Issue 2 copy by hisham Issa

THE STEM CELL ΜϚϋϓ Όϋϒϒ Ηϋϝϙ ΏϘϕϓ ΎύϟϖϚ

Issue 2 Aug 2012

EE Y R F P CO

The power of regenerative medicine in treating spinal cord injury. Building a cardiac muscle using MSCs a novel acheivement by cell safe Stem cells to rebuild a cartilage another tool for orthopedic surgeons

Michael J. Fox Foundation for Parkinson’s Research, the largest private funder of Parkinson’s disease research worldwide using stem cells

Cell safe bank the art of stem cell banking

How my baby’s sample

is stored for years?

Life time freezing for you baby’s Using fully robotic cord stem cell cryo-tanks FDA approved For more info call : 1138

www.cellsafebank.com

1 2 3

Content&

Issue%2%

Spinal!cord!

Cartilage!!

Cardiac!

!!!!Axonal Re-

!!!Mesenchymal stem cell therapy to rebuild cartilage!

Cell!safe!has! succeeded!to!create! a!heart!muscle!from! stem!cells!!

myelination by Cord Blood Stem Cells after Spinal Cord Injury !

Letter&from&the&Chairman& Prof&Sherif&N&Amin& The!Future!of!Stem!cell!In!Egypt,!a!science!cell! safe!introduced!to!the!middle!east!community! Cell!Safe!bank!,!the!name!that!introduced! the!stem!banking!in!Egypt!in!2008.!Cell! safe!helped!in!the!formation!of!the! regulatory!law!after!which!any!wants!to! open!a!stem!cell!bank!,!can!do!it!in!no! time!provided!they!followed!the! regulations!created!2008.! Again!as!a!market!leader,!cell!safe!team! educated!the!medical!society!about!stem! cell!banking!and!stem!applications!and! through!this!awareness!the!society! benefits!more!and!more!

Then!cell!safe!created!a!Stem!Cell! department!in!MSA!university! biotechnology!to!generate!a!source!of! stem!cell!biologists,!and!after!three!years! cell!safe!now!graduated!over!sixty!stem! cell!biologists!of!different!nationalities! Stem!cell!Research!center!has!been! created!2010!and!published! internationally!over!five!papers!in!the! most!eminent!stem!cell!conferences! worldwide!(AABB!annual!meeting,!The! ISSCR!annual!meetings!,!APCBBC!and!NYSF!

Finally!cell!safe!has!helped!in!attracting! international!pharmaceutical!companies! in!the!field!of!stem!cell!technology!to!have! distributors!in!Egypt!,!so!future!expansion! and!scientific!offices!can!help!and! participate!in!the!awareness!and! development!of!the!field.! Finally!Cell!Safe!as!a!market!leader!will! continue!to!improve!and!develop!stem! cell!technology!in!Egypt! Sherif N Amin

Spinal cord injury

JOURNAL OF NEUROTRAUMA

Volume 24, Number 2, 2007

Axonal Re-myelination by Cord Blood Stem Cells after Spinal Cord Injury VENKATA RAMESH DASARI, DANIEL G. SPOMAR, CHRISTOPHER S. GONDI, CHRISTOPHER A. SLOFFER, KAY L. SAVING, MEENA GUJRATI, JASTI S. RAO and DZUNG H. DINH University of Illinois College of Medicine at Peoria, Peoria, Illinois.

ABSTRACT Human umbilical cord blood stem cells (hUCB) hold great promise for therapeutic repair after spinal cord injury (SCI). Here, we present our preliminary investigations on axonal remyelination of injured spinal cord by transplanted hUCB. Adult male rats were subjected to moderate SCI using NYU Impactor, and hUCB were grafted into the site of injury one week after SCI. Immunohistochemical data provides evidence of differentiation of hUCB into several neural phenotypes including neurons, oligodendrocytes and astrocytes.

lorem ipsum dolor met set quam nunc parum

2009

Ultrastructural analysis of axons reveals that hUCB form morphologically normal appearing myelin sheaths around axons in the injured areas of spinal cord. Co localization studies prove that oligodendrocytes derived from hUCB secrete neurotrophic hormones neurotrophin-3 (NT3) and brain-derived neurotrophic factor (BDNF). Cord blood stem cells aid in the synthesis of myelin basic protein (MBP) and proteolipid protein (PLP) of myelin in the injured areas, thereby facilitating the process of remyelination. Elevated levels of mRNA expression were observed for NT3, BDNF, MBP and PLP in hUCB-treated rats as revealed by fluorescent in situ hybridization (FISH) analysis. Recovery of hind limb locomotor function was also significantly enhanced in the hUCBtreated rats based on Basso-BeattieBresnahan (BBB) scores assessed 14 days after transplantation. These findings demonstrate that hUCB, when

transplanted into the spinal cord 7 days after weight-drop injury, survive for at least 2 weeks, differentiate into oligodendrocytes and neurons, and enable improved locomotor function. Therefore, hUCB facilitate functional recovery after moderate SCI and may prove to be a useful therapeutic strategy to repair the injured spinal cord.

Introduction HAVE BEEN MANY EFFORTS to restore normal neuronal functions —and thus motor functions—after spinal cord injury (SCI), in which the myelin sheaths and/or myelinating cells (e.g., oligodendrocytes) are destroyed. Although some spontaneous remyelination occurs, this process is not consistent enough for complete repair (2et al., 1997). This phenomenon depends on molecules (e.g., growth factors), most of which are still unidentified (Woodruff and Franklin, 1999). Since the natural capacity of the CNS to recover from injury is limited, most research into SCI focuses upon promotion of axonal growth, remyelination of demyelinating axons, and reduction of neuronal degeneration. Demyelination contributes to the dysfunction of the traumatically injured spinal cord in both humans and experimental animals (Waxman, 1989; Bunge et al., 1993; Cao et al., 2005b; Guest et al., 2005; Totoiu et al., 2005). Remyelination of demyelinated, but otherwise intact, axons could be an important strategy for the treatment of spinal cord injury (Blight, 2002). At present, transplantation is the most promising approach for restoring lost myelin. Recent studies have focused on the use of transplanted oligodendrocyte precursor cells (OPC) or neural stem cells (NSC) after SCI (Brustle et al., 1999; Keirstead et al., 1999; Liu et al., 2000; Cao et al., 2001; Ogawa et al., 2002; Bambakidis et al., 2004; Hill et al., 2004; Hofstetter et al., 2005). Transplantation of embryonic stem cell-derived NSC or OPC has led to partial functional improvement after SCI suggesting the feasibility of facilitating functional recovery from SCI by remyelination (Barres et al., 1994b; McDonald et al., 1999; Keirstead et al., 2005). Human umbilical cord blood is a valuable source of stem cells that have the therapeutic potential to initiate and maintain tissue repair. This capability holds special promise for the treatment of neural diseases, for which no cure is currently available. In addition, therapies based on hUCB are attractive because the cells are readily available and less immunogenic as compared to other sources of stem cells, such as bone marrow. The therapeutic potential of hUCB may either be attributed to the inherent ability of stem cell populations to replace damaged tissues outright, or alternatively, to their ability to repair damaged tissues through neural protection and secretion of neurotrophic factors by various cell types within the graft (Sanberg et al., 2005). Perhaps more importantly, stem cells could promote axonal regeneration either by constituting a “bridge” through a lesion site capable of supporting axonal attachment and growth or by secreting diffuse molecules,such as growth factors, to attract injured axons. Previous studies have reported that hUCB are beneficial in reversing the behavioral effects of spinal cord injury, even when infused 5 days after injury (Saporta et al., 2003). Transplanted hUCB differentiate into various neural cells and induce motor function improvement in cord-injured rat models (Kuh et al., 2005). To date, three reports have utilized hUCB in SCI. More thorough experiments are needed to evaluate how hUCB modulates improvement after SCI and whether it possesses the potential of tissue plasticity (Enzmann et al., 2006). It is also unclear whether the enhanced functional recovery results from remyelination of demyelinated axons by engrafted cells or by trophic support to spare the white matter that would otherwise degenerate. Thus, the relationship between remyelination and functional recovery after traumatic SCI remains unresolved and mechanistic explanations are needed. In this study, we grafted hUCB into the injured spinal cords of male rats to evaluate functional recovery in the hind limbs due to remyelination of the demyelinated axons. Our preliminary results evaluate the secretion of neurotrophic hormones by hUCBdifferentiated oligodendrocytes and their role in remyelination.

METHODS

Study Design This study was designed to assay the differentiation of hUCB into different neural phenotypes in the injured spinal cord, functional improvement in motor control, and axonal remyelination and regeneration in spinal cord injured rats after transplantation of hUCB. Since human spinal cord trauma is primarily a disorder of males (Jack- son et al., 2004), we used male rats for all of the following experiments. Spinal Cord Injury and Post-Surgical Care A total of 52 rats were used in this study and assigned to different groups as described in Table 1. Moderate spinal cord injury was induced using the weight drop de- vice (NYU Impactor) developed at New York University (Gruner, 1992) and the injury protocol developed by a multicenter consortium (Multicenter Animal Spinal Cord Injury Study: Basso et al., 1995, 1996a, 1996b) as reported previously (Liu et al., 1997; Xu et al., 1998; Lee et al., 2003). Briefly, adult male rats (Lewis rats, 250–300 g) were anesthetized with ketamine (100 mg/kg) and xy- lazine (5 mg/kg; ip; both from MedVet International, Mettawa, IL). 16 The dorsal aspect of the back was shaved and scrubbed with Betadine solution. A laminectomy was performed at the T9–T10 level exposing the cord beneath without disrupting the dura. The spinous processes of T8 and T11 were then clamped to stabilize the spine, and the exposed dorsal surface of the cord was subjected to a weight-drop impact at T10 using a 10 g rod (2.5 mm in diameter) dropped at a height of 12.5 mm. After injury, the muscles and skin were closed in layers, and the rats were placed in a temperature and humidity-controlled chamber overnight. Cefazolin (25 mg/kg; Fisher, Hanover Park, IL) was given to prevent urinary tract in- fection for 3–7 days. Manual expression of the urinary bladder was performed two times per day until reflex bladder emptying was established. For the sham-operated controls, the animals underwent a T10 laminectomy without weight-drop injury. All surgical interventions and post-operative animal care were approved by the Institutional Animal Care and Use Committee of the University of Illinois College of Medicine at Peoria.

Behavioral Assessment after SCI A behavioral test was performed to measure the functional recovery of the rats’ hind limbs following the procedure as described in Basso et al. (1995). The scale used for measuring hind-limb function with these procedures ranges from a score of 0, indicating no spontaneous movement, to a maximum score of 21, with an increasing score indicating the use of individual joints, coordinated joint movement, coordinated limb movement, weight-bearing, and other functions. Rats were first gently adapted to the open field used for the test. After a rat had walked continuously in the open field, two investigators conducted 4-min testing sessions on each leg. Two individuals “blinded” to rat treatment status performed the open field test at least once a week from day 1 post-2 SCI to 3 weeks post-SCI on all animals in the study. Behavioral outcomes and examples of specific BBB locomotor scores were recorded using digital video. Intraspinal Grafting of hUCB BBB locomotor rating scores were obtained before transplantation and every week after SCI. Animals were re-anesthetized as described above, and the laminectomy site was re-exposed. Sham control group animals were injected 7 days after laminectomy with 5 mL of sterile PBS using a 10-mL Hamilton syringe. The hUCB-transplanted group was injected 7 days after injury, with a 5- mL mononuclear cell layer of hUCB (5 106 cells/mL). These cells were delivered into the site of injury, at a rate of 0.5 mL/min using a 10-mL Hamilton syringe. Thus, a total of 2.5/ 105 cells were grafted into

each injured spinal cord. The hUCB were previously labeled with DiI (1,1dioctadecyl-3,3,3,3tetramethyl-indocarbocyanine per chlorate) (Molecular Probes, OR) in order to facilitate identification of the cells within the subsequent histological specimens. Cyclosporine A (10 mg/kg; Bedford Labs, Bedford, OH) was administered as an immuno- suppressant for 7 days after transplantation of hUCB. The cyclosporine-treated group rats received cyclosporine A (10 mg/kg) for 7 days after SCI.

Culture and In Vitro Differentiation of hUCB Human umbilical cord blood was collected from healthy volunteers with informed consent and according to a protocol approved by the Institutional Review Board. Human UCB were enriched by sequential Ficoll density gradient purification followed by selection of stem cells with the following markers: CD44, CD133, and CD34. The cells were grown in Mesencult basal medium (Stem Cell Technologies, USA) supplemented with 20% heat inactivated FBS (Hyclone, Logan, UT) and 1% penicillin and streptomycin (Invitrogen, Carls- bad, CA). Stem cells were incubated at 37°C in an incu- bator with 5% CO2 at saturating humidity. When cells reached 70–80% confluency, cells were detached with TrypLE Express (Invitrogen) and centrifuged at 250g for 3 min and re-plated. An acclimatization step was carried out 24 h prior to neural induction by replacing the growth medium with preinduction medium consisting of Neurobasal medium (Invitrogen) supplemented with 10% FBS (Hyclone), 1% penicillin-streptomycin (Invitrogen), 1% 200 mM L-glutamine (Mediatech Inc.-Fisher, Hanover Park, IL), 2% B27 (Invitrogen), 1% N2 (Invitrogen), bFGF (10 ng/mL; Invitrogen), -NGF (10 ng/mL; Sigma, St. Louis, MO), BDNF (10 ng/mL; EMD Bio- sciences, San Diego, CA), and NT-3 (10 ng/mL; EMD Biosciences). Neural differentiation was then initiated the following day by incubating the cells in neurogenic medium (preinduction medium with 0.5 M retinoid acid (Sigma) and hEGF (10 ng/mL; Sigma). The cells were observed for differentiation for 10 days. Electron Microscopic Studies To further characterize chronic histopathology, rats were anesthetized and perfused with 4% paraformaldehyde followed by a fixative solution (2% glutaraldehyde, 2% paraformaldehyde, and 2 mM CaCl2 in 0.1 M cacodylate buffer, pH 7.3). Next, 1m sections were cut from the lesion epicenter with glass knives on an ultramicrotome, stained with toluidine blue, and examined under light microscopy. After fixation with 2.5% glutaraldehyde, the TEM samples were post-fixed with 1% osmium tetroxide, dehydrated, and flat embedded in Epon 812 epoxy resin (Tousimis, Rockville, MD). A Reichert OMU3 ultramicrotome (Austria) was used to prepare 600Å thin sections that were mounted on 200 mesh copper grids, stained with uranyl acetate and lead citrate. The sections were viewed under a JEOL (Tokyo, Japan) JEM 100C electron microscope. F3or SEM, after fixation with 2.5% glutaraldehyde, the samples were dehydrated, critical point dried (Denton Critical Point Apparatus, Cherry Hill, NJ), and sputtercoated (Commonwealth Scientific, Alexandria, VA) with 200Å gold. The samples were viewed under a JEOL (Tokyo, Japan) JSM35 electron microscope and were tilted and rotated for a cross-section view. Subcellular Fractionation and Western Blot Analysis Different protein levels in spinal cord tissue after SCI were compared with those in laminectomy controls and hUCB-treated samples. For Western blot analysis, rats (n 3 per group) were euthanized, and 2-cm lengths of spinal cord centered on T10 (the injury site) were rapidly removed, weighed, and frozen at 70°C until used. Segments of spinal cord (5 mm) were isolated using the lesion site as the epicenter and

the tissues were resuspended in 0.2 mL of homogenization buffer (250 mM sucrose, 10 mM HEPES, 10 mM Tris-HCl, 10 mM KCl, 1% NP-40, 1 mM NaF, 1 mM Na3VO4, 1 mM EDTA, 1 mM DTT, 0.5 mM PMSF plus protease inhibitors: 1 g/mL pepstatin, 10 g/mL leupeptin, and 10 g/mL aprotinin, with pH of 7.4) and homogenized in a Dounce homogenizer. Tissue homogenates were centrifuged at 14,000g for 20 min at 4°C. Protein levels in the super- natant were determined using the BCA assay (Pierce, Rockford, IL). Samples (50 g of total protein per well) were subjected to 10–14% SDS-PAGE (Laemmli and Favre, 1973) and transferred onto nitrocellulose filters and the reaction was detected with Hyperfilm-MP autoradiography film (Amersham, Piscataway, NJ). For Western blot analysis, the following antibodies were used: rabbit anti-Neurotrophin-3 (1:500 dilution; Abcam, Cambridge, MA), mouse anti-MBP (1:5000 dilution; BD Biosciences, Franklin Lakes, NJ), goat anti-PLP (1:1000 dilution; Chemicon, Temecula, CA) and sheep anti- BDNF (1:500 dilution; Chemicon). The membranes were blocked with 5% nonfat skim milk in TBS for 1 h at room temperature and then incubated with primary antibodies overnight at 4°C. The membranes were then processed with HRP-conjugated secondary antibodies. Immunoreactive bands were visualized using chemiluminescence ECL Western blotting detection reagents (Amersham, Piscataway, NJ). Experiments were performed in triplicate to ensure reproducibility. Values for injured and control samples were compared using the Student’s t-test. A p value of less than 0.05 was considered significant. Immunohistochemical Assessment To evaluate the cellular characteristics of transplanted cells in vivo, we performed immunohistochemical analysis. Three weeks after the induction of SCI, rats were perfused with PBS and 4% paraformaldehyde. The animals’ spinal cords were removed and fixed in 4% paraformaldehyde. After fixation for an additional hour, 1.5-cm lengths of spinal cord tissue centered at T10 (the injury site) were cryoprotected and frozen in blocks that contained both normal and injured tissue; and serial longitudinal and cross sections (5 m thick) of the spinal cord were obtained with a microtome and cryostat. The specimens were then stored at 80°C for less than 1 month before further processing. The lesion was reconstructed by staining slides representing each millimeter of tissue with luxol blue, hematoxylin, and eosin. Additional slides representing the epicenter and levels 1 and 2 mm rostral and caudal to the lesion were used for immunocytochemistry. Following storage, the sections were rinsed with PBS for 20 min. The sections were then treated with blocking solution (1% BSA in 1 PBS) to prevent nonspecific staining, and were incubated with primary antibodies (1:100 dilution; 1:200 dilution for the secondary antibody) overnight at 4°C. Neuronal or glial markers were detected using fluorescent staining. We used the following primary antibodies: mouse anti-CD44 (Biomeda, Foster City, CA)/ rabbit anti-CD44 (Abcam), rabbit anti-GFAP (Abcam), rabbit antineurofilament H 200kD (NF200; Chemicon), rabbit anti-NT-3 (Abcam), mouse anti-MBP (BD Biosciences), goat anti-PLP (Chemicon), sheep anti- BDNF (Chemicon), and mouse anti-APC (Calbiochem). After staining with primary antibodies, the sections were washed three times in PBS (10 min/wash) and incubated in goat anti-mouse or anti-rabbit HRP-conjugated secondary antibodies. After 1 h, sections were washed three times in PBS (10 min/wash), incubated in DAB solution (Sigma) until staining was evident microscopically. For immunofluorescence studies, the sections were washed three times in PBS (10 min per wash) and incubated in Texas Red conjugated anti-mouse secondary antibody or FITC-conjugated anti-rabbit secondary antibody for 1 h at room temperature. Sections were then washed three times in PBS (10 min per wash), counter stained with DAPI, cover slipped using fluorescent mounting medium (Dako, USA), and observed under both fluorescence microscope (IX71; Olympus, Melville, NY)

Now In collaboration with national Egyptian banks you can store your baby’s cord blood with us for 20 years through small bank installments For more info Call 1138 www.cellsafebank.com

and a confocal microscope (Olympus Fluoview). Negative controls (without primary antibody) were maintained for all the samples. Fluorescent images were captured using a fluorescence microscope (IX71 Olympus) and/or a confocal microscope (Olympus Fluoview) and counted using Image-Pro Discovery Analysis software (Media Cybernetics, Silver Spring, MD). Statistical analysis was performed by comparing groups using Student t-test (p 0.05). RNA Extraction and Neurotrophic Factors

RT-PCR

Total RNA from the epicenter of the spinal cords of sham control, injured and hUCBtreated rats were isolated using RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Total RNA concentrations were determined spectrophotometrically. Next, 1g of total RNA was reverse transcribed into cDNA in reverse transcription reaction with SuperScript One-Step RT-PCR System with Platinum Taq (Invitrogen) according to the manufacturer’s instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as control. We used the following sequences for the forward and reverse primers: • For BDNF: 5GTGA TGACCA TCCTTTTCCTT3 (forward) and 5CCACTATCTTCCCCTTTTAAT- GGT3 (reverse) • For NT-3: 5GTGACCA TGTCCA TCTTGT3 (forward) and 5 GCCAA TTCA TGTTCTTCCGA T3 (reverse) • For MBP: 5 GTGA TGGCA TCACAGAAGAGA3 (forward) and 5CTCTCAGCGTCTTGCCA TGGG- AGA3 (reverse) • F o r P L P : 5GCCAAAGACATGGGTTTGTTAGAGT3 (forward) and 5GGGAGA TCAGAACTTG-GTGCCT3 (reverse)

• For GAPDH: 5CCACCCA TGGCAAA TTCC3 (forward) and 5CAGGAGGCA TTGCTGA TGA T3 (reverse) The housekeeping gene GAPDH was used for normalization of BDNF, NT-3, MBP, and PLP mRNA expression. Optimum annealing temperatures, cycle numbers, and RT input were empirically determined by amplification of a single PCR product at the appropriate molecular weight for each target cDNA. Samples were subjected to 25–35 cycles at 95°C for 30 sec, 58–60°C for 30 sec, and 72°C for 1 min on GeneAmp PCR System 9700 (Perkin Elmer, Boston, MA) in 25-L reaction volumes. After amplification, RT-PCR products were separated on a 1% agarose gel containing 0.5 mg/mL ethidium bromide. The amplified cDNA fragments were visualized under ultraviolet light. Densitometry readings of gel bands were performed using a ChemiImager Model 2.1.C (Alpha Innotech Co., San Leandro, CA). Experiments were performed in triplicate and the values obtained for the relative intensity were subjected to statistical analysis. Fluorescent In Situ Hybridization (FISH) Analysis For mRNA in situ hybridization we followed the method of Wrathall et al. (1998) with slight modifications. At 21 days after SCI, spinal cords from injured rats, hUCB-treated rats and controls (n 3) were rapidly removed. The tissue was frozen in blocks that contained one uninjured control and one or more injured and hUCB- treated spinal cords. Serial 5-m cross-sections were prepared on a cryostat, thaw mounted on slides coated with 3-aminopropyltriethoxysilane (Sigma) and stored frozen until they were used for in situ hybridization. Oligonucleotide antisense sequences with a length of 48 bases were used as probes for the following genes: neurotrophic hormones NT3 and BDNF; PLP, a major protein of CNS myelin and MBP, a major component of CNS myelin.

NT3 sense: GCCAGGCCAGTCAAAAACGGTTGCA- GGGGGA TTGA TGACAAACACTGG NT3 antisense: CCAGTGTTTGTCATCAATCCCCCTGCAACCGTTTTTGACTGGCCTGGC BDNF sense: AGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAA TGCC BDNF antisense: GGCATTGCGAGTTCCAGTGCCT- TTTGTCT A TGCCCCTGCAGCCTTCCT PLP sense: TCCAGAGGCCAACATCAAGCTCATTCTTTGGAGCGGGTGTGTCA TTGT PLP antisense: ACAATGACACACCCGCTCCAAAG- AA TGAGCTTGA TGTTGGCCTCTGGA MBP sense: ATGGCATCACAGAAGAGACCCTCACAGCGACACGGATCCAAGTACTTG MBP antisense: CAAGTACTTGGATCCGTGTCGCTGTGAGGGTCTCTTCTGTGA TGCCA T

The oligonucleotides were labeled with FITC at 3 ends (Sigma-Genosys, The Woodlands, TX). For in situ hybridizations, slides were post-fixed with 4% formaldehyde in PBS, pH 7.4, for 10 min, acetylated (0.25% acetic anhydride in 0.1 M triethanolamine HCl, pH 8, for 10 min), and dehydrated with graded alcohols and chloroform. They were then incubated overnight at 37°C with hybridization buffer [50% formamide, 5 SSC, 5 Den- hardt’s solution (1% BSA, 1% Ficoll and 1% Polyvinyl pyrrolidone), 0.025% bakers yeast tRNA (Sigma) and 0.05% herring sperm DNA (Sigma)] containing 200 ng/mL of each oligonucleotide probe. The next day, slides were washed sequentially with 2 SSC (0.15 M NaCl, and 15 mM sodium citrate, pH 7.0) for 5 min at room temperature, 0.2 SSC (1 h at 72°C in shaking water bath) and 0.2 SSC (5 min at room temperature) and then allowed for detection of fluorescent-labeled probes using ELF 97 mRNA in situ hybridization kit (Invitrogen). Finally, the slides were counterstained with Hoechst 33342 (for visualization of cell nuclei) and mounted using mounting medium. Visualization of FISH signal was done with a fluorescence microscope (IX71 Olympus) and/or a confocal microscope (Olympus Fluoview). Sections stained with sense probes served as controls, which do not show any signal.

Statistical Analysis Quantitative data from open-field locomotor scores were evaluated for statistical significance by one-way analysis of variance (ANOVA) with replications; data from RT-PCR and Western blot analyses were also evaluated for statistical significance using one-way ANOVA. Results were considered statistically significant at p 0.05. All data points represent group mean SEM.

AXONAL REMYELINATION BY CORD BLOOD STEM CELLS

FIG. 1. Transdifferentiation of hUCB into neural phenotypes in vitro. RA-treated CD44! cells were fixed and incubated with primary antibodies directed against NF-200 (A), GFAP (B), and APC (C). After immunostaining, cells were counterstained with DAPI. Neural cell markers and phase-contrast images were merged. Extreme left panel shows bright field images and extreme right panel shows nuclei of the cells stained with DAPI. Scale bar " 50 !m. (A) Cells expressing NF-200 and displaying neuron like morphology with long axonal projections. (B) Cells immunostained with the anti-GFAP antibody. Some of the cells are round and relatively small, whereas others contain long projections with immunoreactive filamentous structures that are visible in the cytoplasm. (C) APC-immunoreactive cells displaying morphology characteristic of oligodendrocytes, with flat cell body and short or long branched projections. Smaller, round immunoreactive cells are also occasionally present. All these cells exhibit CD44 markers specific for hUCB. A subpopulation of hUCB-derived cells growing in a monolayer before clone formation was found to be negative for all investigated antigens. The results are expressed as the mean # SE of cell number from nine independent cultures (three parallel experiments from three separate cord blood preparations).

RESUL TS

Survival and Differentiation of hUCB In Vivo in the Injured Spinal Cord

One week after SCI, hUCB were transplanted into the injury site of hUCBFig. 2A), oligodendrocytes (APC; 2B) and astrocytes around the injury epicenter (Fig. 3A). In contrast, in In Vitro Differentiation ofFig.Stem treated group. Two weeks after transplantation, robust survival of (GFAP; Fig. 2C) could be identified distinctly. Most sur- hUCB-treated rats, colocalization studies confirmed transplanted hUCB was observed in the spinal cords of treated rats, with Cellsviving to Neural Phenotypes hUCB were oligodendrocytes (46.19% were APC- the presence of hUCB-differentiated oligodendrocytes cells distributed around the cavities throughout the injury site. The

labeled) followed by neurons, with some hUCB-derived as- widely distributed around theneural injuryphenotypes epicenter,intowards differentiation of these hUCB into several the spinal In order to establish differentiation potential trocytes presentthe in the dorsal region of the of cord (Table white matter (Fig. 3B).analysis Mostly, we2). observed cord2). couldthe be dorsal traced by immunoflourescence (Fig. Surviving hUCB before intraspinal grafting, we assessed the We observed differentiation of hUCB up to 2mm rostrohUCB-differentiated oligodendrocytes towards cauhUCB labeled with antibodies against markers specific for stemthe cells (CD trans- differentiation of these stem cells to neural caudally to the injury epicenter. Many of the hUCB-derived dal region the injury epicenter thanprotein; rostral Fig. region. 44) co-localized withof NF-200 (a neurofilament 2A), phenotypes under in vitro conditions. Human UCB can oligodendrocytes (APC; Fig. 2B) and astrocytes (GFAP; Fig. 2C) could be oligodendrocytes immunoreactive be induced to differentiatewere and also express neural-specificfor MBP and Hence, we confined our study to the dorsal white matter, identified caudal distinctly. Mostinjury sur- epicenter. viving hUCB were oligodendrocytes PLP, which are integral components of myelin. to the Myelination was found antigens. When exposed to hEGF/RA, hUCB (46.19% were APClabeled) followed by neurons, withthe some hUCBthroughout the dorsal white matter and along margins morphologically appear to take on some of the derived astrocytes present in the dorsal region of the cord (Table 2). We of the lesion zone of hUCB-treated group. An important features of neural cells in culture, including long Demyelination due to Spinal Cord Injury observed differentiation of hUCB up to 2mm rostrocaudally to the change in the myelin was the presence of vacuoles as injury the bipolar extensions and branching ends. We observed epicenter. Many of the hUCB-derived oligodendrocytes were also neural differentiation of hUCB the afterextent 10 days culture. We next evaluated of in axonal demyelination myelin layers separated as revealed by electron microimmunoreactive for MBP and PLP, which are integral components of After neural culture,after cellsSCI. fromDegenerative hUCB expressed the in the spinal scopic studies (Fig. 3C). Many axons showed degeneraand survival changes myelin. neural cord antigens found in neurons (NF-200) 1A), In SCI rats, tion, and extracellular space increased (Fig. 3D). Many were observed at three weeks (Fig. post-SCI. astrocytes 1B), of andoligodendrocytes oligodendroytes was evident demyelinated axons appeared morphologically normal, loss (GFAP; of large Fig. numbers Demyelination due to Spinal Cord Injury (APC; Fig. 1C). Among the differentiated cells, neurons comprised the major population followed by oligodendrocytes and astrocytes (Table 2). The stem cells expressed these markers only after culture in the neurogenic differentiation media.

We next 397evaluated the extent of axonal demyelination and survival after SCI. Degenerative changes in the spinal cord were observed at three weeks post-SCI. In SCI rats, loss of large numbers of oligodendrocytes was evident around the injury epicenter (Fig. 3A).

DASARI ET AL.

FIG. 2. Survival and differentiation of hUCB in rat spinal cords. Differentiation of hUCB in injured spinal cords showing specific antigens: CD44 (hUCB marker) colocalized with the following: (A) NF-200 (a neurofilament protein). (B) APC (oligodendrocyte marker). (C) GFAP (an astrocyte marker). The differentiation of hUCB in vivo was observed after intraspinal grafting into injured spinal cords 7 days post-SCI. NF-200-, GFAP-, and APC-positive cells occurred in the vicinity of the injury site. Scale bar ! 100 !m. Results are from three independent sections 2 mm caudal from the injury epicenter (n " 3).

Some axons were wrapped by thin myelin relative to their axonal diameters In contrast, in hUCB-treated rats, co-localization although some showed axoplasmic organelle condensacated that demyelination contusive in hUCB-treated spinal cords, occurred thereby after suggesting re- SCI myelination. In studies confirmed the presence of hUCB-differentiated tion, suggesting axonal degeneration. However, many with some of the demyelinated axons going the conclusion, ultrastructural analysis indicated that through demyelination occurred oligodendrocytes widely distributed around the injury healthy-appearing demyelinated axons, which were after un- contusive process of remyelination after treatment withaxons hUCB. SCI with some of the demyelinated going through the epicenter, towards the dorsal white matter (Fig. 3B). dergoing remyelination, were evident in the hUCBprocess of remyelination after treatment with hUCB. Mostly, we observed hUCB-differentiated treated rats (Fig. 3E). Scanning electronic microscopic oligodendrocytes towards the caudal region of the Survival of Differentiated Oligodendrocytes studies reveal that the myelin around the axons and surSurvival of Secretion Differentiated Oligodendrocytes and Secretion of Neurotrophic injury epicenter than rostral region. Hence, we and of Neurotrophic Hormones rounding the growth cones of axons was damaged in Hormones inin the Spinal Cord confined our study to the dorsal white matter, caudal to in the Spinal Cord jured spinal cords (Fig. 3F), whereas in the hUCB-treated the injury epicenter. Myelination was found throughout groups, remyelination aided in the development and navNext, we addressed whether axonal remyelination is Next, we addressed whether axonal remyelination is mediated by hUCBthe dorsal white matter and along the margins of the igation of growth cones (Fig. 3G). Some axons were mediated by hUCB-derived oligodendrocytes or due to derived oligodendrocytes or due to endogenous repair mechanisms of the lesion zone of hUCB-treated group. An important wrapped by thin myelin relative to their axonal diame- endogenous repair mechanisms of the injured spinal cord. injured spinal cord. Two weeks after transplantation, the number of cells change in the myelin was the presence of vacuoles as ters in hUCB-treated spinal cords, thereby suggesting re- Two weeks after transplantation, the number of cells that that had survived and differentiated into several neural phenotypes after the myelin layers separated as revealed by electron myelination. In conclusion, ultrastructural analysis indi- had survived and differentiated into several neural phenotransplantation was evaluated by immunoreactivity. Oligodendrocyte microscopic studies (Fig. 3C). Many axons showed survival after SCI was evaluated using APC immunolabeling. The number degeneration, and extracellular space increased (Fig. of APC-positive cells was greatly reduced after SCI. However, we observed 3D). Many demyelinated axons appeared 398 good recovery of oligodendrocytes in the hUCB-treated group, in which morphologically normal although some showed APC-positive cells were distributed along the dorsal regions of the white axoplasmic organelle condensation, suggesting axonal matter. Three weeks post-SCI, axons were present in differing degrees degeneration. However, many healthy-appearing within all hUCB-transplanted spinal cords. This suggests that demyelinated axons, which were undergoing neuritogenesis at the lesion site can be enhanced by the presence of growthremyelination, were evident in the hUCB- treated rats promoting substrates. The extent of axon growth can be influenced by (Fig. 3E). Scanning electronic microscopic studies growth factor expression. Once we confirmed that most surviving hUCB reveal that the myelin around the axons and surwere oligodendrocytes, we evaluated the secretion of neurotrophic rounding the growth cones of axons was damaged in hormones NT3 and BDNF and myelin components MBP and PLP in the injured spinal cords (Fig. 3F), whereas in the hUCBspinal cord using DAB treated groups, remyelination aided in the development and navigation of growth cones (Fig. 3G).

FIG. 3. Remyelination due to intraspinal grafting of hUCB. Section from injured rats showing loss of oligodendrocytes around the injury epicenter (A). The section is stained with APC antibody. (B) Greater preservation of oligodendrocytes in hUCB-treated sections. Merged image of section immunostained with APC and CD44 antibodies. (Insets) For both A and B, inset shows DAPI images. Transmission electron micrographs showing deformation of myelin sheath and axons in contused spinal cords (!) (C,D). Myelin is thin and fragmented in many axons (*). In contrast, hUCB-treated sections showing normal myelin with several layers (E) (!) indicates demyelinated axons undergoing remyelination. Scanning electron micrographs showing ruptured myelin (!) in injured (F) and smooth myelin sheath (!) in hUCB-treated (G) spinal cords. Magnification shown at 35,000! for TEM and 15,000! for SEM (n " 2).

DASARI ET AL.

FIG. 4. Stem cellâ&#x20AC;&#x201C;mediated secretion of neurotrophic factors and synthesis of myelin proteins in treated rats. Immunohistochemical comparison of uninjured sham control, injured and hUCB-treated spinal cord sections was performed to analyze the secretion of neurotrophic hormones (NT3 and BDNF) and synthesis of myelin proteins (MBP and PLP). Paraffin sections from spinal cord blocks adjacent to the epicenter were probed with respective antibodies using DAB immunohistochemistry and counterstained with hematoxylin to stain the live nuclei and then photographed using bright-field microscope. Arrows indicate the stained portions with respective antibodies. *Note that the presence of demyelinated axons in the injured sections are indicated. Scale bar ! 200 !m. Results are from three independent sections caudal from the injury epicenter (n " 3).

types after transplantation was evaluated by immunoreactivity. Oligodendrocyte survival after SCI was evaluated using APC immunolabeling. The number of APC-positive cells was greatly reduced after SCI. However, we observed good recovery of oligodendrocytes in the hUCB-treated

group, in which APC-positive cells were distributed along the dorsal regions of the white matter. Three weeks post-SCI, axons were present in differing degrees within all hUCB-transplanted spinal cords. This suggests that neuritogenesis at the lesion site can be en-

400

AXONAL REMYELINATION BY CORD BLOOD STEM CELLS

FIG. 5. Confocal scanning microscope images demonstrate the secretion of neurotrophic hormones in spinal cords of rats. Cryosections from spinal cord blocks adjacent to the epicenter were processed for immunoflourescence studies as described in the text. Sections were immunostained with FITC-conjugated CD44 and Texas-red conjugated APC antibodies. Further, they were DAB-stained with NT3 and BDNF antibodies. All the sections were stained with DAPI for showing nuclear localization. In hUCB-treated sections, remyelination was established by co-localization of APC with NT3 and BDNF (A,B). Arrows indicate NT3 and BDNF secreting hUCB-derived oligodendrocytes. Scale bar ! 200 !m. Quantitative estimation from sham control, injured, and hUCB treated sections for NT3 (C) and BDNF (E). (D,F) Quantitation of hUCB-derived oligodendrocytes secreting NT3 and BDNF respectively. Results are from three independent sections caudal from the injury epicenter (n " 3). Error bars indicate SEM. *Significant at p # 0.05.

colabeling with APC and the Schwann cell marker. Quantitative analysis immunochemistry (Fig. 4). The increased expression of hanced by the presence of growth-promoting substrates. immunochemistry 4). The increased expression of indicates that higher numbers (Fig. of oligodendrocytes, which secrete NT3 these two neurotrophic hormones and the synthesis of extent ofby axon growth can be growth neurotrophic hormones theassynthesis BDNF,these were two present in hUCB-treated spinaland cords comparedofto myelinThe components hUCB establish the influenced prominent by and expression. Once we confirmed myelin components by hUCB establish the prominent role injured spinal cords (Fig. 5C,5E). A significant proportion of NT3-serole offactor stem cells in the remyelination of axons.that most surviving hUCB were oligodendrocytes, we evaluated the secretion of stem cellsoligodendrocytes in the remyelination axons. tion; Fig. 5D) creting hUCB-derived (11.41ofcells/secof neurotrophic hormones BDNF and and myelin To determine the maturation state of the transplanted BDNF-secreting hUCB-derived oligodendrocytes (9.66 cells/ To determine the maturation state NT3 of theand transplanted section; Fig. 5F) were observed in treated rats. The hUCB-derived components MBP and PLP in the spinal cord using DAB hUCB, cells were double immunostained with NT3, hUCB, cells were double immunostained with NT3, oligodendrocytes constitute a significant proportion of oligodendrocytes BDNF and a mature oligodendrocyte marker, APC. As apart from 401 the endogenous population suggesting the role of hUCB-deshown in Figure 5, transplanted hUCB-differentiated rived oligodendrocytes in the secretion of NT3 and BDNF. oligodendrocytes expressed NT3 and BDNF respectively, apposing the longitudinal axons in the white matter, suggesting that some transplanted hUCB formed mature myelin (Fig 5A,B). Although APC has been reported previously to label Schwann cells in addition to oligodendrocytes after SCI (McTigue et al., 1998), we did not observe

Similarly, we also evaluated the immunoreactivity of MBP and PLP proteins, which are constituent proteins of the myelin sheath. Colocalization studies with three antibodies established the role of hUCBderived oligodendrocytes in the synthesis of MBP and PLP proteins (Fig. 6A,B)

DASARI ET AL.

FIG. 6. Confocal scanning microscope images demonstrate the synthesis of myelin proteins in spinal cords of rats. Cryosections from spinal cord blocks adjacent to the epicenter were processed for immunoflourescence studies as described in the text. Sections were immunostained with FITC-conjugated CD44 and Texas-red conjugated APC antibodies. Further, they were DAB-stained with MBP and PLP antibodies. All the sections were stained with DAPI for showing nuclear localization. In hUCB-treated sections, remyelination was established by co-localization of APC with MBP and PLP (A,B). Arrows indicate MBP and PLP synthesizing hUCBderived oligodendrocytes. Scale bar ! 200 !m. Quantitative estimation from sham control, injured and hUCB treated sections for MBP (C) and PLP (E). (D,F) Quantitation of hUCB-derived oligodendrocytes synthesizing MBP and PLP, respectively. Results are from three independent sections caudal from the injury epicenter (n " 3). Error bars indicate SEM. *Significant at p # 0.05.

Quantitative analysis confirmed the presence of higher significantly in the injured sections, compared with the BDNF and a mature oligodendrocyte marker, APC. As decreased gesting that some transplanted hUCB formedasmature numbers MBP-positive cells hUCB-differentiated (Fig. 6C) and corresponding segments of shamAPC control rats (Fig. 7). preTreatment of SCI shownofinAPC, Figure 5, transplanted myelin (Fig 5A,B). Although has been reported APC, PLP-positive cells (Fig.NT3 6E)and in BDNF hUCB-treated with hUCB thecells transcription the genes of the present oligodendrocytes expressed respectively, ratsviously to labelrestored Schwann in additionoftoall oligodendrospinal cords. the Similar to the axons neurotrophic hormones, apposing longitudinal in the white matter, sug- study. cytesCo-immunofluorescence after SCI (McTigue et al.,studies 1998), we not observe withdidhUCB-specific antibodies hUCB-derived oligodendrocyte synthesized MBP and illustrates that hUCB are involved in the synthesis of neurotrophic PLP cells were 8.74 (Fig. 6D) and 10.74 (Fig. 6F) hormones and myelination genes. This would augment myelin formation 402 respectively, per each section analyzed. by the oligodendrocytes and improve locomotor function after SCI. These results support the ultra structural studies of remyelination by Fluorescent In Situ Hybridization (FISH) Analysis hUCB. To establish the loss of neurotrophic hormones and myelin proteins after SCI, we determined the mRNA levels of neurotrophic hormones NT3, BDNF and MBP, PLP genes using FISH technique. The level of mRNA expression of all the above genes was

Western Blot and RT-PCR Analyses To further confirm the secretion of neurotrophic hormones and the synthesis of myelin proteins by hUCB-derived oligodendrocytes at the transcription and translation levels, we used RT-PCR and Western blot analyses. The change in the mRNA levels after SCI was determined

AXONAL REMYELINATION BY CORD BLOOD STEM CELLS

FIG. 7. Pattern of mRNA expression of neurotrophic factors and myelin proteins in spinal cords of rats. FISH analysis of neurotrophic factors and myelin proteins depicting sham control, injured, and hUCB-treated samples in the dorsal white matter region. Sequential serial sections hybridized with FITC-conjugated oligonucleotide antisense probes for NT3, BDNF, MBP, and PLP were photographed using confocal microscope as described in the text. hUCB treated sections show colocalization with CD44 antibody, specific for hUCB. (Inset) Representative Hoechst-33342 stained images. Scale bar ! 100 !m. Results are from three independent sections caudal from the injury epicenter (n " 3).

colabeling with APC and the Schwann cell marker. Quantitative analysis indicates that higher numbers of oligodendrocytes, which secrete NT3 and BDNF, were present in hUCB-treated spinal cords as compared to injured spinal cords (Fig. 5C,5E). A significant proportion of NT3-secreting hUCB-derived oligodendrocytes (11.41 cells/section; Fig. 5D) and BDNF-secreting hUCB-derived oligo-

dendrocytes (9.66 cells/section; Fig. 5F) were observed in treated rats. The hUCB-derived oligodendrocytes constitute a significant proportion of oligodendrocytes apart from the endogenous population suggesting the role of hUCB-derived oligodendrocytes in the secretion of NT3 and BDNF. Similarly, we also evaluated the immunoreactivity of MBP and PLP proteins, which are constituent proteins of

403

DASARI ET AL.

FIG. 8. Expression of neurotrophic factors and myelin proteins in injured and treated spinal cords of rats. RT-PCR analysis of neurotrophic factors and myelin proteins depicting control, sham control, injured, and hUCB-treated samples (A). Housekeeping gene GAPDH was used as loading control. Quantitative data showing pixel density of RT-PCR bands (n ! 2; B). Western blot analysis of changes in the levels of neurotrophic factors and myelin proteins following spinal cord injury and hUCB treatment (C) and their corresponding quantitative analysis of bands using Image Pro software (D). There was no significant difference between control and sham controls. GAPDH was used as loading control. This figure shows representative gels and blots obtained in one experiment that was repeated three times with similar results (n ! 3). Error bars indicate SEM. *Significant at p " 0.05.

the myelin sheath. Co-localization studies with three antibodies established the role of hUCB-derived oligodendrocytes in the synthesis of MBP and PLP proteins (Fig. 6A,B). Quantitative analysis confirmed the presence of higher numbers of APC, MBP-positive cells (Fig. 6C) and APC, PLP-positive cells (Fig. 6E) in hUCB-treated spinal cords. Similar to the neurotrophic hormones, hUCB-derived oligodendrocyte synthesized MBP and PLP cells were 8.74 (Fig. 6D) and 10.74 (Fig. 6F) respectively, per each section analyzed.

the injured sections, as compared with the corresponding segments of sham control rats (Fig. 7). Treatment of SCI rats with hUCB restored the transcription of all the genes of the present study. Co-immunofluorescence studies with hUCB-specific antibodies illustrates that hUCB are involved in the synthesis of neurotrophic hormones and myelination genes. This would augment myelin formation by the oligodendrocytes and improve locomotor function after SCI. These results support the ultra structural studies of remyelination by hUCB.

Fluorescent In Situ Hybridization (FISH) Analysis

Western Blot and RT-PCR Analyses

To establish the loss of neurotrophic hormones and myelin proteins after SCI, we determined the mRNA levels of neurotrophic hormones NT3, BDNF and MBP, PLP genes using FISH technique. The level of mRNA expression of all the above genes was decreased significantly in

To further confirm the secretion of neurotrophic hormones and the synthesis of myelin proteins by hUCB-derived oligodendrocytes at the transcription and translation levels, we used RT-PCR and Western blot analyses. The change in the mRNA levels after SCI was determined us-

404

AXONAL REMYELINATION BY CORD BLOOD STEM CELLS

FIG. 9. Hind limb functional recovery after spinal cord contusion. The BBB locomotor rating scale showed functional recovery of all hUCB-treated animals until day 21 post-SCI. The score indicating a gait characterized by no hind limb weight bearing and no coordinated hind limb movement is 0, whereas the score indicating a gait characterized by partial hind limb weight bearing and partial hind limb coordination is 13. The locomotor recovery scores averaged across hind limbs for weekly testing of rats with moderate contusion using NYU impactor (A). Each point represents the highest locomotor score achieved each day. Error bars indicate SEM (n " 5 per group). Video images of hind limb movements in rats (B). Spinal cord injury with NYU impactor resulted in paraplegia of hind limbs of rats when compared to normal rats. The hind limbs are internally rotated and the tail is not supporting the body weight. In hUCB-treated rats, hind limbs are recovered from the injury and are externally rotated. Pre, DASARI ET AL. pre-operative; PO, post-operative; ! indicates transplantation point. Error bars indicate SEM. *Significant at p # 0.05).

TABLE 2. DIFFERENTIATION OF hUCB IN VITRO AND IN VIVO graft may promote ne using standardized RT-PCR analysis. There was tection and secretion ing standardized RT-PCR analysis. store hind limb locomotor function after SCI. Hind limb significant upregulation of NT3, BDNF,There MBPwas and significant PLP In vitro In vivo upregulation of NT3, BDNF, MBP and PLP genes (Fig. locomotor performance was tested in all rats using the al., 2005). Cord bloo genes (Fig. 8A,B) in hUCB-treated rats as compared to Marker (%) (%) 8A,B) in hUCB-treated rats as compared to injured rats. BBB open-field procedure described above. All animals in neurological and f injured rats. Similar results were obtained at the Similar results were obtained at the protein level (Fig. were subjected to BBB testing at 1, 7, 14, and 21 days protein level (Fig. 8C,D) also. Western blot analysis NF-200 46.31 " 0.81 37.83 " 0.68 spinal cord rats (Kuh 8C,D) also. Western blot analysis indicated reduced bands post-SCI and before transplantation. Animals with a"low indicated reduced bands of neurotrophic factors in the GFAP 17.21 " 0.29 15.98 0.49 Saporta et al. (2003) of neurotrophic factors in to thetheinjured cords in spinal comparison APC score and equally dysfunctional hind limbs were selected injured cords in comparison hUCB-treated 36.48 " 0.47 46.19 " 0.71 cial in reversing the b to the hUCB-treated spinal cords. There were no signifi- for transplantation with hUCB. Performance in open field cords. There were no significant differences observed jury, even when infu Quantification of the extent of NF-200, GFAP and APC expressing differences observed in control and sham was by transplantation of hUCB. Quantification of enhanced the extent of NF-200, GFAP and APC ex- hypothesized that 7 d in cant control and sham control rats. These data control were rats. locomotion cells neurogenic induction medium vitro and the These data were with the immunohistochemistry In incontrast inability of the ininjured group to injured suppressing cells to in the neurogenic induction medium ininvitro and in spinal consistent with theconsistent immunohistochemistry results and time for grafting hUC cord in vivo results and that NT3 and BDNF enhanced the theport weight with their hind For limbs, rats transplanted injured spinal cord in vivo. in vitro experiments, with the resuggested that suggested NT3 and BDNF enhanced the survival, tion potential of axo survival, differentiation, and myelination of hUCB-derived sults hUCB demonstrated partial ambulation are expressed as the meanweight-supported " SE of cell number from nine differentiation, and myelination of hUCB-derived with their hind limbs, rats transplanted with hUCB demonstrated oligodendrocytes in vivo. (Fig. 9). A statistical in BBB from scores was independent cultures (three difference parallel experiments three sep- hind limbs after SC oligodendrocytes in vivo. partial weight-supported ambulation (Fig. 9). A statistical difference achieved 2 weeks after transplantation. arate cord blood preparations [hUCB]). For inThe vivosham-operexperiments, medium that promote in BBB scores was achieved 2 weeks after transplantation. The shamLocomotor Functional Recovery group showed almost normal function theated results are expressed as the mean " SE of cellthroughout number from of neuronal populatio Locomotor Functional Recovery after Transplantation operated group showed almost normal function throughout entiation the after Transplantation of hUCB of stem cell three from the injury epicenthe independent observationsections period.2 mm The caudal injured group had BBB of hUCB observation period. The injured group had BBB scores of 0 for both astrocytes was observ from hUCB treated (n 1#day 3). post-SCI, which then of 0 for bothgroup legs at Finally, we checked whether the transplantation of terscores legs at 1 day post-SCI, which then gradually increased to final scores jor population. In con gradually increased to final scores of 6.54 ! 0.21 at 3 hUCB, which helped in remyelination of axons, could reFinally, we checked whether the transplantation of of 6.54 0.21 at 3 weeks post-SCI (Fig. 9A). The hUCB-transplanted cells differentiated m hUCB, which helped in remyelination of axons, could group showed significantly improved hind limb performance at 2 405 rons. This is not surp restore hind limb locomotor function after SCI. Hind weeks (Fig. 9A).as The hUCB-transplanted group weeks post-SCI post-transplantation compared to the injured groups (p cord, stem cells prob limb locomotor performance was tested in all rats showed significantly improved hind limb at post0.05), with BBB scores of 15.78 0.15.performance At 2 weeks using the BBB open-field procedure described above. generation of lost oli the hUCB-treated showed consistent 2transplantation, weeks post-transplantation as group compared to the injuredplantar All animals were subjected to BBB testing at 1, 7, 14, stepping, forelimb-hind limb coordination and no toe-drag during groups (p ! 0.05), with BBB scores of 15.78 " 0.15. At and also in the remye and 21 days post-SCI and before transplantation. 9B). In contrast, the the hUCB-treated injured group exhibited no the molecular m 2walking weeks (Fig. post-transplantation, group ever, Animals with a low score and equally dysfunctional consistent plantar stepping, no toe clearance, and dragging of body of stem cells and thei showed consistent plantar stepping, forelimb-hind limb hind limbs were selected for transplantation with weight. Thus, the hUCB-transplanted group showed significantly are being studied. coordination and no toe-drag during walking (Fig. 9B). hUCB. Performance in open field locomotion was greater functional recovery than the injured group. However,Destruction of the In contrast, the injured group exhibited no consistent enhanced by transplantation of hUCB. In contrast to cyclosporine-treated rats showed some improvement over injured rats plantar stepping, no toe clearance, and dragging of body cord is believed to be the inability of the injured group to support weight (BBB average score of 9.15 0.31).

weight. Thus, the hUCB-transplanted group showed significantly greater functional recovery than the injured group. However, cyclosporine-treated rats showed some improvement over injured rats (BBB average score of 9.15 " 0.31).

extent of functional Balentine (1978) obse tramyelinic vacuoliz shown that many dem ons exist in the spina the demyelinated axo

DISCUSSION Demyelination results in the loss of motor functions subsequent to CNS injury. Restoring myelin through the transplantation of myelin-producing cells may offer a logical approach to recover optimal neurological functions. In addition to replacing lost cells, transplantation appears to modify the host environment to promote endogenous remyelination. Thus, remyelination appears to be one of the most feasible restoration strategies (Mc- Donald and Belegu, 2006). It has been reported that stem cells transplanted into the injured lesion were able to differentiate into oligodendrocytes and astrocytes, integrate into axonal pathways, and regenerate and remyelinate the injured axons (Ishii et al., 2001; McDonald and Howard, 2002; Murakami et al., 2003; Vroemen et al., 2003). Human cord blood stem cells are more pluripotent and genetically flexible than bone marrow neural stem cells and are more easily obtained. Various cell types within the graft may promote neural repair by delivering neural protection and secretion of neurotrophic factors (Sanberg et al., 2005). Cord blood stem cells have been implicated in neurological and functional improvements in injured spinal cord rats (Kuh et al., 2005). Previous studies by Saporta et al. (2003) have shown that hUCB are beneficial in reversing the behavioral effects of spinal cord injury, even when infused 5 days after injury. Hence, we hypothesized that 7 days post-injury would be the peak time for grafting hUCB and evaluating their remyelination potential of axons and functional improvement of hind limbs after SCI. Since we used the neurogenic medium that promotes differentiation of a mixed culture of neuronal population in the present study, trans-differentiation of stem cells to neurons, oligodendrocytes and astrocytes was observed in vitro, neurons being the major population. In contrast, in the injured spinal cord, stem cells differentiated mostly to oligodendrocytes than neurons. This is not surprising because, in the injured spinal cord, stem cells probably are more involved in the regeneration of lost oligodendrocytes in the injured areas and also in the remyelination of injured fiber tracts. How- ever, the molecular mechanisms of

trans-differentiation of stem cells and their survival in vivo for longer periods are being studied. Destruction of the myelinated long tracts of the spinal cord is believed to be a critical factor in determining the extent of functional impairment (Banik et al., 1980). Balentine (1978) observed vesicular degeneration and intramyelinic vacuolization after SCI in rats. We have shown that many demyelinated, but otherwise intact, axons exist in the spinal cord after contusive SCI and that the demyelinated axons survive for at least 3 weeks after the injury. These results are consistent with previous histological studies showing that there is chronic demyelination of axons after traumatic SCI in experimental animals (Balentine, 1978; Banik et al., 1980; Bam- bakidis et al., 2004; Cao et al., 2005a,b; Totoiu et al., 2005). Also, these results are in conformity with Bresnahan (1978), who observed ultrastructural details of many swollen axons, dark axons, empty myelin sheaths and myelin sheath with debris inside in spinal cords of SCI monkeys after three weeks. Since massive oligodendrocyte death attributable to apoptosis occurs acutely after SCI, it is likely that endogenous oligodendrocyte precursor cells are unable to completely restore lost myelin in the injured spinal cord. Increasing the number of cells with the ability to differentiate into oligodendrocytes by transplantation may be a very important method for replacing lost myelin. In this study, we observed reduced levels of MBP and PLP, both at the mRNA and proteins levels in the injured spinal cord, as revealed by FISH, RT-PCR and Western blot analyses. These results are in agreement with Wrathal et al. (1998) and Ray et al. (2003). We observed that many transplanted-hUCB differentiated into oligodendrocytes as compared to astrocytes or neurons. Both oligodendrocytes and myelinated axons were elevated within the hUCB-transplanted group. These data suggest that hUCB differentiated to oligodendrocytes, and the neurotrophins (NT3 and BDNF) secreted by these oligodendrocytes enhanced myelinogenesis. Ultrastructural analysis showed that the hUCB formed morphologically normal-appearing sheaths around

the axons in the injured areas. This is consistent with the rapidity of observed locomotor improvement (2 weeks) and the observation that most hUCB-derived cells were oligodendrocytes, many immunoreactive for myelin basic protein and proteolipid protein. Transplantation of oligodendrocytes or oligodendrocyte progenitors into demyelinating chemical lesions can be associated with remyelination and improved axonal conduction (Waxman, 1992). Other possibilities include the reduction of delayed oligodendrocyte death, or the enhancement of host axonal regeneration. We suggest that this enhancement of locomotion underlies the accelerated axonal growth and, hence, functional recovery. Traumatic spinal cord injury results in loss of tissue, including important myelinated fiber tracts carrying descending motor and ascending sensory information. Reduced myelination could result from loss of myelinating cells and/or reduced myelin synthesis by surviving oligodendrocytes. Both NT3 and BDNF regulate neuronal development and axonal regeneration (Xu et al., 1995). They are also important mediators of myelination. NT3 enhances the survival and proliferation of OPCs in vitro (Barres et al., 1994a; Kumar et al., 1998; Yan et al., 2000; Franklin et al., 2001) and in vivo (Barres et al., 1994b). Myelination by oligodendrocytes is also enhanced by NT3 in both cultures of neurons and the injured CNS (McTigue et al., 1998; Yan et al., 2000; Jean et al., 2003; Bambakidis et al., 2004). BDNF is important for myelin formation in peripheral nerve during development because inactivation of BDNF signaling by deleting trkB receptors causes myelin deficits both in vivo and in vitro (Barres et al., 1993; Cosgaya et al., 2002). The augmented myelination due to neurotrophic hormones NT3 and BDNF and myelin genes MBP and PLP may have been caused by direct action of the hUCB-transformed oligodendrocytes or their precursors.

Conclusion

These results suggest that umbilical cord blood stem cells are beneficial in reversing the behavioral effects of spinal cord injury, even when infused 7 days post-SCI. Further, hUCBderived cells were observed in injured areas, but not in noninjured areas of rat spinal cords. Behavioral recovery similar in magnitude to that shown here has previously been shown in

Although the suggestion has been made that mature oligodendrocytes can divide and contribute to remyelination (Wood et al., 1991), the majority of research has focused on and supported the hypothesis that endogenous oligodendrocyte progenitors are present within the CNS, which can differentiate into mature cells capable of myelinating bare axons (Norton, 1996). Axons of the mature mammalian CNS have an intrinsic capacity to regenerate, but they can do so for an extended distance when supported by a matrix that arises spontaneously at the injury site (West et al., 2001). However, co-localization studies suggest that the source of the new oligodendrocytes in the injured spinal cord was a population of hUCB, and that these oligodendrocytes secrete NT3 and BDNF. These NT3 and BDNF may, in turn, enhance proliferation and survival of oligodendrocyte precursors. A more in-depth analysis of the formation of new myelin is needed to examine this hypothesis. Another possibility is that proliferative oligodendrocyte progenitors are known to be present in the adult CNS. Also, precursor cells in the subcortical white matter differentiated in response to chemical demyelination and subsequently re- myelinated the lesion area (Gensert et al., 1997). Growth factors can increase the proliferation and survival of oligodendrocyte progenitors (Barres et al., 1993; Barres et al., 1994b; McMorris et al., 1996). The present study reveals that the presence of NT3 and BDNF in the injured spinal cord induced the formation of new oligodendrocytes. Furthermore, hUCB producing these neurotrophins promoted neuritogenesis and myelination of the in-growing axons.

acute injury models (Saporta et al., 2003). In the present study, we maintained a cyclosporinetreated group as another control to check the potential of hUCB in promoting functional recovery in SCI rats. It is apparent that the cyclosporine may have some synergistic effect with hUCB in improving significant functional recovery of hUCB-treated rats. The

results are consistent with the hypothesis that hUCB-derived stem cells migrate to and participate in the healing of neurological defects caused by traumatic insult. We continue to study the long-term survival and effects of hUCB on remyelination.

For more info Call 1138 www.cellsafebank.com

Same day processing of stem cells

WHO

recommendations Delay kills your cells, maximum 48hs after delivery then cells start to die

www.cellsafebank.com

For more info call 1138

May 31, 2012

Mesenchymal stem cell therapy to rebuild cartilage

Knee injury stem cell therapy new hopes

David Magne, Claire Vinatier, Marion Julien, Pierre Weiss and Jerome Guicheux Recherche sur les Biomate Ě riaux et les Biotechnologies, Boulogne-sur-Mer, France Disorders affecting cartilage touch almost the whole population and are one of the leading causes of invalidity in adults. To repair cartilage, therapeutic approaches initially focused on the implantation of autologous chondrocytes, but this technique proved unsatisfactory because of the limited number of chondrocytes obtained at harvest. The discovery that several adult human tissues contain mesenchymal stem cells (MSCs) capable of differentiating into chondrocytes raised the possibility of injecting MSCs to repair cartilages. The important data published recently on the factors controlling chondrocyte commitment must be thoroughly considered to make further progress towards this therapeutic approach. The potential application of MSC therapy provides new hope for the development of innovative

treatments for the repair of cartilage repair articular cartilage: abrasive chondroplasty, micro-fracture, spondisorders. We are all affected by gialization, autologous transplants of periosteum or perichondrium and cartilage disorders osteochondral matrix (mosaicplasty). These approaches Cartilages are poorly vascularized have unfortunately proven tissues with a very weak capacity for unsatisfactory (reviewed in [1]). self-repair. After trauma and in More than ten years ago, Brittberg et diseases that result in cartilage al. [2] proposed a treatment based degradation, cartilages will there- on the transplantation of autologous fore never heal. Together with chondrocytes extracted from a lowcardiovascular diseases, disorders weight-bearing region of the body affecting cartilages are the main and expanded in vitro. This cause of decreased quality of life approach was the first general tissue and invalidity in adults. engineering treatment to be Osteoarthritis (OA), for instance, approved for cartilage repair, under affects most people over the age of the trademark Carticelw, marketed 65. OA is a consequence of in the US by Genzyme Biosurgery, mechanical and biological events with similar products in Europe that destabilize articular cartilage marketed by Codon and others homeostasis. The disease process leads to joint pain, tenderness, limitation of movement, occasional effusion and variable degrees of inflammation. Numerous surgical approaches have been developed to

REBUILD CARTILAGE May 31, 2012

MSC to rebuild cartilage A new hope in knee injuries By David Magne et al

This method led to encouraging results but also remains unsatisfactory, particularly because articular chondrocytes are not easily extractable and because in culture chondrocytes lose expression of cartilage-specific proteins, resulting in the formation of a fibrocartilage lacking the biological and mechanical properties of the normal tissue.

may be considered as a cartilage. With the exception of the growth plate, cartilages are persistent tissues whose formation and maintenance are under the control of a single cell type: the chondrocyte. Studies of chondrogenesis and chondrocyte maturation have almost exclusively been based on chondrocytes from the growth plate, the formation of which occurs in the context of endochondral ossification. By contrast, the differentiation of Back pain also affects a large number of people; the point articular chondrocytes and IVD cells remains obscure. Chondrocyte prevalence rates in several studies ranged from 12% to 35%, with differentiation will therefore first be considered in detail in the around 10% of sufferers becoming chronically disabled (reviewed context of the growth plate. in [4]). Back pain is strongly associated with degeneration of the intervertebral disc (IVD), the composition of which, as discussed Growth plate cartilage below, is quite similar to that of articular cartilage. The main role of IVDs is to provide biomechanical properties, but alterations in these Bone formation occurs through two distinct developmental properties are thought to be the leading cause of degeneration and, processes: endochondral and intramembranous ossification. subsequently, of back pain [5]. Current treatments are conservative Endochondral ossification occurs in the long bones of the limbs, and palliative, and are aimed at returning patients to work (reviewed basal part of the skull, vertebrae, ribs and medial part of the in [4]). Disc- degeneration-related pain is also treated surgically clavicles, whereas intramembranous ossification takes place in either by discectomy or by immobilization of the affected vertebrae. several craniofacial bones and the lateral part of clavicles. In both Although surgical procedures produce good short-term clinical processes, mesenchymal cells are recruited into condensations results in terms of pain relief, they alter the biomechanics of the before differentiation. During endochondral ossification, they form spine, leading to further degeneration of the surrounding tissue and a cartilaginous template, the growth plate, prefiguring the future discs at adjacent levels. bone. During intramembranous ossification, they directly commit to osteoblasts, and bone formation does not require a cartilaginous Incidence of these diseases is rising exponentially with current mold. During endochondral ossification, cells located in the centre demographic changes and an increasingly aged population. Young of condensations differentiate into chondrocytes, expressing early people are also affected by cartilage disorders. The first unequivocal markers such as collagen types II, IX and XI, and the proteoglycan findings of degeneration in the lumbar discs can be seen in the 11 to aggrecan, whereas cells located in condensations surrounding the 16 year age group and w20% of people in their teens have discs cartilage element differentiate into osteoblasts (reviewed in [6]). with mild signs of degeneration (reviewed in [4]). In addition, Chondrocytes then further differentiate to become postmitotic, preyoung subjects frequently present with cartilage focal lesions as a hypertrophic chondrocytes, and then hypertrophic chondrocytes, result of trauma, often from sporting activities, and in some which express type X collagen instead of type II. Hypertrophic instances, this articular surface damage leads to progressive joint chondrocytes calcify their surrounding extracellular matrix (ECM) degeneration. These dramatic data have played a role in the launch and eventually die through apoptosis. Vascular invasion of calcified of the Bone and Joint Decade by the headquarters of the World cartilage then brings osteoclasts, which degrade the matrix, and Health Organization in Geneva in January 2000 (â&#x20AC;&#x2DC;Joint diseases, osteoblasts, which form bone at the expense of growth plate back complaints, osteoporosis and limb trauma resulting from cartilage (Figure 1). accidents have an enormous impact on individuals and societies, and on healthcare services and economies [.] We must act now.â&#x20AC;&#x2122; Articular cartilage http:// www.boneandjointdecade.org/). In addition to their role in controlling long bone formation, Since the discovery that mesenchymal stem cells (MSCs) can be chondrocytes are also responsible for the formation and easily recovered from a wide variety of adult human tissues, and maintenance of articular cartilage, which makes smooth, frictionless have the capacity to differentiate toward chondrocytes, much effort movement possible while also dissipating stresses in the joints and has been focused on engineering cartilage with MSCs, but it is still acting as a load-bearing surface (Figure 2a). Much less is known a long way from satisfactory clinical application. If thoroughly about the formation of articular cartilage than is known about considered, the crucial recent advances in the field of growth plate cartilage. Most of the joints form through segmentation chondrogenesis and MSC behavior will help us over- come the of a pre-existing cartilage rod. This process begins at the site of a difficulties. In this review, we will first briefly explain what future articulation with the appearance of regions of high cell cartilages are, how they form and how they are degraded. Then we density, called interzones, in which the cells lose the expression of will consider the recent developments in research into chondrocyte chondrocyte-specific markers such as type II collagen (reviewed in differentiation, and finally try to discuss on the possible application [6]). Later in development, the interzone cells differentiate and form of these developments to MSC therapy of cartilage disorders. three layers. The central layer of the interzone, the central intermediate lamina, has a lower cell density, and cells in this region Cartilages: formation, function, and disorders will eventually die through apoptosis, thereby creating the joint cavity. Cells on either side of the central intermediate lamina will Hyaline cartilages are avascular tissues that, at different locations in differentiate into articular chondrocytes, separated by the joint the body (for example, the growth plate of long bones, nasal septum cavity. Adult articular cartilage can also be subdivided into three and joints), serve distinct functions. Although IVD is not layers (Figure 2b). The surface zone is characterized by flattened, traditionally considered to be hyaline cartilage, its composition is discoid cells that mainly secrete proteoglycans. closer to that of articular cartilage than to any other tissue, and thus

REBUILD CARTILAGE May 31, 2012

Review

TRENDS in Molecular Medicine

Vol.11 No.11 November 2005

Mesenchymal cells ← Sox9 ← TGF-β super-family members

Condensation

↑ Wnt canonical pathway ↓ Sox9 ↓ Wnt canonical pathway ↑ Sox9

Differentiation

Perichondrium

Sox9, Collagen II

Ossification Perichondrium Cortical bone

Osteoblast

Chondroclast

Sox9, Collagen II, IX, XI, aggrecan

Sox9, Collagen II

Figure 1. A schematic representation of a longitudinal section of a long bone during endochondral ossification. On receiving signals elicited by factors such as members of the TGF-b superfamily, mesenchymal cells are recruited into condensations. In the core of the condensations, strong Sox9 activation and low Wnt/b-catenin signaling promote overt chondrocyte differentiation, whereas cells at the periphery form the perichondrium. Later in development, growth plate chondrocytes become flattened and organized into columns in which they proliferate, expressing markers such as collagen type II. The hypertrophic maturation of chondrocytes is above all under the control of the Ihh/PTHrP loop: Ihh expressed in pre-hypertrophic cells induces expression of PTHrP in cells located in the perichondrium. PTHrP in turn inhibits hypertrophic differentiation. Ihh might also positively regulate osteoblast differentiation. On the contrary, members of the Wnt family such as Wnt4 trigger hypertrophic differentiation, characterized by type X collagen expression. Hypertrophic chondrocytes eventually mineralize their ECM and die through apoptosis. Vascularization of the growth plate allows chondroclasts to degrade the cartilage, while osteoblasts derived from mesenchymal cells secrete Leo Praesen

Cartilage

Cbfa1, Collagen X

Osteoblasts Cbfa1, Collagen I

Wnt

Bone Hypertrophic

Proliferative

Prehypertrophic

Cartilage

521

PTHrP

Ihh TRENDS in Molecular Medicine

MSC to rebuild cartilage A new hope in knee injuries

Sox9 inactivation after the establishment of mesenchymal ossification [11]. Local expression of TGF-b1 in rat aorta David Magne et al that is reversible condensations does not, however, prevent osteoblast also induces a By cartilaginous metaplasia differentiation, indicating that Sox9 is required to when the treatment with TGF-b1 is stopped [12]. TGF-b establish osteochondro-progenitor cells that produce both may promote cell condensation by inducing expression of Intervertebral discsSox9 [13], although chondrocytes and osteoblasts. the treatment with TGF-b1 is stopped [12]. TGF-b may promote cell the chondrocyte transcription factor Spatial regulation of chondrogenesis and osteoblastothe precise mechanisms involved remain unclear. TGF-b condensation by inducing expression of the chondrocyte genesis might be under the controltranscription Wnt Sox9 [13], although the precise mechanisms might also stimulate Sox9 transcriptional activity, factor IVDs lie between the vertebral bodies linking them together, and are of the canonical signaling pathway [15,16]. Wnts activate the canonical through smad3 activation [13]. Inactivation of Sox9 in involved remain the main joints of the spinal column. IVDs are composite structures pathway by binding to the Frizzled family of receptors andunclear. TGF-b might also stimulate Sox9 limb buds before chondrogenic mesenchymal condenactivity, through smad3 activation [13]. Inactivation the LRP5/6 family of aco-receptors. This binding stabilizes sation results with in theacomplete absence of condensation, peripheral annulus fibrosus (AF) surrounding central transcriptional b-catenin, which then translocates of into the nucleus and the subsequent and bone formation Sox9 in where limb buds before chondrogenic mesenchymal nucleuscartilage pulposus (NP), and a[14]. cartilage end-plate interspersed www.sciencedirect.com

between the disc and the vertebral bodies (Figure 2c). NP composition is very close to that of articular cartilage, being largely composed of water, type II collagen and aggrecan, although NP might have a higher proteoglycan content [8,9]. What we know about chondrocyte differentiation In the present review, chondrocyte differentiation is schematically divided into three steps. These three stages are cell condensations, which are necessary for both prechondrogenic and pre-osteogenic commitment; chondrocyte differentiation; and finally chondrocyte hypertrophic maturation. Cell condensations Members of the transforming growth factor (TGF)-b superfamily, TGF-b1, -b2 and -b3, and bone morphogen- etic protein (BMP)-2, -4, -6, and -7 are considered to be the main inducers of endochondral ossification [6,10]. For instance, in vivo injection of TGF-b1 or TGF-b2 in the subperiosteal region of rat femurs induces endochondral ossification [11]. Local expression of TGF-b1 in rat aorta also induces a cartilaginous metaplasia that is reversible when

condensation results in the complete absence of condensation, and the subsequent cartilage and bone formation [14]. Sox9 inactivation after the establishment of mesenchymal condensations does not, however, prevent osteoblast differentiation, indicating that Sox9 is required to establish osteochondro-progenitor cells that produce both chondrocytes and osteoblasts. Spatial regulation of chondrogenesis and osteoblastogenesis might be under the control of the canonical Wnt signaling pathway [15,16]. Wnts activate the canonical pathway by binding to the Frizzled family of receptors and the LRP5/6 family of co-receptors. This binding stabilizes b-catenin, which then translocates into the nucleus where it interacts with members of the T-cell-factor (TCF)/ lymphoid-enhancer factor (LEF) HMG-box family to activate target genes. Genetic inactivation of b-catenin causes ectopic formation of chondrocytes at the expense of osteoblast differentiation during both endochondral and intramembranous ossification, whereas ectopic canonical Wnt signaling leads to enhanced ossification and suppression of chondrocyte formation [15].It is likely that the inhibitory effect of b-catenin on chondrogenesis is due to transcriptional down-regulation of Sox9 [16].

REBUILD CARTILAGE May 31, 2012

MSC to rebuild cartilage A new hope in knee injuries By David Magne et al

522

The spatial and temporal chondrocyte differentiation in cell condensations may be controlled by the preferential expression of Wnt5a, Wnt11 and Wnt14 at the periphery of the newly formed cartilage in the limb [17], and by expression of Wnt antagonists such as Sfrp-3 into prechondrogenic mesenchymal condensations (reviewed in [18]). In prechondrogenic condensations, in the presence of low b-catenin protein levels, Sox9 might cause b-catenin degradation [19], thereby further favoring chondrocyte differentiation. The mutual inhibition between Sox9 expression and the canonical Wnt signaling indicates that chondrocyte differentiation is controlled by a positive feedback loop in which initial inhibition of the canonical Wnt signaling leads to Sox9 expression, which further inhibits Wnt signaling and osteoblast differentiation to promote full differentiation of chondrocytes [15].

spatial and temporal control of Sox9 activity. Sox5 and Sox6 are also expressed early during chondrocyte differentiation, but probably downstream of Sox-9 in the differentiation pathway [14]. Sox5- and Sox6deficient mice still form cartilage, even though they express reduced levels of collagen type II, IX and XI, and aggrecan [24]. Unlike Sox9, Sox5 and Sox6 do not have transactivation domains and the molecular mechanisms whereby these two factors affect chondrocyte differentiation have not yet been elucidated. Differentiated chondrocytes in the growth plate and joints become located in a hypoxic environment, which induces activation of hypoxia inducible factor (HIF)-1. HIF-1 makes chondrocyte survival possible in hypoxic conditions [25] and may be required to maintain expression of chondrocyte markers such as type II collagen [26].

The canonical Wnt signaling pathway is also likely to be crucial in the chondrogenesis taking place in joints. The b-catenin-mediated Wnt pathway might be necessary and sufficient for inducing synovial joint formation [17,20]. Activation of the canonical Wnt pathway may lead to loss of chondrocyte markers through decreased Sox9 expression [17,20]. Simultaneously, maintenance of the differentiated state in articular chondrocytes may be due to expression of Sfrp-2 and Sfrp-3 [17,21].

Hypertrophic chondrocyte differentiation

In the growth plate, and probably also in articular cartilage [7] and the IVD end-plate [27], chondrocytes undergo hypertrophic differentiation, characterized by expression of collagen type X. Hypertrophic conversion has almost exclusively been studied in the context of the growth plate. Although Sox9 appears important in the first steps of chondrocyte differentiation, the transcription factor Cbfa1 is involved in the control of hypertrophy. Cbfa1 expression increases with Overt chondrocyte differentiation maturation of chondrocytes and type X collagen expression is disturbed in Cbfa1- deficient mice [28]. In addition to its role in cell condensations, Sox9 The Wnt canonical pathway might also be involved in positively regulates expression of collagen types II, IX, hypertrophic differentiation. When over- expressed in XI and aggrecan (reviewed in [22]). Sox9 the chick, Wnt4, which is normally expressed in cells transcriptional activity is positively modulated by flanking the peri-articular region, accelerates the of proliferating to hypertrophic factors such as CREB-binding protein (CBP/p300) and progression Review TRENDS in Molecular Vol.11 No.11 November 2005 [18,29]. The distribution of b-catenin, peroxisome proliferator-activated receptor gammaMedicine co- chondrocytes activator 1a (PGC-1a) [13,23], which might represent a changing from largely cytoplasmic in proliferating (a)

Figure 2. A schematic representation of longitudinal sections of (a,b) articular cartilage and (c) an intervertebral disc. (a) Articular cartilage lies between the synovial fluid and the subchondral bone. (b) It is composed of three zones: the surface zone composed of flat cells, the central zone of round cells organized into columns, and a narrow, calcified deep zone. The surface and central zones are essentially composed of collagen type II and proteoglycans, whereas the deep zone contains collagen type X. (c) Nucleus pulposus (NP) in the intervertebral disc displays a similar composition

(b) Bone Calcified articular cartilage Collagen X Articular cartilage mid zone Sox9, Collagen II Articular cartilage surface zone Sox9, Collagen II Synovial fluid Joint capsule (c) Vertebral body Inner AF Collagen II Outer AF Collagen I

End-plate Collagen X NP Sox9, Collagen II, proteoglycans

TRENDS in Molecular Medicine

Figure 2. A schematic representation of longitudinal sections of (a,b) articular cartilage and (c) an intervertebral disc. (a) Articular cartilage lies between the syn the subchondral bone. (b) It is composed of three zones: the surface zone composed of flat cells, the central zone of round cells organized into columns, and a na deep zone. The surface and central zones are essentially composed of collagen type II and proteoglycans, whereas the deep zone contains collagen type X pulposus (NP) in the intervertebral disc displays a similar composition and structure, being largely composed of collagen type II and proteoglycans, and also be from the vertebral bony body by a zone of calcified cartilage, the end-plate. AF, annulus fibrosus.

REBUILD CARTILAGE May 31, 2012

MSC TO REBUILD CARTILAGE A NEW HOPE IN KNEE INJURIES

development of intra-articular osteochondral tissues, named osteophytes [33], in which mesenchymal cells from periosteum or synovial tissue differentiate towards hypertrophic, type X collagenexpressing cells [37]. The changes By David Magne et al associated with IVD degeneration appear and pre-hypertrophic chondrocytes, to very similar, with the loss of Sox9, collagen nuclear in hypertrophic cells, also suggests type II, and aggrecan, and an increase in that the canonical Wnt pathway is involved collagen type X expression [27,38,39]. in terminal differentiation [21]. Hypertrophic conversion is also largely Applying our basic knowledge to controlled by a signaling loop involving cartilage engineering Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP; Figure 1). Mesenchymal stem cells for engineering In addition to its role in stimulating cartilage osteoblast differentiation [30,31], Ihh secreted by the pre- hypertrophic chondrocytes signals to its receptor Patched The use of autologous chondrocytes for in cells of the surrounding perichondrium tissue engineering raises several major [32]. This results in expression of PTHrP, issues such as morbidity at the donor site, which inhibits hypertrophic differentiation low cell number upon harvest, and loss of chondrocyte markers in culture. MSCs of pre-hypertrophic cells. have therefore been considered to be a promising alternative. Initially discovered Role of chondrocytes in cartilage in the bone marrow, MSCs are stromal cells homeostasis that support hematopoiesis, and have the ability to give rise to many lineages such as In persistent cartilages, chondrocytes are myoblasts, hepatocytes, adipocytes, responsible for the maintenance of the osteoblasts and chondrocytes [40]. However, balance between secretion and degradation not all stromal cells from bone marrow are of the ECM. In the course of degenerative multipotent. Although most surface markers diseases such as OA, the equilibrium have been found inadequate as a means to between secretion and degradation is altered identify stem cells because the putative in favor of the latter, because of mechanical markers may also be found on non-stem and inflammatory factors. After traumatisms, cells, or a particular marker may only be chondral defects do not heal and are often expressed on a stem cell at a certain stage or subject to inflammation. During OA, under certain conditions [41], MSCs are chondrocyte behavior is often believed to be uniformly positive for heterogeneous, although it is commonly markers such as CD29, CD44, CD71, CD90, observed that cells lose expression of ECM CD106, and negative for markers of the proteins while increasing that of proteases hematopoietic lineage, including CD14, (reviewed in [33]). In late stages of OA, CD4, and CD45. For a long time, bone inflammatory cytokines such as interleukin marrow was considered the main reservoir (IL)-1b and tumor necrosis factor (TNF)-a of MSCs. Typically the MSCs recovered may cause loss of chondrocyte markers by from a 2- ml bone marrow aspirate can be decreasing Sox9 levels [34], increasing expanded 500-fold over a period of about expression of Wnt, and stabilizing b-catenin three weeks [35,36]. In addition, one of the consistent features of joints affected by OA is the

BETTER RESULTS NEW CULTURE TECH

resulting in a theoretical yield of 12.5 to 37.5 billion cells [42]. The cells generally retain their pluripotency for at least a further 6–10 passages [42]. Because the recovery of MSCs from bone marrow is also a source of pain, morbidity and is not very high yielding, many researchers have investigated other sources. MSCs were subsequently isolated in several locations such as adipose tissue [43], cryopreserved umbilical cord blood [44], human exfoliated deciduous teeth [45], skin [46] and even peripheral blood [47]. Interestingly, several recent studies have provided some evidence that during culture chondrocytes revert to a primitive phenotype similar to that of

Cell Safe Bank Stem cell preservation is not a luxury its an insurance against leukemia for your child and the whole family The future of medicine in Egypt

for more info call

1138 www.cellsafebank.com

MSCs, and can be also induced to redifferentiate into multiple lineages [48–50]. When transplanted into non-immuno compromized animals, human MSCs undergo site-specific differentiation into multiple lineages and persist in the long term [51]. The persistence of MSCs and maintenance of their pluripotency in a xenogenic environment may be due to their lack of an HLA type II receptor and the secretion of cytokines. Nevertheless, there remain major obstacles in the path towards the clinical use of MSCs. For example, the addition of fetal calf serum (FCS) in the culture media poses the risk of the transmission of viruses or prions and a reaction to bovine proteins. It has been determined that 7–30 mg of FCS proteins

FASHIONMONTHLY May 31, 2012

MSC to rebuild cartilage A new hope in knee injuries By David Magne et al

are associated with a standard preparation of 100 million MSCs, a dosage that will probably be needed for clinical therapies [42]. In the first clinical trials using MSCs in the treatment of osteogenesis imperfecta, an immune response caused by anti-FCS antibodies was observed in one patient, even though clinical results were promising in other patients [52]. One of the biggest challenges facing the advancement of MSC therapy is therefore the development of FCSfree alterna- tives. Autologous serum and artificial serum substitutes have already proved promising in allowing proliferation while maintaining pluripotency [53,54]. Although implantation of unmodified MSCs has been reported to repair cartilage defects in rabbits [55], the implantation of uncommitted cells often leads to fibrocartilage formation, indicating that the in vivo environment is not sufficient to promote chondrogenesis. Before envisioning the ex vivo use of growth factors or genetic manipulations, we must, however, carefully consider that the chondrogenic potential of MSCs is dependent on the plating density and period of expansion [56], and is favored by hypoxia [57] and hydrostatic pressure [58]. The chondrocyte differentiation of MSCs is typically achieved in the presence of TGF-b [6,10,59], whereas the IVD cell differentiation of MSCs may be favored by TGF- b3, ascorbate and dexamethasone [8]. However, although TGF-b inhibits chondrocyte terminal differentiation [60], TGF-b-containing media have been associated with type X collagen expression in MSCs [8,43,56]. It must therefore be carefully checked that re-implantation in persistent cartilages of MSC treated with TGF-b will not lead to uncontrolled chondrocyte hypertrophy. For instance, repair of cartilage in rats by implantation of mesenchymal cells overexpressing BMP-2 led to osteophyte formation [61]. Osteophyte formation might be prevented by forced overexpression of Sox9, which promotes cell condensation and early differentiation, but blocks hypertrophy (reviewed in [2]). Unfortunately, Sox9 overexpression failed to induce chondrogenesis in MSCs [13], probably because additional signals are necessary for Sox9 activity [62]. The ets transcription factor ERG, which is expressed during development in a pattern similar to that of Sox9, has been reported to prevent chondrocyte hypertrophic maturation [63]. The precise role of ERG in chondrocyte differentiation remains obscure, however. The canonical Wnt signaling could also be manipulated to modulate chondrogenesis by altering b-catenin levels [15]. Levels of b-catenin would have to be kept low to promote initial chondrocyte differentiation and inhibit hypertrophic differentiation. Accordingly, mouse embryonic mesenchymal progenitor cells in which b-catenin was inactivated differentiate toward chondrocytes in osteogenic conditions [15]. In this context, the recent conflicting report that activation of the nuclear effector of the Wnt canonical pathway, LEF-1, promotes chondrogenic differentiation of the mesenchymal C3H10T1/2 cells [64], appears surprising and will need to be confirmed with a more relevant cell model.

cartilage has greater mechanical properties, implantation of immature cartilage has several significant advantages (reviewed in [3]). Firstly, immature engineered cartilage can be injected, allowing minimally invasive procedures that will reduce morbidity. Secondly, immature cartilage will integrate better with the surrounding host cartilage by taking the form of a defect that has an irregular size and shape. Thirdly, injectable scaffolds that will reticulate and adhere in situ will prevent the use of periosteal flaps, which are commonly used to maintain cells in the defect, but are difficult to suture to the surrounding healthy cartilage, and often result in leaks (reviewed in [65]). Finally, given that the water content of cartilage is high and that chondrocyte differentiation increases with scaffold hydrophily [66], the use of hydrogels would be advantageous. Hydrogels are cross-linked polymeric systems capable of absorbing large volumes of aqueous solutions. Besides their hydrogel composition, which can be highly variable, important parameters that need to be thoroughly considered are their resorbability and their architectural properties. Indeed, any biomaterial, either synthetic or from a foreign origin, must ideally be eliminated once the material has permitted the formation of a functional tissue. The threedimensional parameters of hydrogels need to be precisely controlled to optimize their bioactivity. The network density of hydrogels can be modulated by altering cross- linking density, which in effect, changes the volume of water that is absorbed in the hydrogel and the mechanical properties (reviewed in [3]). Hydrogel reticulation can be triggered by temperature changes (glycol polymer Pluronicsw, collagen, ECM extract from a mouse sarcoma Matrigele, and fibrin glue; reviewed in [3]), addition of a polymerizing agent (alginate) [67], change in pH (cellu- lose) [68] or exposure to light [69]. To date, numerous hydrogels have been synthesized and tested both in vitro and in small animal models of articular cartilage defects (reviewed in [3,70]). Although encouraging results have been obtained in some studies [55,71], much work still needs to be accomplished to optimize the biological and, above all, mechanical properties of the newly formed articular cartilage tissue. In addition, clinical application will depend on the successful application of these hybrid materials and technologies to large animal models that are more relevant to humans. In contrast to articular cartilage repair, the tissue engineering approaches to repairing the IVD are only just starting to emerge. A recent study has nevertheless demonstrated the feasibility of using MSCs embedded in Atelocollagen to restore altered disc tissue in a rabbit model [72]. There is still a lack of relevant animal models for IVD degeneration, however. Several models of induced or spontaneous degeneration have been described but they fall short on many criteria (for a review see [73]). An acceptable model therefore has to be developed to facilitate understanding of how stem cell therapy can be used to correct or ameliorate disc disease.

Scaffolds for cartilage engineering Concluding remarks Two approaches can be considered in cartilage tissue engineering: implanting either cartilage that is immature (without a dense cartilage ECM), or mature (with an ECM). In case of immature engineered cartilage, a combination of cells and a scaffold will form the new tissue in vivo; in case of mature engineered cartilage, the tissue is formed in vitro before implantation. Although mature

MSCs, which are easily available in several adult tissues and are able to undergo chondrogenic commitment, are of great interest in articular cartilage engineering. Several recent studies on chondrocyte commitment have provided us with new possibilities to optimize MSC-induced chondrogenesis.

REBUILD CARTILAGE May 31, 2012

MSC TO REBUILD CARTILAGE A NEW HOPE IN KNEE INJURIES By David Magne et al

In particular, the stimulation of chondrogenesis by manipulation of the Wnt/b-catenin pathway provides a great challenge. Concerning intervertebral disc regeneration, much work remains to be accomplished to characterize precisely the phenotype of the NP cells and decipher whether MSCs can satisfactorily rebuild a degenerated NP. Finally, hybrid materials combining MSCs with injectable scaffolds will have to be tested in relevant animal models of articular cartilage defects and IVD degeneration. The successful application of this approach in humans requires answers to these questions (Box 1). The number of people experiencing invalidity as a consequence of cartilage disorders is increasing exponentially, so effective therapeutic strategies must be developed now. Acknowledgements This work was supported by grants from ‘Association de Recherche pour la Polyarthrite Rhumatoıde’, ‘Societe ́ Francaise de Rhumatologie’ and INSERM EM 9903. David Magne received a fellowship from ‘Re ́gion des Pays de la Loire’, Claire Vinatier received a fellowship from the French Ministry of Research and Technology and Marion Julien received a fellowship from INSERM and ‘Region des pays de la Loire’. Published TRENDS in Molecular Medicine Vol.11 No.11 November 2005 for full reference visit our website www.cellsafebank.com

Stem cell Banking All the steps of banking are monitored to insure perfection. Cell safe bank the art of stem cell banking. for more info call

1138

or visit our website www.cellsafebank.com

APCBBC Your leaders in stem cell banking

AIM As a consortium, members aim to make cord blood stem cell banking not only accessible, but affordable and useful to the respective community of expectant parents worldwide who wish to take advantage of what this new medical technology has to offer.

Objective APCBBC members agree to uphold recognition standards of Ethical Standards of Practice (ESP), in areas of practice, integrity and confidentiality in each organization towards the public and industry players. The objective of ESP is to create an environment for leading cord blood banks in Asia Pacific to support each other in line with APCBBCâ&#x20AC;&#x2122;s mission to serve the community better.

The 10th meeting will be held in Egypt hosted by Cell Safe next October in Gouna Cell safe will host the tenth annual meeting of the Asia pacific cord blood bank consortium that will be held in Gouna Stiegenberger hotel in the period from the 3rd till the 6th of October 2012 , with all the most eminent scientists of stem cell banking in Asia and the pacific region , setting the rules standards and policies of stem cell banking

Issue #: [Date]

Dolor Sit Amet

Ethical Standards of Practice (ESP) Practice

The Hong Kong Meeting

The Consortiumâ&#x20AC;&#x2122;s Objectives: 1. To be primary providers of quality cord blood stem cell banking services; 2. To provide culturally appropriate, relevant and accessible services to diverse groups of parents throughout the region; 3. Empower positive change and continuous improvement for cord blood banks; 4. Promote the benefits of cord blood stem cells to health professionals and parents in the community; 5. Highlight cord blood stem cell transplantation and the benefits of cord blood stem cells to family associations; 6. Elevate the significance of cord blood stem cell banking to government, business, nongovernment and families.

7. Responsibilities to Consortium. Consortium members shall strive to fulfill the mission upheld by APCBBC by active contribution and participation in consortium. 8. Integrity of Profession. Consortium members shall work towards maintaining and promoting high standards of practice in the industry by upholding and advancing the values, ethics and knowledge of the profession. Each member has the responsibility to develop their own skills and performance to be at par with industry leaders. 9. Use of Accepted Standards. Consortium members shall conduct all practices (dissemination of information, harvesting procedure, lab processing, transport of stem cell unit, storage) according to approved international standards.

Integrity 1. Integrity of Information. Consortium members shall not, in verbal or written form, provide false information, be it regarding their own company, achievements or results. 2. False Accusations. Consortium members shall be careful not to falsely or unjustly accuse, demean or criticize other members and industry players. 3. Unbiased Attitude. Consortium members shall treat each other with respect, dignity and without any bias.

Confidentiality 1. Release of Confidential Information. Consortium members shall not release confidential data shared by other members during meeting and presentation of APCBBC, to any party outside consortium. 2. Personal Use of Information. Consortium members shall not use information gained from APCBBC for personal gain or where it may cause conflict of interest or where it may harm the other consortium members.

M J.Fox

“Stem cells are an avenue of research that we’ve pursued and continue to pursue but it’s part of a broad portfolio of things that we look at.

BY ABC NEWS BY RUSSELL GOLDMAN DESIGN HISHAM ISSA

Michael J. Fox Looks Past Stem Cells in Search For Parkinson’s Cure Michael J. Fox, whose turn from Parkinson’s disease patient to scientific crusader made him one of the country’s most visible advocates for stem cell research now believes the controversial therapy may not ultimately yield a cure for his disease, he told ABC’s Diane Sawyer in an exclusive interview. There have been “problems along the way,” Fox said of stem cell studies, for which he has long advocated. Instead, he said, new drug therapies are showing real promise and are “closer today” to providing a cure for Parkinson’s disease, a degenerative illness that over time causes the body to become rigid and the brain to shut down. “Stem cells are an avenue of research that we’ve pursued and continue to

FoxTrialFinder.org

2009

pursue but it’s part of a broad portfolio of things that we look at. There have been some issues with stem cells, some problems along the way,” said Fox, who suffers from the diseases’ telltale tics and tremors. “It’s not so much that [stem cell research has] diminished in its prospects for breakthroughs as much as it’s the other avenues of research have grown and multiplied and become as much or more promising. So, an answer may come from stem cell research but it’s more than likely to come from another area,” he said. Fox, who recently appeared in episodes of “Curb Your Enthusiasm” and “The Good Wife,” has dedicated himself to finding a cure for Parkinson’s, the disease with which he was diagnosed in 1991. Fox said he still strongly believes in stem cell research and government support of those studies, praising ongoing research at New York’s Memorial Sloan-Kettering

Hospital. When asked about earlier criticism he received from conservative talk show host Rush Limbaugh about his advocacy, Fox said it only “sharpens your resolve.” Scientists are conducting research and looking for a cure on multiple fronts, Fox said, including drug therapies, experimental surgeries, and developing tests to help make earlier diagnoses. To that end, his Michael J. Fox Foundation for Parkinson’s Research, the largest private funder of Parkinson’s disease research worldwide, has recently launched an online initiative to increase studies across the country by pairing patients with clinical trials in their areas. The Fox Trial Finder (Visit FoxTrialFinder.org for more info on clinical trial participation) harnesses the power of the Internet to find patients and, based on their profile of symptoms, pair them with research scientists conducting clinical trials.

Thirty percent of all clinical trials fail to recruit a single subject, according to the foundation’s web site, and many more, some 85 percent, are delayed because scientists are unable to find enough participants. “People can fill out a form anonymously… and then we can let them know about… clinical trials happening in their area,” Fox said. Some 200 trials are currently seeking recruits through the website, but one of the most promising will “try to find a biomarker for Parkinson’s, which is really important,” Fox said.