukemia cells, K562, NB4, U937 HL60, and CEM cells.

C. Effects of COX-2 inhibitors on proliferation of leukemia cells We examined the effects of COX-2 inhibitors, etodolac and meloxicam, on the proliferation of leukemia cells by MTT assay (Figure 3). K562, NB4, U937, HL60, and CEM cells were incubated with etodolac or meloxicam at the indicated concentrations for 72 h.

Etodolac strongly suppressed cell proliferation in a dosedependent manner. In K562 cells, the growth inhibitory effect of etodolac was observed at 50 µM, and became obvious at 100 µM (Figure 3A). Similar growth inhibition by etodolac was shown in NB4, U937, HL60, and CEM cells, respectively (Figure 3B, C, D, and E). The growth of these cells was completely suppressed at 100 µM etodolac. At concentrations of 100 µM and higher, changes in cell proliferation were not seen (data not shown). In all leukemia cells, growth inhibition by 100 µM etodolac was seen on day 2, and became obvious on

D. Etodolac leukemia cells

induced

apoptosis

in

All leukemia cells were treated for 24, 48, or 72 h and subsequently stained with propidium iodide and analyzed using flow cytometry (Table 1, Figure 4).

In contrast, after treatment of leukemia cells with meloxicam, induction of apoptosis was slightly observed.

Treatment of all leukemia cells with etodolac led to a time-and dose-dependent induction of apoptosis. Doses of 50-100 µM were sufficient to induce apoptotic changes.

Moreover, addition of PGE2 did not completely prevent etodolac-induced apoptosis (data not shown).

Table 1.

Cell line

% of apoptotic cells (24h)

% of apoptotic cells (48h)

% of apoptotic cells (72h)

50 µM etodolac

100 µM etodolac

50 µM etodolac

100 µM etodolac

50 µM etodolac

100 µM etodolac

K562

15.6 ± 2.6

32.5 ± 1.8

66.4 ± 3.1

79.2 ± 3.9

79.2 ± 3.6

88.4 ± 4.3

NB4

19.6 ± 2.1

37.5 ± 2.4

64.8 ± 1.5

84.3 ± 4.1

80.3 ± 2.9

94.2 ± 4.1

U937

20.5 ± 3.5

38.2 ± 3.1

76.5 ± 2.6

79.3 ± 2.5

80.2 ± 3.5

89.6 ± 3.6

HL60

18.3 ± 1.9

21.5 ± 1.7

65.6 ± 2.3

80.4 ± 3.2

74.6 ± 3.4

89.3 ± 4.6

CEM

21.7 ± 2.3

26.3 ± 2.2

64.3 ± 1.9

79.8 ± 2.9

76.8 ± 2.7

92.4 ± 4.1

Figure 3. Cell proliferation of K562, NB4, HL60, U937, and CEM cells treated with etodolac or meloxicam. The cells were treated with etodolac or meloxicam at the indicated concentration for 72 h. Cell proliferation was measured by MTT assay. Data represent the mean (± SD) of three independent experiments. Panel (A), (B), (C), (D), and (E) show the inhibition of proliferation in K562, NB4, U937, HL60, and CEM cells, respectively. !; etodolac, "; meloxicam.

157

Nakamura et al: COX-2 induction of apoptosis in leukemia cells

Figure 4. Effects of etodolac or meloxicam on apoptosis of K562, NB4, HL60, U937, and CEM cells. These cells were treated with 50 µM, 100 µM etodolac, or 50 µM, 100 µM meloxicam for 24, 48, or 72 h. After treatment, cell were stained with propidium iodide and analyzed by flow cytometry. Data represent the mean (± SD) of three independent experiments. Panel (A), (B), (C), (D), and (E) show the apoptotic cells (%) in K562, NB4, U937, HL60, and CEM cells, respectively. (!; treated with 50 µM etodolac, "; treated with 100 µM etodolac, #; treated with 50 µM meloxicam, $; treated with 100 µM meloxicam)

E. Effects of etodolac and meloxicam on caspase-3 activity in leukemia cells

F. Etodolac decreased the expression of various apoptotic regulatory proteins, bcl-2, bcl-xL, caspase -9, -8, -7, -3, cIAP-1, and survivin

Caspases are responsible for many of the biological and morphological changes that occur during apoptosis.

Since caspase-3 is an important effector in apoptosis, we next investigated whether the induction of apoptosis of leukemia cells by etodolac or meloxicam was mediated by the activation of caspase-3. As shown in Figure 5, induction of caspase-3 activation was observed at 100 µM etodolac, and caspase-3 activity was blocked by incubation with the caspase inhibitor, Z-VAD-FMK (50 µM). A 4.3-6.5 fold increase in caspase 3 activity was detected in K562, NB4, U937, HL60, and CEM cells after treatment with 100 µM etodolac, and a 2.5-3.9 fold decrease in caspase-3 activity was detected in all leukemia cells by addition of Z-VAD-FMK. In contrast, after 16 h treatment of leukemia cells with meloxicam, the moderate caspase-3 activation (a 2.9-3.9 fold increase) detected as compared with etodolac. Therefore, caspase-3 activity was more strongly detected in treatment with etodolac than meloxicam. Moreover, addition of PGE2 did not completely prevent etodolac-induced caspase-3 activation (data not shown).

The effects of 24 h treatment with etodolac or meloxicam in leukemia cells were examined in relation to expression of various apoptotic regulatory proteins (Figure 6). As shown in Figure 6A, treatment of leukemia cells with meloxicam exerted little effect on bcl-2 and bclxL protein expression. On the other hand, etodolac treatment resulted in reduction of bcl-2 protein expression in a dose-dependent manner, and exerted little effect on bcl-xL protein expression except for HL60 and U937 cells.

Next, we examined the activities of caspase-9, -8, -7, and –3 on effects of etodolac and meloxicam (Figure 6B).

Procaspase-8 levels remained unchanged with etodolac or meloxicam treatment. Treatment of etodolac resulted in significant cleavage of procaspase-9, -7, and –3 in a dosedependent manner. In contrast, meloxicam treatment had no effect or slightly reduction on the cleavage of procaspase-9, -7, and –3 in HL60, U937 and CEM cells, or K562 and NB4 cells, respectively. Lastly, little change in expression of c-IAP-1 and survivin was noted with meloxicam treatment. On the other hand, etodolac treatment resulted in reduction of c-IAP-1 and survivin protein expression in a dose-dependent manner (Figure 6C). Thus, treatment leukemia cells with etodolac induced

158

Cancer Therapy Vol 2, page 159 down-regulation of the anti-apoptotic proteins, and was associated with activation of caspase cascades.

mitochondrial membrane potential was determined by DiOC6 uptake and subsequent flow cytometry. After 16 h of treatment of all leukemia cells with etodolac or meloxicam, no substantial changes of the mitochondrial membrane potential were shown (data not shown).

However, after 18 h of treatment with etodolac, the DiOC6 fluorescences were significantly reduced in a dosedependent manner in these cells (Figure 7).

G. Changes of the mitochondrial membrane potential ("#m) in leukemia cells by treatment with etodolac or meloxicam In preceding the activation of caspases, the disruption of the mitochondrial membrane potential was investigated in COX-2-induced apoptosis. The breakdown of the

Figure 5. Effects of etodolac or meloxicam on caspase 3 activation in K562, NB4, U937, HL60, and CEM cells.For caspase 3 activation, and investigating whether etodolac - or meloxicam - induced activation of caspase 3 was reversed by addition of a caspase inhibitor, ZVAD-FMK, these cells were treated with etodolac (100 µM) or meloxicam (100 µM) with or without 50 µM Z-VAD-FMK for 16 h and then collected. Cell lysates were analyzed for caspase - 3 activation. The level of caspase 3 activity in the cells was measured using a CaspACE Assay System by using a microplate reader. Data represent the mean (± SD) of three independent experiments. (1) untreated, (2) etodolac (100 µM), (3) etodolac (100 µM) and Z-VAD-FMK (50 µM), (4) meloxicam (100 µM), (5) meloxicam (100 µM) and ZVAD-FMK (50 µM).

Figure 6. Western blot analysis of effects of etodolac and meloxicam on the expression of various apoptotic regulatory proteins, bcl-2, bcl-xL, caspase -9, -8, -7, -3, cIAP-1, and survivin. K562, NB4, HL60, U937, and CEM cells were treated with etodolac or meloxicam for 24 h, after which cells were lysed, proteins separated by SDS-PAGE, and Western analysis performed to monitor expression of various proteins. (A) bcl-2 (left panels) and bcl-xL (right panels), (B) Procaspase-8 (left upper panels), Procaspase-9 (right upper panels), Procaspase-3 (left bottom panels), and Procaspase-7 (right bottom panels), and (C) survivin (left panels) and cIAP-1 (right panels). (1) Cells cultured without agents, (2) cells cultured with 50 µM etodolac, (3) cells cultured with 100 µM etodolac, (4) cells cultured with 50 µM meloxicam, and (5) cells cultured with 100 µM meloxicam for 24 h.

159

Nakamura et al: COX-2 induction of apoptosis in leukemia cells

Figure 7. Effects of etodolac and meloxicam on the mitochondrial membrane potential of leukemia cell lines, K562, NB4, U937, HL60, and CEM cells. Cells were treated with 50, or 100 ÂľM etodolac (left lane panels) or 50, or 100 ÂľM meloxicam (right lane panels) for 18 h. To determine the mitochondrial membrane potential, cells were stained with DiOC6 and analyzed by flow cytometry. (A) K562, (B) NB4, (C) U937, (D) HL60 and (E) CEM cells.

these cells (data not shown). These results demonstrated that etodolac treatment induced a time-and dose-dependent breakdown

After 24 h of the treatment with etodolac, remarkable reduction of DiOC6 fluorescence were observed, indicating breakdown of the mitochondrial membrane potential in 160

Cancer Therapy Vol 2, page 161 of the mitochondrial potential. In contrast, no significant breakdown of the mitochondrial membrane potential was observed in these cells treated with meloxicam.

remarkable reduction of bcl-2 expression was observed.

Moreover, remarkable reduction of bcl-2 expression in all leukemia cells was observed after 18 and 24 h of the etodolac treatment (data not shown). Etodolac treatment also induced a time-and dose-dependent down regulation of the bcl-2 expression. In contrast, the meloxicam treatment led to no detectable change in the intracellular bcl-2 expression in leukemia cells.

H. Effects of COX-2 inhibitors on expression of anti-apoptotic bcl-2 protein in leukemia cells Since the bcl-2 protein is reported to have an important role to maintain the mitochondrial membrane potential, we examined whether treatment with etodolac or meloxicam changed bcl-2 protein expression in leukemia cells by flow cytometry (Figure 8). After 16 h of treatment of leukemia cells with etodolac, bcl-2 down–regulation preceded the breakdown of the mitochondrial membrane potential. In particular, on the treatment of K562 and NB4 cells with 100 µM etodolac,

I. RT-PCR analysis of bcl-2, bcl-xL, bak and bax mRNA in leukemia cells treated with etodolac Next, we investigated expression of antiapoptotic (bcl-2 and bcl-xL) and proapoptotic (bax and bak) mRNAs in leukemia cells treated with etodolac by RT-PCR (Figure 9).

Figure 8. Effects of etodolac and meloxicam on intracellular bcl-2 protein expression of leukemia cell lines, K562, NB4, U937, HL60, and CEM cells. Cells were treated with 50, or 100 µM etodolac (left lane panels) or 50, or 100 µM meloxicam (right lane panels) for 16 h. After treatment, cells were washed, permeabilized, stained with a FITC-conjugated monoclonal mouse anti-human bcl-2 antibody, and analyzed by flow cytometry. (A) K562, (B) NB4, (C) U937, (D) HL60 and (E) CEM cells.

161

Nakamura et al: COX-2 induction of apoptosis in leukemia cells treatment of leukemia cells with 100 µM R- or, Setodolac, induction of apoptosis was slightly observed compared with etodolac. Interestingly, induction of apoptosis with the combination of R-and S-etodolac was not significantly observed. It was demonstrated that etodolac, which consists of R- and S-etodolac, induced apoptosis, whereas simple mixture of R- and S-etodolac significantly did not.

All cell lines were treated with 50 or 100 µM etodolac for 12 h. All cell lines had relatively equal amplification of the housekeeping gene G3PDH, implying that equal amounts of each mRNA were used in these experiments. Bcl-2 mRNA expression was decreased in all cell lines treated with 50 and 100 µM etodolac, and remarkable reduction of bcl-2 mRNA in all leukemia cells was observed after 100 µM etodolac treatment. Etodolac treatment also induced a dose-dependent reduction of the bcl-2 mRNA expression.

In contrast, no significant reduction of bcl-xL mRNA was detected in these cells after 12 h of treatment of etodolac.

Interestingly, bax mRNA expression was also decreased in all cell lines as well as bcl-2 mRNA, but no significant reduction of bak mRNA expression was detected in all leukemia cells. Etodolac treatment induced the reduction of bcl-2 and bax mRNA following breakdown of mitochondrial membrane potential in leukemia cells.

IV. Discussion The aim in this study was to investigate how etodolac induced apoptosis in leukemia cells. The data presented here provide novel insights into the molecular mechanisms of it. There are many COX-2 inhibitors, that have sulphonyl, sulphone, or sulphonamide groups, and in this study, we used etodolac and meloxicam, which have quite similar potency for inhibition of the COX-2 enzyme.

Interestingly, etodolac has no sulphonyl, sulphone, or sulphonamide groups, and is different from other COX-2 inhibitors. Recent reports have shown that COX-2 is a key enzyme, and promotes angiogenesis, inflammation, cellular adhesion, growth, differentiation and apoptosis (Eberhart and Dubois, 1995; Tsujii and DuBois, 1995). If COX-2 is a relevant target in leukemia cells, COX-2 inhibitors should be effective in inhibiting the proliferation of leukemia cells. We showed that etodolac strongly induces apoptosis in leukemia cells, K562, NB4, U937, HL60, and CEM cells. However, our data showed that COX-2 mRNA expression was not detected in both HL-60 and CEM cells, while that in K562, NB4, and U937 cells was detected in same level. The effects of etodolac–induced apoptosis were found to be strong and similar for both COX-2 positive and negative leukemia cell lines, and there were no significant differences. In contrast, meloxicam affected moderate induction of apoptosis in leukemia cells. These differences between etodolac and meloxicam were evident in MTT proliferation assays as well as apoptosis assays It is generally recognized that COX-2 inhibitors exert their actions via blocking PG synthesis by direct COX-2 inhibition (Fujita et al, 2001). Our study showed that etodolac or meloxicam significantly inhibited PGE2 production. However, addition of PGE2 did not rescue the etodolac–induced apoptosis (data not shown). Therefore,.

J. In vivo K562 cell growth inhibition by etodolac treatment We confirmed the use of etodolac in a leukemia cell line in vivo. K562 cells were implanted s.c. into nude mice. Etodolac (8.0 mg/kg or 16.0mg/kg), meloxicam (16.0 mg/kg), or PBS were injected i.v. via tail vein at day 4, 8, 12, 16, 20, 24. As shown in Figure 10, there were significant differences in K562 cell growth in etodolac treated mice compared with meloxicam or PBS treated mice at day 16 after the initial injection (day 4). Moreover, etodolac (16.0 mg/kg) in K562 cell growth inhibition was a marked antitumor effect compared with 8.0 mg/kg etodolac. It was reported that when 400mg (8.0 mg/kg) etodolac was administered to adult human orally, the serum concentrations achieved were ~ 75 µM (21 µg/ml).

These data demonstrate that etodolac reduces the growth of K562 leukemia cells in vivo.

K. Effects of etodolac or stereoisomers of etodolac (R-etodolac or S-etodolac) on apoptosis of K562, NB4, HL60, U937, and CEM cells.

All leukemia cells were treated for 48 or 72 h and subsequently stained with propidium iodide and analyzed using flow cytometry (Table 2). In contrast, after Table 2.

Cell line

% of apoptotic cells (48h) 100 µM etodolac

% of apoptotic cells (72h) 100 µM etodolac

K562

80.2 ± 6.2

89.8 ± 6.2

NB4

85.3 ± 5.5

95.2 ± 4.6

U937

81.1 ± 4.9

91.2 ± 6.2

HL60

81.2 ± 6.2

88.3 ± 5.3

CEM

80.6 ± 4.9

94.2 ± 6.7

162

Cancer Therapy Vol 2, page 163 whether COX-2 inhibitors block proliferation of cancer cells or induce apoptosis solely by inhibiting PG synthesis has not been clarified. Our data showed that etodolac directly down-regulated bcl-2 expression and induced caspase -3-dependent apoptosis in leukemia cells. Our findings suggested that there were COX-2 independent pathways in etodolac–induced apoptosis.

In apoptosis, ionizing radiation, UV light, heat shock, kinase inhibitors, and anti-cancer drugs have all been shown to induce apoptosis through bcl-2–regulated mitochondrial pathway (Strasser et al, 1995; Belka et al, 2000; Ochs and Kaina, 2000; Jendrossek et al, 2002). Bcl2 has anti–apoptotic functions and and decreases of bcl-2 protein expression affect the life–span of cells (Guenal et al, 1997; Li et al, 2001; Huigsloot et al, 2002). Indeed, in this study, etodolac induced some cellular events, including down–regulation of bcl-2 mRNA and protein expression, breakdown of the mitochondrial membrane potential, and caspase-9, -7, and –3 activation, which all are indicative for the involvement of mitochondrial apoptosis pathways. We showed that decreases of bcl-2 triggered by etodolac treatment induced activation of caspase-9, -7 and –3 but not caspase-8. These caspases activation preceded etodolac–induced apoptosis, indicating the mitochondrial–mediated caspase activation (Leoni et al, 1998). Experiments with caspase inhibitor, Z-VADFMK, confirmed this event, and Z-VAD-FMK significantly reduced apoptosis. These findings indicate the activation of caspase-9, -7, and –3 is important for etodolac–induced apoptosis, whereas caspase-8 is not essential. In addition, decrease of cIAP-1 and survivin was shown in leukemia cells treated with etodolac. These events might enhance the induction of apoptosis by etodolac.

Etodolac has been reported to consist of stereoisomers, R- and S- etodolac (Brocks et al, 1991). Setodolac is a specific COX inhibitor, while R-etodolac lacks COX inhibitory activity (Brocks et al, 1992; Mignot et al, 1996). However, both stereoisomers have no

significant differences on effects of apoptosis induction.

Therefore, effects of apoptosis induction have been reported to be independent COX inhibition pathway, and R- etodolac has been used in clinical trials in prostate cancer and B-chronic lymphocytic leukemia (CLL) (Adachi et al, 2004). In vitro in CLL, multiple myeloma (MM), and lymphoma cells, etodolac has reported to induce apoptosis (Adachi et al, 2000; Leoni et al, 2001; Leoni et al, 2002; Nardella and LeFevre, 2002). Retodolac (SDX-101; Salmedix Inc) displayed an IC50 ranging from 180 to 300 µM in primary CLL cells (Adachi et al, 2004). In CLL, SDX-101 is currently being developed in phase II clinical trials. The activity in lymphoma cell lines tested ranged from 140 (with diffuse large B cell lymphoma, SUDHL-9 cells) to 320 µM (for Burkitt’s lymphoma, Ramos and Raji cells). MM cell lines displayed an IC50 of about 150 µM in RPMI8226 and 350 µM in U266 cells (Nardella and LeFevre, 2002).

Figure 9. RT-PCR analysis of bcl-2, bcl-xL, bax, and bak mRNA expression levels in K562, NB4, U937, HL60, and CEM cells by treatment of etodolac. K562, NB4, U937, HL60, and CEM cells were untreated and treated with 50 or 100 µM etodolac for 12 h. (1) untreated, (2) treated with 50 µM etodolac and (3) 100 µM etodolac.

Figure 10. Etodolac inhibits the in vivo growth of K562 cells. 3 $ 107 K562 cells were injected s.c. into the dorsal flank of nude mice.

Etodolac ($, 8.0 mg/kg; #, 16.0 mg/kg) and meloxicam (!, 16.0 mg/kg) were administered on day 4, 8, 12, 16, 20 24. All drugs were administered i.v. ", control animals.

163

Nakamura et al: COX-2 induction of apoptosis in leukemia cells

Figure 11. Effects of etodolac, R-etodolac, S-etodolac, or the combination of R- and S-etodolac on apoptosis of K562, NB4, HL60, U937, and CEM cells. These cells were treated with 100 µM etodolac, 100 µM R-etodolac, 100 µM S-etodolac, or the combination of 100 µM R- and 100 µM S-etodolac for 48 or 72 h. After treatment, cell were stained with propidium iodide and analyzed by flow cytometry. Data represent the mean (± SD) of three independent experiments. Panel (A), (B), (C), (D), and (E) show the apoptotic cells (%) in K562, NB4, U937, HL60, and CEM cells, respectively. ("; treated with 100 µM etodolac, #; treated with 100 µM R-etodolac, $; treated with 100 µM S-etodolac, !; treated with the combination of 100 µM R-etodolac and 100 µM S-etodolac)

It has been reported that no correlation between overexpression of bcl-2 and other anti-apoptotic bcl-2 family members. Sensitivity to SDX-101 was observed, and the mechanism of action of SDX-101 studied in primary CLL cells involved the down–regulation of the anti-apoptotic protein Mcl-1, the activation of the PPARs, and the induction of NOR1, an orphan nuclear receptor that has been associated with apoptosis. However, in our study, we found the down–regulation of bcl-2 in leukemia cells, K562, NB4, U937, HL60, and CEM cells, treated with etodolac, which contains both R- and S-etodolac, by flow cytometry and subsequently, collapse of mitochondrial membrane potential. After 16 h treatment with etodolac, in which we could not detect the changes of mitochondrial membrane potential and both bcl-2 and bcl-xL protein by flow cytometry and western blotting analysis, respectively, while we could detect slight differences of cytoplasm bcl2 protein by flow cytometry. After 12 h treatment with etodolac, bcl-2 and bax mRNA level decreased in a dose dependent manner, while bcl-xL and bak mRNA level unchanged. Therefore, these findings suggest that etodolac induce the down–regulation of bcl-2 in leukemia cells, and etodolac-relating apoptosis is regulated by the reduction of bcl-2 mRNA and the maintenance of bak mRNA. Bak and bax may have a proapoptotic function that is independent on their ability to heterodimerize with bcl-2 and bcl-xL proteins. In etodolac–induced apoptosis, it might be important to remain bak mRNA expression. Future work will focus on the mechanism of etodolac–induced bcl-2 mRNA down regulation. Moreover, we also detected the

reduction of bcl-xL protein, whereas did not detect changes of bcl-xL mRNA. These data might indicate that the effects of etodolac were attributed to the instability or degradation of bcl-xL protein.

The i.v. administration of etodolac at doses of 8.0–16.0 mg/kg resulted in significant and dose–related growth inhibition of K562 leukemia cells compared to PBS or meloxicam treatments, and the toxicity or pronounced morbidity was not observed.

Finally, we investigated the effects of R-etodolac, Setodolac, and the combination of R- and S-etodolac compared to etodolac in leukemia cells, K562, NB4, U937, HL60, and CEM cells. After treatment with 100 µM R- etodolac, S- etodolac, and the combination of R- and Setodolac, the proliferation of leukemia cells was slightly inhibited, while etodolac significantly inhibited the proliferation of leukemia cells at 100 µM. Etodolac was compounded chemically, and 100 µM racemate of etodolac contains 50 µM R-etodolac and 50 µM Setodolac. The differences between the combination of Rand S-etodolac and racemate of etodolac on the mechanisms of the inhibition of cell proliferation are unknown. When racemate was added, changes in the joint style to receptors might arise, and synergistic effects might be pulled out. When R- and S-etodolac was mixed before addition into a well, the inhibition effects of the combination and rasemate of etodolac were same grade.

In conclusion, our findings indicate etodolac–induced apoptosis follows a bcl-2 dependent

164

Cancer Therapy Vol 2, page 165 Hengartner MO (2000) The biochemistry of apoptosis. Nature 407, 770-776.

Hida T, Yatabe Y, Achiwa H, Muramatsu H, Kozaki K, Nakamura S, Ogawa M, Mitsudomi T, Sugiura T, and Takahashi T (1998) Increased expression of cyclooxygenase 2 occurs frequently in human lung cancers, specifically in adenocarcinomas. Cancer Res 58, 3761-3764.

Huigsloot M, Tijdens IB, Mulder GJ, and van de Water B (2002) Differential regulation of doxorubicin-induced mitochondrial dysfunction and apoptosis by Bcl-2 in mammary adenocarcinoma (MTLn3) cells. J Biol Chem 277, 3586935879.

Jendrossek V, Handrick R, and Belka C (2002) Celecoxib activates a novel mitochondrial apoptosis signaling pathway.

FASEB J 17, 1547-1549.

Kawamori T, Rao CV, Seibert K, and Reddy BS (1998) Chemopreventive activity of celecoxib, a specific cyclooxygenase-2 inhibitor, against colon carcinogenesis.

Cancer Res 58, 409-412.

Kroemer G and Reed JC (2000) Mitochondrial control of cell death. Nat Med 6, 513-519.

Kujubu DA, Fletcher BS, Varnum BC, Lim RW, and Herschman HR (1991) TIS10, a phorbol ester tumor promoter-inducible mRNA from Swiss 3T3 cells, encodes a novel prostaglandin synthase/cyclooxygenase homologue. J Biol Chem 266, 12866-12872.

Leoni LM, Chao Q, Cottam HB, Genini D, Rosenbach M, Carrera CJ, Bdihardjo I, Wang X, and Carson DA (1998) Induction of an apoptotic program in cell-free extracts by 2chloro-2â&#x20AC;&#x2122;-deoxyadenosine 5â&#x20AC;&#x2122;-triphosphate and cytochrome c.

Proc Natl Acad Sci USA 95, 9567-9571.

Leoni LM, Adachi S, Tawatao RI, Kitada S, Welch J, Genini D, Cottam HB, Gottlieb RA, Glass CK, Kippe TJ, Reed JC, and Carson DA (2001) Induction of apoptosis in chronic lymphocytic leukemia and multiple myeloma cells by Retodolac. Luek Lymphoma 42 (suppl 1), 49.

Leoni LM, Carson DA, Scranton S, and Rosenthal AS (2002) In vitro and in vivo activity of SDX-101 (R-etodolac), a proapoptotic compound for the treatment of chronic lymphocytic leukemiam multiple myeloma and lymphoma (abstract). Ann Oncol 13, 147.

Li X, Marani M, Mannucci R, Kinsey B, Andriani F, Nicoletti I, Denner L, and Marcelli M (2001) Overexpression of BCLX(L) underlies the molecular basis for resistance to staurosporine-induced apoptosis in PC-3 cells. Cancer Res 61, 1699-1706.

Liu CH, Chang SH, Narko K, Trifan OC, Wu MT, Smith E, Haudenschild, C, Lane TF, and Hla T (2001) Overexpression of cyclooxygenase-2 is sufficient to induce tumorigenesis in transgenic mice. J Biol Chem 276, 18563-18569.

Mignot I, Presle N, Lapicque F, Monot C, Dropsy R, and Netter P (1996) Albumin binding sites for etodolac enantiomers.

Chirality 8, 271-280.

Molina MA, Sitja-Arnau M, Lemoine MG, Frazier ML, and Sinicrope FA (1999) Increased cyclooxygenase-2 expression in human pancreatic carcinomas and cell lines: growth inhibition by nonsteroidal anti-inflammatory drugs. Cancer Res 59, 4356-4362.

Nakanishi Y, Kamijo R, Takizawa K, Hatori M, and Nagumo M (2001) Inhibitors of cyclooxygenase-2 (COX-2) suppressed the proliferation and differentiation of human leukaemia cell lines. Eur J Cancer 37, 1570-1578.

Nardella FA and LeFevre JA (2002) Enhanced clearance of leukemic lymphocytes in B-cell chronic lymphocytic leukemia with etodolac. Blood 99, 2625-2626.

Ochs K and Kaina B (2000) Apoptosis induced by DNA damage O6-methylguanine is Bcl-2 and caspase-9/3 regulated and Fas/caspase-8 independent. Cancer Res 60, 5815-5824.

mitochondrial pathway, but COX-2 independent pathway in various leukemia cell lines. Moreover, etodolac more effectively induce apoptosis than R- and/or S-etodolac.

Acknowledgements This work was Supported by Medical Frontier (# 029), Clinical Research for Evidenced Based Medicine, Ministry of Health Labor and Welfare of Japan, and Study on the target-therapy to adult refractory leukemia based on the molecular characteristics (#15-4), National Cancer Center of Japan. We thank Nippon Shinyaku Co. Ltd. and Boehringer Ingelheim for providing etodolac and meloxicam, respectively.

References Adachi S, Amox DG, Kitada S, Carson DA, and Leoni LM (2000) Etodolac: A nonsteroidal anti-inflammatory drug that induces apoptosis in B-cell chronic lymphocytic leukemia cells in vitro and in vivo (abstract). Proc Am Assoc Cancer Res 41, 739.

Adachi S, Leoni LM, Carson DA, and Tatsutoshi N (2004) Apoptosis induced by molecular targeting therapy in hematological malignancies. Acta Haematol 111, 107-123.

Belka C, Rudner J, Wesselborg S, Stepczynska A, Marini P, Lepple-Wienhues A, Faltin H, Bamberg M, Budach W, and Schulze-Osthoff K (2000) Differential role of caspase-8 and BID activation during radiation- and CD95-induced apoptosis. Oncogene 19, 1181-1190.

Brocks DR, Jamali F, and Russell AS (1991) Stereoselective disposition of etodolac enantiomers in synovial fluid. J Clin Pharmacol 31, 741-746.

Brocks DR, Jamali F, Russell AS, and Skeith KJ (1992) The stereoselective pharmacokinetics of etodolac in young and elderly subjects, and after cholecystectomy. J Clin Pharmacol 32, 982-989.

Cheng EH, Wei MC, Weiler S, Flavell RA, Mak TW, Lindsten T, and Korsmeyer SJ (2001) BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAKmediated mitochondrial apoptosis. Mol Cell 8, 705-711.

Deveraux QL, Takahashi R, Salvesen GS, and Reed JC (1997) X-linked IAP is a direct inhibitor of cell-death proteases.

Nature 388, 300-304.

Deveraux QL, Roy N, Stennicke HR, Van Arsdale T, Zhou Q, Srinivasula SM, Alnemri ES, Salvesen GS, and Reed JC (1998) IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases.

EMBO J 17, 2215-2223.

Deveraux QL and Reed JC (1999) IAP family proteins-suppressors of apoptosis. Genes Dev 13, 239-252.

Eberhart CE and Dubois RN (1995) Eicosanoids and the gastrointestinal tract. Gastroenterology 109, 285-301.

Fujita J, Mestre JR, Zeldis JB, Subbaramaiah K, and Dannenberg AJ (2001) Thalidomide and its analogues inhibit lipopolysaccharide-mediated Iinduction of cyclooxygenase2. Clin Cancer Res 7, 3349-3355.

Guenal I, Sidoti-de Fraisse C, Gaumer S, and Mignotte B (1997) Bcl-2 and Hsp27 act at different levels to suppress programmed cell death. Oncogene 15, 347-360.

Half E, Tang XM, Gwyn K, Sahin A, Wathen K, and Sinicrope FA (2002) Cyclooxygenase-2 expression in human breast cancers and adjacent ductal carcinoma in situ. Cancer Res 62, 1676-1681.

Hawkey CJ (1999) COX-2 inhibitors. Lancet 353, 307-314.

165

Nakamura et al: COX-2 induction of apoptosis in leukemia cells Oshima M, Dinchuk JE, Kargman SL, Oshima H, Hancock B, Kwong E, Trzaskos JM, Evans J, and Taketo MM (1996) Suppression of intestinal polyposis in Apc delta716 knockout mice by inhibition of cyclooxygenase 2 (COX-2). Cell 87, 803-809.

Piazza GA, Alberts DS, Hixson LJ, Paranka NS, Li H, Finn T, Bogert C, Guillen JM, Brendel K, Gross PH, Sperl G, Ritchie J, Burt RW, Ellsworth L, Ahnen DJ, and Pamukcu R (1997) Sulindac sulfone inhibits azoxymethane-induced colon carcinogenesis in rats without reducing prostaglandin levels.

Cancer Res 57, 2909-2915.

Shattuck-Brandt RL, Varilek GW, Radhika A, Yang F, Washington MK, and DuBois RN (2000) Cyclooxygenase 2 expression is increased in the stroma of colon carcinomas from IL-10(-/-) mice. Gastroenterology 118, 337-345.

Sheng H, Shao J, Kirkland SC, Isakson P, Coffey RJ, Morrow J, Beauchamp RD, and DuBois RN (1997) Inhibition of human colon cancer cell growth by selective inhibition of cyclooxygenase-2. J Clin Invest 99, 2254-2259.

Shimizu S, Konishi A, Kodama T, and Tsujimoto Y (2000) BH4 domain of antiapoptotic Bcl-2 family members closes voltage-dependent anion channel and inhibits apoptotic mitochondrial changes and cell death. Proc Natl Acad Sci U S A 97, 3100-3105.

Shimizu S, Narita M, and Tsujimoto Y (1999) Bcl-2 family proteins regulate the release of apoptogenic cytochrome c by the mitochondrial channel VDAC. Nature 399, 483-487.

Soslow RA, Dannenberg AJ, Rush D, Woerner BM, Khan KN, Masferrer J, and Koki AT (2000) COX-2 is expressed in human pulmonary, colonic, and mammary tumors. Cancer 89, 2637-2645.

Souza RF, Shewmake K, Beer DG, Cryer B, and Spechler SJ (2000) Selective inhibition of cyclooxygenase-2 suppresses growth and induces apoptosis in human esophageal adenocarcinoma cells. Cancer Res 60, 5767-5772.

Strasser A, Harris AW, Huang DC, Krammer PH, and Cory S (1995) Bcl-2 and Fas/APO-1 regulate distinct pathways to lymphocyte apoptosis. EMBO J 14, 6136-6147.

Sun Y, Tang, XM, Half E, Kuo MT, and Sinicrope FA (2002) Cyclooxygenase-2 overexpression reduces apoptotic susceptibility by inhibiting the cytochrome c-dependent apoptotic pathway in human colon cancer cells. Cancer Res 62, 6323-6328.

Thun MJ, Namboodiri MM, and Heath CW Jr (1991) Aspirin use and reduced risk of fatal colon cancer. N Engl J Med 325, 1593-1596.

Tsujii M and DuBois RN (1995) Alterations in cellular adhesion and apoptosis in epithelial cells overexpressing prostaglandin endoperoxide synthase 2. Cell 83, 493-501.

Waskewich C, Blumenthal RD, Li H, Stein R, Goldenberg DM, and Burton J (2002) Celecoxib exhibits the greatest potency amongst cyclooxygenase (COX) inhibitors for growth inhibition of COX-2-negative hematopoietic and epithelial cell lines. Cancer Res 62, 2029-2033.

Wilson KT, Fu S, Ramanujam KS, and Meltzer SJ (1998) Increased expression of inducible nitric oxide synthase and cyclooxygenase-2 in Barrett's esophagus and associated adenocarcinomas. Cancer Res 58, 2929-2934.

Wolf BB and Green DR (1999) Suicidal tendencies: apoptotic cell death by caspase family proteinases. J Biol Chem 274, 20049-20052.

Xie WL, Chipman JG, Robertson DL, Erikson RL, and Simmons DL (1991) Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing. Proc Natl Acad Sci U S A 88, 2692-2696.

Yamazaki R, Kusunoki N, Matsuzaki T, Hashimoto S, and Kawai S (2002) Selective cyclooxygenase-2 inhibitors show a differential ability to inhibit proliferation and induce apoptosis of colon adenocarcinoma cells. FEBS Lett 531, 278-284.

Zetterberg E, Lundberg LG, and Palmblad J (2003) Expression of cox-2, tie-2 and glycodelin by megakaryocytes in patients with chronic myeloid leukaemia and polycythaemia vera. Br J Haematol 121, 497-499.

Zou H, Li Y, Liu X, and Wang X (1999) An APAF1.cytochrome c multimeric complex is a functional apoptosome that activates procaspase-9. J Biol Chem 274, 11549-11556.

Dr. Satoki Nakamura

166

Cancer Therapy Vol 2, page 167 Cancer Therapy Vol 2, 167-172, 2004

Variation between independently cultured strains of the MDA-MB-231 breast cancer cell line identified by multicolour fluorescence in situ hybridisation Research Article

Mark B. Watson, John Greenman, Phil J. Drew, Michael J. Lind, Lynn Cawkwell* Postgraduate Medical Institute of the University of Hull in association with the Hull York Medical School, University of Hull, Cottingham Road, Hull, HU6 7RX, UK.

__________________________________________________________________________________ *Correspondence: Dr L Cawkwell PhD, R&D Building, Castle Hill Hospital, Hull, HU16 5JQ, UK; Tel: +44 1482 875875 ext 3617; Fax: +44 1482 622398; Email: L.Cawkwell@hull.ac.uk Key Words: breast cancer, multicolour fluorescence in situ hybridisation, Abbreviations: derivative, (der); genomic hybridisation, (CGH); Multicolour FISH, (MFISH); salt sodium citrate, (SSC); short tandem repeat, (STR) Received: 18 May 2004; Accepted: 21 May 2004; electronically published: May 2004

Summary Established cell lines derived from breast carcinomas provide important models, which can be used to study the genetics, biochemistry and dynamics of breast cancer in vitro. However, the very nature of these cell lines, along with their widespread and prolonged culture in plastic, may eventually lead to genotypic and phenotypic variations between strains cultured by different research groups. The aim of this study was to investigate the in vitro genetic divergence at the chromosome level of the breast cancer cell line MDA-MB-231. Multicolour fluorescence in situ hybridisation (MFISH) allows rapid detection, discrimination and karyotyping of all chromosomes within a single metaphase spread. Strains of MDA-MB-231 obtained from 3 different laboratories: (I) Hull, (II) York and (III) USA were subjected to MFISH analysis. Karyotypic aberrations were identified, which were common to all strains of this cell line, for example, the marker chromosomes der(2)t(2;12;8) and der(2)t(8;2). However, several other unique abnormalities were identified between strains enabling the production of a map of proposed karyotypic divergence. The potential genetic divergence of cell lines cultured extensively in the laboratory should therefore be taken into account during the interpretation of in vitro experimental data. important tools in the field of drug discovery. Recently, they have been successfully used as a screening panel for the 4-aryloxy- and 4-arylsulfanyl-phenyl-2-aminothiazole compounds â&#x20AC;&#x201C; a family of potential cancer cell growth inhibitors (Gorczynski et al, 2004). However, there are inherent problems with the use of cell lines in general and especially those derived from tumours.

First, the phenomenon of intraspecies cross-contamination of established cell cultures appears to be widespread and may account for some misrepresentation of data (MacLeod et al, 1999).

Second, the karyotypic evolution of the commonly used MCF-7 cell line in continued culture both over time, and between individual cultures grown at independent research facilities has been previously reported (Bahia et al, 2002).

We utilised multicolour fluorescence in situ hybridisation (MFISH) to analyse the karyotypic variation among independently cultured strains of another widely used breast cancer cell line - MDA-MB-231, to determine

I. Introduction Prior to new breast cancer therapies being entered into clinical trials they are thoroughly tested using strictly controllable model systems. Established breast cancer cell lines such as MCF-7, MDA-MB-231, T-47D and BT20 are commonly utilised for this purpose and also as general in vitro models of breast cancer pathogenesis, progression, response to chemotherapy and drug resistance. In a recent review of the relevance of breast cancer cell lines as model systems, an extensive literature search revealed that studies involving MCF-7, MDA-MB231 and T-47D accounted for over two thirds of all studies using breast cancer cell lines (Lacroix and Leclercq, 2004). Such cell lines retain many of the characteristics of their parent tumour (for example, the ER positive status of MCF-7) and are considered to represent the parent tumour both genotypically and phenotypically to a certain extent (remembering that tumours are by nature heterogeneous entities). Breast cancer cell lines are also

167

Watson et al: Variation between cultured strains of breast cancer cell line identified by MFISH whether this type of variation is limited to MCF-7, or is more widespread.

specifically bound probe and counterstained with 15 µl of 42 ng/ml DAPI in Antifade. Four to ten high power (100x objective) metaphase images were captured from each slide using a Nikon!

E800 epifluorescent microscope with a Ludl! 6-position filter wheel (with filters for each of the six fluorochromes– SpectrumGold", SpectrumAqua", SpectrumRed", SpectrumGreen", SpectrumFRed" and DAPI) and a Photometrics Sensys" CCD camera. Images were analysed using Quips SpectraVysion" analysis software on an Apple! G3 Power Macintosh. All metaphase spreads identified prior to probe treatment were captured, however only those of sufficient quality were included in the final composite karyotype.

Composite karyotypes were produced for each metaphase then compiled to give an overall karyotype for each strain (Table 1).

II. Materials and methods A. Cell culture Strains of MDA-MB-231 were obtained from the Department of Biology, University of York and Abbott Laboratories, Downers Grove, IL. Cells were cultured in RPMI growth media supplemented with 10% foetal calf serum, 1% glutamine, 1% penicillin streptomycin and 1% fungizone (all purchased from Invitrogen Ltd, Paisley, UK).

B. Preparation of metaphase spreads Metaphase chromosome spreads were produced according to standard protocols (Ashman et al, 2002; Watson et al, 2004).

Cultures at near confluence (60-70%) underwent an 18 hour incubation period with 10 µl of 10 µg/ml colcemid (final concentration 20 ng/ml). Cells were pelleted (200 g for 8 min), and the pellet resuspended in 8ml hypotonic solution (0.075M KCl). After incubation at 37°C for 20 minutes, cells were fixed in 3 changes of 3:1 methanol:acetic acid and stored for 18 to 24 hours at -20°C. Chromosome spreads were prepared by dropping 25 µl of suspension onto clean, humidified glass slides and allowed to air dry before visualisation using phase contrast microscopy (Nikon ! E800, Nikon UK Ltd, Kingston, England).

Visualisation prior to the addition of MFISH probe allowed assessment of the quality of the metaphases produced as well as selection of the best quality spreads to be analysed.

D. Analysis As per ISCN guidelines (1995), abnormal chromosomes were included if two or more metaphase spreads exhibited the same aberration. Chromosomes were reported in shortened ISCN format as derivative (der) chromosomes.

III. Results The composite karyotypes compiled from the raw MFISH data for each strain of the MDA-MB-231 cell line are displayed in Table 1. The chromosomal aberrations shared by each strain are highlighted in red, revealing many unique translocations and differences in chromosomal copy number. The chromosomal translocations shared by, and unique to, the three strains are further summarised in Table 2.

Figure 1 demonstrates the use of MFISH in the identification of derivative chromosomes and highlights two of the chromosomes common to all strains of the MDA-MB-231 cell line – der(2)t(2;12;8) and der(15)t(20;15).

The derivative chromosome der(6)t(6;19;12;8), which is one marker that distinguishes the MDA-MB-231 (I) strain (Table 2), is also shown in Figure 1. A possible route for karyotypic divergence of the MBA-MB321 cell line is given in Figure 2

C. MFISH All MFISH reagents and analysis software systems were purchased from Abbott Laboratories (Maidenhead, UK). MFISH was carried out according to previously described protocols (Ashman et al, 2002; Watson et al, 2004). Slides were treated with pepsin and RNAse to remove cytoplasmic protein and RNA, to maximise probe binding. The slides were fixed in 1% v/v formaldehyde and denatured in 70% formamide/2x salt sodium citrate (SSC) prior to the addition of 10 µl denatured SpectraVysion" 24-colour probe and hybridization at 37°C for 72 hours. Post hybridization, slides were washed to remove non-

Table 1. Consensus karyotypes compiled using the MFISH data for each of the three MDA-MB231 stains (I), (II) and (III).

The chromosome number range is given in bold at the beginning of each karyotype. Whole and derivative chromosomes are given as the modal number as derived from the compiled karyotypes of each strain. In some cases it was not possible to use the modal number. In accordance with ISCN guidelines (1995), in these instances each set of abnormalities were given along with the number of spreads containing the abnormality [n]. [cp n] identifies the number of individual spreads used to compile each composite karyotype. Chromosomal aberrations shared by each strain are highlighted in red.

Sample MDA-MB231 (I)

MDA-MB231 (II)

MDA-MB231 (III)

Composite Karyotype (38-99). 1x3, 2x1, der(2)t(2;12;8), der(2)t(8;2)x2, 3x1, der(3)t(3;8), 4x4[3], 4x3[3], 4x2[2] der(4)t(4;9), 5x2, der(5)t(5;7), 6x2, der(6), der(6)t(6;14), der(6)t(6;19;12;8), 7x2, der(8)t(18;8), 9x3, 10x3, 11x3, 12x2, 13x1, der(13)t(16;13), 14x2, der(14), der(11)t(11;15), der(15)t(20;15), 16x2, 17x3, 18x2, der(?)t(18;5), 19x2[4], 19x3[4], der(19)t(19;7), 20x2, 21x3, 22x1, Xx2 [cp 8].

(58-63). 1x3, 2x1, der(2)t(2;12;8), der(2)t(8;2)x2, 3x2, der(3)t(3;8), 4x3, 5x2, der(5)t(5;7), 6x2, der(6), der(6)t(6;14), der(6)t(6;19;12;8), 7x2, der(8)t(12;8), der(8)t(18;8), 10x3, 11x3, 12x2, 13x1, der(13)t(13;21), 14x3, der(11)t(11;15), der(15)t(20;15), 16x2, 17x3, 18x2, 19x2, der(19)t(19;7), 20x3, 21x1[2], 21x2[2], 21x3[2], Xx1, der(X)t(X;4) [cp 6].

(61-64). 1x3, 2x1, der(2)t(2;12;8), der(2)t(8;2)x2, 3x3, 4x3, 5x2, der(5)t(5;7), 6x2, der(6), der(6)t(6;14), 7x3, 8x1, der(8)t(12;8), der(8)t(18;8), 9x3, 10x3, 11x3, 12x2, 13x2, 14x2, der(14), der(11)t(11;15), der(15)t(20;15), 16x2, 17x3, 18x2, der(19)t(19;X;5), 19x2, 20x3, 21x1, der(21)t(21;8), 22x2, Xx2, der(X)t(5;X) [cp8].

Key: der = derivative chromosome, iso = isochromosome, dic = dicentric chromosome

168

Cancer Therapy Vol 2, page 169

Table 2. Derivative chromosomes identified by MFISH analysis of the three strains of MDA-MB231. Chromosomes identified in any one strain were only counted if found in two or more metaphase spreads (+ translocation present; translocation absent). Translocations highlighted in red were shared by each of the three strains.

Translocation der(2)t(8;2) der(2)t(2;12;8) der(3)t(3;8) der(4)t(4;9) der(5)t(5;7) der6 der(6)t(6;14) der(6)t(6;19;12;8) der(8)t(8;18) der(8)t(12;8) der(13)t(13;21) der(13)t(16;13) der14 der(15)t(20;15) der(15)t(11;15) der(19)t(19;7) der(19)t(19;X;5) der(21)t(21;8) der(X)t(X;4) der(X)t(5;X) Total Number of Translocations

MDA-MB231 (I) + + + + + + + + + + + + + + 14

MDA-MB231 (II) + + + + + + + + + + + + + 12

MDA-MB231 (III) + + + + + + + + + + + + 11

Figure 1. MFISH analysis of MDA-MB231(I) strain showing an example metaphase spread analysed using MFISH. The derivative chromosomes der(2)t(2;12;8) (labelled a) and der(15)t(20;15) (labelled b) were common to all three strains of MDA-MB231. The derivative chromosome der(6)t(6;19;12;8) (labelled c) was found only in strain I.

169

Watson et al: Variation between cultured strains of breast cancer cell line identified by MFISH

Figure 2. Flow chart demonstrating the possible karyotypic evolution of the MDA-MB231 cell line between individual laboratories.

methods such as short tandem repeat (STR) profiling.

This system uses a series of primers to amplify the corresponding polymorphic loci, producing a numerical code representing the lengths of the PCR products produced. This system has previously been used to successfully identify a random panel of cell lines from cell banks around the world (Masters et al, 2001).

IV. Discussion The karyotypic evolution of established cell lines in culture has been demonstrated previously using MFISH (Bahia et al, 2002), comparative genomic hybridisation (CGH) (Jones et al, 2000) and conventional G-banding techniques (Mamaeva, 1998). However, this phenomenon had until now only been demonstrated in only one breast cancer cell line, namely MCF-7 (Jones et al, 2000; Bahia et al, 2002). It now appears that this type of evolution is not restricted to MCF-7, but also occurs in the MDA-MB231 breast cancer cell line. The identification of karyotypic evolution in established breast cancer cell lines has important implications for their use as models in the study of cancer and cancer therapy.

Thus, this phenomenon makes direct comparisons of data (especially cytogenetic data) between laboratories difficult and poses the risk of misinterpretation of results.

Despite this however, established breast cancer cell lines still have the potential to be good models of genetic change (Nugoli et al, 2003) provided the starting material is thoroughly characterised and adequate controls are in place. Such control measures include the parallel culture and analysis of control cultures to prevent misinterpretation of any mutations arising spontaneously.

A complete cytogenetic analysis of the parent cell line (the direct ancestor of the experimental and control lines) should also allow direct comparisons of any karyotypic changes occurring after experiments. Cross contamination of cells lines can be monitored by the routine use of

Acknowledgements We gratefully acknowledge the Department of Biology, University of York and Abbott Laboratories, Downers Grove, IL for strains of the MDA-MB231 cell line.

References Ashman JNE, Brigham J, Cowen ME, Bahia H, Greenman J, Lind M, and Cawkwell L (2002) Chromosomal alterations in small cell lung cancer revealed by multicolour fluorescence in situ hybridisation. Int J Cancer 102, 230-236.

Bahia H, Ashman JNE, Cawkwell L, Lind M, Monson JRT, Drew PJ and Greenman J (2002) Karyotypic variation between independently cultured strains of the cell line MCF7 identified by multicolour fluorescence in situ hybridisation.

Int J Oncol 20, 489-494.

Gorczynski MJ, Leal RM, Mooberry SL, Bushweller JH, and Brown M (2004) Synthesis and evaluation of substituted 4aryloxy- and 4-arylsulfanyl-phenyl-2-aminothiazoles as inhibitors of human breast cancer cell proliferation. Bioorg Med Chem 12, 1029-1036.

170

Cancer Therapy Vol 2, page 171 ISCN (1995) An international system for human cytogenetic nomenclature. Mitelman F (Ed). Basel, Karger.

Jones C, Payne J, Wells, D, Delhanty JDA, Lakhani SR, and Kortenkamp A (2000) Comparative genomic hybridisation reveals extensive variation among different MCF-7 cell stocks. Cancer Genet and Cytogenet 117, 153-158.

Lacroix M, and Leclercq G (2004) Relevance of breast cancer cell lines as models for breast tumours: an update. Breast Cancer Res Treat 83, 249-289.

MacLeod RAF, Dirks WG, Matsou Y, Kaufmann M, Milch H, and Drexler HG (1999) Widespread intraspecies crosscontamination of human tumour cell lines arising at source.

Int J Cancer 83, 555-563.

Mamaeva SE (1998) Karyotypic evolution of cells in culture: a new concept. Int Rev Cytol 178, 1-40.

Masters JR, Thomson JA, Daly-Burns B, Reid YA, Dirks WG, Packer P, Toji LH, Ohno T, Tanabe H, Arlett CF, Kelland LR, Harrison M, Virmani A, Ward TH, Ayres KL, and Debenham PG (2001) Short tandem repeat profiling provides an international reference standard for human cell lines.

PNAS 98(14), 8012-8017.

Nugoli M, Chuchana P, Vendrell J, Orsetti B, Ursule L, Nguyen C, Birnbaum D, Douzery EJP. Cohen P, and Theilliet C (2003) Genetic variability in MCF-7 sublines; evidence of rapid genomic and RNA expression profile modifications.

BMC Cancer 3(1), 13.

Watson MB, Bahia H, Drew PJ, Lind MJ, and Cawkwell L (2004) Chromosomal alterations in breast cancer revealed by multicolour fluorescence in situ hybridisation. Int J Oncol 24 (In Press).

Dr. Lynn Cawkwell

171

Watson et al: Variation between cultured strains of breast cancer cell line identified by MFISH

172

Cancer Therapy Vol 2, page 173 Cancer Therapy Vol 2, 173-176, 2004

Prostate cancer patients with Maspin-negative tumors can live over a decade§ Research Article

Aminah Jatoi1*, Neil Ellison2, Patrick A. Burch1, James Quesenberry3, Kristen Shogren1, Jeff A. Sloan1, Phuong L. Nguyen,4 Charles Y.F. Young1 1

Mayo Clinic and Mayo Foundation, Rochester, MN 55905, 2Geisinger Clinic & Medical Center CCOP, Danville, PA 17822, 3St. Lukes Regional Medical Center, Sioux City, IA 51104, 4 University of Minnesota, Minneapolis, MN 55405

__________________________________________________________________________________ *Correspondence: Aminah Jatoi, M.D., Mayo Clinic, 200 First Street SW, Rochester, MN 55905; Telephone: (507) 284-5352, Fax: (507) 284-1803; E-mail: jatoi.aminah@mayo.edu Key Words: Prostate cancer, Maspin-negative, Immunohistochemistry, Abbreviations: North Central Cancer Treatment Group, (NCCTG); prostate specific antigen, (PSA) § This study was conducted as a collaborative trial of the North Central Cancer Treatment Group and Mayo Clinic and was supported in part by Public Health Service grants CA-25224, CA-37404, CA-15083, CA-63826, CA-35448, CA-60276, CA-35195, CA-37417, CA35113, CA-52352, and CA-35415 Received: 4 May 2004; Accepted: 21 May 2004; electronically published: May 2004

Summary Background/Purpose: Maspin is a newly discovered tumor suppressor gene. Previous studies in prostate cancer suggest this gene’s expression correlates with higher tumor grade and predicts biochemical relapse. To date, however, no study has examined the prognostic impact of maspin expression on survival in patients with prostate cancer. The current study was undertaken to provide descriptive data on the predictive impact of maspin expression on survival in prostate cancer patients. Methods: As part of a multi-institutional clinical trial in patients with androgen-independent prostate cancer, this preliminary investigation stained 11 diagnostic prostate biopsies for maspin and prostate specific antigen (PSA). Normal prostate tissue within these biopsies served as positive controls. All 11 patients were followed prospectively from the time of trial enrollment. Results: All 11 tumors stained positively for PSA and negatively for maspin. Within the cohort, there was a median survival of 123 months (range: 27 to 127 months) with 6 of 11 patients still alive. Metastatic prostate cancer was the cause of death in all 5 deceased patients. Conclusions: Although maspin is a tumor suppressor gene, patients with maspin-negative tumors can nonetheless live for over a decade. Hence, maspin-negativity should not be used to counsel prostate cancer patients on the prospect of a limited life expectancy. occurred in 52% of tumors. Positive-maspin staining was associated with greater tumor differentiation and earlier tumor stage. In their retrospective analysis with a median follow up of 64 months, these investigators reported a shorter disease-free survival, as defined by the absence of PSA elevation, among maspin-negative patients: 26 versus 41 months, in maspin-negative and –positive patients, respectively (P=0.04). In a second retrospective study, Zou and others examined 97 prostate tumors and observed maspin-positivity in 37% (Zou et al, 2002). Although these investigators observed that maspin expression provided no predictive value, only 27 patients within this group had manifested a biochemical recurrence after a median 59-month follow up. These investigators did, however, observe a trend to suggest that maspin expression was associated with well-differentiated tumors (P=0.05), a finding that suggests maspin does in fact predict a favorable prognosis. Taken together, the above clinical and laboratory data suggest that the presence of

I. Introduction Maspin is a newly discovered member of the serpin family and has received increasing attention as a tumor suppressor gene. Mapped to chromosome 18q21.3-q23, this gene is thought to play a critical role in metastases (McGowen et al, 2000). In cell culture, maspin’s 24 kilodalton gene product inhibits metastatic invasion and spread of malignant cells (Sheng et al, 1996). Although mechanisms remain uncertain, recent data from Zhang and others suggest this molecule’s antiangiogenesis properties may in part explain such anti-tumor effects (Zhang et al, 2000).

Recent clinical data also suggest the importance of maspin as a tumor suppressor gene in prostate cancer patients. Machtens and others studied 84 prostate tumors (Machtens et al, 2001). They observed that positive immunohistochemistry staining for maspin, defined as the presence of a staining reaction in at least 40% of cells,

173

Jatoi et al: Prostate cancer patients with Maspin-negative tumors with 1mM EDTA plus steam. The sections were then exposed to 0.3% hydrogen peroxide to quench indigenous peroxidase activity. They were then incubated with a monoclonal antimaspin antibody at a 1:10 dilution for 60 minutes at room temperature. Envision Plus (Dako Corporation, Carpinteria, California, USA) was used as the secondary antibody according to the manufacturer's directions.

PSA staining was accomplished similarly. Tissue sections were blocked with protein block (Dako Corporation, Carpinteria, California, USA) to prevent non-specific binding of antibody.

Slides were incubated with a PSA antibody at a dilution of 1:2200. AEC chromogen was used as the substrate for visualizing the antibody staining. Slides were counterstained with Gill's Hematoxylin.

All slides were reviewed by a pathologist who provided an estimate of the percentage of maspin staining in the sample. If at least 40% of cells were staining for maspin (Machtens et al, 2001), the sample was scored as positive. PSA staining was assessed similarly and was done to provide confirmation of prostate cancer within the sample.

maspin may carry with it a favorable prognostic effect for patients with prostate cancer and that, conversely, maspinnegativity may portend a poor prognosis.

How long do patients with maspin-negative prostate tumors actually live? Although the foregoing case control studies are robust and well planned, they were not designed to answer this question. Nor were they able to provide concrete survival data. In fact, these studies did not examine survival, the most obvious endpoint reflective of prognosis. Rather, they looked only at biochemical relapse, as manifested by prostate specific antigen (PSA) elevation -- at best only a crude surrogate for survival.

Furthermore, as is the case with any retrospective investigations, the outcome data in these studies are not comparable to those gleaned prospectively. To gain an accurate clinical understanding of the prognostic effect of maspin-negativity, clinical data must be obtained in a prospective fashion. Thus, although the two large studies cited earlier suggest that maspin-negativity predicts a poor prognosis, they do not provide tangible, descriptive data to allow us to understand the clinical implications of this tumor suppressor protein.

The present exploratory investigation was undertaken to begin to answer the question posed above. The goal of this investigation was to provide prospective, illustrative data on the impact of maspin expression on survival in prostate cancer patients. As the translational component of a multi-institutional trial, this investigation relied on meticulous survival and cause-of-death data from a cohort of prostate cancer patients, thereby assembling a small but solid database that allowed for exploration of the clinical ramifications of maspin-negativity in patients with this malignancy.

D. Statistics Kaplan-Meier curves were constructed for all patients who had paraffin-embedded slides submitted. A log-rank test was used to compare survival between patients whose slides were maspin-negative and â&#x20AC;&#x201C;positive. A P-value < 0.05 was deemed statistically significant. All other data are presented descriptively.

III. Results A total of thirteen paraffin-embedded tissue blocks from thirteen separate prostate cancer patients were received. One tissue block did not include an adequate malignant tissue to allow for immunohistochemistry staining, and the other was mislabeled to the point where correlative clinical history was untraceable. Thus, a total of 11 tissue blocks were evaluated.

Eight of the samples were from the biopsy obtained at the time of the original prostate cancer diagnosis. Three represented biopsy material from patients with a prior diagnosis of prostate cancer within the preceding 2 years.

All tumor specimens from these 11 patients showed strongly positive PSA staining, or staining within > 40% of prostate tumor cells.

With normal prostate tissue on these biopsies serving as a positive control, all the prostate tumors showed negative maspin-staining, as indicated by < 40% staining on visual inspection, in keeping with the threshold defined

by Machtens et al, (2001). The sample with the most positive staining demonstrated staining in 10% of cells (Figure 1).

Kaplan Meier survival curves show a median survival of 123 months (range: 27 to 127 months) within the cohort with 6 of 11 patients still alive. Metastatic prostate cancer was the cause of death in all 5 deceased patients, all of whom had received hormonal manipulation as primary therapy for their prostate cancer.

A comparison of patients with weak versus those with absolutely negative maspin immunohistochemistry staining showed no statistically significant differences with regard to survival: 123 versus 127 months, respectively (P= 0.72, log rank test) (Figure 2).

II. Materials and methods A. Overview This study comprised the translational component of a phase II trial conducted within the North Central Cancer Treatment Group (NCCTG). Twenty-two institutions participated. The trial had examined the antineoplastic effects of green tea in patients with androgen independent prostate cancer, as defined by the Prostate Specific Antigen Working Group (Bubley et al, 1999). The clinical results of this trial of 43 evaluable patients showed that green tea carried no antineoplastic effects and have been previously reported (Jatoi et al, 2003). At the time of patient registration, all sites were given the option of sending diagnostic, paraffin-embedded tissue blocks to the NCCTG Operations Office.

B. Clinical follow up As part of patient monitoring while receiving the study agent, patients met with their oncologists for a history, physical examination, and laboratory testing once a month. Patients who appeared stable on treatment over 6 months were then evaluated at two-month intervals. Patients who stopped therapy were followed at 6-month intervals until death. Oncologists were asked to provide information on cause of death.

C. Immunohistochemistry Tissue blocks were stained for maspin and PSA. Each tissue block was cut into sections that were 5 microns in thickness and mounted on charged glass slides. Sections were deparaffinized and hydrated. Antigen retrieval was performed

174

Cancer Therapy Vol 2, page 175

Figure 1. A. prostate cancer with negative maspin staining (magnification 200x); insert shows residual normal prostate glands with positive maspin staining within the specimen from the same patient (magnification of insert 200x). B the same specimen as in Figure 1A but with positive PSA staining (magnification 200x). C invasive prostate cancer with positive staining for maspin (magnification 200x).

Maspin-positive tumor cells constitute 10% of the tumor in this specimen. D shows the same specimen as in Figure 1C with positive staining for PSA.

Figure 2. A comparison of patients with weak versus those with absolutely negative maspin immunohistochemistry staining showed no statistically significant differences with regard to survival: 123 versus 127 months, respectively (P= 0.72, log rank test). The median survival within this cohort was 123 months (range: 27 to 127 months) with 6 of 11 patients still alive.

175

Jatoi et al: Prostate cancer patients with Maspin-negative tumors inaccessibility that occurred with time. Hence, the findings from this investigation may not allow for accurate prediction of median survival in maspin-negative patients, but they do allow for drawing a general conclusion that maspin-negativity does not necessarily predict early demise.

In short, patients with maspin-negative prostate tumors may live for many years after their diagnosis. A more in depth understanding of maspin and how it functions as a tumor suppressor gene is of great scientific consequence. However, from a clinical standpoint, maspin-negativity should not be used to counsel prostate cancer patients on the prospect of a limited life expectancy.

IV. Discussion Within this cohort of 11 patients, maspin-negativity was not associated with a markedly diminished life expectancy. Median survival within this cohort was 123 months, and six patients remain alive. Although prior retrospective studies show that patients with maspinnegative tumors carry a higher tumor grade and might suffer a shorter time until biochemical relapse, no prior study had directly evaluated the prognostic impact of maspin-negativity in terms of actual survival. The goal of this study was to provide descriptive data on patient survival as they pertain to maspin-negativity, and the data presented here show that patients with maspin-negative tumors may live for longer than 10 years. Thus, immunohistochemistry staining with maspin does not appear to be a powerful prognosticator of great clinical utility.

Three aspects of this study deserve further comment.

First, all eleven tumor samples stained negatively for maspin. In effect, there was no comparative group that allowed us to state definitively that patients with maspinpositive tumors lived longer compared to patients with maspin-negative tumors. However, the absolute survival of greater then 10 years among patients whose tumors were maspin-negative allows us to conclude that although survival may be worse in the absence of maspin, in actuality it is not really that bad. Secondly, and as noted earlier, the size of this cohort was relatively small, as only a small subset of patients had had their blocks submitted.

However, meticulous follow up to the time of death, coupled with the fact that the five patients who died did in fact have confirmation of death from prostate cancer, make this investigation worth reporting. The data presented here suggest that during a one-to-one encounter, maspin-negativity should not be used to counsel a patient on life expectancy, as patients may live for many years despite having a maspin-negative prostate tumor.

Third, this study did not follow patients from the time of diagnosis. Rather patients entered this investigation once they developed androgen independent prostate tumors. Although one might argue that this study “selected” long-term survivors, it is important to point out that if any “selection” had occurred, it likely occurred in a manner favoring a bleaker life expectancy for maspinnegative patients. It is possible that many patients with maspin-negative tumors were cured and thus were never eligible for this trial. It is also possible that patients who were surviving for even longer than 10 years did not have their slides sent in because of a greater likelihood of

References Bubley GJ, Carducci M, Dahut W, Dawson N, Daliani D, Eisenberger M, Figg WD, Freidlin B, Halabi S, Hudes G, Hussain M, Kaplan R, Myers C, Oh W, Petrylak DP, Reed E, Roth B, Sartor O, Scher H, Simons J, Sinibaldi V, Small EJ, Smith MR, Trump DL, and Wilding G (1999) Eligibility and response guidelines for phase II clinical trials in androgenindependent prostate cancer: recommendations from the Prostate Specific Antigen Working Group. J Clin Oncol 17, 3461-3467.

Jatoi A, Ellison N, Burch PA, Sloan JA, Dakhil SR, Novotny P, Tan W, Fitch TR, Rowland KM, Young CY, and Flynn PJ (2003) A phase II trial of green tea in the treatment of androgen-independent metastatic prostate cancer. Cancer 97, 1442-1446.

Machtens S, Serth J, Bokemeyer C, Bathke W, Minssen A, Kollmannsberger C, Hartmann J, Knuchel R, Kondo M, Jonas U, and Kuczyk M. (2001) Expression of the p53 and maspin protein in primary prostate cancer: correlation with clinical features. Int J Cancer 95, 337-342.

McGowen R, Biliran H, Sager R, and Sheng S (2000) The surface of prostate carcinoma DU145 cells mediates the inhibition of urokinase-type plasminogen activator by maspin. Cancer Res 60, 4771-4778.

Sheng S, Carey J, Seftor EA, Dias L, Hendrix MJC, and Sager R (1996) Maspin acts at the cell membrane to inhibit invasion and motility of mammary and prostate cancer cells. Proc Natl Acad Sci 93, 11669-11674.

Zhang M, Volpert O, Shi YH, and Bouck N (2000) Maspin is an angiogenesis inhibitor. Nat Med 6, 96-199.

Zou Z, Zhang W, Young D, Gleave MG, Rennie P, Connell T, Connelly R, Moul J, Srivastava S, and Sesterhenn I (2002) Maspin expression profile in human prostate cancer and in vitro induction of maspin expression by androgen ablation.

Clin Cancer Res 8, 1172-1177.

176

Cancer Therapy Vol 2, page 177 Cancer Therapy Vol 2, 177-186, 2004

Extracorporeal photoimmune therapy: A therapeutic alternative treatment of cutaneous Tcell lymphoma and immunological diseases Review Article

Massimo Martino*, Giuseppe Console, Giulia Pucci, Giuseppe Irrera, Giuseppe Messina, Giuseppe Bresolin1, Fortunato Morabito, Pasquale Iacopino Bone Marrow Transplant Center, ”A. Neri” 1 Immuno-Transfusion Service, Department of Hematology and Transfusion Medicine, “Bianchi-Melacrino-Morelli” Hospital, Reggio Calabria, Italy

__________________________________________________________________________________ *Correspondence: Dr. Massimo Martino, Centro Unico Regionale Trapianti di Midollo Osseo, Azienda Ospedaliera BianchiMelacrino-Morelli, 89122 Reggio Calabria, Italy; Phone 39.0965.397883; mobil phone 3289169716; fax 39.0965.25082; e-mail: massimartino@tin.it Key Words: Extracorporeal photoimmune therapy, cutaneous T-cell lymphoma, immunological diseases, Photopheresis, graft-versus host-disease, Immunomodulation, organ transplants, autoimmune disease Abbreviations: 8-methoxypsoralen, (8-MOP); acid citrate dextrose, (ACD); cutaneous T-cell lymphoma, (CTCL); disease-free survival, (DFS); Extracorporeal photoimmune therapy, (ECP); Food and Drug Administration, (FDA); graft-versus-host-disease, (GVHD); interferon, (IFN); partial remission, (PR); systemic lupus erythematosus, (SLE); total skin electron beam therapy, (TSEBT); Ultraviolet A therapy, (PUVA); ultraviolet light, (UVA) Received: 3 May 2004; Accepted: 14 June 2004; electronically published: June 2004

Summary Extracorporeal phototherapy (ECP) is an immunotherapeutic modality that has demonstrated clinical efficacy in cutaneous T cell lymphoma/Sezary syndrome (CTCL), scleroderma, in patients with refractory acute and chronic gvhd after bone marrow transplantation and other autoimmune disorders. ECP involves extracorporeal exposure of peripheral blood mononuclear cells to photoactivated 8-methoxypsoralen (8-MOP), followed by reinfusion of the treated cells. 8-MOP is a naturally occurring furocourarin that is biologically inert, unless exposed to ultraviolet A light, whereupon it becomes photoactivated and covalently binds and crosslinks DNA, leading to initiation of apoptosis. During a single treatment cycle of ECP, approximately 240 cc of buffy coat and 300 ml of plasma are collected into a buffy coat bag from six collection cycles. The cells are exposed to UVA at 2 Jcm2/cell beginning immediately after the first cells are collected.18 Examination of the cells after UVA exposure and prior to reinfusion demonstrates that about 2–5% of the total circulating peripheral blood mononuclear cells undergo apoptosis.18 An intravenous formulation of 8-MOP, UVADEX, allows direct instillation of the photosensitising agent into the collected plasma and buffy coat ex vivo prior to UVA exposure. The implications of these immunomodulatory effects of ECP on pathogenesis and clinical outcome remain a fertile area for future research. has been used in the treatment of systemic sclerosis and other autoimmune diseases and for complications involving transplants of organs (rejection) or allogenic bone marrow (graft-versus-host-disease, GVHD).

The immunomodulating mechanism of action was described for the first time in mice exposed to UVA in the presence of 8-MOP. Immunosuppression was accompanied by a reduction in the number and function of the epidermoidal Langerhans cells and by a change in the production of cytokines by the keratinocytes (Vogelsang et al, 1987). Subsequently numerous experiments showed that administering spleen and bone marrow cells, treated

I. Introduction Extracorporeal photoimmune therapy (ECP) is an immunological treatment, which is defined as the extracorporeal exposure of pathogenic leucocytes to irradiation by ultraviolet light (UVA) in the presence of a photosensitising drug known as 8-methoxypsoralen (8MOP). ECP was introduced for the first time by Edelson et al, (1987) for the treatment of Sezary's syndrome and was approved in 1988 by the United States Food and Drug Administration (FDA) for the treatment of advanced forms of cutaneous T-cell lymphoma (CTCL); subsequently ECP

177

Martino et al: Extracorporeal photoimmune therapy for T-cell lymphoma and immunological diseases with ECP, to mice which had undergone allogenic bonemarrow transplants, significantly reduced the occurrence of GVHD, providing evidence of a UVA effect on the cells responsible for alloreactivity (Ullrich, 1991).

when using discontinuous flow apparatus in an extracorporeal circulation, there is a high risk of hypotension.

III. Cutaneous T-cell lymphoma

II. The "Photopheresis" system

The photopheresis procedure was developed initially

by Edelson et al, (1987) as a therapy for treating CTCL and Sezary's syndrome. In the initial study responses in excess of 60% were noted in the patients treated, with an average response time of 4-6 months when treatment was carried out once a month for 2 consecutive days (Rook and Wolfe, 1994; Wolfe et al, 1994; Lim and Edelson, 1995).

In a retrospective analysis of 450 patients treated in the United States and in Europe, the response percentage was 56 and 66%, respectively. Immunological studies have shown that the subset characterised by the CD4+/CD7pattern and by a normal CD4/CD8 ratio had a higher likelihood of clinical response (Rook et al, 1999). The anti-tumoral effect was correlated with the appearance of CD8+ cytotoxic T-cells in the peripheral blood and cutaneous tumoral infiltration. The number of SĂŠzary cells dropped in the majority of patients treated with ECP, while there were no significant variations in the population of normal CD4+ lymphocytes.

Edelson et al, (1987) subsequently showed, in the same group of patients, an increase in average survival of 60 months versus 33 months in the historical control group not treated with ECP. Further trials confirmed the good results, but they all presented the scientific limitation of not being randomised studies (Fraser-Andrew et al, 1998; Russel-Jones, 2000).

Gottlieb et al (1996) published the results of a retrospective study involving an appreciable number of patients, evaluated over 10 years, in which ECP was used on its own or combined with interferon (IFN) (12 patients) and other topical or systemic drugs. In this cohort of patients, 31 underwent 6 or more cycles of ECP while 28 patients received ECP as monotherapy. 71% of patients responded to the treatment; a further 7 patients (25%) obtained partial remission. In this study it was very significant to observe that the presence of SĂŠzary cells in the peripheral blood was associated with a favourable clinical response, as has been confirmed in other experiments (Rook et al, 1999). Gottlieb et al, (1996) showed that treatment with ECP is associated with an improved survival rate. In this study, average survival was 77 months from the start of treatment and 100 months from diagnosis.

In a similar retrospective revaluation Duvic et al, (1996) reported an overall response of 50% in a group of 34 patients; 6 patients (18%) achieved complete remission (CR) and 11 (32%) partial remission (PR). It must be emphasised that 28 of the 34 patients had an erithrodermic form of CTCL and that the best response was obtained with a treatment schedule involving two monthly procedures. Duvicâ&#x20AC;&#x2122;s experiment involved a treatment which had been modified in comparison with the one described by Edelson, increasing cell separation cycles from 6 to 9 and using ACD (acid citrate dextrose) as anticoagulant instead of heparin; he also intensified treatment

Taking samples of lymphocytes from the patient using a process of leucapheresis, and then activating them with 8-MOP and UVA carried out ECP in an extracorporeal circulation. The drug is activated by the presence of UVA radiation, and so only the cells exposed to this light are modified. The half-life of photoactivated 8-MOP is extremely short; therefore the cells can be reinfused immediately once treatment has been completed with very few side effects for the patient. Completion of each individual procedure normally requires between 3 and 5 hours; good patient venous access from a peripheral vein or, alternatively, from a central venous catheter, is essential.

There are two ECP systems: 1) The Therakos system, which uses UVAR XTSTM apparatus, following a protocol of two procedures in 2 consecutive days for each treatment cycle (125 ml bowl, 6-9 fractionation cycles; 225ml bowl, 3-4 fractionated cycles); the machine, using a single needle, allows whole blood to be taken from the patient and centrifuged in order to produce a blood fraction enriched with leucocytes. 8MOP in liquid form is mixed with the buffy coat fractionated in this way, then this fraction is exposed to the prescribed quantity of UVA rays in order to photoactivate the drug. The red corpuscles and the remaining portion of plasma are re-infused into the patient, without being subjected to the ultraviolet light treatment. The advantage of this system is that the circuit is continuous, and therefore allows blood to be taken, separated, irradiated and then returned to the patient in a sterile and closed circuit; 2) The Bio-Genic system, developed by Vilber Lourmat, in which the mononucleate cells are collected using various cell separation systems, and then processed, irradiated and finally infused in two separate and distinct phases ("open" system).The main disadvantage of this system is the risk of bacterial contamination correlated with the blood manipulation before the reinfusion in the patient.

Various treatment protocols are proposed. The basic CTCL protocol requires two treatments, carried out on 2 successive days, every 4 weeks; more aggressive protocols are normally applied when dealing with rejection after organ transplant. The total duration of treatment is established by evaluating the condition and treatment response of the individual patient. The side effect, which occurs most frequently during the procedure, is photophobia, consequently it is a good rule to give the patient the protection of dark goggles for the hours immediately following treatment. In some patients a temporary rise in temperature has been noted with an increase of the erythema, which can accompany the pyrexial reaction. In addition it is essential to carefully monitor blood pressure throughout the procedure, because

178

Cancer Therapy Vol 2, page 179 for non-responding patients to intervals of 2 weeks. The modifications made did not result in any advantage for the patients. One interesting fact was an increase in type G immunoglobulin, suggesting that ECP could be associated with an improvement of the immune function.

No clear advantages of ECP in terms of the survival of patients suffering from CTCL emerged from one single trial (Russel-Jones et al, 1997).

Numerous publications have also shown that combining ECP with biological response modifiers such as IFN can work in non-responding patients (Rook et al, 1991; Gottlieb et al, 1996; Jumbou et al, 1999; Fimiani et al, 1999).

Rook et al, (1991) had already published a work showing that combining ECP with low doses of IFN can achieve CR with the T-cells disappearing from the peripheral blood. Recent studies evaluated the combination of immunomodulator drugs such as interleukin-2 (Fritz et al, 1999), interleukin-12, or GMCSF (Rook et al, 1997; Wood et al, 1999) with ECP. The most important data published in literature, concerning the therapeutic synergism of treatment schemes used in order to improve long-term results, mainly concerned the combination of total skin electron beam therapy (TSEBT) and ECP (Wilson et al, 1995, 2000). In an initial work Wilson et al, (1995) assessed 163 patients who had been treated with TSEBT with a total dose of 36 Gy at 1 Gy/day for 9 weeks. All patients obtained CR or good PR with TSEBT, and then they were randomised in order to be treated with polichemotherapy schemes (anthracyclin + cyclophosphamide) or with ECP. In patients treated with chemotherapy survival after 3 years was 75% while in those treated with ECP it was 100%. In the analysis of the overall survival curves, only the group treated with ECP achieved a statistically significant difference (p < 0.06).

The same group subsequently recorded its own experience of using ECP in combination with TSEBT in mycosis fungoides, in its erythrodermic variant (Wilson et al, 2000). In this retrospective, non-randomised study, 44 patients were evaluated, 73% of who achieved CR and overall disease-free survival (DFS) was 63%. After stratifying the patients, the DFS was 49% for those treated with TSBET alone and 81% in patients treated in combination with ECP. From the cumulative results from numerous groups, we conclude that conventional ECP is efficacious in a high percentage of those CTCL patients who have circulating malignant T cells in the context of a still-near-normal immunocompetence. However, it is equally clear that a sizeable population of patients with extensive CTCL do not fit the profile of good responders to conventional ECP. Given the increased understanding of the mechanism underlying the efficacy of ECP and the improvements that have recently been made in the treatment modality, we favor the initiation of randomized trials of the improved ECP method, rather than the presumably antiquated conventional method.

A. Immunomodulation of ECP in T lymphoma The direct anti-idiotype antibody response against the clonal T-cell population, which occurs during ECP, is probably induced by UVA-mediated cell damage. During the procedure 8-MOP remains biologically inert until it is activated by the specific waves of UVA energy. The T lymphocytes seem to be the cell population which is most sensitive to this effect, as demonstrated by Yoo et al, (1996), who pointed out that only the normal T population and the T pattern of the Sézary syndrome showed signs of a process of apoptosis within 24 hours of carrying out ECP, with the appearance of typical markers such as annexin (Bladon and Taylor, 1999). ECP determines a selective variation of the subpopulations of T-cells, with normalisation of the CD4/CD8 ratio (Zouboulis et al, 1998) and maturation of the CD4+ line towards the inflammatory line (Th1), in comparison with the adjuvant one (Th2). In pathology such as CTCL, the increase in Th1 production in turn determines a higher production of IL-2 by the monocytes, with a negative feedback effect towards the Th2, which are probably the cytokines responsible for the clinical symptoms of the lymphoma (Di Renzo et al, 1997). While the lymphocytes seem to be resistant to the apoptotic effects of photopheresis, the induction of TNF-! secretion by the photoactivated monocytes facilitates apoptosis of the lymphocytes (Vowels et al, 1992). In addition, the photoactivation of the monocytes seems to stimulate their differentiation into dendritic CD 83+ and CD 36+ cells, capable of phagocytizing the apoptotic T-cells (Berger et al, 2001). In the presence of coadjuvant molecules, these dendritic cells are capable of determining an initial immune-cellular response (Edelson, 1991). These mechanisms are not, however, sufficient to justify the induced immunogenicity because the percentage of lymphocytes treated during ECP constitutes 10-15% of the total lymphocyte population.

Consequently the problem of the mechanism of action of photopheresis still leaves a wide margin for future studies.

IV. ECP and graft-versus host-disease (GVHD) GVHD remains a major cause of morbidity and mortality after allogeneic stem cell transplantation. While improvements in immunosuppressive regimens have reduced the frequency and severity of acute GVHD, the incidence of chronic GVHD remains unchanged at 27–50% after sibling matched related donor transplants and 42–72% after unrelated donor bone marrow or peripheral blood stem cell transplanted (Lazarus and Rowe, 1995; Urbano-Ispizua et al, 1997; Remberger et al, 2001). Factors associated with cGVHD have been well described and include increased donor and recipient age, HLA-disparate and unrelated donor transplants, prior acute GVHD, and use of alloimmune female donors (Ratanatharathorn et al, 2001). The onset of cGVHD has arbitrarily been defined as occurring 100 days after allogeneic stem cell infusion, and its clinical features are distinguished from acute GVHD in that they more closely resemble autoimmune diseases Histopathologic changes 179

Martino et al: Extracorporeal photoimmune therapy for T-cell lymphoma and immunological diseases which include sclerodermatous skin changes resulting from collagen deposition, pulmonary fibrosis, esophageal dysfunction, dry mouth or mucocutaneous ulcerations, cholestasis and myositis or fasciitis are thought to be initiated, in part, by autoantibodies to cell surface and intracellular proteins(Shulman et al, 1978).

This pathology is responsible for the significant posttransplant morbidity and mortality, due to both direct organ dysfunction and the significant increase in predisposition towards serious infections. The factors mostly responsible for this phenomenon are the donorâ&#x20AC;&#x2122;s Tlymphocytes, although other types of cells are implicated, with the consequent amplification of this process by various cytokines.

Conventional therapeutic approaches for cGVHD, including corticosteroids and immunosuppressive agents have demonstrated limited efficacy in patients with extensive disease. Ultraviolet A therapy (PUVA), while effective in alleviating the symptoms of chronic skin GVHD, has had no impact on visceral involvement. Novel strategies, including humanized anti-CD25 antibody (dacluzimab) and and anti-TNF-antibody (infliximab), have shown promise in limited pilot studies (Przepiorka et al, 2000; Simpson, 2000; Basara et al, 2001).

B. ECP and chronic GVHD Owsianowski et al, (1994) published the first work that evaluated the association between ECP and chronic GVHD. The author reported the experience of one individual case that showed improvement of lichenoid lesions on the skin, muscle thickening and sicca syndrome, and normalisation of the CD4/CD8 ratio and increase of NK cells from 8 to 20%.

Subsequently, in 1996, Rosetti et al published a trial on 9 paediatric patients showing improvement of cutaneous, hepatic and pulmonary GVHD. ECP was carried out for 2 consecutive days every 3 weeks for 6 months, and then monthly. The patients who responded showed normalisation of the CD4/CD8 ratio and a reduction in the number of CD56+ and HLA-DR+ cells after 9 months of treatment (Rosetti et al, 1996). A further study was published by Abhvankar et al, (1998) with a very small number of patients, who had a response in the case of scleroderma-type skin symptoms, but not in the case of visceral involvement.

Two recent studies reported the results of treatment in 11 and 15 patients, respectively (Greinix et al, 1998; Child et al, 1999). None of the patients had responded to 1st and 2nd line treatment with corticosteroids and cyclosporin. In one study ECP had been started at a late point after the onset of GVHD (average of 510 days), while in the other study it had been started at an early stage (average 178 days). In the group receiving early treatment the clinical responses were 12/15 in the case of cutaneous pathology; 11/11 in the case of muco-cutaneous involvement; 7/10 for hepatic GVHD and 5/6 in the case of ocular disease. In the group receiving late treatment the response on the skin was also good (10/10) but not for the other locations, confirming that the best responses are obtained if treatment is started within 10 months of the transplant. Intensification of treatment (twice per month for the first 4-6 months) had an impact on the response percentage. The clinical improvement allowed the immunosuppressive therapy to be reduced. The average time for suspending cortisone was 80 days, the average duration of response after suspension of ECP 12 months, with 14% of patients relapsing after suspending treatment.

A more systemic immunomodulatory effect, however, has been achieved with ECP, where direct exposure of peripheral blood mononuclear cells to UVAactivated 8-methoxypsoralen by apheresis is administered.

Complete responses of cutaneous chronic GvHD have been reported in up to 80% of steroid-refractory patients, with improvement even in sclerodermatous skin (Messina et al, 2003;.Seaton et al, 2003; Di Venuti et al, 2002) (Table 1). Improvement in visceral chronic GvHD has been less consistent. Reports of high complete response rates in hepatic and gut GvHD (Messina et al, 2003) have not been consistently observed (Seaton et al., 2003).No clinical factor predicting response to ECP has been observed.

Ilhan et al (2004) treated eight patients with a median age 42 (range, 17-43) with ECP (UVAR XTS) on 2 consecutive days every 2-4 weeks until resolution of GVHD over a period of 6-15 months concomitantly with immunosuppressive agents. Beyond extensive steroid

A. ECP and acute GVHD The work with the highest number of patient recruits suffering from GVHD who received treatment was published by Greinix et al, (2000). In this trial 21 patients with a median age of 38 years who developed steroidrefractory acute GVHD grades II to IV after stem cell grafting from sibling or unrelated donors and were referred to ECP. Three months after initiation of ECP 60% of patients achieved a complete resolution of GVHD manifestations. Complete responses were obtained in 100% of patients with grade II, 67% of patients with grade III, and 12% of patients with grade IV acute GVHD. Three months after start of ECP complete responses were achieved in 60% of patients with cutaneous, 67% with liver, and none with gut involvement. Adverse events observed during ECP included a decrease in peripheral blood cell counts in the early phase after stem cell transplantation (SCT). At the time of trial, 57% of patients were alive at a median observation time of 25 months after SCT. Probability of survival at 4 years after SCT was 91% in patients with complete response to ECP compared to 11% in patients not responding completely. Their findings suggested that ECP was an effective adjunct therapy for acute steroid-refractory GVHD with cutaneous and liver involvement, but, in patients with acute GVHD grade IV or gut involvement other therapeutic options are warranted.

Our comment is that the experience of ECP treatment of patients with acute GVHD is still limited.

Furthermore, there are differences in patient selection, entry criteria, additive immunosuppressive treatment and tapering down during ECP treatment and frequency of treatment among different centers. All these aspects stress the importance of randomized prospective multicenter studies.

180

Cancer Therapy Vol 2, page 181 Table 1. ECP treatment of refractory chronic GVHD Authors Study design No. CR Greinix et al Retrospective 15 0

PR NA*

Messina et al

Phase II

44

15

10

Seaton et al

Phase II

28

NA

NA

Di Venuti et al

Phase II

23

0

14

Comment CR in 12 of 15 patients with cutaneus GVHD, and in 7 of 10 with liver GVHD Ages 0.3-25 years. Highest responses in liver (60%) and gut (58%) chronic GVHD. Response significantly associated with improved survival (96 vs 58% 5-year survival, p=0.04) Responses described by site only. Skin chronic GVHD (1/21 CR and 9/21 PR), Liver GVHD (8/25 PR), Oral (3/6/ PR) Highest responses seen in skin GVHD (67%), responses also seen in gut (2/3) and oral mucosa (4/13)

*Criteria for PR often not well defined. NA = not available refractory cutaneous cGVHD, three patients had also bronchiolitis obliterans (BO). Skin scores were assessed by an experienced dermatologist. Clinical, laboratory and radiological findings after 4 months of ECP were accepted as response criteria. The patients received in this almost fully automated system mean 261.4 ml buffy-coat was processed within 193 min using UVADEX sterile solution.

After a median of 12 cycles of treatment, 6 patients showed a favorable response. ECP was tolerated well only one patient developed thrombocytopenia and another patient had a massive GIS bleeding due to an esophageal tear. Reduction in cholestatic parameters was observed in patients with liver cGVHD, improvement in respiratory functions and CT evaluations in two, and reduction in immunosuppressive requirement in all patients. The most impressive result was the reduced need for hospitalization of these patients and improvement of skin lesions. All but one of the skin biopsy scores was also better after ECP. At the Reggio Calabria Transplant Centre, the Therakos system is being used in a study conducted on patients suffering from acute and chronic GVHD following allogenic bone-marrow transplant, with recycling of ECP at intervals of 7 days. To date 15 patients have been treated with good overall response (unpublished data). However there are still no definitive responses with regard to whether or not such an intensive treatment, compared with one spread out over a longer period, could have significant clinical advantages, without causing the patient side effects.

The rising incidence of cGVHD and poor response of many patients to conventional immunosuppressive treatments have led to the increasing use of ECP as a treatment for refractory disease. This series illustrates that ECP can produce clinical improvements in patients with advanced disease and features that are associated with an adverse prognosis. Nevertheless, ECP is a time-consuming and relatively expensive treatment that requires specialized equipment and staff expertise. Improved criteria for patient selection would be useful to improve direction of this treatment resource. Several analysis of pretreatment patient characteristics and laboratory parameters did not identify any variables that were predictive of a favourable response to treatment. However, comparison of international data with previous smaller

series suggests that the initiation of ECP at an earlier stage is associated with more favorable response to treatment.

Seaton et al. (2003) leaded a study of patients with advanced cGVHD, ECP was initiated approximately 3 years after allogeneic transplantation and 2 years after onset of cGVHD. These data provide new evidence that ECP can be effective in extensive, long-standing cGVHD when treatment is initiated at an advanced stage after conventional immunosuppressive and corticosteroid therapy has failed. ECP should be considered most beneficial for patients with predominantly mucocutaneous cGVHD. However, in the absence of baseline criteria that accurately predict response, selection of these patients must continue to be made on clinical grounds.

C. Mechanism of action of ECP in GVHD There is little data in the literature analysing the immunomodulation of ECP in chronic GVHD. Although acute GVHD is unanimously recognised as a pathology correlated to alloreactivity, the etiology of chronic type GVHD is disputed and it is believed that it may be a development of the acute form or the result of a change in post-transplant reconstitution of immunology with the development of auto-antibodies and clonal T-cells autoreactive against their own organism. Acute GVHD is probably correlated with a change in function of the Th1 cells and certainly the inflammatory cytokines, such as IL2, IL-1, IFN" and TNF!, contribute to tissue damage (Abhyankar et al, 1993; Tanaka et al, 1997).

Recently Alcindor et al, (2001) published a study evaluating the function of lymphocytes and dendritic cells in patients suffering from chronic GVHD who underwent ECP for 2 consecutive days every 2 weeks. The average time following the transplant was 667 days; 7 out of 10 patients treated had a clinical response, particularly in the skin (improvement of ocular symptoms in 5/7 patients: in lesions of the oral mucous membrane in 5/8; in the liver in 2/3). Immunosuppressive treatment was reduced or suspended in 7 out of the 10 patients. The results contrasted with those reported by other authors (Simpson, 2000), who emphasised the non-effectiveness of ECP if started a long time after the onset of GVHD. In all the patients who responded there was a reduction of over 50% of the population of the CD 80+ and CD123 + dendritic 181

Martino et al: Extracorporeal photoimmune therapy for T-cell lymphoma and immunological diseases population, without significant changes in the expression of CD28 on the surface of the lymphocytes, suggesting that ECP did not act on the type I major histocompatibility complex, responsible for the functional control of the T cells. The reduction of the cells presenting the antigen, together with a reduction of CD8+ cells, revealed an overall suppression of alloreactivity.

O'Hagan et al, (1999) published a case history of 4 patients who underwent lung transplants complicated by obliterating bronchiolitis, not responding to immunosuppressive treatment. ECP was used for 2 consecutive days twice per month until the pulmonary condition stabilised, then as maintenance therapy every 46 weeks; the results obtained resulted in temporary stabilization of the condition and slight improvement of respiratory parameters.

These studies present a preliminary look at the potential clinic value of photopheresis as an additional to standard immunosuppression in organ transplants. Future trials will need to include an analysis of the cost-benefit ratio of photopheresis, and additional clinical studies and long-term follow-up will be required to assess the value of photopheresis in recipients of solid-organ transplants and the ultimate effect of this treatment on graft and patient survival.

V. ECP and organ transplants In order to evaluate the incidence of post-heart transplant rejection, Barr et al, (1998) randomised 60 patients into groups receiving standard immunosuppressive treatment (with cyclosporin, azathiaprine and prednisone) on its own or in combination with ECP. This study demonstrated a statistically significant reduction in the number of acute rejection episodes in recipients of cardiac transplants who received photopheresis therapy in addition to standard triple-drug immunosuppression. Longer follow-up will be required to assess the effects of a reduction in the risk of acute rejection on long-term graft function, the long-term survival of graft recipients, and the the development of graft vasculopathy.

VI. ECP and autoimmune disease The autoimmune pathologies that might potentially benefit from ECP are summarised in Table 2. An initial study using ECP to treat autoimmune disease produced favorable results in patients with pemphigus vulgaris (Rook et al, 1990).

Table 2 Potential fields of application of extracorporeal photochemotherapy Oncology SĂŠzary syndrome (T-cell cutaneous lymphoma) Chronic lymphocytic leukaemia Dermatology Psoriasis Autoimmune disease Scleroderma Multiple sclerosis (anecdotal data) Rheumatoid arthritis Pemphigus vulgaris Crohn's disease (anecdotal data) Organ transplant Rejection of heart transplant Rejection of lung transplant Rejection of kidney transplant Bone-marrow transplant and haemopoietic stem cells Graft-versus-host-disease (GVHD) Infectious diseases Hepatitis C (anecdotal data) AIDS (anecdotal data) Metabolic diseases Type 1 diabetes mellitus

182

Cancer Therapy Vol 2, page 183 Four patients with uncontrolled disease, despite prolonged courses of treatment with high dose of prednisone in combination with cyclophosphamide or azathiopirine, responded to ECP. All patients initially had improvement in the extent of their skin disease that allowed for significant tapering of all treatment. Significant reduction in serum levels of antiepidermal cell immunoglobulin occurred in conjunction with clinical improvement. Three patients achieved CR and halted immunosuppressive treatment; 3 suffered a relapse but CR was easily obtained with new photopheresis treatment. It’s a common experience that once clinical improvement occurs, gradual tapering of corticosteroids and immunosuppressive medications can proceed; however, simultaneous abrupt tapering of ECP along with the tapering of other medications may result in the early reoccurrence of skin lesions. ECP produced no serious adverse effects in any of the four patients during several years of follow-up.

In 1992 a multi-center randomized study was published (Rook et al, 1992) which evaluated the results of a study on 72 patients suffering from systemic sclerosis of recent onset with progressive involvement of the skin, comparing ECP with treatment with D-penicillamine Substantial skepticism has arisen regarding the use of ECP for systemic sclerosis because it manifests primarily as a fibrosing disease with increased deposition of collagen within the skin and involved visceral organs. Despite its status as a fibrosing disease, recent observation have implicated the immune system as a prime factor in the genesis of the increased collagen production. In this study, after 6 months of treatment, an improvement was registered in the skin in 68% of the patients treated with ECP, as opposed to 32% of those treated in the other arm of the study. Thus, in the early phases of treatment, a significantly higher response rate was obtained with ECP (p= 0.02). At both the 6 and 10 mo evaluation point, the mean skin severity score, mean percentage involvement, and mean oral aperture measurements were significantly improved from baseline among those who received ECP. Mean right- and left-hand closure measurements had also improved significantly by 10 mo of therapy. Skin biopsy studies demonstrated an association between clinical improvement and decreases thickness of the dermal layer.

It is noteworthy that adverse effects of ECP were minimal during this trial and did not require discontinuation of treatment by any patients. In contrast, 25% of patients who received D-penicillamine were required to permanently discontinue this drug due to side-effects when used for aggressive cases of recent onset systemic sclerosis.

In 1992 a trial was published (Knobler et al, 1992) conducted on patients suffering from systemic lupus erythematosus (SLE) which showed that in 5 patients treated with ECP, in combination with conventional cures, CR was obtained and was persisting after 30 months of follow-up, even though there was no change in the laboratory parameters characterising the disease.

In addition to these studies, the results of pilot trials have suggested the potential efficacy of ECP for rheumatoid arthritis (Malawista et al, 1991), epidermolysis bullosa acquisita (Miller et al, 1995; Gordon et al, 1997), atopic dermatitis (Prinz et al, 1994). Other clinical

indications that have been studied where efficacy has not been demonstrated include multiple sclerosis, chronic hepatitis C, and AIDS-related complex.

VII. Conclusions The future prospects of ECP concern defining the mechanism of action, its use in other pathologies and the combination of ECP-pharmacological treatment and/or radiotherapy. Photopheresis is a relatively safe and promising treatment. This review clearly shows that the fields of application of the procedure could be vast, and could include metabolic diseases, such as recently demonstrated by Ludvigsson et al, (2001) who presented a randomised study in 49 children suffering from type 1 diabetes mellitus, demonstrating possible control of the disease using phototherapy.

It could also include pathologies of an infectious nature (hepatitis C) (O’Brien et al, 1999) and even diseases such as Crohn's disease (Reinisch et al, 2001).

It is clear that all the published works present case histories involving small numbers and, in addition, that there are few randomised studies. Starting from these premises, national and international studies, aimed not only at developing the clinical possibilities of the treatment, but also at evaluating its biological aspects, are desirable, given the potential of the treatment, which, for the time being, has many unknown aspects.

References Abhvankar S, Godder K, Chiang K, et al, (1998) Extracorporeal photopheresis with UVADEX for the treatment of chronic graft-versus-host disease. Exp Hematol 26, 32 Abhyankar S, Gilliland DG, Ferrara JL (1993) Interleukin-1 is a critical effector molecule during cytokine dysregulation in graft-versus- host disease to minor histocompatibility antigens. Transplantation 56, 1518–1523 Alcindor T, Gorgun G, Miller KB, et al, (2001) Immunomodulatory effects of extracorporeal photochemotherapy in patients with extensive chronic graftversus-host disease. Blood 98, 1622–1625.

Barr ML, Meiser BM, Eisen HJ, et al, (1998) Photopheresis for the prevention of rejection in cardiac transplantation.

Photopheresis Transplantation Study Group. New Engl J Med 339, 1744–1751 Basara N, Gunzelmann S, Willenbacher W, et al, (2001) New immunosuppressants in BMT/GVHD. Transplant Proc 33, 2220–2222.

Berger CL, Xu AL, Hanlon D, et al, (2001) Induction of human tumor-loaded dendritic cells. Int J Cancer 91, 438–447.

Bladon J, Taylor PC (1999) Extracorporeal photopheresis induces apoptosis in the lymphocytes of cutaneous T-cell lymphoma and graft-versus-host disease patients. Br J Haematol 107, 707–711 Child FJ, Ratnavel R, Watkins P, et al, (1999) Extracorporeal pho-topheresis (ECP) in the treatment of chronic graftversus-host disease (GVHD). Bone Marrow Transplant 23, 881–887 Di Renzo M, Rubegni P, De Aloe G, et al, (1997) Extracorporeal photochemotherapy restores Th1/Th2 imbalance in patients with early stage cutaneous T-cell lymphoma. Immunology 92, 99–103.

DiVenuti G, Miller DF, Sprague K et al., (2002). Phopheresis as

183

Martino et al: Extracorporeal photoimmune therapy for T-cell lymphoma and immunological diseases a treatment for chronic graft-vs-host disease after allogeneic bone marrow transplantation. Blood; 100: 846a.

Duvic M, et al, (1996) Photopheresis therapy for cutaneous Tcell lymphoma. J. Am. Acad 35, 573-579 Edelson R, Berger C, Gasparro F, et al, (1987) Treatment of cutaneous T-cell lymphoma by extracorporeal photochemotherapy. Preliminary results. New Engl J Med 316, 297–303 Edelson RL (1991) Photopheresis, a clinically relevant immunobiologic response modifier. Ann NY Acad Sci 636, 154–164.

Fimiani M, et al, (1999) Role of extracorporeal photochemotherapy alone and in combination with interferon alfa in the treatment of cutaneous T-cell lymphoma. Am. Acad. Dermatol. 41, 502-503 Fraser-Andrew E, et al, (1998) Extracorporeale photopheresis in Sezary syndrome. Arch. Dermatol 134, 1001-1005 Fritz TM, et al, (1999) Combination treatment with extracorporeal photopheresis, interferon alfa and interleukin2 in a patient with the Sezary syndrome. Br. J. Dermatol.

140, 1144-1147 Gordon K, Chan L, Woodley D (1997) Treatment of refractory epidermolysis bullosa acquisita with extracorporeal photochemotherapy. Br J Dermatol 136: 415-420 Gottlieb S, et al, (1996) Treatment of cutaneous T-cell lymphoma with extracorporeal photopheresis momotherapy and in combination with recombinant interferon alpha, a 10 year experience at a single institution. J. Am. Acad.

Dermatol 35, 946.957 Greinix HT, Volc-Platzer B, Kalhs P, et al, (2000) Extracorporeal photochemotherapy in the treatment of severe steroid-refractory acute graft-versus-host disease, a pilot study. Blood 96, 2426–2431.

Greinix HT, Volc-Platzer B, Rabitsch W, et al, (1998) Successful use of extracorporeal photochemotherapy in the treatment of severe acute and chronic graft-versus-host disease. Blood 92, 3098–3104 Heald P, et al, (1992) Treatment of erythrodermic cutaneous Tcell lymphoma with extracorporeal photochemotherapy. J. Am. Acad. Dematol 27, 427-433 Ilhan O, Arat M, Arslan O, et al (2004) Extracorporeal photoimmunotherapy for the treatment of steroid refractory progressive chronic graft-versus-host disease. Transfus Apheresis Sci. 2004 Jun;30(3):185-7.

Jumbou O, et al, (1999) Long-term follow-up in 51 patients with mycosis fungoides and Sezary syndrome treated by interferon-alfa. Br. J. Dermatol. 140, 427-431 Knobler RM, Graninger W, Lindmaier A, et al, (1992) Extracorpreal photochemotherapy for the treatment of SLE. Arthr Rheum 35, 319-324 Lazarus HM, Rowe JM (1995) New and experimental therapies for treating graft-versus-host disease. Blood Rev 9, 117–133 Lim HW, Edelson RL (1995) Photopheresis for the treatment of cutaneous T-cell lymphoma. Hematol Oncol Clin North Am 9, 1117–1126.

Ludvigsson J, Samuelsson, Ernerudh J, et al, (2001) Photopheresis at onset of type 1 diabetes, a randomised, double blind, placebo controlled trial. Arch Dis Child 85, 149-154 Malawsta S, Trock D, Edelson R. (1991) Treatment of rheumatoid arthritis by extracorporeal photochemotherapy: a pilot study. Arthritis Rheum 34: 646-654 Miller J, Stricklin G, Fine J et al, (1995) Remission of severe epidermolysis bullosa acquisita by extracorporeal photochemotherapy. Br J Dermatol 133; 467-471 Messina C, Locatelli F, Lanino E et al., (2003) Extracorporeal

photochemotherapy for paediatric patients with graft-versus host disease after haematopoietic stem cell transplantation. Br J Haematol; 122: 118–127.

O’Brien CB, Henzel BS, Moonka DK, et al, (1999) Extracorporeal photopheresis alone and with interferon-alpha 2a in chronic hepatitis C patients who failed previous interferon therapy. Dig Dis Sci 44, 1020-1026 O’Hagan AR, Stillwell PC, Arroliga A, et al, (1999) Photopheresis in the treatment of refractory bronchiolitis obliterans complicatinglung transplantation. Chest. 115, 1459-1462 Owsianowski M, Gollnick H, Siegert W, et al, (1994) Successful treatment of chronic graft-versus-host disease with extracorporeal photopheresis. Bone Marrow Transplant 14, 845–848 PrintzB, Nachbar F, Plewig G (1994) Treatment of severe atopic dermatitis with extracorporeal photochemotherapy. Arch Dermatol Res 287: 48-52 Przepiorka D, Kernan NA, Ippoliti C, et al, (2000) Daclizumab, ahumanized anti-interleukin-2 receptor alpha chain antibody, for treatment of acute graft-versus-host disease. Blood 95, 83–89.

Ratanatharathorn V, Ayash L, Lazarus HM, et al, (2001) Chronic graft-versus-host disease, clinical manifestation and therapy.

Bone Marrow Transplant 28, 121–129.

Reinisch W, Nahavandi H, Santella R, et al, (2001) Extracorporeal photochemotherapy in patients with steroiddependent Crohn’s disease, a prospective pilot study.

Aliment Pharmacol Ther 15, 1313.1322 Remberger M, Ringden O, Blau IW, et al, (2001) No difference in graft-versus-host disease, relapse, and survival comparing peripheral stem cells to bone marrow using unrelated donors.

Blood 98, 1739–1745.

Rook A, et al, (1991) Combined therapy for Sezary syndrome with extracorporeal photochemotherapy and low-dose interferon alfa therapy. Arch. Dermatol. 127, 1535.1540 Rook AH, et al, (1997) Pathogenesis of cutaneous T-cell lymphoma, implication for the use of recombinant cytochines and photopheresis. Clin. Exp. Immunol. 107 (Suppl.1), 1620 Rook AH, Freundich B, Jegasothy BV, et al, (1992) Treatment of systemic sclerosis with extracorporeal photochemotherapy, results of a multicenter trial. Arch. Dermatol. 128, 337-346 Rook AH, Jegasothy B, Heald P, et al, (1990) Extracorporeal photpchemotherapy for drug resistant pemphigus vulgaris.

Ann Intern Med 112, 303-305 Rook AH, Suchin KR, Kao DM, et al, (1999) Photopheresis, clinical applications and mechanism of action. J Invest Dermatol Symp Proc 4, 85–90 Rook AH, Wolfe JT ( 1994) Role of extracorporeal photopheresis in the treatment of cutaneous T-cell lymphoma, autoimmune dis-ease, and allograft rejection. J Clin Apheresis 9, 28–30 Rosetti F, Dall’Amico R, Crovetti G, et al, (1996) Extracorporeal photochemotherapy for the treatment of graft-versus-host disease. Bone Marrow Transplant 18 (Suppl. 2), 175–181.

Rosetti F, Zulian F, Dall’Amico R, et al, (1995) Extracorporeal pho-tochemotherapy as single therapy for extensive, cutaneous, chronic graft-versus-host disease.

Transplantation 59, 149–151 Russel-Jones AR, et al, (1997) Extracorporeal photopheresis in Sezary syndrome. Lancet. 350, 886 Russel-Jones R (2000) Extracorporeal photopheresis in cutaneous T-cell lymphoma. Inconsistent data undrline the need for randomised studies. Br. J. Dermatol. 142, 16-21+ Shulman HM, Sale GE, Lerner KG, et al, (1978) Chronic cutaneous graft-versus-host disease in man. Am J Pathol 91, 545–570.

184

Cancer Therapy Vol 2, page 185 Simpson D (2000) Drug therapy for acute graft-versus-host disease prophylaxis. J Hematother Stem Cell Res 9, 317–325.

Seaton ED, Szydlo RM, Kanfer E, et al. (2003) Influence of extracorporeal photopheresis on clinical and laboratory parameters in chronic graft-versus-host disease and analysis of predictors of response. Blood15, Vol . 102, N.4, 12-171223 Tanaka J, Imamura M, Kasai M, et al, (1997) The important balance between cytokines derived from type 1 and type 2 helper T cells in the control of graft-versus-host disease.

Bone Marrow Transplant 19, 571–576 Ullrich SE (1991) Photoinactivation of T-cell function with psoralen and UVA radiation suppresses the induction of experimental murine graft-versus-host disease across major histocompatibility barriers. J Invest Dermatol 96, 303–308.

Urbano-Ispizua A, Garcia-Conde J, Brunet S, et al, (1997) High incidence of chronic graft-versus-host disease after allogeneic peripheral blood progenitor cell transplantation.

The SpanishGroup of Allo PBPCT. Haematologica 82, 683–689 Vogelsang GB, Wolff D, Altomonte V, et al, (1987) Treatment of chronic graft-versus-host disease with ultraviolet irradiation and psoralen (PUVA). Bone Marrow Transplant 17, 1061–1067 Vowels BR, Cassin M, Boufal MH, et al, (1992) Extracorporeal photochemotherapy induces the production of tumor necrosis factor-alpha by monocytes, implications for the treatment of cutaneous T-cell lymphoma and systemic sclerosis. J Invest Dermatol 98, 686–692 Wilson LD, et al, (1995) Systemic chemotherapy and extracorporeal photochemotherapy for T3 and T4 cutaneous T-cell lumphoma patients who have achieved a complete response to total skin electron beam therapy. Int J. Radiat.

Oncol. Biol. Phys., 32, 987-995

Wilson LD, et al, (2000) Experience with total skin electron beam therapy in combination with extracorporeal photopheresis in the management of patients with erythodermic (T4) mycosis fungoides. J. Am. Acad.

Dermatol. 43, 54-60 Wolfe JT, Lessin SR, Singh AH, Rook AH (1994) Review of immu-nomodulation by photopheresis, treatment of cutaneous T-cell lymphoma, autoimmune disease, and allograft rejection. Artif Organs 18, 888–897 Wood GS, Yoo EK, et al, (1999) Interleukin 12 induces lesion regression and cytotoxic T cell responses in cutaneous T cell lymphomas. Blood. 94, 902-908 Yoo EK, Rook AH, Elenitsas R, et al, (1996) Apoptosis induction of ultraviolet light A and photochemotherapy in cutaneous T-celllymphoma, relevance to mechanism of therapeutic action. J Invest Dermatol 107, 235–242 Zouboulis CC, Schmuth M, Doepfmer S, et al, (1998) Extracorporeal photopheresis of cutaneous T-cell lymphoma is associated with reduction of peripheral CD4 T lymphocytes. Derma-tology 196, 305–308.

Dr. Massimo Martino

185

Martino et al: Extracorporeal photoimmune therapy for T-cell lymphoma and immunological diseases

186

Cancer Therapy Vol 2, page 187 Cancer Therapy Vol 2, 187-194, 2004

Methylation analysis of cell cycle control genes RB1, p14ARF and p16INK4a in human gliomas Research Article

M. Josefa Bello1, Pilar Gonzalez-Gomez1, M. Eva Alonso1, Nilson P. Anselmo2, Dolores Arjona1, Cinthia Amiñoso1, Isabel Lopez-Marin1, Jose M. de Campos3, Alberto Isla4, Jesus Vaquero5, Cacilda Casartelli2 and Juan A. Rey1* 1

Laboratorio de Oncogenética Molecular y Epigenética del Cáncer, Unidad de Investigación, Departamento de Cirugía Experimental, and 4Departamento de Neurocirugia, Hospital Universitario La Paz, 28046 Madrid, Spain.

2 Departamento de Genetica, Facultade de Medicina de Ribeirao Preto, Universidade de Sao Paulo, Ribeirao Preto, SP, Brazil.

3 Departamento de Neurocirugía, Hospital del Río Hortega, Valladolid, Spain.

5 Departamento de Neurocirugía, Clínica Puerta de Hierro, Madrid, Spain.

__________________________________________________________________________________ *Correspondence: Juan A. Rey, Ph.D., Laboratorio de Oncogenética Molecular y Epigenética del Cáncer, Unidad de Investigación, Departamento de Cirugía Experimental, Hospital Universitario La Paz. Paseo Castellana, 261, 28046 Madrid. Spain. ; Fax: +34 91 727 70 50; E-mail: jarey.hulp@salud.madrid.org Key Words: RB1, p14ARF, p16INK4a, CpG island, aberrant methylation, epigenetics, gliomas, astrocytoma, oligodendroglioma, ependymoma, glioblastoma Abbreviations: central nervous system, (CNS); methylation-specific polymerase chain reaction, (MSP); neurofibromatosis 1, (NF1); polymerase chain reaction, (PCR); World Health Organisation, (WHO) Received: 9 June 2004; revised: 23 June 2004 Accepted: 01 July 2004; electronically published: July 2004

Summary Aberrant methylation of CpG islands located in promoter regions is one of the major mechanisms for silencing cancer-related genes in tumor cells. We determined the frequency of aberrant CpG island methylation for three cell cycle control-associated genes RB1, p14ARF and p16INK4a in 198 glioma biopsies consisting of: 16 pilocytic astrocytomas (World Health Organisation grade I), 26 low-grade diffuse astrocytomas (WHO grade II), 23 anaplastic astrocytomas (WHO grade III), 53 glioblastomas (WHO grade IV: 43 primary and 10 secondary), one giant cell astrocytoma, 24 oligodendrogliomas (WHO grade II), 16 anaplastic oligodendrogliomas (WHO grade III), six oligoastrocytomas (WHO grade II-III), two WHO grade I ependymomas, 24 ependymomas (WHO grade II), five anaplastic (WHO grade III) ependymomas, and two ependymoblastomas (WHO grade IV) as well as in two non-neoplastic brain samples, using methylation-specific polymerase chain reaction (MSP) and sequencing. The three tumor-related genes were unmethylated in the two normal brain control samples. In contrast, 106 of 198 (54%) of the tumors had an abnormal methylation pattern in at least one of the target genes. The overall methylation frequencies for all three genes were: 13% (26/198) for RB1; 21% (42/198) for p14ARF, and 37% (74/198) for p16INK4a. Some differences may be established regarding the methylation profiles of specific genes and tumor types: pilocitic astrocytomas showed hyperemethylation in 44% for p16INK4a gene and in only 6% of the p14ARF. Lowgrade astrocytomas had two genes (RB1 and p16INK4a) with methylation rates >30% and p14ARF had a lower hypermethylation rate (15%). There were also differences between primary and secondary glioblastomas: p16INK4a and RB1 have higher methyaltion rates in the latter group (60% and 40%, respectively) than in the primary glioblastomas (37% and 12%, respectively). No methylation at all was detected for RB1 in pure oligodendrogliomas, whereas p14ARF was hypermethylated at significant rates (46-50%) in both low-grade and anaplastic oligodendrogliomas. In contrast, p16INK4a was hypermethylated more frequently in low-grade than in anaplastic oligodendrogliomas. Ependymal tumors primarily displayed p14ARF methylation and lower values for the other two genes. We conclude that methylation is a common mechanism that contributes to inactivating cell cycle controlrelated genes in glial neoplasms because these genes present a high frequency of aberrant methylation of the 5’ CpG island in this study. This aberration seems to occur early in the carcinogenesis process since it is already present in the low-grade forms.

187

Bello et al: Methylation analysis of cell cycle control genes in human gliomas EGFR genes (Kleihues and Cavenee, 2000). Several other non-random anomalies are also characteristic features of these gliomas, including loss of heterozygosity at 1p, 10p, 10q, 11p, 19q and 22q, although the putative tumor suppressing genes remain unidentified. A distinct pattern of involvement of these genes and chromosomal regions characterizes both forms of glioblastoma. The main differences consist of EGFR gene amplification and TP53 mutations, which respectively characterize primary and secondary glioblastomas (Kleihues and Cavenee, 2000).

Tumors with a major oligodendroglial component account for 4% of all primary brain tumors and represent between 5% and 18% of all intracranial gliomas, including oligodendroglioma (WHO grade II), anaplastic oligodendroglioma (WHO grade III) and mixed oligoastrocytoma (Kleihues and Cavenee, 2000). They arise preferentially in the cerebral hemispheres of adult patients with a mean age at diagnosis of ~40 years. Lowgrade oligodendrogliomas are characterized by a high incidence of loss of chromosome arms 1p and 19q, and anaplastic forms accumulate allelic losses on the short arm of chromosome 9 and on chromosome 10 (for review see Kleihues and Cavenee, 2000).

Ependymomas represent 3-9% of all intracranial brain tumors and about 60% of spinal tumors, and commonly arise in children (Kleihhues and Cavenee, 2000). Cytogenetic and molecular biology studies have demonstrated a preferential involvement of chromosome 22 (by losses), parallel to the inactivation of the NF2 gene (located at 22q12), primarily in sporadic cord tumors.

Additional genomic abnormalities include chromosome 7 gains and overrepresentation of chromosomes 2, 5, 9, 12, 15, 18, 20q and X, and proportional losses of 13q. Losses of 6q and 9p, with gains of 1q, have primarily been found in intracranial ependymomas (Weremowicz et al, 1992; Rubio et al, 1994; Ebert et al, 1999; Hulsebos et al, 1999; Rousseau-Merk et al, 2000; Kraus et al, 2001; Alonso et al, 2002). These findings, thus, suggest that intracranial and spinal cord ependymomas progress along different genetic pathways that may influence differences in the clinical behavior of these gliomas.

Tumorogenesis of gliomas seems to be a multi-step process composed of genetic and epigenetic alterations involving tumor suppressor genes, cell cycle regulatory genes, oncogenes, and as yet unidentified genes located at specific chromosomal regions (Kleihues and Cavenee, 2000). Transcriptional silencing by hypermethylation of CpG islands located in the promoter regions is considered a common epigenetic mechanism for inactivation of tumor-related genes (Esteller, 2003). CpG islands are 0â&#x20AC;&#x2122;52 Kb regions rich in cytosine-guanine dinucleotides, present in the 5â&#x20AC;&#x2122; region of about half of all human genes (Baylin et al, 1998). Little information is available on the CpG island methylation status of neurogenic neoplasms.

Isolated previous studies focus on high-grade astrocytomas, primarily the anaplastic forms and glioblastoma multiforme (Costello et al, 1996; Park et al, 2000; Nakamura et al, 2001a; 2001b; Yin et al, 2002; Gonzalez-Gomez et al, 2003a, 2003b; Uhlmann et al, 2003) and less frequently on low-grade astrocytomas (Costello et al, 2000; Gonzalez-Gomez et al, 2003a;

I. Introduction Primary brain tumors are neoplasms that originate from various intracranial tissues. About 17,000 new cases occur annually and primary cancer of the central nervous system (CNS) is the cause of death of approximately 13,000 individuals per year (Surawicz et al, 1998). More than 60% of all brain tumors have a glial origin, including pilocytic astrocytoma, low-grade astrocytoma, anaplastic astrocytoma, glioblastoma, oligodendroglioma, anaplastic oligodendroglioma, mixed oligoastrocytoma and lowgrade and anaplastic ependymomas (Kleihues and Cavenee, 2000).

Pilocytic astrocytoma (a slow-growing tumor with a World Health Organization (WHO) grade I) is considered to be the most common glioma in children, accounting for 10% of cerebral and 85% of cerebellar astrocytomas. It constitutes the principal CNS neoplasm in neurofibromatosis 1 (NF1) (Burger et al, 2000).

Cytogenetic analysis of pilocytic astrocytoma has revealed normal karyotypes or a variety of aberrations, primarily involving gains of chromosomes 7 and 8 (Rey et al, 1987; Karnes et al, 1992; White et al, 1995). Allelic losses at 1p36 or at 17q have been identified in a few cases (von Deimling et al, 1993; Bello et al, 1995), and comparative genomic hybridization analysis identified gains of chromosomes 19, 22 and 9q34.1-qter, and losses of chromosome 19 (Sanoudpu et al, 2000). Regarding TP53 gene mutations discordant data are available; early studies identified sequence changes in a few tumors (von Deimling et al, 1993), whereas 35% of samples (7 of 20) analyzed by Hayes et al. (1999) displayed mutations of this gene. The only consistent gene alteration described in this astrocytoma subtype is a loss of NF1 alleles that occurs in up to 90% of informative NF1-associated cases, in contrast to only 4% of sporadic tumors (Burger et al, 2000). LOH analysis at 1p, 10, 17 and 19q, and mutation detection at TP53, p16INK4a and EGFR has been performed on 12 samples, including three NF1-associated tumors (Tada et al, 2003). None of the genetic abnormalities commonly detected in higher-grade astrocytomas were found in the sporadic cases. In contrast, LOH 10 and 17q (including the PTEN and NF1 regions, respectively) and homozygous deletion of p16INK4a were identified in the NF1-associated samples. These data support the hypothesis that some NF1-associated pilocytic astrocytomas would differ genetically from sporadic cases.

Diffuse astrocytic gliomas are the most common primary neoplasm occurring in the CNS and are histologically classified as WHO grade II astrocytomas, WHO grade III anaplastic forms, and WHO grade IV glioblastoma (Kleihues and Cavenee, 2000). Low grade (WHO grade II) tumors and anaplastic grade III astrocytomas usually occur in adults and show a strong tendency toward progression. Glioblastoma, the most malignant subtype of glioma, may develop either from diffuse or anaplastic tumors (secondary glioblastoma) or de novo (primary glioblastoma) without a defined prior tumor lesion. Multiple genetic alterations have been identified in these astrocytic neoplasms; these alterations primarily involve inactivation or amplification/overexpression of TP53, p16 INK4a, RB1, PTEN, MDM2, and 188

Cancer Therapy Vol 2, page 189 for 16 hours in the dark. After treatment, DNA was purified using the DNA clean-up Kit (Promega, Madison, WI) as recommended by the manufacturer, incubated with 3mol/L NaOH (room temperature for 5 min), precipitated with 10mol/L ammonium acetate and 100% ethanol, washed with 70% ethanol and re-suspended in 30 µl distilled water. The primer sequences of these genes for the methylated and unmethylated reactions were as reported (Xing et al, 1999; Simpson et al, 2000). PCR was performed for the methylated and unmethylated alleles using a thermal cycler in standard conditions with variable (55-66°C) annealing temperatures. Each PCR reaction (20µl) was loaded directly onto non-denaturing 6% polyacrylamide gels or 2-3% agarose gels, stained with ethidium bromide, and visualized under UV illumination. Samples giving signals approximately equivalent to the positive control were designated as methylated.

As positive control for methylated alleles, we used DNA (from lymphocytes of healthy volunteers) treated with SssI methyltransferase (New England Biolabs), then subjected to bisulfite treatment. To verify the identity of PCR products, they were purified and sequenced (after PCR re-amplification with the same primer set) using the ABI PRISM Byg-Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems) on the Applied Biosystem model 3100 or 377 DNA sequencers. Each amplicon was sequenced bidirectionally.

2003b; 2003c; Uhlmann et al, 2003), oligodendrogliomas (Watanabe et al, 2001a;Wolter et al, 2001; Yin et al, 2002; Alonso et al, 2003; Hong et al, 2003; Uhlmann et al, 2003), pilocytic astrocytoma (Gonzalez-Gomez et al, 2003c; Uhlmann et al, 2003) and ependymomas (Rousseau et al, 2003; Alonso et al, 2004).

In the present study we determined the frequency of methylation of three genes: RB1, p14ARF and p16INK4a in a series of 198 gliomas, including astrocytic, oligodendroglial and ependymal tumors, and in two normal brain tissue samples, using polymerase chain reaction (PCR)-based techniques involving sodium bisulfite modification of DNA (MSP) and sequencing of the PCR products.

II. Materials and methods A. Sample collection and DNA preparation Fresh tumor tissues were obtained from 198 patients with malignant gliomas, including 16 WHO grade I pilocytic astrocytomas; 26 WHO grade II diffuse astrocytomas; 23 WHO grade III anaplastic astrocytomas; 53 WHO grade IV glioblastomas multiformes (43 primary and 10 secondary); one giant cell astrocytoma; 24 WHO grade II oligodendrogliomas; 16 WHO grade III anaplastic oligodendrogliomas, six WHO grade II-III mixed oligo-astrocytomas; two WHO grade I ependymomas, 24 WHO grade II ependymomas, five anaplastic (WHO grade III) ependymomas, and two ependymoblastomas (WHO grade IV) as well as two nonneoplastic brain samples.

Tumors were diagnosed according to the WHO guidelines (Kleihues and Cavenee, 2000), and the tumor cell content was estimated by histologic examination to be approximately 7590%. DNA was prepared from frozen tissues using standard methods, as described (Rey et al, 1992).

III. Results Examples of methylation of all three genes, sequences from methylated alleles aligned against the corresponding wild type sequence, and bar diagrams that illustrate the methylation frequency of each gene in the different histological glioma subtypes are shown in Figure 1.

All but 92 study samples displayed CpG island hypermethylation in at least one gene (54%). The methylation frequency of the RB1, p14ARF and p16INK4a genes was 13%, 21%, and 37%, respectively. In contrast, methylation of these genes did not occur in either of the two normal brain samples. The methylation frequencies for the three genes in every tumor type studied are shown in Table 1.

B. Bisulfite treatment of DNA, methylationspecific polymerase chain reaction (MSP) and sequencing Bisulfite modification of genomic DNA was performed as reported (Herman et al, 1996). Briefly, 2µg of genomic DNA was denatured with 2mol/L NaOH (37°C for 10 min), followed by incubation with 3mol/L sodium bisulfite (pH 5.0) at 55-56°C

Table 1: Methylation frequencies of cell-cycle control genes in histological subtypes of gliomas Tumor type PA A AA Secondary GB Primary GB Total GB GCA O AO OA E-I E AE EB

RB1 3/16 9/26 3/23 4/10 5/43 9/53 0/1 0/24 0/16 1/6 0/2 1/24 0/5 0/2

(%) (19) (35) (13) (40) (12) (17) (0) (0) (0) (17) (0) (4) (0) (0)

p14ARF 1/16 4/26 5/23 0/10 9/43 9/53 0/1 11/24 8/16 1/6 0/2 2/6 1/3 N.D.

(%) (6) (15) (22) (0) (21) (17) (0) (46) (50) (17) (0) (33) (33) --

p16INK4a 7/16 15/26 13/23 6/10 16/43 22/53 0/1 6/24 2/16 3/6 0/2 6/24 0/5 0/2

(%) (44) (58) (57) (60) (37) (42) (0) (25) (12.5) (50) (0) (25) (0) (0)

PA: Pilocytic Astrocytoma; A: grade II Astrocytoma; AA: Anaplastic Astrocytoma; GB: Glioblastoma; GCA: Giant Cell Astrocytoma; O: grade II Oligodendroglioma; AO: Anaplastic Oligodendroglioma; OA: Mixed Oligo-astrocytoma; E-I: grade I Ependymoma; E: grade II Ependymoma; AE: Anaplastic Ependymoma; EB: Ependymoblastoma. N.D. Not done

189

Bello et al: Methylation analysis of cell cycle control genes in human gliomas

Figure 1. Examples of MSP analysis for RB1, p14ARF, and p16INK4a in gliomas. Lane U, amplified product with primers recognizing unmethylated sequence; lane M, amplified product with primers recognizing methylated sequence. NC: negative control of methylation; PC: positive control of methylation; L: ladder. The forward sequences of representative methylated tumors are shown. Sequences are aligned against the wild-type (Wt) sequences showing a change of C to T by bisulfite treatment. C in CpG dicnucleotides that were methylated remains unaffected. The frequency of aberrant methylation for all three genes in every glioma subgroup is shown on the right. (The tumor nomenclature is the same described in Table 1).

RB1 was primarily methylated in astrocytic and mixed tumors, with frequencies ranging from 13% (in anaplastic astrocytoma) to 40% in secondary glioblastoma.

On the other hand, pure oligodendrogliomas and ependymomas presented 0-4% aberrant RB1 methylation.

In contrast, p14ARF hypermethylation rates were higher in

oligodendroglial tumors (46% and 50% in low-grade and anaplastic oligodendrogliomas, respectively), and values of about 20-30% characterized p14ARF in anaplastic astrocytomas and ependymomas. On the other hand pilocytic astrocytomas and secondary glioblastoma displayed a 0-6% methylation rate for this gene. The 190

Cancer Therapy Vol 2, page 191 p16INK4a gene was hypermethylated by >35% of each subtype of astrocytic tumor, including pilocytic astrocytomas. However, the methylation rate for this gene was lower than 25% in pure oligodendrogliomas and ependymal tumors.

As shown in Table 2, simultaneous promoter methylation of two or three genes was demonstrated in some tumors as follows: RB1 and p16INK4a in 7% (14/198) of cases, p16INK4a together with p14ARF in 8% (15/198) of cases, and RB1 plus p14ARF in 0.5% (1/198) of cases. Three gliomas showed hypermethylation of all three genes (1.5%). Promoter methylation of either RB1 or p16INK4a was present in 41% of samples (82/198).

In most tumors, gene hypermethylation was always accompanied by amplification of the unmethylated reaction (Figure 1). This finding was expected, since the tumor specimens were macroscopically isolated samples that contained both tumor and a small fraction of nonmalignant tissues.

Alternatively, cytosine hemimethylation, that is the cytosine on one chromosome is methylated but its homologue on the other chromosome is not, might also explain the finding. Sequencing of the corresponding methylated PCR products demonstrated the presence of invariable CpG as was expected (Figure 1).

Loss of RB1 function has been described in a variety of tumor types, and hypermethylation of the promoter is recognized as an important RB1 silencing mechanism (Ohtani-Fujita et al, 1993). RB1 methylation was most frequent in astrocytic neoplasms in our tumor series and, in agreement with previous reports (Nakamura et al, 2001a; Gonzalez-Gomez et al, 2003a), we found RB1 promoter methylation more frequently in secondary (40%) than in primary (12%) glioblastomas. The non-random frequencies (13-35%) of aberrant RB1 methylation that we detected in the low-grade and anaplastic astrocytomas might be indicative of a subgroup of astrocytic tumors that further develop towards secondary glioblastoma, thus displaying a more aggressive biological behavior. In fact, loss of RB1 expression has been associated with a higher grade of malignancy in several human neoplasms (Cryns et al, 1994; Tsuda et al, 2000). In oligodendroglial and ependymal tumors we found very low rates or no methylation of this gene. Since RB1 inactivating mutations are also infrequent in these tumors (Gonzalez-Gomez et al, 2003a), the inactivation of the RB1 cell cycle control pathways should occur through the silencing of another alternative genes. However, oligo-astrocytomas presented a 17% rate of aberrant RB1 methylation, probably corresponding to the astrocytic component in these mixed tumors.

Low rates of p14ARF hypermethylation were found in the pilocytic astrocytoma group (6%) and low-grade astrocytomas (15%) and this frequency increased slightly in anaplastic astrocytomas (22%). Loss of p14ARF expression has been shown to be an important event in the genetic pathways for the development of both primary and secondary glioblastoma (Nakamura et al, 2001b; Ghimenti et al, 2003). Although promoter hypermethylation of this gene has been reported as more frequent in secondary tumors (Nakamura et al, 2001b), we found 21% p14ARF methylation in primary glioblastoma and no secondary glioblastoma in our series displayed this anomaly. This finding may be due to the small number of secondary tumors included in our study; p14ARF promoter methylation has been proposed as an early event in a subset of lowgrade astrocytomas (as occurs in our tumor series) that may undergo malignant progression to secondary glioblastoma. Some of these highly malignant (secondary) tumors display homozygous deletion of p14ARF (Nakamura et al, 2001b). With regard to oligodendroglial tumors, previous studies on p14ARF methylation have shown variable results: Dong et al (2001) found 2%, whereas Wolter et al (2001) found 41%, and Watanabe et al (2001b) detected p14ARF methylation in 21% of grade II oligodendrogliomas and 15% of the anaplastic forms. Our data show 46% and 50% in grade II and grade III forms, respectively, whereas 17% of our mixed tumors showed epigenetic alteration in this gene; these figures are closer to those we detected in astrocytomas. The epigenetic inactivation of p14ARF is a frequent alteration in ependymal tumors, since about 30% of the samples (low-grade and anaplastic forms) displayed this alteration in our series.

These findings agree with the data recently provided by Rousseau et al (2003), who detected 21% epigenetic change in this gene in this glioma subtype and, in

IV. Discussion The results presented here clearly demonstrate that CpG island hypermethylation of cell-cycle control genes is a frequent event in gliomas, as methylation of one or more genes was observed in 54% of the analyzed samples (106 of 198). Our study shows that hypermethylation rates vary by gene, and that it occurs in most instances at early stages of gliomagenesis, because it is already present in the lowgrade forms. This was primarily evident for p16INK4a, which presented methylation rates >40% in low-grade astrocytic tumors such as pilocytic astrocytoma and WHO grade II tumors. For its part p14ARF was hypermethylated in <15% of these low-grade astrocytomas.

RB1 is located on the long arm of chromosome 13 (13q14) and is the classical example of a tumor suppressor gene. It encodes a nucleoprotein (pRB) that plays a key role in the cell cycle regulation complexes that govern the G1-S transition of cells, thus allowing mitosis and cell division (Friend et al, 1986; Lee et al, 1987).

Table 2: Isolated and concurrent methylation frequencies of cell-cycle control genes in gliomas Gene Frequency RB1 13% (26/198) p14ARF 21% (42/198) p16INK4a 37% (74/198) RB1 + p14ARF RB1 + p16INK4A p14ARF + p16INK4a RB1 + p14ARF + p16INK4a

0.5% 7% 8% 1.5%

(1/198) (14/198) (15/198) (3/198)

RB1 or p16INK4a

41%

(82/198)

191

Bello et al: Methylation analysis of cell cycle control genes in human gliomas agreement with their data, aberrant p14ARF hypermethylation was more frequently identified in the intracranial ependymal tumors. An inverse correlation has been reported for p14ARF and TP53 mutations in glioblastomas (Ichimura et al, 2000).

Since oligodendrogliomas and ependymomas rarely present TP53 inactivating mutations (for review see Kleihues and Cavenee, 2000), silencing of the p14ARF gene through aberrant promoter methylation may be a mechanism to inactivate the p14ARF/MDM2/TP53 cell-cycle signaling pathway in these glioma subtypes. Recent data have demonstrated a high percentage of p14ARF inactivation in glioblastomas with classical, astrocytic or oligodendroglial differentiation areas (Ghimenti et al, 2003), suggesting again that silencing this gene is an important step in tumorogenesis and/or progression of distinct glioma subtypes Aberrant methylation was the molecular gene silencing mechanism in some of those cases.

Oligodendrogliomas and ependymomas showed a lower rate of p16INK4a promoter hypermethylation than astrocytic tumors. We found a 25% rate of p16INK4a aberrant hypermethylation in oligodendrogliomas and a 12.5% rate in the anaplastic forms, as well as a 25% rate in the low-grade ependymomas. Dong et al, (2001), Walter et al (2001) and Watanabe et al, (2001) also showed variable results in methylation studies of this gene. They respectively report rates of 12%, 32% and 0%. Rates of about 21% aberrant methylation in the p16INK4a gene were identified in ependymomas (Rousseau et al, 2003; Alonso et al, 2004). Variable frequencies of p16INK4a hypermethylation have also been reported in secondary glioblastoma, and range from 70% to <5% (Costello et al, 1996; Fueyo et al, 1996; Hegi et al, 1997; Burns et al, 1998; Nakamura et al, 1998; Schmidt et al, 1998; Park et al, 2000; Yin et al, 2002; Gonzlaez-Gomez et al, 2003).

Our results corroborate the proposal that a high rate of p16INK4a CpG island hypermethylation is characteristic of both primary and secondary glioblastoma subtypes and also of the lower grade astrocytic forms. A 44% rate for p16INK4a CpG island hypermethylation was found in the pilocytic astrocytomas included in our series. The mixed oligo-astrocytoma group was different from the pure oligodendrogliomas, perhaps due to their astrocytic component. Interestingly, an association between a worse prognosis and p16INK4a inactivation either by deletion/mutation or aberrant promoter methylation has been recently reported in oligodendrogliomas (Bortolotto et al, 2000).

Concurrent aberrant hypermethylation was identified in several cases; for instance methylation occurred in both p16INK4a and either RB1 or p14ARF in 7-8% of cases, whereas only one sample (0.5%) displayed concurrent RB1 plus p14ARF methylation. Accordingly, promoter hypermethylation of the p14ARF gene seems to be independent of the methylation status of p16INK4a even though their promoters are very close to each other on 9p21 and they share two exons, albeit in different reading frames (Sherr et al, 1996; Kamijo et al, 1998), and they are frequently co-deleted in glioblastoma (Newcomb et al, 2000). The transcriptional activity of p14ARF is regulated independently of p16INK4a and participates in a regulatory

feedback loop with p53 and MDM2 (Kamijo et al, 1998).

The p16INK4a protein function is closely related to RB1 in cell cycle regulation; it regulates G1-S phase transition by inhibiting the activity of cyclin-dependent kinases CDK4 and CDK6. This cell-cycle control pathway was inactivated in 41% of the gliomas we studied, since methylation of both or either the RB1 or p16INK4a gene occurred. Some cases in our series displayed a concurrent aberrant hypermethylation of both RB1 and p16INK4a that might represent a redundant epigenetic alteration of this cell-cycle control pathway.

In conclusion, this study demonstrates that CpG island methylation of cell-cycle control genes is a common event in gliomas. It generally occurs at early stages of carcinogenesis, since it is already present in the low-grade forms. Some differences in the pattern of gene methylation were observed: hypermethylation of p14ARF occurred more frequently in oligodendrogliomas and ependymomas than in astrocytic tumors. On the other hand p16INK4a and RB1 were frequently methylated in astrocytic gliomas. In agreement with previous data (Gonzalez-Gomez et al, 2003c; Uhlmann et al, 2003) our findings suggest an important role for epigenetic changes in the development of pilocytic astrocytoma, a glial tumor in which no consistent genetic alteration has been identified previously. Finally, epigenetic inactivation of the cellcycle control genes in some glioma subtypes might be indicative or predictive of an aggressive behavior: RB1 or p14ARF in astrocytic tumors (Nakamura et al, 2001a; 2001b), or p16INK4a in oligodendrogliomas (Bortolotto et al, 2000). Accordingly, therapies addressed to promoting re-expression of these genes (Swanton, 2004) might be useful in the management of glioma patients. An accurate glioma-subtype histological diagnosis together with an inequivocal identification of samples displaying promoter hyperemethylation, in combination with gene mutational/expression analyses, will contribute to optimizing the clinical application of molecular characterization of gliomas; this should lead to a firm establishment of predictive prognostic factors and specific therapies.

Acknowledgements This study was supported by Grants 02/0669, 03/0235 from Fondo de Investigaciones Sanitarias (FIS), Ministerio de Sanidad, and Grant 08.1/0040/2003.1 from Consjeria de Educacion, Comunidad de Madrid, and grant from Fundaciรณn MAPFRE-Medicina. M. Eva Alonso is supported by a predoctoral felowship from Consejeria de Educacion, Comunidad de Madrid. C. Casartelli is supported by Fundaรงao de Amparo a Pesquisa de estado do Sao Paolo (FAPESP) and Coordenaรงao de Aperfeiรงoamento de Pesoal de Nivel Superior (CAPES).

We are indebted to Dr J.L. Sarasa and Dr. M. Gutierrez for histological diagnosis of tumor samples.

References Alonso ME, Bello MJ, Arjona D, Gonzalez-Gomez P, Lomas J, de Campos JM, Kusak ME, Isla A, Rey JA (2002) Analysis

192

Cancer Therapy Vol 2, page 193 of the NF2 gene in oligodendrogliomas and ependymomas.

Cancer Genet Cytogenet 134, 1-5.

Alonso ME, Bello MJ, Gonzalez-Gomez P, Arjona D, de Campos JM, Gutierrez M, Rey JA (2004) Aberrant CpG island methylation of multiple genes in ependymal tumors. J Neuro-Oncol 67, 159-165.

Alonso ME, Bello MJ, Gonzalez-Gomez P, Arjona D, Lomas J, De Campos JM, Isla A, Sarasa JL, Rey JA (2003) Aberrant promoter methylation of multiple genes in oligodendrogliomas and ependymomas. Cancer Genet Cytogenet 144,134-142.

Baylin SB, Herman JF, Graff JR, Vertino PM, Issa JP (1998) Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv Cancer Res 72, 141-196.

Bello MJ, Leone PE, Nebreda P, de Campos JM, Kusak ME, Vaquero J, Sarasa JL, Garcia-Miguel P, Queizan A, Hernandez-Moneo JL, Pesta_a A, Rey JA (1995) Allelic status of chromosome 1 in neoplasms of the nervous system.

Cancer Genet Cytogenet 83, 160-164.

Bortolotto S, Chado.Piat L, Cavalla P, Bosone I, Chio A, Mauro A, Schiffer D (2000) CDKN2A/p16 inactivation in the prognosis of oligodendrogliomas. Int J Cancer 88, 554-557.

Burger PC, Scheithauer BW, Paulus W, Szymas J, Giannini C, Kleihues P (2000) Pilocytic astrocytoma. In: Pathology and genetics of tumors of the nervous system. World health organization classification of tumors. Kleihues P and Cavenee WK (eds). IARC Press, Lyon, pp 45-51.

Burns KL, Ueki K, Jhung SL, Koh J, Louis DL (1998) Molecular genetic correlates of p16, cdk4, and pRb immunohistochemistry in glioblastomas. J Neuropathol Exp Neurol 57, 122-130.

Costello JF, Berger MS, Huang HS, Cavenee WK (1996) Silencing of p16/CDKN2 expression in human glomas by methylation and chromatin condensation. Cancer Res 56, 2405-2410.

Costello JF, Plass C, Cavenee WK (2000) Aberrant methylation of genes in low-grade gliomas. Brain Tumor Pathol 17, 4956.

Cryns VL, Thor A, Xu HJ, Hu SX, Wierman ME, Vickery AL, Benedict WF, Arnold A (1994) Loss of the retinoblastoma tumor-suppressor gene in parathyroid carcinoma. N Engl J Med 330, 757-761.

Dong S-M, Pang JC-S, Poon W-S, Hu J, To K-F, Chang AR, Ng H-K (2001) Concurrent hypermethylation of multiple genes is associated with grade of oligodendroglial tumors. J Neuropathol Exp Neurol 60, 808-816.

Ebert C, von Haken M, Meyer-Pullitz B, Wiestler OD, Reifenberger G, Pietsch T, von Deimling A (1999) Molecular genetic analysis of ependymal tumors. NF2 mutations and chromosome 22q loss occur preferentially in intramedullary spinal ependymomas. Am J Pathol 155, 627632.

Esteller M (2003) Relevance of DNA Methylation in the Management of Cancer. Lancet Oncol 4, 351-358.

Friend SH, Bernards R, Rogelji S, Weinberg RA, Rapaport JM, Alberts DM, Dryja TP (1986) A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 323, 643-646.

Fueyo J, Gomez-Manzano C, Bruner JM, Saito Y, Zhang B, Zhang W, Levin VA, Yung WK, Kyritsis AP (1996) Hypermethylation of the CpG island of p16/CDKN2 correlates with gene inactivation in gliomas. Oncogene 13, 1615-1619.

Ghimenti C, Fiano V, Chiado-Piat L, Chio A, Cavalla P, Schiffer D (2003) Deregulation of the p14ARF/Mdm2/p53 pathway and G1/S transition in two glioblastoma sets. J Neuro-Oncol 61, 95-102.

Gonzalez-Gomez P, Bello MJ, Alonso ME, Arjona D, Lomas J, De Campos JM, Isla A, Rey JA (2003a) CpG island methylation status and mutation analysis of the RB1 gene essential promoter region and protein-binding pocket domain in nervous system tumours. Br J Cancer 88, 109-114.

Gonzalez-Gomez P, Bello MJ, Arjona D, Lomas J, Alonso ME, de Campos JM, Vaquero J, Isla A, Gutierrez M, Rey JA (2003b) Promoter hypermethylation of multiple genes in astrocytic gliomas. Int J Oncol 22, 601-608.

Gonzalez-Gomez P, Bello MJ, Lomas J, Arjona D, Alonso ME, Aminoso C, De Campos JM, Vaquero J, Sarasa JL, Casartelli C, Rey JA (2003c) Epigenetic Changes in Pilocytic Astrocytomas and Medulloblastomas. Int J Mol Med 11, 655-660.

Hayes VM, Dirven CM, Dam A, Verlind E, Molenaar WM, Mooij JJ, Hofstra RM, Buys CH (1999) High freqeuncy of TP53 mutations in juvenile pilocytic astrocytomas indicates role of TP53 in the development of this tumors. Brain Pathol 9, 463-467.

Hegi ME, zur Hausen A, Ruedi D, Malin G, Kleihues P (1997) Hemizygous or homozygous deletion of the chromosomal region containing the p16INK4A gene is associated with amplification of the EGF receptor gene in glioblastomas. Int J Cancer 73, 57-63.

Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB (1996) Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 93, 9821-9826.

Hong C, Bollen AW, Costello JF (2003) The contribution of genetic and epigenetic mechanisms to gene silencing in olgodendrogliomas. Cancer Res 63, 7600-7605.

Hulsebos TJM, Oskam NT, Bijleveld EH, Westerveld A, Hermsen MA, van den Oweland AMW, Hamel BC, Tijssen CC (1999) Evidence for an ependymoma tumor suppressor gene in chromosome region 22pter-22q11.2. Br J Cancer 81, 1150-1154.

Ichimura K, Bolin MB, Goike HM, Schmidt EE, Moshref A, Collins VP (2000) Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities. Cancer Res 60, 417-424.

Kamijo T, Weber JD, Zambetti G, Zindy F, Roussel MF, Sher CJ (1998) Functional and phisical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc Natl Acad Sci USA 95, 8292-8297.

Karnes PS, Tran TN, Cui MY, Raffel C, Gilles FH, Barranger JA, Ying KL (1992) Cytogenetic analysis of 39 pediatric central nervous system tumors. Cancer Genet Cytogenet 92, 169-174.

Kleihues P, Kavenee WK (2000) Pathology and genetics of tumors of the nervous system. World health organization classification of tumors. IARC Press, Lyon.

Kraus JA, de Millas W, Sรถrensen N, Herbold C, Schichor C, Tonn JC, Wiestler OD, von Deimling A, Pietsch T (2001) Indications for a tumor suppressor gene at 22q11 involved in the pathogenesis of ependymal tumors and distinct from hSNF5/INI1. Acta Neuropathol 102, 69-74.

Lee WH, Shew JY, Hong F, Sery T, Donoso LA, Young LJ, Bookstein R, Lee EYHP (1987) The retinoblastoma susceptibility gene product is a nuclear phosphoprotein associated with DNA binding activity. Nature 329, 642-645.

Nakamura M, Konishi N, Hiasa Y, Tsunoda, Nakase H, Tsuzuki T, Aoki H, Sakitani H, Inui T, Sasaki T (1998) Frequent alterations of cell-cycle regulators in astrocytic tumors as detected by molecular genetic and immunohistochemical analyses. Brain Tumor Pathol 15, 83-88.

Nakamura M, Watanabe T, Klangby U, Asker C, Wiman K, Yonekawa Y, Kleihues P, Ohgaki H (2001b) p14ARF deletion

193

Bello et al: Methylation analysis of cell cycle control genes in human gliomas and methylation in genetic pathways to glioblastomas. Brain Pathol 11,159-168.

Nakamura M, Yonekawa Y, Kleihues P, Ohgaki H (2001a) Promoter hypermethylation of the RB1 gene in glioblastomas. Lab Invest 81,77-82.

Newcomb EW, Alonso M, Sung T, Miller DC (2000) Incidence of p14ARF gene deletion in high-grade adult and pediatric astrocytomas. Hum Pathol 31, 115-119.

Ohtani-Fujita N, Fujita T, Aoike A, Osifchin NE, Robbins PD, Sakai T (1993) CpG island methylation inactivates the promoter activity of the human retinoblastoma tumor suppressor gene. Oncogene 8, 1063.1067.

Park S-H, Jung KC, Ro JY, Kang GH, Khang SK (2000) CpG island methylation of p16 is associated with absence of p16 expression in glioblastomas. J Korean Med Sci 15, 555-559.

Rey JA, Bello MJ, de Campos JM, Kusak ME, Moreno S (1987) Chromosomal composition of a series of 22 human lowgrade gliomas. Cancer Genet Cytogenet 29, 223-237.

Rey JA, Bello MJ, Jimeze-Lara A, Vaquero J, Kusak ME, de Campos JM, Sarasa JL, Pesta単a A (1992) Loss of heterozygosity for distal markers on 22q in human gliomas.

Int J Cancer 51, 703-706.

Rousseau E, Ruchoux MM, Scaravilli F, Chapon F, Vinchon M, De Smet C, Godfrain C, Vikkula M (2003) CDKN2A, CDKN2B and p14ARF are frequently and differently methylated in ependymal tumours. Neuropathol Applied Neurobiol 29, 574-583.

Rousseau-Merk M, Versteege I, Zattara-Cannoni H, Figarella D, Lena G, Aurias A, Vagner- Capodano A (2000) Fluorescence in situ hybridization determination of 22q12-q13 deletion in two intracerebral ependymomas. Cancer Genet Cytogenet 121, 223-227.

Rubio MP, Correa KM, Ramesh V, MacCollin MM, Jacoby LB, von Deimling A, Gusella JF, Louis DN (1994) Analysis of the neurofibromatosis 2 gene in human ependymomas and astrocytomas. Cancer Res 54, 45-47.

Sanoudpu D, Tingby O, Ferguson-Smith MA, Collins VP, Coleman N (2000) Analysis of pilocytic astrocytoma by comparative genomic hybridization. Br J Cancer 82, 12181222.

Schmidt EE, Ichimura K, Messerle KR, Goike HM, Collins VP (1997) Infrequent methylation of CDKN2A(MTS1/p16) and rare mutation of both CDKN2A and CDKN2B(MTS2/p15) in primary astrocytic tumors. Br J Cancer 75, 2-8.

Sher CJ (1996) Cancer cell cycles. Science 274, 1672-1677.

Simpson DJ, Hibberts NA, McNicol AM, Clayton RN, Farrell WE (2000) Loss of pRb expression in pituitary adenomas is associated with methylation of the RB1 CpG island. Cancer Res 60, 1211-1216.

Surawicz TS, Davis F, Freels S, Laws ER, Menk HR (1998) Brain tumor survival: Results from the National Cancer Data base. J Neuro-Oncol 40, 151-160.

Swanton C (2004) Cell-cycle targeted therapies. The Lancet Oncology 5, 27-36.

Tada K, Kochi M, Saya H, Kuratsu J, Shiraishi S, Kamiryo T, Shinohima N, Ushio Y (2003) Preliminary observations on genetic alterations in pilocytic astrocytomas associated with neurofibromatosis 1. Neuro-Oncol 5, 228-2234.

Tsuda H, Yamamoto K, Inoue T, Uchiyama I, Umesaki N (2000) The role of p16-cyclin D/CDK-pRb pathway in the tumorigenesis of endometroid-type endometrial carcinoma.

Br J Cancer 82, 675-682.

Uhlmann K, Rohde K, Zeller C, Szymas J, Vogel S, Marczinek K, Thiel G, N端rnberg P, Laird PW (2003) Distinct methylation profiles of glioma subtypes. Int J Cancer 106, 52-59.

Von Deimling A, Louis DN, Menon AG, von Ammon K, Ellison D, Wiestler OD, Seizinger BR (1993) Deletions on the long arm of chromosome 17 in pilocytic astrocytoma. Acta Neuropathol 86, 81-85.

Watanabe T, Nakamura M, Yonekawa Y, Kleihues P, Ohgaki H (2001a) Promoter hypermethylation and homozygous deletion of the p14ARF and p16INK4a genes in oligodendrogliomas. Acta Neuropathol 101, 185-189.

Watanabe T, Yokoo H, Yokoo M, Yonekawa Y, Kleihues P, Ohgaki H (2001b) Concurrent inactivation of RB1 and TP53 pathways in anaplastic oligodendrogliomas. J Neuropathol Exp Neurol 60, 1181-1189.

Weremowicz S, Kupsky WJ, Morton CC, Fletcher JA (1992) Cytogenetic evidence for a chromosome 22 tumor suppressor gene in ependymoma. Cancer Genet Cytogenet 61, 193196.

White FV, Anthony DC, Yunis EJ, Tarbel NJ, Scott RM, Schofield DE (1995) Nonrandom chromosomal gains in pilocytic astrocytomas of childhood. Hum Pathol 26, 979986.

Wolter M, Reifenberger J, Blaschke B, Ichimura K, Schmidt EE, Collins VP, Reifenberger G (2001) Oligodendroglial tumors frequently demonstrate hypermethylation of the CDKN2A (MTS1, p16INK4a), p14ARF, and CDKN2B (MTS2, p15INK4b) tumor suppressor genes. J Neuropathol Exp Neurol 60, 1170-1180.

Xing EP, Nie Y, Song Y, Yang G-Y, Cai YC, Wang L-D, Yang CS (1999) Mechanisms of inactivation of p14ARF, p15INK4b, and p16INK4a genes in human esophageal squamous cell carcinoma. Clin Cancer Res 5, 2704-2713.

Yin D, Xie D, Hofman W-K, Miller CW, Black KL, Koeffler HP (2002) Methylation, expression, and mutation analysis of the cell cycle control genes in human brain tumors. Oncogene 21, 8372-8373.

194

Cancer Therapy Vol 2, page 195 Cancer Therapy Vol 2, 195-200, 2004

Epithelial-mesenchymal transition and progression of oral carcinomas Review Article

Kazushi Imai*, Toshiyuki Okuse, Tadashige Chiba, Masako Morikawa, Kazuo Sanada Department of Biochemistry, School of Dentistry at Tokyo, The Nippon Dental University, Tokyo, Japan

__________________________________________________________________________________ *Correspondence: Kazushi Imai Department of Biochemistry School of Dentistry at Tokyo, The Nippon Dental University, 1-9-20 Fujimi, Chiyoda-ku, Tokyo 102-8159, Japan; Tel: 81.3.3261.8870; fax: 81.3.3261.8875; e-mail: KIMAI@Tokyo.ndu.ac.jp Key words: EMT, oral cancer, transcription factor Abbreviations: E-cadherin, (CDH1); !-catenin, (CTNNB1); epithelial-mesenchymal transition, (EMT); high mobility group A, (HMGA); LIM domain-binding protein, (LDB); LIM-only protein, (LMO) Received: 15 June 2004; Accepted: 01 July 2004; electronically published: July 2004

Summary Oral carcinomas are devastating diseases with poor patient survival. This unfortunate outcome could partly result from that carcinoma cells frequently loose epithelial cell characteristics and gain mesenchymal cell-type features, as referred to epithelial-mesenchymal transition (EMT). Induction of EMTs makes carcinoma cells invasive and metastatic. Unveiling the mechanism for EMTs would be a challenge for development of a novel strategy for patients suffered from the disease. In this review, we will focus on transcriptional regulation of carcinoma cellEMTs, in addition to the WNT signaling pathway, based on our recent findings. dedifferentiation, invasion of the surrounding stroma and vessel walls, embolism, and stromal invasion and proliferation in distant organs. With few exceptions, carcinomas are derived from single somatic cells and their progeny. Carcinoma cells in the emerging neoplastic clone accumulate within them a series of genetic and/or epigenetic changes that lead to changes in gene activity and hence to altered phenotype that are subjected to selection for tumor progression (Ponder, 2001). Loss of epithelial morphology and acquisition of mesenchymal characteristics, often referred to as the epithelialmesenchymal transition (EMT), are typical for carcinoma cells and predispose tumors to a more advanced state of progression (Hay, 1995; Birchmeier et al, 1996; Thiery, 2002). The genetic instability may trigger alterations in regulatory sequences of correct gene expression and may accumulate EMTs in carcinomas from a standpoint of tumor progression. Induction of EMTs in squamous carcinoma cells drives tumor progression through enhancement of invasive and metastatic features (Oft et al, 2002; Grille et al, 2003). Identifying the mechanism(s) that is involved in EMTs provides insights into understanding the pathway of tumor progression and development of a novel strategy predicting tumor malignancy and may contribute to long-term survival of patients (Thiery, 2002).

I. Introduction Squamous cell carcinomas are the most common malignant neoplasm of the oral cavity. Worldwide, annual incidence of new cases exceeds 300,000. However, surgery, radiotherapy and chemotherapy have not improved the five-year survival rate of this devastating disease in more than two decade (Lippman and Hong, 2001). Because of their location, treatment leads to longterm survival functional significant and cosmetic defects in survivors, which can have a significant impact on the quality of life. The high mortality rate may be due to the fact that oral carcinoma cells easily invade into territorial tissues and metastasize to the cervical lymph nodes.

Treatment failures can be attributed to multiple factors but remain difficult to predict, because no reliable molecular marker is currently available in early detection or as indicators of prognosis. The tailoring of individual treatment strategies to aggressively treat those carcinomas at greatest risk of patient death would likely improve longterm survival. There is an urgent need to identify characteristics of the primary tumor that might predict aggressive tumors. Thus, it is an important issue to uncover molecular pathways of carcinoma progression to be a metastatic disease.

Metastasis of carcinoma cells requires several steps, including detachment from the primary site, 195

Imai et al: EMTs in oral carcinoma cells

II. Activation pathway

of

WNT

2004). Analogous findings are reported in colorectal carcinomas (Kirchner and Brablets, 2000; Brabletz et al, 2001; Takahashi et al, 2002). Since the WNT pathway triggers EMTs (Eger et al, 2000), activation of WNT expression and signaling in oral carcinoma cells may stimulate EMTs and progression of tumors. However, activation of the WNT pathway also plays a pivotal role in developmental and non-tumorgenic events (Okuse et al, manuscript submitted). In these situations, the pathway will be terminated after completion of the events. Thus, if the WNT pathway takes an indispensable part in tumorgenesis and/or tumor progression, we should address a mechanism responsible for the sustained expression of WNTs in carcinoma cells.

signaling

Torrential flooding of intracellular signaling establishes the biological status of carcinoma cells, and their interaction makes difficult to understand the primary pathway for tumor progression. Among numbers of the pathway, !-catenin (CTNNB1)-mediated WNT signaling is stimulated in varieties of tumors. WNT was identified as an oncogenic gene activated by chromosomal integration of Mouse Mammary Tumor Virus, and constitutes a large gene family (19 members in human). Ligation of secreted WNT molecules to cell surface receptors (frizzled and LDL receptor-related protein) sparks signaling pathway (Seidensticker and Behrens, 2000). In this pathway, WNTfrizzled binding abrogates kinase activity of glycogen synthase kinase 3- !, liberating CTNNB1 from degradation and increasing the cytoplasmic-free CTNNB1 pool. An excess amount of CTNNB1 translocates into the nucleus and transcribes target genes. In the absence of WNT, glycogen synthase kinase-3! forces CTNNB1 to degrade, resulting in a decrease of the free CTNNB1 pool (Seidensticker and Behrens, 2000). WNT pathway directly activates expression of genes involved in proliferation, invasion and EMTs of carcinoma cells (www.stanford.edu/~rnusse/wntwindow.html). Therefore, it seems reasonable to suppose that the WNT pathway promotes progression of tumors. In oral carcinomas, carcinoma cells express keratinocyte-type WNTs (WNT 6 and 7A), but also miss-express fibroblast-type (WNT3, 11 and 16) or other cell-type (WNT3A, 4, 7B and 14).

Carcinoma cells express WNT3 and activate the WNT pathway at the invasive front (Figure 1) (Uraguchi et al,

III. Miss-expression of mesenchymespecific transcription factors It is widely accepted that many of molecular pathways underlying tumorgenesis represent aberrations of the normal developmental processes. In a majority of tumors, transcription factors can be re-expressed that are derivatives of embryonic cells in which the transcription factors are normally expressed during embryogenesis.

However, transcription factors can be expressed in tumorgenic cells derived from those in which a particular transcription factors are not normally expressed during development (Abate-Shen, 2002). PAX5 is expressed in medulloblastoma, but not in the cerebellum from which this tumor is derived (Kozmik, 1995). Miss-expression of transcription factors, as opposed to the re-expression,

Figure 1. Immunolocalization of WNT3 and CTNNB1 in oral carcinoma tissues. (A) WNT3 was localized to carcinoma cells at the invasive front. (B) Endothelial cells (small arrow), fibroblasts (arrowhead), and macrophage-like cells (large arrow) adjacent to carcinoma cells were also positively stained. (C) Normal gingiva did not react to WNT3 antibody. (D, E) CTNNB1 stained cell-cell junction of carcinoma cells. (F, G) At the extremity of carcinoma invasion, CTNNB1 showed diffuse cytoplasmic or nuclear staining.

Bar = 100 Âľm (A, C-E) and 50 Âľm (B, F, G). Reproduced from Uraguchi et al, 2004 with kind permission from Journal of Dental Research.

196

Cancer Therapy Vol 2, page 197 cells gain the characteristics of EMTs and facilitate tumor invasion (Figure 2). In addition, HMGA2 protein expression is closely associated with tumor recurrence and patient survival. This is highlighted by the fact that 100% of patients who died of tumor recurrence express HMGA2 protein, and every HMGA2-expressing patient without lymph node metastasis died of tumor recurrence.

Furthermore, protein expression is closely associated with the long-term patient survival rate independent of other risk factors (Figure 3). Although survival of clinically metastasis-negative patients free from disease recurrence is limited to 51.7%, 100% of HMGA2-negative patients survive without tumor recurrence (Miyazawa et al, 2004).

Treatment of clinically metastasis-negative patients with chemotherapy or radiotherapy with neck dissection is a controversial issue (Lippman and Hong, 2001). HMGA2 may be a novel superior marker for tumor recurrence and examination of HMGA2 protein expression by immunostaining on incisional biopsy specimens would predict tumor aggressiveness and stratify patients into risk group.

could provide phenotypic alterations and accumulate the cellular trans-differentiation, especially EMTs, in carcinomas. In this section, we provide evidence for missexpression of mesenchyme-specific transcriptional cofactors in oral carcinoma cells and contribution for the pathology of diseases.

A. HMGA2 The high mobility group A (HMGA) family consists of three members, HMGA2, HMGA1a and HMGA1b. A prominent feature of the HMGA family is the three DNAbinding domains, termed AT-hooks, that bind to AT-rich DNA in the minor groove. They have no transcriptional activity per se, but through binding with other transcription factors, they organize the framework of the nucleoprotein-DNA transcriptional complex and enhance the transcription of several genes, which are specifically expressed in mesenchymal cells (Thanos 2002, Carey et al, 1988). Because HMGA2 is predominantly expressed in undifferentiated mesenchymal cells during development (Zhou et al, 1996), it has been hypothesized that inappropriate activation of the HMGA2 gene in terminally differentiated mesenchymal cells that initiate the tumorgenic pathway and leads to a mesenchymal tumor (Ashar et al, 1995; Schoenmakers et al, 1995). However, very little is known about a role of HMGA2 expression in carcinomas of epithelial origin. Quantitative analysis of HMGA2 gene expression demonstrated that oral carcinomas ectopically express the gene at levels 163.4 ± 90.4 (mean ± 1 S.D.)-fold greater than that of normal counterparts. HMGA2 protein expression is identified in 73.8% of carcinomas and predominantly seen in most carcinoma cells at the invasive front, where carcinoma

B. LMO4 and LDB1 The LIM-only protein (LMO) carries two tandemly repeat LIM zinc-binding domain, which acts as an adaptor for transcription factors facilitating assembly of large transcriptional complexes (Breen et al, 1998; Sugihara et al, 1998). LMO4 gene is widely distributed in embryonic tissues (Kenny et al, 1998; Sugihara et al, 1998), and involved in negative regulation of breast carcinoma cell differentiation (Visvader et al, 2001). LMO4 binds with a high affinity to the LIM domain-binding protein 1 (LDB1), which binds to transcription factors and bridge a

Figure 2 Immunolocalization of HMGA2 in squamous cell carcinomas. A shows a low-power view of HMGA2 staining. A high-power view of the staining at the center and invasive front is shown in B (depicted in inset b in A) and C (depicted in inset c in A), respectively.

D, a carcinoma tissue section was reacted with nonimmune IgG instead of anti-HMGA2 antibody as a negative control reaction. E, normal epithelial cell of the gingiva was negatively stained. Bar, 250 (A), 50 (C and D), and 150 µm (E). Reproduced from Miyazawa et al, 2004 with kind permission from Cancer Research.

197

Imai et al: EMTs in oral carcinoma cells

Figure 3 Disease-specific survival in oral carcinoma patients based on the expression of HMGA2. The graph summarizes Kaplan-Meier survival analysis for patients with positive or negative HMGA2 staining. Statistically significant differences were examined between negative and positive HMGA2 staining (P = 0.0006). Reproduced from Miyazawa et al, 2004 with kind permission from Cancer Research.

Figure 4 Immunoreactivity of LMO4 and LDB1 at the primary site of oral carcinomas. A positive direct correlation between LMO4 (horizontal line) and LDB1 (vertical line) immunoreactivity was found by simple linear regression (r2 = 0.669, P < 0.01). Open circles, crossed and shaded circles indicated well, moderately, and poorly differentiated carcinomas, respectively. Reproduced from Mizunuma et al, 2003 with kind permission from British Journal of Cancer.

binding of transcription factors, including LIMhomeodomain, zinc-finger and basic helix-loop-helix proteins (Jurata et al, 1996; Morcillo et al, 1997).

Formation of protein complexes synergistically activates the expression of target genes (Jurata et al, 1998).

However, in the presence of LMO protein, it competes

unique bipartite DNA sequence separated by about one helix turn from each other (Jurata et al, 1996; Wadman et al, 1997). Both LMO and LDB proteins appear to have essential functions in cell proliferation and lineage determination, and oncogenesis (Jurata et al, 1998; Thaler et al, 2002). The LIM domain of LDB1 contributes to the 198

Cancer Therapy Vol 2, page 199 direct binding between LDB and the transcription factor (Rabbitts, 1998; Thaler et al, 2002). Miss-expression of LMOs by the chromosomal translocation is observed in Tcell leukemia and inhibits differentiation of neuronal cells (Thaler et al, 2002). We observed that normal keratinocyte and oral carcinoma cells express LDB1, but LMO4 expression is only detected in carcinoma cells. These proteins are predominantly expressed in carcinoma cells at the invasive front, and upregulated in parallel with tumor dedifferentiation (Figure 4) (Mizunuma et al, 2003).

Although biological consequences of LMO4 expression in oral carcinoma cells is not certain, we are currently investigating the LMO4-binding transcription factor and target genes.

expression of transcription factors or activation of oncogenic signaling would be a candidate. Understanding the molecular mechanism(s) for EMTs is not only an interesting issue cell biologically but also may provide a novel strategy for cancer therapy.

References Abate-Shen C (2002) Deregulated homeobox gene expression in cancer: cause or consequence? Nat Rev Cancer 2, 777-85.

Ashar HR, Fejzo MS, Tkachenko A, Zhou X, Fletcher JA, Weremowicz S, Morton CC, Chada K. (1995) Disruption of the architectural factor HMGI-C: DNA-binding AT hook motifs fused in lipomas to distinct transcriptional regulatory domain. Cell 82, 57-65.

Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, Garcia De Herreros A. (2000) The transcription factor Snail is a repressor of E-cadherin gene expression in epithelial tumor cells. Nat Cell Biol 2, 84-8.

Birchmeier C, Birchmeier W, Brand-Saberi B (1996) Epithelialmesenchymal transition in cancer progression. Acta Anat 156, 217-26.

Brabletz T, Jung A, Reu S, Porzner M, Hlubek F, KunzSchughart LA, Knuechel R, Kirchner T. (2001) Valiable !catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci USA 98, 10356-61.

Breen JJ, Agulnick AD, Westphal H and Dawid IB (1998) Interaction between LIM domains and the LIM domainbinding protein Ldb1. J Biol Chem 273, 4712-7.

Cano A, Pérez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F, Nieto MA (2000) The transcription factor Snail controls epithelial-mesenchymal transition by repressing E-cadherin expression. Nat Cell Biol 2, 76-83.

Carey J (1988) Gel retardation at low pH resolves trp repressorDNA complex for quantitative study. Proc Natl Acad Sci USA 85, 975-9.

Cheng CW, Wu PE, Yu JC, Huang CS, Yue CT, Wu CW, Shen CY. (2001) Mechanisms of inactivation of E-cadherin in breast carcinoma: modification of the two-hit hypothesis of tumor suppressor gene. Oncogene 20, 3814-23.

Eger A, Stockinger A, Schaffhauser B, Beug H, Foisner R. (2000) Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear trnaslocation of !catenin/lymphoid enhancer binding factor-1 transcriptional activity. J Cell Biol 148, 173-87.

Graff JR, Gabrielson E, Fujii H, Baylin SB, Herman JG. (2000) Methylation patterns of the E-cadherin 5’ CpG island are unstable and reflect the dynamic, heterogenous loss of Ecadherin expression during metastatic progression. J Biol Chem 275, 2727-32.

Grille SJ, Bellacosa A, Upson J, Klein-Szanto AJ, van Roy F, Lee-Kwon W, Donowitz M, Tsichlis PN, Larue L. (2003) The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines. Cancer Res 63, 2172-8.

Hay ED (1995) A review of epithelo-mesenchymal transformation. Acta Anat 154, 8-20.

Imhof BA, Vollmers HP, Goodman SL, Birchmeier W. (1986) Cell-cell interaction and polarity of epithelial cells: specific perturbation using a monclonal antibody. Cell 35, 667-75.

Jurata LW, Kenny DA, Gill GN. (1996) Nuclear LIM interactor, a rhombotin and LIM homeodomain interacting protein, is expressed early in neuronal development. Proc Natl Acad Sci USA 93, 11693-8.

Jurata LW, Pfaff SL, Gill GN. (1998) The nuclear LIM domain

IV. Downregulation of E-cadherin expression First step of carcinoma progression is dissociation from cell-cell adhesion, which is mediated by E-cadherin (CDH1). An animal model of pancreatic carcinoma demonstrated that a direct role of CDH1 in adenoma-tocarcinoma conversion (Perl et al, 1998), indicating CDH1 as a tumor suppressor gene. Disruption of CDH1-mediated cell-cell adhesion by anti-CDH1 antibodies induces EMTs of carcinoma cells (Imhof et al, 1983). Although loss of tumor suppressor gene expression has been believed to result from the classical Knudson’s two-hit hypothesis, emerging evidence indicate that somatic mutation with loss of heterozygosity is extremely rare in sporadic cancer and that epigenetic pathways are responsible for the lack of CDH1 in the majority of sporadic carcinomas (Cheng et al, 2001; Graff et al, 2000). Recently, transcriptional repressor, SNAIL, and promoter hypermethylation are considered to be primary cause of CDH1 downregulation (Cano et al, 2000; Batlle et al, 2000; Graff et al, 2000).

However, other CDH1 repressors, including SLUG, SIP1 and E12/47, are also known. We considered what epigenetic aberrations could repress CDH1 in oral carcinoma cells. Unexpectedly, SNAIL expression was not related to the CDH1 expression status. However, SIP1 expressing cells negligibly expressed CDH1. Promoter hypermethylation was also predominantly observed in CDH1-negative cells (Maeda et al, manuscript submitted).

Synergistic action and balance between SIP1 expression and promoter hypermethylation may be critical determinant for the epigenetic loss of CDH1 during oral carcinoma progression and plays a role in an induction of EMTs.

V. Conclusion In this review, we focused on molecular pathway for an induction of EMTs in oral carcinoma cells. Transient alterations in cell proliferation, differentiation, and migration activities initiated through changes of microenvironments are observed in pathological and physiological conditions. However, in the case of malignant tumors, it is well within the realm of possibility that tumor cells have been destined for undergoing to EMTs by more upstream critical aberrations. Aberrant

199

Imai et al: EMTs in oral carcinoma cells interactor NLI mediates homo- and heterodimerization of LIM domain transcription factors. J Biol Chem 273, 3152-7.

Kenny DA, Jurata LW, Saga Y, Gill GN. (1998) Identification and characterization of LMO4, and LMO gene with a novel pattern of expression during embryogenesis. Proc Natl Acad Sci USA 95, 11257-62.

Kirchner T, Brabletz T (2000) Patterning and nuclear betacatenin expression in the colonic adenoma-carcinoma sequence. Analogies with embryonic gastrulation. Am J Pathol 157, 1113-21.

Kozmik Z, Sure U, Ruedi D, Busslinger M, Aguzzi A. (1995) Deregulated expression of PAX5 in medulloblastoma. Proc Natl Acad Sci USA 92, 5709-13.

Lippman SM, Hong WK (2001) Molecular markers of the risk of oral cavity. N Engl J Med 344, 1323-6.

Miyazawa J, Mitoro A, Kawashiri S, Chada KK, Imai K. (2004) Expression of mesenchyme-specific gene HMGA2 in squamous cell carcinomas of the oral cavity. Cancer Res 64, 2024-9.

Mizunuma H, Miyazawa J, Sanada K, Imai K. (2003) The LIMonly protein, LMO4, and the LIM domain-bindng protein, LDB1, expression in squamous cell carcinomas of the oral cavity. Br J Cancer 88, 1543-8.

Morcillo P, Rosen C, Baylies MK, Dorsett D. (1997) Chip, a widely expressed chromosomal protein required for segmentation and activity of a remote wing margin enhancer in Drosophila. Genes Dev 12, 2912-20.

Oft M, Akhurst RJ, Balmain A. (2002) Metastasis is driven by sequential elevation of H-ras and Smad2 levels. Nat Cell Biol 4, 487.

Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G (1998) A causal role for E-cadherin in the transition from adenoma to carcinoma. Nature 392, 190-3.

Ponder BA (2001) Cancer genetics. Nature 411, 3366-41.

Rabbitts TH (1998) LMO T-cell translocation oncogenes typify genes activated by chromosomal translocations that alter transcription and development processes. Genes Dev 12, 2651-7.

Seidensticker MJ, Behrens J (2000) Biochemical interactions in the wnt pathway. Biochem Biophys Acta 1495, 168-82.

Schoenmakers EF, Wanschura S, Mols R, Bullerdiek J, Van den Berghe H, Van de Ven WJ. (1995) Recurrent rearrangements in the high mobility group protein family, in a subset of breast cancers: relationship to histologic grade. Nature Genet 10, 436-44.

Sugihara TM, Bach I, Kioussi C, Rosenfeld MG, Andersen B. (1998) Mouse deformed epidermal autoregulatory factor 1 recruits a LIM domain factor, LMO4, and CLIM coregulators. Proc Natl Acad Sci USA 95, 15418-23.

Takahashi M, Tsunoda T, Seiki M, Nakamura Y, Furukawa Y. (2002) Identification of membrane-type matrix metalloproteinase-1 as a target of the !-catenin/Tcf4 complex in human colorectal cancers. Oncogene 21, 5861-7.

Thaler JP, Lee SK, Jurata LW, Gill GN, Pfaff SL. (2002) LIM factor Lhx3 contributes to the specification of motor neuron and interneuron identity through cell-type-specific proteinprotein interactions. Cell 110, 237-49.

Thanos D, Manatis T (1992) The high mobility group protein HMGI(Y) is required for NF-"B-dependent virus induction of the human IFN-! gene. Cell 71, 777-89.

Thiery JP (2002) Epithelial-mesenchymal transitions in tumor progression. Nat Rev Cancer 2, 422-54.

Uraguchi M, Morikawa M, Shirakawa M, Sanada K, Imai K. (2004) Activation of WNT family expression and signaling in squamous cell carcinomas of the oral cavity. J Dent Res 83, 327-32.

Visvader JE, Venter D, Hahm K, Santamaria M, Sum EY, O'Reilly L, White D, Williams R, Armes J, Lindeman GJ. (2001) The LIM domain gene LMO4 inhibits differentiation of mammary epithelial cells in vitro and is overexpressed in breast cancer. Proc Natl Acad Sci USA 98, 14452-7.

Wadman IA, Osada H, Grutz GG, Agulnick AD, Westphal H, Forster A, Rabbitts TH. (1997) The LIM-only protein Lmo2 is a bridging molecule assembling an erythroid DNA-binding complex which includes the TAL1, E47, GATA-1 and Ldb1/NLI proteins. EMBO J 16, 3145-57.

Zhou X, Benson KF, Przybysz K, Liu J, Hou Y, Cherath L, Chada K. (1996) Genomic structure and expression of the murine Hmgi-c gene. Nucleic Acid Res 24, 4071-7

200

Cancer Therapy Vol 2, page 201 Cancer Therapy Vol 2, 201-216, 2004

Hyaluronan: a suitable carrier for an histone deacetylase inhibitor in the treatment of human solid tumors Review Article

Danila Coradini* and Alberto Perbellini Biomolecular Determinants in Prognosis and Therapy Unit, Department of Experimental Oncology, Istituto Nazionale per lo Studio e la Cura dei Tumori, Milano; Laboratory of Molecular Biology and Stem Cell Engineering, National Institute of Biostructures and Biosystems, University of Bologna, I-40138 Bologna, Italy

__________________________________________________________________________________ *Correspondence: Danila Coradini; Phone: +39 02 23 90 30 53; Fax: +39 02 23 90 30 52; e-mail: danila.coradini@istitutotumori.mi.it Key Words: hyaluronan, sodium butyrate, cancer therapy Abbreviations: butyric acid (But); clusters of differentiation, (CD); extra-cellular matrix receptor type III, (ECMRIII); hyaluronic acid (HA); hyaluronic butyric ester (HA-But); histone deacetylase (HDAC); hyaladherin, (Hyal); Lewis lung carcinoma, (LL3); liver endothelial cell clearance receptor, (LEC receptor); receptor for hyaluronate-mediated motility, (RHAMM); suberoylanilide hydroxamic acid, (SAHA); trichostatin A, (TSA) Received: 3 June 2004; Revised: 12 July 2004; Accepted: 13 July 2004; electronically published: July 2004

Summary Histone deacetylase (HDAC) inhibitors are an exciting new class of drugs potentially useful as anti-cancer agents.

These compounds, most of which have been identified during the last decade, can induce growth arrest, terminal differentiation and/or apoptosis in a variety of solid and haematological tumors. This review focuses on a newly synthesized cell-targeted bioconjugate (HA-But) obtained by esterification of butyric acid (But), the smallest HDAC inhibitor, with hyaluronic acid (HA), a natural linear polymer, consisting of repeating disaccharidic units, which selectively recognizes CD44, a transmembrane receptor over-expressed in most malignant tumors. In vitro, HA-But has provided to be 10-fold more effective than But in inhibiting cells proliferation of a panel of human cancer cell lines, representative of the most common human cancers and, similarly to But, has been shown to regulate the expression of some cell cycle-related proteins, to induce growth arrest in the G1/G0 phase of the cell cycle and to increase hystone acetylation indicating that the presence of the hyaluronan backbone does not interfere with the biological activity of butyric residues. In vivo, pharmacokinetics studies have shown different rate of distribution of radiolabeled HA-But according to the route of administration (i.v., i.p. or s.c.): few minutes after i.v. treatment, with substantial accumulation in the liver and spleen; relatively slow rate after i.p. or s.c. treatment, with a marked persistence of the drug in the site of injection in the case of s.c. administration. In addition, in mice HA-But treatment has demonstrated a marked efficacy in inhibiting primary tumor growth and lung metastases formation from Lewis lung carcinoma (LL3) and in inhibiting liver metastases originating from intra-splenic implant of LL3 or B16-F10 melanoma cells. In particular, the effect of s.c. and i.p. treatment with HA-But on liver metastases resulted respectively in 87% and 100% metastases-free animals, and in a significant prolongation of the survival time compared to the control groups. Present findings suggest a possible clinical application of this hyaluronic butyric ester as antiproliferative agent in primary and metastatic lesions. aggregation, matrix-cell and cell-matrix signalling, receptor-mediated internalization and cell migration. In addition to these physiological properties, CD44 has been found to be overexpressed in most tumor cells and associated with tumor progression.

Aim of this review is to describe the in vitro and in vivo results obtained using a novel bioconjugate in which hyaluronan is used as a carrier for butyric acid, the

I. Introduction Hyaluronan is one of the main constituent of extracellular matrix where it is organized by specific interactions with other matrix macromolecules and provides an essential support for cells orientation through the binding with specific cell surface receptors, the most important of which is CD44. CD44 is involved in a variety of cellular functions including leukocyte rolling, cell-cell 201

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy smallest inhibitor of histone deacetylases (a class of enzyme involved in the regulation of gene expression), known to induce growth arrest, terminal differentiation and/or apoptosis in a variety of solid and haematological tumors.

II. Hyaluronan: structure chemical-biological properties

Hyaluronan has an extraordinarily high rate of turnover in vertebrate tissues. A 70-kilo individual has 15 g of hyaluronan, 5 g of which turns over daily, and in the bloodstream, hyaluronan has a half-life of two to five minutes. In fact, a large proportion of the hyaluronan molecules are rapidly captured by receptors on hepatic sinusoidal endothelial cells, which internalize them for subsequent catabolism in lysosomes. Sinusoidal endothelial cells actively remove almost 90 percent of the circulating hyaluronan, even though the spleen is also involved in its degradation (Fraser et al, 1985).

Degradation is predominantly enzymatic (mainly by hyaladherins) and occurs in a highly controlled stepwise fashion with a discrete decrease in polymer size which results in a series of hyaluronan fragments having widely different biological activities depending on chain lengths.

In fact, high and low molecular weight chains appear to have opposite effects on cell behaviour. While the extracellular high molecular weight (about 107 Da) chains are space-filling molecules that hydrate tissues, appear in the earliest stages of wound healing, when spaces must be created to facilitate polymorphonuclear leukocytes infiltration of the wound area, bind fibrinogen (Weigel et al, 1986; Frost and Weigel, 1990), inhibit angiogenesis (Feinberg and Beebe, 1983), and are anti-inflammatory and immune-suppressive (McBride and Bard, 1979; Delmage et al, 1986), small hyaluronan fragments, in the 6-20 kDa size range, interact with a different set of receptors that trigger signalling cascades, are highly angiogenic (promote differentiation of the endothelial cells) and potent stimulators of inflammatory cytokines and of dendritic cells (Termeer et al, 2000, 2003; Noble, 2002).

and

In 1934 Karl Meyer and his assistant John Palmer isolated and described a novel glycosaminoglycan from the vitreous of bovine eyes that they named hyaluronic acid (HA) (Meyer and Palmer, 1934). This was the birth for one of the natureâ&#x20AC;&#x2122;s most versatile and fascinating macromolecules. Today this macromolecule is most frequently referred to as hyaluronan reflecting the fact that it exists in vivo as a polyanion and not in the acid form.

However, it would take an additional 20 years before Meyerâ&#x20AC;&#x2122;s laboratory completed the experimental work with the definition of the precise chemical structure of the basic disaccharide motif that forms hyaluronan (Weissman and Meyer, 1954): D-glucuronic acid and D-Nacetylglucosamine linked together through alternating !1,4 and !-1,3 glycosidic bonds (Figure 1).

In the cell, hyaluronan synthase enzymes (Has1, Has2 and Has3), localized in the plasmatic membrane, synthesize this linear, high molecular weight polymer in which the number of repeating disaccharide units can reach 10,000 or more and a molecular mass of about 4 million of Daltons (each disaccharide unit is about 400 Da).

Hyaluronan is present in all vertebrates and is a major constituent of the extracellular matrix, where it is organized by specific interactions with other matrix macromolecules. In some cases, including vitreous of the human eye, synovial fluid or in the matrix produced by the cells around the oocyte prior to ovulation, hyaluronan is important in giving to this fluids their visco-elastic properties; in others, including hyaline cartilages and connective tissues, it serves as an essential structural element in the matrix, regulating the water molecules retention in the interstitial space, and providing a support for cell orientation (Tammi et al, 2001).

III. CD44 receptor To organize themselves, cells interact with extracellular matrix through specific cell surface receptors recognizing hyaluronan, several of which have been identified. They include: CD44, Receptor for HyaluronateMediated Motility (RHAMM), LYVE, HARE and Liver Endothelial Cell clearance receptor (LEC receptor)

Figure 1. Hyaluronan basic structure. The repeating disaccharide unit consists of --4)!-D-glucuronic acid (1->3)!-D-Nacetylglucosamine-(1--

202

Cancer Therapy Vol 2, page 203 (Entwistle et al, 1996; Pilarski et al, 1999; Day and Prestwich, 2001), but this list is likely to increase in the future. Nevertheless, the major hyaluronan receptor and the most studied to date is CD44 (Isacke and Yarwood, 2002). CD44 is a plasma membrane-associated multistructural and multifunctional glycoprotein, which derives its name from its identity with a family of common leukocyte antigens (Clusters of Differentiation, CD) as defined by the International Workshop on Human Leucocyte Differentiation Antigens. However, prior to its designation as CD44, other names had been given to this protein, including Pgp-1, Hermes antigen, HUTCH-1, HCAM, ECMRIII (Extra-Cellular Matrix Receptor type III) as well as the common functional name of hyaluronan receptor.

CD44 identification, obtained in the late 1970s, derived from the observation that in many studies on cellcell aggregation hyaluronan was found to mediate crossbridging adjacent cells suggesting the existence of membrane-localized hyaluronan binding sites.

CD44 is a single-pass transmembrane glycoprotein of approximately 85 kD consisting of four functional domains (Figure 2A). The distal extracellular domain is the region primarily responsible for the binding of hyaluronan; the membrane-proximal extracellular domain is the primary site of alternative splicing of CD44 mRNA responsible for the different isoforms of CD44 and is the site of insertion for lateral glycosaminoglycan chains; the transmembrane domain is similar to that of many other single-pass protein; the cytoplasmic domain or tail, which

Figure 2. (a) Schematic CD44 receptor structure. The distal extracellular domain is the region primarily responsible for the binding of hyaluronan; the membrane-proximal extracellular domain is the primary site of alternative splicing of CD44 mRNA responsible for the different isoforms of CD44 and is the site of insertion for lateral glucosaminoglycanes chains; the transmembrane domain is similar to that of many other single-pass protein; the cytoplasmic domain or tail, which exhibits protein motifs responsible for the interaction with cytoskeletal proteins and intracellular signalling. (b) alternative splicing of CD44 exons. The exons that encompass the CD44 gene are numbered and diagrammed. V1-v10 are the variant exons that exhibit extensive rearrangements due to alternative splicing resulting in a myriad of variant isoforms of CD44.

203

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy exhibits protein motifs responsible for the interaction with cytoskeletal proteins and intracellular signalling. As other transmembrane glycoprotein receptors, CD44 undergoes extensive post-translational modifications including phosphorylation, N- or O-glycosylation and addition, in some CD44 isoforms, ofglycosaminoglycan chains. All these modifications are being actively explored as potential modulators of hyaluronan binding or of other CD44 functions.The CD44 gene, located on chromosome 11p13, consists of 20 exons (Figure 2B) and encodes for multiple mRNA transcripts, which arise from the alternative splicing of 12 of the 20 exons (Isacke and Yarwood, 2002). The standard and most prevalent form, termed CD44s, consists of a protein encoded by exons 1-5, 16-18, and 20 and exhibits an extracellular domain (exons 1-5 and 16), a highly conserved transmembrane domain (exon 18), and a cytoplasmic domain (exon 20) that selectively interacts with cytoskeletal proteins and regulates specific signalling.

Alternative splicing of exons 6-15, also named variant exons v1-v10, originates several CD44 isoforms with an increased length of extracellular domain ranging in size from 80 to 250 kDa. In addition, either exon 19 or 20 may be differentially expressed because of alternative splicing and generate two variations of the intracellular â&#x20AC;&#x153;tailâ&#x20AC;? portion of the molecule. The alternatively spliced message, containing exon 19 instead of exon 20, generates a short-tailed form of the CD44 protein, lacking of intracellular signalling motifs and of protein domains necessary for interaction with cytoskeletal components.

Since the inhibition of the expression of short-tailed form induces an increase in hyaluronan internalization, it has been postulated this isoform as a dominant negative, with a modulatory function on the protein/cytoskeletal interaction.

Little information is available concerning the regulation of CD44 gene expression. CD44 is transcriptionally upregulated by proinflammatory cytokines, such as interleukine 1 which increases CD44 mRNA and protein expression levels in chondrocytes and vascular smooth muscle cells, or by growth factors such as epidermal growth factor and transforming growth factor-!, which upregulate CD44 expression in fibroblasts, in several tumor cell types, and in epithelial cells undergoing stratification.

CD44 is known to participate in a wide variety of cellular functions, including leukocyte rolling on hyaluronan (Clark et al, 1996), cell-cell aggregation, matrix-cell and cell-matrix signalling, receptor-mediated internalization/degradation of hyaluronan and cell migration. With regard to hyaluronan internalization, as shown in Figure 3A, a minimum of six hyaluronan sugar residues, corresponding to three repeating disaccharidic units, are requested for the binding to the cell surface via CD44. The high molecular weight extracellular polymer is constrained to the cell surface by the combined efforts of CD44 and the GPI-anchored enzyme hyaladherin (Hyal)-2 located in specialized invaginations of the plasma membranes (caveolae) composed of cholesterol and gangliosides, termed lipid rafts, significant because they also recruit a large number of key signalling molecules. As

Figure 3. (a) CD44-mediated hyaluronan internalization.

Hyaluronan sugar residues, corresponding to three repeating disaccharides units, bound to the cell surface via CD44, is internalized by invagination of the plasma membrane and degraded by lysosome. (b-d) CD44-mediated HA-But internalization. (b) negative control; (c) after 4 h of treatment with fluorescinated HA-But; (d) after 4 h of treatment with fluorescinated HA-But plus monoclonal antibody anti-CD44 (Reproduced from Coradini et al, 1999 with kind permission from International Journal of Cancer).

204

Cancer Therapy Vol 2, page 205 demonstrated by autoradiography using 3H-labeled hyaluronan (Hua et al, 1993), the caveolae then becomes an endosome that subsequently fuses with a lysosome completing the degradation of the hyaluronan. The hyaluronan polymer is then cleaved to 20 kDa limit fragments (Lepperdinger et al, 1998) corresponding to about 50 disaccharide units, around the size at which a stable tertiary structures is expected to form (Scott and Heatley, 2002). These Hyal-2-generated hyaluronan fragments are further degraded by Hyal-1 to small disaccharides that when sufficiently small can diffuse out of lysosomes into the cytoplasmic compartment or alternatively may leave the lysosome through specific transporters, as other metabolites do, such as amino acids and other sugars. This process is quite rapid as we have observed incubating cells expressing unoccupied CD44 receptors with fluorescein-tagged hyaluronan (Figure 3B-D) and it is specifically CD44-mediated as demonstrated by the block of fluorescein-tagged hyaluronan internalization in the presence of an anti-CD44 antibody (Coradini et al, 1999). The specificity of hyaluronan/CD44 interaction has been also demonstrated using fluorescein-labeled dextran, a polysaccharide with structure and molecular weight similar to hyaluronan, but unable to bind CD44. Experiments performed under similar conditions, clearly demonstrated a lack of dextran internalization, supporting the hypothesis that hyaluronan internalization does not occur via simple fluid phase pynocytosis but rather via a CD44-mediated active process.

CD44 may represent an efficient way to facilitate locomotion through the tumor-associated hyaluronan-rich matrix.

Preclinical studies have demonstrated a correlation among cellular capacity for CD44-mediated endocytosis, hyaluronan degradation and tumor metastatic aggressiveness: the malignant cells that better internalize and degrade hyaluronan appear to be the most metastatic (Zuhalka et al, 1995; Strobel et al, 1997). These experimental findings have been confirmed also in clinical studies conducted on different type of tumors. Studies on patients with non-Hodgkinâ&#x20AC;&#x2122;s lymphoma have demonstrated a direct relation between tumor progression and CD44v6 isoform expression, suggesting this variant as an independent prognostic factor (Stauder et al, 1995).

Similar observations have been reported also for colorectal (Wielenga et al, 1993; Mulder et al, 1994), gastric (Mayer et al, 1993), pancreatic (Gunthert et al, 1991), renal (Terpe et al, 1996), hepatocellular (Endo and Terada, 2000), cervical (Kainz et al, 1995), ovarian (Uhl-Steidl et al, 1995), non-small lung (Hirata et al, 1998), breast carcinoma (Kaufmann et al, 1995; Martin et al, 1997), and melanoma (Manten-Horst et al, 1995), in which the presence of the isoforms, and in particular of CD44v6, was associated with advanced stage, unfavourable clinicopathological features and an adverse prognosis. Taken together these findings indicate that CD44 variants expression represents an important new acquisition for the knowledge of tumor cell and assumes a prognostic value in systemic as well as in solid tumors.

IV. CD44/hyaluronan interactions and tumor invasion and metastasis

V. Histone deacetylase inhibitors One of the most important aspects of the complex network that controls normal cell functions is the regulation of gene expression through chromatin structure rearrangement, which depends on the level of acetylation of the chromatin-associated histones and regulates the access of transcription factors to DNA (Grunstein, 1997).

The degree of histones acetylation depends on a dynamic equilibrium between two classes of enzymes, histone acetyltransferases (HAT) and histone deacetylases (HDAC), which respectively add or remove acetyl groups from the amino-terminal lysine residues of histones.

Eleven mammalian HDACs have been till now identified and ordered into three classes. Class I deacetylases (HDACs 1, 2, 3 and 8) share homology in the catalytic sites; class II includes HDACs 4, 5, 7, and 9 which share homology in C-terminal catalytic domain and the N-terminal regulatory domain, whereas HDAC11 contains conserved residues in the catalytic core regions shared by both class I and II, and HDAC6 and HDAC10 have two regions of homology with the class II catalytic site. The third class of HDACs is the conserved nicotinamide adenine dinucleotide-dependent Sir2 family of deacetylase (De Ruijter et al, 2003).

There is increasing evidence that HDACs are not redundant in function and distribution (Khochbin et al, 2001). Class I HDACs are found exclusively in the nucleus, whereas class II shuttle between the nucleus and cytoplasm upon certain cellular signals (De Ruljter et al, 2003). HDACs do not bind directly to DNA but are

In the last years there has been intense interest in the association of CD44 expression and tumor progression and metastasis. It is not surprising that many malignant cell types overexpress CD44 because it is expressed by many cells prior to their cancer transformation. However, although CD44 is expressed by some normal human epithelial and mesenchymal cells, differential screening for epitopes present on tumor cells revealed that cancer phenotype is more likely associated with alternatively spliced isoforms of CD44 and in particular with CD44v6 variant. This isoform contains an inserted aminoacid sequence within the extracellular domain of the molecule which derives from the addition of exon 11. Interest in CD44 variants peaked when it was found that transfection of nonmetastatic tumor cells with CD44v6 isoform enhanced cell efficiency for metastasis (Gunthert et al, 1991; Seiter et al, 1993) and that conversely it was inhibited by the addition of an anti-CD44 monoclonal antibody (Guo et al, 1994; Breyer et al, 2000) or an antisense oligonucleotide against CD44 (Reeder et al, 1998; Harada et al, 2001). From these initial observations, numerous studies have documented the prevalence of CD44 variant isoforms in human cancers, including the expression of alternatively spliced combinations of the v3, v6 and v9 isoforms (Knudson, 1998). Since most tumors, particularly solid cancers, are often enriched in hyaluronan, which provides them an essential migrationpromoting micro-environment, enhanced expression of 205

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy recruited by protein complexes that may differ in their subunit composition.

Balance between HAT and HDACs activity can be disrupted by HDAC inhibitors, whose mechanism of action is based on their ability to inhibit the activity of HDAC enzymes. Inhibition of HDAC activity, thus enhances HAT activity leading to histones hyperacetylation and DNA unfolding; nonaccessible promoter regions become thus available targets for transcription factors, allowing the re-expression of several genes, including those responsible for cell growth control and differentiation (van Lint et al, 1996). In fact, experimental evidences indicate that HDAC inhibitors induce growth arrest, differentiation and/or apoptotic cell death of a broad spectrum of transformed cells including both haematological cancers and solid tumors (Marks et al, 2001a). HDAC inhibitors represents, therefore, a new class of potentially effective anticancer agents (Marks et al, 2001b).

The HDAC inhibitors so far identified belong to several chemical structural classes including: (a) short-chain fatty acid, of which sodium butyrate (the sodium salt of butyric acid) is a prototype (Candido et al, 1978); (b) hydroxamic acid, including trichostatin A (TSA) (Yoshida et al, 1990) and a series of hydroxamic acid-based hybrid polar compounds, such as suberoylanilide hydroxamic acid (SAHA) (Richon et al, 1998); (c) cyclic tetrapeptides containing or not the 2amino-8-oxo-9,10 epoxy-decanoyl moiety (Depsipeptide, Apicidin) (Darkin-Rattray et al, 1996; Nakajima et al, 1998); (d) benzamides (MS 27-275) (Saito et al, 1999).

Class I and II, but not class III HDACs are inhibited by all these compounds through a direct interaction between the inhibitor and the enzyme as demonstrated by crystallographic analysis (Finnin et al, 1999).

In the next paragraphs we will focus on the smallest of them: butyric acid.

VI. Butyric derivatives

acid

and

that control cell proliferation (Tabuchi et al, 2002). In particular, we have observed that But is able to modulate some cell cycle-related proteins including cyclin D1, p53, p27kip1 and p21wafl (Coradini et al, 2000; Pellizzaro et al, 2001), this latter supposed to be one of the genes most commonly induced by HDAC inhibitors; its expression has been found to directly correlate with histones acetylation (Richon et al, 2000).

As a consequence of this regulatory activity, But increases differentiation markers expression, such as alkaline phosphatase in colon cancer cells (Coradini et al, 2000) or induces apoptosis probably through the activation of caspase 3 and 7 expression (Hague, 1995).

Due to its antiproliferative and differentiatiating activities, associated with the relative absence of systemic toxicity, But has been proposed for the prevention of colorectal cancer (Scheppach et al, 1995) and as therapeutic agent for the treatment of preneoplastic and neoplastic lesions (Sowa and Sakai, 2000). However, the first clinical study undertaken using high doses of sodium butyrate (Miller et al, 1987) resulted only in a partial and temporary remission from disease, principally due to the relative low potency of the agent (to be effective the drug must be administered at millimolar concentrations), to the low effective plasma concentrations, which are insufficient to inhibit cell growth, but sufficient to induce side effects including hypernatriema, and to the rapid clearance (t贸=6 minutes) which resulted in a very short half-life requiring a continuous administration in order to obtain suitable plasma concentrations (Daniels et al, 1998).

However, in consideration of the antiproliferative and differentiating effects of But, supported by many preclinical studies, new chemical derivatives have been developed to overcome the constraints which hampered But clinical application. To obtain compounds able to increase But in vivo effectiveness over a sustained period while satisfying the important requirements for specificity and low toxicity, different approaches have been investigated, most of them implying the association with a chemically suitable drug delivery, able to stabilize the molecule and reduce its degradation. Thus, Pouillart et al, (1991) have synthesized monosaccharidic derivatives, which were hampered by the rapid metabolism of monosaccharides in the organism (Planchon et al, 1992).

They also reported the synthesis of triglyceride derivatives in which one or two butyric residues were covalently bound to glycerol substrate, containing one or two palmitic acid molecules (Planchon et al, 1993). Another group developed a pro-drug based on the acyloxyalkyl derivatives of carboxylic acids, which release butyric acid after intracellular hydrolysis (Rephaeli et al, 1991) and one of them, AN9 (pivaloyloxymethyl butyrate), has been shown to be effective in inducing cell growth inhibition at a concentration 10-fold lower than But (Aviram et al, 1994; Zimrah et al, 1997). In addition, phenol butyric derivatives, such as phenylbutyrate have been investigated, but clinical trials studies seem to indicate a limited drug efficacy associated with central nervous system toxicity (Gore et al, 2002).

To overcome both chemical and pharmacological constraints we decided to take advantage of hyaluronan

butyric

Butyric acid (But) is a short-chain fatty acid naturally present in the human colon in millimolar concentrations and is produced by colonic bacteria during the metabolic degradation of complex carbohydrates (Cunning, 1981; Hill et al, 1995; Pryde et al, 2002). In vivo experiments have demonstrated an increasing gradient of But concentration from the crypts to the lumen, that plays a pivotal role during the normal turnover of mucosal epithelium (Roediger, 1980; McIntyre et al, 1993). In fact, low But concentrations induce physiological colonocyte proliferation and migration from colon crypts towards the lumen, where higher concentrations induce cell growth arrest, differentiation and, finally, apoptosis (Whiteley et al, 1996). A decrease in physiological concentrations has been proved to be associated to the alterations in cell growth and differentiation observed in the adenomacarcinoma sequence (Clausen, 1995).

According to its mechanism of action as an histone deacetylase inhibitor, But modulates the activity of several transcription factors, including AP1, c-myc and Sp1, through which it regulates the expression of many proteins 206

Cancer Therapy Vol 2, page 207 properties and to use it as a carrier on which covalently bind many butyric residues simultaneously in order to increase the drug/carrier ratio (Figure 1). Choosing hyaluronan as a carrier for the delivery of butyric acid, some important chemical concerns have been taken into account: 1. the bond between the carrier and the drug must be sufficiently stable to increase the in vivo half-life of the active principle without effect on its efficacy; 2. the carrier must be a molecule that the organism will not eliminate too rapidly and must be devoid of toxic side effects. In addition, hyaluronan responds to a major challenge in cancer therapy: the selective delivery of an anti-cancer molecule of small size directly into the tumor cells through the linking to a cellular receptor of the water-soluble, polymer-drug conjugates (Lou and Prestwich, 2002).

Following this approach, to increase the therapeutic potential of But by a selective targeting and contemporarily decrease its undesirable side effects, we have developed a new bioconjugate constituted by the smallest HDAC inhibitor covalently linked to hyaluronan, which in addition to an high chemical versatility and a good biocompatibility, is characterized by the selective uptake to CD44, overexpressed in most human cancers.

Moreover, a not negligible effect of such a conjugate could be the disruption, by the presence of exogenous hyaluronan, of the interaction between CD44 receptors, expressed on tumor cell membranes, and the hyaluronan of the extracellular matrix. Since CD44-hyaluronan interaction is an important requirement to promote tumor growth and metastasis spread, the administration of exogenous hyaluronan which competes for CD44 binding could markedly reduce local growth and dissemination.

This detrimental effect on tumor growth and spread could be mediated also through the inhibition of neoangiogenesis, the formation of new blood vessels from existing vascular network, which allows a tumor mass to overcome the constraints related to the lack of the oxygen and nutrients required for growth and spread (Carmeliet and Jain, 2000). Through a complex mechanism of action, which implies also the synthesis of some angiogenesisrelated factors, the most important of which is the Vascular Endothelial Growth Factor (VEGF), tumor cells activate proliferation and migration of endothelial cells (Siemeister et al, 1998) that respond to the angiogenic stimulus overexpressing CD44 on their plasma membrane and moving through the extracellular matrix towards the tumor mass to be vascularized (Trochov et al, 1996). Since we have demonstrate that But is able to modulated VEGF synthesis (Pellizzaro et al, 2002), the new bioconjugate may act also as an antiangiogenic agent.

In the next paragraphs we will describe the most important preclinical results obtained with such an interesting derivative.

VII. In vitro studies hyaluronic butyric derivative

with

reaction is accomplished by means of an activated form of butyric acid, i.e., an adduct between butyric anhydride and 4-dimethlylaminopyidine. Using this synthetic strategy a better control of the reaction, in terms of yield and conversion, is performed and a butyric-ester derivative with a degree of substitution (i.e., the ratio between the number of butyric residues and the number of repeating disaccharidic unit of the polysaccharide) ranging from 0.1 to 0.8 is obtained.

It is interesting to note that, when evaluated as a function of the degree of substitution, the growth inhibitory activity of HA-But has been found inversely related to the number of butyric residues bound per disaccharidic unit with an high Spearman correlation coefficient (rs=0.984, P=0.01) which suggests that the presence of too many butyric residues could hamper the binding of HA to CD44 receptor, due to the shielding of the functional groups involved in the recognition process.

The in vitro growth inhibitory activity of HA-But, in comparison to But, has been evaluated on a large series of cancer cell lines, representative of the most widely diffuse human solid tumors: breast (MCF7 and MDA-MB231), ovary (IGROV1), prostate (DU145), bladder (253J), colon (HT29), liver (HepB3 and HepG2), pancreas (MiaPaCa), lung carcinoma (NCI-H460 and NCI-H460M) and melanoma (JR8). All responded to the antiproliferative effect of HA-But with a dose-dependent inhibition of cell growth higher than that of But. The higher effectiveness of HA-But with respect to But alone is evident considering the ratio between the effectiveness of the drug (expressed in term of the concentration which inhibits cell growth by 50% of the control, IC50) and that of But alone (Table 1).

In fact, in all but one cell lines the ratio IC50HA-But/IC50But has been found below 1 and in some of them (i.e., DU145, HT29, NCI-H460, NCI-H460M, HepB3 and HepG2) the drug have shown an antiproliferative activity 7-30 fold higher than that of But. These results suggest that the use of HA as a carrier for butyric acid can significantly improve its biological activity without any chemical alteration for But or cytotoxic effect due to the presence of HA backbone, that alone produces an almost null cytotoxic effect (Coradini et al, 2004a, 2004b). The finding that the inhibitory activity is obtained in all the tumor cells investigated, despite their different histological origin, is not surprising taking into account the pivotal role of a HDAC inhibitor on gene expression during cell replication, as confirmed by the lack of any effect on normal slowly proliferating fibroblasts, notwithstanding the high expression of CD44 (83%) (Coradini et al, 2004a). It is interesting to note that the metastatic subclone of non-small lung carcinoma (NCI-H460M) responds to HA-But to an extent similar to that of the parental clone (NCI-H460) probably because of the similar rate of growth (expressed as time of duplication) and expression of CD44 receptors. This finding is of particular relevance since it supports the possibility of using HA-But also for the treatment of metastatic lesions as successfully assessed in in vivo animal models and described in paragraph VIII. Cytometric analysis showed that, as expected (Knudson, 1998), all tumor cell lines overexpressed CD44

the

Hyaluronic butyric ester (HA-But) has been synthesized as described in Coradini et al, (1999) starting from HA with a molecular weight of about 85 kDa and the procedure has been further refined to improve synthesis control (Coradini et al, 2004a). Briefly, the esterification 207

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy receptors on their plasma membrane, even though in a different extent (from 18% to 97%) and that the receptor turnover is not affected by the treatment with HA-But. This last finding is of particular pharmacological relevance, since the constant presence of the receptors on plasma membrane guarantees a continuous internalization of the drug. However, our data indicate that the quantitative expression of CD44 does not appear tightly correlated to its biological effect. In fact, despite the presence of CD44 receptors is a fundamental requirement for the effectiveness of HA-But, no relationship was found between the extent of CD44 expression and the inhibitory activity of the drug (Table 2): in fact a similar antiproliferative effect is observed in CD44-poor and in CD44-rich cell lines. For example, HepG2 and NCI-H460, two cell lines characterized by a different CD44 expression (18% and 91%, respectively), respond to HA-But in a similar manner suggesting that, after a sufficiently prolonged treatment interval (in this case 6 days), the drug is effective also in CD44-poor tumor cells, probably due to the very rapid CD44 turnover which guarantees a constant presence of the receptor and therefore a continuous internalization. Anyway, even though CD44 is the major receptor for hyaluronan, other membrane receptors including RHAMM, could be responsible for such an internalization (see paragraph III).

With regard to the mechanism of action, HA-But exerts an effect very similar to But indicating a lack of interference of HA backbone in the activity of butyric

Table 2. Relationship between CD44 expression and inhibitory effect of HA-But in a representative series of cell lines Cell line HepG2 MCF7 HT29 HepB3 NCI-H460 NCI-H460M JR8

MCF7 MDAMB231 IGROV1 DU145 253J HT29 HepB3 HepG2 MiaPaCa NCI-H460 NCI-H460M JR8

But IC50 (mM) mean±SD

HA-But IC50 (mM) mean±SD

HA-But IC50 But IC50

0.6±0.030 0.3±0.015

0.2±0.012 0.4±0.023

0.33 1.33

0.6±0.033 1.0±0.06 0.8±0.043 1.4±0.069 3.0±0.134 2.1±0.116 1.8±0.09 1.3±0.068 0.8±0.041 0.8±0.044

0.4±0.025 0.033±0.002 0.4±0.020 0.2±0.010 0.31±0.026 0.12±0.052 0.7±0.04 0.12±0.005 0.1±0.006 0.4±0.022

0.67 0.03 0.50 0.14 0.19 0.17 0.39 0.08 0.13 0.50

HA-But IC50 (mM)

18 60 71 78 91 91 97

0.12 0.20 0.20 0.31 0.12 0.10 0.40

The expression of CD44 receptors was evaluated by flow cytometry using a murine monoclonal antibody raised against human CD44 (clone 5F12, Neo Markers). Parallel fresh samples (1x106 cells) were incubated first with primary antibody at a dilution of 1:20 fo 60 min at room temperature and then with a secondary FITC-conjugated goat anti-mouse antibody (Sigma) at a dilution of 1:50 for 30 min at room temperature in the dark.

The negative control sample was incubated with the secondary antibody alone. The fluorescence of stained cells was measured using a FACScan flow cytometer. The fluorescence signal was collected in linear and logarithmic mode; at least 30,000 events were recorded for each sample.

residues, which maintain their biological properties. In fact, HA-But induces an hyperacetylation of histone H4, a dose-dependent overexpression of some G1/S transitionrelated proteins, including the cyclin-dependent kinase inhibitors p27 kip1 and p21waf1, and the block of cell growth in the G0/G1 phase of cell cycle (Coradini et al, 2004a).

Table 1. Effect of HA-But, with respect to But expressed in terms of IC50 values Cell line

CD44 expression (%)

VIII. In vivo studies with the butyric derivative The in vivo capability of HA-But to inhibit primary tumor growth and metastatic spread has been investigated in several animal models. However, in a preliminary series of experiments, pharmacokinetics and toxicity studies have been performed to investigate the HA-But biodistribution according to the different routes of administration and the possible side effects. Therefore, for pharmacokinetics purposes, HA-But has been labelled to technetium-99m (99mTc), the "-emitting radioisotope most widely used in radiodiagnosis and as a radioactive probe in pharmacological studies (Vittori et al, 1997). An efficient labelling method allowed us to directly anchor 99mTc to HA polymer with minor changes in charge, conformation and hydrophilicity and no significant changes in biodistribution and physiological interactions (Jurisson, 2002) but obtaining labelling yields of about 95%. Thus, 99m solutions containing Tc-HA-But have been administered i.v., i.p. or s.c. to healthy male CBA/Lac mice and scintigraphic images have been collected with a 5-min interval for 1 hr after i.v. injection, with a 30-min interval for 2 h after i.p. administration and with a 10-min interval for 6 h after s.c. injection, using a YAP camera, a "-camera with an high spatial resolution, specifically

Cell lines were kept for 6 days, an interval time sufficient to observe a statistically significant difference with respect to control, in the suitable medium supplemented with increasing concentrations of HA-But (range: 0.001 - 4 mg/ml) or sodium butyrate (range: 0.001 - 4 mM). Experiments were performed at least twice and samples were run in eight replicates. At the end of the experiments the antiproliferative effect was evaluated using MTT or Alamar Blue method, for adherent or floating cells, respectively. IC50 was defined as the concentration of drug that inhibits cell growth by 50% of the control. Ratios between IC50 values for the compounds significantly different from 1 (equal IC50 for the two compounds) are bolded.

208

Cancer Therapy Vol 2, page 209 designed for the imaging analysis of the in vivo distribution of radiolabelled compounds evaluated by a dedicated software (Giron, 2002).

The results have indicated that, with regards to i.v. injection, few minutes after treatment, there is a substantial accumulation of the compound in liver, uniformly distributed in both lobes (Figure 4) which becomes more intense after 1 hour. Scintigraphic images indicate that the compound accumulates also in the kidneys probably in relation to excretion of the fragments produced by the polymer degradation. The results have been confirmed by the evaluation of ex-vivo distribution of

HA-But which shows the liver as the organ of preferential accumulation in agreement with the finding obtained with native HA (Gustafsson et al, 1994) and the observation that circulating hyaluronan is physiologically degraded by hepatic sinusoidal endothelial cells via CD44 receptor (Seagusa et al, 2002). In addition, imaging analysis indicated an accumulation of 99mTc-HA-But also in the spleen as expected considering the role of the spleen in HA degradation (Laurent et al, 1995). In fact, considering the amount of labeled HA-But accumulated in a given organ and expressed as percentage of the injected dose (%ID) liver and spleen accumulate respectively 45% and

Figure 4. In vivo distribution of 99mTc HA-But was investigated using a YAP camera, a high spatial resolution "-camera. Scintigraphic images of mouse abdomens were obtained 1 h after i.v. or oral, 2h after i.p., 6 h after s.c. administration of an HA-But saline solution containing 99mTc-HA-But. Arrows indicate the main sites of accumulation.

209

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy 2.6% of the injected dose. However, when considering the amount of 99mT-HA-But accumulated per g of tissue (expressed as percentage of the injected dose per gram of tissue, % I.D./g) and thus taking into account the size of each organ, the spleen accumulated 11.66% I.D./g, an amount consistent with that found in the liver, which accumulated 15.83% I.D./g.

Liver uptake decreases considerably when the labelled compound is administered intraperitoneally or subcutaneously. In fact, i.p. (Figure 4) administration reduces the accumulation in the liver to a 23.5% which further decreases to a 0.5% after s.c. administration (Figure 4). Interestingly, scintigraphic images collected 6 hours after s.c. administration showed that a 36% of injected 99mTc-HA-But is still localized at the site of injection. These differences in HA-But pharmacokinetics, depending on the route of administration, may be exploited to appropriately target HA-But: i.v. route could be used for treating intrahepatic lesions, whereas s.c. route may be more useful for treating local lesions or to partially bypass the hepatic drug segregation.

To obtain a complete information on HA-But biodistribution, a series of experiments have been performed also administering 99mTc-HA-But orally or rectally. As shown in Figure 4, oral administration results in a partial retention of the drug in the stomach (21% I.D.) and in an accumulation in the duodenum (59.7% I.D.).

Scintigraphic images collected after 1 hour following rectal administration indicated that the drug localizes preferentially in the colon (48.3% I.D.) with a remarkable retention also in the rectum (14.3% I.D.). Ex-vivo analysis has clearly demonstrated that 99mTc-HA-But was actively internalized by the colonocytes suggesting a topic use of HA-But for treating colorectal carcinomas.

Acute and subacute toxicity experiments have indicated that HA-But administered i.v., i.p., or s.c. and followed up for 30 days did not cause toxicity. In particular, as reported in Table 3, when administered i.v., HA-But LD 50 (i.e., the dose which induces lethal effect in a 50% of the animals) is higher than 0.4 mg/ml, which was the maximum injectable dose permitted by the solution viscosity. When administered i.p. or s.c., HA-But LD50 values are respectively superior to 0.1 mg/ml and 0.2 mg/ml. During a 30-day follow up interval no animals died. Subacute toxicity experiments, performed administering i.p. 0.1 mg/ml HA-But for 10 days consecutively or injecting s.c. 0.04 mg/ml for 25 days consecutively, indicate a complete lack of toxicity

confirmed by the observation that during the 90-day follow up interval no animals died.

On the basis of the in vitro results, pharmacokinetics and toxicologic indications and keeping with the main sites of localization for human solid tumors, three major applications of HA-But have been explored: intratumor administration for treating localized lesions, such melanoma, i.v. injection for treating intrahepatic lesions and s.c. administration for treating lung metastases. In fact, liver and lung, in addition to harboring primary tumors, are often targets for metastatic spread from primaries arising in other organs, including colorectal carcinoma, breast cancer and melanoma.

Therefore, to investigate the in vivo pharmacological activity of HA-But we used three murine experimental models: a. subcutaneously inoculated mammary tumor cells (MCa), able to induce both local and lung lesions; b. subcutaneously inoculated LL3, able to induce both local and lung lesions; c. intrasplenic inoculated LL3 or melanoma cells (B16/F10), both able to induce intrahepatic lesions. In addition, we have explored the activity of HA-But also in a systemic model: the intraperitoneally inoculated lymphoma cells (TLX5), able to induce both intraperitoneal ascitis and brain metastases.

For the evaluation of the HA-But effect in treating localized tumor lesion, female mouse s.c. inoculated with MCa cells were treated intratumorally 11 days after cells inoculum with 0.05 mg/ml/day for 9 days. As shown in Figure 5, the intratumor treatment with a free of toxicity dose of HA-But significantly reduced primary tumor size as compared to untreated controls with a statistically significant difference starting from day 20. Moreover, intratumor injection of HA-But also reduced the number (-51%, P<0.05) and the weight (-51%, P<0.05) of lung metastases produced by MCa with a statistically significant difference in comparison to the untreated animal group.

Similar results have been obtained when the effect of HA-But was investigated in the s.c. inoculated LL3 cells model, able to induce local and lung metastatic lesions, and intratumorally treated with HA-But (0.05 mg/ml/day) for 9 days starting from day 12. Also in this case, intratumor injection of HA-But reduced (-70%, P<0.01) primary lesion size and decreased the number (-45%, 0.05) and the weight (-65%, P<0.01) of lung metastases with a statistically significant difference in comparison to the untreated animal group (Coradini, 2004a).

Table 3. Acute and subacute toxicity of HA-But after i.p., s.c. and i.v. administration Dose Route of administration (mg/ml/mouse) Acute 0.1 i.p.

0.2 s.c.

0.2 i.v.

0.4 Subacute 0.1 i.p.(x10 days) 0.04 s.c.(x25 days) The observation time was of 30 days and the survival time has been evaluated at 90 days.

210

Mortality death/total 0/5 0/5 0/5 0/5 0/10 0/15

Cancer Therapy Vol 2, page 211

Figure 5. In vivo effect of intratumor administration of HA-But in CBA/Lac female mice (10 per group) inoculated s.c. with 1.5x106 MCa cells at day 0 and treated from day 11 for 9 days with HABut 6Âľm/mouse. Primary tumor growth was evaluated every day and lung metastases were evaluated at day 27 at the sacrifice of the animals.

Even though we have no direct information on the effect of HA-But on cell motility and/or invasive potential of the metastatic cell line used in our experiments it is likely to assume that the compound should be able to compete for the binding to CD44 receptors with the endogenous components of the extracellular matrix (Skubitz, 2002) and to exert a detrimental effect on cell motility and therefore on invasion potential (Alaniz et al, 2002). The most exciting results have been obtained treating with HA-But the intrahepatic lesions induced by the intrasplenically inoculated LL3 or B16/F10 cells, two cell lines known for their particular aggressiveness (Barbara-Guillem et al, 1989; Carrascal et al, 2003) and which express high percentage of CD44-positive cells (respectively 68% and 87%). Intrasplenic inoculum model was chosen to better reproduce the biological outcome of liver metastases avoiding the use of conventional in vivo experimental models which imply the production of â&#x20AC;&#x153;artificialâ&#x20AC;? liver colonization via intravenously injected tumor cells (Asao et al, 1992).

As shown in Table 4, s.c. or i.p. administration of HA-But dramatically reduced the formation of liver metastases produced by both cell lines. In particular, as regard LL3 cells, 86% of the s.c. treated animals and 87.5% of the i.p. treated animals were free of macroscopically detectable metastases, and only one animal per treatment group (i.p. or s.c.) presented metastatic foci at sacrifice (i.e., 15 days after implantation). Conversely, in the untreated group, only 14% of the s.c. treated animals and 12.5% of the i.p. treated animals were metastastase free. A similar response rate was observed also in mice that were intrasplenically implanted with B16/F10 melanoma cells; at sacrifice all s.c. or i.p. HA-But treated animals were free of macroscopically detectable liver metastases versus none of animals in both (s.c. and i.p.) control groups. In addition, histological analysis of the liver parenchyma indicated that

HA-But did not affect liver morphology (Coradini et al, 2004b).

These interesting results have been further strengthened by a parallel series of experiments in which the effect of HA-But on survival time of tumor-bearing animals was investigated. Prolonged treatment with low doses of Ha-But (s.c. 0.04 mg/ml/day plus i.p. 0.1 mg/ml on day 4,11,18,25 and 31) significantly increased (P<0.03) the survival time of treated mice over untreated controls.

Noteworthy, 90 days after tumor implantation 80% HABut treated animals were still alive versus 27% in the untreated group (Coradini et al, 2004b).

With regard to the activity of HA-But on the intraperitoneally inoculated lymphoma cells (TLX5) model able to induce both intraperitoneal ascitis and brain metastases, in a preliminary experiment we have observed that the s.c. treatment with HA-But at the doses of 0.05 or 0.1 mg/ml for 7 days resulted in a dose-dependent reduction of the number of tumor cells present in the peritoneal ascitis (32% and 69%, respectively) with respect to controls (Table 5) not paralleled by a concomitant increase of survival time, because the animals death in this model is due to brain metastases and Ha-But cannot pass the blood-brain barrier.

IX. Conclusion and perspectives The studies summarized in this review provide evidence that HA-But, a new bioconjugate constituted by a backbone of HA, one of the main component of the extracellular matrix, partially esterified with butyric acid, the smallest HDAC inhibitor, is a potent inhibitor of cell growth in vitro and an antiproliferative/antimetastatic agent in vivo and that hyaluronan is a very suitable carrier due to its high biocompatibility, its ability to stabilize But molecule, to specifically target But to tumor cells, to internalize it via CD44 without interfere with its mechanism of action.

211

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy Table 4. Effect of 7-day i.p. or s.c. treatment with HA-But on liver metastasis formation following intrasplenic implantation of LL3 or B16/F10 melanoma cells LL3-induced No. of liver No. of metastasismetastases free animals control >10 1/7 HA-But <5 6/7* i.p. control >10 1/8 HA-But <5 7/8* *P<0.05, with respect to control (Fisher’s exact test) Route of administration s.c.

Treatment group

B16-F10-induced No. of liver No. of metastasesmetastases free animals >10 0/7 6/6* >10 0/7 7/7*

Table 5. Effect of HA-But treatment in mouse lymphoma model Treatment Survival time Peritoneal ascitis (mg/ml/mouse) (days) (No. of cells x 106) Control group 9.6±0.2 689.0±126.0 HA-But (0.05) 10.4±0.8 471.3±48.1* HA-But (0.1) 11.6±0.6 216.3±48.5* *P<0.05, with respect to control Groups of 10 CBA/Lac male mice inoculated i.p. with 100.000 cells TLX5 at day 0, treated i.p. starting 24 h after tumor implant, with HA-But for 7 days. Survival time was evaluated in 5 mice, whereas other 5 mice were sacrificed at day 8 for the count of peritoneal tumor cells.

Undoubtedly, several other HDAC inhibitors, including TSA, SAHA, depsipeptide, MS-275 inhibit tumor growth in animal models and are in phase I and II clinical trials either as monotherapy or in combination with other cytotoxics and differentiation agents (Kelly et al, 2002).

For example, phase I trial with SAHA, administered either intravenously or orally, have found that the drug is well-tolerated and has anti-tumor activity in heavily pretreated patients with advanced solid and haematologic tumors (Kelly et al, 2003). Moreover, administered orally has good bioavailability and induces responses in patients with prior therapy-resistant cutaneous T cell lymphomas.

Similarly, in a phase I trial, depsipepide has been found active against refractory neoplasms (Sandor et al, 2002) and MS-275 has been found, when orally administered, well tolerated and biological active in terms of histone acetylation (Gojo et al, 2002).

However, the use of these drugs does not allow the achievement of the major goal in cancer therapy: to selectively target anticancer molecules to organs or compartments harboring tumor cells. Conversely, HA-But which has high affinity for CD44, a specific membrane receptor provided to be overexpressed in most human cancers, including breast, colon, lung and hepatic carcinoma, could be a promising antineoplastic agent for the specific treatment of primary as well as metastatic tumors. Exploiting the overexpression of CD44 receptors on tumor cells membrane, hyaluronan is thus able to selectively target But to the neoplastic lesions. Although CD44 is expressed by some normal human epithelial and mesenchymal cells in which plays important roles in immune recognition, lymphocyte trafficking and cell-cell and cell-matrix interactions, we have demonstrated, in agreement with literature data (Byrd, 1999), that in normal cells like fibroblasts HA-But has no activity suggesting that the drug is really effective only in actively proliferating cells like tumor cells.

During the past few years the search for small molecules able to form pharmacological useful interactions with proteins that play a pivotal role in the regulation of cancer cell growth has gained an increasingly position within the drug discover process. Focusing on cancer, the discovery of small molecule compounds (such as butyric acid) able to interact with particular transcriptional targets that participate in the development and progression of cancer represents an exciting future perspective aimed in substituting the classic cytotoxic and hormonal anticancer agents with more selective drugs with greater efficacy and minimal side effects. In this light the development of drugs such as HA-But could respond to the these new strategies.

Acknowledgements I. Scarlata, C. Pellizzaro, R. Rossin and S. Zorzet contributed respectively to the synthesis of HA-But, in vitro experiments, pharmacokinetics evaluation and in vivo studies.

References Alaniz L, Cabrera PV, Blanco G, Ernst G, Rimoldi G, Alvarez E, and Hajos SE (2002) Interaction of CD44 with different forms oh hyaluronic acid Its role in adhesion and migration of tumor cells. Cell Commun Adhes 9, 117-30 Arano Y (2002) Recent advances in 99mTc radiopharmaceuticals Abb Nucl Med 16 79-93 Asao T, Shibata HR, Batist G, and Brodt P, (1992) Eradication of hepatic metastases of carcinoma H59 by combination chemioimmunotherapy with liposomal muramyl tripeptidesfluorouracil and leucovorin. Cancer Res 52, 6254-7 Aviram A, Zimrah Y, Shaklai M, Nudelman A, Rephaeli A (1994) Comparison between the effect of butyric acid and its pro-drug pivaloiloxy-methilbutyrate on histones hyperacetylation in an HL-60 leukemic cell line Int J Cancer 56 906-9

212

Cancer Therapy Vol 2, page 213 Barbera-Guillem E, Alonso-Varona A, Vidal-Vanaclocha F (1989) Selective implantation and growth in rats and mice of experimental liver metastasis in acinar zone one. Cancer Res 49, 4003-10 Breyer R, Hussein S, Radu DL, Putz KM, Gunia S, Hecker H, Samii M, Walter GF, Stan AC (2000) Disruption of intracerebral progression of C6 rat glioblastoma by in vivo treatment with anti-CD44 monoclonal antibody. J Neurosurg 92, 140-9 Byrd JC, Shinn C, Ravi R, Willis CR, Waselenko JK, Flinn IW, Dawson NA, Grever MR (1999) Depsipeptide (FR901228): a novel therapeutic agent with selective in vitro activity against human B-cell chronic lymphocytic leukemia cells. Blood 94, 1401-8 Candido EP, Reeves R, Davie JR (1978) Sodium butyrate inhibits histone deacetylation in cultured cells. Cell 14, 10513 Carmeliet P and Jain RK (2000) Angiogenesis in cancer and other diseases. Nature 407, 249-57 Carrascal MT, Mendoza L, Valcarcel M, Salado C, Egilegor E, Telleria N, Vidal-Vanaclocha F, Dinarello CA (2003) Interleukin-18 binding protein reduces B16 melanoma hepatic metastasis in neutralizing adhesiveness and growth factors of sinusoidal endothelium. Cancer Res 63, 491-7 Clark RA, Alon R, Springer TA (1996) CD44 and hyaluronandependent rolling interactions of lymphocytes on tonsillar stroma. J Cell Biol 134, 1075-87 Clausen MR (1995) Butyrate and colorectal cancer in animals and in humans. Eur J Cancer Prev 4, 483-90 Coradini D, Pellizzaro C, Abolafio G, Bosco M, Scarlata I, Cantoni S, Stucchi L, Zorzet S, Turrin C, Sava G, Perbellini A, Daidone MG (2004a) Hyaluronic acid butyric esters as promising antineoplastic agents in human lung carcinoma: a preclinical study. Invest New Drugs 22, 207-17 Coradini D, Pellizzaro C, Marimpietri D, Abolafio G, Daidone MG (2000) Sodium butyrate modulates cell cycle-related proteins in HT29 human colonic adenocarcinoma cells. Cell Prolif 33, 139-46 Coradini D, Pellizzaro C, Miglierini G, Daidone MG, Perbellini A (1999) Hyaluronic acid as drug delivery for sodium butyrate: improvement of the antiproliferative activity on a breast cancer cell line. Int J Cancer 81, 411-16 Coradini D, Zorzet S, Rossin R, Scarlata I, Pellizzaro C, Turrin C, Bello M, Cantoni S, Speranza A, Sava G, Mazzi U, and Perbellini A (2004b) Inhibition of Hepatocellular Carcinomas in vitro and Hepatic Metastases in vivo in Mice by the Histone Deacetylase Inhibitor HA-But. Clin Cancer Res (in press) Cummings JH (1981) Short chain fatty acids in the human colon.

Gut 22, 763-79 Daniel P, Brazier M, Cerutti I, Pieri F, Tardivel I, Desmet G, Baillet J, Chany C (1989) Pharmacokinetic study of butyric acid administered in vivo as sodium and arginine butyrate salts. Clin Chim Acta, 181255-63 Darkin-Rattray SJ, Gurnett AM, Myers RW, Dulski PM, Crumley TM, Allocco JJ, Cannova C, Meinke PT, Colletti SL, Bednarek MA, Singh SB, Goetz MA, Dombrowski AW, Polishook JD, Schmatz DM (1996) Apicidin: a novel antiprotozoal agent that inhibits parasite histone deacetylase.

Proc Natl Acad Sci 93, 13143-7 Day AJ and Prestwich GD (2001) Hyaluronan-binding proteins: tying up the giant. J Biol Chem 277, 4585-8 de Ruijter AJ, van Gennip AH, Caron HN, Kemp S, van Kuilenburg AB (2003) Histone deacetylases: characterisation of the classical HDAC family Biochem J 3707, 37-49 Delmage JM, Powars DR, Jaynes PK, Allerton SE (1986) The selective suppression of immunogenecity by hyaluronic acid.

Ann Clin Lab Sci 16, 303-10

Endo K and Terada T (2000) Protein expression of CD44 (standard and variant isoforms) in hepatocellular carcinoma: relationships with tumor grade clinicopathologic parameters p53 expression and patient survival. J Hepatol 32, 78-84 Entwistle J, Hall CL, and Turley EA (1996) HA receptors: regulators of signalling to the cytoskeleton. J Cell Biochem 61, 569-77 Feinberg RN and Beebe DC (1983) Hyaluronan in vasculogenesis Science 220 1177-79 Finnin MS, Donigian JR, Cohen A, Richon VM, Rifkind RA, Marks PA, Breslow R, Pavletich NP (1999) Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature 401, 188-93 Fraser JR, Alcorn D, Laurent TC, Robinson AD, Ryan GB (1985) Uptake of circulating hyaluronic acid by the rat liver.

Cell Tissue Res 242, 505-10 Frost SJ and Weigel PH (1990) Binding of hyaluronic acid to mammalian fibrinogens, Biochim Biophys Acta 1034. 39-45 Fukuse T, Hirata T, Naiki H, Hitomi S, Wada H (1998) Expression of CD44 variant exon 6 in stage I non-small cell lung carcinoma as a prognostic factor. Cancer Res 58, 110810 Giron MC, Bello M, Caliceti P, and Mazzi U (2002) YAPcamera for biodistribution studies in mice of 99mTcradiotracers In: M Nicolini and U Mazzi (eds) Technetium rhenium and other metals in chemistry and nuclear medicine Ed6 pp555-557 SG, Editoriali Padova Italy Gojo I, Karp JE, and Mann D (2002) Phase I study of histone deacetylase inhibitor (HDI)MS-275 in adults with refractory or relapsed hematologic malignancies. Proc Am Soc Hem abs n, 2198 Gore SD, Weng LJ, Figg WD, Zhai S, Donehower RC, Dover G, Grever MR, Griffin C, Grochow LB, Hawkins A, Burks K, Zabelena Y, Miller CB (2002) Impact of prolonged infusion of the putative differentiating agent sodium phenilbutyrate on myelodysplastic syndromes and acute myeloid leukaemia.

Clin Cancer Res 8, 963-70 Grunstein M (1997) Histone acetylation and chromatin structure and transcription. Nature 389, 349-52 G端nthert U, Hofmann M, Rudy W, Reber S, Zoller M, Haussmann I, Matzku S, Wenzel A, Ponta H, Herrlich P (1991) A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65, 13-24 Gustafsson S, Bjorknan T, and Westlin JE (1994) Labelling of high molecular weigth hyaluronan with 125-I-tyrosine.

Studies in vitro and in vivo in the rat Glico Conj J. 11, 60813 Hague A and Paraskeva C (1995) The short-chain fatty acid butyrate induces apoptosis in colorectal tumour cell lines.

Eur J Cancer Prev 4, 359-64 Harada N, Mizoi T, Kinouchi M, Hoshi K, Ishii S, Shiiba K, Sasaki I, Matsuno S (2001) Introduction of antisense CD44 cDNA down-regulates expression of overall CD44 isoforms and inhibits tumour growth and metastasis in highly metastatic colon carcinoma cells. Int J Cancer 91, 67-75 Hill MJ (1995) Bacterial fermentation of complex carbohydrates in the human colon Eur J Cancer Prevention 4 353-8 Isacke CM and Yarwood H (2002) The hyaluronan receptor CD44 J Biochem Cell Biol 34, 718-21 Kainz C, Kohlberger P, Sliutz G, Tempfer C, Heinzl H, Reinthaller A, Breitenecker G, Koelbl H (1995) Splice variants of CD44 in human cervical cancer stage IB to IIB. Gynecol Oncol 57, 383-7 Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich P (1995) CD44 variant exon epitopes in primary breast cancer and length of survival. Lancet 345, 615-9

213

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy Kelly WK, Oâ&#x20AC;&#x2122;Connor OA and Marks PA (2002) Histone deacetylase inhibitors: from target to clinical trials. Expert Opin Investig Drugs 11, 1695-1713 Kelly WK, Richon VM, O'Connor O, Curley T, MacGregorCurtelli B, Tong W, Klang M, Schwartz L, Richardson S, Rosa E, Drobnjak M, Cordon-Cordo C, Chiao JH, Rifkind R, Marks PA, Scher H (2003) Phase I clinical trial of histone deacetylase inhibitor: suberoylanilide hydroxamic acid (SAHA) administered intravenously. Clin Cancer Res 9, 3578-88 Khochbin S, Verdel A, Lemercier C, Seigneurin-Berny D (2001) Functional significance of histone deacetylase diversity.

Curr Opin Genet 11, 162-6 Knudson W (1998) The role of CD44 as a cell surface hyaluronan receptor during tumor invasion and metastasis.

Frontiers Biosci 3, 604-15 Laurent TC, Laurent UB, and Fraser B. Jr (1995) Functions of hyaluronan Ann Rheum Dis. 54, 429-32 Lepperdinger G, Strobl B and Kreil G (1998) HYAL2 a human gene expressed in many cells encodes a lysosomal hyaluronidase with a novel type of specificity J Biol Chem.

273, 22466-70 Luo Y and Prestwich GD (2002) Cancer-targeted polymeric drugs Curr Cancer Drug Targets. 2, 209-26 Manten-Horst E, Danen EH, Smit L, Snoek M, Le Poole IC, Van Muijen GN, Pals ST, Ruiter DJ (1995) Expression of CD44 splice variants in human cutaneous melanoma and melanoma cell lines is related to tumor progression and metastatic potential. Int J Cancer 64, 182-8 Marks PA, Richon VM, Breslow R, Rifkind RA (2001b) Histone deacetylase inhibitors as new cancer drugs. Curr Opinion Oncol 13, 477-83 Marks PA, Rifkind RA, Richon VM, Breslow R, Miller T, and Kelly WK (2001a) Histone deacetylases and cancer: causes and therapies. Nat Rev Cancer 1, 194-202 Martin S, Jansen F, Bokelmann J, Kolb H (1997) Soluble CD44 splice variants in metastasizing human breast cancer. Int J Cancer 74, 443-5 Mayer B, KW Jauch U Gunthert CG Figdor FW Schildberg I Funke and JP Johnson (1993) De novo expression of CD44 and survival in gastric cancer. Lancet 342, 1019-22 McBride WH and Bard JB (1979) Hyaluronidase-sensitive halos around adherent cells Their role in blocking lymphocytemediated cytolysis. J Exp Med 149, 507-15 McIntyre A, Gibson PR and Young GP (1993) Butyrate production from dietary fibre and protection against large bowel cancer in a rat model. Gut 34, 386-91 Meyer K and Palmer JW (1934) The polysaccharide of the vitreous humor. J Biol Chem 107, 629-34 Miller AA, Kurschel E, Osieka R, Schmidt CG (1987) Clinical pharmacology of sodium butyrate in patients with acute leukemia. Eur J Cancer Clin Oncol, 23 1283-7 Mulder JW, Kruyt PM, Sewnath M, Oosting J, Seldenrijk CA, Weidema WF, Offerhaus GJ, Pals ST (1994) Colorectal cancer prognosis and expression of exon-v6-containing CD44 proteins. Lancet 344, 1470-2 Nakajima H, Kim YB, Terano H, Yoshida M, Horinouchi S (1998) FR901228 a potent antitumor antibiotic is a novel histone deacetylase inhibitor. Exp Cell Res 241, 126-33 Naor D, Nedvetzki S, Golan I, Melnik L, Faitelson Y (2002) CD44 in cancer. Crit Rev Clin Lab Sci 39, 527-79 Nishida Y, Knudson CB, Knudson W (1993) Internalization of hyaluronan by chondrocytes occurs via receptor-mediated endocytosis. J Cell Sci, 106 365-75 Noble PW (2002) Hyaluronan and its catabolic products in tissue injury and repair. Matrix Biol 21, 25-9

Pellizzaro C, Coradini D, Daidone MG (2002) Modulation of angiogenesis-related proteins synthesis by sodium butyrate in colon cancer cell line HT29. Carcinogenesis 23, 735-40 Pellizzaro C, Coradini D, Daniotti A, Abolafio G, Daidone MG (2001) Modulation of cell cycle-related proteins but not of p53 expression by sodium butyrate in a human non-small cell lung cancer cell line. Int J Cancer 91, 658-64 Pilarski LM, Pruski E, Wizniak J, Paine D, Seeberger K, Mant MJ, Brown CB, Belch AR (1999) Potential role for hyaluronan and the hyaluronan receptor RHAMM in mobilization and trafficking of hematopoietic progenitor cells. Blood 93, 2918-27 Planchon P, Magnien V, Beaupain R, Mainguene C, Ronco G, Villa P, Brouty-Boye D (1992) Differential effects of butyrate derivatives on human breast cancer cells grown as organotipic nodules in vitro and as xenografts in vivo. In vivo 6, 605-10 Planchon P, Pouillart P, Ronco G, Villa P, Pieri F (1993) Differential elimination of syntetic butyric triglicerides in vivo: a pharmacokinetic study. J Pharm Sci 82, 1046-8 Pouillart P, Cerutti I, Ronco G, Villa P, Chany C (1991) Butyric monosaccharide ester-induced cell differentiation and antitumour activity in mice Importance of their prolonged biological effect for clinical application in cancer therapy.

Int J Cancer 49, 89-95 Pryde SE, Duncan SH, Hold GL, Stewart CS, Flint HJ (2002) The microbiology of butyrate formation in the human colon.

FEMS Microbiol Letters 217, 133-9 Reeder JA, Gotley DC, Walsh MD, Fawcett J, Antalis TM (1998) Expression of antisense CD44 variant 6 inhibits colorectal tumour metastasis and tumour growth in a wound environment. Cancer Res 58, 3719-26 Rephaeli A, Rabizadeh E, Aviram A, Shaklai M, Ruse M, Nudelman A (1991) Derivatives of butyric acid as potential anti-neoplastic agents. Int J Cancer 49, 66-72 Richon VM, Emiliani S, Verdin E, Webb Y, Breslow R, Rifkind RA, Marks PA (1998) A class of hybrid polar inducers of transformed cell differentiation inhibits histone deacetylaeses. Proc Natl Acad Sci 95, 3003-7 Richon VM, Sandhoff TW, Rifkind RA, Marks PA (2000) Histone deacetylase inhibitor selectively induces p21WAF1 expression and gene-associated histone acetylation. Proc Natl Acad Sci 97, 10014-9 Roediger WEW (1980) Role of anaerobic bacteria in the metabolic welfare of the colonic mucosa in man. Gut 21, 793-8 Saegusa S, Shuji I and Kawarada Y (2002) Changes in serum hyaluronic acid levels and expression of CD44 and CD44 mRNA in hepatic sinusoidal endothelial hepatectomy in cirrhotic rats. Worls J Surg 26, 694-9 Saito A, Yamashita T, Mariko Y, Nosaka Y, Tsuchiya K, Ando T, Suzuki T, Tsuruo T, Nakanishi O (1999) A synthetic inhibitor of histone deacetylase MS-275 with marked in vivo antitumor activity against human tumors. Proc Natl Acad Sci 96, 4592-7 Sandor V, Bakke S, Robey RW, Kang MH, Blagosklonny MV, Bender J, Brooks R, Piekarz RL, Tucker E, Figg WD, Chan KK, Goldspiel B, Fojo AT, Balcerzak SP, Bates SE (2002) Phase I trial of the histone deacetylase inhibito depsipeptide (FR901228 NSC630176) in patients with refractory neopalsms. Clin Cancer Res 8, 718-28 Scheppach W, Bartram HP and Richter F (1995) Role of shortchain fatty acids in the prevention of colorectal cancer. Eur J Cancer 31A, 1077-80 Scott JE and Heatley F (2002) Biological properties of hyaluronan in aqueous solution are controlled and sequestered by reversible tertiary structures defined by NMR spectroscopy. Biomacromolecules 3, 547-53

214

Cancer Therapy Vol 2, page 215 Seiter S, Arch R, Reber S, Komitowski D, Hofmann M, Ponta H, Herrlich P, Matzku S, Zoller M (1993) Prevention of tumor metastasis formation by anti-variant CD44. J Exp Med 177, 443-55 Simeister G, Martiny-Baron G, and Marmé D (1998) The pivotal role of VEGF in tumor angiogenesis: molecular facts and therapeutic opportunities. Cancer and Metastasis Rev 17, 241-8 Skubitz AP (2002) Adhesion molecules Cancer Treat Res 107 305-29 Sowa Y and Sakai T (2000) Butyrate as a model for “gene regulating chemopreventing and chemotherapy”. Biofactors 12, 283-7 Stauder R, Eisterer W, Thaler J, Gunthert U ( 1995) CD44 variant isoforms in non-Hodgkin’s lymphoma: a new independent prognostic factor. Blood 85, 2885-99 Strobel T, Swanson L, and Cannistra SA (1997) In vivo inhibition of CD44 limits intra abdominal spread of a human ovarian cancer xenograft in nude mice: a novel role for CD44 in the process of peritoneal implantation. Cancer Res 57, 1228-32 Tabuchi Y, Arai Y, Kondo T, Takeguchi N, Asano S (2002) Identification of genes responsive to sodium butyrate in colonic epithelial cells. Bioch Bioph Res Comm 293, 128794 Tammi MI, Day AJ, and Turley EA (2001) Hyaluronan and homeostasis: a balancing act. J Biol Chem 277, 4581-4 Termeer CC, Hennies J, Voith U, Ahrens T, Weiss JM, Prehm P, Simon JC (2000) Oligosaccharides of hyaluronan are potent activators of dendritic cells. J Immunol 165, 1863-70 Termeer CC, Sleeman JP, and Simon JC (2003) Hyaluronan magic glue for the Regulation of the immune response?

Trends Immunol 24, 112-4 Terpe HJ, Storkel S, Zimmer U, Anquez V, Fischer C, Pantel K, Gunthert U (1996) Expression of CD44 isoforms in renal cell tumors Positive correlation to tumor differentiation. Am J Pathol 148, 453-63 Trochon V, Mabilat C, Bertrand P, Legrand Y, Smadja-Joffe F, Soria C, Delpech B, Lu H (1996) Evidence of involvement of CD44 in endothelial cell proliferation migration and angiogenesis in vitro Int J Cancer 66 664-8 Uhl-Steidl M, Muller-Holzner E, Zeimet AG, Adolf GR, Daxenbichler G, Marth C, Dapunt O (1995) Prognostic value of CD44 splice variant expression in ovarian cancer. Oncol 52, 400-6 Van Lint C, Emiliani S, and Verdin E (1996) The expression of a small fraction of cellular gene is changed in response to histone hyperacetylation. Gene Exp 5, 245-54

Vittori F, Malatesta T, and Notaristefani F (1997) The YAP camera: an accurate gamma-camera particularly suitable fo new radiopharmaceuticals research. IEEE Trans On Nucl Sci 44, 47-53 Weigel PH, Fuller GM and LeBoeuf RD (1986) A model for the role of hyaluronic acid and fibrin in the early events during the inflammatory response and wound healing, J Theor Biol 119. 219-34 Weissman B and Meyer K (1954) The structure of hyalobiouronic acid and of hyaluronic acid from umbilical cord. J Am Chem Soc 76, 1753-7 Whiteley LO, Higgins JM, Purdon MP, Ridder GM, Bertram TA (1996) Evaluation in rats of the dose-response relationship among colonic mucosal growth colonic fermentation and dietary fiber. Dig Dis Sci 41, 1458-67 Wielenga VJ, Heider KH, Offerhaus GJ, Adolf GR, van den Berg FM, Ponta H, Herrlich P, Pals ST (1993) Expression of CD44 variant proteins in human colorectal cancer is related to tumour progression. Cancer Res 54, 4754-6 Yoshida M, Kijima M, Akita M, Beppu T (1990) Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem 265, 171749 Zahalka MA, Okon E, Gosslar U, Holzmann B, Naor D (1995) Lymph node (but not spleen) invasion by murine lymphoma is both CD44- and hyaluronate-dependent. J Immunol 154, 5345-55 Zimra Y, Wasserman L, Maron L, Shaklai M, Nudelman A, Rephaeli A (1997) Butyric acid and pivaloiloxymethilbutyrate AN9 a novel butyric acid derivative induces apoptosis in HL-60 cells. J Cancer Res Clin Onc 123, 15260

Danila Coradini

215

Coradini and Perbellini: Hyaluronan butyric ester for cancer therapy

216

Cancer Therapy Vol 2, page 217 Cancer Therapy Vol 2, 217-226, 2004

Oxaliplatin in the management of advanced colorectal cancer: Different associations and schedules Research Article

Francesco Recchia1,2*, Alisia Cesta1, Gaetano Saggio1, Giampiero Candeloro1, Silvio Rea2,3 1

Unità operativa di Oncologia, Ospedale Civile di Avezzano, Fondazione Carlo Ferri, Monterotondo, Roma, 3 Oncologia chirurgica, Università degli studi de L’Aquila. Italy 2

__________________________________________________________________________________ *Correspondence: Prof Francesco Recchia, MD., Via Rossetti 1, 67056 Luco dei Marsi (AQ), Italy, Tel, 0863-499250; Fax, 0863499388; E-mail: frecchia1946@libero.it Key Words: Advanced colorectal cancer, chemotherapy, oxaliplatin, leucovorin, 5-fluorouracil, immunotherapy Abbreviations: 13-cis retinoic acid, (RA); 5-fluorouracil, (5FU); alanine aminotransferase, (ALT); aspartate aminotransferase, (AST); combination of CPT-11, bolus 5-FU and LV, (FOLFIRI); combination of L-OHP with LV and infusional 5-FU, (FOLFOX); confidence intervals, (CI); vascular endothelia growth factor, (VEGF); interleukin-2, (IL-2); irinotecan, (CPT-11); leucovorin, (LV); metastatic colorectal cancer, (MCC); minimal residual disease, (MRD); oxaliplatin, (L-OHP); upper limit of normal, (ULN) Received: 3 June 2004; Revised: 9 July 2004 Accepted: 12 July 2004; electronically published: July 2004

Summary Since the introduction into clinical practice of irinotecan (CPT-11) and oxaliplatin (L-OHP) for the treatment of metastatic colorectal cancer (MCC), we have adopted several therapeutical strategies in order to improve response rate and decrease the toxicity profile. In a phase II study the administration of L-OHP was fractionated over two days and combined with leucovorin (LV) and 5-fluorouracil (5FU) in bolus and continuous infusion (FOLFOX regimen) for the treatment of 46 patients with MCC, pretreated with CPT-11 and 5FU/LV (FOLFIRI regimen). A 32.6% response rate was obtained with an overall median survival of 12.2 months. In a further phase II study conducted with the same drug combination administered to 54 chemotherapy-naïve patients, a 50% response rate and overall survival of 19.2 months were achieved. As the FOLFOX and FOLFIRI regimens have been shown to be the two most active regimens in the treatment of MCC, an additional study was carried out in 26 untreated patients, alternating FOLFOX and FOLFIRI regimens, with the aim of further reducing toxicity and avoiding the emergence of chemotherapy resistant cellular clones. With this strategy the response rate was increased to 69%. Finally, in order to prolong responses, a selected group of 20 patients, after surgical resection of metastases from MCC and 12 courses of fractionated FOLFOX regimen, was treated with a therapy including interleukin-2 (IL-2) and 13-cis retinoic acid (RA), aimed to decrease the vascular endothelial growth factor (VEGF). After a median follow-up of 20 months, a statistically significant decrease of VEGF was observed, while median time to progression and overall survival were not reached yet (5-year survival rate 52%). In conclusion, different associations and schedules may improve the clinical outcome of patients with MCC treated with L-OHP-based chemotherapy. colorectal cancer (MCC). Modulation of 5-FU action with leucovorin (LV) has increased response rates in the treatment of this disease, but unfortunately the duration of response has not improved (Advanced colorectal cancer meta-analysis project, 1992). Additional progress has been accomplished by changing the schedule of 5-FU administration. In fact, 5-FU when given in a bolus preferentially inhibits RNA synthesis, while as a

I. Introduction Colorectal carcinoma is the second most common cancer in the Western World. In Europe 90,000 patients die from this disease each year (Black et al, 1997). In Italy each year, nearly 20,000 new patients develop colorectal cancer with a 55% mortality rate (Bonadonna et al, 1999).

In the last 4 decades, 5-fluorouracil (5-FU) has been the most important drug in the treatment of metastatic

217

Recchia et al: Strategies in advanced colorectal cancer toxicity permitted. Treatment, preceded by administration of an hydroxytryptamine-3 antagonist and dexamethasone, consisted of L-OHP 50 mg/m2 in 250 ml of 5% dextrose in water, LV 200 mg/m2 in a 2-hour I.V. infusion, followed by 5-FU 400 mg/m2 bolus and 5-FU 600 mg/m2 in a 22-hour continuous infusion, over two consecutive days. Elastomeric pumps were used for the infusion. Patients were assessed for toxicity before each cycle of chemotherapy according to WHO Criteria. Peripheral neuropathy was graded using the oxaliplatin-specific scale (Caussanel et al, 1990). Chemotherapy was delayed until recovery, if neutrophil and platelet counts were <1.5 x 109/L and <100 x 109/L, respectively or for significant non-hematological toxicity. In case of grade 2 hematological toxicity or diarrhea the doses of all drugs were reduced by 10%. In case of grade 3 or 4 neutropenia, mucositis or diarrhea the 5-FU dose was reduced by 20%. The dose of L-OHP was lowered by 20% in case of grade 3 thrombocytopenia or grade 3 diarrhea and by 50% in case of grade 4 thrombocytopenia. If grade 3 neurotoxicity occurred, the doses of L-OHP were reduced by 20% and stopped in case of grade 4. Patients who continued to be treated with the protocol chemotherapy beyond 6 months, were allowed to prolong the interval between chemotherapy cycles from 2 to 3 weeks, in order to permit full recovery of treatment-induced toxicities.

Patients were removed from the study in case of progressive disease, unacceptable toxicity, consent withdrawal or disease stability after 1 year.

continuous infusion it inhibits thymidilate synthase and DNA synthesis (Sobrero et al, 1997). Based on these principles, the introduction into clinical practice of a bimonthly schedule combining LV with 5-FU bolus and continuous infusion (the “de Gramont” regimen), has improved response rates and decreased toxicity profiles, but has still not improved survival (de Gramont et al, 1997). Irinotecan (CPT-11) and oxaliplatin (L-OHP) are 2 new drugs that have been recently introduced into clinical practice. The combination of CPT-11, bolus 5-FU and LV (IFL) has been the most widely used regimen for the treatment of patients with MCC in the United States of America and Canada (Saltz et al, 2000). The combination of L-OHP with bolus LV and 5FU and infusional 5-FU (FOLFOX) was approved in 1999, in Europe, as first-line treatment of MCC, following the results of a study that showed improved response compared with a regimen containing LV and 5-FU alone (de Gramont et al, 2000).

Combining CPT-11 with the de Gramont regimen (FOLFIRI) resulted also in increased response rate, time to pregression and overall survival with respect to the de Gramont regimen alone (Douillard et al, 2000). Recently published trials have ascertained the superiority of FOLFOX with respect to FOLFIRI, both in the adjuvant and in metastatic disease chemotherapy setting (Goldberg et al, 2003, 2004). Furthermore, the FOLFOX regimen has been shown to be superior to both the FOLFIRI and CPT11/L-OHP combinations, both in terms of time to progression and overall survival, with a comparable toxicity profile (Goldberg et al, 2004). While both CPT-11 and L-OHP have contributed substantially to the improvement of survival of patients with MCC, here we report on four studies conducted with L-OHP- containing regimens, but with different schedules and associations, aimed at improving response rates and decreasing the toxicity profiles in patients with MCC.

C. Evaluation Prior to treatment a complete history was taken and a physical examination was performed, weight was recorded and complete differential blood count, serum bilirubin, creatinine, albumin, alkaline phosphatase, transaminases, lactic dehydrogenase, and carcinoembryonic antigen were determined.

Initial radiological investigations included chest X-ray and computed tomography of abdomen and pelvis and an electrocardiogram. An X-ray skeletal survey was performed when abnormal areas of uptake were observed in bone scans; CT scanning was used to evaluate hepatic lesions. Blood counts were repeated weekly, serum biochemistry was determined before each course of treatment and CEA and radiological investigations were repeated every 4 courses of chemotherapy (2 months).

Follow-up visits were performed monthly. Treatment endpoints were patients’ response rate and survival. Objective responses were evaluated according to WHO criteria (Miller et al, 1981).

II. Patients and Methods A. Patient eligibility Patients were required to have histologically confirmed, colorectal adenocarcinoma, a measurable lesion >2 cm. Patients enrolled in the first phase II study were treated with a FOLFIRIlike regimen as first-line chemotherapy, while those entered in the second phase II study were chemotherapy naïve. Patients exposed to radiation therapy for rectal cancer were included, if the measurable lesion was outside the irradiated field. Other inclusion criteria were, adequate hematological (neutrophils >2 x 109/L, platelets >100 x 109/L, hemoglobin >10 g/dL, hematocrit >30%), hepatic [total bilirubin level of <1.5 mg/dL, aspartate aminotransferase (AST) and alanine aminotransferase (ALT) < 3 times the upper limit of normal (ULN)] and cardiac functions.

Patients with additional malignancies, other than curatively treated skin and cervical cancer or with active cardiovascular disease, were excluded. All patients were required to sign a consent form approved by the Ethical Committee of the Civilian Hospital of Avezzano, in adherence with provisions set forth in the Helsinki Agreement.

D. Statistical methods For the response rate, exact binomial 95% confidence intervals (CI) were calculated. Survival and time to progression were calculated from the date of protocol entry to the time of progression or death, and both were assessed using the Kaplan and Meier product-limit method (Kaplan and Meier, 1958).

Patients who underwent metastasectomy were not censored for progression-free survival. Logrank test was used to compare survival curves.

III. Results A. Patients’ characteristics The studies comprise 146 consecutive patients with metastatic colorectal carcinoma evaluated and treated at the Civilian hospital of Avezzano. The patients median age was 60 years, 77 patients had been treated with a 5FU/LV adjuvant chemotherapy before developing metastatic disease, while 69 patients had metastatic disease at the diagnosis. Twenty patients were operated for metastasectomy, and 15 patients underwent resection of

B. Treatment and follow-up evaluation Following the initial staging procedures, a central venous line catheter was positioned into the subclavian vein under local anaesthesia. Chemotherapy was administered on an outpatient basis for 2 consecutive days and repeated every 2 weeks if

218

Cancer Therapy Vol 2, page 219 metastatic disease after administration of the FOLFOX regimen. Patients’ characteristics are included in Table 1.

effect of the doses administered and by the peak plasma concentrations of L-OHP (Extra et al, 1998). In order to further decrease toxicity, chemotherapy was preceded by the administration of 2400 mg of reduced gluthatione (GSH), 4 meq Mg SO4 and 10 meq KCl. L-OHP was administered, 50 mg/m2 and LV 200 mg/m2 in a 2-hour I.V. infusion, followed by 5-FU 400 mg m2 bolus and 5FU 600 mg/m2 in a 22-hour continuous infusion, on days 1 and 2 every 2 weeks (De Gramont regimen). In the firstline chemotherapy study including 54 patients (Recchia et al, 2004a) we obtained an overall response rate of 50% (95% CI, 36% to 64%), with a median time to progression and overall survival of 10.3 and 19.2 months, respectively (Figure 1), whereas in the study of 46 patients pretreated with the FOLFIRI regimen (Recchia et al., 2003a), the response rate to salvage chemotherapy was 32.6% (95% CI, 19.5% to 48,06%). Median time to progression and overall survival were 6.4 months (range 3.1-31+), and 12.2 months (range 3.7-31.1+), respectively (Figure 2).

Overall survival for the 100 patients enrolled in these phase-II studies, from the start of chemotherapy for metastatic disease was 22.5 months (Figure 3). The toxicity profile of these 2 studies was particularly favorable. In chemotherapy naïve patients, grade 2-3 leukopenia was observed in 31% of patients, while only 10% of patients developed peripheral neuropathy. Grade 4 thrombocytopenia was observed in 1 patient. Eighty-five percent of patients had no nausea or vomiting. Grade 1-4 diarrhea occurred in 11% of patients. Treatment was delayed in 39 courses of chemotherapy (8%) and the doses were reduced in 24 (5%).

B. Fractionation of FOLFOX over two days in first and second line chemotherapy for metastatic colorectal carcinoma In vitro and clinical studies have shown that L-OHP as a single agent has demonstrated superior activity compared to cisplatin or carboplatin (Raymond et al, 1997), while in a combination with 5-FU has a greater than additive effect on colorectal cancer cell lines (Raymond et al, 1998). Moreover, synergism in the action of L-OHP, 5-FU and LV has been demonstrated, irrespective of sequence of administration (Fischel et al, 1998). We therefore conducted 2 phase II studies administering this combination of drugs (FOLFOX regimen), to chemotherapy naïve (Recchia et al, 2004a) and to pretreated MCC patients (Recchia et al, 2003a). LOHP doses were fractionated over two days and administered with 5-FU/LV bolus and continuous infusion with the aim of increasing the activity of this regimen and decreasing toxicity. Neurotoxicity, which may occur as acute neurosensory toxicity involving hands, feet and larynx and as chronic sensory neuropathy with loss of Table 1. Characteristics of patients Characteristics No. % No of patients 146 100 Age, years Median 60 Range 35-79 Sex Males 95 65 Females 51 35 Performance status (ECOG) 0-1 115 79 2 26 18 3 5 3 Site of primary disease Colon 102 70 Rectum 44 30 Metastatic disease at diagnosis 74 51 Metastatic sites Liver 92 42 Lung 31 14 Abdomen 51 23 Bone 13 6 Nodes 14 7 Peritoneal carcinomatosis 12 5 Brain 6 3 35 patients had 2 metastatic sites, and 16 patients had 3 or more metastatic sites

Figure 1. --- Time to progression: events 41 (89%), censored 5 (11%), median time to progression: 6.4 months (range 3.1-31+) ! Overall survival: events 25 (54%), censored 21 (46%), median overall survival 12.2 months (range 1-31.1+)

sensation, dysesthesias in the distal extremities and functional impairment, is one of the most important doselimiting toxicities of L-OHP, caused by the cumulative

219

Recchia et al: Strategies in advanced colorectal cancer (Goldie and Coldman, 1979). In a further attempt to improve responses obtained in the 2 previously reported multicenter phase II studies where fractionated CPT-11 had been used as first- (Recchia et al, 2004a) or secondline chemotherapy in MCC (Recchia et al, 2004a), we performed a further study in which both regimens FOLFOX and FOLFIRI were alternated in each patient with aim of decreasing the chances of developing resistance to the drugs and decrease the toxicity profile.

This trial included 26 patients of whom 14 were female; 9 patients had a median disease-free survival of 14 months, while 17 patients had stage IV disease at the diagnosis. Patients received FOLFOX as the first course of chemotherapy, as previously described. After 14 days patients were treated with the FOLFIRI regimen in which CPT-11, 90 mg/m2 and LV 200 mg/m2 were administered in a 2-hour I.V. infusion, followed by 5-FU 400 mg m2 bolus and 5-FU 600 mg/m2 in a 22-hour continuous infusion, on days 1 and 2 every 2 weeks. A response rate of 69% was observed, while disease stability occurred in 11% of patients, signifying that 80% of patients had a benefit from chemotherapy. After a median follow up of 12 months median time to progression had not been reached yet, while 77% of patients were still alive.

Toxicity was exceptionally low with no grade 3 or 4 hematologic or neurologic toxicity.

Figure 2. --- Time to progression: events 47 (87%), censored 7 (13%), median time to progression: 10.3 months (range 2.853.2+) ! Overall survival: events 36 (67%), censored 18 (33%), median overall survival 19.2 months (range 1.5-53.2+)

D. Immunotherapy for patients radically treated with surgery and chemotherapy for metastatic recurrent colorectal cancer A high percentage of patients with solid tumors achieve a complete clinical remission after initial treatment. Unfortunately, the majority of them finally relapse due to â&#x20AC;&#x153;minimal residual diseaseâ&#x20AC;? (MRD) represented by residual tumor cells detectable only by the most sensitive methods (Mathè et al, 1986). The low efficiency of the immune system, induced by surgical and chemotherapeutic treatments will prevent the eradication of these cell clones by cell-mediated immunity (Finke et al, 1999). Such immune dysfunction is usually worsened by cytotoxic therapy (Mackall et al, 1994). Performance status, disease extent, weight loss and, independently from other factors, lymphocytopenia (Riesco, 1970; Stanley, 1980; Lavin et al, 1982) are negative prognostic factors.

Chemotherapy may damage interleukin-2 (IL-2) cellmediated immune function for prolonged periods of time (Mackall et al, 1994; Wise et al, 1988). Vascular endothelial growth factor (VEGF), a diffusible glycoprotein produced by normal and neoplastic cells, is an important regulator of physiologic and pathologic angyogenesis (Ferrara N et al, 2003). Preclinical and clinical studies have shown that a murine monoclonal antihuman antibody against VEGF can inhibit the growth of human tumor xenofrats and an humanized variant of this antibody in combination with irinotecan-based chemotherapy resulted in statistically significant and clinically meaningful improvement in survival among patients with metastatic colorectal cancer (Kim KJ et al, 1993, Hurwitz H et al., 2004). IL-2, defined as the hormone of the immune response, has pleiotropic activities on cell-mediated and humoral immunity. IL-2

Figure 3 . Events 79 (79%), censored 21 (21%), overall median survival 22.5 months (range 1.5-100+)

In patients pretreated with chemotherapy, grade 2-3 leukopenia was observed in 34% of patients, while only 10% of patients developed grade 2-3 peripheral neuropathy. Grade 4 thrombocytopenia was low and was only observed in 1 patient. Allergic cutaneous reactions were observed in 4 patients after a cumulative median dose of oxaliplatin of 800 mg/m2 (range 450-1000 mg/m2).

In these two studies we have shown not only that overall survival was comparable to and even better than the survival obtained in other trials in which L-OHP was administered in one day, but the neurotoxicity profile was particularly favorable.

C. Alternation of fractionated FOLFOX and FOLFIRI in first line chemotherapy for metastatic colorectal carcinoma The high failure rates encountered in the chemotherapy of some cancers suggest that drug resistance is a common phenomenon. Since L-OHP and CPT-11 are non-cross resistant their combined use may diminish emergence of resistant neoplastic clones and may be associated with enhanced anti-neoplastic activity with a lower toxicity profile. Based on this hypothesis, rapid cyclic alternating chemotherapy has been suggested as a favourable treatment modality in several cancer types 220

Cancer Therapy Vol 2, page 221 induces T cell proliferation, enhances the generation of cytotoxic T lymphocytes and activates T and B cells. In addition, IL-2 amplifies the tumoricidal activity of NK cells (Smith, 1988). The IL-2-receptor interaction (Cantrell et al, 1984) is augmented through a paracrine route, that involves IFN-" function (Smith, 1988). The induction of endogenous LAK cell activity and production of tumor inhibitory cytokines (Pavletic et al, 1993) may constitute the primary cytotoxic activity of IL-2. Another important aspect is the inhibition of angiogenic activity by IL-2 through the induction of IFN-", which in turn, induces p-10, a protein with potent antiangiogenic activity (Keane et al, 1999). Some chemotherapy-refractory tumors such renal cell carcinoma and melanoma, have shown responses to high-dose IL-2 (Fyfe et al, 1995).

Nevertheless, high-dose intravenous IL-2 has been shown to have a high toxicity through the mechanism of vascular leak syndrome with hypotension, oliguria, respiratory distress, cardiac arrhythmias and mental status change (Fyfe et al, 1995).

Murine studies have shown that IL-2 has a higher efficacy, when tumor burden is low (Charak et al, 1991).

Consequently it may be preferable to administer of IL-2 after surgical cytoreduction and after having achieved the maximum response to chemotherapy (Belldegrun et al, 2000). In this setting the action of IL-2 could be very effective on cancer cells damaged by chemotherapy (Mitchell, 1992). IL-2 could be, indeed, the optimal cytokine to restore the cell-mediated immune function in cancer patients after successful chemotherapy.

Unfortunately the high toxicity of I.V. IL-2 prevents its universal adoption in this category of patients. However, this objective could be achieved by the subcutaneous administration of lower-dose IL-2, known to be active with a minor toxicity profile, not only in cancer patients (Lindemann et al, 1993), but also in HIV-immunodeficient patients (Davej et al, 1997).

Another class of biological agents, capable of enhancing IL-2 function are retinoids that share several synergistic effects with IL-2. In fact, retinoids boost both IL-2 receptors and T-helper cells and co-operate with IL-2 in augmenting IFN-" and IL-2 production by human peripheral mononocytes (Prabhala et al, 1991). IL-2 cultured with RA produces a synergistic increase in IFN-" production (4 to 90 fold), while anti-IL-2 antibodies abrogate this effect (Prabhala et al, 1991). Finally, retinoids inhibit the proliferation of various cell lines, inducing differentiation and apoptosis. We have previously reported that a 0.5 mg/Kg dose of 13-cisretinoic acid (RA) on a 5-day/week schedule was very well tolerated in patients with advanced non-small cell lung cancer (Recchia et al, 1999; Recchia et al, 2000). In a phase 1B study, associating IL-2 administered subcutaneously with RA administered orally for prolonged periods of time, we determined that the optimal biological dose (OBD) for a phase II study was 1.8 x 106 IU and 0.5 mg/Kg for 5 days/week respectively, for 2 cycles of 3 weeks/month, for up to 2 years (Recchia et al, 2001). This regimen was easily administered, well tolerated and improved both total lymphocyte count and CD4/CD8 ratio in patients with tumor response or stabilization after

standard chemotherapy. Moreover, it induced a complete response in 2/18 patients treated with long-term maintenance therapy. In a further phase II randomized study we have shown that the combination of IL-2 and RA could decrease, significantly, the VEGF in the same category of patients (Recchia et al, 2004b).

In an attempt to apply the aforementioned findings to clinical practice, we conducted a study in a selected group of 20 patients with MCC (Recchia et al, 2004c), with the objective to verify whether the combination of IL-2 and RA could improve the outcome of patients operated for colorectal cancer recurrence (8 liver, 12 pelvis ¨ peritoneum). Twenty patients with a median age of 66 years were entered into the study from September1998 to September 2001. Fifty-five percent of patients were males, performance status 0 in 65% of patients and 1 in the remaining 35%. Eight patients had synchronous metastases, while 12 patients had a median disease-free survival of 14 months and had received a 5-FU/LV based adjuvant chemotherapy. After curative resection of metastases patients were treated for 6 months with the fractionated FOLFOX regimen as previously described.

After chemotherapy patients received, subcutaneously, IL2, 1.8 x 106 I.U. plus RA 0.5 mg/Kg, orally, for 5 days/week for 2 consecutive cycles of 3 weeks, with a 1week rest, for 1 year.

This therapy was continued on alternate weeks for one more year. The third year the patients continued with an alternate schedule or as necessary according to the immune competence and to VEGF value. Patients were monitored every 2 months by determination of VEGF, CD4/CD8 ratio, NK and tumor markers. Responses were assessed every 4 months by the CT scan or MR scan. The toxicity of IL-2 and RA was low. With a combination of surgery and chemotherapy, a 75% response rate was obtained (95% C.I., 51%-91%). After a median follow-up of 20 months, there was an improvement of CD4/CD8, NK and a statistically significant decrease of VEGF (Figure 4), while median time to progression and overall survival were not reached yet (5-year survival rate 52%.

Compared with 40 patients well matched for all characteristics, IL-2 and RA therapy improved the DFS and overall survival after curative resection of metastases from colorectal cancer (Figure 5). A phase III randomized trial has been started.

IV. Discussion Despite the progress that has been made in the adjuvant treatment of colorectal cancer, approximately half of the patients develop metastatic disease (Boring et al, 1992). The low 5-year survival rate of patients with MCC, shows that this is a relatively chemo-resistant disease; in fact, both MDR1 and GSH S-transferase genes are hyper expressed in colorectal carcinoma cells (Shen et al, 1997). However, with a series of therapetical strategies it is possible to improve the clinical outcome of these patients.

221

Recchia et al: Strategies in advanced colorectal cancer L-OHP, LV and 5-FU being 92 %, 92%, and 94% respectively. These results are further supported by the fact that only 8% of cycles were delayed, the dose was reduced in only 5% and treatment was maintained over a considerable length of time with a median of 9 cycles administered (range 4-21).

One of the major toxicities encountered with the administration of L-OHP is neurotoxicity (Table 2).

Recent data indicate that L-OHP may act on specific isoforms of the voltage gated sodium (Na+) channel to increase the excitability of sensory neurons, an action inhibited by the Na+ channel blocker carbamazepine (Gamelin et al, 2002). In our studies (Recchia et al, 2003a, 2004a) grade 2 or 3 neurotoxicity was observed in 10% of patients. Such a low rate of neuropathy, as compared with the data in literature, was most likely due to the low daily dose of L-OHP and to the prior administration of 2400 mg of GSH, KCl (10 meq) and MgSO4 (4 meq). In fact, the mean cumulative dose of the L-OHP administered to each patient was 900 mg (range 400-1700). Moreover it has been demonstrated that the addition of GSH to the chemotherapy does not reduce the clinical activity of LOHP (Cascinu et al, 2002). All studies employing L-OHP in the treatment of advanced colorectal cancer have reported varying degrees of neurological toxicity with grade 3 toxicity increasing sharply with increasing L-OHP dosage. In 2 studies where the dose of L-OHP was 130 mg/m2, 89% of patients showed some form of neurological toxicity (Machover et al, 1996). In the study that lead to approval, in Europe, of L-OHP combined with LV and infusional 5-FU as first-line treatment of MCC, L-OHP was administered on day 1 at the dose of 85 mg/m2. Grade 1,2 or 3 neurological toxicity was observed in 68% of patients (de Gramont et al, 2000). Haematological toxicity was also reported; however, it reached grade 4 in only 16% of patients. Stomatitis and diarrhea were in the same range as that reported with other regimens, while severe nausea-vomiting occurred less frequently (4% of patients) as compared to CPT-11 based regimens. Grade 3 alopecia was reported in 29% of patients.

Recently published results of international studies have firmly established the role of a combination of LOHP with LV/5-FU regimen in the treatment of MCC. One study in particular has shown the superiority of the FOLFOX regimen compared both with the CPT-11/LV/5FU and the CPT-11/L-OHP regimens in terms of time to progression and overall survival, with a comparable toxicity profile (Goldberg et al, 2004). In this study, paresthesias grade 3 or greater, were observed in 18% of patients, whereas quality of life did not vary with respect to the three chemotherapy schedules. These data confirm that FOLFOX should be considered as a reference regimen in the first-line treatment of MCC. Considering the decreased toxicity profile with the fractionated administration of L-OHP, an activity comparable to that observed in other studies using standard regimens and an acceptable safety profile, the fractionated bimonthly L-OHP, 5-FU/LV may be considered as an attractive treatment for patients with MCC. In the adjuvant setting, the characteristics of the fractionated FOLFOX regimen are very appealing, due to

Figure 4. Vascular endothelial growth factor

Figure 5. Overall survival of FOLFOX alone versus FOLFOX plus interleukine-2 and 13-cis-retinoic acid

In fact, the overall response rate and overall survival, in the aforementioned studies has been progressively increasing. From a 32.6% of response rate and overall survival of 12.2 months for the pretreated MCC patients, we improved the response rate of 50% and an overall survival of 19.2 months for patients treated with FOLFOX in first-line chemotherapy (range 3.7-31.2+). For the entire cohort of 100 patients treated with all three drugs, the median survival was 22.5 months with a 5-year survival rate of 18% (Figure 3). The response rate was further increased to 69% in the protocol alternating FOLFOX and FOLFIRI regimens. In this study median disease-free survival and median overall survival have not been reached yet, after a median follow-up of 12 months. A major step forward was obtained for a selected group of 20 patients that presented with metastatic, resectable, colorectal carcinoma. In these patients after resection of metastases and chemotherapy, the biological therapy produced a prolonged disease-free survival and a 5-year overall survival of 52%. In this cohort of patients some immunological parameters were monitored. With respect to baseline values, there was a statistically significant improvement of CD4+/CD8+ ratio, NK and lymphocyte number and a statistically significant decrease of VEGF (Figure 4). Treatment compliance for this regimen was good, with the median relative dose-intensity delivered for 222

Cancer Therapy Vol 2, page 223 Table 2. Toxicity according to WHO criteria WHO grade 0 Hematologic Leucopenia Neutropenia Thrombocytopenia Anemia Infection Gastrointestinal Oral Nausea & vomiting Diarrhea Hepatic Neurotoxicity Renal Allergy Cutaneous Alopecia skin

1

No.

%

No.

%

No.

2 %

No.

3 %

No.

4 %

Total No. %

49 59 103 85 134

34 40 71 58 92

46 14 24 48 3

31 10 16 33 2

41 24 16 13 6

28 16 11 9 4

10 33 3 0 3

7 23 2 0 2

16 0 0 0

11 0 0 0

146 146 146 146

100 100 100 100

110 121 123 137 121 141 132

75 83 84 93 83 96 90

23 14 9 8 16 3 0

15 10 6 6 11 2 0

7 6 7 1 5 1 3

6 4 5 1 4 1 2

6 5 7 0 4 1 11

4 3 5 0 2 1 8

0 0 0 0 0 0 0 0

0 0 0 0 0 0 0 0

33 139

23 95

23 6

15 4

48 1

33 1

42 0

29 0

0 0

0 0

146 146 146 146 146 146 146 146 146 146 146

100 100 100 100 100 100 100 100 100 100 100

Cancer J Clin 42, 127-8.

Cantrell DA, Smith KA (1984) The interleukin-2 T cell system, a new cell growth model. Science 224, 1312-16.

Cascinu S, Catalano V, Cordella L, Labianca R, Giordani P, Baldelli AM, Beretta GD, Ubiali E, Catalano G (2002).

Neuroprotective effect of reduced glutathione on oxaliplatinbased chemotherapy in advanced colorectal cancer: a randomized, double-blind, placebo-controlled trial. J Clin Oncol 15, 3478-3483.

Caussanel JP, Levi F, Brienza S, Misset JL, Itzhaki M, Adam R, Milano G, Hecquet B, Mathe G. (1990) Phase I trial of 5days continuous venous infusion of oxaliplatin at circadian rhythm modulated rate compared with constant rate. J Natl Cancer Inst 82, 1046-1050.

Charak BS, Brynes RK, Katsuda S, Groshen S, Chen SC, Mazumder A (1991) Induction of graft versus leukemia effect in bone marrow transplantation, dosage and time schedule dependency of interleukin 2 therapy. Cancer Res. 51, 2015-20.

Davey R, Chaitt D, Piscitelli S, Wells M, Kovacs JA, Walker RE, Falloon J, Polis MA, Metcalf JA, Masur H, Fyfe G, Lane HC (1997) Subcutaneous administration of interleukin-2 in human immunodeficiency virus-type-1 infected persons. J Infect Dis 175, 781-789. de Gramont A, Banzi M, Navarro M, Tabernero J, Hickish T, Bridgewater J, Rivera F, Figer A, Fountzilas G, Andre T. (2003) Oxaliplatin/5FU/LV in adjuvant colon cancer, results of the international randomised MOSAIC trial. Proc Am Soc Clin Oncol; 22, 253, Abstract n.1015. de Gramont A, Bosset JF, Milan C, Rougier P, Bouche O, Etienne PL, Morvan F, Louvet C, Guillot T, Francois E, Bedenne L. (1997) Randomized trial comparing monthly low-dose leucovorin and fluorouracil bolus with bimonthly high dose leucovorin and fluorouracil bolus plus continuous infusion for advanced colorectal cancer, A French intergroup study. J Clin Oncol 15, 808-817. de Gramont A, Figer A, Seymour M, Homerin M, Hmissi A, Cassidy J, Boni C, Cortes-Funes H, Cervantes A, Freyer G, Papamichael D, Le Bail N, Louvet C, Hendler D, de Braud F, Wilson C, Morvan F, Bonetti A. (2000) Leucovorin and fluorouracil with or without oxaliplatin as firsty line treatment in advanced colorectal cancer. J Clin Oncol 18, 2938-2947.

Douillard JY, Cunningham D, Roth AD, Navarro M, James RD,

the fact that high neurological toxicity should not be tolerated in non-metastatic patients. In conclusion, a 3.5 month increase in overall survival of patients with MCC has been obtained from chemotherapy with 5FU/LV and L-OHP or CPT-11. Furthermore, a major step forward has been achieved in our trials with the use of biological response modifiers IL-2 and RA. One of the major factors responsible for the increase of disease-free survival and overall survival could be the statistically significant improvement of lymphocyte, NK and CD4+/CD8+ ratio.

In fact, a parallel increase in lymphocyte count and response has been described in patients with non-smallcell lung cancer (Lissoni et al, 1999). Moreover the statistically significant decrease of VEGF observed in our studies, could have had a role in the inhibition of the angiogenic switch. The strategies described in the chemotherapeutic regimens reported here have contributed to an overall improvement in the outcome of patients with MCC.

Acknowledgements The authors would like to thank Annette Pickford for reviewing the manuscript.

References No authors listed (1992) Advanced colorectal cancer metaanalysis project, Modulation of fluorouracil by leucovorin in patients with advanced colorectal cancer, Evidence in terms of response rate. J Clin Oncol 10, 896-903.

Belldegrun A, Shvarts O, Figlin RA (2000) Expanding the indications for surgery and adjuvant interleukin-2 based immunotherapy in patients with advanced renal cell carcinoma. Cancer J. Sci. Am. 6 (Suppl.1), S88-S92.

Black RJ, Bray F, Ferlay J and Parkin DM (1997) Cancer incidence and mortality in the European Union, Cancer registry data and estimates of national incidence for 1990.

Eur J Cancer 33, 1075-1077.

Bonadonna G, Robustelli della Cuna G (1999) Medicina Oncologica, Masson, 953.

Boring CC, Squires TS, Tong T (1992) Cancer statistics 1. CA.

223

Recchia et al: Strategies in advanced colorectal cancer Karasek P, Jandik P, Iveson T, Carmichael J, Alakl M, Gruia G, Awad L, Rougier P (2000) Irinotecan combined with fluorouracil compared with fluorouracil alone as first-line treatment for metastatic colorectal cancer: a multicentre randomised trial. Lancet 355, 1041-1047.

Extra JM, Marty M, Brienza S, Misset JL. (1998) Pharmakokinetics and safety profile of oxaliplatin. Semin Oncol 25, 13-22 (suppl 2).

Ferrara N, Gerber HP, LeCounter J. (2003) The biology of VEGF and its recepotors. Nat. Med. 9, 669-676.

Finke J, Ferrone S, Frey A et al. (1999) Where have all T cells gone? Mechanisms of immune evasion by tumors. Immunol Today 4, 158-160.

Fischel JL, Etiemme MC, Formento P, Milano G. (1998) Search for the optimal schedule for the oxaliplatin/5-fluorouracil association modulated or not by folinic acid, Preclinical data.

Clin Cancer Res 14, 2529-2535.

Fyfe G, Fisher RI, Rosenberg SA, Sznol M, Parkinson DR, Louie AC (1995) Results of treatment of 255 patients with metastatic renal cell carcinoma who received high-dose recombinant interleukin-2 therapy. J Clin Onc13, 688-696.

Gamelin E, Gamelin L, Bossi L, Quasthoff S. (2002) Clinical aspects and molecular basis of oxaliplatin neurotoxicity, current management and development of preventive measures. SeminOncol. (5 Suppl 15), 21-33.

Goldberg RM, Sargent DJ, Morton RF, Fuchs CS, Ramanathan RK, Williamson SK, Findlay BP, Pitot HC, Alberts SR. (2004) A randomized controlled trial of fluorouracil plus leucovorin , irinotecan, and oxaliplatin combinations in patients with previously untreated metastatic colorectal cancer. J Clin Oncol 22, 23-30.

Goldie JH, Coldman AJ. (1979) A mathematic model for relating the drug sensitivity of tumors to the spontaneous mutation rate. Cancer Treat Rep 63, 1727-1733.

Grothey A, Sargent D, Goldberg RM, Schmoll HJ. (2004) Survival of patients with advanced colorectal cancer improves with the availability of fluorouracil-leucovorin, irinotecan, and oxaliplatin in the course of treatment. J Clin Oncol 22, 1209-1214.

Hurwitz H, Fehrenbacher L, Novotny W, Cartwright T, Hainsworth J, Heim W, Berlin J, Baron A, Griffing S, Holmgren E, Ferrara N, Fyfe G, Rogers B, Ross R, Kabbinavar F. (2004) Bevacizumab plus irinotecan, fluorouracil, and leucovorin for metastatic colorectal cancer.

N Engl J Med. 350, 2335-2342.

Kaplan EL, Meier P (1958) Nonparametric estimation from incomplete observations. J Am Stat Ass 53, 457-481.

Keane MP, Belperio JA, Arenberg DA, Burdick MD, Xu ZJ, Xue YY, Strieter RM (1999) IFN-"-inducible protein-10 attenuates bleomycin-induced pulmonary fibrosis via inhibition of angiogenesis. J. Immunol. 163, 5686-92.

14,115-7.

Machover D, Diaz-Rubio E, De Gramont A, Schilf A, Gastiaburu JJ, Brienza S, Itzhaki M, Metgzer G, Nâ&#x20AC;&#x2122;Daw D, Vignoud J, Abad A, Francois E, Gameli E, Marty M, Sastre J, Seitz J-F, Ychou M (1996) Two consecutives phase II studies OF Oxaliplatin (L-OHP) for treatment of patients with advanced colorectal carcinoma who were resistant to previous treatment with fluoropyrimidines. Ann Oncol 7, 95-98.

Mackall CL, Fleisher TA, Brown MR, Magrath IT, Shad AT, Horowitz ME, Wexler LH, Adde MA, McClure LL, Gress RE (1994) Lymphocyte depletion during treatment with intensive chemotherapy for cancer. Blood 84, 2221-2228.

Mathe G, Reizenstein P (1986) Managing minimal residual malignant disease. Oncology 43, 137-42.

Miller AB, Hoogstraten B, Staquet M, and Winkler A (1981) Reporting results of cancer treatment. Cancer 47, 207-214.

Mitchell, M.S (1992) Principles of combining biomodulators with cytotoxic agents in vivo. Semin Oncol 19, 51-56.

Pavletic Z, Benyunes MC, Thompson JA, Lindgren CG, Massumoto C, Alderson MR, Buckner CD, Fefer A (1993) Induction by interleukin-7 of lymphokine-activated killer activity in lymphocytes from autologous and syngeneic marrow transplant recipients before and after systemic interleukin-2 therapy. Exp. Hematol. 21, 1371-8.

Prabhala RH, Garenwal HSS, Hicks MJ, Sampliner RE, Watson RR(1991) The effects of 13-cis-Retinoic acid and betacarotene on cellular immunity in humans. Cancer 67, 15561560.

Raymond E, Buquet-Fagot C, Djelloul S, Mester J, Cvitkovic E, Allain P, Louvet C, Gespach C (1997) Antitumor activity of oxaliplatin in combination with 5-fluorouracil and the thymydilate synthase inhibitor AG337 in human colon, breast, and ovarian cancer. Anticancer Drugs 8, 886-875.

Raymond E, Chaney SG, Taamma A, Cvitkovic E (1998) Oxaliplatin, a review of preclinical and clinical studies. Ann Oncol 9, 1053-1071.

Recchia F, Cesta A, Saggio G, Alesse P, Gallo R, Rea S (2004b) Interleukin-2 (IL-2) with 13-cis retinoic acid (RA) is more effective than IL-2 alone, as maintenance therapy in advanced cancer responsive to chemotherapy. Final result of a phase-II randomized trial. Proc Am Ass Cancer Res 45, 1082. Abstract #4684.

Recchia F, De Filippis S, Pompili P.L, Rosselli M, Saggio G, Ciorra A, Piccinini M, Rea S (1999) Carboplatin, vindesine, 5-fluorouracil- leucovorin and 13-cis retinoic acid in the treatment of advanced non-small cell lung cancer. A phase II study. Clin Ter 150, 269-74.

Recchia F, De Filippis S, Rosselli M, Saggio G, Cesta A, Fumagalli L, Rea S (2001) Phase IB study of subcutaneously administered Interleukin-2 in combination with 13-cis retinoic acid as maintenance therapy in advanced cancer.

Clin Cancer Res 7, 1251-1257.

Recchia F, De Filippis S, Saggio G, Cesta A, Amiconi G, Di Blasio A, Rea S (2004c) Interleukin-2 (IL-2) with 13-cis retinoic acid (RA) prolongs disease-free and overall survival in metastatic colorectal cancer. Proc Am Soc Clin Oncol 23, 276. Abstract #3629.

Recchia F, Nuzzo A, Lalli A, Di Lullo L, De Filippis S, Saggio G, Di Blasio A, Rea S (2003b) Multicenter Phase II Study of CPT-11 Fractionated over Two Days with Bimonthly Leucovorin and 5-Fluorouracil in Patients with Metastatic Colorectal Cancer. Anticancer Res 23, 2903-8.

Recchia F, Rea S, Nuzzo A, Lalli A, Di Lullo L, De Filippis S, Saggio , Di Blasio A, Massa E Mantovani G (2003a) Multicenter phase II study of fractionated bimonthly oxaliplatin with leucovorin and 5-fluorouracil in patients with metastatic colorectal cancer, pre-treated with chemotherapy. Oncol Rep 10, 65-69

Kim KJ, Li B, Winer J, Armanini M, Gillett N, Phillips HS, Ferrara N. (1993). Inhibition of vascular endothelial growth factor-induced angiogenesis suppresses tumour growth in vivo. Nature 362, 841-844.

Lavin PT, Bruckner HW, Plaxe SC (1982) Studies in prognostic factors relating to chemotherapy for advanced gastric cancer.

Cancer 50, 2016-2023.

Lindemann A, Brossart P, Hoffklen K, Flasshove M, Voliotis D, Diehl V, Hecker G, Wagner H, Mertelsmann R (1993) Immunomodulatory effects of ultra low dose IL-2 in cancer patients, a phase I B study. Cancer Immunol.Immunother.

37, 307-315.

Lissoni P, Fumagalli L, Paolorossi F, MandalĂ M (1999) Changes in lymphocyte number during cancer chemotherapy and their relation to clinical response.Int. J. Biol.Markers

224

Cancer Therapy Vol 2, page 225 Recchia F, Rea S, Nuzzo A, Lalli A, Di Lullo L, De Filippis S, Saggio G, Amiconi G, Massa E, Mantovani G. (2004a) Oxaliplatin fractionated over two days with bimonthly leucovorin and 5-fluorouracil in metastatic colorectal cancer.

Anticancer Res 24, In press.

Recchia F, Sica G, De Filippis S, Rosselli M, Saggio G, Guerriero G, Pompili P L, Rea S (2000) Cisplatin, vindesine, mitomycin-c and 13-cis retinoic acid in the treatment of advanced non-small cell lung cancer. A phase II pilot study.

Anticancer Res. 20, 1985-90.

Riesco A (1970) Five-year cancer cure, relation to total amount of peripheral lymphocytes and neutrophils. Cancer 25, 135140.

Saltz LB, Cox JV, Blanke C, Rosen LS, Fehrenbacher L, Moore MJ, Maroun JA, Ackland SP, Locker PK, Pirotta N, Elfring GL, Miller LL (2000) Irinotecan plus fluorouracil and

leucovorin for metastatic colorectal cancer , Irinotecan study group. N Engl J Med 343, 905-914.

Shen H, Kauvar L, Tew KD (1997) Importance of glutathione and associated enzymes in drug response. Oncol Res 9, 295.

Smith KA (1988) Interleukin-2, inception, impact and implications. Science 240, 1169-76.

Sobrero AF, Aschele C, Bertino JR (1997) Fluorouracin in colorectal cancer, A tale of two drugs- Implication for biomedical modulation. J Clin Oncol 15, 368-381.

Stanley KE (1980) Prognostic factors for survival in patients with inoperable lung cancer. J.Natl.Cancer Inst. 65, 25-32.

Wise JA, Mokyr MB, Dray S (1988) Effect of low-dose cyclophosphamide therapy on specific and nonspecific T cell-dependent immune responses of spleen cells from mice bearing large MOPC-315 plasmacytomas. Cancer Immunol Immunother 27, 191-7.

From left to right: dott. Giampiero Candeloro, dott. Gaetano Saggio, dott. Francesco Recchia, dott. Alisia Cesta

225

Recchia et al: Strategies in advanced colorectal cancer

226

Cancer Therapy Vol 2, page 227 Cancer Therapy Vol 2, 227-238, 2004

AKT: A novel target in pancreatic cancer therapy Review Article

Melinda M. Mortenson, Joseph M. Galante, Michael G. Schlieman, Richard J. Bold* Department of Surgery, University of California Davis Medical Center, Sacramento, CA

__________________________________________________________________________________ *Correspondence: Richard Bold, MD, Division of Surgical Oncology, Suite 3010, Davis Cancer Center, 4501 X Street, Sacramento, CA 95817; Phone: (916) 734-5907; FAX: (916) 731-5706; E-mail: richard.bold@ucdmc.ucdavis.edu Key words: pancreatic cancer therapy, Protein kinase B, PI3-kinase/AKT pathway, K-ras, Growth factor receptors, HER-2/neu, Downstream effectors of AKT, IKK/NF-!B, PTEN, mTOR, cFLIP, cell cycle regulation, Apoptosis, Chemosensitization Abbreviations: carboxyl-terminal modulator protein, (CTMP); cyclin dependent kinase, (CDK); FLICE-inhibitory protein, (cFLIP); insulin like growth factor receptor, (IGF-R); phosphatase and tensin homologue deleted on chromosome ten, (PTEN); phosphatidylinositol-3 kinase, (PI3K); phosphorylated, (activated) AKT, (pAKT); proliferating cell nuclear antigen, (PCNA); retinoblastoma protein, (Rb); SH2 containing phosphatases, (SHIPs); vascular endothelial growth factor receptor, (VEGF-R) Received: 1 July 2004; Accepted: 12 July 2004; electronically published: July 2004

Summary The serine/threonine kinase AKT (also known as Protein Kinase B) has been shown to mediate a potent survival signal in normal cells. There is increasing evidence of constitutive activation of AKT by various upstream signals in diverse cancer which confers the same survival signal but with the cellular consequence of resistance to the apoptotic effects of chemo- and radiotherapy. Given the lack of effective treatment for pancreatic cancer, new targets of therapy are desperately needed if any impact on this lethal malignancy is to be made. We review the signaling cascade of AKT (both upstream activators and downstream effectors) and the cellular consequences of AKT activation in pancreatic cancer. We further discuss the early experimental evidence that supports the concept that AKT is an appropriate molecular target for therapy in pancreatic cancer. of the histological and genetic progression of pancreatic ductal adenocarcinoma has been developed (Sohn and Yeo, 2000; Bardeesy and DePinho, 2002; Schneider and Schmid, 2003) which may provide the background for the development of targeted therapy (Wolff, 2002; Gunzburg et al, 2003; Westphal and Kalthoff, 2003). Activating Kras and HER-2/neu mutations occur early, followed by loss of p16 expression, and then later, inactivation of p53 and DPC4 (Hruban et al, 2001; Hansel et al, 2003). Each of these genetic defects has been shown to be involved in the biology of pancreatic cancer; however, targeting these events has been difficult. Ongoing research may identify additional genetic defects for which targeted therapy is effective.

I. Introduction Pancreatic adenocarcinoma is the fourth leading cause of cancer-related death in the United States today (Jemal et al, 2004). The diagnosis of pancreatic cancer carries a poor prognosis with a mean 5-year survival of only 3% (Bardeesy and DePinho, 2002) and a median survival of 5 months (Sakorafas and Tsiotou, 1999).

Because of a lack of early symptoms, less than 20% of patients present with resectable disease and even then, the 5-year survival is a dismal 20% (Ahrendt and Pitt, 2002).

Few effective treatment options are available when surgical resection is not possible. Gemcitabine is one of the few chemotherapeutic agents with any activity against pancreatic cancer and has become the standard of care, however, it only prolongs survival to 6-7 months with a response rate of 10% (Heineman, 2002). Ongoing clinical trials of gemcitabine in combination with other chemotherapeutics await analysis, but dramatic advances are unlikely (Heineman, 2002). Clearly, innovative treatment options are needed to make any progress in this lethal malignancy.

The understanding of the molecular biology of pancreatic cancer is rapidly expanding and hopefully can be utilized to develop better treatment strategies. A model

II. AKT (Protein kinase B) AKT (also known as protein kinase B) is a serine/threonine kinase involved in the regulation of cell proliferation, survival/apoptosis, angiogenesis, metabolism, and protein synthesis (Chang et al, 2003a; Luo et al, 2003; Fresno et al, 2004). Just in the last several years, there has been the consistent observation that activation of AKT is frequent among various types of cancer, initiating a potent survival/anti-apoptotic signal 227

Martenson et al: AKT as a novel target in pancreatic cancer therapy (Sun et al, 2001). The first evidence supporting the role of AKT in cancer came with the isolation of v-AKT from the AKT8 retrovirus associated with a spontaneous T-cell lymphoma in a mouse model (Staal and Hartley, 1988; Bellacosa et al, 1991). Unlike other oncogenes, however, overexpression does not transform NIH3T3 cells; constitutive activation is required (Sun et al, 2001). Three separate subtypes of AKT have since been isolated (AKT1, AKT2 and AKT3) (Nicholson and Anderson, 2002). All three isoforms are ubiquitously expressed with AKT1 being the dominant isoform except in insulinresponsive tissues. AKT1 knockout mice are viable but smaller than wild-type littermates with increased apoptosis in various tissues (Chen et al, 2001; Peng et al, 2003).

AKT2 knockout mice are also viable though insulinresistant and prone to diabetes (Garofalo et al, 2003). The majority of research on AKT in cancer has focused on AKT1, which appears to be the primary mediator of the anti-apoptotic signal (Aoki et al, 1998).

The development of phospho-specific antibodies allows for determining whether a specific kinase is in the activated state. We have established a tumor bank of pancreatic adenocarcinomas and examined 78 tumor specimens for the presence of phosphorylated (activated) AKT (pAKT) (Schlieman et al, 2003). This heterogeneous group of tumors represented a mix of localized/resected tumors (N=35; 45%) and metastatic tumors (N=43; 55%).

Of these 78 tumor specimens, 46 (59%) demonstrated activation of AKT by virtue of immunohistochemical staining for pAKT (Figure 1). Histologic grading demonstrated that almost one-half of tumors were moderately well differentiated, one-fifth was well differentiated and one-third was poorly differentiated.

AKT activation correlated with histologic grade in that AKT was activated in 76% of the poorly differentiated tumors but only 38% of the well-differentiated tumors.

This correlation suggests the involvement of AKT in more aggressive tumors as histologic grade remains one of the most significant prognostic variables in this cancer (Takahashi et al, 1997; Kedra et al, 2001). Our data demonstrate that AKT is activated in almost 60% of pancreatic adenocarcinoma tumors, placing it near the top of tumors that have been reported to harbor AKT activation.

These observations have been recently corroborated in 61 patients who had undergone curative resection of pancreatic adenocarcinoma (Yamamoto et al, 2004).

Using the same immunohistochemical technique for detection of activated AKT by virtue of pAKT staining, 46% of the tumors demonstrated constitutive activation of AKT. Given that this group of patients was homogeneous, survival analysis was performed and demonstrated a significant correlation between activation of AKT and poorer survival. The 5-year survival rate was only 16.4 months for patients whose tumors demonstrated activation of AKT, but 50.6 months for patients whose tumors did not demonstrate activated AKT. The presence of activated AKT maintained its prognostic significance in a multivariate analysis suggesting a central role of AKT activation in the biology of pancreatic cancer.

III. Upstream regulators of PI3kinase/AKT pathway One of the main activators of AKT is phosphatidylinositol-3 kinase (PI3K). PI3K is activated by multiple upstream receptor tyrosine kinases and G-protein coupled receptors in response to a variety of growth stimuli (Chang et al, 2003b; Luo et al, 2003). PI3K activates AKT by generating phosphatidylinositol-3,4,5triphosphate (PIP-3), which mediates translocation of AKT to the cell membrane (Figure 2). AKT is subsequently activated by phosphorylation on Thr308 by PDK1 (Vanhaesebroeck et al, 2000; Wick et al, 2000; Brazil et al, 2002). In addition, maximal activation of AKT requires a second phosphorylation at Ser473 by PDK2 (Chan and Tsichlis, 2001; Nicholson et al, 2002).

The activity of AKT is further regulated by PTEN (phosphatase and tensin homologue deleted on

Figure 1. Representative immunohistochemical staining for phospho-AKT in pancreatic tumors. (A) tumor without detectable expression, (B) tumor with strong expression of phospho-AKT consistent with activation of AKT. Normal pancreatic ducts do not have detectable phospho-AKT (x40, original magnification).

228

Cancer Therapy Vol 2, page 229

Figure 2. A primary mechanism of AKT activation is by phosphatidylinositol-3 kinase (PI3K). PI3K, a heterodimer of a p85 regulatory subunit and a p110 catalytic subunit, can be activated by various receptor tyrosine kinases or G protein-coupled receptors. PI3K phosphorylates phosphatidylinositol-4, 5-diphosphate (PIP-2) to generate phosphatidylinositol-3,4,5-triphosphate (PIP-3), which binds to the pleckstrin homology domain of AKT, allowing for subsequent phosphorylation by PDK1 and/or PDK2. Negative regulation of AKT involves dephosphorylation of PIP-3 to PIP-2 by PTEN, disrupting the PDK1/PDK2 interaction.

chromosome ten). PTEN essentially functions as a tumor suppressor by dephosphorylating PIP-3, therefore blocking activation of AKT (Chan and Tsichlis, 2001). Mutations or deletions of PTEN (such as in glioblastome multiforme or prostate cancer) lead to constitutively activated AKT (Davies et al, 1998, 1999). Other negative regulators of AKT include SH2 containing phosphatases (SHIPs), phosphatases effective against PI3K, and carboxylterminal modulator protein (CTMP), a negative regulator of AKT at the plasma membrane (Chang et al, 2003b).

B. Growth factor receptors Among the many receptor tyrosine kinases capable of activating AKT, several have been shown to play a role in pancreatic cancer; these include the vascular endothelial growth factor receptor (VEGF-R), insulin like growth factor receptor (IGF-R), and c-erb2 (HER-2/neu). VEGF, a multifunctional protein involved in tumor angiogenesis and metastases, has been strongly implicated in the aggressive behavior of pancreatic cancer (Itakura et al, 1997; a Itakura et al, 2000). Pancreatic tumors overexpress both VEGF and VEGF-R compared to normal pancreatic exocrine tissue. VEGF signals through AKT to maintain cell viability of endothelial cells and perhaps tumor cells (Larrivee and Karsan, 2000; Lie et al, 2000; Kliche and Waltenberger, 2001). Inhibition of VEGF receptors both in vitro and in xenograft models of pancreatic cancer decreased AKT activation, increased apoptosis and decreased tumor growth (Solorzano et al, 2001; Hoshida et al, 2002; Tseng et al, 2002; Buchler et al, 2003a).

Another receptor tyrosine kinase that has been selectively targeted in pancreatic cancer is the IGF1-R. Overexpression of IGF1-R confers resistance to apoptosis and increases invasiveness and metastatic capacity in pancreatic cancer cell lines (Bergmann et al, 1995; Min et al, 2003). Inhibition of IGF1-R decreases AKT activity, increases apoptosis in vitro and decreases tumorigenicity in vivo. Inhibition of IGF1-R is associated with a decrease in activated AKT, suggesting that AKT is involved in the downstream signaling of IGF1-R. Interestingly, overexpression of IGF1-R is dependent on AKT activation. This represents an interesting autocrine pathway in which AKT activation increases IGF1-R levels, which then further activates AKT and the coupled downstream pathways (Knuefermann et al, 2003).

A. K-ras The ras gene family consists of GTPases, which translate extracellular signals from membrane coupled receptors into intracellular signal transduction pathways.

Mutation of the K-ras gene is one of the earliest and most frequent genetic events observed in pancreatic cancer, occurring in over 95% of tumors (Hirai et al, 1995; Sakorafas et al, 2000; Ren et al, 2004). Mutation leads to constitutive activation with subsequent stimulation of downstream signal transduction pathways regulating cellular survival, proliferation, and invasion (Ellis and Clark, 1997; Katz and McCormick, 1997). Of the many effector pathways, the PI3K/AKT pathway has been implicated as a major mediator of constitutive ras activation, conferring various phenotypic consequences such as protection from anoikis and c-myc induced apoptosis (Kauffmann-Zeh et al, 1997; Khwaja et al, 1997; Downward et al, 1998; Shields et al, 2000). Inhibition of PI3K blocks cells from ras induced transformation, supporting the importance of PI3K/AKT pathway as a downstream effector of the survival signal of ras activation (Rodriguez-Viciana et al, 1997; Krasilnikov, 2000; Shao et al, 2004; Sheng et al, 2004).

C. HER-2/neu

229

Martenson et al: AKT as a novel target in pancreatic cancer therapy The HER-2/neu oncogene is a member of the ErbB family of receptor tyrosine kinases. Multiple studies have shown that HER-2/neu is an upstream activator of the AKT pathway (Zhou et al, 2000, 2001a; Clark et al, 2002; Yakes et al, 2002). For example, in HER-2/neu overexpressing breast cancer cell lines, AKT is constitutively active in vitro (Zhou et al, 2000). In addition, the chemoresistance demonstrated in HER-2/neu overexpressing breast cancer cells has been linked to increased AKT activity (Clark et al, 2002; Knuefermann et al, 2003). In pancreatic cancer, HER-2/neu overexpression has been reported to vary between 7-82% (Hall et al, 1990; Williams et al, 1991; Yamanaka et al, 1993; Lei et al, 1995; Day et al, 1996; Dergham et al, 1997a; Dugan et al, 1997; Apple et al, 1999; Safran et al, 2001). The relationship between overexpression of HER-2/neu and activated AKT in pancreatic cancer has been studied in our laboratory. Of 78 human pancreatic tumor specimens examined, HER-2/neu was overexpressed in 67% of tumors and correlated with AKT activation (Schlieman et al, 2003). We furthermore demonstrated coupling of HER2/neu overexpression to AKT activation using the MiaPaCa-2 cell line, which has high levels of HER-2/neu. In vitro inhibition of HER-2/neu with the blocking monoclonal antibody trastuzamab (HerceptinR) decreased the degree of AKT activation.

Buchler et al. evaluated the cellular effect of trastuzamab treatment on several pancreatic cancer cell lines and noted growth inhibition in vitro in all cell lines that overexpressed HER-2/neu (Buchler et al, 2001).

Tumor growth in vivo was similarly inhibited by trastuzamab treatment in the HER-2/neu overexpressing MIA-PaCa-2 cell line. Interestingly, we found this cell line to harbor the highest level of HER-2/neu overexpression as well as the greatest degree of AKT activation among 7 pancreatic cancer cell lines examined. The experimental observations of the potential significance of HER-2/neu in pancreatic cancer have led to clinical trials of trastuzamab alone or in combination with gemcitabine (Jacobs, 2002; Wolff, 2002). Preliminary data is promising in the subset of pancreatic cancer patients whose tumors overexpress HER-2/neu.

significant epigenetic cause of AKT activation in pancreatic cancer.

IV. Downstream effectors of AKT There are multiple downstream signaling pathways that have been coupled to AKT (Figure 3). These include transcription factors (e.g. NF-!B, forkhead/AFX, CREB and p53), mediators of apoptosis (e.g. bad and caspase 9), cell cycle regulators (e.g. p21, p27, mTOR and cyclin D1), and proteins involved in metabolism (i.e. GSK-3) (Franke et al, 2003). It remains unclear which of these mediate the various phenotypic consequences of AKT activation in cancer. A discussion of all the downstream signaling pathways regulated by AKT is beyond the scope of the current review; therefore only those downstream pathways that have been reported to have significance in pancreatic cancer will be discussed.

A. IKK/NF-!B NF-!B represents a group of transcription factors composed of p65 (relA), p50, p52, relB, and c-rel, which function as homo- and heterodimers. NF-!B transcriptionally regulates diverse genes including c-IAP1, c-IAP-2, c-FLIP, Bcl-2, A1/bfl-1, cyclin D, p21, VEGF, and p53 with the end result of prosurvival signaling (Stehlik et al, 1998; Guttridge et al, 1999; Wang et al, 1999, 2003; Benoit et al, 2000; Kurland et al, 2001; Micheau et al, 2001; Basile et al, 2003; Tergaonkar et al, 2003; Xiong et al, 2004). The transcriptional activity of NF-!B is initiated by nuclear translocation following release from the inhibitory protein I!B-#. Phosphorylation of I!B-# by IKK is one AKT-dependent mechanism responsible for the activation of NF-!B (Madrid et al, 2001), though it is increasingly clear that there may be additional AKT-independent mechanisms of activation of NF-!B (Pianetti et al, 2001). NF-!B has been shown to have important biologic consequences in pancreatic cancer and may be an important biochemical sequelae of AKT activation (Gilmore, 1999; Madrid et al, 2000; Mayo and Baldwin, 2000). NF-!B is constitutively activated in the majority of pancreatic tumors through a PI3K-dependent activation of IKK (Wang et al, 1999; Liptay et al, 2003; Arlt et al, 2003).

Of the various downstream targets of NF-!B, one of the more relevant in pancreatic cancer is the antiapoptotic protein bcl-2 (Fahy et al, 2003; Fujioka et al, 2003). The bcl-2 family consists of both proapoptotic (bax, bak) and antiapoptotic (bcl-2, bcl-X L) members which are critical in the regulation of induction of apoptosis through interactions at the mitochondrial membrane with subsequent effects on the release of cytochrome c (Tsujimoto and Shimizu, 2000; Reed, 1997). If the relative balance of antiapoptotic members predominates, the apoptotic threshold is raised and cells fail to undergo apoptosis even in the presence of powerful apoptotic signals.

D. PTEN PTEN mutations or deletions do not appear to be a major factor in the activation of AKT observed in pancreatic cancer (Sakurada et al, 1997; Okami et al, 1998; Matsumoto et al, 2002). However, the function of PTEN can be inhibited, with subsequent activation of the PI3K/AKT pathway. TGF-" has been recently shown to reduce transcription of PTEN (Li et al, 1997).

Overexpression of TGF-" is common in pancreatic cancer and has been associated with a poorer prognosis (Friess et al, 1993). Whether this is causally related to the reduction of PTEN levels, and therefore indirectly activates AKT remains unclear. Immunohistochemical analysis of pancreatic tumors has correlated high levels of TGF-" with low levels of PTEN (Ebert et al, 2002). Therefore, the genetic defects in the TGF-" signaling pathway may be a

230

Cancer Therapy Vol 2, page 231

Figure 3. Downstream effectors of AKT include regulators of apoptosis (e.g. bad, caspase 9. c-FLIP), gene transcription (NF-!B through IKK, FKHD, and HIF-1# through mTOR), cell cycle progression (p53 through MDM2, p27 and RB through mTOR).

Representative genes regulated by transcription factors activated by AKT are shown.

Preliminary data in pancreatic cancer specimens demonstrate elevated levels of HIF-1# mRNA and HIF-1# protein by IHC (Zhong et al, 1999; Buchler et al, 2003b; Kuwahara et al, 2004). Furthermore, overexpression of HIF-1# correlates with advanced tumor stage and poorer survival (Shibaji et al, 2003). Thus, the activation of AKT through upstream effectors may have an effect on HIF-1# and subsequently VEGF through mTOR leading to a more metastatic phenotype. Inhibitors of mTOR (e.g. rapamycin, CC1-779 and RAD001) have shown activity against a broad range of human cancers both in vitro and xenograft models including pancreatic (Shah et al, 2001a; Huang and Houghton, 2003; Xu et al, 2004; Boulay et al, 2004). Therefore, inhibition of the AKT/mTOR pathway may be another mechanism to target tumor angiogenesis, and achieve similar efficacy to that observed in experimental models that have inhibited VEGF (Hoshida et al, 2002; Buchler et al, 2003; Parikh et al, 2003; Solorzano et al, 2003).

We and others have shown that bcl-2 is frequently overexpressed in pancreatic tumors (Bold et al, 1999a; Campani et al, 2001), and this overexpression correlates with resistance to the cytotoxic effects of gemcitabine (Bold et al, 1999b; Shi et al, 2002). We have also shown that the PI3K/AKT/NF-!B pathway is a central mediator of the bcl-2 overexpression in pancreatic cancer (Fahy et al, 2003).

B. mTOR Another downstream effector of AKT is mammalian target of rapamycin (mTOR), a serine/threonine kinase that is directly phosphorylated by AKT (Nave et al, 1999; Sekulic et al, 2000). The substrates of mTOR are involved in regulation of gene transcription and cell cycle progression. These targets include the 40S ribosomal protein S6 kinase (p70s6k), cyclin D1/A, the cyclin dependent kinase (CDK) inhibitors p21 and p27, and the retinoblastoma protein (Rb) (Huang and Houghton, 2003; Abraham, 2004). Pancreatic cancers have been shown to have increased mTOR activity (Xu et al, 2004) and inhibition with rapamycin is sufficient to sensitize tumors to the apoptotic effect of gemcitabine (Grewe et al, 1999; Shah et al, 2001a).

An important target of mTOR is the transcription factor hypoxia-inducible factor, HIF-1# (Hudson et al, 2002). HIF-1# is responsible for activating transcription of multiple genes, such as VEGF, which are involved in neovascularization and metastasis (Semenza, 2002).

C. cFLIP FLICE-inhibitory protein (cFLIP) is a caspase-8 homologue that inhibits the death receptor pathway of apoptosis (Wajant, 2003). The expression of cFLIP has been shown to be regulated by PI3K/AKT pathway in several solid tumors (Panka et al, 2001); inhibition of AKT decreases cFLIP protein levels and increases sensitivity to apoptosis. The AKT-dependent regulation of cFLIP levels may be through the FKHR-L1 transcription factor, though the specific details remain unknown (Skurk

231

Martenson et al: AKT as a novel target in pancreatic cancer therapy et al, 2004). Elnemr et al, found that despite Fas receptor expression, the Fas pathway of death receptor-induced apoptosis was not functional in pancreatic cancer (Elnemr et al, 2001). This may be due to concomitant overexpression of c-FLIP, which would block the effects of the Fas-FasL signaling (Ungefroren et al, 1998).

Therefore, inhibition of the AKT pathway in pancreatic cancer may reduce cFLIP levels, and allow death receptor mediated apoptosis. It has already been demonstrated that inhibition of NF-!B in pancreatic cancer cells decreases cFLIP levels and sensitizes cells to death receptor mediated apoptosis (Thomas et al, 2002).

G1-S phase of the cell cycle in response to mitogenic stimuli (Chang et al, 2003b). Whether p21 is a significant effector of AKT activation in pancreatic cancer is not completely clear, directly targeting p21 in pancreatic cancer has demonstrated efficacy (Shah et al, 2001b) AKT also phosphorylates p27, another CDK inhibitor, which may function as a putative tumor suppressor. Cancers with low p27 levels demonstrate more aggressive behavior when compared to tumors will normal p27 levels (Sgambato et al, 2000). Phosphorylation of p27

by AKT causes cytoplasmic retention and loss of its inhibitory actions against Cdk-2 (Viglietto et al, 2002).

Furthermore, through its actions on the Forkhead family of transcription factors, AKT indirectly decreases levels of p27 (Chandramohan et al, 2004). Immunohistochemical studies in pancreatic cancer have found decreased levels of p27, which may have prognostic significance (Feakins and Ghaffar, 2003; Juuti et al, 2003).

V. AKT and cell cycle regulation AKT can contribute to uncontrolled cellular division through effects on cell cycle progression with direct and indirect effects on p21, p27 and cyclin D (Figure 4). An important CDK inhibitor involved in regulation of the cell cycle is p21, which has been shown to both inhibit cell cycle progression and DNA synthesis as well as be a mediator of cell survival (Li et al, 2002). Elevated p21 is seen in a variety of tumors including pancreatic and has been correlated with chemoresistance (Dergham et al, 1997b; Li et al, 2002; Moller et al, 2002). AKT directly phosphorylates p21 with the overall consequence of promoting cell survival (Zhou et al, 2001b). First, phosphorylation at Thr145 disrupts binding of p21 with proliferating cell nuclear antigen (PCNA) allowing PCNA to complex with DNA polymerase allowing DNA synthesis (Rossig et al, 2001). This phosphorylation causes p21 to exit the nucleus and become retained in the cytoplasm (Zhou et al, 2001b) where it forms antiapoptotic complexes. Second, phosphorylated p21 is able to activate cyclin D1-CDK4 that allows for progression through the

VI. Cellular inhibition of AKT

effects

following

Current experimental methods of inhibition of AKT primarily utilize inhibition of the upstream activator, PI3K. Two commercially available PI3K inhibitors are wortmannin, a fungal metabolite that binds to the p110 subunit of PI3K, and LY294002, a reversible small molecule inhibitor. Both have been demonstrated to decrease activation of AKT in vitro and in vivo (Powis et al, 1994; Cuenda and Alessi, 2000; Stein, 2001; Matsumoto et al, 2002). Furthermore, these agents inhibit tumor growth and induce apoptosis in multiple tumor models of pancreatic cancer (Ng et al, 2000, 2001; Perugini et al, 2000; Shah et al, 2001c; Bondar et al, 2002;

Figure 4. Activated AKT promotes cell cycle progression through multiple mechanims, including direct phosphorylation of p21 which leads to release of PCNA with subsequent activation of DNA polymerase. Phosphorylation of another cdk inhibitor, p27, sequesters it in the cytoplasm thereby eliminating the inhibitory binding to CDK2. Cyclin D1 is further an indirect target of AKT through GSK-3 as well as FKHD-mediated transcription, both of which lead to increased cyclin D levels which then bind to CDK4/6 leading to G1 progression.

232

Cancer Therapy Vol 2, page 233 Yao et al, 2002; Fahy et al, 2003; Semba et al, 2003; YipSchneider et al, 2003; Takeda et al, 2004).

Unfortunately,secondary to issues with toxicity as well as effective drug delivery, neither wortmannin nor LY294002 is currently suitable for use in clinical trials (West et al, 2002; Fresno et al, 2004). Other inhibitors of either PI3K or AKT directly are under development and preliminary data has shown acceptable toxicity in preclinical testing (Castillo et al, 2004).

is transfected into normal epithelial cells, there is a marked resistance to anoikis (Khwaja et al, 1997; Yu et al, 2001).

In pancreatic cancer, many cell lines appear resistant to anoikis, which may be secondary to AKT activation (unpublished observations).

VII. Conclusions Cancer arises out of a field of disturbed apoptotic regulation and/or uncontrolled proliferation. Through its myriad effects on proteins involved in cell proliferation, apoptosis and cell cycle, AKT certainly contributes to tumorigenesis in many tumor types and is important in the pathogenesis of pancreatic cancers. Targeted inhibition of AKT shows promise given its central position in cell survival signaling through diverse downstream pathways.

Unfortunately, there is a lack of specific and tolerable inhibitors of the AKT pathway. Currently, small molecule inhibitors are under investigation, however, none are currently in clinical use. Targeted therapy of the AKT pathway may be an important novel target in the future treatment of pancreatic cancer.

A. Apoptosis Inhibition of the PI3K/AKT pathway is sufficient to induce apoptosis in diverse tumor cell lines. However, PI3K/AKT inhibition is not effective in cell lines that have low levels of AKT or in normal cell lines (Jetzt et al, 2003). In pancreatic cancer, Bondar et al. observed apoptosis induced by both LY294002 and wortmannin in six of seven cell lines that displayed constitutive AKT activation but not in the two cell lines that did not (Bondar et al, 2002). Therefore, it appears that increased levels of phosphorylated AKT may be a requirement for effective use of PI3-kinase/AKT targeted therapies. This may be advantageous in terms of protecting non-neoplastic cells from effects of these therapies.

References Abraham RT (2004) mTOR as a positive regulator of tumor cell responses to hypoxia. Curr Topics Microbiol Immunol 279, 299-319.

Ahrendt SA, Pitt HA (2002) Surgical management of pancreatic cancer. Oncology 16, 725-34.

Aoki M, Batista O, Bellacosa A, Tsichlis P, Vogt PK (1998) The akt kinase: molecular determinants of oncogenicity. Proc Natl Acad Sci U S A 95, 14950-5.

Apple SK, Hecht JR, Lewin DN, Jahromi SA (1999) Immunohistochemical evaluation of K-ras, p53, and HER2/neu expression in hyperplastic, dysplastic and carcinomatous lesions of the pancreas: Evidence for multistep carcinogenesis. Human Path 30, 123-29.

Arlt A, Gehrz A, Muerkoster S, Vorndamm J, Kruse ML, Folsch UR, Schafer H (2003) Role of NF-kB and Akt/PI3K in the resistance of pancreatic carcinoma cell lines against gemcitabine-induced cell death. Oncogene 22, 32433251.Bardeesy N, DePinho RA (2002) Pancreatic cancer biology and genetics. Nature 2, 897-909.

Basile JR, Eichten A, Zacny V, Munger K (2003) NF-!Bmediated induction of p21(Cip1/Waf1) by tumor necrosis factor # induces growth arrest and cytoprotection in normal human keratinocytes. Mol Cancer Res 1, 262-70.

Bellacosa A, Testa JR, Staal SP, Tsichlis PN (1991) A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region. Science 254, 274-7.

Benoit V, Hellin AC, Huygen S, Gielen J, Bours V, Merville MP (2000) Additive effect between NF-!B subunits and p53 protein for transcriptional activation of human p53 promoter.

Oncogene 19, 4787-94 Bergmann U, Funatomi H, Yokoyama M, Beger HG, Korc M (1995) Insulin-like growth factor I overexpression in human pancreatic cancer: evidence for autocrine and paracrine roles.

Cancer Res 55, 2007-11.

Bold RJ, Chandra J, McConkey DJ (1999a) Gemcitabineinduced programmed cell death (apoptosis) of human pancreatic carcinoma is determined by Bcl-2 content. Ann Surg Oncol 6, 279-85.

Bold RJ, Hess KR, Pearson AS, Grau AM, Sinicrope FA, Jennings M, McConkey DJ, Bucana CD, Cleary KR, Hallin PA, Chiao PJ, Abbruzzese JL, Evans DB (1999b) Prognostic

B. Chemosensitization It is now fairly well established that some, if not all, of the cytotoxic effect of traditional chemo- and radiotherapy is through the initiation of endogenous apoptotic pathways. However, these agents also activate potent survival pathways, including PI3K/AKT, that can lead to chemoresistance (West et al, 2002). Perhaps one of the most dramatic results we have observed is chemosensitization in pancreatic cancer. Gemcitabine induces very little apoptosis but addition of LY294002 or dominant negative AKT combined with gemcitabine substantially increases the fraction of cells undergoing apoptosis, thereby converting gemcitabine into a potent apoptotic agent (Ng et al, 2001; Fahy et al, 2003; Fahy et al, 2004). We have further demonstrated the correlation of AKT-dependent chemoresistance with NF-!B dependent activation of bcl-2 transcription (Fahy et al, 2004).

C. Metastasis Increased metastatic potential in pancreatic cancer has been correlated with both NF-!B and VEGF, both of which are targets of AKT. It has been observed that AKT may be linked to the development of metastasis through a variety of mechanisms. Tanno et al, activated AKT through a src pathway which led to an upregulation of IGF-IR expression in pancreatic cancer cell lines conferring higher invasive potential than control cell lines (Tanno et al, 2001). AKT activation may be important in preventing anoikis, a specific type of apoptosis resulting from loss of cell-cell or cell-cell matrix interaction that normally prevents cell survival in a site distant from its primary organ. Idogawa et al, demonstrated that AKT has the ability to induce resistance to anoikis through modulation of bcl-2 family members, I!B#, and caspase 9 (Idogawa et al, 2003). When constitutively activated AKT

233

Martenson et al: AKT as a novel target in pancreatic cancer therapy factors in resectable pancreatic cancer: p53 and bcl-2. J Gastrointest Surg 3, 263-77.

Bondar VM, Sweeney-Gotsch B, Andreeff M, Mills GB, McConkey DJ (2002) Inhibition of the phosphatidylinositol 3'-kinase-AKT pathway induces apoptosis in pancreatic carcinoma cells in vitro and in vivo. Mol Cancer Ther 1, 989-97.

Boulay A, Zumstein-Mecker S, Stephan C, Beuvink I, Zilbermann F, Haller R, Tobler S, Heusser C, O'Reilly T, Stolz B, Marti A, Thomas G, Lane HA (2004) Antitumor efficacy of intermittent treatment schedules with the rapamycin derivative RAD001 correlates with prolonged inactivation of ribosomal protein S6 kinase 1 in peripheral blood mononuclear cells. Cancer Res 64, 252-61.Brazil DP, Park J, Hemmings BA (2002) PKB binding proteins. Getting in on the Akt. Cell 111, 293-303.

Buchler P, Reber HA, Buchler M, Shrinkante S, Buchler MW, Friess H, Semenza G, Hines OJ (2003b) Hypoxia-inducible factor 1 regulates vascular endothelial growth factor expression in human pancreatic cancer. Pancreas 26, 56-64.

Buchler P, Reber HA, Buchler MC, Roth MA, Buchler MW, Friess H, Isachoff WH, Hines OJ (2001) Therapy for pancreatic cancer with a recombinant humanized anti-HER-2 antibody (Herceptin). J Gastrointest Surg 5, 139-146.

Buchler P, Reber HA, Ullrich A, Shiroiki M, Roth M, Buchler MW, Lavey RS, Friess H, Hines OJ (2003a) Pancreatic cancer growth is inhibited by blockade of VEGF-RII. Surgery 134, 772-82.

Campani D, Esposito I, Boggi U, Cecchetti D, Menicagli M, De Negri F, Colizzi L, Del Chiaro M, Mosca F, Fornaciari G, Bevilacqua G (2001) Bcl-2 expression in pancreas development and pancreatic cancer progression. J Pathol 194, 444-50.

Castillo SS, Brognard J, Petukhov PA, Zhang C, Tsurutani J, Granville CA, Li M, Jung M, West KA, Gills JG, Kozikowski AP, Dennis PA (2004) Preferential inhibition of Akt and killing of Akt-dependent cancer cells by rationally designed phosphatidylinositol ether lipid analogues. Cancer Res 64, 2782-92.

Chan TO, Tsichlis PN (2001) PDK2: a complex tail in one Akt. Sci STKE 2001(66), PE1.

Chandramohan V, Jeay S, Pianetti S, Sonenshein GE (2004) Reciprocal control of Forkhead box O 3a and c-Myc via the phosphatidylinositol 3-kinase pathway coordinately regulates p27(Kip1) levels. J Immunol 172, 5522-7.

Chang F, Lee JT, Navolanic PM, Steelman LS, Shelton JG, Blalock WL, Franklin RA, McCubrey JA (2003a) Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: a target for cancer chemotherapy. Leukemia 17, 590-603.

Chang F, Steelman LS, Lee JT, Shelton JG, Navolanic PM, Blalock WL, Franklin RA, McCubrey JA (2003b) Signal transduction mediated by the Ras/Raf/MEK/ERK pathway from cytokine receptors to transcription factors: potential targeting for therapeutic intervention. Leukemia 17, 126393.

Chen WS, Xu PZ, Gottlob K, Chen ML, Sokol K, Shiyanova T, Roninson I, Weng W, Suzuki R, Tobe K, Kadowaki T, Hay N (2001) Growth retardation and increased apoptosis in mice with homozygous disruption of the Akt1 gene. Genes Dev 15, 2203-8.

Clark AS, West K, Streicher S, Dennis PA (2002) Constitutive and inducible Akt activity promotes resistance to chemotherapy, trastuzumab, or tamoxifen in breast cancer cells. Mol Cancer Ther 1, 707-17.

Cuenda A, Alessi DR (2000) Use of kinase inhibitors to dissect signaling pathways. Methods Mol Biol 99, 161-75.

Davies MA, Koul D, Dhesi H, Berman R, McDonnell TJ, McConkey D, Yung WK, Steck PA (1999) Regulation of Akt/PKB activity, cellular growth, and apoptosis in prostate carcinoma cells by MMAC/PTEN. Cancer Res 59, 2551-6.

Davies MA, Lu Y, Sano T, Fang X, Tang P, LaPushin R, Koul D, Bookstein R, Stokoe D, Yung WK, Mills GB, Steck PA (1998) Adenoviral transgene expression of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. Cancer Res 58, 5285-90.

Day JD, Diguiseppe JA, Yeo C, Lai-Goldman M (1996) Immunohistochemical evaluation of HER-2/neu expression in pancreatic adenocarcinoma and pancreatic intraepithelial neoplasms. Human Path 27, 119-24.

Dergham ST, Dugan MC, Arlauskas P, Du W (1997a) Relationship of family cancer history to the expression of P53, P21, HER-2/neu, and K-ras mutation in pancreatic adenocarcinoma. Inter J Pancreat 21, 225-34.

Dergham ST, Dugan MC, Joshi US, Chen YC, Du W, Smith DW, Arlauskas P, Crissman JD, Vaitkevicius VK, Sarkar FH (1997b) The clinical significance of p21 (WAF1/CIP-1) and p53 expression in pancreatic adenocarcinoma. Cancer 80, 372-81.

Downward J (1998) Ras signalling and apoptosis. Curr Opin Genet Dev 8, 49-54.

Dugan MC, Dergham ST, Kucway R, Singh K (1997) HER2/neu expression in pancreatic adenocarcinoma: relation to tumor differentiation and survival. Pancreas 14, 229-36.

Ebert MP, Fei G, Schandl L, Dietzmann K, Herrera P Friess H, Gress TM, Malfertheiner P (2002) Reduced PTEN expression in the pancreas overexpressing transforming growth factor-" 1. Br J Cancer 86, 257-62.

Ellis CA, Clark G (1997) The importance of being K-ras.

Cellular Sig 12, 425-434.

Elnemr A, Ohta T, Yachie A, Kayahara M, Kitagawa H, Fujimura T, Ninomiya I, Fushida S, Nishimura GI, Shimizu K, Miwa K (2001) Human pancreatic cancer cells disable function of Fas receptors at several levels in Fas signal transduction pathway. Int J Oncol 18, 311-6.

Fahy BN, Schlieman M, Virudachalam S, Bold RJ (2003) AKT inhibition is associated with chemosensitization in the pancreatic cancer cell line MIA-PaCa-2. Br J Cancer 89, 391-7.

Fahy BN, Schlieman MG, Virudachalam S, Bold RJ (2004) Inhibition of AKT abrogates chemotherapy-induced NF-!B survival mechanisms: implications for therapy in pancreatic cancer. J Am Coll Surg 198, 591-9.

Feakins RM, Ghaffar AH (2003) p27 Kip1 expression is reduced in pancreatic carcinoma but has limited prognostic value.

Hum Pathol 3, 385-90.

Franke TF, Hornik CP, Segev L, Shostak GA, Sugimoto C (2003) PI3K/Akt and apoptosis: size matters. Oncogene 22, 8983-98.

Fresno Vara JA, Casado E, de Castro J, Cejas P, Belda-Iniesta C, Gonzalez-Baron M (2004) PI3K/Akt signaling pathway and cancer. Cancer Treat Rev 30, 193-204.

Friess H, Yamanaka Y, Buchler M, Ebert M, Beger HG, Gold LI, Korc M (1993) Enhanced expression of transforming growth factor " isoforms in pancreatic cancer correlates with decreased survival. Gastroenterology 105, 1846-56.

Fujioka S, Sclabas GM, Schmidt C, Niu J, Frederick WA, Dong QG, Abbruzzese JL, Evans DB, Baker C, Chiao PJ (2003) Inhibition of constitutive NF-!B activity by I!B# M suppresses tumorigenesis. Oncogene 22, 1365-70.

Garofalo RS, Orena SJ, Rafidi K, Torchia AJ, Stock JL, Hildebrandt AL, Coskran T, Black SC, Brees DJ, Wicks JR, McNeish JD, Coleman KG (2003) Severe diabetes, agedependent loss of adipose tissue, and mild growth deficiency in mice lacking Akt2/PKB ". J Clin Invest 112, 197-208.

234

Cancer Therapy Vol 2, page 235 Gilmore TD (1999) The Rel/NF-kB signal transduction pathway: introduction. Oncogene 18, 6842-6844.

Grewe M, Gansauge F, Schmid RM, Adler G, Seufferlein T (1999) Regulation of cell growth and cyclin D1 expression by the constitutively active FRAP-p70s6k pathway in human pancreatic cancer cells. Cancer Res 59, 3581-3587.

Gunzburg WH, Lohr M, Salmons B (2002) Novel treatments and therapies in development for pancreatic cancer. Expert Opin Investig Drugs 11, 769-86.

Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin AS Jr (1999) NF-!B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 19, 5785-99.

Hall PA, Hughes CM, Staddon SL, Richman PI (1990) The cerbB-2 Proto-oncogene in human pancreatic cancer. J Path 161, 195-200.

Hansel DE, Kern SE, Hruban RH (2003) Molecular pathogenesis of pancreatic cancer. Annu Rev Genomics Hum Genet 4, 237-56.

Heineman V (2002) Present and future treatment of pancreatic cancer. Semin Oncol 29(suppl 9), 23-31.

Hirai H, Okabe T, Anraku Y, Fujisawa M, Urabe A, Takaku F (1985) Activation of the c-K-ras oncogene in a human pancreas carcinoma. Biochem Biophys Res Commun 127, 168-74.

Hoshida T, Sunamura M, Duda DG, Egawa S, Miyazaki S, Shineha R, Hamada H, Ohtani H, Satomi S, Matsuno S (2002) Gene therapy for pancreatic cancer using an adenovirus vector encoding soluble flt-1 vascular endothelial growth factor receptor. Pancreas 25, 111-121.

Hruban RH, Iacobuzio-Donahue C, Wilentz RE, Goggins M, Kern SE (2001) Molecular pathology of pancreatic cancer.

Cancer J 7, 251-8.

Huang S, Houghton PJ (2003) Targeting mTOR signaling for cancer therapy. Curr Opin Pharmacol 3, 371-377.

Hudson CC, Liu M, Chiang GG, Otterness DM, Loomis DC, Kaper F, Giaccia AJ, Abraham RT (2002) Regulation of hypoxia-inducible factor 1# expression and function by the mammalian target of rapamycin. Mol Cell Biol 22, 7004-14.

Idogawa M, Adachi M, Minami T, Yasui H, Imai K (2003) Overexpression of BAD preferentially augments anoikis. Int J Cancer 107, 215-23.

Itakura J, Ishiwata T, Friess H, Matsumoto FH, Buchler MW, Korc M (1997) Enhanced expression of vascular endothelial growth factor in human pancreatic cancer correlates with local disease progression. Clin Cancer Res 3, 1309-16.

Itakura J, Ishiwata T, Shen B, Kornmann M, Korc M (2000) Concommitant over-expression of vascular endothelial growth factor and its receptors in pancreatic cancer. Int J Cancer 85, 27-34.

Jacobs AD (2002) Gemcitabine-based therapy in pancreas cancer: gemcitabine-docetaxel and other novel combinations.

Cancer Supplement 95, 923-927.

Jemal A, Tiwari RC, Murray T, Ghafoor A, Samuels A, Ward E, Feuer EJ, Thun MJ (2004) Cancer statistics, 2004. CA Cancer J Clin 54, 8-29.

Jetzt A, Howe JA, Horn MT, Maxwell E, Yin Z, Johnson D, Kumar CC (2003) Adenoviral-mediated expression of a kinase-dead mutant of Akt induces apoptosis selectively in tumor cells and suppresses tumor growth in mice. Cancer Res 63, 6697-706.

Juuti A, Nordling S, Louhimo J, Lundin J, von Boguslawski K, Haglund C (2003) Loss of p27 expression is associated with poor prognosis in stage I-II pancreatic cancer. Oncology 65, 371-7.

Katz ME, McCormick F (1997) Signal transduction from multiple Ras effectors. Curr Opin Genet Dev 7, 75-9.

Kauffmann-Zeh A, Rodriguez-Viciana P, Ulrich E, Gilbert C, Coffer P, Downward J, Evan G (1997) Suppression of cMyc-induced apoptosis by Ras signalling through PI(3)K and PKB. Nature 385, 544-8.

Kedra B, Popiela T, Sierzega M, Precht A (2001) Prognostic factors of long-term survival after resective procedures for pancreatic cancer. Hepatogastroenterology 48, 1762-1766.

Khwaja A, Rodriguez-Viciana P, Wennstrom S, Warne PH, Downward J (1997) Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO J 16, 278393.

Kliche S, Waltenberger J (2001) VEGF receptor signaling and endothelial function. IUBMB Life 52, 61-6.

Knuefermann C, Lu Y, Liu B, Jin W, Liange K, Wu L, Schmidt M, Mills GB, Mendelsohn J, Fan Z (2003) HER2/PI3K/AKT activation leads to multidrug resistance in human breast adenocarcinoma cells. Oncogene 22, 3205-3212.

Krasilnikov MA (2000) Phosphatidylinositol-3 kinase dependent pathways: the role in control of cell growth, survival, and malignant transformation. Biochemistry 65, 59-67.

Kurland JF, Kodym R, Story MD, Spurgers KB, McDonnell TJ, Meyn RE (2001) NF-!B1 (p50) homodimers contribute to transcription of the bcl-2 oncogene. J Biol Chem 276, 45380-6.

Kuwahara K, Sasaki T, Kobayashi K, Noma B, Serikawa M, Iiboshi T, Miyata H, Kuwada Y, Murakami M, Yamasaki S, Kariya K, Morinaka K, Chayama K (2004) Gemcitabine suppresses malignant ascites of human pancreatic cancer: correlation with VEGF expression in ascites. Oncol Rep 11, 73-80.

Larrivee B, Karsan A (2000) Signaling pathways induced by vascular endothelial growth factor. Int J Mol Med 5, 44756.

Lei S, Appert HE, Nakata B, Domenico DR (1995) Overexpression of HER2/neu oncogene in pancreatic cancer correlates with shortened survival. Inter J Pancreat 17, 1521.

Li DM, Sun H (1997) TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor ". Cancer Res 57, 2124-9.

Li Y, Dowbenko D, Lasky LA (2002) AKT/PKB Phosphorylation of p21cip/WAF1 enhances protein stability of p21cip/WAF1 and promotes cell survival. J Biol Chem 277, 11352-11361.

Liptay S, Weber CK, Ludwig L, Wagner M, Adler G, Schmid RM (2003) Mitogenic and antiapoptotic role of constitutive NF-kB/Rel activity in pancreatic cancer. Int J Cancer 105, 735-746.

Liu W, Ahmad SA, Reinmuth N, Shaheen RM, Jung YD, Fan F, Ellis LM (2000) Endothelial cell survival and apoptosis in the tumor vasculature. Apoptosis 5, 323-8.

Luo HR, Hattori H, Hossain MA, Hester L, Huang Y, Lee-Kwon W, Donowitz M, Nagata E, Snyder SH (2003) Akt as a mediator of cell death. Proc Natl Acad Sci U S A. 100, 11712-7.

Madrid LV, Mayo MW, Reuther JY, Baldwin AS Jr (2001) Akt stimulates the transactivation potential of the RelA/p65 Subunit of NF-!B through utilization of the I!B kinase and activation of the mitogen-activated protein kinase p38. J Biol Chem 276, 18934-40.

Madrid LV, Wang C, Guttridge DC, Schottelius AJG, Baldwin AS, Mayo MW (2000) Akt Suppresses Apoptosis by Stimulating the Transactivation Potential of the RelA/p65 Subunit of NF-kB. Mol Cell Biol 20, 1626-1638.

Matsumoto J, Kaneda M, Tada M, Hamada J, Okushiba S, Kondo S, Katoh H, Moriuchi T (2002) Differential

235

Martenson et al: AKT as a novel target in pancreatic cancer therapy mechanisms of constitutive Akt/PKB activation and its influence on gene expression in pancreatic cancer cells. Jpn J Cancer Res 93, 1317-26.

Mayo MW, Baldwin AS (2000) The transcription factor NF-kB: control of oncogenesis and cancer therapy resistance.

Biochim Biophys Acta 1470, M55-M62.

Micheau O, Lens S, Gaide O, Alevizopoulos K, Tschopp J (2001) NF-!B signals induce the expression of c-FLIP. Mol Cell Biol 21, 5299-305.

Min Y, Adachi Y, Yamamoto H, Ito H, Itoh F, Lee CT, Nadaf S, Carbone DP, Imai K (2003) Genetic blockade of the insulinlike growth factor-I receptor: a promising strategy for human pancreatic cancer. Cancer Res 63, 6432-41.

Moller A, Malerczyk C, Volker U, Stoppler H, Maser E (2002) Monitoring daunorubicin-induced alterations in protein expression in pancreas carcinoma cells by two-dimensional gel electrophoresis. Proteomics 2, 697-705.

Nave BT, Ouwens M, Withers DJ, Alessi DR, Shepard PR (1999) Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem J 1, 427-431.

Ng SS, Tsao MS, Nicklee T, Hedley DW (2001) Wortmannin inhibits pkb/akt phosphorylation and promotes gemcitabine antitumor activity in orthotopic human pancreatic cancer xenografts in immunodeficient mice. Clin Cancer Res 7, 3269-75.

Ng SSW, Tsao MS, Chow S, Hedley DW (2000) Inhibition of PI 3-kinase enhances gemcitabine-induced apoptosis in human pancreatic cancer cells. Cancer 60, 5451-5.

Nicholson KM, Anderson NG (2002) The protein kinase B/Akt signalling pathway in human malignancy. Cell Signal 14, 381-95.

Okami K, Wu L, Riggins G, Cairns P, Goggins M, Evron E, Halachmi N, Ahrendt SA, Reed AL, Hilgers W, Kern SE, Koch WM, Sidransky D, Jen J (1998) Analysis of PTEN/MMAC1 alterations in aerodigestive tract tumors.

Cancer Res 58, 509-11.

Panka DJ, Mano T, Suhara T, Walsh K, Mier JW (2001) Phosphatidylinositol 3-kinase/Akt activity regulates c-FLIP expression in tumor cells. J Biol Chem 276, 6893-6.

Parikh AA, Liu WB, Fan F, Stoeltzing O, Reinmuth N, Bruns CJ, Bucana CD, Evans DB, Ellis LM (2003) Expression and regulation of the novel vascular endothelial growth factor receptor neuropilin-1 by epidermal growth factor in human pancreatic carcinoma. Cancer 98, 720-9.

Peng XD, Xu PZ, Chen ML, Hahn-Windgassen A, Skeen J, Jacobs J, Sundararajan D, Chen WS, Crawford SE, Coleman KG, Hay N (2003) Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev 17, 1352-65.

Perugini RA, McDade TP, Vittimberga FJ Jr, Callery MP (2000) Pancreatic cancer cell proliferation is phosphatidylinositol 3kinase dependent. J Surg Res 90, 39-44.

Pianetti S, Arsura M, Romieu-Mourez R, Coffey RJ, Sonenshein GE (2001) Her-2/neu overexpression induces NF-!B via a PI3-kinase/Akt pathway involving calpain-mediated degradation of I!B-# that can be inhibited by the tumor suppressor PTEN. Oncogene 20, 1287-99.

Powis G, Bonjouklian R, Berggren MM, Gallegos A, Abraham R, Ashendel C, Zalkow L, Matter WF, Dodge J, Grindey G (1994) Wortmannin, a potent and selective inhibitor of phosphatidylinositol-3-kinase. Cancer Res 54, 2419-23.

Reed JC (1997) Bcl-2 family proteins: strategies for overcoming chemoresistance in cancer. Adv Pharmacol 41, 501-32.

Ren YX, Xu GM, Li ZS, Song YG (2004) Detection of point mutation in K-ras oncogene at codon 12 in pancreatic diseases. World J Gastroenterol 10, 881-4.

Rodriguez-Viciana P, Warne PH, Khwaja A, Marte BM, Pappin D, Das P, Waterfield MD, Ridley A, Downward J (1997) Role of phosphoinositide 3-OH kinase in cell transformation and control of the actin cytoskeleton by Ras. Cell 89, 457-67.

Rossig L, Jadidi AS, Urbich C, Badorff C, Zeiher AM, Dimmeler S (2001) Akt-dependent phosphorylation of p21(Cip1) regulates PCNA binding and proliferation of endothelial cells. Mol Cell Biol 21, 5644-57.

Safran H, Steinhoff M, Mangray S, Rathore R, King TC, Chai L, Berzein K, Moore T, Iannitti D, Reiss P, Pasquariello T, Akerman P, Quirk D, Mass R, Goldstein L, Tantravahi U (2001) Overexpression of the HER-2/neu oncogene in pancreatic adenocarcinoma. Am J Clin Oncol 24, 496-9.

Sakorafas GH, Tsiotou AG, Tsiotos GG (2000) Molecular biology of pancreatic cancer; oncogenes, tumor suppressor genes, growth factors, and their receptors from a clinical perspective. Cancer Treatment Rev 26, 29-52.

Sakorafas GH, Tsiotou, AG (1999) Multi-step pancreatic carcinogenesis and its clinical implications. Eur J Surg Oncol 25, 562-565.

Sakurada A, Suzuki A, Sato M, Yamakawa H, Orikasa K, Uyeno S, Ono T, Ohuchi N, Fujimura S, Horii A (1997) Infrequent genetic alterations of the PTEN/MMAC1 gene in Japanese patients with primary cancers of the breast, lung, pancreas, kidney, and ovary. Jpn J Cancer Res 88, 1025-8.

Schlieman MG, Fahy BN, Ramsamooj R, Beckett L, Bold RJ (2003) Incidence, mechanism and prognostic value of activated AKT in pancreas cancer. Br J Cancer 89, 2110-5.

Schneider G, Schmid RM (2003) Genetic alterations in pancreatic carcinoma. Mol Cancer 2, 15-21.

Sekulic A, Hudson CC, Homme JL, Yin P, Otterness DM, Karnitz LM, Abraham RT (2000) A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res 60, 3504-3513.

Semba S, Moriya T, Kimura W, Yamakawa M (2003) Phosphorylated Akt/PKB controls cell growth and apoptosis in intraductal papillary-mucinous tumor and invasive ductal adenocarcinoma of the pancreas. Pancreas 26, 250-7.

Semenza GL (2002) Signal Transduction to Hypoxia-inducible Factor 1. Biochem Pharm 64, 993-998.

Sgambato A, Cittadini A, Faraglia B, Weinstein IB (2000) Multiple functions of p27Kip1 and its alterations in tumor cells: a review. J Cell Physiol 183, 18-27.

Shah SA, Potter MW, Hedeshian MH, Kim RD, Chari RS, Callery MP (2001c) PI-3' kinase and NF-!B cross-signaling in human pancreatic cancer cells. J Gastrointest Surg 5, 603-12 Shah SA, Potter MW, McDade TP, Ricciardi R, Perugini RA, Elliott PJ, Adams J, Callery MP (2001b) 26S proteasome inhibition induces apoptosis and limits growth of human pancreatic cancer. J Cell Biochem 82, 110-22.

Shah SA, Potter MW, Ricciardi R, Perugini RA, Callery MP (2001a) FRAP-p70s6K signaling is required for pancreatic cancer cell proliferation. J Surg Res 97, 123-130.

Shao J, Evers BM, Sheng H (2004) Roles of phosphatidylinositol 3'-kinase and mammalian target of rapamycin/p70 ribosomal protein S6 kinase in K-Ras-mediated transformation of intestinal epithelial cells. Cancer Res 64, 229-35.

Sheng H, Shao J, DuBois RN (2004) Akt/PKB activity is required for Ha-Ras-mediated transformation of intestinal epithelial cells. J Biol Chem 276, 14498-504 Shi X, Liu S, Kleeff J, Friess H, Buchler MW (2002) Acquired resistance of pancreatic cancer cells towards 5-Fluorouracil

236

Cancer Therapy Vol 2, page 237 and gemcitabine is associated with altered expression of apoptosis-regulating genes. Oncology 62, 354-62.

Shibaji T, Nagao M, Ikeda N, Kanehiro H, Hisanaga M, Ko S, Fukumoto A, Nakajima Y (2003) Prognostic significance of HIF-1# overexpression in human pancreatic cancer.

Anticancer Res 23, 4721-7.

Shields JM, Pruitt K, McFall A, Shaub A, Der CJ (2000) Understanding Ras: 'it ain't over 'til it's over'. Trends Cell Biol 10, 147-54.

Skurk C, Maatz H, Kim HS, Yang J, Abid MR, Aird WC, Walsh K (2004) The Akt-regulated forkhead transcription factor FOXO3a controls endothelial cell viability through modulation of the caspase-8 inhibitor FLIP. J Biol Chem 279, 1513-25.

Sohn TA, Yeo CJ (2000) The molecular genetics of pancreatic ductal carcinoma: a review. Surg Oncol 9 ,95-101.

Solorzano CC, Baker CH, Bruns CJ, Killion JJ, Ellis LM, Wood J, Fidler IJ (2001) Inhibition of growth and metastasis of human pancreatic cancer growing in nude mice by PTK 787/ZK222584, an inhibitor of the vascular endothelial growth factor receptor tyrosine kinases. Cancer Biother Radiopharm 16, 359-70.

Solorzano CC, Hwang R, Baker CH, Bucana CD, Pisters PW, Evans DB, Killion JJ, Fidler IJ (2003) Administration of optimal biological dose and schedule of interferon # combined with gemcitabine induces apoptosis in tumorassociated endothelial cells and reduces growth of human pancreatic carcinoma implanted orthotopically in nude mice.

Clin Cancer Res 9, 1858-67.

Staal SP, Hartley JW (1988) Thymic lymphoma induction by the AKT8 murine retrovirus. J Exp Med 167, 1259-64.

Stehlik C, de Martin R, Kumabashiri I, Schmid JA, Binder BR, Lipp J (1998) Nuclear factor (NF)-!B-regulated Xchromosome-linked iap gene expression protects endothelial cells from tumor necrosis factor #-induced apoptosis. J Exp Med 188, 211-6.

Stein RC (2001) Prospects for phosphoinositide 3-kinase inhibition as a cancer treatment. Endocr Relat Cancer 8, 237-48.

Sun M, Wang G, Paciga JE, Feldman RI, Yuan ZQ, Ma XL, Shelley SA, Jove R, Tsichlis PN, Nicosia SV, Cheng JQ (2001) AKT1/PKB # kinase is frequently elevated in human cancers and its constitutive activation is required for oncogenic transformation in NIH3T3 cells. Am J Pathol 159, 431-7.

Takahashi T, Niino N, Ishikura H, Okushiba S, Dohke M, Katoh H (1997) Predictive factors for long-term survival in patients with pancreatic carcinoma. Hepatogastroenterology 44, 1463-8.

Takeda A, Osaki M, Adachi K, Honjo S, Ito H (2004) Role of the phosphatidylinositol 3'-kinase-Akt signal pathway in the proliferation of human pancreatic ductal carcinoma cell lines.

Pancreas 28, 353-8.

Tanno S, Tanno S, Mitsuuchi Y, Altomare DA, Xiao GH, Testa JR (2001) AKT activation up-regulates insulin-like growth factor I receptor expression and promotes invasiveness of human pancreatic cancer cells. Cancer Res 61, 589-93.

Tergaonkar V, Bottero V, Ikawa M, Li Q, Verma IM (2003) I!B kinase-independent I!B# degradation pathway: functional NF-!B activity and implications for cancer therapy. Mol Cell Biol 23, 8070-83.

Thomas RP, Farrow BJ, Kim S, May MJ, Hellmich MR, Evers BM (2002) Selective targeting of the nuclear factor-!B pathway enhances tumor necrosis factor-related apoptosisinducing ligand-mediated pancreatic cancer cell death.

Surgery 132, 127-34.

Tseng JF, Farnebo FA, Kisker O, Becker CM, Kuo CJ, Folkman J, Mulligan RC (2002) Adenovirus-mediated delivery of a

soluble form of the VEGF receptor Flk1 delays the growth of murine and human pancreatic adenocarcinoma in mice.

Surgery 132, 857-65.

Tsujimoto Y, Shimizu S (2000) Bcl-2 family: life-or-death switch. FEBS Lett 466, 6-10.

Ungefroren H, Voss M, Jansen M, Roeder C, Henne-Bruns D, Kremer B, Kalthoff H (1998) Human pancreatic adenocarcinomas express Fas and Fas ligand yet are resistant to Fas-mediated apoptosis. Cancer Res 58, 1741-9.

Vanhaesebroeck B, Alessi DR (2000) The PI3K-PDK1 connection: more than just a road to PKB. Biochem J 346, 561-76.

Viglietto G, Motti ML, Bruni P, Melillo RM, D'Alessio A, Califano D, Vinci F, Chiappetta G, Tsichlis P, Bellacosa A, Fusco A, Santoro M (2002) Cytoplasmic relocalization and inhibition of the cyclin-dependent kinase inhibitor p27kip1

by PKB/Akt-mediated phosphorylation in breast cancer.

Nature Medicine 8, 1136-1145.

Wajant H (2003) Targeting the FLICE inhibitory protein (FLIP) in cancer therapy. Mol Interv 3, 124-7.

Wang CY, Guttridge DC, Mayo MW, Baldwin AS Jr (1999) NF!B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis.

Mol Cell Biol 19, 5923-9.l Wang Q, Wang X, Evers BM (2003) Induction of cIAP-2 in human colon cancer cells through PKC delta/NF-!B. J Biol Chem 278, 51091-9.

Wang W, Abbruzzese JL, Evans DB, Larry L, Cleary KR, Chiao PJ (1999) The nuclear Factor-kB RelA transcription factor is constitutively activated in human pancreatic adenocarcinoma cells. Clinical Cancer Res 5, 119-127.

West KA, Castillo SS, Dennis PA (2002) Activation of the PI3K/Akt pathway and chemotherapeutic resistance. Drug Resist Updat 5, 234-48.

Westphal S, Kalthoff H (2003) Apoptosis: targets in pancreatic cancer. Mol Cancer 2, 6-20.

Wick MJ, Dong LQ, Riojas RA, Ramos FJ, Liu F (2000) Mechanism of phosphorylation of protein kinase B/Akt by a constitutively active 3-phosphoinositide-dependent protein kinase-1. J Biol Chem 275, 40400-6.

Williams TM, Weiner DB, Greene MI, Maguire HC Jr (1991) Expression of c-erbB-2 in human pancreatic adenocarcinomas. Pathobiology 59, 46-52.

Wolff RA (2002) Exploiting molecular targets in pancreatic cancer. Hematol Oncol Clin North Am 16, 139-57.

Wu X, Senechal K, Neshat MS, Whang YE, Sawyers CL (1998) The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc Natl Acad Sci USA 95, 15587-91.

Xiong HQ, Abbruzzese JL, Lin E, Wang L, Zheng L, Xie K (2004) NF-!B activity blockade impairs the angiogenic potential of human pancreatic cancer cells. Int J Cancer 108, 181-8.

Xu G, Zhang W, Bertram P, Zheng XF, McLeod H (2004) Pharmacogenomic profiling of the PI3K/PTEN-AKT-mTOR pathway in common human tumors. Int J Oncol 24, 893900.

Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL (2002) Herceptin-induced inhibition of phosphatidylinositol-3 kinase and Akt Is required for antibody-mediated effects on p27, cyclin D1, and antitumor action. Cancer Res 62, 4132-41.

Yamamoto S, Tomita Y, Hoshida Y, Morooka T, Nagano H, Dono K, Umeshita K, Sakon M, Ishikawa O, Ohigashi H, Nakamori S, Monden M, Aozasa K (2004) Prognostic significance of activated Akt expression in pancreatic ductal adenocarcinoma. Clin Cancer Res 10, 2846-50.

237

Martenson et al: AKT as a novel target in pancreatic cancer therapy Yamanaka Y, Friess H, Kobrin M, Buchler M (1993) Overexpression of HER2/neu oncogene in human pancreatic carcinoma. Human Path 24, 1127-34.

Yao Z, Okabayashi Y, Yutsudo Y, Kitamura T, Ogawa W, Kasuga M (2002) Role of Akt in growth and survival of PANC-1 pancreatic cancer cells. Pancreas 24, 42-46.

Yip-Schneider MT, Wiesenauer CA, Schmidt CM (2003) Inhibition of the phosphatidylinositol 3'-kinase signaling pathway increases the responsiveness of pancreatic carcinoma cells to sulindac. J Gastrointest Surg 7, 354-63.

Yu JT, Foster RG, Dean DC (2001) Transcriptional repression by RB-E2F and regulation of anchorage-independent survival.

Mol Cell Biol 21, 3325-35.

Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D, Buechler P, Isaacs WB, Semenza GL, Simons JW (1999) Overexpression of hypoxia-inducible factor 1a in

Melinda M. Mortenson

Joseph M. Galante

common human cancers and their metastases. Cancer Res 59, 5830-5835.

Zhou BP, Hu MC-T, Miller SA, Yu Z, Xia W, Lin SY, Hung MC (2000) HER-2/neu blocks tumor necrosis factor-induced apoptosis via the Akt/NF-kB Pathway. J Biol Chem 275, 8027-8031.

Zhou BP, Liao Y, Xia W, Spohn B, Lee MH, Hung MC (2001b) Cytoplasmic localization of p21cip1/WAF1 by Akt-induced phosphorylation in HER-2/neu-overexpressing cells. Nature Cell Biol 3, 245-252.

Zhou BP, Liao Y, Xia W, Zou Y, Spohn B, Hung MC (2001a) HER-2/neu induces p53 ubiquitination via Akt-mediated MDM2 phosphorylation. Nat Cell Biol 3, 973-82.

Michael G. Schlieman

238

Richard J. Bold