SAMJ Vol 105, No 1 (2015)

JANUARY 2015

VOL. 105 NO. 1

The humanistic side of medical education

3

Medical certification of death

27

The iPhone as a screening tool for deafness

31, 35

The HPV Vaccine and Cervical Cancer Screen (VACCS) project

33, 40

Severe blunt thoracic trauma: Differences between adults and children CME: Food allergy

47 62-74

REFRESH YOUR MAC FOR ONLY R899

techxperts.co.za

800

R

08600 11 700

iPad Air WiFi + Cellular 16GB

7499

R

90

WARRANTY

1 YEAR

(86932,89216,89373,87350) MS

+

we’ll come to you

we’ll fix it

• iOS 8 Ready • FaceTime HD camera • 1080p HD video recording • A7 chip with 64-bit architecture • M7 motion coprocessor

INCLUDES: Soulmate Tablet Bag Everlast iPad Air Screen Protector Microsoft Office 365 Personal TOTAL VALUE R8199.90

Available in all stores nationwide.

Visit techxperts.co.za for the detailed Mac Refresh service checklist.

IT business solutions

+

Offer valid January 2014. Exclusive to Medical Journal SA Readers. Terms & Conditions apply.

Visit incredible.co.za for full Terms & Conditions. MS - Mega Stores only. Please call 0860 011 700 to confirm stock availability

DTP 5356

January 2015

GUEST EDITORIAL

3

The humanistic side of medical education S Benatar

4

EDITOR’S CHOICE

VOL. 105 NO. 1

EDITOR Janet Seggie, BSc (Hons), MD (Birm), FRCP (Lond), FCP (SA) EDITOR EMERITUS Daniel J Ncayiyana, MD (Groningen), FACOG, MD (Hon), FCM (Hon) CONSULTING EDITOR JP de V van Niekerk, MD, FRCR

CORRESPONDENCE 5

Injury severity in relation to seatbelt use F M Abu-Zidan

5

Driving innovation, leadership and change at Groote Schuur Hospital, Cape Town, South Africa B Patel

IZINDABA 7 8 9 11 13

Mental health under-budgeting undermining SA’s economy Turning ‘fate’ into destiny by seizing a second chance at life Basson unrepentant as drawn-out sentencing argument begins SA’s ailing public health sector ‘responding to treatment’?

Litigation benefits state-delivered medicine – but for how long?

15 15

16

BOOK REVIEWS Troubled Children – Poems of Contemplation The Primary Health Care Approach and Restructuring of the MB ChB: A Case Study of the Faculty of Health Sciences, University of Cape Town The AIDS Conspiracy: Science Fights Back

SAMJ FORUM

17

CLINICAL ALERT Listerial brainstem encephalitis – treatable, but easily missed P Fredericks, M Britz, R Eastman, J A Carr, K J Bateman

21

MEDICAL EDUCATION The research component of specialist registration – a question of alligators and swamps?

A personal view C M Aldous, M Adhikari, C C Rout

23

GENETICS IN MEDICINE No evidence for clinical utility in investigating the connexin genes GJB2, GJB6 and GJA1 in non-syndromic hearing loss in black Africans A Wonkam, J Bosch, J J N Noubiap, K Lebeko, N Makubalo, C Dandara

27

MEDICAL PRACTICE Medical certification of death in South Africa – moving forward E H Burger, P Groenewald, A Rossouw, D Bradshaw

EDITORIALS 31

Turning up the volume on hearing loss in South Africa S Peer

33

Cervical cancer prevention in South Africa: HPV vaccination and screening both essential to achieve and maintain a reduction in incidence M H Botha, K L Richter

RESEARCH 35

Hearing loss in the developing world: Evaluating the iPhone mobile device as a screening tool S Peer, J J Fagan

40

The Vaccine and Cervical Cancer Screen (VACCS) project: Acceptance of human papillomavirus vaccination in a school-based programme in two provinces of South Africa M H Botha, F H van der Merwe, L C Snyman, G Dreyer

1

January 2015, Vol. 105, No. 1

DEPUTY EDITOR Bridget Farham, BSc (Hons), PhD, MB ChB SCIENTIFIC EDITOR Ingrid Nye, BSc TECHNICAL EDITORS Paula van der Bijl, BA, HDipLib Emma Buchanan, BA NEWS EDITOR Chris Bateman | Email: chrisb@hmpg.co.za HEAD OF PUBLISHING Robert Arendse PRODUCTION COORDINATOR Bronlyne Granger ART DIRECTOR Brent Meder DTP & DESIGN Carl Sampson ONLINE MANAGER Gertrude Fani DISTRIBUTION MANAGER Edward Macdonald | Tel. 021-681-7085 HEAD OF SALES AND MARKETING Diane Smith | Tel. 012-481-2069 Email: dianes@samedical.org PROFESSIONAL ADVERTISING Bronlyne Granger | Tel. 021-681-7000 E-mail: bronlyne.granger@hmpg.co.za HMPG BOARD OF DIRECTORS Prof. M G Veller (Chair), Prof. M Lukhele, Dr M Mbokota, Prof. A A Stulting, Dr M R Abbas, Dr G Wolvaardt ASSOCIATE EDITORS Q Abdool Karim, A Dhai, N Khumalo, R C Pattinson, A Rothberg, A A Stulting, J Surka, B Taylor, M Blockman ISSN 0256-9574 Publisher website: www.hmpg.co.za SAMA website: www.samedical.org Journal website: www.samj.org.za

The number 1 selling , most affordable 14’s pack.

1

2

R36,65 SEP excl.VAT

2

E F F E C T I V E A F F O R D A B L E H E A LT H C A R E For further product information contact PHARMA DYNAMICS : P O Box 30958 Tokai 7966 • Tel 021 707 7000 • Fax 021 701 5898 • www.pharmadynamics.co.za • Customer Care Line 0860-PHARMA (742 762) Lancap 15mg. Each capsule contains 15 mg lansoprazole. Reg No.: RSA S4 40/11.4.3/0247 NAM NS2 07/11.4.3/0098. For full prescribing information, refer to the package insert approved by the Medicines Control Council. 1) IMS data, Units MAT/06/2014. 2) Department of Health website: http://www.doh.gov.za. LOB61/09/2014.

43

High concentrations of natural rubber latex allergens in gloves used by laboratory health personnel in South Africa* M E Ratshikhopha, T S Singh, D Jones, M F Jeebhay, A L Lopata

47

Severe blunt thoracic trauma: Differences between adults and children in a level I trauma centre D L Skinner, D den Hollander, G L Laing, R N Rodseth, D J J Muckart

52

Mapping South African public health research (1975 - 2014)* B Poreau

56 Regulation of HIV receptor expression in cervical epithelial cells by Gram-negative bacterial lipopolysaccharide*

K J Sales, T Klein, A A Katz

CONTENTS LISTED IN Index Medicus (Medline).

Excerpta Medica (EMBASE).

Biological Abstracts (BIOSIS).

Science Citation Index (SciSearch). Current Contents/Clinical Medicine SAMJ SUBSCRIPTION RATES Local subscriptions R1 248.00 p.a.

Foreign subscriptions R2 832.00 p.a.

Single copies R104.00 Members of the Association receive the SAMJ only on request, as part of their membership benefit.

CONTINUING MEDICAL EDUCATION

62

REVIEW South African food allergy consensus document 2014 M E Levin, C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, for the South African Food Allergy Working Group (SAFAWG)

66

ARTICLES Non-IgE-mediated food allergies A J Terblanche, A C Lang, C L Gray, E Goddard, S Karabus, M Kriel, A I Manjra, S M Risenga, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

67

Exclusion diets and challenges in the diagnosis of food allergy A C Lang, A I Manjra, A J Terblanche, S M Risenga, C L Gray, E Goddard, S Karabus, M Kriel, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

68

Epidemiology of IgE-mediated food allergy C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

© Copyright: Health and Medical Publishing Group (Pty) Ltd, a subsidiary of the South African Medical Association

69

Diagnosis of food allergy: History, examination and in vivo and in vitro tests D A van der Spuy, A J Terblanche, S Karabus, M Kriel, A I Manjra, E Goddard, C L Gray, A C Lang, S M Risenga, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

71

Elimination diets and dietary interventions for the management of food allergies A C Lang, D A van der Spuy, E Goddard, A J Terblanche, M Kriel, C L Gray, S Karabus, A I Manjra, S M Risenga, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

Use of editorial material is subject to the Creative Commons Attribution – Noncommercial Works License. http://creativecommons.org/licenses/bync/3.0

72

Severe food allergy and anaphylaxis: Treatment, risk assessment and risk reduction S M Risenga, M Kriel, S Karabus, A I Manjra, C L Gray, E Goddard, A C Lang, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

73

Vaccination in food allergic patients S Karabus, C L Gray, E Goddard, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

74

Novel therapies in the management of food allergy: Oral immunotherapy and antiimmunoglobulin E C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG)

South African Food Allergy Working Group (SAFAWG) authors of the South African food allergy consensus document 2014† M E Levin, C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, for the South African Food Allergy Working Group (SAFAWG)

*Full article available online only.

Available online only.

Subscriptions: Tel. 012-481-2071 E-mail: members@samedical.org The SAMJ is published monthly by the Health and Medical Publishing Group (Pty) Ltd, Co. registration 2004/0220 32/07, a subsidiary of SAMA. 28 Main Road (Cnr Devonshire Hill Road), Rondebosch, 7700 Tel. (021) 681-7200.

E-mail: publishing@hmpg.co.za Website: www.samedical.org Please submit all letters and articles for publication online at www.samj.org.za

Plagiarism is defined as the use of another’s work, words or ideas without attribution or permission, and representation of them as one’s own original work. Manuscripts containing plagiarism will not be considered for publication in the SAMJ. For more information on our plagiarism policy, please visit http://www.samj.org.za/ index.php/samj/about/editorialPolicies Printed by Creda Communications

†

PROFESSIONAL ADVERTISING CPD QUESTIONS

‘Elephant Sundowner.’

A group of elephants approach a water hole for their evening drink in Mpumalanga, South Africa.

Artist: Dr Roger Melvill, Neurosurgeon

2

January 2015, Vol. 105, No. 1

™

GUEST EDITORIAL

The humanistic side of medical education The influential Flexner report of 1910 was the precursor of innovation in modern medical curricula, and by correctly placing knowledge of the human body and of biological science at the centre of medicine, great strides were made in medical education and practice.

William Osler in his 1919 presidential address to the British Classical Society entitled ‘The old humanities and the new medicine’ described how ‘Scientific education and the humanities should inform each other ... The humanities are the hormones … which do for society at large what the thyroid gland does for the individual.’[1] Less attention was paid to this recommendation for medical education, despite Osler’s status as a revered clinician and teacher.

One hundred years after the Flexner Report recommended major changes to medical education, an international panel has released a vision of medical education for the 21st century.[2] The report calls for doctors to be transformative leaders and team workers for change in a very different and globalised world. The judicious application of modern medical knowledge and technological skills in the practice of medicine unquestionably requires the ability to work effectively in multidisciplinary teams and to have appropriate attitudes to patients and colleagues. The same applies to undertaking medical research for the advancement of knowledge.

This new international report briefly notes the importance of ethics, and values are mentioned several times. However, no account is offered of either the values that should be exemplified in health professional education, or the content and method of ethics education relevant to 21st-century healthcare.

Humanistic attributes relevant to healthcare include the ability to listen to and observe sensitively all aspects of our shared human vulnerability and frailties, with appreciation of the diversity of social, cultural and environmental differences that shape people’s lives and health in myriad ways. Moral imagination helps us to see ourselves in the ‘other’ (especially in multicultural and class-differentiated societies), and to have compassion and empathy for suffering and the stresses of lives that may be very different from our own. Never to be forgotten is the imperative to respect the uniqueness and individuality of every person and to have an existential appreciation of life’s value and its finitude. Sensitivity to ethical dilemmas is also crucial.

While these attributes have long been valued as an essential aspect of medical practice, they have received much less formal attention in medical education. However, in recent decades there has been a re-emphasis on teaching the humanities in medicine.[3-5] Methods used to instil or promote such qualities in aspirant practitioners range from theoretical courses in the humanities, including ethics, through practical uses of art, music and narratives in literature and theatre to illustrate human life in all its agonising varieties.[5,6] More recently, the role of ‘virtue as excellence’ in the practice of medicine has been promoted.[7] Virtuous traits encompass rigour and objectivity as intellectual abilities, and such ethical attributes as honesty, compassion and temperance. These virtues derive from commitment to excellence as the internal purpose of the professional role and from the

3

habits of working practically and self-reflectively within one’s professional field.

The hope of teaching the humanities in medicine is that improvement in attitude and practice may result from sensitising students to the many complex social and ethical issues faced in healthcare, and through providing them with insight into the role of moral reasoning in ranking potential solutions with justifying reasons and transparency.[8] Clearly, good examples shown by established clinicians and teachers at the bedside and by leaders who set institutional and national policies could inspire emulation by new generations of health professionals.

Excellence in all these aspects of practice provides the grounds for inspiring confidence, trust and hope without deceit, and trust remains an important ingredient in the medical context. Those who have experienced the internal satisfaction of caring well for fellow humans and who have benefited from such care themselves, become more aware of this critically important role of healthcare professionals.

The humanities sensitise us to comprehend that the achievement of good health is dependent on more than the provision of healthcare.

The foundations of good health lie in better living conditions and other social and societal determinants of health that optimise maternal and child health and provide a good start to life. These are the precursors for improving lives that can then benefit further from modern medicine.[9] Healthcare cannot be seen in isolation, and changes in medical education and healthcare services are more likely to be implemented successfully if associated with improvements in these other spheres of our lives.[10] Healthcare professionals can contribute on all these fronts through their clinical skills and humanistic practices, and by being agents for constructive progress in their communities and globally at a very challenging time in history.

Solomon Benatar Bioethics Centre, University of Cape Town, South Africa, and Joint Centre for Bioethics, University of Toronto, Canada solomon.benatar@uct.ac.za 1. Osler W. The Old Humanities and the New Science. Boston: Houghton Miflin, 1920:26-28.

2. Frenk J, Chen L, Bhutta ZA, et al. Health professionals for a new century: Transforming education to strengthen health systems in an interdependent world. Lancet 2010;376(9756):1923-1958. [http:// dx.doi.org/10.1016/S0140-6736(10)61854-5] 3. Benatar SR. The humanities in medicine at UCT. S Afr Med J 1997;87(12):1662-1664.

4. Seggie J. Medicine and the humanities: Doctors as artists. S Afr Med J 2014;104(2):92. [http://dx.doi. org/10.7196/SAMJ.7936] 5. Reid S. The ‘medical humanities’ in health sciences education in South Africa. S Afr Med J 2014;104(2):109-110. [http://dx.doi.org/10.7196/SAMJ.7928] 6. Kumagai AK. A conceptual framework for the use of illness narratives in medical education. Acad Med 2008;83(7):653-658. [http://dx.doi.org/10.1097/ACM.0b013e3181782e17] 7. Benatar SR, Upshur R. Virtue in medicine reconsidered: Individual health and global health. Perspect Biol Med 2013;56(1):126-147. [http://dx.doi.org/10.1353/pbm.2013.0005] 8. Benatar SR, Benatar D. From medical manners to moral reasoning: An historical overview of Bioethics in the UCT Faculty of Health Sciences. S Afr Med J 2012;102(6):406-408.

9. Birn A-E. Addressing the societal determinants of health: The key global health ethics imperative. In: Benatar S, Brock G, eds. Global Health and Global Health Ethics. Cambridge: Cambridge University Press, 2011:37-52.

10. Mayosi BM, Benatar SR. Health and health care in South Africa: 20 years after Mandela. N Engl J Med 2014;371:1344-1353. [http://dx.doi.org/10.1056/NEJMsr1405012]

S Afr Med J 2015;105(1):3. DOI:10.7196/SAMJ.9043

January 2015, Vol. 105, No. 1

EDITOR’S CHOICE

CME: Food allergy

The prevalence of food allergy is increasing worldwide, and it is an important cause of anaphylaxis. There are no local South African (SA) food allergy guidelines. This issue of CME was developed from guidelines devised by the Allergy Society of South Africa, the South African Gastroenterology Society and the Association for Dietetics in South Africa. Subjects may have reactions to more than one food, and different types and severity of reactions to different foods may coexist in one individual. A detailed history directed at identifying the type and severity of possible reactions is essential for every food allergen under consideration. Skin-prick tests and specific IgE (ImmunoCAP) tests prove IgE sensitisation rather than clinical reactivity. The magnitude of sensitisation combined with the history may be sufficient to ascribe causality, but where this is not possible a graded oral food challenge may be required to assess tolerance or clinical allergy. For milder non-IgE-mediated conditions a diagnostic elimination diet may be followed by food reintroduction at home to assess causality. The primary therapy for food allergy is strict avoidance of the offending food/s, taking into account nutritional status and provision of alternative sources of nutrients.

This issue of CME leads the generalist carefully through the epidemiology, diagnosis and management of the food allergic patient.

Preventing cervical cancer

Primary prevention of cervical cancer is now possible with the availability of human papillomavirus (HPV) vaccines targeting HPV types 16 and 18, which cause the majority of cervical cancers worldwide. The target population for primary prevention is initially girls aged between 9 and 11 years, attending primary school.

Importantly, medical aids are encouraging vaccination of boys also!

In this issue we publish the first of a series of three papers that trumpet the success of the Vaccine and Cervical Cancer Screen (VACCS) project,[1,2] a school-based HPV vaccination project that gives reality to the announcement in May 2013 by Dr Aaron Motsoaledi, Minister of Health, that ‘… we shall commence to administer the HPV vaccines as part of our school health programme ...’ against a background of an uncontrolled cervical cancer epidemic resulting from high prevalences of HPV and HIV and a relatively unsuccessful cervical cancer screening programme.

Do bacterial STIs enhance HIV susceptibility?

Sales et al.[3] provide evidence how, at a biological level, HIV suscepti­ bility may be enhanced by bacterial sexually transmitted infections (STIs) mediated by Chlamydia trachomatis and Neisseria gonorrhoeae in sexually active women. Broadly, the endotoxic lipopolysaccharide component of bacterial STIs, which are very common in sexually active women, can regulate expression of HIV receptors in the cervical epithelium by increasing the abundance of cell surface machinery used by the HI virus for establishment of infection.

Testing hearing with smartphones

We drew attention in the December SAMJ to use of the cell phone camera in photographing the red reflex in infants’ eyes to ensure early pickup of retinoblastoma.[4] Smartphones have the potential to test hearing through audiometric applications. Given the upsurge of mobile technology in Africa, Peer and Fagan[5,6] evaluated the uHear app (using an Apple iPhone) as a possible hearing screening tool in the developing world. They conclude that it is a feasible screening test to rule out significant hearing loss (pure-tone average >40 dB). It is also highly sensitive for detecting threshold changes at high frequencies, making it reasonably well suited to detect presbycusis, and ototoxic

4

hearing loss caused by HIV and tuberculosis medications. Its portability and ease of use make it opportune to use in communities that lack screening programmes.

Blunt thoracic trauma in children and adults

Few researchers have investigated differences in injury patterns between adults and children. Skinner et al.[7] compare and contrast the incidence and outcomes of blunt thoracic trauma in these two groups.

The commonest mechanism of injury was a motor vehicle collision (MVC), with 75.0% of children being injured during (preve­ ntable!) pedestrian MVCs. Injury patterns differed between adults and children.

Children are far more likely than adults to sustain head injury together with their thoracic trauma, because of their proportionally larger head-tothoracic ratio and their injury as pedestrians. Thoracic injuries consisted predominantly of pulmonary contusions, rib fractures, flail chests and blunt cardiac injury, the incidence of pulmonary contusion being highest in the paediatric group. The increased skeletal compliance and absence of rib fractures in children can make the diagnosis of pulmonary contusions especially difficult – absence of rib fractures in injured children does not signal its absence. Blunt cardiac injury in children is relatively underdiagnosed, but when clinically relevant diagnostic criteria were applied, the authors found a surprisingly high incidence of 10%.

Medical certification of death in SA[8]

We remain notoriously sloppy about filling in the Medical Certificate of Cause of Death, despite improvements to the SA Death Notification Form (DNF). The quality of cause-of-death information remains suboptimal. Clearly, the DNF should be completed truthfully and accurately, and confidentiality of the information on the form maintained. Despite the high prevalence of HIV, estimated to be around 12% according to official statistics, HIV purportedly accounts for only 3% of deaths nationally, signalling gross under-reporting.

There are other quality concerns in the statistical information: a quarter of deaths were reported as due to ill-defined or unknown natural causes (including cardiorespiratory arrest, heart failure, hypoxia, and other nonspecific causes of death), which do not provide information useful for planning prevention strategies. There is also uncertainty about the manner of death for injury deaths, making it difficult to determine whether the injuries were caused by accidents, homicide or suicide. Deaths from gunshot injuries of undetermined intent are currently coded as accidents, thus under-representing homicides in Statistics South Africa data, and misrepresenting the real burden from homicide deaths.

A guide to completing the Notice of Death/Stillbirth (DHA1663) is available at http://www.sahealthinfo.org/bod/deathtraining/ guideline.htm JS 1. Botha MH, van der Merwe FH, Snyman LC, Dreyer G. The Vaccine and Cervical Cancer Screen (VACCS) project: Acceptance of human papillomavirus vaccination in a school-based programme in two provinces of South Africa. S Afr Med J 2015;105(1):40-43. [http://dx.doi.org/10.7196/SAMJ.8419] 2. Botha MH, Richter K. Cervical cancer prevention in South Africa: HPV vaccination and screening both essential to achieve and maintain a reduction in incidence. S Afr Med J 2015;105(1):33-34. [http:// dx.doi.org/10.7196/SAMJ.9233] 3. Sales KJ, Klein T, Katz AA. Regulation of HIV receptor expression in cervical epithelial cells by Gram-negative bacterial lipopolysaccharide. S Afr Med J 2015;105(1):56-61. [http://dx.doi.org/10.7196/SAMJ.8185] 4. Freeman N, Meyer D. Towards early detection of retinoblastoma. S Afr Med J 2014;104(12):856. [http://dx.doi.org/10.7196/SAMJ.8741] 5. Peer S, Fagan J. Hearing loss in the developing world: Evaluating the iPhone as a screening tool. S Afr Med J 2015;105(1):35-39. [http://dx.doi.org/10.7196/SAMJ.8338] 6. Peer S. Turning up the volume on hearing loss in South Africa. S Afr Med J 2015;105(1):31-32. [http:// dx.doi.org/10.7196/SAMJ.9218] 7. Skinner DL, den Hollander D, Laing GL, Rodseth RN, Muckart DJJ. Severe blunt thoracic trauma: Differences between adults and children in a level 1 truama centre. S Afr Med J 2015;105(1):47-51. [http://dx.doi.org/10.7196/SAMJ.8499] 8. Burger EH, Groenewald P, Rossouw R, Bradshaw D. Medical certification of death in South Africa – moving forward. S Afr Med J 2015;105(1):27-30. [http://dx.doi.org/10.7196/SAMJ.8578]

January 2015, Vol. 105, No. 1

CORRESPONDENCE

Injury severity in relation to seatbelt use

To the Editor: I read the article by Van Hoving et al.[1] with great interest. Two interesting aspects of the study are that it included patients in the prehospital setting, and involved both the Division of Emergency Medicine and the Department of Civil Engineering at their institution (Stellenbosch University, Western Cape, South Africa). The authors acknowledge that it is a pilot study with many limitations. Nevertheless, important lessons can be learned from it that may improve the design and performance of future studies.

First, it is known that using seatbelts reduces injury severity and death.[2,3] However, owing to the complexity of road traffic injuries, it is important to include the maximum number of injured patients, depending on the inclusion/exclusion criteria, to strengthen the analysis and permit a proper multivariate analysis to answer the research question properly. It is not clear to me, for example, why patients involved in taxi accidents (n=94) were excluded from the present study.[1] This is an unusual reason for exclusion, especially when only 107 patients were included in the prehospital phase.

Second, study of the biomechanics of road traffic collisions (RTCs) in more detail, including ejection from the vehicle, is essential. The authors cited our study reporting a significant effect of seatbelt use in reducing injury severity when we performed a univariate comparison between patients who had used seatbelts and those who had not.[4] However, once we included other important factors using a general linear model,[5] we found that the mechanism of the collision and vehicle speed were the most important factors affecting the severity of RTC injuries, while the effect of seatbelts became non-significant, indicating that the main effect of seatbelt use was to reduce ejection from the vehicle.[5] Injury severity among patients who were ejected was double that in cases in which the vehicle sustained lateral impact or rolled over.[5] I note that ejection was not included in Van Hoving et al.’s[1] study.

Third, there were many missing hospital data in the study.[1] We have addressed this issue by appointing a full-time researcher to collect data prospectively from hospitals on a daily basis. This has increased the completeness of data on seatbelt use to 98% in our Road Traffic Collision Registry.[4] Finally, I congratulate the authors on their important study and hope that they will find these comments useful.

Fikri M Abu-Zidan

Professor, Consultant Trauma and Acute Care Surgeon and Medical Statistician, Department of Surgery, College of Medicine and Health Sciences, United Arab Emirates University, Al-Ain, United Arab Emirates fabuzidan@uaeu.ac.ae 1. Van Hoving DJ, Hendrikse C, Gerber RJ, Sinclair M, Wallis LA. Injury severity in relation to seatbelt use in Cape Town, South Africa: A pilot study. S Afr Med J 2014;(7)104:488-492. [http://dx.doi. org/10.7196/SAMJ.7933] 2. Abbas AK, Hefny AF, Abu-Zidan FM. Seatbelts and road traffic collision injuries. World J Emerg Surg 2011;6:18. [http://dx.doi.org/10.1186/1749-7922-6-18] 3. Abbas AK, Hefny AF, Abu-Zidan FM. Seatbelt compliance and mortality in the Gulf Cooperation Council countries in comparison with other high-income countries. Ann Saudi Med 2011;31:347-350. [http://dx.doi.org/10.4103/0256-4947.83208] 4. Abu-Zidan FM, Abbas AK, Hefny AF, Eid HO, Grivna M. Effects of seat belt usage on injury pattern and outcome of vehicle occupants after road traffic collisions: Prospective study. World J Surg 2012;36(2):255-259. [http://dx.doi.org/10.1007/s00268-011-1386-y] 5. Abu-Zidan FM, Eid HO. Factors affecting injury severity of vehicle occupants following road traffic collisions. Injury (in press). [http://dx.doi.org/10.1016/j.injury.2014.10.066]

S Afr Med J 2015;105(1):5. DOI:10.7196/SAMJ.9152

5

Driving innovation, leadership and change at Groote Schuur Hospital, Cape Town, South Africa

To the Editor: Globally, cost-effective and equitable delivery of healthcare is becoming a challenge. In the South African (SA) context, balancing the burden of disease and the patient load within available resources, while still maintaining quality of care, is becoming unsustainable. Our public healthcare services need to support a growing population of uninsured citizens together with immigrants from elsewhere in Africa seeking care, and while the reasons for the problem are both economic and related to health service design and delivery, it is compounded by an ageing population, a rising burden of infectious and chronic diseases and the global shortage of adequately skilled healthcare workers. The leaders of today will need to do something different in order to avoid collapse of the system.

Such a change in strategy comes with the realisation that there is no quick fix, and the transformation process will take time to embed and institutionalise. It is not a single event, but part of an overarching strategy. At the core of such a transformational strategy is the need to maximise the value for the patient. However, this focus should not deflect from the need to ensure that the staff who provide the service have the necessary resources and a safe and pleasant environment in which to perform their duties.

Groote Schuur Hospital (GSH) is a central hospital in the Western Cape, SA, and has embraced the Western Cape Department of Health’s vision of ‘Access to patient-centred, quality care’, which is enacted through the values of caring, competence, accountability, integrity, responsiveness and respect. With this foundation, facing the ongoing challenges means that we cannot just continue with business as usual. In taking the hospital forward into the 21st century, the GSH management team adopted a theme of leadership, innovation and change as part of a journey to lead the institution towards excellence in healthcare. Change is required to meet the demands of today’s environment, and this change can be effected through appropriate leadership and driving innovation with a view to improving the quality of care provided. For these transformational processes, we need people to address these changes and paint a picture of the world of tomorrow.

In 1967, the innovative accomplishment of the first human-tohuman heart transplant gave GSH international status. There have been many similar achievements since then, some of which have gone unnoticed. While they may not attract international acclaim, the innovations – whether related to process, service, quality or strategy – have all contributed to improving the quality of patient care provided.

Transformation through new ideas must come from within, and every stakeholder in the healthcare system has a role to play.

With this in mind, GSH and the Faculty of Health Sciences at the University of Cape Town (UCT) have partnered with UCT’s Bertha Centre for Social Innovation and Entrepreneurship to catalyse staffled healthcare innovation. The GSH Facility Board has generously donated the funding for this Groote Schuur Hospital Innovations Programme (GSHIP). This is the first time an African healthcare institution has pursued such an initiative, and we are proud to be leading the way.

For the purposes of the programme, we have defined ‘innovation’ as simply a new and different solution to existing challenges. We have capitalised on the fact that our 3 762 staff members have the intellectual and creative capital to think differently and develop bold solutions that can transform the way in which we deliver healthcare at GSH.

January 2015, Vol. 105, No. 1

CORRESPONDENCE

The GSHIP was officially launched on 6 October 2014. Building up to this, all staff were engaged to help them understand the challenges faced. Based on feedback received, the following eight major challenges were identified for innovation:

• • • •

1. Using waiting time more effectively How could we design a better experience for patients waiting for treatment across the hospital? ‘Waiting’ does not have to be a waste of time, but can become an opportunity to address patients differently.

Innovative solutions could include: • Improving the waiting experience • Reducing waiting times • Addressing the health and wellbeing of patients while they are waiting.

6. Improve care for specific patient groups How could we radically improve the experience of our adolescent or tuberculosis patients waiting for care, and the quality and safety of the care they receive? Innovative solutions could include: • Be centred around the needs of each group • Improve their experience of care • Improve clinical outcomes.

2. Sustaining a culture of care and dignity How could we support staff to deliver compassionate care all the time? Innovative solutions could include: • Developing a caring culture model for teams • Staff support to deal with frustrations • Catalyse a wider culture change.

3. Tracking and communicating What if we had better visibility of the patient’s experience, e.g. waiting times, ward stock levels, free beds, theatre availability, and how well our patients are doing in real time? Innovative solutions could include: • Improve data and information collection • Sharing of data • Effective use of data to reduce bottlenecks in care.

4. Patient records and notes What if we had a better system of keeping track of our patient’s records, inputting data and ultimately spending less time with administrative duties and more time with our patients? Innovative solutions could include: • Reduce time spent searching and waiting for folders • Make record management more user friendly • Make records more applicable across departments and teams.

5. More efficient entry and exit How could we improve the referral process, appointment bookings and quicker, safe discharge? Innovative solutions could include:

Improve the system for patient appointments Improve the referral process Improve the discharge process Ensure that patients have the support they need when discharged home.

7. Working better with district health services (DHSs) How could we support the DHSs, so that our patients can be treated near their homes and avoid unnecessary trips to the hospital?

Innovative solutions could include: • Smoother transition from hospital to community services • Improved communication processes.

8. Boost volunteer resources How could we help families and volunteers to play a more central role in caring for our patients? Innovative solutions could include: • Building the skills of families and volunteers • Develop opportunities for progress.

All staff have been given the opportunity to submit proposals with their innovative ideas. These will be presented to a panel of judges in January, and the selected winners will be awarded funds to implement their project with the aim of completion in October 2015. A space has been provided in GSH that will be transformed into an Innovation Hub, and the partners from the Bertha Centre will provide the expertise to assist innovators to structure their ideas into formal proposals.

With the success of this project, it is hoped that GSH can encourage the scalability of the innovative ideas to other public health facilities in the country.

Bhavna Patel

CEO, Groote Schuur Hospital, Cape Town, South Africa bhavna.patel@westerncape.gov.za S Afr Med J 2015;105(1):5-6. DOI:10.7196/SAMJ.9209

Correction In the article ‘Meeting the sexual and reproductive needs of high-school students in South Africa: Experiences from KwaZulu-Natal’ by Frolich et al., which appeared on pp. 687 - 680 of the October 2014 SAMJ, the 95% confidence interval under ‘Total’ in Table 2 should have read 2.46 - 8.45. The online version of the article (http://dx.doi.org/10.7196/SAMJ.7841) was corrected on 8 December 2014.

6

January 2015, Vol. 105, No. 1

IZINDABA

Mental health under-budget­ing undermining SA’s economy Grossly inadequate and unco-ordinated government spending on treatment of mental illness – which affects one in six South Africans – is costing South Africa (SA) 2.2% of its annual GDP.[1] It is also failing to reduce the 230 attempted suicides recorded daily, while 48% of people living with HIV/AIDS continue to suffer from a mental health condition (South African Depression and Anxiety Group (SADAG) Mental Health Fact Sheet).

The latest available figures from the country’s largest medical aid, Discovery Health, show a 41% increase in mental disorder payouts between 2008 and 2012. A review of the annual reports of the Council for Medical Schemes over the same period reveals that the annual risk ‘spend’ of all medical schemes in the country on mental disorder hospital admissions rose by 511% over the same period (from R96.7 million to R494.6 million), but figures for the public sector (where over 80% of the population are treated) remain unavailable.

Research by the Department of Psychiatry and Mental Health at the University of Cape Town (UCT) shows that three-quarters of South Africans living with a mental illness are not being treated. Over the past two decades, a seemingly progressive national policy shift to decentralisation of care has reduced the number of mental hospitals, but there has been no corresponding increase in communitybased mental health facilities, resulting in 7.7% fewer beds across all prov­in­ces and a downward spiral in delivery.[2] These telling snapshots emerged from presen­­tations given by several top mental health researchers at a summit held at the UCT Lung Institute in Cape Town early in Novem­ber 2014. Neuropsychiatric disorders are now the third-biggest contributor to the local burden of disease, trailing close behind HIV/AIDS and other infectious diseases.

According to Prof. Crick Lund of the Department of Psychiatry and Mental Health at UCT, depression is costing the country ‘more to not treat, than to treat’. He and several fellow UCT psychiatrists and epidemiologists currently estimate mean lost earnings due to severe mental illness (major depression and anxiety disorders) at R54 121 per affected adult per annum (after adjustment for age, gender, substance abuse, education, marital status and household size). The 2013 South African Stress and Health Survey (SASH) projected the total annual cost to the country in lost earnings

at R40.6 billion as far back as 2003 (equal to 2.2% of the GDP), dwarfing direct national department of health spending on mental

Prof. Crick Lund, of UCT’s Department of Psychiatry and Mental Health.

health of R665.52 million, (2005 figures).[1] ‘Depression is highly prevalent and has a major social and economic impact in SA. Our findings indicate that providing treatment for mental disorders like depression can actually improve individual and household economic circumstances. Poverty is associated with increased prevalence, increased severity and a longer course and worse outcome (of mental health disorders). Depression plays an important role in maintaining conditions of poverty in SA, particularly for people with severe depression.[3] We need to urgently invest in and scale up mental health care,’ Lund stressed to summit delegates.

Further illustrating the social and economic impact, he said that measuring ‘days out of role’ (the inability to work or carry out dayto-day activities) put the average individual figure at 28 days per year for anxiety disorders and 27 days per year for depression.[4] The 12-month prevalence (the proportion of people who report having symptoms meeting the diagnostic criteria for anxiety, mood and substance disorders) in SA currently stands at 16.5%,[5] with a lifetime prevalence of common mental disorders among adults pegged at 30.3%.[6] Lund reported that women have twice the risk of depression compared with men, but said men had twice the risk of substance abuse.

7

January 2015, Vol. 105, No. 1

Treat depression, improve antiretroviral treatment outcomes

Living with HIV doubled the risk of depression. ‘Just treating depression with antidepressants leads to better adherence [to antiretroviral drugs], and an improved CD4+ cell count,’ he emphasised. Lund said that the National Department of Health (NDoH) was ‘keen’ to include antidepressants in HIV drug regimens, adding that it was vital to ask people who are not taking their antiretrovirals ‘what else is happening in your life, do you need to see a counsellor?’

Only one in four South Africans living with a mental disorder had any access to appropriate care, he added. The country’s (in) capacity in terms of available psychiatrists and psychologists emerged during question time in Parliament early this November, and hardly inspires confidence in anything changing any time soon. Limpopo and Mpumalanga have 24.2% and 33% of their psychiatric posts filled, while North West has only 31% of the psychologists it needs. Only the Western Cape has filled all its vacancies for both disciplines.

According to the UCT faculty research, comparing a 2006 staff/population norms study with 2010 staff/population ratios, SA is short of 646 psychiatrists and 466 psychologists.[7] Lund said the solution was not just to train more psychiatrists and psychologists but to train more general healthcare workers who could detect and manage common mental health problems, with supervision and support from the specialists. ‘Only then will we be able to narrow the 75% treatment gap,’ he emphasised.

Research by the Faculty of Psychiatry and Mental Health at the University of Cape Town shows that threequarters of South Africans living with a mental illness are not being treated.

The researchers concluded that mental health service planning had frequently been conducted in ‘an incoherent, haphazard manner’, in which the basis for resource allocation was not made explicit. Provincial health departments were free to address mental health according to their own priorities, with few financial incentives to increase efficiency or resource allocation for mental health services.[8]

IZINDABA

The NDoH says it has embarked on ‘a process to develop work force staffing norms to ensure equitable distribution of human resources for health, using World Health Organization ‘Workload Indicators of Staffing Need’. A report would be made available ‘once this work has been completed’.

8 000 South Africans commit suicide annually

According to SADAG, the largest NGO of its kind in SA, there are 23 known suicides daily across the nation. A full 11% of all non-natural deaths in the country are due to suicide. SADAG deals with 400 calls per day on 15 helplines and gets 600 000 ‘hits’ per month on its website, offering 98 support groups. It estimates that there are 7.5 nurses, 0.4 social workers, 0.28 psychiatrists, 0.32 psychologists and 2.8 inpatient beds for every 100 000 South Africans. Drawing on research from SASH, the World Health Organization, the NDoH and the Medical Research Council, the group says that about six million South Africans ‘could’ be suffering from post-traumatic stress disorder (PTSD), and that 82.1% cannot afford private healthcare. One survey revealed that about half of all South Africans do not see mental health as a priority (SADAG Mental Health Fact Sheet). A total of some 8 000 South Africans choose to end their lives every year. Figures from the Council for Medical Schemes, based on medical aid claims paid out, show that the incidence of bipolar disorder increased by 228% between 2006 and 2011 (from 0.7 to 2.3/1 000 medical aid members).

Prof. Dan Stein, Chairperson of the Depart­ ment of Psychiatry and Mental Health at

UCT, drew a distinction between trauma and PTSD. He said that motor vehicle accidents were among the biggest contributors to PTSD in SA. Merely witnessing trauma was unlikely to cause major PTSD on its own – however, the burden of trauma in SA was ‘so huge’ that the impact was unavoidable. He singled out group vigilantism as a major contributor to PTSD and said that mental health generally in SA was ‘underdiagnosed and undertreated’.

Stein is leading a research team analysing blood samples from animals at the time of major trauma in an attempt to predict PTSD, based on the genes in their white blood cells. He is also a world authority on brain functional imaging and genetic studies.

Prof. Stefan Hofmann, a world expert on cognitive behavioral therapy (CBT) and a leader in Boston University’s clinical CBT programme, told the mental health summit it was ‘shocking’ to him that CBT was not the first-line treatment in the very country that had helped pioneer it. Referring to the late Dr Joseph Wolpe, an SA psychiatrist whose initial PTSD work with soldiers in World War II moved global thinking away from a Freudian psychoanalytic approach to a more pragmatic systematic ‘desensitisation approach’, Hofmann decried the supremacy of what he termed less-successful therapies locally. He said that CBT was a ‘hugely effective treatment’ with a sound empirical foundation that was evolving with close links to psychiatry and neuroscience. Its newer approaches included strategies to augment specific processes with pharmacological agents (in more severe cases). CBT also had new ways of conceptualising and classifying

mental disorders, not to mention tailoring treatment to the specific cultural background of the individual, he added. A 2009 global meta-analysis showed CBT to ‘consistently outperform or equal all other treatments’.

Hofmann said one study in the UK showed that by training an additional 3 600 CBT therapists, a saving of the equivalent of R12.6 billion was achieved. CBT was now part of a ‘global sea-change in therapy’, he added.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(1):7-8.

DOI:10.7196/SAMJ.9166 1. Lund C, Myer L, Stein D, Williams DR, Flisher AJ. Mental illness and lost income among adult South Africans. Soc Psychiatry Psychiatr Epidemiol 2013;48(5):845-851. [http://dx.doi. org/10.1007/s00127-012-0587-5] 2. Lund C, Kleintjes S, Kakuma R, Flisher AJ, the MHaPP Research Programme Consortium. Public sector mental health systems in South Africa: Inter-provincial comparisons and policy implications. Soc Psychiatry Psychiatr Epidemiol 2010;45(3):393404. [http://dx.doi.org/10.1007/s 00127-009-0078-5] 3. Lund C, de Silva M, Plagerson S, et al. Poverty and mental disorders: Breaking the cycle in low and middle income countries. Lancet 2011;378(9801):1502-1514. [http://dx.doi. org/10.1016/S0140-6736(11)60754-X] 4. Mall S, Lund C, Vilagut G, Alonzo J, Williams DR, Stein DJ. Days out of role due to mental and physical illness in the South African stress and health study. Soc Psychiatry Psychiatr Epidemiol 2014; August. [http://dx.doi.org/10.1007/s00127-014-0941-x] 5. Williams DR, Herman A, Stein DJ, et al. Twelve-month mental disorders in South Africa: Prevalence, service use and demographic correlates in the population-based South African Stress and Health Study. Psychological Medicine 2008;38(2):211220. [http://dx.doi.org/10.1017/S0033291707001420] 6. Stein DJ, Seedat S, Herman A, et al. Lifetime prevalence of psychiatric disorders in South Africa. Br J Psychiatry 2008;192(2):112-117. [http://dx.doi.org/10.1192/bjp.bp.106.029280] 7. Lund C. Flisher AJ. Norms for mental health services in South Africa. Soc Psychiatry Psychiatr Epidemiol 2006;41(7):587-594. [http://dx.doi.org/10.1007/s00127-006-0057-z] 8. Lund C, Kleintjes S, Kakuma R, Flisher AJ, the MHaPP Research Programme Consortium. Public sector mental health systems in South Africa: Inter-provincial comparisons and policy implications. Soc Psychiatry Psychiatr Epidemiol 2010;45(3):393404. [http://dx.doi.org/10.1007/s00127-009-0078-5]

Turning ‘fate’ into destiny by seizing a second chance at life ‘What happened in the past is totally out of my control now.’ With that simple yet life-giving affirma­ tion, Daryl Brown, 27, legless in a wheelchair after jumping into the path of a London underground train on 29 September 2013, sums up the seachange in his world view.

As he slowly regained consciousness between the tracks with the bloodied stump of one leg lying beside his ear and rats scampering around his gaping wounds, the young university graduate had no idea how

this barter with death would serve him. He prayed he’d die before the rescuers crawling under half the length of the train got to him, and he stifled agonised screams ‘so as not to traumatise the families and little kids’ alighting, blissfully unaware, above him. In hospital, whenever he regained any semblance of awareness, he feigned unconsciousness. A male nurse wheeling him on a gurney for an MRI scan made the first compassionate contact. ‘He told me his name was Mads and said, “We’ve got you – we thought you weren’t with us,” squeezing my hand. I told him I’d been faking it – he didn’t let go of my hand after that.’

8

January 2015, Vol. 105, No. 1

Daryl Brown.

IZINDABA

Meticulously planned

That autumn Sunday suicide bid – months in the planning, with a meticulously typed police advisory in his pocket (they didn’t find it) and an explanatory e-mail sent to his mother’s work computer for reading on Monday – was the first inadvertent step on Daryl’s journey to admitting he was suffering from longstanding, untreated depression. Bullied for being gay (though he did not know he was) from his last year in primary school onwards, and confronting a fraught relationship between his parents at home, Daryl became inured to being pushed around in school passages and mocked in the bathrooms. ‘I only then realised what being gay was. I didn’t want to be gay if it was as awful as they were making it out to be. I thought depression was an excuse for not wanting to deal with my issues … that I could overcome them myself. I couldn’t think of anything a psychologist could say to make me feel better, it made no sense to me. I wish someone had come to give a talk at the school. I tried to solve it myself by getting involved in the church. I prayed to God to make me straight.

Then I threw myself into my university work before finally deciding to “come out”.’

Daryl believed that if he ‘lived who he really was’ he would feel better, ‘but my mind and body had developed these negative habits’. London became his ‘last-ditch attempt’ at getting his life right. He secured his master’s degree and began his first romantic relationship with a ‘good, kind and generous’ partner, which ended in tears and deep depression six months later. ‘I thought if he can’t stay with me, no one will. I thought I was useless.’ He set himself a 3-month deadline for death, organised a ‘farewell’ (as if he was returning to Cape Town) with his London friends, deactivated his Facebook account so nobody would twig that he hadn’t returned home. His ex-boyfriend confessed to him that he’d suffered from depression for three years and ‘needed to deal with it himself’. ‘His worries seemed more important than mine,’ recalls Daryl. He checked flights to Cape Town so

that his deception would be complete if friends asked, and gave his landlord a month’s notice.

Sunday seemed a good day to end it all – it would cause the least commuter disruption and general public trauma. He shouldered his worldly possessions and headed off, settling down on an empty station bench ‘completely disconnected from myself’, playing Suduko on his cell phone. Then, in his own words, as the train finally approached, he ‘just strolled off the platform’.

For the first time, psychotherapy seemed like a credible solution.

‘If people understood what I was going through, maybe there were ways of treating it. It was a huge relief for me to contemplate that this is was actually manageable – that there was a medical reason for the way I felt and thought.’

The long road back

When he’d finally recovered sufficiently to begin psychotherapy, Daryl says he still tried to hide a lot. ’I thought if I tell them about my ex they’ll judge him and who he is.’

Then a psychologist at the Douglas Bader Rehabilitation Centre in London asked him ‘all these incredibly incisive questions’.

‘She seemed to know how depressed people think. She knew my most intimate thoughts and feelings. For the first time I realised I’m not crazy and I’m not alone. For the first time psychology seemed like a credible solution. If people understood what I was going through, maybe there were ways of treating it. It was a huge relief for me to contemplate that this was actually manageable – that there was a medical reason for the way I felt and thought.

I used to feel like I was balancing this huge bucket of water on my head and it would

come crashing down, showing that I can’t deal with life.’

Today Daryl is working in digital market­ing in Cape Town, writing a daily blog, playing in a disabled volleyball team, and convinced that his suicide attempt was a blessing in disguise, prompting him into cognitive behavioural therapy (CBT), a modality he is convinced works, one of his favourite mindset-altering books being Eckhardt Tolle’s The Power of Now. ‘Sometimes I do feel that people feel sorry for me – like if I’m struggling to get cash at the check-out point, I still worry what the cashier will think of me – but now I’m slowly beginning to think it doesn’t matter, I’ll probably never see her again. I doubt that I’d be in therapy if it hadn’t been for that suicide attempt, and nobody would have known about my depression. It was a cry for help, but served its purpose. I’ve learnt that there’s no point in resisting. CBT has taught me that. I’m still very hard on myself and tell myself I have no right to feel sorry for myself because I did this to myself. But my friends point out that my disability is not the result of me or my actions, but because of an illness I have, which is depression.’

Daryl continues to work on his blog and inspire others labouring under the stigma of despair. He’s about as ‘out’ as you can be when it comes to dealing with a subject that society still largely holds as taboo. Like the South African Depression and Anxiety Group that supports him and countless others, he doesn’t believe that talking about his suicide bid will prompt copy-cat attempts. Instead it will probably help save those lives complicated by this hugely misunderstood condition.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(1):8-9.

DOI:10.7196/SAMJ.9167 SADAG contact details: (011) 234-4837, SMS 31393, and www.sadag.org

Basson unrepentant as drawn-out sentencing argument begins Despised apartheid-era chemi­ c al warfare expert Dr Wouter Basson, dubbed ‘Dr Death’ by his detractors and currently practising as a highly respected cardiologist in Durban­ ville, Cape Town, failed to show that he

even ‘reflected on the possibility that he violated medical ethics’.

This was said by Dr Marjorie Jobson, director of the support group for victims of apartheid Khulumani, in aggravation of sentence at the end of November 2014, just over 11 months after Basson, aged

9

January 2015, Vol. 105, No. 1

65, was found guilty of unprofessional conduct by a Health Professions Council of South Africa (HPCSA) inquiry. The inquiry, by a committee of the Medical and Dental Professions Board headed

by Prof. Jannie Hugo, found that the unrepentant cardiologist violated basic

IZINDABA

medical ethics and failed to exercise his choice in support of them. She backed a petition from leading medical professional and human rights bodies, including the South African Medical Association, calling for his striking from the roll and harsh sanction. The petition was presented during the sentencing hearing by Mark Heywood, executive director of the activist organisation Section 27, amid dramatic contestation and attempts at ridicule by Basson’s defence counsel, Japie Cilliers, SC.

Strong sanctions prompt remorse – De Kock an example Cardiolgist and chemical warfare expert Dr Wouter Basson.

medical ethics, which they described as ‘especially important in times of war and conflict’, and defiled the ‘unique and sacred position’ of trust in doctors by society that impelled them to stay true to the ethical values of ‘beneficence, nonmalificence, justice and autonomy’. Basic medical ethics had not changed since the time of the offences.

The committee found that Basson, while project officer of Project Coast and its military front teargas and drugs manufacturing company, Delta G, in the late 1980s and early 1990s, co-ordinated the production and stockpiling of Mandrax, ecstasy and teargas on a major scale and provided ‘disorientating substances for cross-border kidnapping’. He also supplied cyanide suicide capsules to apartheid undercover operatives for use if captured. Under the instructions of the chief of the Defence Force, Basson weaponised thousands of 120 mm mortars with teargas for use by Jonas Savimbi’s National Union for the Total Independence of Angola (Unita) forces that South Africa abortively backed in the 1980s, committing troops and heavy weaponry to fight the Cuban-backed MPLA in Angola.

Basson, in testimony prior to his acquittal on related criminal charges in the High Court in Pretoria – and subsequent failed state appeal bids to the Supreme Court of Appeal and the Constitutional Court (ending in 2005) – has insisted that his now confirmed unprofessional conduct came within the context of war and conflict and that no proof was ever obtained that he caused harm or death.

Dr Jobson said that Basson neglected core

Jobson testified that ‘in theory he [Basson] can say that his activities did not have lethal consequences … it is only out of the reality of sanctioning his behavior that there is any reflection on what their perpetrators caused on the citizens of South Africa.

Eugene De Kock [the jailed governmentsanctioned apartheid-era covert Vlakplaas murder squad chief] is a prime example.’

She said sanction created the opportunity for reflection and accepting responsibility.

‘Without it, we never get to a point where people consider that perhaps their activities were not in the best interest of the country and the majority of the people,’ she added. Asked by Cilliers whether she was appealing to the hearing to pass a harsh sentence so that the cardiologist would show remorse, Jobson said a punitive sentence would be ‘fitting’. ‘Everywhere in the world where I go, the first question which arises is how is it possible that Dr Basson has never been sanctioned up to now? People cannot comprehend that. We believe that his practice needs a very severe sanction. The problem is that Dr Basson has not conceded … he has not shown that he has reflected on the possibility that he violated medical ethics. He has not taken responsibility.’

Basson’s ‘no killing, no harm’ defence dubious – witness

Jobson described Basson’s claims that his activities were non-lethal as ‘dubious’.

‘Khulumani has a membership of 6 800 families of the disappeared people who were abducted in operations by the security police using [chemical] agents.’

Heywood went head-to-head with Cilliers after reading out the petition signed by 230 doctors and top medical

10

January 2015, Vol. 105, No. 1

and human rights bodies demanding Basson’s deregistration as a doctor.

Cilliers described 230 signatures out of 39 000 available doctors as ‘insignificant’, suggesting that this actually meant that the majority of doctors supported Basson.

He described Heywood as a ‘layman and administrator of petitions’, accusing him of using the hearing as a platform to promote his Section 27 NGO. Heywood shot back, ‘I am a rights bearer and a consumer of healthcare,’ adding that the issue of ethics did not reside only with professionals but with ‘everyone else’. Heywood said the Constitution under the new dispensation allowed him to question the activities of anyone he chose to, accusing Cilliers of not understanding the nation’s most funda­ mental legal document. To suggest that the signatory numbers were insignificant was profoundly mistaken and disrespectful of some of the country’s leading medical academics, researchers and representative bodies. To Cilliers’ rebuttal that he was ‘talking numbers’, Heywood replied, ’I am talking names’.

Disgrace to the medical profession – HPCSA

In initial sentencing argument, pro forma prosecutor Sallie Joubert told the Pretoria hearing that Basson acted in a manner disgraceful to the medical profession. ‘We will argue that his conduct [during the apartheid era] amounts to disgraceful conduct and that he is a disgrace to the medical profession.’ Joubert submitted that the appropriate penalty would be to strike Basson from the register of medical professionals – and for him to pay the (substantial, but as yet unquantified) costs of the lengthy HPCSA inquiry into his conduct.

Among those present during the senten­ cing argument were members of the Khulumani victims support group, including a Mamelodi mother who lost her 17-yearold ANC exile son in a security police ‘dirty tricks’ operation.

Argument in mitigation of sentence will be heard in January, with a further postponement to March probable for actual sentencing.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(1):9-10.

DOI:10.7196/SAMJ.9222

IZINDABA

SA’s ailing public health sector ‘responding to treatment’?

Only one of the most vital patient care domains in public healthcare facilities today meets minimum local and international standards – that of positive caring staff attitudes – but while patient waiting times have increased, other critical areas show ‘marginal to good’ improvements.

This emerged from a comparison of the most recent (relatively small) sampling of facilities nationally, ranging from clinics all the way up to regional hospitals, with a comprehensive sampling of national healthcare facilities done 2 years ago by the same survey agents, using the same criteria.

The 2012 results shocked the nation, with the national Department of Health (NDoH) unsuccessfully trying to keep the findings under wraps (City Press, a Johannesburg weekly newspaper, used the Promotion of Access to Information Act to pry loose the full audit). Izindaba can now show the best available data snapshot of the current situation after being assured by none other than Dr Carol Marshall, CEO of the Office for Healthcare Standards Compliance (OHSC), that both surveys were conducted by the same agents her office hired, using the same criteria. Infection prevention and control (IPC) and cleanliness were among five (of six) vital patient care areas that have shown improvement since the frightening reality of a 2012 baseline national facility audit stung the NDoH into a multipronged response.

Five of six vital patient care areas still below par

These two crucially related areas (IPC and cleanliness), taken together for measurement and arguably responsible for thousands of avoidable patient deaths (especially of babies) in recent years, have improved by an overall 7% (from a crossfacility average of 50% to 57%) over the past 2 years. However, and crucially importantly, this marginal gain – and measurements in all but one of the vital patient care areas – remains below the minimum acceptable score of 70% set by local and international patient care standards. The percentage rating for patient waiting times has actually gone down by 5% (from 68% to 63%), almost certainly as a result of inexorably increasing patient pressure on insufficient facilities and staff. The most encouraging statistic to emerge is a 40.1% leap in ‘positive caring attitudes’ held by public health facility staff members (from 30% to the 70% threshold), followed by a 27% improvement in patient safety and security (34% to 61%), with availability of medicines and supplies increasing by nearly 12% (54% to 65.5%).

This last improvement is a hopeful sign that woefully inadequate supply management systems, corruption and theft might actually be yielding slightly to the raft of new initiatives. Izindaba singled out for interrogation the 7% improvement in the combined category of ‘IPC and cleanliness’ – chiefly because of unacceptably high

Infection control veteran Prof. Shaheen Mehtar.

11

January 2015, Vol. 105, No. 1

nosocomial infection rates, the runaway drug-resistant tuberculosis (TB) pandemic and intermittent but ongoing episodes of multiple, avoidable neonatal inpatient deaths. What emerged was that direct support of the worst-performing facilities by agents of the OHSC improved training, expanded all-round IPC, boosted staff hygiene awareness, improved equipment supplies and led to the incorporation of IPC into the hospital revitalisation programme.

The percentage rating for patient waiting times has actually gone down by 5% (from 68% to 63%), almost certainly a result of inexorably increasing patient pressure on insufficient facilities and staff.

This was the view of Prof. Shaheen Mehtar, internationally renowned IPC authority and former head of Stellenbosch University and Tygerberg Hospital’s academic unit for IPC. Mehtar, one of the louder protesting voices 8 years ago when a slew of baby deaths in Eastern Cape rural and urban hospitals was attributed to poor nurse hygiene practices and a lack of basic equipment, said the findings of the resultant 2012 national hospitals baseline audit proved to be the much-needed catalyst for the improvements, however far below the minimum threshold they fell. ‘They [the NDoH] got the shock of their lives.

They thought they were amazing, but they weren’t. We’re very lucky to have Motsoaledi [national health minister],’ she added.

The 2012 National Health Care Facilities Baseline Audit, conducted by a consortium of four independent bodies (Exponant, Health Information Systems Program, Arup (consulting engineers) and the South African Medical Research Council), found that only one of 394 hospitals, Witrand Psychiatric Hospital in North West Province, ticked all the ‘accepted standards boxes’ for cleanliness, infection control, drug stocks, staff attitude, patient safety and waiting times. The baseline audit was conducted in 3 880 healthcare facilities between May 2011 and May 2012 to assess the feasibility of the proposed multi-billion rand National Health Insurance (NHI) – hence its huge political sensitivity.

IZINDABA

From ‘annoying but true’ to ‘some progress’ – expert

Inspectors went around the country check­ ing hospital infrastructure, the condition of medical equipment, opening hours, workload, staff numbers and standards.

They found that only 32 of all the hospitals and clinics complied with infection control guidelines and that only two facilities could guarantee patient safety. According to Marshall, the second similar audit showing the improvements was done in August this year. Mehtar described the results of the original 2012 survey, especially the IPC results, as ‘very annoying, but true’, adding that the latest sampling ‘seems to indicate some progress’. A founder member and chairperson of the Infection Control African Network (ICAN), chairperson of the World Health Organization (WHO)’s Sterile Service and filoviruses and personal protective equipment committees plus a co-author of the WHO’s Waste Management Interim Guidelines, Mehtar said that WHO guidelines recommended one infection control professional (ICP) per 250 beds.

South Africa (SA), however, had one ICP per hospital, ‘whether it has 200 or 1 500 beds’.

‘The point is that it’s not nearly enough.

Yes, it will cost billions to get this right, but think of the billions that will be spent treating avoidable hospital-acquired infections if we don’t!’ On the positive side, hand hygiene now stood at over 70% compliance (on average), the result of an ambitious awareness campaign, providing adequate handwash basins, soap and paper towels/driers, plus placing alcohol drop containers at every ward entrance and next to each high-care bed. ‘I think they realised that here you have a very inexpensive investment that gives very handsome returns,’ Mehtar added. Given the post-2012 interventions, strongly driven by Motsoaledi and his Director-General Malebona Precious Matsoso, there was now ‘no reason for us not to have done exceptionally well in infection control. I do know that we are now leaders on the continent in a very sustained sort of way,’ she added. Asked to outline how the hospital revitalisation programme had contributed to this, she said that refurbished/ redesigned hospitals plus all new hospitals now had vastly improved isolation facilities, good negative-pressure ventilation and better personal protection equipment, with improved and better monitored IPC policies.

Mehtar said that taking baseline TB prevalence into account, European hosp­itals had a nosocomial infection rate of 5/100 000 TB patients compared with SA’s 1 000/100 000.

About 35% of all local admissions were TB smear-positive, with 7 - 9% resistant to multiple drug interventions. Some of her current research centred on quantifying the number of healthcare workers who were TB-positive and lobbying provinces to consider classifying all TB among healthcare workers as ‘occupationally acquired’. Needlestick injury data also revealed that a quarter of all infected bloods were both HIV- and TB-positive, meaning that if healthcare workers were compromised, they were well advised not to work in TB wards.

In an exclusive interview with Izindaba, Marshall revealed that her OHSC (initiated 6 years ago) had now covered ‘about 20%’ of the nation’s public health facilities, benchmarking minimum norms and standards and then measuring the processes they’d put in place. She said her teams had targeted facilities at National Health Insurance pilot sites, particularly district hospitals, ‘because this is where most people go and where most of the problems are’.

Update by new hospital standards chief

In an exclusive interview with Izindaba, Marshall revealed that her OHSC (initiated 6 years ago) had now covered ‘about 20%’ of the nation’s public health facilities, benchmarking minimum norms and stan­ dards and then measuring the processes they’d put in place. She said her teams had targeted facilities at NHI pilot sites, particularly district hospitals, ‘because this is where most people go and where most of the problems are – you will know that they are not the best … probably the weakest. So it’s not even random sampling (the 20%); we’ve not gone for the shining stars,’ she added. Marshall said her outfit was not currently measuring outcomes (once regulations for the National Health Amendment Act are published, the OHSC will have powers to request data, audit facilities and measure outcomes, imposing severe penalties – including closing down facilities for non-compliance). An incentivised approach will eventually reward higher-performing facilities with increased budgets to ensure that money follows efficient service delivery.

Asked how she believed her office had contributed to improving infection control and hygiene, she said that after the 2012 facilities baseline report ‘we produced a list of what facilities must have in order to maintain standards of infection control.

12

January 2015, Vol. 105, No. 1

We now inspect for those things and check whether supplies and equipment are on site.

We’re talking detail like whether they have the right kinds of disinfectants – soap and water are not enough when we’re talking about specialist care.’

Marshall emphasised that the comparison being done by Izindaba was based on a small v. large sampling of facilities (221 v. 3 880), and said her own office did not currently measure outcomes, but farmed this work out. ‘We will when the [to be published] regulations empower us. What we’re doing is ramping up our capacity, training inspectors. We’re just appointing more staff now and moving into our own building,’ she added. She said the National Health Amendment Act dictated that the OHSC inspect facilities every 4 years.

‘We’re not there to supply stats, we’re there to determine which institutions comply with our norms and standards. I’d say that we’ve now probably got enough information to calibrate our instruments.’ (The national core standards were drafted in 2008 and published in 2011.)

Waxing philosophical, Marshall said this was ‘not a long time, given what has been achieved, even if to me it felt like forever – but people tell me it’s an amazingly short time to set up a new institution from scratch.’ Responding to Mehtar’s highlighting of the woeful inadequate number of infection control officers at larger hospitals, she said more had been appointed, ‘but not as many as we should have – this is one of the things we’ll start measuring. I can’t tell you about IPCs per hospital … I know we’ve debated that … but I can’t recall whether there’s a proposal being put forward.

Our position would be let’s start somewhere.’

She reiterated that the OHSC was ‘pitching care at the level of district hospitals – we’ve deliberately resisted pressure to turn this into something pitched at academic institutions which generally do better.’

Training expanded and improved

Mehtar said that since 2005 her department had trained hundreds of people in a basic 5-day IPC course and helped set up infection control forums in most provinces. She began an IPC Master’s course at Stellenbosch 2 years ago, which had grown from half a dozen students to about 90 currently. Turning to the Ebola outbreak in West Africa, she said that because of the positions she held at the WHO, she had been asked to set up IPC training resource centres in Uganda and Sierra Leone and had been provided with 9 months of funding to do so. Working under the auspices of the ICAN, the training would begin in earnest in November 2014. Of the rampant West African outbreak, which is

IZINDABA

accelerating with infections tripling every fortnight, she said she believes that ‘it will be a year before we even see the light of day’, adding that she thought SA was better than the USA at containing viral hemorrhagic fever outbreaks, with far more experience.

MSF Ebola decontamination procedures questioned

Told about the death and infection rate among Médecins Sans Frontières (MSF) health­ care workers in West Africa, Mehtar criticised their use of spraying off personal protection suits with heavily chlorinated water, saying this was an outdated and inappropriate adaptation from cholera outbreaks, which she claimed was where MSF’s greatest experience lay. ‘The principle of infection control is to keep things dry! There’s a big problem with taking those damn big suits off – you need a buddy for dressing and undressing (doubling the infection risk). You also shouldn’t have water squishing around all over the place.

We always use impervious or semipervious gowns and face shields. Can you imagine being

completely covered in a plastic bag where your core temperature rises to 38.6oC and working for over an hour at a time? You get pretty hot and sweaty, your goggles get fogged up and you can’t even see properly to put up a drip. Basically you end up with heavily reduced function and awareness and a lot of mistakes can happen, especially if you’re stumbling all over the place with wee, poo and chlorine on the floor.’

MSF’s humanitarian affairs advisor Jens Pedersen, a nurse who recently returned from working as an Ebola medical team leader in Monrovia, Liberia, told Izindaba that in MSF’s 20-year experience of containing Ebola outbreaks in six West and Central African countries, chlorinated water was ‘very effective in preventing infection’ and the ‘most appropriate’ measure for the resourcelimited settings MSF worked in, where basic remedies were often the most efficient. ‘We’re aware of the debates questioning the use of chlorinated water, but we’ve yet to see any credible alternatives.’ Addressing the personal protection equipment process, he said the ‘buddy system’ was used as a supportive

mechanism in the high-risk zone to ensure safety, but ‘buddies’ were not involved in the undressing process. From when MSF began responding to the Ebola outbreak in March this year, 540 international staff had worked with 3 000 national colleagues. To date (23 October), 23 MSF staff members had been infected, of whom 13 had died, 7 had recovered and 3 were still in care. Every time a volunteer was diagnosed with Ebola, an investigation was done to determine the ‘exact circumstances’ of contamination, focusing on verifying the efficacy of the biosecurity measures used and how well implemented and respected they were. An MSF probe also established that of the 23 staff who contracted Ebola, most were infected in the local communities, while none of the ‘handful’ of staff infected in the treatment centre itself were contaminated during the process of undressing.

Chris Bateman S Afr Med J 2015;105(1):11-13.

DOI:10.7196/SAMJ.9169

Litigation benefits state-delivered medicine – but for how long?

The soaring costs of private medical indemnity insurance for specialists in the higher-risk disciplines are preventing these thinly spread state-employed doctors from seeking extra income in the private sector – benefit-

Dr Graham Howarth, Head of MPS Medical Services for Africa.

ing state patients and improving professional supervision of junior colleagues.

This enigma came to the fore recently when a Cape Town obstetrician, who prefers to remain anonymous, responded to a series of articles in the SAMJ exposing the much-abused and controversial Remuneration for Work Outside the Public Service (RWOPS) practice. RWOPS was originally designed by the national health department as a retention tool and to enhance clinical skills not usually available in the public sector. However, top-end state medical salaries have since been hiked closer to what private consultants earn, lending weight to accusations of financial greed and state patient neglect against a significant minority of specialists.

The controversy included disgruntled public sector junior consultants and medical officers complaining of a lack of teaching and availability of their senior colleagues, while several provincial health administrations launched investigations using medical aid claims records. More recently, national health minister Dr Aaron Motsaoledi, speaking at a South African Medical Association conference in Durban, blamed RWOPS abuse for junior doctors’ deteriorating ability to conduct caesarean sections – with backing from his

13

January 2015, Vol. 105, No. 1

chief advisor on maternal and infant mortality surveillance, Prof. Jack Moodley. Motsoaledi has since imposed a silent moratorium on provinces cracking down on ‘errant’ specialists – until he has received a long-outstanding report with pragmatic recommendations on RWOPS from the Committee of Medical Deans.

Although the dominant private insurer, the London-based Medical Protection Society (MPS), offers reduced rates for limited private practice, it imposes an annual gross RWOPS income ceiling of R240 000 per annum – a source of considerable dissatisfaction among higher-risk consultants.

MPS RWOPS income ceiling on super-high risk rates

Doctors in the public sector are fully covered by the state against ‘adverse patient events’, but those who also do RWOPS are forced to take out insurance just like their private counterparts.

IZINDABA

Herein lies the rub. Although the dominant private insurer, the London-based Medical Protection Society (MPS), the world’s leading protection organisation for doctors, dentists and other healthcare professionals, offers reduced rates for limited private practice, it imposes an annual gross RWOPS income ceiling of R240 000 per annum – a source of considerable dissatisfaction among higherrisk consultants. A combination of patientclaims litigators becoming smarter, fast evolving (and expensive) medical technology and growing patient awareness have sent the overall cost of clinical negligence soaring beyond 150% in South Africa (SA) in recent years. SA is the only country to have incurred a mid-year MPS subscription hike for the highest-risk discipline, obstetrics, from R156 515 per annum to R187 830 in 2011.

However, the most dramatic hike in obstetric MPS subscriptions is yet to come: they will leap from R330 000 per annum currently to R450 000 next year. Any extrapolation of these figures over the next 5 - 10 years (before even taking specialist overheads into account) seriously begs the question of who will be left in the private sector to deliver babies.

Co-authoring an article in the November SAMJ, Dr Graham Howarth, Head of MPS Medical Services for Africa, predicts that if SA obstetricians are unwilling to deliver in the private sector, the 170 000-plus annual national deliveries will move to the State sector, putting unprecedented pressure on already overburdened facilities and shifting liability to the State. He predicts fewer consultants in high-risk specialties, with those remaining practising defensive medicine, an absence or severe curtailing of private specialist obstetric care with paediatricians and opthalmologists reluctant to manage newborn children, fewer neuro­ surgeons in private practice, and fewer still with a primary interest in anything other than spinal surgery – and all restricted to larger urban areas.[1] The second highest risk discipline is neurosurgery, with the subscriptions of those doing spinal work rising from R318 190 to R338 520 next year (or on the month-anniversary of the relevant specialist first joining MPS). This is followed by a category covering all surgeons (plastic, bariatric, orthopaedic, non-spinal and fertility medicine), where subscriptions jump from R131 080 per annum to R140 860.

‘Below’ these disciplines the increases are described by the MPS as ‘relatively stable’.

The scale of the problem is reflected in SA’s highest-ever medical damages settlement of R25 million in June 2013, to a patient who had undergone neurosurgery. A recent probe into the impressions of defensive medical practice and medical litigation among SA neurosurgeons conducted by the Division of Neurosurgery in the Faculty of Health Sciences at the University of Cape Town proves revealing. Annual operative caseloads were reported as being between 200 and 300 by 30% of respondents, with over a quarter (26.6%) reporting more than 10 000 cases over their practice lifetime. Most respondents (72.7%) were in private practice, with just under a quarter (22.5%) in state service, of whom two-thirds did some form of limited private practice.[2] A 10-year study of maternity litigation in the UK (obstetric claims), via the National Health Service Litigation Authority (part of the NHS), shows that obstetrics accounted for 49% of all payouts. The trend is believed to be very similar in SA.

An MPS survey of 322 of their SA members last month reveals that 70% of doctors received a complaint about the care they provide, with 57% citing clinical issues and 39% saying communication/manner and attitude was the reason behind the complaint.

Direct threat to NHI delivery

Howarth said of the threat by litigation to specialist healthcare delivery, ‘I think it points to the kind of future we’d have if people are not very careful. Private patients and providers, public patients and providers, politicians and policy pundits all have a vested interest in solving the problem – there is not a medical answer – it has to enter public debate.’ There’s also a growing body of opinion (through no fault of the MPS) that the rising costs of indemnity cover will dissuade young medical graduates from specialising in the disciplines most affected, thus aggravating the chances of our vital consultant-led district health teams ever being able to impact in a way that advances the ambitious and hugely necessary National Health Insurance.

14

January 2015, Vol. 105, No. 1

The MPS has 30 000 SA members and nearly 300 000 members worldwide. Opera­ ting as a mutual society (not an insurer), it has among the strongest financial reserves of any healthcare indemnifier globally, with assets available to meet claims and other costs standing at close to R20 billion. It currently has well over a billion rand in outstanding claims and a ‘substantial amount for matters that have already occurred but are not yet claims’, boasting that it has never once turned down a proven claim of negligence. Any healthcare professional who was an MPS member at the time of a ‘patient incident’ is covered ‘beyond the grave’. However, in an attempt to mitigate the steeply rising obstetrics subscriptions, the MPS is now offering considerably cheaper ‘to the grave’ cover, provided the obstetrician was an MPS member at the time of an incident or when they were sued – or that they informed the MPS of the adverse event while still a member. This ‘risk-sharing’ arrangement will cost R186 160 per annum. There are no immediate MPS data on this new product.

Time will tell whether obstetricians will gamble on avoiding even one settlement involving lifelong payments towards the upkeep of an impaired newborn infant.

In the meantime, it’s to the unenviable ‘shelter’ of the state sector – or overseas – that many will go. An MPS survey of 322 of their SA members last month reveals that 70% of doctors received a complaint about the care they provided, with 57% citing clinical issues and 39% saying that communication/manner and attitude was the reason behind the complaint. A full 84% of doctors believe they now experience more complaints, with 44% considering the main cause to be easier access to lawyers and 43% believing it is because patients ‘expect more’.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(1):13-14.

DOI:10.7196/SAMJ.9168 1. Howarth GR, Goolab B, Dunn RN, Fieggen AG. Public somnambulism: A general lack of awareness of the consequences of increasing medical negligence litigation. S Afr Med J 2014;104(11):752-753. [http://dx.doi.org/10.7196/SAMJ.8568] 2. Roytowski D, Smith TR, Fieggen AG, Taylor A. Impressions of defensive medical practice and medical litigation among South African neurosurgeons. S Afr Med J 2014;104(11):736-738. [http://dx.doi.org/10.7196/SAMJ.8336]

IZINDABA

BOOK REVIEWS Troubled Children – Poems of Contemplation

By Joan Westaway and Mick Leary.

Alloa, Scotland: Diadem Books, 2014.

ISBN 978-1-291-95246-9 ‘How many times have I stood with my ear to your shell listening for an echo …’

The American author Joan Didion once commented that she writes to discover what she thinks and feels. We all possess a creative capacity that can help us to expand our understanding of our inner and outer worlds. Insight into who we are and what drives us helps us to be more effective in all areas of our lives.

Medicine is particularly challenging, in that practitioners are up close and personal with the difficulties of mind, body and spirit. We are affected by our patients, even though we might try to detach by donning the white coat of technical expertise and scientific fact. Too often we tuck our feelings away to cope with a demanding job.

Joan Westaway is an experienced child psychiatrist who turned to the pen to explore her observations. Her poems often have the quality of a debriefing, as she

lets loose the frustrations, heartaches and pleasures of working with children and adolescents who are emotionally troubled or do not fit in with society’s expectations of ‘normal’.

‘In my mirror we are trapped; the attacker and the attacked, like two cobras interlocked and trading venom in a windowless prison –’

Dawn Garisch Author of Eloquent Body (Modjaji, 2012) and Dance With Suitcase (Tiber Tree Press, 2013), Cape Town, South Africa dawn.garisch@gmail.com

the reformed MB ChB curriculum that was implemented in 2002. Dr Hartman is an educational scientist – my term for the colleagues usually termed educationists – and founding director of the Educational Development Unit in UCT’s FHS, which

became the ‘engine room’ of educational reform as curriculum restructuring began.

Given the strength of her case history, and the scientific method deployed, my term is apt and deserved.

At UCT’s FHS, the dominant ‘habitus’ (Hartman’s word) was the traditional biomedical (diagnose and treat) approach to illness, in the context of an increasing burden of disease, shrinking health and tertiary educational budgets and reliance on secondary and tertiary hospital-based service learning and ‘apprenticeship’ training. All conspired to bring about an imperfect, as yet unrealised, biopsychosocial habitus that is the ideal of the PHC holistic/comprehensive approach.

Dr Hartman’s case study meticulously records the processes as they evolved towards realisation of a ‘blueprint’, developed in the opening phases of development of the reformed curriculum that was launched in 2002.

In the words, echoed by the Health Professions Council of South Africa, of an external report: ‘it would appear that much of the excellent theoretical input and emphasis

The Primary Health Care Approach and Re­struc­ turing of the MB ChB: A Case Study of the Faculty of Health Sciences, University of Cape Town

By Nadia Hartman. Lambert Academic Publishing, 2014. ISBN: 978-3-8484-4941-5. info@lap-publishing.com In the late 1990s, the Faculty of Health Sciences (FHS) at the University of Cape Town caught the ‘wave’ of educational curriculum reform, responding to several imperatives. The context was post-1994 democratic South Africa (SA), and the government’s efforts to establish a primary healthcare (PHC)-led national health system requiring (since health professionals would receive service-based training within such a system) congruent curriculum reform.

The Primary Health Care Approach and Restructuring of the MB ChB is the distillation of Dr Nadia Hartman’s research into the extent to which alignment was achieved between the PHC philosophy, espousing a biopsychosocial approach to patients, and

Some poems are from the perspective of the patient, others from that of the therapist. Joan does not stay on the surface of the matter, but immerses herself and the reader in the world of the disturbed. Her poems are occasionally hard to understand, as she mirrors and is pulled by the emotions of her patients.

I thought this could be a weakness, but later saw it as a strength. The reader is con­ fronted with confusion, not unlike that which the psychiatrist initially encounters when working with patients. Each poem is then contextualised by Joan’s colleague Mick Leary, a paediatric neurologist.

Through her brave, thoughtful writing, Joan challenges us to be honest about our responses, to develop a critical attitude to ways in which medical practice falls short of the goal to heal, and to grow empathy with our patients.

‘See these sockets, they were my eyes; now they are dongas, the waterholes of flies –’

15

January 2015, Vol. 105, No. 1

IZINDABA

on the biopsychosocial approach in a PHC context in the first 3 years [of the curriculum] is undermined by the traditional biomedical approach of the latter years.’

The penultimate chapter (chapter 6) is a rich summary of the processes, which took place over two years, that put ‘flesh’ on the ‘bones’ of the curriculum blueprint, and of the shifts in control of the educational strategies from heads of departments to within the Education Development Unit.

The successes are highlighted: the multi­ disciplinary and multiprofessional faculty foundation courses that embed, and are strongly aligned with, the PHC approach; and the basic sciences courses (running over 2½ years), characterised by a (UCT-specific) hybrid of problem-based learning applied to commonly occurring illnesses that are representative of SA’s disease burden, along with clinical skills training that begins in year 2 and continues through year 3.

So also are the failures, the basis of which is multifactorial but the consequences of which are clinical. Years 4 - 6, characterised by biomedical, silo-based disciplinary teaching and experiential learning in secondary and tertiary hospital settings, are unlikely to ‘fit’ a graduate for ‘real-world’ SA practice in (sometimes) unsupervised internships and community service – and encourage subspecialist rather than general practice/ general specialty career choices after graduation.

In the words of one of the curriculum design team conveners: ‘we [referring to UCT’s FHS] started a curriculum change process to produce generalists and did not invest in strengthening our small Primary Care Department’. Equally sobering, all these years later, is to hear another state: ‘there is ignorance around the Department of Health’s policy document on health systems transformation (underpinned by

The AIDS Conspiracy: Science Fights Back

the PHC approach) and the HPCSA’s 1997 Training Guidelines (that mandate the PHC educational approach) … the MB ChB has never been subject to a major revision, so the tendency to specialise has been unchecked and it is a foreign concept that their practice could be guided by anyone other than themselves … autonomous behavior that is (now) being challenged by the HPCSA Accreditation process’.

In the context, the Guest Editorial that opens this issue of SAMJ[1] deserves noting.

Hartman’s book will interest those who are (medical) educationists, and those medical colleagues who choose medical education as a subspecialty interest.

Janet Seggie Editor janet.seggie@hmpg.co.za 1. Benatar S. The humanistic side of medical education. S Afr Med J 2015;105(1):3. [http://dx.doi.org/10.7196/SAMJ.9043]

and the then Minister of Health delayed the provision of treatment, resulting in hundreds of thousands of deaths, increasing the spread of the virus, and marginalising our medical professionals and scientists.

Natrass identifies players who contribute to the development and maintenance of conspiracies: the hero scientists, dissidents who lend credibility to the movement; the cultropreneurs, alternative therapists who exploit this for their own benefit; the living icons, who claim to be living proof of the legitimacy of the denialism; and the praise singers, media people who broadcast the false messages to the public.

Science and evidence-based medicine have fought back by their evidence and political credibility. However, this is not a single battle. It requires ongoing vigilance.

By Nicoli Natrass. Johannesburg: Wits University Press, 2012.

ISBN 9781868145621

Prof. Nicoli Natrass is an economist who has contributed substantially to the under­ standing of health issues in South Africa (SA).

In this important book she addresses the background factors that contributed to the dark AIDS denialism period in SA’s healthcare history. Although the book deals primarily with the AIDS pandemic, many of the insights contribute to a better understanding of the way in which all conspiracy beliefs function.

Conspiracy beliefs included that the human immunodeficiency virus (HIV) may have been created in a laboratory, and that the pharmaceutical industry invented AIDS to sell more toxic drugs. Swallowing this belief from the denialists, President Mbeki

J P van Niekerk Consulting Editor jpvn@iafrica.com

16

January 2015, Vol. 105, No. 1

FORUM

CLINICAL ALERT

Listerial brainstem encephalitis – treatable, but easily missed P Fredericks, M Britz, R Eastman, J A Carr, K J Bateman Pearl Fredericks and Jonathan Carr are affiliated to the Division of Neurology, Department of Internal Medicine, Tygerberg Hospital and Faculty of Medicine and Health Sciences, Stellenbosch University, Tygerberg, Cape Town, South Africa. Marcell Britz is a specialist neurologist in private practice in Port Elizabeth, Eastern Cape, South Africa. Roland Eastman and Kathleen Bateman are affiliated to the Division of Neurology, Department of Medicine, Groote Schuur Hospital and Faculty of Health Sciences, University of Cape Town, South Africa.

Corresponding author: K Bateman (kathleen.bateman@uct.ac.za)

Listerial brainstem encephalitis (LBE) is an uncommon form of listerial central nervous system infection that progresses rapidly and is invariably fatal unless detected and treated early. We report on six adult patients with LBE, of whom five were managed or co-managed by our unit during the period January - June 2012. All presented with a short prodromal illness followed by a combination of brainstem signs, including multiple cranial nerve palsies with emphasis on the lower cranial nerves, ataxia, motor and sensory long-tract signs, a depressed level of consciousness and apnoea. In two cases the diagnosis was delayed with adverse outcomes. LBE may be difficult to diagnose: clinicians may not be aware of this condition, the brainstem location may not be recognised readily, general markers of inflammation such as the erythrocyte sedimentation rate, C-reactive protein level or white cell count may be normal, and the cerebrospinal fluid is typically normal or there are only mild and nonspecific findings. Serological tests are unreliable, and diagnosis is achieved through blood cultures, magnetic resonance imaging and clinical recognition.

S Afr Med J 2015;105(1):17-20. DOI:10.7196/SAMJ.8700

Listeria monocytogenes is a very common intra­ cellular Gram-positive coccobacillus occurring in the soil, and humans may be affected via the oral route from contaminated food. The organism has a remarkable resistance to eradication during food processing, has unique virulence factors,[1,2] and is an important cause of food-borne epidemic disease with high associated mortality.[3] Following ingestion, infection occurs across the intestinal epithelium and spreads to the liver, where it becomes established within the cytosol of macrophages. Macrophages may then traffic infection via the bloodstream to the meninges and fetoplacental unit.[1] The disease usually presents as a febrile diarrhoeal illness, but may also cause septicaemia, meningitis and chorioamnionitis. Listerial meningitis may be the third most common cause of acute community-acquired bacterial meningitis.[2] Listerial brainstem meningitis (LBE), however, is an uncommon, sporadically occurring form of listerial infection that progresses rapidly and is invariably fatal unless treated early.[3-5] Cases are often undetected.[5] It is characterised by a prodromal febrile illness followed within 4 - 10 days by the abrupt onset of cranial nerve deficits associated with encephalopathy, hemiparesis, hemisensory loss and/ or cerebellar signs.[3-5] Unlike the other forms of central nervous system (CNS) listeriosis, LBE is striking in respect of the stepwise development of brainstem signs in the absence of meningism. This presentation is probably accounted for by a novel route of infection that exploits retrograde axonal transport to the brainstem along the cranial nerves that supply the oropharynx.[2,6]

Methods

We report on six patients with LBE, of whom five were managed or co-managed by the neurology unit at Tygerberg Hospital, Western Cape, South Africa, during the period January - June 2012. Definite cases were defined as cases with a compatible clinical syndrome

17

(prodrome followed by stepwise neurological deficits due to brainstem disease) and microbiological demonstration of L. monocytogenes in blood, cerebrospinal fluid (CSF) or brain tissue. Probable cases were defined as cases with a compatible clinical syndrome with ancillary tests (brain imaging and CSF analysis) supporting the diagnosis and evidence of improvement after commencement of antilisterial therapy.

The Stellenbosch University Human Research Ethics Committee approved the reporting of clinical material (S13/10/223).

Case report

The index case (patient 1) was a 59-year-old woman who presented with a 1-week flu-like illness followed by ataxia and sensory loss involving the face. Thereafter she developed a deteriorating level of consciousness and died within 3 weeks.

At onset she complained of fever, dizziness and unremitting frontal headache, and she was treated with telithromycin followed by moxifloxacin for suspected sinusitis. One week later, she developed hoarseness, numbness of the left cheek and ataxia of the left arm. A chest radiograph was normal. Magnetic resonance imaging (MRI) of the brain showed signal abnormalities in the pons and left middle cerebellar peduncle on fluid-attenuated inversion recovery (FLAIR) sequences, with subtle contrast enhancement on T1-weighted images.

Intravenous (IV) methylprednisolone was given for 3 days for a presumptive diagnosis of acute disseminated encephalomyelitis (ADEM), during which her condition remained stable and she was apyrexial. However, a day later, she developed a fever and became comatose, and was found to have bilateral papilloedema. CSF protein and glucose levels were normal, and there were 4 polymorpho­nuclear cells per high-power field on microscopy. A CSF Gram stain was negative, and neither the CSF nor initial blood cultures yielded growth after 5 days of incubation. Repeat MRI of the brain showed exten­sion of signal abnormalities into both cerebellar peduncles, the cerebellum

January 2015, Vol. 105, No. 1

18

January 2015, Vol. 105, No. 1

F

Recent sinusitis

6

HA, dizziness, facial numbness, hoarseness

Fever, L CN V2 (S), CN X, L arm dysmetria, coma

TEL, MXF

MP (d11)

Death (d17)

Gender

Comorbid disease

Length of prodrome (days)

Symptoms (in order of onset)

Signs (in order of onset)

Antibiotics prior to cultures

Treatment

Nadir

Outcome

Alive, no focal signs (d41)

d10

AMP (d8); ACV (d5); RHZE (d8 - d22)

AMX (d2), CRO (d3)

Fever, nystag, L dysmetria, gait ataxia (d3); drowsiness, apnoea (d6); bilat CN IV, L CN VII (LMN), nystag, CN X, mild quadriparesis (d8)

Fever, dizziness, ataxia

3

Hpt, DM

M

37

Caledon, W Cape

2

Alive, residual facial numbness, mild gait ataxia (d33)

d13

AMP (d11)

RHZE (d5)

R Horner’s, bilat CN VI, nystag, L CN V (S), L CN X, worsening L dysmetria, gait ataxia (d11)

Unilat HA; N&V, gait ataxia, dysphonia (d5); L facial numbness, D/V (d6)

5

HIV*, ethanol abuse

M

51

Paarl, W Cape

4

Death (d18)

ACV, CRO, DXM (d11); AMP (d12); GEN (d14)

Fever, coma, bilat ptosis, bilat gaze palsies, skew deviation, R CN VII (LMN), quadriparesis, hyperreflexia (d11)

fever, dysarthria, dysphagia, numb L arm

1

RA on immunosuppressants

F

36

Kleinmond, W Cape

Alive, residual mild R facial palsy, L gaze palsy (d60)

d20

CRO (d14); DXM (d17); AMP (d20)

Fever, meningism, R CN VII (LMN) (d7); drowsiness, vertigo, hiccups, L gaze palsy, R hemisensory (d17)

HA, dizziness; R facial palsy, N&V (d7)

7

None

M

25

Villiersdorp, W Cape

5

6

Alive, no focal signs (d72)

d35

MP (d15); CRO, TMP/SXT, MTZ, AMP (d35)

R CN VI, R CN VII, L CN X, L hemisensory, bilat leg dysmetria (d15), R hemiplegia (d35)

HA; dizziness, gait ataxia (d7); L facial numbness, R facial palsy (d15); D/V, N&V

7

None

F

32

Atlantis, W Cape

PE = Port Elizabeth; E Cape = Eastern Cape Province, South Africa; W Cape = Western Cape Province; F = female; M = male; Hpt = hypertension; DM = diabetes mellitus; RA = rheumatoid arthritis; CN = cranial nerve; S = sensory; L = left; R = right; bilat = bilateral; unilat = unilateral; LMN = lower motor neuron; nystag = nystagmus; HA = headache; N&V = nausea and vomiting; D/V = double vision; d = days since illness onset; TEL = telithromycin; MXF = moxifloxacin; AMX = amoxicillin; CRO = ceftriaxone; RHZE = rifampicin, isoniazid, pyrazinamide, ethambutol; MP = methylprednisolone; AMP = ampicillin; ACV = acyclovir; DXM = dexamethasone; GEN = gentamycin; TMP/SXT = trimethoprim/sulfamethoxazole; MTZ = metronidazole. *Not on combination antiretroviral therapy.

59

Age (years)

1

Discussion

PE, E Cape

and rostrally into the basal ganglia. There was no clinical response to treatment with IV corticosteroids and acyclovir. Subsequent MRI brain imaging revealed progression of disease to involve the upper cervical cord, brainstem, cerebellum, bilateral basal ganglia and rostral left cerebral hemisphere. A repeat CSF sample was acellular with normal chemistry and microscopy. The patient died after 17 days of illness. Blood cultures taken on day 15 as well as CSF cultures taken on day 17 cultured L. monocytogenes, and at autopsy L. monocytogenes microabscesses were confirmed (Fig. 1).

Patient

Fig. 1. Oil-immersion photomicrograph at × 1 000 magnification shows Gram-positive short intracellular rods.

Geographical location

3

We report two definite (patients 1 and 4) and four probable cases of LBE. The clinical data and ancillary tests are summarised in Tables 1 and 2, respectively. LBE typically begins with a prodrome of up to 16 days (median 4 days),[3,4] with isolated cases reported to have prodromes of more than a month.[3] In our series, the median time before the onset of neurological signs was 5.5 days. Headache (73%), fever (85%) and nausea or vomiting (64%) are the most commonly reported early features,[3,4] but these were absent in a third of our patients.

Mental state at admission is often preserved (59%).[3] The prodrome is followed by the onset of focal signs of lower brainstem and cerebellar involvement. Patients fre­ quently present with asymmetrical cranial nerve dysfunction (VII, VI, IX, X and V, in order of descending frequency).[3-5] Untreated patients deteriorate over days with new cranial nerve deficits and the emergence of ‘crossed’ or bilateral longtract signs (hemiparesis more often than hemisensory loss), cerebellar signs and/ or encephalopathy. At maximal evolution, most patients have combined cranial nerve deficits and long-tract signs (81%), and more than half have cerebellar signs.[3-5] Cranial

Table 1. Clinical presentation, course and outcomes

FORUM

FORUM

Table 2. Laboratory, pathology and radiological investigations Patient 1

2

3

4

5

6

WCC

13

13.07

6.52

12.17

15.31

9.57

CRP

ND

97

86

85

ND

ND

Inflammatory markers

CSF

Cells (PMN, Ly, E)

4, 0, 0

11, 484, 5

66, 21, 6

12, 68, 9

4, 375, 0

0, 60, 0

Protein (g/L)

0.3

0.8

0.69

0.5

0.59

0.63

Glucose (mmol/L)

6.3

6

3.2

2.8

3.3

3.3

Blood

Pos (d15)

Neg (× 2)

Neg (× 2)

Pos (× 2)

Neg (× 2)

Neg (× 2)

CSF

Pos (d17)

Neg

Neg

ND

Neg

Neg

Brain biopsy

L. monocytogenes culture

Pos

ND

ND

ND

ND

ND

CT

ND

N

Well-defined ring lesions dorsal Po, L MCP

Poorly defined lesions R Po, R MCP; incomplete ring enhancement

N

N

MRI

istribution of high signal on D T2WI & FLAIR sequences

L Po, MCP, and Cb

L cerebral ped, L MCP, L Cb

ND

R cerebral ped, R MCP, Me, upper cord

R cerebral ped, R MCP, dorsal Po, Me, upper cord

Mb, dorsal Po, Cb vermis, Me; after 9 d interval: new lesions L thalamic, L parietal

nhancement pattern on T1WI E pre-/post gadolinium

Subtle, incomplete ring dorsal Po

Complete ring

ND

Incomplete ring

Patchy, nodular

Patchy, nodular; complete ring

CN enhancement present

N

Y

Y

Y

N

N

Radiological differential reported

Demyelination (BS/ADEM), glioma

Abscess

Tuberculoma, listerial abscess

Demyelination (ADEM)

Demyelination (ADEM)

Abscess, demyelination

WCC = white cell count; CRP = C-reactive protein; CSF = cerebrospinal fluid; PMN = polymorphonuclear cell; Ly = lymphocyte; E = erythrocyte; CT = computed tomography; MRI = magnetic resonance imaging; T2WI = T2-weighted imaging; FLAIR = fluid attenuated inversion recovery; Pos = positive; Neg = negative; d = days since symptom onset; ND = not done; N = normal; L = left; R = right; Mb = midbrain; Po = pons; MCP = middle cerebellar peduncle; Cb = cerebellum; Me = medulla; ped = peduncle; CN = cranial nerve; N = no; Y = yes; BS = Bickerstaff encephalitis; ADEM = acute disseminated encephalomyelitis.

nerve involvement is seen in all patients at the nadir of the illness. Frequently, noncontiguous cranial nerve nuclei will be affected during the course of the illness; for instance, patient 6 had left trigeminal sensory involvement, right abducens palsy and lower motor neuron facial weakness, as well as a left palatal palsy (cranial nerve X), indicating multifocal brainstem involvement. Respiratory failure due to involvement of the medulla may occur early and necessitate ventilatory support.[3,5] A reduced level of consciousness was present in four of the six patients.

The differential diagnosis of brainstem enceph­alitis varies depending on population

and geographical region.[7] Broadly, this presentation may be due to demyelination (e.g. multiple sclerosis, ADEM) or autoimmune/inflammatory (e.g. Behçet’s dis­ ease, paraneoplastic), infectious and very rarely neoplastic diseases (e.g. lymph­­ oma).[7,8] Infectious causes in adults include viruses, such as entero- and herpesviruses.

Surprisingly, however, a bacterial infection such as listeria is one of the most common infectious causes of brainstem encephalitis.

In an SA setting, tuberculosis and pro­ gressive multifocal leucoencephalopathy due to JC virus infection are also important considerations in the setting of progressive brainstem disease.

19

January 2015, Vol. 105, No. 1

With CNS invasion, listeriosis may target the meninges resulting in the typical clinical picture of acute/subacute bacterial meningitis,[2] but unlike other bacteria may also target the brain parenchyma and specifically the rhombencephalon (pons, medulla, cerebellum). In humans, brainstem infection occurs in up to 11 - 24% of patients with CNS listeriosis.[3,5] In LBE, it appears that food-borne bacteria invade the brainstem by retrograde axonal migration along the oropharyngeal cranial nerves.[2] A postmortem study of nine human cases of LBE revealed brainstem microabscesses that were prominently distributed within the nuclei, tracts and intraparenchymal

FORUM

portions of the cranial nerves innervating the oropharynx (V, VII, IX, X and XII).[9] Injection of listerial bacteria into the facial nerves of mice was followed 5 - 10 days later by ipsilateral CNS deficits that were prevented by section of the nerve proximal to the inoculation site.[10] Similarly, injection of listerial bacteria into the sciatic nerves of mice resulted in a flaccid paraparesis that was prevented by sectioning the sciatic nerve proximal to the inoculation site.[10] Actindependent locomotion of L. monocytogenes along microtubules has been demonstrated in other eukaryote cells and remains the most plausible explanation for bacterial propagation along axons.[11] Factors predisposing to LBE in humans have not been identified. Unlike listerial meningitis, where two-thirds of patients are immunosuppressed by medication, advanced age or comorbid disease, LBE has been reported to occur mainly in immunocompetent adults.[3] Of our patients, three had comorbid conditions such as immunosuppressant therapy, diabetes, alcoholism and HIV infection.

Of importance, CSF abnormalities in LBE are not typical of bacterial infections of the CNS, and one in five patients may have normal CSF on initial sampling.[3] A relatively normal CSF glucose level, mod­erate lymphocytic pleocytosis and a moderately increased CSF protein level may mistakenly be attributed to viral or myco­bacterial infection, or, as in one of our patients, to inflammatory demyelination.[3-5] The CSF was normal in one of our patients, and patient 3 had a neutrophil-predominant mild pleocytosis.

In a review of patients with LBE by Armstrong and Fung,[3] CSF Gram stains were positive in only 10% of cases, with CSF cultures positive in 33 - 41% and blood cultures in 61%. Positive cultures were

Fig. 2. Sagittal MRI brain scan (T1WI post gadolinium) of patient 4 showing rim-enhancing lesions in the brainstem. (MRI = magnetic resonance imaging.)

obtained in two of our six patients (two on blood, one on CSF).

MRI is the radiological investigation of choice in the diagnosis of brainstem disease. In our series, findings on MRI were abnormal in all patients studied (five scanned, see example in Fig. 2), and showed T2 signal change in the brainstem, cerebellar peduncles and cerebellum associated with variable enhancement on contrasted T1-weighted images. Computed tomography (CT) is less sensitive than MRI in LBE;[3–5] two of five patients in this study had abnormal findings. Striking cranial nerve enhancement may be seen on MRI,[12] or, less often, on CT, and was present in three of our six patients (two MRI, one CT). Radiological appearances are nonspecific, however, and in a region of high tuberculosis prevalence listerial brainstem abscesses may be radiologically indistinguishable from tuberculomas. In the absence of microbiological or histo­ pathological confirmation, empiric treat­ ment for both L. monocytogenes and Myco­ bacterium tuberculosis may have to be considered. Rapid radiological and clinical improvement would favour listeriosis over tuberculosis as the likely cause.

Supratentorial abscess formation may occur in conjunction with LBE and was present in patients 1 and 6 in our series.[3,13] Follow­ ing the prodrome and initial neurological deficit, patient 6 received high-dose cortico­ steroids for a presumed diagnosis of ADEM, after which disease progression appeared stable until abrupt deterioration on day 35.

MRI showed left thalamic and parietal lobe abscess formation. A biopsy specimen of brain tissue for culture, obtained 5 days after starting intravenous ampicillin, was negative. The patient made a remarkable recovery.

High-dose ampicillin is the drug of choice.

The recommended treatment is ampicillin 2 g IV 4-hourly for 21 days,[14] although some authors suggest longer treatment periods and the addition of an amino­ glycoside.[15] Gentamicin acts synergistically with ampicillin and may be added in patients with immune impairment.[3] Co-trimoxazole is an acceptable alternative in penicillinallergic patients.[14] It is important to note that third-generation cephalosporins, commonly recommended as first-line therapy for bacterial meningitis of unknown cause, have no activity against Listeria species.

Untreated patients invariably die,[3-5] usu­ ally within 5 - 18 days after symptom onset.[3] Treated survival rates of 49 - 64% have been reported.[3,4] Early treatment with ampicillin is associated with improved survival (76%)

20

January 2015, Vol. 105, No. 1

compared with delayed treatment or initial treatment with inappropriate antibiotics such as cephalosporins.[3] Neurological dysfunction improves within 2 - 7 days of drug initiation.[4] In our series, no patient suffered disabling sequelae.

Small epidemics of listeriosis from contam­ inated food sources are frequently reported in countries where the infection is notifiable, and the source of the contaminated food has often been identified. Given the high fatality rate of listeriosis, contaminated food is an important public health hazard. In SA, however, the disease is not notifiable at present. It is of interest that, as three patients in this series presented within 6 months of each other and came from geographically closely related areas, the infection may have been caused by a common contaminated food source.

References 1. Freitag NE, Port GC, Miner MD. Listeria monocytogenes – from saprophyte to intracellular pathogen. Nat Rev Microbiol 2009;7(9):623-628. [http://dx.doi.org/10.1038/nrmicro2171] 2. Disson O, Lecuit M. Targeting of the central nervous system by Listeria monocytogenes. Virulence 2012;3(2):213-221. [http:// dx.doi.org/10.4161%2Fviru.19586] 3. Armstrong RW, Fung PC. Brainstem encephalitis (rhomb­ encephalitis) due to Listeria monocytogenes: Case report and review. Clin Infect Dis 1993;16(5):689-702. [http://dx.doi. org/10.1093/clind/16.5.689] 4. Uldry PA, Kuntzer T, Bogousslavsky J, et al. Early symptoms and outcome of Listeria monocytogenes rhombencephalitis: 14 adult cases. J Neurol 1993;240(4):235-242. [http://dx.doi.org/10.1007/ BF00818711] 5. Antal E-A, Dietrichs E, Løberg E-M, Melby KK, Maehlen J. Brain stem encephalitis in listeriosis. Scand J Infect Dis 2005;37(3):190194. [http://dx.doi.org/10.1080/00365540410020938] 6. Madarame H, Seuberlich T, Abril C, Zurbriggen A, Vandevelde M, Oevermann A. The distribution of E-cadherin expression in listeric rhombencephalitis of ruminants indicates its involvement in Listeria monocytogenes neuroinvasion.

Neuropathol Appl Neurobiol 2011;37(7):753-767. [http://dx.doi. org/10.1111/j.1365-2990.2011.01183.x] 7. Jubelt B, Mihai C, Li TM, Veerapaneni P. Rhombencephalitis/ brainstem encephalitis. Curr Neurol Neurosci Rep 2011;11(6):543552. [http://dx.doi.org/10.1007/s11910-011-0228-5] 8. Moragas M, Martínez-Yélamos S, Majós C, Fernández-Viladrich P, Rubio F, Arbizu T. Rhombencephalitis: A series of 97 patients.

Medicine (Baltimore) 2011;90(4):256-261. [http://dx.doi. org/10.1097/MD.0b013e318224b5af] 9. Antal E-A, Løberg E-M, Dietrichs E, Maehlen J. Neuropathological findings in 9 cases of Listeria monocytogenes brain stem encephalitis. Brain Pathol 2005;15(3):187-191. [http://dx.doi.org/10.1111/j.1750-3639.2005.tb00519.x] 10. Antal E-A, Løberg E-M, Bracht P, Melby KK, Maehlen J. Evidence for intraaxonal spread of Listeria monocytogenes from the periphery to the central nervous system. Brain Pathol 2001;11(4):432-438. [http://dx.doi.org/10.1111/j.1750-3639.2001. tb00411.x] 11. Dons L, Jin Y, Kristensson K, Rottenberg ME. Axonal transport of Listeria monocytogenes and nerve-cell-induced bacterial killing. J Neurosci Res 2007;85(12):2529-2537. [http://dx.doi. org/10.1002/jnr.21256] 12. Moro A, Albino PHDC, Bresciani AP, et al. Rhombencepha­ litis caused by Listeria monocytogenes with striking involvement of trigeminal nerve on MR imaging. Arq Neuropsiquiatr 2011;69(3):568-569. [http://dx.doi. org/10.1590/S0004-282X2011000400033] 13. Soares-Fernandes JP, Beleza P, Cerqueira JJ, et al. Simultaneous supratentorial and brainstem abscesses due to Listeria monocytogenes. J Neuroradiol 2008;35(3):173-176. [http:// dx.doi.org/10.1016/j.neurad.2007.07.009] 14. Van de Beek D, Brouwer MC, Thwaites GE, Tunkel AR. Advances in treatment of bacterial meningitis. Lancet 2012;380(9854):1693-1702. [http://dx.doi.org/10.1016/S01406736(12)61186-6] 15. Mylonakis E, Hohmann EL, Calderwood SB. Central nervous system infection with Listeria monocytogenes: 33 years’ experience at a general hospital and review of 776 episodes from the literature. Medicine (Baltimore) 1998;77(5):313-336. [http:// dx.doi.org/10.1097/00005792-199809000-00002]

Accepted 1 August 2014.

FORUM

MEDICAL EDUCATION

The research component of specialist registration – a question of alligators and swamps? A personal view C M Aldous, M Adhikari, C C Rout Colleen Aldous is a senior lecturer in the School of Clinical Medicine at the University of KwaZulu-Natal, Durban, South Africa. She is a medical scientist with a PhD in science education and is involved in postgraduate research mentorship across several medical disciplines including surgery, orthopaedics, dermatology, paediatrics, opthalmology, general medicine and psychology. Her own research interest is human genetics, and she is a member of the national steering committee and working group reviewing National Department of Health policy guidelines for human genetics services. Miriam Adhikari, MB ChB, FCP (Paeds), PhD, is currently Scientific Advisor to the Postgraduate Office, School of Clinical Medicine at UKZN. She has had a long and distinguished research career at the UKZN medical school and has received several awards and accolades for her long-term and continued service to paediatrics in the province. She has served on several Health Professions Council of South Africa committees across the country, and has a wealth of experience in postgraduate education. Chris Rout, MB BS, FFARCS, FCA (SA), is in private anaesthetic practice in Durban. He maintains a research interest in obstetric anaesthesia and is developing interests in clinical skills transfer, clinical support needs of medical officers in rural district hospitals, and the influence of Plato on 15th century Florentine art.

Corresponding author: C M Aldous (colleenaldous@gmail.com)

The recent implementation of the research requirement for specialist registration presents difficulties with regard to the provision of research supervision, particularly in those medical schools that previously followed the path of qualification via the Colleges of Medicine of South Africa examinations. The differences between the requirements for research supervision as stated in the Health Professions Council of South Africa memorandum and those of the Committee for Higher Education are causing disparities between medical schools similar to those that led to the memorandum in the first place. While the research component of specialist training can only improve the quality of both patient care and academic endeavour, it requires an enormous investment of time on the part of both the specialist trainees and their supervisors. In order to deal with this, specific issues outlined in the article need to be addressed.

S Afr Med J 2015;105(1):21-22. DOI:10.7196/SAMJ.8732

In January 2010, the Medical Subcommittee for Postgraduate Education and Training of the Health Professions Council of South Africa (HPCSA) published new requirements for specialist registration in South Africa (SA).[1] This was to solve the problem of variations between training centres in integrated assessment, variations between exit outcomes 1 and 2 (associated with differences between several MMed centres and the national Colleges of Medicine), and failure to comply with outcome 3 to undertake and complete a relevant research study.

The solution was a common exit examination (currently the Fellowship of the Colleges of Medicine), strict application of the portfolio requirement, and completion of a research component before specialist registration could occur. The research would be completed ‘under the supervision of the Head of Department or nominee’ and assessed to show that ‘appropriate theoretical knowledge is demonstrated; a research protocol is compiled according to required norms; a progress report on the research project is given on a regular basis; and that research results are reported in a format of a dissertation according to acceptable scientific norms’. The research study would be allocated a minimum of 60 credits in terms of the Standards Generating Body of the Medical and Dental Board of the HPCSA, would be ‘assessed at university level’, and ‘may be used as a credit for Part III of the MMed degree’.[1] This excellent solution to the pre-existing variations in qualifications for specialist registration has, however, introduced difficulties for some training centres. These include finding supervisors who fulfil regulatory requirements, provision of adequate research time for specialist trainees, and provision of time for supervision.

Although under the control of the HPCSA, post numbers allocated to specialist training are administered by training institutions

21

(effectively university departments). Irrespective of the HPCSA ruling, universities must abide by Committee for Higher Education (CHE) postgraduate policies, procedures and regulations.[2] These state that the criteria for selection and appointment of supervisors, in addition to their being acceptable to the research community, must include the following: • The supervisor has a qualification in a relevant field of study higher than, or at least at the same level as, the exit level of the postgraduate programme he/she is supervising.

• The supervisor has an appropriate research track record, as well as experience, expertise and peer recognition in the field of study.

• In the case of inexperienced or new supervisors, there is ongoing staff development and support, and joint supervision is explored as an option.

Although some centres have fared better than others, potential supervisors meeting all qualifying criteria are currently scarce in many medical school departments. The unknown extent of this problem has been highlighted in a recent editorial.[3] This scarcity is due partly to recent challenges to specialist training in SA[3] and partly to specialists having previously developed their experience and expertise in tandem with research relevant to their specialty, but without acquiring degrees. A wellpublished clinician would be rewarded with seniority, often a professorship, and might be head of a department with only the fellowship diploma as the highest documented level of scholarship.

Should these highly accomplished academics now be considered as inadequately qualified to supervise MMed students because they do not have a master’s degree?

January 2015, Vol. 105, No. 1

FORUM

It could be argued that the research environment, encompassed by the CHE Criteria for Programme Accreditation,[2] is more important than supervisors’ paper qualifications. Master’s and doctorate degrees are markers of learning achievement; they are not markers of research or teaching (supervision) excellence. Neither guarantees development as a successful research supervisor or an ‘appropriate research track record, experience, expertise and peer recognition’, although those with PhD qualifications might be expected to pursue a research track record through future research in their fields.

It takes time for a student to produce the required quality of research, time for good supervision, and time to create more supervisors.

Brenda Wingfield[4] applied the ‘10 000 hours hypothesis’[5] to argue that it should take 10 000 hours of focused and productive work to complete a PhD (i.e. become an expert in a highly focused topic), 4 000 hours for an MSc degree, and 2 000 hours for an honours degree. The South African Qualifications Authority equates one credit with 10 notional hours of learning[6] that are supposed to approximate the time the student requires to achieve learning outcomes, assuming a 45-week full-time academic year.

In the case of the research component of both HPCSA and CHE regulations, this amounts to a minimum of 60 credits, equivalent to 600 hours’ work. This is at variance with Wingfield’s estimate, largely because the regulations relate to minimum requirements and her figures relate to reality.

We argue that both figures are underestimates, given the required learning outcomes (producing a scientifically sound research protocol, conducting research and then presenting the research in a scientifically accepted manner) and the lack of research experience that registrars have when they commence their specialist training.

The further burden borne by specialist trainees of acquiring required clinical skills and expertise, in addition to an extensive theoretical background, is acknowledged by the CHE as a ‘permitted exception’ where professional registration in health sciences ‘... has a credit load far in excess of the indicative 180 credits that the HEQSF [Higher Education Qualifications Sub-Framework] requires for a Master’s degree’[6] (appendix 1, p. 42).

Wingfield[7] also showed that to supervise a research project takes about 10% of the time that the student has to commit to complete the degree. Even using the above minimum 600 hours allocated to the student, this equates to 60 hours of supervisor commitment per specialist trainee. Although this might be averaged over 4 years, examination preparation and clinical commitments restrict the time available. Supervision has to be fitted into an already crowded schedule of teaching, personal research and clinical service. Firstclass teaching and first-class research are both full-time jobs[8] that, for a clinician, have to be added to his or her third full-time job of patient care. We argue that the figures are gross underestimates of the time necessary for effective supervision, even with well-motivated students. It should be borne in mind that many specialist trainees have no intrinsic interest in research; rather, its pursuance is viewed as a compulsory component of their training, leading to specialist professional qualification.

In the natural sciences it could take as little as 9 years from admission as an undergraduate to achieve a doctorate, which would represent the start of establishing ‘an appropriate research track record, as well as experience, expertise and peer recognition in the

22

field of study’; this hypothetically might take an additional 3 years as a full-time academic. In medicine the equivalent figures would be at least 16 years to achieve a PhD (assuming release from patient care for part of the time) and, considering continuing commitment to clinical work, at least 5 years to establishing a track record, etc. Clearly any mitigation of the current lack of CHE-compliant supervisors is not going to happen overnight.

The unacknowledged reality is that each medical school is coming to grips with the issue of accommodating both CHE and HPCSA supervisor regulations in different ways; one might insist on the master’s/PhD rule and ignore requirements for research track record, etc.; another might ignore the CHE regulations and combine Fellowship of the Colleges of Medicine with two first-author publications; yet another might trust individual department heads to pick and choose. In short, we are heading back to the situation of separate processes leading to specialist registration.

If the current inconsistencies between regulatory bodies’ rules represent the alligators snapping at us, the reasons behind the recent change in HPCSA regulations represent the swamp we are currently forgetting to drain.

The research component, either in its HPCSA or CHE guise, is an important addition to the specialist training curriculum. It can only improve the quality of both patient care and academic endeavour.

However, it requires an enormous investment of time on the part of both the specialist trainees and their supervisors, of whom, with regard to the latter, there is a shortage.

The following issues should be addressed: • The Department of Health should recognise the academic requirements of specialist training and allocate time for this to both trainees and their supervisors in order to comply with the requirements of the HPCSA. • The HPCSA and CHE should start reading from the same page regarding research supervision. Descriptors such as ‘appropriate research track record’, etc. must be defined. The process should allow for awarding both the Fellowship and the MMed to our specialist trainees, which they richly deserve.

• A way should be found to incorporate into the supervision process those excellent teachers and researchers who rose through the profession at a time when research was regarded as a way to increase knowledge and improve patient care, not just a gateway to an academic career or a cash-cow for universities.

1. Health Professions Council of South Africa Subcommittee for Postgraduate Education and Training (Medical). New Requirements for the Registration of Specialists in South Africa. http://www.hpcsa. org.za/downloads/medical_dental/new_requirements_for_registration_of_specialists_in_sa.pdf (accessed 24 February 2011).

2. CHE Criteria for programme accreditation, November 2004. 3.1.8 Postgraduate policies, procedures and regulations: Criterion 9 (ii). http://nr-online.che.ac.za/html_documents/CHE_accreditation_ criteria_Nov2004.pdf (accessed 28 July 2014).

3. Benatar S. Professional competence and professional misconduct in South Africa. S Afr Med J 2014;104(7):480-482. [http://dx.doi.org/10.7196/SAMJ.8492] 4. Wingfield B. How long does it take to get a PhD? S Afr J Sci 2010;106(11/12), Art. #469, 1 page. [http:// dx.doi.org/10.4102/sajs.v106i11/12.469] 5. Gladwell, M. Outliers: The Story of Success. New York: Little, Brown and Company, 2008.

6. The Higher Education Qualification Sub-framework. Qualifications, volumes of learning and credits, para 29, p. 15. CHE 2013. http://www.che.ac.za/sites/default/files/publications/HEQSF%202013.pdf (accessed 17 July 2014).

7. Wingfield B. How much time does it take to supervise a PhD student? S Afr J Sci 2012;108(11-12), Art. #1454, 2 pages. [http://dx.doi.org/10.4102/sajs.v108i11/12.1454] 8. Prince MJ, Felder RM, Brent R. Does faculty research improve undergraduate teaching? An analysis of existing and potential synergies. Journal of Engineering Education 2007;96(4):283-294. [http://dx.doi. org/10.1002/j.2168-9830.2007.tb00939.x]

Accepted 5 August 2014.

January 2015, Vol. 105, No. 1

FORUM

GENETICS IN MEDICINE

No evidence for clinical utility in investigating the connexin genes GJB2, GJB6 and GJA1 in non-syndromic hearing loss in black Africans A Wonkam, J Bosch, J J N Noubiap, K Lebeko, N Makubalo, C Dandara Assoc. Prof. Ambroise Wonkam is a medical geneticist trained at the University of Geneva, Switzerland, whose research interest is reflected in more than 70 publications with a focus on monogenetic diseases of people of African descent. He was the principal investigator on this project. Jason Bosch completed his MSc in human genetics on the project, with molecular analysis of the GJB2 and GJA1 genes, and Kamogelo Lebeko did all the experiments on the GJB6 gene for her honours degree in human genetics. Nomlindo Makubalo, a paediatrician, spent two years in the medical genetics unit and did all the clinical phenotyping of the cohort from the Eastern Cape, South Africa, where she is currently practising. Assoc. Prof.

Collet Dandara, a molecular geneticist, supervised all the molecular experiments in the project. All these authors were affiliated to the Division of Human Genetics, Department of Clinical Laboratory Sciences, Faculty of Health Sciences, University of Cape Town, South Africa, during the course of the project. Jean Jacques Noubiap, of the Faculty of Medicine and Biomedical Sciences, University of YaoundĂŠ I, YaoundĂŠ, Cameroon, is a general practitioner with strong research interests. He performed all the clinical phenotyping of the Cameroonian cohort for his MD degree.

Corresponding author: A Wonkam (ambroise.wonkam@uct.ac.za) Background. Deafness is the most common sensory disability in the world. Globally, mutations in GJB2 (connexin 26) have been shown to play a major role in non-syndromic deafness. Two other connexin genes, GJB6 (connexin 30) and GJA1 (connexin 43), have been implicated in hearing loss, but these genes have seldom been investigated in black Africans. We aimed to validate the utility of testing for GJB2, GJB6 and GJA1 in an African context.

Methods. Two hundred and five patients with non-syndromic deafness from Cameroon and South Africa had the full coding regions of GJB2 sequenced. Subsequently, a carefully selected subset of 100 patients was further sequenced for GJB6 and GJA1 using Sanger cycle sequencing. In addition, the large-scale GJB6-D3S1830 deletion was investigated.

Results. No pathogenic mutations that could explain the hearing loss were detected in GJB2, GJB6 or GJA1, and the GJB6-D3S1830 deletion was not detected. There were no statistically significant differences in genomic variations in these genes between patients and controls. A comprehensive literature review supported these findings.

Conclusion. Mutations in GJB2, GJB6 and GJA1 are not a major cause of non-syndromic deafness in black Africans and should not be investigated routinely in clinical practice.

S Afr Med J 2015;105(1):23-26. DOI:10.7196/SAMJ.8814

Deafness is one of the leading causes of disability in the world. The prevalence of hearing loss is highest in South Asia and sub-Saharan Africa, attributable to poor healthcare systems where complications at birth as well as infections result in loss of hearing in

the newborn.[1] Screening for hearing loss in newborns is standard practice in many countries and is the most effective way of detecting hearing problems and reducing the negative effects of hearing loss. South Africa (SA) does not have a national screening programme. At best, only 7.5% of public hospitals provide screening for hearing loss, with only 1% providing universal screening.[2] The situation is even worse in the rest of sub-Saharan Africa.[3] Clinical presentation of hearing loss is extremely heterogeneous, ranging from mild to total hearing loss and presenting either as a single symptom or as one of many clinical features. The causes of hearing loss can be genetic or environmental. A recent review of the aetiology of childhood hearing loss showed that 48.3% of cases of hearing loss were of unknown cause, 30.4% were genetic and 19.2% were acquired.[4] In developing communities, the environment contributes significantly more to congenital hearing loss than in the developed world. In Africa, bacterial meningitis contributes to cases of hearing loss in infants and young children.[3] With improved healthcare there will be a

23

reduction in cases of hearing loss caused by disease and an increase in the proportion attributable to genetics, the majority of which are non-syndromic.[1] To date, 65 different genes, with many different causative mutations, have been identified that contribute to non-syndromic deafness.[5] Mutations in gap junction (GJ) genes, specifically GJB2 (connexin 26), have been shown to be the major contributors to deafness globally.[6]

GJ proteins (connexins) regulate functions of the cochlea

GJs are intercellular channels that allow ions, second messengers and small metabolites to be exchanged by adjacent cells. Connexins form intercellular channels by combining in groups of six to form a structure called a connexon.[7] Connexons from adjacent cells join together to form GJs (Fig. 1, A). The connexin proteins are named according to their weight; connexin 26 is a protein with a molecular weight of 26 kDa. The two major groups of connexins are the alpha and beta connexins, based on sequence similarity of the cytoplasmic loop. GJB2 was the second beta connexin gene to be identified. GJB2 is located on chromosome 13 and codes for the GJ protein connexin 26. Connexin 26 is involved in the transport of potassium ions and other small molecules and is expressed in the cochlea (Fig. 1, B).[8] It

January 2015, Vol. 105, No. 1

FORUM

A Connexin

Cell 1: Cytoplasmic membrane

Cell 2: Cytoplasmic membrane

Connexon

Fig. 1. GJ proteins (connexins) and the inner ear. A: Connexins form intercellular channels by combi­ ning in groups of six to form a structure called a connexon; two connexons from adjacent cells join together to form GJs. B: Cross-section through the cochlea. Red cells express connexin 26 (adapted from Willems et al.[8]). (GJ = gap junction.)

is believed that mutations in GJB2 (connexin 26 gene) affect its ability to transport potassium ions and therefore regulate the endocochlear potential required for nerve impulses involved in hearing, but the mode of action is not definitively elucidated.[9]

No mutations in connexin genes GJB2, GJB6 or GJA1 among Cameroonians and Xhosa South Africans

With the exception of Ghana,[10] mutations in GJB2 (connexin 26) have not been shown to be a major contributor to deafness in sub-Sahara Africa.[6] Could other potential candidate genes, GJB6 (connexin 30) and

GJA1 (connexin 43), lead to non-syndromic deafness in Africans? The GJB6-D13S1830 deletion is present in up to 9.7% of people of European descent,[11] and represents the second leading genetic cause of nonsyndromic deafness. When GJA1 mutations were detected in African Americans,[12] GJA1 emerged as a possible candidate for hearing loss in indigenous Africans. However, failure by investigators to differentiate between GJA1 and its pseudogene led to this hypothesis being discarded.[13] We performed a series of molecular investigations and reviewed the literature with the aim of validating the clinical utility of testing for GJB2, GJB6 and GJA1 in the African context. As part of this validation,

24

January 2015, Vol. 105, No. 1

we recruited a total of 205 patients affected with non-syndromic hearing loss from a well-described Cameroonian cohort[3] and newly recruited black South Africans of Xhosa ancestry, the majority (85%) of whom had sensorineural deafness. All 205 patients were investigated for GJB2 gene, as previously reported.[14] A subset of 100 selected patients, with deafness likely to be of genetic cause (mostly familial cases) and who did not have any mutation in GJB2 gene, were investigated for mutations in the GJB6 and GJA1 genes.[15] All the coding regions of GJB2, GJB6 and GJA1 were amplified and detec­ tion of del(GJB6-D13S1830) was also investigated.[14,15] In the GJB2 gene, two likely pathogenic mutations were detected in two unrelated Cameroonian participants, g.3741_3743delTTC (p.F142del) and g.3816G>A (p.V167M) in a single individual each and in the heterozygous state (Table 1).

No pathogenic mutation was detected among the SA patients.[14] Phylogeny analysis of the sequence data from the Cameroonian and SA controls, together with that of various populations extracted from the 1000 Genomes Project, shows as expected that the SA patients and Cameroonian controls grouped with the other African populations.

There was a low variance when comparing sequences in GJB2 in Africans with that of other population groups: the principal component analysis explains only 40% of the variations.[14] Specific sequence variants in the GJB2 gene in Africans could therefore not explain the low occurrence of mutations associated with non-syndromic deafness in this population.

In the GJB6 gene, none of the patients had the GJB6-D13S1830 deletion. Only one variant (rs145762940) was detected, in the heterozygous state, in the coding region of GJB6, leading to the c.480G>A (p.G160=) change.[15] Equally, in the GJA1, five variants were detected; one of these occurred in the intron, but none were known to be pathogenic.[15]

Few mutations in GJB2, GJB6 or GJA1 genes among other populations of African ancestry

Our report and review of the literature confirmed that GJB2 gene is of little significance in non-syndromic hearing loss in populations of African descent (Table 1).[10,14,16-20] In addition, by combining data from previously unstudied deaf Xhosa patients in SA, Cameroonian patients, previous studies in Africans and the 1000 Genomes Project,

FORUM

Table 1. Comparison of pathogenic mutations found in GJB2 in a few populations of African ancestry Variations

Country (observed/total alleles)

Genomic

Coding

Cameroon

Ghana¶

Kenya/Sudan§

South Africa‡

USA (African Americans)

g.3352_3353insG

c.35dupG

-

1/730

-

-

-

g.3352delG

c.35delG

-

-

10/1 178

-

7/100**

g.3396C>T

c.79G>A

-

-

-

-

2/46||, NA||

g.3419T>C

c.101T>C

-

-

-

-

NA||

g.3426G>A

c.109G>A

-

-

1/1 178

-

-

g.3455_3460del

c.138_143del

-

-

1/1 178

-

-

g.3512C>A

c.195C>A

-

-

1/1 178

-

-

g.3553T>C

c.236T>C

-

1/730

-

-

-

g.3566C>G

c.249C>G

-

-

-

-

1/100**

g.3586_3587insT

c.269_270insT

NA*

-

-

-

-

g.3658A>G

c.341A>G

-

-

-

-

NA||

g.3697G>A

c.380G>A

-

-

1/1 178

-

-

g.3741_3743delTTC

c.424_426delTTC

1/360

-

-

-

-

g.3744C>T

c.427C>T

-

110/730

-

-

1/100**

g.3795G>A

c.478G>A

-

-

1/1 178

-

NA||

g.3816G>A

c.499G>A

1/360†

-

4/1 178

-

NA||

g.3850T>C

c.533T>C

-

4/730

-

-

-

g.3868G>A

c.551G>A

-

1/730

-

-

-

g.3906G>T

c.589G>T

-

1/730

-

-

-

g.3925-3926delinsAA

c.608_610delinsAA

-

2/730

-

-

-

g.3958C>T

c.641T>C

-

1/730

-

-

-

†

NA = variations found during the study, but only in the control group. Variant information was obtained through the relevant paper’s own results and a combination of the Deafness Variation Database (http://deafnessvariationdatabase.org/) and the Connexin-Deafness Homepage (http://davinci.crg.es/deafness/index.php).

Study references *Trotta et al.,16 †Bosch et al.,14 ‡Kabahuma et al.,17 §Gasmelseed et al.,18 ¶Hamelmann et al.,10 ||Samanich et al.19 and **Pandya et al.20 indicate that the mutation was found neither in patients nor in controls.

the analysis further supported the limited contribution of GJB2 genes in non-syndromic hearing loss in Africans. Interestingly, we reported two cases of keratitis-ichthyosis-deafness (KID) syndrome in two Cameroonian patients,[21] caused by mutations in GJB2. In both cases the mutation found (p.Asp50Asn) was the most common in many populations globally.[5,22] Adding to the established founder effect of the GJB2 mutations reported in European and Asian populations,[5] the data indicate that the high frequency of GJB2 mutations in non-syndromic hearing loss have evolved in Eurasian populations after their migration out of Africa, and spread with population migrations. Finally, at the genetic level, the Cameroonian population diversity mimics that of various ethnolinguistic groups in African populations;[23] it is anticipated that results from a carefully selected sample in this population could capture those of many other populations on the African continent.

As in previous studies in Africans,[17] African Americans and Caribbean Hispanics with GJB6 mutations,[19] we did not find either the GJB6-D13S1830 deletion or coding region changes. Similarly, no pathogenic variants were detected in GJA1, suggesting their nonimplication in hearing loss among the Cameroonians and black South Africans studied,[15] as has been reported in African Americans.[13]

Clinical implications and research perspectives

From our analysis, there is no evidence that mutations in GJB2, GJB6 or GJA1 are associated with non-syndromic deafness in sub-

25

Saharan African patients. We therefore recommend against routine use of either gene for clinical testing in patients of African ancestry.

We suggest that future research should take advantage of the power of massively parallel sequencing to screen multiple genes at once.

This approach has previously been shown to offer the best chance of uncovering the genetic causes of deafness in settings with a genetically diverse populations.[24] Funding. The research was funded by the University of Yaoundé for clinical phenotyping and DNA extraction and by the National Health Laboratory Service, SA, for recruitment of SA samples, DNA extraction and molecular analysis. Jason Bosch was supported by funding provided by the University of Cape Town through the Ada and Bertie Levenstein Scholarship. Kamogelo Lebeko is supported by an internship funding provided by the South African National Research Foundation.

Acknowledgements. We thank Efata School for the Deaf and Blind for their assistance, and the patients and their families for their participation.

1. Stevens G, Flaxman S, Brunskill E, Mascarenhas M, Mathers CD, Finucane M; Global Burden of Disease Hearing Loss Expert Group. Global and regional hearing impairment prevalence: An analysis of 42 studies in 29 countries. Eur J Public Health 2013;23(1):146-152. [http://dx.doi.org/10.1093/eurpub/ckr176] 2. Swanepoel D1, Störbeck C, Friedland P. Early hearing detection and intervention in South Africa. Int J Pediatr Otorhinolaryngol 2009;73(6):783-786. [http://dx.doi.org/10.1016/j.ijporl.2009.01.007] 3. Wonkam A, Noubiap JJN, Djomou F, Fieggen K, Njock R, Toure GB. Aetiology of childhood hearing loss in Cameroon (sub-Saharan Africa). Eur J Med Genet 2013;56(1):1-6. [http://dx.doi.org/10.1016/j. ejmg.2012.09.010]

January 2015, Vol. 105, No. 1

FORUM

4. Korver AM, Admiraal RJ, Kant SG, et al. Causes of permanent childhood hearing impairment.

Laryngoscope 2011;121(2):409-416. [http://dx.doi.org/10.1002/lary.21377] 5. Van Camp G, Smith RJH. Hereditary Hearing Loss Homepage. http://hereditaryhearingloss.org/ (accessed 3 May 2012).

6. Chan DK, Chang KW. GJB2-associated hearing loss: Systematic review of worldwide prevalence, genotype, and auditory phenotype. Laryngoscope 2014;124(2):E34-E53. [http://dx.doi.org/10.1002/ lary.24332] 7. Meşe G, Richard G, White TW. Gap junctions: Basic structure and function. J Invest Dermatol 2007;127(11):2516-2524. [http://dx.doi.org/doi:10.1038/sj.jid.5700770] 8. Willems PJ. Genetic causes of hearing loss. N Engl J Med 2000;342(15):1101-1109. [http://dx.doi. org/10.1056/NEJM200004133421506] 9. Iossa S, Marciano E, Franzé A. GJB2 gene mutations in syndromic skin diseases with sensorineural hearing loss. Curr Genomics 2011;12(7):475-785. [http://dx.doi.org/10.2174/138920211797904098] 10. Hamelmann C, Amedofu GK, Albrecht K, et al. Pattern of connexin 26 (GJB2) mutations causing sensorineural hearing impairment in Ghana. Hum Mutat 2001;18(1):84-85. [http://dx.doi. org/10.1002/humu.1155] 11. Del Castillo I, Villamar M, Moreno-Pelayo MA, et al. A deletion involving the connexin 30 gene in nonsyndromic hearing impairment. N Engl J Med 2002;346(4):243-249. [http://dx.doi.org/10.1056/ NEJMoa012052] 12. Liu XZ1, Xia XJ, Adams J, et al. Mutations in GJA1 (connexin 43) are associated with non-syndromic autosomal recessive deafness. Hum Mol Genet 2001;10(25):2945-2951. [http://dx.doi.org/10.1093/ hmg/10.25.2945] 13. Paznekas WA, Boyadjiev SA, Shapiro RE, et al. Connexin 43 (GJA1) mutations cause the pleiotropic phenotype of oculodentodigital dysplasia. Am J Hum Genet 2003;72(2):408-418. [http://dx.doi. org/10.1086/346090] 14. Bosch J, Noubiap JJN, Dandara C, et al. Sequencing of GJB2 in Cameroonians and black South Africans and comparison to 100 Genomes Project data support the need to revise strategy for discovery of nonsyndromic deafness genes in Africans. OMICS 2014;18(11):705-710. [http://dx.doi.org/10.1089/ omi.2014.0063]

15. Bosch J, Lebeko K, Nziale JJ, Dandara C, Makubalo N, Wonkam A. In search of genetic markers for nonsyndromic deafness in Africa: A study in Cameroonians and black South Africans with the GJB6 and GJA1 candidate genes. OMICS 2014;18(7):481-485. [http://dx.doi.org/10.1089/omi.2013.0166].

16. Trotta L, Iacona E, Primignani P, et al. GJB2 and MTRNR1 contributions in children with hearing impairment from Northern Cameroon. Int J Audiol 2011;50(2):133-138. [http://dx.doi.org/10.3109/14992027.2010.537377] 17. Kabahuma RI, Ouyang X, Du LL, et al. Absence of GJB2 gene mutations, the GJB6 deletion (GJB6D13S1830) and four common mitochondrial mutations in nonsyndromic genetic hearing loss in a South African population. Int J Pediatr Otorhinolaryngol 2011;75(5):611-617. [http://dx.doi. org/10.1016/j.ijporl.2011.01.029] 18. Gasmelseed NMA, Schmidt M, Magzoub MMA, et al. Low frequency of deafness-associated GJB2 variants in Kenya and Sudan and novel GJB2 variants. Hum Mutat 2004;23(2):206-207. [http://dx.doi. org/10.1002/humu.9216] 19. Samanich J, Lowes C, Burk R, et al. Mutations in GJB2, GJB6, and mitochondrial DNA are rare in African American and Caribbean Hispanic individuals with hearing impairment. Am J Med Genet A 2007;143A(8):830-838. [http://dx.doi.org/10.1002/ajmg.a.31668] 20. Pandya A, Arnos KS, Xia XJ, et al. Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 2003;5(4):295-303. [http://dx.doi.org/10.1097/01.GIM.0000078026.01140.68] 21. Wonkam A, Noubiap JJN, Bosch J, Dandara C, Toure GB. Heterozygous p.Asp50Asn mutation in the GJB2 gene in two Cameroonian patients with keratitis-ichthyosis-deafness (KID) syndrome. BMC Med Genet 2013;14(1):81-87. [http://dx.doi.org/10.1186/1471-2350-14-81] 22. Gasparini P, Rabionet R, Barbujani G, et al. High carrier frequency of the 35delG deafness mutation in European populations. Eur J Hum Genet 2000;8(1):19-23. [http://dx.doi.org/10.1038/sj.ejhg.5200406] 23. Tishkoff SA, Reed FA, Friedlaender FR, et al. The genetic structure and history of Africans and African Americans. Science 2009;324(5930):1035-1044. [http://dx.doi.org/10.1126/science.1172257] 24. Shearer AE, Black-Ziegelbein EA, Hildebrand MS, et al. Advancing genetic testing for deafness with genomic technology. J Med Genet 2013;50(9):627-634. [http://dx.doi.org/10.1136/jmedgenet-2013-101749]

Accepted 13 October 2014.

This month in the SAMJ ...

Colleen Aldous* is a senior lecturer in the School of Clinical Medicine at the University of KwaZulu-Natal, Durban. She is a medical scientist who holds a PhD in science education. She is involved in mentorship of research at the postgraduate level across several medical disciplines, e.g. surgery, orthopaedics, dermatology, paediatrics, opthalmology, general medicine and psychology. Her own research interest is within the discipline of human genetics, specifically in the epidemiology thereof. She is currently part of the National Steering Committee and Working Group for the review of the National Department of Health Policy Guidelines for Human Genetics Services. * Aldous CM, Adhikari M, Rout CC. The research component of specialist registration – a question of alligators and swamps? A personal view. S Afr Med J 2015;105(1):21-22. [http://dx.doi.org/10.7196/SAMJ.8732]

David Lee Skinner* is a surgical consultant in the intensive care unit at King Edward VIII Hospital, Durban.

He is an Honorary Clinical Fellow and member of the Perioperative Research Group in the Department of Anaesthetics and Critical Care, University of KwaZulu-Natal. He completed his MMed in acute kidney injury (AKI) in trauma patients and has research interests in AKI, blunt thoracic trauma and perioperative medicine.

Further research goals involve the investigation and management of AKI associated with crush injury. He believes that trauma and critical care research are essential for improving rational service delivery in our resource-constrained healthcare system. * Skinner DL, den Hollander D, Laing GL, Rodseth RN, Muckart DJJ. Severe blunt thoracic trauma: Differences between adults and children in a level I trauma centre. S Afr Med J 2015;105(1):47-51. [http://dx.doi.org/10.7196/SAMJ.8499]

Prof. Mike Levin* is head of the Division of Asthma and Allergy in the Department of Paediatrics, University of Cape Town and Red Cross War Memorial Children’s Hospital, Cape Town. He lectures on allergy to medical students and professionals, presents at national and international allergy congresses, and has a special interest in the epidemiology of allergy in Africa, severe allergies, anaphylaxis and patient support and education. * Levin ME, Gray CI, Goddard E, et al., for the South African Food Allergy Working Group (SAFAWG). South African food allergy consensus document 2014. S Afr Med J 2015;105(1):62-65. [http://dx.doi.org/10.7196/SAMJ.9098]

26

January 2015, Vol. 105, No. 1

FORUM

MEDICAL PRACTICE

Medical certification of death in South Africa – moving forward E H Burger, P Groenewald, A Rossouw, D Bradshaw Lené Burger is a forensic pathologist in the Division of Forensic Medicine, Faculty of Medicine and Health Sciences, Stellenbosch University, and the Western Cape Forensic Pathology Service. Pam Groenewald, Stacey Rossouw and Debbie Bradshaw represent the Burden of Disease Research Unit at the Medical Research Council, Parow, Cape Town, South Africa. The authors compiled the training materials and provided the training for the intervention described in this article. They have published extensively regarding causes of death and the death notification form.

Corresponding author: E H Burger (ehb@sun.ac.za)

Despite improvements to the Death Notification Form (DNF) used in South Africa (SA), the quality of cause-of-death information remains suboptimal. To address these inadequacies, the government ran a train-the-trainer programme on completion of the DNF, targeting doctors in public sector hospitals. Training materials were developed and workshops were held in all provinces. This article reflects on the lessons learnt from the training and highlights issues that need to be addressed to improve medical certification and cause-of-death data in SA. The DNF should be completed truthfully and accurately, and confidentiality of the information on the form should be maintained. The underlying cause of death should be entered on the lowest completed line in the cause-of-death section, and if appropriate, HIV should be entered here. Exclusion clauses for HIV in life insurance policies with Association of Savings and Investments South Africa companies were scrapped in 2005. Interactive workshops provide a good learning environment, but are logistically challenging. More use should be made of online training resources, particularly with continuing professional development accreditation and helpline support. In addition, training in the completion of the DNF should become part of the curriculum in all medical schools, and part of the orientation of interns and community service doctors in all facilities.

S Afr Med J 2015;105(1):27-30. DOI:10.7196/SAMJ.8578

In recent years, the death notification form (DNF) used in South Africa (SA) has gone through some major changes. At the dawn of democracy in the country, two different forms were used: the BA-679 and the BI-12. Little statistical information was collected on these forms, and the causes of death were not entered in the format prescribed by the World Health Organization (WHO).

These problems were remedied in the BI-1663, a 2-page form introduced in 1998.[1] About 12 years later, the form was revised to the DHA-1663, to capture more demographic information, provide improved security measures to prevent identity fraud, and include a perinatal cause-of-death section for stillbirths and deaths within the first week of life.

Despite improvements to the form, the quality of cause-of-death information in SA remains suboptimal.[2,3] In a recent evaluation, Joubert et al.[4] found that the extent to which certification and coding of conditions accurately reflected causes of death was unsatisfactory.

Despite the high prevalence of HIV (estimated to be 12.2% in 2012),[5] according to official statistics, HIV only accounted for 3.4% of deaths nationally in 2010,[6] indicating gross under-reporting. In the same year, tuberculosis (11.6%), influenza and pneumonia (7.2%) and intestinal infectious diseases (5.0%), all known complications of HIV infection, were the leading causes of death, and ‘Other viral diseases, not elsewhere classified’ (relating to ‘retroviral disease’, a euphemism for HIV) also featured in the top ten causes of death.[6] This reflects the continued reluctance of many doctors to report HIV as a cause of death.

There are other quality concerns in the statistical information. In 2010, 23.9% of deaths were reported as due to ill-defined or unknown natural causes. These include cardiorespiratory arrest, heart failure, hypoxia and other nonspecific causes of death, which do not provide

27

information useful for planning prevention strategies.[6] There was also much uncertainty about the manner of death for injury deaths, as there is no field for such information on the DNF, and doctors often fail to report it in the cause-of-death section. This makes it difficult to determine whether the injuries were caused by accidents, homicide or suicide. Following international coding practices, deaths from gunshot injuries of undetermined intent are currently coded as accidents, thus under-representing homicides in Statistics South Africa (Stats SA) data, and so misrepresenting the real burden of homicide deaths.[6]

Train-the-trainer intervention

Recognition of the inadequacies of the SA cause-of-death data for monitoring the health status of the nation led to the formation of a task team in 2010/2011 to build capacity for ongoing medical certification training in the health services, among other system-strengthening activities.[2] The task team comprised members representing Stats SA, the national Department of Health and the national Department of Home Affairs. Through Stats SA, a team (comprising the authors) was appointed to develop a train-the-trainer programme targeting certifiers/doctors in public sector hospitals. The brief was: • To compile a guideline for medical doctors for completing the DHA-1663 • To prepare a 2-day training programme, with the aim of training ‘master trainers’ at facilities in all provinces • To prepare a presentation for master trainers to use when training their colleagues • To prepare a flyer with summary guidelines on DNF completion.

An important aim of the training was to help doctors focus on the underlying cause of death, defined by the WHO as: (i) the disease

January 2015, Vol. 105, No. 1

FORUM

or injury that initiated the train of morbid events leading directly to death; or (ii) the circumstances of the accident or violence that produced the fatal injury.[7] A flow diagram indicating the thought process for completing a cause-of-death sequence was developed for the training and, based on participant inputs, later refined (Fig. 1).

On the death of a patient, the clinician first needs to decide whether referral to the Forensic Pathology Service (FPS) is required. For this decision, the guidelines set by the regulations to the National Health Act[8] and the Health Professions Act[9] are followed. If referral to the FPS is not required, the underlying cause of death should be written on the lowest completed line in Part 1 of the Medical Certificate of Cause of Death section on the DNF. The terminal or immediate cause of death is the final disease or condition that the patient suffered from before death, and should be written on the first line of the cause-ofdeath sequence.[7] The DNF should not contain any mechanisms of death, such as hypoxia, heart failure or cardiac arrest – these are terms that indicate the physiological abnormality in the body at the time of death, but cannot and should not indicate the underlying or immediate cause of death.[7] To facilitate maximal attendance, the training programme was conducted in all provinces, enabling doctors from every district to attend. The guideline and training resources developed for the programme are freely available at http://www.sahealthinfo.org/bod/ deathtraining/guideline.htm Topics covered included: • The value of mortality statistics, highlighting that national statistics are compiled from information written on DNFs by doctors, and that good quality statistics can assist managers in adequately planning for healthcare in facilities, districts and provinces • How to complete the DNF correctly, focusing on the cause-ofdeath section • Identifying all cases that should be referred to the FPS. The training also prepared the participants to train at local facilities, and accredited the master trainers to enable allocation of continuing professional development (CPD) points to their trainees. Lectures and group discussions were distributed over 2 days, and participants had to prepare mock presentations as ‘homework’ on the first evening.

The purpose of the homework was to provide an opportunity for revision of the topics covered on day 1, and to ensure that doctors could communicate this information accurately. In order to be accredited as master trainers, doctors had to obtain a score of at least 80% in an open-book competency test.

A total of 288 doctors attended 15 training sessions; 178 successfully completed the competency test, and 100 were accredited as master trainers. Subsequently 609 health personnel attended 45 in-hospital training sessions provided by 27 of the master trainers. Of these, 385 doctors had been awarded CPD points at the time of writing. However, 73 of the 100 accredited master trainers had not commenced any training, despite encouragement to do so.

Lessons learnt from training experience Training

Clinical managers of hospitals were initially targeted, since they can be held to account for the quality of medical certification in their facility. In addition, they are in a position to instruct doctors to attend in-hospital training sessions. However, it was found that family physicians tended to be more interested and were often good communicators. This cadre may therefore be well suited to provide ongoing training.

28

Doctors were generally receptive to the training and found it useful. They indicated their willingness to change their practice, notwithstanding some reservations about reporting HIV. The training workshops were conducted over 2 days. We believe that this contributed to a greater understanding of the important concepts and allowed more time for interactive, practical sessions.

We were able to focus on problems that are specific to the national scenario, against the background of the international standard.

Aung et al.[10] found that interactive workshops with theoretical and practical components were most effective, and that printed material alone was the least effective in improving the quality of death certification. However, interactive workshops can be costly and labour intensive. In our experience, the length of the workshop impacted on attendance – some doctors were not able to attend the full training because of other responsibilities. This raises the question of whether the training period could have been shortened or divided to allow for practical experience before becoming a trainer. However, an extended training period poses significant logistical challenges.

The WHO has developed an online training tool for International Statistical Classification of Diseases and Related Health Problems, 10th revision (ICD-10) medical certification, which Walker et al.[11] recently evaluated and found easy to use and complete in less than an hour, however, some participants mentioned that group discussions might be useful. It should be noted that our trainees appreciated the opportunity to discuss difficult situations during the training.

Reporting HIV

At every workshop, doctors raised concerns about reporting HIV on the DNF. These included patient confidentiality, the impact on life insurance or funeral policy claims, and the mistaken belief that reporting HIV is not allowed. The last page of the DNF, which contains the cause-of-death information, is supposed to be confidential and is sent directly to the Department of Home Affairs in a sealed envelope, without any copies of the page being made. However, many doctors told us that envelopes were not always available and expressed concern that family members or funeral undertakers might open the envelope. Some doctors reported instances of insurance companies insisting on a copy of the last page before processing the claim, which appears to act as another disincentive for full disclosure of the causes of death.

In order to address this issue, we had in-depth discussions with the chairperson of the Association of Savings and Investments South Africa (ASISA). He confirmed that all exclusion clauses for HIV were scrapped in January 2005. This means that HIV is treated like other chronic diseases such as diabetes or ischaemic heart disease.

Most companies require HIV testing upon application for insurance, and cover will be declined or subscriptions loaded if the applicant tests positive. However, should HIV develop during the term of the contract, insurance will be paid out in the event of death due to HIV. Unfortunately, some insurance companies (covering approximately 5% of the market) are not members of ASISA and their policies in this regard are not clear (personal communication, Pieter Coetzee, chairperson of ASISA). Further concerns about the impact on insurance claims are addressed in section 14 of the National Health Act, which states that personal information may be disclosed if: (i) a person has consented to it; and (ii) a court order or any law requires that disclosure.[12] Usually when a person takes out a life insurance policy, the insured gives written consent to the insurer, granting the right to access any information needed, especially at death. By doing so, the insured waives his right to privacy, and refusal to do so leads to the person not being insured.

January 2015, Vol. 105, No. 1

FORUM

Completing the Death Noti cation Form Before putting pen to paper, think rst What set o the chain of events that led to death?

• Physical or chemical in uences on the body: Physical e ects, e.g. gunshot wounds, blunt force trauma Chemical e ects, e.g. poisons, drugs, anaphylaxis Trauma caused by ‘nature’ e.g. dog bite, lightning, bee sting Complications of trauma, e.g. tetanus, gas gangrene, bronchopneumonia.

• Procedure-related deaths: Section 56 of the Health Professions Act, 56 of 1974.

‘The death of a person undergoing, or as a result of, a procedure of a therapeutic, diagnostic or palliative nature, or of which any aspect of such a procedure has been a contributory cause, shall not be deemed to be a death from natural causes.’

• Sudden and unexpected deaths: ‘Cot deaths’ (sudden infant death syndrome) Sudden deaths in apparently healthy adults without an obvious reason for the death.

• Omission or comission: Any death, suspected to be due to action or neglect from family, the responsible doctor or others.

Yes

No (i.e. natural causes)

Refer to Forensic Pathology Service

Disease that set the chain of events in motion

Underlying cause of death - in Part 1

Determine what happened subsequently

Intermediate cause of death - in Part 1

What was the nal disease?

Immediate cause of death - in Part 1

Did any other disease contribute to death, without CAUSING any of the diseases mentioned so far?

Contributing cause of death - in Part 2

77. CAUSES OF DEATH Part 1

Now write the cause of death sequence in this order, with the underlying cause of death in the lowest completed line:

Part 2

Enter the disease, injuries or complications that caused the death. Do not enter the mode of dying, such as cardiac or respiratory arrest, shock or heart failure. List only one cause on each line

Immediate cause

IMMEDIATE CAUSE (final disease or condition resulting in death)

a) Due to (or as a consequence of)

Sequentially list conditions, if any, leading to immeditae cause.

b) Due to (or as a consequence of)

Erter UNDERLYING CAUSE last (Disease or injury that initiated events resulting in death)

c)

Other significant conditions contributing to death but not resulting in underlying cause given in Part 1

Immediate cause Immediate cause

Due to (or as a consequence of)

Underlying cause

d) Due to (or as a consequence of)

Other contributory conditions

For stillbirths and babies <7days, complete section G2 of the DHA-1663 a. Main disease or conditions in foetus or infant

No sequence necessary, just MAIN conditions in infant and mother (a ecting the infant)

b. Other disease or conditions in foetus or infant c. Main maternal disease or condition affecting foetus or infant d. Other maternal disease or condition affecting in foetus or infant e. Other relevant circumstances

Make sure that you: • Write only diseases, don’t write mechanisms of death, e.g. hypoxia, cardiac failure, prematurity • Give speci c details, like type and site of cancer • Write legibly!

• Seal the last page of the form in an envelope for confidentiality Fig. 1. Completing the Death Notification Form.

29

January 2015, Vol. 105, No. 1

Approxim death

FORUM

The DNF should be completed truthfully and accurately. The Births and Deaths Registration Act[13] (section 15) places a legal obligation on a medical practitioner to state the known cause of death on the DNF. Making a false statement on the DNF constitutes a criminal offence (section 31).[13]

Improving the system/form

In discussion with participants, it was clear that in many underresourced settings envelopes were not available to seal the last page of the DNF. In the recently released regulations to the Births and Deaths Registration Act, provision is made for the printing of the last page of the DNF on a self-sealing page. This will overcome the problem with envelopes and, it is hoped, encourage full disclosure of the causes of death.

Many doctors admitted to signing DNFs for decedents they had not personally seen. Legally this practice is not acceptable. Recent Health Professions Council of South Africa cases of fraud[14] have highlighted the importance of not signing a DNF for a decedent who was not actually seen. In rural areas where doctors are not available, the DHA-1680 form can be completed for natural deaths by a tribal leader. Furthermore, it is important for hospitals to provide space where doctors can examine the unclothed body of a deceased person to confirm death and the identity of the deceased, and exclude possible injuries that might necessitate referral to the FPS. By law, unnatural deaths must be referred to the FPS. However, feedback from the participants indicated that in some parts of the country, referral to the FPS was problematic and sometimes haphazard. This was due to a perceived lack of resources, poor co-operation from the South African Police Service, and ignorance of the need to refer all possible unnatural deaths.

The way forward

• A review of our experiences in developing and contributing to the medical certification training programme has identified some key issues that need to be addressed to ensure that SA cause-of-death statistics continue to improve.

• All doctors need to realise the importance and public health utility of accurate cause-of-death data for improving population health, and therefore how important it is to complete the cause-ofdeath section of the DNF correctly. These statistical data inform prioritisation in health policy decisions, budgets and resource allocation, and even influence insurance premiums.

• HIV reporting remains problematic. The Department of Health needs to allay certifying doctors’ concerns by providing clear guidance about the legal and public health requirements for accurate reporting of cause of death. In addition, leaders in the insurance industry need to clarify their collective stance on HIV and inform both the public and certifiers of the current policies and their consequences, including that all exclusion clauses for HIV have been scrapped since 2005. Additionally, all doctors should be made aware that making a false statement on the DNF constitutes a criminal offence.

30

• Some controversy remains among forensic pathologists and legal experts about the legality of indicating the manner of death (circumstances, i.e. homicide, suicide or accident) on the death notification form. Unfortunately, a proposal to include the alleged manner of death on the revised DNF was not accepted in the regulations to the Births and Deaths Registration Act recently gazetted. This uncertainty has to be addressed if useful statistical information about unnatural causes of death is to be obtained.

• Ensuring that doctors certify correctly requires an ongoing systemwide strategy of training and reinforcement. We believe that training in the completion of the DNF should become part of the curriculum in all medical schools, and part of the orientation of interns and community service doctors in all facilities. Regular update sessions for seasoned doctors should also be provided.

Academic involvement and support is needed in all regions of the country.

• The development and evaluation of an online medical certification of death training tool with CPD accreditation and helpline support should be a priority.

Acknowledgements. This initiative was sponsored by Statistics South Africa, and the research team worked closely with an interdepartmental task team on Civil Registration and Vital Statistics headed by Dr Maletela Tuoane-Nkhasi of Stats SA. Members of the team include Thomas Sigama, Caroline Pienaar and Kekeletso Rakgotho of the Department of Home Affairs, Thulani Masilela, Mohlapametse Maditsi and Edwina Mabuela of the Department of Health, and Nontsikelelo Manzini-Matebula, Mmamokete Mogoswane, Abram Moyo and Aletia Barkley of Stats SA. 1. Bradshaw D, Kielkowski D, Sitas F. New birth and death registration forms – a foundation for the future, a challenge for health workers? S Afr Med J 1998;88(8):971-974.

2. Pillay-van Wyk V, Bradshaw D, Groenewald P, et al. Improving the quality of medical certification of cause of death: The time is now! S Afr Med J 2011;101(9):626.

3. Burger EH, van der Merwe L, Volmink J. Errors in the completion of the Death Notification Form. S Afr Med J 2007;97(11):1077-1081.

4. Joubert J, Rao C, Bradshaw D, et al. Evaluating the quality of national mortality statistics from civil registration in South Africa, 1997-2007. PLoS One 2013;8(5):e64592. [http://dx.doi.org/10.1371/ journal.pone.0064592] 5. Shisana O, Rehle T, Simbayi LC, et al. South African National HIV Prevalence, Incidence and Behaviour Survey, 2012. Cape Town: HSRC Press, 2014.

6. Statistics South Africa. Mortality and Causes of Death in South Africa, 2010: Findings from Death Notification. Statistical release P0309.3. Pretoria: Statistics South Africa, 2013. http://www.statssa.gov. za/publications/p03093/p030932010.pdf (accessed 24 February 2014).

7. World Health Organization. International Statistical Classification of Diseases and Related Health Problems. Vol. 2. 10th revision. Geneva: World Health Organization, 1992.

8. Regulations to the National Health Act No. 61 of 2003. GN R636 in Government Gazette 30075; 20 July 2007.

9. Health Professions Act No 56 of 1974. http://www.hpcsa.co.za/Uploads/editor/UserFiles/downloads/ legislations/acts/health_professions_ct_56_1974.pdf (accessed 25 November 2014).

10. Aung E, Rao C, Walker S. Teaching cause-of-death certification: Lessons from international experience.

Postgrad Med J 2010;86(1013):143-152. [http://dx.doi.org/10.1136/pgmj.2009.089821] 11. Walker S, Rampatige R, Wainiqolo I, Aumua A. An accessible method for teaching doctors about death certification. Health Information Management Journal 2012;41(1):4-10.

12. National Health Act No. 61 of 2003. http://www.saflii.org/za/legis/consol_act/nha2003147/ (accessed 25 November 2014).

13. Births and Deaths Registration Act No. 51 of 1992. http://www.saflii.org/za/legis/consol_act/ badra1992301/ (accessed 25 November 2014).

14. Masombuka S. Death Doctor gets second life. The Times, 23 October 2013, p. 5.

Accepted 8 November 2014.

January 2015, Vol. 105, No. 1

EDITORIAL

Turning up the volume on hearing loss in South Africa Estimates of the world’s population living with disabling hearing loss, defined as >40 dB in the better-hearing ear in adults (>15 years) and >30 dB in children (0 - 14 years), currently run to 360 million people worldwide.[1] Of even more concern is that the majority of those affected live in the low- and middle-income communities of the developing world (South Asia, Asia-Pacific and sub-Saharan Africa (SSA)).[2] As South Africa (SA) falls within SSA, increasing awareness and raising advocacy are key to addressing the problem at a national level. The challenge in addressing this global burden lies not only in early identification in high-risk groups (both children and adults), but also in the provision of early interventions.

Hearing loss is reported to be the most prevalent sensory disorder in childhood, affecting approximately 6/1 000 live births in developing countries annually (compared with 2/1 000 in developed countries).[3,4] This figure increases further when preventable hearing loss from the long-term effects of untreated otitis media in children is included.[5] The latter condition is very prevalent in SSA, with more than 50% of cases occurring in children under 10 years of age.[6] The long-term sequelae of childhood hearing loss, congenital or acquired, are well documented, with delays in development of speech, language and cognitive skills often resulting in slow learning and poor schooling early on,[7,8] and problems with employment and societal integration in the long term.[4] Hearing loss in adults accounts for 91% of global deafness sufferers, one-third of whom are over 65 years of age, the remaining two-thirds being in the economic prime of life. [1] Hearing impairment in adults leads to social isolation, stigmatisation and economic disadvantage. Presbycusis or age-related hearing loss is often underdiagnosed and undertreated, even though the elderly are considered a high-risk group.[9] Additionally, recent studies show hearing loss to be independently associated with an increased prevalence of poor cognitive function and incident dementia when people with hearing loss are compared with individuals of the same age with normal hearing.[9] Other highrisk groups include patients taking various drugs that can cause ototoxicity, including antituberculosis drugs, chemotherapeutic agents and antiretrovirals (ARVs), aetiologies particularly relevant in SA medical practice.[10] Early identification through screening programmes can effectively reduce the burden of deafness by 50%, but this is restricted to a large extent by socioeconomic factors.[11] In developed communities, service delivery models from screening to diagnosis work effectively in all high-risk populations through institutionbased programmes in communities with existing infrastructure and access to healthcare. These models need to be adapted to allow for the deficiencies of healthcare systems in the developing world.

While SA has a comparatively well-developed infrastructure within SSA, critical shortages of trained professionals and poor resources still exist.[12] An example of the above is the early hearing detection and intervention pathway (EDHI) in SA. In the developed world, national protocols successfully screen more than 90% of newborns through universal newborn hearing screening (UHNS).[3] UHNS proposes that screening for hearing loss must occur no later than 1 month of age; diagnosis should follow shortly thereafter, to be finalised by 3 months of age, and referral for early intervention should be in place no later than 6 months of age. In SA the inverse ratio holds, with close to 90% of babies not having hearing

31

screening[3] despite local Health Professions Council of South Africa guidelines suggesting the above diagnostic sequence.[13] Theunissen and Swanepoel[14] surveyed the national status of EDHI, and estimated that only 7.5% of public sector hospitals nationally provided some form of infant hearing screening and <1% provided universal screening, highlighting the lack of implementation of screening systems to detect infant hearing impairment. Lack of appropriate equipment and staff shortages were key shortcomings.

In addition, there are currently no screening programmes for adult high-risk groups, screening instead being done at the discretion of healthcare providers.[10] Interventions principally involve rehabilitation and aim to prevent the disability posed by restricted hearing loss from becoming one that limits participation in society at large. They include family-orientated support services, special education and access to social integration. Specific rehabilitation includes the provision of amplification devices such as hearing aids and/ or cochlear implants. Störbeck[4] reported that <2.5% of babies with newborn hearing loss will receive hearing aids, and <10% will have access to early intervention. Additionally, in SA the age of hearing-aid fitting for infants with hearing loss is generally delayed despite the presence of isolated screening programmes.[15] International guidelines recommend that cochlear implantation as early as possible (within the 12 - 36 months window) provides the best chance of achieving and maintaining age-appropriate spoken language skills into and through the school years.[16] Costs remain the major drawback to widespread use of regular implantation; nevertheless there are six cochlear implant programmes in SA (two public and four private), and interest in their expansion is growing.

With severe shortages of audiologists and ear, nose and throat (ENT) specialists across Africa,[12] screening options for primary prevention need to be modified. Community-based infant hearing screening should feature in mother and child care visits such as those for immunisations,[8,11] and school-based screening should be provided for older children. In addition, mothers, healthcare workers and teachers should be educated accordingly.

As universal adult hearing screening is not sustainable, high-risk groups should be prioritised. Community-related projects already in existence, such as medical units that cater for high-risk groups, are a simple and often untapped resource within which hearing screening programmes can be initiated. Education of patients and healthcare workers in these medical units (e.g. ARV clinics) is necessary to facilitate hearing screening during regular visits.

Screening programmes with validated, easy-to-use, available automated technologies, where referral for appropriate intervention is possible, are optimal and sustainable. Technologies such as smart­ phones and tablets readily lend themselves to this strategy and can potentially be implemented widely.

Government should do more to implement and support EDHI pilot programmes, and prioritise centres that will facilitiate accountable EDHI programmes nationally.[14] All eligible patients should be adequately informed of the possi­ bility of implantation, without prejudice to their socioeconomic and financial status. Non-governmental organisations and industry should campaign to increase funding for more government-based cochlear implant programmes to cater for people without economic means.

January 2015, Vol. 105, No. 1

EDITORIAL

Conclusion

Current global health efforts by the World Health Organization and the Prevention of Blindness and Deafness campaign have created some awareness, but the vast majority of people in need are not being reached. Addressing the global burden of hearing loss means addressing the inequities facing the population most affected as much as addressing the sensory disability. More initiatives are needed from governments and global health groups to improve health and social systems and reduce disease related to poverty. In addition, custodians of hearing health (audiologists, ENT specialists, paediatricians, general practitioners) need to collaborate with industry and governments to capitalise on advances in technology that can provide sustainable service delivery.

Shazia Peer Division of Otorhinolaryngology, Faculty of Health Sciences, University of Cape Town, South Africa Clinical Fellow, Department of Otolaryngology, Head & Neck Surgery, University of Toronto and SickKids Hospital, Toronto, Canada Corresponding author: S Peer (shaziapeer@gmail.com) 1. World Health Organization. WHO Global Estimates on Prevalence of Hearing Loss. Geneva: WHO, 2012. http://www.who.int/pbd/deafness/WHO_GE_HL.pdf?ua=1 (accessed 20 November 2014).

2. Stevens G, Flaxman S, Brunskill E, et al. Global and regional hearing impairment prevalence: An analysis of 42 studies in 29 countries. Eur J Public Health 2013;23(1):146-152. [http://dx.doi. org/10.1093/eurpub/ckr176]

3. Olusanya BO, Newton VE. Global burden of childhood hearing impairment and disease control priorities for developing countries. Lancet 2007;369(9569):1314-1317. [http://dx.doi.org/10.1016/ S0140-6736(07)60602-3] 4. Störbeck C. Childhood hearing loss in the developing world. International Journal of Child Health and Nutrition 2012;1(1):59-65. [http://dx.doi.org/10.6000/1929-4247.2012.01.01.07] 5. Butler I. Identification and management of childhood hearing loss. Continuing Medical Education 2012;30(9):314-317.

6. Tiedt NJ, Butler IRT, Hallbauer UM, et al. Paediatric chronic suppurative otitis media in the Free State Province: Clinical and audiological features. S Afr Med J 2013;103(7):467-470. [http://dx.doi. org/10.7196/SAMJ.6636] 7. Burke M, Shenton R, Taylor M. The economics of screening infants at risk of hearing impairment: An international analysis. Int J Pediatr Otorhinolaryngol 2012;76(2):212-218. [http://dx.doi.org/10.1016/j. ijporl.2011.11.004] 8. Olusanya B. Highlights of the new WHO report on newborn and infant hearing screening and implications for developing countries. Int J Pediatr Otorhinolaryngol 2011;75(6):745-748. [http:// dx.doi.org/10.1016/j.ijporl.2011.01.036] 9. Lin FR, O’Brien RJ, Resnick SM, et al. Hearing loss and incident dementia. Arch Neurol 2011;68(2):214220. [http://dx.doi.org/10.1001/archneurol.2010.362] 10. Peer S. Otorhinolaryngology – not just tonsils and grommets: Insights into the ENT scene in South Africa. S Afr Med J 2013;103(7):455-457. [http://dx.doi.org/10.7196/samj.7121] 11. Olusanya BO. Priorities for early hearing detection and intervention in sub-Saharan Africa. Int J Audiol 2008;47(Suppl 1):S3-S13. [http://dx.doi.org/10.1080/14992020802287143] 12. Fagan JJ, Jacobs M. Survey of ENT services in Africa: Need for a comprehensive intervention. Global Health Action 2009;2:1-7. [http://dx.doi.org/10.3402/gha.v2i0.1932] 13. Health Professions Council of South Africa. Early Hearing Detection and Intervention Programmes in South Africa: Position Statement. Pretoria: HPCSA, 2007.

14. Theunissen M, Swanepoel D. Early hearing detection and intervention services in the public health sector in South Africa. Int J Audiol 2008;47(Suppl 1):S23-S29. [http://dx.doi. org/10.1080/14992020802294032] 15. Swanepoel DW, Störbeck C, Friedland P. Early hearing detection and intervention in South Africa.

International Journal of Pediatric Otorhinolaryngology 2009;73(6):783-786. [http://dx.doi. org/10.1016/j.ijporl.2009.01.007] 16. Geers AE, Nicholas JG. Enduring advances of early cochlear implantation for spoken language development. J Speech Lang Hear Res 2013;56(2):643-655. [http://dx.doi.org/10.1044/10924388(2012/11-0347]

S Afr Med J 2015;105(1):31-32. DOI:10.7196/SAMJ.9218

Russian Doll Do not look behind the lacquered smile.

What is left of laughter when liking her and hers is all?

Do not tap her floor and foothold for a beating heart, nor twist her lips in glasnost, nor pry their red-etched seal apart.

And peel the layers of her fullness gently, the figment of her surfeit do not spoil in rough research of hollow places, where the hurt of hunger has not healed.

Stroke the black sheen of her ball gown as if Death had not danced within for what is left of decorum when a smile is probed for meaning?

--------------Children who have suffered grave emotional or physical hardship may in defence project an outward appearance of wellbeing and serenity. Using the metaphor of the many-layered Russian doll, this poem warns against too-rapid stripping off of outer defensive shells.

(From Troubled Children – Poems of Contemplation, reviewed by Dawn Garisch on p. 15.)

32

January 2015, Vol. 105, No. 1

EDITORIAL

Cervical cancer prevention in South Africa: HPV vaccination and screening both essential to achieve and maintain a reduction in incidence Cervical cancer remains an important cause of morbidity and mortality in South Africa (SA). A national cervical cancer prevention programme exists that offers three cervical cytology smears per lifetime, starting after the age of 30 at 10-year intervals. Despite this programme the incidence remains unacceptably high, cases are often diagnosed late, and many patients have poor response to treatment. Primary healthcare systems in many areas are poorly developed, and uptake of cytological screening is generally poor, with some metropolitan areas and regions doing slightly better. Health systems interventions are necessary to improve the quality of screening.[1] In addition, there is often significant loss to follow-up after the initial screening test among women identified with abnormal cytology. Determinants of the high cervical cancer rate and poor outcome of treatment are similar to those in other developing countries and include a low doctor/population ratio, a high prevalence of HIV infections, and competing healthcare needs.

A lack of consumer (patient) knowledge and empowerment leads to a low degree of health-seeking behaviour.

Disease prevention

Disease prevention strategies can be broadly categorised as primary prevention and secondary prevention. Primary prevention aims to reduce the risk of an individual contracting a particular disease by eliminating the aetiological agents from the environment. In the case of cervical cancer, the most important risk factor for the development of premalignant and malignant disease is persistent infection with oncogenic types of human papillomavirus (HPV) infection.

Since the approval of the HPV vaccines in SA in 2008, they have been available in the private market. Uptake has been slow because of factors such as the initial high costs of both vaccines, poor community knowledge of cervical cancer and the causal relationship between HPV and cervical cancer, and lack of population experience with and acceptance of vaccines targeting adolescents.[2,3] A schoolbased introduction was suggested for SA.[4] The national Department of Health introduced an HPV vaccine roll-out programme in April 2014. Introduction of the HPV vaccination programme in public schools is widely supported by scientists and healthcare workers involved in the prevention and treatment of cervical cancer, who emphasise the excellent efficacy and safety record of the vaccines.[5] Linking health interventions may achieve cost-effective ways of preventing disease. Information from a qualitative study in SA concluded that HPV vaccination can be linked to other adolescent preventive health services.[6] The strong link between HIV infection and immunosuppression with HPV-associated disease is well established. By controlling HIV, the incidence of HPV-related disease will also be reduced. In addition, HIV treatment facilities can be used to monitor cervical screening and treatment.

Smoking is associated with an increased risk of development of squamous and other carcinomas of the cervix, and a national antismoking campaign, like the programme introduced in SA under health minister Dlamini-Zuma, would be highly effective in reducing smoking-related diseases including cervical cancer.

Secondary prevention by screening has been shown to reduce cervical cancer significantly when comprehensive population-based

33

call-and-recall programmes were introduced. Since the SA cervical cytology programme is not a programme of this sort and has low uptake rates, success has been limited. Opportunistic screening will continue to be an important part of our programme for the foreseeable future. Linking opportunistic screening of mothers to vaccination of their children is a potential way to increase disease awareness and screening uptake.

Adolescent vaccination programmes

The successful introduction of a school-based vaccination programme is a momentous task, especially in settings like SA where no national adolescent, adult or school-based vaccination programmes existed before roll-out. Education of healthcare practitioners and the general public will be crucial to the success of such a programme, as no framework and culture for the immunisation of older youth and adult populations are established in SA. HPV vaccine implementation programmes from other countries have shown that a school-based approach is most successful when HPV vaccines are introduced in girls 9 - 14 years of age.[7] The first of a series of three articles describing the Vaccine and Cervical Cancer Screen (VACCS) project appears in this issue of SAMJ.[8] These pilot projects combined vaccination of adolescent girls against HPV with cervical cancer screening interventions offered to their female caregivers.

Lessons that can be learned from such vaccination pilot projects are useful to guide nationwide implementation locally and in other African countries. Barriers that had to be addressed included the challenges associated with administration of a three-dose vaccine in a busy school calendar. A two-dose schedule was investigated in phase 2 of the study in the light of new efficacy data in girls 9 - 14 years of age.[9] The relative lack of health infrastructure for adolescent vaccination programmes was overcome by using schoolbased infrastructure and dedicated roving vaccination teams.

Parental or caregiver consent procedures could impact on vaccine uptake in school-based programmes and may be a barrier to new vaccine introduction.[7] Clear messages to parents will reduce the likelihood of negative publicity and address concerns about safety.

Vaccine uptake among girls whose caregivers attended information evenings were significantly better (almost 90%) than that among girls whose caregivers did not attend (around 50%),[8] underscoring the importance of information dissemination, creating of awareness and disease-specific education. Information must be distributed using multiple strategies, which can utilise health workers or teachers.[7] Providing written information only may not be enough in some communities. Overall, only around 50% of all invited girls were ultimately sufficiently vaccinated, mainly owing to lack of parental consent. After similar experiences, alternative strategies were employed in some countries. Community-based consent strategies that negated individual parental consent was introduced in Vietnam and Uganda, and parent opt-out strategies were used in Tanzania and Rwanda.[7] The acceptability of mandatory vaccination in the SA context will probably be problematic.

Vaccine course completion rates were addressed. A limitation of the national HPV vaccine roll-out programme is the absence of alternative vaccination opportunities when vaccination is missed as a result of absenteeism. The VACCS trials showed that at

January 2015, Vol. 105, No. 1

EDITORIAL

least two opportunities may be needed per facility because of illness or school-related activities that could cause girls to miss the vaccination opportunity, especially if a two-dose schedule is used.

HPV vaccine coverage and completion rates may also increase by the introduction of an additional public health facility-based HPV vaccination programme, which currently does not exist. The importance of grade-based as opposed to age-based eligibility criteria and completion of the vaccination series in one calendar year, as is done in the national roll-out, is highlighted by these data.

Linking vaccination and screening

An exciting and novel approach is the linking of cervical cancer screening of female caregivers to the vaccination of schoolgirls. Even though the uptake of self-screening for high-risk HPV was relatively low, a significant proportion (around 30%) of women at increased risk for cervical cancer were identified. It is important to understand that the aim of home-based cervical cancer screening is as an adjunct to existing healthcare facility-based screening programmes to reach unscreened, high-risk women who did not access healthcare. An additional benefit of linking screening to vaccination is the ease of traceability of screened women, which decreases the loss to follow-up experienced in the current national screening programme.

Implementation of HPV vaccine programmes and extension of cervical cancer screening programmes in African countries are important steps towards reducing the high burden of cervical cancer in this region.

Future considerations

Screening with HPV testing will almost certainly replace traditional cervical cytology in the not-too-distant future. Studies to evaluate the validity of the various HPV tests in our setting are extremely important. Higher rates of HPV infection, possible differences in genotype distribution and the effects of a high background incidence will affect the performance characteristics of HPV-based screening. The possibility of patient-collected (self-sampling) specimens will cater for a large number of women who may not have access to healthcare facilities.

HPV vaccination will only make a significant impact if high enough vaccination rates can be achieved. Continuing education of the public and of healthcare workers is essential. Monitoring of the programme to evaluate vaccination rates needs to be in place from the start. A catch-up school-based vaccination campaign to include a larger cohort of girls, perhaps up to 18 years of age, will be costeffective and may produce herd protection.

34

Conclusion

There is currently no comprehensive cervical cancer control programme in place. We urgently need to outline strategies to: • maximise the number of individuals receiving HPV vaccines • monitor the vaccination programme effectively • commit to a screening policy, with consideration of HPV testing and self-sampling.

In primary and secondary prevention of cervical cancer, opportunities for linkage with existing infrastructure and services should be investigated.

M H Botha Department of Obstetrics and Gynaecology and Unit for Gynaecological Oncology, Faculty of Medicine and Health Sciences, Stellenbosch University, Tygerberg, Cape Town, South Africa K L Richter Department of Medical Virology, School of Medicine, Faculty of Health Sciences, University of Pretoria, South Africa, and National Health Laboratory Service, Pretoria Corresponding author: M H Botha (mhbotha@sun.ac.za) 1. Smith N, Moodley J, Hoffman M. Challenges to cervical cancer screening in the Western Cape province. S Afr Med J 2003;93(1):32-35.

2. Adefuye PO, Broutet NJ, de Sanjose S, Denny LA. Trials and projects on cervical cancer and human papillomavirus prevention in sub-Saharan Africa. Vaccine 2013;31(Suppl 5):F53-F59. [http://dx.doi. org/10.1016/j.vaccine.2012.06.070] 3. Harries J, Moodley J, Barone MA, Mall S, Sinanovic E. Preparing for HPV vaccination in South Africa: Key challenges and opinions. Vaccine 2009;27(1):38-44. [http://dx.doi.org/10.1016/j. vaccine.2008.10.033] 4. Botha MH, Dochez C. Introducing human papillomavirus vaccines into the health system in South Africa. Vaccine 2012;30(Suppl 3):C28-C34. [http://dx.doi.org/10.1016/j.vaccine.2012.03.032] 5. Richter KL, Dreyer G, Lindeque BG, Botha MH. HPV vaccine: Can we afford to hesitate? S Afr Med J 2014;104(8):522-523. [http://dx.doi.org/10.7196/SAMJ.8449] 6. MacPhail C, Venables E, Rees H, Delany-Moretlwe S. Using HPV vaccination for promotion of an adolescent package of care: Opportunity and perspectives. BMC Public Health 2013;13:493. [http:// dx.doi.org/10.1186/1471-2458-13-493] 7. Paul P, Fabio A. Literature review of HPV vaccine delivery strategies: Considerations for school- and non-school based immunization program. Vaccine 2014;32(3):320-326. [http://dx.doi.org/10.1016/j. vaccine.2013.11.070] 8. Botha MH, van der Merwe FH, Snyman LC, Dreyer G. The Vaccine and Cervical Cancer Screen (VACCS) project: Acceptance of human papillomavirus vaccination in a school-based programme in two provinces of South Africa. S Afr Med J 2015;105(1):40-43. [http://dx.doi.org/10.7196/SAMJ.8419] 9. World Health Organization. Human papillomavirus vaccines: WHO position paper. Wkly Epidemiol Rec 2014;43(89):465-492.

S Afr Med J 2015;105(1):33-34. DOI:10.7196/SAMJ.9233

January 2015, Vol. 105, No. 1

2, 1 CME†

6, 1 MI, 1 c MRC & Wits, 1 CME

4, 1 c Wits, 1 CME

Jan

Feb

Mar

January 2015, Vol. 105, No. 1

32

1

1

1, 1 c USA, 1 CME

4, 1 CME

37

Sept

Oct

Nov

Dec

2

4

3

1

19

3

1

1

2

2

4

1

1 c UKZN & UCT

4

Stell

17

2

4

1

2

1

1

1

1

1

1

2

KZN

12

1

1

2

2

1

1

1

1

2

Pret

2

1

1

WSU

1

1 CME

1

UFS

1

1

Limp

1

1

NW

Institution*

1

1

UNISA

2

1

1

CPUT

6

1

1

2

1

1

NICD, NHLS

8

2

2

1, 1 CME

2

1

CSIR, HSRC, MRC

13

1

3

1

1

3, 1 CME

2

2

Other SA

3

1

1

1 CME

1

MI

10

2

1

1 CME

1

2

1

1

2

Other ex-SA

UCT = University of Cape Town; Wits = University of the Witwatersrand; Stell = Stellenbosch University; KZN = University of KwaZulu-Natal; Pret = University of Pretoria; WSU – Walter Sisulu University; UFS = University of the Free State; Limp = University of Limpopo; NW = North-West University; UNISA = University of South Africa; CPUT = Cape Peninsula University of Technology; NICD = National Institute for Communicable Diseases; NHLS = National Health Laboratory Service; CSIR = Council for Scientific and Industrial Research; HSRC = Human Sciences Research Council; MRC = Medical Research Council; SA = South Africa/n; MI = multi-institutional. *According to submitting/corresponding author; may be MI. † Continuing Medical Education component of the SAMJ. CME articles represent responses to requests from the CME editor and are typically multiauthor, often from several institutions including from outside SA, e.g. USA, Australia. ‡ Guidelines are always MI. § Excluding CME articles.

Total

4

1, 1 c Stell

Aug

1

1

2, 1 CME

2

4

Jun

3

May

1

2

2 c UCT

7

Wits

Jul

5, 1 c USA & Wits, 1 CME

Apr

§

UCT

Month

Sources of articles published in SAMJ/CME during 2014

2

1

1

G’lines‡

EDITORIAL

RESEARCH

Hearing loss in the developing world: Evaluating the iPhone mobile device as a screening tool S Peer, MB BCh, FCORL (SA), MMed (Otol); J J Fagan, MB ChB, FCS (SA), MMed (Otol) Division of Otorhinolaryngology, Faculty of Health Sciences, University of Cape Town, South Africa Corresponding author: S Peer (shaziapeer@gmail.com) Background. Developing countries have the world’s highest prevalence of hearing loss, and hearing screening programmes are scarce.

Mobile devices such as smartphones have potential for audiometric testing.

Objectives. To evaluate the uHear app using an Apple iPhone as a possible hearing screening tool in the developing world, and to determine accuracy of certain hearing thresholds that could prove useful in early detection of hearing loss for high-risk populations in resource-poor communities.

Methods. This was a quasi-experimental study design. Participants recruited from the Otolaryngology Clinic, Groote Schuur Hospital, Cape Town, South Africa, completed a uHear test in three settings – waiting room (WR), quiet room (QR) and soundproof room (SR).

Thresholds were compared with formal audiograms.

Results. Twenty-five patients were tested (50 ears). The uHear test detected moderate or worse hearing loss (pure-tone average (PTA) >40 dB) accurately with a sensitivity of 100% in all three environments. Specificity was 88% (SR), 73% (QR) and 68% (WR). It was highly accurate in detecting high-frequency hearing loss (2 000, 4 000, 6 000 Hz) in the QR and SR with ‘good’ and ‘very good’ kappa values, showing statistical significance (p<0.05). It was moderately accurate in low-frequency hearing loss (250, 500, 1 000 Hz) in the SR, and poor in the QR and WR. Conclusion. Using the iPhone, uHear is a feasible screening test to rule out significant hearing loss (PTA >40 dB). It is highly sensitive for detecting threshold changes at high frequencies, making it reasonably well suited to detect presbycusis and ototoxic hearing loss from HIV, tuberculosis therapy and chemotherapy. Portability and ease of use make it appropriate to use in developing world communities that lack screening programmes.

S Afr Med J 2015;105(1):35-39. DOI:10.7196/SAMJ.8338

Hearing disability is one of the world’s major health problems.[1] An estimated 360 million people currently live with disabling hearing loss (defined as hearing loss >40 dB in the better-hearing ear in adults (>15 years) and >30 dB in the better-hearing ear in children (0 - 14 years).[2] The prevalence is greatest in the developing world, where the majority of deaf people reside.[1] Hearing loss is more common in adults than in children, constituting 91% of all cases.[2] The highest prevalence rates are found in sub-Saharan Africa (15.7%) and South Asia (17%).[1] Failure to deal with this health challenge perpetuates economic and health decline, as confirmed by the inverse relationship between the prevalence of hearing loss and gross national income.[2] For the individual, hearing loss leads to poor communication and social isolation.[3] The deaf are less likely to obtain employment than people with normal hearing, and those who are employed often earn incomes in the lowest bracket.[1,3] Screening programmes directed at high-risk groups are necessary.

If effective, they can reduce morbidity from hearing loss through early detection and rehabilitation.[4] Highly sensitive tools that yield lower false-positive and higher true-negative results are ideal for screening and monitoring hearing. There are currently few screening programmes for high-risk groups in the developing world.[5] High-risk groups include the elderly and patients receiving potentially ototoxic medications: chemotherapeutic agents,[6] second-line antituberculosis (TB) regimens and antiretrovirals (ARVs).[1,7,8] These groups are at risk of developing high-frequency hearing loss, as explained below.

High-risk groups Presbycusis

Presbycusis (adult-onset hearing loss) is generally underdiagnosed and undertreated. This leads to late detection, disease progression

35

and poor rehabilitation.[9,10] Such hearing loss is predominantly high frequency and sensorineural. Lin et al.[11,12] reported that older adults with hearing loss are more likely to develop cognitive impairment and dementia than their contemporaries without hearing loss.

Regular monitoring and early detection and treatment of presbycusis would maintain an existing quality of life.

HIV and TB therapy

Currently approximately 25 million people in South Africa (SA) are HIV-positive.[13] Hearing loss can be caused by HIV and/or its treatment; both are implicated in sensorineural hearing loss.[7] Treatment aimed at opportunistic infections and antineoplastic therapy can have synergistic hearing effects on patients receiving ARVs.[7,8] TB therapy is one such treatment, and TB is an increasing problem in sub-Saharan Africa owing to co-infection with HIV. There are increasing numbers of cases of multidrug-resistant (MDR) TB in SA,[8,14] the treatment of which involves injectable aminoglycosides that are known to cause ototoxicity[8,15] via a synergistic ototoxic effect together with ARVs on the outer hair cells of the cochlea, leading to high-frequency sensorineural hearing loss (HFSNHL).[15]

Chemotherapy

Cancer rates are increasing rapidly in the developing world.[16] Cisplatin, a commonly used antineoplastic drug, is known to cause irreversible dose-dependent ototoxicity[6,17] leading to HFSNHL. Noise exposure may result in a three-fold increased risk of hearing loss with cisplatin.[17,18] Ototoxicity monitoring is aimed at preventing or minimising the progression of hearing loss through prospective hearing

January 2015, Vol. 105, No. 1

RESEARCH

assessments. It is the most reliable method of detecting ototoxicity prior to development of symptomatic hearing loss[19] and permits clinicians to counsel patients, possibly modify treatment regimens, and rehabilitate hearing. Three methods of testing can be utilised, namely conventional audiology, high-frequency audiometry (HFA) and otoacoustic emissions. HFA has significant change criteria and excellent specificity and sensitivity,[8,19] but is generally not available in developing countries.

Objectives

Advances in screening techniques

The study was approved by the Research Ethics Committee, Faculty of Health Sciences, University of Cape Town, SA. The design was quasi-experimental. Study participants were consecutively recruited from patients attending the Otolaryngology Clinic at Groote Schuur Hospital, Cape Town. The inclusion criteria were age 15 - 80 years and having had a formal audiogram performed by a trained audiologist at Groote Schuur Hospital in the previous 2 weeks. Exclusion criteria included otorrhoea, visual impairment, learning disability, and poor gross motor skills rendering the patient incapable of tapping the screen. Non-English-speaking patients were not excluded if they understood the instructions after the task had been explained to them. All participants gave informed consent. The results obtained from the iPhone testing did not affect treatment plans.

While screening programmes traditionally involve audiologists testing patients in soundproof booths, alternative screening methods have evolved in recent years. Telehealth projects allow patients in remote areas to be tested using high-speed internet.[20] Portable audiometers are also becoming more advanced, and provide good-quality diagnostic audiometry in any environmental setting.[21] Global mobile phone penetration of the world’s population is at 85%,[22] and 1 in 5 Africans own smartphones. Automated hearing screening apps, using commercially available technology, present an opportunity to address the global problem of hearing loss. Yeung et al.[23] from the Children’s Hospital of Eastern Ontario reported on the first portable clinical ‘conditioned play’ iPad-based audiometer for the paediatric population. Their study shows promise in focusing on the shortcomings of existing play audiometry. Other authors have reported on the Apple uHear app using an iPodTouch device, with varying results. uHear is a hearing program devised by Unitron and Apple for use on any touchinterface Apple device, and is freely available for download from the iTunes Apple store.

Szudek et al.[24] were the first of three groups to evaluate this app as a potential hearing screening tool. Using an iPodTouch, participants were tested in different noise level environments.

Pure-tone averages (PTAs) calculated as a mean at thresholds of 500, 1 000, 2 000 and 4 000 Hz from the uHear application were compared with the formal audiogram. uHear was able to correctly diagnose the presence of moderate or worse hearing loss (PTA >40 dB) in 100 participants, with a sensitivity of 98% and a specificity of 82% in the clinic. In the soundproof room, sensitivity improved to 100% and specificity to 90%. KhozaShangase et al.[25] sampled a group of children using the uHear application on an iPodTouch in a school environment. PTAs (mean at thresholds of 500, 1 000 and 2 000 Hz) from the uHear test were compared with PTAs from formal audiograms. They reported large deviations in the lower frequencies, standard deviations of >10 dB at individual thresholds and a 34% increased pick-up rate of hearing loss. The third study, by Handzel et al.,[26] tested participants with unilateral sudden sensorineural hearing loss using the uHear on an iPodTouch, and reported a sensitivity of 76% and a specificity of 91% when compared with a formal audiogram. Inaccurately elevated thresholds at low frequencies using uHear were also detected, corroborating the findings of the previous study.[25] Interestingly, uHear reflected hearing thresholds more accurately in mid- to high frequencies than in low ones, and deviations in low frequencies were less pronounced in the abnormal-hearing (diseased) ear. These two observations were also reported by Szudek et al.[24] These studies have highlighted two important points. Firstly, it is possible to rule out moderate or disabling hearing loss.[24,26] Secondly, even though low frequencies may be inaccurately elevated,[24-26] the degree of hearing loss in the participant with abnormal hearing can possibly be predicted in the high frequencies.[24,26]

36

To determine the accuracy of: (i) the iPhone using the uHear app as a screening tool for moderate or worse hearing loss (PTA >40 dB), where PTA is the mean at thresholds of 500, 1 000, 2 000 and 4 000 Hz; and (ii) individual thresholds at certain frequencies, especially the high frequencies (which may be of use in high-risk population groups).

Methods

Test instruments

An iPhone 4 mobile device (iOS 4.2) was used. The uHear app (version 1.0) was downloaded from iTunes on to the device at no cost. The application allows users to test their pure-tone airconduction hearing sensitivity as well as speech in noise. For this study, participants completed only the hearing sensitivity test, which employs a 267 ms pulse duration, with a ‘10 dB down and 5 dB up’ approach. The time delay between tone presentations is randomised to prevent anticipation, and the lowest threshold with two positive responses of three excursions is recorded as the hearing sensitivity.

‘Earbud’ earphones that come standard with the device were used, and the buds were cleaned with an alcohol swab before and after every test in the presence of the participant. With reference to calibration, a single iPhone was used to test all participants. The same uHear application (version 1.0) was used for all participants tested.

Ambient noise levels in three test environments were measured at regular intervals with the OMD G45 71-6229 Psio sound level meter, providing an adequate measure of quality control. Sound levels for the respective environment complied with the South African Bureau of Standards requirements for all three environments.

Technique

Otoscopic examination was performed to exclude otorrhoea and wax impaction. Infection control was maintained during testing. All participants had formal audiograms done, and were tested in three different settings with the iPhone, i.e. the waiting room (WR), a quiet room (QR) and the soundproof room (SR).

Instructions to participants

Participants were given the device and the earphones to insert. The uHear app was selected, earphone connectivity confirmed and the participant advised to ‘tap the screen when a sound is heard’. The programme plays a series of pure tones of varying levels so that a threshold can be determined. On hearing a sound, the participant was expected to follow the commands. The duration of the test is 6 minutes. No audiologist is normally required, as the program is a selfassessment one. However, as this was a formal study an investigator was present to ensure that the test was completed.

January 2015, Vol. 105, No. 1

RESEARCH

Data analysis

For hearing screening, the presence or absence of moderate or worse hearing loss (PTA >40 dB) in each ear was determined by formal audiometry, as 40 dB is considered the critical hearing threshold for disabling hearing loss according to the World Health Organization, and warrants further investigation.

The iPhone uHear PTAs in all three settings were compared with the formal audiogram PTAs, where the PTA is calculated as a mean of thresholds (hearing in dB) at 500, 1 000, 2 000 and 4 000 Hz. These data were captured into 2 × 2 tables to calculate sensitivity, specificity and accuracy ratios.

Additionally, in view of the possibility for agreement by ‘chance’, kappa analysis was performed on iPhone thresholds from all three settings when compared with the formal audiogram to detect agreement at all six frequencies. Kappa values range from <0.2 to 1.0 depending on how well two thresholds correlate with each other at a particular frequency. The best correlation kappa value, i.e. ‘very good’, is one that is closest to 1. This describes how well the thresholds at a particular frequency correlated with the thresholds at the same frequency of the gold standard, the formal audiogram, and values this correlation according to the range described in Table 1.

Table 1. Kappa range of values and their correlation Kappa values

‘Agreement’/comparison

<0.2

Poor

0.21 - 0.4

Fair

0.41 - 0.6

Moderate

0.61 - 0.8

Good

0.81 - 1.0

Very good

Results

Thirty patients met the inclusion criteria and were recruited, of whom five were excluded for incomplete testing (unrelated to the device or software). Twenty-five patients were therefore fully tested (50 ears in total). Participants’ demographics are described in Table 2.

Accuracy of the iPhone uHear as a screening test. All ears with moderate or worse hearing loss (PTA >40 dB) were detected in all three settings. This translated to a sensitivity of 100%. Of the 42 ears without moderate or worse hearing loss (PTA ≤40 dB), 15 had moderate or worse hearing in the WR (specificity 64%), 11 had moderate or worse hearing in the QR (specificity 74%), and 5 had moderate or worse hearing loss in the SR (specificity 88%) (Table 3).

Accuracy in the WR was calculated as 70%, that in the QR as 78% and that in the SR as 90%.

Accuracy of the iPhone uHear thresholds at all six frequencies.

Kappa analysis compared the ‘agreement’ of the iPhone thresholds in all three rooms with the formal audiogram thresholds as reflected in Table 4. The iPhone was highly accurate at the high frequencies (2 000, 4 000 and 6 000 Hz), where there was ‘good’ and ‘very good’ correlation in the SR and QR (Table 4). This was found to be statistically significant (p<0.05). The iPhone did not correlate well at low frequencies in all three rooms, being ‘fair to moderate’ in the SR and ‘poor to moderate’ in the QR. The WR showed ‘poor to fair’ correlation at low frequencies and ‘moderate’ correlation at high frequencies.

The iPhone uHear therefore reflected thresholds more accurately in the mid- to high frequencies than in the low frequencies. Furthermore, the SR did not eliminate this low-frequency inaccuracy. These two salient findings correlate with all three studies reviewed.[24-26]

Discussion

Table 2. Participants’ demographics and hearing loss (as graded by the ASHA degree of severity of hearing loss) Participants, N

25

Age (years), mean (range)

43 (15 - 86)

Age distribution (years), n 15 - 20

4

21 - 40

7

41 - 60

6

61 - 80

8

Gender, n

Our study is one of the first to evaluate smartphone-assisted audiometry as a hearing screening tool for populations that currently have no access to formal audiometry. Results indicate that the iPhone uHear application is reasonably accurate at screening for moderate or worse (disabling) hearing loss. We found a sensitivity of 100%, with a very high negative predictive value, implying an ideal test for screening. The highest test accuracy (90%) was found in an SR, with a specificity of 88%, rendering the least false positives. This highlights the need for caution when testing in a WR setting.

Table 3. Accuracy of the iPhone as a screening test in three different settings (WR, QR, SR), compared with the formal audiogram Formal audiogram, n iPhone, n

Male

13

Female

12

Ears with PTA (dB), n

PTA ≤40 dB

PTA >40 dB

PTA ≤40 dB

17

0

PTA >40 dB

25

8

WR

≤25 (normal)

24

26 - 40 (mild loss)

18

PTA ≤40 dB

31

0

41 - 55 (moderate loss)

5

PTA >40 dB

11

8

56 - 70 (moderate to severe loss)

2

71 - 90 (severe loss)

1

PTA ≤40 dB

37

0

≥91 (profound loss)

0

PTA >40 dB

5

8

ASHA = American Speech-Language-Hearing Association; PTA = pure-tone average.

37

QR

SR

PTA = pure-tone average; WR = waiting room; QR = quiet room; SR = soundproof room.

January 2015, Vol. 105, No. 1

RESEARCH

Table 4. Kappa values (range of values and their correlation are set out in Table 1) seen with iPhone and formal audiogram thresholds in three different settings (WR, QR, SR) Formal audiogram, low frequencies (Hz) iPhone, low frequencies (Hz)

250

500

1 000

–0.0516

0.2217

0.4123

WR 250 500

0.0044

0.2399

0.4997

1 000

–0.0693

0.2526

0.5126

–0.0101

0.2751

0.5677

QR 250 500

0.0134

0.3102

0.5113

1 000

–0.0239

0.212

0.5207

0.097

0.5309

0.4386

SR 250 500

0.1309

0.5283

0.5316

1 000

0.0113

0.481

0.66 (p=0.000)

Formal audiogram, high frequencies (Hz) iPhone, high frequencies (Hz)

2 000

4 000

6 000

WR 2 000

0.496

0.663

0.4261

4 000

0.4667

0.339

0.5529

6 000

0.484

0.187

0.517

0.73 (p=0.001)

0.5122

0.5535

QR 2 000 4 000

0.4471

0.74 (p=0.000)

0.69 (p=0.000)

6 000

0.4339

0.69 (p=0.0092)

0.79 (p=0.0026)

0.75 (p=0.000)

0.72 (p=0.0039)

0.69 (p=0.005)

SR 2 000 4 000

0.73 (p=0.000)

0.85 (p=0.000)

0.89 (p=0.000)

6 000

0.77 (p=0.007)

0.92 (p=0.0010)

0.94 (p=0.000)

WR = waiting room; QR = quiet room; SR = soundproof room. *In the ‘good’ and ‘very good’ correlation values (Table 1), p-values of <0.05 imply good statistical significance (figures in brackets).

The iPhone uHear application was found to be highly accurate for detecting high-frequency hearing loss in the QR and SR in patients with various levels of hearing. The iPhone uHear application could therefore be used to screen those at high risk of developing highfrequency hearing loss through early detection of abnormal or worsening thresholds.

The iPhone uHear application is therefore an appropriate tool to screen for disabling hearing loss, and to detect high-frequency hearing loss in the abovementioned highrisk groups in poorly resourced communities that have limited access to healthcare. In particular, it can be used to screen and monitor hearing in drug-related ototoxicity where high-frequency assessments of both conventional audiometry and HFA have a

high degree of sensitivity to detect early change in hearing.[19] In addition, uHear is a self-assessment application that is available free from iTunes for all Apple users and is downloadable to any Apple device with a touchscreen interface and speakers (includes iPhone, iPad and iPodTouch). The test is quick and easy to perform, and designed for use by people of any language, socioeconomic status and intellectual capacity. Patients who are bed-bound, isolated or too weak to travel to an audiology centre could benefit from a mobile, freely available self-assessment hearing screening test like this.

Study limitations

More participants with varying degrees of hearing loss would possibly yield

38

January 2015, Vol. 105, No. 1

more accurate positive and negative predictive values, thereby rendering the testing more accurate. Environmental noise may have been a cause for poor results at the lower frequencies. Testing can possibly be improved by using background noise eliminators. Inset earphones are theoretically recommended as an effective way to reduce ambient noise. Being placed within the external ear canal, they can provide 30 - 40 dB attenuation of ambient noise.[27] In our study, inaccuracy can be related to insertion depth; ‘earbud’ earphones sit just beyond the concha at the entrance to the external ear canal, which could explain the poor low-frequency outcomes. In future, testing that incorporates inset earphones cupped by circumaural ear covers with integrated ambient noise level monitoring that eliminates or adjusts testing to accommodate background noise could be done. Although this would be ideal, it does counter the intention to screen using a device with its standard hardware. A single iPhone device was used for this study; to avoid problems relating to inter-device reliability, every iPhone may have to be calibrated.

Conclusions

The sensitivity of the uHear app used with the iPhone is adequate to screen for disabling hearing loss, and has good accuracy to high-frequency hearing loss in SRs and QRs. Early detection of hearing loss with hearing screening programmes is therefore possible using mobile digital technology. A mobile, non-operator-dependent method used to screen for disabling hearing loss and detect early high-frequency threshold changes, such as an Apple iPhone, can help overcome the lack of trained audiologists or available infrastructure in developing countries.[5] Because of the portability of the device, hearing screening with the iPhone uHear test is taken directly to the patient and is an opportune way to utilise existing community health and educational facilities. Oncology units, ARV rollout centres and TB hospitals with MDR/ extensively drug-resistant patients are ideal centres in which to use this technology.

In addition, satellite clinics that regularly dispense chronic medication to older adults can also be considered.

Disclaimer. The Division of Otorhino­ laryngology, Groote Schuur Hospital, and the authors do not have any affiliation to the Apple or Unitron companies.

RESEARCH

References 1. Stevens G, Flaxman S, Brunskill E, et al. Global and regional hearing impairment prevalence: An analysis of 42 studies in 29 countries. Eur J Public Health 2011;23(1):146-152. [http://dx.doi. org/10.1093/eurpub/ckr176] 2. World Health Organization. WHO Global Estimates on Prevalence of Hearing Loss. Geneva: WHO, 2012. http://www.who.int/pbd/deafness/WHO_GE_HL.pdf?ua=1 (accessed 20 November 2014).

3. Tucci DL, Merson M, Wilson BS. A summary of the literature on global hearing impairment: Current status and priorities for action. Otol Neurotol 2009;31(1):31-41. [http://dx.doi.org/10.1097/ MAO.0b013e3181c0eaec] 4. Swanepoel DW, Storbeck C, Friedland P. Early hearing detection and intervention in South Africa.

International Journal of Pediatric Otorhinolaryngology 2009;73(6):783-786. [http://dx.doi. org/10.1016/j.ijporl.2009.01.007] 5. Fagan JJ, Jacobs M. Survey of ENT services in Africa: Need for a comprehensive intervention. Global Health Action 2009;2:1-7. [http://dx.doi.org/10.3402/gha.v2i0.1932] 6. Whitehorn H, Sibanda M, Lacerda M, et al. High prevalence of cisplatin-induced ototoxicity in Cape Town, South Africa. S Afr Med J 2014;104(4):288-291. [http://dx.doi.org/10.7196/SAMJ.7389] 7. Katijah KS. Is there a need for ototoxicity monitoring for HIV:AIDs. Afr J Pharm Pharmacol 2010;4(9):574-579.

8. Harris T, Peer S, Fagan JJ. Audiological monitoring for ototoxic tuberculosis, human immunodeficiency virus and cancer therapies in a developing world setting. J Laryngol Otol 2012;126(6):548-551. [http:// dx.doi.org/10.1017/S0022215112000357] 9. Pacala JT, Yueh B. Hearing deficits in the older patient: ‘I didn’t notice anything’. JAMA 2012;307(11):1185-1194. [http://dx.doi.org/10.1001/jama.2012.305] 10. Yueh B, Shapiro N, MacLean CH, Shekelle PG. Screening and management of adult hearing loss in primary care scientific review. JAMA 2003;289(15):1976-1985. [http://dx.doi.org/10.1001/ jama.289.15.1976] 11. Lin FR, Metter EJ, An Y, et al. Hearing loss and cognition in the Baltimore Longitudinal Study of Aging.

Neuropsychology 2011;25(6):763-770. [http://dx.doi.org/10.1037/a0024238] 12. Lin FR, O’Brien RJ, Resnick SM, et al. Hearing loss and incident dementia. Arch Neurol 2011;68(2):214220. [http://dx.doi.org/10.1001/archneurol.2010.362] 13. World Health Organization. UN Core Epidemioloigical Slides. 2013. http://www.unaids.org/en/ media/unaids/contentassets/documents/epidemiology/2013/gr2013/201309_epi_core_en.pdf (accessed 20 November 2014).

14. World Health Organization. Multidrug and Extensively Drug Resistant TB (M/XDR-TB): 2010 Report on Surveillance and Response. Geneva: WHO, 2010.

15. Harris T, Bardien S, Schaaf HS, et al. Aminoglycoside-induced hearing loss in HIV-positive and HIVnegative multidrug-resistant tuberculosis patients. S Afr Med J 2012;102(6):363-366.

16. Farmer P, Frenk J, Knaul FM, Shulman LN, et al. Expansion of cancer care and control in countries of low and middle income: A call to action. Lancet 2010;376(9747):1186-1193. [http://dx.doi. org/10.1016/S0140-6736(10)61152-X] 17. Bokemeyer C, Berger CC, Hartmann JT, et al. Analysis of risk factors for cisplatin-induced ototoxicity in patients with testicular cancer. Br J Cancer 1998;77(8):1355-1362. [http://dx.doi.org/10.1038/ bjc.1998.226] 18. Fausti SA, Schaffer HJ, Olson DJ, et al. Audiometric monitoring for early detection of aminoglycoside ototoxicity. J Infect Dis 1992;165(6):1026-1032. [http://dx.doi.org/10.1093/infdis/165.6.1026] 19. American Academy of Audiology. Position Statement and Clinical Practice Guidelines: Ototoxicity Monitoring.October 2009. http://audiology-web.s3.amazonaws.com/migrated/OtoMonGuidelines. pdf_539974c40999c1.58842217.pdf (accessed 20 November 2014).

20. Swanepoel DW, Clark JL, Koekemoer D, et al. Telehealth in audiology: The need and potential to reach underserved communities. Int J Audiol 2010;49(3):195-202. [http://dx.doi. org/10.3109/14992020903470783] 21. Maclennan-Smith F, Swanepoel DW, Hall JW. Validity of diagnostic pure-tone audiometry without a sound-treated environment in older adults. Int J Audiol 2013;52(2):66-73. [http://dx.doi.org/10.3109 /14992027.2012.736692] 22. Kujawski M. Finally some 2012 statistics for the African mobile phone market. 2012. http://www. mikekujawski.ca/2012/05/30/finally-some-2012-statistics-for-the-african-mobile-phone-market/ (accessed 20 November 2014).

23. Yeung J, Javidnia H, Heley S, et al. The new age of play audiometry: Prospective validation testing of an iPad-based play audiometer. J Otolaryngol Head Neck Surg 2013;42:21. [http://dx.doi. org/10.1186/1916-0216-42-21] 24. Szudek J, Ostevik A, Dzieglielewski P, et al. Can uHear me now? Validation of an iPod-based hearing loss screening test. J Otolaryngol Head Neck Surg 2012;41(Suppl 1):S78-S84.

25. Khoza-Shangase K, Kassner L. Automated screening audiometry in the digital age: Exploring uHear and its use in a resource stricken developing country. Int J Technol Assess Health Care 2013;29(1):4247. [http://dx.doi.org/10.1017/S0266462312000761] 26. Handzel O, Ben-Ari O, Damian D, et al. Smartphone-based hearing test as an aid in the initial evaluation of unilateral sudden sensorineural hearing loss. Audiol Neurootol 2013;18(4):201-207. [http://dx.doi.org/10.1159/000349913] 27. Berger EH, Killion MC. Comparison of the noise attenuation of three audiometric earphones, with additional data on masking near threshold. J Acoustic Soc Am 1989;86:1392-1403. [http://dx.doi. org/10.1121/1.398699]

Accepted 10 November 2014.

RESEARCH

The Vaccine and Cervical Cancer Screen (VACCS) project: Acceptance of human papillomavirus vaccination in a school-based programme in two provinces of South Africa M H Botha,1 MB ChB, MMed (O&G), FCOG (SA), PhD; F H van der Merwe,1 MB ChB, MMed (O&G), FCOG (SA); L C Snyman,2 MB ChB, MPraxMed, MMed (O&G), FCOG (SA); G Dreyer,2 MB ChB, MMed (O&G), MCOG (SA), PhD epartment of Obstetrics and Gynaecology and Unit for Gynaecological Oncology, Faculty of Medicine and Health Sciences, Stellenbosch D University, Tygerberg, Cape Town, South Africa 2 Department of Obstetrics and Gynaecology and Gynaecological Oncology Unit, Faculty of Health Sciences, University of Pretoria, South Africa 1

Corresponding author: M H Botha (mhbotha@sun.ac.za)

Background. The incidence of cervical cancer in South Africa (SA) remains high, and the current screening programme has had limited success. New approaches to prevention and screening tactics are needed.

Objectives. To investigate acceptance of school-based human papillomavirus (HPV) vaccination, as well as the information provided, methods of obtaining consent and assent, and completion rates achieved.

Methods. Information on cervical cancer and HPV vaccination was provided to 19 primary schools in Western Cape and Gauteng provinces participating in the study. Girls with parental consent and child assent were vaccinated during school hours at their schools.

Results. A total of 3 465 girls were invited to receive HPV vaccine, of whom 2 046 provided written parental consent as well as child assent.

At least one dose of vaccine was delivered to 2 030 girls (99.2% of the consented cohort), while a total of 1 782 girls received all three doses.

Sufficient vaccination was achieved in 91.6% of the vaccinated cohort. Of all invited girls, 56.9% in Gauteng and 50.7% in the Western Cape were sufficiently vaccinated.

Conclusion. This implementation project demonstrated that HPV vaccination is practical and safe in SA schools. Political and community acceptance was good, and positive attitudes towards vaccination were encountered. During the study, which mimicked a governmental vaccine roll-out programme, high completion rates were achieved in spite of several challenges encountered.

S Afr Med J 2015;105(1):40-43. DOI:10.7196/SAMJ.8419

Cervical cancer remains an important cause of morbidity and mortality in South Africa (SA).[1] The age-standardised incidence rate of cervical cancer in southern Africa is approximately 27/100 000,[2] and most cases are diagnosed in late stages. Persistent infection with oncogenic human papillomavirus (HPV) is an essential step in the development of invasive cervical cancer.[3] HPV is highly infectious, but does not cause disease in all cases, and most individuals will clear infections. Since HPV is almost exclusively an epithelial disease, most transient HPV infections do not confer longterm immunity owing to a poor immune response.

A national cervical cancer prevention programme was launched in SA in 2000, offering three Papanicolaou smears in a woman’s lifetime, starting after the age of 30 at 10-year intervals, but has had limited success in reducing the incidence of HPV-associated disease.

Some provinces in SA have fairly well-developed cytology screening services, but there is poor uptake of prevention services for cancer.

Among women with abnormal cytology, there is also significant loss to follow-up after the initial screening test.[4] Since the introduction of effective HPV vaccines, a primary preventive strategy became available to combat the epidemic.

Currently there are two vaccines registered in SA: the bivalent vaccine Cervarix, containing virus-like particles (VLPs) for HPV types 16 and 18, and the quadrivalent vaccine Gardasil, containing VLP antigens for HPV types 16 and 18 as well as non-oncogenic HPV types 6 and 11. VLPs are combined with an adjuvant, which leads to an improved immune response and long-term efficacy.

Both vaccines have been extensively tested in large populations,

40

and have also been found to be safe and immunogenic among African populations.[5] The bivalent HPV vaccine has also shown sustained immune responses in HIV-positive women, and was well tolerated.[6] Local reactions such as pain, swelling and redness can occur, as may systemic adverse events including fever, nausea, dizziness, fatigue, headache and myalgia.

Cost-effectiveness studies have shown universal, femaleonly HPV vaccination before exposure to be an effective and economically viable option in developed countries.[7] Recently there has been increasing emphasis on the inclusion of low- and middle-income countries in the drive to reduce the global cancer burden. Evidence from qualitative studies suggests that South Africans will support introduction of HPV vaccination, but that education remains a key ingredient in any roll-out.[8] Adolescent health was identified as an area for development in the SA National Health Initiative Green Paper, with preventive health an important part of this plan. This focus is linked to a re-engineered primary healthcare plan and a newly developed school health programme (SHP).

In May 2013, Dr Aaron Motsoaledi, national Minister of Health, announced during the health budget speech that: ‘... we shall commence to administer the HPV vaccines as part of our SHP ...’.

This courageous step is widely applauded in view of an uncontrolled cervical cancer epidemic resulting from high prevalence rates of HPV and HIV and the relatively unsuccessful cervical cancer screening programme described above. The success of this programme will depend on offering the vaccine to the target group via a functional SHP, education, and high vaccine uptake and completion rates. Data

January 2015, Vol. 105, No. 1

RESEARCH

on factors influencing successful schoolbased implementation as well as acceptance rates among SA primary schoolgirls and their parents are limited.

This paper describes recruitment, information provided and consent and assent methods used, and reports on the acceptance of HPV vaccination and completion rates among learners invited to receive HPV vaccination in a primary school-based programme.

Methods Approval

Approval to conduct the project in schools was obtained from the national and provincial departments of health and education. Ethics approval was received from the participating university human research ethics committees (Stellenbosch N11/01/008 and Pretoria 219/2009). There was discussion between the investigators and school principals, important teachers and the school governing bodies to explain the rationale of the work.

Study procedures

Selection of sites and participants Primary schools in low socioeconomic areas in Western Cape and Gauteng provinces were identified and contacted to invite them to participate in this prospective demonstration study. Children in grades 4â&#x20AC;&#x201E;-â&#x20AC;&#x201E;7 received an invitation letter to an information evening to take home.

Information, consent and assent procedures Teachers encouraged learners to bring the reply slip back. An information event was scheduled at each school in the afternoon or early evening. At the information events parents were interviewed after informed consent for the interview had been obtained. Structured interviews were conducted by trained interviewers and lasted about 20 minutes. The interview focused on demographic information and knowledge and perceptions of cervical cancer screening and vaccination. After the interviews, information about cervical cancer and ways of preventing it, including vaccination and screening, was given to parents and learners. The parents were then given the opportunity to provide written consent for vaccination of their children.

Children were asked to give written assent as well, in order to meet research ethics requirements. Children aged 12 years and older were legally capable of giving consent without parental consent. The parents were invited to take part in a screening programme.

Parents who did not attend information events were given the opportunity to give consent after written information leaflets were sent home with their children. These consent forms were collected by teachers before the vaccination date.

Vaccine procedures Vaccines for the study were donated by both vaccine companies. For practical reasons, the majority of girls in a particular school received the same brand of vaccine. All children younger than 10 years received Gardasil, owing to licensing at the time of the study. Vaccination was performed and recorded by registered nurses during school hours.

Schools were visited on at least two occasions for each vaccination time point to account for absenteeism. Learners were observed for 20 minutes after each dose for possible early adverse events.

Statistical analysis

For the purposes of this analysis, we defined the invited cohort (IC) as all female learners, aged 9 years and older, enrolled in grades 4, 5, 6 and 7. The consented cohort (CC) was defined as all participants who had written parental consent as well as assent from the learner herself. Girls with consent who did not receive the vaccine were included in the CC. The vaccinated cohort (VC) included all girls who received at least one dose of vaccine.

Consent rate was calculated as the CC as a proportion of the IC. Vaccine uptake rates were calculated[9] in a number of ways to allow comparison with previously published HPV vaccine reports. The consented uptake rate was calculated as the VC as a proportion of the CC, and the invited uptake rate was calculated as the VC as a proportion of the IC.

Vaccine completion was calculated using the VC as denominator, while sufficient vaccination was calculated using the IC as denominator. When two vaccine doses were administered, data for girls receiving the two doses within a short period of time (<6 months apart) were separated from those who received the vaccines at least 6 months apart. For the purposes of these calculations, girls who received at least two doses 6 months apart were considered sufficiently vaccinated, while those receiving no dose at 6 months were considered insufficiently vaccinated. This is based on recent data suggesting protective antibody levels against vaccine HPV types in similar recipients.[10]

Results

The number of girls of the target age enrolled in the schools approached was 3 465. A total of 2 046 girls had written parental consent as well as written child assent, and 2 030 girls received at least one dose. These cohorts, shown in Table 1, were used to calculate vaccination success rates.

The rate of consent for the total study population was 59.0%. We were able to confirm the consent documents of 87.5% of all parents who attended the information events in Gauteng. Similar data for the Western Cape were not available. Of the consented children, almost all (99.2%) received at least one dose of vaccine. When vaccine uptake rates were calculated for the total target population, we obtained rates of 63.7% for the Gauteng schools and 53.9% in the Western Cape. Recruitment documents and methods were identical for the two provinces, and the reasons for the observed difference in the rate of vaccine uptake were probably independent of the study method.

These figures are set out in Table 2.

Table 1. Study population and cohorts IC

Gauteng girls (n)

Western Cape girls (n)

Total girls (N)

1 654

1 811

3 465

CC

1 059

987

2 046

VC

1 053

977

2 030

IC = invited cohort; CC = consented cohort; VC = vaccinated cohort.

Table 2. Vaccine consent and uptake rates Gauteng girls

Western Cape girls

Total girls

Consent rate, n/N (%)

1 059/1 654 (64.0)

987/1 811 (54.5)

2 046/3 465 (59.0)

Consented uptake rate, n/N (%)

1 053/1 059 (99.4)

977/987 (99.0)

2 030/2 046 (99.2)

Invited uptake rate, n/N (%)

1 053/1 654 (63.7)

977/1 811 (53.9)

2 030/3 465 (58.6)

41

January 2015, Vol. 105, No. 1

RESEARCH

Table 3. Completion rates in the VC (N=2 030) Three doses received

Gauteng, n (%)

Western Cape, n (%)

Total, n (%)

870 (82.6)

912 (93.3)

1 782 (87.8)

Two doses 6 months apart

71 (6.7)

6 (0.6)

77 (3.8)

Sufficiently vaccinated

941 (89.4)

918 (94.0)

1 859 (91.6)

Single dose received

9 (0.9)

10 (1.0)

19 (0.9)

Two doses <6 months apart

103 (9.8)

49 (5.0)

152 (7.5)

Insufficiently vaccinated

112 (10.6)

59 (6.0)

171 (8.4)

Total VC

1 053 (100)

977 (100)

2 030 (100)

VC = vaccinated cohort.

Table 4. Vaccination rates in the IC (N=3 465) Gauteng, n (%)

Western Cape, n (%)

Total, n (%)

Three doses received

870 (52.6)

912 (50.4)

1 782 (51.4)

Two doses 6 months apart

71 (4.3)

6 (0.3)

77 (2.2)

Sufficiently vaccinated

941 (56.9)

918 (50.7)

1 859 (53.7)

Single dose received

9 (0.5)

10 (0.6)

19 (0.5)

Two doses <6 months apart

103 (6.2)

49 (2.7)

152 (4.4)

No vaccine received

601 (36.3)

834 (46.1)

1 435 (41.4)

Insufficiently vaccinated

713 (43.1)

893 (49.3)

1 606 (46.3)

Total IC

1 654 (100)

1 811 (100)

3 465 (100)

IC = invited cohort.

Regarding vaccine completion rates, in the Western Cape 93.3% of all girls who started vaccination received all three doses, and in Gauteng this figure was 82.6%. This difference in completion rates is attributed in part to two schools in Gauteng where the third vaccine dose was scheduled for the following calendar year. In the total group, 91.6% of vaccinated girls were considered sufficiently vaccinated, the figure again being higher in the Western Cape than in Gauteng.

Completion rates are set out in Table 3.

Considering both the influences of vaccine uptake and doses received, 53.7% of the target population in this study was considered sufficiently vaccinated at the end of the study period. Another 4.9% were vaccinated, but received a suboptimal vaccine dosage – usually the first two doses not followed by a third dose 6 months after the first dose.

Detailed data are presented in Table 4.

Vaccination proceeded without any serious side-effects, and no serious adverse events were reported. There was protocol violation in two instances where two girls received one dose each without full written consent.

Discussion

In general, the staff at the schools co-operated and supported the study. At the

majority of schools, staff members helped with the information evenings. Attendance at these meetings varied from school to school and according to seasons, television schedules and safety concerns. Most of the parents who attended the information events gave consent for vaccination of their children, but a significant percentage did not attend these events and did not reply to the written invitation to take part in the study. The successful Australian schoolbased programme sends information to parents and asks for a detailed consent form to be returned to the school.[11] Information leaflets were also used to communicate with parents in a demonstration project in another province of SA, but the authors do not mention the number of children approached or the proportion for whom parental consent was achieved.[12] Information leaflets may work in certain schools, but our experience was that about 30 - 40% of parents did not respond to letters sent home with the learners. In the current study, relatively limited written information was provided to parents, but written information was combined with an invitation to an information event at which detailed verbal information was given and opportunity for questions and discussion provided. Using this recruitment method,

42

January 2015, Vol. 105, No. 1

a consent rate of almost 90% was reached among parents attending the information event, v. a rate of almost 60% for the total IC. The high acceptance rate following better information underlines the importance of clear, direct communication with parents.

In Rwanda a high rate of acceptance was achieved after educational interventions to parents.[13] There seems to be a better response to vaccination uptake in certain populations when interactive communication (rather than written only) strategies are used for transfer of information.[14] Verbal, interactive information sessions may be key to success in areas where literacy levels are low.

Uptake rates in many HPV vaccination projects around the world have been reported as high.[11,12] In our CC, 99.4% of girls were vaccinated and 91.6% received at least two doses of vaccine 6 months apart. Another 7.5% received their second dose after the first without receiving the last, while 87.8% received all three doses.

Lower uptake was achieved when all invited girls are considered, but this is difficult to compare with other studies owing to a lack of local data.[12] Linking primary and secondary prevention in a mother-daughter programme was tested in this study and other sites.[12,15] Mothers and/or caregivers of learners were given the opportunity to undergo screening. The results of this part of the study will be reported in the next issue of the SAMJ.[9]

Conclusion

This implementation project demonstrated that HPV vaccination is practical and safe in SA schools. Political and community acceptance is good, and we encountered positive attitudes towards vaccination. This study mimicked a governmental vaccine roll-out programme, and despite several challenges, high completion rates were achieved.

Parents who received complete information on the HPV vaccine demonstrated a very high acceptance rate, appropriate information contributing significantly to vaccine uptake.

This effective communication is shown to achieve better coverage for vaccination; importantly, the awareness created may also lead to improved screening uptake. Vaccine completion was much improved by ensuring administration of all doses within a single calendar or academic year.

Acknowledgements. The assistance of the following groups and persons that enabled this project to be completed successfully is gratefully acknowledged.

RESEARCH

Financial support was received from the Cancer Research Initiative of South Africa, a national collaborative research programme supported by the South African Medical Research Council, the Cancer Association of South Africa and First for Women Insurance for screening, treatment of screen-positive women and investigator support. The vaccine manufacturing companies GlaxoSmithKline/Aspen SA and Merck supported this investigator-initiated study by generously donating all vaccines used in the project.

Prof. Gerhard Lindeque provided valuable advice, Ms Bertha Grond managed the finances, Ms Riekie Burden, Sr Nicolene Laubscher, Sr Nadine Chamberlain and their teams of registered nurses handled study and vaccine processes, Dr Karin Richter managed the laboratory screening data, Ms Cathy Visser collated and analysed the vaccination and screening data, consultants and registrars in the Department of Obstetrics and Gynaecology, University of Pretoria, presented lectures at the information events, and undergraduate medical students at the University of Pretoria and Stellenbosch University administered the questionnaires.

References 1. ICO (Institut Català d’Oncologia) Information Centre on HPV and Cancer. South Africa: Human Papillomavirus and Related Cancers, Fact Sheet 2013. http://www.hpvcentre.net/statistics/reports/ ZAF_FS.pdf (accessed 24 March 2014).

2. Ferlay J, Soerjomataram I, Ervik M, et al. GLOBOCAN 2012 v1.0, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 11. Lyons, France: International Agency for Research on Cancer, 2013. http://globocan.iarc.fr (accessed 28 March 2014).

3. Stanley M. Prevention strategies against the human papillomavirus: The effectiveness of vaccination.

Gynecol Oncol 2007;107(2):S19-S23. [http://dx.doi.org/10.1016/j.ygyno.2007.07.068] 4. Cronje HS, Beyer E. Screening for cervical cancer in the developing world. Best Pract Res Clin Obstet Gynaecol 2005;19(4):517-529. [http://dx.doi.org/10.1016/j.ijgo.2003.09.009] 5. Sow PS, Watson-Jones D, Kivia N, et al. Safety and immunogenicity of human papillomavirus-16/18 AS04-adjuvanted vaccine: A randomized trial in 10 - 25-year-old HIV-seronegative African girls and young women. J Infect Dis 2013;207(11):1753-1763. [http://dx.doi.org/10.1093/infdis/jis619] 6. Denny L, Hendricks B, Gordon C, et al. Safety and immunogenicity of the HPV-16/18 AS04adjuvanted vaccine in HIV-positive women in South Africa: A partially-blind randomised placebocontrolled study. Vaccine 2013;31(48):5745-5753. [http://dx.doi.org/10.1016/j.vaccine.2013.09.032] 7. Anonychuk AM, Bauch CT, Merid ME, van Kriekinge G, Demarteau N. A cost-utility analysis of cervical cancer vaccination in preadolescent Canadian females. BMC Public Health 2009;9:401. [http://dx.doi.org/10.1186/1471-2458-9-401] 8. Harries J, Moodley J, Barone MA, Mall S, Sinanovic E. Preparing for HPV vaccination in South Africa: Key challenges and opinions. Vaccine 2009;27(1):38-44. [http://dx.doi.org/10.1016/j.vaccine.2008.10.033] 9. Snyman LC, Dreyer G, Botha MH, van der Merwe FH, Becker PJ. The Vaccine and Cervical Cancer Screen (VACCS) project: Linking cervical cancer screening to HPV vaccination in the South West Tshwane District of Gauteng. S Afr Med J 2015 (in press). [http://dx.doi.org/10.7196/ SAMJ.8418] 10. Dobson SRM, McNeil S, Dionne M, et al. Immunogenicity of 2 doses of HPV vaccine in younger adolescents vs 3 doses in young women: A randomized clinical trial. JAMA 2013;309(17):1793-17802. [http://dx.doi.org/10.1001/jama.2013.1625] 11. Australian Government Department of Health. HPV school vaccination program. 2014. http://hpv. health.gov.au/the-program/#.UzlD_9LHlic (accessed 31 March 2014).

12. Moodley I, Tathiah N, Mubaiwa V, Denny L. High uptake of Gardasil vaccine among 9 - 12-yearold schoolgirls participating in an HPV vaccination demonstration project in KwaZulu-Natal, South Africa. S Afr Med J 2013;103(5):318-321. [http://dx.doi.org/10.7196/SAMJ.6414] 13. Binagwaho A, Wagner CM, Gatera M, Karema C, Nutt CT, Ngaboa F. Achieving high coverage in Rwanda’s national human papillomavirus vaccination programme. Bull World Health Organ 2012;90(8):623-628. [http://dx.doi.org/10.2471/BLT.11.097253] 14. Galagan SR, Paul P, Menezes L, LaMontagne DS. Influences on parental acceptance of HPV vaccination in demonstration projects in Uganda and Vietnam. Vaccine 2013;31(30):3072-3078. [http://dx.doi. org/10.1016/j.vaccine.2013.04.056] 15. Abuelo CE, Levinson KL, Salmeron J, Sologuren CV, Fernandez MJV, Belinson JL. The Peru Cervical Cancer Screening Study (PERCAPS): The design and implementation of a mother/daughter screen, treat, and vaccinate program in the Peruvian jungle. J Community Health 2013;39(3):409-415. [http:// dx.doi.org/10.1007/s10900-013-9786-6]

Accepted 10 November 2014.

High concentrations of natural rubber latex allergens in gloves used by laboratory health personnel in South Africa M E Ratshikhopha,1 MSc (Med); T S Singh,1,2 PhD; D Jones,1 MPH; M F Jeebhay,3 MB ChB, MPhil (Epi), MPH, PhD; A L Lopata,4,5 PhD National Institute for Occupational Health, National Health Laboratory Service, Johannesburg, South Africa Department of Clinical Microbiology and Infectious Diseases, School of Pathology, University of the Witwatersrand, Johannesburg, South Africa 3 Centre for Occupational and Environmental Health Research, University of Cape Town, South Africa 4 Division of Tropical Health and Medicine and Centre for Biodiscovery and Molecular Development of Therapeutics, James Cook University, Townsville, Australia 5 Division of Immunology and Institute of Infectious Disease and Molecular Medicine, University of Cape Town, South Africa 1

2

Corresponding author: M E Ratshikhopha (edith.ratshikhopha@nioh.nhls.ac.za)

Introduction. Gloves made of natural rubber latex (NRL) are commonly used by healthcare workers because of their good qualities.

However, allergic reactions to latex allergens are still commonly reported.

Objective. To measure the concentrations of Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 allergens in gloves used by a large laboratory service in South Africa.

Methods. NRL gloves as well as non-latex gloves supplied by various suppliers that were used by the laboratory personnel during the period June 2009 - May 2010 were obtained from various suppliers on the vendor list. Proteins were extracted from the gloves and Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 allergens were quantified using the FITkit assay.

Results. Twenty NRL gloves from 13 different brands were analysed. Only four (20%) of the 20 NRL gloves analysed had a total allergen content <0.15 µg/g, the suggested threshold limit for low allergenicity for the sum of these four allergens.

Conclusion. This study demonstrated that a very low proportion of gloves tested had a total allergen content below the threshold for low allergenicity.

S Afr Med J 2015;105(1):43-46. DOI:10.7196/SAMJ.8082

43

January 2015, Vol. 105, No. 1

RESEARCH

While natural rubber latex (NRL) gloves generally offer effective barrier protection against contact with body fluids, micro-organisms and solvents,[1] adverse reactions have been associated with their use.

These include immunoglobulin E-mediated allergic reactions and irritant and allergic contact dermatitis.[2] Allergic reactions to NRL gloves are attributed to a very small frac­ tion of residual extractable proteins containing allergens.[3] Signifi­ cant differences in allergen levels have been shown in different brands of gloves.[4] Thirteen different hevein latex proteins have been recog­nised as allergens by the Allergen Nomenclature Subcommittee of the World Health Organization/International Union of Immunological Societies.[5] Latex allergenicity has been determined by measuring the levels of the clinically relevant hevein allergens (Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02) in the gloves used by healthcare workers (HCWs).[6] In that study, the sum of the concentrations of the four allergens quantified, when set at 0.15 µg/g, discriminated ‘lowallergenic’ (<10 allergy units (AUs)/ml) from ‘moderate- to highallergenic’ (≥10 AUs/ml) gloves.[6] A South African (SA) study quantified Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 in gloves used in dental schools and found the levels to be above the suggested recommendation.[7] Previous studies have shown a reduction in latex allergy when workers were exposed exclusively to powderfree low-protein latex gloves.[8-9]

Objective

To measure the concentrations of Hev b1, Hev b 3, Hev b 5 and Hev b 6.02 latex-specific allergens in gloves being used by a large laboratory service provider, and to determine the allergen levels of gloves to be purchased from prospective suppliers of new gloves prior to their purchase.

Materials and methods

The procurement of NRL gloves by most large health service provi­ ders is based on cost-effectiveness and meeting criteria of the South African Bureau of Standards guidelines (SANS11193-1:2010) for latex gloves. All goods procured by the laboratory service provider are registered on the organisation’s procurement system database. A search of the procurement system database using the word ‘gloves’ was conducted on 3 June 2009 and repeated on 6 May 2010. A list of NRL and non-latex gloves that were active on the system, with accompanying information on the supplier, glove type, glove size, glove cost and brand, was compiled. The laboratory analysis was performed at the National Institute for Occupational Health, Johannesburg, SA. After the initial evaluation of the allergen content of gloves used in the organisation, criteria were set and tender specifications developed and advertised in the local newspaper. Only companies that met the criteria were asked to submit samples of gloves that they intended to supply for confirmatory testing.

Extraction of latex proteins was done as described by Mabe et al.[7] The FITkit (Icosagen AS, Estonia) was used to quantify Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 allergens according to the manufacturer’s instructions. Briefly, precoated Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 monoclonal antibody microtitre plates were used. The extracted sample, controls and standards were added to wells and incubated. All the measurements were done in duplicate.

The plates were washed, horseradish peroxidase (HRP)-labelled specific monoclonal antibody was added to each well, and the plates were incubated at room temperature. After washing the plates, HRP substrate was added to all wells and the plate was incubated at room temperature again. Absorbance was measured at 405 nm and the

44

concentrations were reported in µg/L, which was converted to µg/g of glove. STATA 9 software (StataCorp 1984 - 2007, USA) was used to analyse the data. Non-parametric tests were applied because the data were not normally distributed.

Results

Twenty NRL glove samples, comprising 13 brands, were analysed.

The types included 14 examination gloves, 5 surgical gloves and 1 household glove; 14 of the gloves were non-powdered and 6 were powdered (Table 1). Only 4 of the 20 NRL gloves analysed had a total allergen content (sum of Hev b 1, Hev b 3, Hev 5 and Hev b 6.02 concentrations) <0.15 µg/g, which has been suggested as the threshold limit for low allergenicity for the sum of the four allergens.[6] These included the brand K non-sterile examination glove, brand C powder-free surgical glove, brand F ‘high-risk’ examination glove and brand A surgical glove. There were differences in concentrations of allergens between different types of gloves of the same brand. The brand C powder-free glove had a total allergen content <0.15 µg/g, whereas the powered glove had a content >0.15 µg/g. Of the two types of brand F gloves, the one labelled ‘high risk’ had a total allergen content <0.15 µg/g and the other one a total allergen content >0.15 µg/g. The concentrations of the brand K gloves also differed (Table 1). The non-sterile glove had a total allergen content <0.15 µg/g, while the sterile glove had a total allergen content >0.15 µg/g.

The price of latex gloves ranged from R0.26 to R11.30 per pair in January 2011. No correlation was found between prices and the total allergen levels (rs –0.2024; p>0.05). However, it is worth noting that the cheapest glove had the highest content of Hev b allergens, and that one of the gloves with a total allergen content below the recommended cut-off was the most expensive.

The mean (standard deviation) total allergen content for powdered gloves was 21.86 (5.63) µg/g, higher than the average for the nonpowdered gloves of 14.22 (6.29) µg/g. However, the difference was not statistically significant (p>0.05). There was also no significant difference between the allergen concentrations of surgical and examination gloves, although the numbers were too small to make a valid conclusion.

The initial testing of gloves in this study provided the impetus for requesting potential glove suppliers to have their gloves tested during the tender selection process. Of 27 companies that submitted a tender bid, only 11 met the criteria of the tender specifications. Five NRL glove brands were supplied for testing. The total allergen levels were <0.15 µg/g in three of the brands tested. These included brand F gloves and two other brands that were not among those tested in the initial analysis.

Discussion

Only 20% of the NRL gloves tested had a total allergen content below the suggested threshold for low allergenicity. The findings of this study are very similar to those previously reported on glove use by dental HCWs,[7] which showed that all the glove brands used in SA dental schools that were tested had concentrations above the threshold of 0.15 µg/g for the sum of four allergens tested. Three of the six brands tested in the dental study were also tested in the present study, and the results were similar. Both the current study and the dental study highlight the inferior quality of gloves being used in healthcare facilities. This situation may be very common in the healthcare setting in SA, and indeed in other African countries. It is therefore important to educate managers and procurement officers about the test available to assess the quality and latex concentration of gloves.

January 2015, Vol. 105, No. 1

RESEARCH

Table 1. Concentration of latex allergens* of NRL glove brands used by a large laboratory service provider (results presented from lowest to highest concentration) Brand

Type

Powdered

Hev b 1 (µg/g)

Hev b 3 (µg/g)

Hev b 5 (µg/g)

Hev b 6.02 (µg/g)

Total allergen† (µg/g)

Brand K non-sterile

Exam

No

0

0

0

0

<0.15

Brand C

Surgical

No

0

0

0.03

0.03

<0.15

Brand F ‘high risk’

Exam

No

0

0.07

0

0

<0.15

Brand A

Surgical

No

0

0.14

0

0

<0.15

Brand E

Exam

No

0

0.75

0.19

0.20

1.14

Brand D

Exam

No

0

0.65

0.11

0.45

1.21

Brand K sterile

Exam

No

0.66

0.91

0.11

0.19

1.88

Brand C

Surgical

Yes

0.08

0.01

0.44

1.57

2.10

Brand F

Exam

No

0.27

2.29

0.19

0.36

3.12

Brand G

Exam

No

1.05

5.00

0.27

0

6.32

Brand I

Household

No

0.14

0.58

10.19

2.06

12.97

Brand J

Surgical

Yes

0

0.12

13.22

1.75

15.09

Brand M

Exam

No

0

3.66

6.00

7.32

16.99

Brand D

Exam

Yes

3.72

5.00

4.77

3.72

17.21

Brand B

Surgical

Yes

0

0.16

0.16

22.55

22.87

Brand M

Exam

No

0.11

3.70

15.03

13.32

32.16

Brand G

Exam

Yes

0.21

0.68

18.14

13.57

32.61

Brand H

Exam

No

0.000

0.00

8.71

30.84

39.55

Brand D

Exam

Yes

2.04

2.69

20.70

15.79

41.22

Brand L

Exam

No

0.33

1.42

41.67

39.77

83.18

NRL = natural rubber latex. *Detection limit (DL): Hev b 1 0.05 µg/g; Hev b 3 0.05 µg/g; Hev b 5 0.025 µg/g; Hev b 6.02 0.025. Values below the DL are recorded as zero. † Total allergen: sum of Hev b 1, Hev b 3, Hev b 5 and Hev b 6.02 concentrations.

Our findings have relevance to the organisational goal of reducing exposure to latex in the workplace. Apart from the widespread move from a powdered to a powder-free glove policy in response to scientific evidence identifying cornstarch powder as the main agent responsible for the development of latex sensitisation and allergy in exposed HCWs,[9] gloves with low latex allergen concentrations can further reduce latex allergy by limiting cutaneous exposure and dose.

Laboratory studies have demonstrated that as much as 2.2% of latex allergen protein can penetrate intact skin within 24 hours of exposure.

In addition, penetration of allergens through compromised skin barriers can increase by 50-fold.[10] In the light of these findings, recommendations were made to the procurement division of the organisation for drafting the criteria for the tender process for potential glove tender bidders. These included suggestions that all gloves supplied to the organisation must be certified with the South Africa Bureau of Standards or other international bodies to ensure an acceptable quality level. In addition, suppliers of NRL gloves were required to submit a laboratory report showing concentrations of latex-specific proteins. Glove suppliers that met the tender criteria were also required to submit a batch of the gloves that they intended to supply for confirmatory analysis of latex allergen levels. In these cases, the total allergen concentrations were <0.15 µg/g in three of the five NRL glove brands tested. One of them, brand F, had concentrations <0.15 µg/g in the first and second rounds of testing. Two other brands, tested in the second round only, also had concentrations <0.15 µg/g.

This study has demonstrated that detailed allergen analysis of gloves conventionally accepted for ‘safe’ use is an important means of reducing latex exposure. It is envisaged that this strategy will reduce

45

the risk of sensitisation and development of allergy in sensitised individuals, as previous studies have shown that using NRL gloves with a low allergen content reduces the concentrations of allergens and the number of new cases of allergy.[11] Various studies have also reported latex proteins to be higher in powdered than in nonpowdered gloves,[7,12] and in the present study the total allergen content of the four Hev b allergens was >0.15 µg/g in all the powdered gloves tested. This is a reason to recommend powder-free gloves.

Although substitution of powdered with powder-free latex gloves has been shown to reduce latex allergy and associated symptoms, cutaneous exposure remains a concern.[10] The benefit of NRL gloves can still be retained by purchasing low-allergen and powder-free gloves.[13] Since the current study did not show a correlation between total allergen content and price of gloves, it is clear that gloves with low concentrations of allergens can be purchased without increasing the costs to the procuring organisation.

Conclusion

The allergen content of different types of NRL gloves varies greatly.

This study demonstrated that a very small proportion of gloves tested (20%) had a total allergen content below the suggested threshold for low allergenicity. Identification of latex gloves with a low content of allergens can contribute towards minimising the risk of sensitisation and allergic reactions to latex. Ultimately, in all healthcare settings the health and wellbeing of staff who are required to wear gloves rests with the relevant purchasing authorities. The absence of a correlation between latex allergen content and price of gloves suggests that costeffective purchasing of non-powdered, low protein latex gloves is possible.

January 2015, Vol. 105, No. 1

RESEARCH

References 1. Rego A, Roley L. In-use barrier integrity of gloves: Latex and nitrile superior to vinyl. Am J Infect Control 1999;27(5):405-410. [http://dx.doi.org/10.1016/S0196-6553(99)70006-4] 2. Cohen DE, Scheman A, Stewart L, et al. American Academy of Dermatologyâ&#x20AC;&#x2122;s position paper on latex allergy. J Am Acad Dermatol 1998;39(1):98-106. [http://dx.doi.org/10.1016/S0190-9622(98)70406-2] 3. Reddy S. Latex allergy. Am Fam Physician 1998;57(1):93-102.

4. Palosuo T, Alenius H, Turjanmaa K. Quantitation of latex allergens: Methods. 2002;27(1):52-58. [http:// dx.doi.org/10.1016/S1046-2023(02)00051-8] 5. Wagner S, Breiteneder H. Hevea brasiliensis latex allergens: Current panel and clinical relevance. Int Arch Allergy Immunol 2005;136(1):90-97. [http://dx.doi.org/10.1159/000082938] 6. Palosuo T, Reinikka-Railo H, Kautiainen H, et al. Latex allergy: The sum quantity of four major allergens shows the allergenic potential of medical gloves. Allergy 2007;62(7):781-786. [http://dx.doi. org/10.1111/j.1398-9995.2007.01411.x] 7. Mabe DO, Singh TS, Bello B, Jeebhay MF, Lopata AL, Wadee A. Allergenicity of latex rubber products used in South African dental schools. S Afr Med J 2009;99(9):672-674.

8. Tarlo SM, Easty A, Eubanks K, et al. Outcomes of a natural rubber latex control program in an Ontario teaching hospital. J Allergy Clin Immunol 2001;108(4):628-633. [http://dx.doi.org/10.1067/ mai.2001.118792]

46

9. Jackson EM, Arnette JA, Martin ML, Tahir WM, Frost-Arner L, Edlich RF. A global inventory of hospitals using powder-free gloves: A search for principled medical leadership. J Emerg Med 2000;18(2):241-246. [http://dx.doi.org/10.1016/S0736-4679(99)00202-4] 10. Hayes BB, Afshari A, Millecchia L, Willard PA, Povoski SP, Meade BJ. Evaluation of percutaneous penetration of natural rubber latex proteins. Toxicol Sci 2000;56(2):262-270. [http://dx.doi. org/10.1093/toxsci/56.2.262] 11. Hunt LW, Kelkar P, Reed CE, Yunginger JW. Management of occupational allergy to natural rubber latex in a medical center: The importance of quantitative latex allergen measurement and objective followup. J Allergy Clin Immunol 2002;110(2 Suppl):S96-S106. [http://dx.doi.org/10.1067/mai.2002.125442] 12. Koh D, Ng V, Leow YH, Goh CL. A study of natural rubber latex allergens in gloves used by healthcare workers in Singapore. Br J Dermatol 2005;153(5):954-959. [http://dx.doi.org/10.1111/j.13652133.2005.06820.x] 13. Palosuo T, Antoniadou I, Gottrup F, Phillips P. Latex medical gloves: Time for a reappraisal. Int Arch Allergy Immunol 2011;156(3):234-246. [http://dx.doi.org/10.1159/000323892]

Accepted 15 July 2014.

January 2015, Vol. 105, No. 1

RESEARCH

Severe blunt thoracic trauma: Differences between adults and children in a level I trauma centre D L Skinner,1 MB ChB, FCS (SA), MMed; D den Hollander,2 MB ChB, FCS (SA), Cert Trauma (SA), MPhil; G L Laing,2 MB ChB, FCS (SA), Cert Trauma (SA); R N Rodseth,1,3 MB ChB, FCA (SA), MMed, Cert Crit Care (SA), MSc, PhD; D J J Muckart,2,4 FRCS, MMedSc, FCCM (SA), ACS (SA) epartment of Anaesthetics and Critical Care, Nelson R Mandela School of Medicine, College of Health Sciences, University of KwaZulu-Natal, D Durban, South Africa 2 Department of Surgery, Nelson R Mandela School of Medicine, College of Health Sciences, University of KwaZulu-Natal, Durban, South Africa 3 Population Health Research Institute, Hamilton, Canada, and Department of Outcomes Research, Cleveland Clinic, Cleveland, Ohio, USA 4 Department of Trauma Surgery: Level I Trauma Unit and Trauma Intensive Care, Inkosi Albert Luthuli Central Hospital, Durban, South Africa 1

Corresponding author: D L Skinner (drdavidskinner@gmail.com) Background. Trauma is a leading cause of death in the developing world. Blunt thoracic trauma represents a major burden of disease in both adults and children. Few studies have investigated the differences between these two patient groups.

Objective. To compare mechanism of injury, presentation, management and outcome in children and adults with blunt thoracic trauma.

Methods. Patients were identified from the database of the trauma intensive care unit at Inkosi Albert Luthuli Central Hospital, Durban, South Africa. Demographics and relevant data were extracted from a pre-existing database.

Results. Of 415 patients admitted to the unit, 331 (79.7%) were adults and 84 (20.2%) children aged <18 years. The median injury severity score (ISS) was similar for both age groups (32 v. 34; p=0.812). Adults had a higher lactate level at presentation (3.94 v. 2.60 mmol/L; p=0.001). Of the children, 96.4% were injured in motor vehicle collisions, 75.0% as pedestrians. Compared with adults, children had significantly fewer rib fractures (20.2% v. 42.0%; p<0.001), flail chests (2.4% v. 26.3%; p<0.001) and blunt cardiac injuries (BCIs) (9.5% v.

23.6%; p=0.004), but sustained more lung contusions (79.8% v. 65.6%; p=0.013). Mortality in children was significantly lower than in adults (16.7% v. 27.8%; p=0.037).

Conclusion. Thoracic injuries in children are the result of pedestrian collisions more often than in adults. They suffer fewer rib fractures and BCIs, but more lung contusions. Despite similar ISSs, children have significantly lower mortality than adults. More effort needs to be concentrated on child safety and preventing pedestrian injury.

S Afr Med J 2015;105(1):47-51. DOI:10.7196/SAMJ.8499

Trauma is a leading cause of death in the developing world, and represents a major burden of disease in South Africa (SA).[1,2] Children are disproportionately affected.[3] Blunt trauma secondary to motor vehicle collisions (MVCs) contributes to the majority of admissions to trauma centres.[4] Significant blunt thoracic trauma in both adults and children requires advanced imaging and critical care support that places strain on a resource-limited healthcare system.

Paediatric trauma from MVCs is often multisystem, with a high incidence of thoracic involvement.[5] Paediatric blunt thoracic trauma presents difficulties in both diagnosis and management owing to differences in anatomy.[6] Initial investigations may not reveal significant axial skeletal damage despite high energy transfer and resultant lung contusion, because of the elastic nature of the childâ&#x20AC;&#x2122;s chest wall. Associated injuries such as rib and sternal fractures are thought to occur less commonly in the paediatric population.

Importantly, their absence does not indicate lesser severity of injury.

Few articles have investigated the differences in injury pattern between adult and paediatric populations.[6-11] We aimed to review and contrast the incidence and outcome of blunt thoracic trauma among adults and children in a single level I trauma centre over a 6-year period.

Methods

We conducted a retrospective observational study of patients admit­ ted to the trauma intensive care unit (TICU) at Inkosi Albert Luthuli Central Hospital (IALCH), Durban, KwaZulu-Natal Province, SA,

47

from March 2007 to March 2013. This 10-bed unit admits critically injured patients and serves a drainage area with a population of approximately 11 million. Admissions are either directly from the scene of the incident, or inter-hospital transfers (IHTs) from a facility lacking the necessary imaging modalities or intensive care facilities to manage the patient. All patients who are admitted to the TICU are stabilised in a resuscitation area and any necessary imaging or surgical procedures are performed before admission to the unit.

We included all patients presenting to the unit with blunt chest trauma, either in isolation or as part of multiple system injury, irrespective of age. Children were defined as any patient <18 years of age. We excluded patients with penetrating thoracic injuries or blunt injury with no thoracic trauma, and those declared dead on arrival at the resuscitation area.

The trauma unit database and hospital information systems (Medicom and Soarian) were used to retrieve patient data for this analysis. We extracted: (i) patient demographics: age, gender, mechanism of injury, injury severity score (ISS) and site of referral (scene or IHT); (ii) initial lactate value; (iii) presence of rib fractures (single and multiple fractures were included), pulmonary contusion, flail segments, sternal fracture or blunt aortic injury; (iv) other system injuries, which were divided into head, face, spine, abdomen, limb (either single or multiple) and external; (v) length of stay in the TICU; and (vi) in-hospital mortality and cause of death.

A pulmonary contusion was defined as the presence of typical lung parenchymal changes on computed tomography (CT) with the presence

January 2015, Vol. 105, No. 1

RESEARCH

injuries not requiring mechanical ventilation received regional analgesia in the form of either a thoracic epidural or a paravertebral block.

The primary aim of this study was to examine the outcomes of critically ill patients with blunt thoracic trauma in terms of TICU mortality and length of stay in the unit. A secondary aim was to describe the types of thoracic trauma in both children and adults and to document their differences.

of hypoxaemia. A flail chest was defined as two or more rib fractures at two or more places; patients classified as having sustained a flail chest were not included in the rib fracture group.

Blunt cardiac injury (BCI) was defined as the presence of blunt thoracic trauma combined with an elevated serum troponin level; clinical findings of pericardial rupture, cardiac herniation or central tendon rupture; hypotension requiring inotropic support not explained by haemorrhagic, septic or neurogenic shock; and electrocardiographic (ECG) abnormalities or transthoracic echocardiography findings in keeping with BCI. ECG changes recorded included atrial or ventricular dysrhythmias, ST-segment elevation or depression, T-wave inversion or conduction abnor­malities. Echocardiography findings recorded included regional wall motion abnormalities, paradoxical septal wall motion, septal wall defects, pericardial collections, chordal or valve rupture, and aortic root dissection.

Patients were stabilised either in theatre or in the resuscitation unit before transfer to the TICU. The need for further imaging was evaluated in all patients and CT scans were performed for suspected great-vessel injury and to identify other system injuries, unless contraindicated. Analgesia was provided in the form of intravenous opiates or paracetamol. Patients with isolated thoracic

Statistics

Means (standard deviations (SDs)) are reported for normally distributed data, and medians and interquartile ranges (IQRs) for 120

Over the 6-year period, 415 patients were admitted with blunt thoracic trauma. Of these 84 were children, of whom 55 were <10 years of age (Fig. 1). While males predominated overall, there were fewer males in the paediatric group. ISSs were similar in the paediatric and adult groups (median 34 (IQR 25 - 41) v. 32 (24 - 41);

107

75

80 Patients, n

Results

94

100

60

data not normally distributed. Ranges are reported for all ages. The χ2 test or Fisher’s exact test were used for categorical data, and Student’s t-test and the Mann-Whitney U-test for continuous data where appropriate. A p-value of <0.05 was considered significant.

55 39

40

22

15

20 0

0-9

10 - 19

20 - 29

30 - 39

40 - 49

50 - 59

60 - 69

4

4

70 - 79

80 - 89

Age, deciles

Fig. 1. Age distribution of all patients.

Table 1. The demographics of patients admitted to the TICU with blunt chest trauma, 2007 - 2013 Demographics

Total population

Adult (≥18 years)

Paediatric (<18 years)

Patients, n (%)

N=415

331 (79.8)

84 (20.2)

Age (years), mean (SD), range

30.2 (16.2), 2 - 84

36.6 (12.9), 18 - 84

8.40 (4.1), 2 - 17

p-value

Male gender, n (%)

N=293

244 (73.7)

49 (58.3)

0.007*

ISS, median (IQR)

32 (24 - 41)

32 (24 - 41)

34 (25 - 41)

0.812

Referral from scene, n (%)

105 (25.3)

86 (26.0)

19 (22.6)

0.576

Presentation lactate level (mmol/L), mean (SD)

3.67 (3.36)

3.94 (3.6)

2.60 (2.1)

0.001*

TICU = trauma intensive care unit; SD = standard deviation; ISS = injury severity score; IQR = interquartile range. *p<0.05.

Table 2. Mechanism of injury Mechanism, n (%)

Total population (N=415

Adult (≥18 years) (n=331)

Paediatric (<18 years) (n=84)

p-value

MVC pedestrian

187 (45.1)

124 (37.5)

63 (75.0)

<0.001*

MVC passenger

117 (28.2)

100 (30.2)

17 (20.2)

0.078

MVC driver

72 (17.4)

71 (21.5)

1 (1.2)

<0.001*

Structure collapse/blunt trauma NOS

17 (4.1)

15 (4.5)

2 (2.4)

0.542

Motorcycle

12 (2.9)

12 (3.6)

0 (0)

0.136

Fall

10 (2.4)

9 (2.7)

1 (1.2)

0.694

MVC = motor vehicle collision; NOS = not otherwise specified. *p<0.05.

48

January 2015, Vol. 105, No. 1

RESEARCH

p=0.812), although the mean (SD) lactate level at presentation was significantly lower in the paediatric population (2.60 (2.06) v.

3.94 (3.57); p=0.001) (Table 1).

The commonest mechanism of injury was an MVC, accounting for 93.5% of admissions.

The majority of children (75.0%) were injured in pedestrian MVCs. Not surprisingly, there were significantly more adults in the MVC driver category. Very few patients had injuries from structure collapse, assaults, motorcycle accidents or falls (Table 2).

The thoracic injuries seen across the whole group consisted predominantly of pulmonary contusions (68.4%), rib fractures (38.1%) and a surprisingly high number of flail chests (21.4%) and BCIs (20.7%). Sternal fracture was uncommon, with an incidence of 3.1%. Only one child (1.2%) sustained a blunt thoracic aortic injury, which required repair under bypass by the cardiothoracic surgical service (Figs 2 and 3). The incidence of pulmonary contusion was highest in the paediatric

group, while rib fractures, flail chests and BCIs predominated in the adult group (Table 3).

Among the patients with multiple system injuries, head injuries predominated in the paediatric group (61.9% v. 42.3%; p<0.001), while spinal injuries predominated in the adult group (20.2% v. 2.9%; p<0.001) (Table 4). Only 31 patients were admitted with isolated thoracic trauma, the majority of patients sustaining injury to two or more systems (Table 5).

The overall mortality rate was 25.5%, but the rate was significantly lower in the paediatric group than in the adult group (16.7% v. 27.8%; p=0.037). Length of stay in the TICU was similar in the two groups, with no statistically significant difference (Table 6). There was a significantly higher number of deaths from traumatic brain injury in the paediatric group (42.9 v. 15.2%; p=0.024).

There were no significant differences in deaths from thoracic or septic complications between adults and children.

Discussion

Fig. 2. CT scan, coronal view, showing rupture of the descending aorta in an 11-year-old child. (CT = computed tomography.)

Fig. 3. CT scan, sagittal view, showing rupture of the descending aorta in the same child. (CT = computed tomography.)

Death and disability from trauma in SA is endemic and has been termed the ‘malignant epidemic’ in previous publications.[1,2] SA has a road traffic accident mortality rate of 10.39/100 000 people, according to a study done from 2001 to 2006, with the

Table 3. Spectrum of thoracic injuries in blunt thoracic trauma Injury, n (%)

Total population (N=415)

Adult (≥18 years) (n=331)

Paediatric (<18 years) (n=84)

p-value

Rib fractures

158 (38.1)

141 (42.0)

17 (20.2)

<0.001*

Flail chest

89 (21.4)

87 (26.3)

2 (2.4)

<0.001*

Blunt aortic injury

16 (3.9)

15 (4.5)

1 (1.2)

0.212

Sternal fracture

13 (3.1)

13 (3.9)

0 (0)

0.080

Blunt cardiac injury

86 (20.7)

78 (23.6)

8 (9.5)

0.004*

Pulmonary contusion

284 (68.4)

217 (65.6)

67 (79.8)

0.013*

Adult (≥18 years) (n=331)

Paediatric (<18 years) (n=84)

p-value

Numbers add up to > total population owing to multiple thoracic injuries per patient. *p<0.05.

Table 4. Body regions injured other than thorax Body region, n (%)

Total population (N=415

Head

192 (46.8)

140 (42.3)

52 (61.9)

0.001*

Face

61 (14.7)

50 (15.1)

11 (13.1)

0.732

Abdomen

137 (33.0)

104 (31.4)

33 (39.3)

0.194

Limb(s)

266 (64.1)

218 (65.9)

48 (57.1)

0.161

Spine

69 (16.6)

67 (20.2)

2 (2.4)

<0.001*

External

54 (13.0)

40 (12.1)

14 (16.7)

0.277

Numbers add up to > total population owing to multiple system injury. *p<0.05.

49

January 2015, Vol. 105, No. 1

RESEARCH

Table 5. Number of body regions injured in addition to thoracic injury Body regions (N), n (%)

Total population (N=415)

Adult (≥18 years) (n=331)

Paediatric (<18 years) (n=84)

p-value

0 – isolated chest

31 (7.5)

24 (7.3)

7 (8.3)

0.816

1

118 (28.4)

96 (29.0)

22 (26.2)

0.685

2

153 (36.9)

123 (37.2)

30 (35.7)

0.899

3

95 (22.9)

73 (22.1)

22 (26.2)

0.467

4

17 (4.1)

14 (4.2)

3 (3.6)

1.000

5

1 (0.2)

1 (0.30)

0 (0)

1.000

Table 6. Outcomes of patients with blunt thoracic injury Outcome

Total population (N=415)

Adult (≥18 years) (n=331)

Paediatric (<18 years) (n=84)

p-value

Overall mortality, n (%)

106 (25.5)

92 (27.8)

14 (16.7)

0.037*

Length of stay, median (IQR)

11 (6 - 16)

11 (6 - 19)

12 (6 - 19)

0.400

IQR = interquartile range. *p<0.05.

peak occurring among young males aged 35 - 49 years. A significant number of children are injured by MVCs: 3.89/100 000 in the 0 - 14-year age group, rising to 9.33/100 000 in the 15 - 24 age group.[12] Paediatric trauma has been referred to as ‘the neglected childhood killer disease’, having significant social, economic and health system impact.[13] In our study, the vast majority of adults and children sustained complex multiple system trauma during MVCs, isolated blunt thoracic trauma being rare. The facilities required to manage such patients are scarce in a resource-constrained healthcare system.

Paediatric trauma from pedestrian MVCs is highly preventable.

This study highlights the ongoing challenges faced by emergency care personnel in SA. These include dealing with the high incidence of paediatric trauma, in the face of a relative lack of resources designated specifically for injured children.

Shortages in staffing, combined with the high workload experienced in many SA emergency departments, place a great burden on personnel involved in paediatric trauma care. This burden is further exacerbated by the psychological and emotional impact of dealing with severely injured children on a regular basis.

Blunt thoracic trauma has rarely been studied in the paediatric population.[6-11] Injury patterns are thought to differ between adults and children.[14,15] Our study indeed shows that children are far more likely than adults to sustain head injury together with their thoracic trauma. This finding is probably explained by the proportionally

Fig. 4. Supine chest radiograph of a 7-year-old child with blunt thoracic trauma on admission to the TICU. (TICU = trauma intensive care unit.)

larger head/thoracic ratio in children and their higher incidence of injury in pedestrian MVCs. Children travelling as passengers also remain a vulnerable group: in a recent study, Van Hoving et al.[16] showed a very low rate of seatbelt use among child passengers in the Cape Town metropole, with compliance as low as 14.4%.

BCI in children is relatively under­ diagnosed, owing to difficulties in diagnosis and a lack of clinical suspicion.[17,18] We applied clinically relevant criteria to the diagnosis of BCI and found a surprisingly high incidence of 9.5%. This highlights the need for a high index of suspicion for BCI in children with blunt thoracic injuries and other potentially distracting injuries.

The long-term sequelae of this injury remain a subject for further investigation.

50

January 2015, Vol. 105, No. 1

Fig. 5. Axial chest CT scan of the same 7-yearold child, showing extensive bilateral pulmonary contusions and a small anterior pneumothorax not evident on the supine chest radiograph. (CT = computed tomography.)

Blunt vascular injuries are believed to be uncommon in children, as we found in our patients, but are potentially life threatening.

Pulmonary contusions are similarly notoriously difficult to diagnose. The increased skeletal compliance and absence of rib fractures can make this diagnosis in children particularly difficult. Conventional X-ray imaging can be misleading and the severity of lung contusion unappreciated, especially immediately after the injury, as shown in Figs 4 and 5. In our study, the paediatric group had fewer rib fractures (20.2%) and flail chests (2.4%) than the adult group, but had a far higher incidence of pulmonary contusion (79.8% v. 65.6%; p=0.013). This emphasises the fact that absence of rib fractures in injured children does not signal absence of underlying lung contusion, in keeping with other authors’ experience.[7]

RESEARCH

There was a significantly lower mortality rate in the paediatric group (16.7% v. 27.8%; p=0.037), despite ISSs in the two groups being similar. This lower mortality contrasts with other authors’ experience. Allen et al.[18] found no difference in mortality between adult and paediatric patients. The overall mortality in the paediatric group of 16.7% is in keeping with other studies of paediatric thoracic trauma.[6-9] Although there was no difference in referral types (i.e. referral from the scene, with little or no resuscitation initiated, or IHT, with prior stabilisation), there was a significantly lower baseline lactate level in the paediatric group. Children have a greater ability to compensate for trauma-related shock than adults, with hypotension appearing as a late sign of hypovolaemic shock.[20] The difference in lactate levels between the adult and paediatric groups is not easily explained, as the two groups had similar injury severity. Discrepancies in lactate production between children and adults following trauma have not been adequately investigated or reported in the literature, and further research is needed to examine whether this difference is a result of differing compensatory mechanisms in shock.

A review of the activity of the Johannesburg Hospital Trauma Unit conducted over a 17-year period from 1985 to 2001 revealed an increase in the volume of paediatric trauma, the majority of injuries in the 5 - 14-year age group occurring in pedestrian MVCs.[2] This is replicated in our experience, with 13.2% of our patients having been under the age of 10 years. Further efforts by government programmes and non-governmental organisations to raise awareness of child safety among parents and older children are urgently required.

Study limitations

The study was performed in a single centre that serves a large heterogeneous population. Patients admitted to the TICU are often severely injured, thus skewing the overall profile of the patients towards those with more severe injuries.

The referral vascular surgery service in KwaZulu-Natal is situated in the same hospital (IALCH) as the TICU, and as a number of patients with aortic injuries were referred specifically for investigation and treatment by IALCH’s vascular team, the number of patients seen with aortic injury may have been increased.

Conclusion

The burden of adult and paediatric trauma in SA remains unaccep­ tably high. Thoracic injuries are the result of pedestrian collisions more often in children than in adults. Children suffer fewer rib

51

fractures and less blunt cardiac injury, but more lung contusions.

Children’s thoracic injuries are more often associated with head injuries and less often with spine injuries than is the case in adults. Children have a significantly lower mortality than adults, despite similar ISSs. Notably, the majority of paediatric deaths were secondary to traumatic brain injury rather than thoracic injury.

More effort needs to be concentrated on injury prevention and child safety, especially road safety and pedestrian supervision.

References 1. Muckart DJ. Trauma – the malignant epidemic. S Afr Med J 1991;79(2):93-95.

2. Bowley DM, Khavandi A, Boffard KD, et al. The malignant epidemic – changing patterns of trauma. S Afr Med J 2002;92(10):798-802.

3. Van As AB. Paediatric trauma care. African Journal of Paediatric Surgery 2010;7(3):129-133. [http:// dx.doi.org/10.4103/0189-6725.70409] 4. Veysi VT, Nikolaou VS, Paliobeis C, Efstathopoulos N, Giannoudis PV. Prevalence of chest trauma, associated injuries and mortality: A level I trauma centre experience. Int Orthop 2009;33(5):14251433. [http://dx.doi.org/10.1007/s00264-009-0746-9] 5. Tovar JA, Vazquez JJ. Management of chest trauma in children. Paediatr Respir Rev 2013;14(2):86-91. [http://dx.doi.org/10.1016/j.prrv.2013.02.011] 6. Nakayama DK, Ramenofsky ML, Rowe MI. Chest injuries in childhood. Ann Surg 1989;210(6):770775. [http://dx.doi.org/10.1097/00000658-198912000-00013] 7. Ismail MF, al-Refaie RI. Chest trauma in children, single center experience. Arch Bronconeumol 2012;48(10):362-366. [http://dx.doi.org/10.1016/j.arbr.2012.07.007] 8. Balci AE, Kazez A, Eren S, Ayan E, Ozalp K, Eren MN. Blunt thoracic trauma in children: Review of 137 cases. Eur J Cardiothorac Surg 2004;26(2):387-392. [http://dx.doi.org/10.1016/j.ejcts.2004.04.024] 9. Rielly JP, Brandt ML, Mattox KL, Pokorny WJ. Thoracic trauma in children. J Trauma 1993;34(3):329331. [http://dx.doi.org/10.1097/00005373-199303000-00003] 10. Roux P, Fisher RM. Chest injuries in children: An analysis of 100 cases of blunt chest trauma from motor vehicle accidents. J Pediatr Surg 1992;27(5):551-555. [http://dx.doi.org/10.1016/00223468(92)90443-B] 11. Peclet MH, Newman KD, Eichelberger MR, Gotschall CS, Garcia VF, Bowman LM. Thoracic trauma in children: An indicator of increased mortality. J Pediatr Surg 1990;25(9):961-965; discussion 5-6. [http://dx.doi.org/10.1016/0022-3468(90)90238-5] 12. Road Traffic Accident Deaths in South Africa, 2001-2006: Evidence from Death Notification. Statistics South Africa, 2009.

13. Van As AB, Millar AJ. From the pursuit of excellence to the quest for significance: Promotion of a Childsafe South Africa. S Afr Med J 2012;102(6):427-428.

14. Liman ST, Kuzucu A, Tastepe AI, Ulasan GN, Topcu S. Chest injury due to blunt trauma. Eur J Cardiothorac Surg 2003;23(3):374-378. [http://dx.doi.org/10.1016/s1010-7940(02)00813-8] 15. Tovar JA. The lung and pediatric trauma. Semin Pediatr Surg 2008;17(1):53-59. [http://dx.doi. org/10.1053/j.sempedsurg.2007.10.008] 16. Van Hoving DJ, Sinclair M, Wallis LA. Patterns of seatbelt use in different socioeconomic communities in the Cape Town metropole, South Africa. S Afr Med J 2013;103(9):628-631. [http://dx.doi. org/10.7196/SAMJ.7126] 17. Clancy K, Velopulos C, Bilaniuk JW, et al. Screening for blunt cardiac injury: An Eastern Association for the Surgery of Trauma practice management guideline. J Trauma Acute Care Surg 2012;73(5 Suppl 4):S301-S306. [http://dx.doi.org/10.1097/TA.0b013e318270193a] 18. Dowd MD, Krug S. Pediatric blunt cardiac injury: Epidemiology, clinical features, and diagnosis.

Pediatric Emergency Medicine Collaborative Research Committee: Working Group on Blunt Cardiac Injury. J Trauma 1996;40(1):61-67. [http://dx.doi.org/10.1097/00005373-199601000-00012] 19. Allen GS, Cox CS Jr, Moore FA, Duke JH, Andrassy RJ. Pulmonary contusion: Are children different? J Am Coll Surg 1997;185(3):229-333. [http://dx.doi.org/10.1016/S1072-7515(97)00022-7] 20. Kleinman ME, Chameides L, Schexnayder SM, et al. 2010 American Heart Association Guidelines for Cardiopulmonary Resuscitation and Emergency Cardiovascular Care: Part 14: Pediatric Advanced Life Support. Circulation 2010;122:S876-S908. [http://dx.doi.org/10.1161/ CIRCULATIONAHA.110.971101]

Accepted 10 November 2014.

January 2015, Vol. 105, No. 1

RESEARCH

Mapping South African public health research (1975 - 2014) B Poreau, MD, PhD Institut Santé Publique – Relations Internationales (Public Health – International Studies Institute), Rue E Pons, 69004, Lyons, France Corresponding author: B Poreau (poreau_brice@yahoo.fr)

Background. Since 1994, South Africa (SA) has faced up to the challenge of building a strong economy, to which public health provides an important underpinning.

Objectives. To map the scientific research in public health in SA after the end of apartheid and to present the links between the different financing/funding systems.

Methods. Bibliographic analyses utilising the Web of Science of papers published during the period 1975 - 2014, analyses of journals, most cited articles, authors, publication years, organisations, funding agencies, countries and keywords, and mapping of the relations between countries involved in public health research and of the Web of Science Categories using VOSviewer.

Results. I accessed 2 246 articles published between 1975 and 2014, the majority of which were published after 2007. The main countries of research were the USA, SA, Switzerland and the UK, representing the main network collaborations. The relevant keywords were HIV, woman, child, program/programme, rural, tuberculosis, district and sex.

Conclusions. Public health research in SA reached a high level 16 years after the end of apartheid. The chief field that emerged was the spread of HIV, including mother-to-child transmission, and the policies applied to all districts of SA, through a network of institutions between the USA and SA. S Afr Med J 2015;105(1):52-55. DOI:10.7196/SAMJ.8866

Since 1994 and the dawn of democracy in South Africa (SA), the country has made significant efforts to build one of the strongest econ­omies in Africa. Development of the national health system, the foundation of which is the primary healthcare approach, has been a major goal[1] aimed at the needs of the population.[2] Public health covers the fields of infectious disease, parasitology, mental health, and organisation and financing of health facilities.

After 2007, the World Health Organi­zation (WHO) presented several programmes on public health in SA.[1] The main objectives of the 2008 - 2013 co-operation strategy were the fight against HIV, tuberculosis (TB) and malaria, the fight against motherto-child transmission (MTCT) of HIV,[1] corresponding to Millennium Development Goals (MDGs) 4 - 6, the need to strengthen health policies and to prevent and reduce disease, disability and premature death from non-communicable diseases, and the strengthening of surveillance systems.

The aim of this article is to analyse scientific publications on public health from SA during the period 1975 - 2014, in the context of the social situation in the country.

Methods

The Science Citation Index-Expanded (SCIE) database, accessed through the Web of Science platform from Thomson Reuters, was used. In the advanced search,

the articles were obtained using this formula: TS=(public health AND South Africa) for the period 1975 - 2014. Each record was verified to ensure its relevance. This aim was to analyse differences before and after 1994.

There were no restrictions regarding the document types.

The ‘analysis results’ function of the Web of Science was then performed. Journals, most cited articles, authors, countries, funding agencies, organisations, publication years and Web of Science Categories were extracted.

To evaluate the research networks between countries, after analysis by country, the records of each country were viewed and then the analysis was performed a second time in order to understand the links between the chosen country and the other countries. The mapping diagram was then developed.

To analyse the Web of Science Cate­ gories, the data were exported into a file ‘analyze.txt’. This file can be read by the programme wc10.exe. It generated mapfiles for VOSviewer.[3] Finally, several keyword (KW) researches were performed to find the main relevant topics. These analyses were to compare with former bibliometric studies in other fields.[3-5]

Results

I obtained 2 246 records. There were 30 publications before 1994, but 1 686/2 246 (72%) after 2007 (Table 1).

The three authors with most records were Karl Peltzer, Alan Flisher and Diane

52

January 2015, Vol. 105, No. 1

Table 1. Records per year from 1987 to 2014 (72% of publications were after 2007) Publication years

Records, n

1987

1

1991

6

1992

12

1993

11

1994

11

1995

14

1996

16

1997

28

1998

40

1999

34

2000

35

2001

43

2002

48

2003

39

2004

63

2005

75

2006

84

2007

131

2008

154

2009

177

2010

225

2011

263

2012

297

2013

315

2014

124

RESEARCH

McIntyre, all three of whom were attached to SA academic institutions. The main journals were the South African Medical Journal (146/2 246), AIDS (89/2 246), BMC Public Health (64/2 246), PLoS One (50/2 246), Tropical Medicine and International Health (37/2 246) and the Bulletin of the World Health Organization (36/2 246).

The main research funding agencies were Wellcome Trust (UK, 55 records), the National Institutes of Health (USA, 37 records) and the National Research Foundation of South Africa (SA, 28 records) (Table 2). The UK, the USA and the European Union, as well as SA, are involved in financing public health research in SA. The three most represented institutions in SA were the University of Cape Town (362/2 246), the University of the Witwatersrand (264/2 246) and the University of KwaZuluNatal (152/2 246).

The ten main countries involved were SA (1 246/2 246), the USA (669/2 246), the UK (395/2 246), Switzerland (130/2 246), Australia (101/2 246), Canada (94/2 246), France (93/2 246), Belgium (81/2 246), the Netherlands (69/2 246) and Kenya (55/2 246).

The networks between the main countries were mapped (Fig. 1). The scientific network concerning SA public health research, with the main countries involved, is described.

The main arrow/link is between SA and the USA (with 236 records of 1 246 linked to SA) as the most important collaboration.

The second most important collaboration is between SA and the UK (186/1 246). Finally, the diagram illustrates three other important networks: SA-Switzerland (51/1 246), SA-Australia (48/1 246) and SA-Belgium (50/1 246).

Keyword analysis revealed the terms HIV (907/2 246 records), programme(s) and program(s) (638/2 246 records), woman (women) (466/2 246), child(ren) (438/2 246), rural (360/2 246), tuberc­ ulosis (269/2 246), district (209/2 246), sex (187/2 246), environment (131/ 2 246), malaria (121/2 246), mental health (118/2 246 records) and violence (102/2 246).

Finally, VOSviewer was used to map the Web of Science Categories (Fig. 2). The most important categories were Public, Environmental and Occupational Health, Infectious Diseases and Social Sciences Biomedical.

Discussion

According to my analysis, the majority of public health studies were undertaken in the post-apartheid era,[6-7] very few having been published before 1994. At the end of the 1990s and in the first years of the 2000s, the themes were those found in this survey.

USA

Netherlands UK

South Africa Canada

Belgium

Kenya

Switzerland

Australia

France

Fig. 1. Scientific networks in South African public health research and the main countries involved.

Fig. 2. Web of Science Categories mapped with VOSviewer. The most important categories are Public Environmental Occupational, Infectious Diseases and Social Sciences Biomedical.

Table 2. Funding agencies* Funding agencies

Records, n

Wellcome Trust

55

National Institutes of Health

37

National Research Foundation

28

Bill and Melinda Gates Foundation

28

Medical Research Council of South Africa

15

European Commission

11

Department of Health in South Africa

10

European Union

10

National Institute of Mental Health

10 Continued ...

53

January 2015, Vol. 105, No. 1

RESEARCH

Table 2. (continued) Funding agencies* Funding agencies

Records, n

National Research Foundation South Africa

10

World Health Organization

10

WHO

9

Canadian Institutes of Health Research

8

National Institute of Allergy and Infectious Diseases

8

USAID

8

Atlantic Philanthropies

7

GlaxoSmithKline

7

Medical Research Council South Africa

7

South African Department of Health

7

United States Agency for International Development

7

United States Agency for International Development USAID

7

University of the Witwatersrand

7

US National Institutes of Health

7

Water Research Commission WRC of South Africa

7

Doris Duke Charitable Foundation

6

Fogarty International Center

6

Fogarty International Center National Institutes of Health

6

Irish Aid

6

National Institutes of Health NIH

6

National Research Foundation NRF

6

National Research Foundation NRF of South Africa

6

United States National Institute on Aging

6

Bristol Myers Squibb

5

CDC

5

Centers for Disease Control and Prevention

5

Education Trust Fund of Nigeria

5

FAS

5

National Department of Health

5

Stellenbosch University

5

Swedish Council for Working Life and Social Research

5

Swiss National Science Foundation

5

UK Medical Research Council

5

University of Fort Hare

5

Wellcome Trust London UK

5

Andrew W Mellon Foundation

4

AUSAID

4

CNPQ

4

Department for International Development

4

Human Sciences Research Council South Africa

4

International Development and Research Centre

4

International Development Research Centre

4

John D and Catherine T MacArthur Foundation

4

National Institute of Allergy and Infectious Diseases NIAID

4

National Institute of Mental Health NIMH

4 Continued ...

54

January 2015, Vol. 105, No. 1

HIV was prevalent in SA public health policy,[8] and furthermore corresponded to MDG 6 (combat HIV/AIDS, malaria and other diseases).

The WHO focused on five objectives in SA in order to promote the MDGs.[1] In this context, the main topics in this analysis were HIV, malaria, TB and mental health. This WHO emphasis in 2008 - 2013 corresponded to an increase in relevant public health publications (Table 1). The major collaboration was between the USA and SA (Fig. 1), while national public health policies were also significant. The National Department of Health (NDoH) developed the Negotiated Service Delivery Agreement 2010 - 2014,[2] with four main objectives: increased life expectancy; reduction in maternal and child mortality rates (corresponding to MDGs 4 and 5); combating HIV and AIDS and decreasing the burden of disease from TB (corresponding to MDG 6); and strengthening health system effectiveness.

The involvement of the NDoH, and more generally the other government departments in the realm of public health, was greater than similar involvement in other African countries.[9] This corresponds with the results of my analysis: the three most represented organisations, as well as the three authors most cited, were South African. Moreover, the National Research Foundation of South Africa was a major funding agency (Table 2).

This analysis demonstrated that the main field of public health concerned HIV spread and MTCT, so that new programmes were developed to address this trans足mission.[8] I suggest that other public health issues, such as those in the field of mental health, might have been better represented. I noticed that the Mental Health Care Act No. 17 of 2002[2] aimed to provide a legal framework for mental health and in particular the management of patients in mental health institutions, with emphasis on human rights.

This Act corresponded to an increase in publications on mental health and raised questions about the mental health structures in SA.[10-11] Finally, the Web of Science Category Public, Environmental and Occupational Health was dominant, [11] with national policies correctly having had this focus (Fig. 2), reflecting the reality that SA remains an unequal society, with a Gini coefficient of 0.65 in 2011.[2]

Study limitations

The SCIE database provided the means for me to undertake this study. I acknow足 ledge the limitation that, as a consequence, only publications appearing in this

RESEARCH

Table 2. (continued) Funding agencies* Funding agencies

Records, n

National Science Foundation North West University

4

PEPFAR

4

Pfizer

4

Research Foundation Flanders

4

Rockefeller Foundation

4

SIDA

4

US National Institutes of Health

4

UK Department for International Development

4

University of Cape Town

4

University of Michigan

4

US Centers for Disease Control and Prevention

4

US Department of Health and Human Services DHHS

4

Andrew W Mellon Foundation USA

3

Bank Netherlands Program Partnership

3

Boehringer Ingelheim

3

Canadian International Development Agency

3

Department for International Development DFID

3

Directorate General for Development Cooperation DGDC through the Flemish Interuniversity Council VLIR UOS

3

European Developing Countries Clinical Trial Partnership Senior Fellowship Award

3

Ford Foundation

3

Gilead Sciences

3

GlaxoSmithKline Biologicals

3

Health Canada

3

Health Economics and AIDS Research Division Heard at the University of KwaZulu-Natal

3

Human Sciences Research Council

3

International Development Research Centre of Canada

3

Medical Research Council

3

Merck

3

MRC UK

3

National Health Laboratory Service Research Trust

3

National Institute of Allergy and Infectious Disease NIAID

3

National Institute on Drug Abuse

3

Pan American Health Organization

3

Pfizer Foundation

3

Poliomyelitis Research Foundation

3

President S Emergency Plan PEPFAR

3

Public Health Agency of Canada

3

Research Committee of The World Bank

3

SA National Research Foundation

3

Sanofi Pasteur

3

FAS = Forskningsrådet för arbetsliv och socialvetenskap (Swedish Council for Social and Work Life Research); AUSAID = Australian Agency for International Development; CNPQ = Conselho Nacional de Desenvolvimento Científico e Tecnológico (Brazilian Council for Scientific and Technological Development); PEPFAR = US President’s Emergency Plan for AIDS Relief; SIDA = Swedish International Development Cooperation Agency; VLIR UOS = Vlaamse Interuniversitaire Raad – Universitaire Ontwikkelingssamenwerking (Flemish Inter-university Council – University Cooperation Development). *Names of agencies are exactly as they appear in the records.

55

January 2015, Vol. 105, No. 1

database were used. It is therefore possible that participation of other countries, especially African countries, may have been underestimated in SA public health research.

Other national databases could be used to develop the public health research links between SA and other African countries.

References 1. World Health Organization. WHO Country Cooperation Strategy 2008-2013. South Africa: WHO, 2009.

2. Department of Health. South Africa. Annual Report 2011-2012.

2012. http://www.health.gov.za/docs/annual_reports/2012/ annualreport.pdf (accessed 16 November 2014).

3. Leydesdorff L, Carley S, Rafols I. Global maps of science based on the new Web-of-Science Categories. Scientometrics 2013;94(2):589-593. [http://dx.doi.org/10.1007/s11192-012-0784-8] 4. Law J, Whittaker J. Mapping acidification research: A test of the co-word method. Scientometrics 1992;23(3):417461. [http:// dx.doi.org/10.1007/BF02029807] 5. Chiu WT, Huang JS, Ho YS. Bibliometric analysis of severe acute respiratory syndrome related research in the beginning stage.

Scientometrics 2004;61(1):69-77. [http://dx.doi.org/10.1023/ B:SCIE.0000037363.49623.28] 6. Yach D, Tollman SM. Public health initiatives in South Africa in the 1940s and 1950s: Lessons for a post-apartheid era. Am J Public Health 1993;83(7):1043-1050. [http://dx.doi.org/10.2105/ AJPH.83.7.1043] 7. Volmink JA, Metcalf CA, Zwarenstein M, et al. Attitudes of private general practitioners towards health care in South Africa.

S Afr Med J 1993;83(11):827-833.

8. Coutsoudis A, Pillay K, Kuhn L, Spooner E, Tsai WY, Coovadia HM. Method of feeding and trans­mission of HIV-1 from mothers to children by 15 months of age: Prospective cohort study from Durban, South Africa. AIDS 2001;15(3):379-387. [http://dx.doi. org/10.1097/00002030-200102160-00011] 9. Poreau B. Mapping Rwanda public health research (1975-2014).

Afr Health Sci 2014 (in press).

10. Hugo CJ, Boshoff DEL, Traut A, Zungu-Dirway N, Stein DJ. Community attitudes toward and knowledge of mental illness in South Africa. Soc Psychiatry Psychiatr Epidemiol 2003;38(12):715719. [http://dx.doi.org/10.1007/s00127-003-0695-3] 11. Mayosi BM, Lawn JE, van Niekerk A, Bradshaw D, Karim SSA, Coovadia HM. Health in South Africa: Changes and challenges since 2009. Lancet 2012;380(9858):2029-2043. [http://dx.doi. org/10.1016/S0140-6736(12)61814-5]

Accepted 4 September 2014.

RESEARCH

Regulation of HIV receptor expression in cervical epithelial cells by Gram-negative bacterial lipopolysaccharide K J Sales, PhD; T Klein, BSc (Med) (Hons); A A Katz, PhD MRC/UCT Receptor Biology Research Unit, Institute of Infectious Disease and Molecular Medicine and Division of Medical Biochemistry, Faculty of Health Sciences, University of Cape Town, South Africa Corresponding author: K J Sales (kurtjsales@gmail.com)

Background. Sexually transmitted infections (STIs) caused by the Gram-negative bacteria Chlamydia trachomatis and Neisseria gonorrhoeae are associated with an increased risk of HIV acquisition in South African women. HIV infection involves binding of the virus to CD4+ receptors on host cells and subsequent binding to a chemokine co-receptor that mediates fusion with the host target cell membrane.

Objective. To investigate the potential impact of STIs on HIV receptor expression in cervical epithelial cells, and the molecular pathways mediating this effect.

Methods. Expression of Toll-like receptor 4 (TLR4), CD4+ and CCR5 was investigated in HPV type 18-positive (HeLa) and HPV-negative (C33A) cervical epithelial cells, uterine adenocarcinoma cells (Ishikawa), cervical squamous cell carcinoma tissue and normal cervical tissue by real-time polymerase chain reaction (RT-PCR) analysis. HIV receptor expression in HeLa cells was investigated in the presence/absence of 10 µg/mL bacterial lipopolysaccharide (LPS) and chemical inhibitors of epidermal growth factor receptor (EGFR), extracellular signalregulated kinase (ERK1/2) or cyclo-oxygenase-2 (COX-2) by RT-PCR analysis.

Results. TLR4, CD4+ and CCR5 expression was elevated in HeLa, C33A and Ishikawa cell lines and carcinoma tissue, compared with normal cervical tissue. Treatment of HeLa cells with LPS increased expression of the primary HIV chemokine co-receptor CCR5 (p<0.01) and several alternative HIV receptors including CCR2b (p<0.01), CXCR6 (p<0.05) and GPR1 (p<0.05), but not CD4+. We found that LPSmediated CCR5 expression occurred via induction of the EGFR, ERK1/2 and COX-2 signalling pathways.

Conclusion. Our findings suggest that STIs have the potential to enhance susceptibility to HIV infection in women by regulating expression of HIV receptors in cervical epithelial cells.

S Afr Med J 2015;105(1):56-61. DOI:10.7196/SAMJ.8185

Sexually transmitted infections (STIs) with the Gramnegative bacteria Chlamydia trachomatis and Neisseria gonorrhoeae are major public health problems in South Africa (SA) and are significantly associated with HIV infection.[1] In women, STI ultimately occurs at the mucosal surface of the genital tract, where inflammation from both non-ulcerative and ulcerative infections increases localised immune cell mobilisation, in turn enhancing susceptibility to HIV infection.[1] Although HIV preferentially targets CD4+-positive immune cells for infection, recent laboratory studies have shown that cervical epithelial cells can become productively infected and behave as viral reservoirs, sequestering and transferring virus to activated peripheral blood mononuclear cells in the submucosa.[2-5] HIV infects cells via receptors on the host cell surface. The virus first attaches to the surface of the host cells. The initial step in membrane fusion begins with binding of the viral envelope protein (Env, consisting of a trimer of gp120-gp41 heterodimers) to the CD4+ cell surface protein and a chemokine co-receptor present on the host cell.[6] While most HIV-1 variants use CCR5 and CXCR4 as the main co-receptor in vivo, up to 12 other chemokine co-receptors (including CCR2b, CXCR6 and GPR1) for HIV infection have been identified in vitro.[7,8] Although the molecular mechanisms regulating HIV chemokine receptors in the cervix are unclear, inflammatory prostaglandins derived by metabolism of arachidonic acid by cyclo-oxygenase enzymes (COX-1 and COX-2)[9] have been shown to regulate HIV chemokine expression in uterine epithelial cells in the female genital tract.[10] These observations suggest that inflammation can drive expression of HIV co-receptors in cervical epithelial cells.

56

We investigated: (i) the potential impact of Gram-negative bacterial STIs on the regulation of receptors involved in HIV infection in the cervix using the endotoxic component of the Gram-negative bacteria, lipopolysaccharide (LPS), as a mimetic of infection; and (ii) the potential molecular pathways underlying the action of LPS.

Methods Reagents

Phosphate-buffered saline (PBS) and Tri-reagent® were purchased from Sigma Chemical Company (SA). AG1478, SC560, NS398 and PD98059 were purchased from Calbiochem (Merck, Germany).

CCR5 (CKR5; sc-6128) antibody was purchased from Santa Cruz Biotechnology (Whitehead Scientific, SA).

Ethics approval

Ethics approval for the study was obtained from the University of Cape Town Research Ethics Committee (REC/REF: 067/2011).

Written informed consent was obtained from all subjects before sample collection.

Tissue collection

Cervical cancer tissue specimens were obtained at the time of surgery or biopsy from patients who were attending the gynaecological oncology clinic at Groote Schuur Hospital (GSH), Cape Town, SA, and had previously been diagnosed with stage 1A moderately differentiated squamous cell carcinoma of the cervix (N=10). The median age of the patients was 41 years. Histologically normal cervical tissue (N=10) was collected from women undergoing Wertheim’s hysterectomy for benign gynaecological indications at

January 2015, Vol. 105, No. 1

RESEARCH

GSH. The median age of these patients was 50.5 years. Sections of tissue were excised from the ectocervix-transformational zone by a specialist pathologist. Tissue sections were placed into a 15 mL collection tube containing serum-free Dulbecco’s Modified Eagle Medium supplemented with 1% penicillin-streptomycin. The tubes were placed on ice and transported to the laboratory. Each sample was divided equally into aliquots before snap-freezing using liquid nitrogen.

Cell culture and treatments

HeLa cells authenticated and verified as cervical adenocarcinoma cells containing HPV type 18 were purchased from Bio-Whittaker (UK). C33A cells were a gift from Prof. Virna Leaner (Division of Medical Biochemistry, University of Cape Town). Ishikawa cells were obtained from the European Collection of Cell Culture (UK). All cell lines were cultured as described previously.[10] For HeLa cell experiments, cells were seeded at a density of 2 × 105 cells in 3 cm dishes and allowed to attach and grow overnight. The following day, cells were serum starved for 24 hours in serum-free medium. Cells were then treated with vehicle (PBS) or 10 µg/mL LPS for 4, 8, 16 or 24 hours. For inhibitor experiments, cells were serum starved and treated with inhibitor alone or 10 µg/mL LPS and inhibitor of epidermal growth factor receptor (EGFR) tyrosine kinase (AG1478; 200 nM), extracellular signal-regulated kinase (ERK1/2) (PD98059; 50 µM), COX-1 (SC-560; 10 µM) or COX-2 (NS398; 10 µM). The concentrations of chemical inhibitors were determined empirically by titration using the IC50 values from the manufacturer as a guide. At the concentrations and time used, the inhibitors showed no adverse effect on cell viability. Fold increase was calculated by dividing the values obtained from the LPS only/ LPS plus inhibitor treatments by the vehicle only/vehicle plus inhibitor treatments.

Real-time polymerase chain reaction (RT-PCR) analysis

RNA was extracted using Tri-reagent (Sigma) following the manufacturer’s guidelines and reverse transcribed as described previously.[10] All gene expression experiments were carried out on an Illumina Eco™ quantitative RT-PCR machine and detected using SYBR green (Bioline, Celtic Molecular, SA) incorporation during Table 1. Primer sequences for RT-PCR Gene target

Primer sequence

CD4+ FOR

CTAAGCTCCAGATGGGCAAG

CD4 REV

CACCACCAGGTTCACTTCCT

CCR5 FOR

AGCTATGCAGGTGACAGAGACTCTT

CCR5 REV

TCCCCGACAAAGGCATAGAT

CCR2b FOR

TGCCTGACTCACACTCAAGG

CCR2b REV

GGCTTCTCAGCAACTGAACC

CXCR4 FOR

CAGTGGCCGACCTCCTCTT

CXCR4 REV

CAGTTTGCCACGGCATCA

CXCR6 FOR

GGTTCTTCTTGCCACTGCTC

CXCR6 REV

CATGAGGTTGAAGGGCATCT

GPR1 FOR

TTCTGCCCCTGTACATCTCC

GPR1 REV

AGAAGCCAAAAGCCAGATGA

TLR4 FOR

AGAGTTTCCTGCAATGGATCAAG

TLR4 REV

TGCTTATCTGAA GGTGTTGCACAT

+

RT-PCR = real-time polymerase chain reaction.

57

the PCR reaction. Sequences of PCR primers used are outlined in Table 1. A melt curve was performed for each PCR reaction, and all PCR products gave a single peak confirming the purity of the PCR product. Results were calculated using the comparative cycle threshold (Ct) method, and expression of each cDNA sample was normalised for RNA loading using the average Ct value obtained from two independent reference genes (18s ribosomal RNA and glyceraldehyde 3-phosphate dehydrogenase) as internal controls. All data were expressed relative to an endogenous control of HeLa cell cDNA included in each experiment or converted to fold increase, which was determined by dividing the relative expression of the treatment group by the relative expression of each control group. The experiment was conducted in duplicate and data were presented as means (standard error of the mean (SEM)).

Western blot analysis

Cell lysis, protein quantification and immunoblot experiments were conducted as described previously,[11] using a specific CCR5 antibody.

CCR5 protein was revealed by chemiluminescence and quantified using a UVP BioSpectrum 500 Imaging System (Scientific Group, SA). The experiment was conducted three times and data were presented as means (SEM).

Statistical analysis

Statistical analysis was performed using one-way analysis of variance and the Newman-Keuls multiple comparison or Dunnett post-hoc test to compare differences in gene expression between the experimental groups. A paired t-test was conducted between vehicle and LPS-treated cells on the untransformed means, before conversion to fold increase. An unpaired t-test was used to compare CCR5 expression in samples treated with LPS in the presence of signalling inhibitors with that in samples treated with LPS only.

Analysis and histograms were generated using Graphpad Prism software version 5.00 (Graph Pad, USA). Data were considered significant at p<0.05.

Results

Expression of TLR4, CD4+ and CCR5 in uterine-cervical cells and tissues

We hypothesised that the endotoxic LPS component of the Gramnegative bacteria C. trachomatis and N. gonorrhoeae, often transmitted during sexual intercourse and deposited in the vagina and cervix, could impact on HIV receptor expression in the cervical mucosa. LPS mediates its effect via a signalling receptor, Toll-like receptor 4 (TLR4), to alter signal transduction pathways and increase inflammatory gene expression. We initially investigated the expression of TLR4 in HPV type 18-transformed cervical cancer cells (HeLa), HPV-negative cervical cancer cells (C33A), uterine endometrial adenocarcinoma cells (Ishikawa), cervical squamous cell carcinoma tissue and normal cervical tissue by quantitative RT-PCR analysis.

We found differential expression of TLR4 (Fig. 1, A), CCR5 (Fig. 1, B) and CD4+ (Fig. 1, C) in all cell lines and tissues investigated.

TLR4 expression was higher in HeLa cells, Ishikawa cells and cancer tissues than in C33A cells or normal cervical tissue (Fig. 1, A; *p<0.05, **p<0.01). CCR5 (Fig. 1, B; p<0.05) and CD4+ (Fig. 1, C; p<0.05) expression was elevated in cervical cancer tissue compared with normal cervical tissue, but was not significantly different from expression in HeLa cells, C33A cells or Ishikawa cells.

LPS regulates expression of HIV receptors in HeLa cells

Since we had determined that TLR4 was present in cervical tissues and could therefore mediate inflammatory signalling in the cervical mucosa,

January 2015, Vol. 105, No. 1

5

**

3

1

La

0.1

He

C 1 000

*

100 10 1

ix al ce rv

rm

Ce rv

No

A C3 3

ce r

0.1

He La

Relative CD4+ mRNA expression (log10)

Ish ika wa Ce rv ica lc an ce No r rm al ce rv ix

C3 3A

He

La

0

10

C3 3A

*

100

lc an

1

*

*

1 000

ica

2

10 000

ika wa

4

B

Ish ika wa Ce rv ica lc an ce No r rm al ce rv ix

Relative CCR5 mRNA expression (log10)

A

Ish

Relative TLR4 mRNA expression

RESEARCH

Fig. 1. Relative expression of TLR4 (A), CCR5 (B) and CD4+ (C) in uterine-cervical cells and tissues (HeLa cells (n=3), C33A cells (n=3), Ishikawa cells (n=3), cervical squamous cell carcinoma tissue (n=10) and normal cervical tissue (n=10)), as determined by quantitative RT-PCR analysis. * and ** represent significance at p<0.05 and p<0.01, respectively, as determined by analysis of variance with Dunnettâ&#x20AC;&#x2122;s post-test analysis. Data are presented as means (SEM).

(TLR4 = Toll-like receptor 4; RT-PCR = real-time polymerase chain reaction; SEM = standard error of the mean.)

we next investigated the impact of LPS stimulation on HIV receptor expression in cervical epithelial cells, using HeLa cells as a model system.

HeLa cells were treated with vehicle (dark bars in Fig. 2) or LPS (light bars) for 4, 8, 16 and 24 hours, and the RNA was extracted and subjected to reverse transcription and quantitative RT-PCR analysis. We found that CCR5 expression increased in a time-dependent manner, reaching a maximum at 24 hours (Fig. 2, A; p<0.01). We found no significant alteration in expression levels of the main HIV receptor CD4+ in response to LPS treatment at any time point investigated (Fig. 2, B).

HIV-1 and HIV-2 strains have been reported to be capable of utilising several alternative chemokine receptors, including CCR2b, CXCR4, CXCR6 and GPR1, to mediate infection of cells.[7,8] We found that LPS stimulation of HeLa cells increased CCR2b (Fig. 2, C; p<0.01),

58

CXCR6 (Fig. 2, E; p<0.05) and GPR1 (Fig. 2, F; p<0.05) at 4, 8 and 24 hours, respectively, compared with vehicle-treated cells. In contrast, we found no difference in CXCR4 receptor expression in HeLa cells treated with LPS at any time point investigated (Fig. 2, D). These data indicate that LPS could potentially regulate expression of a host of chemokine co-receptors in the cervix, which could mediate infection of cells by HIV strains capable of utilising alternative CD4+-co-receptor combinations, different from CD4+-CCR5 or CD4+-CXCR4.

LPS induces CCR5 receptor expression via the EGFR, COX-2 and ERK1/2 pathways

Since CCR5 is the main receptor utilised by HIV strains for infection, we focused our analysis on this molecule. We have previously

January 2015, Vol. 105, No. 1

RESEARCH

B 2.0

15

** 10

*

5

0

4

4

8

8

16

16

LPS treatment, hours

24

1.0 0.5 0.0

4

4

4

4

16 16 LPS treatment, hours 8

8

24

24

24

24

D 8

CXCR4 mRNA expression (fold increase over control)

CCR2b mRNA expression (fold increase over control)

1.5

24

C

**

6 4 2 0

4

4

8 8 16 16 LPS treatment, hours

24

1.5

1.0

0.5

0.0

24

E

8 8 16 16 LPS treatment, hours

F 3

4

*

GPR1 mRNA expression (fold increase over control)

CXCR6 mRNA expression (fold increase over control)

CD4+ mRNA expression (fold increase over control)

CCR5 mRNA expression (fold increase over control)

A

2

1

0

4

4

8 8 16 16 LPS treatment, hours

24

24

*

3 2 1 0

4

4

16 16 LPS treatment, hours 8

8

24

24

Fig. 2. LPS induces expression of HIV chemokine co-receptors in HeLa cells. (A) CCR5, (B) CD4+, (C) CCR2b, (D) CXCR4, (E) CXCR6 and (F) GPR1 mRNA expression as determined by RT-PCR analysis. HeLa cells were treated with control (PBS, dark bars) or 10 Âľg/mL LPS (light bars) for 4, 8, 16 or 24 hours.

Data are presented as means (SEM) from six individual experiments done in duplicate. * and ** indicate significance at p<0.05 and p<0.01, respectively, for treatment v. control as determined by the paired t-test and analysis of variance. (LPS = lipopolysaccharide; RT-PCR = real-time polymerase chain reaction; PBS = phosphate-buffered saline; SEM = standard error of the mean.)

highlighted a role for the inflammatory COX-prostaglandin pathway in mediating chemokine receptor expression in the female reproductive tract via the EGFR and ERK1/2 pathways.[10] In the present study, we investigated the role of the EGFR, ERK1/2 and COX pathways in regulating CCR5 expression, using a panel of specific

59

chemical inhibitors of cellular signalling. HeLa cells were treated with vehicle or LPS in the presence/absence of inhibitors of EGFR kinase (AG1478), ERK1/2 (PD98059), COX-1 (SC560) or COX-2 (NS398) for 24 hours, and the mRNA and protein were subjected to quantitative RT-PCR (Fig. 3, A) and Western blot (Fig. 3, B) analysis,

January 2015, Vol. 105, No. 1

RESEARCH

A

B

*

1

**

**

Co nt ro

LP AG S 14 78 + PD LP 98 S 05 9+ LP SC S 56 0+ LP NS S 39 8+ LP S

0

*

NS

2

*

1 0

*

*

LP AG S 14 78 + PD LP 98 S 05 9+ LP SC S 56 0+ LP NS S 39 8+ LP S

2

3

l

NS

3

Co nt ro

**

CCR5 protein expression (fold increase over control)

4

l

CCR5 mRNA expression (fold increase over control)

5

Fig. 3. Effects of chemical inhibitors of specific signal transduction pathways on CCR5 expression. Chemical inhibitors used: EGFR kinase (AG1478), ERK1/2 (PD98059), COX-1 (SC560) and COX-2 (NS398). HeLa cells were treated with vehicle or inhibitor in the presence/absence of 10 µg/mL LPS for 24 hours. (A) CCR5 mRNA expression was analysed and quantified using quantitative RT-PCR analysis. (B) LPS regulation of CCR5 protein expression was confirmed by Western blot analysis using a specific CCR5 antibody. Data are represented as means (SEM) of three independent experiments. * and ** represent significance at p<0.05 and p<0.01, respectively, as determined by the unpaired t-test. (EGFR = epidermal growth factor receptor; LPS = lipopolysaccharide; ERK1/2 = extracellular signal-regulated kinase; RT-PCR = real-time polymerase chain reaction; SEM = standard error of the mean; NS = not significant.)

respectively. We found that AG1478, PD98059 and NS398, but not SC560, significantly inhibited the LPS-mediated induction of CCR5 mRNA (Fig. 3, A) and protein (Fig. 3, B) in HeLa cells (*p<0.05, **p<0.01).

Discussion

Inflammation of the cervical mucosa is considered a significant risk factor for HIV infection.[1] However, the roles of inflammatory mediators and STIs in regulating pathways involved in HIV infection in the cervix have yet to be fully elucidated. The endotoxic component of Gram-negative bacteria, LPS, is found on the outer bacterial membrane and is responsible for eliciting strong immune responses, associated with infection, by binding to and activating TLR4.[12] We hypothesised that this endotoxic component of Gram-negative bacteria, which is abundantly part of the make-up of C. trachomatis and N. gonorrhoeae, could regulate chemokine receptors and pathways with known roles in HIV infection in cervical epithelial cells to enhance susceptibility of the genital tract to infection.

To investigate whether the endotoxic component of Gram-negative bacteria, LPS, could have an impact on cervical epithelial cells, we screened several uterine-cervical epithelial cell lines, cervical squamous cell carcinomas and normal cervical cells to determine whether TLR4 was present. We found that all cell lines and tissues expressed TLR4, the signalling receptor for LPS, as well as the main HIV receptors CD4+ and CCR5. These findings indicated that all cell lines and tissues expressed the necessary cellular machinery to mediate infection of the cervix by Gram-negative bacteria and HIV. The epithelial compartment of several tissues in the human body, including the gastrointestinal tract, prostate and cervix, has been implicated in the uptake and transport of HIV to submucosal leucocytes.[5,13] Of significance to our study is the observation that cervical epithelial cells can behave as viral reservoirs, to sequester and transfer virus to activated peripheral blood mononuclear cells in the submucosa.[2,5,14] Moreover, several studies have shown that levels of

60

CCR5 in cells positively correlate with HIV infectivity and levels of cellular activation in vivo.[4,15,16] It is therefore plausible that any mechanism that enhances CCR5 expression, or indeed expression of other alternative HIV co-receptors such as CCR2b, CXCR6 and GPR1 investigated in this study, could enhance HIV susceptibility. In sexually active women, this could be enhanced by bacterial STIs mediated by C. trachomatis and N. gonorrhoeae. These agents of infection could mediate HIV infection both directly by regulating cell surface expression of chemokine G protein-coupled receptors to mediate virus fusion and infection and indirectly by facilitating the recruitment of CD4+positive immune cells into the local cervical environment, which could then be targeted by HIV for infection.

Exploring the intracellular pathways mediating the induction of CCR5 by LPS, we found that LPS regulates CCR5 mRNA and protein expression in HeLa cells via the EGFR, ERK1/2 and inflammatory COX-2 pathways. Many pathological disorders or diseases, including cervical cancer, have been characterised by the exacerbated activation and maintenance of these inflammatory pathways.[17] Over the past two decades, significant attention has been paid to inhibition of the inflammatory COX enzyme pathway as a potential therapeutic intervention strategy for a host of inflammatory diseases. Our observations of the role of COX-2 in regulating CCR5 expression suggest that administration of non-steroidal anti-inflammatory drugs such as aspirin to suppress COX-2 expression in sexually active women with lower urinary tract bacterial infections might also suppress inflammatory pathways that regulate HIV receptor expression and susceptibility to HIV infection.

Our study shows that the endotoxic LPS component of bacterial STIs, which are very common in sexually active women, often in the absence of any symptoms of infection, can regulate expression of HIV receptors in the cervical epithelium. Since levels of HIV receptor positively correlate with HIV infectivity, and since the cervical mucosa is known to become productively infected by virus,

January 2015, Vol. 105, No. 1

RESEARCH

our data highlight the potential of STIs for enhancing the risk of infection by HIV during intercourse, by increasing the abundance of cell surface machinery used by the HI virus for establishment of infection.

Sources of funding. This study was supported by grant funding to the MRC/UCT Receptor Biology Research Unit by the Medical Research Council of South Africa and by the following grants to KJS: Poliomyelitis Research Foundation of South Africa, Cancer Association of South Africa, National Research Foundation of South Africa and University of Cape Town Research Committee. The funders played no role in the conception or design of the study, the interpretation of the results or the decision to publish.

References 1. Pham-Kanter GB, Steinberg MH, Ballard RC. Sexually transmitted diseases in South Africa. Genitourin Med 1996;72(3):160-171.

2. Dezzutti CS, Guenthner PC, Cummins JE Jr, et al. Cervical and prostate primary epithelial cells are not productively infected but sequester human immunodeficiency virus type 1. J Infect Dis 2001;183(8):1204-1213. [http://dx.doi.org/10.1086/319676] 3. Maher D, Wu X, Schacker T, et al. HIV binding, penetration, and primary infection in human cervicovaginal tissue. Proc Natl Acad Sci U S A 2005;102(32):11504-11509. [http://dx.doi.org/10.1073/ pnas.0500848102] 4. Wu L, Paxton WA, Kassam N, et al. CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J Exp Med 1997;185(9):1681-1691. [http://dx.doi.org/10.1084/ jem.185.9.1681]

61

5. Wu Z, Chen Z, Phillips DM. Human genital epithelial cells capture cell-free human immunodeficiency virus type 1 and transmit the virus to CD4+ cells: Implications for mechanisms of sexual transmission.

J Infect Dis 2003;188(10):1473-1482. [http://dx.doi.org/10.1086/379248] 6. Wilen CB, Tilton JC, Doms RW. Molecular mechanisms of HIV entry. Adv Exp Med Biol 2012;726:223242. [http://dx.doi.org/10.1007/978-1-4614-0980-9_10] 7. Doranz BJ, Lu ZH, Rucker J, et al. Two distinct CCR5 domains can mediate coreceptor usage by human immunodeficiency virus type 1. J Virol 1997;71(9):6305-6314.

8. Shimizu N, Tanaka A, Oue A, et al. Broad usage spectrum of G protein-coupled receptors as coreceptors by primary isolates of HIV. AIDS 2009;23(7):761-769. [http://dx.doi.org/10.1097/ QAD.0b013e328326cc0d] 9. Rizzo MT. Cyclooxygenase-2 in oncogenesis. Clin Chim Acta 2011;412(9-10):671-687. [http://dx.doi. org/10.1016/j.cca.2010.12.026] 10. Sales KJ, Grant V, Catalano RD, et al. Chorionic gonadotrophin regulates CXCR4 expression in human endometrium via E-series prostanoid receptor 2 signalling to PI3K-ERK1/2: Implications for fetal-maternal crosstalk for embryo implantation. Mol Hum Reprod 2011;17(1):22-32. [http://dx.doi. org/10.1093/molehr/gaq069] 11. Sales KJ, Katz AA, Howard B, et al. Cyclooxygenase-1 is up-regulated in cervical carcinomas: autocrine/ paracrine regulation of cyclooxygenase-2, prostaglandin e receptors, and angiogenic factors by cyclooxygenase-1. Cancer Res 2002;62(2):424-432.

12. Kulp A, Kuehn MJ. Biological functions and biogenesis of secreted bacterial outer membrane vesicles.

Annu Rev Microbiol 2010;64:163-184. [http://dx.doi.org/10.1146/annurev.micro.091208.073413] 13. Meng G, Wei X, Wu X, et al. Primary intestinal epithelial cells selectively transfer R5 HIV-1 to CCR5+ cells. Nat Med 2002;8(2):150-156. [http://dx.doi.org/10.1038/nm0202-150] 14. Gupta P, Collins KB, Ratner D, et al. Memory CD4(+) T cells are the earliest detectable human immunodeficiency virus type 1 (HIV-1)-infected cells in the female genital mucosal tissue during HIV1 transmission in an organ culture system. J Virol 2002;76(19):9868-9876. [http://dx.doi.org/10.1128/ JVI.76.19.9868-9876.2002] 15. Stoddart CA, Keir ME, McCune JM. IFN-alpha-induced upregulation of CCR5 leads to expanded HIV tropism in vivo. PLoS Pathog 2010;6(2):e1000766. [http://dx.doi.org/10.1371/journal.ppat.1000766] 16. Ostrowski MA, Justement SJ, Catanzaro A, et al. Expression of chemokine receptors CXCR4 and CCR5 in HIV-1-infected and uninfected individuals. J Immunol 1998;161(6):3195-3201.

17. Sales KJ, Katz AA. Inflammatory pathways in cervical cancer â&#x20AC;&#x201C; the UCT contribution. S Afr Med J 2012;102(6):493-496.

Accepted 10 November 2014.

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

REVIEW

South African food allergy consensus document 2014 M E Levin, C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: M Levin (michael.levin@uct.ac.za)

The prevalence of food allergy is increasing worldwide and is an important cause of anaphylaxis. There are no local South African food allergy guidelines. This document was devised by the Allergy Society of South Africa (ALLSA), the South African Gastroenterology Society (SAGES) and the Association for Dietetics in South Africa (ADSA).

Subjects may have reactions to more than one food, and different types and severity of reactions to different foods may coexist in one individual. A detailed history directed at identifying the type and severity of possible reactions is essential for every food allergen under consideration. Skin-prick tests and specific immunoglobulin E (IgE) (ImmunoCAP) tests prove IgE sensitisation rather than clinical reactivity. The magnitude of sensitisation combined with the history may be sufficient to ascribe causality, but where this is not possible an incremental oral food challenge may be required to assess tolerance or clinical allergy. For milder non-IgE-mediated conditions a diagnostic elimination diet may be followed with food re-introduction at home to assess causality.

The primary therapy for food allergy is strict avoidance of the offending food/s, taking into account nutritional status and provision of alternative sources of nutrients. Acute management of severe reactions requires prompt intramuscular administration of adrenaline 0.01 mg/kg and basic resuscitation. Adjunctive therapy includes antihistamines, bronchodilators and corticosteroids. Subjects with food allergy require risk assessment and those at increased risk for future severe reactions require the implementation of risk-reduction strategies, including education of the patient, families and all caregivers (including teachers), the provision of a written emergency action plan, a MedicAlert necklace or bracelet and injectable adrenaline (preferably via auto-injector) where necessary.

S Afr Med J 2015;105(1):62-65. DOI:10.7196/SAMJ.9098

Up to 34% of individuals or parents think that they or a family member has a food allergy and 22% avoid particular foods because of the mere possibility that the food may contain an allergen, when in fact only between 1% and 6% test positive on full evaluation.[1] A working group was constituted of medical professionals with interest and expertise in food allergy in South Africa (SA) with representation from the Allergy Society of South Africa (ALLSA), the South African Gastroenterology Society (SAGES) and the Association for Dietetics in South Africa (ADSA). The structure and content of the document was networked, individuals were allocated sections to write and a draft document was compiled. A meeting was then held to discuss the draft document, resolve controversial issues and achieve a consensus document. The document is endorsed by ALLSA, SAGES and ADSA.

Definitions

Adverse reactions to food can be divided into psychological reactions (food aversion), organic reactions (e.g. peptic ulcer disease), anatomical reactions (e.g. strictures), toxic reactions (e.g. food poisoning) and nontoxic reactions (Fig. 1).[2]

Adverse reaction to food

Psychological (food aversion)

Toxic (microbiological pharmacological)

Organic

Non–toxic

Fig 1. Adverse reactions to foods.

Non–toxic

Immune–mediated (food allergy)

IgE–mediated

Mixed IgE– and cell–mediated

Non-immune-mediated (food tolerance)

Cell–mediated

Enzymatic

Pharmacological

Other

Fig. 2. Non-toxic food reactions.

Non-toxic reactions imply an individual hypersensitivity to the food, either immune-

62

January 2015, Vol. 105, No. 1

mediated (food allergy) or not immunemediated[3] (food intolerance) (Fig. 2). Non-

CONTINUING MEDICAL EDUCATION

toxic reactions only occur in susceptible individuals, rather than being experienced by all people exposed to that particular food.

New nomenclature[4] refers to ‘food intolerance’ as ‘non-allergic food hypersensitivity’. Examples include lactose intolerance and hypersensitivity to alcohol or caffeine. This document focuses on immune-mediated reactions (food allergy) only.

Immunoglobulin E (IgE)-mediated food allergy is the clinical result of a type I immediate hypersensitivity reaction due to the presence of IgE antibodies to a specific food. Manifestations occur within minutes up to 2 hours after ingestion of the food.

Symptoms usually recur on exposure to the food on every occasion. Symptoms may be mild or severe, associated with anaphylaxis. Symptoms may include urticaria, angio-oedema and other rashes, oral itching or swelling, and abdominal, airway, cardiovascular and central nervous system symptoms.

IgE-mediated reactions may be divided into immediate-onset reactions (immediate in time) and immediate plus late-phase (in which the immediate-onset symptoms are followed by prolonged or ongoing symptoms).

Non-IgE-mediated food allergy. Non-IgE-mediated conditions include combined IgE- and cell-mediated conditions, such as atopic dermatitis and eosinophilic oesophagitis, and pure T-cell-mediated conditions, such as food protein-induced enterocolitis syndrome, allergic proctocolitis and enteropathy syndromes.[5] Infants and young children are affected predominantly, and present with abdominal complaints such as pain, vomiting, diarrhoea, blood in the stools and failure to thrive.[6] Diagnosing mixed or non-IgEmediated allergy is challenging. A clear cause-effect relationship between exposure to the suspected food and symptoms is not always possible, as symptoms develop over time and are more chronic in nature. Skin-prick tests (SPTs) and specific IgE tests to the allergen are usually negative. An elimination diet may be necessary to diagnose non-IgE-mediated type food allergy.[7] The suspected allergen should be excluded from the diet for 2 - 6 weeks under dietetic guidance to assess for improvement of symptoms. After symptom improvement, a rechallenge is necessary to definitively prove causal relation.[7]

is investigating food allergy in an unselected cohort of 1 - 3-year-olds, show a prevalence of SPT ≥1 mm to any food of 11.6%, SPT ≥3 mm of 9.9% and SPT ≥7 mm of 4.2%. Challenge-proven food allergy prevalence is 1.8%, egg allergy 1.4% and peanut allergy 1.1%.

Food-related anaphylaxis and fatalities

Food allergy appears to be the most common trigger of anaphylaxis in the community. One-third to half of anaphylactic episodes can be attributed to foods;[14] this proportion seems to be higher in children, in whom food is responsible for up to 85% of anaphylactic reactions.[15] In adults, shellfish and nut are the most common triggers of food-induced anaphylaxis, and in children, peanut, tree nut, milk and egg.

Diagnosis of food allergy[16]

An individual may be allergic to multiple allergens, and each allergen may have a different mechanism of reaction and manifest differently, and therefore may require different modalities of diagnosis and management.

No single test can be fully depended on in the diagnosis of food allergy. A detailed history is an essential initial step when a food allergy is suspected.[17] History aids in identifying potentially involved food, in differentiating between potential IgE- and non-IgE-mediated disease and assessing severity of reactions.

Elements of history should be gathered separately for each food under consideration, as a single patient may experience different types of reactions with different foods, each of which will require different diagnostic and management strategies. Elements of a full history, including an allergy-focused family history,[18] clinical history[19,20] and dietary history, can be found in the review in this edition.[16] History alone is however not diagnostic,[20] and additional measures of sensitisation[16] or food challenges[7] are often required.

In suspected IgE-mediated allergy, SPT and/or measurement of serum specific IgE antibodies (ImmunoCAP) to suspected foods are used to prove sensitisation. Sensitisation does not, however, confirm clinical food allergy as these tests indicate an immunological response to the specific allergen, but the diagnosis requires a clear correlation between the test result and clinical reaction (by positive history or food challenge).[21] Blind testing without suspicion of a reaction to a specific allergen is not advocated, as findings are often misleading by indicating asymptomatic sensitisation alone.[22] Tests for sensitisation to foods should not be performed when history indicates that those foods are tolerated.

No validated tests exist to confirm non-IgE- or mixed IgEand non-IgE-mediated food allergies. Diagnosis of this group of allergies depends on elimination of the suspected food, clearance of symptoms, and recurrence of symptoms on re-introduction of the food.[7] In certain cases endoscopy with biopsy is indicated to evaluate the response to dietary changes.[5]

Prevalence of IgE-mediated food allergy[8]

Diagnostic tests to identify sensitisation in IgE-mediated food allergy[16]

Multiple allergens or forms of allergies in individuals

Despite the large number of foods that can cause IgE-mediated reactions, most prevalence studies have focused on the most common allergenic foods, namely cow’s milk, hen’s egg, peanut, tree nut, wheat, soya, fish and shellfish.[9] Food allergy peaks in the first 2 years of life, and then diminishes towards late childhood as tolerance to several foods develops over time. Based on meta-analyses and large population-based studies, the true prevalence of food allergy varies from 1% to over 10%, depending on the geographical area and age of patient being studied.

The prevalence of food allergy in SA is currently under investigation. The prevalence of IgE-mediated food allergy in SA children with moderate to severe atopic dermatitis is 40%;[10] however, this represents a high-risk population for food allergy. An unselected population of 211 Xhosa high-school students showed an overall sensitisation to foods of 5%.[11,12] Preliminary data from the South African Food Sensitisation and Food Allergy (SAFFA) study,[13] which

63

Skin-prick test (SPT) SPT is a valid and useful tool to confirm IgE-mediated sensitisation to a specific allergen.[21] The choice of allergens to be tested should be guided by the history, but should be limited to the lowest necessary number to avoid false-positive results. The mean wheal diameter correlates with the likelihood of clinical allergy, but must be interpreted in the light of the clinical history. In individuals with atopic dermatitis, 95% positive predictive values (cut-off values for the mean wheal diameter in the common food allergens where a clinical reaction can be predicted in 95% of cases) have been described for immediate reactions but may be population-specific.

Allergen-specific serum IgE Serum IgE specific to an individual allergen can be determined by ImmunoCAP assays. Cut-off values for the 95% positive predictive values of a clinical reaction to common food allergens are described

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

(see Van der Spuy et al.[16] in this issue) but may be populationspecific.[22] Purified recombinant allergen-specific IgE tests against individual major allergen components in food may improve the diagnosis of clinical allergy and differentiate true food allergy from cross-reactivity.

Certain component allergens are correlated with persistence of food allergy (e.g. ovomucoid in egg allergy and casein in cow’s milk protein allergy), severity of reactions (e.g. Ara h 2 in peanut allergy) and lack of tolerance of extensively heated products (e.g. ovomucoid and casein).

Elimination diets and challenges in the diagnosis of food allergy[7]

Diagnostic elimination diets Elimination diets become an important diagnostic tool when there is no clear cause and effect between ingestion of food and symptoms.

This is most common when the reaction to the food is not immediate.

In this instance, diagnosis can usually be made by elimination of food for a set period (usually between 2 and 6 weeks), followed by planned and intentional re-introduction.

Food re-introduction after (short-term) elimination diets for mildto-moderate non-IgE-mediated conditions may be performed in a safe clinical environment or with a cautious re-introduction at home.

Foods should be re-introduced one at a time as a single ingredient rather than a composite food with 3 - 4 days of daily consumption before re-introduction of further allergens.

Patients who have had an IgE-mediated immediate reaction to food, a previous severe non-IgE-mediated reaction or a long period of food exclusion should not have a home challenge, but be challenged with a formal incremental food challenge in a controlled setting.[23] Food challenges[7] An incremental oral food challenge (OFC) is a test that consists of a gradual feeding of the suspected food under close observation.[24-27] An OFC is preceded by a period of dietary elimination. OFC testing is the gold standard to diagnose clinical food allergy or to demonstrate tolerance. Incremental food challenge testing for IgE-mediated food allergy should be done by trained practitioners in centres that have experience in performing the procedure in an appropriate setting.

OFCs do not necessarily signify the severity of reactions in real-life situation since challenges are gradual and are stopped the moment a reaction occurs.[28] OFCs performed after a period of elimination may result in acute and severe reactions, even though the food was previously associated only with chronic symptoms.[25,29,30] Food challenges include open, single-blind and double-blinded food challenges.[31,32] OFC must be performed in a setting where resuscitation equipment is available in the event of a severe anaphylactic reaction. It can be performed in an outpatient or inpatient setting depending on patient clinical history. In high-risk cases (previous severe reactions or severe asthma), one-to-one nursing and insertion of an intravenous cannula may be required.

Challenges are terminated when a reaction becomes apparent.[26] Standardised and pre-set criteria are available on when to stop challenges.[33] Sample food challenge schedules are available for common food allergens in South Africa.[24] Patients who tolerate the full dose ‘pass’ the challenge and are then advised to eat a full portion of the food at least twice a week to maintain tolerance. Subjects who have reactions have ‘failed’ the challenge, and should avoid the food and have education and risk reduction strategies implemented where appropriate.

Following a challenge, patients should be observed for a minimum of 2 hours following a negative challenge and 4 hours following a positive one.

64

Elimination diets and dietary interventions for the management of food allergies[34]

The primary therapy for food allergy is strict avoidance of the offending food or foods.

Dietary restriction should be individually tailored to meet the nutritional needs of each patient by a registered dietician who is experienced in food allergies. Patients should be re-evaluated at regular intervals to see if they have developed tolerance. This varies depending on the individual foods and whether it is an IgE- or nonIgE-mediated food allergy. Generally younger children with milk, soya and egg allergy should be reviewed every 6 - 12 months and older children every 1 - 2 years. Tree nut, fish and shellfish allergy may be lifelong, but re-evaluation should be performed every 2 - 4 years to determine whether rechallenges are appropriate or exclusion needs to be continued.[20]

Education

Education is the mainstay of dietary avoidance advice. Children, parents and carers should be educated on common ingredients, reading food labels and how to avoid allergens safely. Children and parents should also be made aware of appropriate safe, cost-effective, freely available and nutritionally adequate substitutes for the avoided foods.

Cow’s milk substitutes

Parents of infants and young children with cow’s milk protein allergy (CMPA) should be counselled on the most appropriate formula or milk substitute to use,[18] taking into consideration the type of reaction experienced, severity of reaction, age of the patient (need for formula as the sole or a significant part of their diet), religious and cultural views, and the cost and palatability of the food.

Breastfeeding

Mothers of infants with CMPA who are breastfeeding should be supported and encouraged to continue breastfeeding.[18,35] In extremely rare circumstances, an elimination diet may need to be followed by the mother, under dietary guidance to ensure nutritional adequacy.[17]

Hydrolysed cow’s milk protein and elemental formulas

The classification of feeds as partially hydrolysed, extensively hydrolysed or elemental depends on the degree of hydrolysis and thus the size of the resulting proteins or amino acids.

Partially hydrolysed infant formulas are not hypoallergenic (tolerated by 90% of subjects with proven CMPA) and are therefore not recommended for the treatment of CMPA, but may have a role in prevention of eczema or CMPA in high-risk individuals.[36-38] Some extensively hydrolysed and amino-acid formulas are truly hypoallergenic. The recommended feed of choice for the dietary management of mild or moderate CMPA in infants not breastfed is an extensively hydrolysed cow’s milk formula.[17,40] The recommended formula for the dietary management of nonbreastfed infants and children with known severe CMPA is an amino-acidbased formula,[17] which is the only completely non-allergenic formula.

Because of the high costs, an amino-acid-based formula has targeted use and is specifically recommended for:[17] • infants with CMPA with severe or life-threatening symptoms • patients with on-going symptoms on an extensively hydrolysed formula • infants with severe growth faltering • in rare circumstances where a stringent exclusion diet in the breastfeeding mother has failed to resolve symptoms in the infant.

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

Soya protein-based infant formulas

Soya-based formulas may be useful in: • infants with IgE-mediated CMPA with proven tolerance to soya[40] • some cases of mild-to-moderate non-IgE-mediated CMPA,[41] bearing in mind the increased risk of co-reactivity between CMPA and soya allergy in non-IgE-mediated conditions. This should be done under close supervision.

Other

Other mammalian milks are not suitable for individuals with CMPA because of extensive cross-reactivity. Plant-based milks, including rice and oat milks, are not nutritionally adequate and are inappropriate as a sole infant formula. Probiotics show a moderate risk reduction for eczema in approximately half of all studies, especially those with both pre- and postnatal administration of probiotics;[42] however, at present a role for probiotics in the prevention or treatment of food allergy is not established and they should not be routinely prescribed.

Severe food allergy and anaphylaxis: Treatment, risk assessment and risk reduction[43] Anaphylaxis

Anaphylaxis may be fatal if not recognised and managed appropriately with treatment given rapidly. The drug of choice for treatment of anaphylaxis is adrenaline administered by the intramuscular (IM) route (not subcutaneously) in the mid-anterolateral thigh with other drugs given as adjunctive therapy.[44,45] The following steps should be instituted in the management of anaphylaxis: • eliminate additional exposure to the allergen • give IM injection(s) of adrenaline • call for help • place the patient in a recumbent position with lower limbs elevated and do not allow the patient to stand quickly • give supplemental oxygen • administer intravenous fluid if hypotensive or incomplete response to IM adrenaline • administer nebulised bronchodilators for lower airway obstruction, and/or nebulised adrenaline for stridor • medications above may be repeated if there is inadequate response to therapy • administer adjunctive therapy (antihistamines and corticosteroids) • admit subjects with anaphylaxis for close observation for biphasic reactions • initiate or review risk-reduction strategies after recovery from the acute episode.

Risk factors for the severity of allergic reactions to foods

Factors associated with increased risk in epidemiological studies[46] include coexisting asthma (and current poor asthma control), previous severe reactions, delayed administration of adrenaline, adolescents and young adults, reaction to trace amounts of foods, use of non-selective β-blockers and those remote from medical care.

Elements of risk reduction[43,46]

These include: • Education and provision of a written emergency treatment plan on allergen avoidance, early symptom recognition and appropriate emergency treatment.

• Risk assessment and stratification with provision of injectable adrenaline (preferably via auto-injector) if necessary. Adrenaline auto-injectors (e.g. EpiPen) are more convenient options than ampoules and syringes which may be difficult to use quickly or accurately, especially by parents/patients in emergency situations.[47] EpiPen is available in a 0.15 mg dose for subjects weighing 8 - 25 kg and a 0.3 mg dose for subjects who weigh >25 kg.

• Training and provision of written instructions in the indications for and method of administration of adrenaline.

• Patients and caregivers should be educated about foods that should be avoided and available alternatives.

• Patients should be informed about reading labels. Clear guidelines should also be set for labelling foodstuffs. This includes products which should be clearly linked to the name of the allergen to avoid confusion.

• The diagnosis of food allergy should, with permission, be communicated to all relevant caregivers, including school teachers.

A MedicAlert necklace or bracelet should be worn by the patient at all times.

• Patients should be encouraged to join an appropriate patient support organisation.

Conclusion

Subjects may have reactions to more than one food, and different types and severity of reactions to different foods may coexist in one individual. A detailed history directed at identifying the type and severity of possible reactions is essential for every food allergen under consideration. SPTs and specific IgE (ImmunoCAP) tests prove IgE sensitisation rather than clinical reactivity. The magnitude of sensitisation combined with the history may be sufficient to ascribe causality, but where this is not possible an incremental food challenge may be required to assess tolerance or clinical allergy.

For milder non-IgE-mediated conditions, a diagnostic elimination diet may be followed with food re-introduction at home to assess causality.

The primary therapy for food allergy is strict avoidance of the offending food/s taking into account nutritional status and provision of alternative sources of nutrients. Acute management of severe reactions requires prompt IM administration of adrenaline 0.01 mg/kg and basic resuscitation. Adjunctive therapy includes antihistamines, bronchodilators and corticosteroids. Subjects with food allergy require risk assessment and those at increased risk for future severe reactions require the implementation of risk-reduction strategies including education of the patient, families and all caregivers (including teachers), the provision of a written emergency action plan, a MedicAlert necklace or bracelet and injectable adrenaline (preferably via auto-injector) where necessary.

References available online at http://dx.doi.org/10.7196/SAMJ.9098

65

January 2015, Vol. 105, No. 1

16270

Are the symptoms really signs of allergy?

Nasal congestion/sneezing, itchy/watery eyes and nose:

65%

• of patients diagnosed as having allergic rhinitis and prescribed antihistamine may not be allergic. 1, 2 Wheezing, coughing, breathing problems:

90%

• of children and asthma have allergy. 3-5

60% of adults with

Dry skin, pruritus, scratching:

30%-70%

• of infants and young children with eczema have underlying allergy. 3, 6

Rule in or rule out allergy early – add a Phadiatop® blood test to increase certainty Phadiatop® measures IgE antibodies to a well-balanced mixture of common inhalant allergens. These tests help you to: • differentiate IgE mediated atopic allergy from other allergy-like symptoms 7-13 • identify patients that need Specific IgE testing for allergen identification and continued allergy care 7-13

Reveal the secrets behind

the allergy-like symptoms A single blood test that helps you to rule in or rule out allergy References: 1. Szeinbach SL, et al. J Manag Care Pharm. 2004 May–Jun;10(3): 234–8. 2. Welsh NR, et al. J Am Pharm Assoc 2006; 46(5): 627. 3. Host A, et al. Allergy. 2003 Jul; 58(7): 559–69.4. Milgrom H. AAAAI news release. Milwaukee, WI: American Academy of Allergy, Asthma & Immunology; June 17, 2003. 5. Allen-Ramey F. J Am Board Fam Pract. 2005; 18(5):434–9. 6. Spergel JM. Am J Clin Dermatol. 2008; 9(4): 233–44. 7. Eriksson NE. Allergy. 1990; 45(4): 285–92. 8. Wever-Hess J, et al. Acta Paediatrica. 1999; 88(8): 827–34. 9. Halvorsen R, et al. Int J Pediatr. 2009; 460737. 10. Ballardini N, et al. Allergy.

2006 Mar; 61(3): 337–43. 11. Williams PB, et al. Ann Allergy Asthma Immunol. 2001;86(2):196–202. 12. Nilsson C, et al. Pediatr Allergy Immunol. 2012 Mar;23(2):159–65. 13. Lau S, et al. Pediatr Allergy Immunol. 2008 Jun;19(4):337–41.

ThermoFisher Scientific 197 Fabriek Street Strijdom Park Randburg 2125. Tel 011 792 6790 Fax 011 793 1064 www.isitallergy.co.za www.thermoscientific.com/phadia/en-za

16270 Fisher Scientific Journal Ad Dr FINAL®.indd 1

2014/08/14 2:40 PM

CONTINUING MEDICAL EDUCATION

ARTICLE SUMMARY

Non-IgE-mediated food allergies A J Terblanche, A C Lang, C L Gray, E Goddard, S Karabus, M Kriel, A I Manjra, S M Risenga, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: A Terblanche (alta.terblanche@up.ac.za)

Non-immunoglobulin E (IgE)-mediated conditions include combined IgE- and cell-mediated conditions such as atopic dermatitis and eosinophilic oeso­ phagitis and pure T-cell-mediated conditions such as food protein-induced enterocolitis syndrome (FPIES), allergic proctocolitis and enteropathy syndromes.

Diagnostic tests in non-IgE-mediated food allergy

Diagnosing mixed or non-IgE-mediated allergy is challenging. A clear cause-effect relationship between exposure to the suspected food and symptoms is not always possible, as symptoms develop over time and are more chronic in nature. Skin-prick tests and specific IgE to the allergen are usually negative. An elimination diet may be necessary to diagnose non-IgE-mediated type food allergy. The suspected allergen should be excluded from the diet for 2 - 6 weeks under dietetic guidance to assess for improvement of symptoms. After symptom improvement, a rechallenge is necessary to definitively prove causal relation.

Endoscopic biopsy is indicated in eosinophilic oesophagitis.

Evidence for patch testing is not convincing.

Combined IgE- and cell-mediated food allergic conditions AD is associated with food allergy in 35% of children with moderate-to-severe skin rash. Of these, approximately 10% (i.e.

3 - 4% of total) have isolated flares of eczema without any IgEmediated symptoms. The prevalence is much lower in patients with less severe disease and in adults. Food allergy should be considered in patients with a convincing history of food allergy and those with moderate-to-severe eczema that does not respond to appropriate and adequate topical treatment. Asymptomatic sensitisation to multiple food allergens occurs commonly, and elimination with rechallenge of suspected agents is essential to prove causality.

Multiple food allergens are implicated, and the age of presentation influences the complex of symptoms: feeding difficulties and failure to thrive in the very young, vomiting and abdominal pain in older children and dysphagia and food impaction in teenagers.

Oesophageal endoscopy with biopsies showing more than 15 eosinophils per high-powered field in the presence of typical symptoms is diagnostic. Eosinophilia due to gastro-oesophageal reflux disease should be eliminated by prior treatment with protonpump inhibitors for at least 6 weeks.

66

Pharmacological therapy Swallowed topical corticosteroids have been shown to be effective in inducing clinical and histological response with few sideeffects.

Systemic corticosteroids are highly effective in severely affected emergency cases or where topical steroids have been ineffective.

Proton-pump inhibitor therapy plays a role in excluding reflux as cause for eosinophilia, but also treats reflux caused by EoE. There is no proven benefit for other immune modulators at present.

Eosinophilic gastroenteritis (EG)

Atopic dermatitis (AD)

Eosinophilic oesophagitis (EoE)

Management of EoE Dietary aspects Elimination diets may be an effective therapy for EoE. Three approaches include: • exclusive elemental or amino-acid-based formula feeding • targeted elimination of specific foods guided by allergy testing • an empirical six-food elimination diet removing the six most common food allergens: soy, egg, milk, wheat, nuts and seafood.

Patients with EG may present at any age, and any portion of the gastrointestinal tract may be involved with symptoms including ascites, nausea, diarrhoea, malabsorption, weight loss, oedema and obstruction. Atopy is present in 50% of cases. Food allergens may be implicated.

Cell-mediated food allergic conditions Food protein-induced enterocolitis syndrome (FPIES)

FPIES occurs primarily in infants younger than 9 months of age.

Dietary exposure to predominantly cow’s milk and soy cause severe emesis, diarrhoea and hypotension approximately 2 hours after ingestion.

Symptoms improve promptly on removal of the culprit food.

Tolerance to the allergens is usually attained by the age of 3 years.

Food protein-induced allergic proctocolitis

Healthy infants present with bloody stools early in life. Cow’s milk protein is usually implicated and removal of cow’s milk from the diet results in resolution of symptoms within 48 hours. The condition has a good prognosis and usually resolves at the end of the first year of life.

S Afr Med J 2015;105(1):66. DOI:10.7196/SAMJ.9104

January 2015, Vol. 105, No. 1

Soy protein infant formulas Nutrition for normal growth and development in term infants 1,2

• Nutritionally equivalent alternative to cow’s milk-based formulas (CMFs)1

• Patterns of growth are similar to those in infants fed CMFs1 • Evidence-based safety analysis raises no clinical concerns

with respect to bone health, metabolic, reproductive, endocrine, immune and neurologic functions1 AAP finds that soy protein-based infant formulas are safe to use.2

The American Academy of Pediatrics (AAP) and the US Food and Drug Administration (FDA) support the use of soy-protein formulas for term infants:1,2 • With galactosaemia or hereditary lactase deficiency2 • With documented transient lactase deficiency1,2 • With documented IgE-associated allergy to cow’s milk, who are not allergic to soy protein1,2 • When a vegetarian diet is preferred2

Soy protein formulas are not recommended for: • Pre-term infants with birth weights lower than 1800 g2 • Prevention or management of colic or fussiness2 • Infants with cow’s milk protein-induced enterocolitis or enteropathy2

References: 1. Vandenplas Y, Castrellon PG, Rivas R, et al. Safety of soya-based infant formulas in children. Br J Nutr 2014;111(8):1340-1360. 2. Bhatia J, Greer F. Use of soy protein-based formulas in infant feeding. Pediatrics 2008;121(5):1062-1063.

CINGULATE 9736

Information for Health Care Professionals only.

Breast milk is best for infants and is recommended for as long as possible during infancy.

Abbott Nutrition International, Abbott Place, 219 Golf Club Terrace, Constantia Kloof, 1709, South Africa.

Tel: (011) 858 2000. Fax: (011) 858 2041. ZANANI140082. October 2014.

CONTINUING MEDICAL EDUCATION

ARTICLE SUMMARY

Exclusion diets and challenges in the diagnosis of food allergy A C Lang, A I Manjra, A J Terblanche, S M Risenga, C L Gray, E Goddard, S Karabus, M Kriel, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: M Levin (michael.levin@uct.ac.za)

Instituting an exclusion diet for 2 - 6 weeks, and follow­ i ng it up with a planned and intentional re-introduction of the diet, is important for the diagnosis of a food allergy when a cause-and-effect relationship between ingestion of food and symptoms is unclear.

There are few nutritional risks in shortterm diagnostic exclusion diets. Extensive or long-term avoidance diets should provide alternative sources of nutrition and be carefully monitored, as nutritional deficiencies may result. Highly restrictive diets should not be continued for longer than 3 - 4 weeks.

If there is no improvement during a diagnostic exclusion diet, further restrictions and whether food allergy has been ruled out should be discussed.

The re-introduction of food after (short-term) exclusion diets for mild-tomoderate non-immunoglobulin E (IgE)mediated condi­ tions may be done in a safe clinical environment or cautiously at home. However, patients who have had an IgE-mediated immediate reaction to food, a previous severe non-IgE-mediated reaction or a long period of food exclusion should not have a home challenge, but a formal food challenge protocol in a controlled setting. After prolonged exclusion (>6 months) of a specific allergen from the diet, skin-prick tests (SPTs) or specific IgE (ImmunoCAP) tests to the specific allergen should be performed before a rechallenge, as an IgE-mediated allergy may have developed.

To diagnose a non-IgE-mediated food allergy, foods should be re-introduced one at a time with sufficient time in between to ensure that a reaction has not occurred. Daily consumption for 3 - 4 days is recommended before re-introduction of further allergens. Introduction of the food as a single ingredient rather than a composite food is preferred.

Welcome to your child’s food challenge Possible outcome of challenge No allergic reaction during the challenge = NEGATIVE

Allergic reaction developed during challenge = POSITIVE

Your child is not allergic to this food

Your child is allergic to this food

Give this food in this form to your child at home 2 to 3 times per week

Continue avoiding this food

Why should you give your child this food now?

To build and maintain tolerance which prevents the child from developing a severe allergy

Get an allergy action plan and medication from the doctor Review with your doctor other related or unrelated foods for advice about medication, avoidance and action plans Before you go: get a follow-up date for a check-up and a dietician appointment

Fig. 1. Flowchart to facilitate patient education and ensure appropriate feedback and follow-up.

67

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

Food challenges

An incremental oral food challenge (OFC) test is the gold standard to diagnose clinical food allergy or demonstrate tolerance. It consists of gradual feeding of the suspected food under close observation.

It should be done by trained practitioners in centres where there is experience in performing the procedure in an appropriate setting and where resuscitation equipment is available in the event of a severe anaphylactic reaction. In high-risk cases (previous severe reactions or severe asthma), one-on-one nursing and insertion of an intravenous cannula may be required.

Food challenge is indicated where SPTs or specific IgE sensitisation does not clearly correlate with clinical symptoms. Where there is a clear reaction confirmed by significant levels of sensitisation on SPTs or specific IgE testing, there is no need to perform an OFC. OFCs may be used to reassess tolerance after a period of dietary exclusion. OFCs performed after a period of exclusion may result in acute and severe reactions, even though the food was previously associated only with chronic symptoms. This occurs most commonly when the specific IgE test for the food was positive.

Types of food challenges include an open OFC, when the patient and doctor both know the content of the food, or a blinded challenge, where the food is concealed in another food and an equivalent-looking and -tasting placebo is used as a control on a separate day. In a singleblind challenge the patient, but not the doctor, is blinded to the food, and in a double-blind, placebo-controlled food challenge (DBPCFC) neither the patient nor the doctor knows the content of the foods.

DBPCFCs are considered the gold standard for diagnosing food allergy and are preferred for research purposes; however, open challenges are a good option for screening when several foods are being considered or there is minimal concern about observer or

patient bias. Open challenges are also performed (at home) the day after a double-blind, placebo-controlled OFC to ensure that a mealsized portion of the food is tolerated in its natural state.

In all challenges, the food is administered gradually in increasing amounts at 15 - 20-minute intervals over about 140 - 180 minutes to a final dose representing an ‘age-appropriate portion size’ tailored to the child or individual. A full meal-sized portion of food is given as a single dose the following day. Sample OFC protocols are available in the online article.

Before a challenge, patients must avoid foods and medications that may either alter symptoms of a reaction or interfere with its treatment. They must be in good health, symptom free and have obtained informed consent.

Patients are closely monitored during a challenge for symptoms of an allergic reaction, and challenges are terminated when a reaction becomes apparent. Standardised and pre-set criteria are available on when to discontinue challenges.

Patients should be observed for a minimum of 2 hours following a negative challenge and for 4 hours after a positive one.

Patients who tolerate the full dose ‘pass’ the challenge and are then advised to eat a full portion of the food at least twice a week to maintain tolerance. Those who have reactions have ‘failed’ the challenge and should avoid the food. They should receive information about this and risk reduction strategies should be implemented where appropriate. After the challenge, the patient should be seen by a clinician to review unrelated food, given advice about avoidance, medication and action plans, and receive follow-up dates for medical and dietetic services (Fig. 1).

S Afr Med J 2015;105(1):67-68. DOI:10.7196/SAMJ.9101

ARTICLE SUMMARY

Epidemiology of IgE-mediated food allergy C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Correspondence to: C Gray (claudiagray.paediatrics@gmail.com)

Food allergy seems to be increasing in developed and developing countries, and has become a major public health concern and the cause of significant morbidity. It is the most common cause of anaphylactic reactions and is associated with significant allergic comorbidity. The prevalence of food allergy has been studied widely in developed countries – less so in developing countries, and minimally in sub-Saharan Africa. Food allergy prevalence studies are currently underway in South Africa (SA).

Studying the prevalence of food allergy

The prevalence of food allergy varies significantly based on geographical region, allergens tested, diagnostic criteria, age of population and concurrent atopic conditions. Self-reporting significantly overestimates the prevalence of food allergy, and sensitisation to foods is much higher than clinically relevant allergies. Therefore, the patient’s history and

68

sensitisation pattern should always be combined with more objective information to prove allergies, ideally by means of supervised incremental oral food challenges – the gold standard in food allergy diagnosis. Recent, large population-based studies, such as the EuroPrevall study in Europe and HealthNuts study in Australia, have used food challenge testing and can be considered flagship studies on the prevalence of food allergy.

Prevalence of food allergy

Despite the large number of foods that may cause immunoglobulin E (IgE)-mediated reactions, most prevalence studies have focused on the most common allergenic foods, i.e. cow’s milk, hen’s egg, peanut, tree nut, wheat, soya, fish and shellfish.

Food allergy peaks in the first two years of life, then diminishes towards late childhood as tolerance to several foods develops. Based on large population studies, the true prevalence of food allergy varies from 1% to >10%, depending on the geographical area and age of the patient

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

Table 1. Summary of prevalence of allergy to individual food allergens Allergen

Prevalence in young children, %

Prognosis

Cow’s milk

0.3 - 3.5 (<0.5 in adults)

>80% outgrown by 16 y

Hen’s eggs

0.5 - 8.0 (<0.5 in adults)

>80% outgrown by 16 y

Wheat

<1

Majority outgrow – 65% by 12 y

Fish

<0.2 (children) and <0.5 (adults)

Usually allergic for life

Shellfish

<0.5 (children) and <2.5 (adults)

Usually allergic for life

Peanut

0.06 - 5.90

20% outgrown

Tree nut

0.2 - 1.4

10% outgrown

Plant food

0.1 - 4.3

being studied. Allergy prevalence to the most common allergenic foods is summarised in Table 1. Cow’s milk and hen’s egg allergies are commonly outgrown: at least 50% by the age of 3 years and the majority by adolescence. Wheat and soya allergies are also generally outgrown, but fish and seafood allergies, as well as peanut and tree nut allergies, tend to persist in at least 80% of patients.

Prevalence of food allergy in SA

The prevalence of food allergy in SA is currently being studied. The prevalence of IgE-mediated food allergy in a cohort of SA children with moderate-to-severe atopic dermatitis (AD) was 40%, the highest allergy rates being to hen’s egg (25%) and peanut (24%). However, children with AD represent a high-risk population for food allergy; therefore, these data do not reflect those

of the general population. Preliminary data from the South African Food Sensitisation and Food Allergy (SAFFA) study, which is investigating food allergy in an unselected cohort of 1 - 3-yearolds, showed an 11.6% prevalence of sensitisation to common foods and a 1.8% prevalence of food allergy. The latter was most common to egg (1.4%) and peanut (1.1%).

Food allergy and anaphylaxis

Food allergy appears to be the most common trigger of anaphylactic reactions in the community, especially in children, in whom food is responsible for up to 85% of such reactions. In adults, shellfish and nut are the most common triggers of food-induced anaphylactic reactions, and in children, peanut, tree nut, milk and egg. The prevalence of anaphylaxis seems to be increasing.

Food allergy and comorbid conditions

Food allergic patients are significantly more likely than non-allergic patients to have concomitant atopic conditions. In patients with food allergy, studies have shown that: • 35 - 71% have evidence of AD • 33 - 40% have evidence of allergic rhinitis • 34 - 49% have evidence of asthma.

Increase in food allergy

Many studies have suggested a true rise in prevalence of true food allergies over the last 10 - 20 years, but this has to be confirmed in further studies. Not only genetic factors, but also several environmental factors may influence the risk of food allergy, such as timing of allergen exposure, microbial exposure, and dietary antioxidant con­ sumption. These need to be investigated urgently to try to curb the increase in food allergy.

Conclusion

Food allergy has increased in several parts of the world over the past 2 - 3 decades, with a prevalence of up to 10% in young children.

Studies in SA show a significant prevalence of food allergy in selected and unselected populations. This has an important impact on public health planning and preparation of allergy services to enable accurate diagnosis and comprehensive management of patients.

S Afr Med J 2015;105(1):68-69. DOI:10.7196/SAMJ.9103

ARTICLE SUMMARY

Diagnosis of food allergy: History, examination and in vivo and in vitro tests D A van der Spuy, A J Terblanche, S Karabus, M Kriel, A I Manjra, E Goddard, C L Gray, A C Lang, S M Risenga, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: M Levin (michael.levin@uct.ac.za)

History

Food allergy cannot be diagnosed by a single test.

A detailed history is an essential initial step in cases of suspected food allergy. It will help to identify potentially involved food by differentiating between potential immunoglobulin E (IgE)- and non-IgE-mediated disease and assessing the severity of reactions.

Aspects of the history should be gathered separately for each food being considered, as a patient may experience different types

69

of reactions with various foods, each of which requires individual diagnostic and management strategies.

An allergy-focused family history should be taken, also of concomitant allergic diseases. History of the episode should include age at first exposure to the food, subsequent exposures and timing, type and severity of all reactions, and treatment received. The form of the food, processing, quantity ingested, other simultaneous ingestions and co-factors should be explored. Patients should be asked about tolerance or reactions to related foods and their ability to

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

eat a full age-appropriate portion containing the most important food allergens. A detailed dietary history should assess the residual diet, details of foods avoided (and reasons for avoidance) and nutritional supplements.

Examination

A physical examination should elicit signs of acute allergy or stigmata of chronic allergic disease. Nutritional status should be assessed by plotting height, weight and weight-for-height. Signs of nutritional deficiencies, such as iron deficiency or rickets, should be sought.

Diagnostic tests

In suspected IgE-mediated allergy, skin-prick tests (SPTs) and/or measurement of serum specific IgE antibodies (ImmunoCAP) to suspected foods is used to prove sensitisation. Sensitisation does not, however, confirm clinical food allergy, as these tests indicate an immunological response to the specific allergen, but the diagnosis requires a clear correlation between the test result and clinical reaction (by positive history or food challenge). The magnitude of the test result (SPT mean wheal size or ImmunoCAP level in kU/L) correlates with the likelihood of clinical allergy, but not the severity of a reaction.

The allergens tested for should be guided by the history, but should be limited to the lowest necessary number to avoid false-positive results. Tests for sensitisation to foods should not be performed when the history indicates that such foods are tolerated. Ninety-five per cent positive predictive values (where a clinical reaction can be predicted in 95% of cases) have been described for immediate reactions, but may be population specific.

There are no validated tests to confirm non-IgE- or mixed IgEand non-IgE-mediated food allergies. Diagnosis of this group of allergies depends on elimination of the suspected food, clearance of symptoms, and re-introduction of the food as an oral food challenge (OFC). In certain cases, endoscopy with biopsy is indicated to evaluate the response to dietary changes.

Diagnostic tests to identify sensitisation in IgE-mediated food allergy Skin-prick test

Allergen extracts, either commercially or directly prepared from the suspected food, are introduced into the skin. A reactive SPT is a sign of sensitisation only, and cannot be considered diagnostic without clear clinical correlation and/or confirmation with an OFC. SPTs are simple and provide rapid results, with good performance, low cost and high sensitivity. Antihistamines should be discontinued for 3 - 5 days before the test. SPTs should be performed in a setting where equipment and medication are available to treat rare, severe reactions, including anaphylaxis.

The mean wheal diameter correlates with the likelihood of clinical allergy, but must be interpreted in light of the clinical history. It is Table 1. Food allergy skin-prick test decision points Food allergen

100% PPV <2 y (wheal diameter)

100% PPV >2 y (wheal diameter)

Cow’s milk

6 mm

>8 mm

Egg

5 mm

>7 mm

Peanut

4 mm

>8 mm

not diagnostic and cannot predict the severity of reactions. Patients with a clear history of a severe reaction to a particular food should not undergo SPTs to that food to prove sensitisation. Where there is uncertainty and an increased risk of a severe reaction, such risks may exceed the benefit. In individuals with atopic dermatitis, positive predictive values (cut-off values for the mean wheal diameter in the common food allergens where a clinical reaction can be predicted in the specified proportion of cases) have been described for immediate reactions (Table 1), but may be population specific.

Allergen-specific serum IgE

Serum IgE specific to a particular allergen can be determined by immunoassays (ImmunoCAP). These assays are validated, reliable and reproducible. Cut-off values for the 95% positive predictive values of a clinical reaction to common food allergens are described in Table 2, but may be population specific.

Table 2. Food allergy ImmunoCAP decision points Food allergen

Decision point (kUA/L)

PPV, %

5 15

95 95

2 7

95 98

Cow’s milk <1 y >2 y Egg <2 y >2 y Peanut

14

100

Fish

20

100

Wheat

26

74

Soya

30

73

Tree nuts

15

95

PPV = positive predictive value.

Purified recombinant allergen-specific IgE tests against individual major allergen components in food may improve the diagnosis of clinical allergy and differentiate true food allergy from cross-reactivity.

Certain component allergens are correlated with persistence of food allergy (e.g. ovomucoid in egg and casein in cow’s milk protein allergy), severity of reactions (e.g. Ara h 2 in peanut allergy) and whether heat-degraded protein will be tolerated (e.g ovomucoid and casein).

Total serum IgE, atopy patch tests and intradermal tests

These tests are not recommended for the routine diagnosis of food allergy.

Non-standardised and unproven procedures

Unconventional tests for allergy diagnosis used by complementary and alternative health professionals include IgG and IgG4 testing, kinesiology or applied kinesiology, iridology, cytotoxic (antigen leukocyte cellular antibody test (ALCAT)/Bryan’s) testing, Vega (electrodermal) testing, and hair analysis. These tests are unvalidated, poorly reproducible, have poor predictive value for allergies and cannot diagnose sensitisation. Practices that claim to affect a cure by removing the patient’s blood, processing it and then re-infusing it into the patient (autohaemotherapy) are strongly discouraged.

PPV = positive predictive value.

S Afr Med J 2015;105(1):69-70. DOI:10.7196/SAMJ.9100

70

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

ARTICLE SUMMARY

Elimination diets and dietary interventions for the management of food allergies A C Lang, D A van der Spuy, E Goddard, A J Terblanche, M Kriel, C L Gray, S Karabus, A I Manjra, S M Risenga, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: A Lang (alison@clinicaldiets.co.za)

The primary therapy for both immunoglobulin E (IgE)and non-IgE-mediated food allergy is strict avoidance of the offending food/s.

It is essential to assess the nutritional status of an infant or child both prior to and during nutritional intervention. Food allergy may be the cause of faltering growth in young children. This may be directly due to malabsorption of nutrients as a result of an allergic enteropathy or indirectly due to extensive dietary restrictions without appropriate nutritious alternatives. Single food avoidance is often straightforward.

Multiple food restrictions usually have greater nutritional challenges.

Dietary restriction should be tailored to meet the nutritional requirements of each patient by a registered dietician who is experienced in food allergies. Regular contact with the healthcare professional is encouraged to adjust management, as tolerance may change over time and the child may outgrow the food allergy. Prolonged unnecessary avoidance may affect nutritional status and quality of life.

Patients should be re-evaluated at regular intervals to see if they have developed tolerance. Generally younger children with milk, soya and egg allergy should be reviewed every 6 - 12 months and older children every 1 - 2 years. Tree nut, fish and shellfish allergy may be lifelong, but re-evaluation performed less frequently (every 2 - 4 years) will determine whether rechallenges are appropriate or exclusion needs to be continued.

Patients should be educated on how to avoid allergens safely by understanding terminology for common ingredients and how to read food labels. They should be made aware of risky situations and crosscontamination.

Information regarding safe, cost-effective and freely available substitutes for the avoided foods should be provided. ‘Free from’ recipes may also be useful.

Cow’s milk substitutes

Parents of infants and young children with cow’s milk protein allergy (CMPA) should be counselled on the most appropriate formula or milk substitute to use, taking into consideration the type of reaction experienced, severity of reaction, age of the patient (need for formula as the sole or a significant part of their diet), religious and cultural views and the cost and palatability of the feed.

Breastfeeding

Mothers of infants with CMPA who are breastfeeding should be supported and encouraged to continue breastfeeding.

Although food allergens in the mother’s diet are transmitted via breastmilk, they may be sufficiently modified to allow inclusion by the mother in varying amounts, as tolerated by the infant. In rare circumstances, an elimination diet will need to be followed by the mother, under dietary guidance to ensure nutritional adequacy.

Partially hydrolysed formulas

Partially hydrolysed infant formulas have not been proven to be hypoallergenic (tolerated by

90% of subjects with proven CMPA) and are therefore not recommended for the treatment of CMPA, but may have a role in prevention of eczema or CMPA in high-risk individuals.

Hypoallergenic formulas

Some extensively hydrolysed and aminoacid-based formulas are truly hypoallergenic.

Table 1 outlines the hypoallergenic formulas available in South Africa.

The recommended feed of choice for the dietary management of mild-to-moderate CMPA in infants not breastfed is an extensively hydrolysed cow’s milk formula.

The recommended formula for the dietary management of non-breastfed infants and children with known severe CMPA is an amino-acid-based formula which is the only completely non-allergenic formula.

Amino-acid-based formula is specifically recommended for: • infants with CMPA with severe or lifethreatening symptoms • patients with ongoing symptoms on an extensively hydrolysed formula • infants with severe growth faltering • in rare circumstances where a stringent exclusion diet in the breastfeeding mother has failed to resolve symptoms in the infant.

Table 1. Commercially available hypoallergenic formulas Product

Intended age*

Description

Neocate (Nutricia)

<1 year

Free amino-acid formula

Aminomed (Nutr-e-Volution)

<1 year

Free amino-acid formula

Neocate Advance (Nutricia)

>1 year

Free amino-acid formula

Comidagen plus (Nutr-e-Volution)

>1 year

Free amino-acid formula

Alfare (Nestle)

<1 year

Whey formula

Allernova Smooth (Novalac)

<1 year

Casein formula

Pepticate (Nutricia)

<1 year

Whey formula

Similac Alimentum (Abbott)

<1 year

Casein formula

Amino-acid-based formulas

Extensively hydrolysed formulas

Formulas specifically formulated for infants <1 year may be used in those >1 year as a supplemental feed in appropriate quantities.

*

71

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

Soya formula

Soya-based formulas may be useful in infants with IgE-mediated CMPA with proven tolerance to soya and some cases of mild-tomoderate non-IgE-mediated CMPA, bearing in mind the increased risk of co-reactivity between CMPA and soya allergy in non-IgEmediated conditions.

Other formulas

There is a high cross-reactivity between mammalian milks; 95% of children allergic to cow’s milk protein react to goat’s milk. These milks are not suitable for CMPA individuals.

Plant-based milks, including rice and oat milks, are not nutritionally adequate, as they contain inadequate protein, calcium and iron. They

are therefore inappropriate as a sole infant formula. They may, however, be used as a substitute in older infants, children and adults in small amounts, provided their nutritional requirements are being met by the rest of the diet.

Probiotics

Probiotics show a moderate risk reduction for eczema in approximately half of all studies, especially those with both pre- and postnatal administration of probiotics; however, at present a role for probiotics in the prevention or treatment of food allergy is not established, and they should not be routinely prescribed.

S Afr Med J 2015;105(1):71-72. DOI:10.7196.SAMJ.9102

ARTICLE SUMMARY

Severe food allergy and anaphylaxis: Treatment, risk assessment and risk reduction S M Risenga, M Kriel, S Karabus, A I Manjra, C L Gray, E Goddard, A C Lang, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: M Levin (michael.levin@uct.ac.za)

An anaphylactic reaction may be fatal if not recognised and managed appropriately with rapid treatment. The drug of choice for treatment is intramuscular adrenaline, with other drugs administered as adjuctive therapy.

In cases of suboptimal response to the initial dose of adrenaline, or with progression of symptoms, a repeat dose should be given.

Basic cardiopulmonary resuscitation should be initiated and maintained to support the airway, oxygenation and circulation. The following steps should be instituted in the initial management of anaphylaxis: • eliminate additional exposure to the allergen • administer intramuscular injection(s) of adrenaline • call for help • place the patient in a recumbent position, with lower limbs elevated, and do not allow the patient to stand up quickly • give supplemental oxygen • administer intravenous fluid in cases of hypotension or incomplete response to intramuscular adrenaline • administer adjunctive therapy (antihistamines and corticosteroids) • admit the patient for close observation for biphasic reactions • instigate or review risk-reduction strategies after an anaphylactic episode.

Adrenaline is the drug of choice in the first-line management of anaphylaxis. There are no absolute contraindications to treatment with adrenaline, which should be administered intramuscularly (not subcutaneously) at a dose of 0.01 mg.kg-1 (0.01 mL/kg of ‘neat’ adrenaline; maximum 0.5 mL) in the mid-anterolateral thigh to achieve peak tissue and plasma concentrations rapidly.

Adrenaline auto-injectors (e.g. EpiPen) are more convenient than ampoules and syringes, which may be difficult to use quickly or accurately in emergency situations – especially by parents or patients.

72

EpiPen injectors are available containing fixed doses of 0.15 mg (children 8 - 25 kg) and 0.30 mg (patients >25 kg) of adrenaline.

H1 antihistamines may be used to treat non-life-threatening manifestations of food allergy. They do not prevent or treat lifethreatening manifestations of anaphylaxis; they are, however, used as adjunctive therapy to adrenaline.

Corticosteroids are often used in anaphylaxis, but they have a delayed mechanism of action and are not useful during an acute anaphylactic episode; however, their anti-inflammatory properties may make them suitable as adjunctive therapy to reduce the risk of biphasic reactions.

Co-factors for reactions. A number of co-factors may augment or amplify the severity of allergic reactions, including exercise, medication, alcohol, fever and infectious diseases. In some cases, concomitant exposure to multiple co-factors is necessary to provoke a reaction, i.e. summation anaphylaxis.

Risk factors associated with the severity of allergic reactions to foods

The severity of reaction to foods cannot be accurately predicted by the size of the wheal of a skin-prick test or the level of specific immunoglobulin E. Factors associated with an increased risk, as shown in epidemiological studies, include co-existing asthma (and poor asthma control), previous severe reactions, delayed administration of adrenaline, adolescents and young adults, reaction to trace amounts of foods, use of non-selective β-blockers and patients in remote areas without medical care.

Risk reduction

Patients should receive education with regard to food allergy and a written emergency treatment plan on strict allergen avoidance (with alternatives), early symptom recognition and appropriate emergency

January 2015, Vol. 105, No. 1

CONTINUING MEDICAL EDUCATION

treatment. Regular follow-up is required for those with food allergy to assess their risk, manage and support their existing treatment, and assess for resolution of food allergies.

Individuals at higher risk of severe reactions include those with a previous anaphylactic reaction to a food, insect sting, latex or unavoidable aeroallergen; co-existent unstable or moderate-to-severe persistent asthma; idiopathic anaphylaxis; and food allergy fooddependent exercise-induced anaphylaxis. There is a relative higher risk for anaphylaxis in mild-to-moderate peanut and/or tree nut allergy in those ≥5 years of age, teenagers or young adults with food allergy, those with reactions to small amounts of food and

those in areas with no medical care. Such patients must be provided with injectable adrenaline (preferably via an auto-injector), training and written instructions on the indications for and method of administration of adrenaline. The patient should also receive a written emergency plan, available at http://www.allergysa.org. The patient’s caregivers should be notified about the food allergy and given a copy of the plan. The patient must always wear a MedicAlert necklace or bracelet and be encouraged to join an appropriate patient support organisation.

S Afr Med J 2015;105(1):72-73. DOI:10.7196/SAMJ.9099

ARTICLE SUMMARY

Vaccination in food allergic patients S Karabus, C L Gray, E Goddard, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: S Karabus (drkarabus@thrivingkids.co.za)

Important potential food allergens in vaccines include egg and gelatin. Rare cases of reactions to yeast, lactose and casein have been reported.

It is strongly recommended that when vaccines are being administered resuscitation equipment must be available to manage potential anaphylactic reactions, and that all patients receiving a vaccine are observed for a sufficient period.

Children who are allergic to egg may safely receive the measlesmumps-rubella (MMR) vaccine; it may also routinely be given in primary healthcare settings. People with egg allergy may routinely receive influenza vaccination; however, some authorities still perform

73

prior skin-prick testing and give two-stage dosing. The purified chick embryo cell culture rabies vaccine contains egg protein and therefore the human diploid cell and purified verocell rabies vaccines are preferred in cases of egg allergy.

Yellow fever vaccine has the greatest likelihood of containing amounts of egg protein sufficient to cause an allergic reaction in allergic individuals. This vaccine should not be routinely administered in eggallergic patients and referral to an allergy specialist is recommended, as vaccination might be possible after careful evaluation, skin-testing and graded challenge or desensitisation.

S Afr Med J 2015;105(1):73. DOI:10.7196/SAMJ.9106

January 2015, Vol. 105, No. 1

201578

DO YOUR PATIENTS GIVE YOU THE ALLERGY SALUTE? Texa Allergy is the market leading second generation antihistamine.1 Recommend yummy banana flavoured Texa Allergy syrup to your child patients.

E F F E C T I V E A F F O R D A B L E H E A LT H C A R E

CONTINUING MEDICAL EDUCATION

ARTICLE

Novel therapies in the management of food allergy: Oral immunotherapy and anti-IgE C L Gray, E Goddard, S Karabus, M Kriel, A C Lang, A I Manjra, S M Risenga, A J Terblanche, D A van der Spuy, M E Levin, for the South African Food Allergy Working Group (SAFAWG) All authors’ degrees, affiliations and conflict of interest statements can be found online at http://dx.doi.org/10.7196/SAMJ.9201 Corresponding author: C Gray (claudiagray.paediatrics@gmail.com)

The process of oral immunotherapy (OIT) consists of a series of dose escalations with the immediate goal of inducing desensitisation and ultimately achieving a state of tolerance.

Owing to the limitations of OIT, including side-effects and lack of proven efficacy in long-term tolerance induction, it is not yet recommended in routine clinical practice and should be restricted to the research setting.

Studies using anti-immunoglobulin E (IgE) antibody in food allergy management are limited, but show promising results. The possible applications are for increasing the sensitivity threshold to certain foods such as peanut, and also for use in combination with OIT to enhance safety and rapidity of the OIT process; however, anti-IgE is not yet licensed for use in food allergy.

S Afr Med J 2015;105(1):74. DOI:10.7196/SAMJ.9105

Oral immunotherapy

Oral immunotherapy (OIT) is the only strategy that aims to achieve a ‘cure’ for the food allergic patient.[1] In most OIT protocols, small amounts of allergen are administered to patients in gradually increasing amounts, with the immediate goal of inducing desensitisation, and ultimately of achieving a state of tolerance.[2-4] With desensitisation, the treated patient manifests a decreased response to the ingested food allergens, but must continue to take daily food doses to maintain non-reactivity. In a state of tolerance, patients with food allergy may safely consume food without following a daily oral food regimen to maintain clinical non-reactivity.

OIT is a lengthy process (months - years) and consists of a series of dose escalations (usually in a controlled setting), with intervening maintenance periods (usually daily doses at home).[5] The safety of OIT is problematic, with allergic reactions, including mild and severe reactions, developing in most patients. Long-term tolerance has not yet been adequately assessed.[6] Owing to the many limitations of OIT, it is not yet recommended in routine clinical practice and should be restricted to the research setting.

Anti-IgE antibody

Currently, the most widely used anti-immunoglobulin E (IgE) antibody is omalizumab.[6] It is approved for treating aeroallergensensitised children and adults (≥12 years of age in the USA, ≥6 years

74

in Europe) with moderate-to-severe persistent asthma inadequately controlled with inhaled corticosteroids.

Studies using anti-IgE antibody in food allergy management are limited, but show promising results. Possible applications are for increasing the threshold of sensitivity to certain foods such as peanut,[7,8] and combined with OIT to enhance safety and rapidity of the OIT process.[9,10] Anti-IgE is however not yet licensed for use in food allergy.

References 1. Nowak-Wegrzyn A, Muraro A. Food allergy therapy: Is a cure within reach? Pediatr Clin N Am 2011;58:511-530. [http://dx.doi.org/10.1016/j.pcl.2011.02.010] 2. Scurlock AM, Vickery BP, Hourihane JO, et al. Pediatric food allergy and mucosal tolerance. Mucosal Immunol 2010;3:345-354. [http://dx.doi.org/10.1038/mi.2010.21] 3. Scurlock AM, Burks AW, Jones SM. Oral immunotherapy for food allergy. Curr Allergy Asthma Rep 2009;9:186-193. [http://dx.doi.org/10.1007/s11882-009-0028-z] 4. Nowak-Wegrzyn A, Sampson HA. Future therapies for food allergies. J Allergy Clin Immunol 2011;127:558-573. [http://dx.doi.org/10.1016/j.jaci.2010.12.1098] 5. Nadeau KC, Kohli A, Iyengar S. Oral immunotherapy and anti-IgE antibody- adjunctive treatment for food allergy. Immunol Allergy Clin N Am 2012;32:111-133. [http://dx.doi.org/10.1016/j.iac.2011.11.004] 6. Humbert M, Beasley R, Ayres J, et al. Benefits of omalizumab as add-on therapy in patients with severe persistent asthma who are inadequately controlled despite best available therapy (GINA 2002 step 4 treatment): INNOVATE. Allergy 2005;60:309-316. [http://dx.doi.org/10.1111/j.1398-9995.2004.00772.]

7. Leung DY, Sampson HA, Yunginger JW, et al. Effect of anti-IgE therapy in patients with peanut allergy.

N Engl J Med 2008;348(11):986-993. [http://dx.doi.org/10.1056/NEJMoa022613] 8. Sampson HA, Leung DY, Burks AW, et al. A phase II, randomized, double-blind, parallel-group, placebo-controlled oral food challenge trial of Xolair (omalizumab) in peanut allergy. J Allergy Clin Immunol 2011;127(5):1309.e1-e10. [http://dx.doi.org/10.1016/j.jaci.2006.11.440] 9. Nadeau KC, Schneider LC, Hoyte L, et al. Rapid oral desensitization in combination with omalizumab therapy in patients with cow’s milk allergy. J Allergy Clin Immunol 2011;127(6):1622-1624. [http:// dx.doi.org/10.1016/j.jaci.2013.09.046] 10. Schneider LC, Rachid R, Lebovidge J, Blood E, Mittal M, Umetsu DT. A pilot study of omalizumab to facilitate rapid oral desensitization in high-risk peanut-allergic patients. J Allergy Clin Immunol 2013;132(6):1368-1374. [http://dx.doi.org/10.1016/j.jaci.2013.09.046]

January 2015, Vol. 105, No. 1

PROFESSIONAL ADVERTISING Tel: 021 681 7000 | E-mail: bronlyne.granger@hmpg.co.za www.hmpg.co.za | www.professionalads.co.za We accept credit card payments - Visa or MasterCard.

A new horizon...

Adult Mental Health Directorate, Royal Cornhill Hospital, Aberdeen, North East Scotland

Consultant Psychiatrists Full-time 40 hours per week

Applications are invited for these replacement Consultant posts from applicants who must be on the Specialist Register or those trained in the UK should have evidence of higher specialist training leading to CCT or be within 6 months of confirmed entry from date of interview or eligibility for specialist registration (CESR) and doctors who are on the GMCâ&#x20AC;&#x2122;s Specialist Register, or are eligible for inclusion in General Adult Psychiatry. The post is based at Royal Cornhill Hospital, a modern purpose built facility in the centre of Aberdeen, part of the University of Aberdeen Medical School Teaching Programme.

Full registration with a licence to practise with the GMC is required.

For more information visit www.gmc-uk.org The postholders will be responsible for leadership of a Mental Health Team providing General Adult Psychiatric services (both Inpatient and Outpatient) to a catchment population in Aberdeen or Aberdeenshire. Catchment populations are based on primary care catchments and there is close liaison between Mental Health Teams and General Practice. There is a full range of specialist services including Old Age Psychiatry, Forensic Psychiatry, Liaison Psychiatry, Eating Disorders, Psychotherapy and Substance Misuse.

The service has fully accredited schemes for Basic and Higher Training in Psychiatry. There is an active CPD Programme for Consultants and many opportunities to develop through Consultant areas.

Aberdeen lies in a region of outstanding natural beauty with both quiet sandy beaches and high mountains within 20 miles of the city centre. This historic city has many architectural splendours and the use of its sparkling granite has earned Aberdeen the name of the Silver City. Recognised as the oil capital of Europe, Aberdeen nevertheless retains its old-fashioned charm and character making it an attractive place in which to live. Scotlandâ&#x20AC;&#x2122;s main ski slopes are also easily accessible. The local theatres and music hall attract a wide ranging cultural programme including many national and international celebrities. Schools, both state and private schools are of a high standard.

Informal enquiries are welcomed by Dr C Robertson, Clinical Director, Adult Mental Health Services on +44 (0)1224 557 541.

To apply please visit www.nhsgrampian.org/jobs and search for Ref No SS9505. Closing date 30th January 2015.

CPD

JANUARY 2015

The CPD programme for SAMJ is administered by Medical Practice Consulting: CPD questionnaires must be completed online at www.mpconsulting.co.za

True (A) or false (B): Evaluating the iPhone as a screening tool for hearing loss in the developing world 1. The elderly and patients receiving potentially ototoxic medication (chemotherapeutic agents, second-line antituberculosis regimens and antiretroviral therapy) are at high risk of developing deafness.

2. Presbycusis (adult-onset hearing loss) is generally predominantly high frequency and sensorineural.

3. Elderly persons with hearing loss are more likely to develop cognitive impairment and dementia than their contemporaries without hearing loss.

SA food allergy consensus document 2014 11. Between 1% and 6% of people who think they have a food allergy test positive.

12. Food allergy peaks in the first 2 years of life, but then diminishes towards late childhood as tolerance to several foods develops over time.

Severe blunt thoracic trauma: Differences between adults and children 4. In a study of patients admitted to a trauma intensive care unit, the majority of injuries in the 5 - 14-year age group had occurred in pedestrian motor vehicle collisions.

5. The incidence of pulmonary contusion in the above study was lowest in the paediatric group, as a result of their more elastic chest walls.

6. Children are more likely than adults to sustain head injury together with their thoracic trauma, because of their proportionally larger head to thoracic ratio.

Epidemiology of IgE-mediated food allergy 14. Cowâ&#x20AC;&#x2122;s milk protein allergy peaks in the first year of life.

15. Two-thirds (66%) of children outgrow egg allergy by the age of 5 years.

Regulation of HIV receptor expression in cervical epithelial cells

by Gram-negative bacterial lipopolysaccharide 7.

Sexually transmitted infections caused by the Gram-negative bacteria Chlamydia trachomatis and Neisseria gonorrhoeae are associated with an increased risk of HIV acquisition in South African (SA) women.

The Vaccine and Cervical Cancer Screen (VACCS) project: Accep­ tance of human papillomavirus (HPV) vaccination in a schoolbased programme 8. Persistent infection with oncogenic HPV is an essential step in the development of invasive cervical cancer.

9. While HPV is highly infectious, it does not cause disease in all cases, with most individuals clearing infections.

10. This implementation project in SA schools demonstrated that HPV vaccination is practical and safe.

Exclusion diets and challenges in the diagnosis of food allergy 13. Exclusion diets are an important diagnostic tool when there is no clear relationship between ingestion of food and symptoms.

Diagnosis of food allergy: History, examination and in vivo and in vitro tests 16. A detailed history is the first step in diagnosis of food allergy.

17. A reactive skin-prick test can be regarded as diagnostic.

Elimination diets and dietary interventions for the management of food allergies 18. Food allergy may be the cause of faltering growth in young children.

Severe food allergy and anaphylaxis: Treatment, risk assessment and risk reduction 19. The drug of choice for treatment of anaphylaxis is intravenous glucocorticoid.

Vaccination in food allergic patients 20. The incidence of vaccine anaphylaxis is less than 1 per million for all vaccines.

CPD questions include articles from CME. The full versions of each article can be found on the SAMJ website (http://www.samj.org.za)

A maximum of 3 CEUs will be awarded per correctly completed test.

INSTRUCTIONS 1. Read the journal. All the answers will be found there.

2. Go to www.mpconsulting.co.za to answer the questions.

Accreditation number: MDB001/007/01/2014 (Clinical)

January 2015, Vol. 105, No. 1

CALL FOR PAPERS

A new international journal supported by PEPFAR and published by the South African Medical Association

HEALTH SYSTEMS NEED STRENGTHENING – BUT HOW? Can TB be cured? Yes. Can we eradicate polio? Definitely. So why are these diseases still out there, causing suffering and hastening death? Why do proven, effective interventions stop short of achieving their potential?

Because weak health systems – the combination of actors, institutions, policies and resources that are directed towards improving population health – prevent well-intentioned policies translating into health gains. The problem is, there is little useful evidence to help policy makers decide how to make their health systems stronger – or even to gauge what stronger really means.

BEST EVIDENCE = RESEARCH + EXPERIENCE + CONTEXT Strengthening Health Systems is a new international peer-reviewed open-access journal that aims to tackle the knowledge gap in health and development by systematically capturing, in the scientific record, the totality of health systems experience and evidence, regardless of whether the authors are academics, policy makers, donors or implementers.

Current understanding of the complex systems that govern health is so poor that we are unable to meaningfully measure, monitor, or manipulate them. And without robust tailored tools like medicine’s Randomised Controlled Trial to facilitate systematic investigation and evidence-gathering, health and development is akin to what medicine was 50 years ago: an art based on expert opinion, rather than a science based on evidence.

Strengthening Health Systems aims to address this science deficit and forge links between policy makers, academics and implementers by publishing not only the best academic research but also crucial experiential knowledge. Field-derived experience provides real-world insights into the contextual factors that are so often missing from the scientific record but which have profound influence on programme success, system performance and health outcomes.

NOW SEEKING SUBMISSIONS Strengthening Health Systems invites submissions that: • Promote greater understanding of health systems in all contexts • Highlight interventions that work and those that do not • Identify lessons that future policy makers and programme designers can learn from, and • Highlight knowledge gaps that will refine the health system research agenda.

With no page fees nor subscription costs, SHS is committed to ensuring wide dissemination and maximal usage of published works.

CONTACTS Please contact the Editor, Hannah Kikaya (hannah.kikaya@hmpg.co.za), with your enquiries and submissions.

This Call for Papers is made possible by the generous support of the American people through the United States Agency for International Development (USAID).

The contents are the responsibility of Strengthening Health Systems and do not necessarily reflect the views of USAID or the United States Government.

TJDR (CT) 40674/E

WE’RE OBSESSED WITH THE FUTURE. AT MEDICLINIC, OUR DECISIONS ARE CALCULATED. OUR ACTIONS ARE CONSIDERED. WE SHARE EXPERT KNOWLEDGE AND COLLECTIVE SKILL FROM OUR HOSPITALS AROUND THE WORLD. WITH THIS KNOWLEDGE, WE CAN CONTRIBUTE TO A FUTURE HEALTH SYSTEM IN WHICH VERIFIABLE, COST-EFFECTIVE QUALITY HEALTHCARE WILL NOT BE COMPROMISED.

EXPERTISE YOU CAN TRUST. SOUTH AFRICA • SWITZERLAND • UAE • NAMIBIA www.mediclinic.co.za