Large Animal Review 2-2021 by E.V. Soc. Cons. a r.l.

0A_Copert LAR 2_2021_ok 07/04/21 13:45 Pagina 2

Poste Italiane spa - Spedizione in A.P. - D.L. 353/2003 (conv. in L. 27/02/2004 N. 46) art. 1, comma 1, DCB Piacenza - Concessionaria esclusiva per la pubblicità: E.V. Soc. Cons. a r.l. - Cremona

02/21

Bimonthly, Year 27, Number 2, April 2021

LAR Large Animal Review

ISSN: 1124-4593

LARGE ANIMAL REVIEW is ranked in Citation Index (SciSearch®) Journal Citation Reports/Science Edition and CAB ABSTRACTS

ORIGINAL ARTICLES BOVINE • Efficacy of Cydectin 0.5% Pour-On and Renegade 1.5% Pour-On to control lice infestation in naturally infested fattening beef • Comparison of analgesia and ataxia degree obtained between three dosages of tramadol in cattle • The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle

OVINE • Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi ram lambs

CAPRINE • The investigation of milk yield, composition, quality, and fatty acids in Angora goats based on rangeland feeding conditions • Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield and composition in Saanen goats

POULTRY • Saccharomyces cerevisiae - derived prebiotic as a sustainable bioactive substance for improving broiler meat quality • Effect of peppermint (mentha piperita l.) in broiler chicken diet on production parameters, slaughter characteristics and gut microbial composition

CASE REPORTS BOVINE • Impaction of the oesophagus in bovine and its surgical management in field condition - A report of 4 cases

SOCIETÀ ITALIANA VETERINARI PER ANIMALI DA REDDITO ASSOCIAZIONE FEDERATA ANMVI

0A_Copert LAR 2_2021_ok 07/04/21 13:45 Pagina 3

0B_Somm LAR 2_2021_ok 07/04/21 09:40 Pagina 57

INDEX

ORIGINAL ARTICLES

Anno 27, numero 2, Aprile 2021 Rivista indicizzata su: CAB ABSTRACTS e GLOBAL HEALTH IF (2019): 0.299

RUDI CASSINI, ANDREA CARCERERI, FRANCESCO LA TORRE, GIULIANO PISONI, VINCENZO SALAMINA, CLAUDIO CECCATO, LUCA COZZA, MARIO PIETROBELLI, ANTONIO FRANGIPANE DI REGALBONO 59

Editor in chief: Massimo Morgante Editorial Board 2019-2021: Anna Rita Attili - Roberto Bardini Francesca Bonelli - Marta Brscic Marco Colombo - Vincenzo Cuteri Antonella Dalle Zotte - Enrico Fiore Giovanni Franzo - Matteo Gianesella Elisabetta Giudice - Paolo Moroni Davide Ranucci - Antonia Ricci Giuseppe Stradaioli - Erminio Trevisi

Comparison of analgesia and ataxia degree obtained between three dosages of tramadol in cattle GIOVANNA COSTA, FILIPPO SPADOLA, MARTINA LENTINI, EMANUELE LUBIAN, FABIO LEONARDI 65

The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle

Managing Editor: Matteo Gianesella

AYTEKIN İBRAHIM, ALTAY YASIN, BOZTEPE SAIM, KESKIN İSMAIL, ZÜLKADIR UĞUR

Technical Editor: Enrico Fiore LARGE ANIMAL REVIEW è una rivista bimestrale pubblicata per favorire l’aggiornamento dei veterinari che si dedicano alla prevenzione e alla cura delle malattie degli animali da reddito e alla qualità e salubrità dei prodotti derivati.

Consiglio direttivo SIVAR 2020-2023 Mario Facchi (Presidente) Daniele Gallo (Presidente Senior) Alberto Ferrero (Vice-Presidente) Michela Conterbia (Segretario) Vito Loconte (Tesoriere) Alessandro Federici (Consigliere) Osvaldo Parolin (Consigliere) Chiara Musella (Consigliere) Mattia Bottacini (Consigliere) Giuseppe Argiolas (Consigliere) Edizioni SCIVAC Palazzo Trecchi - 26100 Cremona Tel. 0372/460440 Iscrizione registro stampa del Tribunale di Cremona n. 299 del 25/9/1995 Direttore Responsabile Antonio Manfredi

OVINE

Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi ram lambs MOHAMED HEDIA, MOHAMED EL-BELELY

CAPRINE

The investigation of milk yield, composition, quality, and fatty acids in Angora goats based on rangeland feeding conditions NEVENA MAKSIMOVIĆ, SLAVČA HRISTOV, ALEKSANDAR MAZIAR ALIZADEHASL, NECMETTIN UNAL

Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield and composition in Saanen goats DINCEL DENIZ, ARDICLI SENA, SAMLI HALE, VATANSEVER BUSE, BALCI FARUK

POULTRY

Saccharomyces cerevisiae - derived prebiotic as a sustainable bioactive substance for improving broiler meat quality AMENI ASKRI, AZIZA RAACH-MOUJAHED, NACEUR M’HAMDI, ZIED MAALAOUI, HAJER DEBBABI

Stampa Press Point - Via Cagnola, 35 20081 Abbiategrasso (MI) - Tel. 02/9462323

Effect of peppermint (mentha piperita l.) in broiler chicken diet on production parameters, slaughter characteristics and gut microbial composition

Spedizione Poste Italiane SPA - Spedizione in A.P. D.L. 353/2003 (Conv. in L. 27/02/2004 N. 46) Art. 1, Comma 1, DCB Piacenza

PETRIČEVIĆ VESELIN, DOSKOVIĆ VLADIMIR, LUKIĆ MILOŠ, ŠKRBIĆ ZDENKA, RAKONJAC SIMEON, PETRIČEVIĆ MAJA, STANOJKOVIĆ ALEKSANDAR 103

Concessionaria esclusiva per la pubblicità E.V. Soc. Cons. a r.l. Palazzo Trecchi - 26100 Cremona Ufficio Pubblicità: Paola Orioli Tel. 0372/403539 - E-mail: info@sivarnet.it Prezzo di copertina: € 10,00. La rivista è inviata a tutti i veterinari interessati ai settori degli animali da reddito con il versamento di € 52,00 per l’Italia; € 62,00 per l’Estero. Servizio abbonamenti: Tel. 0372/403507. Ai Soci SIVAR in regola con il pagamento della quota associativa, la rivista è inviata gratuitamente in quanto la quota è comprensiva dell’abbonamento alla rivista stessa.

BOVINE Efficacy of Cydectin 0.5% Pour-On and Renegade 1.5% Pour-On to control lice infestation in naturally infested fattening beef

CASE REPORTS

BOVINE Impaction of the oesophagus in bovine and its surgical management in field condition - A report of 4 cases SHIVARAJU SHIVARAMU, DARSHAN KUMAR GOWDA KANCHAPPA THIPPESWAMY, SHIVAKUMAR MALAVALLI UMAPATHI, DIVYA MOHAN, KALAISELVAN ELANGOVAN, SWAPNA KUMAR MAITI, AND ASWATHY GOPINATHAN 109

0B_Somm LAR 2_2021_ok 07/04/21 09:40 Pagina 58

Cassini_imp_ok 07/04/21 09:44 Pagina 59

R. Cassini et al. Large Animal Review 2021; 27: 59-63

Efficacy of Cydectin 0.5% Pour-On and Renegade 1.5% Pour-On to control lice infestation in naturally infested fattening beef

RUDI CASSINI1*, ANDREA CARCERERI1, FRANCESCO LA TORRE2, GIULIANO PISONI2, VINCENZO SALAMINA2, CLAUDIO CECCATO3, LUCA COZZA3, MARIO PIETROBELLI1, ANTONIO FRANGIPANE DI REGALBONO1 1 2 3

Department of Animal Health, Production and Health, University of Padova; Legnaro (PD), Italy Zoetis Italia; Roma, Italy Practitioner - Associazione Veterinari Buiatri Orus (http://www.veterinaribuiatriorus.it/); Legnaro (PD), Italy

SUMMARY Typical Italian beef production in feedlot is based on an intensive 6-months fattening period of imported bulls, which are generally treated at their arrival with endectocides. However, emergence of mange and pediculosis are usually reported. In the present study we assessed the efficacy of the administration of Cydectin 0.5% Pour-On at the arrival of the animals, followed by Renegade 1.5% Pour-On after 8 weeks, in controlling lice infestation. One treatment group (T), and one control group (C), composed of 8 animals each, were kept in two different boxes and monitored through clinical observation and lice sampling after one, two, four, six, eight and 13 weeks. Lice were collected from three standard sheared areas (shoulders, back and rump), on the right side of the animals, and observed at the stereo-microscope in laboratory for specimens counts and identification. Differences in counts between C and T groups were evaluated using a nonparametric statistic. Among the four bovine lice species, only Bovicola bovis and Linognathus vituli were found in both groups at pre-treatment sampling and throughout the whole trial. Both species were kept at very low burden in the T group up to the 13th week, whereas their number started to increase exponentially in the C group after the fourth week. It was impossible to compare the trends of the two groups after the sixth week, since the C group was treated due to a mange outbreak. The combination of an initial treatment using a macrocyclic lactone with a second treatment using an insecticide at 2 months after arrival showed to effectively control lice infestation and to prevent clinical signs of pediculosis.

KEY WORDS Lice, bovine, Italy, moxidectin, cypermethrin.

INTRODUCTION In Italy, beef production in feedlots is typically based on young bulls that are imported from other European countries at 350450 kg of body weight (bw), before being fattened over a period of 6-7 months until slaughter at 590-700 kg bw1. These cattle frequently harbour both endo- and ecto-parasites, including several species of helminths2, mites and lice3. As a consequence, animals are routinely treated on arrival with endectocides (e.g., macro-cyclic lactones, MLs), to keep under control all parasites potentially present. However, emergence of clinical signs due to ecto-parasites during the fattening period are commonly reported, and infestation of both mites and lice can spread rapidly in the entire herd4,5. At present, the control programs to fight lice rely mostly on synthetic insecticides5,6. One species of biting louse, namely Bovicola bovis (L.), and three species of sucking lice, Haematopinus eurysternus (Nitzsch), Linognathus vituli (L.), and Solenopotes capillatus (Enderlein), are reported to infest cattle in Europe5,7. Given this basic knowledge, there is a paucity of information on prevalence and in-

tensity of lice infestation in fattening bulls in Italy. This is probably due to their short productive life and to the availability of effective drugs, which allow a satisfactory control of infestations, also in the absence of a detailed knowledge of the magnitude of the problem. However, some products frequently used for the control of external parasites on cattle have been withdrawn from the Italian market in the last years (e.g. amitrazbased spraying formulations). Besides, outbreaks of lice infestation were recently reported in beef herds in Italy8, suggesting the emergence of the problem and consequently the need for adequate tools for their control. The aim of this study was to evaluate the efficacy of a pharmaceutical protocol for the prevention and control of pediculosis in naturally infested fattening bulls, which consisted in the administration of a ML at the arrival of the animals (i.e. Cydectin 0.5% Pour-On, Zoetis, Parsippany, NJ, USA), followed by a pyrethroid insecticide after 8 weeks (i.e. Renegade 1.5% Pour-On, Zoetis, Parsippany, NJ, USA).

MATERIALS AND METHODS Experimental plan Corresponding Author: Rudi Cassini (rudi.cassini@unipd.it).

A total of 16 animals were selected to be included in the trial, out of a group of about 120 animals (Charolais breed, about

Cassini_imp_ok 07/04/21 09:44 Pagina 60

Efficacy of Cydectin 0.5% Pour-On and Renegade 1.5% Pour-On to control lice infestation

420 kg bw each) arrived at the beginning of October 2019 in a fattening farm located in Veneto Region. Animals were divided in two homogeneous groups of 8 individuals each and kept in two different boxes, not directly contiguous, but in the same barn. According to the established experimental protocol, one group was acting as control group (C), and was excluded by any kind of treatment. Due to ethical issue, it was defined that this group was admissible to treatment, if requested by the health conditions. The second group was acting as treatment group (T) and received an initial treatment with moxidectin (Cydectin 0.5% Pour-On) the day after the first sampling (day0) and a second treatment with alpha-cypermethrin (Renegade 1.5% Pour-On) 8 weeks after the initial treatment. All other animals kept in the same barn were solely treated at the day0 with Cydectin 0.5% Pour-On. At day0, an individual faecal sample was retrieved through rectal inspection from 4 animals in each group, to evaluate the endoparasite burden, as general indicator of the health status. Both groups were monitored through clinical observation and lice sampling after one (day7), two (day14), four (day28), six (day42), eight (day56) and 13 (day90) weeks. A monthly sampling was planned for the remaining 3 months of the fattening period.

Lice sampling and counting Although international guidelines9 suggested that lice can be counted on the body surface by direct examination with the naked eye or using magnifying lens, after parting the hair coat (coat opening), we considered this approach unfeasible in the specific context of feedlots. In fact, the size of the animals and their continuous movement make it difficult to properly observe the area for a sufficient time and to avoid potential risks for the operator. Besides, the sole opening of the coat may be insufficient to detect lice when the burden is very low. Therefore, the following protocol was established for collecting and counting lice from animals. Each animal was constrained in a narrow corridor and observed on the whole visible parts of the body to detect macroscopically the presence of lice, using a front light to improve visibility. After this preliminary observation, a squared area of approximately 50 cm2 (7cmx7cm) was sheared using an electric clipper Aesculap© GT 474 Econom II - (B. Brown, Melsungen, Germany) and, if necessary, also a razor blade, in three different areas of the dorsal lateral surface of the animal (shoulders, back and rump), on

Figure 1 - Sampling sites on animal skin (S = shoulders; B = back; R = rump).

the right side of the animals (Figure 1). After cutting, hairs were collected and the area was thoroughly examined and all lice present in it were kept, jointly with the hair, in a transparent plastic box with hermetic closure. Each box was identified by animal tag, sampled area and sampling date. All plastic boxes were transported to the Laboratory of Parasitology and Parasitic Diseases of the University of Padova and carefully examined under the stereo-microscope SZX12 (Olympus, Tokyo, Japan) to count and identify all lice contained in them. Live and dead individuals were counted separately. Lice were identified according to the morphological features5. Faecal samples were analysed by means of a quali-quantitative copro-microscopic analysis, as previously described10, using 5 gr for each sample, to estimate the burden in helminth eggs (EPG=eggs per gram) and coccidian oocysts (OPG=oocysts per gram).

Data analysis Lice showing active movements (live lice) were counted separately from the ones that did not show any kind of movement (dead lice). Only live (motile) lice were included in data display and analysis. If single counts were outside the interval Avg ± 2*St. Dev., calculated among all eight animals of each group for each sampling date, were considered outlier and excluded from the analysis. The average among the remaining animals was calculated and used for displaying data in tables and graphs.

Table 1 - Average counts of biting and sucking lice in Control (C) and Treatment (T) groups at different times. Significant differences (p<0.05) between C and T groups at the Mann Whitney U test are highlighted by different superscript letters.

Activity day0 - Sampling pre-Treatment day0 - Treatment with Cydectin (Group T) Day7 - Sampling day14 - Sampling day28 - Sampling day42 - Sampling day50 - Emergency treatment with Cydectin (Group C) day56 - Sampling day57 - Treatment with Renegade (Group T) day90 - Sampling

week

Bovicola bovis (avg count) C

Linognathus vituli (avg count) C T

0,14

0,25

0,00

0,29

1 2 4 6

0,29 0,00 0,43 13,86a

0,00 0,00 0,13 0,13b

0,00 0,29 1,00 7,25

0,14 0,14 1,38 3,25

1,50

7,14

3,29

3,75

Cassini_imp_ok 07/04/21 09:44 Pagina 61

R. Cassini et al. Large Animal Review 2021; 27: 59-63

Figure 2 - Comparison between C and T groups’ trends in lice average counts (weeks 1-6) of Bovicola bovis (upper; A) and Linognathus vituli (bottom; B).

Figure 3 - Lice average counts in T group (weeks 1-13) of Bovicola bovis (upper; A) and Linognathus vituli (bottom; B).

Cassini_imp_ok 07/04/21 09:44 Pagina 62

Efficacy of Cydectin 0.5% Pour-On and Renegade 1.5% Pour-On to control lice infestation

Differences in counts between C and T groups were evaluated through the Mann Whitney U test, for each sampling date.

RESULTS Animals were clinically healthy at arrival, and 75% (3/4) animals resulted positive for eggs of gastro-intestinal strongyles and coccidian oocysts at coproscopic analysis, in both groups. However, all positive animals showed very limited burden (maximum values of 160 EPG and 200 OPG). Notwithstanding clinical signs referrable to pediculosis were totally absent in the first days after arrival, at the first sampling (pre-treatment) 37.5% (3/8) of the animals resulted naturally infested with two different species of lice (Bovicola bovis and Linognathus vituli), in both groups. The numbers of lice found in the two groups at pre-treatment sampling were not significantly different. The sole presence of these two species was confirmed throughout the whole trial. At the sampling of the sixth week of the trial, three bulls of the C group showed clinical signs of mange, which was confirmed as a mixed Psoroptes-Chorioptes infection by laboratory examination of skin scarification from dorsal lesions. As a consequence, it was necessary to modify the experimental protocol and to treat all animals of the control group at the beginning of the seventh week with a principle active against mange mites (Cydectin 0.5% Pour-On). The comparison between T and C was therefore possible only for the first six weeks, whereas the efficacy in keeping lice burdens at low levels in the T group was investigated up to the end of the trial (13th week). The average lice counts of the eight animals of C and T groups are reported in Table 1 and shown in Figure 2 for both lice species. Burdens of B. bovis were very low up to the 4th week in both groups, but it started increasing sharply in the C group immediately after. At the 6th week sampling the group C showed a burden significantly higher than T (Figure 2A), and parallelly most animals started showing typical clinical symptoms (i.e. scratching, irritability). The numbers of the sucking lice L. vituli were also low up to the 6th week, when the C group showed a sharp increase and recorded a value double than the T group, although the difference was not statistically significant (Figure 2B). The overall trends of average count for both lice species in T group are shown in Figure 3, and their values reported in Table 1. B. bovis burdens were kept constantly low throughout the whole trial (Figure 3A), whereas L. vituli was moderately increasing in numbers at the 8th week sampling. The treatment with Renegade 1.5% Pour-On achieved a reduction in the burden, as demonstrated by the sampling at the 13th week, when the lice were lower than at the 8th week (Figure 3B).

losis and mange outbreaks were in fact taking place in the control group, when it was decided to treat it at the seventh week. The other two species of sucking lice reported in Italy (i.e. S. capillatus and H. eurysternus) were not detected in this group of animals. It should be noted that the sampling approach was focused on investigating the body of the animals, whereas these species are mostly found in the head11 However, during samplings, all parts of the animals were observed (including the head) suggesting that the two species were really absent or, if present, were constantly found at very low burden during the whole observation period. The aim of the study was only partially affected by the mange outbreak in the control group at the seventh week, which didn’t allow to compare treated and control groups up to the end of the trial. In fact, our findings demonstrate the efficacy of the proposed protocol in keeping under control the lice infestation. Both B. bovis and L. vituli were found in less number in the treated group at the end of the first six-weeks period. Moreover, the two species were kept at very low burden in the treated group up to the 13th week. In particular, the inclusion of a second treatment with an insecticide (i.e. Renegade 1.5% Pour-On) seemed to be particularly important for L. vituli, which was starting an ascending curve at the end of the second month, exactly when the insecticide treatment was planned in the protocol. Finally, the newly developed approach for lice detection and counts seems to be particularly sensitive, since few animals were found positive (at low burden) also at the pre-treatment sampling, when they didn’t show any signs of pediculosis. This finding suggests the potential use of this new diagnostic approach, which may allow for an early detection of lice presence, when the burden is still low.

CONCLUSION The tested protocol that combines two different products (Cydectin 0,5% Pour-On at arrival + Renegade 1,5% Pour-On at 2 months after arrival) showed to be effective in controlling lice infestation in a group of fattening beef naturally infested with both biting and sucking lice. During the trial a new and more sensitive system for lice detection was developed, based on the shearing of a limited area (about 50 cm2) of hair on the back of the animals. This approach allowed us to detect lice also at low burdens, and can be used during the clinical activity of practitioners for an early detection of lice infestations. Further studies in different geographical regions is recommended9 to confirm and potentially strengthen the soundness of the results of the present study.

References DISCUSSION Notwithstanding they appeared to be in perfect health conditions, the animals enrolled in the trial were found to be naturally infested at arrival with two species of lice, the biting louse B. bovis, and one of the sucking lice, L. vituli. This finding confirmed that imported cattle are usually asymptomatic carriers of ectoparasites at their arrival in Italy and highlighted the consequential risk for an uncontrolled spread of ectoparasites infestation in feedlots, if animals are left untreated. Both pedicu-

1. Magrin L., Gottardo F., Brscic M., Contiero B., Cozzi G. (2019). Health, behaviour and growth performance of Charolais and Limousin bulls fattened on different types of flooring. Animal, 13: 2603-2611. https://doi.org/10.1017/S175173111900106X. 2. Stancampiano L., Corradini D., Bulgarelli M., Micagni G., Battelli G. (2007). Parasites of the digestive tract in beef cattle imported from France to Italy. Parassitologia, 49: 101-106. 3. Genchi C., Alvinerie M., Forbes A., Bonfanti M., Genchi M., Vandoni S., Innocenti M., Sgoifo Rossi C.A. (2008). Comparative evaluation of two ivermectin injectable formulations against psoroptic mange in feedlot cattle. Vet Parasitol, 158: 110-116. https://doi.org/10.1016/j.vetpar.2008.08.007. 4. Durden L.A. (2019). Lice (Phthiraptera). In: Medical and Veterinary En-

Cassini_imp_ok 07/04/21 09:44 Pagina 63

R. Cassini et al. Large Animal Review 2021; 27: 59-63

5. 6.

tomology. Ed. Mullen G.R. and Durden L.A., 3rd ed., 79-106. Elsevier, Amsterdam, NL. https://doi.org/10.1016/B978-0-12-814043-7.00007-8. Taylor M., Coop R., Wall R. (2007). Veterinary Parasitology, 3rd ed., Blackwell Publishing Ltd, Oxford UK. Benelli G., Caselli A., Di Giuseppe G., Canale A. (2018). Control of biting lice, Mallophaga − a review. Acta Trop, 177: 211-219. https://doi.org/10.1016/j.actatropica.2017.05.031. Milnes A.S., O’Callaghan C.J., Green L.E. (2003). A longitudinal study of a natural lice infestation in growing cattle over two winter periods. Vet Parasitol, 112: 307-323. https://doi.org/10.1016/S0304-4017(02)003904. Bonelli F., Turini L., Sgorbini M., Tognetti R. (2019). A case of pediculosis in a beef herd. Large Anim Rev, 25: 75-77.

9. Holdsworth P.A., Vercruysse J., Rehbein S., Peter R.J., Letonja T., Green P. (2006). World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) guidelines for evaluating the efficacy of ectoparasiticides against biting lice, sucking lice and sheep keds on ruminants. Vet Parasitol, 136: 45-54. https://doi.org/10.1016/j.vetpar.2005.11.008. 10. Frezzato G., Stelletta C., Pacheco Murillo C.E., Simonato G., Cassini R. (2020). Parasitological survey to address major risk factors threatening alpacas in Andean extensive farms (Arequipa, Peru). J Vet Med Sci, 82: 1655-1661. https://doi.org/10.1292/jvms.20-0253. 11. Watson D.W., Lloyd J.E., Kumar R. (1997). Density and distribution of cattle lice (Phthiraptera: Haematopinidae, Linognathidae, Trichodectidae) on six steers. Vet Parasitol, 69: 283-296. https://doi.org/10.1016/S03044017(96)01122-3.

Cassini_imp_ok 07/04/21 09:44 Pagina 64

SOCIETÀ ITALIANA VETERINARI PER ANIMALI DA REDDITO ASSOCIAZIONE FEDERATA ANMVI

CICLO WEBINAR

UN TRITTICO DI WEBINAR SULLE MASTITI Primo webinar: 9 aprile, ore 18 - 19.30 - “Mastite da contagiosi” Secondo webinar: 6 maggio, ore 18 - 19.30 - “Mastite da ambientali” Terzo webinar: 24 giugno, ore 18 - 19.30 - “Mastite da Mycoplasma” Seguilo su VetChannel.it

Partner esclusivo MODERATORE OSVALDO PAROLIN Consigliere SIVAR RELATORI NORMA ARRIGONI Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna GLORIA GIOIA Research Associate Cornell University Ithaca (NY) PAOLO MORONI Università degli Studi di Milano Cornell University Ithaca (NY) INTRODUZIONE AGLI INCONTRI 9 aprile, ore 18 - 19.30 “Mastite da contagiosi”. Relatori: Paolo Moroni, Norma Arrigoni Il webinar affronterà gli aspetti manageriali e di controllo delle patologie da Strep. Agalactiae e da Stap. Aureus negli allevamenti di bovine da latte, con un occhio di riguardo ai piani di monitoraggio ed alla tipologia di campionamento.

MODALITÀ DI PARTECIPAZIONE • Riservato ai soci SIVAR in regola con la quota associativa 2021

CREDITI SPC 2 crediti per ciascun webinar. Totale crediti SPC: 6 I crediti verranno comunicati direttamente alla piattaforma FNOVI dalla Segreteria SIVAR SEGRETERIA ORGANIZZATIVA SIVAR - Paola Orioli +39 0372 403539 info@sivarnet.it www.sivarnet.it Seguici su

6 maggio, ore 18 - 19.30 «Mastite da ambientali». Relatore: Paolo Moroni Scopo dell’incontro sarà quello di affrontare nei dettagli, con case report, la patogenesi delle infezioni mammarie provocate da E. Coli e da Klebsiella soffermandosi in particolar modo sulla gestione delle differenti lettiere e sul periodo di transizione. 24 giugno, ore 18 - 19.30 «Mastite da Mycoplasma» Relatori: Paolo Moroni, Gloria Gioia L’evento cercherà di sensibilizzare sull’epidemiologia di questa patologia mammaria, purtroppo ancora sottostimata, e soprattutto di dare una rivisitazione critica sulle varie tipologie di diagnostica utilizzata nell’identificazione di questo microrganismo. PIATTAFORMA www.vetchannel.it

Il nuovo canale per il tuo aggiornamento scientifico

Organizzato da E.V. Soc. Cons. a r.l. è una Società con sistema qualità certificato ISO 9001:2015

Costa_imp_ok 07/04/21 09:48 Pagina 65

G. Costa et al. Large Animal Review 2021; 27: 65-68

Comparison of analgesia and ataxia degree obtained between three dosages of tramadol in cattle

GIOVANNA COSTA1*, FILIPPO SPADOLA1, MARTINA LENTINI1, EMANUELE LUBIAN1, FABIO LEONARDI2 1 2

Department of Veterinary Sciences, University of Messina, Italy Department of Veterinary Sciences, University of Parma, Italy

SUMMARY Aim - The aim of this study was to evaluate and compare the analgesia and ataxia degree between three dosages of tramadol in cattle. Methods - Thirty Friesian cows undergoing transrectal and transvaginal ultrasound examination were enrolled. They were randomly divided into three groups, A, B, and C. Each group consisted of 10 subjects. Tramadol was administered intravenously as follow: 1 mg/kg (group A), 1.5 mg/kg (group B) and 3 mg/kg (group C). Heart rate, respiratory rate, non-invasive systolic pressure, ataxia score (range 0-3) and stimulus response score (range 0-4) were recorded before tramadol administration and at 10, 20, 30, 60 and 90 minutes after tramadol administration. A cumulative pain score (CPS, range 0-12) was performed. When the CPS was > 10 and stimulus response score was equal to 4, the animals received flunixin meglumine 3.3 mg/kg intravenously as rescue analgesia. Results - Heart rate of cows treated with tramadol 3 mg/kg was significantly lower at 20, 30, 60 and 90 minutes (p < 0.001) compared to those of other groups. Cows treated with tramadol 1.5 mg/kg showed a significant increase (p = 0.010) in the degree of ataxia at all times compared to other groups. The CPS recorded in group C was significantly lower (p = 0.028) compared to those of other groups at all times. Group B showed a significant lower (p = 0.028) stimulus response score compared to those of other groups. In group C, we observed phenomena of excitability and slight transient muscle fasciculation. No rescue analgesia was administered in any subject. Conclusion and clinical relevance - Tramadol 1.5 mg/kg provided better ataxia and analgesia compared to other doses. Furthermore, tramadol 3 mg/kg may cause excitatory movements and muscle fasciculation.

KEY WORDS Tramadol, cattle, ataxia, analgesia.

INTRODUCTION Local anesthetic techniques are widely used in cattle because many diagnostic and surgical procedures are performed with the animal in standing1-3. Nevertheless, in tissues affected by purulent inflammation (e.g., foot diseases, soleari ulcers, podophlemmitis, interdigital dermatitis, nipple injurie, and mastitis), pH tends to acidity, and local anesthetics are ineffective1,45 . In addition, anesthetic blocks may be difficult to performed in case of abdominal surgery. Even though local technique with those agents may be quite effective for pain relief in inflamed tissues, especially if the nerve block is proximal to the affected area, In addition in abdominal surgery where anesthetic blocks cannot be performed; alfa2adrenoceptor agonists3,6-7, opioids and NSAIDs, represent a valid alternative to local anesthetics9-17. Butorphanol, tramadol and other opioid agonist-antagonist provide sedation and analgesia, In various species of ruminants such as camelids and cattle1,9-16. NSAIDs are a valid therapeutic choice for the above mentioned surgical pathologies., because this drugs are anti-inflammatory and painkillers17. Tramadol is as a racemic mixture of two enantiomers. The positive enantiomer inhibits serotonin re-uptake while the nega-

Corresponding Author: Giovanna Costa (glcosta@unime.it).

tive enantiomer inhibits noradrenaline re-uptake1. Both enantiomers of tramadol are agonists of the mu-opioid receptors. All these effects synergistically induce a good analgesia. Tramadol causes few side effects on cardiovascular, respiratory, and gastroenteric systems. Tramadol has a half-life of about 2 hours in goats and alpacas10-12. The 20% of tramadol is bound to plasma proteins (fraction of bound drug), has a high affinity for tissues, and is able to cross the placental barrier. Tramadol is mainly eliminated unchanged with stool and urine (99%), whereas only a very small amount of drug (0.02%) is eliminated by excretion in the milk1. These interesting pharmacological and pharmacokinetic effects of tramadol make it very suitable for analgesic therapy in bovine species, especially since the suspension time could be very short1. The aim of this study was to compare the analgesic property and the ataxia degree obtained with three dosages of tramadol in cattle.

MATERIALS AND METHODS The study was approved by the Review Board for Animals Care of the University of Messina (protocol N 031/2019). Procedures were performed in accordance with Italian law (D.M. 116192), European law (O.J. of E.C. L. 358/1 12/18/1986), and USA laws (Animal Welfare Assurance No A5594-01, Department of Health

Costa_imp_ok 07/04/21 09:48 Pagina 66

Comparison of analgesia and ataxia degree obtained between three dosages of tramadol in cattle

and Human Services, USA) in accordance with the Legislative Decree n. 193 of 6th April 2006. Moreover, the owners provided informed consent. The dairy products were removed from the food supply chain for at least thirty days after the administration of tramadol. Thirty Friesian female cow undergoing transrectal and transvaginal ultrasound examination and biopsy tests, aged between 3 and 4 years, and weighing 500 ±40 kg were enrolled in this study. These subjects came from the Province of Ragusa, Sicily, Italy. Water and food were withdrawn twelve hours before the study. The study involved the evaluation of sedation, through ataxia and, the variation of the following physiological variables: heart rate (HR), non-invasive systolic pressure (NSP), and respiratory rate (RR). After being weighed with a scale (Zoopiro Italy), the degree of ataxia was assessed. Then, the cows were acclimatized for 30 minutes in their housing pen. Baseline parameters were recorded as follows: heart rate (HR) and non-invasive systolic pressure (NSP), placing the cuff at the base of the tail, were measured through a multiparametric monitor (EDAN Italy); respiratory rate (RR) was recorded by observing chest wall motion. The evaluation of ataxia (ataxia score) was carried out, by three unsuspecting observers, by means of the assignment of scores according to the following scheme: 0 = no ataxia. 1 = the animal sways slightly but is stable. 2 = the animal sways and spreads its limbs. 3 = the animal sways and bends with respect to the ground. Then, the degree of analgesia was evaluated using the response to an electrical stimulus. The skin located at three centimeters above the coronary band of the right hind limb was trichotomized. An ultrasound gel was applied to favor electrical conduction, and two electrodes dome-shaped 3 mm diameter were placed. The electrodes were fixed using an adhesive, and electrical stimulation on coronary band was performed using a bipolar stimulator set at 15 mA with alternating current generator (Phasis II electromyograph of Esaote Biomedica IT)1819 . The evaluation of the animal’s behavioral reaction to the electrical stimulus (stimulus response score) was performed by three independent and unaware observers, assigning a score ranging from 0 to 4 using the following scheme: 0 = No reaction. 1 = No stimulated limb’s reaction but the animal raises its head. 2 = The animal lifts its head and slightly subtracts the stimulated limb. 3 = The animal subtracts the stimulated limb. 4 = The animal subtracts the stimulated limb and defends itself. At the baseline, the response to electrical stimulation was evaluated after recording other variables whereas at 10, 20, 30, 60, and 60 minutes after tramadol administration physiological parameters were recorded after the electrical stimulus to evaluate any changes13. A 14-G venous catheter (Suriflo®) was inserted in the jugular vein and the subjects received tramadol (Altadol 5% Formenti Italy) at the following dose: 1 mg/ kg (group A), 1.5 mg/kg (group B), and 3 mg/kg (group C). The dose of tramadol used in the present study has been selected based on the bibliographical review of the dosages of tra-

madol used in ruminants1,9-16. The dosage of tramadol to be administered, in the three groups, has been established by a lottery. A cumulative pain score (CPS) was performed assigning scores to the percentage variations of HR, FR and NSP after tramadol administration, compared to baseline, according to the following scheme: 0 = no variation. 1 = > 0% but ≤ 10%. 2 = > 10% but ≤ 20%. 3 = > 20% but ≤ 30%. 4 = > 30% but ≤ 40% or more20. The total score was obtained by summing the three score. When the score of CPS was > 10 and stimulus response score was equal to 4, the animals received flunixin meglumine (Finadyne® Schering-Pough Netherlands) 3.3 mg/kg intravenously as rescue analgesia. Rescue analgesia was expected above along with the observation. Physiological parameters, stimulus response score, and CPS were recorded before tramadol administration (baseline) and at 10, 20, 30, 60 and 90 minutes after tramadol administration. The time points to collect the variables were chosen only for an alleged intraoperative phase. Data were analyzed using SPSS 15.0 (IBM Company, Italy). Shapiro-Wilk normality test, Kendall’s concordance test, for ataxia and stimulus response score, and a power calculation of sample were performed. The data were expressed with median and range. Differences along the time line and the differences between groups were evaluated using Friedman test P ≤ 0.05 were considered significant.

RESULTS Shapiro-Wilk normality test showed that the data were not normally distributed. The Kendall’s concordance test showed a high degree of agreement between the observers: 100% for ataxia scores, and 99%-100% for stimulus response scores. The size of the sample is not enough to be representative of the population of dairy cattle present in the province of Ragusa. Table 1 showed the data regarding HR, RR, NSP, ataxia score, cumulative pain score, and stimulus pain score. HR was significantly different between groups at all times (p = 0.000). HR recorded in the group C was significantly lower compared to HR recorded in the other groups at 20, 30, 60 and 90 minutes (p = 0.000). RR was significantly different between groups at all times (p = 0.000). RR in group C was significantly lower compared to RR of the other groups at all times (p = 0.000) but it did not change from baseline, in contrast to groups A and B in which modest, even though significant, variations have been observed, compared to baseline values. NSP showed significant differences in groups A and B compared to baseline values (p = 0.000). In group C, NSP remained stable and no significant difference was recorded. Ataxia scores did not show any significant differences at all times in all groups. However, in group B the ataxia scores were higher than those recorded in groups A and C. After tramadol administration (p = 0.010).

Costa_imp_ok 07/04/21 09:48 Pagina 67

G. Costa et al. Large Animal Review 2021; 27: 65-68

Table 1 Recorded Data

Groups

10’

20’

30’

60’

90’

HR (beats/min)

A B C

99(97/100)§#‡ 90(91/89)§#‡ 98(97/101)§#‡

95(93/97)§#‡ 89(88/90)§#‡ 99(98/100)§#‡

96(95/97)§#‡ 87(86/88)*§#‡ 73(72/74)*§#‡

98(97/99)§#‡ 90(89/91)§#‡ 75(74/76)*§#‡

100(99/101)§#‡ 87(86/88)§#‡ 74(72/75)*§#‡

105(98/110)§#‡ 89(85/90)*§#‡ 78(73/75)*§#‡

RR (breaths/mi)

A B C

35(34/36)§#‡ 38(37/40)§#‡ 20(19/22)§#‡

37(35/38)*§#‡ 39(38/40)*§#‡ 20(18/24)§#‡

35(34/36)§#‡ 40(39/41)*§#‡ 20(19/24)§#‡

34(33/35)*§#‡ 45(44/47)*§#‡ 20(19/22)§#‡

35(34/37)*§#‡ 45(44/46)*§#‡ 20(20/22)*§#‡

34(33/35)§#‡ 44(43/46)*§#‡ 20(18/22)§#‡

NSP (mmHg)

A B C

145(143/146)§#‡ 128(126/129)§#‡ 100(99/103)§#‡

159 (158/160)*§#‡ 135(134/134)*§#‡ 100(99/101)§#‡

170(168/171)*§#‡ 136(134/135)*§#‡ 100(98/102)§#‡

152(150/153)*§#‡ 134(132/135)*§#‡ 100(99/101)§#‡

141(139/142)*§#‡ 135(134/136)*§#‡ 100(99/102)§#‡

146(144/148)*§#‡ 136(135/137)*§#‡ 100(98/102)§#‡

Ataxia scores (scale 0/3)

A B C

0(0/0) 0(0/0) 0(0/0)

0(0/0) 1(0/1) 0(0/0)

CPS (Scale 0/4)

A B C

0(1/1) 1(0/1) 0(0/0)‡

(0/2) 1(0/1) 0(0/0)‡

0(1/1) 1(0/2) 0(0/0)‡

Stimulus response score: recorded Scores (Scale 0/4)

A B C

2.6(2/3)* 1(1/2)* 2(1/3)*

2.6(2/3)* 1(1/2)* 3(2/3)*

3(2/3)* 2(1/3)* 3(2/3)*

4(4/4) 4(4/4) 4(4/4)

Heart rate (HR), respiratory rate (RR), non-invasive systolic pressure (NSP), Cumulative Pain Scale (CPS 0/4). Baseline (B), minutes (10, 20, 30, 60, 90) after 1 mg/ kg group A, 1.5 mg/kg group B and 3 mg/kg group C of tramadol injection. * Significant differences along the time line. § Significant difference between group A and the other two groups, # Significant difference between group B and the other two groups, ‡ Significant difference between group C and the other two groups. The differences between the groups was considered significant for p < 0.05.

CPS did not show any significant differences along the timeline in all groups. The CPS of group C were significantly lower compared to CPS of the other groups at all times (p = 0.000). The stimulus response scores have been significantly reduced along the timeline in all groups. The stimulus response score of the group B was significantly lower compared to those of the other groups (p = 0.000). Rescue analgesia was not administered in any subject. In two cows belonging to the group C, we observed phenomena of excitability and transient slight muscle fasciculation.

DISCUSSION This study demonstrates that tramadol doses of 1, 1.5, and 3 mg/kg are effective to produce analgesia in cows. Furthermore, the side effects (excitability and slight muscle fasciculation) highlighted in some cows treated with tramadol 3 mg/kg were mild and transient. The same side effects were reported in cattle administered 1 mg/kg of tramadol combined with 0.02 mg/kg of romifidine and in horses administered 1, 2, and 3 mg/kg of tramadol intravenously14,21. Even though it has been demonstrated that 1 mg/kg of tramadol administered intravenously slowly was more effective compared to the same dose given in a rapid bolus in the bovine, no side effects (e.g., excitability and fasciculation) were highlighted1. Muscle twitching and tremors have been observed in alpaca and in the horse after intravenous administration of tramadol12,21. However, no excitatory effects were recorded in horses that received 3 mg/kg of tramadol, administered intravenously slowly, alone or in combination with romifidine18.

In the present study, we observed a better level of analgesia in the cows received tramadol 1.5 mg/kg. In fact, these animals had a lower degree of response to the noxious stimuli compared to the subject received tramadol 1 and 3 mg/kg. Paradoxically, the cows that received tramadol 3 mg/kg showed no ataxia nor a higher level of analgesia, but phenomena of excitability. Furthermore, the subject administered tramadol 3 mg/kg showed recorded lower values of heart rate, respiratory rate and non-invasive systolic pressure than animals administered tramadol 1 and 1.5 mg/kg. Other authors have observed the same side effects in in sheep10. It is likely that group C (3 mg/kg) had the lowest CPS score because 3 mg/kg of tramadol in cattle could be a too high dosage and can cause the appearance of the side effects of opioids. In fact, these effects could be due to activation of the opioid receptor, which gives excitatory effects that can mask the analgesia obtained1,14,18, 22. There are several limitations the study mainly related the nature of the subjects. First, phenomena of excitability recorded in the group C make difficult the evaluation of the stimulus response scores, and it is likely that these side effects probably could have distorted the results. Slow intravenous administration of tramadol would not have resulted in the appearance of excitability phenomena, and the evaluation of the analgesia would have been more reliable1,18. The lowering of the head is a parameter commonly used to evaluate sedation in cattle14. Unfortunately, this method was difficult to apply in the subjects enrolled in the present study due to their nature. Third, the study was limited to the evaluation of analgesia and sedation in a potential intraoperative phase lasting 90 minutes. We aim to evaluate the half-life and pharmacokinetics of tramadol in cattle with further studies. Finally, another limitation of the study is the low number of subjects.

Costa_imp_ok 07/04/21 09:48 Pagina 68

Comparison of analgesia and ataxia degree obtained between three dosages of tramadol in cattle

CONCLUSION Tramadol 1.5 mg/kg is safe and effective, and provides analgesia compared to tramadol 1 and 3 mg/kg in cattle. The degree of ataxia obtained is not significant with the three tramadol dosages committed in the study, however, in group B the ataxia scores were higher than those recorded in groups A and C.

11.

12.

13.

References 1. Costa Giovanna, Musicò Marcello, Spadola Filippo, Cortigiani Sergio, Leonardi Fabio, Cucinotta Giuseppe, Interlandi Claudia.(2018).Effects of tramadol slow injection vs fast bolus in the therapeutic balance of the foot in bovine Large. Animal Review 24:219-221. 2. Lorena SE, Luna SP, Lascelles BD, Corrente JE. (2013). Attitude of Brazilian veterinarians in the recognition and treatment of pain in horses and cattle. Vet Anaesth Analg. 40: 410-8. 3. Riebold Thomas W. (1996). Anaesthesia and immobilization of specific species (Runinants) Lumb e Jones’ 3 th ed 610-625, University of Illinois press. 4. Barbolini G, Bisetti A, Colizzi V, Damiani G, Migaldi M,. (1989). Immunohistologic analysis of mycobacterial antigens by monoclonal antibodies in tuberculosis and mycobacteriosis. Hum Pathol. 20: 1078-83. 5. Covino B.G., Vassallo H.D. (1976). Local anaesthetics: mechanisms of actions and clinical use. Grune and Stratton, New York, p 90. 6. Costa, G.L., Nastasi, B., Musicò M., Spadola F., Morici, M.,Cucinotta, G., Interlandi, C.(2017a) Influence of ambient temperature and confinement on the chemical immobilization of fallow deer (Dama dama). Journal of Wildlife Diseases. 53:364-367. 7. Costa, G.L.,Nastasi, B.,Musicò, M.,Spadola F., Morici M., Cucinotta, G., Interlandi, C.(2017b) Reply to arnemo and kreeger: ‘‘Commentary on ‘influence of ambient temperature and confinement on the chemical immobilization of fallow deer (Dama dama).Journal of Wildlife Diseases 53:701-702. 8. Spadola F., Costa G., Interlandi C., Musicò M. Hyaluronidase, with xylazine and ketamine, reducing immobilization time in wild cattle (Bos Taurus). LAR 2019 25:159-161. 9. Ismail ZB. Epidural analgesia in cattle, buffalo, and camels. (2016). Vet World. 9: 1450-1455. 10. De Benedictis GM, Giorgi M, Depase A, De Vito V, Della Rocca G, Bellini L. (2017)Cardiovascular effects and intraoperative pharmacokinetics

14.

15.

16.

17. 18.

19.

20.

21. 22.

of tramadol in sheep undergoing spinal surgery. Vet Anaesth Analg.;44:1245-1252 De Sousa AB, Santos AC, Schramm SG, Porta V, Górniak SL,Florio JC, de Souza Spinosa H. (2008). Pharmacokinetics of tramadol and odesmethyltramadol in goats after intravenous and oral administration. J Vet Pharmacol Ther. 31:45-51. Edmondson MA, Duran SH, Boothe DM, Stewart AJ, Ravis WR. 2012 Pharmacokinetics of tramadol and its major metabolites in alpacas following intravenous and oral administration. J Vet Pharmacol Ther.;35:38996. Spadola F., Costa G.L., Morici M., Interlandi C., Nastasi B., Musicò M. (2017). Autologous prosthesis for the surgery of two simultaneous hernias in a calf. Large Animal Review 23: 195-197. Interlandi C., Nastasi B., Morici M., Calabrò P., Costa G.L. (2017). Effects of the combination romifidine/tramadol drug administration on several physiological and behavioral variables in calves. Large Animal Review 23: 51-54. Nishimura LT, Villela IOJ, Carvalho LL, Borges LPB, Silva MAM, Mattos-Junior E. (2017). The Effect of Acepromazine Alone or in Combination with Methadone, Morphine, or Tramadol on Sedation and Selected Cardiopulmonary Variables in Sheep. Vet Med Int. doi: 0.1155/2017/7507616 Braz M, Carreira M, Carolino N, Rodrigues T, Stilwell G (2012). Effect of rectal or intravenous tramadol on the incidence of pain-related behaviour after disbudding calves with caustic paste. Applied Animal Behaviour Science 136: 20-25. Re G., Miciletta M., Barbero R. (2010) Farmacologia dei FANS ed implicazioni cliniche nel bovino da carne. Large animal review 16: 49-52. Costa G.L., Cristarella S., Quartuccio M., Interlandi C. (2015). Anti-nociceptive and sedative effects of romifidine, tramadol and their combination administered intravenously slowly in ponies. Vet Anaesth Analg 42: 220-5. Moens, Y. et al. (2003) A comparison of the antinociceptive effects of xylazine, detomidine and romifidine on experimental pain in horses. Vet Anaesth Analg, 30: 183-190. Costa G.L., Nastasi B., Spadola F., Leonardi F., Interlandi C. 2019 Effect of levobupivacaine, administered intraperitoneally, on physiological variables and on intrasurgery and postsurgery pain in dogs undergoing ovariohysterectomy. Journal of Veterinary Behavior 30:33-36. Seo, J.P., Son WG, Gang S, Lee I. (2011) Sedative and analgesic effects of intravenous xylazine and tramadol on horses. J Vet Sci, 12: 281-286. Shilo Y., Britzi M., Eytan B., Lifschitz T., Soback S., Steinman A. (2008) Pharmacokinetics of tramadol in horses after intravenous, intramuscular and oral administration. J Vet Pharmacol Ther, 31: pp. 60-65.

Ibrahim_imp_ok 07/04/21 09:53 Pagina 69

A. İbrahim et al. Large Animal Review 2021; 27: 69-74

The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle

AYTEKİN İBRAHİM1*, ALTAY YASİN2, BOZTEPE SAİM1, KESKİN İSMAİL1, ZÜLKADİR UĞUR1 1 2

Faculty of Agriculture, Department of Animal Science, University of Selcuk, Konya, Turkey Faculty of Agriculture, Department of Animal Science, University of Eskisehir Osmangazi, Eski ehir, Turkey

SUMMARY Cow cleanliness is important for providing hygienic milk production and the welfare of dairy cows. Body cleanliness scoring was based on subjective evaluating of degree of manure contamination on different areas of the cow’s body. The aim of this study is to evaluate the effects of body cleanliness score on some criteria such as somatic cell count (SCC), pH, conductivity (µS/cm) and color used in the detection of milk quality in dairy cattle. In this respect, Tail Head (TH), Upper Rear Limb (URL), Lower Rear Limb (LRL), Udder Side (US), Ventral Abdomen (VA) and Hind Udder (HU) regions of dairy cows were scored by 5 different assessors according to body cleanliness. _ Consistency (α), correlation coefficient (r) and percentage (X%) values between observers evaluated from 5 assessors for body cleanliness score were found as 0.910, 0.688 and 0.539, respectively. In addition, the highest body cleanliness rates (%) by scoring regions, 2 and 3 scores were observed in the TH, URL and LRL regions. However, in the TH and US regions, it was observed that 1, 2 and 3 prevalence of body cleanliness scores are concentrated in this herd. As a result of analysis of variance, although conductivity (P<0.05) and some milk color parameters such as b* (P<0.05) and C* (P=0.053) values were statistically significant in US region, a* value, which is one of the other color parameters in the HU region, was again found to have higher means in the dirty body cleanliness score group. In other words, when the least squares mean of clean, slightly dirty and dirty animal groups are taken into consideration, it is also observed that other milk quality criteria tend to increase due to the increasing body cleanliness score. These results suggest that a lot more attention should be paid to herd management to ensure hygienic milk production, animal health and welfare in this herd.

KEY WORDS Body cleanliness score; manure management; somatic cell count; conductivity; milk color.

INTRODUCTION Dairy cattle breeders have primarily concentrated in the high milk yield per cow 1. So, dairy breeding programs by selection primarily aim to the improvement of milk yield. However, there are existences of many environmental factors affecting milk production. Taking into account environmental factors are extremely important to demonstrate the phenotypic values of animals as well. Increasing the income obtained from dairy farms can be achieved with well-planned and sustainable herd management. Both paying attention to the applications contained in the herd management and trying to reach the best practices that allow a farm’s economic strength in a farm should be the target. Especially, practical applications (subjective) in farm help save from both labour and time. Body condition scoring2, lameness3, teat4 and body cleanliness scores5,6 are given as these applications. These applications are also important to be used on farm as a practical tool for monitoring animal welfare in addition to saving time and labour in farms.

Corresponding Author: Aytekin İbrahim (aytekin@selcuk.edu.tr).

Cow cleanliness is important for providing hygienic milk production and the welfare of dairy cows. Body cleanliness scoring was based on subjective evaluating of degree of manure contamination on different areas of the cow’s body. The best indicator to measure the success of manure management in a farm is body cleanliness score of animals. Body cleanliness score is one of the important indicators of animal welfare that varies depending on climatic factors, financial power of farms and animal behaviors.7 The presence of poor hygiene in farm facilitates more exposure to environmental pathogens of animals, and so this will cause an increase in the cases of mastitis.8 Mastitis is one of the main problems in herds in terms of increased somatic cell count and bacteria in milk that causes significant risk to human health9, reduces the quality of milk and dairy products10 and also leads to loss of milk production.11,12 Similarly, animals must be sufficiently clean for increasing visuality of animals in breeding sales, meat hygiene in animals slaughtered and controlling the quality of leather product.13 Hauge et al.14 stated that slaughtered dirty animals result in deductions in payment to farmers in Norwegian abattoirs based on national guidelines. Depending on the barn structure, especially in seasons with plenty of rainfall, manure management should be paid more at-

Ibrahim_imp_ok 07/04/21 09:53 Pagina 70

The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle

tention in farms in case there is a greater risk to pathogens, fallrelated injuries, and foot and udder problems. Also, animals should be periodically followed with regard to manure contamination throughout the year by the same people. There are several basic manure transfer mechanisms such as direct transfer, leg transfer, splash transfer and tail transfer that cause manure contamination to animals.6 Body regions used in the hygiene scoring are usually tail head, upper rear limb, lower rear limb, udder side, ventral abdomen and hind udder.15 Hygiene scoring charts were proposed by Reneau et al.5 and Cook and Reinemann6 to monitor cow cleanliness in herd management. The aim of this study is to evaluate the effect of body cleanliness score on some criteria such as somatic cell count (SCC), pH, conductivity (µS/cm) and color used in the detection milk quality in Brown Swiss and Holstein Friesian dairy cattle.

MATERIALS AND METHODS Animals and Data A total of 167 Brown Swiss and Holstein Friesian cows from the Galipoglu HAY-TAR Agricultural Enterprise were used in this study in Konya Province of Turkey. The farm is located at 38°16’44”N latitude and 32°27’03”E longitude, 1065 m above the sea level and 0.53% slope. Cows were housed in a free- stall barn bedded with rubber carpet on concrete and milked twice daily in a 2 x 9 side-closed milking parlor with two milkers. The average daily milk yield of the farm was approximately 20 kg/day. Milking procedure such as pre-milking, pre-dipping, post-milking, post-dipping and disinfection of milking implantation is regularly performed between each milking party in parlor. Milk yields of each cow used in this study were obtained from herd management program (DeLaval Alpro, Version 7.00). Dairy cows were separated into different feeding groups according to daily milk yield during lactation.

Sample Collection and Analysis Farms were visited in August to milk sampling and samples of milk were taken from each cow at the milking by using sampling equipment to represent homogeneous of all milk. Samples of milk were taken into a 50 ml falcon tube and stored at 4–6 °C in a cool box until analyses were made in the laboratory. Analyses were immediately conducted in the laboratory after the end of the morning milking. Somatic cell counts of all samples were then analyzed with the NucleoCounter SCC-100 (Chemometec, Denmark), pH and conductivity (µS/cm) were analyzed two times by an ultrasonic milk analyzer (LACTOSCAN MMC 30 sec Milk Analyzer, Milkotronic Ltd, Bulgaria) and the color characteristics of the samples were measured by the Minolta Chroma Meter CR-400 (Konica Minolta, Inc., Osaka, Japan). CIELAB system measuring parameters are L*, a*, b* from the samples. The L*(darkness-lightness ranges between 0 and 100), a* (green-red ranges between -60 and +60) and b* (blue -yellow ranges between -60 and +60) color values at three times in the milk samples were averaged and recorded. Hueo (rednessyellowness) and Chroma (vividness-dullness) values were calculated using the formula Hueo = Tan-1 x (b*/a*) and Chroma = √‾‾‾‾ a*2 + b*2

Body Cleanliness Scoring For body cleanliness scoring, animals were photographed on

milk sampling day and the day before in right, left and back body regions. By using hygiene scoring charts5,6 such as tail head, upper rear limb, lower rear limb, udder side, ventral abdomen and hind udder, animals captured photos were evaluated individually regarding body cleanliness scores by 5 different assessors in the computer considering the dirtiest side of the body. In fact, the body cleanliness score was evaluated from the dirtier side of the animals because the manure contamination was not the same on either side.

Statistical analysis In this study, the Cronbach’s alpha statistic was used for consistency of the body cleanliness score between two observers taking into account all the scores as well as all observers. Consistency analysis was carried out with the SPSS 18.0 for Windows.16 After consistency of the body cleanliness score, scores were categorized as clean, slightly dirty and dirty considering all the scores. For analysis, clean, slightly dirty and dirty scores were defined as <2, 2≤ and <4, 4 and 5≤ except hind udder, respectively. For hind udder, clean, slightly dirty and dirty scores were defined as <2, 2≤ and <3, 3≤, respectively. SCC values were transformed into somatic cell linear scores (SCLS) to get a normal distribution by applying the following equation17; SCLS = [log2 (SCC/100,000)] +3. Following these, the JUMP statistical software package program18 was used to determine the associations between body cleanliness scores and the traits. The following statistical model was applied; Yijklm = µ + ai +bj + ck + bxijkl + eijklm Where; Yijklm: observed traits [TDMYm, logSCC (cell/ml), pH, conductivity (uS/cm) and color] in ijk-th animal µ: mean, ai: i. effect of parity, i = 1, 2, 3, 4, 5≤ bj: j. effect of body cleanliness scores, j= clean, slightly dirty and dirty score ck: k. effect of calving season, k= winter (December, January and February), spring (March, April and May), summer (June, July and August) and autumn (September, October and November) bxijkl: partial regression coefficient of days in milk (DIM) and test day milk yield in the morning milking (TDMYm) for observed traits eijklm: random error effect Since there was no difference in body cleanliness scores in terms of the milk quality criteria, the breed factor was removed from the statistical model. After statistical analyses, the differences between any two least squares means of the body cleanliness scores were compared with Tukey HSD test for traits by using JUMP statistical software.18

RESULTS AND DISCUSSION Consistency, correlation coefficient and percentage values between assessors Cattles were assessed and scored according to body cleanliness. Then, consistency between body cleanliness scores was evaluated from 5 different assessors. So, five assessors were taken into consideration for compliance in the analysis (P<0.01). Con-

Ibrahim_imp_ok 07/04/21 09:53 Pagina 71

A. İbrahim et al. Large Animal Review 2021; 27: 69-74

_ Table 1 - Consistency (α), correlation coefficient (r) and percentage (X%) values between body cleanliness scores evaluated from 4 different assessors. Assessors

Scoring regions

I r

TH URL LRL US VA HU Overall

0.720 0.784 0.676 0.846 0.864 0.841 0.798

0.562 0.644 0.511 0.733 0.761 0.725 0.664

0.497 0.419 0.437 0.629 0.581 0.635 0.533

TH URL LRL US VA HU Overall

0.732 0.762 0.617 0.763 0.824 0.845 0.766

0.578 0.616 0.446 0.616 0.700 0.732 0.620

III

TH URL LRL US VA HU Overall

0.759 0.774 0.728 0.802 0.918 0.865 0.815

TH URL LRL US VA HU Overall

0.810 0.855 0.780 0.851 0.909 0.896 0.850

General Overall

II r

III r

0.527 0.461 0.485 0.539 0.521 0.677 0.535

0.754 0.757 0.632 0.764 0.802 0.814 0.762

0.606 0.609 0.462 0.618 0.669 0.687 0.616

0.557 0.503 0.413 0.563 0.521 0.647 0.534

0.612 0.631 0.572 0.670 0.849 0.762 0.687

0.491 0.437 0.527 0.527 0.659 0.665 0.551

0.815 0.810 0.648 0.808 0.876 0.867 0.809

0.687 0.680 0.479 0.678 0.779 0.766 0.680

0.551 0.455 0.401 0.521 0.611 0.545 0.514

0.762 0.681 0.614 0.802 0.844 0.783 0.760

0.615 0.516 0.443 0.669 0.729 0.643 0.613

0.413 0.287 0.479 0.497 0.563 0.545 0.469

0.681 0.746 0.639 0.741 0.834 0.812 0.739

0.611 0.521 0.503 0.581 0.623 0.731 0.595 _ Xα=0.910

0.774 0.813 0.700 0.824 0.853 0.868 0.806

0.632 0.569 0.684 0.491 0.539 0.377 0.701 0.563 0.744 0.539 0.766 0.593 0.674 0.522 _ Xr= 0.688

0.778 0.744 0.631 0.789 0.851 0.815 0.781

0.637 0.575 0.592 0.413 0.460 0.473 0.664 0.575 0.741 0.623 0.688 0.575 0.640 0.539 _ X% = 0.539

IV r

0.765 0.829 0.711 0.825 0.949 0.964 0.856

0.619 0.708 0.552 0.702 0.903 0.931 0.747

0.485 0.419 0.461 0.575 0.749 0.928 0.603

α: Cronbach’s Alfa, r: correlation, %: consistency degree, TH: Tail Head, URL: Upper Rear Limb, LRL: Lower Rear Limb, US: Udder Side, VA: Ventral Abdomen and HU: Hind Udder.

_ sistency (α), correlation coefficient (r) and percentage (X%) values between body cleanliness scores evaluated from 5 different assessors are given in Table 1. As can be seen in Table 1, there is a high degree of consistency (α ≥0.760) between two assessors as well as all assessors (0.910). Considering the compatibility between assessors, the highest consistency was found between IV and V assessors (0.856). However, the lowest consistency was found between III and IV assessors (0.760). As can be seen in Schreiner and Ruegg8 study in terms of agreement within observer and between duplicate score, consistency values in current study seems to have a higher values than their study (ranges between 0.25 and 0.88) by using Kappa analysis. This situation was similar to the results of Schreiner and Ruegg8 study. Correspondingly, Reneau et al.5 stated that mean correlation coefficients for hygiene scores assigned twice by 4 experienced assessors were ≥0.884, indicating high repeatability. In this study, mean correlation coefficients (for hygiene scores by 5 assessors) were found as 0.688 and be_ tween ≥0.613. As far as mean percantage (X%) is concerned, values were found as 0.539, indicating acceptable rate.

Body cleanliness rates via scoring regions (%) Body cleanliness rates in the scoring regions according to scores are given in Table 2.

According to Table 2, the highest body cleanliness rates (%) by scoring regions, 2 and 3 scores were observed in the TH, URL and LRL regions. However, it is observed that 1, 2 and 3 body cleanliness scores are concentrated in the TH and US regions in this herd. Neja et al.19 stated that over 33% of the cows were found to be clean, with more of them in the free-stall barn, and also analysis of the cleanliness of body parts showed that the highest hygiene level was characteristic of the udders and underbelly (scores of 1 for 47% and 56% of the cows, respective-

Table 2. Body cleanliness rates in the scoring regions according to scores (%). Scores

Body Cleanliness Rates (%) TH

URL

9.34

10.18

46.71

34.49

30.06

31.50

11.14

16.29

2.75

7.54

LRL

3.95

24.31

18.08

16.05

40.36

47.07

47.43

54.49

34.37

19.16

19.28

24.19

16.89

6.71

10.30

5.27

4.43

2.75

4.91

TH: Tail Head, URL: Upper Rear Limb, LRL: Lower Rear Limb, US: Udder Side, VA: Ventral Abdomen and HU: Hind Udder.

Ibrahim_imp_ok 07/04/21 09:53 Pagina 72

The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle

_ _ Table 3 - Least squares means of milk yield and some criteria used in the milk quality detection via body cleanliness score (X%±SX)

TDMYm: Test day milk yield in the morning milking; DIM: Daily in milk, **P<0.01 (A, B); *P<0.05 (a, b); ns: non-significant.

ly). Different herd management systems affect animal health and welfare. Considering the literature about the body cleanliness studies, body cleanliness rates also vary depending on some factors such as shelter types (closed-open), stall structures (freebound), bearing materials (sand-handle-rubber), mechanization structures, the season when scoring and even animal behaviors in dairy cattle farms.7,20,21,22

Effect of body cleanliness score on some milk quality criteria Although milk is an indispensable source of protein for human nutrition, it plays a critical role in the early life of living being. Therefore, milk quality is important for both health and welfare. Milk with a mastitis is unsuitable for human consumption and health. So, it is extremely important to produce healthy milk from healthy cows. The somatic cell count (SCC), pH, conductivity and milk color are commonly used as a measure of udder health and milk quality.23 In recent years, one or more of these milk quality traits are especially evaluated together to produce healthier milk in dairy cattle.24 In this respect, cow cleanliness is also an indicator of udder health and welfare of dairy cows. In this study, least squares means of milk yield and some criteria used in the detection milk quality via body cleanliness score are given in Table 3. According to results, body cleanliness scores for tail head, upper rear limb, lower rear limb, ventral abdomen and hind udder were not associated with pH and conductivity (P>0.05). However, conductivity values in udder side of clean, slightly dirty

and dirty cows were found as 5.31±0.08, 5.43±0.08 and 5.52±0.10, respectively (P<0.05). As in the conductivity value, b* parameter of milk color were found as 2.34±0.29, 2.59±0.29 and 3.12±0.38, respectively (P<0.05). The same trend exists in the tail head region. b* parameter values in tail head of clean, slightly dirty and dirty cows were found as 2.18±0.33, 2.63±0.28 and 2.15±0.33, respectively. For udder side with regard to chroma values (C*), it is said that dirty cows have more saturated milk with 4.15 value, while in the clean cows with 3.60 appears duller. Also, slightly dirty cows with 3.76 value have a value between both (P=0.053). In addition, dirtier cows in the hind udder region have higher a* parameter of milk color. a* parameter values in the hind udder regions of clean, slightly dirty and dirty cows were found as-2.60±0.16, -2.50±0.16 and -2.13±0.20, respectively. Based on this study result, although there is statistically no difference in milk yield, statistical differences were found between some important milk quality characteristics in some regions according to body cleanliness. Schreiner and Ruegg reported that the mean of udder hygiene scores was 22%, and they also stated that there was a significant relationship between individual cow linear score increasing with poor udder hygiene (especially scores 3 and 4) and environmental pathogen and the prevalence of intramammary infection (P<0.05). In their study made with udder hygiene scoring system on 1250 cows in 8 herds, researchers reported that cows with udder hygiene scores 3 and 4 were infected with 1.5 times more pathogens than cows with udder hygiene scores 1 or 2. However, in their studies, there was a weak relationship between

Ibrahim_imp_ok 07/04/21 09:53 Pagina 73

A. İbrahim et al. Large Animal Review 2021; 27: 69-74

rear limb contamination score and pathogens isolated from the udder (P>0.05). In the study conducted to analyze the effect of the housing system (tie-stall vs free-stall) on cow cleanliness, and the effect of the degree of cow dirtiness on the milk somatic cell count, Neja et al.19 stated that the degree of udder dirtiness created differences (P≤0.01) in the natural logSCC and the natural logSCC increased from 11.54 to 12.37 on average with increased dirtiness of the udder. Also, researchers expressed that greater differences in the cytological quality of milk were found in cows housed in the free-stall system and stated that when analyzing the effect of overall dirtiness of the cows and the body parts on the percentage of SCC classes, it was found that highest quality milk (< 200 000 cells/ml) was produced by clean cows (71.52%). In the current study, although there was no statistically relationship between logSCC and cow cleanliness, it was found that dirty cows had higher logSCC averages in the other regions except TH and VA. Some dairy farmers claim that tail docking keeps the udder cleaner, and therefore improves milk quality and decreases somatic cell count.25 In this study, considering the least squares means of the TH region in terms of some criteria used in the milk quality detection, there were no statistical differences in terms of body cleanliness. However, cows with dirty tails may have also caused dirtiness by contaminating other body parts with tail movements. In a study by Kimeli et al.26 on 234 dairy cows to determine animal- and farm-level factors associated with upper hind leg cleanliness in smallholder dairy cows, it was reported that the prevalence of soiled legs was 59.0% (137/234). As a result, researchers suggest that farmers should address both housing design (especially the roof and stall size) and management issues (especially stall cleanliness) to enhance leg cleanliness and animal welfare.

CONCLUSIONS As a result of analysis of variance in regions where body cleanliness scores is evaluated by five assessors, although conductivity (P <0.05) and some milk color parameters such as b * (P <0.05) and C * (P = 0.053) values are statistically significant in US region, a* value, which is one of the other color parameters in the HU region, was again found to have higher means in the dirty body cleanliness score group. When the least squares averages of clean, slightly dirty and dirty animal groups are taken into consideration, in other words, it is also observed that other milk quality criteria tend to increase due to the increasing body cleanliness score. However, paying attention to important rules in the herd management such as milking and hygiene may also have caused the lack of significant relationships between the body cleanliness score and some milk quality criteria in this herd. According to dairy cattle managements, it is desirable that 80% of cows have 1 body cleanliness score in a dairy cattle herd. If more than 10% of dairy cows have 4 body cleanliness score, hygiene measures must be taken urgently because the cows with a body cleanliness score of 3, 4 and 5 have an increased risk of mastitis.5 However, given body cleanliness rates in the scoring regions in this study, manure and milking management, and grooming practices should be revised to prevent the increase of mastitis cases at this herd.

ACKNOWLEDGEMENTS We are thankful to Galipoglu HAY-TAR Agricultural Enterprise for providing the material used in this study. Statement of conflict of interest: Authors have declared no conflict of interest. Orcid: İbrahim Aytekin: 0000-0001-7769-0685; Yasin Altay: 0000-0003-4049-8301; Saim Boztepe: 0000-0003-10969141; İsmail Keskin: 0000-0001-9358-7522; Uğur Zülkadir: 0000-0003-3243-4949

References 1.

8. 9.

10.

11.

12.

13. 14.

15.

16. 17. 18. 19.

Looper L.M., Stokes S.R., Waldner D.N and Jordan E.R. (2001). Managing Milk Composition: Normal Sources of Varation, Guide D-103. http://aces.nmsu.edu/pubs/_d/d-103.html. [Accession Date:17.07.2020]. Kellogg W. (2013). Body Condition Scoring with Dairy Cattle - FSA4008. https://www.uaex.edu/publications/PDF/FSA-4008.pdf. [Accession Date: 17.07.2020]. Schlageter-Tello A., Bokkers E.A.M., Koerkamp P.W.G., Van Hertem T., Viazzi S., Romanini C.E.B., Halachmi I., Bahr C., Berckmans D and Lokhorst K. (2015). Comparison of locomotion scoring for dairy cows by experienced and inexperienced raters using live or video observation methods. Anim Welf 24(1): 69-79. Mein G.A., Neijenhuis F., Morgan W.F., Reinemann D.J., Hillerton J.E., Baines J.R., Ohnstad I., Rasmussen M.D., Timms L., Britt J.S., Farnsworth R., Cook N and Hemling T. (2001). Evaluation of bovine teat condition in commercial dairy herds: 1. Non-infectious factors. In Proceedings of 2nd International Symposium on Mastitis and Milk Quality, Vancouver, BC, Canada, 13th pp. 347-351. Reneau J.K., Seykora A.J., Heins B.J., Endres M.I., Farnsworth R.J and Bey R.F. (2005). Association between hygiene scores and somatic cell scores in dairy cattle. J Am Vet Med A 227(8): 1297-1301. Cook N.B and Reinemann D.J. (2007). A tool box for assessing cow, udder and teat hygiene. 46th Annual Meeting of the National Mastitis Council. San Antonio, Texas. http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.179.2886. [Accession Date:17.07.2020]. Sant’Anna A.C and Paranhose da Costa M.J.R. (2011). The relationship between dairy cow hygiene and somatic cell count in milk. J Dairy Sci 94(8): 3835-3844. Schreiner D.A and Reugg P.L. (2003). Relationship Between Udder and Leg Hygiene Scores and Subclinical Mastitis. J Dairy Sci 86: 3460-3465. Manlongate N., Yang T.J., Hinckley L.S., Bendel R.B and Krider H.M. (1998). Physiologic-chemoattractant-induced migration of polymorphonuclear leukocytes in milk. Clin Diagn Lab Immunol 5: 375–381. Rice D.N and Bodman G.R. (1997). The somatic cell count and milk quality. http://www.ianr.unl.edu/pubs/dairy/g506.htm [Accession Date: 05.05.2005]. Miller R.H., Paape M.J., Fulton L.A and Schutz M.M. (1993). The relationship of milk somatic cell count to milk yields of Holstein heifers after first calving. J Dairy Sci 76: 728-733. Yalçın C., Cevger Y., Türkyılmaz K and Uysal G. (2000). Estimation of Milk Yield Losses from Subclinical Mastitis in Dairy Cows. Turk J Vet Anim Sci 24(6): 599-604. Bendali F., David V and Leclerc M.C. (2011). La gestion sanitare du troupeau. Agri Production. Paris, France. Hauge S J, Kielland C., Ringdal G., Skjerve E and Nafstad O. (2012). Factors associated with cattle cleanliness on Norwegian dairy farms. J Dairy Sci 95(5): 2485-2496. Cook N.B. (2002). The influence of barn design on dairy cow hygiene, lameness and udder health. Proc. of the 35 th Ann. Conv. Amer. Assoc. Bov. Pract., Madison, WI. Rome, GA, Amer Assoc Bov Pract 97-103. Statistics PASW. (2009) Predictive Analytics SoftWare Statistics (Version 18). SPSS Inc. Ali A.K.A and Shook G.E. (1980). An optimum transformation for somatic cell concentration in milk. J Dairy Sci 63: 487-490. SAS. (2002). JMP statistical discovery software. Version 5. SAS Institute Inc. Neja W., Bogucki M., Jankowska M and Sawa A. (2016). Effect of cow clean-

Ibrahim_imp_ok 07/04/21 09:53 Pagina 74

20.

21.

22.

23.

The effect of body cleanliness (hygiene) score on some criteria used in the detection milk quality in dairy cattle liness in different housing systems on somatic cell count in milk. Acta Veterinaria Brno 85(1): 55-61. Ellis K.A., Innocent G.T., Mihm M., Cripps P., McLean W.G., Howard C.V and Grove-White D. (2007). Dairy cow cleanliness and milk quality on organic and conventional farms in the UK. Int J Dairy Sci 74(3): 302-210. Lombard J.E., Tucker C.B., Von Keyserlingk M.A.G., Kopral C.A and Weary D.M. (2010). Associations between cow hygiene, hock injuries, and free stall usage on US dairy farms. J Dairy Sci 93(10): 4668-4676. Bouffard V., De Passille A.M., Rushen J., Vasseur E., Nash C.G.R., Haley D.B and Pellerin D. (2017). Effect of following recommendations for tiestall configuration on neck and leg lesions, lameness, cleanliness, and lying time in dairy cows. J Dairy Sci 100(4): 2935-2943. Aytekin I and Boztepe S. (2014). Somatic Cell Count, Importance and Ef-

fect Factors in Dairy Cattle. Turkish Journal of Agriculture - Food Science and Technology. 2 (3): 112-121. 24. Aytekin I., Eyduran E and Keskin I. (2018). Detecting the relationship of california mastitis test (CMT) with electrical conductivity, composition and quality of the milk in Holstein-Friesian and Brown Swiss cattle breeds using cart analysis. Fresenius Environmental Bulletin. 27(6): 45594565. 25. Frantz L.M., Morabito E.A., Dolecheck K.A and Bewley J.M. (2019). A comparison of cow cleanliness, fly population, and fly avoidance behaviors among docked, switch-trimmed, and switch-intact dairy cows in 3 commercial dairy herds. J Dairy Sci 102(2): 1584-1588. 26. Kimeli P., Makau A., Leeuwen J.V., Gitau G., Muraya J., McKenna S and Heider L. (2019). Factors associated with leg cleanliness of smallholder dairy cows in Kenya. East Afr J Sci Technol Innov 1(1): 11-26.

Ibrahim_imp_ok 07/04/21 09:53 Pagina 75

Ibrahim_imp_ok 07/04/21 13:40 Pagina 76

Hedia_imp_ok 07/04/21 09:56 Pagina 77

M.G. Hedia et al. Large Animal Review 2021; 27: 77-82

Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi ram lambs

MOHAMED G. HEDIA*, MOHAMED S. EL-BELELY Department of Theriogenology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt

SUMMARY The present detailed study aimed to record for the first time the testicular dimensions (length, width, thickness, and volume), testicular echotexture (pixel intensity, pixel standard deviation, and colored area pixels) using gray-scale/Doppler ultrasonography and investigating the blood flow indices (resistive and pulsatility index) for testicular artery from one hand, and to explore the possible associations between these parameters in Ossimi ram lambs under subtropical conditions from the other hand. 8 ram lambs (aging 4-5 months and weighing 30-40 kg) were submitted to B-mode testicular ultrasonography (US) for evaluation of the testicular length, width, thickness, and volume. The testicular artery was submitted to the pulsed-wave Doppler examination to measure the resistive index (RI) and pulsatility index (PI). Computer-assisted image analysis was applied for Bmode/color Doppler images. Regarding the testicular dimensions, testicular length, width, thickness, and volume were (63.90±10.42 mm, 34.50±3.70 mm, 36.50±2.52 mm, and 58.80±9.98 mm3, respectively). Blood flow indices (RI and PI) experienced a significant strong association between each other (r= 0.878, P ≤0.01). Regarding testicular image analysis, testicular parenchyma recorded higher values of testicular echogenicity (82.5 ±12.47), which was directly associated with other testicular morphometric characteristics (P ≤0.01). As we can conclude, the testicular US is of great potential usefulness to assess the testicular dimension and reproductive growth in ram lambs. RI and PI were directly affected by the sexual stage and could be a reflection of the attainment of puberty and testicular function in rams under subtropical conditions.

KEY WORDS Testes, Doppler, Testicular artery, Ossimi Lambs, Rams.

INTRODUCTION Livestock production is an important industry in different countries in the world particularly in the developing countries to fulfil the needs of meat, milk, and other products (manure and wool). Egypt has a modest population of ovine species which is estimated to 5.69 million heads, which represents approximately 7.4% of all red meat production in Egypt according to FAOSTAT1. The whole red meat-producing farm animals including sheep providing a self-sufficiency ratio of red meat which was estimated as 55.9% in 20172. Besides, farm animals’ production contributes to 10-14% of national income in Egypt, which is expected to decline due to the rapidly increased Egyptian population, which exceeds 100 million according to World Population Review (2018). For these clear points, more efforts should be directed through breeding soundness examination in Ossimi lambs via testicular ultrasonographic and Doppler examination of testicular functionality to maximize the efficiency of sheep production especially the Ossimi breed, which is the most common breed reared in Egypt. Regarding the breeding soundness examination in farm animals, there are different classical methodology concerning with selection of the most appropriate male for breeding. Also, breeders tend to house a limited number of high reproductive qualities to impregnate the largest number of females. These methods consist of routinely used measures as estimating the scro-

Corresponding Author: Mohamed G. Hedia (mohammedhedia@cu.edu.eg).

tal circumference, rectal examination of accessory sex glands, traditional physical examination of testicular and preputial contents as well as semen analysis3-5. Due to the extensive breeding systems, practitioners have to deeply evaluate the breeding capacity of sires using the most advanced available technologies. Recently, Ultrasonography (US) is the most suitable method to scan the normal morphological features of the primary reproductive organ (testis). US is a non-invasive, available technique to reliably scan the reproductive organs6. US provides promising imaging results, where it could be used to verify the normal morphological architecture of the testis and check its main functions (spermatogenesis and steroidogenesis). In addition, US could be used to compare between the normal and abnormal physiological reproductive status, where US allowing andrologists to detect the abnormal pathological testicular contents, which severely deteriorate the breeding capacity of the male7, 8. Despite the gray-scale testicular ultrasonographic examination, testicular Doppler analysis is an emerging recent technique to evaluate the testicular functions through investigating its vascular irrigation via testicular artery, which has a promising outcome in the last decade. As a vital organ, testicular blood flow has great communication with its main functions, where disruption of the testicular blood flow is a critical process on the testicular physiological status9. For that, the examination of the testicular artery by color Doppler and measuring the blood flow indices (resistive and pulsatility index) have a considerable role to deeply investigate the testicular functions10. Several workers in bucks, bulls, dogs, stallions, and rams have detected the direct association between testicular hemodynamics and reproductive quality via investigating the association between tes-

Hedia_imp_ok 07/04/21 09:56 Pagina 78

Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi

ticular blood flow indices, sperm characteristics, and plasma androgen concentrations11-15. In addition to these important methodologies to evaluate the testicular functions, andrologists have recommended another promising technique to investigate the reproductive status through the application of a computer-based technique to assess pre-saved B-mode images of scrotal contents, especially for testicular parenchyma16. Nowadays, several reports have confirmed that there is strong communication between testicular echotextural parameters and sperm quality and quantity characteristics17-19. Testicular ultrasonogram is a software-based method for evaluating the testicular parenchyma echotexture20. Testicular echogenicity (pixel intensity), testicular heterogeneity (pixel standard deviation) as well as testicular vascular area pixels (testicular artery) have been obtained for the testicular parenchyma to correlate the breeding efficiency with testicular image analysis technique to be more trustful for further breeding soundness examination21. According to our knowledge, there is a scarce number of reports concerning using the Doppler ultrasonography to assess the testicular ultrasonographic morphometric, echotextural attributes as well as testicular blood vascular irrigation indices through breeding soundness examination in ram lambs. For that, we hypothesize that the application of such promising techniques has considerable usefulness to evaluate the reproductive status. In addition, sexual maturation could be affect on testicular dimensions, the echotextural appearance of testicular parenchyma as well as blood flow indices of the testicular artery in ram lambs under subtropical conditions.

Ultrasonographic examinations All testicular ultrasonographic scanning was performed by the same investigator. Gray-scale and pulsed-wave Doppler were done using 7.5 MHz linear-array transducer (EXAGO, Echo Control Medical, France). All settings (brightness, frequency, and gain) were kept fixed for all measurements. Rams were kept secured in the lateral recumbency without sedation. The fine scrotal wool was shaved before ultrasound examination. The transducer was covered with an appropriate amount of gel to avoid any imperfections.

Gray-scale testicular ultrasonography Testicular parenchyma was checked for testicular length (L), width (W) and thickness (T) using electronic calipers (Fig. 1). Testicular volume (TV) was calculated using the following formula, where TV= L × W × T × 0.7122.

Pulsed-wave Doppler scanning Testicular blood flow dynamics were measured to check the testicular irrigation (Fig. 2). Spectral Doppler examination was carried out by identifying all vascular structures using B-mode ultrasonography as well as color flow mapping for the proximal pole of the testes (pampiniform .plexus). The angle between the Doppler beam and the longitudinal axis of the testicular artery was never more than 60, with a high pass filter set at 50Hz. The spectral Doppler gate was fixed at 1 mm. The studied blood flow indices were resistive index (RI= (peak systolic velocityend diastolic velocity)/peak systolic velocity) and pulsatility index (PI= (peak systolic velocity-end diastolic velocity)/ mean velocity) according to Batissaco et al.23.

Image analysis MATERIALS AND METHODS Animals and management The present study was conducted using a total number of 8 prepubertal ram lambs (aging 4-5 months and weighing 30-40 kg). All animals were submitted to routine clinical examination especially for the vascular system (pulse rate and capillary refilling time) to exclude any diseased ram from the study. All animals were kept on a balanced ration as well as free access to fresh water. All study protocol was carried out according to the guidelines of animal care and ethical use committee of Cairo University (CU ɪɪ S 5 18).

The pre-saved B-mode/color Doppler images of the testicular parenchyma were used for further computer-assisted image analysis (Fig. 3). Image analysis was performed using image assessment software (Image J, U. S. National Institutes of Health, Maryland, USA). Both testicular echogenicity (pixel intensity) and heterogeneity (pixel standard deviation) were calculated on the area of interest (1 cm2/ testis) by drawing a rectangle 0.5 to 1.0 cm deep into the homogenous testicular parenchyma24. The colored red and blue areas of pampiniform plexus (area of interest) were calculated per pixel using Adope PhotoShop CC softwere (1990-2013, Adope Systems). Colored Doppler im-

Figure 1 - Ultrasonographic estimation of the studied testicular dimension (L, testicular length, T, Testicular thickness, W, testicular width) using electronic calipers.

Hedia_imp_ok 07/04/21 09:56 Pagina 79

M.G. Hedia et al. Large Animal Review 2021; 27: 77-82

Figure 2 - Assessment of blood flow indices (resistive and pulsatility index) for testicular artery in ram lambs.

Figure 3 - Computer-assisted image analysis for pre-saved gray-scale/colored testicular images, where A represents the rectangle area of interest within testicular parenchyma, and B represents calculating the area/pixels within the vascular regions (pampiniform plexus) of testicular artery.

ages were exported to a removable hard disk for further computer analysis. A magnetic lasso tool was obtained to identify the colored area, which is followed by counting the pixels in this area of interest according to Batissaco et al.23.

Statistical analysis The results of the studied variables (testicular morphometric parameters, testicular length, width, thickness, and volume as well as blood flow indices, resistive index, and pulsatility index) were expressed as mean ±SD. The resulted data were tested for normality using Shapiro-Wilk test, where data showed normal statistical distribution. A t-test was used to compare means of the right and left testes’ measurements. Pearson correlation coefficients were studied between the whole variables. Differences were considered significant at P≤0.05. All the statistical analysis was carried out using SPSS, version 16.0.

RESULTS As shown in table1, testicular width, thickness, and volume recorded significant differences between the both testes (P≤0.05), where the mean values for these parameters were 34.51 mm, 36.55 mm and 58.89 mm3, respectively. In addition, the left testis showed the highest testicular dimensions compared with the right testis. Interestingly, there were positive associations (Table 2) between the studied testicular dimensions, where testicular width showed a considerable communication (Table 2) with the testicular thickness (r =0.913, P≤0.01), testicular length (0.770, P≤0.01) and testicular volume (r =0.935, P≤0.01). However, testicular volume recorded a strong association with testicular length (r =0.933, P≤0.01) and testicular thickness (r =0.854, P≤0.01).

Hedia_imp_ok 07/04/21 09:56 Pagina 80

Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi

Table 1 - Mean ±SD of testicular dimensions (length, width, thickness and volume), testicular echotextural attributes (echogenicity, heterogeneity and area/pixels) as well as intratesticular blood flow indices (resistive and pulsatility index) in ram lambs (n=8). Parameters

Right testis

Left testis

Testicular length (mm)

60.52±11.38

67.32±10.87

Testicular width (mm)

33.67±2.38a

35.35±4.64b

Testicular thickness (mm) 3

Testicular volume (mm )

35.25±1.47

P-value

37.85±2.73

51.44±13.30 a

66.33±23.18

Range

Overall

0.623

48.90-81.50

63.92±11.43

0.001

29.80-40.20

34.51±3.70

0.001

33.40-40.70

36.55±2.52

0.001

41.62-93.51

58.89±19.99

Resistive index

0.51±0.05

0.74±0.12

0.025

0.43-0.84

0.62±0.15

Pulsatility index

0.72±0.10a

1.24±0.23b

0.022

0.64-1.60

0.98±0.34

83.26±10.66

81.83±14.50

0.348

63.75-102.15

82.55±12.47

0.018

17.98-24.46

21.15±1.91

0.011

1477-5579

2832±367.21

Testicular echogenicity Testicular heterogeneity Area/pixels a,b

20.63±2.47

21.68±1.00 a

3037±789.87

2627±178.68

at the same row are significantly different at P≤0.05.

Table 2 - Correlation coefficients between testicular morphometric parameters, testicular echotexture measures and testicular blood flow indices in ram lambs. Paired measures

Correlation coefficient

Testicular length × testicular width

0.770**

Testicular length × testicular thickness

0.623**

Testicular length × testicular volume

0.933**

Testicular length × testicular echogenicity

0.505*

Testicular width × testicular thickness

0.913**

Testicular width × testicular volume

0.935**

Testicular width × testicular echogenicity

0.760**

Testicular width × testicular heterogeneity

-0.438*

Testicular thickness × testicular volume

0.854**

Testicular thickness × testicular heterogeneity

0.668**

Testicular volume × testicular heterogeneity

0.658**

Resistive index × pulsatility index

0.878**

Resistive index × testicular heterogeneity

0.458*

* means significant at P≤0.05. ** means significant at P≤0.01.

Regarding the spectral Doppler analysis of the testicular artery (Table 1), both resistive and pulsatility indices experienced considerable changes between the right and left testicular artery (P≤0.05), where the values for resistive and pulsatility indices were ranged between 0.43-0.84 and 0.64-1.60, respectively. There was a strong positive correlation (Table 2) between both indices (r =0.878, P≤0.01). Regarding the testicular computer-assisted image analysis (Table 1 and 2), testicular echogenicity was not significantly different between the right and left testes (P≥0.05), where the overall measurement was 82.55±12.47. while, there were significant different changes between the testicular heterogeneity and testicular vascular area pixels (P≤0.05). testicular heterogeneity showed positive associations with the other testicular dimensions as testicular thickness (r =0.668, P≤0.01) and testicular volume (r =0.658, P≤0.01).

DISCUSSION During the last decade, the using of ultrasonography technology to evaluate testicular functionality has noted a great potential impact on the breeding soundness evaluation in farm animals. However, there is a lack of literatures concerning the potential importance of testicular ultrasonographic imaging and their possible role for the prediction of reproductive efficiency in rams23, 24. In addition to these clear points, the testicular ultrasonographic examination is a highly valuable and accurate technique to definitely measure the true testicular morphometric dimensions, where the classical scrotal circumference examination is not an accurate technique to define the exact testicular volume owing to the presence of a considerable scrotal skin, subcutaneous fascia and epididymis, which could greatly interfere with the precise determination of testicular size25. In the present study, testicular dimensions showed a considerable difference between the right and left testes. However, Martinez et al.26 had reported that testicular weight, not size, affected on daily sperm production and sperm cells concentration in rams, where there is a constant rate of sperm production by 20 million sperm/1 g of testis/day. In agreement with our results, Iraqi ram lambs recorded similar measurements for testicular length, width, and thickness27, where animals showed a closely related bodyweight and growth pattern. In contrast, Karadi lambs28 and Santa Ines lambs29 experienced clear different testicular biometric parameters, where there was a severe decline in testicular length and width, which might be due to the great smaller bodyweight (21.82 kg and 23 kg, respectively) compared with Ossimi lambs in our study (30-40 kg). The testis is a vital compact organ with a high metabolic rate function, where its main functions are spermatogenesis (sperm production) and steroidogenesis (testosterone synthesis). To maintain the testicular physiological roles, constant testicular blood flow should be supplied through the main testicular artery. Regarding the testicular blood irrigation in ram lambs, there is a lack in reports dealing with the characterization of testicular hemodynamics and its potential role for reproductive development in lambs30. The four common parameters of hemodynamics are peak systolic velocity (PSV), end diastolic velocity (EDV), resistive index (RI), and pulsatility index (PI). PSV and EDV are concerning with deeply measure the arterial blood velocities, but these measures are not constant and considerably depending on dif-

Hedia_imp_ok 07/04/21 09:56 Pagina 81

M.G. Hedia et al. Large Animal Review 2021; 27: 77-82

ferent factors10. Resistive index (RI) and pulsatility index (PI) are the most useful blood flow indices to evaluate the testicular vascularity and to predict fertility31, 32. In the current study, the spectral Doppler analysis for testicular artery in Ossimi lambs experienced a non-resistive monophasic pattern of the cardiac cycle. Our investigations were in agreement with those reported in dogs33 and bulls17. In addition, resistive index and pulsatility index showed higher values for the left testis compared with the right one. In agreement with this finding, previous reports in human34 and healthy dogs35 have explained that the left testicular artery arches over the renal vein, which provide a further pressure on the arterial wall and increasing the blood velocities in this area. In addition, we recorded a significantly higher testicular of the left testis compared with the right testis, where the higher testicular volume should be provided a suitable vascular infusion to achieve its functions. Computer-based evaluation of testicular ultrasonogram had been used to monitor the sexual development16, 36. In our study, we recorded that testicular echogenicity (pixel intensity) was higher in the parenchyma of ram lambs. In previous studies, Riberio et al.37 and Camela et al.24 recorded a similar measurement for testicular pixel intensity in Santa Ines and Dorper lambs, respectively. These cellular histomorphological changes are characterized through the increase in the diameter of seminiferous tubules, morphological differentiation of Sertoli cells and the amount of the produces testicular fluids38, 39. As far as we know, spermatogenesis is a vital process and is directly associated with the constant blood supply for the testes via the testicular artery40. This is in agreement with the declined values of RI and PI in the right testis, which allow less resistance against the passing blood within the testicular artery, which supposed to causing the higher values of colored rea pixels in the pampiniform plexus of the right testis compared with the left testis owing to the increased right testicular vascular irrigation.

CONCLUSION As we can conclude, testicular ultrasonographic examination is useful to deeply predict the sexual development in Ossimi ram lambs. Gray-scale imaging could be used through the routine breeding soundness evaluation in ram lambs. Testicular pulsed-wave Doppler analysis is a promising technique to investigate the testicular vascular irrigation and prediction of testicular function. Thus, reproductive development is strongly associated with different testicular ultrasonographic and spectral Doppler analysis in Ossimi ram lambs under subtropical conditions.

CONFLICT OF INTEREST The authors declare that they do not have any conflict of interests.

AUTHORSHIP CONTRIBUTION STATEMENT Hedia is the main investigator in data collection, writing and drafting, while El-Belely is the main supervisor of study design and reviewing.

References 1. FAOSTAT (2018). Food and Agriculture Organization Corporate Statistical Database. 2. CAPMAS (2016). Central Agency for Public Mobilization and Statistics in Egypt. 3. Menegassi S.R.O., Barcellos J.O.J., Borges J.B.S., Canozzi M.E.A., Pripolli V., Júnior C.K., Lopes F.G., Cervo H.J. (2014). Breeding Soundness Examination: Understanding the causes of examination failure in young and mature rams. Int J Plant Anim Sci; 2: 98-104. 4. Tibary A., Boukhliq R., El Allali K. (2018). Ram and Buck breeding soundness examination. Rev Mar Sci Agr Vét; 6: 241-255. 5. Hedia M.G., El-Belely M.S., Ismail S.T., Abo El-Maaty A.M. (2020a). Evaluation of Testicular Blood Flow and Ultrasonographic Measurements in Rams with Emphasis on Laterality. J Adv Vet Res; 10: 17-20. 6. Abdel Razek A., Ali A.(2005). Developmental changes of bull (Bos taurus) genitalia as evaluated by caliper and ultrasonography. Reprod Domest Anim; 40: 23-7. 7. Júnior C.C., Moustacas V.S., Xavier M.N., Costa E.A., Costa L.F., Silva T.M.A., Paixão T.A., Borges A.M., Gouveia A.M.G., Santos R.L.(2012). Andrological, pathologic, morphometric, and ultrasonographic findings in rams experimentally infected with Brucella ovis. Small Rum Res; 102: 213-222. 8. Gouletsou P.G., Galatos A.D., Fthenakis G.C.(2008). Clinical, ultrasonographic and pathological features following unilateral vasectomy in rams. Anim reprod Sci; 103: 52-68. 9. Bergh A., Damber J.E.(1993). Vascular Controls in Testicular Physiology. In: de Kretser, DM, editor. Molecular Biology of the Male Reproductive System. Academic Press, New York; 439-68. 10. Pozor M.A., McDonnell S.M.(2004). Color Doppler ultrasound evaluation of testicular blood flow in stallions. Theriogenol; 61: 799-810. 11. Strina A., Corda A., Nieddu S., Solinas G., Lilliu M., Zedda M.T., Pau S., Ledda S.(2016). Annual variations in resistive index (RI) of testicular artery, volume measurements and testosterone levels in bucks. Comp Clinic Pathol; 25: 409-413. 12. Gloria A., Carluccio A., Wegher L., Robbe D., Valorz C., Contri A. (2018). Pulse wave Doppler ultrasound of testicular arteries and their relationship with semen characteristics in healthy bulls. J anim Sci biotechnol; 9: 14. 13. Lemos H., Dorado J., Hidalgo M., Gaivão I., Martins-Bessa A.(2020). Assessment of dog testis perfusion by colour and pulsed-Doppler ultrasonography and correlation with sperm oxidative DNA damage. Topics Comp Anim Med; p.100452. 14. Rodriguez J.M., Anel-Lopez L., Martín-Muñoz P., Álvarez M., GaitskellPhillips G., Anel L., Rodríguez-Medina P., Peña F.J., Ortega Ferrusola C.(2017). Pulse Doppler ultrasound as a tool for the diagnosis of chronic testicular dysfunction in stallions. PloS one; 12: 0175878. 15. Hedia M.G., El-Belely M.S., Ismail S.T., Abo El-Maaty A.M.(2020c). Seasonal variation in testicular blood flow dynamics and their relation to systemic and testicular oxidant/antioxidant biomarkers and androgens in rams. Reprod Domest Anim; 55: 861-9. 16. Brito L.F.C., Barth A.D., Wilde R.E., Kastelic J.P.(2012). Testicular ultrasonogram pixel intensity during sexual development and its relationship with semen quality, sperm production, and quantitative testicular histology in beef bulls. Theriogenol; 78: 69-76. 17. Rodrigues N.N., Rossi G.F., Vrisman D.P., Taira A.R., Souza L.L., Zorzetto M.F., Bastos N.M., de Paz C.C.P., de Lima V.F.M.H., Monteiro F.M., Oliveira M.E.F.(2020). Ultrasonographic characteristics of the testes, epididymis and accessory sex glands and arterial spectral indices in peri-and post-pubertal Nelore and Caracu bulls. Anim Reprod Sci; 212: 106235. 18. England G.C., Bright L., Pritchard B., Bowen I.M., de Souza M.B., Silva L.D.M., Moxon R.(2017). Canine reproductive ultrasound examination for predicting future sperm quality. Reprod Domest Anim; 52: 202-7. 19. Hedia M.G., El-Belely M.S., Ismail S.T., Abo El-Maaty A.M.(2020b). Seasonal changes in testicular ultrasonogram pixel-intensity and their association with semen characteristics in rams. Asian Pac J Reprod; 9: 49-54. 20. Arteaga A.A., Barth A.D., Brito L.F.(2005). Relationship between semen quality and pixel-intensity of testicular ultrasonograms after scrotal insulation in beef bulls. Theriogenol; 64: 408-15. 21. Moxon R., Bright L., Pritchard B., Bowen I.M., de Souza M.B., da Silva L.D.M., England G.C. (2015). Digital image analysis of testicular and prostatic ultrasonographic echogencity and heterogeneity in dogs and the relation to semen quality. Anim Reprod Sci; 160: 112-9. 22. Hedia M.G., El-Belely M.S., Ismail S.T., Abo El-Maaty A.M. (2019). Monthly changes in testicular blood flow dynamics and their association with testicular volume, plasma steroid hormones profile and semen characteristics in rams. Theriogenol; 123: 68-73.

Hedia_imp_ok 07/04/21 09:56 Pagina 82

Testicular morphometric and echotextural parameters and their correlation with intratesticular blood flow in Ossimi

23. Batissaco L., Celeghini E.C.C., Pinaffi F.L.V., de Oliveira B.M.M., de Andrade A.F.C., Recalde E.C.S., Fernandes C.B. (2013). Correlations between testicular hemodynamic and sperm characteristics in rams. Braz J Vet Res Anim Sci; 50: 384-95. 24. Camela E.S., Nociti R.P., Santos V.J., Macente B.I., Murawski M., Vicente W.R., Bartlewski P.M., Oliveira M.E.F. (2019). Changes in testicular size, echotexture, and arterial blood flow associated with the attainment of puberty in Dorper rams raised in a subtropical climate. Reprod Domest Anim; 54: 131-7. 25. Paltiel H.J., Diamond D.A., Di Canzio J., Zurakowski D., Borer J.G., Atala A. (2002). Testicular volume: comparison of orchidometer and US measurements in dogs. Radiol; 222: 114-9. 26. Martínez J., Limas T., Perón N. (1994). Daily production and testicular and epididymal sperm reserves of Pelibuey rams. Theriogenol; 41: 1595-9. 27. Saeed F.F., Zaid N.W. (2018). Predictor ultrasonographic evaluation of the testis during pubertal age in ram lambs. Adv Anim Vet Sci; 6: 521-5. 28. Omar C.A. (2016). Study of some testicular dimensions and their relationship to body weight in Karadi ram lambs. Assiut Vet Med J; 62: 31-8. 29. Andrade A.K.G., Soares A.T., Freitas F.F., Silva S.V., Peña-Alfaro C.E., Batista A.M., Guerra M.M.P. (2018). Testicular and epididymal ultrasonography in Santa Inês lambs raised in Brazil. Anim Reprod; 11: 110-8. 30. Elbaz H.T., Elweza A.E., Sharshar A.M. (2019). Testicular Color Doppler Ultrasonography in Barki Rams. Alex J Vet Sci; 61(1). 31. Biagiotti G., Cavallini G., Modenini F., Vitali G., Gianaroli L. (2002). Spermatogenesis and spectral echo colour Doppler traces from the main testicular artery. BJU international; 90: 903-8.

32. Kutzler M., Tyson R., Grimes M., Timm K. (2011). Determination of testicular blood flow in camelids using vascular casting and color pulsedwave Doppler ultrasonography. Vet Med international; 2011. 33. Zelli R., Troisi A., Ngonput A.E., Cardinali L., Polisca A. (2013). Evaluation of testicular artery blood flow by Doppler ultrasonography as a predictor of spermatogenesis in the dog. Res Vet Sci; 95: 632-7. 34. Dogra V.S., Gottlieb R.H., Oka M., Rubens D.J. (2003). Sonography of the scrotum. Radiol; 227: 18-36. 35. Souza M.B., da Cunha Barbosa C., Pereira B.S., Monteiro C.L.B., Pinto J.N., Linhares J.C.S., da Silva L.D.M. (2014). Doppler velocimetric parameters of the testicular artery in healthy dogs. Res Vet Sci; 96: 533-6. 36. Chandolia R.K., Honaramooz A., Omeke B.C., Pierson R., Beard A.P., Rawlings N.C. (1997). Assessment of development of the testes and accessory glands by ultrasonography in bull calves and associated endocrine changes. Theriogenol; 48: 119-132. 37. Ribeiro M.D.S., Quirino C.R., Junior A., Pacheco A. (2017). Biometry and ultrasound evaluation of testicles and accessory glands in Santa Ines rams. Revista Brasileira de Zootecnia; 46: 317-23. 38. Evans A.C.O., Pierson R.A., Garcia A., McDougall L.M., Hrudka F., Rawlings N.C. (1996). Changes in circulating hormone concentrations, testes histology and testes ultrasonography during sexual maturation in beef bulls. Theriogenol; 46: 345-57. 39. Eurell J.A., Frappier B.L. (2012). Histologia veterinária de Dellmann. Tradução: Fernando Gomes do Nascimento, Sixth edition. 40. Herwig R., Tosun K., Pinggera G.M., Soelder E., Moeller K.T., Pallwein L., Frauscher F., Bartsch G., Wildt L., Illmensee K. (2004). Tissue perfusion essential for spermatogenesis and outcome of testicular sperm extraction (TESE) for assisted reproduction. J Assis Reprod Gen; 21: 175-180.

Alizadehasl imp_ok 07/04/21 09:57 Pagina 83

M. Alizadehasl; Large Animal Review 2021; 27: 83-90

The investigation of milk yield, composition, quality, and fatty acids in Angora goats based on rangeland feeding conditions

MAZIAR ALIZADEHASL1, NECMETTIN UNAL*2 1

Graduate School of Health Sciences, Ankara University, Ankara, Turkey Department of Animal Breeding and Husbandry, Faculty of Veterinary Medicine, Ankara University, Ankara, Turkey

SUMMARY The study aimed to survey milk yield, composition, some quality characteristics, and fatty acids in Angora goats fed at rangeland conditions. The traits investigated were examined for lactation number (LN; 1, 2, and 3+), lactation stage (LS; early, middle, and late), and milking time (MT; morning and evening). The daily milk yields were determined as 415.60±21.58, 496.73±17.39, and 533.60±18.14 g (P<0.001), and the lactation milk yields were defined as 71.57±4.35, 90.15±3.25, and 96.31±3.99 kg (P<0.001) in the goats with LN 1, 2, and 3+, respectively. Milk chemical composition (fat, protein, lactose, and dry matter) changed significantly (P<0.05, P<0.01, P<0.001) because of LN, LS, and MT. The milk pH values were not varied significantly by LN, however, varied by LS (P<0.001) and MT (P<0.01) importantly. While LN did not affect the milk color coordinates, the effects of LS on a* values (P<0.001) and MT on a* and b* values (P<0.001) were prominent. The majority of fatty acids did not differ significantly among LN but differed importantly (P<0.05, P<0.01, P<0.001) due to the LS. Almost half of the total fatty acids consisted of palmitic (C16:0) + oleic (C18:1) acids, and the mean SFA ratio was 70.954±0.365% during the entire lactation period. Fatty acids responsible for odor specific to goat milk have decreased in the late stage of lactation. The ratios of ω6/ω3 were below the limit value of four during the lactation period. The results revealed that the milk production traits of Angora goats based on rangeland feeding conditions were higher than the averages accepted for the breed, with the acceptable values for milk composition and quality characteristics. Fatty acid compositions varied throughout the lactation period, including an increase in SFA and a decrease in UFA.

KEY WORDS Angora goat, milk quality, milk yield, rangeland feeding, fatty acid.

INTRODUCTION Angora goat is a world-famous goat breed with its unique mohair production. It has been bred in lots of countries such as Turkey, the United States of America, Australia, and South Africa for a long time, and this breed was originated from the region of Ankara, the capital city of Turkey. The number of Angora goats in Turkey decreased continuously from 6 million heads in 1960 to 1.2 million heads in 1990, and to 147 thousand in 2009, the lowest population in history; then, it started to increase due to support of breeding and mohair production and reached 241 thousand heads in 20191. Some socio-economic factors, including the low price for mohair, reducing rangeland, migration from rural to urban have been effective in declining the number of Angora goats. In particular, the decrease in income from mohair, the primary product, is the main issue among the problems. Thus, in recent years, the utility of meat and milk yields of Angora goats has come to the fore. Angora goat is a small-sized breed. It was well adapted to continental climate conditions. The goats are generally managed extensively, depends upon pastures, rangelands, and cereal stub-

Corresponding Author: Necmettin Unal (unaln@ankara.edu.tr)

bles. They also utilize shrubbery areas. Angora goats have the ability to walk long in the rangeland and benefit from rugged pasture, and spend most of the year in these areas2. The investigations on Angora goat in Turkey generally focused on yield, quality, and improvement of the mohair. Besides, the researches on reproductive performance of goats, and survival and growth of kids were also conducted. However, the yield, quality, and composition of Angora goat milk are poorly characterized; one research3 about the entire lactation milk yield of the breed in Turkey has been carried out at the flock raised under semi-intensive conditions. Although the feeding of Angora goats was mainly based on rangelands, there is no scientific report on the yield, composition, quality, and fatty acid composition of the milk during the entire lactation period. The yield and contents of goat milk could be affected by a wide of factors such as breed, stage of lactation, season and year, lactation number, diet, feeding and management conditions, milking time, and system of production3,4,5,6,7,8. On average, goat milk contains 12-13% dry matter, consisting of about 3.8% fat, 3.5% protein, 4.1% lactose, and 0.8% minerals4. It was expressed that researches on milk composition of goats were restricted and primarily intensified on dairy goat breeds. It is necessary to make systematic studies for defining the quality of goat milk4. Daily milk yield of 548-926 g, the fat ratio of 4.93-5.67%, and protein ratio of 4.06-4.16% have been reported for the 3-16

Alizadehasl imp_ok 07/04/21 09:57 Pagina 84

The investigation of milk yield, composition, quality, and fatty acids in Angora goats

weeks of the lactation period in Angora goats fed intensively with diets formulated with different crude protein levels5. The recent research by McGregor6, daily milk yield, fat, protein, and lactose of the milk for Angora goats, fed with concentrate ad libitum, were notified as 1.74 kg, 8.92%, 3.71%, and 5.48% on the 42nd day of lactation period, respectively. Milking of hair goats, the main breed of goat population in Turkey, is a general practice, although the majority of Angora goat flocks are not milked, the reasons for this being a long suckling period and poor milk production. On the other hand, some breeders have utilized from Angora goat in terms of milk yield in recent years. Milk obtained from Angora goats by hand milking or machine milking is partly used locally for the nutritional needs of the rural owners, and excess milk is used for cheese making. Thus, it is important to examine both milk yield and milk quality characteristics of Angora goats, whose feeding is usually based on rangeland. The hypothesis in this research was that the characteristics of milk production and the quality of Angora goats fed at rangeland conditions might enable them to benefit for milk yield. This research was conducted to investigate milk yield, content, some milk quality characteristics, and fatty acid composition at the different stages of lactation in Angora goats fed at rangeland conditions.

MATERIALS AND METHODS The Animal Research Local Ethics Committee of Ankara University approved all procedures applied in the current study (Approval number: 2015-4-72).

month of lactation, indoor keeping from March 17 to April 17, the same feeding of late gestation period was also applied. The sunflower and barley included 88.75 and 91.00% dry matter, 14.7 and 11.5% crude protein, 5.25 and 5.00% crude cellulose, 1.95 and 1.90% crude fat, 3.2 and 2.5% crude ash, and 2.72 and 2.85 Mcal/ kg dry matter, respectively. From the beginning of the second month to the end of the lactation, the goats were fed only from rangeland, and no additional feed was given. Since 10 July, the goats were also utilized from cereal stubbles. In the morning, the goats were taken to the rangeland and stayed during the day and were brought back to the house in the evening. The goats were kept under shades in the hot hours of the daytime during summertime. The flock was shepherded all the time during grazing. Thus, the sedentary system was applied for herd keeping. Kidding took place in a littered floor building with ambient temperature. Routine kid management after kidding, such as iodine treatment of the navel, injection of Vitamin E – Selenium, ear tagging was practiced. The kids were kept with their dams following the birth and allowed to suckle their mothers. After two months of age, the kids were gone to the rangeland with their mothers until the end of lactation. The milk obtained on control days was used for feeding the kids. The vegetation in the region was composed of grasses, legumes, and other plant families with a portion of 49.64% and 11.97% and 38.39%, respectively. The most frequent plant species were Festuca ovina (23.66%) and Koeleria cristata (10.23%) from 13 species in grasses; Astragalus angustifolius (4.21%) and Astragalus lycius (1.94%) from 10 species in legumes; Thymus sipyleus (11.34%) and Veronica multiflora (6.08%) from 19 species in other plants families9.

Animals and managements

Data collection

The research was carried out at a private farm, in Ayaş district of Ankara province, in the Central Anatolian Region of Turkey, where a semiarid continental climate prevails. The farm is located at 40° N and 32° E and an altitude of 910 m above sea level. The farm kept about 900 Angora goats from different lactation numbers in the 2015 year. Kiddings took place between March 1st and April 10th, 2015, and intensified around March 1525th. The animal material of the research was formed of a total 46 Angora goats, 13 and 15 and 18 heads from the lactation number 1 and 2 and 3+, selected randomly from this flock. All the research goats had a single kid and gave birth on the same day, March 17, 2015. Since no goats have been used as a dairy goat, the kids were allowed to suckle their mothers during the entire lactation period to maintain lactation. Data for milk yield of two goats from lactation number 1 and 3+ were not obtained after 75th and 105th days of lactation, respectively, because of drying off due to the death of their kids. The milk samples for determining the quality characteristics of milk were taken from 10 heads, selected randomly, from each lactation number group of the study. The milk samples were taken from the morning (around 08:00 am) and evening (around 06:00 pm) milking at the early (45th day), middle (75th day), and late (135th day) stages of lactation. All the research goats were managed with the farm flock. The goats were offered a mixture feed of sunflower with 100 g/day/head and barley with 250 g/day/head and roughage (barley straw with ad libitum) for six weeks before kidding. The goats were kept in shelter during the winter season. During the first

Measurements of milk yield were initiated 2 weeks later after the kidding and continued at 4 weeks intervals. The kids were separated from their dams overnight, 12 hours prior to milking. Following a 12 hours separation, the goats were milked by hand milking (morning milking). The hand-milking process was performed again after 12 hours (evening milking). Milk yield was individually recorded for each goat for 24 hours periods. The amount of milk after milking was measured using an electronic scale (precision: 5 g). The data for the lactation curves at 30th, 60th, 90th, 120th and 150th days were calculated by interpolation method. Individual milk yield per lactation was calculated from the data collected on control days by using Trapeze II Method10. During the research, environmental temperatures (minimum and maximum) and relative humidity published by Meteorological Services were recorded daily for the place where the research was conducted. The milk chemical composition and somatic cell count both morning and evening milk were determined using Milk Analyser (Bentley 150 Combi). Milk fat, protein, lactose, and dry matter were defined with an Infrared Milk Analyzer (Bentley 150) using an optical infrared analysis system; somatic cell count was detected with Somatic Cell Count Analyser (Bentley Somacount 150) using flow cytometry method. Milk pH and color analyses were made in fresh milk samples; fatty acid composition analysis was undertaken in frozen milk cream samples kept at −18°C. Milk pH was measured with a portable pH meter (Metler Toledo SG2 with an Inlab 427 probe) after milking. Meat color

Alizadehasl imp_ok 07/04/21 09:58 Pagina 85

M. Alizadehasl; Large Animal Review 2021; 27: 83-90

was estimated using the CIE-L*a*b* system with a chromameter Konica Minolta CR-400 after milking. The CIE-L*a*b* places the color coordinates in a uniform color space with L* (lightness; from 0 to 100 on a scale, 0: black and 100: white), a* (redness; −a*: green color and +a*: red color), and b* (yellowness; −b*: blue color and +b*: yellow color)11. For fatty acids analysis, equal amounts of milk samples (50 ml) from morning and evening milk were centrifuged for 30 min, 4000 rpm at +4 oC, and milk cream from the top of the tube was gathered in 1.5 ml vials, and frozen at -18 oC until analysis. During analysis, approximately 200 µl milk cream was saponified with 0.5 ml of 2N methanolic KOH for 2 min/ mixed at room temperature. Later, 5 ml n-Heptane was added, vortexed for 2 min, and a few mg of anhydrous Na2SO4 was added. Later, tubes were centrifuged at 800 rpm/3 min and allocated to separate an organic phase. Fatty acid methyl esters (FAME) were collected from the top layer and transferred into vials. Separation of fatty acids was performed with HP Agilent 6890/5972 model GC-MS equipped with HP Innowax colon (60 m length, 0.25 mm i.d. x 0.25 µm film). While the injector temperature was set at 250 oC, the detector temperature was 270 oC. The split ratio of injection was 1:50, and the total injection volume of 1 µl. The injector was washed three times with n-Heptane before each injection. The oven temperature was programmed initially at 150 oC for 3 min and was increased to 240 oC with a 3 oC/min ramp rate. Helium was used as a carrier gas. The separation length was continued as 40 min. Detected picks were corrected with FAME Mix C4-24, Sigma after MS detection. Moreover, the nutritive value (NV), the atherogenic index (AI), and the thrombogenic index (TI) were calculated according to the formulas suggested by Ulbricht and Southgate12.

Statistical analysis Daily milk yield and milk production traits were analysed using one-way ANOVA with Tukey’s HSD test. Data for milk composition, some milk quality characteristics, and fatty acid composition were analysed using Least Squares Mixed Model Procedures of SPSS 23.0 statistical software, and the analytical models were as follows: yijkl = + animi + LNj + LSk + MTl + LNjxLSk + LNjxMTl + LSkx MTl + LNjxLSkx MTl + eijkl (for milk composition and some milk quality characteristics) yijk = + animi + LNj + LSk + LNjxLSk + eijk (for fatty acid composition and sums and indexes based on fatty acids) in which yijkl: each trait, : overall mean, animi: the random effect of the ith animal, LNj: the fixed effect of jth lactation number (1, 2, and 3+), LSk: the fix effect of kth lactation stage (early, middle, late), MTl: the fixed effect of the lth milking time (morning and evening), eijkl: the residual component of the model. A covariance matrix for the random effect of animals was assumed as a simple variance components structure, and estimated using the restricted maximum likelihood method. Post-hoc testing for significant interactions was performed using simple effect analysis with Bonferroni adjustment. In cases where the interaction term was not statistically significant, Tukey’s HSD test was used to analyse the main effects. A probability value of less than 0.05 was considered significant.

RESULTS The means measured by the General Directorate of Meteorology for the region of Ayaş, the study was carried out, are shown in Figure 1, and daily milk yield and milk production traits are

Table 1 - Means (± SEM) daily milk yield (g) and milk production (kg) traits. Daily milk yield at the different days of lactation period (g)

LN Means

105

135

165

X±Sx

497.31±23.22a

631.46±41.69a

545.00±44.75a

379.67±31.27a

252.67±15.78a

85.67±8.81a

X±Sx

579.67±24.86b

781.87±34.30b

689.00±30.12b

484.87±23.96b

332.67±20.12b

120.33±8.79b

X±Sx

649.17±22.16c

865.61±40.90b

699.17±36.52b

490.76±26.32b

343.41±24.32b

122.06±11.29b 0.033

P TOTAL

<0.001

0.001

0.003

0.013

0.014

X±Sx

583.59±16.13

772.13±26.43

654.67±23.15

458.45±16.91

315.00±13.48

111.55±6.18

Entire lactation period

Means

Daily milk yield (g)

Lactation duration (day)

X±Sx

415.60±21.58a

171.50±2.70a

71.57±4.35a

X±Sx

496.73±17.39b

181.53±2.33b

90.15±3.25b

X±Sx

533.60±18.14b

179.82±2.16b

96.31±3.99b <0.001

P TOTAL

Milk production (kg)

<0.001

0.016

X±Sx

488.84±12.88

178.14±1.48

87.47±2.67

Means with unlike letters in columns (a, b, c) differ significantly (P<0.05). LN Lactation number.

Alizadehasl imp_ok 07/04/21 09:58 Pagina 86

The investigation of milk yield, composition, quality, and fatty acids in Angora goats

Figure 1 - The graphics for temperatures with relative humidity’s at the farm during the study.

given in Table 1. While the daily milk yield during the entire lactation period was 415.60±21.58, 496.73±17.39, and 533.60±18.14 g (P<0.001), the milk yield were 71.57±4.35, 90.15±3.25, and 96.31±3.99 kg (P<0.001) for LN 1, 2, and 3+, respectively. The lactation curves for daily milk yield of the goats

as measured by LN are shown in Figure 2. The milk yield of the goats peaked around the 6th week of lactation. Milk chemical composition and somatic cell counts (SCC) values are presented in Table 2. While milk fat ratios were among 4.23-5.26%, and it was affected by LN (P<0.001), LS

Table 2 - Least squares means (±SE) of milk chemical composition and SCC. Items Fat (%)

Protein (%)

Traits Lactose (%)

Dry matter (%)

SCC (x103/ml)

5.26±0.17a

4.15±0.05a

4.91±0.05a

15.46±0.19a

328.39±65.90

4.89±0.16a

3.96±0.04b

4.97±0.04ab

15.00±0.18ab

251.84±65.25

4.23±0.16b

4.16±0.04a

5.05±0.04b

14.62±0.18b

166.95±64.22

<0.001

0.005

0.119

0.007

0.218

LN 1

LS Early

4.37±0.15a

4.26±0.05a

4.99±0.04a

14.81±0.17a

531.61±61.17a

Middle

5.15±0.16b

3.96±0.04b

5.15±0.05a

15.42±0.18b

124.43±63.58b

Late

4.85±0.18ab

4.05±0.05b

4.79±0.05b

14.86±0.20a

91.14±70.29b

0.002

<0.001

<0.035

<0.001

Morning

3.38±0.13

3.99±0.04

5.09±0.04

13.58±0.15

125.66±53.18

Evening

6.21±0.13

4.19±0.04

4.87±0.04

16.48±0.15

372.47±53.18

<0.001

LNxLS

0.707

0.306

0.041

0.507

0.131

LNxMT

0.290

0.870

0.835

0.438

0.315

LSxMT

0.090

0.404

0.078

0.042

0.142

P MT

P Interactions

LNxLSxMT TOTAL

0.650

0.997

0.790

0.792

0.715

4.79±0.10

4.09±0.03

4.98±0.03

15.03±0.11

249.06±37.60

Means with unlike letters in columns (a, b) differ significantly (P<0.05). LN Lactation number, LS Lactation stage, MT Milking time, SCC Somatic cell count.

Alizadehasl imp_ok 07/04/21 09:58 Pagina 87

M. Alizadehasl; Large Animal Review 2021; 27: 83-90

Figure 2 - Lactation curves for various lactation numbers.

Table 3 - Least squares means (±SE) of some milk quality characteristics. Items

Traits pH

Color L*

LN 1

6.55±0.01

91.29±0.36

-4.38±0.07

7.84±0.15

6.51±0.02

90.97±0.35

-4.40±0.06

7.41±0.15

6.53±0.01

90.43±0.35

-4.42±0.07

7.37±0.14

0.153

0.224

0.928

0.053

Early

6.51±0.01a

91.10±0.33

-4.61±0.06a

7.71±0.14

Middle

6.59±0.02b

90.55±0.35

-4.58±0.06a

7.27±0.15

Late

6.49±0.02a

91.04±0.38

-4.01±0.07b

7.65±0.16

<0.001

0.465

<0.001

0.072

Morning

6.51±0.01

90.77±0.29

-4.67±0.06

6.60±0.12

Evening

6.55±0.01

91.02±0.29

-4.12±0.06

8.49±0.12

0.004

0.538

<0.001

LNxLS

0.300

0.588

0.203

0.083

LNxMT

0.820

0.363

0.826

0.079

LSxMT

0.337

0.231

0.017

0.428

P MT

P Interactions

LNxLSxMT TOTAL

0.946

0.799

0.614

0.301

6.53±0.01

90.90±0.22

-4.40±0.04

7.54±0.09

Means with unlike letters in columns (a, b) differ significantly (P<0.05). LN Lactation number, LS Lactation stage, MT Milking time.

Alizadehasl imp_ok 07/04/21 09:58 Pagina 88

The investigation of milk yield, composition, quality, and fatty acids in Angora goats

Table 4 - Means (±SE) of fatty acid composition (in percent). Fatty Acids 2

Early

Middle

Late

Interaction LNxLS

TOTAL

C4:0

0.220±0.044

0.216±0.043

0.290±0.040

0.371

0.277±0.039

0.185±0.042

0.263±0.046

0.243

0.207

0.242±0.025

C6:0

0.732±0.029

0.712±0.029

0.700±.027

0.720

0.888±0.026a

0.646±0.028b

0.611±0.031b

<0.001

0.230

0.715±0.016

C 8:0

1.724±0.087

1.616±0.084

1.691±0.079

0.656

2.055±0.077a

1.576±0.082b

1.401±0.091b

<0.001

0.571

1.677±0.048

C10:0

8.938±0.300

9.113±0.292

9.335±0.275

0.619

10.680±0.268a

8.677±0.283b

8.031±0.315b

<0.001

0.508

9.129±0.167

C12:0

4.600±0.201

4.713±0.196

5.069±0.184

0.200

5.529±0.180a

4.111±0.190b

4.741±0.211b

<0.001

0.738

4.794±0.112

C14:0

9.484±0.250

9.803±0.243

10.326±0.229

0.047

9.598±0.223

9.857±0.235

10.157±0.262

0.273

0.893

9.871±0.139

C14:1

0.286±0.020

0.331±0.019

0.293±0.018

0.232

0.301±0.018

0.311±0.019

0.298±0.021

0.884

0.407

0.304±0.011

C15:0

1.129±0.037

1.140±0.036

1.059±0.034

0.211

1.188±0.033a

1.199±0.035a

0.941±0.039b

<0.001

0.316

1.109±0.021

C15:1

0.203±0.010

0.198±0.010

0.219±0.009

0.266

0.222±0.009a

0.227±0.010a

0.171±0.011b

<0.001

0.359

0.207±0.006

C16:0

28.114±0.551

27.486±0.536

28.469±0.505

0.411

23.846±0.492a

28.551±0.520b

31.672±0.579c

<0.001

0.996

28.023±0.307

C16:1

0.935±0.043ab

0.985±0.041b

0.834±0.039b

0.030

1.044±0.038a

0.813±0.040b

0.897±0.045b

<0.001

0.792

0.918±0.024

C17:0

0.820±0.021

0.799±0.020

0.772±0.019

0.233

0.773±0.018a

0.910±0.019b

0.706±.022a

<0.001

0.707

0.797±0.011

C17:1

0.254±0.010ab

0.272±0.009a

0.231±0.009b

0.009

0.281±0.009a

0.252±0.009ab

0.223±0.010b

<0.001

0.781

0.252±0.005

C18:0

14.646±0.638

13.911±0.621

13.694±0.585

0.528

13.089±0.570a

16.436±0.602b

12.725±0.670a

<0.001

0.956

14.083±0.355

C18:1

22.426±0.636

23.329±0.619

22.175±0.583

0.375

24.048±0.567a

21.014±0.600b

22.868±0.667ab

0.002

0.214

22.643±0.354

C18:2 ω6

2.800±0.102

2.851±0.099

2.657±0.094

0.338

3.148±0.091a

2.592±0.096b

2.570±0.107b

<0.001

0.854

2.770±0.057

C18:3 ω3

1.060±0.042

1.058±0.041

1.060±0.038

0.999

1.209±0.037a

1.143±0.039a

0.825±0.044b

<0.001

0.608

1.059±0.023

C18:3 ω6

0.994±0.057

0.948±0.056

0.850±.053

0.170

1.529±0.051a

0.745±0.054b

0.517±0.060c

<0.001

0.873

0.931±0.032

C20:0

0.365±0.017

0.350±.016

0.750

0.336±0.015a

0.412±0.016b

0.331±0.018a

0.001

0.997

0.360±0.009

C20:1

0.136±0.009

0.128±0.009

0.134±.008

0.806

0.139±0.008ab

0.149±0.009a

0.110±0.010b

0.012

0.895

0.132±0.005

C22:0

0.158±0.007

0.152±0.006

0.795

0.138±0.006a

0.203±0.006b

0.122±0.007a

<0.001

0.749

0.154±0.004

Means with unlike letters in lines (a, b, c) differ significantly (P<0.05). LN Lactation number, LS Lactation stage.

(P<0.01), and MT (P<0.001), SCC was similar for LN, but different for LS (P<0.001) and MT (P<0.001). The differences of percentages among milk protein (P<0.01) and dry matter (P<0.01) for LN groups were significant. In addition, percentages for protein, lactose, and dry matter were influenced significantly by LS and MT (P<0.05, P<0.001). The interactions among factors for milk composition and SCC were generally found to be insignificant. Table 3 shows the pH and color coordinates means of the milk obtained from the goats with different LN and LS. The pH values generally differed significantly for LS (P<0.001) and MT (P<0.01), and it was measured between 6.49 and 6.59. The effects of LN on the color coordinates were not significant, however the effects of LS on a*, and MT on a* and b* were highly prominent (P<0.001). The interactions among factors for pH and color coordinates were not generally significant. The milk fatty acid composition, and sums and indexes based on fatty acids were presented in Tables 4 and 5, and they varied significantly (P<0.01, P<0.001) because of LS, with some exceptions for C4:0, C14:0, and C14:1. Major fatty acids in milk were palmitic (C16:0) (28.023%), oleic (C18:1) (22.643%), and stearic (C18:0) (14.083%) acids during the entire lactation period.

DISCUSSION The main systems of goat farming are pasture-rangeland and indoor systems, or mixed systems of them, such as summer pasture-rangeland/winter indoors or indoors/outdoors due to climate. The systems based on pasture-rangeland may vary

subject to agro-climatic and socio-ecologic conditions of the regions. Considering the systems based on grazing and indoor systems, these systems affect both level of milk production and the milk components (fat, protein, lactose, fatty acids), especially in milk production7. In the current study, daily milk yield was increased due to LN, and this may be due to higher feed intake of the older goats and well-developed udder tissue and gastrointestinal system compared to the young goats. It is noteworthy that there was a wide variation of daily milk yield in the flock where this research was conducted. It was determined that the goats yielded half the lactation milk yield in the one-third of the lactation period and the other half of the lactation milk yield in the last two-thirds of the lactation period. As can be seen from the Figure 2, it was found remarkable that the shapes of lactation curves for different LN groups were similar to the typical shapes of lactation curves, except for shorter lactation duration, obtained for dairy goats8,13. In this study, the lactation milk yield (87.47 kg) and lactation period (178.14 days) were found to be significantly higher than the values (35 kg and 120 days) reported as breed characteristics for Angora goat2, however similar to the findings (88.2 kg and 179.3 days) ascertained for the same breed in semi-intensive conditions3. These results support that Angora goats could also benefit for milk yield. LN, LS, and MT caused a significant change in milk fat content. The LN 1 goats had a higher milk fat content than those of the other LN goats. At the same time, the milk yield of LN 1 goats was lower than those of the others (Table 1). It has been well documented that fat content is negatively correlated with milk yield4,8,13, and increase milk yield decrease fat content by

Alizadehasl imp_ok 07/04/21 09:58 Pagina 89

M. Alizadehasl; Large Animal Review 2021; 27: 83-90

Table 5 - Sums and indexes based on fatty acids. Items

LS P

Interaction LNxLS

TOTAL

Late

72.764±0.619b

71.701±0.689b

<0.001

0.284

70.954±0.365

22.766±0.594b

24.568±0.661ab

<0.001

0.232

24.456±0.351

Early

Middle

SFA

70.929±0.657

70.027±0.639

71.906±0.602

0.109

68.398±0.586a

MUFA

24.241±0.630

25.242±0.613

23.886±0.577

0.262

26.035±0.562a

PUFA

4.854±0.141

4.857±0.138

4.567±0.130

0.216

5.886±0.126a

4.480±0.133b

3.911±0.148c

<0.001

0.909

4.759±0.079

UFA

29.095±0.652

30.099±0.634

28.453±0.597

0.174

31.922±0.582a

27.246±0.615b

28.479±0.684b

<0.001

0.344

29.216±0.363

DFA

43.741±0.922

44.010±0.898

42.147±0.845

0.266

45.011±0.823a

43.683±0.870ab

41.204±0.968b

0.015

0.753

43.299±0.513

MUFA/SFA

0.348±0.011

0.361±0.011

0.333±0.010

0.166

0.382±0.010a

0.317±0.010b

0.345±0.011b

<0.001

0.255

0.348±0.006

PUFA/SFA

0.069±0.002

0.070±0.002

0.064±0.002

0.114

0.086±0.002a

0.062±0.002b

0.055±0.002b

<0.001

0,985

0.068±0.001

UFA/SFA

0.417±0.012

0.431±0.012

0.397±0.011

0.112

0.468±0.011a

0.378±0.011b

0.400±0.013b

<0.001

0.355

0.415±0.007

ω6

3.795±0.128

3.799±0.124

3.507±0.117

0.153

4.677±0.114a

3.337±0.121b

3.087±0.134b

<0.001

0.967

3.700±0.071

ω3

1.060±0.042

1.058±0.041

1.060±0.038

0.999

1.209±0.037a

1.143±0.039a

0.825±0.044b

<0.001

0.608

1.059±0.023

ω6/ω3

3.698±0.167

3.733±0.163

3.388±0.153

0.240

3.962±0.149a

3.002±0.158b

3.854±0.176a

<0.001

0.785

3.606±0.093

1.363±0.049

1.383±0.047

1.297±0.045

0.389

1.562±0.044a

1.336±0.046b

1.145±0.051c

<0.001

0.865

1.348±0.027

2.132±0.116

1.932±0.112

2.137±0.106

0.338

1.797±0.103a

2.330±0.109b

2.075±0.121ab

0.003

0.283

2.067±0.064

1.975±0.112

1.740±0.109

1.888±0.102

0.314

1.494±0.100a

2.136±0.105b

1.974±0.117b

0.001

0.382

1.868±0.062

Means with unlike letters in lines (a, b, c) differ significantly (P<0.05). LN Lactation number, LS Lactation stage, SFA Saturated fatty acids, MUFA Monounsaturated fatty acids, PUFA Polyunsaturated fatty acids, UFA Total unsaturated fatty acids, DFA Desirable fatty acids (C18:0 + UFA), NV (Nutritive value) (C18:0 + 18:1) / C16:0, ω6/ω3 (C18:2ω6 + C18:3ω6) / C18:3ω3, AI Atherogenic index, TI Thrombogenic index.

dilution7. Karadağ et al.14 who studied the milk yield of Saanen crossbreds reported that the fat content of the milk decreased as LN rose (3.22, 3.07, 2.96, and 2.89% for LN 1, 2, 3, and 4+, respectively). Morand-Fehr et al.7 underlined that pasture or rangeland based farming systems result in milk performance characterized by high-fat content due to diets rich in fibre. The effects of LN, LS, and MT on milk protein percentage were prominent; protein contents were found to be highest in the early lactation stage (4.26%), decreased in the middle (3.96%) and the last (4.05%) stages while the evening milk had approximately 0.20% higher protein than the morning milk. The changes for milk protein percentage according to the LS were ascertained from the studies carried out on Damascus goats8,15. The higher protein content of evening milk in the current study was similar to the results of Turkish Saanen goats13. The milk lactose percentage was influenced significantly by the LS and MT. Similar to the Damascus Cyprus goats16, the milk lactose percentage in the late lactation stage was lower than those of the other lactation stages; however, in contrast to the study on Turkish Saanen Goats13, the lactose percentage of morning milk (5.09%) was higher than the that of evening milk (4.87%). The dry matter percentages in the milk obtained between 13.58-16.48% were higher than the results of dairy goat breeds16,17 but similar to indigenous hair goat breed18. As reported by Goetsch et al.19, there were great differences for SCC among goat breeds, and it usually between 2×105 and 10×105 mL. The SCC was changed significantly according to LS and MT. Much lower SCC compared to findings of the studies8,17,19 could be a result of all the goats in this study in which had never been used as dairy goat, as stated before. The SCC values of Angora goats in the present study were acceptable because of assuming that an SCC value greater than 1x106/ml was regarded as undesirable17. pH is a very essential parameter for ascertaining milk quality as it converts milk to cheese via coagulation of proteins. pH values in the present trial, measured between 6.49 to 6.59, were compatible with the findings of Pizzillo et al.20 for Garganica

and Siriana goats. It is well understood that the milk color affects the color properties of the subsequent dairy products. It has been observed that as the LN increased the milk L* (lightness index) tend to decrease, although the differences were insignificant. The milk lightness is related to many natural pigmentations, including mainly fat globules21. LS had significant effects on a* (redness index) because of decreasing a* values as lactation progress. The b* (yellowness index) values did not differ significantly in LN and LS, but significantly in MT. The b* value in milk is closely related to fat content and level of βcarotene; a greater milk fat content results in increasing the b* index21. Feeding types of goats may be altered fat content, thus b* value of milk. An increase in the b* value in evening milk might be explained by the rising content of fat in evening milk. The fatty acid composition of goat milk is one of the important parameters of milk quality, especially the effect on human nutrition. The fatty acid profile and contents in milk influence the quality, texture, aroma, and flavor of milk and milk products22. Twenty-one fatty acids in the current trial were detected from butyric acid (C4:0) to behenic acid (C22:0), and the effect of LS on fatty acid composition was generally found to be important. Caproic (C6:0), Caprylic (C8:0), and Capric (C10:0) acids, which are among the medium-chain fatty acids, have a great role in the specific odor of goat milk4. A significant decrease in these fatty acids from the early lactation stage to the late lactation stage may indicate that the specific odor of goat milk reduces towards the end of lactation. The primary saturated fatty acids (SFA) identified from the milk fat were palmitic acid (C16:0) and stearic acid (C18:0), while oleic acid (C18:1) was the main monounsaturated fatty acid (MUFA). Palmitic acid, which is important because of nutritive value, was significantly increased with lactation progress, in accordance with the reports of Damascus goats8. Stearic acid, which is one of the desirable fatty acids, showed a significant increase from early to middle lactation stage (13.089% to 16.436) but decreased (12.725%) in the late lactation stage, similar to the early lactation stage. This situation was different from the results for Damascus goats by Yakan et al.8. Due to the im-

Alizadehasl imp_ok 07/04/21 09:58 Pagina 90

The investigation of milk yield, composition, quality, and fatty acids in Angora goats

portance of the SFA and UFA values for evaluating fatty acid composition in milk, high SFA and low UFA are not desirable because of human health. It was found that SFA increased, and UFA decreased in the middle and late stages of lactation compared to the early stages of lactation. While the average values of SFA and UFA during entire lactation in this trial were in line with those described by Goetsch et al.19, the changing for SFA rising and UFA decreasing during lactation was noteworthy. The overall ratio between ω6 and ω3 PUFA (3.606), one of indexes used to assess the nutritional value of fats, should not exceed 4.012, were under the recommendation level in the present study. This was dissimilar to the results with higher ratios for ω6/ω3 in Damascus goats which were fed with concentrate and pasture (6.01 and 6.75)8, and in Saanen and Swedish Landrace goats which were fed with mainly concentrate diet (6.05 and 6.33)22. In this study, the low ratio of ω6/ω3 may be related to the feeding of goats based on rangeland, in fact, it was reported that feeding on rangeland increased ω3 in milk4. Considering nutritive value (NV) and atherogenic index (AI) and thrombogenic index (TI), the other indexes used to assess the nutritional value of fats, NV decreased during entire lactation, AI and TI values increased in the middle lactation stage and then decreased partially. However, it was noted that both AI and TI values found in the current study were above the desired value of 1 throughout the lactation period12. The lower the AI value, the better for human nutrition.

Bibliografia 1. 2. 3.

9. 10. 11.

CONCLUSIONS

12. 13.

The study displayed the milk yield and lactation period of Angora goats based on rangeland feeding conditions was higher than the averages accepted for the breed. It has been determined that Angora goats had acceptable values for milk composition and quality characteristics. Fatty acid compositions varied throughout the lactation period, SFA increased, and UFA decreased, and indexes of nutritional values partially decreased at the late stage of lactation.

ACKNOWLEDGEMENTS This study was prepared from senior author PhD thesis.

14.

15.

16.

17.

18.

19. 20.

21.

22.

Anonymous (2020). Turkish Statistical Institute, Livestock Statistics, http://www.turkstat.gov.tr, Turkey. Yalçın B.C. (1986). Sheep and Goats in Turkey. FAO Animal Production and Health Paper, Rome. Erol H., Akçadağ H.I., Ünal N., Akçapınar H. (2012). Milk yield and its effect on kids growth in Angora goats. Ankara Univ Vet Fak Derg, 59: 129134. Park Y.W., Haenlein G.F.W. (2010). Milk Production. In: Goat Science and Production, Ed. Solaiman S.G., 1st Ed., 275-292, Wiley-Blackwell, New York. Sahlu T., Carneiro H., El Shaer H., Fernandez J., Hart S., Goetsch A. (1999). Dietary protein effects on and the relationship between milk production and mohair growth in Angora does. Small Rum Res, 33: 25-36. McGregor B.A. (2018). The effects of nutrition and parity on the development and productivity of Angora goats: 3. Effects of six combinations of mid pregnancy and postnatal nutrition on udder development, lactation, milk composition and net energy of milk production. Small Rum Res, 161: 13-23. Morand-Fehr P., Fedele V., Decandia M., Le Frileux Y. (2007). Influence of farming and feeding systems on composition and quality of goat and sheep milk. Small Rum Res, 68: 20-34. Yakan A., Özkan H., Eraslan Sakar A., Ates C.T., Ünal N., Koçak Ö., Doğruer G., Özbeyaz C. (2019). Milk yield and quality traits in different lactation stages of Damascus goats: concentrate and pasture based feeding systems. Ankara Univ Vet Fak Derg, 66: 117-129. Kendir H. (1999). Vegetation composition, forage yield and range condition of a natural rangeland in Ayas (Ankara). Tarım Bil Derg, 5: 104-110. Maria G., Gabina D. (1992). Simplification of milk recording scheme in Latxa milking sheep. Livest Prod Sci, 31: 313-320. CIELAB (1976). CIELAB Colour System, Commission International de l’Eclairage, Paris, France. Ulbricht T.L.V., Southgate D.A.T. (1991). Coronary heart disease: seven dietary factors. Lancet, 338: 985-992. Tölü C., Irmak S., Açıkel Ş., Akbağ H., Savaş T. (2016). Comparison of milk yield, milk composition and residual milk of machine and handmilked in Turkish Saanen Goats. Tarım Bil Derg, 22: 462-470. Karadağ O., Yılmaz M., Yıldırım M., Yüksel M.A., Sezenler T. (2012). Saanen, G1 ve G2 keçilerinde üreme, süt verimi ve besi özellikleri üzerinde kar ıla tırmalı ara tırmalar. Gıda, Tarım ve Hayvancılık Bakanlığı Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü, Büyükbaş ve Küçükbaş Hayvancılık Araştırmaları Program Değerlendirme Toplantısı, 139153, Antalya. Mahmoud N.M.A., El Zubeir I.E.M., Fadlelmoula A.A. (2014). Effect of stage of lactation on milk yield and composition of first kidder Damascus does in the Sudan. J Anim Prod Adv, 4: 355-362. Rawya A.A.S., Ahmed K.A. (2014). Physicochemical characteristics of Damascus (Shami) Cyprus goats milk in different lactation periods. IJLASS, 2: 67-72. Paape M.J., Wiggans G.R., Bannerman D.D., Thomas D.L., Sanders A.H., Contreras A., Moromi P., Miller R.H. (2007). Monitoring goat and sheep milk somatic cell counts. Small Rum Res, 68: 114-125. Balia F., Pazzola M., Dettori M.L., Mura M.C., Luridiana S., Carcangiu V., Piras G., Vacca G.M. (2013). Effect of CSN1S1 gene polymorphism and stage of lactation on milk yield and composition of extensively reared goats. J Dairy Res, 80: 129-137. Goetsch A.L., Zeng S.S., Gipson T.A. (2011). Factors affecting goat milk production and quality. Small Rum Res, 101: 55-63. Pizzillo M., Claps S., Cifuni G.F., Fedele V., Rubino R. (2005). Effect of goat breed on the sensory, chemical and nutritional characteristics of ricotta cheese. Livest Prod Sci, 94: 33-40. McDermott A., Visentin G., McParland S., Berry D.P., Fenelon M.A., De Marchi M. (2016). Effectiveness of mid-infrared spectroscopy to predict the color of bovine milk and the relationship between milk color and traditional milk quality traits. J Dairy Sci, 99 (5): 3267-3273. Yurchenko S., Sats A., Tatar V., Kaart T., Mootse H., Joudu I. (2018). Fatty acid profile of milk from Saanen and Swedish Landrace goats. Food Chemist, 254: 326-332.

Deniz_imp_ok 07/04/21 09:59 Pagina 91

D. Deniz et al. Large Animal Review 2021; 27: 91-96

Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield and composition in Saanen goats

DINCEL DENIZ1*, ARDICLI SENA1, SAMLI HALE1, VATANSEVER BUSE2, BALCI FARUK1 1 2

Department of Genetics, Faculty of Veterinary Medicine, Bursa Uludag University, TR-16059 Nilufer, Turkey Department of Biology, Institute of Health Science, Bursa Uludag University TR-16059 Nilufer, Turkey

SUMMARY The expression of CSN1S2 gene is known to regulate the α-S2 casein levels in milk composition, moreover is estimated to affect the milk yield and composition in goat. However, the knowledge about the CSN1S2 gene on milk yield and composition is restricted in Saanen goats. Therefore, this study aimed to specify the effect of CSN1S2 polymorphisms on milk yield/composition parameters. The genotyping of Saanen goats (n=120) was performed by PCR-RFLP methods. The GLM procedure was prefered as statistical analysis to defined the effect of those variations on investigated traits. The result showed that the AA (26.67%), BB (33.33%) and AB (40.00%) for A-B variant; N* (94.17%), N*0 (5.83%) for D-0 variant; FF (7.50%), NF/NF (65.83%) and F/NF (26.67%) for F variant in Saanen goats. The effect of A-B allele of CSN1S2 gene (P<0.05) and parity (P<0.001) on milk composition yields were found significant in the current study. However, the effect of A-B allele on lactation milk yield was determined tended to be significant (P=0.090). Moreover, significant correlations between the milk composition parameters such as fat, protein, TS (total solid), SNF(solid not fat), casein, or lactose were observed (P<0.001). The novel outputs might be useful for developing goat breeding strategies or improving the dairy industry, especially for milk products.

KEY WORDS Goat, parity, milk yield/composition, Saanen, CSN1S2.

INTRODUCTION Goat milk has high importance due to the economic, nutritional, and medical properties, also is a good source for the humans who suffers an allergy from cattle milk1. Proteins are the main nutritional and bioactive components of milk that are produced mainly from mammary gland tissue2. The casein which forms the 80 percent of milk protein in ruminants composed of four types as alphaS1-casein (α-S1 casein), alphaS2-casein (α-S2 casein), beta-casein (β-casein) and kappa casein (κ-casein)3. Besides being the most important of allergens in milk, α-S2 casein, which is a kind of phosphoprotein is consisting of 208 amino acids4. Although the CSN1S2A and CSN1S2B gene have been established at the casein loci in the human genome, it is known that the α-S2-casein does not exist in human milk5. The tolerance to cow milk in humans may be related to the presence of this protein has been thought. Milk caseins, which constitute the primary food source in mammals with placenta, were controlled by CSN1S1, CSN1S2, CSN2, and CSN3 genes that are cumulated at 250-kb DNA fragment in the caprine chromosome5. The casein genes were determined polymorphic in the literature6-8. These genotypic diversities have been seen as an essential factor in terms of genetic progression. Moreover, these variations allow selecting the suitable choice for dairy products depending on the genetic basis3. The CSN1S2 is an 18.438 nucleotide length gene consisting of 18 exons ranging in size from 21 to 266 nucleotides9. Fur-

Corresponding Author: Dincel Deniz (deniz@uludag.edu.tr).

thermore, the CSN1S2 gene that is structurally similar to other calcium-sensitive genes due to their organization at the 5’ and 3’ endings have seven alleles (A, B, C, D, E, F, and 0) in goats4. Also, these alleles relevant to three different levels of α-S2 casein in milk, such as normal (2.5 g/L per allele), intermediate (1.5 g/L-per allele), or null (absence of α-S2 casein)3. The alleles of A(0.400) and F(0.330) of CSN1S2 gene were determined more frequently in Sarda goats; also, the D and E alleles were not found at the investigated flock4. On the other hand, the frequency of the N* (N*=A, B, C, and E) and F allele was specified 0.522 and 0.478 in the Czech goats, respectively besides, the heterozygous FN* genotype has the highest frequency in the studied breed7. The daily milk yield and the average protein yield of lactation were determined highest in Czech goats with N*N* genotype; 2.68 ± 0.06 kg and 17.194 ± 0.507 kg, respectively. The most common genotype was determined as AA in Girgentana10,11 Arbi “Tunisian” goats12 and AF in Argentana des Etnas goats10. However, the A+B+C+E allele frequency was determined 0.635 in Bulgarian dairy goats (Hungarian Milking White, Hungarian Milking Brown, Hungarian Milking Multicolor) with the lowest frequency belongs to 0 alleles (0.146)13. In terms of CSN1S2 gene, the variation was noticed in the literature with the different allele and genotype frequencies. Also, the A, B, C, G alleles were identified with the frequencies of 0.920, 0.080, 0.000 and 0.000 respectively in Saanen goats (n = 26) by Chiatti et al.14. Moreover, the most frequent genotype was found AA (22/26) in that flock. However, the most frequent genotype was found AC (0.300) in Saanen dairy goats (n=20) at another study performed by Grobler et al.15. The studies were performed to determine the allele and genotype frequencies of the CSN1S2 gene that were done in Sarda, Czech (Czech), Girgentana, Argentana des Etnas, Arbi, and Bul-

Deniz_imp_ok 07/04/21 09:59 Pagina 92

Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield

garian milkman (Hungarian Milking White, Hungarian Milking Brown, Hungarian Milking Multicolor) goat breeds in summary. Besides, the limited information existed in the literature for Saanen goats in terms of CSN1S2 gene; to the best of our knowledge, the effect of those variations on milk composition has not been investigated extensively up to now in Saanen goats. However, the CSN1S2 gene was strongly thought to be effective on milk yield and composition in other species or races. Therefore, this study was carried out to identify the frequency of CSN1S2 gene alleles and it’s the effect on total milk yield and composition in Saanen goats.

MATERIALS AND METHODS

phism method (PCR-RFLP) (3,17). The PCR amplification was performed in a total volume of 25 μL containing 14.5 μL dH2O, 5 μL Protocol for OneTaq® Quick-Load 2X Master Mix with Standard Buffer (M0486), 1 L (0.025 M) of each primer, and 2.5 L of the DNA sample at a concentration of 100 ng/μL. Subsequently, the 5 μL of the amplified product was digested with the corresponding restriction enzyme that the details were given in Table 1. Agarose gel electrophoresis (containing ethidium bromide) was used for separating the PCR and RFLP products at 90-100V for 45 to 60 minutes for visualization. Afterward, the obtained PCR-RFLP fragments were visualized by a gel imaging system (DNr-Minilumi, DNR Bio-Imaging Systems), and the observed patterns were evaluated according to aspects of the authors in the literature.

Animal sources and milk analysis

Statistical analysis

The analysis was performed on 120 purebred Saanen goats belongs to the farm located at Bursa province in the Marmara Region of Turkey. The herd was barned in intensive conditions. All goats were feeding with the same diets and had water ad libitum during the research due to standard commercial practices. The milk data from Saanen goats (the ages range from 1 to 6) were recorded during the lactation period while they were milking twice a day. Also, the samples were collected in sterile sample containers twice a month for evaluation and were transported to the laboratory via the cold chain. The samples were qualified for milk composition such as protein, fat, casein, or lactic acid using infrared spectroscopy by filter technology with Fourier data transformation (FTIR- MilkoScan™ FT1, Foss Electric, Denmark). The experiments were performed in compliance with the ethical requirements with the approval of the local Ethics Committee for Animal Research (2018-04/01).

The direct counting method was chosen to identify the genotype frequencies of investigated SNPs. The variations among observed and expected frequencies of genotypes were examined by χ2 test in order to confirm Hardy-Weinberg Equilibrium (HWE). The statistical analysis were carried out with the general linear model (GLM) procedure of Minitab (Minitab Inc., State College, PA, USA, version 17.1.0) to evaluate the differences between the investigated parameters and individual effects. The stepwise regression model was used to choose the best appropriate model for the investigated factor; thus, the D0 and F polymorphisms were removed from the model. According to the selected method, the mixed model was applied to established possible significant differences between the genotypes as follow: Yijk = μ + Ai + Pj + eijk, where Yijk symbolized the observed value; μ is the overall mean for each trait; Ai is the fixed effect of A-B alleles of CSN1S2 gene (i= AA, BB, AB); Pk is the fixed effect of parity (k=1th, 2th, 3th, 4th, 5th); e ijk is the random error (The adjusted R2 value varies from 53.33 to 60.32 for the studied traits). The population genetic incidences such as expected heterozygosity (He), effective allele numbers (Ne), and the polymorphism information content (PIC) were estimated by the descriptive data of Botstein et al.18. In addition, Pearson’s correlation coefficient (PCC) was used to evaluate the phenotypic correlation coefficients on the basis of the population. Three groups of PCC were classified as described below: PCC is < 0.25 equal to low correlation, PCC is between 0.25 – 0.50 equal to intermediate correlation, and PCC is > 0.50 equal to high correlation19. The significance level accepted 0.05 for HWE, for

Genomic analysis The phenol-chloroform method described by Green and Sambrook16 was used to extract the DNA from the blood sample. The blood samples (4 mL) were collected from the peripheral blood to the K3EDTA tubes and then were reached the laboratory via the cold chain. The SNP markers of the CSN1S2 gene were preferred from different sources as given in Table 1, and the information of them was confirmed by the databases such as GeneBank or EMBL (https://www.ncbi.nlm.nih.gov/ search/all/?term= or http://www.ensembl.org). Genotypes of CSN1S2 polymorphisms were determined using a polymerase chain reaction and restriction fragment length polymor-

Table 1 - Description of primer sequences, PCR conditions, restriction enzymes that were applied for genotyping the polymorphisms of CSN1S2 gene in the current study. Alleles of CSN1S2 gene

Acc. no.

Primer sequences (from 5 to 3 )

PCR amplicon

Restriction enzyme

A-B

X65160 (GenBank)

F: GCCATTCATCCCAGAAAG R: CTCTTCATTTGCGTTCCTTA

1,2 kb

D-0

AJ131370 (EMBL)

F: GACACATAGAGAAGATTC R: CGTTGGGACATTTTATCT

AJ131370 (EMBL)

F: TCTCTTGCCATCAAAACA R: TGGTCTTTATTCCTCTCT

Genotyping

References

MseI

AA: 230, 270, 300 bp BB: 230, 270, 400 bp AB: 230, 270, 300, 400bp

Cosenza et al., 1998

301 bp

NcoI

0: 301 bp D: 62, 133 bp N*:133, 168 bp *N:A,B,C,D,E or F

Ramunno et al., 2001

310 bp

Alw26I

FF: 310 bp NF/NF: 131, 179 bp F/NF: 131, 179, 310 bp

Ramunno et al., 2001

Deniz_imp_ok 07/04/21 09:59 Pagina 93

D. Deniz et al. Large Animal Review 2021; 27: 91-96

Table 2 - The population genetic indices and genotypic frequencies of CSN1S2 gene, accordance with HWE. Alleles of CSN1S2 gene

Genotype

A-B

26.67

33.33

40.00

113

94.17

N*0

5.83

7.50

NF/NF

65.83

F/NF

26.67

D-0

0.4978

0.0563 F

FF +

0.3295

1.9912

1.0630

1.4914

PIC

0.3739

0.0547

0.2752

χ2(HWE)

4,6301

0,1083

4,4043

P(HWE)

Allele frequencies A

0.467

0.533

0.971

0.029

0.208

0.792

0,031

0,742

0,036

N*: A,B,C,E or F; NF+: not F, χ2(HWE) - Hardy-Weinberg equilibrium χ2 value, *P < 0.01; P < 0.001 - not consistent with equilibrium. n: number of goats. He: gene heterozygosity; Ne: effective allele number, PIC: polymorphism information content.

0.001- 0.05 for GLM procedure, moreover the P-value less than 0.10 (P < 0.10) was considered as a tendency in the current study.

RESULTS The genotypic structure of the investigated population We investigated the A-B, D-0, and F alleles of CSN1S2 gene in the Saanen population. The distribution of genotype and allele frequencies, moreover, the population genetic parameters including He, Ne, and PIC values of these genotypes with X2 and P significance of Hardy-Weinberg equilibrium (HWE) are presented in Table 2. Although the A-B and F variations were not consistent (P≤0.05), the D-0 marker was found compatible with HWE (P=0.742). The He, Ne, and PIC values were observed to varying from 0.0563 to 0.4978; 1.0630 to 1.9912; 0.0547 to 0.3739 respectively by the statistics. The PCR and RFLP results were shown in Figure 1 and 2; according to the results, three genotypes (AA, BB and AB) were determined for A-B marker in the current study, and the AB genotype which was characterized by fragment sizes of 230, 270, 300 and 400 bp was defined as the most frequent in the studied Saanen flock (40.00%). Similarly, the AB allele, the homozygote and heterozygote genotypes were detected for F allele of CSN1S2 in the present study. The genotype frequencies of F marker were 65.83% for NF/NF, 26.67 for F/NF, and 7.50% for FF in Saanen goats. Although three different genotypes were established for A-B and F variations of CSN1S2 gene, there were detected only N* and N*0 genotypes for D-0 with the ratio of 94.17% and 5.83%, respectively. The D allele, which forms the bands of 133 and

Figure 1 - The electrophoresis patterns of PCR products of CSN1S2 gene.

Figure 2 - The RFLP digestion products of CSN1S2 gene electrophoresed in 2.0-2.5% agarose gels. (L: DNA Ladder-amplicon length 100-1500 bp; NC: Negative control for overall. D: The RFLP products of A-B variant of CSN1S2 gene, Line 1, 3: AB; Line 2, 4: AA; Line 5:BB. E: The RFLP products of F variant, Line 1, 3, 4, 5: NF/NF; Line 2: F/NF. F: The RFLP products of D/0 variant, Line 1 to 5: N*0).

Deniz_imp_ok 07/04/21 09:59 Pagina 94

Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield

Correlations between the compositions of goat milk

62 bp, was not existing in this study. Thus the most frequent alleles were found B (0.533) for A-B; N* (0.971) for D-0 and NF (0.792) for F variation that was given in Table 2.

The outputs of Pearson correlation coefficients were given in Table 4. According to the summary of the descriptive data of PCC, the high correlations were detected as expected in the current study. The milk yield was highly correlated with the studied parameters such as protein, fat, TS, SNF, casein, and lactose (P<0.001). Simultaneously, the high level of correlations was indicated significantly between the whole milk composition parameters of Saanen in the present study (P<0.001).

Relationship of CSN1S2 gene polymorphism with milk yield and composition The least-square means and standard errors for the CSN1S2 gene (A-B allele) and parity effects on milk yield and composition are given in Table 3. According to results, the A-B allele of CSN1S2 gene had significant effects on protein, fat, TS, SNF, casein, and lactose yield of goat milk (P<0.05). Moreover, this variant had a tendency to be significant on the milk yield parameter in Saanen goat (P=0.090). The AA genotype was correlated with higher fat yield (18.83±1.68 kg) than AB and BB genotype. Similarly, the higher protein, TS, SNF, casein, and lactose yield were observed in animals with AA genotype for AB marker. On the other hand, significant associations were established between the parity and all investigated traits (P<0.001) in the study. The highest milk yields such as total milk yield, fat, TS, SNF, casein, and lactose belong to the animals at 3th and 4th parity, while the highest value for milk protein was recorded at 3th to ≥ 5th parity. The milk yield and composition parameters seemed to be at the lowest value on the first parity in accordance with the results.

DISCUSSION The genotypic structure of the investigated population This research established the relationship between CSN1S2 alleles, which are a strong candidate for milk traits in various breeds, and milk production parameters in Saanen dairy goats. Seven alleles of the gene, including A, B, D, F, and 0 identified up to now10, and according to the results, the B was found the most frequent allele (0.533) for A-B variant in the current study. These findings are in disagreement with those reported by Sacchi et al.20, who indicated the allele frequencies between 0.014 to 0.175 in Vallasena, Roccaverano, Maltese, Jon-

Table 3 - Effects of CSN1S2 gene polymorphisms on milk yield and composition in Saanen goats with the levels of significance, leastsquares means, and standard errors. Genotype

Total Milk yield (kg)

Protein (kg)

Fat (kg)

TS** (kg)

SNF+ (kg)

Casein (kg)

Lactose (kg)

531.8 ± 44.5

15.90 ± 1.31a

18.83 ± 1.68 a

59.01 ± 4.92a

41.66 ± 3.52a

12.48 ± 1.03a

21.67 ± 1.91a

425.3 ± 21.3

11.95 ± 0.62b

13.69 ± 0.80 b

43.37 ± 2.35b

31.00 ± 1.68b

9.45 ± 4.98b

15.87 ± 0.91b

459.0 ± 23.2

12.73 ± 0.68ab

14.22 ± 0.87 b

45.94 ± 2.56ab

32.92 ± 1.83ab

9.95 ± 5.42ab

16.93 ± 0.99ab

A-B

P Parity

0.090

316.2 ± 27.9

7.52 ± 0.81

8.54 ± 1.05

27.40 ± 3.08

2th

389.2 ± 32.9bc

10.96 ± 0.96 b

12.79 ± 1.24bc

3th

515.1 ± 29.3a

15.86 ± 0.86 a

19.92 ± 2.20

5.89 ± 6.50

10.34 ± 1.19c

40.92 ± 3.63b

29.29 ± 2.60b

8.66 ± 7.67b

15.21 ± 1.41bc

18.46 ± 1.10a

57.68 ± 3.23a

40.75 ± 2.31a

12.44 ± 6.83a

20.72 ± 1.25a

21.59 ±1.62

66.10 ± 4.77

46.06 ± 3.41

14.10 ± 1.00

23.67 ± 1.85a

15.42 ± 1.30 a

16.52 ±1.67ab

55.09 ± 4.89ab

39.95 ± 3.50ab

12.05 ± 1.03ab

20.83 ± 1.90ab

***

603.6 ± 43.2

17.88 ± 1.27

≥ 5th

536.1 ± 44.3ab ***

N*: A, B, C, E or F, TS**: total solid, SNF : solid not fat, ***= P<0.001, *= P<0.05, NS=not significant, a,b,c,d,e = Different superscripts within a column indicate significant differences. ~ : tended to be significant (P<0.010)

Table 4 - The Pearson correlations between the composition characteristics of Saanen milk1.

Variables

Milk yield

Protein

0.926

Protein

Fat

SNF

Fat

0.867

0.948

0.928

0.988

0.980

SNF

0.941

0.993

0.952

0.993

Casein

0.922

0.999

0.956

0.991

0.993

Lactose

0.950

0.973

0.937

0.983

0.993

All correlations were found statistically significant (P<0.001).

Casein

0.973

Deniz_imp_ok 07/04/21 09:59 Pagina 95

D. Deniz et al. Large Animal Review 2021; 27: 91-96

ica, and Garganica goats. Moreover, the present observation conflict with the work of Vacca et al.4,12,21 in which the allele frequencies were found 0.06 and 0.366 in Sarda and Tunisian local goat breeds, respectively. The frequency of A allele (0.467) was determined similar to data recorded by Marletta et al.10, who dedicated the frequency as 0.413 in Argentata dell’Etna goats. On the other hand, the higher values for A were recorded in Girgentana (0.744) by Marletta et al.10. Previous studies indicate that the D allele of CSN1S2 gene was not detected in local Tunisian breeds12; Vallasena, Roccaverano goats13, and Turkish goats22. In close agreement with the literature, the N* allele was observed the most frequent for D-0 variant (0.971), and the frequencies of 0 were detected 0.029 in the present study. The differences between the allele frequencies of the literature and the current research should be explained by the flock or breed differences. Consistent with the A-B or D-0 variants, the frequencies of F allele exhibited a variation in the literature. According to the literature, the frequency of F allele varies from 0.190 to 0.408 in Vallasena, Roccaverano, Maltase, Jonica, Garganica20; local Tunisian breeds12; Hungarian milking goats, Italian goats13; Girgentana11; Guanzhong23, and Sarda goats21 respectively. The frequency of F allele was determined 0.208 in the present study, which is in agreement with Yue et al.23, who reported the frequency as 0.205 in Xinong Saanen breed. On the other hand, these findings were noticed to be higher than Lan et al.6 in Saanen goats (0.087). This could be due to the flock or race variations that have different gene pools, as in other alleles. The genotype frequency of AA, BB, and AB of A-B variant were found 26.67%, 33.33%, and 40.00% in the study, as given in Table 2. This conclusion is not consistent with data found in the literature by Chiatti et al.14, who indicated the genotype frequencies of AA and AB were 84.62% and 15.38% in Saanen goats. Moreover, the homozygote genotype for B allele for CSN1S2 gene did not exist in that study. Othman and Ahmed24 emphasized that the 0 alleles were not observed in Egyptian goats breeds; all individuals had N*N* genotype for D-0 variant. Our results for N*N* genotype (94.17%) were similar to data recorded by Othman and Ahmed24; however, two different genotypes, including N*0 were found in the present study. The most frequent genotype was detected NF/NF in Saanen goats, which was similar to data recorded by Othman and Ahmed24, Lan et al.25, and Balcioglu et al26. In other respects, the lowest frequency for F variant was identified as FF (13.61%) in close agreement with Lan et al.25, Balcioglu et al.26, and Sztankóová et al.7. The reason for the observed similarities might be due to the genetic resemblance of the flocks.

(15.90±1.31 kg), fat yield (18.83±1.68 kg), TS yield (59.01±4.92 kg), SNF yield (41.66±3.52 kg), casein yield (12.48±1.03 kg) and lactose yield (21.67±1.91 kg) were observed in goats with AA than AB or BB genotypes. On the other hand, no significant associations were confirmed between the A, F alleles, and physical, chemical, or cytological parameters of Sarda breed by the other study of the identic researcher4. The reason for the impact differences between the literature and current results might be arised from the breed dissimilarity. Also, it was thought that the effect of A-B variant of CSN1S2 on casein yield was identified for the first time in Saanen goats in the present study. Prasad et al.27 reported that the milk yield of Jamunapari, Barbari, and Black Bengal goats was the highest in the first parity. On the other hand, the effects of parity were found significant in Maltese goats by Carnicella et al.28, and the highest milk yield was indicated at third (301.3±4.38 kg) and the fourth (302.1±3.99 kg) parity. Unlike the findings of Prasad et al.27 our results consisted of Carnicella et al.28 that the highest milk yields of Saanen goats were found on the 3rd (515.1±29.3 kg) and the 4th (603.6±43.2 kg) parity in the present study. Although Addass et al.29 and Zahraddeen et al.30 emphasized that the impact of parity on TS yield was not significant, our results were similar to recorded by Prasad et al.27, who indicated the highest TS ratio at the 5th parity in Jamura, Bahrani and Black Bengal goats. Prasad et al.27 noted the highest protein value at the 1st to 4th parity in the same research. It was known that the protein yield of milk is an essential criterion for the cheese-making ability for all species. Carnicella et al.28 reported the highest protein ratio at the first parity in Maltese dairy goats. However, Prasad et al.27 observed the higher protein at the 1st to 4th parity. In contrast to Carnicella et al.28, the highest protein yield was found at the 3rd to 5th parity in Saanen goats in the current study. The fat value, which is another significant compound of milk, was detected to be impressed by parity in goats; thus, the highest fat yields were found at 1st 28 or 3rd 29-30 parity in the literature. Similar results with Zahraddeen et al.30 and Addass et al.29 were adjusted in the present study. But also our observations seemed to be a conflict with the work of Carnicella et al. (2008). On the other hand, the highest lactose yield was found on the 3rd 29-30 and 5th parity27 in goats. The present findings support the hypothesis that the highest lactose yields were established at the 3rd and 4th parity in dairy goats. It was well known that milk production increases with age until the peak yield. The reason for the higher milk composition yield to be seen on the 3-4th could be explained by this situation.

Relationship of CSN1S2 gene polymorphism with milk yield and composition

Correlation between the milk composition parameters is an important item for the purpose of milk production. Addas et al.29, and Zahraddeen et al.30 indicated that no significant correlations were found between the TS and fat composition of goat milk. Moreover, they reported that the lactose was significantly associated with the TS and fat in Red Sokoto (RS), Sahel (SG), and West African Dwarf (WAD) goat breeds (P≤0.05). However, Prasad et al.27 were found significant correlations between the TS and fat composition of milk. Unlike the previous studies performed in RS, SG, and WAD goats, the observation of the current study was compatible with the work of Prasad et al.27 that the correlations between the TS and fat were significant in Saanen goats. Moreover, our results showed that, as demonstrated in previous studies performed by Addas et al.29,

The composition of milk determines several fields, such as the economic value, cheese-making ability, or the raw material selection for the dairy product. The effect of A-B variant of CSN1S2 genotype and parity on these parameters was adjusted significantly in the present study. Vacca et al.21 indicated that the impact of A-B and F allele/variant was found significant on daily milk yield, fat, and protein yield in Sarda goats. The daily milk yield, fat yield, and protein yield of Sarda goats were detected 931.1 g/day, 48.78 g/d, and 39.89 g/d in AA genotyped individuals, respectively. The present findings support the hypothesis of Vacca et al.21 that the higher protein yield

Correlations between the compositions of goat milk

Deniz_imp_ok 07/04/21 09:59 Pagina 96

Identification of the frequency of CSN1S2 gene alleles and the effects of these alleles and parity on milk yield

and Zahraddeen et al.30, significant correlations were observed with the lactose and TS or fat composition. Although the correlations between the lactose yield and TS or protein was defined as significant, no significant association was determined in terms of the correlation between the lactose and fat compound of goat milk by Prasad et al.27. In addition, important correlations were detected between the protein and fat composition in Beetal and Beetal crossbreeds at the same research. The results obtained in the present investigation are in agreement with the findings reported by Prasad et al.27 in terms of correlations between the protein and fat or lactose. We assume that the diversity in the correlations can be caused by different breeds with variable milk composition and yields.

CONCLUSION As a consequence, goat milk, which is one of the valuable animal protein sources, as well as its beneficial structure and organoleptic properties, is important for both the human health and dairy industry to prevent and be an adjunctive treatment of many diseases. The genetic structure of Saanen goats was identified in terms of CSN1S2 variants in the present study. The most frequent genotypes were specified as AB for A-B variant, N* for D-0 variant, and NF/NF for F variant. Moreover, a wide range of associations between the CSN1S2 gene (A-B allele), parity, and the milk yield and compositions were identified in Saanen goats. The selection of these goats with that favorable genotypes may result in animals with higher milk composition yields; thus, a benefit for management systems in dairy goat breeding and the development of breeding strategies might be achieved.

ACKNOWLEDGEMENT This study was financially supported by the Scientific Research Projects Unit of Bursa Uludag University by the project number KUAP(V)-2018/12.

References 1. Warsama L.M., El Zubeir I.E.M. (2015). Comparison of chemical composition of goat milk from farms and individual households in Khartoum State, Sudan, Management of land use systems for enhanced food security: conflicts, controversies and resolutions. Tropentag, Berlin, Germany. 2. Lima M. J. R., Teixeira-Lemos E., Oliveira J., Teixeira-Lemos L. P., Monteiro A. M. C., Costa J. M. (2018). Nutritional and health profile of goat products: focus on health benefits of goat milk. In Goat Science. InTech. https://doi.org/10.5772/intechopen.70321., 191-194. 3. Ramunno L., Cosenza G., Pappalardo M., Longobardi E., Gallo D., Pastore N., Di Gregorio P., Rando A. (2001). Characterization of two new alleles at the goat CSN1S2 locus, Anim Genet, 32: 264-268. 4. Vacca G.M., Ouled Ahmed Ben Ali H., Pazzola M., Sanna M., Dettori M.L., Carcangiu V. (2009a). An investigation on allele frequency at the CSN1S2 locus and its relationship with milk parameters in the Sarda goat. J Anim Feed Sci, 18: 628-637. 5. Martin P., Szymanowska M., Zwierzchowski L., Leroux C. (2002). The impact of genetic polymorphisms on the protein composition of ruminant milks. Reprod. Nutr. Dev, 42: 433-459. 6. Lan X.Y., Chen H., Pan C-Y., Li R-B., Li X-C., Fang X-T. (2005a). Between Polymorphisms of CSN3, CSN1S2 and β-lg Genes and Litter Sizes of Xinong Saanen Dairy Goat. Zhongguo Nong Ye Ke Xue, 38(11):2333-2338. 7. Sztankóová Z., Rychtářová J., Kyselová J., Mátlová V., Štípková M., Matějíčková J., Marková M. (2013). Effect of the αs1-, αs2-, β- and κ-casein genotypes on the milk production parameters in Czech goat dairy

breeds. Grant J, 2:76-80. 8. Turhan Dincel D., Ardicli S., Samli H., Balci F. (2016). Determining the frequencies of B1, B2, B3 and E alleles of the CSN1S1 gene and their effects on milk yield and composition in Saanen goats. S. Afr. J. Anim. Sci, 46(2): 180-190. 9. Groenen M.A.M., Dijkhof R.J.A., Verstege A.J.M., Van Der Poel J.J. (1993). The complete sequence of the gene encoding bovine αs2-casein. Gene 123:187-193. 10. Marletta D., Bordonaro S., Guastella A.M., D'urso G. (2004). Genetic polymorphism at CSN1S2 locus in two endangered sicilian goat breeds. J. Anim. Breed. Genet, 121: 52-56. 11. Palmeri M., Mastrangelo S., Sardina M., Portolano B. (2014). Genetic variability at αs2-casein gene in girgentana dairy goat breed, Ital. J. Anim. Sci,13: 116-118. 12. Vacca G.M., Ouled Ahmed Ben Ali H., Carcangiua V., Pazzolaa M., Dettoria M.L. (2009b). Genetic structure of the casein gene cluster in the Tunisian native goat breed, Small Rumin Res, 87: 33-38. 13. Kusza S., Veress G., Kukovics S., Jávor A., Sanchez A., Angiolillo A., Bösze Z. (2007). Genetic polymorphism of αs1- and αs2- caseins in Hungarian milking goats. Small Ruminant Res, 68: 329-332. 14. Chiatti F., Chessa S., Bolla P., Caroli A., Pagnacco G. (2005). Casein genetic polymorphisms in goat breeds of Lombardy, Ital J Anim Sci, 4(2):46-48. 15. Grobler R., Visser C., Chessa S., Van Marle-Koster E. (2017). Genetic polymorphism of CSN1S2 in South African dairy goat populations, S. Afr. J. Anim. Sci, 47(1): 72-78. 16. Green M., Sambrook D.W.J. (2012). Isolation and quantification of DNA. Molecular Cloning: A Laboratory Manual, 4th ed., 1:11-80, Cold Spring Harb. Press. Cold Spring Harb. New York. 17. Cosenza G., Rando A., Longobardi E., Masina P., Ramunno L. (1998). A MseI RFLP at the goat αs2-casein gene, Anim Genet, 29: 150-160. 18. Botstein D., White R.L., Skolnick M., Davis R.W. (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet,.32: 314-331. 19. Buyukozturk S. (2002). Basit ve Kısmi Korelasyon, In: Sosyal Bilimler çin Veri Analizi El Kitabı. Ed. Buyukozturk S, 23rd ed., 31-34, Pegem Yayıncılık, Ankara, Turkey. 20. Sacchi P., Chessa S., Budelli E., Bolla P., Ceriotti G., Soglia D., Rasero R., Cauvin E., Caroli A. (2005). Casein Haplotype Structure in Five Italian Goat Breeds. J Dairy Sci, 88(4): 1561-1568. 21. Vacca G.M., Dettori M.L., Piras G., Manca F., Paschino P., Pazzola M. (2014). Goat casein genotypes are associated with milk production traits in the Sarda breed. Anim Genet, 45(5):723-731. 22. Bozkaya F., Mundan D., Karabulut O., Yerturk M., Gurler S., Aral F. (2008). An investigation on the distribution of O and D alleles of the CSN1S2 gene in goat populations raised in southeastern region of Turkey. Small Rumin Res, 78: 193-196. 23. Yue X.P., Fang Q., Zhang X., Mao C.C., Lan XY, Chen H., Lei C.Z. (2013). Effects of CSN1S2 Genotypes on Economic Traits in Chinese Dairy Goats. Asian-Australasian journal of animal sciences, 26(7), 911-915. https://doi.org/10.5713/ajas.2013.13018 2013). Effects of CSN1S2 Genotypes on Economic Traits in Chinese Dairy Goats. Asian-Australas J Anim Sci, 26(7):911-915. 24. Othman E.O., Ahmed S. (2006). Analysis of Genetic Polymorphisms in the Egyptian Goats CSN1S2 Using Polymerase Chain Reaction. J. Biol. Sci, 6: 238-241. 25. Lan X.Y. Chen H., Zhang R-F., Tian Y. Zhang Y-D., Fang X-T., Sun W-B. Lei C-Z, Hu S-R. (2005b) Association of Polymorphisms of CSN1S2 Gene with Average Milk Yield and Body Sizes Indexes in Xinong Saanen Dairy Goat. Xu Mu Shou Yi Xue Bao, 36(4): 318-322. 26. Balcioglu M.S., Karsli T., Sahin E., Karabag K. (2016). Genetic polymorphism at CSN1S2 locus in hair goats reared in Antalya. 7(1):25042509. VII International Scientific Agriculture Symposium, Jahorina, Bosna Hersek. 27. Prasad H.V., Tewari H.K., Sengar O.P. (2005). Milk yield and composition of the beetal breed and their crosses with Jamunapari, Barbari and Black Bengal breeds of goat. Small Rumin Res, 58: 195-199. 28. Carnicella D., Dario M., Ayres M.C., Laudadio V., Dario C. (2008). The effect of diet, parity, year and number of kids on milk yield and milk composition in Maltese goat. Small Rumin Res, 77: 71-74. 29. Addass P.A., Tizhe A.P., Midau A., Alheri P.A., Yahya M.M. (2013). Effect of genotype, stage of lactation, season and parity on milk composition of goat, in Mubi, Adamawa State, Nigeria. Ann Biol Res, 4(8): 248-252. 30. Zahradden D., Butswat I.S.R., Mbap S.T. (2007). Evaluation of some factors affecting milk composition of indigenous goats in Nigeria. Livestock Res Rural Dev, 19(11): 1-6.

Askri_imp_ok 07/04/21 10:03 Pagina 97

A. Askri et al. Large Animal Review 2021; 27: 97-101

Saccharomyces cerevisiae-derived prebiotic as a sustainable bioactive substance for improving broiler meat quality

AMENI ASKRI1*, AZIZA RAACH-MOUJAHED2, NACEUR M’HAMDI2, ZIED MAALAOUI3, HAJER DEBBABI1 1

University of Carthage, National Agronomic Institute of Tunisia, Department of Agro-Food Industries, UR17GR01 PATIO; 43 Av. Charles Nicolle, Tunis 1082 2 University of Carthage, National Agronomic Institute of Tunisia, Department of Animals’Sciences, 43 Av. Charles Nicolle, Tunis 1082 3 Arm & Hammer Animal Nutrition, North Africa, Tunis, Tunisie, Tunis 1002

SUMMARY This study aimed to investigate the effect of supplementation with a commercial prebiotic based on a Saccharomyces cerevisiae derived-prebiotic on meat quality traits of broiler chicken. A total of 192 male chicks Arbor Acres were divided into four groups with six replicates each and were housed in cages (8 birds/cage). The first group (T0) was unsupplemented and considered as a positive control. The experimental groups supplemented with three increasing levels of prebiotic (T1=1; T2=1.5 and T3=2 g of prebiotic per kg of basal diet) and the prebiotic was removed from the diet one week. At the end of the 6 weeks, the birds were slaughtered, dressed, and subjected to quality analyses. Breast muscle pH was measured at 0h, 2h, 6h, and 24h after slaughter. The color values of the CIE Lab Color System (skin, breast, and thigh) were determined 24h post-mortem. Sensory analysis was conducted to evaluate flavor, texture, juiciness, and global acceptance of chicken breast meat from broilers fed prebiotic. The groups fed with prebiotics showed higher pH values of breast muscle at 0 and 2 hours post-mortem (P <0.05), but not at pH 6 hours and ultimate pH among all samples (P>0.05). Inclusion prebiotics induced significant decreases in the breast “lightness L*” compared to the control group. However, no significant changes (P > 0.05) were observed in the skin breast and thigh. An increase in a* (redness) value and a decrease in b* (yellowness) value were observed in all supplemented groups, in comparison with controls. A significant decrease in b* (yellowness) values were observed in all parts of supplemented samples (skin, thigh, and breast). Sensory analysis showed that supplementation with prebiotic at the higher dose (2 g/kg) has significantly improved global hedonic acceptance. This study highlighted that using Saccharomyces cerevisiae derived-prebiotic in the broiler diet may be a beneficial and natural tool for improving meat quality.

KEY WORDS Prebiotic, pH, color, sensory characteristics, meat, broiler.

INTRODUCTION Poultry production had socio-economic and cultural values in most developing countries including Tunisia. Poultry meat is not only a valuable source of high-quality proteins but also of minerals and vitamins1. Many studies reported that the level of those compounds, as well as meat quality, is determined not only genetically, but it is also affected by environmental factors and especially on the content of feeds2. Nevertheless, the use of antibiotics as growth promoters (AGPs) faces serious objections such as antibiotic-resistant pathogens and drug residues in poultry products, which can affect public health3. Therefore, antibiotics are being taken out of poultry diets around the world and have been prohibited by many countries as AGPs4. This ban contributed to increased incidence of enteric diseases, poor growth performance, and therefore serious economic damage5. The focus of alternatives to replace antibiotics has gained increasing interest in animal nutrition in recent years6. Moreover, consumers are becoming more mindful of animal production systems, and in particular the feeding, since antibiotics can im-

Corresponding Author: Ameni Askri (askria.ing@gmail.com).

pair their health. Particular concern has been paid to the use of prebiotics as a substitute for AGPs. Recent researches have focused on the importance of prebiotics as functional foods in poultry nutrition to sustain productivity and improve the quality of animal products in particular fatty acid profile and nutritional ratios of meat7. Prebiotic has been defined as a nondigestible food ingredient that improves the host’s microbial balance. Several types of nondigestible oligosaccharides, such as fructooligosaccharides (FOS), galactooligosaccharides (GOS), mannan oligosaccharides (MOS) and isomalto oligosaccharides (IMO), are considered to be prebiotic and have been studied as sustainable alternatives to AGPs8. Although many studies have established the beneficial effects of prebiotics in maintaining gut health and promoting animal performance. However, there was a scarcity of studies on the impact of prebiotics administration on meat quality. Thus, the influence of prebiotics on meat quality improvement remains controversial. Further investigations are needed to clarify the effect of prebiotics administration on meat quality in broiler chickens. Among the prebiotics examined in broilers, yeast-based products derived from the strain Saccharomyces cerevisiae have been shown to improve animal health and metabolism as well as to decrease morbidity, thereby enhancing the growth performance9, 10. Moreover, Askri et al.11 have confirmed the favorable effects of inclusion

Askri_imp_ok 07/04/21 10:03 Pagina 98

Saccharomyces cerevisiae-derived prebiotic as a sustainable bioactive substance for improving broiler meat quality

on different levels of Saccharomyces cerevisiae-derived prebiotic in broiler diet on meat production. Taken together these data indicated that duration prebiotic inclusion has paramount importance since it can negatively affect meat sensory quality when prebiotic was given during the whole rearing period9. The present study aimed to evaluate the effects of a commercial S. cerevisiae derived prebiotic supplementation on meat quality traits in broiler chickens and consumers’acceptance.

Konica Minolta Sensing Inc., Osaka, Japan). The readings were taken on equivalent positions. The tip of the chromameter measuring head was placed flat against the surface of the skin or of the meat for breast and thigh. In this coordinate system, the L* value measures lightness, ranging from 0 (black) to +100 (white). The a* value ranges from –100 (green) to +100 (red), and the b* value ranges from –100 (blue) to +100 (yellow).

Sensory analysis Sensory evaluation was performed by semi-trained panelists. The group of panelists who participated in the study was composed of 10 normal sighted persons, aged from 23 to 30 years. They were recruited at random from among students of the National Agronomic Institute of Tunisia. Only those selected who declared that their senses of taste and smell were not debilitated and that they consumed poultry meat at least once a week. They were informed that the aim of the experiment was poultry meat, but did not know the species of birds or the type of meat being evaluated. Breast samples were cooked in a pre-warmed oven (180oC) until the internal temperature reached 75oC. The samples were standardized (size, codification, and tasting temperature) and evaluated by the sensory panel. Each panelist was asked to evaluate cooked breast samples according to the following attributes: color intensity, odor, fat and strange flavor, tenderness, juiciness, and global acceptance. They were scored in a 10-point scale for organoleptic quality that is, excellent 10; good 8-9; fair 6-7; marginal acceptable 4-5; unacceptable 2-3; bad 0-112.

MATERIALS AND METHODS Birds and experimental design All birds were individually identified, weighed, divided into four groups and were housed in individual cages. Birds received diet and water ad libitum throughout the rearing period. Daily observations were made about general flock condition, temperature, lighting, water, feed, and anticipated events in the house.

Diets and treatments Diets are composed of corn and soybean meal and did not contain antimicrobial growth promoters or coccidiostats. The prebiotic product composed of Refined functional carbohydrates (RFC), including mannan oligosaccharides (MOS), β-glucan, and D-mannose which account for 20 to 30% of the cell dry mass, derived from the cell wall of Saccharomyces cerevisiae, with yeast culture (Arm & Hammer Animal and Food Production). The chicks received one of four treatments randomly as follows: T0 was a positive control unsupplemented; T1; T2 and T3 were supplemented with 1; 1.5 and 2 g of prebiotic per kg of basal diet. The study of Askri et al.9 revealed an unpleasant taste, attributed to a yeasty flavor when this prebiotic supplemented in broiler diet during the whole rearing period (six weeks). Based on these results, the prebiotic was given most of the rearing period (until the fifth week) and was removed one week before slaughter to avoid alteration of meat sensory quality. Slaughter survey at the age of six weeks, a total of 72 birds were randomly selected (18 from each group), weighed, and slaughtered. After evisceration and cutting, the dressed broilers (breast and thigh) were kept for different analyses.

Statistical analysis Statistical analysis were performed using Statistical Analysis Software for Windows SAS 9.413. Data were analyzed using the GLM procedure, where treatment was the main factor. Prior analysis the residuals of the traits were tested for normality. Dunnet’s test was applied to compare every mean to a control mean. Additionally, regression (linear, cubic, and quadratic) models were run to study dose-dependent responses. All values were expressed as a statistical means± standard error. The overall level for statistical significance was set at P<0.05.

pH measurement

RESULTS

The pH was measured at different time points post-mortem (0h; 2h; 6h and 24h) in the breast muscle at 2 cm depth using a calibrated pH meter equipped with a penetrating glass electrode (Hanna HI- 99163).

The variation of post-mortem pH value in the muscle breast of different groups of broilers is depicted in Table 1. Our results indicated that prebiotic supplementation has increased the post-mortem pH values of breast muscle at 0 and 2 hours, post-mortem, but no significant increase was noticed at 6 and 24h post-mortem. For all the supplemented groups, pH tended to increase over time.

Color parameters The CIE Lab color of skin and meat (breast and thigh) were determined at 24h post-mortem using a chromameter (CR410

Table 1 - Effect of prebiotic supplementation at different levels on breast meat pH post-mortem. p-values of regression model

T0 (Control)

T1 (1 g/kg)

T2 (1.5 g/kg)

T3 (2 g/kg)

P-Value (ANOVA)

Linear

Quadratic

Cubic

5.80±0.12b

5.85±0.11a

5.92±0.14a

5.86±0.17a

0.049

0.056

0.048

0.041

5.76±0.45

5.79±0.14

5.86±0.12

0.037

0.041

0.052

0.039

5.71±0.25

5.72±0.18

5.74±0.19

5.73±0.20

0.628

0.194

0.417

0.628

24 h

5.68±0.09

5.70±0.19

5.72±0.11

5.73±0.13

0.892

0.898

0.890

0.892

a-c

5.82±0.15

Means within a row with different superscripts are significantly different (P <0.05). Values represent the Mean ± SEM.

Askri_imp_ok 07/04/21 10:03 Pagina 99

A. Askri et al. Large Animal Review 2021; 27: 97-101

DISCUSSION

The results of the color characteristics were presented in Table 2. Supplementation prebiotic induced significant decreases in the breast “lightness L*”. Nevertheless, no significant changes (P>0.05) were observed in the skin breast and thigh “lightness L*”. Interestingly, an increase in a* (redness) values in thigh and breast samples were observed. Indeed, all thigh supplemented samples had a higher redness value compared with control one, but the significant increase was noticed only in T1 and T3 samples (P<0.05). Besides, redness of breast samples was significantly higher in all supplemented samples (T0=6.74; T1=7.22; T2=7.12; T3=7.04). A significant decrease in b* (yellowness) values were observed in all parts of supplemented samples (skin, thigh, and, breast). As shown in Table 3, supplementation with Saccharomyces cerevisiae-derived prebiotic has modified breast meat sensory parameters, in terms of tenderness, juiciness, and taste scores (P<0.05). However, no significant differences were found (P>0.05) between control samples and those from chicken fed increasing doses of prebiotic, for odor, color, and flavor (P>0.05), indicating that supplementation with Saccharomyces cerevisiae as prebiotics had no negative effect on these sensory characteristics. Interestingly, the incorporation of Saccharomyces-derived prebiotic at a higher dose (2 g/kg) has significantly improved taste scores (Table 3). Therefore, this result confirmed our hypothesis that pulling out prebiotic one week before slaughtering could reduce or even remove the unpleasant taste, attributed to a yeasty flavour19.

The meat pH is currently used for the assessment of meat quality, processing suitability, and hardness14. The pH values reported in our study entirely fit within those reported in the study of Lipi ski et al.15. Similarly, Rehman et al.16 reported an increase in pH at 0 and 2 h post-mortem. Alteration in pH during rigor mortis is an indicator of some biochemical processes (protein denaturation) to transform muscle into the meat17. Therefore, this difference in muscle pH at 0 and 2 hours postmortem suggest different metabolic changes related to prebiotic administration. This change in pH can affect meat quality characteristics, such as color, texture, and water-holding capacity (WHC). In the present study, supplementation of increasing doses of prebiotic in broiler diet did not significantly affect ultimate pH. Accordingly, Maiorano et al.18 reported that galactooligosaccharides prebiotic delivered in ovo did not affect the ultimate pH of the pectoral muscle (P > 0.05). Konca et al.19 evaluated the effects of prebiotic in finishing turkey diets on meat pH value and also reported that dietary treatment did not affect the pH value at 24 h of post-mortem period. Moreover, similar pH values (P > 0.05) were observed among experimental groups delivered trans-galactooligosaccharides in ovo14. Conversely, Cheng et al.20 showed elevated breast muscle pH value at 24 h post-mortem in broilers with the incorporation of synbiotic (P < 0.05), whereas Sang-Oh and Byung-Sung21 showed a sig-

Table 2 - Effect of prebiotic supplementation at different levels on meat and skin color characteristics of broilers. T0 (Control)

Skin

T1 (1 g/kg)

T2 (1.5 g/kg)

T3 (2 g/kg)

p-values of regression model

P-Value (ANOVA)

Linear

Quadratic

Cubic

65.06±2.22

65.19±2.34

64.07±2.13

63.74±2.24

0.072

0.091

0.093

0.098

0.035

0.046

0.043

0.041

0.037

0.041

0.052

0.039

4.18±1.52

4.18±1.67

4.56±1.27

24.12±2.33

23.49±2.51

23.09±2.37

23.19±2.42

59.28 ±3.24

57.59±3.17

58.51±3.61

58.38±2.48

0.628

0.194

0.417

0.628

8.89±1.25b

9.47±1.37a

8.93±1.72b

9.06±0.93a

0.041

0.052

0.089

0.092

13.02±1.25a

11.40±2.73b

12.03±2.43ab

11.45±1.71b

0.049

0.056

0.048

0.041

61.90±2.68

60.18±3.47

0.037

0.048

0.052

0.039

Breast a

Thigh

4.00±1.21

59.8±2.37

60.52±2.82

6.74±1.13

7.22±0.91

7.12±1.31

7.04±1.12

0.049

0.194

0.417

0.628

14.74±1.91a

13.09±2.32b

13.01±1.73b

12.7±2.53c

0.047

0.059

0.079

0.087

L: Lightness; a: redness; b; yellowness; a-c Means within a row with different superscripts are significantly different (P <0.05). Values represent the Mean ± SEM.

Table 3 - Effect of prebiotic supplementation at different levels on sensory scores and global acceptance of meat broilers. p-values of regression model

T0 (Control)

T1 (1 g/kg)

T2 (1.5 g/kg)

T3 (2 g/kg)

P-Value (ANOVA)

Odour

4.00±2.14a

3.75±1.91a

4.25±1.04a

3.75±1.38a

0.923

0.920

0.832

0.514

Colour

2.75±2.12a

3.75±1.39a

4.62±1.51a

3.62±1.60a

0.206

0.195

0.099

0.514

Tenderness

3.00±1.93c

4.12±1.36b

5.00±1.93 a

3.62±0.51bc

0.028

0.089

0.297

0.419

0.028

0.174

0.726

0.643

Juiceness

3.00±1.31

3.12±0.83

4.00±1.60

4.50±2.07

Linear

Quadratic

Cubic

Taste

2.87±0.99

3.87±2.42

4.50±1.51

5.00±1.92

0.017

0.123

0.691

0.930

Flavor

3.37±2.39a

3.87±2.10a

4.12±1.46a

4.12±1.35a

0.391

0.836

0.704

0.956

Global acceptance

3.75±1.67b

3.62±1.30b

5.62±2.00a

6.62±1.30a

0.001

0.002

0.331

0.225

a-c

Means within a row with different superscripts are significantly different (P <0.05). Values represent the Mean ± SEM.

Askri_imp_ok 07/04/21 10:03 Pagina 100

100

Saccharomyces cerevisiae-derived prebiotic as a sustainable bioactive substance for improving broiler meat quality

nificant decrease on chicken meat ultimate pH after administration of dietary inulin prebiotic. The pH measurements at 24 h, at the end of the post-mortem process, were found to be within the acceptable range for commercial meats22. Based on the results from the present study, it can be postulated that the beginning of the onset of rigor mortis was around 6 hours post mortem. According to Hwang et al.23, muscle pH during the onset of rigor mortis, and ultimate pH have a significant effect on meat quality because these imply the rate of post mortem metabolism in muscle tissue, and subsequently govern protein denaturation and water-holding capacity. Watanabe et al.24 have reported that the ultimate pH of muscle is a key element of meat quality and is related to the reduction of glycogen and liberation of lactic acid pre- and post-slaughter. The current findings are in line with the results of Akiba et al.25 who observed an increase in redness value in the breast and thigh muscles of broilers when feed supplemented with yeast Phaffia rhodozyma. Similarly, Cho et al.26 have observed an increase in breast meat redness in broilers receiving prebiotic diets, whereas L* and b* values were not affected. As reported by Pelicano et al.27 using Saccharomyces cerevisiae, redness (a*) was significantly higher (P<0.05) in treated groups. Konca et al.19 revealed that mannan-oligosaccharides did not affect meat pigmentation of finishing turkeys. Several studies have established a correlation between ultimate pH and CIE Lab color indexes. A lower pH in breast meat can lead to a pale color and low WHC15. According to Jiang et al.28, higher a* value was considered as the most appreciated by consumers and lower b* value indicated less pale meat. Our results indicated a positive effect of Saccharomyces cerevisiae-derived prebiotic on meat tenderness (Table 3). Similarly, Zhang et al.29 showed that meat tenderness has been improved by the incorporation of whole yeast or Saccharomyces cerevisiae extract in broiler diet. Likewise, increased tenderness of breast muscle in broilers fed mannan oligosaccharides (prebiotics) was found by Abdel-Raheem & Abd-Allah30. As reviewed by Mir et al.31, texture constitutes one of the most important quality attributes, associated with consumers’ satisfaction in the eating quality of poultry. Furthermore our results clearly showed that supplementation with prebiotic at a higher dose (2 g/kg) has significantly improved global acceptance (Table 3). Gardzielewska et al.32 have also shown that the addition of oligosaccharides (prebiotics) to broiler diets led to better sensory characteristics. However, no significant correlations were found between global acceptance and quality parameters (ultimate pH, Lab indexes). In terms of product color, although no significant difference was found in sensory color scores, our data are in agreement with those of Yang et al.33 indicating that an increase of a* value could improve consumers’ acceptance. To the best of our knowledge, there have been limited researches on the impact of prebiotics on meat organoleptic and sensory quality of broilers. Moreover, incorporation of S. cerevisiae into the diet enhanced color/appearance, flavor/taste, odor and juiciness, and overall acceptability of broiler meat34. Janocha et al.35 have also shown that mixtures containing Saccharomyces positively influenced meat flavor. Cho et al.26 revealed an improvement of moisture loss in breast meat from chickens receiving β-glucan (Agrobacterium sp.) and kefir (a fermented milk product) combined supplementation. On the other hand, Pelicano et al.27 using S. cerevisiae in drinking water and diet have pointed out the preservation of meat sensory quality after feeding broilers with probiotics.

CONCLUSION Saccharomyces cerevisiae-derived prebiotic preparations are an interesting source in poultry production systems. They are natural supplements and therefore no need grace period. Our study has shown that supplementation of broilers diet by a commercial Saccharomyces cerevisiae-derived prebiotic at a dose of 2 g/kg has improved post-slaughter quality indicators. Using prebiotic has significantly increased pH just after slaughtering at doses up to 2 g/kg and 6 hours after the slaughter at a dose of 2 g/kg. Interestingly, it did not negatively affect ultimate pH, an extremely important parameter for consumers. Moreover, prebiotic administration has improved meat instrumental color, by increasing redness (a*) and reducing yellowness (b*). Sensory analysis has indicated significant changes in breast meat taste and tenderness, and preservation of odor, color, juiciness, and flavor, leading to a significant improvement of consumers’ global acceptance of breast meat from supplemented animals. In conclusion, this study revealed that Saccharomyces-derived prebiotic at a dose of 2 g/kg added to broiler diets is recommended not only to improve animal performances as shown previously (Askri et al., 2020) but also to provide a better meat quality, thereby increasing the profitability of these animals. Further studies in both experimental and commercial settings are needed to understand the extent of this contribution, and in particular to assess the mechanisms of action of prebiotics.

ACKNOWLEDGMENTS The authors thank the National Agronomic Institute of Tunisia and the company Arm&Hammer Animal Nutrition for financial support.

References 1. Smith L.C., Wiesmann D. (2007). Is food insecurity more severe in South Asia or Sub-Saharan Africa: A comparative analysis using household expenditure survey data. 2. Lombardi-Boccia G, Lanzi S, Aguzzi A. (2005). Aspects of meat quality: trace elements and B vitamins in raw and cooked meats. J Food Compost Anal, 18: 39-46. 3. Dibner J.J., Richards J.D. (2005). Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci, 84: 634-643. 4. EPC. (2005). Europe Union Commission. Ban on antibiotics as growth promotors in animal feed enters into effect. Regulation 183/2003/WC on additives for use in animal nutrition, replacing directive 70/524/EEC on additives in feed-stuffs, Brussels, 22 December. 5. Maiorano G., Bednarczyk M. (2016). Prebiotics and synbiotics in broiler chicken production: in vivo performance and meat quality aspects: A review. The 4th International Scientific Conference “Animal Biotechnology”. Slovak J. Anim, 49: 151-156. 6. Slyranda B.A., Kennedy. I., Asha A.Y.A., Joel. B.N., Auwal A., Usman A., Muhammad B.G., Mohammed A.I., Haruna. A., Mohammed M.B., Hama`Adama M.I., Patrick. T.N. (2011). Effects of Feeding Onion (Allium cepa) and Garlic (Allium sativum) on Some Performance Characteristics of Broiler Chickens. Poult. Sci. J, 4: 22-27. 7. Samanta S., Haldar S., Ghosh T.K. (2010). Comparative efficacy of an organic acid blend and bacitracin methylene disalicylate as growth promoters in broiler chickens: effects on performance, gut histology, and small intestinal milieu. Vet. Med. Int, : 645-650. 8. Gibson G.R., Roberfroid M.B. (1995). Dietary modulation of the human colonic microbiota, introducing the concept of prebiotics. J. Nutr, 125: 1401-1412.

Askri_imp_ok 07/04/21 10:03 Pagina 101

A. Askri et al. Large Animal Review 2021; 27: 97-101 9. Askri A., Fitouhi N., Raach-Moujahed A., Abbassi MS., Maalaoui Z., Debbabi H. (2018). Effect of a commercial prebiotic «AVIATOR®» on zootechnical performances, caecal microflora, and meat quality of broilers. Journal of New Sciences Sustainable Livestock Management, 8: 161168. 10. Froebel L.K., Jalukar S., Lavergne T.A., Lee J.T., Duong T. (2019). Administration of dietary prebiotics improves growth performance and reduces pathogen colonization in broiler chickens. Poult. Sci, 98: 6668-6676. 11. Askri A., Raach-Moujahed A., M’hamdi N., Maalaoui Z., Debbabi H. (2020). Broiler’s performance and carcass characteristics improvement by prebiotic supplementation. Large Anim. Rev, 26: 249-256. 12. Meilgaard M.C., Carr B.T., Civille G.V. (2006). Sensory evaluation techniques. Retrieved from https://www.amazon.fr. 13. SAS Institute Inc. (2014). Langage reference concepts SAS® 9.4. Cary, NC, United States. 14. Dankowiakowska A., Bogucka J., Sobolewska A., Tavaniello S., Maiorano G., Bednarczyk M. (2019). Effects of in ovo injection of prebiotics and synbiotics on the productive performance and microstructural features of the superficial pectoral muscle in broiler chickens. Poult. Sci, 98: 51575165. 15. Lipiński K., Zofia A., Kotlarczyk S., Mazur-Kuśnirek M., Kaliniewicz J., Makowski, Z. (2019). The effect of herbal feed additive on the growth performance, carcass characteristics and meat quality of broiler chickens fed low-energy diets. Arch. Anim. Breed, 62: 33-40. 16. Rehman H.F., Zaneb H., Masood S., Yousaf MS., Ashraf S., Khan I., Shah M., Khilji MS., Rehman H. (2018). Effect of Moringa Oleifera Leaf Powder Supplementation on Pectoral Muscle Quality and Morphometric Characteristics of Tibia Bone in Broiler Chickens. Braz. J. Poult. Sci, 20: 817-824. 17. Forrest J.C., Aberle E.D., Hedrich H.B., Judge M.D., Merkel R.A. (1975). Principles of meat science. (pp. 417)., San Francisco, California. 18. Maiorano G., Sobolewska A., Cianciullo D., Walasik K., Elminowska-Wenda K., Slawínska A., Tavaniello S., Zylínska J., Bardowski J., Bednarczyk M. (2012). Influence of in ovo prebiotic and synbiotic administration on meat quality of broiler chickens. Poult. Sci, 91: 2963-2969. 19. Konca Y., Kirkpinar F., Mert S. (2009). Effects of mannan-oligosaccharides and live yeast in diets on the carcass, cut yields, meat composition and colour of finishing turkeys. ajas, 22: 550-556. 20. Cheng Y.F., Chen Y.P., Li X.H., Yang W.L., Wen C., Kang Y.R., Wang A.Q, Zhou Y.M. (2017). Effects of synbiotic supplementation on growth performance, carcass characteristics, meat quality and muscular antioxidant capacity and mineral contents in broilers. J. Sci. Food Agric, 97: 3699-3705. 21. Sang-Oh P., Byung-Sung P. (2011). Influence of Inuloprebiotic Supplementation of the Diets of Broiler Chickens on Shelf-Life and Quality Characteristics of Meat. J Anim Vet Adv, 10: 1336-1341.

101

22. Sams A.R., Mills K.A. (1993). The effect of feed withdrawal duration on the responsiveness of broiler pectoralis to rigor mortis acceleration. Poult. Sci, 72: 1789-1796. 23. Hwang I.H., Devine C.E. Hopkins D.L. (2003). The biochemical and physical effects of electrical stimulation on beef and sheepmeat tenderness. Meat Science, 65:677-691. 24. Watanabe A., Daly C.C., Devine C.E. (1996). The effects of the ultimate pH of meat on tenderness changes during aging. Meat Sci, 42: 67-78. 25. Akiba Y., Sato K., Takahashi K. Matsushita K., Komiyama H., Tsunekawa H., Nagao H. (2001). Meat color modification in broiler chickens by feeding yeast Phaffia rhodozyma containing high concentrations of astaxanthin. J Appl Poultry Res, 10: 154-161. 26. Cho J.H., Zhang Z.F., Kim I.H. (2013). Effects of single or combined dietary supplementation of β-glucan and kefir on growth performance, blood characteristics and meat quality in broilers, Br. Poult. Sci, 54: 216-221. 27. Pelicano E.R.L., Souza P.A de., Souza H.B.A de., Oba A., Norkus E.A., Kodawara L.M., Lima T.M.A de. (2003). Effect of different probiotics on broiler carcass and meat quality. Braz. J. Poult. Sci, 5: 207-214. 28. Jiang S., Jiang Z., Zhou G., Lin Y., Zheng C. (2014). Effects of Dietary Isoflavone Supplementation on Meat Quality and Oxidative Stability During Storage in Lingnan Yellow Broilers. J. Integr. Agric, 13: 387-393. 29. Zhang A.W., Lee B.D., Lee S.K., Lee K.W., An G.H., Song K.B., Lee, C.H. (2005). Effects of yeast (Saccharomyces cerevisiae) cell components on growth performance, meat quality, and ileal mucosa development of broiler chicks. Poult. Sci, 84: 1015-1021. 30. Abdel-Raheem S.M., Abd-Allah S.M.S. (2011). The Effect of single or combined dietary supplementation of mannan oligosaccharide and probiotics on performance and slaughter characteristics of broilers. Int. J. Poult. Sci, 10: 854-862. 31. Mir N. A., Rafiq A., Kumar F., Singh V., Shukla V. (2017). Determinants of broiler chicken meat quality and factors affecting them: a review. JFST, 54: 2997-3009. 32. Gardzielewska J., Tarasewicz Z., Szczerbi ska D., Jakubowska M., Karamucki T., Natalczyk-Szymkowska W. (2003). Modification of quail meat quality with oligosaccharide feed supplementation. EJPAU, Series Animal Husbandry, 6(2). 33. Yang C., Chowdhury M. A., Huo Y., Gong J. (2015). Phytogenic compounds as alternatives to in-feed antibiotics: potentials and challenges in application. PLoS Pathog, 4: 137-156. 34. Kumar R., Ali N., Siddique R.A., Singh R., Rajkumar., Sahu D.S., Roy D., Fahim, A. (2019). The effect of different level of mushroom (Agaricus bisporus) and probiotics (Saccharomyces cerevisiae) on sensory evaluation of broiler meat. J. Entomol. Zool, 7: 347-349. 35. Janocha A., Osek M., Turyk Z., Milczarek A. (2011). Evaluation of an impact of mixtures containing brewer's yeast Saccharomyces cerevisiae on postslaughter quality of broiler chickens. Acta Sci. Pol. Zootech, 10: 41-5.

Askri_imp_ok 07/04/21 10:03 Pagina 102

Petri evi _imp_ok 07/04/21 10:09 Pagina 103

Petričević Veselin et al. Large Animal Review 2021; 27: 103-107

Effect of peppermint (Mentha piperita L.) in broiler chicken diet on production parameters, slaughter characteristics and gut microbial composition

103

N g r

PETRIČEVIĆ VESELIN1, DOSKOVIĆ VLADIMIR2*, LUKIĆ MILOŠ1, ŠKRBIĆ ZDENKA1, RAKONJAC SIMEON2, PETRIČEVIĆ MAJA1, STANOJKOVIĆ ALEKSANDAR1 1 2

Institute for Animal Husbandry, Belgrade-Zemun, Republic of Serbia Faculty of Agronomy, University of Kragujevac, Čacak, Republic of Serbia

SUMMARY This study was conducted to evaluate the productive performance, carcass quality and cecal microbial composition of broiler chickens fed diets supplemented with different concentrations of peppermint powder. Peppermint (Mentha piperita L.) is characterized by strongly scented leaves. It is used as a remedy in herbal medicine, and consists of up to 4% essential oil (with 3545% menthol). The study included 960 one-day mixed-sex Ross 308 broilers. The chickens were assigned to 4 treatments and were housed in 24 boxes, with 6 replicates per treatment. Broilers received three diets (starter, grower and finisher) differing in the amount of supplemental peppermint powder, and were fed ad libitum. The diets contained different levels of supplemental peppermint powder: control group (C) - without peppermint, 02P - 0.2% peppermint, 04P - 0.4% peppermint, and 06P - 0.6% peppermint. The body weight of chickens was measured when changing their feed (days 10 and 24) and at the end of the experiment (day 42). Average feed intake, average daily gain, mortality, feed conversion, and the European Production Efficiency Factor (EPEF) were determined. At the end of the trial, 12 broilers of both sexes were randomly selected from each group and slaughtered to measure their carcass traits. Positive effects of peppermint supplementation were identified. The 04P chickens had significantly higher (p<0.01) values of average daily gain, feed conversion and EPEF compared with the C broilers. There were no significant differences in slaughter results (dressing percentages, the proportions of breast, drumsticks, thighs, wings, abdominal fat, heart, liver and stomach). The total numbers of aerobic bacteria and Lactobacilli were not affected by the peppermint supplementation into broiler diet. The Escherichia coli count in the 04P and 06P birds was lower than that in the C broilers (p<0.05). The results showed that the supplementation of 0.6% peppermint powder to broiler diet had positive effects on weight gain, feed conversion and cecal microbial composition.

KEY WORDS Broiler chickens, cecal microflora, nutrition, peppermint, productive performance.

INTRODUCTION There has been an increasing use of antibiotics for growth promotion in animal nutrition worldwide although they are banned in some countries. Since antimicrobial agents cause bacterial resistance, they can be replaced with alternative growth promoters, such as organic acids, probiotics, prebiotics or phytobiotics. In contrast to antibiotics, phytobiotics pose no risk of bacterial resistance. Phytogenic feed additives are plant components used as whole plant parts (spices) or plant extracts and essential oils to improve animal health. Phytobiotics have a positive effect on the health and gut microbial status of animals (by inhibiting pathogen growth and increasing the total number of beneficial bacteria), thus improving their resistance to digestive tract diseases and, hence, their performance20. Peppermint (Mentha piperita L.) belongs to the family Lami-

Corresponding Author: Dosković Vladimir (vlade321@gmail.com).

aceae, and is characterized by strongly scented leaves. It is used as a remedy in herbal medicine, and consists of up to 4% essential oil (with 35-45% menthol). Pattnaik et al. 16 compared the essential oils of various plants, and found significant antimicrobial and antibacterial efficacy of menthol. In addition to essential oil, the leaf of peppermint contains flavonoids, 612% tannins, triterpenes, bitter substances and other useful ingredients, which contribute to the beneficial effect of this plant. A number of authors have studied the effect of peppermint as a feed supplement in broiler diet. Ocak et al. 15, Al-Kassie 2, and Gurbuz and Ismael 8 evaluated the effects of various levels of dietary dried peppermint on the performance and carcass traits of chickens. Al-Kassie and Witwit 3 and Narimani-Rad et al. 14 used several medicinal plants, including peppermint. Nanekarani et al. 13 added different concentrations of the ethanolic extract of peppermint to drinking water. Hernandez et al. 9 found that the chemical composition of the phytobiotic used in diet and the essential oil extraction method employed can affect the test results. Cross et al. 6 reported differences in body weights between chickens fed diets supplemented with essen-

Petri evi _imp_ok 07/04/21 10:09 Pagina 104

104

Effect of peppermint (Mentha piperita L.) in broiler chicken diet on production parameters, slaughter characteristics...

tial oils (rosemary and Breckland thyme (Thymus serpyllum). The hypothesis tested in this research was that peppermint contains a mixture of complex bioactive components that can improve the productive performance, health and gut microbial status of broilers, and that the use of certain concentrations of peppermint powder in broiler diet, as a simpler and more accessible method compared with the use of peppermint extract, can produce the expected effects. The aim of the study was to assess the effect of the dietary inclusion of different concentrations of dried peppermint leaf on the productive performance, carcass quality and intestinal microflora in broilers.

MATERIALS AND METHODS Experimental design and nutrition The study included 960 one-day mixed-sex Ross 308 broilers. The chickens were assigned to 4 treatments and were housed in 24 boxes, with 6 replicates per treatment. Twenty male and 20 female broilers were kept in 2 × 2 m cages (0.1 m2 per bird). Ambient temperature was 33 °C at placement, and decreased gradually from day 24 onwards to achieve 24 °C. In the first week, the lighting regime was set to 23 hours of light (L) and 1 hour of darkness (D); thereafter, it was below 18L:6D. During the experiment, broilers were fed ad libitum, and received complete corn and soya based mash diets (starter, grower and finisher) formulated according to hybrid producer’s recommendations and analyzed for their proximate composition in an accredited laboratory (Table 1). The diets contained different levels of supplemental peppermint powder: control group (C) - without peppermint, 02P - 0.2% peppermint, 04P - 0.4% pep-

Table 1 - Composition of basal diets. Ingredient, g/kg

Starter 0-10 d

Grower 11-24 d

Finisher 25-42 d

Corn

521.9

572.9

624.9

Soybean meal

320

260

207

Full fat soybean (extruded)

100

Vegetable oil

Limestone

Monocalcium phosphate

Salt

Production indicators The body weights and feed consumption of chickens were measured when changing feed (days 10 and 24) and at the end of the study (day 42). Average feed intake, average daily gain, mortality and feed conversion were determined. The European Production Efficiency Factor (EPEF) was calculated using the average body weight, vitality, feed conversion and fattening duration, according to the formula: EPEF = (Live weight, kg x Livability, % / Age of depletion, days x Feed Conversion Ratio, kg feed/kg gain) x 100.

Slaughter indicators At the end of the experiment, 1 male and 1 female chicken (12 chickens per treatment), whose body weight corresponded to the average body weight of the group, were selected from each box and slaughtered after 4 hours of starvation. Chickens were processed by hand, and cooled to 4 °C for 24 hours. After cooling, carcass weight and abdominal fat content were determined, and carcasses were dissected into major parts (breasts, thighs, drumsticks, wings) to obtain their weights. The liver, heart and stomach were weighed during carcass dressing.

Microbiological analysis of cecal contents The cecal contents of slaughtered broilers were placed in sterile bottles and taken to the laboratory as fast as possible. Proper dilutions of cecal contents were made in nutrient broth and within 1 hour plated under aseptic conditions on selected media. Total aerobic bacterial count was determined on plate count agar (PCA) (Torlak) after incubation at 30 °C for 72 hours under aerobic conditions. Total Escherichia coli count was determined on the modified UTI agar (UTI agar, Himedia) after incubation at 37 °C for 24 hours in an aerobic environment. MRS agar (Becton Dickinson) was used to determine the presence and total count of Lactobacilli at 37 °C for 72 hours under anaerobic conditions.

Vitamin + mineral premix

Statistical analysis

DL-methionine

0.1

The results obtained were analyzed using the GLMM (Generalized Linear Mixed Model) of the statistical software SAS (version 9.3 - SAS Inst. Inc., Cary, NC, USA). The significance of differences was assessed at the probability level p<0.05. Prior to the statistical processing of the data for the microbiological analysis of the cecum, their transformation was performed using the logarithmic function log10(x) and tested for normal distribution.

Nutrients (analyzed) and energy level (calculated)

permint, and 06P - 0.6% peppermint. Peppermint plants were grown and processed (dried and ground) by a local producer and were safe for human use. The particle diameter of peppermint powder was 1 mm. Standard proximal chemical analysis showed that peppermint powder contained 91.1% dry matter, 13.7% crude protein, 5.4% crude fat, 16.9% crude fiber and 9.1% ash.

ME, MJ/kg

12.7

13.1

13.4

Crude protein, %

22.2

20.3

18.1

Crude fat, %

6.25

7.36

7.52

Crude fiber, %

3.35

3.11

2.92

Lysine, %

1.25

1.01

0.96

Methionine, %

0.49

0.48

0.45

Ca, %

1.01

0.98

0.96

P, %

0.62

0.59

0.58

Contents per kilogram: vitamin A, 12000 IJ; vitamin D3, 5000 IJ; vitamin E, 50 mg; vitamin K3, 6 mg; thiamine, 3 mg; riboflavin, 9.4 mg; niacin, 5 mg; pantothenic acid, 10 mg; pyridoxine, 4 mg; folic acid, 1.5 mg; vitamin B12, 0.02 mg; biotin, 0.02 mg; choline, 400 mg; Mn, 100 mg; Fe, 30 mg; Zn, 100 mg; Cu, 8 mg; I, 0.5 mg; Se, 0.2 mg.

RESULTS AND DISCUSSION The effects of the peppermint supplementation of broiler diet on the productive performance of broilers are shown in Table 2. During the starter and grower periods, there were no significant differences in feed intake, average daily gain and feed

Petri evi _imp_ok 07/04/21 10:09 Pagina 105

Petričević Veselin et al. Large Animal Review 2021; 27: 103-107

conversion. In the third experimental period (25-42 days), the increase in dietary peppermint level gave higher values for average daily gain and feed conversion. The 06P chickens had a significantly (p<0.05) higher average daily gain compared with the C birds. Feed conversion was significantly (p<0.01) better in the 06P chickens than in the C and 02P broilers. Over the whole experimental period, increasing supplemental peppermint levels led to an increase in the average daily gain. This parameter was higher (p<0.01) in the 06P chickens than in the C ones. Feed conversion in 06P broilers was better (p<0.01) than in the C and 02P birds. Across groups, broilers showed no significant differences in mortality. As feed conversion and average daily gain were higher in the 06P and 04P chickens, significantly higher (p<0.01) EPEF values were determined compared with C broilers. The increase in peppermint levels in broiler diet increased the EPEF values. The research focused on the practical application of ground peppermint, as a simpler and cheaper way of using this plant compared with the purchase of its essential oil. The obtained results revealed beneficial effects of peppermint in broiler diet, as manifested by higher daily gains and better feed conversion. As the concentration of active ingredients in broiler feed increased, higher daily gains and better feed conversion were obtained. Narimani-Rad et al. 14 reported improvement in the performance and carcass quality of broilers receiving 0.5% peppermint in their diet containing a mixture of medicinal herbs. Antiseptic properties come from menthol, which prevents the growth of pathogenic bacteria in the digestive system while improving digestion and nutrient absorption16. The positive effects of peppermint supplementation on broiler performance were also recorded by Al Ankari et al.1, Arab Ameri Table 2 - Production performance of broilers receiving peppermint powder supplemented diets. C

02P

04P

06P

SEM

0.132

0.284

Starter period (1-10 d) FI, g/d

21.37

21.30

21.53

21.97

ADG, g/d

13.83

13.84

14.00

14.81

0.167

0.108

FCR, g/g

1.55

1.54

1.48

0.012

0.382

FI, g/d

74.82

76.06

74.67

76.76

0.391

0.175

ADG, g/d

44.44

45.65

44.81

45.85

0.397

0.573

FCR, g/g

1.68

1.67

1.68

0.011

0.959

140.36

0.760

0.192

Grower period (11-24 d)

Finisher period (25-42 d) FI, g/d

144.53 b

143.64 144.18 ab

ADG, g/d

68.60

69.34

FCR, g/g

2.10a

2.07a

FI, g/d

91.80

71.99

72.90

0.622

0.028

2.01ab

1.93b

0.019

0.001

91.01

0.295

0.696

Whole period (1-42 d)

91.90 bc

91.19 ab

ADG, g/d

47.51

48.23

49.12

50.06

0.246

0.000

FCR, g/g

1.93a

1.90a

1.87ab

1.82b

0.012

0.002

1.25

0.83

0.369

0.619

255.66bc 266.27ab 278.93a 3.223

0.001

Mortality, % EPEF

2.08 244.27c

C - without peppermint, 02P - 0.2% peppermint, 04P - 0.4% peppermint, and 06P - 0.6% peppermint. SEM - Standard error of the means; FI - Feed intake; ADG - Average daily gain; FCR - Feed conversion rate; a, b, c In a row, the least squares means with different superscripts differ significantly (p<0.05)

105

et al. 4, and Asadi et al. 5. In a study by Nanekarani et al. 13, the addition of 0.3% of ethanolic extract to drinking water improved the production characteristics of broilers and decreased the proportion of abdominal fat. In contrast, Hernandez et al. 9 found no significant differences in feed intake and feed conversion between broilers after dietary treatment with two herbal extracts. Also, Toghyani et al. 19 obtained no significant differences in the final body weight between broilers fed diets supplemented with 4% peppermint and control birds. In our study, mortality rate was higher in control chickens than in the other groups of broilers, but without significant differences. AlKassie 2 reported a significantly lower mortality rate in chickens receiving 0.5% peppermint in their diet compared with the control, which may be associated with the favorable effect of active ingredients of essential oils on the intestinal microbiota and the resulting stimulation of endogenous enzyme secretion and vitality of chickens. The results of slaughter traits of broiler chickens fed diets supplemented with different levels of peppermint are shown in Table 3. Dressing percentages, and the proportions of breast, drumsticks, thighs, wings, abdominal fat, heart, liver and stomach were not affected by the examined factor (p>0.05). The increase in the dietary level of peppermint had no significant effect on carcass quality parameters. These results are supported by the findings of Ocak et al. 15, who found no differences in the dressing percentages of broilers receiving 0.2% peppermint in their diet; Toghyani et al. 19, who reported no significance for the effect of peppermint supplementation on the proportion of carcass parts and organs; Hernandez et al. 9, who determined no significant effect on a mixture of herbal extracts on the weight of internal organs; and Khursheed et al. 11, who found no significant differences in the dressing percentage and the proportions of heart, stomach and liver between chickens fed diets supplemented with 0%, 1% and 2% peppermint. The effects of dietary peppermint powder on the microbiological composition of the cecum of broiler chickens are shown in Table 4. The total numbers of aerobic bacteria and Lactobacilli did not differ significantly between groups. Significant differences (p<0.05) were determined for the Escherichia coli count, which was higher in control birds than in the 04P and 06P broilers. The increase in peppermint level led to a gradual reduction in the number of Escherichia coli. In this study, the use of peppermint in the nutrition of broiler chickens was found to improve the ratio of beneficial to harmful bacteria in the cecum. A favorable microbiological status of the digestive tract results in better health and better nutrient digestibility. These results are consistent with Jamroz et al. 10 , who found a significant reduction in the number of Escherichia coli and an increase in the number of Lactobacilli in chickens fed diets supplemented with plant extracts. Giannenas et al. 7 reported an increase in lactic acid bacteria and a decrease in coliforms in the cecum of turkeys receiving a mixture of essential oils and thymols. The authors also determined a significant improvement in the antioxidant status of turkeys. Roofchaee et al. 17 obtained a decrease in the number of Escherichia coli, but no change in the count of Lactobacilli in the cecum of broilers fed broccoli-containing diets supplemented with oregano essential oil. Also, Kirkpinar et al. 12 recorded no differences in the number of Lactobacilli in chickens receiving a mixture of essential oils. Saki et al. 18 reported a significant decrease in Escherichia coli in broiler chickens given the essential oil of thyme in drinking water.

Petri evi _imp_ok 07/04/21 10:09 Pagina 106

106

Effect of peppermint (Mentha piperita L.) in broiler chicken diet on production parameters, slaughter characteristics...

Table 3 - Slaughter traits of broilers receiving peppermint powder supplemented diets. C

02P

04P

06P

SEM

Body weight (BW), g

2013.3

2055.8

2045.0

2079.2

36.21

0.939

Carcass weight (CW), % BW

67.74

67.42

67.50

67.76

0.204

0.918

Breasts, % CW

28.65

29.01

29.30

29.51

0.170

0.313

Drumsticks, % CW

15.11

15.27

14.83

15.15

0.107

0.537

Thighs, % CW

17.00

17.28

16.94

17.16

0.097

0.602

Wings, % CW

11.27

11.38

11.18

11.40

0.082

0.770

Abdominal fat, % CW

0.90

0.87

0.88

0.75

0.027

0.218

Organ weights, % BW Heart

0.51

0.53

0.52

0.51

0.008

0.872

Liver

1.73

1.72

1.74

1.78

0.028

0.870

Gizzard

1.91

1.87

1.92

1.95

0.022

0.599

C - without peppermint, 02P - 0.2% peppermint, 04P - 0.4% peppermint, and 06P - 0.6% peppermint. SEM - Standard error of the means.

Table 4 - Bacterial counts from the cecal content of broilers receiving peppermint powder supplemented diets. C

02P

04P

06P

SEM

The total number of aerobic bacteria 8.55

8.59

8.33

8.26

0.075

0.331

Escherichia coli

6.92a

6.83a

6.44ab

6.23b

0.091

0.019

Lactobacilli

7.33

7.50

7.46

7.60

0.047

0.244

C - without peppermint, 02P - 0.2% peppermint, 04P - 0.4% peppermint, and 06P - 0.6% peppermint. SEM - Standard error of the means. a-b In a row, the least squares means with different superscripts differ significantly (p<0.05)

CONCLUSIONS

The results of the present study indicated that the use of 0.6% of peppermint in broiler diet had a beneficial effect on average daily gain, feed conversion, EPEF value and cecal E. coli count, without affecting carcass quality.

Acknowledgments This work was supported by the Ministry of Education, Science and Technological Development of the Republic of Serbia, Contracts No. 451-03-68/2020-14/200022 and 451-0368/2020-14/200088.

Conflict of interest statement

The authors declare that there are no conflicts of interest. 10.

References 11. 1.

2. 3.

Al-Ankari A.S., Zaki M.M., Al-Sultan S.I. (2004). Use of habek mint (Mentha longifolio) in broiler chicken diets. Int. J. Poult. Sci. 3(10): 629634. Al-Kassie G.A.M. (2010). The role of peppermint (Mentha piperita) on performance in broiler diets. Agric. Biol. J. N. Am. 1(5): 1009-1013. Al-Kassie G.A.M., Witwit N.M. (2010). A comparative study on diet supplementation with a mixture of herbal plants and dandelion as a source of probiotics on the performance of broilers. Pak. J. Nutr. 9(1): 67-71. Arab Ameri S., Samadi F., Dastar B., Zarehdaran S. (2016). Efficiency of peppermint (Mentha piperita) powder on performance, body temperature and carcass characteristics of broiler chickens in heat stress condition. Iran. J. Appl. Anim. Sci. 6(4): 943-950.

12.

13.

Asadi N., Husseini S.D., Tohidian M.T., Abdali N., Mimandipoure A., Rafieian-Kopaei M., Bahmani M. (2017). Performance of broilers supplemented with peppermint (Mentha piperita L.) powder. EvidBased Complement Alt. Med. 22(4): 703-706. Cross D.E., Mcdevitt R.M., Hillman K., Acamovic T. (2007). The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. Br. Poult. Sci. 48(4): 496-506. Giannenas I., Papaneophytou C.P., Tsalie E., Pappas I., Triantafillou E., Tontis D. (2014). Dietary supplementation of benzoic acid and essential oil compounds affects buffering capacity of the feeds, performance of turkey poults and their antioxidant status, pH in the digestive tract, intestinal microbiota and morphology. Asian-Australas J Anim Sci. 27(2): 225-236. Gurbuz Y., Ismael A. (2016). Effect of peppermint and basil as feed additive on broiler performance and carcass characteristics. Iran. J. Appl. Anim. Sci. 6(1): 149-156. Hernandez F., Madrid J., Garcia V., Orengo J., Megias M.D. (2004). Influence of two plant extracts on broilers performance, digestibility and digestive organ size. Poult Sci. 83(2): 169-174. Jamroz D., Wiliczkiewicz A., Wertelecki T., Orda J., Skorupi ska J. (2005). Use of active substances of plant origin in chicken diets based on maize and locally grown cereals. Br. Poult. Sci. 46(4): 485-493. Khursheed A., Banday M.T., Khan A.A., Adil S., Ganai A.M., Sheikh I.U., Sofi A.H. (2017). Effect of mint leaves with or without enzyme supplementation on blood biochemistry, carcass characteristics and sensory attributes of broiler chicken. Adv. Anim. Vet. Sci. 5(11): 449455. Kirkpinar F., Ünlü H.B., Özdemir G. (2010). Effects of oregano and garlic essential oils on performance, carcase, organ and blood characteristics and intestinal microflora of broilers. Livest. Sci. 137(13): 219-225. Nanekarani S., Goodarzi M., Heidari M., Landy N. (2012). Efficiency of ethanolic extract of peppermint (Mentha piperita) as an antibiotic growth promoter substitution on performance, and carcass characteristics in broiler chickens. Asian Pac. J. Trop. Biomed. 2(3): 1611-1614.

Petri evi _imp_ok 07/04/21 10:09 Pagina 107

Petričević Veselin et al. Large Animal Review 2021; 27: 103-107 14. Narimani-Rad M., Nobakht A., Aghdam Shahryar H., Kamani J., Lotfi A. (2011). Influence of dietary supplemented medicinal plants mixture (Ziziphora, Oregano and Peppermint) on performance and carcass characterization of broiler chickens. J. Med. Plants Res. 5(23): 56265629. 15. Ocak N., Erener G., Burak F., Sungu M., Altop A., Ozmen A. (2008). Performance of broilers fed diets supplemented with dry peppermint (Mentha piperita) or thyme (Thymus vulgaris) leaves as growth promoter source. Czech J. Anim. Sci. 53(4): 169-175. 16. Pattnaik S., Subramanyam V.R., Bapaji M., Kole C.R. (1997). Antibacterial and antifungal activity of aromatic constituents of essential oils. Microbes, 89: 39-46. 17. Roofchaee A., Irani M., Ebrahimzadeh M.A., Akbari M.R. (2011). Effect of dietary oregano (Origanum vulgare L.) essential oil on growth

107

performance, cecal microflora and serum antioxidant activity of broiler chickens. Afr. J. Biotechnol. 10(32): 6177-6183. 18. Saki A.A., Kalantar M., Khoramabadi V. (2014). Effects of drinking thyme essence (Thymus vulgaris L.) on growth performance, immune response and intestinal selected bacterial population in broiler chickens. Poult. Sci. J. 2(2): 113-123. 19. Toghyani M., Toghyani M., Gheisari A.A., Ghalamkari G., Mohammadrezaei M. (2010). Growth performance, serum biochemistry, and blood hematology of broiler chicks fed different levels of black seed (Nigella sativa) and peppermint (Mentha piperita). Livest. Sci. 129(1-3): 173-178. 20. Windisch W., Schedle K., Plitzner C., Kroismayr A. (2008). Use of phytogenic products as feed additives for swine and poultry. Journal Animal Science 86(14 Suppl.): 140-148.

Petri evi _imp_ok 07/04/21 10:09 Pagina 108

Shivaraju imp_ok 07/04/21 10:11 Pagina 109

S. Shivaraju et al. Large Animal Review 2021; 27: 109-111

Impaction of the oesophagus in bovine and its surgical management in field condition A report of 4 cases

109

SHIVARAJU SHIVARAMU³*, DARSHAN KUMAR GOWDA KANCHAPPA THIPPESWAMY¹, SHIVAKUMAR MALAVALLI UMAPATHI¹, DIVYA MOHAN2, KALAISELVAN ELANGOVAN³, SWAPNA KUMAR MAITI³, ASWATHY GOPINATHAN³ ¹ Veterinary Officer, Government of Karnataka, India. ² Veterinary Surgeon, Government of Kerala, India. ³ Division of surgery, Indian veterinary research institute, India.

SUMMARY The main aim of this article was to discuss about the clinical signs and diagnosis of oesophageal obstruction in field conditions. In this case report it was observed animals exhibited clinical signs like protrusion of the tounge, ptyalism, free gas bloat, drooling of the saliva, distension of the paralumbar fossa. Diagnosis was mainly based on the history and clinical signs. After ruling out rabies attemepts were made to remove the obstruction by gentle massage and using probing, but it failed. Surgical intervention was done using sedation or local anaesthesia. Oesophagotomy was done to relieve the obstruction. The oesophagus was sutured in two layers followed by muscle and skin. Wound dehiscence was the only complication noted. All animals made uneventful recovery.

KEY WORDS Foreign body, choke, oesophagotomy, wound dehiscence.

INTRODUCTION Only a few diseases have been documented that cause oesophageal disorders in the bovine, the most common being foreign body obstruction. Anatomically, oesophagus comprises four layers that include the outer adventitial layer (tunica adventitia), muscular layers (tunica muscularis), submucosa (tela submucosa), and mucosal layer (tunica mucosa). The term choke (intraluminal obstruction) is generally used in references to an esophageal impaction (obstruction) that may be partial or complete. It usually occurs when foreign objects, large feedstuff, medicated boluses, trichobezoars, leather, coconut, cloth, palm kernel and unripened mango or esophageal granuloma lodge in the lumen of the oesophagus1-6. Objects lodged in the cervical oesophagus may be located via palpation. The common sites of obstruction in bovines include pharynx, cervical oesophagus, thoracic inlet, the base of heart and cardia7. It is an emergency surgical condition causing severe gaseous distention of the rumen resulting from the inability of the cow to eructate and release gas, which may be life-threatening if not treated timely8. The present paper reports surgical management of choke in two cows and 2 buffaloes under field conditions.

HISTORY AND CLINICAL SIGNS In the first case, a five-year-old female crossbred HolsteinFriesian that had swallowed a beetroot reported at farmer’s premises, with signs of drooling saliva with extended head and

Corresponding Author: S. Shivaraju (shivaraju558@gmail.com).

neck, free gas bloat and hard swelling in the cervical region. Attempts of local veterinarian failed to relive choke by aboral retrival by one hand and retrogade manipulation of choked material by another hand or pushing into rumen using probang under sedation. In the second case, a six year old female HF crossbred was showing frequent chewing movement with protrusion of the tongue, restlessness, stoppage of rumination and ptyalism after having feed from feed trough as reported by the owner on telephonic conversation. Physical examination revealed distension of left side paralumbar fossa and swelling on the neck region. In the 3rd case, female pluriparous buffalo of 6-7 years old presented to the nearby veterinary dispensary with the history of difficulty in swallowing, cud dropping, increased salivation with frequent coughing and retching. On palpation, a movable mass observed in the neck region next to trachea. A stomach tube was passed to identify the site of obstruction and to relive the choke if any. In the 4th case, a female buffalo heifer had a history of anorexia, depression and dysphagia along with the hard swelling on the mid-cervical region and dehydration with sunken eyeballs. Earlier it was symptomatically treated by the local paravet. The clinical examination revealed a hard immovable mass on the mid-cervical oesophagus having fibrous consistency. In all the four cases, rectal temperature, respiratory rate and pulse rates were within normal physiological range. After ruling out rabies, an oral examination performed to evaluate the pharynx and dental abnormalities. Manual efforts to dislodge the obstruction by gentle massage over the site and using probang failed in all presented cases. Based on history, clinical examination, palpation and familiarity of the cases to the author, it was decided to perform the surgical intervention.

Shivaraju imp_ok 07/04/21 10:11 Pagina 110

110

Impaction of the oesophagus in bovine and its surgical management in field condition - A report of 4 cases

SURGICAL MANAGEMENT

After confirmation of obstruction in the oesophagus and with owner’s prior verbal consent, all animals were restrained in right lateral recumbency. 2% lignocaine hydrochloride (40 ml) was infiltrated around the swelling to achieve local analgesia in 2 cows and 2 buffaloes were sedated by using xylazine hydrochloride 0.01 mg/kg b.wt., and local infiltration of 2% lignocaine done around the surgical site. The site was prepared for aseptic surgery. An 8 to 10 cm long longitudinal incision was made along the dorsal border of the jugular furrow between the sternocephalicus muscle and trachea, near to the level of obstruction. Then, 4 to 6 cm incision was made over the muscular coat of the oesophagus directly over the foreign body, on incision oesophagus separated into elastic inner layer (mucosa and submucosa) and the outer muscular layers and adventitia (Figure 1). After getting into lumen foreign bodies, beetroot, onion, rope and tarpaulin removed from case 1, 2, 3 and 4 respectively (Figure 2). After washing the lumen with metronidazole solution, the mucosal layer was sutured with simple interrupted sutures intraluminal knots and submucosa and muscularis were opposed with simple continuous pattern using chromic catgut. The muscles and skin were closed in a routine manner by using nonabsorbable suture.

POSTOPERATIVE CARE Postoperatively, tincture benzoin gauze was applied over the surgical wound and alternative day dressing done till complete healing. All animals were administered within ceftriaxone (25 mg/kg, IM) and meloxicam (5 mg/ml) and intravenous fluid (0.9% NS and RL) for 5 days. After that, a soft diet was advised and then roughages were introduced gradually from day 7th post-operatively. Sutures were removed after 10th day of surgery. Two cows and one buffalo had an uneventful recovery, one buffalo showed wound dehiscence, restoration to normal feeding was observed after 10 and 15 days of post-surgery respectively.

Figure 2 - Surgical removed foreign bodies A) Case 3, B) Case 4.

COMPLICATIONS One buffalo showed wound dehiscence at the surgical site (Figure 3). All animals were observed for esophageal stricture, no animals showed clinical signs of the same over the 15 months (Figure 4).

DISCUSSION

Figure 1 - Foreign body within oesophagus (Case 1, Beetroot).

Bovines are frequently affected by esophageal obstruction than other animals and this is attributable to their greedy nature and peculiar indiscriminate feeding habits9,15. Intraluminal obstruction of the oesophagus in ruminants is popularly referred to as choke, which may occur due to attempts to swallow vegetables, whole fruits, or foreign objects6,10. We found intraluminal blockade of the oesophagus by onion, beetroot (case 1 and 2) and rope (case 3), tarpaulin (case 4). Impaction of the oesophagus is a clinical emergency that needs prompt intervention because it prohibits eructation of fermentative gases to escape the rumen reticulum, and free-gas bloat develops. Radiography may be a useful tool to identify atypical cases of oesophageal obstruction, but in field condition, it is difficult to do the same. So clinical signs and physical examinations are vital for diagnosis. Acute severe bloat and ptyalism are the clas-

Shivaraju imp_ok 07/04/21 10:11 Pagina 111

S. Shivaraju et al. Large Animal Review 2021; 27: 109-111

Figure 3 - Wound dehiscence was observed in a buffalo (Case 4).

sical signs of complete esophageal obstruction in ruminants, but other less specific clinical signs occur with varying frequency9,15. Various conservative treatments have been described for the management of esophageal foreign bodies in ruminants. The objective is either to advance the object aborally so that it passes into the rumen or to manipulate the foreign body so that it can be extracted orally. Trocarization or stomach tube passing must be done to relieve bloat, before attempting to the removal of the causative agent9. Conservative trials are percutaneous massage, manual retrieval, regional administration of lignocaine (reduce the muscle contraction and facilitates the removal of foreign bodies)11. In the present study, such manipulative trials were failed and all suggestions were directed to correct the cases through surgical intervention. Although esophagatomy is well-established technique, Ruben (1997) reported the risk of postoperative complications like esophagatomy incisional dehiscence and fistula formation. According to Meagher and Mayhew, 1978, for successful outcomes, the timely intervention of choke cases by manipulative /surgically and post-operative care are the vitals. The preservation of blood supply, aseptic technique, apposition of tissues without tension is also essential for good results. In the present article, 3 cases (2 cows and 1 buffalo) were treated within 8 to 16 hours and 1 case after 36 hrs from the onset of clinical signs. Late presentation of case attributable to free gas bloat and inflammation, necrosis and rupture of oesophagus by pressure created by obstructing material14. The serosal covering is needed for forming a fibrin seal, lack of serosal layer and constant movement during swallowing may be responsible for wound dehiscence in one buffalo in our case report. More loss of saliva during choke leads dehydration and metabolic acidosis, which should be corrected pre and postoperatively by fluid therapy15.

111

Figure 4 - Recovered animal after 15 months of surgery (Case 2).

Conflict of Interest Authors declare that they have no conflict of interest.

Authors Contribution All the authors have contributed in terms of giving their technical knowledge to frame the article.

References 1.

2. 3.

4. 5. 6.

7. 8.

9. 10.

11. 12.

CONCLUSION

13.

It can be concluded that based on the history and clinical signs the oesophageal obstruction can be diagnosed in field condition. The timely intervention, surgical management and proper post operative care can give fruitful results.

14. 15.

Salunke V.M., Ali M.S., Bhokre A.P., Panchbhai V.S. (2003). Oesophagotomy in standing position. An easy approach to successful treatment of oesophageal obstruction in buffalo. A report of 18 cases. Intas Polivet, 4: 366-367. Madhava Rao., T., Bharti S., Raghavender K.B.P. (2009). Oesophageal obstruction in a buffalo: a case report. Intas Polivet, 10:1-3. Kamble M., Rant S.U., Fani F. (2010). Oesophageal obstruction due to accidental ingestion of cloth in a buffalo and its surgical management. Polivet. 11: 167-168. Hari Krishna N.V.V., Sreenu M., Bose V.S.C. (2011). An unusual case of ooeshophageal obstruction in a female buffalo. Buffalo bulletin.30. 4-9. Viswanatha B., Ranganath L., Mahesh V., Ramesh Rathod. (2012). Choke in a Cow- A Case Report. Vet. World. 5:40-41. Misk N.A., Ahmed F.A., Semieka M.A. (2004). A clinical study in esophageal obstruction in cattle and buffaloes. Egypt Vet Med Assoc. 64: 83-94. Tyagi R.P.S., Singh J. (1999). Ruminant Surgery. Ist Edn. CBS Publishers and Distributers, New Delhi, India. Pp- 192. Radostits O.M., Gay C.C., Blood D.C., Hinchcliff K.W. (2000). Veterinary Medicine: A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses, 9th Edition. London:WB Saunders, pp. 341-45, 193-97,182021. Smith B.P. Large Animal Internal Medicine. 4th ed. St. Louis, MO, USA: Mosby; 2008. pp. 804-805. Mahesh V., Manjunatha D.R., Ranganath L. (2010). Surgical management of cervical oesophageal obstruction in a crossbred cow. Intas Polivet. 11: 165-166. Patel J.H., Brace D.M. (1995). Esophageal obstruction due to a trichobezoar in a cow. Can Vet J 1995; 36: 774-775. Ruben J.M. (1997). Surgical removal of a foreign body from the bovine oesophagus. Vet. Rec. 100: 220. Meagher D.M., Mayhew I.G. (1978). The surgical treatment of upper oesophageal obstruction in the bovine. Canadian Vet. Journal, 19: 128-132. Ravikumar S.B., Arunkumar P., Madhusudan A. (2003). Oesophageal obstruction in a buffalo - a case report. Intas Polivet 2003; 4: 48-49. Fubini S.L., Ducharme N.G.(2004). Surgery of the calf gastrointestinal system. In: Fubini SL, Ducharme NG, editors. Farm Animal Surgery. St. Louis, MO, USA: Mosby: pp. 463-464.

Shivaraju imp_ok 07/04/21 10:11 Pagina 112

LAR

Large Animal Review

GUIDELINES FOR AUTHORS Official scientific journal of SIVAR

Large Animal Review is a bimonthly magazine published by SIVAR (Italian Society of Farm Animals Veterinary Practitioners) for scientific updating of veterinarians who deal with animals in livestock production and the supply chain control in the production of food industry. The topics of main interest for the journal are those of internal medicine, surgery, obstetrics, animal nutrition, zootechnics, infectious and parasitic diseases, food safety and security, animal welfare, prevention and management.

■

MANUSCRIPTS Large Animal Review publishes manuscripts in the form of reviews, original articles and case reports; manuscripts must comply with the guidelines below. Review - This is a complete coverage of a specific topic accompanied by a detailed and updated bibliography. Authors interested in writing a review should contact the editor of Large Animal Review. The text should not have more than 48.000 characters (including spaces) and not be accompanied by more than 15 figures or tables. Original Article - The papers published in Large Animal Review are short or full-length research articles related to the topic of the journal. The full text article should not exceed 32.000 characters (including spaces) and should not be accompanied by more than 10 figures or tables. Manuscripts in the form of short articles should not exceed 16.000 characters and no more than 4 figures or tables. Case Report - Single clinical or herd case report should be presented in Large Animal Review. The manuscript must not exceed 10.000 characters (including spaces) and no more than 4 figures or tables.

■

FORMAT All manuscripts (review, original articles and case reports) must have the following structure. Language - English or Italian. Title - The title of the manuscript has to be short and explicative and written on the front of the first page. Under the title, names of authors should be given indicating the surname and the name (e.g., Smith Tom). Institutional addresses are displayed below the author names; footnotes referring from author names to displayed addresses should be numbered. The full name, mailing address, phone number, and e-mail address of the corresponding author should appear directly below the affiliation lines on the title page. The corresponding author will be identified by a symbol footnote (e.g., Smith Tom*) and e-mail address below the affiliation lines on the first page of the published article (e.g., *Corresponding author: Smith Tom, University of …). Abstract - Abstract has to be placed on the second page of the manuscript and written in English. Abstracts should be limited from 300 to 500 words. The abstract disseminates scientific information through abstracting journals and is a convenience for readers. Exclude references, figure or table.

Key Words - After the abstract, list 3 to 5 key words have to be placed. In case of manuscripts written in Italian, the key words have also be translated into English. Body of the Paper - The manuscript of the original articles must show the following outline: introduction, materials and methods, results, discussion, conclusions, acknowledgments and bibliography. Regarding the reviews, the outline is not expected, but the topic must be clearly argued and divided in chapters. The text should be typed in Microsoft Word preferably, or OpenOffice or Rich Text Format, with lines and pages numbered consecutively, using Times New Roman font at 12 points. All margins should be at least 2 centimeters, single spacing and cannot exceed the number of characters (including spaces) indicated in the previous section for each type of manuscript. Tables and Figures - Tables, graphs and images must be included in the manuscript text and numbered (Arabic numerals). The titles or captions should describe concisely the data shown, sufficiently detailed and comprehensible to the reader. Tables and figures should be placed in separate sections at the end of the manuscript. References - The references must be selected by the authors (not more than 30, except in a review) and should be cited in the text with a serial number in round brackets and listed in the same numerical order in the bibliography. For articles from journals you should indicate: surname and first initial of the author and co-author/s names, year of publication, article title, abbreviated indication of the magazine (Index Medicus), volume number, number of first and last pages. For citations to articles or chapters contained in textbooks, you should indicate: surname and first initial of the Author and co-author/s names, year of publication, chapter’s title, book title, volume number (if more than one volume) editors, edition, first and last page of the chapter, publishing house and its location. Examples: – Journals - Galey F.D., Terra R., Walker R., Adaska J., Etchebarne M.A., Puschner B., Fisher E., Whitlock R.H., Rocke T., Willoughby D., Tor E. (2000). Type C botulism in dairy cattle from feed contamined with a dead cat. J Vet Diagn Invest, 12: 204-209. – Books - Gustafson D.P. (1986). Pseudorabies. In: Diseases of swine, Ed. Dunn H.W., 5th ed., 274-289, Iowa State University Press, Ames, IA. – Conferences - Barbano D. M. (1996). Mozzarella cheese yield: Factors to consider. Page 29 in Proc. Wisconsin Cheese Makers Mtg., Madison. Ctr. Dairy Res., Univ. Wisconsin, Madison.

■

SUBMISSION OF MANUSCRIPTS The manuscripts have to be submitted exclusively on the following link: www.largeanimalreview.com Informations: Dr. Enrico Fiore - Technical Editor largeanimalreview@sivarnet.it

- I TA L I A N A S S O C I AT I O N

FA R M A N I M A L P R A C T I T I O N E R S

Centro Studi EV - Cremona (I) - Tel. +39 0372 403539 - info@sivarnet.it - www.sivarnet.it

0A_Copert LAR 2_2021_ok 07/04/21 13:45 Pagina 4

02/21

0A_Copert LAR 2_2021_ok 07/04/21 13:45 Pagina 1