SAJCH Vol 9, No 1 (2015)

CHILD HEALTH THE SOUTH AFRICAN JOURNAL OF

January 2015

Volume 9

No. 1

• Neonate endotracheal tube positioning using bedside ultrasonography • Trends in perinatal health indices • Sleep duration and nutritional status in adolescents • Adherence to phototherapy guidelines in neonates • Diagnosis of Smith-Lemli-Opitz syndrome

CHILD HEALTH THE SOUTH AFRICAN JOURNAL OF

January 2015

Volume 9

No. 1

CONTENTS

EDITOR J M Pettifor FOUNDING EDITOR N P Khumalo EDITORIAL BOARD: SAJCH Prof. M Adhikari (University of KwaZulu-Natal, Durban) Prof. M Kruger (Stellenbosch University) Prof. H Rode (Red Cross Hospital, Cape Town) Prof. L Spitz (Emeritus Nuffield Professor of Paediatric Surgery, London) Prof. A Venter (University of the Free State, Bloemfontein) Dr T Westwood (Red Cross Hospital, Cape Town) Prof. D F Wittenberg (University of Pretoria)

Editorial

J M Pettifor

Research

HEALTH & MEDICAL PUBLISHING GROUP:

S H de Kock, S F Otto, G Joubert

CONSULTING EDITOR J P de V van Niekerk

2

Perinatal statistics – some good news

3 The feasibility of determining the position of an endotracheal tube in neonates by using bedside ultrasonography compared with chest radiographs

EDITOR-IN-CHIEF Janet Seggie

6 Ventriculostomy infections at the paediatric neurosurgical unit at Dr George Mukhari Academic Hospital

DEPUTY EDITOR Bridget Farham

SCIENTIFIC EDITOR Ingrid Nye

D P Motloba, M D Ngqandu

9 Trends in perinatal health indices in the Amajuba District, KwaZulu-Natal, South Africa, 1990 - 2012

TECHNICAL EDITORS Emma Buchanan Paula van der Bijl

F S Bondi, T I Runsewe-Abiodun

14

Prevalence and risk factors of anaemia in paediatric patients in South-East Nigeria

M D Ughasoro, I J Emodi, H U Okafor, B C Ibe

HEAD OF PUBLISHING Robert Arendse

18

Sleep duration and its effect on nutritional status in adolescents of Aligarh, India

N Faizi, Z Khan, A Amir, S A Azmi

PRODUCTION MANAGER Emma Jane Couzens

Short Report

ART DIRECTOR Brent Meder

NEWS EDITOR Chris Bateman

22 Adherence to phototherapy guidelines in term neonates: Study at a private tertiarylevel neonatal unit

DTP, LAYOUT & SETTING Carl Sampson

T Ekram, B Singh, D Kumar, S K Mittal, S Kumari

Case Reports

DISTRIBUTION MANAGER Edward Macdonald

G A E Solomon, G Jones, G de Jong, A D Marais

23

Biochemical and genetic diagnosis of Smith-Lemli-Opitz syndrome in South Africa

27 A case of disseminated Candida dubliniensis in a preterm infant: The importance of early detection and management of invasive fungal infections in neonates

C Crause

HEAD OF SALES AND MARKETING Diane Smith (012) 481 2069 | dianes@samedical.org ISSN 1994-3032 JOURNAL WEBSITE: www.sajch.org.za Printed by Creda Communications

30 Acute fulminant myocarditis complicated by complete atrioventricular block with favourable outcome in a resource-limited setting

Q Merchant, B S Hasan, S Akhtar

33

CPD Questions

ublished by Health and Medical Publishing Group, P 28 Main Road (Cnr Devonshire Hill Road), Rondebosch 7700 apers for publication should be addressed to the Editor, P via website: www.sajch.org.za Tel: (021) 681-7200 E-mail: publishing@hmpg.co.za Cover: 'Chameleons' by Everenchia, Red Cross Children's Hospital Primary School

©Copyright: Health and Medical Publishing Group (Pty) Ltd

Manuscripts containing plagiarism will not be considered for publication in the SAJCH. For information on our plagiarism policy, please visit the editorial policy section on our website. (http://www.sajch.org.za/index.php/ sajch/about/editorialPolicies)

EDITORIAL

Perinatal statistics – some good news Perinatal and maternal health statistics are used extensively as markers for the effectiveness of health service provision in a country. Because of their importance in this role, several of the rates were incorporated into the Millennium Development Goals (particularly Goals 4 and 5). In Minister Trevor Manuel’s forward to the Millennium Development Goals, Country Report 2013[1] compiled by Statistics South Africa (SA), he highlighted the lack of consensus on the actual levels of maternal mortality because of different data sources and methodology; however, he acknowledged that SA was lagging behind that particular target. The official 2010 figure was 269/100 000 live births, which is seven-fold greater than the 2015 goal of 38/100 000 live births. The report indicated that SA was unlikely to achieve its 2015 target for maternal deaths, but was likely to achieve the target of 100% of births being attended by skilled health personnel by 2015. According to Statistics SA, our infant mortality rate was 38/1 000 live births in 2010, with the 2015 target being 18/1 000 live births. Approximately 40% of our <5-year-old mortality is made up of neonatal deaths, therefore if SA is going to effectively reduce <5 mortality, it will have to substantially reduce its neonatal mortality rate.

In this issue of the SA Journal of Child Health (SAJCH), the changes in perinatal health statistics over a 22-year period in a rural area of KwaZulu-Natal have been meticulously documented.[2] The importance of the information contained in this research is that the data refer to a health region or district rather than a health facility, thus providing insights into the changing pattern of health indices within a community. What is clearly evident from the information provided is the role that HIV/AIDS and its management (or lack thereof) have played in determining the initial deterioration and subsequent improvement in the recorded health indices. What is pleasing to see is the progressive and maintained decline in all three indices of neonatal wellbeing since about 2004; neonatal mortality, stillbirth and perinatal mortality rates have declined but have only been below the 1990 rates since 2008. A similar pattern is observed in maternal mortality, although the yearly fluctuations are greater.

In general, the change in the statistics is a welcome trend, but one should not be complacent about a continued decline in mortality rates as there is a suggestion from the figures provided that the decline is plateauing off. It is likely that it will become more and more difficult to ensure continued falls in mortality unless there is an improvement in health professionals’ training in neonatology, an improvement in staffing in the maternity sections and an assurance that equipment is maintained.

Although the majority of the statistical trends are welcomed, there are several that might be of concern. Despite an improvement in the percentage of antenatal clinic registrations, some 15% of pregnant mothers did not attend a single antenatal clinic (ANC) before delivery, and only a third booked at an ANC before 20 weeks of gestation. Furthermore, there has been a fall in the percentage of clinic deliveries from 24% in 1990 to 6% in 2012, which reflects

2

SAJCH

an increase in the burden of deliveries that must be borne by the district hospital. As the authors indicate, this increase in mothers deliver­ing at the district hospital has been associated with an increase in the caesarean section rate, probably to the benefit of the child through a reduction in neonatal asphyxia and meconium aspiration.

However, the shift in deliveries from the health clinics to the district hospital must be associated with the appropriate increase in staff and equipment so as to prevent unattended deliveries and delays in obtaining caesarean sections, and to ensure appropriate ante- and postnatal care. It is hoped that the current article will stimulate other health regions to undertake similar studies so that more accurate and realistic perinatal health indices are obtained countrywide.

Audits such as the one referred to above are essential if we are to understand the effectiveness and value of our healthcare and of specific management protocols. Therefore, audits should be an integral part of all healthcare delivery. It is not surprising that we often forget that we are required to get appropriate ethical and health authority approval prior to submitting such research to journals for publication. The SAJCH, together with a number of other SA journals, formally agreed in 2012 to follow the recommendations of the International Committee of Medical Journal Editors (ICMJE), which in its detailed recommendations on article writing and publishing states: ‘The Methods section should include a statement indicating that the research was approved or exempted from the need for review by the responsible review committee (institutional or national). If no formal ethics committee is available, a statement indicating that the research was conducted according to the principles of the Declaration of Helsinki should be included.’[3] The SAJCH will only publish articles in which the authors make it clear that they have abided by the ICMJE recommendations. These recommendations only refer to scholarly work being submitted for publication and thus for possible inclusion in the public domain. Audits conducted within departments or hospitals for internal use only do not fall within these criteria.

J M Pettifor MB BCh, FCPaed (SA), PhD (Med), MASSAf Editor, South African Journal of Child Health References

1. Statistics South Africa. Millennium Development Goals, Country Report 2013.

Pretoria: Statistics South Africa, 2013. http://beta2.statssa.gov.za/wp-content/ uploads/2014/02/MDGR (accessed 25 January 2015).

2. Bondi FS, Runsewe-Abiodun TI. Trends in perinatal health indices in the Amajuba District, KwaZulu-Natal, South Africa, 1990 - 2012. S Afr J Child Health 2015;9(1):9-13. [http://dx.doi.org/10.7196/SAJCH.782] 3. The International Committee of Medical Journal Editors. Recommendations for the Conduct, Reporting, Editing, and Publication of Scholarly Works in Medical Journals. 2014. http://icmje.org (accessed 25 January 2015).

S Afr J CH 2015;9(1):2. DOI:10.7196/SAJCH.940

JANUARY 2015 Vol. 9 No. 1

RESEARCH

The feasibility of determining the position of an endotracheal tube in neonates by using bedside ultrasonography compared with chest radiographs S H de Kock,1 MB ChB, HED; S F Otto,1 MB ChB, MMed Rad (Diag), LLD, MPH; G Joubert,2 BA, MSc 1 2

Department of Clinical Imaging Sciences, Faculty of Health Sciences, University of the Free State, Bloemfontein, South Africa Department of Biostatistics, Faculty of Health Sciences, University of the Free State, Bloemfontein, South Africa

Corresponding author: S H de Kock (sharonhdekock@yahoo.com) Background. Neonates in our neonatal intensive care unit (NICU) receive a large amount of radiation with X-rays (XRs) being done daily, even more often with reintubation, repositioning of endotracheal tubes (ETTs) and confirmation thereof, which has been our NICU policy for many years.

Objective. To investigate the feasibility of determining the position of ETTs in neonates by using bedside ultrasonography (BUS), and to compare the results with those obtained from chest XR (CXR) findings.

Methods. A prospective, cross-sectional study was done on intubated neonates in the NICU at Universitas Academic Hospital, Bloem­ fontein, to determine the position of ETTs by using BUS. Results. Thirty intubated patients included in this study had a median age of 13.5 days and a median weight of 1.6 kg. Ninety-three per cent of ETT placements were considered optimal when visualised by BUS, while 73.3% were considered to be placed optimally when CXR was viewed. When CXR and BUS findings were compared regarding optimal placing, the agreement was poor (κ=0.10; 95% confidence interval –0.2 - 0.4). In four patients, the distance from the aortic arch to the tip of the ETT was outside the expected range of 1.5 - 2.2 cm: in two patients it was <1.5 cm (6.7%) and in the other two >2.25 cm (6.7%). BUS measurements were done mainly in extended head (53.3%) or neutral (36.7%) position.

Conclusion. Although poor agreement between CXR and BUS findings was obtained, possibly because of handling of patients with secondary shifting of ETTs, BUS was found not to be comparable with CXR, but an alternative feasible method to determine the optimal position of ETTs in the trachea in neonates when using other reference points, with the added advantage of no radiation exposure.

S Afr J CH 2015;9(1):3-5. DOI:10.7196/SAJCH.740

The current situation in our neonatal intensive care unit (NICU) at Universitas Academic Hospital, Bloemfontein, is that all neonates undergo a daily routine X-ray (XR) (either chest or abdominal, or both). Those neonates who are intubated are X-rayed more often, for example, with reintubation, repositioning of endotracheal tubes (ETTs) or when deterioration of their condition is noted. This has been our NICU policy for many years. Consequently, neonates are exposed to high levels of radiation, which should be reduced where possible.

A literature search suggested that a study to determine the position of an ETT using bedside ultrasonography (BUS) would be feasible and possible. Several studies have confirmed that BUS can accurately determine the placing of ETTs in a paediatric ICU setting.[1-3] Ultrasound (US) and chest radiography agreed on ETT placement in 83% of cases, with US having a sensitivity of 91% and a specificity of 50%.[4] Hosseini et al.[5] used right subcostal US with good results to evaluate diaphragmatic motion for secondary confirmation of ETT position. The overall accuracy of BUS was 98.1% (95% confidence interval (CI) 93.0 - 100%).[5] A kappa of 0.85 indicated a very good agreement between the bedside upper airway ultrasonography and waveform capnography.[6] In a Cochrane review, Schmölzer et al.[7] compared techniques to ascertain correct ETT placement in neonates, including US, but found insufficient evidence to determine the most effective technique.

3

SAJCH

Having a US machine readily available in our NICU, we considered it appropriate to optimise available resources in order to expedite service delivery efficiently with a quicker examination that clinicians could do themselves, with real-time alterations and confirmation of ETT positioning. Therefore, the objective of the study was to investigate the feasibility of determining the position of ETTs in neonates by using BUS, and to compare the results with those obtained from chest XR (CXR) findings.

Methods

A prospective, cross-sectional study was done on intubated neonates in the NICU at Universitas Academic Hospital, Bloemfontein, over a 3-month period, to determine the position of ETTs by using BUS. The procedure and purpose of the investigation were discussed with patients’ mothers or caregivers, from whom written consent was obtained. An information document regarding the study and contact details of the researcher was supplied.

Exclusion criteria included patients whose mothers did not give consent and patients with whom the medical team was actively busy with resuscitation and intervention.

At approximately 6 o’clock every morning, each patient in the NICU undergoes a routine CXR, done by radiographers on night duty. For this particular study, intubated patients received an additional US conducted by the first author, a radiology registrar, after radiographers had completed routine XRs in the NICU. This

JANUARY 2015 Vol. 9 No. 1

RESEARCH approach contributed to the time delay between the two methods of examination.

A Toshiba (Japan) Nemio XG US machine with a small curvilinear probe (6 MHz) was used to determine the position of the ETT by BUS. Sagittal and axial images were obtained.

During a pilot study on five neonates, before official data collection commenced, it was determined that the ETT could be visualised well with BUS, although BUS could not determine the exact level of the tip of the ETT according to the thoracic vertebrae, as was the case with CXR. Keeping this in mind, it was decided to apply relevant surface anatomy. Anatomically, the thyroid lies anterior and lateral to the most proximal part of the trachea at the C6/7 vertebral level. [8] The aortic arch begins and ends at the manubriosternal junction at the T4/5 level. [8] The bifurcation of the trachea in neonates is at the T3 - T5 level. In ~85% of neonates, the tracheal bifurcation occurs at T4 level. [9] The ideal position of an ETT in a neonate with the head in neutral position is at the T1/2 level,[9,10] and when applying surface anatomy, inferior to the level of the thyroid and superior to the aortic arch.

The patients included in this study were mainly premature babies with low birth weight (LBW). The mean thoracic vertebral body height was 5 mm, and the mean intervertebral disk height was 2.5 mm, giving a distance of ~7.5 mm from the inferior end of one thoracic vertebra to the inferior end of the next. Optimal measured distances from the aortic arch to the tip of the ETT (as obtained by BUS) correlated with distances of 1.5 - 2.25 cm (T1/2 level) in our patient population.

Two data forms, A and B, were used to capture information on each patient.

The reference points noted above were used by the first author on Form A to record the position of the ETT. The correct patient information was noted at the top of both forms, also by the first author, who handed Form B to an independent ‘blind’ radiologist, who assessed the early morning 06h00 CXR and noted the position of the ETTs on Form B. Statistical analysis of data was done by the Department of Biostatistics, University of the Free State. Results were summarised by frequencies and percentages (categorical variables) and medians (numerical variables, owing to skew distributions).

Before commencement of the study, ethical approval was obtained from the Ethics Committee, Faculty of Health Sciences, University of the Free State.

Permission to conduct the study was also obtained from the Clinical Head of the Universitas Academic Hospital in

Bloemfontein. Written parental consent was obtained for every participant.

Results

The 30 patients included in this study had a median age of 13.5 (range 2 - 38) days, and a median weight of 1.6 (1.2 - 3.1) kg.

A median delay of 48 minutes between CXR and BUS occured. Table 1 outlines the positions of ETTs according to the early morning CXR, showing the exact position/level of the ETTs in relation to the vertebral bodies. As shown, 73.3% of ETTs were considered to be placed optimally when CXR was viewed, with optimal being defined by the radiologist as being between C7/T1 disk space and T2/3 disk space.

Table 2 outlines the position of the ETTs as observed with BUS and the patient’s head position during BUS. According to BUS findings, 93.3% of ETTs were placed optimally, which was defined (objectively) as being at the lower level of the thyroid or just below the thyroid.

Table 3 compares CXR and BUS findings regarding optimal placing. The agreement between these findings was poor (κ=0.10; 95% CI –0.2 - 0.4).

Table 4 shows the measured distances from the aortic arch to the tip of the Table 1. ETT position as found on CXR (N=30) n (%) 8 (26.7)

T1

3 (10.0)

T1/2

5 (16.7)

T2

4 (13.3)

T2/3

3 (10.0)

T3

5 (16.7)

T3/4

2 (6.7) 22 (73.3)

Not optimal

8 (26.7)

ETTs in all the patients included in this study could be visualised very well using BUS, which was found feasible and easy to use when applying relevant surface anatomy to determine the optimal position. It can also be used in real time during intubation, without the risk of radiation exposure.

If the position of ETT according to BUS and clinical evaluation is unsatisfactory,

n (%) ETT level At thyroid level

17 (56.7)

Below thyroid level

13 (43.3)

Head position Extension

16 (53.3)

Neutral

11 (36.7)

Flexion

3 (10.0)

ETT positioning

ETT positioning Optimal

Discussion

Table 2. ETT position observed with BUS and patient’s head position during BUS (N=30)

ETT level Above T1

ETT as obtained by BUS. The thoracic vertebral body height of our specific patient population, including the intervertebral disk space, was ~7.5 mm. The estimated distance from T4 (level of aortic arch) to T2 was 1.5 cm, and 2.25 cm from T4 to T1.

Ideally, the tip of the ETT should be ~1.5 2.25 cm from the level of the aortic arch (at T1/T2 level). In two (6.7%) patients, the measurements were <1.5 cm (T3 level) and in another two (6.7%), it was >2.25 cm (C7 level).

Fig. 1 shows a saggital US image in the midline of the neck of an intubated neonate, illustrating ETT and approximate distance to the tip from the aortic arch. Fig. 2 shows an axial US image in the midline of the neck of an intubated neonate, illustrating ETT and thyroid gland anterolateral to the trachea.

Optimal

28 (93.3)

Not optimal

2 (6.7)

Table 3. Comparison of CXR and BUS findings with regard to optimal ETT positioning (N=30) On CXR, n (%) Optimal

Not optimal

Total

ETT position Optimal

21 (70.0)

7 (23.3)

28 (93.3)

Not optimal

1 (3.3)

1 (3.3)

2 (6.7)

22 (73.3)

8 (26.7)

30 (100)

On BUS Total

4

SAJCH

JANUARY 2015 Vol. 9 No. 1

RESEARCH Table 4. Distances from the aortic arch to the tip of the ETT, as observed by means of BUS (N=30) Distance (cm)

n (%)

1.3

1 (3.3)

1.4

1 (3.3)

1.5

1 (3.3)

1.6

1 (3.3)

1.7

1 (3.3)

1.8

7 (23.3)

1.9

2 (6.7)

2.0

4 (13.3)

2.1

7 (23.3)

2.2

3 (10.0)

2.3

2 (6.7)

alterations can be made immediately in real time and confirmed by using BUS, making the procedure time- and cost-effective.

Repositioning of ETTs by handling the babies or altering their head positions from flexion (most CXR head positions) to extension was most likely the main reason why BUS and CXR findings were not comparable.[11] Because small babies have short necks and a relatively small acoustic window in which to do BUS, head position should at least be neutral, although extension is the ideal position to visualise ETTs with BUS. Another possible reason for poor correlation between CXR and BUS was because the head positions of participants were not standardised or recorded when CXRs were performed for this study, a limitation which was not anticipated before the study commenced.

As noted in the Methods, ETTs should be above the arch of the aorta, and below or at the lower level of the thyroid to be correctly in position. Both of these reference points can be observed easily and very well with BUS. These reference points stay constant for every baby independent of weight or size.

Study limitations

Fig. 1. Saggital US image in the midline of the neck of an intubated neonate illustrating ETT and approximate distance to the tip from the aortic arch.

Possible measurement errors included repositioning of the ETT during the interval between the CXR and BUS examinations. An ETT can move up to 3.1 mm with neck flexion and up to 7.4 mm with extension in LBW infants,[11] the latter being the ideal position for BUS to visualise the ETT optimally.

Conclusion

Fig. 2. Axial US image in the midline of the neck of an intubated neonate illustrating ETT and thyroid gland anterolateral to the trachea.

Although anatomical reference points for BUS and CXR determination of ETT position­ing are not comparable, BUS was found to be an easy, feasible alternative method to determine the optimal position of ETTs in the trachea of neonates when using relevant surface anatomical reference points. It can also be particularly useful in limiting radiation exposure of neonates.

More refinement of this method is needed; doctors attending to this patient population would need to be trained to use the technique themselves and to gain experience and

5

SAJCH

JANUARY 2015 Vol. 9 No. 1

confidence in performing the procedure, which is a method worth­while exploring.

Acknowledgements. We would like to thank Dr W Harmse, diagnostic radiologist, for interpretation of CXRs, and Dr D Struwig, medical writer, Faculty of Health Sciences, University of the Free State, for technical and editorial preparation of the manuscript.

References 1. Hsieh KS, Lee CL, Lin CC, Hwang TC, Weng KP, Lu WH. Secondary confirmation of endotracheal tube position by ultrasound image. Crit Care Med 2004;32(9 Suppl):S374-S377. [http://dx.doi. org/10.1097/01.CCM.0000134354.20449.B2] 2. Galicinao J, Bush AJ, Godambe SA. Use of bedside ultrasonography for endotracheal tube placement in pediatric patients.

Pediatrics 2007;120(6):1297-1303. [http:// dx.doi. org/10.1542/peds.2006-2959] 3. Dennington D, Vali P, Finer NN, Kim JH. Ultrasound confirmation of endotracheal tube position in neonates. Neonatology 2012;102(3):185189. [http://dx.doi.org/10.1159/000338585] 4. Kerrey BT, Geis GL, Quinn AM, Hornung RW, Ruddy RM. A prospective comparison of diaphragmatic ultrasound and chest radiography to determine endotracheal tube position in pediatric emergency department.

Pediatrics 2009;123(6):e1039-1044. [http:// dx.doi. org/10.1542/ peds.2008-2828] 5. Hosseini JS, Talebian MT, Ghafari MH, Eslami V. Secondary confirmation of endotracheal tube position by diaphragm motion in right subcostal ultrasound view. Int J Crit Illn Inj Sci 2013;3(2):113117. [http://dx.doi.org/10.4103/2229-5151.114269] 6. Adi O, Chuan TW, Rishya M. A feasibility study on bedside upper airway ultrasonography compared to waveform capnography for verifying endotracheal tube location after intubation. Crit Ultrasound J 2013;5(1):7. [http://dx.doi.org/10.1186/2036-79025-7] 7. Schmölzer GM, Roehr CC. Techniques to ascertain correct endotracheal tube placement in neonates.

Cochrane Database Syst Rev 2014;9:CD010221. [http://dx.doi.org/10.1002/14651858.CD010221. pub2] 8. Butler P, Mitchell AWM, Heally JC. Applied Radiological Anatomy. 2nd ed. Cambridge: Cambridge University Press, 2006:2-4.

9. Blayney MP, Logan DR. First thoracic vertebral body as reference for endotracheal tube placement. Arch Dis Child Fetal Neonatal Ed 1994;71(1):F32-F35. [http://dx.doi.org/10.1136/fn.71.1.F32] 10. Thayyil S, Nagakumar P, Gowers H, Sinha A. Optimal endotracheal tube tip position in extremely premature infants. Am J Perinato 2008;25(1):13-16. [http://dx.doi.org/10.1055/s-2007-995221] 11. Rost JR, Frush DP, Auten RL. The effects of neck position on endotracheal tube location in low birth weight infants. Pediatr Pulmonol 1999;27(3):199-202. [http://dx.doi.org/10.1002/ (SICI)1099-0496(199903)27:3%3C199::AIDPPUL8%3E3.0.CO;2-O]

RESEARCH

Ventriculostomy infections at the paediatric neurosurgical unit at Dr George Mukhari Academic Hospital D P Motloba,1 BDS, MDent (Comm Dent), MPH (Epidemiology), MBL; M D Ngqandu,2 MB ChB, MMed (Neurosurgery) 1 2

Department of Community Dentistry, University of Limpopo, Medunsa Campus, Pretoria, South Africa Department of Neurosurgery, University of Limpopo, Medunsa Campus, Pretoria, South Africa

Corresponding author: D P Motloba (pagollangmotloba@hotmail.com)

Background. External ventricular drains (EVDs) are essential to the clinical management and care of patients with neurosurgical complica­ tions, but EVD use is routinely associated with concomitant infection, sometimes resulting in mortality.

Objective. To undertake an epidemiological study of ventriculostomy-related infections among paediatric neurosurgical patients at the Dr George Mukhari Academic Hospital, Pretoria, South Africa.

Methods. Retrospective analysis was conducted on the clinical records of 92 children admitted to the neurosurgical unit at the hospital between 2010 and 2013. Records were included in the study only if they were complete, legible and accurate. Data were collected on the following variables: age, gender, frequency of catheter change, cerebrospinal fluid (CSF) sampling, use of prophylaxis, microbiology, Glasgow Coma Scale, glucose, chlorine, and other clinical, chemical and laboratory parameters routinely observed as part of patients’ work-ups.

Results. Two or more EVDs were placed on 45.7% (40) children, with a maximum of seven EVDs per child. Ventriculitis incidence was 28.3% (26 of 92). There was a significant association between the number of EVDs inserted and the incidence of ventriculitis (p=0.010).

More frequent CSF sampling also increased ventricular-related infections (p=0.000), as did prolonged EVD retention (p=0.001). Using prophylactic antibiotics or impregnated catheters did not reduce ventriculitis incidence significantly.

Conclusion. Evidence supports adherence to strict sterilisation protocols and techniques when inserting EVDs. Catheters should not be retained for extended periods, and CSF sampling can be limited to once in 3 days. Routine use of antibiotic-impregnated EVDs and antistaphylococcal prophylaxis is still recommended.

S Afr J CH 2015;9(1):6-8. DOI:10.7196/SAJCH.767

External ventricular drains (EVDs) are regarded as an essential part of the armamentarium available to divert pathological and excess cerebrospinal fluid (CSF) from the ventricles to the exterior in a variety of neurosurgical conditions. Despite their proven success and efficiency, EVDs have been associated with increased incidence of ventriculitis.

Ventriculitis forms part of a wide clinical spectrum that includes ventricle-associated infection and ventriculostomy colonisation as part of the same disease phenomenon. A lack of consensus about the exact definition of ventricular infections accounts for a wide range in the incidence of ventriculitis reported (0 - 45%), possibly due to misclassification bias.[1,2] The literature is inconsistent about the determinants of ventriculitis, especially in paediatric patients, on whom data are relatively scarce.

Most studies associate increased incidence of EVD-related infections with lack of sterility, catheter duration, number of EVDs used, cathetertype EVDs, lack of prophylactic antibiotic use, colonisation and systemic infection.[3] Gram-negative pathogens are largely implicated, more so than Gram-positive pathogens, and coagulase-negative Staphylococcus spp. are the most frequently reported colonising bacteria. Thus far, there is no consensus on the effectiveness of using antibiotic-impregnated catheters and prophylaxis to reduce infections.

Against this background, we conducted this research at the paediatric neurosurgery unit of the Dr George Mukhari Academic Hospital at the Medunsa Campus of the University of Limpopo, Pretoria, South Africa (SA), to estimate the incidence of ventriculitis in this unit; no prior study of this nature had been done (in general, similar studies in paediatric populations are limited, particularly in SA). The specific research objectives of the study included exploring 6

the distribution and determinants of ventriculitis, and estimating associations with some clinical and demographic indicators.

Methods

A descriptive survey of clinical records was selected as the study design, because it is appropriate and convenient for this setting and purpose. Data were collected retrospectively from the records of patients admitted to the paediatric neurosurgical unit at the hospital between January 2010 and December 2013, who had had an EVD inserted as part of their treatment, and if all records were accurate, legible and complete. Patients were excluded from the study if they were older than 12 years. Information was sourced from the hospital’s clinical records, specifically from theatre records and the neurosurgical unit, and the National Health Laboratory Service.

Data were collected on each patient’s age, gender, type of EVD, number of EVD changes, duration for which the EVD was in situ, the frequency of CSF sampling, prophylactic antibiotic use and outcome.

For the purposes of our study, ventriculitis was defined as a positive culture (based on a CSF sample or a sample from the tip of the catheter), together with a systemic manifestation of infection, such as fever and/or high C-reactive protein.

Statistical analysis

Biostatistical analysis was conducted using SPSS version 22 (IBM, USA). Hypothesis testing was done to establish any association between the incidence of ventriculitis and the descriptive variables, by using Pearson’s χ2 test for categorical variables and Student’s t-test for continuous variables. The p-values associated with the tests were considered significant at p<0.05.

SAJCH JANUARY 2015 Vol. 9 No. 1

RESEARCH Ethical approval

This study was reviewed and approved by the Medunsa Research Ethics Committee (MREC/M/291/2012: PG).

Table 1. Demographic characteristics and association with incidence of ventriculitis

Results

Ventriculitis (n=26), n (%)

No ventriculitis (n=66), n (%) p-value

Gender

Over the review period of 3 years, 92 patients had EVDs inserted during hospitalisation.

Of the 92 patients, 26 (28.3%) developed ventriculitis. A further seven cases showed bacteriological growth on CSF culture, but were considered to be colonised or contaminated on additional clinical grounds.

0.790

Male

44 (47.8)

13

31

Female

48 (52.2)

13

35

21 (22.8)

9

12

Clinical outcome Died

Patient demographics

The results reflected no gender predisposition to develop ventriculitis in this population (p=0.79). However, we found a significant negative association between age and ventriculitis (p=0.007): as age increased, the incidence of ventriculitis decreased. Clinical outcomes were reported on 78 children, of whom 21 (22.8%) died, and 22 (23.9%) recovered fully. Notably, children who developed ventriculitis were 1.6 times more likely to die than to recover, but this finding was not statistically significant (p=0.45) (Table 1).

Improved

22 (23.9)

7

15

Unchanged

35 (38.0)

6

29

Unreported

14 (15.2)

-

-

>1 year

38 (41.3)

5 (19.2)

33 (50.0)

Median, years (Q1; Q3)

1 (1; 2)

0.65 (0.3; 1.0)

1.3 (0.4; 4.25)

Age

0.450 0.110* 0.007

*Between those who died and unchanged.

Table 2. Association between EVD characteristics and ventriculitis

Attributes of EVDs and incidence of ventriculitis

Children who developed ventriculitis had two times more EVDs inserted than non-cases; the difference was significant (p=0.01). Increased frequency of CSF collection significantly in­ creased the incidence of ventriculitis (p=0.00).

Increased length of time for which EVDs were kept in situ also significantly increased the inci­ dence of ventriculitis (p=0.001). The length of time for which EVDs were in situ was five times as long in those who developed ventriculitis as in those who did not (Table 2).

Variable

All patients (N=92), mean (SD)

Ventriculitis (n=26), mean (SD)

No ventriculitis (n=66), mean (SD) p-value

EVDs inserted

1.80 (1.34)

2.54 (1.77)

1.52 (1.01)

0.010

CSF samples collected

3.65 (4.08)

6.77 (5.42)

2.49 (2.57)

0.000

Cumulative period EVD in situ (days)

17.47 (31.40)

42.31 (45.43)

7.88 (14.68)

0.001

Table 3. Prophylaxis, antibiotic-impregnated catheters and ventriculitis Ventriculitis No ventriculitis (n=26), n (n=66), n

Variable Type of EVD inserted

Antibiotic use and ventriculostomy infection

Prophylactic antibiotic cover and catheter types were used based on availability.

With this pattern of use, it was found that prophylactic antibiotic cover did not reduce the risk of infection. Similarly, the incidence of ventriculitis remained similar between groups of children for whom antibioticimpregnated catheters were used (42%) v. groups of children for whom standard, plain EVDs were used (37.5%). However, the results were not statistically significant (Table 3).

Of the samples processed, 26.1% (24 of 92) revealed bacterial growth, characterised by slightly more Gram-negative microorganisms.

Coagulase-negative Staphylococcus, which is commonly regarded as a contaminant, was isolated in 43.5% (10 of 24) of the samples, Pseudomonas aeruginosa was found in 21.7%, and Klebsiella pneumoniae in 17.4% (Table 4). The risk of developing ventriculitis was three times higher from Gram-negative

All patients (N=92), n (%)

Variable

0.790

Antibiotic impregnated

15

40

Plain

11

26

Yes

19

42

No

7

24

Prophylactic antibiotic cover

organisms than from Gram-positives, which supports the assertion that Gram-negative microorganisms are primary causative agents in ventriculitis (p=0.008) (Table 5).

Discussion

The incidence of ventriculitis in our study was 28.3%, higher than the results reported in prior studies, namely 6.65%,[3] 0 - 22%,[4] and 23.3%.[5] This variance in infection rates may be attributed to the lack of a uniform definition of ventriculitis, which renders comparison of findings difficult.[1] In our study, a stringent definition of ventriculitis (incorporating positive cultures, CSF pleocytosis and clinical symptoms) was applied in order to reduce the possibility of misclassification.[6] 7

SAJCH

JANUARY 2015 Vol. 9 No. 1

p-value

0.390

Our finding that gender was not correlated with ventriculitis supports the results reported by Kim et al.[6] and Lyke et al.,[7] but is contrary to the findings of Lo et al.[8] and Arabi et al.,[9] who found that more female than male patients developed ventriculitis.

While gender as a risk factor for disease is well-established in older cohorts, we did not find that gender-related variations mediated or played a role in infection in children.

Because most studies focus on adults, it is difficult to show any relationship be­ tween ventriculitis and age. However, our results were based on a paediatric population, and they revealed a significant negative association between age and ventriculitis. So far, very few studies support our findings that there is a

RESEARCH Study limitations

Pseudomonas aeruginosa

5 (21.7)

–

A retrospective study design and the small sample size could have a negative effect on the validity and generalisation of the results.

Other limitations are the lack of data on the patients’ HIV status and indications for antibiotic cover. Despite these limitations, this study provides credible contribution to the existing body of knowledge.

Klebsiella pneumoniae

4 (17.4)

–

Acinetobacter baumannii

2 (8.7)

–

Conclusion

Streptococcus salivarius

1 (4.3)

+

Stenotrophomonas maltophilia

1 (4.3)

–

Table 4. Common causative organisms in ventriculitis Causative microorganism

n (%)

Gram stain

Coagulase-negative Staphylococcus

10 (43.5)

+

Table 5. Bacterial gram staining and ventriculitis Variable

Ventriculitis (n=26), n

No ventriculitis (n=66), n

Bacterial staining

p-value 0.008*

Gram-negative

12

1

Gram-positive

4

7

No growth

16

58

We conclude that prolonged retention of EVDs, increased frequency of EVD changes and increased CSF sampling increase the incidence of infection. The use of prophylactic antibiotics and antibioticimpregnated catheters may reduce the occurrence of ventriculitis, although the evidence is not significant.

We recommend that catheters be retained for maximum 5 days, that CSF sampling be limited to once every 3 days unless dictated by clinical circumstances, and that strict sterilisation protocols and thorough aseptic techniques be adhered to during insertion EVD insertion. In addition, antibiotic-impregnated EVDs should be used and antistaphylococcal prophylaxis should be administered with EVD insertion.

References

*Fisher’s exact test was used.

significant age-related risk and susceptibility to the development of ventri­ culostomy-related infections.[10,11] This strong association emphasises the need to institute stringent clinical and preventative measures among the youngest children, who face an increased risk of infection.

The statistically significant association between how long EVDs are kept in situ and the onset of ventriculitis is similar to the findings of other studies.[9,11,12] Specific evidence reported in the literature suggests that the risk of infection increases when EVDs are retained for more than 5 days,[11] 7 days[9] and 10 days.[13] Our results indicated that multiple catheterisation or frequent EVD changes are associated with high infection rates; similar outcomes are reported in several other studies.[14,15] However, in contrast, some authors assert that multiple EVD replacements are not a significant independent risk factor for ventriculitis.[13,15] CSF sampling poses a risk of infection: Korinek et al.[16] and Hoefnagel et al.[10] have demonstrated that serial collection of CSF tended to predispose patients to ventriculitis. Our findings support such an association, because more than twice the number of CSF samples were collected from those who developed ventriculitis than from those who did not, and the difference was statistically significant. Collectively and individually, multiple CSF sampling and catheterisation contributed to an increased risk of bacterial contamination and colonisation. Concomitantly, prolonged retention of EVDs promotes microbiological shift, bacterial succession and increased virulence the longer the EVD remains in place. This may explain the increased incidence of ventriculitis associated with these factors.

Debate continues about the efficacy of antibiotic-impregnated catheters in reducing EVD-related infection.[16] Pooled metaanalyses confirm the positive affect of antibiotics in reducing ventriculitis. [16,17] Our findings (p=0.797) in this regard showed insignificant differences and therefore support similar reports of no association.[18] However, failure to demonstrate this relationship may be attributed to the small sample size, and the less robust, retrospective, cross-sectional study design.

In line with our findings, microorganisms derived from the CSF or catheters were predominately Gram-negative. Coagulase-negative Staphylococcus is commonly introduced by EVD insertion, because it is predominantly skin commensal.[16] 8

SAJCH

1. Kim DK, Uttley D, Bell BA, Marsh HT, Moore AJ. Comparison of rates of infection of two methods of emergency ventricular drainage. J Neurol Neurosurg Psychiatry 1995;58(4):444-446.

2. Dasic D, Hanna SJ, Bojanic S, Kerr RS. External ventricular drain infection: The effect of a strict protocol on infection rates and a review of the literature. Br J Neurosurg 2006;20(5):296-300. [http://dx.doi. org/10.1080/02688690600999901] 3. Lozier AP, Sciacca RR, Romagnoli MF, Connolly, ES Jr. Ventriculostomy-related infections: A critical review of the literature. Neurosurgery 2002;51(1):170-181. [http://dx.doi.org/10.1097/00006123-200207000-00024] 4. Lee JH, Cha SH, Lee J, et al. Ventriculostomy-related infections in the neurosurgical intensive care unit: The risk factors and the outcomes. Korean J Crit Care Med 2011;26(4):208-211. [http://dx.doi.org/10.4266/kjccm.2011.26.4.208] 5. Strojnik T, Golc J, Zakelšek J. Infections of external ventricular drainages. Cent Eur J Med 2013;8(2):250-256. [http://dx.doi.org/10.2478/s11536-012-0115-8] 6. Kim JH, Desai NS, Ricci J, et al. Factors contributing to ventriculostomy infection. World Neurosurg 2012;77(1):135-140. [http://dx.doi.org/10.1016/j. wneu.2011.04.017] 7. Lyke, KE, Obasanjo OO, Williams MA, O’Brien M, Chotani R, Perl TM. Ventriculitis complicating use of intraventricular catheters in adult neurosurgical patients. Clin Infect Dis 2001;33(12):2028-2033. [http://dx.doi. org/10.1086/324492] 8. Lo CH, Spelman D, Bailey M, Cooper DJ, Rosenfeld JV, Brecknell JE. External ventricular drain infections are independent of drain duration: An argument against elective revision. J Neurosurg 2007;106(3):378-383. [http://dx.doi. org/10.3171/jns.2007.106.3.378] 9. Arabi Y, Memish ZA, Balkhy HH, et al. Ventriculostomy-associated infections: Incidence and risk factors. Am J Infect Control 2005;33(3):137-143. [http:// dx.doi.org/10.1016/j.ajic.2004.11.008] 10. Hoefnagel D, Dammers R, Ter Laak-Poort MP, Avezaat, CJ. Risk factors for infections related to external ventricular drainage. Acta Neurochir (Wien) 2008;150(3):209-214. [http://dx.doi.org/10.1007/s00701-007-1458-9] 11. Park P, Garton, HJL, Kocan, MJ, Thompson, BG. Risk of infection with prolonged ventricular catheterization. Neurosurgery 2004;55(3):594-601.

12. Kitchen WJ, Singh N, Hulme S, Galea J, Patel HC, King AT. External ventricular drain infection: Improved technique can reduce infection rates. Br J Neurosurg 2011;5(5):632-635. [http://dx.doi.org/10.3109/02688697.2011.578770] 13. Holloway, KL, Barnes T, Choi S, et al. Ventriculostomy infections: The effect of monitoring duration and catheter exchange in 584 patients. J Neurosurg 1996;85(3):419-424.

14. Pople I, Poon W, Assaker R, et al. Comparison of infection rate with the use of antibiotic-impregnated v. standard extraventricular drainage devices: A prospective, randomized controlled trial. Neurosurgery 2012;71(1):6-13. [http://dx.doi.org/10.1227/NEU.0b013e3182544e31] 15. Zabramski, JM, Whiting, D, Darouiche, RO, Horner, TG, Olson, J, Robertson C. Efficacy of antimicrobial-impregnated external ventricular drain catheters: A prospective, randomized, controlled trial. J Neurosurg 2003;98(4):725-730. [http://dx.doi.org/10.3171/jns.2003.98.4.0725] 16. Korinek AM, Reina M, Boch AL, Rivera AO, de Bels D, Puybasset L. Prevention of external ventricular drain-related ventriculitis. Acta Neurochir (Wien) 2005;147(1):39-45. [http://dx.doi.org/10.1007/s00701-004-0416-z] 17. Sonabend AM, Korenfeld Y, Crisman C, Badjatia N, Mayer SA, Connolly, ES Jr. Prevention of ventriculostomy-related infections with prophylactic antibiotics and antibiotic-coated external ventricular drains: A systematic review. Neurosurgery 2011;68(4):996-1005. [http://dx.doi.org/10.1227/ NEU.0b013e3182096d84] 18. Gleicher D, Barad DH. Gender as a risk factor for autoimmune diseases.

J Autoimmun 2007;28(1):1-6. [http://dx.doi.org/10.1016/j.jaut.2006.12.004]

JANUARY 2015 Vol. 9 No. 1

RESEARCH

Trends in perinatal health indices in the Amajuba District, KwaZulu-Natal, South Africa, 1990 - 2012 F S Bondi,1 MBBS, FWACP (Paed); T I Runsewe-Abiodun,2 MB BCh, FWACP (Paed) 1 2

Madadeni Hospital, Newcastle, South Africa epartment of Paediatrics, Olabisi Onabanjo University Teaching Hospital, Sagamu, Nigeria D

Corresponding author: T I Runsewe-Abiodun (dr_abiodun@yahoo.com)

Background. In order to address the high perinatal mortality rate, South Africa (SA) commenced a number of interventions from 1995.

These included the abolition of user fees, basic antenatal care, on-the-spot diagnosis and treatment of syphilis, and the prevention of mother-to-child transmission of HIV. However, there is a dearth of information on the long-term effect of these programmes on perinatal indicators in district hospitals, where most births and deaths occur.

Objective. To determine the levels and trends in maternal and neonatal indicators in Amajuba District, KwaZulu-Natal Province, SA, and to ascertain the dynamics of these indicators vis-Ă -vis the transformation of healthcare in SA. Methods. The study location was Madadeni Hospital and its nine feeder maternity clinics. Information pertaining to all deliveries and their outcome from these health facilities from 1990 to 2012 was extracted from the clinical registers. Data were analysed using SPSS version 15.0 (IBM, USA). Quantitative variables were summarised as means, while qualitative data were expressed as proportions and percentages. The trends for each outcome variable for the entire study period (1990 - 2012) were analysed and presented as line graphs and tables.

Results. There were 154 821 live births and 4 133 stillbirths from 1990 to 2012. The overall mean values for stillbirth rate, perinatal mortality rate, neonatal mortality rate and maternal mortality ratio were 26.3 (standard deviation 5.6), 40.9 (9.6), 16.8 (4.7) and 114 (56.6), respectively. There was a general improvement in all the perinatal health indices in the early 90s, followed by a general worsening until the early 2000s, after which a consistent decline was noted.

Conclusion. The perinatal health indices in Amajuba District have followed a pattern similar to that found in the rest of SA: an increase during the late 90s to early 2000s, followed by a decline from the late second half of the first decade of this century.

S Afr J CH 2015;9(1):9-13. DOI:10.7196/SAJCH.782

Globally, each year there are 0.5 million maternal deaths, 2 million infants die within 24 hours and there are 2.6 million stillbirths. Almost all (99%) of these deaths occur in low- and middle-income countries,[1,2] mainly as a result of scarcity of healthcare institutions; even where available, these facilities are typically overcrowded, understaffed and ill-equipped, resulting in poor-quality care.[3] Thus, in order to achieve Millenium Development Goals 4 and 5,[4] substantial improvements in delivery of healthcare services will be required. In order to address the issue of high perinatal mortality, South Africa (SA) implemented a number of interventions. These included the abolition of user fees, basic antenatal care, on-the-spot syphilis testing and treatment, and primary healthcare.[5-9] Furthermore, in Amajuba District, the use of nasal continuous positive airway pressure commenced in 1996,[10] antenatal care was transferred to clinics in 2000, the use of nevirapine for the prevention of mother-to-child transmission (PMTCT) of HIV started in 2003.

The other major developments occurred in 2009: care centres became baby friendly, a six-bed kangaroo mother care (KMC) unit was established, ambulance services were upgraded and the care centres obtained the Council for Health Services Accreditation of SA (COHSASA).

The paradox is that despite these developments, national reports indicate that progress towards reducing neonatal and maternal deaths is disappointing, and by the middle of the decade 2000 2010, SA was one of the few countries in the world with rising mother and child mortality.[3,11,12] As a result of considerable inequalities that still exist in SA with regard to access to quality 9

SAJCH

healthcare,[3,13] the relevance of national averages to Amajuba District is not clear.

In this study, we therefore set out to use local information to evaluate services in Amajuba District. We documented and analysed the level and trends in neonatal and maternal health indicators, and examined them against the backdrop of the ongoing transformation of healthcare in SA.

Methods

Research design

This was a retrospective, descriptive study involving delivery of all babies of at least 500 g in the Madadeni Hospital and its nine feeder maternity clinics. The study period spanned between 1990 and 2012.

Study location

Madadeni hospital is located in the Amajuba District, KwaZulu-Natal Province, SA. It provides the main maternal and neonatal services to mostly rural and semirural communities in Amajuba District. The hospital and its feeder maternity clinics serve a total population of 500 000 people.

For most of this study period (1990 - 2006), maternal and neonatal bed space remained unchanged in Madadeni Hospital, which provided district-level care. Service was rendered by 4 6â&#x20AC;&#x201A; medical officers in obstetrics and 1 medical officer in the Special Care Baby Unit (SCBU).

Changes in care were limited to increased use of prenatal steroids and magnesium sulphate, the establishment of a four-bed high-care unit in 1996, and a six-bed KMC unit in 2009. Between

JANUARY 2015 Vol. 9 No. 1

RESEARCH 1990 and 2009, admission to the SCBU was flexible, but from 2010 to 2012, only infants with strictly defined medical conditions were admitted.

Table 1. Perinatal health indices by year Year

SBR

PMR

NNMR

MMR

Study technique

1990

24.6

35.5

13.0

97

Data were extracted from the clinical registers of Madadeni Hospital and the nine feeder maternity clinics in its catchment area for the period 1990 - 2012. Infant information retrieved included weight at birth, place of birth, presence of perinatal asphyxia (Apgar score <7 at 5 minutes), exposure to syphilis (mother Wassermann reaction positive), presence of meconium-stained liquor and chorioamnionitis (foul-smelling liquor and maternal pyrexia). For the purpose of this study, these parameters were used to determine risk of syphilis, meconium aspiration syndrome and bacterial septicaemia. The outcome of the babies was also noted.

For each mother-infant pair, presence or absence of episiotomy, ruptured uterus and mode of delivery were noted. From 2003, the HIV status and use of antiretroviral (ARV) drugs for the PMTCT of HIV were also noted.

1991

26.9

42.0

16.3

122

1992

28.4

39.0

16.5

39

1993

25.7

36.2

12.1

60

1994

22.6

35.8

14.5

46

1995

23.2

35.3

13.0

60

1996

20.0

37.0

20.5

70

1997

34.0

50.6

18.3

223

1998

29.2

44.4

16.6

141

1999

28.5

49.1

21.5

128

2000

30.2

50.8

22.0

129

2001

29.5

49.4

21.1

92

Ethical issues

2002

37.3

54.5

19.9

128

2003

34.9

52.6

18.7

151

2004

34.0

55.8

26.0

175

Data entry, validation and analysis were done using SPSS ver­ sion 15.0 (IBM, USA). Quantitative variables were summarised as means (standard deviations (SDs)), while qualitative data were expressed as proportions and percentages. The trends for each outcome variable for the entire study period (1990 - 2012) were analysed and presented as line graphs and tables.

2005

30.8

49.1

21.5

109

2006

26.8

48.1

24.1

184

2007

24.0

40.1

16.7

149

2008

18.8

32.1

14.6

182

2009

23.4

34.6

14.5

66

Results

2010

18.8

25.5

10.7

79

2011

16.9

23.9

8.5

80

2012

18.6

24.6

8.0

26

The hospital medical manager gave permission for the study.

Data analysis

There were 158 954 births in registered in Madadeni and its feeder maternity clinics between 1990 and 2012, of which 154 821 (97.4%) were live and 4 133 (2.6%) were stillbirths. Of the 158 954 deliveries in this series, 136 065 (85.6%), 20 664 (13%) and the remaining 2 225 (1.4%) were in hospital, the clinics and homes, respectively.

Perinatal indices

The overall mean (SD) values for stillbirth rate (SBR), perinatal mortality rate (PMR), neonatal mortality rate (NNMR) and maternal mortality ratio (MMR) were 26.3 (5.6), 40.9 (9.6), 16.8 (4.7) and 114 (56.6), respectively.

There was a general decrease in all the perinatal health indices in the early 90s, followed by an increase up until the early 2000s, after which a consistent decline was noted (Table 1, Figs 1 and 2). It is noteworthy that the decline in adverse perinatal outcomes was not smooth, as it depicts peaks and troughs.

There was a substantial decline in the perinatal indices as exhibited by the percentage changes, especially the MMR (Table 2).

The overall low birth weight rate and the stillbirth:neonatal death rate were 9% and 4.3%, respectively. The perinatal care index ranged between 3.3 and 6.8, with an average of 4.9. It declined in the early 90s and thereafter climbed up for the next 10 years until the second descent commenced after 2007.

Feeder clinics utilisation

Over the study period, there was a consistent drop in both the number of mothers seeking to give birth in the clinics (potential clinic birth rate) and the proportion of labouring women in the clinics who eventually delivered in those centres (actual clinic birth rate). Thus, the contribution of the clinics to the overall births in Amajuba District dropped from 24% in 1990 to 6% in 2012, accompanied by increased referrals from these care centres 10

SAJCH

Table 2. Percentage changes in perinatal and maternal indices over the study period Parameter

Lowest, % (year*)

Highest, % (year*)

% changes†

SBR

17 (2011)

37 (2002)

–28

PMR

25 (2011)

60 (2004)

–32

NNMR

8 (2012)

27 (2004)

–70

MMR

25 (2012)

244 (2006)

–90

*Year of occurrence. † Between highest and lowest indices.

to the hospital. A sharp increase in the referrals was observed in 2000 (Fig. 3).

Antenatal care

The mothers of 134 157 (84.4%) of the 158 954 births received some form of antenatal care (one or more visits), while the remaining 24 797 (15.6%) received none. As depicted in Fig. 4, 5% of the pregnant women who delivered in 1990 received no care, against 1.9% in 2012. Booking rate before 20 weeks generally remained low until early 2000. Hence, the antenatal care bookings before 20 weeks more than doubled when 1990 was compared with 2012 (13.5% and 30.5%, respectively).

Delivery and postdelivery events

Of the 158 954 deliveries, 136 065 (85.6%), 20 664 (13%) and 2 225 (1.4%) were in hospital, clinic and homes, respectively. The mode

JANUARY 2015 Vol. 9 No. 1

RESEARCH 70 PMR NMR

60

SBR

Deaths per 1 000 live births

50

40

Discussion

30

20

10

0 90

19

92

19

94

19

96

19

98

19

00

04

02

20

20

20

06

20

08

20

10

20

12

20

Year

Fig. 1. Trends in perinatal health indices.

300

Maternal deaths per 100 000 live births

before plummeting after 1995 (Fig. 6). At the beginning of the PMTCT programme in 2003, only 7.3% of women attending antenatal clinics tested positive for HIV. By 2012, the percentage had increased to between 30 and 34%.

While only 3% of eligible HIV-positive women were on highly active ARV therapy as at 2008, the corresponding figure in 2012 was 90%.

MMR

250

200

150

100

50

0

90

19

92

19

94

19

96

19

98

19

00

20

02

20

04

20

06

20

08

20

10

20

12

20

Year Fig. 2. Trends in maternal mortality.

of delivery was normal vertex delivery in 138â&#x20AC;&#x201A; 131 cases (85.8%), caesarean section in 21 691 (13.5%) and assisted in 1â&#x20AC;&#x201A; 110 (0.7%).

The episiotomy rate rose steadily until the late 1990s, when it began descending.

The caesarean section rate varied marginally between 12 and 14% from 1990 to 2007, after which it rose to 19.7% in 2012 (Fig. 5). Also, from 2004, there has been no reported case of ruptured uterus. The risk of meconium

aspiration rose steadily up until 2007, when it dropped sharply. Perinatal asphyxia had been increasing from 2.1% in 1990 to 6.8% in 2007, but in 2007 this began a descent and subsequently remained at values <5%.

Risk of non-pregnancy-related infections

Although overall infections showed a steady decline, syphilis showed an initial increase 11

SAJCH

JANUARY 2015 Vol. 9 No. 1

The current study indicated the need for continued efforts to use high-quality data derived from communities to monitor the state of obstetric and neonatal services in the communities.

Most births and deaths in SA occur in district hospitals, and, not infrequently, deaths result from substandard care.â&#x20AC;&#x201A;[3,5,13] Therefore, it is not surprising that in its quest for accelerated reduction in maternal and childhood deaths, the SA government implemented a series of quality improvement programmes to improve care in district hospitals. These strategies were monitored by two facility-based audits, namely the Perinatal Problem Identification Programme, and the Child Problem Identification Programme.[5] Unfortunately, large studies to evaluate the trend in perinatal indicators in district hospitals are not readily available, and thus healthcare workers often do not have baseline data to refer to.

It is with this in mind that we undertook this study, in which perinatal indices in a typical district hospital and its catchment primary healthcare centres were documented and analysed for the period between 1990 and 2012. Since the data represent hospital, clinic and home births, it is reasonable to assume that they are representative of Amajuba District and can thus be used as a barometer to measure the state of maternal and neonatal health in this district.

The major strength of this study was its large sample size, access to a mostly nonreferral sample and use of maternity data to evaluate services within the district.

The striking overall finding revealed the wave-like fluctuation in perinatal indices, with two peaks and troughs; the 1990s witnessed the first decline in SBR, PMR and MMR, followed by a rise in these indices until after 2005, when another decline ensued.

It is noteworthy that the initial worsening of perinatal indicators up until after 2005 coincided with the peak of the HIV/AIDS epidemic in SA,[3,5] and the transition to better outcomes followed the intensification of the PMTCT programme and the widespread availability of ARVs to pregnant women and infants.[9,14] Current reports emanating

RESEARCH 80

Potential clinic birth rate

Percentage of total births (%)

70

Actual clinic birth rate Clinic transfer rate

60 50 40 30 20 10 0 90 992 994 996 998 000 002 004 006 008 010 012 1 2 2 2 2 1 2 2 1 2 1

19

Year

Fig. 3. Trends in clinic utilisation. % unbooked

35

% booked

Percentage of total births (%)

30

25

20

15

health facilities since 2003. This finding attests to the fact that more women in Amajuba District now have access to emergency obstetric care. It is unlikely that other risk factors for ruptured uterus, such as contracted pelvis, inappropriate use of uterotonic drugs and scarred uterus, have substantially changed during the course of this study.

Another notable finding in this report was that there was a progressive decrease in births in the clinics, as manifested by a decline in both the number of labouring women seeking initial care in the clinics, and the overall contribution of the clinics to total births in the Amajuba District.

While patients side-stepping the clinics for hospital births may denote a weakness in the primary healthcare system, this change in behaviour of the population may have contributed positively to the overall decline in deaths, as more mothers were offered caesarean section towards the latter part of this series.

The perinatal care index over the entire study period was much higher than what was expected.[22] This seems to suggest that there is need for additional effort to improve the healthcare system and delivery within the district in spite of the apparent gains. However, averting further perinatal deaths will require knowledge of the major causes of neonatal and maternal deaths in Amajuba District, narrowing the gulf of socioeconomic quintiles in SA[23] and holistic, synchronised healthcare. All these are beyond the scope of this study.

Conclusion

10

5

0 90

19

92

19

94

19

96

19

98

19

00

20

02

20

04

20

06

20

08

20

10

20

12

20

Year

Fig. 4. Trends in antenatal care; booking refers to the percentage of mothers booking before 20 weeks’ gestation.

from SA reveal that after years of rising childhood[15] and maternal mortality,[13,16-18] there has been a dramatic decline in deaths in the last 5 years, and the turnaround may be ascribed to rapid scale-up measures for the PMTCT programme and expanded rollout of ARVs to infected mothers and infants.

There are several other possible reasons for improved maternal and newborn health markers in this current study, including better management of an underperforming

health system that was caving in under the pressure of the then HIV epidemic,[19] the consultant outreach programme,[20] better ante-, peri- and postnatal care,[10] improved ambulance services and thus a better referral system[21] (which led to improved patient flow to the hospital from the clinics and muchreduced clinic deliveries), a concomitant increase in the caesarean section rate and the decline in perinatal asphyxia.

Furthermore, in this study, there was no recorded case of ruptured uterus in the 12

SAJCH

JANUARY 2015 Vol. 9 No. 1

This study of perinatal indices in Ama­ juba District revealed that there has been a reversal of the worsening trend that occurred during the 1990s, which was largely ascribed to the effect of the HIV/AIDS epidemic. The turnaround is as a result of various factors, such as improvements in comprehensive obstetric and neonatal care, the PMTCT programme and the overall elevation of the quality of care in our facilities.

Acknowledgements. The authors hereby acknow­ ledge the support of the medical, nursing and medical record staff of the maternity wing of Madadeni Hospital in the data collection.

References 1. Bhutta Z, Chopra M, Axelson H, et al. Countdown to 2015 decade report (2000-10): Taking stock of maternal, new-born, and child survival.

Lancet 2010;375(9730):2032-2044. [http://dx.doi. org/10.1016/S0140-6736(10)60678-2] 2. World Health Organization/United Nations Children’s Fund. Countdown to 2015. Building a Future for Women and Children: The 2012 Report.

Washington DC: World Health Organization/ United Nations Children’s Fund, 2012.

3. Chopra M, Lawn JE, Sanders D, et al. Achieving the health millennium development, South

RESEARCH 25 Episiotomy rate CSR Percentage of total births (%)

20

MAS risk % Perinatal asphyxia

15

10

5

0 90

19

92

19

94

19

96

19

98

19

00

20

02

20

04

20

06

20

08

20

10

20

12

20

Year

Fig. 5. Trends in delivery and postdelivery events. (CSR = caesarean section rate; MAS = meconium aspiration syndrome.)

5.0

Syphilis risk

4.5

Sepsis risk

Percentage of total births (%)

4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

90 91 92 93 94 95 96 97 98 99 00 01 02 03 04 05 06 07 08 09 10 11 12 19 19 19 19 19 19 19 19 19 19 20 20 20 20 20 20 20 20 20 20 20 20 20

Year

Fig. 6. Trends in peripartum infection.

Africa: Challenges and priorities. Lancet 2009:374(9694):1023-1031. [http://dx.doi. org/10.1016/S0140-6736(09)61122-3] 4. United Nations. The Millenium Development Goals Report 2011. New York: United Nations, 2011. http:// www.undp.org/...home/librarypage/mdg/MDG_ report_2011.html (accessed 19 December 2014).

5. Bradshaw D, Chopra M, Kerber K, et al. Every death counts: Use of mortality audit data for decision making

to save the lives of mothers, babies and children in South Africa. Lancet 2008:371(9620):1294-1301. [http://dx.doi.org/10.1016/S0140-6736(08)60564-4] 6. Greenfield DH. Evaluation of the use of neonatal manual of perinatal education programme.

Proceedings of the 7th World IAMANEH Conference 2000. Capetown, South Africa. http:// www.rmchsa.org/wp-content/resources/resources_ by_theme/ (accessed 19 December 2014).

13

SAJCH JANUARY 2015 Vol. 9 No. 1

7. Bergh AM, van Rooyen E, Pattison RC. Scaling up kangaroo mother care in South African educational facilities. Human Resour Health 2008:6:13. [http:// dx.doi.org/10.1186/1478-4491-6-13] 8. Pattinson RC. On-site screening for syphilis: The time has come. S Afr Med J 1998:88(6 Suppl);780-781.

9. Department of Health. National strategic plan: HIV, AIDS and STIs. Pretoria: Department of Health, 2007.

10. Bondi FS, Adhikari M. Improved survival of non-ventilated very-low-birth-weight infants at Madadeni Hospital, KwaZulu-Natal. S Afr J CH 2007;1(1):10-13.

11. Pattinson RC, ed. Saving Babies 2008-2009: Seventh Report on Perinatal Care in South Africa.

Pretoria: Tshepesa Press, 2011.

12. Tollman SM, Kahn K, Garenine M, Gear JSS. Reversal in mortality trends: Evidence from Agincourt field site, South Africa: 1992-1995.

AIDS 1999;13(9):1091-1097.

13. Bradshaw D, Bourne D, Nannan N. What are the Leading Causes of Death Among South African Children? MRC Policy Brief No. 3, December 2003. Cape Town: Medical Research Countil, 2003.

14. Grimwood A, Fatti G, Mothibi E, Eley B, Jackson D. Progress of preventing mother-to-child transmission of HIV at primary healthcare facilities and district hospitals in three South African provinces. S Afr Med J 2012;102(2):8183.

15. Kerber KJ, Lawn TE, Johnson LF, et al.

South African child deaths 1990-2011: Have HIV services reversed the trend enough to meet the Millenium Development Goal 4?

AIDS 2013;27(16):2637-2648. [http://dx.doi. org/10.1097/01.aids.0000432987.53271.40] 16. Wabili N, Chersich M, Zuma K, Bauw D, Goudge J, Dwane N. Equity in maternal health in South Africa: An analysis of health service in a national household survey. PLoS One 2013:8(9):e73864. [http://dx.doi.org/10.1371/journal.pone.0073864] 17. Garene M, Keih K, Collinson MA, Gómez-Olivé FX, Tollman S. Maternal mortality in rural South Africa: The impact of case definition on levels and trend. Int J Womens Health 2013;5:457-463. [http://dx.doi.org/10.2147/IJWH.S45983] 18. Gouz JP, Gulmezoglu AM, Vogel J, et al. Moving beyond essential interventions for reduction of maternal mortality (the WHO multicountry survey on maternal and newborn health): A cross-sectional study. Lancet 2013;381(9879):1747-1755. [http:// dx.doi.org/10.1016/S0140-6736(13)60686-8] 19. Bateman C. Coming soon: Nowhere to hide for hospital managers. S Afr Med J 2001;101(5):294-296.

20. Graede B, MacKerrow NH. Outreach programme: Consultant visits to rural hospitals. Continuing Medical Education 2011;29(2):54-58.

21. Schoon MG. Impact of inter-facilty transport on maternal mortality in the free state province. S Afr Med J 2013;103(8):534-537. [http://dx.doi. org/10.7196/samj.6828] 22. Pattison RC. Introduction, methods and definition of the survey. In: Pattison RC, ed. Saving Babies: A Perinatal Care Survey of South Africa. Durban: Medical Research Council, 2000:1-7.

23. Victora CG, Barros AJD, Axelson H, et al. How changes in coverage affect equity in mother and child health interventions in 35 count down to 2015 countries: An analysis of national surveys.

Lancet 2012;380(9848):1149-1156. [http://dx.doi. org/10.1016/S0140-6736(12)61427-5]

RESEARCH

Prevalence and risk factors of anaemia in paediatric patients in South-East Nigeria M D Ughasoro, MBBS, MPh, MSc (Health Economics), FWACP; I J Emodi, MBBS, FMCPaed; H U Okafor, MBBS, FWACP, FMCPaed; B C Ibe, MBBS, FWACP, FMCPaed Department of Paediatrics, College of Medical Sciences, University of Nigeria, Enugu, Nigeria Corresponding author: M D Ughasoro (kakatitis@yahoo.co.uk) Background. The causes of anaemia have regional variations, and further variation is expected among paediatric hospital patients. How­ ever, the prevalence of anaemia and its contributing risk factors among paediatric patients remain understudied in South-East Nigeria.

Methods. The study involved 286 anaemic (haemoglobin (Hb) ≤10 g/dL) and 295 non-anaemic preschool children attending a hospital outpatient department. A clinical research form was used to document demographic data, anthropometric measurements, disease details and packed cell volume. Common anaemia risk factors previously documented were studied. The prevalence rates of the independent variables were calculated and level of significance was determined, using χ2.

Results. The prevalence of anaemia was 49.2%, with the highest prevalence among children <12 months old (p=0.009). There was a significant association between anaemia and maternal education above primary education (p=0.01), but there was no association with socioeconomic status (p=0.7) or nutritional status (p=0.1). The prevalence of the major risk factors among anaemic children was: malaria parasitaemia 48.3% (p=0.03), iron deficiency 42.3% (p=0.001), glucose-6 phosphate dehydrogenase (G6PD) deficiency 24.8% (p=0.02), HIV seropositivity 13.3% (p=0.02), sickle cell anaemia 2.4% (p=0.3) and helminth infection 1.1% (p=0.32).

Conclusions. Malaria and iron deficiency remain common among ill children <5 years old who are anaemic. The treatment of these con­ ditions should be considered when managing an anaemic ill child in order to reduce morbidity and mortality.

S Afr J CH 2015;9(1):14-17. DOI:10.7196/SAJCH.760

Anaemia is a global health problem[1,2] with a major debilitative effect,[3] especially in children in subSaharan Africa.[4,5] Globally, different causative factors of anaemia have been identified,[6,7] each with an intrinsic potential to cause anaemia,[8,9] and the relative contribution of these individual risk factors has regional variations.

Even within a region, further variation between community and hospitalised children may exist.

Studies have shown that malaria,[10-12] HIV,[13,14] iron deficiency,[15,16] glucose-6 phosphate dehydrogenase (G6PD) deficiency, sickle cell anaemia (SCA)[10,11] and intestinal helminths[17] are potential causes of anaemia. Over the years in Nigeria, different intervention programmes have been adopted based on common causes of anaemia, with the aim of preventing and controlling childhood anaemia.[18,19] In spite of these interventions, the prevalence of anaemia remains high.

Therefore, there may be some benefits if the main contributors to anaemia among ill children are determined. In addition, evaluation at the micro or small-unit level rather than national or global level will help in the design of a cost-effective intervention that can reduce anaemia-related morbidity and mortality in that locality.

Anaemia among ill children, especially those <5 years old, is associated with higher morbidity and mortality than in apparently healthy children. Our objective was to determine the prevalence of anaemia and causative factors among <5-year-old paediatric patients in South-East Nigeria. The outcome of this study will facilitate the design of an effective management protocol for anaemic children <5 years of age who present to health facilities in South-East Nigeria.

health facility that receives patients from both urban and rural areas.

It is strategically located in the semitropical rainforest of Nigeria with an estimated annual rainfall of more than 1 520 mm and a temperature that varies between 22.4° and 30.8°C.[20] The malaria transmission rate is high all year round, with an average rate of more than 15% in both wet and dry seasons.

Methods

A clinical research form (CRF), including a questionnaire, was administered by face-to-face interview with the respondents. The CRF was pilot-tested in a health centre in Enugu, after which certain revisions were made prior to the study. The information collected was on socioeconomic data, physical examination and anthropometric

Study site and population

This study was conducted in the children’s outpatient clinic (CHOP) and children’s emergency room (CHER) of the University of Nigeria Teaching Hospital (UNTH) in Enugu, Nigeria. UNTH is a three-tier 14

SAJCH

Study design

The study was a cross-sectional, hospital-based, descriptive study.

All children aged between 6 and 59 months who visited the CHOP or CHER were consecutively recruited over a period of 12 months between February 2009 and January 2010. The sample size was calculated at 283 patients with Epi-Info software version 6.04 (Centers for Disease Control and Prevention (CDC), USA), using the prevalence of anaemia among children aged 6 - 59 months of 21.7%,[5] with a 95% confidence limit.

Ethical considerations

The UNTH ethical committee gave ethical approval before the study was commenced. Written informed consent was obtained from the parents/caregivers of participating children. The results of the investigations were acted upon according to local protocol; children with anaemia diagnosed by immediate haemoglobin estimation were referred to appropriate units, where they were reviewed, investigated and managed with haematinics and/or blood transfusion as appropriate.

Data collection

JANUARY 2015 Vol. 9 No. 1

RESEARCH measurements. Blood and stool samples were also collected.

Socioeconomic status

Socioeconomic status (SES) was determined according to parental educational level, and occupation according to Oyedeji.[21] Social classes I and II were categorised as higher social classes, and III - V as lower classes.

Anthropometric measurements

Weight was measured using a Seca floor scale (Seca Corporation, USA) for children ≤24 months, and a Harson weighing scale (Harson Scales Company, USA) for children >24 months old. Recumbent length was measured using a SECA 416 measuring board for children <2 years old, while height was measured using a stadiometer for those aged ≥2 years. Each measurement was repeated to get the mean. Those children whose weight-for-age, height-for-age, and weightfor-height were below the 3rd centile of the World Health Organization (WHO) Child Growth Standard Chart were classified as underweight, stunted and wasted, respective­ ly, while those above the 3rd centile but less than the 97th centile were classified as having normal nutrition. Children above the 97th centile for weight-for-height were classified as overweight/obese.

Haematological investigations

Haemoglobin concentration was deter­ mined using the Hemocue method (HemoCue HB 301).[22] The WHO and CDC proposed cut-off for anaemia in

children aged 6 months - 5 years was used to categorise the children. Children with haemoglobin (Hb) ≤10 g/dL were classified as anaemic.

Blood smears for thick blood film were stained with Giemsa stain for malaria parasitaemia. The slides were viewed for the presence or absence of asexual Plasmodium falciparum parasites by a trained microscopist.

Total iron-binding capacity and serum iron were determined by standard direct total iron-binding capacity (TIBC) assay[23] and the ferrozine colorimetric method, respectively.[24] A serum iron level of <9 μmol/L and total iron-binding capacity of >80 μmol/L were taken as cut-off points for iron deficiency.

The patients’ HIV status was determined using the Determine HIV 1/2 (Abbott Diagnostic Division, The Netherlands) rapid kits. G6PD status was determined using the standard methaemoglobin reduction test. [25] Haemoglobin genotype was determined by electrophoresis of the patient’s blood on cellulose acetate membrane at the alkaline pH of 8.9.[26]

Stool study

version 15.0 statistical software (IBM, USA).

The children were categorised into anaemic (Hb ≤10g/dL) and non-anaemic groups.

Means and standard deviations were used to summarise quantitative variables (age of children) and proportions of categorical variables were analysed using the χ2 test and Yates correction (where necessary). The prevalence of each variable was determined for each group (anaemic and non-anaemic).

The p-value (p<0.05) was used to determine statistically significant associations.

Results

Socioeconomic and demographic characteristics of the subjects

Most (92.8%) of the respondents (caregivers) were mothers, and most (69.5%) of these had tertiary education. The presence of anaemia correlated inversely with educational level of the parents/caregivers (p=0.04). The predominant occupation of the caregivers was civil service (33.7%), followed by being unemployed (24.6%). There was a significant association between occupation of the caregivers and anaemia. One-third of caregivers (35.4%) was classified as being

The stool sample was examined for parasite ova using the Kato-Katz method. Presence or absence of hookworm ova was defined as infection or non-infection, respectively.

Table 1. Age distribution of subjects diagnosed with anaemia

Data analysis

Data were double-entered and verified in Epi-­ Info version 6.04 and analysed using SPSS

Age groups (months)

Anaemic, n (%)

6 - 12

76 (26.5)

13 - 36

146 (51.0)

37 - 59

64 (22.3)

Table 2. Risk factors associated with childhood anaemia Risk factors

Anaemic children (N=286), n (%)

Relative risk, % (CI)

p-value

Malaria (n=256)

138 (48.3)

1.20 (1.01 - 1.41)

0.03

Serum iron (<9 μmol/L) (n=178)

121 (42.3)

1.66 (1.42 - 1.93)

0.01

TIBC (> 80 μmol/L) (n=138)

97 (33.9)

1.65 (1.41 - 1.92)

0.01

G6PD deficiency (n=120)

71 (24.8)

1.26 (1.05 - 1.50)

0.02

HIV seropositivity (n=59)

38 (13.3)

1.33 (1.08 - 1.65)

0.02

Haemoglobin genotype (SS) (n=10)

7 (2.4)

1.44 (0.93 - 2.13)

0.34*

Hookworm (ova) (n=4)

3 (1.1)

1.51 (0.86 - 2.71)

0.32*

CI = confidence interval. *Yates correction.

Table 3. Anthropometric measures for the subjects Variables

Anaemic children (N=286), n (%)

Relative risk, % (CI)

p-value*

Stunting (<3rd centile) (n=93)

45 (15.7)

0.98 (0.78 - 1.23)

0.82

Wasting (<3rd centile) (n=47)

18 (6.3)

0.76 (0.52 - 1.11)

0.10

Underweight (<3rd centile) (n=39)

17 (5.9)

0.88 (0.61 - 1.27)

0.51

MUAC ≤12.5 cm (n=30)

20 (7.0)

1.38 (1.06 - 1.80)

0.07

*Correlates with anaemia in children.

15

SAJCH

JANUARY 2015 Vol. 9 No. 1

RESEARCH of low SES. There was no significant association between SES and anaemia.

Of the 652 children who participated, 581 children had complete questionnaires with investigation results, and these comprised the analysed sample. Male children were in a slight majority (54.9%).

The overall prevalence rate of anaemia was 49.2%.

The prevalence of anaemia among children between the ages of 13 and 36 months was high (51%), and this was statistically significant (Table 1).

Malaria was present in 138 anaemic children (48.3%) and 118 nonanaemic children (40.0%) (relative risk (RR)=1.20, p=0.03) (Table 2).

Low serum iron was detected in 121 anaemic children (42.3%) and 57 non-anaemic children (19.3%) (RR=1.66, p=0.01), while a high TIBC was found in 33.9% of anaemic children compared with 13.9% of controls (RR=1.65, p=0.01). G6PD deficiency was detected in 71 anaemic children (24.8%) and 49 non-anaemic children (16.6%) (RR=1.26, p=0.02).

HIV seropositivity was detected more frequently in anaemic children (13.3%) than non-anaemic children (7.1%) (RR=1.33, p=0.02).

Haemoglobin genotype SS was not found more frequently in anaemic children (n=7, 2.4%) than non-anaemic children (n=3, 1.0%) (RR=1.44, p=0.34).

Hookworm ova were detected in three anaemic children (1.0%) and one non-anaemic child (0.3%) (RR=1.51, p=0.32).

Table 3 shows that 45 anaemic children (15.7%) and 48 nonanaemic children (16.3%) were stunted, (RR=0.98, p=0.82). No association was found between wasting and anaemia (RR=0.76, p=0.10) or between underweight and anaemia (RR=0.88, p=0.51).

Twenty anaemic children (7.0%) and 10 non-anaemic children (3.4%) had a mid-upper arm circumference (MUAC) <12.5 cm. No significant association was found between low MUAC and anaemia (RR=1.38, p=0.07)

Discussion

In this study, the anaemia prevalence among paediatric patients <5 years of age was high, especially among children 13 - 36 months old. This is similar to what has been reported in other studies,[17,27] and has been suggested to be a result of: malaria infection with poor immunity to malaria in this age group; nutritional anaemia due to poor complementary feeding practices;[7,28] increase in body demand due to rapid growth; and increased activity due to achieved motor milestones. Anaemia was not associated with gender or SES. Different studies have reported contrasting views on the association between anaemia and gender,[27,29] as well as SES.[30,31] The reasons for these differences are not clear. The fact that this study was hospital based might have contributed to the observed differences. Most ill children from all socioeconomic groups might have sought care from different sources by the time they seek healthcare from the hospital. This delay in access of healthcare allows the underlying illness enough time to cause anaemia as a complication.

Malaria was significantly higher among anaemic paediatric patients, a finding reported by other studies[12-14] but which is in contrast to expectation, as the region has seen an overall reduction in malaria burden.[32] A possible explanation for this may be that although there has been an overall reduction in malaria burden in the community, the malaria burden in ill children <5 years old has not changed much. The practice of self-medication[33] may have contributed to delay in appropriate health-seeking behaviour, and may have allowed enough time for malaria to cause anaemia through different mechanisms.[34] Iron deficiency was also found to be significantly associated with anaemia. This is similar to some previous studies,[17,18] but contrary to the findings of Callis et al.[11] and Cardoso et al.[28] Irondeficiency anaemia is sinister in young children.[11] The International 16

SAJCH

Nutritional Anaemia Consultative Group (INACG) and WHO have recommended daily iron supplementation both for treatment and prophylaxis, especially for groups at risk.[11] This intervention seems to be adequately implemented among pregnant women who attend antenatal care and among sickle cell anaemic children attending routine follow-up clinic visits, but little or no activity is noted among otherwise well children. This study has revealed the need to improve the practice of daily iron supplementation, especially for children <5 years of age.

There was a low prevalence of hookworm infections among both anaemic and non-anaemic paediatric patients <5 years of age.

This supports other studies that reported no association between anaemia and the prevalence of hookworm in children <5 years of age,[14,19] but in older age groups[35] the prevalence of hookworm infections increases. The findings of this study support the design of the anthelminthic programme, which excludes children <5 years of age from treatment; according to the Deworm the World Initiative, the implementation of the deworming programme should be school based.[36] However, there is still need for further study to determine the prevalence of other intestinal helminths among paediatric patients <5 years old. Although helminths may not be causing anaemia, they could contribute to other morbidity in young children.

Among the investigated paediatric patients, the prevalence of G6PD deficiency was high, and was significantly associated with anaemia, which contrasted with SCA – another haematologic genetic disorder that was found to have a low prevalence and no significant association with the prevalence of anaemia. This lack of association contrasts with the common assumption. However, it is insightful to note that although the prevalence of anaemia among SCA patients may be high, the prevalence of SCA among anaemic children was low. Therefore, the possibility of SCA being the contributing factor to anaemia among anaemic paediatric patients is very remote. This should influence the prioritisation of investigations, especially in sub-Saharan regions, where the poverty rate is high and iron deficiency is very common.

In this study, HIV prevalence among anaemic paediatric patients was low, at 13%, but it was significantly associated with anaemia. This is different from what other studies have reported.[13,15,16] Few studies have investigated the prevalence of HIV among anaemic children <5 years of age. The current finding does not disprove the potential of HIV to cause anaemia, but highlights that HIV/AIDS is not among the common causes of anaemia among paediatric patients.

Indicators of malnutrition were not found to be significantly associated with anaemia in paediatric patients in this study. This association has been reported by Callis et al.,[11] but contrasts with the findings of Bernal et al.[37] and Ngnie-Teta et al.[38] There is no clear explanation for these reported differences, but it is likely that anthropometric measurements poorly reflect micronutrient status such as those of iron and folate, which are better assessed biochemically.[39,40] A limitation of the study was the lack of bacteriological studies.

A blood culture would have shown the prevalence of sepsis among children with anaemia, since bacterial infection is common in subSaharan African regions.

Conclusion

This study has shown that multiple factors contribute to anaemia in paediatric patients in Nigeria. Among these multiple causes, malaria and iron deficiency remain the major contributing factors.

Therefore, in every child that presents with anaemia, an effort should be made to exclude malaria and iron deficiency. Furthermore, boosting malaria control programmes and promotion of iron supplementation programmes can reduce the burden of anaemia in Nigeria.

JANUARY 2015 Vol. 9 No. 1

RESEARCH Acknowledgements. We are grateful to all the caregivers who allowed their children to be part of the study. The authors are thankful to the resident doctors in the Department of Paediatrics for their collaboration in the work.

References 1. Chapler CK, Cain SM. The physiologic reserve in oxygen-carrying capacity: Studies in experimental hemodilution. Can J Physiol Pharmacol 1986;64(1):712.

2. World Health Organization. Worldwide prevalence of anaemia 1993-2005. WHO Global Database on Anaemia. Geneva: World Health Organization, 2008.

3. Murray CJL, Lopez AD. The global burden of disease: A comprehensive assessment of mortality and disability from diseases, injury and risk factors in 1990 and projected to 2020. In: Murray CJL, Lopez AD. Global Burden of Disease and Injury series, Vol. 1. UK: Harvard University Press, 1996:1-43.

4. Koram KA, Owusu-Agyei S, Utz G, et al. Severe anaemia in young children after high and low malaria transmission seasons in the Kassena-Nankana district of northern Ghana. Am J Trop Med Hyg 2000;62(6):670-674.

5. Anumudu CI, Okafor CM, Ngwumohaike V, Afolabi KA, Nwuba RI, Nwagwu M. Epidemiological factors that promote the development of severe malaria anaemia in children in Ibadan. Afr Health Sci 2007;7(2):80-85.

6. National Heart, Lung, and Blood Institute. What Causes Anaemia? http:// www.nhibi.nih.gov/health/health-topics/topics/anaemia/cause/html (accessed 13 April 2009).

7. Tagbo BN, Ughasoro MD. Complementary feeding pattern of infants attending the University of Nigeria Teaching Hospital (UNTH), ItukuOzalla, Enugu.

Niger J Paediatr 2009;36(3&4):51-59.

8. McAuley CF, Webb C, Makani J, et al. High mortality from Plasmodium falciparum malaria in children living with sickle cell anemia on the coast of Kenya. Blood 2010;116(10):1663-1668. [http://dx.doi.org/10.1182/ blood-2010-01-265249] 9. Kreuzer KA, Rockstroch JK. Pathogenesis and pathophysiology of anaemia in HIV infection. Ann Hematol 1997;75(5-6):179-187.

10. Fleming A. Anaemia in Northern Nigeria and two South African cities.

In: Nestel P, ed. Iron Interventions for Child Survival. Proceedings, May 17-18, 1995, London. Arlington, USA: John Snow (JSI) Opportunities for Micronutrient Intervention (OMNI), 1995:139-142.

11. Callis JC, Phiri KS, Faragher EB, et al. Severe anaemia in Malawian children.

N Eng J Med 2008;358(9):888-899. [http://dx.doi.org.10.1056/NEJMoa072727] 12. Akhwale WS, Lum JK, Kaneko A, Eto H, Obonyo C, Björkman A, Kobayakawa T. Anaemia and malaria at different altitudes in the western highlands of Kenya. Acta Trop 2004;91(2):167-175. [http://dx.doi.org/10.1016/j. actatropica.2004.02.010] 13. Schellenberg D, Armstrong-Scelenberg JRM, Mushi A, et al. The silent burden of anaemia in Tanzanian children: A community-based study. Bull World Health Organ 2003;81(8):581-590.

14. Omoregie R, Eghafona NO. Effect of urinary tract infection on the prevalence of anaemia among HIV patients in Benin City, Nigeria. N Z J Med Lab Sci 2009;63(2):44-46.

15. Stoltzfus RJ, Chwaja HM, Montresor A, Albonico M, Savioli L, Tielsch JM. Malaria, hookworms and recent fever are related to anaemia and iron status indicators in 0- to 5-yr-old Zanzibari children and these relationships change with age. J Nutr 2000;130(7):1724-1733.

16. Kaur S, Deshmukh PR, Garg BS. Epidemiological correlates of nutritional anaemia in adolescent girls of rural Wardha. Ind J Com Med 2006;31(4):10-12.

17. Muhangi L, Woodburn P, Omara M, et al. Associations between mild to moderate anaemia in pregnancy and helminth, malaria and HIV infection in Entebbe Uganda. Trans R Soc Trop Med Hyg 2007;101(9):899-907. [http:// dx.doi.org/10.1016/j.trstmh.2007.03.017] 18. Lagos State Ministry of Health. Malaria Control Programme. http://www. lsmoh.com. (accessed 23 October 2013).

17

SAJCH

19. Stoltzfus RJ, Dryfuss ML, International Nutritional Anemia Consultative Group (INACG). Guidelines for the use of iron supplements to prevent and treat iron deficiency anaemia. http://www.who.int (accessed 11 April 11 2012).

20. Enete IC, Alabi MO. Observed urban heat island characteristics in Enugu urban during the dry season. Glob J Human Soc Sci 2012;12(10):74-80.

21. Oyedeji GA. Socioeconomic and cultural background of hospitalised children in Ilesha. Nig J Paediatr 1995;12:111-117.

22. Von Schenck H, Falkensson M, Lundberg B. Evaluation of “HemoCue”, a new device for determining haemoglobin. Clin Chem 1986;32(3):526-529.

23. Siek G, Lawlor J, Pelczar D, Sane M, Musto J. Direct serum total iron-binding capacity assay suitable for automated analyzers. Clin Chem 2002;48(1):161-166.

24. Al-BuhairamAM, Oluboyede OA. Determination of serum iron, total iron binding capacity and serum ferritin in healthy Saudi adults. Ann Saudi Med 2001;21(1-2):100-103.

25. Bain BJ. Basic haematological techniques. In: Dacie JV, Lewis SM, eds. Practical Haematology (8th ed.). New York; Churchill Livingstone Inc., 1995:49-82.

26. White JM, Frost BA. Investigation of the haemoglobinopathies. In: Dacie JV, Lewis SM, eds. Practical Haematology (8th ed.). New York; Churchill Livingstone Inc., 1995:179-199.

27. Siegel EH, Stoltzfus RJ, Khatry SK, LeClerg S, Katz J, Trelsch JM. Epidemiology of anaemia among 4 to 7 months children living in South-central Nepal. Eur J Clin Nutr 2006;60(2):228-235. [http://dx.doi.org/10.1038/sj.ejcn.1602306] 28. Cardoso MA, Scopel KKG, Muniz PT, Villamor E, Ferreira MU. Underlying factors associated with anaemia in Amazonian children: A population-based, cross-sectional study. PLoS ONE 2012;7(5):e36341. [http://dx.doi.org/10.1371/ journal.pone.0036341] 29. Pasricha SR, Black J, Muthayya S, et al. Determinants of anaemia among young children in rural India. Pediatrics 2010;126(1):e149-149. [http://dx.doi/. org/10.1542/peds.2009-3108] 30. Animasahun BA, Temiye EO, Ogunkunle OO, Izuora AN, Njokanma OF. The influence of socioeconomic status on the hemoglobin level and anthropometry of sickle cell anaemia patients in steady state at the Lagos University Teaching Hospital. Niger J Clin Pract 2014;14(4):422-427. [http://dx.doi. org/10.4103/1119-3077.91748] 31. Keikhaei B, Zandian K, Ghasemi A, Tabibi R. Iron-deficiency anaemia among children in Southwest Iran. Food Nutr Bull 2007;28(4):406-411.

32. Tagbo O, Henrietta UO. Comparison of clinical, microscopy and rapid diagnostic test methods in the diagnosis of Plasmodium falciparum malaria in Enugu, Nigeria. Niger Postgrad Med J 2007;14(4):285-289.

33. Théra MA, D’Alessandro U, Thiéro M, et al. Child malaria treatment practices among mothers in the district of Yanfolila, Sikasso region, Mali. Trop Med Int Health 2000;5(12):876-881.

34. Hassan K, Sullivan KM, Yip R, Woodruff BA. Factors associated with anaemia in refugee children. J Nutr 1997;127(11):2194-2198.

35. Adeyeba OA, Tijani BD. Intestinal helminthiasis among malnourished schoolage children in peri-urban area of Ibadan, Nigeria. Afr J Clin Exp Microbiol 2002;3(1):24-28.

36. Deworm the World Initiative, Evidence Action. GiveWell Real Change for Your Dollar. www.givewell.org (accessed July 2012).

37. Bernal C, Velásquez C, Alcaraz G, Botero J. Treatment of severe malnutrition in children; Experience in implementing the World Health Organization Guidelines in Turbo, Colombia. J Pediatr Gastroenterol Nutr 2008;46(3):322-328.

38. Ngnie-Teta I, Receveur O, Kuate-Defo B. Risk factors for moderate to severe anaemia among children in Benin and Mali: Insight from a multilevel analysis.

Food Nutr Bull 2007;28(1):76-89.

39. World Health Organization. Iron Deficiency Anaemia, Assessment, Prevention, and Control. A Guide for Programme Managers. http://www.who.int/nutrition/ publications/micronutrients/anaemia_iron_deficiency/WHO_NHD_01.3/en/ (accessed 14 January 2014).

40. Hettiarachchi M, Liyanage C. Dietary macro- and micro-nutrient intake among a cohort of pre-school children from southern Sri Lanka. Ceylon Med J 2010;55(2):47-52.

JANUARY 2015 Vol. 9 No. 1

RESEARCH

Sleep duration and its effect on nutritional status in adolescents of Aligarh, India N Faizi, MBBS, MD, MPH; Z Khan, MBBS, DCH, MD; A Amir, MBBS, MD; S A Azmi, MBBS, MD JN Medical College and Hospital, Aligarh Muslim University, Aligarh, India Corresponding author: N Faizi (nafisfaizi@gmail.com) Background. The World Health Organization describes obesity as one of today’s most blatantly visible – yet most neglected – public health problems. Sleep duration has been found to have an association with overweight and obesity in many studies, most of which have been conducted outside India. The prevalence of chronic partial sleep deprivation has increased dramatically in the past half century, in parallel with the rising epidemics of overweight and obesity. In addition, sleep per se has a special relevance in obesity.

Objective. This study was part of a larger study based on the Global School Health Survey, and was conducted in the 13 - 15-year-old age group. The study had two objectives: first, it enquired into sleep duration in the aforementioned adolescents and assessed whether this was adequate or inadequate; and second, it sought to evaluate and assess the relationship between sleep duration and the nutritional status of these adolescents, whether overweight or obese.

Methods. A cross-sectional study was conducted in all three schools affiliated to the Aligarh Muslim University Board of Examination.

A pretested and prevalidated questionnaire was used to assess sleep duration, and anthropometry was done on all the students of these schools who fulfilled the inclusion criteria. AnthroPlus (World Health Organization, Switzerland) and SPSS (IBM, USA) version 20 were used for z-score and other statistical calculations, respectively.

Results. A total of 1 416 students were studied, of which 23.6% reported inadequate sleep duration. It was found that those with inadequate sleep had significantly higher odds of being overweight or obese, with an odds ratio of 1.56 (confidence interval 1.12 - 2.15). The inadequacy of sleep duration was also associated with a higher body mass index for age z-score (0.77 (standard deviation 0.57)), compared with those with adequate sleep duration (–0.31 (0.08)), which was found to be significant (t=22.59, df=1, p<0.001).

Conclusion. Inadequate sleep is an obesogenic factor, even in developing countries. It is a cause of concern, as the habits developed/ strengthened at this stage may be lifelong.

S Afr J CH 2015;9(1):18-21. DOI:10.7196/SAJCH.777

The World Health Organization (WHO) describes obesity as one of today’s most blatantly visible – yet most neglected – public health problems.[1] The prevalence of overweight and obesity has been gradually increasing, becoming a public health problem, not only in developed countries but also in developing countries such as India. [2] The ‘New World syndrome’, which is likely to create an enormous socioeconomic and public health burden of non-communicable diseases, states obesity as one of the first cluster of diseases.[3] Lifestyle factors are cited as one of the reasons for an increase in the prevalence of overweight or obesity. Significant studies have been conducted to identify the relationship between lifestyle factors and obesity. Prior research has examined factors such as nutrition transition, junk food and soft drink intake frequency and physical activity profiles for their association with the prevalence of overweight or obesity. An optimal public health outcome is achievable if the factors causing obesity, besides the conventional ones of diet and physical activity, can be scientifically found, and corresponding remedial measures implemented.[4] Among these other factors, sleep duration has been found to have an association with overweight and obesity in many studies, most of which have been conducted outside India.[5-7] The prevalence of chronic partial sleep deprivation has increased dramatically in the past half century, in parallel with the rising epidemics of overweight and obesity.[8] According to Dahl and Lewin,[9] sleep duration per se has a special relevance in adolescence, as: (i) there are substantial biological and psychosocial changes in sleep, and circadian regulation exists across pubertal development; (ii) interactions between physical 18

SAJCH

and psychosocial domains during adolescence can lead to dramatic alterations in sleep patterns and habits; (iii) increasing evidence indicates that many adolescents frequently obtain insufficient sleep. [9] Therefore, it is becoming increasingly important to study the prevalence of inadequate sleep duration (IASD) in adolescents and its plausible association with their nutritional status.

Adolescence is considered a period of transition, and the habits that are developed during this period usually continue for life.

Environmental and habitual factors for various diseases, if identified during this period, can be corrected by taking preventive actions before they become incurable for life. IASD or sleep loss due to voluntary bedtime restriction has become a hallmark of modern societies, such as those in the USA and others.[10] Such lifestyle patterns are now increasingly being imported to developing countries such as India.

Timely research and effective intervention can help in restraining this from becoming a pervasive problem, which can potentially affect a significant 22% of the aggregate Indian population, comprising adolescents. A school-based intervention is likely to be more successful in this regard, as adolescence is also considered as a unique phase in life that presents the greatest opportunities for sustained health and wellbeing through education and preventive efforts.[11] Driven by the aforementioned intent and reasons, this study, as a part of a larger study based on the Global School Health Survey, was conducted in the 13 - 15-year-old age group with two objectives: first, the study made an enquiry into the sleep duration in Indian adolescents, and assessed whether this was adequate or inadequate; and second, it sought to evaluate and assess the relationship between sleep duration and the nutritional status of these adolescents, whether overweight/obese.

JANUARY 2015 Vol. 9 No. 1

RESEARCH Methods

This research was a cross-sectional, one-time assessment of nutritional status and selfreported sleep duration at night. The study was conducted over a period of 6 months, from November 2011 to April 2012.

The study was conducted in three different Aligarh schools, all of which are affiliated to the Aligarh Muslim University Board of Examination, and rank among the largest schools in the district of Aligarh. Prior permission was obtained from the school authorities.

The inclusion criterion was all students aged between 13 and 15 years, enrolled in the aforementioned schools, who were present and gave their consent for the study.

The students were weighed with minimal clothing and standing height was used.

The proforma comprised questions on the particulars of the participants and the usual duration of sleep. Concurrently, anthropometry was conducted and recorded. Assessment of average sleep duration was based on the answers to two specific questions: (i) On a usual working day (weekday), what is the time that you go to bed and what is the time that you wake up? (ii) On Saturday nights, what time do you go to bed? and (iii) At what time do you wake up on Sundays? While these questions were drawn from previous published research, there were a few minor adaptations,[12] because these schools are open 6 days a week. The questionnaire was pilot tested and validated before the actual research was conducted.

From the answers to the questions mentioned above, average sleep duration was found to be equal to: (weekday sleep duration × 6/7) + (weekend sleep duration × 1/7).

in the upright position to the nearest 0.1 kg using calibrated instruments, and height was measured without shoes to the nearest 0.1 cm.

Body mass index (BMI) for age z-scores were used to define overweight and obese.

Other precautions taken during the study were regular calibration of instruments and recording date of birth from written records (school register). Those students whose BMIfor-age z-score values were flagged by WHO AnthroPlus during the data entry or who were found to have extreme values were revisited within 2 days, and anthropometry was repeated.

The multidisciplinary Institutional Board of Studies ethically approved the study.

Appropriate counselling, health education, and balanced diet and nutrition advice were offered to all the participants. Those who were in need of referral were referred to the JN Medical College, Aligarh.

Data management and processing

All the students of the three schools who fulfilled the inclusion criteria (N=1 416) were included in the study. Weight and height were entered in WHO AnthroPlus on the day of visit. AnthroPlus was used to find the z-scores (based on the WHO MGRS 2007)[14] for that age and gender.

SPSS (IBM, USA) version 20 was used to derive the relationship between sleep duration and overweight/obesity, and for other relevant statistical calculations. Chisquare tests were applied to determine the differences between sleep duration in males and females, and to examine the association between overweight/obesity and inadequacy of sleep duration, if any. BMI

z-scores of those with IASD were compared with those who had ASD by t-test.

Results

A total of 1 416 students were sampled for the study, including 712 males and 704 females.

Among the study population, 23.6% (n=334) reported IASD, and 76.4% (n=1 082) reported ASD. There was no significant difference between the sleep duration prevalence in males and females (Table 1).

The prevalence of overweight and obesity was found to be 12.3% (n=174) and 2.33% (n=33), respectively, without any significant difference between genders.

Among those with IASD, 19.2% (64/334) were found to be either overweight or obese, significantly higher than 13.2% overweight/ obese in those with ASD. Further analysis revealed that the probability of being either overweight or obese was significantly higher in those who reported IASD (odds ratio (OR)=1.56, 95% confidence interval (CI) 1.12 - 2.15) (Table 2).

The mean (SD) BMI was found to be different in the IASD (22.2 (2.3)) and ASD groups (19.1 (2.3)). The mean BMI-forage z-score for the IASD group was found to be 0.77 (0.57) compared with the ASD group (–0.31 (0.08)), and these values were significantly different on t-testing (t=22.54, df=1; p<0.001). Thus, IASD had a higher OR of being overweight or obese and was also associated with a higher BMI-for-age z-score and with overall BMI.

Discussion

This study found that sleep duration was inadequate in 23.6% of the adolescents, and

Table 1. Prevalence of inadequate and ASD Sleep duration

Sleep duration <7 hours/day was qualified as IASD, and ≥7 hours/day as adequate sleep duration (ASD), based on previous studies. [13] Any adolescent with a body mass for age z-score of ≥1 standard deviation (SD) (equivalent to 85th percentile) was considered overweight, as per the WHO Reference Standards 2007 (WHO AnthroPlus). Any adolescent with a body mass for age z-score of ≥2 SD (equivalent to 97th percentile), was considered obese, as per the WHO Reference Standards 2007 (WHO AnthroPlus).[14] The nutritional status/anthropometric records were assessed against the WHO multicentric growth reference standards (WHO Multicentric Growth Reference Standards (MGRS)), as the WHO AnthroPlus software was used in this study.[14] Anthropometric measurements of weight and standing height were recorded using standard techniques as prescribed. [15] Weight was measured with minimal possible clothing

Age (years)

Gender

IASD, n (%)

ASD, n (%)

Total

Statistical test results

13

Male

36 (16.1)

188 (83.9)

224

Female

48 (20.1)

191 (79.9)

239

χ2 =1.25, df=1, p=0.26

Male

75 (29.8)

177 (70.2)

252

Female

57 (23.5)

186 (76.5)

243

Male

63 (26.7)

173 (73.3)

236

Female

55 (24.8)

167 (75.2)

222

Male

174 (24.4)

538 (75.6)

712

Female

160 (22.7)

544 (77.3)

704

14 15 Total

χ2=2.52, df=1, p=0.11 χ2=0.22, df=1, p=0.64 χ2=0.58, df=1, p=0.45

Table 2. Association of sleep duration with nutritional status

19

Nutritional status

IASD

ASD

Total

Result

Overweight/obese

64

143

207

χ2=7.23, df=1, p<0.007

Normal

270

939

1 209

Total

334

1 082

1 416

SAJCH

JANUARY 2015 Vol. 9 No. 1

RESEARCH those with IASD had a higher chance of developing overweight or obesity and tended to have a higher BMI-for-age z-score than their ASD counterparts. A similar association between a high BMI and obesity has been reported for comparable age groups in Germany,[7] the USA,[4,16] Vietnam,[17] Taiwan[18] and the UK,[19] among others.

In India, Gujarati adolescents of 16 - 19 years old were found to have a significant relationship between IASD at night and body fat percentage and total body fat mass.[13] In south India, in individuals of 6 - 16 years old who visited the hospital for minor complaints or routine checkups, inadequacy of sleep was found to be associated with being overweight, based on International Obesity Task Force[20] standards. In contrast, a report from south India by the National Institute of Nutrition[21] in Hyderabad found no significant difference between the sleep duration of normal and overweight adolescents in south India. To our knowledge, this is the first community-based study in north India with a large sample size that employs the recently recommended WHO MGRS 2007 standards and examines the effect of sleep duration inadequacy.

There are various plausible mechanisms for the association between IASD and obesity. Sleep restriction reduces the secretion of adipocyte and appetite-regulating hormone leptin, and consequently increases one’s appetite.[22] Loss of adequate sleep also results in higher production of ghrelin; the resultant leptinghrelin interaction leads to increased appetite. In addition, sleep inadequacy affects basic metabolic rate and also provides more opportunity to eat. Together with the thermic effect of food,[23] these factors cause tiredness and lead to low physical activity. It is now well-known that regardless of whether sleep deprivation is acute or chronic, both lead to appetite dysregulation and weight gain.

These, in turn, lead to insulin resistance, causing an increased risk of diabetes mellitus type 2.[10] Some studies have also found gender differences in the association between sleep inadequacy and obesity; some found the association to be significant only in boys[19,23,24] and some found a higher probability of association in boys.[25] Our study did not find any such differences either in existence or in the degree of association. IASD was found to have an association with both genders, and there was no significant difference between the degree of association in boys or girls.

Study limitations

The main limitation of this study was that the measurement of sleep duration was based on self-reporting, which may not be the most reliable of the methods. However, there is no reason to believe that the non-obese or non-overweight adolescents could have been the only ones misreporting their sleep duration. Therefore, the authors believe that this limitation may not have a significant effect on the accuracy and generalisability of results. Another important limitation is the issue of temporality, which has been present in many such studies, including the meta-analysis by Cappuccio et al.[6] Without the temporality, that is whether an adolescent had inadequate sleep therefore she/he is obese or vice versa, it is difficult to confirm causality by this study alone.

Conclusions

There is significant epidemiological evidence that points towards the inadequacy of sleep being an obesogenic factor, even in developing countries such as India. With non-communicable diseases accounting for nearly 56% of the total mortality in South-East Asia,[26] in which India has a major share, a variable such as sleep, which may lead to both obesity and/or diabetes mellitus type 2, cannot and should not be ignored.

It should be stressed that for a healthy mind and body, an adequate duration of optimum sleep is important, especially during school education years. Adolescence is a transition phase in human development; sleep deprivation as a habit often develops during 20

SAJCH

this phase because of changes in biological timing of sleep, for example adolescents going to bed later but waking up on time for school.[27] Therefore, specific advice should be given to students at schools. Boarding schools should lay down and enforce strict rules regarding the time to go to bed. Studying late at night should be discouraged, and healthier alternatives should be provided. Because of the vulnerable nature of these ages, advice should also be enforced through primary healthcare centres and adolescent clinics, as the habits developed or strengthened during adolescence often tend to stay for life.

Other important advice suggested by experts includes sleep hygiene, such as a regular bedtime routine, ensuring a suitable bedroom environment with a comfortable bed that should be used only for sleeping (and not reading or listening to music), not indulging in active physical activity within a couple of hours before sleeping, and removal of televisions, computers or other gadgets from the bedroom. It is also important to restrict the intake of caffeinated drinks in the evening or night, and to avoid stimulating activities during bedtime, including but not limited to heavy study, playing computer games, or active debating and discussions. [28] In particular, a key piece of advice is not to have a television in the room in which the adolescent sleeps.[29] Although these suggestions have been researched in other settings, an important opportunity for research exists in developing countries such as India, where these suggestions should be tested further to assess their effectiveness.

References 1. World Health Organization. Nutrition: Controlling the Global Obesity Epidemic. Geneva: World Health Organization, 2013. http://www.who.int/ nutrition/topics/obesity/en/ (accessed 28 September 2013).

2. Gupta DK, Shah P, Misra A, et al. Secular trends in prevalence of overweight and obesity from 2006 to 2009 in urban Asian Indian adolescents aged 1417 years. PLoS One 2011;6(2):e17221. [http://dx.doi.org/10.1371/journal. pone.0017221] 3. World Health Organization. Obesity: Preventing and Managing a Global Epidemic. Report of a WHO Consultation. WHO Technical Report Series No. 894. Geneva: World Health Organization, 2000.

4. Gupta NK, Mueller WH, Chan W, Meininger JC. Is obesity associated with poor sleep quality in adolescents? Am J Hum Biol 2002;14(6):762-768. [http://dx.doi. org/10.1002/ajhb.10093] 5. Lumeng JC, Somashekar D, Appugliese D, Kaciroti N, Corwyn RF, Bradley RH. Shorter sleep duration is associated with increased risk for being overweight at ages 9 to 12 years. Pediatrics 2007;120(5):1020-1029. [http://dx.doi. org/10.1542/peds.2006-3295] 6. Cappuccio FP, Taggart FM, Kandala NB, et al. Meta-analysis of short sleep duration and obesity in children and adults. Sleep 2008;31(5):619-626.

7. Kleiser C, Rosario AS, Mensink GBM, Prinz-Langenohl R, Kurth BM. Potential determinants of obesity among children and adolescents in Germany: Results from the cross-sectional KiGGS study. BMC Public Health 2009;9:46. [http:// dx.doi.org/10.1186/1471-2458-9-46] 8. Knutson KL, van Cauter E, Rathouz PJ, DeLeire T, Lauderdale DS. Trends in the prevalence of short sleepers in the USA: 1975–2006. Sleep 2010;33(1):37-45.

9. Dahl RE, Lewin DS. Pathways to adolescent health sleep regulation and behavior. J Adolesc Health 2002;31(6 Suppl):175-184.

10. Spiegel K, Knutson K, Leproult R, Tasali E, Cauter EV. Sleep loss: A novel risk factor for insulin resistance and type 2 diabetes. J Appl Physiol 2005;99(5):20082019. [http://dx.doi.org/10.1152/japplphysiol.00660.2005] 11. Kleinert S. Adolescent health: An opportunity not to be missed. Lancet 2007;369(9567):1057-1058. [http://dx.doi.org/10.1016/S0140-6736(07)60374-2] 12. Lytle LA, Pasch KE, Farbaksh K. The relationship between sleep and weight in a sample of adolescents. Obesity (Silver Spring) 2011;19(2):324-331. [http:// dx.doi.org/10.1038/oby.2010.242] 13. Shaikh WA, Patel M, Singh S. Sleep deprivation predisposes Gujarati Indian adolescents to obesity. Indian J Community Med 2009;34(3):192-194. [http:// dx.doi.org/10.4103/0970-0218.55282] 14. Blössner M, Siyam A, Borghi E, Onyango A, de Onis M. WHO AnthroPlus for Personal Computers Manual Software for Assessing Growth of the World’s Children. Geneva: World Health Organization, 2009.

15. World Health Organization. Physical Status: The Use and Interpretation of Anthropometry. WHO Technical Report Series No. 854. Geneva: World Health Organization, 1995:439.

16. Snell EK, Adam EK, Duncan GJ. Sleep and the body mass index and overweight status of children and adolescents. Child Dev 2007;78(1):309-323. [http:// dx.doi.org/10.1111/j.1467-8624.2007.00999.x] 17. Dieu HT, Dibley MJ, Sibbritt D, Hanh TT. Prevalence of overweight and obesity in preschool children and associated socio-demographic factors in

JANUARY 2015 Vol. 9 No. 1

RESEARCH Ho Chi Minh City, Vietnam. Int J Pediatr Obes 2007;2(1):40-50. [http://dx.doi. org/10.1080/17477160601103922] 18. Chen MY, Wang EK, Jeng YJ. Adequate sleep among adolescents is positively associated with health status and health-related behaviors. BMC Public Health 2006;6:59. [http://dx.doi.org/10.1186/1471-2458-6-59] 19. Gibson S, Lambert J, Neate D. Associations between weight status, physical activity, and consumption of biscuits, cakes and confectionery among young people in Britain. Nutr Bull 2004;29(4):301-309. [http://dx.doi.org/10.1111/ j.1467-3010.2004.00445.x] 20. Cole TJ, Bellizzi NC, Flegal KM, Dietz WH. Establishing a standard definition for child overweight and obesity worldwide: International survey. BMJ 2000;320(7244):1240-1246. [http://dx.doi.org/10.1136/bmj.320.7244.1240] 21. National Institute of Nutrition. Adolescent Obesity: Andhra Pradesh.

Hyderabad: National Institute of Nutrition, 2007.

22. Mullington JM, Chan JL, van Dongen HP, et al. Sleep loss reduces diurnal rhythm amplitude of leptin in healthy men. J Neuroendocrinol 2003;15(9):851-854.

23. Knutson KL. The association between pubertal status and sleep duration and quality among a nationally representative sample of US adolescents. Am J Hum Biol 2005;17(4):418-424. [http://dx.doi.org/10.1002/ajhb.20405]

21

SAJCH

24. Eisenmann JC, Ekkekakis P, Holmes M. Sleep duration and overweight among Australian children and adolescents. Acta Paediatr 2006;95(8):956-963. [http:// dx.doi.org/10.1080/08035250600731965] 25. Sekine M, Yamagami T, Handa K, et al. A dose response relationship between short sleeping hours and childhood obesity: Results of the Toyama Birth Cohort Study. Child Care Health Dev 2002;28(2):163-170.

26. World Health Organization. Global burden of disease: Updated projections.

Geneva: World Health Organization, 2008. http://www.who.int/healthinfo/ global_burden_disease/estimates_regional/en/index.html (accessed 2 March 2013).

27. Carskadon MA, Acebo C, Jenni OG. Regulation of adolescent sleep: Implications for behavior. Ann N Y Acad Sci 2004;1021:276-291. [http://dx.doi. org/10.1196/annals.1308.032] 28. Taheri S. The link between short sleep duration and obesity: We should recommend more sleep to prevent obesity. Arch Dis Child 2006;91(11):881884. [http://dx.doi.org/10.1136/adc.2005.093013] 29. Spear BA, Barlow SE, Ervin C, et al. Recommendations for treatment of child and adolescent overweight and obesity. Pediatrics 2007;120(Suppl 4):S254-S288. [http://dx.doi.org/10.1542/peds.2007-2329F]

JANUARY 2015 Vol. 9 No. 1

SHORT REPORT

Adherence to phototherapy guidelines in term neonates: Study at a private tertiary-level neonatal unit T Ekram,1 MD; B Singh,2 MD; D Kumar,2 MD; S K Mittal,2 MD; S Kumari,2 MD 1 2

School of Medical Science and Research, and Sharda Hospital, Sharda University, Greater Noida, Uttar Pradesh, India Department of Paediatrics, Pusphanjali Crosslay Hospital, Ghaziabad, Uttar Pradesh, India

Corresponding author: T Ekram (tarique2k3@yahoo.co.in) Guidelines for starting phototherapy for neonatal jaundice in term neonates have been published by the American Academy of Pediatrics (AAP) and others, such as the National Institute for Health and Clinical Excellence (NICE), but the practical implementation of such guidelines and factors associated with possible non-adherence have not been studied. We report our experience at a self-paying tertiary-care hospital. Of the 155 term babies given phototherapy in our hospital between August 2012 and August 2013, 65 (41.9%) babies were found to have received phototherapy at serum bilirubin values lower than recommended AAP guidelines. Factors found responsible for non-adherence to guidelines were: (i) parents’ request for early discharge, with unwillingness to come the next day for follow-up despite borderline serum bilirubin level noted in 25 (38.5%); (ii) clinical assessment of bilirubin was higher than reported laboratory value in 16 (24.6%); and (iii) babies were given phototherapy as parents had been counselled regarding the need for phototherapy by a referring paediatrician in 12 (18.5%).

S Afr J CH 2015;9(1):22. DOI:10.7196/SAJCH.714

Guidelines for giving phototherapy for jaundice in babies born beyond 35 weeks of gestation have been published by various organisations, including the American Academy of Pediatrics (AAP)[1] and others, such as the National Institute for Health and Clinical Excellence (NICE).[2] The practical implementation of such guidelines and factors associated with possible non-adherence have not been studied, especially in self-paying tertiary-care centres of the developing world, such as India. This prompted us to review our data concerning adherence to published phototherapy guidelines, and to determine the reasons, if any, for non-adherence.

Methods

In this retrospective study, the case records of neonates admitted between August 2012 and August 2013 in a self-paying, tertiary-level neonatal intensive care unit (NICU) of northern India were reviewed.

The following were recorded: baby’s and mother’s blood group, gestational age, serum bilirubin level with age in hours, duration of phototherapy, risk factors associated with hyperbilirubinaemia, e.g. history of birth asphyxia,[1] glucose-6-phosphate dehydrogenase (G6PD) status, thyroid profile and sepsis screen (if done). The study protocol received institutional ethics committee approval. Data were analysed using statistical software SPSS version 17 (IBM, USA).

Results

Of 571 admissions, 319 were term babies (including 3 babies who required an exchange transfusion), and 155 infants received phototherapy. Only 90/155 (58.1%) received phototherapy according to the AAP 2004 guidelines (Table 1).[1] In 65 (41.9%) babies, phototherapy was initiated below the recommended serum bilirubin level. In 25/65 (38.5%), phototherapy was initiated because the parents insisted on early discharge and were unlikely to be available for further follow-up. In 12 (18.4%), early phototherapy was initiated because a local paediatrician had referred the baby after counselling.

In 16 (24.6%), clinical assessment of serum bilirubin was considered to be higher than was reported by the laboratory, and among these, 10 babies had risk factors for hyperbilirubinaemia and received phototherapy as a precautionary measure. The median duration of phototherapy was 36 hours in the case of those babies who received phototherapy according to the guidelines, and 24 hours in the case 22

SAJCH

of babies receiving phototherapy below the recommended bilirubin level.

Discussion

In this study, we found that the guidelines for starting phototherapy in term neonates were ignored in more than 40% of babies in this particular hospital. Early intended discharge with reluctance to return for follow-up (most common reason), inappropriate counselling by a referring paediatrician, and discordance between laboratory value and clinical assessment were the key factors that led to non-adherence to available guidelines for the initiation of phototherapy. As phototherapy causes disruption of mother-and-baby bonding and also has cost implications, its empirical use should be minimised. Babies with high-risk factors have more chances of receiving phototherapy despite having a bilirubin level below the recommended level.

Conclusion

Phototherapy guidelines are not always adhered to. Similar studies from other centres are required in order to confirm reasons for nonadherence and to minimise deviation from guidelines.

References

1. American Academy of Pediatrics Subcommittee on Hyperbilirubinemia.

Management of hyperbilirubinemia in the newborn infant 35 or more weeks of gestation. Pediatrics 2004;114(1):297-316. [http://dx.doi.org/10.1542/peds.114.1.297] 2. National Collaborating Centre for Women’s and Children’s Health, for the National Institute for Health and Clinical Excellence (NICE). Neonatal jaundice: Clinical guidelines. London: Royal College of Obstetricians and Gynaecologists, 2010.

Table 1. Characteristics of study population (N=155) Variables

n (%)

Phototherapy given according to guidelines

90 (58.1)

Phototherapy not given according to guidelines

65 (40.1)

Borderline level, parents insisting on early discharge and not willing to return for follow-up 25 (38.5) Parents already counselled by a referring paediatrician

12 (18.5)

Clinical assessment overestimated bilirubin

16 (24.6)

No reason given

12 (18.4)

JANUARY 2015 Vol. 9 No. 1

CASE REPORT

Biochemical and genetic diagnosis of Smith-LemliOpitz syndrome in South Africa G A E Solomon,1,2 MSc; G Jones,3 MB ChB, FCP (SA) (Paed); G de Jong,4 MB ChB, BSc Hons (Genetics), MMed (Paed), MD; A D Marais,1,2,5 MB ChB, FCP (SA) Chemical Pathology, Clinical Laboratory Sciences, University of Cape Town, South Africa Cape Heart Group, Medical Research Council of South Africa, Cape Town, South Africa 3 Sandton Mediclinic, Johannesburg, South Africa 4 Department of Molecular Biology and Human Genetics, Faculty of Medicine and Health Sciences, Tygerberg Hospital, Stellenbosch University, Cape Town, South Africa 5 National Health Laboratory Service, Groote Schuur Hospital, Cape Town, South Africa 1 2

Corresponding author: A D Marais (david.marais@uct.ac.za) Background. The Smith-Lemli-Opitz syndrome (SLOS), due to defective function of 7-dehydrocholesterol reductase, is an autosomal recessive disorder that is more common than other defects in cholesterol biosynthesis. The dysmorphology can be suggestive, but bio­ chemical and genetic investigations are required for confirmation of this diagnosis to assist with the management of the patient and planning for future children in affected families.

Objective. To perform biochemical and genetic work-ups in four South African families of European ancestry with suspected SLOS in a range of presentations, from early fatality, congenital malformations, feeding problems and developmental delay.

Methods. Plasma was analysed by ultraviolet spectrophotometry. The genetic cause was investigated by polymerase chain reaction, followed by high-resolution melting and sequencing of amplicons displaying abnormal patterns.

Results. Spectrophotometry confirmed the diagnosis in three families. Genetic confirmation was made in these patients, and carrier status confirmed in the parents of the fatal case. All the patients were of European ancestry, and the mutations reflected those in European studies.

Conclusion. This rare disorder should be considered in antenatal assessment when increased nuchal lucency is detected on sonography, or in newborns with syndactyly, hypotonia and feeding problems. Less severe forms could present with developmental delay and behavioural problems. Confirmation of the diagnosis may assist in decisions about nutritional management as well as future pregnancies in the affected family and primary relatives.

S Afr J CH 2015;9(1):23-26. DOI:10.7196/SAJCH.771

The clinical description of a dysmorphic syndrome

by Smith, Lemli and Opitz in 1964[1] was linked with abnormal sterol biosynthesis 30 years later. [2] A sys­ tematic review[3] of the effects of abnormal choles­terol biosynthesis indicated that the plasma accumulates 7-dehydrocholesterol and its precursor, and is often associated with hypocholesterolaemia. Nevertheless, the cholesterol concentration may be in the normal range and should not be a deterrent for further investigation when the clinical features are suggestive of this syndrome. Faecal and biliary sterols are abnormal, and bile acid metabolism is also affected. Porter[4,5] reviewed cholesterol biosynthetic errors. Cholesterol precursors that accumulate in SmithLemli-Opitz syndrome (SLOS), lathosterolosis and desmosterolosis disrupt intrauterine development at a critical period of facial and brain development, when cholesterol binds covalently to sonic hedgehog protein involved in signalling to responding cells.[6] Engel­ king[7] investigated the pathogenesis in a mouse model, and demon­ strated that the precursors were operative in bringing about the abnormalities rather than the lack of cholesterol, as suppression of the production of precursors by lovastatin ameliorated the condition.

A clinical review[8] indicated the prevalence of SLOS to be between 1 in 20 000 - 70 000 births in individuals of European descent, with a gene frequency of ~1% for a mutation in 7-dehydrocholesterol reductase (7DHCR). The clinical spectrum of manifestations is broad, but can be summarised as craniofacial abnormalities including cleft palate and microcephaly, postaxial polydactyly and syndactyly of the toes, cardiac defects, pyloric stenosis, aganglionosis of the colon and 23

SAJCH

ambiguous genitalia. Failure to thrive, hypotonia and developmental delay as well as self-injurious behaviour and autism are reported.

Photosensitivity may be marked. The manifestations depend on the severity of the disruption of enzyme activity, and compensatory mechanisms may vary as well. The spectrum has been subdivided into the severe extreme (type 2) and the less severe (type 1); the latter may not be clinically recognised until developmental delay or behavioural problems are noticed. The fetal manifestations have been documented.[9] The diagnosis is best made by gas chromatography and mass spectrometry, but ultraviolet spectrophotometry can detect 7-dehydrocholesterol in extracts from plasma;[10] however, other abnormal precursor sterols could be overlooked by this method.

Dried blood spot analysis may not be ideal, as 7-dehydrocholesterol is prone to oxidation.[11] Amniotic fluid can be used to confirm the diagnosis antenatally.[12] The genetic causes of SLOS in Europe have been summarised[13] and compared with those in the USA. There were some differences in distribution in the European countries, but by far the most common mutation (35%) was at the intron-exon junction of exon 8, with p.trp151X (10%), p.thr95met (8%) and p.val326leu (7%). The first two mutations may have appeared ~3 000 years ago in north-west and north-east Europe. It is not clear whether the heterozygous state confers an advantage, but 7-dehydrocholesterol is the precursor to forming vitamin D in the skin.

Information about SLOS is limited in South Africa (SA). A diagnosis on clinical grounds has been reported.[14,15] In this article, we report experience with referred cases and wish to make medical

JANUARY 2015 Vol. 9 No. 1

CASE REPORT practitioners aware of this condition in order to improve diagnosis, antenatal diagnosis and genetic counselling, as well as to ensure optimal management.

Methods

Blood samples (anticoagulated with ethylene diamine tetra-acetate) were accepted from referring medical practitioners who suspected SLOS on clinical grounds, including samples from the parents, with fasting lipid profiles when possible. Consent for genetic diagnosis was obtained by the medical practitioners. A brief description is given for each family in order of referral. The information is summarised in Table 1 along with the results of genetic investigation.

Family 1

The first-born boy to unrelated parents had abnormal nuchal translucency by sono­ graphic examination at 12 weeks of gestation.

Later, short femora and a ventricular septal defect were identified. At birth by caesarean section in 2008, microcephaly, hypospadias and syndactyly (Fig. 1) were noted along with hypotonia and poor sucking reflexes.

Neurological development was impaired and feeding difficulties were encountered.

Nasogastric feeding was under­taken and later a gastrostomy was performed for feeding.

The plasma cholesterol concentration was 1.1 - 1.5 mmol/L. Cholesterol intake was increased, and plasma cholesterol rose to 3.5 mmol/L. The impression was that such feeding improved wellbeing and behaviour.

The raised plasma 7-dehydrocholesterol (750 μmol/L) was confirmed by ultraviolet spectrophotometry. Transaminase elevation was noted and considered to be part of the inherited disorder. At the age of 4 years, his mass is 22 kg and his height is 0.98 m. He can indicate his wishes but cannot speak. He lives at home and attends a schooling facility during the day.

anteverted nares, syndactyly on the feet and mild deformities of the hand. Feeding difficulties included poor swallowing, reflux and vomiting. A gastrostomy was performed to assist with feeding at 4 months and a Nissen fundoplication was performed to deal with reflux. The biochemical diagnosis of SLOS was made at the age of 6 months, with a 7-dehydrocholesterol concentration of 836 μmol/L. With dietetic help, choles­ terol supplementation was undertaken with a synthetic nutritional formula; staff involved in her treatment were of the opinion that she improved. The plasma cholesterol concentrations ranged from 3.3 to 4.1 mmol/L on cholesterol supplementation. On combination treatment with simvastatin (0.3 mg/kg/day), plasma 7-dehydrocholesterol was 0.125 μmol/L. Head banging, finger biting and pulling of hair started at 14 months. Investigations for ataxia revealed abnormalities of the cerebellar vermis on nuclear magnetic resonance imaging. At the age of 2 years, her developmental assessment placed her at 1 year and she had begun developing autistic behaviour.

Family 3

The first daughter was born with defects and died without a diagnosis within hours, in 1987. The second daughter, born in 1989, had multiple abnormalities including microcephaly, syndactyly and no nasal bridge. She also had a cleft palate. Tube feeding was instituted and projectile vomiting

was noted. The cleft palate was repaired after a year, but feeding remained problematic.

She required positioning so that liquid diets could drain into the stomach. Repeated ear infections resulted in admissions to hospital.

Self-injurious behaviour was noted early on, necessitating the use of a protective helmet.

She did eventually lose sight in both eyes owing to injury. At the age of 24 years, she has a height of 1.13 m and a mass of 22 kg.

She cannot speak, is unable to sit on her own, sleeps little and is incontinent. When sedation was required, diazepam and most other commonly used agents failed, but hydroxyzine was suitable. The third child does not have SLOS.

Family 4

The first boy of unrelated healthy parents was born with a mass of 2.38 kg and low Apgar scores. There were multiple defects and he died on the second day. The antenatal course, including sonography, was unremarkable. At birth, the following features were recorded: webbed neck, rockerbottom feet, polydactyly of the hands and feet, and cardiac murmur.

The clinical diagnosis of SLOS was suggest­ ed. The next pregnancy terminated spon­ taneously, but thereafter a normal female child was born. The diagnosis was pursued in order to counsel the primary relatives, as two brothers had married two sisters.

Biochemical diagnosis

Plasma was separated and sterols were extracted into hexane.[10] Absorbances were

Table 1. Clinical, laboratory and genetic findings in four families with Smith-LemliOpitz syndrome Family 1

Family 2

The first-born girl of unrelated healthy parents had an unremarkable antenatal course, but at caesarean section in 2011 was noted to be hypotonic, microcephalic, had bifrontal narrowing, small palpebral fissures,

Family 2

Family 3

Family 4

Index birth

2008

2011

1989

2011

Status

Alive

Alive

Alive

Deceased

Gender

Male

Female

Female

Male

Ethnicity*

Afrikaans

English

English

Afrikaans

Syndactyly†

Yes

Yes

Yes

Yes

Microcephaly

Yes

Yes

Yes

Yes

Hypotonia

Yes

Yes

Yes

Yes

Cleft palate

No

No

Yes

No

Developmental delay

Yes

Yes

Yes

n/a

Injurious behaviour

Yes

Yes

Yes

n/a

Feeding difficulty

Yes

Yes

Yes

n/a

Abs 282/234 (nm)

3.08

3.12

1.95

n/a

Mutation maternal

G410S

T289I

T93M

W151X

Mutation paternal

G410S

W151X

IVS8-1G>C

V281M

Abs = absorption. *All patients were classified as white, with language group indicating present self-identification. †

Syndactyly is of second and third toes. The rays appear divergent rather than the common abnormality, which appears parallel.

Fig. 1. Syndactyly of second and third digits of the foot in the patient from family 1.

24

SAJCH

JANUARY 2015 Vol. 9 No. 1

CASE REPORT Table 2. Primers for amplification of translated exons in DHCR7 Amplicon

Forward primer 5’ - 3’

Reverse primer 5’ - 3’

Exon 3

CCAGGAGCAGTGGTGGA

CTAGCTGGGAGAACAGGC

Exon 4

CCAGTGTGACTGCCTGCAT

CAGGGCAGGGGCTGCTGA

Exon 5

TTTGCAGGTGCCCTCCAGGCG

GGGATGAGAACGGGAGCCTGGG

Exon 6

GAAAGCGCCTTCATTTCTGAATC

CCCGCTGCTAAGAACATACC

Exon 7

GCTTCATCTTGTGAGATATGCTCATCC

ATCGGCGTTTCACCCTCT

Exon 8

TGATTTCCCCGAGGTCC

CTCTGCCCACCTCCTCA

Exon 9a

CGAGCCCACACTCCTGTC

CACAGGCCAGGCAGTAG

Exon 9b

CAGAGGCACCACAGCAA

CCCTAGGGCGTGCCCTT

recorded at 234 nm and 282 nm, and the ratio was calculated. The molar extinction coefficient was deter­mined with commercially available 7-dehydro­cholesterol. The presence of 7-dehydro­ cholesterol was confirmed by argentation thin-layer chromatography.

Genetic diagnosis

Genomic DNA was extracted using the QIAamp DNA Mini Kit from Qiagen (USA) and screened for mutations in the DHCR7 gene using quantitative real-time polymerase chain reaction (PCR) high-resolution melting (HRM) (RT-qPCR-HRM).

Primer pairs were designed to amplify the coding exons 3 - 9 of the DHCR7 gene, with amplicon lengths ranging from 160 to 370 base pairs (Table 2). Primer melting temperatures were adjusted for the LCGreen family of double-stranded DNA binding dyes. Each exon was analysed in a single PCR product, except exon 9, which was split into two amplicons. Samples were amplified on the LightScanner32 (Idaho Technology Inc, USA), an HRM-enabled, real-time PCR machine, and screened for sequence variations by curve analysis in a single run.

PCR was performed in a 10 µL reaction volume containing 50 ng of genomic DNA, 0.5 µM of each primer, 1× (undiluted) LightScanner Master Mix and PCR-grade water to adjust to the total volume of 10 µL. If necessary, 0.5% dimethyl sulphoxide (DMSO) was added to the reaction. The reaction conditions included an activation step at 95oC for 2 minutes, followed by 40 cycles of 95oC for 10 seconds, variable melting temperatures for 20 seconds, and 72oC for 20 seconds. Before the HRM step, products were denatured at 95oC for 5 seconds and renatured at 40oC for 30 seconds. HRM was carried out over the range of 60oC to 95oC, with a ramp rate of 0.3oC/s.

Results

The spectrophotometric analysis proved effective for the diagnosis of SLOS, as the ratio of absorbances at 234 nm and 282 nm was unequivocally raised in the patients

when compared with a large number of control plasma samples. The patients from families 1, 2 and 3 had ratios of 3.08, 3.12 and 1.95, respectively (normal ratio <0.30).

The mutations identified were all previously reported to be pathogenic, and only one patient was a true homozygote for a pathogenic mutation. The mutations and their association with the parents are indicated in Table 1. The mutations were: exon 4 (threonine substituted by methionine at amino acid 93, T93M), exon 6 (tryptophan codon results in a stop of translation, W151X), exon 8 (threonine substituted by isoleucine at amino acid 289, T289I) and at the junction of the 8th intron and 9th exon, IVS8-1).

Discussion

Healthcare in SA is constrained by limited resources, and the focus is on primary healthcare, including antenatal care, childbirth and health of the infant.

The emphasis on the most common disorders is appropriate, but patients with uncommon or severe disorders, especially those that develop complications competing for facilities and resources, should at least have a diagnosis for making decisions about management. Not only is there a need for assessment of these patients by gynaecologists, obstetricians and paediatricians, but also by clinical geneticists. Special biochemical and genetic investigations that are essential for a diagnosis are limited in SA. We describe four cases in whom the most common severe cholesterol biosynthetic error was fully characterised in families of European ancestry. Not unexpectedly, the mutations correspond with the most frequently reported mutations in Europe, and the clinical manifestations are similar.

The prevalence of SLOS as well as the carrier frequency of this recessive disorder is not well studied in populations other than those of European descent. The clinical features of SLOS are somewhat nonspecific and can vary. The dysmorphology may be 25

SAJCH

JANUARY 2015 Vol. 9 No. 1

less striking with age. The features that could indicate SLOS during pregnancy are increased nuchal lucency and the presence of various malformations. Diagnosis can be made on the amniotic fluid, which has been studied for the presence of 7and/or 8-dehydrocholesterol and its ratio to total cholesterol.[12,16] The expression of the disorder is not only related to the residual enzyme activity but also to certain modifying factors. The clinical appearance at birth is suggestive but not specific, as other disorders need to be considered because several clinical features are shared, especially two other cholesterol biosynthetic errors (desmosterolosis, lathosterolosis).

A careful evaluation should differentiate SLOS from Williams syndrome, WolfHirschhorn syndrome, Smith-Magenis syndrome, Malpuech syndrome, Rett syndrome, craniofacial ciliopathies as well as disorders that can render male genitalia ambiguous. Feeding difficulties and failure to thrive may arise in the neonatal and infantile period. Nutritional support in this period may require special care for adequate energy and nutrient intake, and mode of delivery: nasogastric tube feeding may suffice but percutaneous gastric feeding may be required. Confirmation of the diagnosis indicates that the child will continue failing to thrive, and will need more aggressive intervention for feeding. It is uncertain whether a cholesterol-enriched diet improves development, as the brain relies on de novo synthesis of cholesterol. Simvastatin, as an inhibitor of hydroxy-methylglutaryl co-enzyme A reductase, will limit the production of both 7-dehydrocholesterol and cholesterol, with the former building up as a result of the defect in this disorder.

If there is residual activity to synthesise cholesterol but a reduction of its precursor that may adversely affect its function(s), then there may be improvement. There has, however, been a cautionary note about this therapy.[18] Developmental delay, behavioural problems and autism may later lead to the identification of SLOS. Moreover, termination of pregnancy may be elected when there is an antenatal diagnosis of the disorder, especially in those with a severe phenotype. Proving the diagnosis may thus enhance clinical decisions on management, minimise hospitalisation and reduce expenses for unnecessary investigations, of which some may be very expensive.

In Europe, the most common four mutations overall account for 60% of SLOS. These four mutations were identified in the first four families of European ancestry in SA in whom the diagnosis of SLOS was made. This rare disorder appears not to have a prominent founder effect in SA, as there is a range of mutations. Furthermore,

CASE REPORT there are three mutations in the two families of Afrikaner ancestry.

The parents of the child in family 1 traced back their family without convergence until at least 1740. Systematic genetic detection of mutations in 7DHCR in the population at large is not warranted owing to the rarity of the condition, but consideration should be given to this disorder if antenatal development is abnormal.

Biochemical confirmation of the diagnosis of SLOS without genetic substantiation will allow correct counselling about the risk of the condition being present in 25% of future pregnancies. Genetic identification will allow detection of carriers in the parents’ siblings and other relatives, whose offspring should be monitored more closely, as the frequency for mutations in 7DHCR is suspected in about 1% of European populations.

The formal diagnosis of SLOS by gas chromatography and mass spectrometry is not available in SA. Such diagnostic investigation proved unaffordable in overseas laboratories, as these and other costs in management are supported to only a limited extent by medical schemes, and state hospitals and clinics and their laboratory services. However, the spectrophotometric test is reliable and affordable, and has been shown to be suitable for amniotic fluid extracts with confirmation on thin-layer chromatography.

In the case of SLOS, the concurrence of syndactyly, hypotonia, feeding difficulties and other malformations is highly suggestive of the diagnosis. Ideally, the index of suspicion for severe inherited metabolic disorders should be raised in order that referral and investigation will lead to diagnosis and optimal management amid limited resources. Specialised centres in which clinics work in conjunction with specialised laboratories should be supported to provide for the increasing need to diagnose and manage metabolic disorders that are amenable to biochemical and/or genetic diagnosis. Once the mutations have been identified, chorionic villus biopsy can be undertaken to identify the disorder at the 11th week of pregnancy. Not only would such centres assist in reducing the burden of SLOS within the affected families, but they would also provide important information for teaching and planning of healthcare in SA.

Acknowledgments. We would like to thank Mr AR Mohamed for performing screening tests, Ms B Ratanjee for assistance with sample preparation, Dr M Witsch-Baumgartner and Prof. G Utermann for

26

SAJCH

confirmation of the findings of the first patient, and the parents for assistance in the work-up of families.

References

1. Smith DW, Lemli L, Opitz JM. A newly organized syndrome of multiple congenital abnormalities. J Pediatr 1964;64(2):210-217. [http://dx.doi. org/10.1016/S0022-3476(64)80264-X] 2. Opitz JM, de la Cruz F. Cholesterol metabolism in the RSH/Smith-LemliOpitz syndrome: Summary of an NICHD conference. Am J Med Genet 1994;50(4):326-338.

3. Salen G, Shefer S, Batta AK, et al. Abnormal cholesterol biosynthesis in the Smith-Lemli-Opitz syndrome. J Lipid Res 1996;37:1169-1180.

4. Porter FD. Malformation syndromes due to inborn errors of cholesterol synthesis.

J Clin Invest 2002;110(6):715-724. [http://dx.doi.org/10.1172/JCI16386] 5. Porter FD, Herman GE. Malformation syndromes caused by disorders of cholesterol synthesis. J Lipid Res 2011;52(1):6-34. [http://dx.doi.org/10.1194/jlr.R009548] 6. Porter FD. Cholesterol precursors and facial clefting. J Clin Invest 2006;116(9):2322-2325. [http://dx.doi.org/10.1172/JCI29872] 7. Engelking LJ. Severe facial clefting in Insig-deficient mouse embryos caused by serol accumulation and reversed by lovastatin. J Clin Invest 2006;116(9):23562365. [http://dx.doi.org/10.1172/JCI28988] 8. Porter FD. Smith-Lemli-Opitz syndrome: Pathogenesis, diagnosis and management.

Eur J Hum Genet 2008;16(5):535-541. [http://dx.doi.org/10.1038/ejhg.2008.10] 9. Quélin C, Loget P, Verloes A, et al. Phenotypic spectrum of fetal SmithLemli-Opitz syndrome. Eur J Med Genet 2012;55(2):81-90. [http://dx.doi. org/10.1016/j.ejmg.2011.12.002] 10. Honda A, Batta AK, Salen G, Tint GS, Chen TS, Shefer S. Screening for abnormal cholesterol biosynthesis in the Smith-Lemli-Opitz syndrome: Rapid determination of plasma 7-dehydrocholesterol by ultraviolet spectroscopy. Am J Med Genet 1997;68(3):288-293.

11. Gelzo M, Dello Russo A, Corso G. Stability study of dehydrocholesterols in dried spot of blood from patients with Smith-Lemli-Opitz syndrome, using filter-paper treated with butylated hydroxytoluene. Clin Chim Acta 2012;413(34):525-526. [http://dx.doi.org/10.1016/j.cca.2011.11.008] 12. Griffiths WJ, Wang Y, Karu K, et al. Potential of sterol analysis by liquid chromatography-tandem mass spectrometry for the prenatal diagnosis of Smith-Lemli-Opitz syndrome. Clin Chem 2008;54(8):1317-1324. [http:// dx.doi.org/10.1373/clinchem.2007.100644] 13. Witsch-Baumgartner M, Schwentner I, Gruber M, et al. Age and origin of major Smith-Lemli-Opitz syndrome (SLOS) mutations in European populations. J Med Genet 2008;45(4):200-209. [http://dx.doi.org/10.1136/jmg.2007.053520] 14. De Jong G, Kirby PA, Muller LM. RSH Smith Lemli Opitz Syndrome: Severe phenotype with ectrodactyly. Am J Med Genet 1998;75(3):283-287.

15. Moodliar M, Singh R. Smith-Lemli-Opitz syndrome. Paediatric Quarterly 2010;2:17-20.

16. Kelley RI. Diagnosis of Smith-Lemli-Opitz syndrome by gas chromatography/ mass spectrometry of 7-dehydrocholesterol in plasma, amniotic fluid and cultured fibroblasts. Clin Chim Acta 1995;236(1):45-48.

17. Starck L, LÖvgren-Sandblom A, BjÖrkhem I. Simvastatin in Smith Lemli Opitz Syndrome: A safe approach? Am J Med Genet 2002;113(2):183-189. [http:// dx.doi.org/10.1002/ajmg.10722]

JANUARY 2015 Vol. 9 No. 1

CASE REPORT

A case of disseminated Candida dubliniensis in a preterm infant: The importance of early detection and management of invasive fungal infections in neonates C Crause, MB ChB, MMed

Department of Anatomical Pathology, University of Pretoria; and Tshwane Academic Division, National Health Laboratory Service, Pretoria, South Africa Corresponding author: C Crause (christine.crause@nhls.ac.za)

This case report highlights the importance of timely diagnosis of disseminated fungal infections in neonates, as well as the increased incidence of infection with non-albicans Candida, and the association with surgical conditions such as necrotising enterocolitis.

S Afr J CH 2015;9(1):27-29. DOI:10.7196/SAJCH.722

A preterm male infant of 27 weeks’ gestation was born to a 23-year-old gravida 2, para 1, HIV-negative mother via spontaneous vaginal delivery. Two weeks prior to the delivery, the mother had been admitted for acute pyelonephritis and treated with intravenous antibiotics. The infant weighed 1 kg, considered appropriate for gestational age (AGA) and had low Apgar scores. He was intubated, ventilated and started on surfactant, penicillin G and amikacin. On day 6 post delivery, he developed necrotising enterocolitis (NEC), grade III. A bowel resection was performed and meronem was added. Histology on the bowel resection showed features consistent with NEC. Postoperative sonar examination of the brain revealed an intraventricular haemorrhage, and examination of the heart revealed a patent ductus arteriosus of 3.1 mm. The C-reactive protein and white-cell counts were only marginally raised. A β-D-glucan assay was not done. The infant died on day 14 post delivery, and a postmortem was requested.

External examination of the body showed a male infant, with petechial haemorrhages on the upper extremities and chest. A fresh surgical scar, measuring 4 cm in length, was noted in the

right hypochondrium. Weight, crown-rump length, crown-heel length, foot length and head circumference were AGA. Macroscopic evaluation of the organs showed congestion of both lungs and the liver. The brain appeared markedly autolytic.

Microscopic examination revealed multiple well-formed granu­ lomas in both lungs (Fig. 1), kidneys, the liver (Fig. 2), brain (Fig. 3) and right adrenal gland. Fungal elements consistent with Candida spp. were seen within these granulomas. The periodic acid-Schiff special stain highlighted the fungal organisms (Fig. 4). Examination of the autolytic tissue from the brain showed an extensive fungal meningo­ encephalitis (Fig. 3). Examination of the thymus revealed parenchymal haemorrhages seen in the first 12 hours following a stressful event.

Marked sinusoidal congestion was present in the spleen.

A blood culture was obtained from the infant 2 days prior to his death and the culture was positive for the species Candida dubliniensis.

Review of the histology of the large bowel resection specimen revealed the presence of fungal elements similar to those seen on postmortem examination (Fig. 5). This was not reported at the time of the initial excision.

Fig. 1. Granulomatous inflammation of the lung.

Fig. 2. Granulomatous inflammation of the liver.

27

SAJCH

JANUARY 2015 Vol. 9 No. 1

CASE REPORT

Fig. 3. Fungal elements in the cerebrum (frontal).

Fig. 4. Fungal elements consistent with Candida dubliniensis (PAS special stain). (PAS = periodic acid-Schiff.)

Fig. 5. Fungal elements on the serosal surface of the large bowel (excision specimen, PAS special stain).

Discussion

This case shows an unusual pathogen as cause of sepsis in a preterm infant. The importance of early detection, not only for the clinician but also for the histopathologist, is highlighted in this case report.

A steady decline in the incidence of neonatal fungal blood stream infections has been reported in the USA and Kuwait.[1-3] This is in contrast 28

SAJCH

to a recent study at the Charlotte Maxeke Johannesburg Academic Hospital (CMJAH) neonatal unit, as published by Ballot et al.,[4] which showed an increase in neonatal fungal infections between 2007 and 2011.

It is often difficult to confirm the diagnosis by laboratory investigations, as serological tests are not entirely reliable and microbiological cultures are mostly negative or misinterpreted as colonisation or contamination.

A large number of cases are only diagnosed at autopsy.

Risk factors for fungal sepsis in the neonatal population include very low birth weight, prematurity (<30 weeks), prolonged hospitalisation, mechanical ventilation, endotracheal intubation, use of central venous lines, use of broad-spectrum antibiotics, total parenteral nutrition and previous colonisation with Candida spp.[3] The clinical signs and symptoms are often nonspecific and not easily distinguishable from bacterial sepsis. Onset is insidious, and the mean age of infection is 33 days.[5] Symptoms may include temperature instability, carbohydrate intolerance, hypotension, apnoea, bradycardia and abdominal distension. The spectrum of symptoms may be intermittent and sometimes absent. A septic verylow-birth-weight (VLBW) infant who deteriorates despite antibiotic treatment should be considered to have a fungal infection. Infants who are first diagnosed at autopsy are often of younger age, have fewer predisposing factors and have deteriorated rapidly.[6] Candida spp. colonise up to 60% of VLBW neonates (those weighing <1 500 g) during their first month in the neonatal intensive care unit. Such colonisation may progress to invasive fungal infection in up to 20% of these patients.[7] Systemic neonatal Candida infection has a predilection for certain organs, including skin, eyes, central nervous system and gastrointestinal tract, and is often disseminated at the time of diagnosis (as was also the case in our patient). Candida was found to be an important pathogen in NEC in at least two recent studies.[4,8] The incidence varied from 7.5% in the USA to 23% in South Africa.

The presence of intravascular colonisation of the gastrointestinal tract suggests that candidiasis not only complicates but may in fact cause NEC. Intraluminal fungi damage the endothelial lining with secondary necrosis and an absence of an inflammatory response.

A knowledge of the risk factors, including an association with NEC, awareness of the nonspecific signs and symptoms, as well as negative cultures in these patients should assists clinicians and pathologists in the timely diagnosis of fungal infections in neonates.

In a review of neonatal blood stream infections in the CMJAH neonatal unit between 2002 and 2003, C. albicans was isolated in 80% of cases. Non-albicans spp. were isolated in 20% of cases.[9] When the incidence was calculated for the period 2007 - 2011 at the same institution, a significant increase in non-albicans isolates (specifically C. parapsilosis) was found. A single case of C. dubliniensis was seen.

C. dubliniensis was first isolated from the oral cavities of both HIV-positive and HIV-negative individuals in 1995.[10] Subsequent epidemiological studies have revealed that this species is prevalent globally, is seen in human and non-human habitats, is present in other body sites and has been diagnosed in both HIV-positive and -negative patients. C. dubliniensis has the potential to cause invasive disease, specifically in immunocompromised patients, and may originate from the host’s own flora.[10] There have been several small case series reports of paediatric C. dubliniensis infections, particularly in immunocompromised hosts. These patients are often undergoing chemotherapy for underlying malignancy or are infected with HIV.[11,12] The data on neonatal C. dubliniensis are limited and comprises mainly case reports. [13,14] It is likely that HIV-infected patients are not the only hosts susceptible to these infections, as there is an increasing number of reports of various other infected patient populations.

Kim et al.[15] state that given the lack of clinical significance and reliability of simpler laboratory tests, the additional time and effort required to distinguish all C. albicans isolates from C. dubliniensis

JANUARY 2015 Vol. 9 No. 1

CASE REPORT may not be warranted. Larger epidemiological studies are needed to understand better the pathogenic nature of C. dubliniensis in neonatal patients.

Acknowledgements. Thanks to Profs H Wainwright and R O C Kaschula for their valued comments on the case, and Prof. Delport for requesting the postmortem examination on this patient.

References 1. Fridkin SK, Kaufman D, Edwards JR, Shetty S, Horan T. Changing incidence of Candida bloodstream infections among NICU patients in the United States: 19952004. Pediatrics 2006;117(5):1680-1687. [http://dx.doi/org/10.1542/peds.2005-1996] 2. Chitnis AS, Magill SS, Edwards JR, Chiller TM, Fridkin SK, Lessa FC. Trends in Candida central line-associated bloodstream infections among NICUs, 1999-2009.

Pediatrics 2012;130(1):e46-52. [http://dx.doi.org/10.1542/peds.2011-3620] 3. Al-Sweih N, Khan Z, Khan S, Devarajan LV. Neonatal candidaemia in Kuwait: A 12year study of risk factors, species spectrum and antifungal susceptibility. Mycoses 2009;52(6):518-523. [http://dx.doi.org/10.1111/j.1439-0507.2008.01637.x.]

4. Ballot DE, Bosman N, Nana T, Ramdin T, Cooper PA. Background changing patterns of neonatal fungal sepsis in a developing country. J Trop Pediatr 2013;59(6):460-464. [http://dx.doi.org/10.1093/tropej/fmt053] 5. Nicholls JM, Yuen KY, Tam AY. Systemic fungal infections in neonates. Br J Hosp Med 1993;49(6):420-424.

6. Baley JE, Kliegman RM, Fanaroff AA. Disseminated fungal infections in very low birth weight infants: Clinical manifestations and epidemiology. Pediatrics 1984;73(2):144152.

29

SAJCH

7. Manzoni P. A multicenter randomized trial of prophylactic fluconazole in preterm neonates. N Engl J Med 2007;356(24):2483-2495. [http://dx.doi. org/10.1056/NEJMoa065733] 8. Parra-Herran CE, Pelaez L, Sola, JE, Urbiztondo AK, Rodriguez MM. Intestinal candidiasis: An uncommon cause of necrotizing enterocolitis (NEC) in neonates. Fetal Pediatr Pathol 2010;29(3):172-180. [http://dx.doi. org/10.3109/15513811003777342] 9. Motara FBD, Perovic O. Epidemiology of neonatal sepsis at Johannesburg Hospital.

S Afr J Epidemiol Infect 2005;20(3):4.

10. Loreto ES, Scheid LA, Nogueira CW, Zeni G, Santurio JM, Alves SH. Candida dubliniensis: Epidemiology and phenotypic methods for identification.

Mycopathologia 2010;169(6):431-443. [http://dx.doi.org/10.1007/s11046-0109286-5] 11. Meis JF, Ruhnke M, de Pauw BE, Odds FC, Seigert W, Verweij PE. Candida dubliniensis candidemia in patients with chemotherapy-induced neutropenia and bone marrow transplantation. Emerg Infect Dis 1999;5(1):150-153. [http:// dx.doi.org/10.3201/eid0501.990119] 12. Sebti A, Kiehn TE, Perlin D, et al. Candida dubliniensis at a cancer center. Clin Infect Dis 2001;32(7):1034-1038. [http://dx.doi.org/10.1086/319599] 13. Baradkar VP, Mathur M, Kumar S. Neonatal septicaemia in a preterm infant due to Candida dubliniensis. Indian J Med Microbiol 2008;26(4):382-385. [http://dx.doi.org/10.4103/0255-0857.43574] 14. Grizelj R, Vuković J, Sarić D, Luetić T. Giant mycotic right atrial thrombus due to Candida dubliniensis septicaemia. Pediatr Infect Dis J 2010;29(8):785-786. [http://dx.doi.org/10.1097/INF.0b013e3181e0ccc0] 15. Kim J, Garofalo L, Blecker-Shelly D, McGowen KL. Candida dubliniensis infections in a pediatric population: Retrospective identification from clinical laboratory isolates of Candida albicans. J Clin Microbiol 2003;41(7):3354-3357. [http://dx.doi.org/10.1128/JCM.41.7.3354-3357.2003]

JANUARY 2015 Vol. 9 No. 1

CASE REPORT

Acute fulminant myocarditis complicated by complete atrioventricular block with favourable outcome in a resource-limited setting Q Merchant, MBBS; B S Hasan, MD, FAAP; S Akhtar, MBBS, FCPS (Paed), FCPS Department of Pediatrics and Child Health, Aga Khan University, Karachi, Pakistan Corresponding author: S Akhtar (saleem.sadqani@aku.edu)

Complete heart block in paediatric acute fulminant myocarditis (AFM) is rare and carries a grave prognosis. Aggressive haemodynamic support, especially mechanical support, i.e. with an extracorporeal membrane oxygenator during the initial presentation, improves the outcome in such patients. Unavailability of mechanical support in developing countries warrants aggressive rhythm management to achieve haemodynamic stability. We report a case of a 5-month-old who presented with AFM complicated with complete heart block.

Quick recognition, aggressive cardiopulmonary management and transcatheter placement of a temporary pacemaker as soon as possible resulted in complete recovery in this patient. Aggressive management with rhythm control can lead to a favourable outcome in paediatric patients with AFM complicated by complete heart block, even in a resource-limited set-up.

S Afr J CH 2015;9(1):30-32. DOI:10.7196/SAJCH.656

Myocarditis has an estimated incidence of 10 in 100 000 and is the most common acquired cause of cardiac failure requiring heart transplant in children. [1,2] Viruses form the main aetiological basis, with Coxsackie B virus being responsible for the majority of viral myocarditis cases.[2] The clinical presentation of myocarditis varies from mild fever, flu-like symptoms and malaise to complete cardiovascular collapse, being acute fulminant myocarditis (AFM).[3] AFM is characterised by sudden onset of severe and extensive haemodynamic compromise.[4] Complete atrioventricular heart block (CAVB) is a rare complication of myocarditis and contributes to further haemodynamic compromise. [5] Although more dramatic in its presentation, if it is managed aggress­ ively with mechanical circulatory support, affected patients may have full recovery and less risk of developing dilated cardiomyopathy. [4] In a limited-resource setting where mechanical cardiac support is not available, immediate recognition, management and rhythm control may be the only hope for a favourable outcome.

This case report presents a 5-month-old boy with AFM complicated with CAVB and cardiogenic shock to emphasise the value of early recognition of the disease and the associated rhythm disturbances, timely interventions and aggressive protocol-based management.

Case report

A 5-month-old, previously healthy male presented to the emergency room (ER) of a tertiary care hospital with a 5-day history of high-grade, intermittent fever with associated cough and decreased appetite. He had developed significant respiratory distress 12 - 14 hours prior to his arrival at the ER. The child appeared drowsy and pale, with mottled, cool, clammy skin. Moreover, he was in acute respiratory distress.

He was afebrile (36.8°C) but was found to be hypotensive, tachypneic and bradycardic (40 beats per minute (bpm)). His peripheral pulses were irregular and feeble, while peripheral perfusion was poor (>3 s).

Abdominal examination revealed a palpable liver edge, 4 - 5 cm below the costal margin. The 12-lead electrocardiogram (ECG) findings were consistent with CAVB. Emergent echocardiogram (ECHO) revealed a structurally normal heart, but with moderate to severe biventricular systolic dysfunction with an ejection fraction of 30%.

Initial laboratory work-up revealed raised troponin I levels of 44.5 ng/ 30

SAJCH

mL. Serum electrolytes showed serum creatinine 0.8 mg/dL, blood urea nitrogen (BUN) 31 mg/dL, bicarbonate 15.8 mmol/L, serum glutamic pyruvic transaminase 2 695 IU/L, serum glutamic oxaloacetic transaminase 7 559 IU/L and serum creatine phosphokinase 1 967 IU/L. Provisional diagnosis was AFM with cardiogenic shock. He was started on aggressive supportive therapy with fluids, oxygen and inotropes.

Owing to CAVB and haemodynamic instability, emergent temporary pacemaker insertion was planned. A catheterisation laboratory was available and thus intravenous (IV) pacemaker insertion was planned rather than transcutaneous pacing. While in the ER, the patient went into asystole. Immediate cardiopulmonary resuscitation was initiated and the patient revived in 4 - 5 minutes. He was immediately rushed to the catheterisation laboratory where the temporary transvenous pacing catheter was inserted into the right ventricle at midseptal level (pacing rate: 120 bpm; output: 1 mA; sensitivity: 2; mode: Demand). The ECG at the beginning of catheterisation is shown in Fig. 1. ER presentation to pacemaker placement time (‘door to pacemaker’ time) was <60 minutes.

After the successful procedure, he was moved to the cardiac intensive care unit (CICU). Over the course of his CICU admission, he had persistent hypotension, which was adequately managed by inotropic support with dopamine and milrinone. Treatment with IV immunoglobulin (IVIG) and methyl prednisolone (for inotrope resistant shock) was initiated.

The patient did not develop any subsequent rhythm disturbances and no changes were made to the pacemaker setting over the course of his CICU stay. There was a pacer check every day to see if the patient returned back to sinus rhythm (>80 bpm). According to the CICU treatment protocol and based on the patient’s clinical status and haemodynamic stability, support was weaned accordingly (the patient was extubated before pacemaker removal and the inotropes were subsequently weaned off as tolerated by the patient). Intermittent and eventually sustained atrioventricular conduction returned on the 4th day after admission. The convalescent rhythm was sinus with heart rate at 139 bpm (Fig. 2). Following the improvement in his clinical and cardiac functioning status, the child was finally extubated on the 6th day after admission. IV inotropic support was gradually weaned and the transvenous pacemaker was removed on 7th day after admission.

The child gradually improved and the subsequent echocardiograms done on the 8th day after admission showed normal biventricular

JANUARY 2015 Vol. 9 No. 1

CASE REPORT function with an improved ejection fraction of 70%. The patient was eventually discharged on the 12th day after admission. At latest

follow-up he had made a full recovery. An extensive work-up to determine the etiology of myocarditis could not be done owing

Fig. 1. ECG strip of the patient at the beginning of catheterisation, showing complete heart block.

Fig. 2. ECG at convalescence showing sinus rhythm with heart rate of 139 bpm.

to financial constraints. The mother of the patient was not screened for subclinical lupus.

Discussion

AFM complicated by CAVB carries a grave prognosis if not managed aggressively. Early recognition, rhythm control and institution of mechanical cardiac support improves the outcome.[6] Unfortunately, owing to financial constraints and dearth of resources in the developing world, mechanical circulatory devices are not available to be used in all cases of AFM. However, as shown by this case report, aggressive protocol-based management including adequate inotropic support, venti­ lation and respiratory support, and timely inter­­ ventions such as pacemaker insertion, can bear satisfactory results and be lifesaving (Fig. 3).

It is important to understand that CAVB in myocarditis, though dramatic in presentation, has the potential for full recovery the majority of the time. A systematic review identified a total of 40 patients <20 years of age.[5] Of these, 27 (67%) returned to atrioventricular conduction within 7 days of admission, 11 (28%) required permanent pacing owing to persistent atrioventricular blockage, while

Paediatric ICU management Respiration • Continue PPV for 24 - 48 h.

Wean off as tolerated after 48 h based on CVS evaluation • Switch to BiPAP and then extubate • If tolerated, switch to oral medicines after extubation • Prior to extubation, dexamethasone 0.5 mg/kg/dose

CVS • Place CVL (preferable IJV, SCV) + arterial line • Follow mixed VO2 Q 12 h • Add L-carnitine 100 mg/kg/day for 6 weeks • ECHO: Monitor cardiac functions daily • Pro-BNP: If good marker for monitoring of cardiac dysfunction

CNS • Continue paralysis and sedation for 24 - 48 h • Lift after 48 h and check for CVS signs and symptoms

Monitor frequently for end organ perfusion (urine output, acidosis, skin condition, body temperature, CNS status) • Can use digoxin 5 µg/kg/dose if only persistent tachycardia (age-specific heart rate), urine output >1 mg/kg/h and serum potassium >3.5 mmol. Stop immediately if heart rate <120 bpm, serum potasium <3 mmol or acute kidney injury While weaning off ventilator, check cardiac indicators (heart rate, pulse, perfusion). If stable on VO2 >60 - 65, switch to oral medication • Carvedilol (0.25 mg/kg/day Q 12 h). Increase as tolerated according to SBP

Fluid and electrolytes • Strict I/O charting (keeping in negative balance) Monitor and treat: • Hypoglycaemia • Hypocalcaemia • Acidosis • Hypokalaemia • Electrolytes Q 4 - 6 h • BUN/Cr Q 12 - 24 h • Monitor for acute kidney injury (if present, start peritoneal dialysis) Haematology • Start LMWH 1 mg/kg/dose twice daily for 48 h for DVT prophylaxis

• ACE inhibitors (0.1 mg/kg/dose Q 8 h) • Aspirin (3 - 5 mg/kg/day for 2 days) • Oral furosemide • Oral spironolactone

Abbreviations

Therapeutic measures: If duration of symptoms <1 month, administer IVIG 2 g/kg IV one dose, can be repeated if needed If duration of symptoms ≥1 month, administer prednisolone

Fig. 3. Paediatric intensive care unit management protocol for patients presenting with myocarditis. (PPV = positive pressure ventilation; CVS = cardiovascular system; BiPAP = Bilevel positive airway pressure; CVL = central venous line; IJV = internal jugular vein; SVC = superior vena cava; VO2 = venous oxygen saturation; Q = every; Pro-BNP = Pro-brain natriuretic peptide; CNS = central nervous system; bpm = beats per minute; SBP = systolic blood pressure; ACE = angiotensin converting enzyme; IVIG = intravenous immunoglobulin; I/O = intake output record; BUN/Cr = blood urea nitrogen/creatinine; LMWH = low molecular weight heparin; DVT = deep venous thrombosis.)

31

SAJCH JANUARY 2015 Vol. 9 No. 1

CASE REPORT Emergency room management (first 2 hours) Clinical signs and symptoms • Episodes of AGE/ URTI • Poor feeding, lethargy, irritability, fast breathing • Signs of shock (tacycardia, poor peripheral pulses and perfusion, cold clammy skin) Hepatomegaly and gallop positive

Hepatomegaly and gallop negative

Labs: Trop I (troponin I), pro-BNP, CBC, Na+, K+, HCO3, BUN/Cr, Ca+, RBS, ALT/AST, CXR, ECG, ECHO, group and hold

Labs: CBC, blood chemistry

High suspicion of acute myocarditis 5 mL/kg over 30 min Respiratory treatment • High flow oxygen, PPV • Drugs for intubation: atracurium, fentanyl and ketamine • Avoid succinylcholine and midazolam • CXR if suggestive of pulmonary oedema (treat aggressively)

20 mL/kg IV bolus stat

CVS treatment • Milrinone (0.5 µg/kg/min) if blood pressure normal • Dobutamine (5 - 20 µg/kg/min) + • Dopamine (5 - 10 µg/kg/min) • Epinephrine (0.01 - 0.5 µg/kg/min) if unable to maintain SBP. Can be given through peripheral veins • Furosemide (either 1 mg/kg/dose Q 6 h or infusion 0.1 - 0.4 mg/kg/h IV) • Spironolactone 1 mg/kg/day divided twice daily Monitor and treat arrythmia (poor prognosis if present)

Fluid and CNS electrolyte • Paralyse and sedate: • 2/3 of Atracurium, maintenance fentanyl, fluid morphine, • Keep negative ketamine, fluid balance midazolam • If acidosis • Omeprazole present, treat 1 mg/kg/day with HCO3 • Antibiotics • Goal is to • Packed cells maintain transfusion urine output if Hb <10 g/dL >2 mL/kg/h

Miscellaneous • Keep NPO for first few hours • Omeprazole 1 mg/kg/day • Antibiotics • Packed cells transfusion if Hb <10 g/dL

Hepatomegaly and gallop positive

Hepatomegaly and gallop negative

Septic shock treatment

Fig. 4. ER management protocol for patients presenting with myocarditis. (AGE/URTI = acute gastroenteritis/upper respiratory tract infection; Trop I = troponin I; pro-BNP = pro-brain natriuretic peptide; RBS = random blood sugar; ALT/AST =Alanine/aspartate amino transferase; CXR = chest X-ray; NPO = nothing per oral; CBC = complete blood count.)

2 (5%) passed away. Similarly, Chien et al.[7] identified 9 children with AFM complicated with CAVB, of whom 6 regained normal sinus rhythm, 2 developed persistent CAVB, 1 received permanent pacemaker implantation and 1 died due to persistent low cardiac output and ventricular tachycardia (VT). Our case demonstrated complete recovery by the 8th day after admission.

Early recognition of CAVB rhythm in children with AFM and timely intervention with prompt pacemaker insertion is crucial in these instances, and can be lifesaving as demonstrated by this case report.

Any delay in the treatment can lead to further complications such as VT and irreversible cardiogenic shock. The literature has reported deaths in cases of myocarditis complicated with CAVB attributed to ventricular arrest.[8] Short periods of VT remain a possibility even after pacemaker insertion, and the risk is greatest during the first 2 days after pacemaker insertion. Thus, careful close monitoring and immediate treatment is recommended, as VT can lead to severe haemodynamic compromise.

Periods of VT can be a marker of ongoing or exacerbated myocardial damage and should be aggressively treated to avoid death.[9] A protocol-driven management of such patients can help to streamline care with the intention of improving the outcome. The crux of these protocols should be early recognition and timely (hour-byhour) management as done in patients presenting with septic shock.

Eventually, a decreased cardiac output despite pacemaker insertion and the need for excessive inotropic support is a sign of a poor prognosis.

In such instances, early establishment of extracorporeal membrane oxygenation to optimise cardiac output gives the best chance of survival, 32

which unfortunately is not available in limited-resource settings.[8] In conclusion, outcome can be improved with early recognition and aggressive management of CAVB in patients with myocarditis.

Protocol-based management in the ER can significantly improve the outcomes for these patients (Fig. 4).

References 1. Stiller B. Management of myocarditis in children: The current situation. Adv Exp Med Biol 2008;609:196-215. [http://dx.doi.org/10.1007/978-0-387-73960-1_15] 2. Dancea AB. Myocarditis in infants and children: A review for the paediatrician.

Paediatr Child Health 2001; 6(8):543-545.

3. Amabile N, Fraisse A, Bouvenot J, Chetaille P, Ovaert C. Outcome of acute fulminant myocarditis in children. Heart 2006;92(9):1269-1273. [http://dx.doi. org/10.1136/hrt.2005.078402] 4. McCarthy RE, Boehmer JP, Hruban RH, et al. Long-term outcome of fulminant myocarditis as compared with acute (nonfulminant) myocarditis. N Engl J Med 2000;342(10):690-695. [http://dx.doi.org/10.1056/NEJM200003093421003] 5. Batra AS, Epstein D, Silka MJ. The clinical course of acquired complete heart block in children with acute myocarditis. Pediatr Cardiol 2003;24(5):495-497. [http://dx.doi.org/10.1007/s00246-002-0402-2] 6. Heitink-Pollé KM, Rammeloo L, Hruda J, Plötz FB. Rapid and full recovery after life-threatening complete atrioventricular block: An isolated feature of myocarditis?

Eur J Pediatr 2004;163(7):410-411. [http://dx.doi.org/10.1007/s00431-004-1455-4] 7. Chien SJ, Liang CD, Lin IC, Lin YJ, Huang CF. Myocarditis complicated by complete atrioventricular block: Nine years’ experience in a medical center. Pediatr Neonatol 2008;49(6):218-222. [http://dx.doi.org/10.1016/S1875-9572(09)60014-0] 8. Duncan BW, Bohn DJ, Atz AM, French JW, Laussen PC, Wessel DL. Mechanical circulatory support for the treatment of children with acute fulminant myocarditis. J Thorac Cardiovasc Surg 2001;122(3):440-448. [http://dx.doi. org/10.1067/mtc.2001.115243] 9. Kato S, Morimoto S, Hiramitsu S, et al. Risk factors for patients developing a fulminant course with acute myocarditis. Circ J 2004;68(8):734-739.

SAJCH JANUARY 2015 Vol. 9 No. 1

CPD January 2015 The CPD programme for SAJCH is being administered by Medical Practice Consulting: CPD questionnaires must be completed online at www.mpconsulting.co.za

True (T) or False (F): Regarding positioning of endotracheal tubes in neonates: 1. The position of an endotracheal tube in neonates in an intensive care unit can feasibly be assessed by bedside ultrasonography rather than by using chest radiography.

2. The thyroid gland lies at the vertebral level of C4/5.

3. Tracheal bifurcation occurs in most neonates, at the level of T4.

Regarding external ventricular drains: 4. Ventriculitis in children who have external ventricular drains (EVD) is associated with the duration that EVDs are in situ.

5. Streptococcus is a common organism cultured in ventriculitis.

Regarding perinatal health statistics in KwaZulu-Natal: 6. Home deliveries are a common occurrence in Amajuba district of KwaZulu-Natal.

7. Nearly one-third of mothers in 2012 attended antenatal care clinics before 20 weeksâ&#x20AC;&#x2122; gestation.

8.

The intensification of the prevention of mother-to-child transmission programme has been associated with a dramatic decline in maternal deaths.

Regarding anaemia in children: 9.

In Nigerian <5-year-old children presenting with anaemia, glucose-6-phosphate dehydrogenase (G6PD) deficiency is present in about a quarter of patients.

10. The World Health Organization classifies children (6 months 5â&#x20AC;&#x201A; years of age) as being anaemic if Hb <13 g/dL. 11. Helminth infections are a common cause of anaemia in children <5 years of age.

Regarding sleep duration and nutrition in children: 12. Excessive sleep duration is associated with obesity in adolescents.

13. Adequate sleep duration is considered to be >7 hours/night for adolescents.

Regarding phototherapy in neonates: 14. Over 40% of full-term infants in a tertiary care hospital in India had phototherapy initiated not in accordance with recognised international guidelines.

Regarding the Smith-Lemli-Opitz syndrome: 15. The molecule 7-dehydrocholesterol is a precursor of skin synthesis of cholecalciferol.

16. The presence of syndactyly, hypotonia and feeding difficulties is suggestive of the diagnosis.

Regarding neonatal infections: 17. In preterm infants admitted to neonatal units, colonisation by non-albicans Candida species is more common than colonisation with Candida albicans.

18. Candida species colonise up to 60% of very-low-birth-weight infants during the first month of life in the neonatal intensive care unit.

Regarding acute myocarditis in children: 19. Coxsackie A virus is responsible for the greatest proportion of cases.

20. Complete atrioventricular heart block is a serious complication of acute myocarditis.

A maximum of 5 CEUs will be awarded per correctly completed test.

CPD questionnaires must be completed online via www.mpconsulting.co.za. After submission you can check the answers and print your certificate. Accreditation number: MDB001/009/01/2014 (Clinical)

33

SAJCH

JANUARY 2015 Vol. 9 No. 1