SAMJ Vol 105, No 12 (2015)

DECEMBER 2015

VOL. 105 NO. 12

Climate change and health 997, 1018 Ebola – views from the field and ethical challenges 1006, 1008, 1012 Should doctors sue patients?

1010 #FeesMustFall and universal health coverage 1014 Health risks of excess solar UV radiation – our children are ignorant!

1024 Outbreak of carbapenemase-producing K. pneumoniae 1030 HIV viral load measurement on dried blood spots 1036 PET-CT evaluation of pulmonary mass lesions in a TB-endemic area 1049 CME: Rheumatology

1070-1078

IFC

DECEMBER 2015

VOL. 105 NO. 12

GUEST EDITORIAL

SAMJ

997

Climate change, public health and COP21 – a South African perspective C Y Wright, M Norval, P N Albers

EDITOR-IN-CHIEF Janet Seggie, BSc (Hons), MD (Birm), FRCP (Lond), FCP (SA)

999

EDITOR’S CHOICE

DEPUTY EDITOR Bridget Farham, BSc (Hons), PhD, MB ChB

CORRESPONDENCE 1000

A matter of context – time to clinically validate 9-month infant HIV testing in South Africa(?)

A Haeri Mazanderani, L Fairlie, C A Madevu-Matson, V Black, G G Sherman

1001

Rural district hospitals: Ambulance services, staff attitudes, and other impediments to healthcare delivery J du T Zaaijman

1001

Gonadal pathology in a girl with 45,X/46,XY mosaicism T Kemp, L Smith, S Akerman

1003 1004

SAMA president, medicopolitical veteran, psychiatrist and treatment pioneer Attacking ‘prejudice’ against generics could save SA billions

SAMJ FORUM

1006

PHOTO ESSAYS Ebola: Experiences from the field – Liberia R Burton

1008

Ebola: Personal view from the field – Sierra Leone T H Boyles

1010

MEDICINE AND THE LAW Is it ever justified for doctors to sue their patients whose allegations against them have been dismissed by the courts or the Health Professions Council of South Africa?

D J McQuoid-Mason

MANAGING EDITOR Ingrid Nye

NEWS EDITOR Chris Bateman | Email: chrisb@hmpg.co.za PRODUCTION MANAGER Emma Jane Couzens

1012

Reflections on ethical challenges associated with the Ebola epidemic S R Benatar

1014

#FeesMustFall and the campaign for universal health coverage J Doherty, D McIntyre

1016

Growing genomic research on the African continent: The H3Africa Consortium M Ramsay

REVIEW

CEO AND PUBLISHER Hannah Kikaya | Email: hannahk@hmpg.co.za

TECHNICAL EDITORS Emma Buchanan Paula van der Bijl

EDITORIALS

ASSOCIATE EDITORS Q Abdool Karim, A Dhai, N Khumalo, R C Pattinson, A Rothberg, A A Stulting, J Surka, B Taylor, M Blockman HMPG

IZINDABA

1018

EDITORS EMERITUS Daniel J Ncayiyana, MD (Groningen), FACOG, MD (Hon), FCM (Hon) JP de V van Niekerk, MD, FRCR

Climate change is catchy – but when will it really hurt?* A Sweijd, C Y Wright, A Westwood, M Rouault, W A Landman, M L MacKenzie, J J C Nuttall, H Mahomed, T Cousins, K Winter, F Berhoozi, B Kalule, P Kruger, T Govender, N Minakawa

DTP & DESIGN Carl Sampson HEAD OF SALES AND MARKETING Diane Smith | Tel. 012 481 2069 Email: dianes@hmpg.co.za JOURNAL ADVERTISING Charles William Duke Benru de Jager Reneé van der Ryst Ladine van Heerden | Tel. 012 481 2121 Email: ladinev@hmpg.co.za ONLINE SUPPORT Gertrude Fani | Tel. 072 463 2159 Email: publishing@hmpg.co.za FINANCE Tshepiso Mokoena HMPG BOARD OF DIRECTORS Prof. M Lukhele (Chair), Dr M R Abbas, Dr M J Grootboom, Mrs H Kikaya, Prof. E L Mazwai, Dr M Mbokota, Dr G Wolvaardt

RESEARCH

ISSN 0256-9574

1024

School students’ knowledge and understanding of the Global Solar Ultraviolet Index C Y Wright, A I Reeder, P N Albers

SAMA website: www.samedical.org Journal website: www.samj.org.za

1030

Molecular characterisation and epidemiological investigation of an outbreak of blaOXA-181 carbapenemase-producing isolates of Klebsiella pneumoniae in South Africa R K Jacobson, M R Manesen, C Moodley, M Smith, S G Williams, M P Nicol, C M Bamford

1036

Measurement of viral load by the automated Abbott real-time HIV-1 assay using dried blood spots collected and processed in Malawi and Mozambique F Erba, D Brambilla, S Ceffa, F Ciccacci, R Luhanga, Z Sidumo, L Palombi, S Mancinelli, M C Marazzi, M Andreotti, M Giuliano

995

December 2015, Vol. 105, No. 12

1039

Time for a culture change? Suboptimal compliance with blood culture standards at a district hospital in Cape Town* M S Abrahams, A C Whitelaw, H Orth

1044

Diagnosing childhood pulmonary tuberculosis using a single sputum specimen on Xpert MTB/RIF at point of care* N Gous, L E Scott, S Khan, G Reubenson, A Coovadia, W Stevens

1049

The diagnostic accuracy of integrated positron emission tomography/computed tomography in the evaluation of pulmonary mass lesions in a tuberculosis-endemic area* R du Toit, J A Shaw, E M Irusen, F von Groote-Bidlingmaier, J M Warwick, C F N Koegelenberg

1053

Diabetes mellitus and non-traumatic lower extremity amputations in four public sector hospitals in Cape Town during 2009 and 2010* G L Dunbar, D A Hellenberg, N S Levitt

1057

Investigating the association between diabetes mellitus, depression and psychological distress in a cohort of South African teachers* A K Domingo, L Asmal, S Seedat, T M Esterhuizen, C Laurence, J Volmink

1061

An electronic colonoscopy record system enables detailed quality assessment and benchmarking of an endoscopic service* A Benamro, J L Bruce, D L Clarke

1064

Dyspepsia prevalence and impact on quality of life among Rwandan healthcare workers: A cross-sectional survey* R Bitwayiki, J T Orikiiriza, F Kateera, P Bihizimana, B Karenzi, P Kyamanywa, T D Walker

CONTINUING MEDICAL EDUCATION

1070

GUEST EDITORIAL Musculoskeletal disorders – disease burden and challenges in the developing world A Gcelu, A A Kalla

1071

REVIEW Lupus nephritis: A simplified approach to diagnosis and treatment in South Africa I G Okpechi, A Gcelu, O I Ameh

1075

ARTICLES Evidence-based treatment of systemic lupus erythematosus and its complications* B Hodkinson, M A Makda

1075

A clinical update on paediatric lupus* G W Spittal, L B Lewandowski, C Scott

1076

Infections in the management of rheumatic diseases: An update* S A Botha-Scheepers, B Sarembock

1076

Meeting the challenges in the diagnosis of inflammatory myopathies* M Manie

1077

Juvenile idiopathic arthritis – an update on its diagnosis and management* C Scott, N Brice

1077

Approach to lower back pain* F Moosajee, A A Kalla

1078

Gout and hyperuricaemia* M N Abrahams

*Full article available online only.

PROFESSIONAL ADVERTISING

CPD QUESTIONS

CONTENTS LISTED IN Index Medicus (Medline) Excerpta Medica (EMBASE) Biological Abstracts (BIOSIS) Science Citation Index (SciSearch) Current Contents/Clinical Medicine SAMJ SUBSCRIPTION RATES Local subscriptions R1 248.00 p.a.

Foreign subscriptions R2 832.00 p.a.

Single copies R104.00 local, R236.00 foreign Members of the South African Medical Association receive the SAMJ only on request, as part of their membership benefit.

Subscriptions: Tel. 012 481 2071 Email: members@samedical.org The SAMJ is published monthly by the Health and Medical Publishing Group (Pty) Ltd, Co. registration 2004/0220 32/07, a subsidiary of SAMA. HEAD OFFICE Health and Medical Publishing Group (Pty) Ltd Block F, Castle Walk Corporate Park, Nossob Street, Erasmuskloof Ext 3, Pretoria, 0181 Tel. 012 481 2069 Email: dianes@hmpg.co.za EDITORIAL OFFICE Suites 9 & 10, Lonsdale Building, Gardener Way, Pinelands, 7405 Tel. 021 532 1281 | Cell. 072 635 9825 Email: publishing@hmpg.co.za Please submit all letters and articles for publication online at www.samj.org.za © Copyright: Health and Medical Publishing Group (Pty) Ltd, a subsidiary of the South African Medical Association Use of editorial material is subject to the Creative Commons Attribution – Non-commercial Works Licence. http://creativecommons.org/licenses/by-nc/3.0 Printed by TANDYM PRINT

Juvenile hyenas.

Photo: Susan Flegg.

996

December 2015, Vol. 105, No. 12

GUEST EDITORIAL

Climate change, public health and COP21 – a South African perspective Climate change and health in South Africa

Observed climate trends and projections for South Africa (SA) suggest important directional changes, with annual average temperatures likely to increase by approximately 2°C more than the predicted average global increase of 2oC by 2100.[1,2] Extreme temperature events, such as heat waves and continuous stretches of very hot days,[3] will probably become more common. The ability to predict temperature has improved in recent years, providing sound opportunities for assessing temperaturerelated health impacts in SA.[4] There is less certainty regarding future rainfall, but spatial and temporal changes are expected, with some western areas of SA having less rain and more wind, while eastern areas will have more rain. These climatic changes place SA among one of the most vulnerable countries in the world, especially given the current high incidence of several life-threatening diseases, combined with poverty and inequality of access to health.

Evidence suggests that climatic factors play an important role in the diseases common in SA. Forty percent of morbidity and mortality in children aged under 13 years in Limpopo Province was considered attributable to the combined influence of temperature and rainfall in an analysis of two decades of climate data, despite this being a relatively short period on a climate scale.[5] Several diseases have direct associations with specific climatic factors. Diarrhoeal infections were linked in one study to anomalously dry seasons and increases in monthly average maximum temperatures in sub-Saharan Africa.[6] Malaria in Limpopo is more significantly associated with temperature than rainfall,[7] and models suggest a possible expansion in malaria zones in Africa, including SA in the future.[8] Schistosoma worms, the cause of schistosomiasis (including bilharzia), may thrive in warmer water and emergent transmission in previously unaffected areas may occur.[9,10] Dengue virus, carried by mosquitoes, may spread into SA from Mozambique and Angola.[11] Indirect effects of climate change on health include impacts on agriculture and food security. Water scarcity, poor water quality and unreliable access to water threaten the production of staple food crops at both subsistence and commercial levels. Changes in crop species, growing regimens and farming approaches may be necessary.[12] For example, agro-biodoversity may be possible through promotion of neglected and under-utilised indigenous crop species that are able to adapt to water-scarce conditions.[13] Pest risk is an additional threat to crops, especially maize in eastern Africa, and possibly in SA too. For example, predicted warming may allow Chilo partellus, a damaging cereal stem borer, to expand its range from warm lowlands into higheraltitude areas, highland tropics and moist transitional regions.[14] Climate change also threatens social structures and political factors in SA. Resource-poor communities currently face a number of stresses that curtail quality of life, livelihood options and opportunities. Climate stress and extreme events may exacerbate this problem further and possibly even undermine current strategies for development.[15] Coping with climate stressors and finding adaptive techniques, for example for water storage or farming, will require complex and localised solutions.[16] Food insecurity and extreme events could also lead to mass population migration impacting on disease transmission patterns, burdening healthcare systems and pressurising demand for local services.

997

The extent to which a changing climate is likely to create other public health pressures in SA is largely unknown, but it is considered to be a potentially substantial burden.[17] Given the high incidence of HIV/AIDS and tuberculosis, as well as the increasing incidence of chronic illnesses, particularly cardio­ vascular and respiratory (asthma and bronchitis) diseases and cancers, in addition to climateexacerbated diseases, the need for basic services such as water, sanitation and waste removal among populations with pre-existing medical conditions is paramount. Furthermore, vulnerable groups need options for reducing temperatures in warm weather, such as air conditioning and electric fans. These methods rely on electricity, which is often not available in SA. Predicted increases in temperature in the future heighten the pressing need for innovative ideas towards planning, preparedness and interventions to curtail the public health impacts of climate change in the country.

Medical emergency-type response needed

In its recent report,[18] the Lancet Commission developed a ‘Medical Emergency Model’ to map climate change-health impacts and the policy responses that would be necessary to ensure the high­ est attainable standards of health for populations worldwide.

Addressing the complex interactions of climate change and health, including the direct, indirect and social determinants of health, is essential to prevent the unravelling of the last century’s gains in development and global health. In fact, responding to climate change could be the greatest global health opportunity of the 21st century.

Diverse co-benefits for climate and health relate to changes in diet, transport, insulation and fuel sources. The rapid phase-out of coal-fired power stations to protect cardiovascular and respiratory health is recommended in the report. At a time when SA is facing an energy crisis, and given its reliance on coal for electricity produc­ tion, perhaps an opportunity is being missed to kill ‘two birds with one stone’. Clean, renewable energy options should be seriously considered. Cities need to provide communities with environments for healthy lifestyles, such as by creating suitable infrastructures for walking and cycling. This is a unique opportunity for a developing country such as SA to find ‘green’, sustainable solutions when implementing basic services. For solutions to succeed, technology is not the stumbling block, neither is finance; the barrier is the will to connect the finance to the policy and politics for a rapid transition to low-carbon economies.[18]

The way forward

In December 2015, France will host the 21st Session of the Confer­ ence of the Parties to the United Nations Framework Convention on Climate Change (COP21/CMP11). The main goal is to reach a new international agreement on climate to limit global warming to less than 2°C. Climate projections indicate that SA is likely to exceed this global average increase, with warming up to 4°C.[2] SA may therefore be considered to be one of the countries facing the greatest challenge regarding climate change-related impacts on human health – this in addition to the present quadruple burden of infectious and chronic diseases, interpersonal violence and injuries, and ill-health associated with poverty.[19]

December 2015, Vol. 105, No. 12

GUEST EDITORIAL

The SA public health community has an important role to play in accelerating progress to tackle the adverse impacts of climate change on health. This entails effectively communicating health and climate risks, ensuring that climate change mitigation strengthens public health, adapting to new and emerging health risks, and reducing direct air pollution emissions. Planning and preparedness remain key effective measures for adapting to climate change in the public health sector. All population groups require, and deserve, basic public health systems and services including clean water, sanitation and (access to) essential primary healthcare.

Furthermore, data and research are needed to build the knowledge base for climate-health decisions, policy-making and planning. Local behaviour and beliefs require consideration, as health-seeking attitudes differ between communities and traditional healers may be consulted in lieu of formal healthcare. The National Department of Health Climate Change and Health Adaptation Plan provides the framework to implement policy, programmes and research to understand and manage the possible impacts of climate change on public health in SA. A significant effort by all relevant government departments at all levels, together with civil society, industry and other key sectors, is needed to realise the goals of the Plan and to ensure the best possible protection of the health of South Africans.

Caradee Y Wright South African Medical Research Council and University of Pretoria, South Africa cwright@mrc.ac.za

Mary Norval University of Edinburgh, Scotland

1. Engelbrecht F, Bopape M-J. High resolution projected climate futures for southern Africa. Presented at the 27th Annual Conference of the South African Society for Atmospheric Sciences: The Interdependent Atmosphere, Land and Ocean, 22-23 September 2011, Hartbeespoort, North-West Province, South Africa.

2. Niang I, Ruppel OC, Abdrabo MA, et al. Africa. In: Barros VR, Field CB, Dokken DJ, et al., eds.

Climate Change 2014: Impacts, adaptation, and vulnerability. Part B: Regional aspects. Contribution of Working Group II to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change.

Cambridge: Cambridge University Press, 2014:1199-1265.

3. Garland RM, Matooane M, Engelbrecht FA, et al. Regional projections of extreme apparent temperature days in Africa and the related potential risk to human health. Int J Environ Res Public Health 2015:12(10):12577-12604. [http://dx.doi.org/10.3390/ijerph121012577] 4. Lazenby MJ, Landman WA, Garland RM, DeWitt DG. Seasonal temperature prediction over southern Africa and human health. Meteorological Applications 2014;21(4):963-974. [http://dx.doi. org/10.1002/met.1449] 5. Thompson AA, Matamale L, Shonisani DK. Impact of climate change on children’s health in Limpopo Province, South Africa. Int J Environ Res Public Health 2012;9(3):831-854. [http://dx.doi.org/10.3390/ ijerph9030831] 6. Bandyopadhyaya S, Kanjib S, Wanga L. The impact of rainfall and temperature variation on diarrheal prevalence in sub-Saharan Africa. Applied Geography 2012;33(April):63-72. [http://dx.doi. org/10.1016/j.apgeog.2011.07.017] 7. Komen K, Olwoch J, Rautenbach H, Botai J, Adebayo A. Long-run relative importance of temperature as the main driver to malaria transmission in Limpopo Province, South Africa: A simple econometric approach. Ecohealth 2015;12(1):131-143. [http://dx.doi.org/10.1007/s10393-014-0992-1] 8. Tanser FC, Sharp B, le Seur D. Potential effect of climate change on malaria transmission in Africa.

Lancet 2003;362(9398):1792-1798. [http://dx.doi.org/10.1016/S0140-6736(03)14898-2] 9. McCreesh N, Nikulin G, Booth M. Predicting the effects of climate change on Schistosoma mansoni transmission in eastern Africa. Parasit Vectors 2015;8(4). [http://dx.doi.org/10.1186/s13071-0140617-0] 10. Pederson UB, Stendel M, Midzi N, et al. Modelling climate change impact on the spatial distribution of fresh water snails hosting trematodes in Zimbabwe. Parasit Vectors 2014;7(December):536. [http:// dx.doi.org/10.1186/s13071-014-0536-0] 11. Fullerton LM, Dickin SK, Schuster-Wallace CJ. Mapping the global vulnerability to dengue using the water-associated index. United Nations University, 2014. http://inweh.unu.edu (accessed 18 September 2015).

12. Oyekale AS. Climate change induced occupational stress and reported morbidity among cocoa farmers in south-western Nigeria. Ann Agric Environ Med 2015;22(2):357-361. [http://dx.doi. org/10.5604/12321966.1152095] 13. Chivenge P, Mabhaudhi T, Modi AT, Mafongoya P. The potential role of neglected and underutilised crop species as future crops under water scare conditions in sub-Saharan Africa. Int J Environ Res Public Health 2015;12(6):5685-5711. [http://dx.doi.org/10.3390/ijerph120605685] 14. Khadioli N, Tonnang ZE, Muchugu E, et al. Effect of temperature on the phenology of Chilo partellus (Swinhoe) (Lepidoptera, Crambidae): Simulation and visualization of the potential future distribution of C. partellus in Africa under warmer temperatures through the development of life-table parameters. Bull Entomol Res 2014;104(6):809-822. [http://dx.doi.org/10.1017/ S0007485314000601] 15. Reid P, Vogel C. Living and responding to multiple stressors in South Africa – glimpses from KwaZuluNatal. Glob Environ Change 2006;16(2):195-206. [http://dx.doi.org/10.1016/j.gloenvcha.2006.01.003] 16. Thomas DSG, Twyman C, Osbahr B, Hewitson B. Adaptation to climate change and variability: Farmer responses to intra-seasonal precipitation trends in South Africa. Clim Change 2007;83(3):301-322. [http://dx.doi.org/10.1007/s10584-006-9205-4] 17. Abayomi A, Cowan MN. The HIV/AIDS epidemic in South Africa: Convergence with tuberculosis, socioecological vulnerability and climate change patterns. S Afr Med J 2014;104(8):583-586. [http:// dx.doi.org/10.7196/SAMJ.8645] 18. Costello A, Abbas M, Allen A, et al. Managing the health effects of climate change: The Lancet Commissions. Lancet 2015;373(9676):1693-1733. [http://dx.doi.org/10.1016/S0140-6736(09)60935-1] 19. Norman R, Matzopoulos R, Groenewald P, Bradshaw D. The high burden of injuries in South Africa.

Bull World Health Organ 2007;85(9):649-732. [http://dx.doi.org/10.2471/BLT.06.037184]

Further reading Admasu K, Debessa K. Action to protect human health from climate change: An African perspective. Lancet 2015. Published online 23 June 2015. [http://dx.doi.org/10.1016/S0140-6736(15)61139-4] Watts N, Adger WN, Agnolucci P, et al. Health and climate change: Policy responses to protect public health: The Lancet Commissions. Lancet 2015;6736(15):60854-60856. [http://dx.doi.org/10.1016/ S0140-6736(15)60854-6]

Patricia N Albers South African Medical Research Council, South Africa

S Afr Med J 2015;105(12):997-998. DOI:10.7196/SAMJ.2015.v105i12.10232

998

December 2015, Vol. 105, No. 12

EDITOR’S CHOICE

CME: Rheumatology

December’s CME focuses on musculoskeletal (MSK) disorders, which represent a major disease burden and challenges in the developing world, mainly because of lack of resources and poor training in diagnosis and management. Many patients with diseases such as systemic lupus erythematosus and rheumatoid arthritis have reduced life expectancy and face a lifetime of pain and other problems. The advent of the synthetic disease-modifying anti-rheumatic drugs has significantly improved outcomes, but the challenge of early diagnosis and initiation of treatment remains in the developing world – and these drugs are expensive.

MSK disorders still rank highest in prevalence as causes of chronic ill health, long-term disability and consultation with health professionals, as was shown in the Burden of Global Disease 2010 Study. This is against the background of MSK disorders contributing only 3.4% and 1.7% of the total disease burden in the developed and developing world, respectively. Osteoarthritis and low back pain remain the largest contributors to the global disability burden. The Bone and Joint Decade 2000 - 2010, endorsed by many organisations including the World Health Organization and many governments, has acknowledged the rising burden of MSK disorders. Dr Ayanda Gcelu and Prof. Asgar Kalla have put together an excellent issue of CME that will provide generalists in all spheres with a greater understanding of these important diseases.

while six projects focus on the rise of non-communicable diseases (encompassing stroke, diabetes, kidney disease, rheumatic heart disease, obesity and cancer) on the continent.

Ebola update

As the acute Ebola epidemic in West Africa flickers out (42 days having passed, at the time of writing, without a fresh infection in two of the three countries affected), it was dismaying to learn that the infection has reared its ugly head again: in the case of volunteer Scottish nurse Pauline Cafferkey (reminding us of the virus’s tendency to hide in immunologically privileged sites,[8] raising the spectre of unrecognised complications among survivors in countries in which healthcare services were decimated by the outbreak), and a few new cases in Guinea. Statements from the Royal Free Hospital, London, and NHS Greater Glasgow and Clyde said that the 39-year-old nurse, no longer infectious, was well enough to return to Scotland and had been transferred to the Queen Elizabeth University Hospital in Glasgow to complete her hospital treatment. Her condition is stable.[9] During the recent West African Ebola epidemic, SA’s own heroes and heroines were among those who ‘risked and persisted, sacrificed and saved’ and were named Time Person of the Year for 2014.[10] Rosie Burton and Tom Boyles were among them, and offer their own insights in their personal views from the field.[11,12]

Climate change

The COP21: Conference of the Parties to the United Nations Frame­ work Convention on Climate Change (UNFCCC), ‘Towards an inclusive climate negotiation’,[1] is due to take place in Paris in the first week of December, hence our guest editorial,[2] which explores the adverse health effects accruing from the potential 4oC rise in temperature in South Africa (SA) and Africa.

Over 190 nations will be represented at the conference, with over 40 000 participants and delegates from around the world. Its main focus will be to devise a new international consensus on how the world could keep global warming below 2°C. For the first time, each country is expected to have announced its contribution towards reducing the impact of climate change, and a report will be made available to the general public before the official commencement of the conference. It is said that a climate fund of USD100 billion per year – the money to be sourced from private and public agencies, from 2020 – from developed countries to assist developing countries in fighting climate change is to be launched.[3] I suspect that we should not hold our respective breaths regarding consensus, or the proposed fund.

We have stressed in earlier issues the adverse health effects of unem­ ployment. Africa’s greatest resource is its youth, yet 70% are without jobs; in SA, over 50% of young people are jobless.[4] It is said that the climate risk and the job risk, in SA and sub-Saharan Africa,[3] could be addressed simultaneously if the Paris conference prioritises the green economy.

According to the South African Green Economy Modelling Report,[5] prioritising investments in the energy sector will maximise the employment creation potential of a green economy. The report further states that ‘If the investments are spread equally across all sectors, then the agriculture sector will deliver the highest employment creation potential.’[5,6]

Genomic research in Africa

Ramsay[7] outlines the role of the H3Africa Consortium and high­ lights the need to include Africans in global genomic research, and, importantly, to do so from an African perspective. The H3Africa projects address infectious diseases, including genetic determinants of susceptibility to trypanosomiasis and tuberculosis, and studies on the microbiome in cervical cancer and in respiratory diseases,

999

Ms Cafferkey thanked staff at the Royal Free Hospital, including senior matron Breda Athan and consultant Dr Michael Jacob, for the care she had received.[9]

To close …

The SAMJ wishes its readers, authors and reviewers all best wishes over the holiday season – and easier and happier links in 2016!

JS 1. United Nations Conference on Climate Change. http://www.cop21.gouv.fr/en/cop21-cmp11/cop21main-issues (accessed 16 September 2015).

2. Wright CY, Norval M, Albers PN. Climate change, public health and COP21 – a South African perspective. S Afr Med J 2015;105(12):997-998. [http://dx.doi.org/10.7196/SAMJ.2015.v105i12.10232] 3. COP21: Towards an inclusive climate negotiation in Paris. http://www.csag.uct.ac.za/2015/07/17/cop21-towards-an-inclusive-climate-negotiation-in-paris/ (accessed 16 September 2015).

4. Global Youth Unemployment Trends – a generation at risk. http://www.ilo.org/global/research/globalreports/global-employment-trends/youth/2013/lang–en/index.htm (accessed 16 September 2015).

5. South African Green Economy Modelling (SAGEM) Report. https://www.environment.gov.za/sites/ default/files/docs/greeneconomy_modellingreport.pdf (accessed 16 September 2015).

6. Modernising agriculture to address youth unemployment in Africa. http://www.sabc.co.za/news/a/5 aa916004577a29db0aab7c7c599c9eb/Modernising-agriculture-to-address-youth-unemployment-inAfrica-20141409 (accessed 16 September 2015).

7. Ramsay M. Growing genomic research on the African continent: The H3Africa Consortium. S Afr Med J 2015;105(12):1016-1017. [http://dx.doi.org/10.7196/SAMJ.2015.v105i12.10281] 8. Burton R. Ebola: Lessons learned. S Afr Med J 2015;105(9):698-699. [http://dx.doi.org/10.7196/ SAMJnew.8492] 9. BBC news. Ebola nurse Pauline Cafferkey ‘has made full recovery’. http://www.bbc.com/news/ukscotland-34791692 (accessed 15 November).

10. Time. Von Drehle D, Baker A. Person of the Year. The Ebola fighters: The ones who answered the call. 10 December 2014. time.com/time-person-of-the-year-ebola-fighters/ (accessed 19 October 2015).

11. Burton R. Ebola: Experiences from the field – Liberia. S Afr Med J 2015;105(12):1006-1008. [http:// dx.doi.org/10.7196/SAMJ.2015.v105i12.10239] 12. Boyles TH. Ebola: Personal view from the field – Sierra Leone. S Afr Med J 2015;105(12):1008-1009. [http://dx.doi.org/10.7196/SAMJ.2015.v105i12.9935]

December 2015, Vol. 105, No. 12

ADVERT TO BE SOLD

CORRESPONDENCE

A matter of context – time to clinically validate 9-month infant HIV testing in South Africa(?)

To the Editor: In their recent article, Fairlie et al.[1] rightly point out the need for increased identification and early treatment of postnatally HIV-infected infants, and suggest that testing at 9 months of age using HIV rapid tests (HRTs) will assist in this regard. While I agree with them on this point, I am less certain that such a practice will reduce the number of HIV polymerase chain reaction (PCR) tests done with resultant cost savings, as they have concluded. All HRTs that are positive at 9 months will have to be confirmed with HIV PCR testing, as maternal antibodies may persist well beyond this time point. Delayed seroreversion at >18 months of age in HIVuninfected infants has been described in Malawi, Vietnam, Brazil and the USA. The US study detected anti-HIV antibodies by enzymelinked immunosorbent assay (ELISA) testing in 14% of uninfected infants >18 months of age, with the median time to seroreversion occurring at >13 months of age.[2] The slower time to seroreversion from previously established cut-offs appears to be related to the introduction of combination antiretroviral therapy for prevention of mother to-child transmission during pregnancy, although the exact mechanisms of anti-HIV antibody clearance remain unclear.

Whereas there are anecdotal observations of delayed seroreversion in uninfected infants >18 months of age from South Africa (SA), to the best of my knowledge there are no local published data regarding time to loss of antibodies using rapid tests in infants exposed to World Health Organization Option B/B+. Hence there is concern that if routine use of HRTs is implemented at 9 months for all HIVexposed infants, without clinical validation of HRT kits beforehand, a considerable proportion of these infants may require further HIV PCR testing. Furthermore, those infants who are still breastfeeding will require additional HIV testing 6 weeks after cessation of breast­ feeding, with further repeat HIV PCR testing being required if seroreversion still has not occurred at this time. This will not only add to the escalating costs of infant diagnosis but will probably have a negative impact on the throughput and turnaround time of very early infant testing, which should remain the priority, at least for the time being. Fairlie et al.[3] base their findings on data suggesting that HRTs are able to detect seroreversion in the majority of HIV-exposed uninfected infants by 8 - 10 months of age. Whereas this may have been the case 10 years ago, it does not necessarily hold true today.

Before a multicentre nationwide pilot study, as suggested by the authors, clinical validation of different HRTs needs to be prioritised within the current Option B+ context.

Ahmad Haeri Mazanderani

Centre for HIV and Sexually Transmitted Infections, National Institute for Communicable Diseases, Johannesburg, South Africa, and Department of Medical Virology, University of Pretoria, South Africa ahmadh@nicd.ac.za 1. Fairlie L, Madevu-Matson CA, Black V, Sherman GG. Time to implement 9-month infant HIV testing in South Africa. S Afr Med J 2015;105(9):765-768. [http://dx.doi.org/10.7196/SAMJnew.8175] 2. Gutierrez M, Ludwig DA, Khan SS, et al. Has highly active antiretroviral therapy increased the time to seroreversion in HIV exposed but uninfected children? Clin Infect Dis 2012;55(9):1255-1261. [http:// dx.doi.org/10.1093/cid/cis662] 3. Sherman GG, Lilian RR, Coovadia AH. The performance of 5 rapid human immunodeficiency virus tests using whole blood in infants and children: Selecting a test to achieve the clinical objective. Pediatr Infect Dis J 2012;31(3):267-272. [http://dx.doi.org/10.1097/INF.0b013e31823752a0]

Fairlie et al. respond: We thank Dr Haeri Mazanderani for his interest in our article and for the opportunity to raise the profile of the debate on early infant diagnosis (EID) of HIV. While we acknowledge that the SA Department of Health (DoH) guidelines[1] are excellent in terms of establishing EID, there is a gap once infants exit the current 18-week visit.[2] If they are breastfeeding

1000

and test negative before 18 weeks or their mothers previously tested HIV negative and seroconvert during breastfeeding, they usually do not get tested again until they become ill many years later.

Despite numerous efforts, measles immunisation rates decrease by 18 months; HIV testing rates are low at 18 months, and postbreastfeeding HIV testing rates are unknown but are assumed to be low.[3] Since measles immunisation rates at 9 months are high[3] and many infants have discontinued breastfeeding by then, the 9-month visit presents a perfect opportunity for an Expanded Programme on Immunisation (EPI)-integrated HRT. We agree that delayed seroreversion in infants would affect the model we described by increasing the number of HIV PCR tests required at 9 months.[2] Gutierrez et al.[4] ask ‘Has highly active antiretroviral therapy increased the time to seroreversion in HIV exposed but uninfected children?’ and describe an older median age (13.9 months) at seroreversion than previous studies. Their study was a retrospective record review of children exposed to maternal combination antiretroviral therapy (cART) in the USA.[4] They were unable to define a clear mechanism to explain these findings, but noted a significant association between late seroreversion and protease inhibitor (PI)-based ART (p=0.026) and caesarean section (p=0.0052), respectively.[4] The majority of SA pregnant women on Option B+ receive first-line cART (a non-nucleoside reverse transcriptase inhibitor, usually efavirenz, and not PI-based therapy) and SA DoH guidelines do not recommend routine caesarean section for HIV-infected women, most of whom give birth vaginally, which is associated with earlier seroreversion.[1] In our article we proposed using HRTs that have been shown to detect seroreversion at an earlier age than the more sensitive laboratory-based HIV ELISA test used

by Gutierrez et al.[2,4,5] Although unknown, the differences in ART, delivery method and proposed rapid test used in SA suggest that our HIV-exposed uninfected infants will serorevert at an earlier age.

In the absence of data on the timing of seroreversion in HIVexposed infants in the SA context, it is imperative that we do not disadvantage children by assuming that the findings of one study conducted under different field conditions in a different population will apply elsewhere. Even with lower rates of seroreversion at 8 - 10 months, negative HRTs would be expected to predominate in HIVexposed, uninfected infants if appropriate HRTs are used. A test to screen children at <1 year on site, at a routine, well-attended EPI visit. would provide an additional opportunity to diagnose HIVinfected children early and initiate ART at a high-risk time, reducing morbidity and mortality.

We believe that the time is right to include, rather than exclude, children from HIV testing beyond early infant diagnosis. Adults are able to test frequently in the health system and are encouraged to do so, whereas HIV testing in children errs on the side of fewer tests, yet children have the highest morbidity and mortality if not diagnosed early.

Piloting 9-month HRTs at EPI visits in SA for HIV-exposed infants will encourage maternal retesting postpartum, as recommended in the guidelines, provide an opportunity for infant HIV PCR testing in those with a positive HRT, and allow for monitoring of seroreversion rates in the context of Option B+ in our local population using a different HRT. Furthermore, if maternal HIV antibodies persist in 14% of HIVexposed children aged 18 months and seroreversion is incomplete at 24 months in HIV-exposed and uninfected children,[4] additional HIV PCR testing is urgently required in HRT-positive children aged >18 months in SA to prevent lifelong cART in uninfected children.

In summary, while we appreciate the points made, we believe that the current infant testing strategy lacks an EPI-based test at a fixed time point after 18 weeks and under 1 year, and that 9-month HIV testing could enhance EID and earlier ART initiation and replace the

December 2015, Vol. 105, No. 12

ADVERT TO BE SOLD

CORRESPONDENCE

post-weaning HIV test in HRT-negative infants who are no longer breastfeeding. Additional research and monitoring are essential.

Lee Fairlie

Wits Reproductive Health and HIV Institute, University of the Witwatersrand, Johannesburg, South Africa lfairlie@wrhi.ac.za

Caitlin Anna Madevu-Matson

Wits Reproductive Health and HIV Institute, University of the Witwatersrand, Johannesburg, South Africa, and ICAP at Columbia University, Mailman School of Public Health, Columbia University, New York, USA

Vivian Black

Wits Reproductive Health and HIV Institute, University of the Witwatersrand, Johannesburg, South Africa

Gayle G Sherman

Department of Paediatrics and Child Health, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa, and Centre for HIV and STI, National Institute for Communicable Diseases, Johannesburg, South Africa 1. National Department of Health, South Africa. National Consolidated Guidelines for the Prevention of Mother-To-Child Transmission of HIV (PMTCT) and the Management of HIV in Children, Adolescents and Adults. NDoH, April 2015.

2. Fairlie L, Madevu-Matson CA, Black V, Sherman GG. Time to implement 9-month infant HIV testing in South Africa. S Afr Med J 2015;105(9):765-768. [http://dx.doi.org/10.7196/SAMJnew.8175] 3. Massyn N, Day C, Dombo M, Barron P, English R, Padarath A, and editors. District Health Barometer 2012/13. Durban: Health Systems Trust, 2013.

4. Gutierrez M, Ludwig DA, Khan SS, et al. Has highly active antiretroviral therapy increased the time to seroreversion in HIV exposed but uninfected children? Clin Infect Dis 2012;55(9):1255-1261. [http:// dx.doi.org/10.1093/cid/cis662] 5. Sherman GG, Lilian RR, Coovadia AH. The performance of 5 rapid human immunodeficiency virus tests using whole blood in infants and children: Selecting a test to achieve the clinical objective. Pediatr Infect Dis J 2012;31(3):267-272. [http://dx.doi.org/10.1097/INF.0b013e31823752a0]

S Afr Med J 2015;105(12):1000-1001. DOI:10.7196/SAMJ.2015.v105i12.10160

emergency: ‘If you have a medical aid, you must go to a private hospital [the nearest private hospital is 350 km away], this hospital is only for indigent patients.’ According to the same writer, a private patient was told ‘You are not sick enough, you cannot see the doctor’; the patient was sent away without being assessed, only to have to return later.

Other first-hand reports of thinly disguised political posturing and racially loaded statements abound. I hesitate to comment on the apparently dysfunctional obstetric services, the unacceptable peri­ natal mortality rate, etc. (all of which is public knowledge locally) at this same rural district facility, which has very reasonable infrastructure, but is in dire and urgent need of revival and re-organisation. I suspect that it is but one of many such examples in the EC. It is obvious that interdepartmental intervention is urgently required. Many things are needed when restoring a rural district hospital to be the essential nucleus of healthcare delivery in remote areas, as has been clearly outlined.[1,2] The purpose of this letter is to stress once more the importance of a reliable ambulance service to and from these hospitals, along roads that are usable. The rural hospital cannot play its role as ‘hub’ without a connecting transport lifeline. The attitudes of some staff members at some district hospitals have to be addressed. Proper training (and re-training) in the basic tenets of the ethos of healthcare are a top priority. Can South Africa ever hope to deliver acceptable healthcare to all its inhabitants, even in the remotest rural areas? I am of the opinion that it is possible. It will, however, require a concerted effort, and on the part of many also a change of heart. A positive and helpful attitude at all times is of the utmost importance when serving patients. It is always reassuring to have confidence and pride in one’s local village hospital, however small it may be. We all need to work towards that goal.

J du T Zaaijman

Rural district hospitals: Ambulance services, staff attitudes, and other impediments to healthcare delivery

Inxuba Yethemba, Eastern Cape, South Africa zaaij@adsactive.com

To the Editor: I was pleased to note the recent article and corres­pondence in the SAMJ dealing with the revival of rural district hospitals.[1,2] However, many problems have to be overcome before this essential ‘hub’ of rural medical services will be restored. Two such problem areas were recently highlighted in our local and regional newspapers. I live in the rural Eastern Cape (EC), so my comments pertain only to this area.

According to an article in Die Burger, Oos-Kaap (2 October 2015), there is a huge shortage of facilities, especially casualty facilities, in EC rural areas. Casualty facilities will obviously not spring up miraculously, without properly functioning rural district hospitals to house and administer them. The article summarised a March 2015 report by the South African Human Rights Commission, after extensive research into the extremely poor health service delivery to patients in EC rural areas, and highlighted the insufficient ambulance services in the area: 12 ambulances to serve one million people v. the accepted norm of one ambulance per 10 000 people. It also stressed the poor road conditions that make some remote areas inaccessible even if an ambulance is available when and where required. This reported lack of effective, reliable transport of patients is a major impediment to rural health care delivery, even should the district hospitals be re-engineered to full function.

The meagre services that are available at some of these existing rural district hospitals are sometimes crippled further by negative staff attitudes. A recent series published in a local newspaper (Advertiser, 28 August and 18 September 2015) reported unfortunate and unpleasant experiences at our local district hospital. The author expressed disappointment and shock about the (non-)treatment her father received at the casualty ward when he attended with an acute medical

1001

1. Le Roux KWDP, Couper I. Rural district hospitals – essentials cogs in the district health system – and primary healthcare re-engineering. S Afr Med J 2015;105(6):440-441. [http://dx.doi.org/10.7196/ SAMJ.9284] 2. Bac M, Hugo J. Rural district hospitals – essential cogs in the district health system – and primary healthcare re-engineering. S Afr Med J 2015;105(9):702. [http://dx.doi.org/10.7196/SAMJnew.8379]

S Afr Med J 2015;105(12):1001. DOI:10.7196/SAMJ.2015.v105i12.10174

Gonadal pathology in a girl with 45,X/46,XY mosaicism

To the Editor: A 13-year-old girl presented with short stature and clitoromegaly. The clitoromegaly had been noticed at birth, but medical attention was only sought at age 13. She had not experienced menarche and had a female gender identity. She had no learning disability.

Her height was 136 cm, below the 5th percentile for age.

Phenotypical abnormalities suggestive of Turner syndrome included a short neck and bilateral clinodactyly of her 4th digits. She had clitoromegaly (length 25 mm and width 10 mm). She had a normal vaginal opening and labia majora, but no labia minora were present.

The urethral opening was in the normal female position. No gonads were palpable. She had minimal axillary hair, Tanner stage 2 breast development and Tanner stage 2 pubic hair development.

Special investigations showed a follicle-stimulating hormone level of 66.5 IU/L and an oestradiol level of <73 pmol/L, in keeping with primary gonadal failure. Her serum testosterone level was significantly elevated at 5.4 nmol/L. G-banding with trypsin treatment and Giemsa stain (GTG-banded) chromosome analysis showed a mosaic karyotype with two cell lines: five cells with a 45,X

December 2015, Vol. 105, No. 12

ADVERT TO BE SOLD

CORRESPONDENCE

karyotype and 15 cells with a 46,XY karyotype. On echocardiography a small patent ductus arteriosus (PDA) with left-to-right shunting was detected. Ultrasound examination showed no renal anomalies.

The patient was referred for gynaecological treatment owing to the risk of development of malignant germ cell tumours.[1] Clitoral reduction and bilateral gonadectomies were performed and a pycnotic uterus was found. The right gonad had macroscopic features of a testis (Fig. 1). Sections showed a fallopian tube, testicular tissue comprising prepubertal tubuli seminiferi with an interstitium with Leydig cell hyperplasia, and a small rim of ovarian stroma. On the left a streak gonad was found. Sections showed a transected fallopian tube, ovarian stroma, and tissue in keeping with an epididymus.

Growth hormone therapy was initiated with a good response.

Female hormone replacement therapy is to commence when the patient reaches an acceptable height. She is awaiting definitive management of the PDA. Patients with 45,X/46,XY mosaicism can share clinical features with Turner syndrome, including short stature and cardiac anomalies. [2,3] PDA has rarely been described in association with 45,X/46,XY mosaicism. [3] Recognition of this condition is important because of the risk of malignancy if the gonads are kept in situ.[1] Patients with 45,X/46,XY mosaicism benefit from growth hormone therapy, similar to patients with Turner syndrome and as demonstrated in our patient.[4]

A

B

Tanja Kemp, Lizl Smith, Simon Akerman

Endocrinology Unit, Department of Internal Medicine, Steve Biko Academic Hospital and University of Pretoria, South Africa kemp.tanja@gmail.com 1. Cools M, Pleskacova J, Stoop H, et al. Gonadal pathology and tumor risk in relation to clinical characteristics in patients with 45,X/46,XY mosaicism. J Clin Endocrinol Metab 2011;96(7):E1171-E1180. [http://dx.doi.org/10.1210/jc.2011-0232] 2. Tosson H, Rose SR, Gartner LA. Description of children with 45,X/46,XY karyotype. Eur J Pediatr 2012;171(3):521-529. [http://dx.doi.org/10.1007/s00431-011-1600-9] 3. Farrugia MK, Sebire NJ, Achermann JC, Eisawi A, Duffy PG, Mushtaq I. Clinical and gonadal features and early surgical management of 45,X/46,XY and 45,X/47,XYY chromosomal mosaicism presenting with genital anomalies. J Pediatr Urol 2013;9(2):139-144. [http://dx.doi.org/10.1016/j. jpurol.2011.12.012] 4. Johansen ML, Hagen CP, Rajpert-De Meyts E, et al. 45,X/46,XY mosaicism: phenotypic characteristics, growth, and reproductive function – a retrospective longitudinal study. J Clin Endocrinol Metab 2012;97(8):E1540-E1549. [http://dx.doi.org/10.1210/jc.2012-1388]

S Afr Med J 2015;105(12):1001-1002. DOI:10.7196/SAMJ.2015.v105i12.10176

Fig. 1. A: Microscopic appearance of the left gonad, with a transected fallopian tube (white centre arrow) on the left and ductus deferens and epididymis tissue (black arrow) on the right. B: Microscopic appearance of the right gonad, with tubuli seminiferi on the left (black arrow) and ovarian stroma on the right (white centre arrow).

This month in the SAMJ ...

Natasha Gous* is Senior Medical Scientist in the Research and Diagnostics Unit, Department of Molecular Medicine, Faculty of Health Sciences, University of the Witwatersrand. She has more than 8 years’ experience in laboratory research and recently completed her PhD in molecular medicine. Her main research efforts are directed towards the evaluation and implementation of new diagnostic strategies for infectious diseases, mainly in the fields of HIV and tuberculosis (TB). Recently her interests have focused on point-of-care testing and how it can be used to improve and integrate HIV and TB testing services in South Africa (SA). Natasha was also part of the National Priority Programme team responsible for the roll-out of the GeneXpert technology in SA. * Gous N, Scott LE, S Khan S, Reubenson G, Coovadia A, Stevens W. Diagnosing childhood pulmonary tuberculosis using a single sputum specimen on Xpert MTB/RIF at point of care. S Afr Med J 2015;105(12):1044-1048. [http://dx.doi.org/10.7196/SAMJ.2015.v105i12.8585]

Rudolph du Toit† obtained his MB ChB (cum laude) at Stellenbosch University in 2006. He completed his training as a physician at Tygerberg Hospital in 2015 and is currently working as a specialist physician in private practice in Windhoek, Namibia. †

u Toit R, Shaw JA, Irusen EM, von Groote-Bidlingmaier F, Warwick JM, Koegelenberg CFN. The diagnostic accuracy of integrated positron emission tomography/ D computed tomography in the evaluation of pulmonary mass lesions in a tuberculosis-endemic area. S Afr Med J 2015;105(12):1049-1052. [http://dx.doi.org/10.7196/ SAMJ.2015.v105i12.10300]

1002

December 2015, Vol. 105, No. 12

S AM F

ing

Prescrib

d Tract an m orming d Blood-F

ascular

System s

al atologic

and y System itourinar es x Hormon al Hormon ystemic ons reparati r ctives fo Anti-Infe General Use ic System d astic an nts Antineopl odulating Age Immunom em st Sy skeletal Musculo Nervous

Central

System

F M SA

frican South A es Medicin ry Formula

frican South A ormulary es F Medicin

es n Medicin ritten w th Africa The Sou searched and linical is re of C ry n la io u is iv rm Fo eD of bers of th niversity by mem cology of the U on with Pharma n, in collaborati ls. a w Cape To care profession health frican South A ulary d by the Publishe ociation, the form cists, Ass rma Medical at doctors, pha ncerned co is aimed sts and others ctive -effe denti nurses, e safe and cost ines. with th bing of medic prescri

ucts

sitic Prod

Antipara

System piratory

on, Associati p, u Medical African Publishing Gro 0040 th u So al oria The d Medic ge, Pret Health an , Lynnwood Rid 74789 X-XX-X PO Box 8-1-XXXXX ISBN 97

Res

Sensory

Organs edia

M Contrast

12th n Editio

doif tCaipeoTon ’s E h t 2 1ve of the Universitymcology anwdnthe

up, itiati Phara A joint in ion of Clinical l Publishing Gro n.

Divis Medica ical Associatio d n a h d Healt ican Me outh Afr for the S rs e sh li pub

oning

t of Pois

Treatmen

The ESSENTIAL MEDICAL REFERENCE for every healthcare professional!

The convenient pocket-sized design enables you to fit it comfortably into your hospital bag or coat pocket, so it can always be at hand for ready reference. South African Medicines Formulary (SAMF), a joint initiative of the University of Cape Town’s Division of Clinical Pharmacology and the Health and Medical Publishing Group, publishers for the South African Medical Association, provides easy access to the latest, scientifically accurate information, including full drug profiles, clinical notes and special prescriber’s points. The thoroughly updated 12th edition of SAMF is your essential reference to the rational, cost-effective and safe use of medicines.

Please direct all order queries to: Diane Smith Tel: 012 481 2069 Health and Medical Publishing Group

Email: dianes@hmpg.co.za Tax invoice to be posted on dispatch of order

IZINDABA

SAMA president, medico­political veteran, psychiatrist and treatment pioneer Keeping a cool head and listening and communi­ cating while being ‘relevant and realistic’ is what the new President of the South African Medical Association (SAMA), top psychiatrist Prof. Denise White, a 12-year veteran of SAMA leadership, hopes to bring to her executive and council.

Prof. Denise White, new President of the South African Medical Association.

Battle-hardened in the trenches of the unprecedented June 2009 doctor strike (while acting as SAMA chairperson) and a pivotal negotiator for huge improvements in doctors’ salary packages via changes to commuted overtime a decade earlier (as chairperson of SAMA’s public sector committee), White, now 70, is both ‘honoured’ and ready for a more ceremonial role. Her calm composure and steady hand in the face of thousands of angry, striking young public sector doctors, outraged by two years of government heel-dragging in implementing the occupation-specific dispensation (OSD) and at odds with SAMA over tactics to bring about change, won her widespread respect among both medical friends and foes. What was a short-lived but highly effective revolution (striking doctors kept one step ahead of their employers by networking via Facebook to orchestrate wildcat nationwide unprotected strikes, at one stage even commandeering SAMA’s

HQ to stage a press conference) led to the first decent increases for doctors in decades, with White and the SAMA Exco subsequently championing the defence and job reinstatement of hundreds of young physicians.

White changed an aspect of global psychiatric practice, receiving international recognition early in her career when she and a colleague identified a link between patients admitted to Groote Schuur’s psychiatric wards with catatonic illness and neuroleptic malignant syndrome (NMS), with an associated 20% mortality rate.

By probing why some patients developed NMS and others not, they identified the administration of neuroleptic drugs to patients with a catatonic illness as the major culprit. When the international scientific and cultural embargoes were lifted on apartheid South Africa (SA), she immediately became a highly sought-after speaker at international psychiatric conferences.

White was described as ‘an inspirational negotiator, a quiet and dedicated leader and a clinician of immense skill and intuition’ on receiving this year’s South African Society of Psychiatrists Distinguished Service Award. As to her willingness to accept the appointment as President of SAMA, White says ‘I think I can add some value.

Obviously I am very humbled being elected as President. It is a ceremonial, titular role, and I think I have an advantage in having had “hands-on” experience with the function and dynamics of the organisation as a member of its Exco in the past. As vice-chair I sat next to five or six different presidents. I won’t be in the front line politically, but hopefully I will be able to offer some insight into processes that won’t be unfamiliar to me.’

Two years before leaving the SAMA leadership cadre in 2009, White was appointed to the Medical and Dental Professions Board (MDB), where she served two 5-year terms and was appointed to several subcommittees of the Board dealing with matters of professional conduct, as well as serving on the health committee of Council (assessing and ruling on ‘impaired’ practitioners), tasks she says she found ‘very worthwhile’.

1003

December 2015, Vol. 105, No. 12

‘It felt like I was really making a contri­ bution to the profession as a whole.

As a Board member our mandate was largely non-political and carried out strictly within the legislative framework governing the operations of the HPCSA [Health Professions Council of South Africa],’ she added. Asked her opinion on the ministerial probe led by her UCT colleague, cardiologist Prof. Bongani Mayosi into dysfunction in the statutory HPCSA, under which the MDB (one of 12 professional boards) falls, she had this to say: ‘The most pertinent issue is that any recommendations they make are put into effect. The report must not just gather dust.’

SAMA has a strained relationship with the HPCSA, given that the MDB pays the lion’s share of its costs but suffers vastly diluted bargaining power. There are longstanding calls by SAMA for the MDB to step outside the HPCSA and form its own council (like the nurses and pharmacists), giving it far more autonomy and individual voice.

Of the HPCSA dysfunction probe, White said that with many ‘critical, experienced’ people having left the Council (shaken by administrative fraud scandals and charges of not carrying out its statutory duties), a great deal of institutional memory had been lost – when the entire structure was dependent on efficient and effective administration.

White changed an aspect of global psychiatric practice, receiving international recognition early in her career when she and a colleague identified a link between patients admitted to Groote Schuur’s psychiatric wards with catatonic illness and neuroleptic malignant syndrome, with an associated 20% mortality rate.

Asked what lessons she had learnt and could use in her counsel of the SAMA executive, White replied: ‘Communication is hugely important. To listen and communi­ cate around issues and to be realistic and

IZINDABA

relevant in dealing with matters. To keep channels of communication open with various stakeholders is essential. SAMA is a collec­tive – teamwork is necessary in brainstorming and decision-making. We have to put personal issues aside for the greater good of health in SA. SAMA is a critical role-player and we have to stay internally intact as a team when big matters such as National Health Insurance are discussed.’ She said that the organisation was challenged by the fine line it has to tread between politics and professional issues, as well as the need to ‘keep its ear to the ground’ to ensure that it was fulfilling its mandate for members. ‘The challenge is being effective for very disparate groups.

To be a trade union and to represent the interests of both public and private sector doctors. It’s not an easy task. This is not an organisation where you can step up to any leadership position being timid or naive – you have to don an asbestos shield to deflect the heat of a crisis and remain cool.’ She said she was fortunate no longer to be in the day-to-day political decision-making engine room, and hoped she could be ‘that person who can add a perspective in times of crisis or decision-making’.

Unsurprisingly, White’s ‘signature theme’ during her year-long presidential tenure will be mental health. With the lifetime adult prevalence of common mental dis­ orders in SA standing at 30%, a full 11%

of citizens experiencing substance abuse problems and maternal mental disorders three times higher in low-income areas, her advocacy will be highly valued by coalface organisations. Says White: ‘The maternal mental disorder statistic (for one) is totally unacceptable. Again, it appears the country is not focusing on developing its resources.

The multiprofessional team is essential for the delivery of good mental health. You need mental health workers out there in the community clinics and rural areas.

It can’t just be hospital based. We need to work out ways of task shifting, with doctors supervising those who actually do the work. I don’t think we’ve developed an effective and adequate human resources plan – we have the research but what comes of it? Unfortunately mental health is the Cinderella of the healthcare professions – always the Oliver Twist.’

Grossly inadequate and unco-ordinated government spending on the treatment of mental illness – which affects one in six South Africans – is costing SA 2.2% of its annual GDP.[1] It is also failing to reduce the 230 attempted suicides recor­ded daily, while 48% of people living with HIV/ AIDS continue to suffer from a mental health condition.[2] Mental health disorders comprise five of the ten leading causes of health disability in SA. According to research published by White’s colleagues, UCT head of psychiatry Prof. Dan Stein

and his associate Prof. Crick Lund, mental health issues cost the SA economy six times the cost of their treatment. Over the past two decades, a seemingly progressive national policy shift to decentralisation of care has reduced the number of mental hospitals, with no corresponding increase in community-based mental health faci­ lities, leading to 7.7% fewer beds across all provinces and a downward spiral in delivery.[3] White takes over the SAMA presidency reins from groundbreaking medical edu­ c­ ationalist, former Medical Research Council chairperson, advisor on upgrading academic hospitals and Eastern Cape healthcare planning commissioner Prof.

Lizo Mazwai.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(12):1003-1004.

DOI:10.7196/SAMJ.2015.v105i12.10301 1. Lund C, Myer L, Stein D, Williams DR, Flisher AJ. Mental illness and lost income among adult South Africans. Soc Psychiatry Psychiatr Epidemiol 2013;48(5):845-851. [http://dx.doi. org/10.1007/s00127-012-0587-5] 2. Lund C, Kleintjes S, Kakuma R, Flisher AJ, the MHaPP Research Programme Consortium. Public sector mental health systems in South Africa: Inter-provincial comparisons and policy implications. Soc Psychiatry Psychiatr Epidemiol 2010;45(3):393- 404. [http://dx.doi.org/10.1007/s 00127-0090078-5] 3. Lund C, de Silva M, Plagerson S, et al. Poverty and mental disorders: Breaking the cycle in low and middle income countries. Lancet 2011;378(9801):1502-1514. [http://dx.doi. org/10.1016/S0140-6736(11)60754-X]

Attacking ‘prejudice’ against generics could save SA billions The use of generics in South Africa (SA) is growing in line with trends in the UK and the USA – but is still nowhere near their levels.

Local overall healthcare spend could be reduced by ZAR4 billion should users take advantage of the newer generics on the market.

With SA healthcare costs off the charts generally for brutally argued reasons (which the Competitions Commission enquiry will recommend on within months), this kind of saving is a no-brainer – but will require a major shift in perceptions on the part of both doctors and their patients.

This is according to Vivian Frittelli, CEO of the National Association of Pharma­

ceutical Manufacturers (NAPM, which represents the interests of generic medicine manufacturers and marketers in SA and the mission of which is to champion greater access to medicine for the SA population), and the first SA President of the International Generic Pharmaceutical Alliance. He told Izindaba that generics were often wrongly perceived by both doctors and patients to be inferior because they were cheaper.

Sophisticated marketing by originator drug companies reinforced this message.

‘I worked for an originator company for 20-odd years and one of our messages was this: if your kid had meningitis, would you use generics? It’s the fear factor, and prejudices many doctors against generics – which the patient obviously follows.’

1004

December 2015, Vol. 105, No. 12

Frittelli said the ZAR4 billion saving was based on 18% of originator drugs having come off patent, allowing generic drugs to fill the gap and therefore be available for the taking. However, use nowhere near matched this because of die-hard traditional consumer behaviour patterns.

A recent NAPM study comparing the cheapest generics v. originator drug prices found that the difference in price of the 200 most prescribed medicines in the private sector had risen to a whopping 56.1% in favour of generics. Explains Frittelli: ‘In other words, basket for basket, you’d save 56.1% by using generics.’ Since 2010 there had been a steady increase in the cost advantage of generics over originator drugs.

Considering that production standards

IZINDABA

and manufacturing costs for both original and generic medicines were similar, these findings were ‘highly significant’, says Frittelli. According to IMS Health, a global organisation that tracks data at sales level, generics account for about 65% of all items dispensed in SA’s private sector, yet cost only 40% of the ZAR22 billion expenditure on drugs.

Using claims data from more than 1 million medical aid members, Mediscor, a pharmacy benefit management organi­ sation, puts generic use at 56%, and growing. Based on data gleaned from IMS Health, every 1% increase in the use of generics would save consumers around R270 million. ‘These savings would enable medical schemes to offer improved benefits or to curb increases in premiums to their members. They also provide a direct benefit for consumers paying for medicines out of pocket or through their medical scheme savings accounts,’ adds Frittelli.

equivalents, while at least 48% of generics are priced at 50% or more below their originator equivalents. In practical terms, for a patient with asthma and allergic rhinitis, compli­ cated once by a fungal infection in the throat due to inhaler use, the savings over a year could be nearly ZAR4 000 should generics

‘I worked for an originator company for 20-odd years and one of our messages was this: if your kid had meningitis, would you use generics? It’s the fear factor, and prejudices many doctors against generics – which the patient obviously follows.’

‘As life expectancy increases and the cost of medicines escalates, the importance of the generics industry is being highlighted as it allows more people greater access to healthcare. The value proposition presented by generics cannot be disputed,’ Frittelli said.

Discovery backs NAPM findings

Discovery Health’s publication Medicine Summit Journal 2015, using data from medical aids administered by Discovery, supports the NAPM findings, reporting a 58.8% utilisation of generics by volume and 46.6% by value. The Discovery summit also revealed that 65% of generic medicines are priced at 40% below their originator

be used. The trend in SA follows that in the UK, where more than two-thirds of all medicines dispensed by the National Health Service (NHS) are generics yet cost only around 29% of the NHS drugs bill, and the USA, where nearly eight out of ten prescriptions filled are for generics, causing expenditure on drugs to slow despite an increase in the price of prescription drugs.

Mr Vivian Frittelli, CEO of the National Association of Pharmaceutical Manufacturers and the first South African President of the International Generic Pharmaceutical Alliance.

Chris Bateman chrisb@hmpg.co.za S Afr Med J 2015;105(12):1004-1005.

DOI:10.7196/SAMJ.2015.v105i12.10317

HP FILLER ADVERT 1005

December 2015, Vol. 105, No. 12

FORUM

PHOTO ESSAY

Ebola: Experiences from the field – Liberia R Burton, BSc, PhD, MBBS, MRCOG, FCP (SA), Cert ID Phys (SA) Physician and Infectious Diseases Specialist, Khayelitsha District Hospital, Cape Town, South Africa, and Department of Medicine, University of Cape Town Corresponding author: R Burton (rosie@polka.co.za)

The experience of all those who have worked with Ebola during the current outbreak has been different, and varied by time and place. I worked with Médicins sans Frontières in Monrovia during October/November 2014. This was the first-ever outbreak of Ebola virus disease in the overcrowded and impoverished areas of a capital city; Ebola was spreading rapidly, and case management had to be upscaled on an unprecedented basis. It was also a time of many questions: for clinicians, these centred on how to optimise survival, and how to maximise care in a resource-limited environment.

S Afr Med J 2015;105(12):1006-1008. DOI:10.7196/SAMJ.2015.v105i12.10239

The Médicins sans Frontières (MSF) Treatment Centre, Monrovia

The MSF Ebola Treatment Centre in Liberia, ELWA 3, opened in August 2014 and was the largest treatment centre ever built. Its 240 beds far exceeded the 20-bed centres in previous outbreaks. ELWA 3 was a field hospital; wards were tents, and there were no actual beds, but mattresses on the floor. Hygiene facilities consisted of latrines and stand-pipes for water and chlorine. The 15-person tents opened into a large outside courtyard within the high-risk area, where the patients who could mobilise would sit, pass the time of day, support each other, and help the less able patients.

Ebola virus disease (EVD) affects people who are in close contact with one another, so affects families. We frequently had three generations of the same family admitted, including children and babies. Families arrived together, but often did not go home together.

We often discovered that family groups were related when people died and there was widespread grieving. Mortality at ELWA was 60%, as for the average mortality this outbreak.[1] The number of new cases in Monrovia peaked in September 2014, when the treatment centre was overwhelmed with patients, and was unable to admit everyone needing care.[2] People were dying outside the gates. When I arrived in October, a government-run treatment centre had opened, relieving the pressure on ELWA. People were no longer turned away at the gates. In November, the number of new cases was falling. However, the collective memory of these times convinced many staff that the respite would only be temporary, and that the tough times would imminently return.

At the peak of the outbreak there were around 70 international MSF staff and 700 Liberian staff. As doctors, we were a minority. Four of us were involved with patient care, each looking after 60 patients.

Drs Rosie Burton and Tom Boyles are infectious diseases specialists in Cape Town, who worked with the Ebola outbreak in West Africa in late 2014. They were involved in different aspects of clinical care, and worked in different health facilities. The two give accounts of their experiences.

1006

We worked with Liberian physician assistants – there are few doctors in Liberia.

As international staff, we were there for the short term. The national staff were there for the long term, most remaining until the centre closed early in 2015. Many had not revealed to their families where they were working, fearing that they would be stigmatised and ostracised. Playing their part in eradicating Ebola was the reason many joined; economic isssues were also important. Many jobs disappeared during the outbreak, schools were closed, and salaries were no longer paid.

Medical care of Ebola patients

ELWA was a centre for both diagnosis and treatment. A Centers for Disease Control laboratory a few minutes’ walk away performed Ebola polymerase chain reaction tests, with a turn­around time of a few hours. No haematology or biochemistry testing was available.

For patients with confirmed EVD, the clinical care was basic. [3] Oral rehydration fluid was the mainstay of fluid management.

Intravenous fluids had been discontinued when ELWA was overwhelmed with patients, as the risk of staff being infected was considered too high. We had no means of assessing fluid balance – input or output. Many patients were too weak or confused to drink unaided, and would be helped by nursing or medical staff when inside the high-risk area, or often, more effectively, by other patients.

Routine medication for both adults and children included analgesia, antiemetics, antidiarrhoeal medication, antimalarial treat­ment, and empiric antibiotics, all given orally.

December 2015, Vol. 105, No. 12

FORUM

A patient’s experience of Ebola

Only a father and his 5-year-old son were going home. His wife had died shortly after admission. Their 9-month-old baby was initially cared for by another patient, who was recovering well and had lost her own baby.

I have a strong memory of the baby, dressed beautifully, happy and smiling, sitting on a mattress outside with his temporary mum. He was so admired by staff and patients alike. It could have been any relaxed family gathering; it felt incongruous this was the high-risk area of an Ebola treatment centre. Despite appearing well, the baby continued to have a high fever that paracetamol could not resolve.

The father recovered. He took care of the baby again, who continued to smile, until one morning he died suddenly in his father’s arms.

Ward rounds in an Ebola treatment centre

The two physician assistants on duty and I did medical rounds twice a day. We went into the high-risk area as early in the morning and as late in the afternoon as possible, to avoid spending time in personal protective equipment (PPE) during the hottest time of day. We could spend between 1 and 2 hours in the high-risk area, depending on the heat, and had up to 60 patients to see. We would be dripping with sweat inside the PPE before we left the dressing station.

We started with the sickest patients, who would still be inside the tents, and worked our way to those who were relatively well, so that if we ran out of time, we would have seen those who needed the most care. In the tents it was extremely hot. Many patients had extensive diarrhoea and vomiting; despite regular cleaning, this was a difficult environment for sick patients. Clinical review largely consisted of assessing symptoms and functional status. Physical examination was very limited. Many patients were confused, and health workers in PPE would have been a cause of further disorientation.

Many questions, few answers

The major question we had as doctors was how we could improve survival. Most of the time, clinical practice is evidence based; with Ebola, evidence for best management was minimal. It was therefore difficult to know if our clinical care was of benefit, simply futile, or could even cause harm.

Some patients were barely responsive and severely dehydrated when admitted, and died soon afterwards. Others appeared relatively well, mobilising and eating and drinking, and then died unexpectedly.

Some survived against all odds, when death had seemed inevitable.

As clinical doctors we met together most afternoons to discuss our problem patients and how we could improve management.

Every day discussion soon focused on what we did not know, the

pathophysiology that could explain our patients’ symptoms and clinical course, and how we could rapidly learn enough to make a difference.

A central issue was fluid and electrolyte depletion – how manage­ment could be optimised, and whether aggressive fluid replace­ ment would improve outcomes. We were concerned that hypokalaemia contributed to mortality, and explained the unpredicted deaths. Many patients were tachypnoeic, not dyspnoeic, and were able to lie flat. We thought they were acidotic due to renal impairment, but had no means of verifying this.

Thanks to excellent wi-fi, we read articles in the major journals as soon as they appeared, looking for data from elsewhere that would improve our management. Publications were appearing that argued that more intensive supportive care was both feasible in resource-poor environments, and would improve survival.[4,5] Diarrhoea of eight litres a day was reported; our fluid replace­ ment was nowhere near this volume.[6] Hypokalaemia and renal impairment were common findings.

Intravenous fluid administration was reinitiated when it was clear that the decline in cases was real and sustained. We began routinely supplementing all adults with oral postassium, and there were plans for point-of-care biochemical monitoring, including of potassium, which finally became possible in December.

There will never be an Ebola outbreak like this again

For me, the hardest part of working with Ebola was not the physical exhaustion of working in PPE in the heat, the emotional impact of patients dying from a rapidly fatal disease, or personal concerns about becoming infected. It was instead the lack of knowledge about Ebola, and not knowing if we could have done more to prevent people dying. Now, nine months on, so much more is known about Ebola. The necessity for optimising supportive care and biochemical testing is acknowledged. Ebola priorities and clinical care evolved throughout this ever-changing outbreak.[7,8] I was there during a particularly historic time, and what I experienced is part of the process of this evolution.

There will be undoubtedly be further outbreaks of Ebola; however, it should never be like this again. Never again will so much be unknown in terms of diagnosis, clinical management and optimising survival, and never again should the global response be so inadequate for so long.

Forty percent of people survived Ebola. The patients in the photographs had been discharged from the high-risk area and were going home.

1007

December 2015, Vol. 105, No. 12

FORUM

1. WHO Ebola Situation Report, 22 July 2105. http://apps.who.int/ebola/current-situation/ebolasituation-report-22-july-2015 (accessed 23 July 2015).

2. Médicins sans Frontières. Ebola: Pushed to the limit and beyond. A critical analysis of the global Ebola response one year into the deadliest outbreak in history. 23 March 2015. http://www.msf.org/article/ ebola-pushed-limit-and-beyond (accessed 26 July 2015).

3. Chertow DS, Kleine C, Edwards JK et al. Ebola virus disease in W Africa – clinical manifestations and management. N Engl J Med 2014;371(22):2054-2057. [http://dx.doi.org/10.1056/NEJMp1413084] 4. Fowler RA, Fletcher T, Fischer II WA, et al. Caring for critically ill patients with Ebola virus disease.

Perspectives from W Africa. Am J Respir Crit Care Med 2014;190(7):733-737. [http://dx.doi. org/10.1164/rccm.201408-1514CP]

5. Lamontagne F, Clement C, Fletcher T, et al. Doing today’s work superbly well – treating Ebola with current tools. N Engl J Med 2014;371(17):1565-1566. [http://dx.doi.org/10.1056/NEJMp1411310] 6. Kreuels B, Wichmann D, Emmerich P, et al. A case of severe Ebola virus infection complicated

by Gram-negative septicemia. N Engl J Med 2014;371:2394-2401. [http://dx.doi.org/10.1056/ NEJMoa1411677] 7. Fletcher TE, Fowler RA, Beeching NJ. Understanding organ dysfunction in Ebola virus disease. Intensive Care Med 2014;40(12):1936-1939. [http://dx.doi.org/10.1007/s00134-0143515-1] 8. Perner A, Fowler RA, Bellomo R, Roberts I. Ebola care and research protocols. Intensive Care Med 2015;41(1):111-114. [http://dx.doi.org/10.1007/s00134-014-3568-1]

PHOTO ESSAY

Ebola: Personal view from the field – Sierra Leone T H Boyles, BM BCh, MA, MRCP, MD, DTM&H, Cert ID Phys (SA) Senior Specialist in Infectious Diseases and HIV Medicine, Groote Schuur Hospital, Cape Town, South Africa Corresponding author: T H Boyles (tomboyles@yahoo.com)

Experiences of healthcare workers responding to the Ebola epidemic in West Africa vary with the types of facility. Patients suspected of having Ebola virus disease (EVD) must be isolated from each other as well as from the wider community until testing is complete; in Sierra Leone such facilities were called Ebola holding units (EHUs). Once EVD was confirmed, patients were moved to Ebola treatment units, where they could be cohorted together safely and treatment efforts focused on EVD itself. While a number of purpose-built units combined an EHU with an Ebola treatment unit, my personal experience was of working in a number of stand-alone EHUs in Freetown, Sierra Leone.

S Afr Med J 2015;105(12):1008-1009. DOI:10.7196/SAMJ.2015.v105i12.9935

The model of care in Freetown, Sierra Leone

I was placed with King’s Sierra Leone Partnership, which is based at the Connaught Hospital, the largest public sector hospital in Sierra Leone. They were working on health system strengthening long before Ebola arrived, and rapidly scaled up their efforts, including the hasty construction of an 18-bed Ebola holding unit (EHU) when the first Ebola virus disease (EVD) cases arrived in the city in May 2014. A further six smaller EHUs were then constructed at health facilities in and around the city. The aim of each unit was primarily to protect staff in other parts of the facility so that they could work as normally as possible. As such, all patients presenting for care, regardless of their symptoms, were first screened for EVD. Those who screened positive were moved to the EHU and the rest continued with care in the facility as usual. The screening algorithm had to be highly sensitive to prevent EVD patients progressing to the general facility, and it was therefore necessarily nonspecific. As a result 30 - 40% of patients admitted to the EHU did not have EVD, which raised some obvious concerns.[1] Most important was the need firstly to practise high-quality infection prevention and control between patients to prevent nosocomial transmission, and secondly to provide treatment for conditions that mimic EVD. Because there were no diagnostic tests at all, it was decided to give all patients antimalarials and ceftriaxone (in case of typhoid or other bacterial infections). It cuts against the grain of an antibiotic steward to use empirical treatment in this way, but this was no ordinary situation.

The clinical problem

Although EVD has always been considered a viral haemorrhagic fever, very little bleeding was seen during the current epidemic.

1008

Rather it proved to be a severe viral gastrointestinal illness with associated fever and thrombocytopenia,[2] so that fluid and electrolyte replacement was critical. Patients who were alert and orientated without vomiting could be encouraged to drink large volumes of oral rehydration solution, and intramuscular antiemetics could be used if needed. The decision to use intravenous fluids was hotly debated among the team I worked with. Proponents, including myself, pointed to the survival benefits that were likely to accrue from replacing lost volume and salts. Opponents had usually seen severe adverse events such as patients pulling out cannulas and bleeding profusely, constituting a high-level infection hazard and hastening death. We

December 2015, Vol. 105, No. 12

FORUM

deemed intravenous fluids to be contraindicated in patients who were agitated or confused or who bled excessively when blood was drawn.

This group in fact had a very poor outlook, and we concentrated on palliative measures. Those in the middle ground, patients who were not confused and agitated but were struggling to keep up with oral fluids, were given intravenous therapy.

The mortality from EVD in West Africa is estimated at around 60%. For foreign healthcare workers presenting to high-resource settings in the early stages it is close to 0%, and the ultimate reason for this is clearly resource availability. There is no good evidence that novel therapies such as Zmapp or convalescent plasma make a huge difference; rather, meticulous attention to detail regarding fluid and electrolyte balance, prompt recognition and treatment of secondary bacterial infection and a host of other basic interventions are important. In contrast to high-resource settings, the units I worked at were not able to test any blood parameters or even monitor temperature and blood pressure regularly. Fluid inputs and outputs could only be measured in the most rudimentary of ways. The average amount of time spent with a patient each day was around 20 minutes, each minute spent wisely to tip the balance in favour of survival.

could have heralded secondary epidemics of vaccine-preventable diseases and increased mortality from malaria.

The working environment

The research agenda

Day-to-day work in an Ebola treatment unit did not draw heavily on my medical skills. Most tasks would normally be undertaken by nurses, cleaners or porters. A typical shift involved moving patients in and out of the unit, doing rounds with medication, fluids and food, and preparing corpses for the burial team by cleaning, bagging and carefully labelling them. Our team had a very flat hierarchy and included expatriate doctors and nurses alongside national staff who included fully qualified nurses, nursing students and hospital cleaners. There were very few Sierra Leonean doctors involved in the response.

The one area of work that did require some clinical skills was assessment of patients for admission to the unit. The screening algorithm was not perfect, and some patients with a negative screen clearly needed admission and testing while others, typically those with chronic illnesses including tuberculosis and HIV, might have screened positive but were in clear need of inpatient hospital care.

I was fortunate to be involved in a number of activities away from the hospital EHU. Most interesting was working on the development of smaller EHUs at satellite facilities. There was a constant need for training, supervision and encouragement, as these units lacked the institutional knowledge of a large tertiary hospital. Being able to keep these units running and therefore allow staff to continue with normal work was probably a major factor in preventing the Ebola epidemic from contributing to a total breakdown in the healthcare system that

Away from the EHUs themselves, there was also research to be planned and carried out. VIP visitors were common, and I was fortunate to have face-to-face meetings with the heads of the Centers for Disease Control, the Wellcome Trust and the London School of Hygiene and Tropical Medicine, to name a few. We were involved in planning and discussing the ethics behind vaccine trials and evaluating a rapid point-of-care diagnostic test for Ebola,[3] all of which added to the experience. However, there was a frustration that research efforts were sometimes aimed at expensive high-tech solutions such as novel antivirals and convalescent plasma, when the basic standard of care, including low-tech solutions such as antidiarrhoeals and antibiotics, had not been optimised.[4] Despite the dreadful nature of the disease and the immense suffering of the patients, from a personal perspective my visit to Freetown was extremely rewarding. As an infectious diseases doctor it was refreshing to be at the centre of such an important event.

1. Lado M, Walker NF, Baker P, et al. Clinical features of patients isolated for suspected Ebola virus disease at Connaught Hospital, Freetown, Sierra Leone: A retrospective cohort study. Lancet Infect Dis 2015;15(9):1024-1033. [http://dx.doi.org/10.1016/S1473-3099(15)00137-1] 2. Chertow DS, Kleine C, Edwards JK, et al. Ebola virus disease in W Africa – clinical manifestations and management. N Engl J Med 2014;371(22):2054-2057. [http://dx.doi.org/10.1056/NEJMp1413084] 3. Walker NF, Brown CS, Youkee D, et al. Evaluation of a point-of-care blood test for identification of Ebola virus disease at Ebola holding units, Western Area, Sierra Leone, January to February 2015. Euro Surveill 2015;20(12):21073. [http://dx.doi.org/10.2807/1560-7917.ES2015.20.12.21073] 4. Boyles T. Priorities in Ebola research – a view from the field. Lancet 2015;385(9962):23. [http://dx.doi. org/10.1016/S0140-6736(14)62469-7]

The 2015 Ralph Kirsch Golden Pen Award for the most cited research paper published in the SAMJ in 2012 has gone to R T Erasmus, D J Soita, M S Hassan, E Blanco-Blanco, Z Vergotine, A P Kengne and T E Matsha for their article entitled ‘High prevalence of diabetes mellitus and metabolic syndrome in a South African coloured population: Baseline data of a study in Bellville, Cape Town’. (S Afr Med J 2012;102(11):841-844. DOI:10.7196/SAMJ.5670)

1009

December 2015, Vol. 105, No. 12

FORUM

MEDICINE AND THE LAW

Is it ever justified for doctors to sue their patients whose allegations against them have been dismissed by the courts or the Health Professions Council of South Africa?

D J McQuoid-Mason David McQuoid-Mason is Professor of Law at the Centre for Socio-Legal Studies, University of KwaZulu-Natal, Durban, South Africa, and publishes and teaches in medical law.

Corresponding author: D J McQuoid-Mason (mcquoidm@ukzn.ac.za)

Doctors should be cautious about suing their patients, because it may generate bad publicity. Where a criminal or civil case or complaint to the Health Professions Council of South Africa by a patient about a doctor’s professional conduct is withdrawn or dismissed, a doctor may only sue the patient for defamation if it can be proved that the patient acted from malice, spite or an improper motive. Doctors may only sue patients for malicious prosecution or abuse of civil proceedings if such patients acted with ‘malice’ and ‘without reasonable and probable cause’. If a doctor successfully defends a case against a patient, the court will usually order the patient to pay the doctor’s costs.

S Afr Med J 2015;105(12):1010-1011. DOI:10.7196/SAMJ.2015.v105i12.10238

The Minister of Health has made public statements condemning the threat to health services by ‘pocketlining’ lawyers who ‘care less about the concept of patient safety’, and work ‘in syndicates’ to encourage litigation against healthcare professionals and hospital services.[1] The Law Society of South Africa responded that legal practitioners ‘cannot “manufacture” malpractice injuries’ because the evidence is ‘substantiated by experts’, and if there is collusion between lawyers and doctors there are mechanisms in the relevant professional bodies and law enforcement agencies that can deal with it.[2] The controversy about patients suing doctors raises the question of whether, in certain situations, the converse applies and doctors can sue their patients. We must therefore consider whether it is ever justified for doctors to sue their patients (or for their lawyers to advise them to do so), where they have successfully defended allegations made against them in criminal or civil cases, or in disciplinary hearings by the Health Professions Council of South Africa (HPCSA). The answer depends upon the nature of the allegations against the doctors, the manner in which they were made, and to whom the complaints were made. This can be clarified by considering situations where the allegations have been dismissed by (i) a criminal court; (ii) a civil court; and (iii) a disciplinary inquiry of the HPCSA. However, doctors are advised to be cautious about suing their patients because this may generate more bad publicity than occurred when the patient originally complained about or sued the doctor.

This has been the experience in the USA when doctors have sued patients for defamation arising from comments made on the social media, even in the rare cases where they have succeeded.[3]

Dismissal of a criminal charge

May doctors who have been acquitted of a crime or have had a criminal charge against them withdrawn sue the patient who complained about them for defamation or malicious prosecution?

1010

Defamation

Defamation occurs where a person’s reputation is lowered in the eyes of others,[4] e.g. it is defamatory to state that a person has committed a crime.[5] However, the law encourages people to report alleged crimes to the police by protecting them from being sued for defamation – even if their report to the police is based on a mistaken but honest belief.

This is because a person who suspects that a crime has been committed may have a moral or social or legal duty to report it to the police, who have a reciprocal interest in receiving reports of criminal conduct.

People reporting alleged crimes are covered by a ‘qualified privilege’ unless the subjects of their reports can prove that such people acted ‘maliciously’.[6] ‘Malice’ means that the person making the report did not have an honest belief when making it, but acted out of spite or an improper motive.[4] A doctor whose criminal case has been dismissed by the court, or if the prosecutors have withdrawn the charge or refused to prosecute, may therefore not sue a patient for defamation unless the doctor can prove that the patient’s report to the police was based on malice.[6] The same ‘privilege’ extends to statements made by complainants or witnesses during a criminal trial. Where such allegations are made in court documents or during a trial, they are subject to a qualified privilege and those making them may not be sued for defamation. [7] Such allegations may only result in a claim for defamation if it is shown that the person making them acted out of malice, or intentionally introduced irrelevant defamatory statements, not supported by reasonable grounds, into the proceedings.[7]

Malicious prosecution

Malicious prosecution occurs where people intentionally abuse the criminal justice system by reporting a crime to the police because of ‘malice’ and do not have ‘reasonable and probable cause’ for their allegations.[8] As in defamation cases, ‘malice’ in malicious prosecution cases means that the person making the report to the police was not acting in good faith, but out of spite or an improper motive.[9] Absence of ‘reasonable and probable cause’ in malicious prosecution

December 2015, Vol. 105, No. 12

FORUM

cases means that the person making the report had no reasonable grounds for suspecting that a crime had been committed by the person concerned.[9] A complainant who was not acting with ‘malice’ and who has ‘reasonable and probable cause’ for making a report to the police cannot be sued by the person who is the subject of their report.

Doctors cannot claim damages for malicious prosecution from patients who lay criminal complaints against them with the police if they are subsequently found not guilty by the courts – unless they can prove that the patients acted ‘maliciously’ and ‘without reasonable and probable cause’.[8] The same applies to criminal complaints where prosecutors have withdrawn charges or declined to prosecute.[8] In cases where doctors are found not guilty of alleged crimes, the courts may still refer these to the HPCSA if they believe that such doctors acted unprofessionally, or the expert witnesses supporting them behaved unprofessionally.[10]

Dismissal of a civil case

As in the case of dismissal of criminal proceedings, where a patient unsuccessfully sues a doctor in a civil case for damages arising from medical malpractice or other unprofessional conduct (such as failure to obtain an informed consent or breach of confidentiality), the doctor may only sue the patient for defamation or abuse of civil proceedings in very limited circumstances.

Defamation

Stating that a professional person is incompetent or has acted unprofessionally is generally regarded as defamatory because it lowers their reputation in the eyes of society, their colleagues and their clients.[11] However, as in criminal cases, allegations that are made in court documents or during a civil trial are subject to a ‘qualified privilege’ and those making them may not be sued for defamation[7] – unless it is shown that the person making them acted maliciously, or intentionally introduced irrelevant defamatory statements into the proceedings.[7] When a civil claim by a patient alleging professional incompetence or unprofessional conduct by a doctor is dismissed by a court, the court will usually make the unsuccessful patient pay the doctor’s costs of defending the action. The successful doctor will not have an action for defamation unless he or she can prove that the patient acted out of malice.[4] However, as in criminal cases, in civil cases where a patient’s claim has been dismissed the courts may still refer unprofessional conduct by the successful doctors or expert witnesses to the HPCSA.[10]

Abuse of civil proceedings

Where courts dismiss civil claims against defendants, such defendants may not sue the people bringing the action unless they can prove that they (and/or their lawyers) abused the use of the civil proceedings in the case. In cases of abuse of civil proceedings – as with malicious prosecution – people bringing the claims must prove that the unsuccessful litigants acted out of malice, spite or an improper motive, and without reasonable and probable cause.[7] Doctors wishing to bring a civil case against an unsuccessful patient based on abuse of civil proceedings must prove that the patient acted ‘maliciously’ and ‘without reasonable and probable cause’.[7] In medical malpractice cases dismissed by the courts, the unsuccessful patients will usually be ordered to pay the legal costs of the successful defending doctors.

Dismissal of a complaint to the HPCSA

If an unfounded complaint is laid with a quasi-judicial body, such as a professional disciplinary body, against a professional person

1011

registered with such a body, the communication will be ‘privileged’ unless such person can show that the complainant acted with an improper motive such as ill-will, spite or malice.[4] As the purpose of the HPCSA is to protect the public and guide the profession, a patient who believes that a doctor has acted unprofessionally is entitled to lay a complaint with the HPCSA and to be protected from any legal action for defamation. Therefore, if a patient complains to the HPCSA about the conduct of a doctor, the patient’s complaint will be ‘privileged’ and immune from litigation by the doctor concerned – unless the doctor can show that the complaint was unjustified and the patient had acted out of malice, spite or an improper motive. Communications between patients and the HPCSA are privileged because patients are entitled to complain to the HPCSA about what they regard as unprofessional conduct and the HPCSA has a reciprocal interest in receiving such information.[4] On receipt of a complaint against a doctor, the registrar of the HPCSA must give the doctor an opportunity to provide an explanation to a preliminary committee of inquiry.[12] If the preliminary committee is satisfied with the doctor’s explanation, no further action will be taken, and the registrar will advise the patient accordingly.[12] In such circumstances doctors may not sue patients unless they can show that the patient acted by malice or an improper motive.

However, if the preliminary committee is not satisfied with the doctor’s explanation, it may ask the doctor to appear before it to give evidence or decide to refer the case to a professional conduct inquiry. [12] If a preliminary inquiry or professional conduct hearing decides that the doctor is not guilty of unprofessional conduct, the doctor may not sue the patient who complained, unless it can be proven that the patient acted from malice or an improper motive.

Conclusion

Doctors are reminded to be cautious when considering whether or not to sue their patients, because it may generate more publicity than the original complaint against them did. Doctors against whom a criminal or civil case or complaint to the HPCSA has been withdrawn or dismissed may not sue a patient who instituted such a case or complaint for defamation, unless it can be proven that the patient’s conduct was based on malice. Doctors who wish to sue patients for malicious prosecution or abuse of civil proceedings must show that such patients acted intentionally with ‘malice’ and ‘without reasonable and probable cause’. The courts will usually award costs to doctors who successfully defend cases against their patients.

1. Motsoaledi A. Doctors call for lawyers to get out of hospitals. S Afr J Bioethics Law 2015;8(1):4-6.

2. Editorial. LSSA concern at Health Minister’s plans for dealing with medical negligence victims. De Rebus 2015;May(Issue 552):21.

3. Segal J. When doctors sue patients – defamation is devastating – but a lawsuit could make it worse. Medical Justice 2015. http://medicaljustice.com/when-doctors-sue-patients-defamation-isdevastating-but-a-lawsuit-could-make-it-worse/ (accessed 20 August 2015).

4. Neethling J, Potgieter JM, Visser PJ. Law of Delict. 4th ed. Durban: Butterworths, 2001:338-350.

5. Sutter v Brown 1926 AD 155.

6. Basner v Trigger 1946 AD 83.

7. Cf. Joubert v Venter 1985 (1) SA 654 (A).

8. McQuoid-Mason DJ. Malicious proceedings. In: Joubert WA, Faris JA, eds. Law of South Africa. Vol. 15. 2nd ed. Durban: LexisNexis, 2008:189-220.

9. Prinsloo v Newman 1975 (1) SA 481 (AD).

10. Cf. Michael v Linksfield Park Clinic (Pty) Ltd 2001 (3) SA 1188 (SCA).

11. Cf. Gayre v SA Associated Newspapers Ltd 1963 (3) SA 376 (T).

12. Regulations relating to the conduct of inquiries into alleged unprofessional conduct under the Health Professions Act, 1974. GN R102 in Government Gazette 31859 of 6 February 2009: reg 4.

Accepted 21 October 2015.

December 2015, Vol. 105, No. 12

EDITORIAL

Reflections on ethical challenges associated with the Ebola epidemic The recent tragic, horrifying and extensively reported Ebola epidemic[1] must surely lead us to question why, despite major medical progress, such epidemics continue to emerge. We should also consider their implications for our global collective future. Seeking to understand the Ebola epidemic requires viewing it in the broadest historical and sociopolitical contexts that have shaped health globally,[2] and specifically in West Africa.[3] The West African context includes the 300-year slave trade from the 1500s to the 1800s, the scramble for Africa in the late 1880s, the legacy of colonialism, and its more recent post-independence history characterised by weak governance, corrupt dictatorships, exploitative competition for its natural resources, conflict, serial wars and migration. As a result of these complex interacting forces and the region’s vulnerability within the global political economy, West Africa is one of the world’s poorest regions, with Liberia, Guinea and Sierra Leone being three of the world’s poorest countries.

In his controversial 1994 article ‘The coming anarchy’, Robert Kaplan[4] wrote that ‘West Africa is becoming a symbol of worldwide demographic, environmental and societal stress … [its] conditions will soon confront our civilization … West Africa’s future, even­tually will also be that of most of the rest of the world.’ In the light of many recent world events, his predictions are evidently partly valid.

The first, most impressive and most sustained response to the recent Ebola epidemic predictably came from Médecins Sans Frontières (MSF), whose members yet again showed remarkable valour in taking on this major challenge[5] (several South Africans volunteered to assist MSF in Sierra Leone[6,7]). The World Health Organization also made some contributions, but its response, like those of many others, was too little too late.[8,9] President Obama’s pledge to provide support at the end of October 2014 came just before the epidemic peaked. Eleven treatment centres were built by the USA when the epidemic was waning, so very few patients benefited.

Critics have viewed responses from those beyond Africa as being determined more by concerns for donor country security and fear of spread to their shores than concern for people whose lives had been blighted for many decades by, inter alia, global economic policies driven by neoliberal ideology.[2,3] However, the more than USD4 billion contributed by many donors, combined with the dedi­ cated efforts of local personnel, MSF and others, made it possible to control the epidemic.[8] The big question is whether a viable plan will be developed and implemented for future outbreaks.

The ethical challenges highlighted by the epidemic can be considered at three levels – interpersonal, public health and global.

Interpersonal ethics

Interpersonal professional ethics has been the topic of extensive debate over many decades, but some specific questions relevant to epidemics are unresolved. For example, it remains contentious whether it is ethical to use untested, unregistered, experimental treatments and interventions that have shown promising results in laboratory animal models, but may have unknown adverse effects in humans. It has been conceded by some that use of such treatments is justifiable, particularly for rapidly fatal diseases.

In reflecting on health professionals’ duty to provide care, it is agreed that there are limits to such duties. What these limits are and

1012

how they may be determined involve complex considerations. Risks to life are inherent in many occupational roles, and dedication to helping others at great personal risk is a hallmark of striving for high professional ideals. Heroic efforts that go well beyond the call of duty are widely acclaimed, but cannot be expected as the norm. Notably, by 5 July 2015 there had been 875 cases of Ebola virus infection among medical staff in three West African countries, and 509 deaths.

Public health ethics

Academic discourse on public health ethics is maturing, but is not fully developed.[10] Previously initiated debates continue on what trials of treatment should be undertaken, and under what conditions, in the context of epidemics.[11,12] Prominence has also been given to the legitimate scope of quarantine measures to control outbreaks of infectious diseases and to how priorities should be set for treatment and prevention when resources are scarce.[11] It is deeply troubling that global preparedness for public health emergencies is so inadequate and that preventive vaccines and effective therapies are not available when the cause of Ebola has been known since 1976.

Such shortcomings should sensitise us to how extreme poverty and lack of access to healthcare are tolerated until tragedies arise.[8,9] These concerns are linked to distrust of national governments against the background of civil wars and brutality in these West African countries. Distrust extends to medical systems and external aid efforts that have responded poorly to much higher levels of morbidity and mortality from more common diseases (e.g. malaria, pneumonia) that are not perceived as very different from Ebola by local residents. Cultural considerations range from the impact of foreign assistance on local practices (for example burial rituals) to how participatory decision-making processes can be transparent in the complex context of pandemics.[8,13] There is little new in recommendations for strengthening fragile healthcare systems, for improving national and international emergency preparedness, surveillance and monitoring, for strength­ ening community co-operation during emergencies, and for revising how new medical products are brought to market. Although previously addressed in relation to HIV, severe acute respiratory syndrome and H1N1 influenza, there has been little action of note.

An incisive penetrating question is why more has not been learned from previous experience.[8]

Global health ethics

Ethical questions and deliberations at the global level are arguably the most critical and most disturbing ones to ask and address, as they concern power relations and macroeconomics. Who is responsible for widespread sustained poverty and adverse living conditions that allow new zoonotic diseases to emerge and spread?

Why do we tolerate widening disparities in wealth that profoundly influence health and shape healthcare services? What ideological and institutionalised legalities drive the formation and continuation of deep, underlying structurally violent forces that have made the world a place that provides a good life for about 20% of people while the remainder struggle to live under highly adverse and unhealthy conditions? How is debt created and sustained? How should we evaluate global responses and global governance for health? Some of these ethical challenges have been addressed in the new and growing

December 2015, Vol. 105, No. 12

EDITORIAL

field of global health ethics,[2,10,14-19] but with few exceptions[3,8,20] have been neglected in the voluminous writings on the Ebola epidemic.

Making progress

Although the Ebola epidemic eventually came under control, avoidance of future epidemics should be informed by recognising Ebola not merely as a biomedical problem, but rather as a ‘sign’ of a serious, yet invisible, danger like the massive underwater component of an iceberg. Other danger signs, also with deep underlying forces (structural violence), contributing to reduced potential for good lives for many people, include recurrent global economic crises, wide disparities in health, dysfunctional and unsustainable healthcare sys­tems, unpayable debt, ideological conflict, wars over access to res­ ources, and the emergence of multidrug-resistant organisms. Environ­ mental degradation and climate change consequent on excessive use of energy and massive pollution in a consumerist market civilisation are additional dangers. All these crises are fuelled by greed, corruption, flawed economic dogma and moral myopia.[16,17] Will we do better in the future? In reviewing the past and speculating about the next 100 years, the philosopher John Gray[21] has grimly suggested that ‘… if geopolitics is the struggle of states for power over natural resources, we find ourselves in an era of geopolitical rivalry with cumulative adverse environmental effects … the projects of international peace and world government that many cherished a century ago have not been realised and the pattern that is emerging at a global level looks likely to be another round in a remarkably familiar kind of human conflict.’

In asking what should be done, an analogy can be drawn with Kaposi’s sarcoma (KS) in patients with HIV/AIDS. Neither simple excision of KS tumours nor applying a ‘balm’ are effective. The development of effective life-extending treatment has flowed from research providing critical insights into the underlying systemic immune deficiency. Similarly, addressing the other abovementioned dangers to life, health and progress requires systemic critiques (from ecological, moral, social, political, economic and spiritual perspectives) of how we inhabit this planet, as well as transdisciplinary research and appropriate action. The goal should be to develop effective, rectifying systemic global responses that extend beyond provision of inadequate international aid. Improvements in global and planetary health require actions driven by more than individualistic, anthropocentric, international and biomedical conceptions of health, to include ecological and systems conceptions that acknowledge the complex interdependence of all life and the limits of our current approaches.[22] Barriers to achieving meaningful global structural change include failure to admit that our predicament is in part attributable to the excessive entitlements and ways of life of privileged populations, and their belief that economic growth and ongoing scientific advances will provide all the solutions. Neglecting the deep underpinnings of

1013

all the above danger signs, with consequent perpetuation of severely adverse living conditions that foster poor health and continuing infectious disease pandemics, reflects our denial of the magnitude and multifactorial causality of multiple escalating global crises, and denial of the potential of human ingenuity to find solutions.[17] Working towards sustainable global/planetary health is the major challenge of the 21st century.[15,18,19] Solomon R Benatar Bioethics Centre, University of Cape Town, South Africa, and Joint Centre for Bioethics and Dalla Lana School of Public Health, University of Toronto, Canada Corresponding author: S Benatar (solomon.benatar@uct.ac.za) 1. Times coverage of Ebola: Pulitzer winning articles and more. New York Times 2015; 20 April. http:// www.nytimes.com/interactive/2015/04/20/world/africa/ebola-coverage-pulitzer.html?_r=0 (accessed 12 October 2015).

2. Birn AE. Addressing the societal determinants of health: The key global health ethics imperative.

In: Benatar S, Brock G, eds. Global Health and Global Health Ethics. Cambridge, UK: Cambridge University Press, 2011:37-52.

3. Sanders D, Sengupta A, Scott V. Ebola epidemic exposes the pathology of the global economic and political system. Int J Health Serv 2015;45(4):643-656. [http://dx.doi.org/10.1177/0020731415606554] 4. Kaplan RB. The Coming Anarchy. The Atlantic 1994; February. http://www.theatlantic.com/magazine/ archive/1994/02/the-coming-anarchy/304670/ (accessed 12 October 2015).

5. Ebola outbreak thrusts MSF into new roles: Relief agency sees its mission expanding after leading response to West Africa epidemic. Nature News 2015; 3 June. http://www.nature.com/news/ebolaoutbreak-thrusts-msf-into-new-roles-1.17690 (accessed 2 October 2015).

6. Burton R. Ebola: Experiences from the field - Liberia. S Afr Med J 1015;105(12):xxxx. [http://dx.doi. org/10.7196/SAMJ.2015.v105i12.10239] 7. Boyles T. Ebola: Personal view from the field – Sierra Leone. S Afr Med J 1015;105(12):xxxx. [http:// dx.doi.org/10.7196/SAMJ.2015.v105i12.9935] 8. Smith MJ, Upshur REG. Ebola and lessons learned from moral failures: Who cares about ethics? Public Health Ethics. Advance on-line publication 17 October 2015. [http://dx.doi.org/10.1093/phe/phv028] 9. Garrett L. Ebola’s lessons: How the WHO mishandled the crisis. Foreign Affairs 2015; 18 August. https:// www.foreignaffairs.com/articles/west-africa/2015-08-18/ebolas-lessons (accessed 12 October 2012).

10. Thompson A, Nixon SA, Upshur R, Robertson A, Benatar SR, Daar A. Public health ethics. In: Bailey TM, Caulfield T, Ries NM, eds. Public Health Law & Policy in Canada. 3rd ed. Markham, Canada: Lexis Nexis Butterworths, 2013:37-57.

11. Donovan CK. Ebola, epidemics, and ethics – what we have learned. Philos Ethics Humanit Med 2014;9-15. [http://dx.doi.org/10.1186/1747-5341-9-15] 12. Ethics and Ebola: Public Health Planning and Response. Presidents Commission on Bioethics.

February 2015. http://bioethics.gov/sites/default/files/Ethics-and-Ebola_PCSBI_508.pdf (accessed 12 October 2015).

13. Komesaroff P, Kerridge I. Ebola, ethics and the question of culture. Bioeth Inq 2014;11(4):413-414. [http://dx.doi.org/10.1007/s11673-014-9581-9] 14. Benatar SR. Health in low-income countries. In: International Encyclopedia of the Social & Behavioral Sciences. 2nd ed. Oxford: Pergamon, 2015:633-639.

15. Pogge T. World Poverty and Human Rights. Cambridge, UK: Polity Press, 2002.

16. Benatar SR. Global justice and health: Re-examining our values. Bioethics 2013;27(6):297-304. [http:// dx.doi.org/10.1111/bioe.12033] 17. Benatar SR, Gill S, Bakker I. Making progress in global health: The need for a new paradigm. Int Aff 2009;85(2):347-371.

18. Benatar S, Brock G, eds. Global Health and Global Health Ethics. Cambridge, UK: Cambridge University Press, 2011.

19. Pinto A, Birn A-E, Upshur R. The context of global health ethics. In: Pinto A, Upshur R, eds. An Introduction to Global Health Ethics. London: Routledge, 2013:3-15.

20. Benatar SR. Explaining and responding to the Ebola epidemic. Philos Ethics Humanit Med 2015;10:5. [http://dx.doi.org/10.1186/s13010-015-0027-8] 21. Gray J. What’s going to happen in the next one hundred years. NewStatesman 2013; 15 May. http:// www.newstatesman.com/politics/2013/05/what-going-happen-next-hundred-years (accessed 12 October 2015).

22. Benatar SR. Health: Global. In: Ten Have H, ed. Encyclopedia of Global Bioethics. New York: Springer.

Living Reference Work, continuously updated online. [http://dx.doi.org/10.1007/978-3-319-055442_219-1].

S Afr Med J 2015;105(12):1012-1013. DOI:10.7196/SAMJ.2015.v105i12.10247

December 2015, Vol. 105, No. 12

EDITORIAL

#FeesMustFall and the campaign for universal health coverage The recent #FeesMustFall protests by students seeking better access to tertiary education remind us how politically and socially explosive inequitable access to social services can be. The protests have effectively highlighted government underfunding of tertiary education and surfaced dissatisfaction with persistent income and service disparities more generally.

As we approach the second Universal Health Coverage Day on 12 December, and with the reportedly imminent release of the National Health Insurance White Paper in South Africa (SA), we need to reflect as a society on our commitment to equitable access to good-quality health services.

On taking office, President Mandela launched his flagship project for free health services for pregnant women and children aged under 5. This was followed by free primary healthcare services.

Mandela recognised not only that access to healthcare was an essential human right, but also that it was an important contribution to the nation-building project, along with other elements of the Reconstruction and Development Programme (RDP).

Yet, in 2015, as is the case with higher education, ‘the missing middle’ of the SA population finds itself with impediments to access: it is insufficiently poor to be exempted from paying user fees for public hospital services, but often too poor to afford them. Many of those eligible for ‘free’ healthcare face insurmountable indirect costs, especially for transport.[1] For many who belong to medical schemes, monthly contributions and associated out-of-pocket payments consume an unsustainable proportion of their incomes.[2] If we examine trends in government expenditure on healthcare, the first decade of the post-apartheid era saw a surprising decline in per capita government expenditure on health, even as the per capita gross domestic product (GDP) increased (Fig. 1). The share of the government budget allocated to health also declined and stagnated at around 11.7% for much of this decade, never returning to its 1996 high of 14.1% (Fig. 2). This occurred at a time when the Department of Health was struggling to remedy the severe backlogs in healthcare infrastructure and human resource production that characterised the apartheid era, and as the HIV/AIDS epidemic escalated into the biggest in the world. Over this same period, the education sector’s percentage share of government expenditure declined even more precipitously. Strangest of all, these downward trends occurred as total government revenue doubled in real terms.[3] In recent months, government has committed to increasing funding for higher education in response to the #FeesMustFall protests.

Slowly increasing public per capita health expenditure in recent years (Fig. 1), and the proposed National Health Insurance, suggest that the debilitating consequences of the ‘lost decade’ in healthcare have rekindled a commitment to universal health coverage.

However, is it feasible in the current context to improve public funding for the health and education sectors? Would gains that have been made in other sectors addressing the social determinants of health, such as the social grants programme, housing and water, not be compromised? The lessons of the post-apartheid era suggest that a shift in fiscal policy is required.

Economic growth for many of the early years following the election of the first democratic government provided a window of opportunity for improved tax collection and transformation of government services. However, in 1996 the launch of a new macroeconomic policy, the Growth, Employment and Redistribution strategy (GEAR), reined in the public expenditure anticipated under

1014

the earlier RDP. It also required reducing the budget deficit and rapid servicing of debt (which peaked at 21.2% of total government expenditure in 1998/99) (Fig. 2). This placed a squeeze on the ‘fiscal space’ for health and education. This was followed by increasing allocations to the ‘economic affairs’ sector, which exceeded the health sector’s share by 2006/07.

A key element of GEAR was a commitment to ‘maintaining a ratio of tax to GDP of about 25 per cent’.[4] The transformation of the South African Revenue Service led to a dramatic increase in real tax revenue, and so reductions in personal income and corporate tax rates assisted in maintaining the tax-to-GDP ratio, which proved popular with the public. According to Treasury’s annual budget reviews, the rate for the highest income tax bracket dropped from 45% to 40% between 1996 and 2008, and from 35% to 28% for corporate income tax rates.

If SA is to achieve equitable access to the full range of social services, not only at the ‘basic level’ (such as basic education and primary healthcare services) but also at higher levels (higher education and all levels of referral hospitals), the fiscal policy limit on government revenue as a percentage of GDP needs to be lifted. The current limit is well below the average in other middle-income countries, of over 32% in Latin America and 37% in Central and Eastern Europe[5] (the average for Organisation for Economic Cooperation and Development (OECD) countries in 2013 was 34%, according to the official OECD statistics website https://stats.oecd.org/Index. aspx?DataSetCode=REV). Increasing the limit is critical, given massive income inequality in SA. As the Economists’ Declaration in a recent issue of The Lancet states, investing in health systems will ‘foster more cohesive societies and productive economies’.[6] It will be important to focus on progressive revenue sources, including taxing the wealthiest more effectively, as well as multinational corporations. This would be in line with the global agreement reached for funding the sustainable development goals, which concluded that: ‘We recognize that significant additional domestic public res­ ources … will be critical to realizing sustainable development and achieving the sustainable development goals. … We will redouble efforts to substantially reduce illicit financial flows by 2030, with a view to eventually eliminating them, including by combating tax evasion and corruption through strengthened national regulation and increased international cooperation. … We will make sure that all companies, including multinationals, pay taxes to the Governments of countries where economic activity occurs and value is created, in accordance with national and international laws and policies.’[7] New government revenue will not easily flow to the health sector, however. National and provincial health leaders have generally battled to make the case for health in national and provincial decision-making bodies. This has been a function of weak health leaders at some moments in history, combined with insufficient technical and analytical capacity to support bids, especially with respect to the costing of programmes.[3] Also, as among the most powerful players influencing budget decisions, the Minister of Finance and Treasury have at times resisted requests for increased funding from the Department of Health, especially when they distrusted the public health sector’s ability to deliver.[3] These are some of the political and administrative challenges that characterise the struggle policy-makers and health advocates

December 2015, Vol. 105, No. 12

EDITORIAL

Di McIntyre South African Research Chair in ‘Health and Wealth’ and Professor, Health Economics Unit, School of Public Health and Family Medicine, University of Cape Town, South Africa Corresponding author: J Doherty (dohertyj@ telkomsa.net) 1. Cleary S, Birch S, Chimbindi N, Silal S, McIntyre D. Investigating the affordability of key health services in South Africa. Soc Sci Med 2013;80(March):37-46. [http://dx.doi.org/10.1016/j. socscimed.2012.11.035] 2. Ataguba JE, Goudge J. The impact of health insurance on health care utilisation and out-of-pocket payments in South Africa. The Geneva Papers on Risk and Insurance – Issues and Practice 2012;37(4):633-654. [http://dx.doi.org/10.1057/ gpp.2012.35] 3. Doherty J. Increasing Tax Revenue and Its Impact on Financing Health Care in South Africa. London: RESYST (Resilient and

2 000

40 000 1 500 30 000 1 000 20 000 500

10 000 -

Health expenditure per capita (ZAR)

GDP per capita (ZAR)

50 000

19 96 19 /97 97 19 /98 98 / 19 99 99 20 /00 00 20 /01 01 / 20 02 02 20 /03 03 / 20 04 04 20 /05 05 20 /06 06 / 20 07 07 20 /08 08 20 /09 09 / 20 10 10 /1 1

-

GDP per capita

Health expenditure per capita

Fig. 1. Public health expenditure in SA fails to keep pace with growth in GDP in the first decade of the post-apartheid era (real terms, 2010 prices).[3] 30% 25% 20% 15% 10% 5% 0%

96 / 19 97 97 /9 19 8 98 /9 19 9 99 /0 20 0 00 /0 20 1 01 /0 20 2 02 /0 20 3 03 / 20 04 04 /0 20 5 05 /0 20 6 06 /0 20 7 07 /0 20 8 08 /0 20 9 09 /1 20 0 10 /1 20 1 11 /1 2

Jane Doherty Independent researcher and part-time lecturer, School of Public Health, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa

2 500

19

Acknowledgments. This work is based on research supported by the RESYST (Resilient and Responsive Health Systems) research consortium funded by UKaid from the Department of International Development.

DM is supported by the South African Research Chairs Initiative of the Department of Science and Technology and National Research Foundation (NRF) of South Africa.

Any opinion, finding and conclusion or recommendation expressed in this article is that of the authors, and the NRF and UKaid do not accept any liability in this regard.

60 000

Share of government budget

face on a daily basis to protect spending on healthcare. These challenges will intensify with the struggle to implement National Health Insurance, which will bring a host of other challenges, not least resistance from stakeholders benefiting from the current status quo.

To preserve the impetus towards universal health coverage, the Minister of Health and others need to engage with debates within Cabinet and Treasury on appropriate macroeconomic and fiscal policy choices.

The Department of Health will strengthen these arguments, and win the trust of colleagues from Cabinet and Treasury, if it is able to demonstrate achievements in service delivery and combat corruption.

Health Social protection Economic affairs

Education Housing, community, water Debt servicing

Fig. 2. Health and education in SA receive declining shares of the government budget in the postapartheid era.[3] Responsive Health Systems), London School of Hygiene and Tropical Medicine, 2014. http://resyst.lshtm.ac.uk/sites/resyst. lshtm.ac.uk/files/docs/reseources/Working%20paper%206.pdf (accessed 8 November 2015).

4. Department of Finance. Growth, Employment and Redistri­ bution: A Macroeconomic Strategy. Pretoria: Department of Finance, 1996:10. http://www.treasury.gov.za/publications/other/ gear/chapters.pdf (accessed 8 November 2015).

5. International Monetary Fund. Fiscal Monitor April 2014 – Public Expenditure Reform: Making Difficult Choices.

Washington, DC: IMF, 2014. https://www.imf.org/external/ pubs/ft/fm/2014/01/pdf/fm1401.pdf (accessed 8 November 2015).

1015

December 2015, Vol. 105, No. 12

6. Summers LH (on behalf of 267 signatories). Economists’ declaration on universal health coverage. Lancet 2015. Published online 17 September 2015. [http://dx.doi.org/10.1016/S01406736(15)00242-1] 7. United Nations. Report of the Third International Conference on Financing for Development. New York: United Nations, 2015: clauses 22-23. http://www.un.org/ga/search/view_doc. asp?symbol=A/CONF.227/20 (accessed 8 November 2015).

S Afr Med J 2015;105(12):1014-1015.

DOI:10.7196/SAMJ.2015.v105i12.10339

EDITORIAL

Growing genomic research on the African continent: The H3Africa Consortium Africa is disproportionately burdened by communi­ cable and non-communicable diseases and their consequences. The 2010 - 2015 life expectancy at birth is 58.2 years for people born in Africa compared with 77.7 years in more developed regions, with a world average of 70.0 years (United Nations, World Mortality Report 2013[1]).

The Human Heredity and Health in Africa (H3Africa) Consortium is unique in its objective to promote human genomic research and health in Africa, led and managed by African investigators and their collaborators.[2] In line with the vision articulated in the H3Africa White Paper published in 2011,[3] the H3Africa Consortium aims to build capacity for genomic research in Africa, promote research on both communicable and non-communicable diseases and improve our understanding of the complexities of their coexistence in African populations, generate data and knowledge to promote an understanding of the health and epidemiological transition across the continent, and improve the health of its people. It provides a platform of integrated resources for biomedical research on the continent and is developing an extraordinary wealth of data. In addition it will host biorepositories with samples from over 75 000 African participants, many of whom have provided broad consent for sharing their data and samples through a managed access approach, to the benefit of the African and international research community.

The H3Africa initiative was born out of discussions in the African Society of Human Genetics and with key funders to high­light the need to include Africans in global genomic research, and importantly to do so from an African perspective. In its first phase, H3Africa is an initiative funded and supported by the Wellcome Trust (UK) and the National Institutes of Health (USA). The first seven grants were awarded in August 2012 and the Consortium has grown to support 26 research groups from 27 African countries with over 500 investigators, including a pan-African bioinformatics network, H3ABioNet (www.h3abionet.org), and biorepository initiatives in Nigeria, South Africa and Uganda. The Consortium meets every 6 months in venues across the continent, starting in Addis Ababa in August 2012 and moving to Accra, Johannesburg, Cape Town, Dar es Salaam, Zambia, and most recently the USA (Washington DC). The eighth meeting is planned for Dakar in May 2016. A fair distribution of meetings across the breadth and length of Africa has not been easy, and multiple challenges have been encountered including the Ebola epidemic, political instability and social upheaval, reflecting the realities on the continent.

At its inception the H3Africa Consortium developed a series of working groups to meet challenges and to support its members through the process of developing genomic research. This was new territory for many of the groups and in many of the countries.

Perhaps the most challenging and unique aspects have been in the ethics arena, where the research envisioned by the Consortium had rarely been conducted on a large scale in Africa. Although some of the concerns are related to inadequate funding and infrastructure, a challenge in all developing countries, the Consortium was sensitive to cultural nuances, perceptions of potential exploitation and the need to promote independence at institutional and national levels, yet aimed to balance this with sensible guidelines that ensure a unified set of principles and operating procedures. Internal debates ranged from how to ensure meaningful community engagement and the challenges of explaining genetics and genomics, to broad

1016

informed consent (defined in this context as managed but open access to data and biospecimens), effective engagement with ethics review committees and benefit sharing. To promote fairness in a scenario where the African partners are generally under-resourced and underfunded in terms of infrastructure, institutional and national support and lack of a critical mass of appropriately skilled researchers, some adaptations have been made to the usual business of international funding organisations.[4] These included guidelines stipulating that grants should be managed by the African partners, that projects should include strong cross-national partnerships, and that capacity development should be included as an important component. During the development of policies for data and biospecimen access and sharing, consideration was given to the length of time that the primary research producers would have for exclusive access, also in terms of promoting the use of the samples with effective African partnerships for a period of 3 years before they can be independently accessed through a Data and Biospecimen Access Committee (DBAC). Furthermore, the DBAC will consist of a majority of African members, but will be an independent committee to promote the vision of the H3Africa Consortium.

Information on the projects, the research questions they address and the policies and guidelines are accessible through the H3Africa website (www.h3africa.org). Meetings and activities are documented, including a record of publications associated with H3Africa, as well as opportunities for collaboration that are managed through a co-ordinating centre. The H3Africa projects range from research groups addressing infectious diseases, including genetic determinants of susceptibility to trypanosomiasis and tuberculosis, to studies on the microbiome in cervical cancer and in respiratory diseases. Six projects focus on the rise of non-communicable diseases on the continent, including stroke, diabetes, kidney disease, rheumatic heart disease, obesity and cancer. Their joint resource will include over 50 000 African participants with significantly overlapping pheno­ typic and biomarker data enabling nested studies, meta-analyses and replication cohorts. One of the future goals is the expansion of studies into longitudinal cohorts. Two studies address neurological dis­ orders, including schizophrenia, and one examines drug susceptibility to tuberculosis. There is a collaborative African Genomics Network including investigators from Botswana and Uganda, a bioinformatics network (http://h3abionet.org) that includes 32 research groups across 15 African countries, biorepository research groups, and several projects addressing ethical, legal and social issues related to genomic research in Africa.

The success of H3Africa will be measured by knowledge generation, high-impact publications and the ability of its members to effectively access research funding for genomic research in Africa.

Ultimately it is about developing strategies and policies towards reducing the burden of disease among Africans and for global health benefit.

For the H3Africa Consortium to realise its full potential, it requires additional partnerships and the support of African governments to promote sustained funding, maintain valuable resources and ensure that African investigators remain important beneficiaries of the Consortium. The establishment of the Alliance for Accelerating Excellence in Science in Africa by the African Academy of Science is a welcome step towards promoting African-led research aligned to local imperatives.[5] African investigators need to prepare themselves

December 2015, Vol. 105, No. 12

EDITORIAL

to be strong players in the global arena of genomic research to ensure that those on the continent can participate fully in the next waves of personalised precision medicine.

Michèle Ramsay Director, Sydney Brenner Institute for Molecular Bioscience, University of the Witwatersrand, Johannesburg, South Africa, Professor of Human Genetics, Faculty of Health Sciences, University of the Witwatersrand, South African Research Chair in Genomics and Bioinformatics of African Populations, and member of the Steering Committee of the H3Africa Consortium

Corresponding author: M Ramsay (michele.ramsay@wits.ac.za) 1. United Nations, Department of Economic and Social Affairs, Population Division. World Mortality Report 2013 (United Nations publication). 2013. http://www.un.org/en/development/desa/ population/publications/pdf/mortality/WMR2013/World_Mortality_2013_Report.pdf) (accessed 4 November 2015) 2. H3Africa Consortium. Enabling the genomic revolution in Africa. Science 2014;344(6190):1346-1348. [http://dx.doi.org/10.1126/science.1251546] 3. H3Africa White Paper. 2011. http://h3africa.org/about/white-paper (accessed 4 November 2015).

4. De Vries J, Tindana P, Littler K, et al. The H3Africa policy framework: Negotiating fairness in genomics. Trends Genet 2015;31(3):117-119. [http://dx.doi.org/10.1016/j.tig.2014.11.004] 5. Nordling L. Africa aims for research autonomy. Nature 2015;520(7546):142-143. [http://dx.doi. org/10.1038/520142a]

S Afr Med J 2015;105(12):1016-1017. DOI:10.7196/SAMJ.2015.v105i12.10281

U N I V E R S I T Y O F C A P E T OWN D E PA R T M E N T O F M E D I C I N E

GENERAL PHYSICIANS CONFERENCE 2016 THURSDAY 18 – SUNDAY 21 FEBRUARY 2016 CAPE TOWN INTERNATIONAL CONVENTION CENTRE

SAVE THE DATE! MORE INFORMATION

AN INTERACTIVE APPROACH TO COMMON MEDICAL DISORDERS AND EMERGENCIES The conference will bring together a panel of expert speakers from Academic Institutions in Southern Africa.

INTERACTIVE SESSIONS,QUIZZES AND UPDATES The topics will be relevant to specialist physicians and trainees, in the private and public sectors, and colleagues beyond our borders.

‘MEET THE EXPERTS’ WORKSHOPS 18 February, Groote Schuur Hospital Topics will include the fields of: Allergology and Clinical Immunology, Cardiology, Dermatology, Diabetes and Endocrinology, Gastroenterology, Geriatrics, Haematology, Hepatology Infectious Diseases and HIV Medicine, Lipidology, Medical Ethics, Nephrology, Neurology, Pharmacotherapy, Pulmonology, and Rheumatology.

>>

WWW.PHYS IC IA N S 2 0 1 6 . C O . Z A

1017

December 2015, Vol. 105, No. 12

+2 7 (0 )2 1 4 0 6 6 7 3 3

RESEARCH

Climate change is catchy – but when will it really hurt?

N A Sweijd,1 PhD; C Y Wright,2 PhD; A Westwood,3 MB ChB, FCP (SA), MD; M Rouault,4 PhD; W A Landman,5 PhD; M L MacKenzie,6 PhD; J J C Nuttall, 7 MB ChB, FCPaed (SA), DTM&H; H Mahomed,8 MB ChB; T Cousins,9 PhD; K Winter,10 PhD; F Berhoozi,11 MA, MPH; B Kalule,12 BVSc, MMed; P Kruger,13 Dip Pub Health; T Govender,8 PhD; N Minakawa,14 PhD pplied Centre for Climate and Earth Systems Science, Council for Scientific and Industrial Research, Cape Town, South Africa A Environment and Health Research Unit, South African Medical Research Council and Department of Geography, Geoinformatics and Meteorology, Faculty of Science, University of Pretoria, South Africa 3 Department of Paediatrics, Faculty of Health Sciences, University of Cape Town, South Africa 4 Department of Oceanography, Faculty of Science, University of Cape Town, South Africa 5 Natural Resources and the Environment, Council for Scientific and Industrial Research, Pretoria, South Africa 6 Centre for Research into Ecological & Environmental Modelling, School of Mathematics & Statistics, St Andrews University, Scotland, UK 7 Infectious Diseases Unit, Department of Paediatrics and Child Health, Red Cross War Memorial Children’s Hospital and Faculty of Health Sciences,University of Cape Town, South Africa 8 Metro District Health Services, Western Cape Government: Health and Division of Community Health, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa 9 Department of Sociology and Social Anthropology, Faculty of Arts and Social Sciences, Stellenbosch University, Stellenbosch, South Africa 10 Department of Environmental & Geographical Science, Faculty of Science, University of Cape Town, South Africa 11 School of Child and Adolescent Health, Faculty of Health Sciences, University of Cape Town, South Africa 12 Department of Pathology, Division of Medical Microbiology, Faculty of Health Sciences, University of Cape Town, South Africa 13 Malaria Institute, Department of Health Limpopo, Tzaneen, South Africa 14 Department of Vector Ecology and Environment, Institute of Tropical Medicine, Nagasaki University, Japan 1 2

Corresponding author: N Sweijd (nsweijd@access.ac.za)

Concern and general awareness about the impacts of climate change in all sectors of the social-ecological-economic system is growing as a result of improved climate science products and information, as well as increased media coverage of the apparent manifestations of the phenomenon in our society. However, scales of climate variability and change, in space and time, are often confused and so attribution of impacts on various sectors, including the health sector, can be misunderstood and misrepresented. In this review, we assess the mechanistic links between climate and infectious diseases in particular, and consider how this relationship varies, and may vary according to different time scales, especially for aetiologically climate-linked diseases. While climate varies in the medium (inter-annual) time frame, this variability itself may be oscillating and/or trending on cyclical and long-term (climate change) scales because of regional and global scale climate phenomena such as the El-Niño southern oscillation coupled with global-warming drivers of climate change. As several studies have shown, quantifying and modelling these linkages and associations at appropriate time and space scales is both necessary and increasingly feasible with improved climate science products and better epidemiological data. The application of this approach is considered for South Africa, and the need for a more concerted effort in this regard is supported.

S Afr Med J 2015;105(12):1018-1023. DOI:10.7196/SAMJ.2015.v105i12.10332

This month, the 21st Conference of Parties of the United Nations Framework Convention on Climate Change meets in Paris to attempt once again to reach an agreement on mitigation targets to reduce the now universally accepted impacts on climate change on the earth system, including the social-ecological-economic system (SEES). While the debate to date in this forum has been focused mainly on providing a sound basis for mitigation action by nation states, the focus will now need to turn to actionable information in a variety of sectors of the SEES. One of these sectors is the health sector, and specifically those diseases of which the aetiology comprises an element of climate as a driver of their incidence and epidemiology.

Of particular concern are infectious diseases, vector mediated or other, which are likely to be affected by trending climate variability or climate change directly. For several decades now, as long-term climate change (as distinct from shorter-term climate variability) has become a better understood and appreciated phenomenon, climate’s potential impact on health has received increasing attention (all time and space scales). While there is a broad range of potential impacts

1018

of climate and climate change on health (including heat tolerance and morbidity, for example), in this article we consider the specific mechanisms of the relationship between climate variability/change and the incidence of infectious diseases in South Africa (SA).

Explaining climate terms

It is important that three inter-related but distinct notional time and space scales of climate dynamics be differentiated in order to understand the relationship between climate and health and how it manifests. Annual seasonal periodicity manifests in typical seasonal weather patterns locally, and these can vary in duration and intensity intra- and inter-annually. For example, the frequency and intensity of heat waves, floods, storms, droughts, winds or even calm days, dryerthan-average Western Cape winters’ impact on water availability in the following summer (e.g. dam levels), or last summer’s properties v. this summer’s properties all vary on a range of time scales. At the inter-annual to multi-year time scale (< decadal), regional to hemispheric climatic configurations or climate modes (viz. El Niño and La Niña, or the El-Niño southern oscillation (ENSO)), which

December 2015, Vol. 105, No. 12

RESEARCH

may recur in several consecutive years or occur periodically, have an impact on the properties of climate (the average weather) at a local to regional scale (often globally). These two notional time scales are commonly considered to comprise ‘climate variability’, whereas ‘climate change’ as a phenomenon considers the changes and trends in the longer-term decadal to multi-decadal climate properties (on global to local space scales) and how these are likely to trend into the future. Here, the term ‘climate’ is used generically to refer to all these time scales unless specified.

Understanding climate in relation to health in general

The predictability of climate variability is important if the relation­ ship between it and infectious disease incidence is to be determined retrospectively, in order to confidently predict its impact in a changing or trending climate regime (i.e. medium-term climate variability over climate change time scales). Several reviews have been published that have identified the importance of climate variability and climate change as a factor in health and epidemiology in general. [1-3] Epstein[4] reviewed several examples of how climate change and variability (and extreme weather events) have been associated with the emergence and re-emergence of infectious diseases, either directly (as a result of the biology of vector-borne diseases) or indirectly by, for example, altering the hydrological cycle. Kolstad and Johansson[5] took a generic approach in examining the potential impact of long-term climate projections on diarrhoea in low latitudes and showed that with the most conservative estimates the incidence would increase by 8 - 11% in their study areas, concluding that in the face of statistical climate change uncertainty, an urgent need for more empirical research exists. In more detailed examples, the role of varying climate modes (e.g.

ENSO) and their impact on seasonal and annual climate variability have been linked to variability in disease incidence.[6,7] Zell[8] pointed out that the relationship between climate and health is complex in that a range of mediated drivers influence it. While seasonal and inter-annual variability can explain much of the variation in disease incidence in these reviewed studies, periodic outbreaks of disease are more likely to be due to longer-term (inter-annual to multi-decadal scale) variability via the impact of ENSO and the quasi-biennial oscillation (QBO) as examples. This is particularly demonstrable with cases involving vector-borne infectious diseases where the agent of infection is subject to environmental life cycle drivers (e.g. malaria). Zell[8] cautioned that these climatic influences act in concert with a range of other natural (or ecologically impacted climate-mediated effects) and human-mediated drivers of disease, and unless concerted efforts are made to examine the contribution of these various drivers, they will be impossible to discern. The impacts of El Niño are most obviously detectable on the west coast of the Pacific, and the work done by Checkley et al.[9] is an excellent example of how these inter-annual phenomena can impact on health. In this case (for a particular ENSO event) they not only showed a departure from ‘normal’ (or long-term average) seasonality of disease incidence patterns (associated with a departure from normal seasonal temperature variability), but were able to calculate the risk of increased disease incidence with each degree of El Niñoattributed winter warming, and a monetary cost associated with these effects.

Climate variability and change in southern Africa

The fact that more concerted and recent climate science outputs in SA have revealed that trends and features of climate variability

1019

are indeed measurable has created an important opportunity to interrogate the relationship between climate and disease in southern Africa, regionally and in respective subregions. If the contribution of climate variability to the variability in infectious disease incidence can be determined on a range of time and space scales, the impact of these climate trends (both observed and projected) on health can then be more accurately estimated. This would provide a basis for a range of health system interventions and planning (possibly in synergy with those for other non-climate drivers of disease incidence) at appropriate time and space scales.

At the climate variability time scale, while the effects of ENSO are less consistent in southern Africa, Pohl et al.,[10] Reason et al. [11] and Landman and Beraki[12] show that seasonal scale climate variability over southern Africa is variably predictable and in some cases (particularly in the north-east) strongly associated with the ENSO state. Lazenby et al.[13] have considered the prediction skill of temperature variability at the seasonal time scale for various time frames (in months) and various lead times and show the utility (and current limitations) of these predictabilities in respect of health applications. This is the approach adopted in a study currently underway in the Mopani district of Limpopo Province which aims to link climate and disease models for malaria, diarrhoea and pneumonia (Fig. 1). Given that some correlation between temperature and malaria incidence is apparent in the region as a whole,[14] the importance of high-resolution and long-term interrogation of these relationships is essential. The Infectious Diseases Early Warning System project (iDEWS) is collaboration among several SA and Japanese partners, which depends on this seasonal predictability skill to improve infectious disease management (Fig. 2).

In the Western Cape, this is a more complex challenge. Phillipon et al.[15] showed that there are statistically demonstrable effects of ENSO impacts on Western Cape rainfall (with a focus on the winter months when rainfall is highest). They contend that both trends and inter-annual shifts (variability) in the position and intensity of frontal systems that bring rainfall to the Western Cape are mediated by ENSO events. Some of these effects are also discernible at high resolution, suggesting that relatively local climate impacts are long range (in space and time) drivers of climate variability.[16] These studies suggest that rainfall and temperature variability (and conversely the Western Cape summer drought) do possess an element of predictability, and at a range of lead times.

When the data set presented in Figs 3 and 4 is considered, both intra- and annual variability in the incidence of diarrhoea is apparent in the Western Cape. Table 1 shows an as yet unexplained shift in peak month from January to March over a four-decade period. This leads to the compelling question as to whether the manifestation of variability in this dataset is attributable to climate variability at several time (and space) scales, and if so, whether the relationship can be mathematically determined for application to disease management at short-, medium- and long-term (climate change) time scales.

On the climate change time scale, analysis on observed 50-year climate data trends in southern Africa has shown important directional changes with increased annual average temperatures, as well as increased temperature maxima and minima both seasonally and on average.[17] Extreme high temperature events have increased significantly in frequency. While the trends in rainfall are less significant and weaker, they do show a tendency towards a drier climate with more intense rainfall events[17] in the south and west of the region, with likely impacts on daily to seasonal rainfall patterns.[18] Model projections of various climate scenarios are variable, possess a high degree of uncertainty and are in some cases contradictory.

Projections for temperature changes are more robust than those for

December 2015, Vol. 105, No. 12

RESEARCH

12 000

10 000

Malaria cases in Limpopo, n

8 000

6 000

4 000

2 000

2013

2011

2009

2007

2005

2003

2001

1999

1997

1995

1993

1991

1989

1987

1985

1983

1981

1979

1977

1975

1973

1971

0

Fig. 1. The incidence of recorded malaria cases in Limpopo Province from 1976 to 2013, while restricted to the summer season, varies inter-annually in an unexplained manner. While increased incidence since the mid-1990s may be artefactual or climate driven, the opportunity to investigate the contribution climate drivers now exists. (After Kruger, personal communication.)

sector is considered in the long-term adaptation scenarios (LTAS),[17] the need for further concerted investigation is a common cause.[19]

Outbreak

What do we know about climate change and health in SA?

0.5 - 1 month insufficient forewarning

Suppression Seasonal climate/disease forecast

3 - 4 months provides sufficient forewarning for preparatory action

Fig. 2. Conceptual representation of iDEWS goals. Providing a seasonal scale climate-disease outlook which quantifies the likelihood of incidence increases or outbreaks will provide the opportunity for improved management interventions aimed at suppressing the impact.

precipitation, but the accepted conclusion is that, under a high CO2 emissions scenario, significant temperature increases (somewhat ameliorated in coastal areas) and a drier climate in the west of the country are predicted.[17] While the impact on the human health

1020

There are very few empirical studies on the relationship between climate and health conducted in SA in general; however, the topic has received attention with a range of publications in the grey literature and course resolution review information. One of the reasons for this is a lack of comparable and consistent long-term data (a global constraint on both climate and disease incidence). As stated above, there is certainly adequate awareness of the potential of climate change impacts on health in particular, as iterated in several articles and review papers.[19-22] These publications generally recognise the theoretical direct and indirect impacts of climate change on health generally and infectious diseases specifically (but not exclusively), and suggest various adaptation measures and research challenges that need to be met. The literature is therefore quite clear (both internationally and locally) that the interdisciplinary approach to this topic is a vital next step. One international study, the ISOTHURM study, which considered the relationship between heat and cold thresholds associated with mortality, included Cape Town as one of the several international cities.[23] This study was mostly descriptive and attempted to draw global conclusions about climate drivers

December 2015, Vol. 105, No. 12

RESEARCH

association of sea surface temperature, sea surface height and precipitation with disease incidence. While the coastal trans­ mission hypothesis is specific to cholera, this study does nevertheless provide an example of how local scale environmental variability can be used toward developing an early-warning system for disease. Thompson et al.[25] studied the relationship between disease and mortality and climate/weather data in Limpopo. They used two decades’ data for

of mortality. As it happened, Cape Town fell out as more of an exception in many respects, as could have been expected given the moderate Mediterranean climate, with a peak in mortality in the winter months due to respiratory illness (associated with cold and wet winters).

Mendelsohn and Dawson[24] analysed a range of oceanographic parameters in asso­ ciation with a cholera outbreak in KwaZuluNatal in 2001 - 2002 and found a strong

Table 1. Diarrhoea cases admitted during peak season to Red Cross War Memorial Children’s Hospital’s Rehydration Unit, Cape Town, per decade showing a shift in the peak months from January to March over this period* Frequency of annual peak in summer diarrhoea cases by month (%) Decade

January

February

March

April

Total

1976 - 1985

40

20

30

10

100

1986 - 1995

40

20

40

0

100

1996 - 2005

0

20

80

0

100

2006 - 2015

0

0

100

0

100

*

After A Westwood, personal communication.

their analysis, which is insufficient to draw conclusions in respect of climate change (their claim), but is more pertinent at the climate variability scale. Their conclusion was that around 40% of incidence of disease was attributable to climatic factors. Komen et al.[14] showed that, statistically, temperature was a greater influence on malaria variability than rainfall for the period 1998 - 2007, and that long-term relationships between climate variables and malaria are indicated.

Despite the lack of precise information, the National and Western Cape governments have developed some policy frameworks to address climate change scale impacts and adaptation planning specific for climatehealth impacts (e.g. LTAS[17]). Each of these does address the need for an integrated approach to climate and health management (among many other impact areas).

Lazenby et al.[13] considered the application of improved seasonal climate forecasting techniques in predicting extreme seasonal temperature in the northern parts of SA, and the direct impact on health. They conclude that the skill of these forecasts is good

900

800

700

Cases, n

600

500

400

300

200

100

t1 1 to be De r1 ce 1 m be r1 Fe 1 br ua ry 12 Ap ril 12 Ju ne 12 Au gu st 12 Oc to be De r1 ce 2 m be r1 Fe 2 br ua ry 13 Ap ril 13 Ju ne 13 Au gu st 13 Oc

1

Au g

us

1

ne 1

il 1

Ju

1

Ap r

y1

0

ar

r1

ru

Fe b

be

0

10 De

ce m

er

to b

Oc

10

us t1

Au g

ne Ju

Ap ril

10

0

Fig. 3. Diarrhoea cases (with dehydration) for 2010 - 2013 in the Western Cape public health system demonstrate the strongly seasonal incidence of paediatric diarrhoea (confirming climate as a key driver). (After A Westwood, personal communication.)

1021

December 2015, Vol. 105, No. 12

Cases, n

8 000 7 000 6 000 5 000 4 000 3 000 2 000 1 000 0

19 76 19 77 19 78 19 79 19 80 19 81 19 82 19 83 19 84 19 85 19 86 19 87 19 88 19 89 19 90 19 91 19 92 19 93 19 94 19 95 19 96 19 97 19 98 19 99 20 00 20 01 20 02 20 03 20 04 20 05 20 06 20 07 20 08 20 09 20 10 20 11 20 12 20 13 20 14

Malaria cases in Limpopo

RESEARCH

Fig. 4. Annual average variability in diarrhoea incidence in the Western Cape, from 1976 to 2014. Although policy changes have artefactually resulted in decreased admissions since 1997, a long-term oscillation in incidence is apparent. (After A Westwood, personal communication.)

enough to develop a heat-health warning system for the country.

On a larger time and space scale, Garland et al.[26] have shown how ‘extreme apparent temperature’ days are likely to increase over the continent under likely climate change mitigation scenarios, and they consider the implications for human health and public health management in various African hotspots.

Regional and international perspective

The literature has many international (including African) examples of studies examining the relationship between climate and disease at a range of time and space scales. Some of these studies are useful indicators of the increasing likely success of these approaches using more sophisticated and/or tailored climate indices and more modern analytical techniques and mathematical models. Cholera has had the most attention in this respect, with Pascual et al.[27] considering the geographical distribution of seasonality and inter-annual variability in the association of cholera and climate in India. Constantin de Magny et al.[28] conducted a study examining the association of speci­fic global and regional climate variability indices in relation to variability in cholera incidence in Ghana. Their results again confirmed a strong statistical relationship between the time series of climate and disease periodicity and incidence and show how a range of time scales (from seasons to years) can be accounted for by respectively associated global and local climate indices. In a very useful contribution, Bandyopadhyaya et al.[29] used climatically defined areas to match with the prevalence of diarrhoea in these (sometimes transboundary) climate zones in sub-Saharan Africa (not including SA). They then tested a range of variables including climatic and non-climatic variables using a series of statistical tests based on a linear model that accounted for the chosen variables. Their results show that low rainfall in the dry season (i.e. anomalously dry) increases the prevalence of diarrhoea and that an increase in monthly average maximum temperature also drives up incidence, while an increase in monthly minimum temperature reduces incidence. This is a very good demonstration of the statistical predictability of the impact of climate on diarrhoeal illness. A recent study from Kenya[30] has shown how important intra-annual and inter-annual seasonal climate signals are in understanding malaria incidence dynamics on a fine temporal and spatial scale. Interestingly, results are also emerging that show how contagious diseases may also have an association with climate variability. Oluwole[31] deals with an example of meningitis epidemics in central and east Africa and their positive association with medium-term climate in the form of ENSO and other climate modes. He concludes that ENSO forecasts should be incorporated into disease management practices.

Several fairly detailed studies in other parts of the world have attempted to examine the association with climate variability (and climate change) and diarrhoeal disease incidence, with varied

1022

success. Bhandari et al.[32] failed to show conclusive associations between their selected medium-term climatic variables and disease incidence, despite trending data in both sets of parameters. This is likely to be the result of methodological issues which in this case relied on simple regressions (as opposed to more complex nonlinear model approaches). Other common downfalls of the analyses performed include inappropriate climatic indices, poorly associated time frames for the data sets (in terms of periodicity of the climate signals and short time frames of the data sets), and also respective resolution of the data sets. Chou et al.[33] took a more comprehensive view in examining this approach in Taiwan and applied a climate variation-guided Poisson regression model to predict the dynamics of diarrhoea-associated morbidity. They were able to show that increased maximum temperature was the primary driver of morbidity in children, with days of high relative humidity and extreme rainfall also contributing in other age groups. This information was useful in developing an early-warning system for the region. Many studies use climate variability associations to make assumptions about long-term climate change scale impacts. [32,34] While this is risky because of the uncertainty around climate change predictions, the basic assumption is that disease incidence will trend in relation to trending climate variables, based on their current relationship, despite a range of potentially unanticipated changes and dynamics in the disease aetiology and climate properties and their relationship.

In this respect, the contribution of Moors et al.[35] is important as the authors have combined a conceptual model (which addresses the mechanisms of the relationship between climate and health), using an assessment of a range of other studies’ empirical (short-term) results, and long-term climate projections to make predictions on the impact of climate change on diarrhoeal diseases in the Ganges basin in India.

This approach combines different time scales and different causal pathways and is a novel and innovative approach.

Another factor to consider is which agent (i.e. specific cause of infec­ tion) is under consideration. Most studies do not differentiate the agent of disease, mostly because incidence data reflect only the symptoms at presentation and do not include any laboratory follow-up. The importance of this is illustrated by D’Souza et al.,[36] who consi­dered the climatic impact on rotavirus infections in children in Australia.

They surmise that agent-specific characteristics of transmission explain why an increase in incidence of rotaviral diarrhoeal disease coincides with a drop in temperature (seasonally) when children are confined indoors and person-to-person transmission is facilitated.

Finally, the statistical and modelling approach to the time series analysis and the association/relationship between climate and disease varies significantly among studies in the literature. This is obviously an important and specialised element of the research which must be carefully considered with the assistance of several methodological publications that address this aspect.[37,38]

December 2015, Vol. 105, No. 12

RESEARCH

Concluding remarks

As more sophisticated and fine-scale climate data and climate modelling outputs emerge, so too do the opportunities to apply this technology to the study of the incidence and epidemiology of (even partially) climate-driven diseases. Climate signals occur at several scales in space and time and the appropriately scaled information should be used to investigate the covariance of climate signals and disease incidence. This means that cognisance of the responses of disease to short-, medium- and long-term climate signals must be considered. The study of the relationship between climate and disease (infectious and other) is also dependent on good epidemiological data that can be aggregated and disaggregated at the right time and space scales to match with the occurrence of those of the climate signals. It is clear, however, that if effective management of climatedriven diseases is to be effected, especially in the light of trending and changing climate signals, and where this component of the aetiology of these diseases is set to become more intense with time, urgent and concerted research should be directed at quantifying this relationship for the past and present, in order to increase confidence of predicting the impact of these trends and changes in the future.

References 1. Patz JA, Grabow ML, Limaye VS. When it rains, it pours: Future climate extremes and health. Annals of Global Health 2014;80(4):332-344. [http://dx.doi.org/10.1016/j.aogh.2014.09.007] 2. Franchini M, Mannucci PM. Impact on human health of climate changes. Eur J Intern Med 2015;26(1):1-5. [http://dx.doi.org/10.1016/j.ejim.2014.12.008] 3. Watts N, Adger WN, Agnolucci P, et al. Health and climate change: Policy responses to protect public health: The Lancet Commissions. Lancet 2015;6736(15):60854-60856. [http://dx.doi.org/10.1016/ S0140-6736(15)60854-6].

4. Epstein PR. Climate change and emerging infectious diseases. Microbes Infect 2001;3(9):747-754. [http://dx.doi.org/10.1016/S1286-4579(01)01429-0] 5. Kolstad EW, Johansson KA. Uncertainties associated with quantifying climate change impacts on human health: A case study for diarrhoea. Environ Health Perspect 2011;119(3):299-305. [http:// dx.doi.org/10.1289/ehp.1002060] 6. Lipp EK, Huq A, Colwell RR. Effects of global climate on infectious disease: The cholera model. Clini Microbiol Rev 2002;15(4):757-770. [http://dx.doi.org/10.1128/CMR.15.4.757-770.2002] 7. Kovats RS, Bouma MJ, Hajat S, Worrall E, Haines A. El Niño and health. Lancet 2003;362(9394):14811489. [http://dx.doi.org/10.1016/S0140-6736(03)14695-8] 8. Zell R. Global climate change and the emergence/re-emergence of infectious diseases. Int J Med Microbiol 2004;293(37):16-26. [http://dx.doi.org/10.1016/S1433-1128(04)80005-6] 9. Checkley W, Epstein LD, Gilman RH, et al. Effects of El Niño and ambient temperature on hospital admissions for diarrhoeal diseases in Peruvian children. Lancet 2000;355(9202):442-450. [http:// dx.doi.org/10.1016/S0140-6736(00)82010-3] 10. Pohl B, Fauchereau N, Reason CJC, Rouault M. Relationships between the Antarctic oscillation, the Madden–Julian oscillation, and ENSO, and consequences for rainfall analysis. J Clim 2010;23(2):238254. [http://dx.doi.org/10.1175/2009JCLI2443.1] 11. Reason CJC, Landman W, Tennant W. Seasonal to decadal prediction of southern African climate and its links with variability of the Atlantic Ocean. Bulletin of the American Meteorological Society 2006;87(7):941-955. http://adsabs.harvard.edu/abs/2006BAMS...87..941R (accessed 9 November 2015).

12. Landman WA, Beraki A. Multi-model forecast skill for mid-summer rainfall over southern Africa. International Journal of Climatology 2010;32(2):303-314. [http://dx.doi.org/10.1002/ joc.2273] Lazenby MJ, Landman WA, Garland RM, deWitt DG. Seasonal temperature prediction skill over southern Africa and human health. Meteorological Applications 2014;21(4):963-974. [http:// dx.doi.org/10.1002/met.1449]

1023

13. Komen K, Olwoch J, Rautenbach H, Botai J, Adebayo A. Long-run relative importance of temperature as the main driver to malaria transmission in Limpopo Province, South Africa: A simple econometric approach. Ecohealth 2015;12(1):131-43. [http://dx.doi.org/10.1007/s10393-014-0992-1] 14. Phillipon N, Rouault M, Richard Y, Favre A. The influence of ENSO on winter rainfall in South Africa.

International Journal of Climatology 2012;32(15):2333-2347. [http://dx.doi.org/10.1002/joc.3403] 15. Dufois F, Rouault M. Sea surface temperature in False Bay (South Africa): Towards a better understanding of its seasonal and inter-annual variability. Cont Shelf Res 2012;4:24-35. [http://dx.doi. org/10.1016/j.csr.2012.04.009] 16. LTAS. Long-Term Adaptation Scenarios Flagship Research Programme (LTAS) for South Africa. Climate Trends and Scenarios for South Africa. Pretoria: Department of Environmental Affairs, 2013. https://www. environment.gov.za/sites/default/files/docs/biodiversity_BookV4.pdf (accessed 11 November 2015).

17. Fauchereau S, Trzaska S, Rouault M, Richard Y. Rainfall variability and changes in southern Africa during the 20th century in the global warming context. Natural Hazards 2003;29(2):139-154. [http:// dx.doi.org/ 10.1023/A:1023630924100] 18. Ziervogel G, New M, Archer van Garderen E, et al. Climate change impacts and adaptation in South Africa. WIREs Climate Change 2014;5(5):605-620. [http://dx.doi.org/10.1002/wcc.295] 19. Myers J, Young T, Galloway M, Manyike P, Tucker T. Responding to climate change in southern Africa – the role of research. S Afr Med J 2011;101(11):820-822.

20. Myers JE, Rother H-A. Public health impact of and response to climate change in South Africa. South African Health Review 2012/13:127-138. http://www.health-e.org.za/wp-content/uploads/2013/04/ SAHR2012_13_lowres_1.pdf (accessed 9 November 2015).

21. Wright CY, Garland RM, Norval M, Vogel C. Human health impacts in a changing South African climate. S Afr Med J 2014;104(8):579-582. [http://dx.doi.org/10.7196/SAMJ.8603] 22. McMichael AJ, Wilkinson P, Kovats RS, et al. International study of temperature, heat and urban mortality: The ‘ISOTHURM’ project. Int J Epidemiol 2008;37(5):1121-1131. [http://dx.doi.org/10.1093/ije/dyn086] 23. Mendelsohn J, Dawson T. Climate and cholera in KwaZulu-Natal, South Africa: The role of environmental factors and implications for epidemic preparedness. Int J Hygiene Environ Health 2008;211(1-2):156-162.

24. Thompson AA, Matamale L, Shonisani DK. Impact of climate change on children’s health in Limpopo province, South Africa. Int J Environ Res Public Health 2012;9(3):831-854. [http://dx.doi.org/10.3390/ijerph9030831] 25. Garland R, Matoaane M, Engelbrecht E, et al. Regional projections of extreme apparent temperature days in Africa and the related potential risk to human health. Int J Environ Res Public Health 2015;12(10):12577-12604. [http://dx.doi.org/10.3390/ijerph121012577] 26. Pascual M, Bouma MJ, Dobson AP. Cholera and climate: revisiting the quantitative evidence. Microbes Infect 2002;4(2):237-245.

27. Constantin de Magny G, Cazelles B, Guegan J-F. Cholera threat to humans in Ghana is influenced by both global and regional climatic variability. EcoHealth 2007;3(4):223-231. http://link.springer.com/ article/10.1007/s10393-006-0061-5 (accessed 9 November 2015).

28. Bandyopadhyaya S, Kanjib S, Wanga L. The impact of rainfall and temperature variation on diarrheal preva­ lence in sub-Saharan Africa. Appl Geogr 2012;33(1):63-72. [http://dx.doi.org/10.1016/j.apgeog.2011.07.017] 29. Midekisa A, Beyene B, Mihretie A, Bayabil E, Wimberly MC. Seasonal associations of climatic drivers and malaria in the highlands of Ethiopia. Parasit Vectors 2015;8(1):339-350. [http://dx.doi. org/10.1186/s13071-015-0954-7] 30. Oluwole OS. Climate regimes, El Niño-Southern Oscillation, and meningococcal meningitis epidemics. Frontiers in Public Health 2015;30(3):187. [http://do.doi.org/10.3389/fpubh.2015.00187] 31. Bhandari GP, Gurung S, Dhimal M, Bhusal CL. Climate change and occurrence of diarrheal diseases: Evolving facts from Nepal. Journal of the Nepal Health Research Council 2012;10(22):181-186.

32. Chou W-C, Wu J-L, Wang Y-C, Huang H, Sung F-C, Chuang C-Y. Modeling the impact of climate variability on diarrhoea-associated diseases in Taiwan (1996-2007). Sci Total Environ 2010;409(1):4351. [http://dx.doi.org/10.1016/j.scitotenv.2010.09.001] 33. Singh RBK, Hales S, de Wet N, Raj R, Hearnden M, Weinstein P. The influence of climate variation and change on diarrheal disease in the Pacific islands. Environ Health Perspect 2001;109(2):155-159.

34. Moors E, Singh T, Siderius C, Balakrishnan S, Mishra A. Climate change and waterborne diarrhoea in northern India: Impacts and adaptation strategies. Sci Total Environ 2013;468/469(S1):139-151. [http://dx.doi.org/10.1016/j.scitotenv.2013.07.021] 35. D’Souza RM, Hall G, Becker NG. Climatic factors associated with hospitalizations for rotavirus diarrhoea in children under 5 years of age. Epidemiol Infect 2008;136(1):56-64.

36. Pourabbas E, d’Onofrio A, Rafanelli M. A method to estimate the incidence of communicable diseases under seasonal fluctuations with application to cholera. Appl Math Comput 2001;118(2-3):161-174. [http://dx.doi.org/10.1016/S0096-3003(99)00212-X] 37. Leyk S, McCormick BJJ, Nuckols JR. Effects of varying temporal scale on spatial models of mortality patterns attributed to paediatric diarrhoea. Spat Spatiotemporal Epidemiol 2011;2(2):91-101. [http:// dx.doi.org/10.1016/j.sste.2011.03.002]

Accepted 5 November 2015.

December 2015, Vol. 105, No. 12

RESEARCH

School students’ knowledge and understanding of the Global Solar Ultraviolet Index C Y Wright,1,2 PhD; A I Reeder,3 PhD; P N Albers,1 MSc nvironment and Health Research Unit, South African Medical Research Council, Pretoria, South Africa E Department of Geography, Geoinformatics and Meteorology, Faculty of Science, University of Pretoria, South Africa 3 Cancer Society Social and Behavioural Research Unit, Department of Preventive and Social Medicine, Dunedin School of Medicine, University of Otago, Dunedin, New Zealand 1 2

Corresponding author: C Y Wright (cwright@mrc.ac.za)

Background. The Global Solar Ultraviolet Index (UVI) is a health communication tool used to inform the public about the health risks of excess solar UV radiation and encourage appropriate sun-protection behaviour. Knowledge and understanding of the UVI has been evaluated among adult populations but not among school students.

Objectives. To draw on previously unpublished data from two school-based studies, one in New Zealand (NZ) and the other in South Africa (SA), to investigate and compare students’ knowledge of the UVI and, where possible, report their understanding of UVI. Methods. Cross-sectional samples of schoolchildren in two countries answered questions on whether they had seen or heard of the UVI and questions aimed at probing their understanding of this measure.

Results. Self-report questionnaires were completed by 1 177 students, comprising 472 NZ (264 year 8 (Y8), 214 year 4 (Y4) students) and 705 SA grade 7 primary-school students aged 8 - 13 years. More than half of the NZ Y8 students answered that they had previously heard about or seen the UVI, whereas significantly more SA students and NZ Y4 students replied that they had neither seen nor heard about the UVI. Among the NZ students who had seen or heard of the UVI, understanding of the tool was fairly good.

Conclusion. The observed lack of awareness among many students in both countries provides an opportunity to introduce an innovative and age-appropriate UVI communication method that combines level of risk with behavioural responses to UVI categories and focus on personal relevance to the UVI message.

S Afr Med J 2015;105(12):1024-1029. DOI: 10.7196/SAMJ.2015.v105i12.10120

Exposure to solar ultraviolet radiation (UVR) during childhood and adolescence is a key risk factor for the subsequent development of malignant melanoma skin cancer[1] and possibly for some non-melanoma skin cancers.[2] The incidence of melanoma is high in several countries, but especially in Australia and New Zealand (NZ),[3] and among the white population group of South Africa (SA).[4] Public health awareness campaigns that communicate the dangers of excess sun exposure, as recommended by the World Health Organization (WHO), have been ongoing at varying intensities. As part of these efforts, in both NZ[5] and SA (personal communication, G Coetzee, South African Weather Service, Pretoria) the Global Solar Ultraviolet Index (UVI) has been broadcast in the media for varying periods of time.

The UVI is an international standard measurement of the intensity of solar UVR at the earth’s surface and was developed through an international effort by the WHO in collaboration with the World Meteorological Organisation, the United Nations Environment Programme and the International Commission on Non-Ionising Radiation Protection (ICNIRP).[6] The higher the numerical value of the UVI, the greater the intensity of solar UVR and the greater the potential for damage to human health from excess exposure. The UVI is promoted as an education tool to be incorporated into programmes that inform the public about the health risks of excess solar UVR and encourage appropriate sunprotection behaviour.

Several studies have been carried out to assess the impact of the UVI, including on whether the UVI is understood by the public of NZ[7] and Australia,[8] on the knowledge, awareness and use of the UVI among Australians,[9] on media uptake in response to advocacy

1024

and promotion,[5] and in relation to public response in the USA.[10] An early systematic review assessed the effectiveness of using tools such as the UVI in mass media communications and concluded that, while understanding of the UVI seemed to be suboptimal, insufficient research in this area meant that recommendations could not be made.[11] A 2012 systematic review found that, although the UVI is an effective instrument for promoting sun protection, the available evidence suggests that its use has not improved sun-protective practices or reduced sun exposure at the population level.[12] To date, most research has focused on adult knowledge and understanding of the UVI, for example in NZ[7] and Germany,[13] and also the impact of UVI on adult tanning behaviour in Sweden.[14] Since excess sun exposure in childhood and adolescence is a known risk factor for skin cancer, and because sun-safe practices are most likely to be adopted as part of a healthy sun-exposure lifestyle from a young age, it is important to determine the level of knowledge and understanding of the UVI among school students. The aims of the present investigation were to draw on previously unpublished data from two school-based studies, one in NZ[15] and the other in SA,[16] to investigate and compare students’ knowledge of the UVI and, where possible, report their understanding of this measure. The findings obtained also provide indicative baselines against which any subsequent survey findings could be compared.

Methods

Both the NZ and SA study methods have been described in detail elsewhere.[15,16] These methods are briefly summarised below, with specific emphasis placed on the UVI sections of the student questionnaires.

December 2015, Vol. 105, No. 12

RESEARCH

New Zealand study

Study location and participants. The cross-sectional study was carried out in five provinces at state or state-integrated schools randomly selected from the Ministry of Education schools database.

A single class, either year 4 (Y4), modal age 8 years, or year 8 (Y8), modal age 12 years, was randomly selected from each school to

participate. Y8 students’ results are comparable with grade 7 (G7) (modal age 12 years) students’ results in SA. Questionnaire. The student survey measures assessed sun-related knowledge, attitudes and behaviours. Either four (Y4) or eight (Y8) questions on the UVI assessed both knowledge and understanding of the UVI. The questions on the UVI (Tables 1 and 2) were similar to

Table 1. Student demographics, self-perceived skin photosensitivity and UVI knowledge, with comparisons between NZ Y8 and SA G7 students NZ students Y4 (N=214) n (%)

Questionnaire item

Y8 (N=274) n (%)

SA students, G7 (N=707) n (%)

p-value*

Demographics Age (years)

N/A

7

16 (7.7)

0 (0.0)

0 (0.0)

8

134 (64.7)

0 (0.0)

0 (0.0)

9

53 (25.6)

0 (0.0)

0 (0.0)

10

4 (1.9)

3 (1.1)

0 (0.0)

11

0 (0.0)

55 (20.6)

6 (0.8)

12

0 (0.0)

140 (52.6)

173 (24.5)

13

0 (0.0)

67 (25.1)

429 (60.8)

Other

0 (0.0)

1 (0.3)

97 (13.7)

Missing data†

8

8

2

Male

106 (51.1)

120 (45.1)

269 (38.3)

Female

100 (48.5)

146 (54.9)

434 (61.7)

Missing data†

8

8

4

Gender >0.001

I f you went out in the sun without protection in the summer for 30 minutes during the middle of the day, would you: Just burn and not tan afterwards

47 (22.7)

55 (20.7)

133 (18.8)

Burn first, then tan afterwards

35 (16.9)

68 (25.6)

151 (21.3)

Not burn at all, just tan

54 (26.0)

71 (26.7)

117 (16.5)

Don’t know

71 (34.2)

71 (26.7)

305 (43.2)

7

9

1

No

142 (68.9)

113 (42.3)

438 (61.9)

Yes

64 (31.1)

154 (57.7)

269 (38.1)

Missing data†

8

7

0

Missing data

†

>0.001

Knowledge of UVI Have you seen or heard about the UVI?

N/A

Where have you seen or heard about the UVI?‡ Radio

17

27

62

Newspaper

15

35

49

Magazine

10

24

66

People talking about it

24

59

83

At school

24

61

111

Other

6

10

21

Don’t know

19

31

98

Total responses

143

319

623

N/A = not applicable. *p-values relate to comparisons between the NZ Y8 and SA G7 students only. † Missing data excluded from calculations. ‡ Students could select more than one answer.

1025

>0.001

December 2015, Vol. 105, No. 12

RESEARCH

is routinely recommended in NZ schools, were chosen for the purpose of measuring sun exposure. Six weeks prior to survey administration, information sheets and consent forms were mailed to class teachers for distribution to parents/guardians. A researcher administered the questionnaire to the class at each school, giving only general instructions to assist completion. Ethical approval was obtained from the University of Otago Human Ethics Committee (Ref. No. 04/028).

those used in a national survey administered to the general public in NZ[7] and a survey administered to secondary students,[13] amended post piloting to ensure age-appropriate language. In addition to basic demographic questions, students were also asked to assess their skin photosensitivity by answering the question: ‘If you went out in the sun without protection in summer for 30 minutes during the middle of the day, would you: just burn and not tan afterwards; burn first and then tan afterwards; not burn at all, just tan; or don’t know’. The words ‘during the middle of the day’ were omitted from the Y4 questionnaire in an attempt to simplify the question for this younger age group.

Procedures. The questionnaire was administered as part of a larger study to measure students’ sun exposure. The fourth and the first terms (October 2004 - April 2005), the period during which sun protection

South African study

Study location and participants. A cross-sectional descriptive study was carried out in the nine provinces of SA. Four schools from each province were randomly selected from the Department of Basic Education schools database after ineligible schools (schools without a G7 class, with a class

Table 2. NZ student responses to questions on understanding of, use of and desire to know more about the UVI by year level and gender Year 4

Year 8

All n (%)

Male n (%)

Female n (%)

All n (%)

Male n (%)

Female n (%)

p-value

Easy to understand

-

-

-

Difficult to understand

-

55 (42.6)

23 (40.3)

32 (39.5)

0.641

-

-

74 (57.3)

34 (59.6)

49 (60.4)

Missing data

-

-

-

25

14

11

Disagree

7 (13.7)

3 (8.6)

4 (25.0)

8 (5.5)

3 (4.8)

5 (6.1)

Agree

32 (62.7)

22 (62.8)

10 (62.5)

59 (41.2)

31 (50.0)

28 (34.5)

Unsure

12 (23.5)

10 (28.5)

2 (12.5)

76 (53.1)

28 (45.1)

48 (59.2)

Missing data

13

8

5

11

9

2

Questionnaire item Would you say the UVI is:

p-value N/A

As the number on the UVI gets bigger, it means the sun’s rays are getting stronger:

As the number on the UVI gets bigger, it means you can spend more time in the sun:

0.203

0.179

N/A

Disagree

-

-

-

80 (55.1)

34 (56.6)

46 (66.6)

Agree

-

-

-

5 (3.4)

2 (3.3)

2 (2.3)

Unsure

-

-

-

60 (41.3)

24 (40.0)

36 (42.8)

Missing data

-

-

-

112

53

59

As the number on the UVI gets bigger, it means that you need to use more sun protection:

0.263

N/A

Disagree

-

-

-

6 (4.1)

4 (6.25)

2 (1.3)

Agree

-

-

-

84 (58.3)

35 (54.6)

49 (34.0)

Unsure

-

-

-

54 (37.5)

25 (39.0)

29 (20.1)

Missing data

-

-

-

111

51

60

Family uses the UVI to help them decide what sun protection to use:

0.487

N/A

No

-

-

-

72 (50.0)

30 (46.8)

42 (52.5)

Yes

-

-

-

14 (9.7)

9 (14.0)

5 (6.2)

Unsure

-

-

-

58 (40.2)

25 (39.0)

33 (41.3)

Missing data

-

-

-

104

48

56

No

58 (28.2)

24 (22.8)

34 (34.0)

51 (19.3)

32 (27.1)

19 (13.0)

Yes

147 (71.7)

81 (77.1)

66 (66.0)

213 (80.6)

86 (72.8)

127 (86.9)

Missing data

1

1

0

2

2

0

0.287

Would you like to know more about the UVI:

1026

0.077

December 2015, Vol. 105, No. 12

0.004

RESEARCH

size of less than 10, sited in a rural location or where English or Afrikaans were not used for teaching at the school) were removed.

Questionnaire. The questionnaire, provided in both English and Afrikaans, was based on that used in the NZ study, but only one question on the UVI was retained, i.e. ‘Have you seen or heard about the UVI?’ The other seven questions were not included because it was noted during piloting that most participants did not recall either hearing or seeing anything about the UVI. In addition to basic demographic questions, students were asked to assess their skin photosensitivity by answering the same question as used for Y4 and Y8 students in NZ (see above).

Procedures. The study took place during the third school term between August and October 2012. School principals were invited by

telephone to permit their schools to participate and those principals who agreed were couriered questionnaires, information sheets and consent forms, as well as a prepaid courier bag to return completed questionnaires to the researcher. Ethical approval for this study was obtained from the Council for Scientific and Industrial Research (CSIR) Research Ethics Committee (Ref. No. 35/2012).

Statistical analysis

All analyses were carried out using Stata 13.1 (StataCorp LP, USA).

Summary descriptive statistics, including observed frequencies for all variables, were calculated. Statistical significance was assessed using p<0.05 for Pearson’s χ2 tests with missing data removed.

Table 3. NZ student responses to questions on understanding of, use of and desire to know more about the UVI by year of age 7 years n (%)

8 years n (%)

9 years n (%)

10 years n (%)

11 years n (%)

12 years n (%)

13 years n (%)

Other n (%)

p-value

Easy to understand

-

-

-

2 (100.0)

12 (54.4)

25 (35.7)

16 (45.7)

0 (0.0)

0.140

Difficult to understand

-

-

-

0 (0.0)

10 (45.5)

45 (64.2)

19 (54.2)

0 (0.0)

Missing data

-

-

-

3

3

16

6

0

Disagree

1 (16.6)

3 (11.5)

3 (15.7)

0 (0.0)

0 (0.0)

7 (8.8)

1 (2.5)

0 (0.0)

Agree

4 (66.6)

14 (53.8)

14 (73.6)

0 0.0

10 (41.6)

30 (37.9)

19 (48.7)

0 (0.0)

Unsure

1 (16.6)

9 (34.6)

2 (10.5)

1 (100.0)

14 (58.3)

42 (53.1)

19 (48.7)

0 (0.0)

Missing data

1

7

5

1

1

7

2

0

Disagree

-

-

-

1 (50.0)

14 (60.8)

41 (51.2)

24 (60.0)

0 (0.0)

Agree

-

-

-

0 (0.0)

0 (0.0)

3 (3.7)

2 (5.0)

0 (0.0)

Unsure

-

-

-

1 (50.0)

9 (39.1)

36 (45.0)

14 (35.0)

0 (0.0)

Missing data

-

-

-

4

32

56

22

0

Disagree

-

-

-

0 (0.0)

2 (8.3)

3 (3.7)

1 (2.5)

0 (0.0)

Agree

-

-

-

0 (0.0)

12 (50.0)

48 (60.0)

24 (61.5)

0 (0.0)

Unsure

-

-

-

1 (100.0)

10 (41.6)

29 (36.2)

14 (35.9)

0 (0.0)

Missing data

-

-

-

5

31

55

22

1

No

-

-

-

0 (0.0)

7 (29.1)

39 (50.0)

26 (65.0)

0 (0.0)

Yes

-

-

-

0 (0.0)

5 (20.8)

6 (7.6)

3 (7.5)

0 (0.0)

Unsure

-

-

-

2 (100.0)

12 (50.0)

33 (42.3)

11 (27.5)

0 (0.0)

Missing data

-

-

-

4

29

53

20

1

No

5 (31.2)

45 (33.8)

7 (13.2)

2 (33.3)

13 (23.6)

26 (18.7)

10 (15.1)

1 (100.0)

Yes

11 (68.7)

88 (66.1)

46 (86.7)

4 (66.6)

41 (76.3)

113 (81.2)

56 (84.8)

0 (0.0)

Missing data

0

1

0

0

0

1

1

0

Questionnaire item Would you say the UVI is:

As the number on the UVI gets bigger, it means the sun’s rays are getting stronger: 0.046

As the number on the UVI gets bigger, it means you can spend more time in the sun: 0.862

As the number on the UVI gets bigger, it means that you need to use more sun protection: 0.657

Family uses the UVI to help them decide what sun protection to use: 0.040

Would you like to know more about the UVI:

1027

December 2015, Vol. 105, No. 12

0.005

RESEARCH

Results

Demographics

For the NZ study, 27 schools participated, 14 of which contributed the 264 Y8 participants and 13 the 214 Y4 participants. A total of 24 schools participated in the SA study and 707 students completed the student questionnaire. Data for a total of 1 177 students were included in all analyses (comprising 472 NZ and 705 SA students; students with missing self-reported gender were omitted).

The median age for the NZ Y4 students was 8 years, for the NZ Y8 students it was 12 years, and for the SA G7 students it was 13 years (Table 1). In both the NZ and the SA study, more females than males answered the questionnaire, this ratio being higher in the SA sample.

Students were asked to assess their skin photosensitivity according to the Fitzpatrick Skin Phototype Classification question on burn/ tan.[17] Of the NZ Y8 students, there was a relatively even distribution selecting one of the four choices, but with the fewest selecting ‘just burn and not tan afterwards’ and similar numbers of students selecting the other two options, i.e. ‘burn first then tan afterwards’ and ‘not burn at all just tan’. This was not the case for the NZ Y4 and the SA G7 sample. About one-third of the NZ Y4 students and more than 40% of the South African students selected ‘Don’t know’ for this question.

Knowledge of the UVI

More than half of the NZ Y8 sample answered that they had previously heard about or seen the UVI, whereas significantly more SA G7 students and NZ Y4 students replied that they had not seen or heard about the UVI. The largest number of students in both countries who reported having seen or heard about it had done so either via television or at school.

Understanding of the UVI

The NZ students were asked additional questions to test their understanding of the UVI (Tables 2 and 3). Of the Y8 students completing the question on ease of understanding the UVI, more than half said that it was difficult to understand. Three questions further probed the students’ understanding of the UVI and its values. For the statement, ‘As the number on the UVI gets bigger, it means the sun’s rays are getting stronger’, the majority of Y8 students were unsure of their answer, except for Y8 male students, of whom half correctly agreed with this statement. About two-thirds of the Y4 students correctly agreed with this statement, with similar percentages of males and females. Y8 students were asked two additional questions testing their UVI understanding. In both cases, most Y8 students correctly selected the correct response, i.e. they disagreed that ‘As the number on the UVI gets bigger, it means you can spend more time in the sun’ and agreed that ‘As the number on the UVI gets bigger, it means you need to use more sun protection’. There were no statistically significant differences by gender for these questions.

One statistically significant difference by self-reported age in years (not year level) was observed for the statement: ‘As the number on the UVI gets bigger, it means the sun’s rays are getting stronger’; students aged 11, 12 and 13 years were more likely than students of other ages to select the ‘unsure’ response.

Use of the UVI and desire to know more about the UVI

Y8 students were asked whether or not their family made use of the UVI to help decide which sun protection to use. Only 14 students replied positively, with the majority answering either negatively or indicating that they were unsure. The final question was about whether or not they would like to know more about the UVI, and the majority of the Y4 and Y8 students expressed a desire to know more

1028

about the UVI, with slightly more Y8 males than females responding negatively. When asked whether their family utilised the UVI to help them decide what sun protection to use, more 11-year-olds than students of other ages selected ‘unsure’.

Discussion

Few studies have considered the understanding and use of the UVI, with this being the first of which we are aware that focused on primary-school students. The aim of this study was to investigate and compare students’ knowledge of the UVI and, where possible, report their understanding of this measure. There is at least some evidence to suggest that some school students have seen or heard of the UVI. However, this is not the case for the majority of students in this study, unlike a study among West Australian adults, aged 18 years and older, that found a high level of awareness and understanding of the UVI.[9] NZ Y8 students were most likely to have seen or heard of the UVI, perhaps because the UVI has been broadcast and published routinely in some NZ media since 1999, and it may have also been discussed in NZ school curricula. Those students who had seen or heard of the UVI had done so at school or via television.

Understanding of general sun exposure and protection also appears to be better in NZ Y8 students, as evidenced by the higher number of Y4 and G7 students reporting their uncertainty regarding what would happen to their skin exposed to the summer sun for 30 minutes.

The UVI was constructed as a simple index using categorical numbers to communicate sun-exposure risk, and sun-protection advice was related to the scale at a later stage.[6] In terms of ease of understanding, when asked whether the UVI was easy or difficult to understand, two-thirds of the students stated that they found the UVI difficult to understand. This may in part explain why the UVI does not appear to change attitudes towards sun protection or sunrelated behaviour, at least for those populations in which ease of UVI understanding has been explored previously. An ICNIRP Working Group decided that changes to the UVI itself were not warranted.[18] However, if a basic comprehension of the UVI metrics is missing, it is unlikely to have a positive influence on sun-related attitudes and behaviours. Teaching about the UVI should begin at school, and this has been the practice in many NZ primary and intermediate schools, although standardised SunSmart Schools curriculum resources, including substantial content about the UVI, were not commissioned and promoted online until 2014.[19] Among the few students who had seen or heard of the UVI, understanding was generally good; most students knew that the increasing UVI numbers meant that the sun’s rays were getting stronger and that more sun protection was required. However, a quarter to half of the students were unsure about the appropriate response, suggesting that many are not confident of their understanding of the UVI. Interestingly, younger students tended to agree more readily than their older counterparts with the UVI understanding question.

Despite only 14 students stating that their family used the UVI to help them decide what sun protection to use, most students of all ages and from both countries wanted to know more about the UVI. The UVI categories have been coupled with sun-related behaviour and sun-protection responses.[6] These messages need to be part of the teaching about UVI in schools.

Study limitations

Study data were collected through the use of self-completed questionnaires. Although the sampling procedures could not ensure representativeness, there is some evidence that neither study sample deviated substantially from the general population of students of the same year and school level.[15,16] The timing of the study was

December 2015, Vol. 105, No. 12

RESEARCH

the probable reason for the age differences between Y8 and G7 students, since the entire SA survey took place in the second half of the year during the third school term, by which time most students, commencing the year at age 12, had attained the age of 13 years. In both studies, owing to natural class composition, more females than males, particularly in the SA sample, answered the questionnaire.

Some comparability bias may be evident as the different population surveys took place in different years, i.e. in 2004/5 and 2012 for the Y4/Y8 and G7 students, respectively.

Conclusion

We have demonstrated that awareness and understanding of the UVI among primary school students in two countries are relatively low. While results may not be fully generalisable, they suggest that greater effort is necessary to raise awareness and understanding of the UVI if it is to be promoted as an effective sun-protection tool. The observed lack of awareness among many school students provides an opportunity to introduce an innovative and age-appropriate approach to teaching of the UVI that goes beyond a simple explanation of the metrics. The teaching approach should combine level of risk with behavioural responses to UVI numbers and/or categories and focus on personal relevance of the UVI message. The data presented here further demonstrate that efforts to increase general sun awareness and appreciation of the associated risks are needed in SA for all population groups.

Funding. For the NZ project, Dr Wright received support from the National Research Foundation of South Africa, the National Institute of Water and Atmospheric Research and an International PhD scholarship from the University of Otago. Dr Wright was employed by the Council of Scientific and Industrial Research when the SA study was carried out.

Dr Reeder and the Cancer Society Social and Behavioural Research Unit received funding from the Cancer Society of New Zealand Inc. and the University of Otago. Funding for the SA project was granted in part by the Cancer Association of South Africa, the Council for Scientific and Industrial Research and the Medical Research Council of South Africa.

Acknowledgements. Sincere thanks go to all the school principals, teachers and students who participated in both studies; to Nathalie

1029

Huston and Jan Jopson (NZ), and Nelvia Phala and Lesley Wright (SA) for assistance with project administration and co-ordination.

References 1. Dennis LK, Vanbeek MJ, Beane Freeman LE, Smith BJ, Dawson DV, Coughlin JA. Sunburns and risk of cutaneous melanoma: Does age matter? A comprehensive meta-analysis. Ann Epidemiol 2008;18(8):614-627. [http://dx.doi.org/10.1016/j.annepidem.2008.04.006] 2. Green AC, Wallingford SC, McBride P. Childhood exposure to ultraviolet radiation and harmful skin effects: Epidemiological evidence. Prog Biophys Mol Biol 2011;107(3):349-355. [http://dx.doi. org/10.1016/j.pbiomolbio.2011.08.010] 3. IARC Globocan. 2012. Melanoma of the skin ASR (W) per 100,00, all ages. http://globocan.iarc.fr/old/ bar_sex_site.asp?selection=16120&title=Melanoma+of+skin&statistic=2&populations=5&window =1&grid=1&info=1&color1=5&color1e=&color2=4&color2e=&submit=%C2%A0Execute%C2%A0 (accessed 20 May 2015).

4. Norval M, Kellet P, Wright CY. The incidence and body site of skin cancers in the population groups of South Africa. Photodermatol Photoimmunol Photomed 2014;30(5):262-265. [http://dx.doi. org/10.1111/phpp.12106] 5. Richards R, Reeder AI, Bulliard J-L. Fine forecasts: Encouraging the media to include ultraviolet radiation information in summertime weather forecasts. Health Educ Res 2004;19(6):677-685. [http:// dx.doi.org/10.1093/her/cyg085] 6. World Health Organization. Global Solar UV Index: A Practical Guide. A joint recommendation of the World Health Organization, the World Meteorological Organization, the United Nations Environment Programme and the International Commission on Non-Ionizing Radiation Protection. 2002. http:// www.who.int/uv/publications/en/UVIGuide.pdf (accessed 20 January 2015).

7. Bulliard J-L, Reeder AI. Getting the message across: Sun protection information in media weather reports in New Zealand. N Z Med J 2001;114(1126):67-70.

8. Carter OBJ, Donovan RJ. Public (mis)understanding of the UV Index. J Health Commun 2007;12(1):41-52. [http://dx.doi.org/10.1080/10810730601093371] 9. Blunden A, Lower T, Slevin T. Knowledge, awareness and use of the UV Index amongst the West Australian public. J Health Commun 2004:9(3):207-221. [http://dx.doi.org/10.1080/10810730490447057] 10. Geller AC, Hufford D, Miller DR, et al. Evaluation of the Ultraviolet Index: Media reactions and public response. J Am Acad Dermatol 1997;37(6):935-941. [http://dx.doi.org/10.1016/S0190-9622(97)70068-9] 11. Saraiya M, Glanz K, Briss PA, et al. Interventions to prevent skin cancer by reducing expo­ sure to ultraviolet radiation: A systematic review. Am J Prev Med 2004;27(5):422-466. [http://dx.​doi.org/10.1016/j.amepre.2004.08.009] 12. Italia N, Rehfuess EA. Is the Global Solar UV Index an effective instrument for promo­ ting sun protection: A systematic review. Health Educ Res 2012;27(2):200-213. [http://dx.​doi.org/10.1093/her/cyr050] 13. Jopson J, Reeder AI. Sun Protection in New Zealand Secondary Schools: Obstacles and Opportunities.

Dunedin: University of Otago, 2004. Available from AI Reeder, tony.reeder@otago.ac.nz 14. Bränström R, Ullen H, Brandberg Y. A randomised population-based intervention to examine the effects of the ultraviolet index on tanning behaviour. Eur J Cancer 2003;39(7):968-974. [http://dx.doi. org/10.1016/S0959-8049(03)00117-5] 15. Wright C, Reeder A, Bodeker G, Gray A, Cox B. Solar UVR exposure concurrent activities and sun-protective practices among primary schoolchildren. Photochem Photobiol 2007;83(3):749-758. [http://dx.doi.org/10.1562/2006-08-22-RA-1010] 16. Wright CY, Albers PN, Oosthuizen MA, Phala N. Self-reported sun-related knowledge, attitudes and behaviours among schoolchildren attending South African primary schools. Photodermatol Photoimmunol Photomed 2014;30(5):226-276. [http://dx.doi.org/10.1111/phpp.12107] 17. Fitzpatrick TB. The validity and practicality of sun-reactive skin types I through IV. Arch Dermatol 1988;124(6):869-871. [http://dx.doi.org/10.1001/archderm.1988.01670060015008] 18. Allinson S, Asmuss M, Baldermann C, et al. Validity and use of the UV Index: Report from the UVI Working Group, Schloss Hohenkammer, Germany, 5 - 7 December 2011. Health Physics 2012;103(3):301-306. [http://dx.doi.org/10.1097/HP0b013e31825b581e] 19. Cancer Society. Curriculum Resources for Level 1, Level 2, Level 3 and Level 4. 2015. http://www. sunsmartschools.co.nz/teachers/curriculum-resources (accessed 20 May 2015).

Accepted 5 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

Molecular characterisation and epidemiological investigation of an outbreak of blaOXA-181 carbapenemaseproducing isolates of Klebsiella pneumoniae in South Africa R K Jacobson,1,2,3* MSc; M R Manesen,4,5,6* MPH; C Moodley,1,2,3 PhD; M Smith,1 MSc; S G Williams,4,6 MD; M P Nicol,1,2,3 MB BCh, MMed (Med Micro), DTM&H, FCPath (Micro), PhD; C M Bamford,1,2,3 MB ChB, MMed (Med Micro) FCPath (Micro) entre for Opportunistic, Tropical and Hospital Infections, National Institute for Communicable Diseases, Groote Schuur Hospital, C Cape Town, South Africa 2 National Health Laboratory Service, Groote Schuur Hospital, Cape Town, South Africa 3 Division of Medical Microbiology, University of Cape Town, South Africa 4 South African Field Epidemiology Training Programme, National Institute for Communicable Diseases, Sandringham, Johannesburg, South Africa 5 School of Health Systems and Public Health, University of Pretoria, South Africa 6 Centers for Disease Control and Prevention, Atlanta, Georgia, USA * These authors are co-first authors.

1

Corresponding author: R K Jacobson (rachaeljacobson@gmail.com)

Background. Klebsiella pneumoniae is an opportunistic pathogen often associated with nosocomial infections. A suspected outbreak of K. pneumoniae isolates, exhibiting reduced susceptibility to carbapenem antibiotics, was detected during the month of May 2012 among patients admitted to a haematology unit of a tertiary academic hospital in Cape Town, South Africa (SA).

Objectives. An investigation was done to determine possible epidemiological links between the case patients and to describe the mechanisms of carbapenem resistance of these bacterial isolates.

Methods. Relevant demographic, clinical and laboratory information was extracted from hospital records and an observational review of infection prevention and control practices in the affected unit was performed. Antimicrobial susceptibility testing including phenotypic testing and genotypic detection of the most commonly described carbapenemase genes was done. The phylogenetic relationship of all isolates containing the blaOXA-181 carbapenemase gene was determined by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing.

Results. Polymerase chain reaction analysis identified a total of seven blaOXA-181-positive, carbapenem-resistant K. pneumoniae isolates obtained from seven patients, all from a single unit. These isolates were indistinguishable using PFGE analysis and belonged to sequence type ST-14. No other carbapenemase enzymes were detected.

Conclusion. This is the first documented laboratory-confirmed outbreak of OXA-181-producing K. pneumoniae in SA, and highlights the importance of enforcing strict adherence to infection control procedures and the need for ongoing surveillance of antibiotic-resistant pathogens in local hospitals.

S Afr Med J 2015;105(12):1030-1035. DOI:10.7196/SAMJ.2015.v105i12.9926

Patients infected with multidrug-resistant Entero­ bacteriaceae were, until recently and with relative success, treated with carbapenems, a class of broadspectrum β-lactam antibiotics. Of great concern is the over-use of carbapenems in hospitals for treating Gram-negative bacterial infections, which is contributing to the increasing emergence of carbapenem resistance.[1] Carbapenem resistance in Klebsiella spp. is mainly attributable to the acquisition of carbapenem-hydrolysing β-lactamase enzymes. The Ambler classification scheme is used to separate these enzymes into classes A, B or D.[3] The OXA-48-like subgroup, of which OXA-181 is a member, are Ambler class D carbapenemases.[3] OXA-48 was first described in the environmental bacterium Shewanella spp., and more recently there have been several reports of this enzyme, mainly in K. pneumoniae isolates, from countries in the Middle East, Europe, and northern and southern Africa.[4-7] OXA-181, a variant of OXA-48, was first identified in K. pneumoniae isolated from a Tanzanian patient.[7] It differs by just four amino acid substitutions in the active site, yet still confers the same levels of enzymatic hydrolysis of carbapenems as OXA48. [7] Several international studies have identified OXA-181-producing Enterobacteriaceae in the UK, the Sultanate of Oman, the Netherlands, Senegal and New Zealand.[7-12] The genetic location of blaOXA-181 is

1030

typically on a Tn2013 transposon, immediately downstream of the insertion sequence ISEcp1B, carried on a 7.6-Kb, ColE-type plasmid.[7] The prevalence of nosocomial infections in African countries has been under-appreciated in the past, and while such outbreaks occurring internationally are frequently reported in the literature, relatively few of these reports originate from developing countries. [13] However, even in lower-income countries, outbreak reports are necessary to increase awareness in the local medical community and highlight the need for enforced and effective infection prevention and control (IPAC) measures to limit the occurrence and transmission of antibiotic-resistant pathogens.

OXA-48-like carbapenem-resistant Enterobacteriaceae are endemic worldwide but had not previously been observed in our hospital. A subsequent report indicates that such organisms had recently been detected in other local institutions.[6] This outbreak report serves as the first description and characterisation of a single outbreak of carbapenemresistant K. pneumoniae in a haematology unit of a local hospital in Cape Town, South Africa (SA), during the month of May 2012.

Objectives

Following the identification of a possible outbreak of carbapenemresistant Klebsiella spp. in a haematology unit in Cape Town, an epidemiological investigation was done to describe the extent of

December 2015, Vol. 105, No. 12

RESEARCH

the outbreak, ascertain possible transmission routes and identify opportunities to prevent further transmission. Laboratory studies were carried out to characterise the molecular basis for carbapenem resistance and the molecular epidemiology of these isolates.

Methods

This was a prospective study, implemented informally in response to the detection on 12 May 2012 of carbapenem-resistant Klebsiella spp. from two patients in the haematology intensive care unit (ICU) of a 900-bed tertiary care referral hospital in Cape Town.

The haematology ICU is utilised by high-risk haematology patients, either with haematological malignancies or undergoing stem cell transplants, typically when neutro­ penic. Patients from both the public hospital and the adjacent private hospital are admitted and nursed in 12 patient isolation rooms by staff from the public or private hospitals, respectively.

However, both teams of staff share communal work areas within the unit, including the nurses’ station, the sluice room and staff rooms. The unit is supported by infection control staff from both private and public hospitals.

Following the identification of carbapenemresistant Klebsiella, an immediate and intensive outbreak response was implemented. Infection control measures were intensified, patient movement in and out of the affected unit was halted, and 2 weeks later it was closed for decontamination, maintenance and repairs.

A policy for weekly stool or rectal swab sur­veillance for carbapenem-resistant Entero­­ bacteriaceae for all haematology and oncology inpatients (in either the ICU or the asso­ ciated wards) was already in place prior to May 2012. Laboratory records were checked for any previous carbapenem-resistant Enterobacteriaceae isolates from both clinical and surveillance specimens. Surveillance was intensified, and stool samples were also obtained from staff members to screen for possible gut carriage. Environmental sampling was not conducted as a previous outbreak suggested very limited benefit.[14] For the outbreak a case was defined as a patient with carbapenem-resistant Klebsiella isolated from a clinical specimen (provider requested) or surveillance (routine screening) culture from the shared haematology ICU from 1 to 31 May 2012. A retrospective review of hospital records was performed for each case patient admitted before 31 May 2012. Demographic, clinical, and laboratory information was abstracted from case patient charts, with all data being collected in the same manner as in the outbreak reported by Marchaim et al.[15] in 2011. Details of the eight patients included in the outbreak are provided in the ‘Results’ section.

Ethical considerations

As this study was conducted as an outbreak investigation for IPAC purposes, informed consent of patients was not obtained on the grounds that specimen collection was based on routine clinical practice and infection control requirements. The investigation was approved by the Human Research Ethics Committee of the University of Cape Town (Ref: 534/2012).

Bacterial identification and genotypic typing

All stool specimens or rectal swabs were plated onto MacConkey agar containing 4 µg/mL gentamicin. The resulting colonies were subsequently identified using the Vitek 2 system (GN and N133 card, bioMérieux, France) and their antibiotic susceptibility profiles determined (Vitek 2). All isolates with reduced susceptibility to the carbapenems were screened for phenotypic carbapenemase activity using the modified Hodge test. The minimum inhibitory concentrations of carbapenems available in this hospital (ertapenem, imipenem and meropenem) were determined using the E-test method (bioMérieux, France). All tests were done and interpreted according to the

Clinical Laboratory Standards Institute criteria (CLSI-2012).[16] Conventional polymerase chain reaction (PCR) assays were performed using, as template, either total cellular DNA extracted from cultured isolates using the ZR-96 Fungal/ Bacterial DNA kit (Zymo Research, Inqaba, South Africa), or total DNA extracted from stool and rectal swab specimens using either the QiaSymphony (QIAGEN, Germany) or ZR fecal DNA Microprep kit (Zymo Research, Inqaba, South Africa). All extractions were carried out as per the manufacturer’s instructions. PCR experiments were performed using PCR primers designed to target internal fragments of the current most clinically significant carbapenemase genes (blaNDM, blaVIM, blaSPM, blaIMP, blaKPC, blaGES and blaOXA-48-like) (Table 1).

The resulting PCR amplicons were purified (QIAquick PCR purification kit, QIAGEN, Germany) and then sequenced. To test for the presence of extended-spectrum β-lactamase (ESBL) (Table 1)[17-26] genes blaCTX-M, blaSHV and blaTEM, conventional PCR assays using primers designed to target internal fragments of these genes were performed and any resulting PCR amplicons of the expected size were sequenced.

Table 1. Primer sequences used in this study Primer

Sequence (5ʹ - 3ʹ)

Gene

Reference

Carbapenemases GESF

ATGCGCTTCATTCACGC

blaGES

17

GESR

GCTCAGGATGAGTTGTG

blaGES

17

IMIF

ATTGACACTCCATTTAC

blaIMI-1

18

IMIR

AACAACCAGTTTTGC

blaIMI-1

18

NDMF

GGTTTGGCGATCTGGTTTTC

blaNDM-1

19

NDMR

CGGAATGGCTCATCACGATC

blaNDM-1

19

OXA48F

CGTGTATTAGCCTTATCG

blaOXA-48-like

20

OXA48R

CGCTAACCACTTCTAGG

blaOXA-48-like

20

VIMF

GTGAGTATCCGACAGTC

blaVIM-1

18

VIMR

GAGCAAGTCTAGACCG

blaVIM-1

18

KPCF

TGTCACTGTATCGCCGTC

blaKPC-1

21

KPCR

CTCAGTGCTCTACAGAAAACC

blaKPC-1

21

SPMF

CTGCTTGGATTCATGGGCGC

blaSPM-1

22

SPMR

CCTTTTCCGCGACCTTGATC

blaSPM-1

22

Extended-spectrum β-lactamases CTXM1F

CGCTTTGCGATGTGCAG

blaCTX-M-1

17

CTXM1R

ACCGCGATATCGTTGGT

blaCTX-M-1

17

SHVC

AGAAGGGTTATTCTTATTTGTCGC

blaSHV

17

SHVD

TCTTTCCGATGCCGCCGCCAGTCA

blaSHV

23

DEB

ATGAGTAAACTTGGTCTGAC

blaTEM

24

3061TEM

AGGAAGCAAAGCTGAAAGGAATCAAATTTGG blaTEM

25

Insertion sequence ISEcp1F

GCAGGTCTTTTTCTGCTCC

ISEcp1 transposase 26

ISEcp1R

TTTCCGCAGCACCGTTTGC

ISEcp1 transposase 26

1031

December 2015, Vol. 105, No. 12

RESEARCH

To describe the genomic arrangement of the identified blaOXA-181 genes in positive isolates in relation to the ISEcp1B gene, which had previously been shown to be associated with the OXA-181 gene,[7] conventional PCR was carried out using primers designed to amplify an internal fragment of the insertion element, ISEcp1B, and an internal portion of the OXA-181 gene (Table 1). The resulting PCR amplicons were purified (QIAquick PCR purification kit) and then sequenced to confirm sequence identity.

The relatedness of the Klebsiella isolates was investigated using pulsed-field gel electro­ phoresis (PFGE) according to a previously published protocol with minor changes.[27] Total genomic DNA was digested, in situ, with XbaI (New England Biolabs Inc., UK) and the resulting DNA fragments were separated by electrophoresis using a 1% w/v, 0.5 × TBEagarose gel in a CHEF-DRII GeneNavigator apparatus (GE Healthcare, USA) with a ramped pulse time of 5 - 60 seconds, over 21 hours, at a constant voltage of 200 V, in 0.5 × TBE buffer maintained at 14°C. The resulting restriction profiles were analysed using GelCompar II version 5.1 software (Applied Maths, Belgium).

A dendrogram indicating the UPGMA clus­ tering between the isolates was created using the Dice similarity coefficient. The band tolerance and optimisation were set at 1.0% and a similarity threshold of ≥80% was used to define related clusters.[28]

Isolation 2

Common room

WC SH

Ante Sister

Cases, n 0 6 May

SH WC

13 May

Laminar 5

Laminar 4

Laminar 3

2

7

Ante Ante

WC SH Ante

WC WC SH SH

Public hospital

Laminar 2

WC Ante SH

Ante

Laminar 1

Ante

Female change Clean/ Sluice autoclave

Ante Ante

SH WC Ante

Isolation 4

Isolation 5

WC SS WC Male change S

SH SH WC WC

1 Isolation 3

27 May

Fig. 1. Timeline and transmission opportunities among the patients during the outbreak. A transmission opportunity was deemed to have occurred if two patients were in the same ward during the same time period.

Kitch

SH Ante WC

20 May Date

Nurses' station

Stock WC SH

Screening of current patients and staff

1

8

Linen store

Review of laboratory records showed that no carbapenem-resistant Enterobacteriaceae had been detected prior to 12 May 2012. A total of 340 rectal swabs or stool specimens, from patients and staff members, were collected and screened for carriage of carbapenem-resistant Enterobacteriaceae. A total of eight patients with carbapenem-

2

Isolation 1

WC Ante SH

Outbreak investigation

Closure of the unit

Unit closed for admission of new patients

3

5 WC Doctors' SH room

Results

Multilocus sequence typing (MLST), speci­ fic for Klebsiella, was performed using seven housekeeping genes as refer­ e nce loci (rpoB, gapA, mdh, pgi, phoE, infB, and tonB) according to the method described by Diancourt et al., [29] with minor amendments. Allele and sequence types were determined using the Insti­ tut Pasteur MLST online database for K. pneumoniae.[30]

Isolation 6

3

WC SH

Store, private Entrance

Ante 4

Isolation 7

Sister, private

Private hospital

Fig. 2. Floor plan of the shared haematology ICU in the hospital, showing the location of the patients identified with carbapenem-resistant Klebsiella during May 2012. Starred rooms indicate locations of affected case patients. (WC = water closet (toilet); S/SH = shower.)

1032

December 2015, Vol. 105, No. 12

RESEARCH

resistant Klebsiella were identified from 12 to 31 May 2012. The eight patients were either infected (blood culture, n=1) or colonised (pus swab, stool, sputum or tracheal aspirate, n=7). No carbapenemresistant Enterobacteriaceae were identified from the rectal swab specimens submitted by the healthcare workers (HCWs). A timeline of the outbreak is depicted in Fig. 1.

ICU, but could be epidemiologically linked to patient 1 because he was transferred and admitted to the bed adjacent to patient 6.

Patient 1 died from a bloodstream infection (6 hours post transfer), and 8 days later a carbapenem-resistant K. pneumoniae was cultured from an endotracheal specimen from patient 6.

Patient characteristics

During the inspection of the IPAC practices in the affected ICU, breaches in contact precaution including lack of use of aprons and gloves by HCWs before entering patient rooms, incorrect disposal of these items and poor hand hygiene were observed.

In addition, incorrect signage relating to standard IPAC practices and inadequate signage for patients about contact pre­ cautions was also documented.

A summary of the patients’ demographic and clinical information is provided in Table 2. The median age was 48 years (range 30 - 77 years) and half of the patients were male. The median hospitalisation time was 16 days (range 3 - 29 days). All patients had underlying malignancies, were receiving cancer chemotherapeutic treatment and had been previously exposed to multiple antibiotics, placing them at high risk for acquiring nosocomial infections.

A timeline for detection of carbapenemresistant Klebsiella isolates indicated that the outbreak occurred over a 2-week period from 12 to 28 May. The floor plan of the affected ICU indicates the placement of 7 of the 8 patients (Fig. 2). Patients 1, 2, 3, 4, 7 and 8 were either placed in the same room as a previous case or in adjacent rooms in close proximity to communal areas, while patient 5 was in close proximity to the doctors’ room and a common staff room.

Seven of the eight patients were admitted to the shared haematology unit for the duration of their hospital stay. The remaining patient (patient 6), who had a respiratory tract colonisation, was identified in a separate

Infection control

Microbiological characterisation of Klebsiella isolates

A total of eight carbapenem-resistant Kleb­ siella isolates (seven K. pneumoniae and one K. oxytoca) were identified. All eight isolates exhibited a multidrug-resis­tance phenotype with resistance to ampi­cillin, co-amoxiclav, cefuroxime, cefoxitin, cefotaxime, cefta­ zidime, cefe­ pime, genta­ micin, amikacin, tigecycline, co-trimoxazole, nalidixic acid and ciprofloxacin, and were susceptible to colistin only. Carbapenem minimum inhibitory concentration (MIC) patterns are shown in Table 2. The isolates demonstrated variable susceptibility to imipenem with reduced susceptibility to both meropenem (range 8 - >32 mg/L) and ertapenem (all

>32 mg/L). The modified Hodge test was positive for all eight isolates. [31] Conventional PCR for OXA-48 and OXA48-like genes generated amplicons of the expected size for all eight isolates. Subsequent sequence analysis revealed that all eight PCR positive isolates had 100% homology with blaOXA-181, a genetic variant of blaOXA-48.

Similar results were obtained from DNA extracted from the corresponding rectal swabs or stool samples. No amplicons were obtained for the other carbapenemase genes screened: blaNDM, blaVIM, blaIMP, blaKPC, blaSPM and blaGES. All eight isolates were positive on ESBL PCR screening for blaCTX-M, blaTEM and blaSHV (with the exception of K. oxytoca, which did not contain blaSHV), as shown in Table 2.

Genetic arrangement of the blaOXA-181

Using the forward primer targeting ISEcp1B and the reverse primer internal to blaOXA-181, an amplicon of the expected size was obtained, suggesting these genes are associated in all eight isolates.

Phylogenetic analysis

To establish the relatedness of the seven K. pneumoniae isolates, PFGE analysis was carried out. K. pneumoniae isolate 4 was not viable. The resultant PFGE fingerprints of six of the K. pneumoniae isolates, patients 1, 2, 3, 5, 6, and 8, were indistinguishable (100% identity) and were assigned to cluster A (Fig. 3). Two contemporary K. pneumoniae isolates, one from another ward (carbapenem susceptible) and one from another local hospital (carbapenem

Table 2. Demographic information, PCR and microbiological results of patients identified with carbapenem-resistant Klebsiella spp.

Patient Date of identity Isolate identity isolation

MIC (mg/L)

Age Gender (y)

Specimen Clinical type outcome

EP

IP

MP

Carbapenemase MHT genes ESBL genes

Case 1

K. pneumoniae

12/05/2012

M

77

Blood

Deceased

>32

6

16

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 2

K. pneumoniae

12/05/2012

M

36

Stool

Survived

>32

4

>32

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 3

K. pneumoniae

17/05/2012

M

44

Stool

Survived

>32

1.5

8

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 4

K. pneumoniae

18/05/2012

F

52

Stool

Deceased*

N/D 4

N/D

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 5

K. pneumoniae

19/05/2012

F

57

Stool

Survived

>32

8

>32

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 6

K. pneumoniae

21/05/2012

F

51

Tracheal aspirate

Survived

>32

4

>32

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

Case 7

K. oxytoca

21/05/2012

F

41

Stool

Survived

>32

>32 16

+

blaOXA-181

blaCTX-M-15, blaTEM

Case 8

K. pneumoniae

24/05/2012

M

30

Stool & pus swab

Survived

>32

4

+

blaOXA-181

blaCTX-M-15, blaTEM, blaSHV

16

EP = ertapenem; IP = imipenem; MP = meropenem; MHT = modified Hodge test. *Died from causes unrelated to K. pneumoniae infection.

1033

December 2015, Vol. 105, No. 12

100

90

80

70

60

50

RESEARCH

Case 1 Case 5 Case 6 Case 2 Case 8 Case 3 Case 7 Contemporary 1 Contemporary 2 80% confidence interval

Fig. 3. Dendrogram and PFGE DNA fingerprints generated by XbaI restriction enzyme treatment of OXA-181-producing K. pneumoniae isolates (patient cases 1, 5, 6, 2, 8, 3) and one K. oxytoca (patient case 7). Two contemporary K. pneumoniae isolates, one from another ward (carbapenem-susceptible, contemporary isolate) and one from another local hospital (carbapenem-resistant, contemporary isolate 2) were included in the analysis as outliers.

resistant) were included in the analysis and shown to be unrelated to cluster A. The K. oxytoca isolate from patient 7 was, as expected, genetically distinct from all the K. pneumoniae strains tested. Since the six K. pneumoniae isolates had the same PFGE profile, MLST analysis was only carried out on two representative K. pneumoniae isolates, case numbers 6 and 4. The results were analysed using the Pasteur database and showed that these two strains are both members of sequence type ST14.

Discussion and conclusions

This study describes the first documented nosocomial outbreak of blaOXA-181-producing, carbapenem-resistant K. pneumoniae and K. oxytoca isolated from a local tertiary aca­ demic hospital in Cape Town. Resistance to the clinically significant carbapenem antibiotics by enzymatic hydrolysis has been described in Enterobacteriaceae worldwide, and recently the class D β-lactamase, OXA48 and its variants have been detected more frequently.[4] While the blaOXA-181 gene has previously been identified in several clonally unrelated K. pneumoniae isolates from SA, India, Singapore, the Netherlands and New Zealand,[4-12] this is the first report describing an outbreak of blaOXA-181 in SA. To our knowledge this is the first identification of a blaOXA-181-producing K. oxytoca isolate.

Although it remains unclear where this organism originated, and since no international travel link could be established for any of the patients, there is evidence to suggest that OXA-181 may have been prevalent in a nearby private sector hospital that could have been a possible source of this organism in the community.[6] The profiles

of six of the K. pneumoniae isolates, patients 1, 2, 3, 5, 6, and 8, were indistinguishable and were assigned to cluster A. Two contempor­ ary K. pneumoniae isolates, one from another ward (carbapenem-susceptible) and one from another local hospital (carbapenemresistant), were included in the analysis and shown to be unrelated to cluster A. PFGE is no longer considered the gold standard for genetic typing because of its lack of discrimination. Therefore, to characterise the genetic background of this clone further, MLST of two representative isolates from cluster A, spanning the defined outbreak period, were selected. MLST indicated that these two isolates belonged to sequence type ST14. K. pneumoniae ST14 has on two previous occasions been associated with ESBLs and not with metallo-β-lactamases or serine carbapenemases, as was observed in these isolates.[10,11] All OXA-181-containing isolates in this study were resistant to carbapenems and positive for carbapenemase production by the modified Hodge test. The co-production of OXA-181 with ESBL enzymes and the accumulation of additional β-lactamase genes in Enterobacteriaceae has been shown to collectively produce an elevated multidrugresistance phenotype.[4,7,9,10] A probable explanation for the uncharacteristically high carbapenem resistance levels observed with these isolates was the presence of additional ESBL genes. Furthermore, the OXA-181 gene was shown to be linked to the ISEcp1B element, which has been shown to up-regulate gene expression and allow for gene mobilisation.[7] Further investigations are underway to determine the plasmid types of these isolates to better elucidate reasons for its successful spread.

1034

December 2015, Vol. 105, No. 12

The IPAC report documented inadequate infection control practices among healthcare staff in the shared haematology unit, and it is possible that this breakdown in infection control practices contributed to the spread of this organism between patients, either directly via the hands of staff or via fomites.

It was observed among HCWs that breaches in contact precautions, including the lack of aprons and gloves prior to entering patient rooms, as well as the incorrect disposal of these items, and overall poor hand hygiene could have contributed to the spread of this organism. HCWs were encouraged to submit faecal samples for the screening of gut carriage of carbapenem-resistant Enterobacteriaceae as a possible source of the outbreak. This investigation could not rule out transmission in other communal areas, such as the radiology department or procedure rooms used for implanting medical devices. Further case-control analysis of patient and provider risk factors would have strengthened this investigation.

In addition, this study could not clearly identify an index patient, given the inconsistent compliance with surveillance screening policy prior to the outbreak.

The following recommendations were made based on the IPAC report from this investigation: stricter adherence to laboratory screening for antibiotic-resistant organisms from routine surveillance rectal swabs of new patients, both on admission and weekly follow-up, as well as the re-education and adherence to IPAC among all staff (temporary and full time). Additionally, improved IPAC signage practices that will increase awareness among hospital staff, the identification of IPAC awareness champions and developing a multidisciplinary team to maintain awareness should be consi­ dered. Ultimately, timely identification of the organism, swift unit closure and a reduction in patient movement coupled with strict contact precautions for colonised patients were effective in limiting further transmission of this isolate, as there were no new cases identified after 28 May. However, given the ongoing circulation of patients between local hospitals, and the potential for long-term asymptomatic carriage, it is likely that carbapenem-resistant Klebsiella will be reintroduced in the future. Vulnerable patients with haematological malignancies are likely to manifest infections as a result of multidrug-resistant organisms, including carbapenem-resistant Klebsiella.

In summary, this outbreak demonstrates the importance of active surveillance coupled with rapid and accurate molecular geno­typic testing in enabling the detection and subsequent control of carbapenemase-

RESEARCH

producing Klebsiella. This work highlights the necessity of not only ensuring that effective infection control measures are in place to identify and limit the spread of such organisms, but also the added value molecular screening offers in confirming an outbreak by determining the molecular epidemiology of the bacterial isolates and the prevalence of resistance genes circulating in our hospitals and communities.

Author contributions. All authors were involved in the conceptualisation of the study. RKJ, CM, MS, CB and MRM collected the data. MRM, MS, SW and CB investigated the outbreak. RKJ, CM, MS, CB, MN, MRM, and SW carried out the data analysis and interpretation. RKJ and MRM drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgements. We acknowledge the National Health Laboratory Service Microbiology Division, Department of Medical Microbiology, University of Cape Town, as well as Sisters Morris, Engelbrecht and Boonzaaier, local infection control sisters and Seymour Williams and Alexander Kallen of the Centers for Disease Control and Prevention, USA. In addition, we acknowledge that the data for the MLST online database for K. pneumoniae are publicly available at http://www.pasteur.fr/mlst.

Funding. This work was supported by the Global Disease and Detection Funding, Centre for Opportunistic Tropical and Hospital Infections, National Institute for Communicable Diseases and the National Health Laboratory Service, Johannesburg.

References 1. Fishman N. Antimicrobial stewardship. Am J Med 2006;119(6A):S53-S61. [http://dx.doi.org/10.1016/ jamjmed.2006.04.003] 2. Goff D. Antimicrobial stewardship: Bridging the gap between quality care and cost. Curr Opin Infect Dis 2011;24(Suppl 1):S11-S20. [http://dx.doi.org/10.1097/01.qco.0000393484.17894.05] 3. Hall BG, Barlow M. Revised Ambler classification of beta-lactamases. J Antimicrob Chemother 2005;55(6):1050-1051. [http://dx.doi.org/10.1093/jac/dkil30] 4. Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: The phantom menace. J Antimicrob Chemother 2012;67(7):1597-1606. [http://dx.doi.org/10.1093/dks121] 5. Poirel L, Héritier C, Tolün V, Nordmann P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother 2004;48(1):15-22. [http://dx.doi. org/10.1128/AAC.48.1.15-22.2004] 6. Brink AJ, Coetzee J, Corcoran C, et al. Emergence of OXA-48 and OXA-181 carbapenemases amongst Enterobacteriaceae in South Africa, and evidence of in vivo selection of colistin resistance as a consequence of selective decontamination of the gastro-intestinal tract. J Clin Microbiol 2013;51(1):369-372. [http://dx.doi.org/10.1128/JCM.02234-12] 7. Potron A, Nordmann P, Lafeuille E, et al. Characterization of OXA-181, a carbapenem-hydrolyzing class D beta-lactamase from Klebsiella pneumoniae. Antimicrob Agents Chemother 2011;55(10):48964899. [http://dx.doi.org/10.1128/AAC.00481-11] 8. Dimou V, Dhanji H, Pike R, Livermore DM, Woodford N. Characterization of Enterobacteriaceae producing OXA-48-like carbapenemases in the UK. J Antimicrob Chemother 2012;67(7):1660-1665. [http://dx.doi.org/10.1093/jac/dks124]

1035

9. Dortet L, Poirel L, Al Yaqoubi F, Nordmann P. NDM-1, OXA-48 and OXA-181 carbapenemaseproducing Enterobacteriaceae in Sultanate of Oman. Clin Microbiol Infect 2012;18(5):E144-148. [http://dx.doi.org/10.1111/j.1469-0691.2012.03796.

10. Kalpoe JS, Al Naiemi N, Poirel L, Nordmann P. Detection of an Ambler class D OXA-48-type β-lactamase in a Klebsiella pneumoniae strain in The Netherlands. J Med Microbiol 2011;60(5):677678. [http://dx.doi.org/10.1099/jmm.0.028308-0] 11. Balm MND, Ngan G, Jureen R, et al. OXA-181-producing Klebsiella pneumoniae establishing in Singapore. BMC Infect Dis 2013;13:58. [http://dx.doi.org/10.1186/1471-2334-13-58] 12. Williamson DA, Heffernan H, Sidjabat H, et al. Intercontinental transfer of OXA-181-producing Klebsiella pneumoniae into New Zealand. J Antimicrob Chemother 2011;66(12):2888-2890. [http:// dx.doi.org/10.1093/jac/dkr396] 13. Manenzhe R, Zar H, Nicol M, Kaba M. The spread of carbapenem producing bacteria: A systematic review. J Antimicrob Chemother 2015;70(1):23-40. [http://dx.doi.org/10.1093/jac/dku356] 14. Madau M, Jacobson R, Minenza N, et al. Outbreak of multi-drug resistant Pseudomonas aeruginosa bloodstream infection in the haematology unit of a South African academic hospital. PLoS One 2013;8(3):E55985. [http://dx.doi.org/10.1371/journal.pone.0055985] 15. Marchaim D, Chopra T, Pogue JM, et al. Outbreak of colistin-resistant, carbapenem-resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. J Antimicrob Chemother 2011;55(2):593-599. [http:// dx.doi.org/10.1128/AAC.01020-10] 16. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-second Informational Supplement, M100-S22S21. Wayne, PA: CLSI, 2012.

17. Segal H, Elisha BG. Resistance to beta-lactams, and reduced susceptibility to carbapenems, in clinical isolates of Klebsiella pneumoniae due to interplay between CTX-M-15 and altered outer membrane permeability. South African Journal of Epidemiology and Infection 2006;21(2):41-44.

18. Jacobson RK, Minenza N, Nicol M, Bamford C. VIM-2 metallo-beta-lactamase producing Pseudomonas aeruginosa causing an outbreak in South Africa. J Antimicrob Chemother 2012;67(7):1797-1798. [http://dx.doi.org/10.1093/jac/dks100] 19. Poirel L, Revathi G, Bernabeau S, Nordman P. Detection of NDM-1-producing Klebsiella pneumoniae in Kenya. Antimicrob Agents Chemother 2011;55(2):934-936. [http://dx.doi.org/10.1128/AAC.01247-10] 20. Manesen R, Bamford C, Smith M, et al. Outbreak of carbapenem-resistant Klebsiella species in an academic hospital, Western Cape, May 2012. National Institute for Communicable Diseases Surveillance Bulletin 2012;10(4):82-86.

21. Yigit H, Queenan AM, Anderson GJ, et al. Novel carbapenem-hydrolyzing beta-lactamase, KPC1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother 2001;45(4):1151-1161. [http://dx.doi.org/10.1128/AAC.45.4] 22. Poirel L, Magalhaes M, Lopes M, Nordmann P. Molecular analysis of metallo-β lactamase gene blaSPM-1-surrounding sequences from disseminated Pseudomonas aeruginosa isolates in Recife, Brazil. Antimicrob Agents Chemother 2004;48(4):1406-1409. [http://dx.doi.org/ 10.1128/ AAC.48.4.1406-1409.2004] 23. Perilli M, Dell’Amico E, Segatore B, et al. Molecular characterization of extended spectrum betalactamases produced by nosocomial isolates of Enterobacteriaceae from an Italian nationwide survey.

J Clin Microbiol 2002;40(2):611-614. [http://dx.doi.org/ 10.1128/JCM.40.2.611-614.2002] 24. Canica MM, Lu CY, Krishnamoorthy R, Paul GC. Molecular diversity and evolution of blaTEM genes encoding beta-lactamases resistant to clavulanic acid in clinical E. coli. J Mol Evol 1997;44(1):57-65.

25. Nelson EC, Segal H, Elisha BG. Outer membrane protein alterations and blaTEM-1 variants: Their role in β-lactam resistance in Klebsiella pneumoniae. Antimicrob Agents Chemother 2003;52(6):899-903. [http://dx.doi.org/10.1093/jac/dkg486] 26. Poirel L, Decousser J, Nordmann P. Insertion sequence ISEcp1B is involved in expression and mobilization of a bla(CTX-M) beta-lactamase gene. Antimicrob Agents Chemother 2003;47(9):29382945. [http://dx.doi.org/10.1128/AAC.47.9.2938-2945.2003] 27. Pulse Net USA. One-day (24-28 h) standardized laboratory protocol for molecular subtyping of Escherichia coli O157:H7, Salmonellaserotypes, Shigella sonnei, and Shigella flexneri by pulsed field gel electrophoresis (PFGE) 2009;(10):1-16. http://www.pulsenetinternational.org/assets/PulseNet/ uploads/pfge/PNL05_Ec-Sal-ShigPFGEprotocol.pdf (accessed 6 November 2015).

28. Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin Microbiol 1995;33(9):2233-2239.

29. Diancourt L, Passet V, Verhoef J, et al. Multilocus sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin Microbiol 2005;43(8):4178-4182. [http://dx.doi.org/10.128/JCM.43.8.4178-4182.2005] 30. Institut Pasteur. Klebsiella pneumoniae MLST database. http://www.pasteur.fr/mlst (accessed 24 January 2015).

31. Girlich D, Poirel L, Nordmann P. Value of the modified Hodge test for the detection of emerging carbapenemases in Enterobacteriaceae. J Clin Microbiol 2012;50(2):477-479. [http://dx.doi. org/10.1128/JCM.05247-11]

Accepted 28 September 2015.

December 2015, Vol. 105, No. 12

RESEARCH

Measurement of viral load by the automated Abbott real-time HIV-1 assay using dried blood spots collected and processed in Malawi and Mozambique F Erba,1 MSc; D Brambilla,2 MSc; S Ceffa,2 MSc; F Ciccacci,2,3 MD; R Luhanga,4 BSc; Z Sidumo,5 BSc; L Palombi,6 MD; S Mancinelli,6 MD; M C Marazzi,7 MD; M Andreotti,8 MSc; M Giuliano,8 MD epartment of Clinical Science and Translational Medicine, University of Roma Tor Vergata, Rome, Italy D DREAM Programme, Community of Sant’Egidio, Rome, Italy 3 Department of Infectious Diseases, University of La Sapienza, Rome, Italy 4 DREAM Programme, Community of Sant’Egidio, DREAM Health Centre, Blantyre, Malawi 5 DREAM Programme, Community of Sant’Egidio, Centro Para Criança, Maputo, Mozambique 6 Department of Biomedicine and Prevention, University of Roma Tor Vergata, Rome, Italy 7 Department of Community Health, LUMSA University, Rome, Italy 8 Department of Therapeutic Research and Medicines Evaluation, Istituto Superiore di Sanità, Rome, Italy 1 2

Corresponding author: M Andreotti (mauro.andreotti@iss.it)

Background. The use of dried blood spots (DBS) for HIV-1 viral load quantification can greatly improve access to viral monitoring for HIV-infected patients receiving treatment in resource-limited settings.

Objectives. To evaluate and validate HIV viral load measurement from DBS in sub-Saharan Africa, with a reliable, all-automated, standard commercial assay such as the Abbott m2000.

Methods. A total of 277 DBS were collected in different health centres in Malawi and Mozambique and analysed for viral load determination using the Abbott m2000 assay with the corresponding plasma samples as gold standard. Samples were extracted using the m2000SP automatic extractor and then processed as the plasma samples using the specific 1.0 mL HIV-RNA DBS protocol.

Results. Among samples with detectable HIV-RNA the correlation between viral load obtained from the paired 131 plasma and DBS samples was high (r=0.946). Overall, viral load values between DBS and plasma differed by less than 0.5 log unit in 90.1% of cases and by less than 1 log unit in 100% of cases. Using a threshold of 1 000 copies/mL (defining virological failure in resource-limited settings), sensitivity was 94.2% and specificity 98.6%, and both positive and negative predictive values were high (98.5% and 94.5%, respectively).

Conclusion. DBS extracted and processed using the Abbott automated system can be reliably used in resource-limited setting to diagnose virological failure.

S Afr Med J 2015;105(12):1036-1038. DOI: 10.7196/SAMJ.2015.v105i12.9673

The use of dried blood spots (DBS) has greatly facili­ tated genetic and metabolic screening of newborns by simplifying sample collection, storage and transport.

Measuring the HIV-1 burden from whole blood dried on filter paper provides a suitable alternative for lowtechnology settings with limited access to laboratory facilities, such as subSaharan Africa (SSA). Nucleic acids in DBS have been shown to be stable for several months at room temperature, provided the DBS specimens are thoroughly dried and are stored with desiccant.[1-4] DBS specimens can therefore be collected at remote rural sites and transported to a central or regional testing laboratory without refrigeration. DBS are user-friendly and cost-effective in resource-limited settings, their ability being demon­ strated to correctly identify virological failure.[5-7] DBS use may therefore represent a paradigm shift in accessibility to virological testing for HIV infection. Indeed, the Diagnostic Access Initiative (http://www.unaids.org) signed in Melbourne during the 20th International AIDS Conference in July 2014, specifically focused on ensuring that all people accessing HIV treatment should have ready access to tests that monitor levels of the virus in their bodies, and underlined the importance of developing new and affordable viral load and early infant diagnosis technology.

The objective of this study was to evaluate and validate, in SSA, HIV viral load measurement from DBS with a reliable, all-automated, standard commercial assay, the Abbott m2000 (Abbott Molecular, USA). The study was performed in two healthcare settings in two different countries,

1036

Malawi and Mozambique, within the health centre network of the DREAM (Drug Resource Enhancement against AIDS and Malnutrition) Programme of the Community of Sant’Egidio. Briefly, DREAM is a holistic programme started in December 2001 for the care of people living with HIV and the prevention of mother-to-child transmission (http://dream. santegidio.org). To date, the DREAM programme is active in ten countries (Mozambique, Malawi, Tanzania, Kenya, Republic of Guinea, Guinea Bissau, Cameroon, Democratic Republic of Congo, Angola and Nigeria) in SSA, with a network of 42 health centres and 20 laboratories. Because of the hub infrastructure used for health centres and laboratories in every country, only those facilities with molecular biology laboratories perform the HIV viral load testing. The possibility of using DBS to deliver samples for HIV viral load may therefore increase the accessibility to the test in rural areas and small settings. In this study, results were analysed according to different thresholds of HIV-RNA in order to develop an HIV viral load testing procedure from DBS that could be implemented in SSA.

Methods

Paired plasma and DBS samples were collected from 119 patients in 20 centres referring to the DREAM Health Centre of Blantyre, Malawi, and from 158 patients in 23 centres referring to the Centro Para Criança, Maputo, Mozambique. The DREAM Programme has been approved by the National AIDS Commission of Malawi and by the Ministério de Saude – Direcção de Planificação e Cooperação of Mozambique.

December 2015, Vol. 105, No. 12

RESEARCH

Results

A total of 277 paired plasma and DBS samples were analysed. Samples were divided according to the HIV-RNA level in plasma: ≤2 log10 (n=109), 2 log10 (range 2.11 - 2.99; n=30), 3 log10 (range 3.10 - 3.99; n=81), 4 log10 (range 4.04 - 4.96; n=29) and ≥5 log10 (range 5.03 6.84; n=28). Samples were analysed after a mean time of 1 week after collection and storage (at room temperature).

Agreement between detectable and undetectable viral load for plasma and DBS was seen in 83.0% of cases. In 16.6% of cases (n=46), HIV-RNA was not detectable in DBS while measurable levels were present in plasma (between 1.76 and 3.83 logs; mean 2.48). One DBS gave a result of 3.54 log10 while the corresponding plasma level was <1.6 log10. In all other cases of undetectable viral load in plasma (n=99), HIV-RNA was not detectable in DBS. The lowest HIV-RNA level detected by DBS was 616 copies/mL. Using the 40 copies/mL threshold, the test had relatively good sensitivity (74%), high specificity (99%) and a high positive predictive value (99.2%) (Table 1). Negative predictive value was low (68.3%) as an effect of the low rate of detection when plasma HIV-RNA was below 3 log copies/mL.

Among samples with detectable HIV-RNA, the correlation between viral load values obtained from the paired 131 plasma and DBS samples was high (Pearson correlation coefficient 0.946 and R2=0.895) (Fig. 1). The mean (SD) difference between the measured viral load in DBS and in plasma was 0.15 (0.27) log copies/mL. HIV-RNA levels obtained from DBS were higher than in plasma in 70.2% of the samples. However, this over-quantification was observed mainly in specimens with a plasma viral load of <3 000 copies/mL (mean (SD) difference 0.38 (0.19)), while the difference for samples with a plasma viral load of >3 000 copies/mL was negligible (0.09 (0.26)). Overall, viral load values between DBS and plasma differed by <0.5 log unit in 90.1% of cases and by <1 log unit in 100%.

Agreement between the two methods was calculated by the BlandAltman method,[8] in which the differences between individual viral load results from plasma and DBS are plotted against the mean of the two results. In Fig. 2 it can be seen that the data are well scattered over the mean along the overall range of viral load examined and that all

7

Plasma HIV-RNA, log10 copies/mL

Eight hundred microlitres of plasma were used to extract nucleic acids with the Abbott automatic extractor, Sample Preparation System (m2000SP). The nucleic acids extracted by m2000SP were used for real-time amplification with the Abbott m2000RT using the 0.6 mL HIV-RNA protocol. DBS (50 µL of peripheral blood per spot) were air-dried overnight and stored in a plastic bag with desiccant at room temperature. DBS eluate was obtained by incubating two of five spots for each sample with 1.7 mL of Abbot Bulk lysis buffer for 15 minutes at room temperature with constant mixing. The eluate was transferred to a test tube and extracted using the m2000SP automatic extractor with the 1.0 mL HIV-1 RNA DBS Exp V04 protocol. The extracted material was then quantitated as the plasma samples with the real-time PCR Abbott m2000RT using the corresponding 1 mL DBS protocol, according to the manufacturer’s instructions.

All HIV-RNA values were log10 transformed before analysis. Results reported as not detected and below detection limit (<40 copies/mL) were analysed considering a value of 1.6 log10 HIV-RNA per mL. Results were expressed as means and standard deviations (SDs). Viral load measured in DBS and paired plasma samples were compared by the Pearson correlation analysis. The Bland-Altman method[8] was used for analysis of concordance between the results obtained from plasma and those obtained from DBS. Statistical analysis was done using SPSS version 22 (IBM, USA).

6

5

4

3

R2=0.895

2 2

3

4 5 6 DBS HIV-RNA, log10 copies/mL

7

Fig. 1. Comparison of viral load in DBS and corresponding values in plasma only for samples with detectable viral load.

Table 1. Sensitivity, specificity, positive and negative predictive values (95% confidence intervals) of DBS according to the limit of detection of the assay (A) and the threshold of 1 000 copies/mL (B) Plasma A DBS

≥40 copies/mL

<40 copies/mL

Total

≥40 copies/mL

131

1

132

Sensitivity 74% (66.9 - 80.3)

<40 copies/mL

46

99

145

Specificity 99% (94.5 - 99.8)

Total

177

100

277

PPV 99.2% (95.8 - 99.9) NPV 68.3% (60.0 - 75.8)

Plasma B DBS

≥1 000 copies/mL

<1 000 copies/mL

Total

≥1 000 copies/mL

130

2

132

Sensitivity 94.2% (88.9 - 97.5)

<1 000 copies/mL

8

137

145

Specificity 98.6 % (94.9 - 99.8)

Total

138

139

277

PPV 98.5% (94.6 - 99.8) NPV 94.5% (89.4 - 97.6)

PPV = positive predictive value; NPV = negative predictive value.

1037

December 2015, Vol. 105, No. 12

RESEARCH

Difference plasma - DBS, log10 copies/mL

1 mean +1.96 SD 0.5

0

mean –1.96 SD

-0.5

-1 3

4 5 6 Mean plasma and DBS, log10 copies/mL

7

Fig. 2. Bland-Altman analysis of agreement between plasma and DBS. The horizontal lines represent the mean difference and 1.96 SDs.

but five samples were within the 1.96 SD limits, underlining the good agreement between the two methods.

The detection rate with DBS was 90.1% when plasma levels were >1 000 copies/mL. Categorising the samples according to this 1 000 copies/ mL threshold, of the 138 samples with a viral load of >1 000 copies/mL, 8 (5.8%) had a DBS viral load of <1 000 copies/ ml and therefore would have been missed if the virological failure threshold had been set at 1 000 copies/mL. Of the 139 samples with a plasma viral load of <1 000 copies/mL, only 2 (1.4%) had an HIVRNA in DBS of >1 000 copies/ml and could represent false virological failure detection. With the threshold of 1 000 copies/mL, sensitivity was 94.2%, specificity 98.6% and positive and negative predictive values 98.5% and 94.5%, respectively (Table 1). The agreement between DBS and plasma HIV-RNA quanti­fication at the 1 000 copies/mL threshold was high, as demon­strated by the Kappa coefficient value of 0.928 (standard error 0.022, p<0.001).

Discussion

Several reports have been published on the use of DBS for viral load quantification using different methodologies, including the Abbott assay.[9] In the great majority of cases the results were comparable with those obtained from plasma. However, the use of DBS collected and prepared in real-world conditions for viral load monitoring with the automated Abbott assay has been reported in only a few studies.[10-12] Our data, obtained from DBS collected and processed by local personnel in Malawi and Mozambique, showed that DBS gave comparable results in respect of the reference method in the range from 3 to 7 logs copies/ mL. However, the detection rate below the threshold of 1 000 copies/mL was lower, as reported in other articles,[2,13] although the lowest plasma RNA value at which DBS RNA was detectable was 616 copies/mL in line with the threshold of 550 copies/mL previously reported for this assay. [5] The modest over-quantification that we observed with DBS can be ascribed to the presence of HIV-DNA and intracellular RNA and seems to have a greater impact on samples with a low viral load (in our study <3 000 copies/mL), as previously reported.[4,11,14] The 2013 HIV treatment guidelines of the World Health Organi­ zation[15] indicate a threshold of 1 000 copies/mL of HIV-RNA to define virological failure using plasma, and suggest use of a higher,

1038

although undefined, threshold when using DBS. In previous studies performed with the Abbott system, sensitivity for the detection of virological failure at 1 000 copies/mL was between 75% and 100% and specificity was between 82% and 97%.[10,11] In our study, very high positive and negative predictive values were observed when using a threshold of 1 000 copies/mL, suggesting that even with the use of DBS the threshold of 1 000 copies/mL can provide reliable results, given the specificity of 98.6% at this threshold.

The last systematic review of the use of DBS for monitoring HIV viral load[9] emphasised the need for a standardised approach for sampling, storing and processing DBS samples in order to establish whether DBS could reliably replace plasma specimens to identify virological failure. Our study suggests that DBS on filter paper, stored at room temperature and processed with an automated extractor, followed by real-time quantification of HIV-RNA, could represent a standard to be applied in resource-limited settings.

Conclusion

Our study demonstrated that HIV-1 quantification from DBS using a standardised commercial assay provides reliable identification of virological failure in SSA. Acknowledgments. We acknowledge assistance of all the health workers of the health centres in Malawi and in Mozambique. The study was supported by the DREAM Programme, Community of Sant’Egidio, Rome, Italy.

References 1. Brambilla D, Jennings C, Aldrovrandi G, et al. Multicenter evaluation of use of dried blood and plasma spot specimens in quantitative assays for human immunodeficiency virus RNA: Measurement, precision, and RNA stability. J Clin Microbiol 2003;41(5):1888-1893. [http://dx.doi.org/10.1128/ JCM.41.5.1888-1893.2003] 2. Mbida AD, Sosso S, Flori P, et al. Measure of viral load by using the Abbott Real-Time HIV1 assay on dried blood and plasma spot specimens collected in 2 rural dispensaries in Cameroon.

J Acquir Immune Defic Syndr 2009;52(1):9-16. [http://dx.doi.org/10.1097/QAI.0b013e3181aeccbc] 3. Van Deursen P, Oosterlaken T, Andre P, et al. Measuring human immunodeficiency virus type 1 RNA load in dried blood spot specimens using NucliSENS EasyQ HIV-1 v2.0. J Clin Virol 2010;47(2):120125. [http://dx.doi.org/10.1016/j.jcv.2009.11.021] 4. Pirillo MF, Recordon-Pinson P, Andreotti M, Mancini MG, Amici R, Giuliano M. Quantification of HIV-RNA from dried blood spots using the Siemens VERSANT® HIV-1 RNA (kPCR) assay.

J Antimicrob Chemother 2011;66(12):2823-2826. [http://dx.doi.org/10.1093/jac/dkr383] 5. Arredondo M, Garrido C, Parkin N, et al. Comparison of HIV-1 RNA measurements obtained by using plasma and dried blood spots in the automated Abbott real-time viral load assay. J Clin Microbiol 2012;50(3):569-572. [http://dx.doi.org/10.1128/JCM.00418-11] 6. Johannessen A, Garrido C, Zahonero N, et al. Dried blood spots perform well in viral load monitoring of patients who receive antiretroviral treatment in rural Tanzania. Clin Infect Dis 2009;49(6):976-981. [http://dx.doi.org/10.1086/605502] 7. Rottinghaus EK, Ugbena R, Diallo K, et al. Dried blood spot specimens are suitable alternative sample type for HIV-1 viral load measurement and drug resistance genotyping in patients receiving first-line antiretroviral therapy. Clin Infect Dis 2012;54(8):1187-1195. [http://dx.doi.org/10.1093/cid/cis015] 8. Bland JM, Altman DG. Statistical methods for assessing agreement between two methods of clinical measurement. Lancet 1986;1(8476):307-310.

9. Smit PW, Sollis KA, Fiscus S, et al. Systematic review of the use of dried blood spots for monitoring HIV viral load and for early infant diagnosis. PLoS One 2014;9(3):e86461. [http://dx.doi.org/10.1371/journal.pone.0086461] 10. Lofgren SM, Morrissey AB, Chevallier CC, et al. Evaluation of a dried blood spot HIV-1 RNA program for early infant diagnosis and viral load monitoring at rural and remote healthcare facilities.

AIDS 2009;23(18):2459-2466. [http://dx.doi.org/10.1097/QAD.0b013e328331f702] 11. Monleau M, Aghokeng AF, Eymard-Duvernay S, et al. Field evaluation of dried blood spots for routine HIV-1 viral load and drug resistance monitoring in patients receiving antiretroviral therapy in Africa and Asia. J Clin Microbiol 2014;52(2):578-586. [http://dx.doi.org/ 10.1128/JCM.02860-13] 12. Rutstein SE, Kamwendo D, Lugali L, et al. Measures of viral load using Abbott RealTime HIV-1 Assay on venous and fingerstick dried blood spots from provider-collected specimens in Malawian district hospitals. J Clin Virol 2014;60(4):392-398. [http://dx.doi.org/10.1016/j.jcv.2014.05.005] 13. Marconi A, Balestrieri M, Comastri G, et al. Evaluation of the Abbott Real-Time HIV-1 quantitative assay with dried blood spot specimens. Clin Microbiol Infect 2009;15(1):93-97. [http://dx.doi. org/10.1111/j.1469-0691.2008.02116.x] 14. Vidya M, Saravanan S, Rifkin S, et al. Dried blood spots versus plasma for the quantitation of HIV1 RNA using a real-time PCR, m2000rt assay. J Virol Methods 2012;181(2):177-181. [http://dx.doi. org/10.1016/j.jviromet.2012.02.006] 15. World Health Organization. 2013. Consolidated guidelines on the use of antiretroviral drugs for treating and preventing HIV infection: Recommendations for a public health approach. http://www. who.int/hiv/pub/guidelines/arv2013/download/en/index.html (accessed 15 October 2015).

Accepted 5 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

Time for a culture change? Suboptimal compliance with blood culture standards at a district hospital in Cape Town M S Abrahams, MB ChB; A C Whitelaw, MB BCh, MSc, FCPath (SA) (Micro); H Orth, MB ChB, MMed (Micro), DTM&H Division of Medical Microbiology, Faculty of Medicine and Health Sciences, Stellenbosch University, Tygerberg, Cape Town, South Africa, and National Health Laboratory Service, Tygerberg Hospital, Cape Town Corresponding author: M S Abrahams (shareef.abrahams@nhls.ac.za)

Background. The benchmark for contaminated blood cultures (BCs) is 3%. The South African (SA) guideline aims to optimise BC yield and reduce contamination. Data on BC collection practices in SA since the publication of the 2010 SA guideline are lacking.

Objective. To evaluate compliance with the national guideline for the optimal use of BCs and determine the BC contamination rate at a local district hospital.

Method. An audit of compliance with 22 BC standards was conducted at a district hospital in Cape Town, SA. Standards were evaluated by reviewing clinical and laboratory data and by a clinician questionnaire.

Results. Of the 425 BCs reviewed, 12.5% had positive growth, and 4.5% grew contaminants. Only 33% of BC bottles contained the recommended fill volume of 8 - 10 mL, and 96.9% of patients had a single BC within a 24-hour period. Of all the BCs, only 7.8% had a combined blood volume of at least 20 mL. The yield of pathogens in BCs collected after antibiotic exposure was 4.9% compared with 7.5% for those cultures with no prior antibiotic exposure (p=0.3). The overall median needle-to-incubator transport time was 11 hours 25 minutes.

Conclusion. The BC contamination rate was high and compliance with most standards was variable or not met. The findings may not be generalisable to other hospitals, and we recommend that each institution reviews its own BC practices. Recommendations made to hospital staff included a re-audit following implementation of these recommendations.

S Afr Med J 2015;105(12):1039-1043. DOI:10.7196/SAMJ.2015.v105i12.9442

Blood culture (BC) is the ‘gold standard’ for the detec­ tion of micro-organisms in the bloodstream.

The 2010 South African (SA) guideline for the optimal use of BCs aims to optimise BC yield and [1] reduce contamination.

There are approximately 20 000 deaths per day from sepsis worldwide,[2] and BC plays an integral role in identifying bacter­aemia and guiding diagnostic and therapeutic choices. It is also one of the cornerstones of antimicrobial stewardship, which has reduced the overuse of antibiotics and costs in hospitalised patients.[3] The interpretation of BC results may be complicated by the recovery of potential contaminants. The Clinical and Laboratory Standards Institute (CLSI)’s benchmark for the maximum acceptable percentage of contaminated BCs is 3%.[4] Contaminated BCs are associated with additional laboratory testing, unnecessary prescription of antibiotics and increased patient charges.[5] A recent audit of BCs among adult patients at GF Jooste Hospital in Cape Town, SA, reported high rates of contamination by coagulase-negative staphylococci (CoNS) ranging from 4.6% to 9.3% per year.[6] To our knowledge, there has not been a comprehensive audit of BC collection practices in SA since the publication of the SA guideline.[1]

Objectives

To evaluate compliance with the SA guideline[1] for the optimal collection of BCs and to determine the institutional BC contamination rate at a district hospital in Cape Town.

Methods

Study design

We conducted an audit of compliance with 22 BC standards (Table 1) derived from the national guideline.[1] Clinical and laboratory data

1039

were extracted over a 3-month period (1 November 2013 - 31 January 2014). All patient data were anonymised. The study was approved by the Research Ethics Committee of Stellenbosch University, Cape Town (Protocol REC S12/09/248).

Setting and patient population

The audit was conducted at a 282-bed district hospital in Cape Town. The hospital is situated 3.5 km from the National Health Laboratory Service (NHLS) microbiology laboratory, located at Tygerberg Hospital. A courier service collects specimens from the hospital and delivers them to the laboratory 12 times a day on week days and 8 times a day over weekends. All adult inpatients (≥13 years) from whom BCs were collected were eligible for inclusion.

Mycobacterial BCs were excluded because the mycobacterial BC instrument used was different from that used for routine BCs.

Definitions

A BC was defined as a sample of blood obtained from a single venepuncture site, irrespective of whether the blood was inoculated into one or multiple BC bottles.

A BC was considered to be contaminated if one or more of the following skin flora organisms were identified in only one of a series of BCs: CoNS, Corynebacterium spp., viridans group streptococci, Micrococcus spp., Bacillus spp., and Propionibacterium spp.[7] This included BCs with a potential pathogen, in addition to a contaminant.

Polymicrobic BCs with more than one contaminant species were considered as being a single contaminated BC.[8] If any of the abovementioned skin flora organisms were cultured from a solitary blood culture (SBC) (single BC within a 24-hour period), the medical records and medication charts were retrospectively reviewed. BCs were classified as clinically significant if antibiotic treatment was initiated or

December 2015, Vol. 105, No. 12

RESEARCH

continued as a therapeutic response to the BC result, an intravascular line was removed or replaced as a therapeutic response to the BC result, or the BC result was associated with an expected clinical condition (e.g. graft sepsis, shunt sepsis or endocarditis). All positive BCs with a recognised pathogen were considered to be clinically significant.

Needle-to-incubator transport time was defined as the time differ­ ence between BC collection and insertion of BC bottles into the BC instrument. Insertion on the day of sample collection was defined as same-day incubation, and insertion on a different day as delayed incubation.

The institutional BC contamination rate was defined as the number of contaminated BCs processed during the study period, divided by the total number of BCs performed during that period.[8]

Data sources

• Clinical and laboratory data were extracted from clinical case notes, laboratory request forms, BC bottles, medication charts and the laboratory information system (LIS).

Table 1. Blood culture standards

• BC bottle volume was determined by subtracting the post-filling weight from the standard pre-filled weight. One mL of blood weighs approximately 1 g. The manufacturer (bioMérieux) recommends that a sample volume of 8 - 10 mL blood be provided per bottle and that the maximum sample volume should not exceed 10 mL per bottle.

• Needle-to-incubator transport time was calculated using the date and time of BC collection documented on the laboratory request form and the times available on the LIS. • A clinician questionnaire was designed to evaluate standards relating to obtaining informed consent, BC ordering practices, skin and bottletop antisepsis, BC collection technique, and storage of BC bottles.

Data evaluation (standards numbered as per Table 1)

• Standard 1 was evaluated by reviewing the working diagnosis in the clinical case notes at the time of BC collection.

• Standards 2, 4 - 6, 8 - 14 and 21 were evaluated by a clinician questionnaire. Selected clinician responses were ranked as follows: always (>95%), usually (50 - 95%), sometimes (5 - 50%), rarely (<5%), and uncertain.

• Standard 3 was evaluated by reviewing laboratory request forms, medication charts and the clinician questionnaire.

• Standard 7 was evaluated by reviewing the site of BC collection as indicated on the laboratory request forms.

• Standards 15 - 20 and 22 were evaluated by reviewing laboratory request forms, BC bottles, clinical case notes and the LIS.

S1

BCs should be drawn if there is a clinical suspicion of a bloodstream infection.

S2

Informed consent should be obtained prior to performing a BC.

S3

BCs should be collected prior to administration of antibiotics.

S4

Hand washing should be performed prior to performing a BC.

S5

Hands should be disinfected prior to performing a BC.

S6

Sterile gloves should be used when performing a BC.

S7

BCs should be drawn from peripheral sites.

S8

BCs should be collected from separate venepuncture sites.

S9

Puncture site should be cleaned using appropriate disinfectant.

S10

Skin disinfectant should be allowed time to dry before inserting the needle.

S11

BC bottle tops should be disinfected prior to inoculation.

S12

Bottle-top disinfectant should be allowed to dry prior to inoculation.

S13

Needles should not be exchanged between BC collection and inoculation of BC bottles.

S14

BC bottles should be inoculated first, if blood is collected for other tests.

Enterobacteriaceae

13

S15

Minimum of 2 and maximum of 3 BCs should be drawn within 24 hours.

Staphylococcus aureus

8

Streptococcus pneumoniae

6

Pseudomonas aeruginosa

5

Cryptococcus neoformans

2 2

S16

Laboratory procedures

BC bottles were transported to the laboratory and incubated either until they flagged positive, or for 5 days (or longer if extended incubation was required) in the BacT/Alert (bioMérieux, SA) BC system. Broths from positive bottles were Gram-stained and further identified using standard techniques.[9]

Statistical analysis

Conventional descriptive methods were used for data analysis.

Percentages were reported for categorical variables and median and interquartile ranges (IQRs) for continuous variables. Selected Table 2. Micro-organisms recovered from blood cultures*

Aerobic BC bottles should be used in a resource-limited setting.

Isolates, n Pathogens

S17

Minimum of 20 mL of blood (10 mL per bottle) should be obtained for each BC.

Staphylococcus hominis† Erysipelothrix rhusiopathiae

1

S18

BC bottles should be correctly labelled.

Streptococcus anginosus

1

S19

Laboratory request form should include patient identifiers, site, date and time of collection, clinical information regarding suspected diagnosis, and contact details of requesting doctor.

S20

BC collection should be documented in the clinical notes.

S21

BC bottles should be left at room temperature if there is a delay in transporting them to the laboratory.

S22

BC bottles should be delivered to the laboratory as soon as possible.

1040

Contaminants Coagulase-negative Staphylococcus spp.

11

Bacillus spp.

4

Viridans group streptococci

3

Corynebacterium spp.

1

Micrococcus spp.

1

*Total of 425 blood cultures with 58 isolates. † Isolate was cultured from two separate blood cultures in a patient with vascular graft sepsis.

December 2015, Vol. 105, No. 12

RESEARCH

categorical data were evaluated using the χ2 test, and a p-value of <0.05 was regarded as statistically significant.

Results

We reviewed 425 BCs (531 BC bottles) collected from 353 patients in different wards over a 3-month period. Table 2 shows the organisms recovered from BCs. More than one bacterial species was demonstrated in 1.2% (5/425) of BCs. The BC contamination rate was 4.5% (19/425) (Table 3).

The clinician questionnaire response rate was 70.0% (30/43).

Compliance with standards relating to obtaining informed consent, skin and bottle-top antisepsis and BC collection technique was variable (Fig. 1). Forty-eight percent (13/27) of doctors reported using only chlorhexidine for skin antisepsis; 26.0% (7/27) reported using chlorhexidine and 70% alcohol; 18.5% (5/27) reported using only 70% alcohol; 3.7% (1/27) reported using both chlorhexidine and povidone; and 3.7% (1/27) reported that they did not know which skin disinfectant to use.

The indications for performing BCs were diverse, with sepsis and fever being the most common indications (Table 4).

We were able to determine the temporal relationship between BC collection and antibiotic exposure for 81.7% (343/425) of Table 3. Total number of, and proportion of, blood culture contaminants expressed in terms of number of blood cultures and number of blood culture bottles

BCs. Of these cultures, 53.6% (184/343) were collected after in-hospital exposure to antibiotics in the preceding 24 hours.

The overall yield of BCs collected after in-hospital antibiotic exposure was 7.6% (14/184) and that of those collected with no prior in-hospital antibiotic exposure was 15.1% (24/159) (odds ratio (OR) 0.46; 95% confidence interval (CI) 0.23 - 0.93; p=0.04).

However, the yield of pathogens in BCs collected after antibiotic exposure was 4.9% (9/184) compared with 7.5% (12/159) for those cultures with no prior antibiotic exposure (OR 0.63; 95% CI 0.26 - 1.54; p=0.3).

The site of BC collection was indicated on 0.7% (3/425) of labora­ tory request forms. Only one request form indicated that the BC was drawn from a central venous catheter (CVC).

Table 4. Indications for blood culture* Indication

Frequency

%

Sepsis

110

25.9

Fever

78

18.4

Pneumonia

50

11.8

Urinary tract infection

15

3.5

Skin and soft-tissue infection

14

3.3

Meningitis

12

2.8

Diarrhoea

8

1.9

Delirium

6

1.4

Endocarditis

6

1.4

Blood cultures (N=425) n (%)

Blood culture bottles (N=531) n (%)

Unclear

70

16.5

Positive blood cultures

53 (12.5)

64 (12.1)

Miscellaneous

55

12.9

Significant positives

34 (8.0)

43 (8.1)

Contaminants

19 (4.5)

21 (4.0)

Total of 425 blood cultures from 353 patients. † Clinical diagnoses were not indicated, no clinical entries could be found, or clinical folder could not be located.

100 90

7 6

3 13

†

*

3

7 20

7

10

10

7

27 27

80 10

43

13

23

23

3 7 3

Respondents (%)

20 57

57

50

47 27

40

Always (>95%) 23

33 13

27

20

17

13

10

30

33

30 10 20 10 0

17

27

37

27

37

20

27

37

87

10

3

) ) ) ) ) ) ) ) 1) 14) (S3 (S4 13) (S5 (S8 S*2 S12 (S6 S10 (S1 ed ed st (S nt ( e (S ry ( tes tics ed ry ( d t i r s e g d m o e c s d fi i s r t u n e o c ib t to ha ure ted con erfo ves sinf nfe ant nct wed wed e ex bal gp glo s di cula disi ng edl allo epu hin Ver allo rile ino op e and s t arti n t t e t s a n e N H t n s e e a v S tl tl ct cta dw te r to bot bot nfe nfe ara Han prio BC BC disi disi sep p n i BCs m o k t o S fr tleBCs bot BC Standards

Fig. 1. Standards evaluated and ranked by clinician questionnaire. (*S = standard.)

1041

Rarely (<5%) Usually (50 - 95%)

13 17

Uncertain Sometimes (5 - 50%)

33

70 60

Non-respondents

December 2015, Vol. 105, No. 12

RESEARCH

Seventy-five percent (318/425) of BCs comprised a single BC bottle, 24.7% (105/425) two bottles, and 0.2% (1/425) three bottles. The majority (96.9%, 342/353) of patients had a single BC in a 24-hour period. Only 3.1% (11/353) of patients had two BCs and no patients had three or more BCs within a 24-hour period. Eighty-six percent (457/531) of all BC bottles received were aerobic bottles. Thirtythree percent (175/531) of BC bottles contained a fill volume of 8 - 10 mL, 46.0% (245/531) contained <8 mL, and 21.0% (111/531) contained >10 mL. Only 7.8% (33/425) of BCs collected had a blood volume of at least 20 mL. Although the pathogen yield from BC bottles with a volume of <8 mL (12/245, 4.9%) was lower than the yield from BC bottles with the recommended volume (14/175, 8.0%), this difference was not statistically significant (OR 0.59; 95% CI 0.26 - 1.31; p=0.19).

We were unable to trace the clinical folders or clinical entry sheets for 7.3% (31/425) of BCs. BC collection was documented in the clinical folders for 85.5% (337/394) of BCs. Ninety-three percent (395/425) of the request forms contained patient stickers with the relevant patient details. The remainder of the forms comprised handwritten patient identifiers, all of which contained a minimum of three data sets (first name, surname and folder number). All laboratory request forms indicated the date of BC collection, but only 76.2% (324/425) indicated both the date and time. Of all the request forms reviewed, 72.5% (308/425) contained clinical information. The name of the requesting doctor was provided on 98.4% (418/425) of forms, but only 1.2% (5/425) of forms contained clinician contact details. All BC bottles were correctly labelled.

Seventy-seven percent (23/30) of clinicians reported leaving BCs at room temperature if there was a delay in transporting them to the laboratory. However, 23% (7/30) failed to respond to this question.

The overall median needle-to-incubator transport time was 11 hours 25 minutes (IQR 7 hours 6 minutes - 16 hours 53 minutes). For sameday incubation the median needle-to-incubator transport time was 7 hours 15 minutes (IQR 5 hours 30 minutes - 9 hours 28 minutes), and for delayed incubation it was 16 hours 24 minutes (IQR 12 hours 23 minutes - 22 hours 30 minutes).

Sixty-three percent (19/30) of clinicians indicated that they were unaware of the SA guideline[1] and 70.0% (21/30) were unaware of the local NHLS specimen collection manual.

Discussion and conclusion

The main findings of our audit related to poor compliance with hand hygiene practices, lack of use of sterile gloves and inadequate skin and bottle-top antisepsis. This was clearly reflected in the high BC contamination rate of 4.5%.

Controversy still exists as to whether sterile gloving should routinely be used during BC collection. However, a randomised cross-over trial by Kim et al.[10] found that routine use of sterile gloves was associated with a reduction in BC contamination.

The SA guideline refers to the use of povidone or alcohol solution to disinfect the puncture site.[1] However, a recent systematic review and meta-analysis has concluded that alcoholic chlorhexidine solutions showed a statistically significant reduction in BC false positives compared with aqueous povidone-iodine.[11] Given the current available data, we strongly recommend the use of alcoholic chlorhexidine for skin disinfection.

The method of applying the skin antiseptic is also important.

Traditionally, the concentric circle method was required if aqueous iodophors were used after the alcohol step to prevent reintroduction of contaminants to previously cleansed areas. There are no data supporting applying alcoholic disinfectants in an outward concentric circle, but vigorous friction is important.[12] If palpation of the vein is

1042

necessary after skin disinfection, the gloved finger should be cleansed with the antiseptic agent and allowed to dry before touching the site.

BC bottle tops are not necessarily sterile, even though they are covered with a lid.[13] Cleaning the BC bottle tops with antiseptic prior to specimen inoculation decreases contamination.[8] Other pre-analytical factors that may also have played a role in the high BC contamination rate but were not explored in our study include whether or not the venepuncture site was repalpated after skin antisepsis, patient-related factors (e.g. unco-operative patients or difficult anatomy for venepuncture), and ward factors (e.g. high staff turnover, inexperienced staff, BC equipment lacking or difficult to locate).

Other significant findings of our audit relate to prior administration of antibiotics, high number of SBCs, inadequate blood volume and prolonged needle-to-incubator transport time. All these factors are likely to contribute to the low BC yield of true pathogens found in this study.

Recent antibiotic treatment can have a significant impact on the BC results by decreasing the sensitivity of the test. BC collection before initiation of antimicrobial therapy is recommended as a standard of care in international sepsis guidelines.[14] The number of SBCs was unacceptably high. The SA guideline[1] recommends two or more BCs in cases where sepsis is suspected; this is supported by the CLSI and the recent international guidelines of the Surviving Sepsis Campaign.[4,14] Two previous Q-Probes studies in the USA evaluated SBC collections as a pre-analytic quality indicator of BC practice.[15] Of 289 572 BCs, the median proportion of SBCs per institution was 10.1%. These studies found that one of the most common reasons for not performing a second culture in adults was that the doctor believed that one culture was sufficient. However, we did not explore the reasons for the high rate of SBCs, but it is probably due to a variety of factors including lack of awareness, time pressures, lack of BC equipment and difficult anatomy for venepuncture.

A striking feature of our audit was that the vast majority of BC bottles were under-filled. The volume of blood tested is the single most important variable for the detection of bacteria and yeast from BCs.[16] Cockerill et al.[17] demonstrated that yields from 20 mL and 30 mL of blood were 29.8% and 47.2% greater, respectively, than those from 10 mL of blood.. Most bacteraemias in adults have a low density of micro-organisms, and 20 - 30 ml per BC is therefore recommended.[4] Of all the BC bottles, 21.0% were overfilled. While underfilling of BC bottles reduces the sensitivity, overfilling of bottles may cause the BC system to flag positive falsely.

BCs received at the Tygerberg NHLS laboratory are not inserted into the continuous-monitoring BC instrument on a 24-hour basis; those received after 22h00 are not pre-incubated, but stored at room temperature until the next day. The extended delay between BC collection and incubation is not recommended, as this may delay or impede the detection of growth by the BC instrument.[18] However, the actual time at which a reduction in BC sensitivity occurs because of delays in loading BC bottles is not clearly established. According to the UK Standards for Microbiology Investigations, BC bottles should be incubated as soon as possible, and within a maximum of 4 hours.[19] The strengths of our clinical audit were: • We incorporated both clinical and laboratory data and it was not solely laboratory based.

• We attempted to evaluate actual practice and not only the BC contamination rate.

• We incorporated all probable skin contaminants and not only CoNS when we calculated the BC contamination rate.

• We used the number of BCs (and not the number of BC bottles) to calculate the BC contamination rate.

December 2015, Vol. 105, No. 12

RESEARCH

• When we cultured a probable contaminant from an SBC, we did not use only the identification of the organism, but also clini­ cal parameters, before making a judgement about the clinical significance of the isolate.

The limitations of our audit were: • We had limited quantitative data on some of the pre-analytic procedures, but they nevertheless provided insight into BC collection practices.

• We inferred the indication for BCs from the working clinical diagnosis documented in the clinical case notes at the time of BC collection, but we did not evaluate specific clinical parameters or results from other special investigations.

• When more than one BC bottle was submitted for the same patient, using the same laboratory request form, it was counted as one BC (unless otherwise specified); this may have led to an underestimation of the number of BCs. • When the site of BC collection was not indicated, it was assumed that it was collected from a peripheral site, which may have led to an underestimation of the number of BCs collected from CVCs. • We did not audit the availability of equipment (phlebotomy materials, BC bottles and sterile BC packs) for performing BCs. In conclusion, our audit showed a high BC contamination rate. It further demonstrated that compliance with most standards at the hospital was variable or not met. However, our findings may not be generalised to other hospitals and we therefore recommend that each institution reviews its own BC practices.

Recommendations for improvement

The audit report was presented to the hospital staff with the following recommendations: • Staff be provided with electronic copies of the SA guideline[1] and the NHLS specimen collection manual.

• Pictorial wall charts be posted in each ward, outlining best-practice recommendations.

• BC record stickers be used, indicating the name of the patient and doctor, and the date, time, site and indication of BC. • Weekly antibiotic stewardship rounds be used as a platform to educate clinicians regarding best practice when collecting BCs. • Pre-assembled BC collection packs with procedural checklists be used.

• Winged blood collection sets (needle and adaptor) be used.

• A revised laboratory request form be used, with a designated space for clinicians to clearly indicate the BC collection.

• Alcoholic chlorhexidine be used as a skin disinfectant in adults.

• Laboratory reports be accompanied by a remark recommending the number of BCs and volume of blood, per bottle, for adult patients.

1043

• Pre-analytical factors associated with prolonged needle-to-incu­ bator transport time be investigated.

• BCs be loaded on the BC instrument on a 24-hour basis.

• The audit be repeated after implementation of interventions.

In addition, the regular use of quality indicators (such as blood volume, contamination rate, SBC rate, positivity rate, number of BCs requested per 1 000 patient-days, needle-to-incubator transport time and number of rejected samples) with monitoring and feedback may strengthen the above interventions.

Acknowledgements. We thank staff at the study hospital and the Tygerberg NHLS laboratory. We gratefully acknowledge the assistance of Sr Marietjie Bester, Kristien Nel, and Jeremy Goodway with the data collection and analysis.

References 1. Ntusi N, Aubin L, Oliver S, et al. Guideline for the optimal use of blood cultures. S Afr Med J 2010;100(12):839-843.

2. Daniels R. Surviving the first hours in sepsis: Getting the basics right (an intensivist’s perspective). J Antimicrob Chemother 2011;66(Suppl2):ii11-ii23. [http://dx.doi.org/10.1093/jac/dkq515] 3. Katsios CM, Burry L, Nelson S, et al. An antimicrobial stewardship program improves antimicrobial treatment by culture site and the quality of antimicrobial prescribing in critically ill patients. Crit Care 2012;16:R216. [http://dx.doi.org/10.1186/cc11854] 4. Clinical Laboratory Standards Institute (CLSI). Principles and Procedures for Blood Cultures; Approved Guideline. CLSI Document M47-A. Wayne, PA: CLSI, 2007.

5. Bates DW, Goldman L, Lee TH. Contaminant blood cultures and resource utilization. The true consequences of false-positive results. JAMA 1991;265(3):365-369. [http://dx.doi.org/10.1001/jama.265.3.365] 6. Kenyon CR, Fatti G, Schrueder N, et al. The value of blood culture audits at peripheral hospitals. S Afr Med J 2012;102(4):232-233.

7. Bekeris LG, Tworek JA, Walsh MK, et al. Trends in blood culture contamination: A College of American Pathologists Q-Tracks study of 356 institutions. Arch Pathol Lab Med 2005;129(10):1222-1225.

8. Schifman RB, Strand CL, Meier FA, et al. Blood culture contamination: A College of American Pathologists Q-Probes study involving 640 institutions and 497 134 specimens from adult patients.

Arch Pathol Lab Med 1998;122(3):216-221.

9. Forbes BA, Sahm DF, Weisfeld AS. Bloodstream infections. In: Bailey and Scott’s Diagnostic Microbiology. 11th ed. St Louis, MO: Mosby, 2007:778-797.

10. Kim NH, Kim M, Lee S, et al. Effect of routine sterile gloving on contamination rates in blood culture: A cluster randomized trial. Ann Intern Med 2011;154(3):145-151. [http://dx.doi.org/10.7326/00034819-154-3-201102010-00003] 11. Caldeira D, David C, Sampaio C. Skin antiseptics in venous puncture-site disinfection for prevention of blood culture contamination: Systematic review with meta-analysis. J Hosp Infect 2011;77(3):223232. [http://dx.doi.org/10.1016/j.jhin.2010.10.015] 12. Baron EJ, Weinstein MP, Dunne WM Jr, Yagupsky P, Welch DF, Wilson DM. Cumitech 1C, Blood Cultures IV. Washington, DC: ASM Press, 2005.

13. Hall KK, Lyman JA. Updated review of blood culture contamination. Clin Microbiol Rev 2006;19(4):788-802. [http://dx.doi.org/10.1128/CMR.00062-05] 14. Dellinger RP, Levy MM, Rhodes A, et al. Surviving sepsis campaign: International guidelines for management of severe sepsis and septic shock: 2012. Crit Care Med 2013;41(2):580-637.[http://dx.doi. org/10.1097/CCM.0b013e31827e83af] 15. Schiffman RB, Bachner P, Howanitz PJ. Blood culture quality improvement: A College of American Pathologists Q-Probes study involving 909 institutions and 289 572 blood culture sets. Arch Pathol Lab Med 1996;120:999-1002.

16. Weinstein MP. Current blood culture methods and systems: Clinical concepts, technology, and interpretation of results. Clin Infect Dis 1996;23(1):40-46. [http://dx.doi.org/10.1093/clinids/23.1.40] 17. Cockerill FR 3rd, Wilson JW, Vetter EA, et al. Optimal testing parameters for blood cultures. Clin Infect Dis 2004;38(12):1724-1730. [http://dx.doi.org/10.1086/421087] 18. Sautter RL, Bills AR, Lang DL, Ruschell G, Heiter BJ, Bourbeau PP. Effects of delayed-entry conditions on the recovery and detection of microorganisms from BacT/ALERT and BACTEC blood culture bottles. J Clin Microbiol 2006;44(4):1245-1249. [http://dx.doi.org/10.1128/JCM.44.4.1245-1249.2006] 19. Investigation of Blood Cultures (for Organisms other than Mycobacterium species). UK Standards for Microbiology Investigations. B 37 Issue 7. http://www.hpa.org.uk/SMI/pdf (accessed 12 September 2013).

Accepted 13 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

Diagnosing childhood pulmonary tuberculosis using a single sputum specimen on Xpert MTB/RIF at point of care N Gous,1 MSc Med; L E Scott,1 PhD; S Khan,2 G Reubenson,2 MB BCh, FCPaed, DCH, DTM&H; A Coovadia,2 MB BCh, FCPaed, DCH, Dip HIV Man; W Stevens,1,3 MB BCh, MMed (Haem), FCPath (Haem) epartment of Molecular Medicine and Haematology, School of Pathology, Faculty of Health Sciences, University of the D Witwatersrand, Johannesburg, South Africa 2 Rahima Moosa Mother and Child Hospital and Department of Paediatrics and Child Health, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa 3 National Health Laboratory Service, Johannesburg, South Africa, and National Priority Programme, South Africa 1

Corresponding author: N Gous (natasha.gous@gmail.com)

Background. The GeneXpert MTB/RIF (Cepheid, USA) (Xpert) has proved successful for pulmonary tuberculosis (TB) diagnosis on decontaminated/concentrated induced sputum specimens from children. Capacity to perform induction in many settings is limited.

Objective. To assess: (i) volumes of ‘routinely obtained’ sputum in a district-level academic hospital; (ii) whether sputum specimens not meeting Xpert-required testing volumes could still be tested; and (iii) performance of Xpert on a single paediatric sputum specimen at point of care (POC).

Methods. Two sputa were collected from paediatric TB suspects (≤14 years) at Rahima Moosa Mother and Child Hospital, Johannesburg, South Africa. One specimen was weighed at POC; if the volume was ≥0.1 mL but <0.5 mL, it was increased to 0.5 mL using saline.

On-site Xpert testing (G3 cartridge) was performed by a dedicated laboratory technician. The second specimen was referred for TB smear microscopy and culture as per standard of care (SOC).

Results. A total of 484 patients presumed to have TB (median age 24 months) were eligible for this study, performed between June 2011 and May 2012. Xpert could not be used on 4.1% of specimens because of volumes <0.1 mL, and 62.8% required addition of saline prior to Xpert testing. Xpert generated a 2.2% error and 3.7% invalid rate, compared with the SOC that rejected 2.3% because of insufficient volume and 2.3% that were contaminated. The diagnostic performance compared with culture was 62.5% (95% confidence interval (CI) 24.7 - 91) and 99.1% (95% CI 97.4 - 99.8) sensitivity and specificity, respectively, for Xpert (n=345) and 33.3% (7.9 - 69.9) and 99.5% (98.1 - 99.9) sensitivity and specificity, respectively, for smear microscopy (n=374).

Conclusions. Up to 67% of ‘routinely obtained’ sputum specimens from children (≤14 years) are below the required volume for Xpert testing but can be ‘topped up’ with saline. Xpert MTB/RIF performed better than microscopy and generated clinically relevant, timeous results, but sensitivity did not reach the same levels as culture in children.

S Afr Med J 2015;105(12):1044-1048. DOI:10.7196/SAMJ.2015.v105i12.8585

Over half a million children are diagnosed with tuberculosis (TB) every year. The majority of these infections occur in 22 high-burden countries[1] and account for 6% of the global TB burden.[2,3] The World Health Organization (WHO) reported a staggering 74 000 deaths in HIV-negative children <15 years of age in 2012 alone, making TB one of the top ten leading causes of death in children.[4] Control programmes are hampered by the increasing spread of multidrug-resistant TB (MDR-TB); globally 40 000 new cases of MDR-TB are reported annually in paediatric populations.[3] In South Africa (SA), children aged ≤14 years are estimated to account for approximately 15 - 20% of the total TB disease burden.[5,6] These global statistics may grossly underestimate the TB burden,[7] as microbiological confirmation of TB is challenging in children.

Typically, the type of specimen obtained for testing depends on the age of the child and the clinical presentation.[8] Specimens other than sputum most frequently include nasopharyngeal aspirates (NPAs), gastric aspirates, induced sputum, throat swabs, fine-needle lymph node aspiration, bone marrow, urine, stool and aseptic fluids (ascitic, pleural and cerebrospinal fluid). With the exception of the bone marrow and lymph node, owing to the paucibacillary nature of the specimens, multiple sampling over several days is required.[8]

1044

Additional challenges are often the poor quality[9] and low quantity of specimen yield that hamper bacteriological confirmation of disease.[10] It is for this reason that no universal diagnostic algorithm for TB in children exists, diagnosis relying on a combination of clinical signs and nonspecific tests.[7] Clearly, a stronger emphasis needs to be placed on advancing the research and development of more effective diagnostic strategies for childhood TB detection.

Accurate and sensitive molecular tests such as the GeneXpert MTB/RIF assay (Cepheid, USA) (Xpert) are proving that reliable and rapid diagnosis of TB can be achieved. The Xpert test was recently approved by the US Food and Drug Administration as the first moderate complexity test to detect both Mycobacterium tuberculosis (MTB) and resistance to rifampicin simultaneously for pulmonary TB.[11] In SA, the National Department of Health (NDoH) and National Health Laboratory Service (NHLS) have implemented the Xpert in 207 smear microscopy centres across the country. Data from the programme reflect the Xpert’s sensitivity over microscopy. The average national TB positivity rate among presumptive pulmonary adult TB cases prior to Xpert was 8%, and this has since increased to 11% in the fourth year of Xpert use.[12] The updated Cochrane review on Xpert’s performance in adults showed a pooled sensitivity of 98% for smear-positive pulmonary TB and 79% for smear-negative TB.[12] In the paediatric population,

December 2015, Vol. 105, No. 12

RESEARCH

studies are limited and most have focused on induced sputa,[9,13-16] where sensitivities ranging from 33.3%[14] to approximately 70%[15,17] in smear-negative, culture-positive paediatric patients are reported. Increased sensitivities of up to 75.9% could be achieved if two induced sputa were tested.[14] Further studies are now concentrating on alternative specimen types such as NPAs,[16] gastric lavage aspirates,[18] bronchoalveolar lavage[19] and stool.[20,21] In all Xpert studies on paediatric popu­ lations, specimens underwent laboratory decontamination and concentration prior to Xpert testing. The aim of this study was threefold: (i) to assess the volume of ‘routinely obtained’ sputum (i.e. no induced sputum facility available) from children ≤14 years of age at a district-level academic hospital; (ii) to determine whether sputum specimens not meeting the Xpert minimum required testing volume could be manipulated before testing; and (iii) to determine the feasibility of performing Xpert MTB/RIF on raw paediatric sputum specimens by a dedicated staff member, at the point of care (POC).

Methods

Patient recruitment

Paediatric patients accessing care at the Rahima Moosa Mother and Child Hospital (RMMCH), Johannesburg, SA, were eligible for inclusion if their treating clinician suspected TB. RMMCH is a district-level academic hospital that provides paediatric care to the population of the west of Johannesburg. The study received approval from the University of the Witwatersrand Human Ethics Committee (Protocol number: M110496).

of age who were suspected of having TB. Respiratory samples were obtained following administration of chest physiotherapy (at the discretion of the individual physiotherapist).

One of these specimens was randomly selected for on-site Xpert testing (G3 version cartridge) by a trained laboratory technician (to replace the first smear) and the second specimen was sent to the NHLS Braamfontein TB laboratory as per routine, for decontamination and concentration (NALC-NaOH), smear microscopy, MGIT culture and DST, when indicated.

Xpert MTB/RIF testing

Specimens were weighed (in their con­ tainers) on a bench-top precision balance (Sigma-Aldrich, USA) to estimate the volume of the specimen. If any specimen was >0.1 mL but less than the minimum required volume of 0.5 mL (estimated at 0.5 g), sterile saline was added using a stan­ dard Finnpipette (Thermo Fisher Scien­tific, USA) and sterile pipette tips to increase the volume to at least 0.5 mL. Testing of specimens on the Xpert MTB/RIF assay was performed on the same day as specimen collection. However, if any specimen could not be tested the same day as a result of late specimen receipt, it was stored in a 4oC fridge overnight, followed by testing the next day as per manufacturer’s instructions. All specimens were processed as per standard Xpert MTB/RIF protocol by addition of Sample Reagent (SR) buffer in a 3:1 or 2:1 ratio to take the final volume to 2 mL (Cepheid, USA). The on-site result obtained

from the Xpert MTB/RIF assay was reported to the treating clinicians.

Statistical analysis

Specimen volumes for Xpert testing were described. Non-parametric tests were used to determine associations between age and volume, Xpert results and volume, and age and pre-processing, at 95% confidence interval (CI). The sensitivity and specificity and positive and negative predictive values (PPV and NPV) were calculated for the Xpert MTB/RIF assay and smear microscopy with a 95% CI using MGIT culture as the gold standard.

Results

Data summary

A flow diagram illustrates the processing of patient samples (Fig. 1). A total of 484 eligible children (median age 24 months) had samples processed between June 2011 and May 2012 (interquartile range (IQR) 12 60). Two sputum specimens were collected by physiotherapy from 484 patients (none required nebulisation); one sample was sent for on-site Xpert testing and the other was sent for routine laboratory testing. The laboratory rejection rate due to insufficient volume for smear and culture processing was 2.3% (11/484). Culture reported a 2.3% (11/473) contamination rate, which was excluded from the quantitative analysis (Fig. 1). After study commencement, culture and smear results for 86 patients could not be retrieved from the laboratory information system and were therefore excluded from final quantitative

498 patients Excluded n=14 (>14 years of age)

Study procedures

At the time of the study, the routine procedure at RMMCH was to collect two sputum specimens; one specimen was sent to the NHLS at Helen Joseph Hospital for TB smear microscopy and the second specimen was sent to the NHLS Braamfontein laboratory for liquid culture (MGIT) and drug susceptibility testing (DST) when necessary. A GeneXpert instrument was placed on site in an existing POC laboratory designated for sample processing (specimen sorting, centrifugation, rapid HIV testing, data capture) at RMMCH. This allowed specimens to be tested on site.

484 eligible patients

484 specimens sent for smear microscopy and MGIT culture

Excluded n=20 (rejected, low volumes <0.1 mL (2.3%))

Excluded n=11 (rejected, low volumes (2.3%)) Excluded n=11 (culture contaminated (2.3%))

464 nn-site Xpert MTB/RIF performed

Excluded n=86 (culture results not found (of which 84/86 also had no smear results))

Excluded n=10 (errors, (2.2%)); n=17 (invalids (3.7%))

Specimen collection

A physiotherapist collected two sputum specimens concurrently, using clinic standard of care methodology, in standard sputum collection containers from children ≤14 years

376 analysable culture results

389 analysable smear results

Fig. 1. Flow chart of specimen analysis.

1045

484 specimens sent for on-site Xpert MTB/RIF

December 2015, Vol. 105, No. 12

437 analysable Xpert MTB/RIF results

RESEARCH

analysis. This coincided with the roll-out of the Xpert in SA’s National Programme, which commenced in March 2011, whereby the diagnostic algorithm for initial TB diagnosis changed from collection of two sputum specimens to one.

Diagnostic performance analysis

Sputum specimen volumes received from children for Xpert testing are shown in Table 1. A total of 20/484 specimens (4.1%) had sputum volumes of <0.1 mL and could not be tested. Of the 464 Xpert tests per­ formed on site, overall error and invalid rates of 2.2% (10/464) (1 volume error and 9 code 5011 errors) and 3.7% (17/464), respectively, were reported (Fig. 1).

Using Spearman’s correlation coefficient (owing to skewness of the data), an overall weak correlation was observed between age and volume of specimens received (rho=0.49).

No association was observed between the volume of specimen received and the Xpert result (p=0.14). However, an association was observed between age and Xpert results (p=0.004), with more TB-positives detected in the older age group (median age 132 months).

While prior specimen manipulation by addition of sterile saline before Xpert testing did not affect the error/invalid rate (p=0.19) reported on the Xpert, more positive results were generated from specimens that did not require the addition of saline; however, this did not reach significance (p=0.18).

Table 2 further categorises the specimens by age and volume and details the per­ formance by Xpert compared with liquid culture as the reference. Sputum volume clearly increased with age and it appears that, on average, specimens from children aged ≥25 months would require less addition of saline prior to Xpert testing. The minimum

age group in which MTB was detected by Xpert was 13 months, with total reported MTB positivity of 2.7% (12/437).

Smear microscopy also only detected MTB from 13 months onwards, reporting 7/389 positive specimens (1.8%) (Table 3). MGIT culture initially reported a positivity rate of 4.0% (15/376); however, after follow-up DST in all culture-positive specimens using the Hain MTBDrplus version 1 assay (Hain LifeScience, GmbH, Germany), only 9/15 were confirmed as MTB complex (2.4%) (Table 3). The other six specimens were probably non-tuberculosis mycobacteria, but were not definitively identified. Culture remained most sensitive in detecting MTB in the lower age group, detecting 1 positive in each age group <24 months and 6 positives in the >60-month category.

Performance data for MGIT culture, smear microscopy and the Xpert MTB/RIF are shown in Table 3.

Smear microscopy was able to identify 3 of the 9 culture-confirmed MTB-positive cases but additionally reported 2 culture-negative (and Xpert-negative) specimens as positive.

Compared with culture on 374 specimens, smear generated a sensitivity and specificity

of 33.3% (95% CI 7.9 - 69.9) and 99.5% (95% CI 98.1 - 99.9), respectively. Relative to smear, Xpert detected 3 additional MTBpositive cases.

Of the 12 Xpert-positive cases reported, corresponding culture results could not be found in 4 cases. Xpert detected 5/9 culture-confirmed MTB-positive specimens and an additional 3 cases. Analysis of 345 patients with both Xpert and culture results demonstrated an Xpert sensitivity of 62.5% (95% CI 24.7 - 91) and high specificity of 99%. Overall the Xpert was able to detect 66.7% of smear-positive, culture-positive cases (2/3) and 50% of smear-negative, culture-positive cases (3/6).

The Xpert MTB/RIF reported only a single specimen (8.3%, 1/12) with rifampicin resistance, but the MTBDRplus v1 reported rifampicin and isoniazid susceptibility in this specimen. Two additional specimens were reported mono-isoniazid-resistant by MTBDrplus v1.

Discussion

Moving the Xpert MTB/RIF assay to the POC has been shown to be feasible, to save

Table 1. Volumes of sputum specimens used for on-site Xpert MTB/RIF testing Specimen volumes received for Xpert (N=484) <0.1 mL

0.1 - 0.4 mL

0.5 - 4 mL

Specimens, n (%)

20 (4.1)

304 (62.8)

160 (33.1)

Age of patients (months), median (IQR)

12 (9 - 24)

12 (9 - 24)

72 (24 - 108)

rho=0.49

Addition of saline

Not tested

Yes

No

p=0.19

Xpert-positive, n/total (%)

N/A

5/304 (1.6)

7/160 (4.4)

p=0.14

Xpert errors, n/total (%)

N/A

7/304 (2.3)

3/160 (1.9)

Xpert invalids, n/total (%)

N/A

10/304 (3.3)

7/160 (4.4)

Statistic

}

p=0.004

Table 2. Diagnostic performance of the Xpert MTB/RIF assay stratified by age of child 0 - 6 months

7 - 12 months

13 - 24 months

25 - 60 months

>60 months

Specimens per age group, n

55

122

81

67

112

Age (months), median (IQR)

4 (3 - 5)

12 (9 - 12)

24 (24 - 24)

48 (36 - 60)

96 (84 - 132)

Volume of sputum (mL), mean (SD)

0.21 (0.17)

0.28 (0.22)

0.37 (0.42)

0.58 (0.80)

1.04 (0.86)

Xpert positives, n (%)

0

0

1 (1.2)

0

11 (9.8)

Sensitivity, % (95% CI)

0 (0 - 97.5)

0 (0 - 97.5)

100 (2.5 - 100)

-

66.7 (22.3 - 95.7

Specificity, % (95% CI)

100 (91.2 - 100)

98.9 (94.5 - 99.9)

100 (94.8 - 100)

100 (92.6 - 100)

97.5 (91.4 - 99.7)

PPV, % (95% CI)

-

0 (0 - 97.5)

100 (2.5 - 100)

-

66.7 (22.3 - 95.7)

NPV, % (95% CI)

97.6 (87.1 - 99.9)

98.9 (94.5 - 99.9)

100 (94.8 - 100)

100 (92.6 - 100)

97.3 (91.4 - 99.7)

Diagnostic performance of Xpert stratified by age (N=437)

Xpert performance stratified by age v. culture (N=345)

1046

December 2015, Vol. 105, No. 12

RESEARCH

Table 3. Performance of smear microscopy, MGIT culture (with LPA confirmation) and the Xpert MTB/RIF for diagnosis of childhood TB Culture

Smear microscopy

Xpert

Specimens, n

376

389

437

MTB-positive, n (%)

9 (2.4)

7 (1.8)

12 (2.7)

MTB-negative, n (%)

367 (97.6)

382 (98.2)

425 (96.3)

MTB RIF-sensitive, n

9

-

11

MTB RIF-resistant, n

0

-

1

Comparator test

374

345

Assay performance

Performance analysis v. culture as the reference Specimens, n Sensitivity, % (95% CI)

33.3 (7.9 - 69.9)

62.5 (24.7 - 91.0)

Specificity, % (95% CI)

99.5 (98.0 - 99.9)

99.1 (97.4 - 99.8)

PPV, % (95% CI)

66.0 (15.4 - 93.5)

62.5 (24.7 - 91.0)

NPV, % (95% CI)

98.4 (96.5 - 99.4)

99.1 (97.4 - 99.8)

LPA = line probe assay.

costs for patients[22] and to have advantages over centralised testing, such as same-day treatment and shorter time to treatment initiation in adult TB suspects.[22-24] Use of the Xpert for paediatric TB diagnosis at POC may introduce additional challenges.

Although obtaining an induced sputum specimen is a simple and well-tolerated procedure,[14] it needs to be conducted by a trained healthcare worker. The capacity to perform such induction is limited[16] and its uptake has been slow. In SA, many healthcare facilities are not able to obtain respiratory specimens (gastric aspirates or sputum) from children and many centres/ clinics lack sputum induction facilities or trained healthcare workers to perform the procedure. Even when respiratory samples are obtained, volumes from children may not be sufficient to meet the required minimum testing volume needed for the Xpert assay.

The setting where this study was performed already had an on-site POC laboratory with a trained technician who managed paediatric HIV testing and collection of dried blood spots, making it feasible for inclusion of the GeneXpert technology, especially since additional specimen types such as stool (under development by Cepheid) and gastric or NPAs may in future be tested by Xpert at POC. Data from our study indicate that a large proportion (67%) of ‘routinely obtained’ sputum specimens received from children ≤14 years of age are below the minimum required testing volume for Xpert and could either not be processed (4.1%) or required the addition of saline prior to Xpert testing (62.8%). Addition of saline required

weighing the specimen container as an estimate of volume and then adding sterile saline using a pipette to make up the volume to approximately 0.5 mL. This did not affect the Xpert result in terms of error/invalid rates, but required extra processing time and technical training for the person performing the testing as well as a supply of sterile saline. Volume has previously also been shown to have minimal impact on Xpert performance.[25] Patient age was associated with Xpert result reporting, with more TB positives detected in older children. This was unrelated to volume of the specimen, but probably as a result of a higher bacillary load in these patients. However, because of small sample numbers, this cannot be definitively proven.

The minimum volume of specimen required for Xpert testing resulted in twice as many specimens not being able to be tested by Xpert compared with those sent to the laboratory for smear microscopy and culture. Xpert also reported an overall error plus invalid rate of 5.9%, higher than the contamination rate of 2.3% reported with culture. The majority of errors were code 5011, a commonly occurring error on the older version G3 cartridges; this has since been rectified with the new G4 cartridge.[26] The positivity rate for MTB in this study population was lower than previously reported from Cape Town, SA,[14] as expected.

Similarly to previously reported data,[14,15] use of Xpert MTB/RIF on a single sputum specimen in our study provided superior detection over smear microscopy. The Xpert MTB/RIF was able to detect 55% of culture-confirmed MTB-positive cases and

1047

December 2015, Vol. 105, No. 12

an additional three cases that were negative on culture. These three additional cases may have been due to the Xpert detecting nonviable organisms. The moderate sensitivity of Xpert compared with culture in our study may be due to the fact that specimen volumes were too low for testing; of the three Xpert false negatives, two were reported on specimens <0.5 mL that had needed addition of saline prior to Xpert testing. However, the wide CI did not allow for an accurate estimation of sensitivity and would need a larger study cohort. One benefit of this study was that an additional 1.6% of TB positives could be detected by Xpert by ‘topping up’ low-volume specimens instead of discarding them. This means that an MTB-positive result could be acted on more timeously than waiting for a culture result.

The costing of Xpert MTB/RIF for diag­ nosis of smear-negative TB in adults visiting a primary healthcare setting in SA has been estimated at USD3.28 less than the cost per valid smear microscopy plus culture result.[27] This study took into account a low error rate (of 1%), electricity, water and space, medical waste disposal, N-95 masks, sputum collection bottles and surface disinfectant.[27] If Xpert is instituted at POC for paediatric/childhood TB diagnosis, it will require increased capacity scale-up and training (good clinical laboratory practice), as well as additional equipment (benchtop balance, pipettes) and consumables (pipette tips, sterile saline). Assessment of each individual clinic’s infrastructure needs, resources and staff requirements, power supply, connectivity and infection control will also need to be taken into account.

An advantage of performing on-site Xpert testing specifically for children is the rapid turnaround of results. However, on-site Xpert testing on inadequate specimen volumes may increase the chances of obtaining errors and invalid results that cannot be repeated on the same sample. In our study, Xpert MTB/RIF out-performed TB microscopy but did not demonstrate acceptable sensitivity in this real-world setting and cannot currently replace TB culture in the diagnosis of paediatric/ childhood TB. Alternative specimen types, which are easier to obtain and not subject to volume limitations, such as stool, may provide a better diagnostic option.

Acknowledgements. We thank Braimoh Bello, Centre for Statistical Analysis and Research (CEASAR), for assistance with statistical analysis. This project was funded in part by the President’s Emergency Plan for AIDS Relief

RESEARCH

(PEPFAR) through the US Centers for Disease Control and Prevention, under the terms of grant 3U2GPS0001328-04. The Grand Challenges Canada grant 0007-02-01-01-01 (to Wendy Stevens) also provided support.

References 1. Stop TB Partnership Childhood TB Subgroup. Guidance for National Tuberculosis Programmes on the management of tuberculosis in children. Chapter 1: Introduction and diagnosis of tuberculosis in children. Int J Tuberc Lung Dis 2006;10(10):1091-1097.

2. World Health Organization. Roadmap for Childhood Tuberculosis: Towards Zero Deaths. Geneva: WHO, 2013. http://www.who.int/tb/challenges/children/en/ (accessed 7 January 2014).

3. World Health Organization. Global Tuberculosis Report 2013. Geneva: WHO, 2013. http://www.who. int/tb/publications/global_report/en/ (accessed 13 January 2014).

4. World Health Organization. Childhood Tuberculosis. Geneva: WHO, 2013. http://www.who.int/tb/ challenges/children/en/ (accessed 7 January 2014).

5. Yezingane Network. Brief: TB & the Invisible Children in South Africa. 2013. http://www.sahivsoc.org/ Topics?page=1&currentFilter=Tuberculosis (accessed 1 November 2013).

6. Zar HJ, Eley B, Nicol MP, Figaji A, Hawkridge A. Advances in childhood tuberculosis – contributions from the University of Cape Town. S Afr Med J 2012;102(6):518-521.

7. Esposito S, Tagliabue C, Bosis S. Tuberculosis in children. Mediterr J Hematol Infect Dis 2013;5(1):e2013064. [http://dx.doi.org/10.4084/mjhid.2013.064] 8. Cuevas LE, Petrucci R, Swaminathan S. Tuberculosis diagnostics for children in high-burden countries: What is available and what is needed? Paediatr Int Child Health 2012;32(Suppl 2):S30-S37. [http://dx.doi.org/10.1179/2046904712Z.00000000076] 9. Nhu NT, Ha DT, Anh ND, et al. Evaluation of Xpert MTB/RIF and MODS assay for the diagnosis of pediatric tuberculosis. BMC Infect Dis 2013;13:31. [http://dx.doi.org/10.1186/1471-2334-13-31] 10. Lawn SD, Brooks SV, Kranzer K, et al. Screening for HIV-associated tuberculosis and rifampicin resistance before antiretroviral therapy using the Xpert MTB/RIF assay: A prospective study. PLoS Med 2011;8(7):e1001067. [http://dx.doi.org/10.1371/journal.pmed.1001067] 11. Food and Drug Administration. FDA news release: FDA permits marketing of first U.S. test labeled for simultaneous detection of tuberculosis bacteria and resistance to the antibiotic rifampin. FDA, 2013. http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm362602.htm. (accessed 1 November 2013).

12. National Health Laboratory Service. GeneXpert MTB/RIF Progress Report to NDoH. South Africa: NHLS, February 2015. http://www.nhls.ac.za/assets/files/GeneXpert%20Progress%20Report%20 February%202015%20Final.pdf (accessed 9 November 2015).

13. Steingart KR, Sohn H, Schiller I, et al. Xpert MTB/RIF assay for pulmonary tuberculosis and rifampicin resistance in adults. Cochrane Database Syst Rev 2014, Issue 1. Art. No.: CD009593. [http:// dx.doi.org/10.1002/14651858.cd009593.pub3]

1048

14. Nicol MP, Workman L, Isaacs W, et al. Accuracy of the Xpert MTB/RIF test for the diagnosis of pulmonary tuberculosis in children admitted to hospital in Cape Town, South Africa: A descriptive study. Lancet Infect Dis 2011;11(11):819-824. [http://dx.doi.org/10.1016/S1473-3099(11)70167-0] 15. Sekadde MP, Wobudeya E, Joloba ML, et al. Evaluation of the Xpert MTB/RIF test for the diagnosis of childhood pulmonary tuberculosis in Uganda: A cross-sectional diagnostic study. BMC Infect Dis 2013;13:133. [http://dx.doi.org/10.1186/1471-2334-13-133] 16. Zar HJ, Workman L, Isaacs W, et al. Rapid molecular diagnosis of pulmonary tuberculosis in children using nasopharyngeal specimens. Clin Infect Dis 2012;55(8):1088-1095. [http://dx.doi.org/10.1093/ cid/cis598] 17. Rachow A, Clowes P, Saathoff E, et al. Increased and expedited case detection by Xpert MTB/RIF assay in childhood tuberculosis: A prospective cohort study. Clin Infect Dis 2012;54(10):1388-1396. [http:// dx.doi.org/10.1093/cid/cis190] 18. Bates M, O’Grady J, Maeurer M, et al. Assessment of the Xpert MTB/RIF assay for diagnosis of tuberculosis with gastric lavage aspirates in children in sub-Saharan Africa: A prospective descriptive study. Lancet Infect Dis 2013;13(1):36-42. [http://dx.doi.org/10.1016/S1473-3099(12)70245-1] 19. Walters E, Goussard P, Bosch C, Hesseling AC, Gie RP. GeneXpert MTB/RIF on bronchoalveolar lavage samples in children with suspected complicated intrathoracic tuberculosis: A pilot study.

Pediatr Pulmonol 2014;49(11):1133-1137. [http://dx.doi.org/10.1002/ppul.22970] 20. Nicol MP, Spiers K, Workman L, et al. Xpert MTB/RIF testing of stool samples for the diagnosis of pulmonary tuberculosis in children. Clin Infect Dis 2013;57(3):e18-e21. [http://dx.doi.org/10.1093/ cid/cit230] 21. Walters E, Gie RP, Hesseling AC, Friedrich SO, Diacon AH, Gie RP. Rapid diagnosis of pediatric intrathoracic tuberculosis from stool samples using the Xpert MTB/RIF Assay: A pilot study. Pediatr Infect Dis J 2012;31(12):1316. [http://dx.doi.org/10.1097/INF.0b013e318266c21c] 22. Van Rie A, Page-Shipp L, Hanrahan CF, et al. Point-of-care Xpert(R) MTB/RIF for smear-negative tuberculosis suspects at a primary care clinic in South Africa. Int J Tuberc Lung Dis 2013;17(3):368372. [http://dx.doi.org/10.5588/ijtld.12.0392] 23. Theron G, Zijenah L, Chanda D, et al. Feasibility, accuracy, and clinical effect of point-of-care Xpert MTB/RIF testing for tuberculosis in primary-care settings in Africa: A multicentre, randomised, controlled trial. Lancet 2014;383(9915):424-435. [http://dx.doi.org/ 10.1016/S0140-6736(13)62073-5] 24. Hanrahan CF, Selibas K, Deery CB, et al. Time to treatment and patient outcomes among TB suspects screened by a single point-of-care Xpert MTB/RIF at a primary care clinic in Johannesburg, South Africa. PLoS One 2013;8(6):e65421. [http://dx.doi.org/10.1371/journal.pone.0065421] 25. Theron G, Peter J, van Zyl-Smit R, et al. Evaluation of the Xpert MTB/RIF assay for the diagnosis of pulmonary tuberculosis in a high HIV prevalence setting. Am J Respir Crit Care Med 2011;184(1):132140. [http://dx.doi.org/10.1164/rccm.201101-0056OC] 26. FIND. Report: Performance of the Xpert MTB/RIF version G4 assay. http://www.stoptb.org/wg/gli/ assets/documents/map/findg4cartridge.pdf (accessed 19 June 2014).

27. Van Rie A. The challenge of diagnosing TB in people with HIV: Is stool the new tool? Int J Tuberc Lung Dis 2013;17(8):995. [http://dx.doi.org/10.5588/ijtld.13.0415]

Accepted 12 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

The diagnostic accuracy of integrated positron emission tomography/computed tomography in the evaluation of pulmonary mass lesions in a tuberculosis-endemic area R du Toit,1 MB ChB, FCP (SA), MMed (Int); J A Shaw,1 MB ChB; E M Irusen,1 MB ChB, FCP (SA), FCCP, PhD; F von Groote-Bidlingmaier,1 MD; J M Warwick,2 MB ChB, FCNP (SA), PhD; C F N Koegelenberg,1 MB ChB, MMed (Int), FCP (SA), FRCP (UK), Cert Pulm (SA), PhD ivision of Pulmonology, Department of Medicine, Faculty of Medicine and Health Sciences, Stellenbosch University and D Tygerberg Academic Hospital, Cape Town, South Africa 2 Division of Nuclear Medicine, Department of Medical Imaging and Clinical Oncology, Faculty of Medicine and Health Sciences, Stellenbosch University and Tygerberg Academic Hospital, Cape Town, South Africa 1

Corresponding author: C F N Koegelenberg (coeniefn@sun.ac.za)

Background. Integrated positron emission tomography/computed tomography (PET-CT) is a well-validated modality for assessing pulmonary mass lesions and specifically for estimating risk of malignancy. Tuberculosis (TB) is known to cause false-positive PET-CT findings.

Objective. To investigate the utility of PET-CT in the evaluation of pulmonary mass lesions and nodules in a high TB prevalence setting.

Methods. All patients referred for the evaluation of a solitary pulmonary nodule or mass and who underwent PET-CT scanning over a 3-year period were included. The PET-CT findings, including maximum standardised uptake value (SUVmax), were compared with the gold standard (tissue or microbiological diagnosis). The sensitivity, specificity, positive and negative predictive values and diagnostic accuracy for malignant disease were calculated according to the SUVmax cut-off of 2.5 and a proposed cut-off obtained from a receiver operating characteristic (ROC) curve.

Results. Forty-nine patients (mean (standard deviation) age 60.1 (10.2) years; 29 males) were included, of whom 30 had malignancy.

Using an SUVmax cut-off of 2.5, PET-CT had a sensitivity, specificity, positive and negative predictive value and diagnostic accuracy for malignancy of 93.3%, 36.8%, 70.0%, 77.8% and 71.4%, respectively. After a ROC curve analysis, a suggested SUVmax cut-off of 5.0 improved the specificity to 78.9% and the diagnostic accuracy to 86.7%, with a small reduction in sensitivity to 90.0%.

Conclusions. The diagnostic accuracy of PET-CT in the evaluation of pulmonary mass lesions using the conventional SUVmax cut-off of 2.5 was reduced in a TB-endemic area. An SUVmax cut-off of 5.0 has a higher specificity and diagnostic accuracy for malignancy, with a comparable sensitivity.

S Afr Med J 2015;105(12):1049-1052. DOI:10.7196/SAMJ.2015.v105i12.10300

A solitary pulmonary nodule (SPN) or mass may either represent lung cancer or a benign disease such as pulmonary tuberculosis (TB). Most such lesions are incidental findings on a chest radiograph, and malignancy is generally actively excluded as it may represent curable disease.[1] As patients with metastatic disease usually do not qualify for resection, the correct assessment and provisional staging of lung cancer patients is crucial in guiding their further management. Integrated positron emission tomography/computed tomography (PET-CT) is an integral part of this diagnostic process, and has been shown to reduce the number of futile thoracotomies.[2] The majority of studies on PET-CT have been conducted in areas with a low or moderate prevalence of TB, a disease which is well known to cause false-positive results.[3,4] Developing regions, particularly TB-endemic areas, therefore face a potential challenge of interpreting PET-CT images as false positive.[5,6] The aim of this study was to assess the sensitivity, specificity, and diagnostic accuracy of integrated PET-CT in the evaluation of SPNs and masses in an area with a very high TB incidence. A secondary aim was to investigate which maximum standardised uptake value (SUVmax) cut-off would potentially be the most suitable in distinguishing between benign and malignant disease in a TB-endemic area. The overall objective of the study was to improve

1049

the management of pulmonary masses by preventing unnecessary thoracotomies for benign lesions.

Methods

Study population

All patients referred to the Division of Pulmonology at Tygerberg Academic Hospital, Cape Town, South Africa, from 2009 to 2012 for evaluation of apparent SPNs or masses (1 - 6 cm in diameter) seen on routine chest radiographs and who subsequently underwent an integrated PET-CT were included. Patients who were found to have mediastinal lymph node involvement (not seen on routine chest radiography) on subsequent imaging (CT or PET-CT) were not excluded. Tygerberg Academic Hospital, a 1 380-bed aca­ demic hospital, is one of two academic referral centres in the city and renders a tertiary service to a population of approximately 1.5 million. According to the 2014 World Health Organization report, this population has one of the highest incidence rates for TB, approxi­ mately 1 000 cases for every 100 000 people each year, and the third highest burden of disease globally after India and China.[7] The study was approved by the Stellenbosch University Health Research Ethics Committee, and informed consent was obtained from all subjects prior to enrolment and prior to all invasive procedures.

December 2015, Vol. 105, No. 12

RESEARCH

Imaging techniques

All studies were performed from the base of the skull to the upper thigh with a Siemens Biograph or Philips Gemini PET-CT with 16-slice uncontrasted CT. The procedure was performed according to European Asso­ [8] ciation of Nuclear Medicine guidelines.

Patients fasted, except for water intake, for at least 6 hours prior to the study. Blood glucose levels were tested prior to the scan, which was postponed if the patient had a level of >11.1 mmol/L. Patients lay supine for 30 minutes prior to the study, and for a further 60 minutes without talking after injection of 18F-fluorodeoxyglucose (FDG). An FDG dose of 7 - 13 mCi was administered according to body weight. All images were interpreted by an experienced nuclear medicine physician, at least one radiologist, and independently by a respira­ tory physician. Positivity was defined clini­ cally as any FDG uptake greater than the mediastinal blood pool. The intensity of the FDG uptake in an area of interest was quantified using a Philips EBW workstation.

A cursor was manually placed at the site of highest visual uptake within the lymph node and the SUVmax was obtained from this slice using a circular region of interest with an 8 mm diameter.

Tissue sampling

The final diagnosis was established by histo­logical or cytological analysis of tissue samples acquired from the pulmonary mass lesion or mediastinal lymph nodes, depending on the results of the PETCT. Patients with a positive result for the pulmonary mass lesion on integrated PETCT and negative results for mediastinal lymph node (N0) and distant metastases (M0) then underwent tissue sampling procedures of the pulmonary mass lesion.

This was performed using CT-guided fineneedle aspiration, transthoracic ultrasoundguided needle aspiration or excision biopsy/ lobar resection as indicated. Patients with a negative integrated PET-CT result for distant metastases and a positive result for mediastinal lymph node involvement (positive N-staging) underwent either endo­ scopic sampling of the mediastinal lymph nodes or tissue acquisition by mediastinoscopy, depending on their accessibility.

Because of the high negative predictive value of integrated PET-CT, negative N-staging and M-staging on PET-CT was considered to be a true negative. This was then confirmed with clinical and radiological follow-up. Each patient included in the study was also tested for Mycobacterium

tuberculosis infection. This was done by Ziehl-Nielsen staining and culture of spu­ tum and/or bronchial washings, and/or histological proof of granulomatous tissue with necrosis, and/or culture of fine-needle aspirates.

Benign disease was defined as TB proven by the methods outlined above, histological confirmation of benign disease on lung resection, or clinical and radiological followup for a period of at least 2 years showing no growth, disappearance or clear evidence of reduction in size of the pulmonary mass lesion.

Chest radiograph and CT findings

The average diameters of the lesions meas­ ured were 29 mm in the vertical axis and 30 mm in the horizontal axis on standard anteroposterior (AP) chest radiograph, and these were very similar to the CT measurements (Figs 1 and 2). Lesions ulti­ mately proven to be malignant were most frequently observed in the right (n=12) and left upper lobes (n=8).

A

Statistical analysis

The results of histological or cytological analysis, or proof of benign disease on radiological follow-up, were considered the gold standard and were correlated with the findings of the integrated PET-CT in order to obtain sensitivity, specificity, positive pre­ dictive value, negative predictive value and diagnostic accuracy of integrated PETCT. These were calculated by standard techniques, initially with an SUVmax cutoff of 2.5. Thereafter a receiver operating characteristic (ROC) curve was obtained from the data set to determine an SUVmax cut-off that would provide the optimal sensitivity and specificity for our data set.

Results

Study population and diagnoses

Fifty patients fulfilled the inclusion criteria, but one was excluded owing to technical problems with acquisition of the PET study, leaving a study population of 49 patients (mean (standard deviation (SD)) age 60.1 (10.2) years; 29 males). The final diagnoses are summarised in Table 1. Lung cancer was confirmed in 30 patients, and two patients were found to have carcinoid tumours. Of the patients with malignant lesions, 21/32 (65.6%) were ultimately found to have resectable disease.

Table 1. Final aetiology in all cases (N=49) Type

n (%)

Adenocarcinoma

19 (38.8)

Squamous cell carcinoma

7 (14.7)

Poorly differentiated carcinoma

2 (4.1)

Carcinoid

2 (4.1)

Active pulmonary TB

8 (16.3)

Other benign*

11 (22.4)

*Other benign diagnoses included solitary fibrous tumour (n=1), old granulomas (n=7), bronchiectasis (n=2) and Haemophilus influenzae infection (n=1).

1050

December 2015, Vol. 105, No. 12

B

Fig. 1. A: An example of a mass lesion in the left upper lobe seen on CT scan. B: PET-CT showed high FDG uptake with an SUVmax of 13.3. The final diagnosis in this case was squamous cell carcinoma.

A

B

Fig. 2. A: CT scan from a patient who presented with a mass lesion in the apical segment of the left lower lobe. B: PET-CT confirmed an FDGavid lesion with an SUVmax of 3.8. This patient was ultimately diagnosed with pulmonary TB.

RESEARCH

Table 2. Respective diagnostic accuracies of SUVmax cut-offs of 2.5 and 5.0 SUVmax 2.5, % (95% CI)

SUVmax 5.0, % (95% CI)

Sensitivity

93.3 (76.5 - 98.8)

90.0 (72.3 - 97.4)

Specificity

36.8 (17.2 - 61.4)

78.9 (53.9 - 93.0)

PPV

70.0 (53.3 - 82.9)

87.1 (69.2 - 95.8)

NPV

77.8 (40.2 - 96.1)

83.3 (57.7 - 95.6)

PPV = positive predictive value; NPV = negative predictive value.

1.0 2.55

5.05 0.8

Sensitivity

0.6

0.4

0.2

0.0

0.0

0.2

0.4

0.6

0.8

1.0

Specificity

Fig. 3. The ROC curve, annotated with the SUVmax cut-off values of 2.5 and 5.0 (see text for details).

PET-CT findings and SUVmax

Malignant lesions had a higher mean (SD) SUVmax than lesions caused by TB (12.4 (6.7) v. 6.8 (5.2), p=0.032). When the SUVmax cutoff of 2.5 was used, the sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy of integrated PET-CT were 93.3%, 36.8%, 70.0%, 77.8% and 71.4%, respectively (Table 2).

A ROC curve was then obtained by comparing each SUVmax with the gold stan­ dard (Fig. 3). A ROC curve with a statistically significant area under the curve was obtained (0.854 (95% confidence interval 0.741 - 0.968), p<0.01). From this curve we could obtain an SUVmax that provided optimal sensitivity and specificity to our test. With a cut-off of 5.0 the sensitivity, specificity, positive predictive value, negative predictive value and diagnostic accuracy of integrated PET-CT for malignancy were 90.0%, 78.9%, 87.1%, 83.3% and 86.7%, respectively (Table 2). These analyses confirmed that an SUVmax cut-off of 5.0 improved the specificity of integrated PET-CT for cancer in our setting from 36.8%

to 78.9% and the diagnostic accuracy from 71.4% to 86.7%, with only a small reduction in sensitivity from 93.3% to 90.0%.

Discussion

We found PET-CT to have poor diagnostic accuracy in an area with a very high inci­ dence of TB. Moreover, an SUVmax threshold of 2.5 had a specificity of only 37%. However, a higher SUVmax cut-off of 5.0 increased the specificity to 79% and diagnostic accuracy from 71% to 87%, with only a marginal reduction in sensitivity from 93% to 90%.

International PET-CT data for the evalua­ tion of SPNs show higher accuracy for cancer in settings where the TB prevalence is substantially lower.[4,9] A recent metaanalysis by Deppen et al.[4] on the ability of PET-CT to diagnose lung cancer accurately in areas with a moderate burden of infectious lung diseases found significant hetero­geneity for sensitivity and specificity across studies.

The authors reported a pooled sensitivity of 99% and specificity of 75%. Alarmingly, there was a 16% lower average adjusted

1051

December 2015, Vol. 105, No. 12

specificity (61% v. 77%) in regions with endemic infectious lung disease compared with non-endemic regions.

Gould et al.[9] previously showed that PET is an accurate, non-invasive method for diag­ nosing an SPN in a developed world setting, with an overall sensitivity of 96.8% and a specificity of 77.8%. A retrospective study of 42 patients with SPNs in California found both an SUVmax cut-off of 2.0 and the visual interpretation yielded similar accuracy, with a sensitivity and specificity of 97% and 85%, respectively.[10] In Brazil, with a TB incidence rate of 66/100 000 population, the sensitivity and specificity of PET-CT (using an SUVmax cutoff of 2.5) were found to be 92.9% and 72.2%, respectively.[11] Limited data exist for the evaluation of PET-CT in other TB-endemic areas. In a Chinese population this modality was found to have a sensitivity and specificity [12] of 88.3% and 61.1%, respectively.

An SUVmax cut-off of 3.96 (determined by a ROC curve analysis) improved the sensitivity to 73.3% and the specificity to 75.0% in this population.[12] Only three studies have evaluated nuclear scanning to assess pulmonary mass lesions in SA.[6,13,14] Schuurmans et al.[13] found a sensitivity of 92.3% and a specificity of 91.7% for the use of technetium 99m-methoxy isobutyl isonitrile as a marker for tumour uptake. Sathekge et al.[6] performed a pro­ spective study of 30 patients to assess the accuracy of dual time point PET-CT in the assessment of SPNs in Pretoria, SA. Their analysis showed similar findings to our study with a sensitivity of 85.7% and a specificity of 25% when using an SUVmax cut-off of 2.5.

When TB (n=12) was excluded from their analysis, the sensitivity improved to 85.7% and the specificity to 100%. The present study confirms the findings of Sathekge et al.[6] regarding poor specificity in an area with high TB prevalence. Moreover, our data suggest that an SUVmax of 5.0 may be a more appropriate cut-off value in an area with a high TB incidence, and additionally that values of 2.5 - 5.0 should be interpreted as indeterminate. In a recent study, Vorster et al.[14] demonstrated that 68Ga-citrate PET/ CT has potential for the detection of both malignancy and TB, but it seemed incapable of providing a clear distinction between malignant and benign lung lesions in a setting with a high prevalence of granulo­ matous diseases such as TB. Importantly, it should be emphasised that the interpretation of PET-CT does not rely solely on SUV values. Swensen et al.,[15] for example, developed a pretest probability model using age, smoking history, history

RESEARCH

of extrathoracic cancer more than 5 years before nodule detection, nodule diameter, upper lobe location and spiculated margin. They achieved an area under the ROC curve of 0.80. Li et al.[16] developed a mathematical model for predicting malignancy using age, diameter, border calcification, spiculation, and family history of tumour. Their model generated a sensitivity of 94.5% and a specificity of 70.0%. Tian et al.[17] included FDG uptake as a variable in developing a prediction model by logistic regression analysis. They used gender, smoking history, age, diameter, spiculation and FDG uptake to estimate the probability of malignancy of SPNs. Using a cut-off value determined by ROC curve analysis, they achieved a sensitivity of 90.2% and a specificity of 87.6%.

PET-CT is therefore not a stand-alone investigation, but can contribute to the determination of malignant probability. Such a model could potentially be developed in a TB-endemic area.

A potential weakness of this study is the inclusion of a small proportion of patients initially assessed to have solitary pulmonary mass lesions or nodules on chest radiograph, who were later found to have more extensive disease on CT or PET-CT. Moreover, a limitation of increasing the SUVmax to 5.0 is that a number of lung malignancies with low metabolic activity (such as adenocarcinoma in situ) may be falsely reported as negative, whereas some tuberculous lesions (which may demonstrate higher SUVmax values) may be interpreted as positive.

In conclusion, the reduced specificity for malignancy of PET-CT in TB-endemic areas can be significantly improved by using an optimised threshold for SUVmax. PET-CT is a valuable adjunct in the assessment of patients with a pulmonary mass lesion on presentation, provided other clinical and radiological evidence is integrated in the assessment. Further research on integrating various SUVs with clinical and radiological prediction scores in settings with a high prevalence of TB is needed.

Acknowledgments. Tonya Esterhuizen of the Centre for Evidencebased Health Care, Stellenbosch University, performed the independent statistical analysis of study data.

1052

References 1. Swensen S, Jett J, Payne W, et al. An integrated approach to evaluation of the solitary pulmonary nodule. Mayo Clin Proc 1990;65(2):173-186. [http://dx.doi.org:/10.1016/s0025-6196(12)65012-5] 2. Fischer B, Lassen U, Mortensen J, et al. Preoperative staging of lung cancer with combined PET-CT. N Engl J Med 2009;361(1):32-39. [http://dx.doi.org/10.1056/nejmoa0900043] 3. Shaw JA, Irusen EM, von Groote-Bidlingmaier F, et al. Integrated positron emission tomography/ computed tomography for evaluation of mediastinal lymph node staging of non-small-cell lung cancer in a tuberculosis-endemic area: A 5-year prospective observational study. S Afr Med J 2015;105(2):145150. [http://dx.doi.org/10.7196/SAMJ.8357] 4. Deppen SA, Blume JD, Kensinger CD, et al. Accuracy of FDG-PET to diagnose lung cancer in areas with infectious lung disease. JAMA 2014;312(12):1227-1236. [http://dx.doi.org/10.1001/jama.2014.11488] 5. Chang J, Lee H, Goo J, et al. False positive and false negative FDG-PET scans in various thoracic diseases. Korean J Radiol 2006;7(1):57-69. [http://dx.doi.org/10.3348/kjr.2006.7.1.57] 6. Sathekge M, Maes A, Pottel H, Stoltz A, van de Wiele C. Dual time-point FDG PET-CT for differentiating benign from malignant solitary pulmonary nodules in a TB endemic area. S Afr Med J 2010;100(9):598-601.

7. World Health Organization. WHO Global Tuberculosis Report 2014. http://www.who.int/tb/ publications/global_report/en (accessed 15 February 2015).

8. Boellaard R, Oâ&#x20AC;&#x2122;Doherty M, Weber W, et al. EANM procedure guidelines for tumour PET imaging: Version 1.0. Eur J Nucl Med Mol Imaging 2010;37(1):181-200. [http://dx.doi.org/10.1007/s00259-0091297-4] 9. Gould M, Maclean C, Kuschner W, Rydzak C, Owens D. Accuracy of positron emission tomography for diagnosis of pulmonary nodules and mass lesions: A meta-analysis. JAMA 2001;285(7):914-924. [http://dx.doi.org/10.1001/jama.285.7.914] 10. Kim S, Allen-Auerbach M, Goldin J, et al. Accuracy of PET/CT in characterization of solitary pulmonary lesions. J Nucl Med 2007;48(2):214-220.

11. Martins Rde C, Almeida S, Siciliano A, et al. Value of [18F]-FDG-PET/CT as a predictor of cancer in solitary pulmonary nodule. J Bras Pneumol 2008;34(7):473-480. [http://dx.doi.org/10.1590/s180637132008000700007] 12. Li Y, Su M, Li F, Kuang A, Tian R. The value of 18F-FDG-PET/CT in the differential diagnosis of solitary pulmonary nodules in areas with a high incidence of tuberculosis. Ann Nucl Med 2011;25(10):804811. [http://dx.doi.org/10.1007/s12149-011-0530-y] 13. Schuurmans M, Ellmann A, Bouma H, et al. Solitary pulmonary nodule evaluation with 99mTcmethoxy isobutyl isonitrile in a tuberculosis-endemic area. Eur Respir J 2007;30(6):1090-1095. [http:// dx.doi.org/10.1183/09031936.00046107] 14. Vorster M, Maes A, Jacobs A, et al. Evaluating the possible role of 68Ga-citrate PET/CT in the characterization of indeterminate lung lesions. Ann Nucl Med 2014;28(6):523-530. [http://dx.doi. org/10.1007/s12149-014-0842-9] 15. Swensen S, Silverstein M, Ilstrup D, Schleck C, Edell E. The probability of malignancy in solitary pulmonary nodules: Application to small radiologically indeterminate nodules. Arch Intern Med 1997;157(8):849-855. [http://dx.doi.org/10.1001/archinte.1997.00440290031002] 16. Li Y, Wang J. A mathematical model for predicting malignancy of solitary pulmonary nodules. World J Surg 2012;36(4):830-835. [http://dx.doi.org/10.1007/s00268-012-1449-8] 17. Tian R, Su M, Tian Y, Li F, Kuang A. Development of a predicting model to estimate the probability of malignancy of solitary pulmonary nodules. Sichuan Da Xue Xue Bao Yi Xue Ban 2012;43:404-408. [http://dx.doi.org/10.1016/j.cllc.2011.06.005]

Accepted 5 November 2014.

December 2015, Vol. 105, No. 12

RESEARCH

Diabetes mellitus and non-traumatic lower extremity amputations in four public sector hospitals in Cape Town, South Africa, during 2009 and 2010 G L Dunbar,1 BSc, MB ChB, FCFP (SA), MMed Fam Med, DA (SA); D A Hellenberg,1 MB ChB, MFamMed, FCFP (SA); N S Levitt,2 MB ChB, MD, FCP (SA) 1 2

ivision of Family Medicine, Faculty of Health Sciences, University of Cape Town, South Africa D Division of Diabetic Medicine and Endocrinology, Groote Schuur Hospital and Faculty of Health Sciences, University of Cape Town, South Africa

Corresponding author: N S Levitt (naomi.levitt@uct.ac.za)

Background. Diabetes mellitus (DM) is the most commonly reported cause of non-trauma-related lower extremity amputations (LEAs) worldwide, but there is a dearth of such information for South Africa (SA).

Objectives. To examine the proportion of LEAs due to diabetes and to describe the associated characteristics of these patients.

Methods. A retrospective analysis of all LEAs was performed in four public sector hospitals in Cape Town, SA, for 2009 and 2010. Operating theatre records were reviewed to identify all patients who had an LEA. Patient records were perused and information extracted using a structured questionnaire.

Results. Records for 941 of 1 134 patients identified as having an LEA were found (recovery rate 82.9%). Of the 867 patients with 1 280 LEAs included in the study, 925 LEAs were in 593 patients with DM and 355 LEAs in 274 non-DM patients. Therefore 72.3% (95% confidence interval (CI) 69.8 - 74.7) of LEAs were in people with DM, while 68.4% (95% CI 65.2 - 71.4) of the total patients had DM. The DM group underwent more multiple LEAs (42.0% v. 23%; p<0.001) and had more multiple admissions (14.3% v. 7.7%; p<0.005) than the non-DM group. Infection (85.7% v. 63.5%,; p<0.001) and ulcer (25.3% v. 15.3%; p=0.001) were the leading causes for LEA in the DM group compared with the non-DM group. Ischaemia was the dominant cause in the non-DM patients (49.3% v. 23.3%; p<0.001), as was smoking (69.7% v.

43.5%, p<0.001), compared with the DM patients.

Conclusions. These data demonstrate an alarming burden of LEAs due to DM in the public sector in Cape Town. Given that the majority of LEAs are preventable with adequate education, screening, treatment and follow-up, effective interventions are needed.

S Afr Med J 2015;105(12):1053-1056. DOI:10.7196/SAMJ.2015.v105i12.9276

Diabetes mellitus (DM) is a major cause of morbidity and mortality globally. In 2010 an estimated 285 million adults had DM. This was projected to rise to 439 million adults by 2030; however, the most recent International Diabetes Federation estimates are that in 2014, 387 million people already had DM, and by 2035 this will rise to 592 million. The prevalence of DM continues to increase, with the largest increase seen in low- and middle-income countries; in South Africa (SA) the prevalence is also rising.[1-5] This increase is mainly due to the growth and ageing of the population, as well as rising rates of urbanisation with associated increased levels of obesity, physical inactivity and unhealthy diet.[6-8] This escalating number of people with DM will impact on disease management systems. DM accounted for 4.3% of all deaths in SA in 2000, placing it as the seventh most common cause of death in this country.[6] The complications of DM are not only common but devastating, and include lower extremity amputations (LEAs), blindness and renal failure, with DM being the most common cause for non-traumarelated LEAs. There is a wide range in the proportion of LEAs due to DM, with studies showing that up to 90% of LEAs worldwide are associated with DM and up to 70% of patients who undergo an LEA die within 5 years of the operation.[6,9,10] There are some African data on diabetes-related LEAs, primarily from small tertiary hospital studies. In each, diabetic foot com­ plications were the major indication for non-traumatic LEAs.[11-13] There are, however, few published data available for SA, and this study attempts to address this deficit, providing a baseline from which further monitoring and planning can be done.

The aim of this study was to examine the contribution of DM to the burden of LEAs in four public sector hospitals in Cape

1053

Town, SA, during 2009 and 2010. The objectives were to determine the demographic characteristics of patients undergoing LEAs, the proportion of these amputations due to DM, the comorbidities, risk factors, causes and complications associated with these LEAs, and the number and sites of these LEAs.

Methods

The study was a retrospective analysis of all LEAs performed in four Cape Town public sector hospitals: Groote Schuur Hospital, a tertiary level hospital, and its associated secondary level hospitals, Somerset, Victoria and G F Jooste Hospitals, from 1 January 2009 to 31 December 2010. These are the public sector hospitals that perform LEAs in the western portion of the Cape Town metropole. Cape Town is situated in the Western Cape Province of SA and has a heterogeneous population of approximately 3.5 million people. Like the rest of SA, disease management is split between the public and private sectors, with 80% of the population being dependent on the public sector.[14,15] All cases of LEAs, defined as the surgical removal of part of the lower limb by transection of the leg, foot or digit, necessarily including the removal of bone,[16] were identified from the theatre registers of these four hospitals for 2009 and 2010. All cases including the terms above-knee amputation (AKA), through-knee amputation (TKA), below-knee amputation (BKA), supramalleolar amputation (SMA), forefoot/transmetatarsal amputation (TMA) and digit amputation (DA) were included as an LEA in this study.

The identified patients’ records were requested from the corresponding hospitals’ records departments, and information was extracted using a structured data capture form. The data collected included number and length of admissions, demographic

December 2015, Vol. 105, No. 12

RESEARCH

details, diabetic status, type and treatment, associated comorbidities, risk factors, cause, amputation details and complications.

Trauma-related LEAs were excluded.

Of the non-trauma-related LEAs, patients whose diabetic status was unknown were also ex­cluded.

Descriptive analysis included percentages for categorical data, means, medians, stan­ dard deviations and ranges for numerical data where appropriate. Tests of significance included the χ2, Fisher’s exact and Wilcoxon tests. Statistical significance of p<0.05 was used.

The study was approved by the University of Cape Town Ethics Research Committee, HREC Ref: 365/2011. Permission to access patient records from the various hospitals was received.

1 517 LEAs in 1 134 patients

Patient records found

Traumatic amputations

Results

As seen in Fig. 1, records for 941 patients were found from the 1 134 patients identified as having an LEA from theatre records, a recovery rate of 82.9%. After exclusion of 39 patients who had a traumatic LEA and a further 35 with unknown DM status, a total of 867 patients with 1 280 LEAs remained, 593 DM patients with 925 LEAs and 274 non-DM patients with 355 LEAs; 72.3% (95% confidence interval (CI) 69.8 - 74.7) and 27.7% (95% CI 25.4 - 30.3) of the LEAs were therefore in DM and non-DM patients, respectively. Of the total number of patients, 68.4% (95% CI 65.2 - 71.4) had DM. The mean age (standard deviation (SD)) of all included patients was 62.2 (12.74) years.

There was no significant difference in the mean age of men and women within and between the DM and non-DM groups.

There were similar proportions of men and women in the DM group (50.1% and 49.9%, respectively), but twice as many men as women in the non-DM group (66.8% v.

33.2%, p<0.001). (The patient records no longer include a population classification code, so this information is not reported.)

Type 2 DM accounted for the majority of the patients in the DM group (n=551, 92.9%); 7 patients (1.2%) had type 1 DM, while the type of diabetes was unknown in 35 (5.9%). Regarding therapy, 299 (50.4%) were on oral therapy, 104 (17.5%) were on insulin, 128 (21.6%) were on a combination of oral and insulin therapy, 3 (0.5%) were on no therapy, 7 (1.2%) were on diet alone and therapy in 52 (8.8%) was unknown.

Table 1 summarises the comorbidities, risk factors, causes and complications asso­ciated with an LEA in the DM and non-DM groups.

Comorbidities. Hypertension, ischaemic heart disease (IHD) and renal impairment were significantly more common in the DM group than in the non-DM group (p<0.001).

1 374 LEAs in 941 patients

44 LEAs in 99 patients

Non-trauma-related LEAs

1 330 LEAs in 902 patients

Diabetes status unknown

50 LEAs in 35 patients

Diabetes status known

Identified from theatre registers

Recovery rate: 82.9%

Excluded from study

Excluded from study

1 280 LEAs in 867 patients

925 LEAs in 593 diabetes patients (72.3% of all LEAs)

355 LEAs in 274 non-diabetes patients (27.7% of all LEAs)

Fig. 1. Flow diagram for inclusion and exclusion of patients in the study.

Conversely, associated alcohol use, asthma/ chronic obstructive pulmonary disease (COPD) and HIV infection, were more common in the non-DM than the DM group (p<0.001), but associated cerebral vascular accidents (CVAs)/transient ischaemic attacks (TIAs) and congestive cardiac failure frequencies did not differ in the DM and non-DM groups.

Associated risk factors. Smoking was the only associated risk factor that was significantly different between the two groups (43.5% in the DM group and in 69.7% in the non-DM group; p<0.001).

Causes of the LEAs. Infection was the major cause of LEAs in both groups, albeit significantly higher in the DM group (p<0.001). Ischaemia accounted for a signi­ ficantly greater proportion of LEAs in the non-DM group (p<0.001), whereas an ulcer was responsible for a significantly greater proportion of LEAs in the DM group (p=0.001). Less common causes, including burns (p<0.05), were more common in the

1054

December 2015, Vol. 105, No. 12

DM group, while malignancy (p<0.01), limb deformity (p<0.05), neurological disorder (p<0.01) and HIV vasculopathy (p<0.01) were more common in the nonDM group.

Complications associated with the LEAs. There were significant differences for the main complications between the two groups, with a further LEA, sepsis and debridement being more common in the DM group than the non-DM group (p<0.05). There was no significant difference for the other main complications of in-hospital death, blood transfusion, and intensive care unit (ICU) admission, or regarding other complications of deep-vein thrombosis (DVT), upper gastrointestinal tract (GIT) bleed and pneumonia between the DM and non-DM groups, although these numbers were very small.

The median duration of hospital admission was 9 days, with an interquartile range of 7 days for both groups, and a range of 1 - 45

RESEARCH

days for the DM patients and 1 - 79 days for the non-DM patients. The 867 patients in the

study were admitted 988 times; there were 688 admissions in the 593 DM patients and

Alcohol

28 (4.7)

41 (15.0)

<0.001

Asthma/COPD

24 (4.1)

27 (9.9)

<0.001

Congestive cardiac failure

33 (5.6)

8 (2.9)

0.088

Renal impairment

28 (4.7)

3 (1.1)

0.0074

HIV

2 (0.3)

23 (8.4)

<0.001

300 admissions in the 274 non-DM patients.

Multiple admissions were more common in the DM patients (14.3%) compared with the non-DM patients (7.7%) (p<0.005).

The DM group had a greater proportion of current multiple LEAs than the nonDM group (42% v. 23%, p<0.001), while 20.4% in the DM group and 17.2% in the non-DM group had an LEA prior to the commencement of the study.

As seen in Fig. 2, the proportions of multi足 ple toectomies and TMAs did not differ significantly between the two groups.

However, the proportions of single toec足 tomies (p=0.002), SMAs (p<0.0001), and BKAs (p<0.0001), were higher in the DM patients, while TKAs (p<0.0001) and AKAs (p<0.0001) were higher in the non-DM group.

Hypercholesterolaemia

75 (12.7)

27 (9.9)

0.2359

Discussion

Smoking

258 (43.5)

191 (69.7)

<0.001

Peripheral vascular disease

138 (23.3)

76 (27.7)

0.1563

Peripheral neuropathy

13 (2.2)

3 (1.1)

0.2653

Table 1. Comparison of comorbidities, risk factors, causes and complications between DM and non-DM patients having a lower extremity amputation DM group n (%)

Non-DM group n (%)

p-value

493 (83.1)

148 (54.0)

<0.001

Comorbidities Hypertension CVA/TIA

76 (12.8)

40 (14.6)

0.4735

Ischaemic heart disease

103 (17.4)

29 (10.6)

0.0097

Risk factors

DM accounted for the vast majority of nontraumatic LEAs performed in 2009 and 2010 in four public sector hospitals in Cape Town.

On average six (number rounded up from 5.7) DM patients had nine (number rounded up from 8.9) LEAs per week over the 2-year period.

These data highlight the considerable burden that diabetes-related LEAs impose on local health services. This is in keeping with numerous studies conducted elsewhere that have stated that LEAs represent a considerable cost for such services, not only for the admission and amputation, but also for the additional components of rehabilitation, home care and social services.[6,9,17,18] The human cost is also considerable for the patients, their families and society. The best way to decrease these costs is to decrease the number of foot complications, including LEAs.

Causes Ulcer

150 (25.3)

42 (15.3)

0.001

Infection

508 (85.7)

174 (63.5)

<0.001

Ischaemia

138 (23.3)

135 (49.3)

<0.001

34 (5.7)

17 (6.2)

0.7841

Complications In-hospital death Further amputation

250 (42.2)

63 (23.0)

<0.001

Blood transfusion

65 (11.0)

24 (8.8)

0.3206

Diabetic ketoacidosis

12 (2.0)

ICU admission

10 (1.7)

5 (1.8)

0.5399

Sepsis/debridement

52 (8.8)

13 (4.7)

0.0364

Other complications* total

9 (1.5)

4 (1.5)

0.9781

*Other complications included vascular event, DVT, upper GIT bleed and pneumonia.

Diabetes

No diabetes

59.7

60.0

40.0

14.7 6.5

* 1.7

AKA

6.2

3.9

TKA

Single toe

0.9

BKA

6.0 2.0

SMA

8.2

10.0 0.0

* 19.5

* 14.8

TMA

20.0

* 28.5

* 27.6

30.0

Multiple toe

Proportion of LEAs, %

50.0

Site of LEA

Fig. 2. Distribution (%) of current LEAs by site in the DM and non-DM patients. (*Indicates significant differences (p<0.002) between DM and non-DM groups.)

1055

December 2015, Vol. 105, No. 12

RESEARCH

This study found that the associated co­morbidities of hypertension, IHD and renal impairment were more common in the DM patients.

This is similar to other studies and is thought to be due in part to the increasing westernisation of lifestyles.[3,19,20] The associated renal impairment probably reflects complications of DM due to poor glycaemic control.

Smoking was the only associated risk factor found to be different, being more prevalent in non-DM patients. This was also reflected in the fact that associated asthma/COPD was more prevalent in the non-DM group. Yet a large proportion of DM patients (43%) smoked, which is of concern, as smoking is known to increase the risk of LEAs in people with DM.[19] Associated peripheral vascular disease (PVD) was similar between the DM and non-DM groups, with about 25% of patients noted to have PVD as a risk factor, which is similar to a previous study.[21] This study found only a small number of patients with associated peripheral neuropathy in the DM group, yet peripheral neuropathy is known to be a substantial cause of foot complications including LEAs.[8,22] The number of patients with associated peripheral neuropathy is probably artificially low, reflecting under-reporting in the patient records.

A preceding ulcer and infection were the more common causes for LEAs in the DM patients, which is in keeping with what previous studies have shown.[3,9,17,19,23] Ischaemia was the most common cause for LEAs in the non-DM patients, perhaps reflecting the higher rate of smoking in this group. Burns causing LEAs were more common in the DM group and can probably be attributed to associated peripheral neuropathy.

Under-reporting of peripheral neuropathy probably reflects failure on the part of healthcare workers to screen for this complication. They are therefore not educating patients on the danger of infections, burns, etc.

Post-LEA sepsis and debridements were found to be more common in the DM patients. This was expected, as sepsis was often the cause for the LEA in this group. Nearly 20% of LEAs in DM patients were SMAs. This indicates that sepsis was a major cause, as this operation is usually a sepsis control procedure, the definitive procedure being a BKA or AKA. It is also notable that the percentage of AKAs in the non-DM group was double that in the DM group.

This may be because DM patients have more LEAs due to an ulcer or infection, requiring a more distal amputation, whereas nonDM patients have more LEAs due to ischaemia, requiring a more proximal amputation. The greater proportion of current, multiple LEAs in the DM group compared with the non-DM group reflects the fact that ‘creeping’ LEAs, i.e. multiple LEAs that start distally and progress proximally, are more prevalent in the DM group.

The strengths of this study are the large numbers of patients identified with a good recovery rate, as well as similar methodology employed as in other global studies.[24] However, it has a number of limitations. Its retrospective nature allowed only for information recorded in the patient folders to be evaluated. Accurate data for comorbidities, risk factors, causes and complications associated with a LEA would require a prospective study. The records often revealed limited information on other factors such as the level of glycaemic control, duration of DM and obesity. The study was undertaken only in the public sector, thus underestimating the true burden of diabetes-related LEAs. Because of the lack of accurate data on DM incidence and population size in the study area, it is difficult to extrapolate the number of LEAs identified in this study to the prevalence of diabetes-related LEAs. It is well known that the majority of foot complications, including LEAs, are preventable with adequate patient education, screening, treatment and follow-up.[3,16,23,25,26] In this regard we have previously demonstrated that a third of patients attending primary care clinics in Cape Town had ‘at-risk feet’ although this had often been unrecorded in the clinic notes.[27] A number of reasons may account for suboptimal foot care: high patient numbers and decreased consultation times

1056

leading to infrequent foot examinations, limited opportunities for patient education and therefore non-adherence, as well as inadequate overall treatment at a primary healthcare level.[6,19,28] While preventive diabetes foot care is not the sole preserve of the doctor or a podiatrist, it is important to note that there is a lack of podiatrists to adequately prevent and treat these complications. Nurses, health promoters and community health workers can all contribute to a diabetes foot programme, but would need to receive appropriate training to enable patients to be active participants in their own care, to screen for at-risk feet and to refer appropriately for further management.

Conclusions

This study highlights the enormous burden of LEAs in the public sector. There is clearly an urgent need to develop and implement foot care programmes to reduce the personal, societal and disease management costs associated with LEAs. This study provides a baseline against which the effectiveness of interventions can be measured in the future.

References 1. Shaw JE, Sicree RA, Zimmet PZ. Global estimates of the prevalence of diabetes for 2010 and 2030.

Diabetes Res Clin Pract 2010;87(1):4-14. [http://dx.doi.org/10.1016/j.diabres.2009.10.007] 2. Peer N, Steyn K, Lombard C, Lambert EV, Vythilingum B, Levitt N. Rising diabetes prevalence among urban-dwelling black South Africans. PLoS One 2012; 4 Sept. [http://dx.doi.org/10.1371/journal. pone.0043336] 3. International Diabetes Federation. IDF Diabetes Atlas. http://www.diabetesatlas.org/ (accessed 1 October 2015).

4. Bertram MY, Jaswal AVS, Pillay van Wyk V, Levitt NS, Hofman KJ. The non-fatal disease burden caused by type 2 diabetes in South Africa, 2009. Global Health Action 2013;6:19244. [http://dx.doi. org/10.3402/gha.v6i0.19244] 5. Mayosi BM, Flisher AJ, Lalloo UG, Sitas F, Tollman SM, Bradshaw D. The burden of noncommunicable diseases in South Africa. Lancet 2009;374(9693):934-947. [http://dx.doi.org/10.1016/ S0140-6736(09)61087-4] 6. Bradshaw D, Norman R, Pieterse D, Levitt NS and the South African Comparative Risk Assessment Group. Estimating the burden of disease attributable to diabetes in South Africa in 2000. S Afr Med J 2007;97(8):700-706.

7. Mbanya JCN, Motala AA, Sobngwi E, Assah FK, Enoru ST. Diabetes in sub-Saharan Africa. Lancet 2010;375(9733):2254-2266. [http://dx.doi.org/10.1016/S0140-6736(10)60550-8] 8. Gill GV, Mbanya JC, Ramaiya KL, Tesfaye S. A sub-Saharan African perspective of diabetes.

Diabetologia 2009;52(1):8-16. [http://dx.doi.org/10.1007/s00125-008-1167-9] 9. Boulton AJM, Vileikyte L, Ragnarson-Tennvall G, Apelqvist J. The global burden of diabetic foot disease. Lancet 2005;366(9498):1719-1724. [http://dx.doi.org/10.1016/S0140-6736(05)67698-2] 10. Girach A, Vignati L. Diabetic microvascular complications – can the presence of one predict the development of another? J Diabetes Complications 2006;20(4):228-237. [http://dx.doi.org/10.1016/j. jdiacomp.2006.03.001] 11. Chalya PL, Mabula JB, Dass RM, et al. Major limb amputations: A tertiary hospital experience in Northwestern Tanzania. J Orthop Surg Res 2012;7:18. [http://dx.doi.org/10.1186/1749-799X-7-18] 12. Enweluzo GO, Giwa SO, Adekoya-Cole TO, et al. Profile of amputations in Lagos University teaching hospital, Lagos, Nigeria. Nig Q J Hosp Med 2010;20(4):205-208.

13. Sié Essoh JB, Kodo M, Djè Bi Djè V, Lambin Y. Limb amputations in adults in an Ivorian teaching hospital. Niger J Clin Pract 2009;12(3):245-247.

14. Statistics South Africa. Community Survey 2007. https://www.statssa.gov.za/publications/P0301/ P0301.pdf (accessed 1 October 2015).

15. Health Systems Trust. Public Sector Dependent Population. http://indicators.hst.org.za/healthstats/14/ data (accessed 1 October 2015).

16. Jeffcoate WJ, van Houtum WH. Amputation as a marker of the quality of foot care in diabetes.

Diabetologia 2004;47(12):2051-2058. [http://dx.doi.org/10.1007/s00125-004-1584-3] 17. Clarke A. Avoiding foot complications in diabetes. CME 2010;28(4):181-185.

18. Apelqvist J, Larsson J. What is the most effective way to reduce incidence of amputation in the diabetic foot. Diabetes Metab Res Rev 2000;16(Suppl 1):75-83. [http://dx.doi.org/10.1002/15207560(200009/10)16:1+<::AID-DMRR139>3.0.CO;2-8] 19. Gamba MA, Gotlieb SLD, Bergmaschi DP, Vianna LAC. Lower extremity amputations in diabetic patients: A case-control study. Rev Saude Publica 2004;38(3):1-5.

20. Levitt NS. Diabetes in Africa: Epidemiology, management and healthcare challenges. Heart 2008;94(11):1376-1382. [http://dx.doi.org/10.1136/hrt.2008.147306] 21. Johannesson A, Larsson G-U, Ramstrand N, Turkiewicz A, Wirehn A-B, Atroshi I. Incidence of lowerlimb amputation in the diabetic and nondiabetic general population. Diabetes Care 2009;32(2):275280. [http://dx.doi.org/10.2337/dc08-1639] 22. Solomon Tesfaye S, Gill G. Chronic diabetes complications in Africa. Africa Health 2011;33(3):37-40. http://www.africa-health.com/articles/may_2011/Diabetes.pdf (accessed 1 October 2015) 23. Tudhope L. The diabetic foot: Recognition and principles of management. CME 2009;27(7):312-315.

24. Unwin N and the LEA study group. Comparing the incidence of lower extremity amputations across the world: The global lower extremity amputation study. Diabet Med 1995;12(1):14-18. [http://dx.doi. org/10.1111/j.1464-5491.1995.tb02055.x] 25. Distiller LA, Brown MA, Joffe BI, Kramer BD. Striving for the impossible dream: A community-based multi-practice collaborative model of diabetes management. Diabet Med 2010;27(2):197-202. [http:// dx.doi.org/10.1111/j.1464-5491.2009.02907.x] 26. Janse van Rensburg G. Preventative foot care in people with diabetes: Quality patient education.

Journal of Endocrinology, Metabolism and Diabetes of South Africa 2009;14(2):1-2. [http://dx.doi.or g/10.1080/22201009.2009.10872194] 27. Levitt NS, Bradshaw D, Zwarenstein MF, Bawa AA, Maphumolo S. Audit of public sector primary diabetes care in Cape Town, South Africa: High prevalence of complications, uncontrolled hyperglycaemia, and hypertension. Diabet Med 1997;14(12):1073-1077. [http://dx.doi.org/10.1002/ (SICI)1096-9136(199712)14:12<1073::AID-DIA498>3.0.CO;2-9] 28. Steyn K, Levitt NS, Patel M, et al. Hypertension and diabetes: Poor care for patients at community health centres. S Afr Med J 2008;98(8):618-620.

Accepted 5 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

Investigating the association between diabetes mellitus, depression and psychological distress in a cohort of South African teachers A K Domingo,1 MB ChB, FC Psych (SA); L Asmal,1 MB ChB, FCPsych (SA), MMed (Psych), MSc Clin Epi; S Seedat,1 MB ChB, FCPsych (SA), MMed (Psych), PhD; T M Esterhuizen,2 MSc (Epidemiology); C Laurence,2 MB ChB, MSc Clin Epi; J Volmink,2,3 BSc, MB ChB, MPH, DPhil epartment of Psychiatry, Faculty of Medicine and Health Sciences, Stellenbosch University, Tygerberg, Cape Town, South Africa D Centre for Evidence-based Health Care, Faculty of Medicine and Health Sciences, Stellenbosch University, Tygerberg, Cape Town, South Africa 3 South African Cochrane Centre, South African Medical Research Council, Tygerberg, Cape Town, South Africa 1 2

Corresponding author: A K Domingo (abduldomingo@gmail.com)

Background. Diabetes mellitus (DM) may increase the risk of depression as a result of a sense of threat of debilitating complications or because of associated lifestyle changes. Depression may increase the risk of type 2 diabetes as a result of poor health behaviours.

Objective. To determine the association between diabetes mellitus, depression and psychological distress in a cohort of South African (SA) teachers.

Methods. Teachers from 111 public schools in the Metro South District of the Cape Metropolitan area, SA, were invited to participate in this study. The Center for Epidemiologic Studies Depression Scale (CES-D) and the Kessler Psychological Distress Scale (K10) were used to assess depression and psychological distress, respectively. A professional nurse completed a physical examination and collected blood for measurement of glucose, cholesterol and serum creatinine.

Results. Of the 388 teachers who completed the questionnaires, 67.5% were female and the average age was 46.2 years (standard devia­tion 8.7). Psychological distress was identified in 28.1% of the cohort and depression in 15.5%, and 7.7% were found to fulfil criteria for DM. A diagnosis of DM was associated with an increased risk of depression (adjusted odds ratio (AOR) 3.90; 95% confidence interval (CI) 1.33 11.37) and psychological distress (AOR 3.62; 95% CI 1.31 - 10.00).

Conclusion. The high prevalence of obesity and DM in this cohort of SA teachers is of concern. A diagnosis of DM was strongly associated with an increased risk of depression and psychological distress.

S Afr Med J 2015;105(12):1057-1060. DOI:10.7196/SAMJ.2015.v105i12.9843

Diabetes mellitus (DM) and depression are highly preva­lent conditions, and each contributes significantly to morbidity and mortality worldwide. The number of people with DM globally is projected to rise from 171 million in 2000 to 366 million in 2030,[1] and develop­ ing countries are likely to carry an increased share of this burden. While data are limited for South Africa (SA), there is evidence that this burden is already considerable, with the prevalence of type 2 DM estimated at 28.2% in a recent community-based study in Bellville South, Cape Town.[2] The estimated prevalence of major depressive episodes (MDE) in SA is also high, based on the findings of the South African Stress and Health (SASH) study.[3] The prevalence of MDE in SA was found to be 9.7% and 4.9% for lifetime and a 12-month period, respectively.[3] Poor health behaviours associated with depression, such as smoking, physical inactivity and high caloric intake, may increase the risk of type 2 DM.[4] Depression is also associated with physiological abnormalities, including activation of the hypothalamic-pituitaryadrenal axis, sympathoadrenal system and proinflammatory cytokines, which can induce insulin resistance and contribute to diabetes risk.[4] Furthermore, the sense of threat of debilitating complications and the lifestyle changes associated with management of diabetes may increase the risk of depression.[4] A meta-analysis of 39 studies reported that 11% of patients with DM met the criteria for comorbid major depressive disorder.[5] Another meta-analysis that examined the relation between depression and diabetes onset found that the risk of developing type 2 DM was 37% greater in depressed adults than in adults without depression.[6]

1057

SA has a quadruple burden of disease: a combination of povertyrelated infectious diseases, violence-related injuries, perinatal and maternal disease, and an increase in lifestyle-related non-commu­ nicable diseases (NCDs).[7] The potential link between depression, psychological distress and DM may therefore be particularly relevant and warrants further investigation.

SA teachers, in common with teachers everywhere, have high job stressors related to time pressures, the educational system, prof­ essional distress and learner misbehaviour.[8] Job stress and lack of job satisfaction are associated with many stress-related illnesses, including hypertension, heart disease, stomach ulcers, asthma, mental distress and alcohol misuse.[8] We investigated the association between DM, depression and psycho­ logical distress in a pilot cohort of SA teachers. Specific objectives of this study were to: (i) describe the demographic and clinical profile of the cohort; (ii) determine the prevalence of DM, depression, and psychological distress; and (iii) determine whether DM is associated with depression and psychological distress.

Methods

Study design

The study involved secondary analysis of SA baseline data from the Partnership for Cohort research and Training (PaCT) pilot study.

The PaCT initiative was established to study NCDs in four African countries (SA, Nigeria, Tanzania and Uganda), and pilot studies were conducted to assess the feasibility of conducting longitudinal cohort studies at each site. The SA pilot study was conducted among teachers,

December 2015, Vol. 105, No. 12

RESEARCH

and additional aims were to determine the prevalence of cardiovascular disease risk factors and chronic kidney disease.

Participants

The principals of 111 primary, secondary, and intermediate public schools where 20 or more teachers were employed in the Metro South District of the Cape metropolitan area were approached for permission for their schools to participate. All teachers from schools where principals indicated a willingness to participate were invited to participate. Teachers excluded from the study were those under the age of 18 years and those intending to retire or to relocate in the following 6-month period.

Procedure

School principals were tasked with distri­ buting self-administered questionnaire packets and consent forms to teachers at their schools. Teachers returned the com­ pleted questionnaires and consent forms in a sealed envelope and were then seen by a nurse, who gathered select physical measure­ ments and biological specimens.

Measures

The core questionnaire was developed in collaboration with Har­ vard University and universities from four African countries using the World Health Organization (WHO) stepwise approach to chronic disease risk factor surveillance (STEPS) as a template.[9] The questionnaire focused on demographic and health-related information such as age, gender, ethnicity, educational level, physical activity, chronic medication use, tobacco use, alcohol consumption, and personal and family medical history related to cardiovascular disease and other chronic NCDs. The questionnaires in SA included the Center for Epidemiologic Studies - Depression Scale (CES-D) and the Kessler Psychological Distress Scale (K10) to determine the risk of depression and psychological distress, respectively. The CES-D is a validated selfreport screening instrument designed to measure the frequency and severity of depressive symptoms in community samples.

It consists of 20 items, each rated on a 4-point scale. A CES-D score of ≥16 was used as a cutoff point for the study and is correlated with mild to moderate depressive symptoms.[10] The K10 is a self-report screening instrument that assesses anxiety and depressive symptoms over the preceding 4 weeks on a 10-item scale. K10 total scores range from 10 to 50, with clinically relevant psychological distress defined as a K10 score of ≥20.[11]

DM was defined as a fasting (>8 hours after a main meal) blood glucose concentration of ≥7.0 mmol/L, or a random (approximately 2 hours after a main meal) blood glucose level ≥11.1 mmol/L, or self-reported diabetes on insulin or oral hypoglycaemic drugs. A professional nurse completed a physical examination and recorded blood pressure (BP), weight, height and waist circumference. Glucose, total cholesterol, high-density lipoprotein cholesterol and serum creatinine were measured.

Data analysis

SPSS version 20 (IBM, USA) was used for analysis of data. A p-value of <0.05 was considered statistically significant. Bivariate associations between categorical exposures and outcomes were assessed using Pearson’s χ2 tests or Fisher’s exact tests, as appropriate.

In the case of continuous predictor variables, t-tests were used if they were normally distributed and Mann-Whitney U-tests were used for non-parametric data. We used unadjusted and adjusted logistic regression to assess the association between DM and depression, and DM and psychological distress. We adjusted for the following poten­ tial confounders: age, gender, body mass index (BMI, kg/m2), hypertension, serum cholesterol, and smoking. A backward stepwise model was con­structed with entry and exit probabilities set at 0.1 and 0.05, respectively. Odds ratios (ORs) and 95% confidence intervals (CIs) are presented in the final model.

Ethical considerations

The institutional ethics committees of Stellen­­bosch and Harvard universities app­

roved the study. Permission to conduct the study was obtained from the Western Cape Education Department and from the principal of each school. A letter was sent to the provincial offices of teacher trade unions to inform them of the study. All participants signed written informed consent and confidentiality was strictly maintained throughout the study. Teachers were not remunerated for participating in the study.

Results

Demographic and clinical characteristics

Fifty-nine of the 111 school principals (53.2%) who were approached agreed to their schools participating in the study.

A total of 489 teachers enrolled in the study, of whom 478 completed the baseline questionnaire. A further 90 participants were excluded because of missing mental health data. The cohort for this analysis comprised 388 partici­ pants with a mean (standard deviation (SD)) age of 46.2 (8.7) years (Table 1). There were more females (n=262, 67.5%) than males (n=126, 32.5%) in the sub-sample. The mean (SD) serum cholesterol was found to be 5.5 (1.1) mmol/L, BP 138.6/81.0 (19.5/11.3) mmHg and serum glucose 5.6 (2.1) mmol/L. Mean serum cholesterol and glucose did not differ significantly between male and female participants. The mean (SD) BMI in both female (31.2 (7.8)) and male (30.0 (5.9)) participants corresponded to the WHO obesity category. Male participants had a mean (SD) systolic BP of 145.5 (19.3) mmHg and diastolic BP of 83.9 (11.2) mmHg, while female participants had signi­ficantly lower

Table 1. Demographic and clinical characteristics Variable

Total (N=388)

Females (n=262)

Males (n=126)

p-value

Age (years), mean (SD)

46.2 (8.7)

46.1 (8.5)

46.4 (9.2)

0.707

Weight (kg), mean (SD)

80.9 (18.2)

77.1 (17.3)

88.1 (17.6)

<0.001

BMI (kg/m ), mean (SD)

30.7 (7.2)

31.2 (7.8)

30.0 (5.9)

0.151

Serum cholesterol (mmol/L), mean (SD)

5.5 (1.1)

5.4 (1.1)

5.5 (1.0)

0.260

Serum glucose (mmol/L), mean (SD)

5.6 (2.1)

5.5 (1.7)

5.9 (2.8)

0.186

Systolic BP (mmHg), mean (SD)

138.6 (19.5)

135.3 (18.7)

145.5 (19.3)

<0.001

Diastolic BP (mmHg), mean (SD)

81.0 (11.3)

79.5 (11.1)

83.9 (11.2)

<0.001

Current smoking, n (%)

74 (19.8)

40 (16.1)

34 (27.4)

0.010

K10, median (interquartile range)

15 (12 - 21)

15 (12 - 21)

14 (12 - 20)

0.479

CES-D, median (interquartile range)

3 (1 - 9)

4 (1 - 10)

3 (0 - 8)

0.885

2

1058

December 2015, Vol. 105, No. 12

RESEARCH

mean (SD) systolic BP (135.3 (18.7) mmHg; p<0.01) and diastolic BP (79.5 (11.1) mmHg; p<0.01).

Prevalence of diabetes mellitus, depression and psychological distress

Thirty participants (7.7%) fulfilled criteria for DM. Of these, 15 (11.9%) were male and 15 (5.7%) female. Based on the K10, 109 (28.1%) participants were found to have psychological distress, with a similar prevalence in men (n=35, 27.8%) and women (n=74, 28.2%).

A CES-D score of ≥16, indicating mild to moderate depressive symptoms, was found in 60 (15.5%) participants (19 (15.1%) men and 41 (15.6%) women).

Association between diabetes, depression and psychological distress

Table 2 reports the results of the univariate analyses of factors associated with depression and psychological distress. The presence of depression as measured by the CES-D was significantly associated with DM, with an OR of 3.65 (95% CI 1.64 - 8.14; p=0.002).

The presence of psychological distress as measured by the K10 was associated with an almost threefold increase in the odds of diabetes (OR 2.81; 95% CI 1.32 - 5.96; p=0.007).

In stepwise logistic regression analysis (Table 3), diabetes remained significantly associated with depression (adjusted OR (AOR) 3.90; 95% CI 1.33 - 11.37; p=0.013) and psychological distress (AOR 3.62; 95% CI 1.31 - 10.00; p=0.013) after controlling for age, gender, BMI, BP, cholesterol and smoking history. Gender, BMI, age, systolic and diastolic BP, serum cholesterol and tobacco smoking did not have a significant effect on the prevalence of psychological distress and depression.

Discussion

There were several key findings. The preva­ lence of self-reported psychological distress (28.1%) and depression (15.5%) was found to be high. Our prevalence rates were found to be higher than the results obtained in the SASH study, where the prevalence of an MDE was found to be 4.9% over a 12-month period, the lifetime prevalence being 9.8%. [3] This may be explained by the high levels of job stress, low salaries and poor support endured by many teachers in the Western Cape. A study by Emsley et al.[13] found that 81% of their cohort of Cape Town-based teachers identified ‘workrelated stress’ as a significant causal factor for the development of their psychiatric

Table 2. Association between depression, psychological distress and diabetes mellitus: Univariate analysis CES-D Age (years)

K10

OR (95% CI)

p-value

OR (95% CI)

p-value

0.96 (0.93 - 0.99)

0.013*

0.96 (0.94 - 0.99)

0.005*

Diabetes mellitus No

Reference

Yes

3.65 (1.64 - 8.14)

Reference 0.002*

2.81 (1.32 - 5.96)

0.007*

Gender Male

Reference

Female

1.04 (0.58 - 1.89)

0.884

1.02 (0.64 - 1.64)

0.924

BMI (kg/m )

1.03 (0.99 - 1.07)

0.196

1.01 (0.97 - 1.05)

0.572

Serum cholesterol (mmol/L)

0.91 (0.69 - 1.21)

0.514

1.06 (0.85 - 1.32)

0.599

Systolic BP (mmHg)

0.99 (0.98 - 1.01)

0.627

0.99 (0.97 - 1.00)

0.050

Diastolic BP (mmHg)

1.02 (0.99 - 1.05)

0.150

0.99 (0.97 - 1.02)

0.690

2

Reference

Smoking No

Reference

Reference

Yes

1.39 (0.71 - 2.70)

0.333

1.42 (0.82 - 2.45)

0.207

*p-values significant at <0.05.

Table 3. Association between depression, psychological distress and diabetes mellitus: Multivariate logistic regression analysis CES-D Age (years)

K10

AOR (95% CI)

p-value

AOR (95% CI)

p-value

0.96 (0.92 - 1.01)

0.137

0.97 (0.93 - 1.00)

0.080

Diabetes mellitus No

Reference

Yes

3.90 (1.33 - 11.37)

Reference 0.013*

3.62 (1.31 - 10.00)

0.013*

Gender Male

Reference

Female

1.11 (0.50 - 2.51)

0.405

Reference 0.98 (0.52 - 1.88)

0.987

BMI (kg/m )

1.02 (0.97 - 1.07)

0.532

1.01 (0.97 - 1.05)

0.606

Serum cholesterol (mmol/L)

0.97 (0.66 - 1.42)

0.780

1.06 (0.78 - 1.46)

0.696

Systolic BP (mmHg)

0.99 (0.96 - 1.01)

0.328

0.98 (0.96 - 1.00)

0.106

Diastolic BP (mmHg)

1.03 (0.98 - 1.07)

0.265

1.01 (0.97 - 1.05)

0.585

2

Smoking No

Reference

Yes

0.96 (0.41 - 2.29)

Reference 0.944

1.15 (0.58 - 2.31)

0.682

*p-values significant at <0.05.

disorder. It should also be noted that our cohort differs from the general population in that it consists of a mostly female sample, of relatively young working age and mixed ancestry.

The SASH study found that females had a 1.75 times greater risk than males of experiencing depression,[3] but in this cohort there was no significant difference in the prevalence of either psychological distress or

1059

December 2015, Vol. 105, No. 12

depression in males and females. This may be due to both genders in our cohort being similar in age, and of similar cardiovascular risk, and experiencing the same type of job stress.

The Global Prevalence of Diabetes study estimates the worldwide prevalence of dia­ betes to be 2.8% in 2000 and 4.4% in 2030. [1] A study conducted during 2008 - 2009 found a crude prevalence rate of type 2 DM of

RESEARCH

28.2% in a cohort of 642 participants in the Western Cape.[2] This high prevalence rate may be explained by the sample being a general community-based sample and this study having included the use of an oral glucose tolerance test to diagnose type 2 DM. The prevalence of DM in our sample was 7.7%. The difference in prevalence rates may further be explained by a possible non-response bias, where known diabetics may have chosen not to participate, or because this sample represented a professional group. After adjusting for confounding variables, DM was associated with a threefold increase in the odds of psychological distress and depression. This is in keeping with other studies that have shown a strong relationship between these two disorders.

Study strengths and limitations

Strengths of this study include the administration of clinical assessments and validated rating scales in a relatively large cohort of teachers from schools in the Cape Town metropole. Limitations include the lack of generalisability of these findings to other professional and general population groups. Ninety participants were excluded owing to missing mental health data, which may reflect hesitancy to report these symptoms; this may have led to an underreporting of the true prevalence of depression and psychological distress.

Conclusion

SA teachers were found to have a high prevalence of obesity and DM and a high mean systolic BP. These comorbidities often cluster, increasing the risk of the metabolic syndrome.

Acknowledgments. We acknowledge the PaCT Steering Committee of the Faculty of Medicine and Health Sciences at Stellenbosch University for their guidance with the SA pilot study and the primary collaborators of the Africa/Harvard School of Public Health Partnership for Cohort Research and Training for their efforts in initiating, carrying out, and co-ordinating

1060

this study in five sites (other than SA): Clement Adebamowo (Nigeria site), Marina Njelekela (Tanzania site), David Guwatudde (Makerere, Uganda site), Francis Bajunirwe (Mbarara, Uganda site), Hans-Olov Adami, Shona Dalal, Michelle Holmes and Todd Reid (HSPH co-ordinating center).

The SA pilot study was made possible through funding obtained from the Dean’s Office of HSPH, and the HSPH Department of Nutrition; the Faculty of Medicine and Health Sciences at Stellenbosch University; and the International Society of Nephrology’s Global Outreach Clinical Research and Prevention Program.

References 1. Wild S, Roglic G, Green A, et al. Global prevalence of diabetes: Estimates for the year 2000 and projections for 2030. Diabetes Care 2004;27(5):1047-1053. [http://dx.doi.org/10.2337/ diacare.27.5.1047] 2. Erasmus RT, Soita DJ, Hassan MS, et al. High prevalence of diabetes mellitus and metabolic syndrome in a South African coloured population: Baseline data of a study in Bellville, Cape Town. S Afr Med J 2012;102(11):841-844. [http://dx.doi.org/10.7196/SAMJ.5670] 3. Tomlinson M, Grimsrud AT, Stein DJ, et al. The epidemiology of major depression in South Africa: Results from the South African Stress and Health study. S Afr Med J 2009;99(5):368-373.

4. Mezuk B, Eaton WW, Albrecht S, et al. Depression and type 2 diabetes over the lifespan: A metaanalysis. Diabetes Care 2008;31(12):2383-2390. [http://dx.doi.org/10.2337/dc08-0985] 5. Anderson RJ, Freedland KE, Clouse RE, et al. The prevalence of comorbid depression in adults with diabetes: A meta-analysis. Diabetes Care 2001;24(6):1069-1078. [http://dx.doi.org/10.2337/diacare.24.6.1069] 6. Knol M, Twisk J, Beekman A, Heine R, Snoek F, Pouwer F. Depression as a risk factor for the onset of type 2 diabetes mellitus. A meta-analysis. Diabetologia 2006;49(5):837-845. [http://dx.doi. org/10.1007/s00125-006-0159-x] 7. Mayosi BM, Flisher AJ, Lalloo UG, Sitas F, Tollman SM, Bradshaw D. The burden of noncommunicable diseases in South Africa. Lancet 2009;374(9693):934-947. [http://dx.doi.org/10.1016/ S0140-6736(09)61087-4] 8. Peltzer K, Shisana O, Zuma K, van Wyk B, Zungu‐Dirwayi N. Job stress, job satisfaction and stress‐ related illnesses among South African educators. Stress Health 2009;25(3):247-257.

9. World Health Organization. STEPwise approach to noncommunicable disease risk factor surveillance (STEPS). Geneva: World Health Organization, 2015. http://www.who.int/chp/steps/riskfactor/en/ (accessed 20 October 2015).

10. Radloff LS. The CES-D scale: A self-report depression scale for research in the general population.

Appl Psychol Meas 1977;1(3):385-401. [http://dx.doi.org/10.1177/014662167700100306] 11. Andrews G, Slade T. Interpreting scores on the Kessler psychological distress scale (K10). Aust N Z J Public Health 2001;25(6):494-497. [http://dx.doi.org/10.1111/j.1467-842X.2001.tb00310.x] 12. Jorm AF. Does old age reduce the risk of anxiety and depression? A review of epidemiological studies across the adult life span. Psychol Med 2000;30(1):11-22. [http://dx.doi.org/10.1017/ S0033291799001452] 13. Emsley R, Emsley L, Seedat S. Occupational disability on psychiatric grounds in South African schoolteachers. Afr J Psychiatry 2009;12(3):223-226. [http://dx.doi.org/10.4314/ajpsy.v12i3.48498]

Accepted 5 October 2015.

December 2015, Vol. 105, No. 12

RESEARCH

An electronic colonoscopy record system enables detailed quality assessment and benchmarking of an endoscopic service A Benamro, MB BCh; J L Bruce, FCS (SA); D L Clarke, PhD Gastroenterology Unit, Grey’s Hospital, Pietermaritzburg, and Department of Surgery, School of Clinical Medicine, College of Health Sciences, Nelson R Mandela School of Medicine, University of KwaZulu-Natal, Durban, South Africa Corresponding author: D L Clarke (damianclar@gmail.com)

Background. Competence in colonoscopy, which is a technically difficult procedure, requires adequate exposure to it and the maintenance of a detailed logbook. Without an electronic record this is difficult to achieve. By implementing an electronic medical record system we aimed to perform a detailed quality assessment audit of colonoscopy, to benchmark our results and generate accurate logbooks for individual endoscopists.

Methods. We reviewed the prospectively maintained Hybrid Electronic Medical Registry (HEMR). Colonoscopies performed between March 2013 and March 2014 were reviewed, and for competency, quality metrics were derived from the guidelines of the American Society of Gastroenterology.

Results. A total of 843 colonoscopies were performed. Seven hundred and seventy procedures were performed by three staff endoscopists who each performed over the required 150 procedures annually (n=197, 338 and 235). The remaining 73 (8.7%) were performed by other staff. In 105 cases (12.5%), bowel preparation was deemed to be inadequate, which caused the procedure to be abandoned in 34 cases.

A total of 64 cases were deemed to be incomplete because of obstructing lesions (n=26), extensive diverticulosis (n=4), technical difficulty (n=31) and patient discomfort (n=3). There were two complications recorded: perforation (n=1) and bleeding (n=1).

Conclusions. The HEMR system enabled the audit of experiences with colonoscopy in our institution. Our results are broadly compatible with the international literature and with a number of guidelines. The development of an electronic record system is a major advance, as it enables meaningful benchmarking and the generation of accurate procedural logbooks.

S Afr Med J 2015;105(12):1061-1063. DOI:10.7196/SAMJ.2015.v105i12.10115

Flexible fibreoptic colonoscopy is the current gold standard investigation for diseases of the colon, as it allows direct visualisation of the entire colon and several therapeutic interventions.[1-3] However, colonoscopy is technically difficult to master and is associated with a significant number of complications. There has therefore been considerable interest in attempts to standardise the teaching of the procedure and in the accreditation of endoscopists, and several regulatory bodies and societies have developed norms and quality markers for endoscopists.[1-3] The advent of dedicated colonoscopic screening programmes around the world has focused attention on the sensitivity and specificity of colonoscopy, and the endoscopist must provide proof of competency based on detailed logbooks. Logbooks are also required for training purposes. Most examining bodies rely on them to ensure that candidates sitting board and fellowship examinations have been exposed to an adequate spectrum of pathology and procedures and have documented evidence that they are competent in these procedures.[4,5] Previously, all record-keeping in our institution was paper based, which made it difficult to record and analyse data, and it was impossible to monitor quality markers and to benchmark the service. The development of our electronic medical record systems enabled us to keep detailed electronic records of all endoscopic procedures.[6,7] By keeping these data in a relational database, we can perform detailed audits of colonoscopies at our institution. We aimed to use data from such an audit to benchmark our results against international quality guidelines and to provide individual endoscopists with a procedural logbook.

1061

Setting

Grey’s Hospital is a tertiary hospital in Pietermaritzburg, KwaZuluNatal Province (KZN), South Africa. The city has a population of just under one million people. Grey’s Hospital is the tertiary referral hospital for the entire western part of KZN, which is a very rural area with a population of about two million people. The Gastroenterology Unit at Grey’s functions with two colonoscopes, and is staffed by a core team of dedicated nursing staff. A dedicated colorectal surgical service at Grey’s is staffed by a senior surgeon, a single subspecialist surgeon (<5 years’ clinical experience) and a single colorectal fellow in training. However, not all colonoscopies are performed by these three doctors. Since 2013 Grey’s Hospital has run a Hybrid Electronic Medical Registry (HEMR) that captures the admission, operative, endoscopic and discharge data of all surgical patients in a relational database.[7] This database is clinician maintained and audited.

Methods

We retrospectively reviewed the prospectively maintained HEMR for all colonoscopies performed between March 2013 and March 2014. These data were used to generate a procedural logbook for each endoscopist and, for competency, were based on the published guidelines[3] of the American Society of Gastroenterology (ASGE), specifically noting the following quality markers: (i) number of procedures per individual endoscopist; (ii) quality of the bowel preparation; (iii) number of times the caecum was intubated; (iv) number of adenomas detected at each procedure; (v) complications; and (vi) number of incomplete procedures.

December 2015, Vol. 105, No. 12

RESEARCH

Results

Discussion

Increased awareness of quality issues in healthcare has resulted in the development of quality metrics to provide an index against which clinicians and institutions can measure their performance. Many international asso­­ ci­ ations for flexible endoscopy have there­ fore promulgated quality metrics for various endoscopic procedures. We used the guide­lines of the ASGE, and benchmarked our unit’s experience against these guide­ lines. Incomplete examinations owing to obstructing lesions or faecal obstruction are regarded as failed procedures, and there should be a polyp detection rate of ≥20%.

The data in the HEMR enabled comparison of our experience with those of published guidelines: 1. N umber of procedures. An endoscopist must be affiliated with a screening centre and must have performed at least 1 000 examinations over his/ her professional lifetime. There should have been at least 150 examinations performed in the preceding 12 months by each endoscopist.[1-5] Three of the staff performing the procedure worked in the colorectal service and easily met this requirement, suggesting that we have an adequate caseload for the training of colorectal specialists. The remaining procedures were preformed by a variety of endoscopists from different services.

350 311

250 200 150

138

100

n ru

ct

io

ht ob st

/w ei g

ha

bi ts

ve illa

bo w el Ch

an

ge

in

Bo w el

ng re en i

Su r

n Un k

no w

nc e

20

y ar

as lm na

Re ct

al

al /a

bl ee di

al in

s

ng

n pa i

s m

as Ab do m

al in

29

38

Sc

51

30

0

133 90

pr im

50

Re ct

Indications, n

300

Ab do m

A total of 843 colonoscopies were performed.

Fig. 1 documents the indications for the proce­dure.

Three colorectal service endoscopists, who each performed more than the required 150 procedures annually, per­ formed a total of 770 procedures. The remaining 73 (8.7%) were performed by other staff. In 105 cases (12.5%), bowel preparation was deemed to be inadequate, which caused the procedure to be aban­ doned in 34 cases. A total of 64 cases were deemed to be incomplete because of obstructing lesions (n=26), extensive diverticulosis (n=4), technical difficulty (n=31) and patient discomfort (n=3). The completion rates of the three members of the colorectal team are documented in Table 1. Both endoscopists with more than a year’s experience had completion rates approximating 98%. Table 1 also documents the adenoma detection rate per endoscopist. There were two compli­ cations recorded: perforation (n=1) and rectal bleeding (n=1). Table 2 lists the complications against level of experience.

Fig. 2 summarises the entire cohort.

Fig. 1. Indications for lower colonoscopy.

Table 1. Polyps detected and completed scopes for individual endoscopists Polyps detected n (%)

Completed scopes n (%)

Total cases N

Senior colorectal specialist, >5 years’ experience

23 (11.5)

198 (99.0)

200

Colorectal specialist, <5 years’ experience (second year)

18 (7.7)

227 (96.6)

235

Colorectal trainee (first year)

28 (8.3)

228 (67.5)

338

Table 2. Complications by level of medical expertise, all patients Type of complication

Complications n (%)

Total procedures N

Non-colorectal trainee

Rectal bleeding

1 (10.0)

10

Non-colorectal consultant

Perforation

1 (10.0)

10

2. Q uality of bowel preparation. The ASGE suggests that the percentage of out­patient examinations with inadequate bowel preparation should not exceed 15% of all procedures. The reported incidence of 13% in this series was within these guidel­ines.

Inadequate bowel preparation makes the procedure technically more challenging and increases the risk of an incomplete study and of complications.[1-3,8,9] 3.

Rate of complete colonoscopy. For a study to be deemed complete, the endo­ scopist must intubate the terminal ileum and visualise the appendiceal orifice. The rate of complete colonoscopy should be >90% for diagnostic colonoscopy and >95% for screening colonoscopy; these rates are being achieved in our endoscopy service. [1-3] Both endoscopists with more than a year’s experience with the procedure had significantly higher completion rates than the first-year trainee.

4. Detection rate of adenoma. Each endo­ scopist should identify one or more adeno­

1062

December 2015, Vol. 105, No. 12

ma­tous polyps in at least 25% of men and 15% of women aged >50 years who are undergoing a screening colonoscopy.

Although few of our procedures were true screening colonoscopies, our detection rate is in keeping with this.[1-3,10,11] 5. C omplications. The rate of perforation secondary to colonoscopy is currently in the order of one perforation per 1 000 1 400 examinations.[1] Table 2 summarises the complications. Our complication rate is slightly higher than the suggested rate, based on the ASGE guidelines. Ongoing audit is necessary to determine whether this problem is persistent and whether a quality improvement programme is necessary to address this.[1-3,10,12] The ongoing drive to ensure that training is quantified and standardised across national centres has involved the mandatory keeping of procedural logbooks. However, these logbooks have mostly been manual, and concerns have been raised that they

RESEARCH

of this HEMR system enabled our service to quantify our workload accurately and to benchmark our service against international guidelines. We could also establish a workload that can be used to support training initiatives. This has implications for service delivery and educational purposes.

Total number of procedures N=843

Poor bowel preparation n=105

Abandon procedures n=34

Proceed with scope n=71

Incomplete procedures n=64

Complications n=2

Obstructive lesion n=26

Rectal bleeding n=1

Extensive diverticulosis n=4

Perforation n=1

Technical difficulty n=31

Patient discomfort n=3

Fig. 2. Schematic breakdown of the entire cohort.

are not standardised. A recent review of operative logbooks found that the method of logging data is trainee-dependent and not uniform, making their evaluation extremely tedious. [4,5] The development of the HEMR allows individuals to keep an accurate electronic record of procedures performed, thereby improving the quality and usability of procedural logbooks. The drive to develop subspecialist training programmes

in surgical gastroenterology is ongoing. An adequate caseload for training is vital to ensure that these training programmes are credible and produce appropriately trained subspecialists. Our caseload seems to be appropriate for both subspecialist trainees.

The three staff members from the colorectal service each met this requirement, suggesting that our caseload is adequate for the training of colorectal specialists. The development

1063

December 2015, Vol. 105, No. 12

References 1. Chen SC, Rex DK. The endoscopist can be more powerful than age and male gender in predicting adenoma detection at colonoscopy. Am J Gastroenterol 2007;102(4):856-861. [http:// dx.doi.org/10.1111/j.1572-0241.2006.01054.x] 2. Rex DK, Petrini JL, Baron TH, et al. Quality indicators of the colonoscopy. Am J Gastroenterol 2006;101(4):873-885. [http:// dx.doi.org/10.1016/j.gie.2014.07.058] 3. American Society for Gastrointestinal Endoscopy and American College of Gastroenterology. http://www.asge.org/ uploadedFiles/Publications_(public)/Practice_guidelines/2014_ Quality_in_endoscopy_set.pdf (accessed 10 October 2015).

4. Colleges of Medicine of South Africa. Fellowship of the College of Surgeons of South Africa: FCS (SA), 2013. http://www. collegemedsa.ac.za/view_exam.aspx?examid=46 (accessed 3 December 2013).

5. Kruger D, Veller MG. Exposure to key surgical procedures during specialist general surgical training in South Africa. S Afr J Surg 2014;52(4):96-100. [http://dx.doi.org/10.7196/sajs.2162] 6. Clarke DL. Trauma quality improvement: The Pietermaritzburg Metropolitan Trauma Service experience with the development of a comprehensive structure to facilitate quality improvement in rural trauma and acute care in KwaZulu-Natal, South Africa.

S Afr Med J 2015;105(2):92-95. [http://dx.doi.org/10.7196/ SAMJ.8792] 7. Laing GL, Bruce JL, Skinner DL, Allorto NL, Clarke DL, Aldous C. Development, implementation and evaluation of a hybrid electronic medical record system specifically designed for a developing world surgical service. World J Surg 2014;38(6):13881397. [http://dx.doi.org/10.1007/s00268-013-2438-2] 8. Ben-Horin S, Bar-Meir S, Avidan B. The impact of colon cleanliness assessment on endoscopist’s recommendation for follow-up colonoscopy. Am J Gastroenterol 2007;102(12):26802685. [http://dx.doi.org/10.1111/j.1572-0241.2007.01486x] 9. Thomas-Gibson S, Rogers P, Cooper S, et al. Judgement of the quality of bowel preparation at screening flexible sigmoidoscopy is associated with variability in adenoma detection rate. Endoscopy 2006;38(5):456-460. [http://dx.doi. org/10.1055/s-2006-925259] 10. Panteris V, Haringsma J, Kuipers EJ. Colonoscopy perforation rate, mechanism and outcome: From diagnostic to therapeutic colonoscopy. Endoscopy 2009;41(11):941-951. [http://dx.doi. org/10.1055/s-0029-1215179] 11. Pickhardt PJ, Nugent PA, Mysliwiec PA, Choi JR, Schindler WR. Location of adenomas missed by optical colonoscopy. Ann Intern Med 2004;141(5):352-359. [http://dx.doi.org/10.7326/00034819-141-5-200409070-00009] 12. Crispin A, Birkner B, Munte A, Nusko G, Mansmann U. Process quality and incidence of acute complications in a series of more than 230,000 outpatient colonoscopies. Endoscopy 2009;41(12):10181025. [http://dx.doi.org/10.1055/s-0029-1215214]

Accepted 5 October 2015.

RESEARCH

Dyspepsia prevalence and impact on quality of life among Rwandan healthcare workers: A cross-sectional survey R Bitwayiki,1,2 MBBS, MMed (IM); J T Orikiiriza,3,4,5 MB ChB, MMed (Paed); F Kateera,3 MB ChB, MSc; P Bihizimana,1,2 MBBS, MMed (IM); B Karenzi,3 DBA, MBA, MA; P Kyamanywa,2 MB ChB, FACS; T D Walker,1,2 MBBS, FRACP, MPHTM University Teaching Hospital, Butare, Rwanda School of Medicine, College of Medicine and Health Sciences, University of Rwanda, Butare, Rwanda 3 Rwanda Military Hospital, Kigali, Rwanda 4 Infectious Diseases Institute, School of Medicine and Health Sciences, Makerere University, Kampala, Uganda 5 Department of Immunology, Trinity College, Dublin, Ireland 1

2

Corresponding author: T D Walker (timwalkerd@gmail.com)

Background. Dyspepsia has been demonstrated worldwide to have major personal and societal impacts, but data on the burden of this disease in Africa are lacking.

Objective. To document the prevalence of dyspepsia and its quality-of-life impact among healthcare workers (HCWs) at Butare University Teaching Hospital (BUTH), Rwanda.

Methods. A cross-sectional survey among consenting HCWs at BUTH was conducted. Multilingual interviewers guided participants through validated questionnaires, including the Short-Form Leeds Dyspepsia Questionnaire (SF-LDQ), to detect the presence and frequency of dyspeptic symptoms, and the Short-Form Nepean Dyspepsia Index (SF-NDI), to examine the impact of dyspepsia on quality of life.

Results. The study included 378 enrolled HCWs, all of whom provided responses to the SF-LDQ and 356 of whom responded to the SF-NDI. The prevalence of dyspepsia in the study population was 38.9% (147/378). Of these 147 HCWs, 79 (53.7%) had very mild dyspepsia, 33 (22.4%) had mild dyspepsia, 20 (13.6%) had moderate dyspepsia and 15 (10.2%) had severe dyspepsia. Females were more likely to complain of dyspepsia than males (98/206 v. 49/172; odds ratio (OR) 2.3; 95% confidence interval (CI) 1.5 - 3.5; p<0.001).

Participants with dyspepsia of at least mild severity had SF-NDI scores reflecting reduced quality of life when compared with non-dyspeptic participants (OR 17.0; 95% CI 5.0 - 57.1; p<0.001), with most marked effects on the ‘tension’ and ‘eating and drinking’ subdomains of the SF-NDI. Conclusion. The prevalence of dyspepsia among HCWs in Rwanda is high and is associated with lowered quality of life.

S Afr Med J 2015;105(12):1064-1069. DOI:10.7196/SAMJ.2015.v105i12.9482

Dyspepsia is a common presenting symptom com­ plex in primary care all over the world, accounting for 3 - 4% of primary healthcare visits.[1] Populationbased surveys in many countries have revealed a highly variable prevalence, from 1.8% to 57%, with a global average of 20.8% in the published literature.[2] These geographical differences are not fully accounted for by variations in symptom definition, although, as expected, large differences have been noted between less strict and more strict definitions of the dys­ peptic symptom complex.[2] Data on the frequency of dyspepsia in primary care settings in Africa are lacking, with only two prior studies having been published, both from Nigeria.[3,4] However, while dyspepsia is a frequent reason for clinic and hospital attendance across Africa, it is not clear what proportion of symptomatic patients seek medical treatment. No previous studies have looked at the impact on quality of life of dyspeptic symptoms in Africans living in the community, although studies in other populations have shown a significant impact on quality of life, but not mortality.[5,6] The vast majority of African studies of dyspepsia have been done in endoscopy or tertiary clinic referral populations. These populations are not representative of the community, for whom the burden of disease is unknown. This study seeks to reduce this knowledge gap by characterising the burden of dyspepsia in a presumed well, clearly defined sample of healthcare workers (HCWs) in Rwanda, to provide

1064

an accurate measure of the frequency and distribution of dyspeptic symptoms among a community-representative sample, and the quality-of-life costs associated with their symptoms.

Methods

This cross-sectional survey was conducted in Butare University Teaching Hospital (BUTH), located in the Huye District in the Southern Province of Rwanda, during October and November 2013, in conjunction with a larger study evaluating viral hepatitis burden and risk determinants among HCWs. The hospital is the sole tertiary referral centre for Southern Rwanda, with 500 beds and a catchment population of about 5 million people. The hospital also serves as a teaching site for Rwanda’s sole medical school. The hospital employed 747 personnel at the time of the study: 419 clinical HCWs, 78 administrative HCWs and 250 cleaners.

Study site and sample size

The survey was powered to assess the prevalence of dyspepsia in the population. The survey’s sample size was estimated at 373 subjects, based on a closed eligible population of 747 HCWs at BUTH, with a presumed dyspepsia prevalence of 35% based on prior communitybased African studies,[3,4] and aiming for a 5% relative standard error in the measurement of dyspepsia prevalence at an alpha level of 0.05. All HCWs were invited to attend the study centre for free viral hepatitis testing, and then were offered participation in this study

December 2015, Vol. 105, No. 12

RESEARCH

on their arrival, independent of the testing. Sampling of all eligible HCWs was consecutive, without random selection.

Inclusion and exclusion criteria

All consenting HCWs aged ≥18 years and currently employed at BUTH were eligible for study enrolment. HCWs on leave or not currently working because of illness at the time of the study were not invited. Postgraduate students on clinical placements were considered as HCWs, but undergraduate students were not eligible.

Questionnaires

Questionnaires were administered and filled out by trained interviewers with language skills in English, French and Kinyarwanda.

The questionnaire was made up of three sections: (i) socio­ demographic data; (ii) the Short-Form Leeds Dyspepsia Questionnaire (SF-LDQ); and (iii) the Short-Form Nepean Dyspepsia Index (SF-NDI).

The SF-LDQ was used to detect the presence and frequency of dyspeptic symptoms, and the SF-NDI to examine the impact of dyspepsia on quality of life.

Where possible, the survey was administered in English, but if necessary the interviewer translated the questions into French or Kinyarwanda. Prior to survey administration, an agreed wording for the oral translation of the English instruments into French and Kinyarwanda was completed, involving translation and backtranslation of the survey instrument by a group of multilingual medical experts. The LDQ and SF-NDI instruments were tested for reliability in a pilot study comprising ten HCWs eligible for study entry but not forming part of the final data set. Qualitative data were obtained from this focus group to improve the questionnaire.

The Short-Form Leeds Dyspepsia Questionnaire The SF-LDQ consists of eight items that assess for the presence and severity of dyspepsia by measuring the frequency and severity of upper abdominal pain/discomfort, heartburn, regurgitation and nausea. It was developed from the Leeds Dyspepsia Questionnaire (LDQ), a longer form survey.[7] Possible scores range from 0 to 32 with higher values corresponding with increasing severity of dyspepsia. The developers of the SF-LDQ have defined a score of 0 as ‘no dyspepsia’, a score of 1 - 4 as ‘very mild dyspepsia’, a score of 5 - 8 as ‘mild dyspepsia’, a score of 9 - 15 as ‘moderate dyspepsia’ and a score >15 as indicative of ‘severe dyspepsia’.[8] In the design of the study, we planned to analyse these results categorically but also dichotomously, with those in the ‘no dyspepsia’ and ‘very mild dyspepsia’ groups defined as non-dyspeptic (i.e. those with an SF-LDQ score of <5). The LDQ and SF-LDQ have been used in many studies and have previously been validated as accurate and reliable tools to assess the presence and severity of dyspepsia in multiple, diverse and multicultural populations.[9,10] The Short-Form Nepean Dyspepsia Index The SF-NDI is a questionnaire comprising ten items, making up five subscales of two items each that examine the impact of dyspepsia on various domains of the quality of life of patients, including tension/ anxiety, disruption of regular eating/drinking, knowledge and control over disease symptoms and interference with work/study.[11] It is also based on an earlier tool, the Nepean Dyspepsia Index (NDI), which was developed to study quality of life in functional dyspepsia.[12] Each item is measured by a 5-point Likert scale ranging from 1 (‘not at all’ or ‘not applicable’) to 5 (‘extremely’). Individual items in each subscale are added to obtain a score range from 10 (lowest score) to 100 (highest score). A higher score on the SF-NDI is indicative of

1065

a poorer quality of life, with patients with scores >15 having been shown by the designers of this instrument to have significantly reduced health-related quality of life. The NDI and SF-NDI have been used in many studies and have been validated in various populations as accurate and reliable tools to measure the impact of dyspepsia on quality of life.[13,14]

Data analysis

Key outcomes for this study include the frequency and quality-oflife impact of dyspepsia, measured by the SF-LDQ and SF-NDI, respectively. Demographic data (age, gender, marital status, department of work, profession and educational level), smoking, and alcohol, aspirin and non-steroidal drug intake are probable predictors of dyspepsia, while we expect these factors may also be co-variable with the quality-of-life impact of dyspepsia, and these were assessed in the sociodemographic section of the questionnaire.

All data were collected using a questionnaire uploaded on personal digital assistants. Query programs were written into the database to limit entry of incorrect data and to ensure data quality. The study co-ordinator and data manager reviewed the data and all associated queries daily for completeness and accuracy. Any missing data were coded as such and excluded from analysis of that variable.

The data were then transferred into SPSS (version 16.0; IBM, USA) and Stata (version 12.1; Stata Corp, USA) for data analysis. Outcome variables were the scores on SF-LDQ and SF-NDI. Comparisons of characteristics between groups of study participants were made using the χ2 test for categorical variables and one-way analysis of variance (ANOVA) for non-normally distributed continuous variables. Associations between predictor variables and outcomes of interest were estimated using both univariate and multivariate logistic regression, for those variables found to be significant by univariate analysis. In the final interpretation of results, a p-value of <0.05 was considered statistically significant.

Ethical considerations

Written informed consent was required from all study participants.

The study was approved by the Butare University Teaching Hospital Research and Ethics Commission and the University of Rwanda School of Medicine Research Commission.

Results

The questionnaire was administered to 378 HCWs at BUTH, all of whom provided responses to SF-LDQ and 356 of whom responded to the SF-NDI. The study population was generally young (mean 34.1 years, range 18 - 63), with a slight female preponderance (54.5%).

The majority were tertiary educated (58.7%), but a significant proportion (18%) had not attended secondary school. Ancillary staff, including cleaners and administration staff, outnumbered both nurses and doctors in the study population. All major hospital departments were represented, in approximate proportion to their number of staff (Table 1). The staff included in the study did not differ significantly in age, gender or department of work from those who were not included.

Using a broad definition of (any) dyspepsia, the prevalence of dyspepsia in the study population was 38.9% (147/378). Of these 147 HCWs, 79 (53.7%) had very mild dyspepsia, 33 (22.4%) mild dyspepsia, 20 (13.6%) moderate dyspepsia and 15 (10.2%) severe dyspepsia. Females were more likely to complain of dyspepsia than males (98/206 v. 49/172, odds ratio (OR) 2.3; 95% confidence interval (CI) 1.5 - 3.5; p<0.001). Higher education levels were asso­ ciated with a lower risk of dyspeptic symptoms (OR 0.6; p=0.015),

December 2015, Vol. 105, No. 12

RESEARCH

Table 1. Baseline characteristics and distribution of 378 study participants

Table 2. Dyspepsia prevalence and its association with demographic and lifestyle factors, by univariate analysis Dyspepsia, n/total (%)

OR (CI)

Variable

n (%)

Gender

Overall

Male

172 (45.5)

Gender

Female

206 (54.5)

Male

49/172 (28.5)

(ref.)

Female

98/206 (47.6)

2.28 (1.48 - 3.50)

Age group (years)

125 (33.1)

30 - 49

232 (61.3)

Single

45/131 (34.4)

≥50

21 (5.6)

Married

96/232 (41.4)

Widowed

4/9 (44.4) 2/6 (33.3)

Single

131 (34.6)

Other

Married

232 (61.4)

Age (years)

Divorced/separated

4 (1.1)

<30

64/150 (42.7)

Widowed

9 (2.4)

30 - 49

69/193 (35.8)

Living together

2 (0.5)

≥50

14/35 (40.0)

Current department of work

NS

NS

Education level

Medicine

47 (12.4)

Primary or secondary*

72/156 (46.2)

(ref.)

Obstetrics & gynaecology

30 (7.9)

Tertiary

75/222 (33.8)

0.60 (0.39-0.91)

Paediatrics

47 (12.4)

Smoking

Surgery

52 (13.9)

Never

133/339 (39.2)

Administration

28 (7.4)

Past

10/32 (31.3)

Laboratory

11(2.9)

Current

4/7 (57.1)

Sterilisation

6 (1.7)

ther departments (cleaning O services, etc.)

156 (41.4) Education

Nil

101/241 (41.9)

Any current

46/137 (33.6)

Never

29/81 (35.8)

Primary level

65 (17.2)

Past

96/256 (37.5)

Secondary/vocational

88 (23.3)

Current

22/43 (51.2)

University/other tertiary

222 (58.7)

(ref.) = referent population for odds ratio calculations.

*NB. The primary and secondary education group includes HCWs with vocational training.

123 (32.5)

Doctors

40 (10.6)

thers (cleaners, laboratory O staff, etc.)

215 (56.9)

but conventional risk factors for dyspepsia, including smoking and use of alcohol, nonsteroidal anti-inflammatory medications and aspirin, were not associated with dyspeptic symptoms in this population (Table 2). Indigestion was the most frequent symptom type reported (in 25% of study subjects), with heartburn (22%), regurgitation (15%) and nausea (9%) all both less frequently observed and showing lower frequency of lifestyle interference on the SF-LDQ (Table 3).

On multivariate analysis, gender (p<0.001) and level of education (p=0.006) remained highly predictive of dyspepsia,

NS

NS

NSAID use

3 (0.8)

Nurses

0.015

Alcohol

None

Staffing group

<0.001

Marital status

18 - 29

Marital status

p-value

147/378 (38.9)

but no other factors in the model were statistically significant, with the exception of the consumption of alcohol, which was associated with a borderline lower risk of dyspepsia (p=0.043).

Participants with dyspepsia had reduced quality-of-life scores, as measured by the SF-NDI, when compared with nondyspeptic participants (p<0.001), the most marked effects being on the tension and eating and drinking subdomains of the SF-NDI. An appreciable difference in quality of life was apparent, with the most marked reduction seen in subjects with at least mild severity dyspepsia, compared with those suffering no or very mild dyspepsia (sum of squares by ANOVA 779.27; p<0.001) (Table 4).

As an alternative measure, the proportion of subjects with reduced quality of life (def­

1066

December 2015, Vol. 105, No. 12

NS

ined as an SF-NDI of ≥15 points, consisting of the bottom 8% of the population) in each dyspeptic symptom group was also calculated, with 1.4% and 10.7% of non- and very mildly dyspeptic patients meeting this threshold, compared with 25.8%, 31.6% and 33.3% of mildly, moderately and severely dyspeptic patients.

Analysis of the predominant symptom and covariance in symptoms on the SF-LDQ was also undertaken, with the goal of defining patients into separate dyspeptic symptom complex groups. These were defined as predominant epigastric pain (‘ulcer-like’), predominant heartburn or regurgitation (‘reflux-like’), predominant nausea (‘dys­ motility-like’) and mixed groups. Of 90 patients with dyspepsia and a predominant symptom available for analysis, 38 (42.2%) described ulcer-like symptoms, 37 (41.1%)

RESEARCH

reflux-like symptoms, 8 (8.9%) dysmotility-like symptoms, and 7 (7.8%) mixed symptoms.

There was a significantly higher SF-LDQ (t=â&#x20AC;&#x201C;3.314, p=0.009) among patients with reflux-like or mixed symptoms (mean 8.25) than among those with ulcer-like or dysmotility-like symptoms (mean 4.94). However, quality of life measured by the SF-NDI was not significantly different between these groups (means 13.16 v.

12.48; p>0.05).

Table 3. Frequency and lifestyle interference of each SF-LDQ symptom type in study subjects Symptom frequency (%)

Interference with lifestyle frequency (%)

Never

281 (74)

322 (85)

< monthly

34 (9)

10(3)

> monthly, < weekly

31 (8)

20 (5)

> weekly, < daily

23 (6)

17 (5)

> daily

9 (2)

9(2)

Never

298 (79)

329 (87)

< monthly

26 (7)

11 (3)

> monthly, < weekly

26 (7)

14 (4)

> weekly, < daily

18 (5)

14 (4)

> daily

10 (3)

10 (3)

Never

320 (85)

353 (93)

< monthly

23 (6)

7 (2)

> monthly, < weekly

18 (5)

8 (2)

> weekly, < daily

12 (3)

6 (2)

> daily

5 (1)

4 (1)

Never

343 (91)

355 (94)

< monthly

20 (5)

9 (2)

> monthly, < weekly

4 (1)

4 (1)

> weekly, < daily

6 (2)

5 (1)

> daily

5 (1)

5 (1)

Symptom type Indigestion

Heartburn

Regurgitation

Nausea

Discussion

Dyspepsia affected more than a third of Rwandan HCWs in this study, and had a significant impact on wellbeing, with symptoms severe enough to impair the quality of life of almost a third of affected HCWs. Ulcer-like and reflux-like symptoms were equally common, perhaps surprisingly, given how infrequently gastro-oesophageal reflux is diagnosed in African endoscopic series. The observed dyspepsia prevalence is at the high end of the range garnered from studies in other parts of the world, although these frequencies depend greatly on the definition of dyspepsia used in the study.[2] One of the key challenges in studying dyspepsia is a lack of a clear, agreed standard definition of dyspeptic symptoms. Older studies tended to use broad descriptive questions on the presence of epigastric discomfort. More recently, the Rome II-III criteria have been developed, which attempt to draw a distinction between reflux symptoms and dyspepsia in order to distinguish gastro-oesophageal reflux disease from functional dyspepsia, but have met with a mixed reception. As a result, a variety of definitions remain in use, with simplicity, prior multicultural validity and ease of administration being our key criteria in choosing the SF-LDQ and SF-NDI for this study.

The SF-LDQ is based upon a broad definition of dyspepsia, not attempting to exclude reflux symptoms from the definition, and assessing symptoms over a 2-month period. In a recent meta-analysis

by Ford et al.,[2] using a broad definition of this type gave a 29.5% pooled prevalence of dyspepsia. However, very few of the studies previously reported have used face-to-face interviews; those that did reported higher than average prevalences, pointing to a possible systematic effect of this data acquisition method on reported dyspepsia prevalence. While the SF-LDQ only assesses a limited range of dyspeptic symptoms, and does not include assessment of postprandial symptoms, which have been highly prevalent in Western studies, correlation between the SF-LDQ and other lengthier tools that include such symptoms has been high in published validation studies.[8,9] As a symptom complex, uninvestigated dyspepsia does not have a single underlying pathological mechanism. Putative contributing factors include Helicobacter pylori infection, gastric acid and gastric dysmotility.[15] In Western populations, about 80% of patients with uninvestigated dyspepsia have a final diagnosis of functional dyspepsia following investigation.[6] The pathogenesis of functional dyspepsia is debated, and has not been well studied in areas with a high prevalence of H. pylori infection, although a recent observational study suggested a role for H. pylori and associated microscopic duodenitis.[16] Traditional risk factors such as alcohol, smoking and nonsteroidal anti-inflammatory drug (NSAID) use were not found

Table 4. Severity of dyspepsia and impact on quality of life, as measured by mean SF-NDI scores in 356 subjects* No dyspepsia

Very mild dyspepsia

Mild dyspepsia

Moderate dyspepsia

Severe dyspepsia

p-value

SF-NDI total score

10.31

11.21

13.90

14.47

15.20

<0.001

SF-NDI: Tension

2.10

2.57

3.39

3.68

3.93

<0.001

SF-NDI: Interference with ADLs

2.06

2.24

2.68

2.84

2.87

<0.001

SF-NDI: Eating/drinking

2.04

2.19

2.71

3.37

3.07

<0.001

SF-NDI: Knowledge/ control

2.06

2.11

2.55

2.16

2.67

0.004

SF-NDI: Work/study

2.05

2.11

2.58

2.42

2.67

<0.001

ADLs = activities of daily living. *SF-NDI scores range from 10 to 50, with higher scores indicating more severely impaired quality of life. The last five rows refer to SF-NDI subdomains, each of which range from 2 to 10. p-values were calculated by Mann-Whitney U-tests, comparing patients with no or very mild dyspepsia with those with more severe dyspepsia.

1067

December 2015, Vol. 105, No. 12

RESEARCH

to be associated with symptoms of dyspepsia in our study. While this initially appears surprising and is in contrast to the wider literature,[2] there are several good reasons why this might be the case among HCWs. First, HCWs are more likely to have an understanding of the link between such risk factors and the onset of dyspeptic symptoms. Secondly and more speculatively, HCWs might be more amenable to changing their behaviours in response to this knowledge, even without medical attention. As this study was cross-sectional, it was unable to examine the effects of dyspepsia on these health-related behaviours over time.

Among Rwandan HCWs in this study, women were more likely to complain of dyspeptic symptoms than men, and more likely to suffer lower quality of life as a result. This is in contrast with the only previous studies of dyspepsia in Africa, conducted in Nigeria,[3,4] where men had a similar rate to women (OR 0.93; 95% CI 0.73 - 1.19.[2] It should be noted that there are significant cultural variations between African nations, and it may be that the role of gender in illness behaviour is significantly different in Nigeria and Rwanda, as has been noted in other illnesses in disparate African contexts. The findings in our study are, however, quite consistent with the broader population-based international literature, where in a recent meta-analysis by Ford et al.[2] the pooled OR for women with dyspepsia requiring investigation was 1.24.

Higher levels of education were protective in this study of HCWs, although this may not be generalisable to non-healthcare education, as most participants in this study had higher qualifications in the health sciences. Previous studies in other populations have not shown any such association,[6] and it is possible that this represents a unique finding, as a result of the characteristics of this population. While H. pylori positivity rates were not measured in this study, it is interesting to note that higher education levels have been associated with lower rates of this infection among HCWs in other parts of the world, and this could explain this result.[17] The presence and relative frequency of two major dyspeptic symptom complexes in this study is revealing. While the previous literature describes most African patients as suffering from ulcer-like symptoms, in our study reflux-like symptoms were just as common, and just as likely to be rated as the major symptom. While the SF-LDQ has two of four question groups related to reflux symptoms (heartburn and regurgitation) and this may explain the higher SF-LDQ scores among subjects with a predominantly reflux-based symptom complex, the quality-of-life impact measured by SF-NDI was similar for both groups, as with studies in other populations.[11,14] In these previous studies, ulcer-like and reflux-like symptom complexes were associated with moderate responses to acid suppression with omeprazole, in contrast to those with dysmotilitylike symptoms.[18] H. pylori eradication has also been only modestly effective in treating dyspeptic symptoms in low-prevalence populations in the Western world. Whether these data can be extrapolated to Africa, where H. pylori carriage rates are much higher and the mind-body interplay around dyspepsia may differ, is unclear.

Study limitations and strengths

We studied HCWs, a relatively well-educated population with greater than average access to healthcare knowledge and resources.

As such, especially given the protective effect of higher levels of education apparent in this population, the study is likely to underestimate rates of dyspepsia in the general Rwandan popu­ lation. Other potential reasons for a lower rate of dyspepsia in this population could include better quality of life, as lower quality of life has been shown to increase the incidence of new dyspepsia in a previous study.[19] The study population was based in a provincial

1068

town, and results may not be easily extrapolated to people leading a traditional village lifestyle.

However, the study being performed in HCWs also gives it some notable strengths. Firstly and most importantly, HCWs have a shared linguistic and pathophysiological understanding of clinical symptoms, which aids the validity of comparison with international cohorts by reducing the cultural gap. Secondly, most study subjects were able to understand both English and French, reducing the need to translate the tools. Thirdly, a relatively small, geographically close study population aided study logistics and maximised recruitment.

Our study nonetheless has several limitations. The cross-sectional methodology used made it impossible to determine the direction of effect in the association between dyspepsia and lower quality of life. It is possible that dyspepsia causes lower quality of life, but equally plausible that patients with lower quality of life might be more susceptible to the onset of dyspeptic symptoms; this complex interplay needs further study. Definitions of dyspepsia are culturally and linguistically bounded, and despite our efforts to translate and validate the SF-LDQ and SF-NDI, it is impossible to know whether these definitions fill exactly the same linguistic and cultural space when translated. Our study was of uninvestigated dyspepsia, and thus the study methodology was unable to distinguish organic and functional causes of dyspepsia, which might have a different natural history in African populations, although the quality-of-life impact of each has been similar in other populations.[6] This should be the subject of future research.

Conclusion

Dyspepsia is a significant symptom complex among HCWs in this Rwandan tertiary institution, and has a major quality-of-life impact in a proportion of these. Reflux-like symptoms were just as common as ulcer-like symptoms, in contrast to findings in endoscopy-based studies. HCWs have high levels of uncontrolled symptoms, and rates may be even higher in the general community because of less access to healthcare resources.

More resources need to be devoted to the diagnosis and management of upper abdominal symptoms in Rwanda and other similar resourcepoor areas. Finally, further research in population-based cohorts is needed to characterise prevalence, symptom-complex patterns and underlying diagnoses in the wider African population.

Author contributions. TDW conceived the study; RB, BK, PK and TDW designed the study; PB, RB and JTO carried out and supervised the interviews; RB, FK and TDW interpreted the data; TDW and RB drafted the manuscript; and RB, PB, FK, JTO, PK, BK and TDW critically revised the manuscript for intellectual content. All the authors read and approved the final manuscript. TDW and RB are guarantors of the paper.

Acknowledgements. We thank Profs Nick Talley and Brendan Delaney for kind permission to use the SF-NDI and SF-LDQ tools, and Rwanda Military Hospital, as well as all staff at Butare University Teaching Hospital for their valued support of this study.

Funding. Rwanda Military Hospital provided study staff, equipment and facilitation for the conduct of this study. The drafting of this study was supported in part by Africa Research Initiatives and Support Enterprise (ARISE), Grant Number W.07.10.102 funded by The Netherlands African Partnership for Clinical Trials and Capacity Building Program (NACCAP) of The Netherlands Organisation for Scientific Research – The Netherlands Foundation for the Advancement of Tropical Research (NWO/WOTRO). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the supporting offices.

December 2015, Vol. 105, No. 12

RESEARCH

References 1. Bodger K, Eastwood PG, Manning SI, et al. Dyspepsia workload in urban general practice and implications of the British Society of Gastroenterology Dyspepsia Guidelines (1996). Aliment Pharmacol Ther 2000;14(4):413-420.

2. Ford AC, Marwaha A, Sood R, et al. Global prevalence of, and risk factors for, uninvestigated dyspepsia: A meta-analysis. Gut 2015;64:1049-1057. [http://dx.doi.org/10.1136/gutjnl-2014-307843] 3. Ihezue CH, Oluwole FS, Onuminya JE, et al. Dyspepsias among the highlanders of Nigeria: An epidemiological survey. Afr J Med Med Sci 1996;25(1):23-29.

4. Holcombe C, Omotara BA, Padonu MK, et al. The prevalence of symptoms of dyspepsia in north eastern Nigeria: A random community based survey. Trop Geogr Med 1991;43(1-2):209-214.

5. Ford AC, Forman D, Bailey AG, et al. Effect of dyspepsia on survival: A longitudinal 10-year follow-up study. Am J Gastroenterol 2012;107(6):912-921. [http://dx.doi.org/10.1038/ajg.2012.69] 6. Aro P, Talley NJ, Agreus L, et al. Functional dyspepsia impairs quality of life in the adult population. Aliment Pharmacol Ther 2011;33(11):1215-1224. [http://dx.doi.org/10.1111/j.13652036.2011.04640.x] 7. Moayyedi P, Duffett S, Braunholtz D, et al. The Leeds Dyspepsia Questionnaire: A valid tool for measuring the presence and severity of dyspepsia. Aliment Pharmacol Ther 1998;12(12):1257-1262.

8. Fraser A, Delaney BC, Ford AC, et al. The Short-Form Leeds Dyspepsia Questionnaire validation study.

Aliment Pharmacol Ther 2007;25(4):477-486. [http://dx.doi.org/10.1111/j.1365-2036.2006.03233.x] 9. Gatta L, Moayyedi P, Tosetti C, et al. A validation study of the Italian Short-Form Leeds Dyspepsia Questionnaire. Intern Emerg Med 2010;5(6):501-506. [http://dx.doi.org/10.1007/s11739-010-0467-5â&#x20AC;&#x2122;] 10. Mahadeva S, Chan WK, Mohazmi M, et al. Validation study of the Leeds Dyspepsia Questionnaire in a multi-ethnic Asian population. J Gastroenterol Hepatol 2011;26(11):1669-1676. [http://dx.doi. org/10.1111/j.1440-1746.2011.06806.x] 11. Talley NJ, Verlinden M, Jones M. Quality of life in functional dyspepsia: Responsiveness of the Nepean Dyspepsia Index and development of a new 10-item short form. Aliment Pharmacol Ther 2001;15(2):207-216.

1069

12. Talley NJ, Verlinden M, Jones M. Validity of a new quality of life scale for functional dyspepsia: A United States multicenter trial of the Nepean Dyspepsia Index. Am J Gastroenterol 1999;94(9):23902397. [http://dx.doi.org/10.1111/j.1572-0241.1999.01363.x] 13. Tian XP, Li Y, Liang FR, et al. Translation and validation of the Nepean Dyspepsia Index for functional dyspepsia in China. World J Gastroenterol 2009;15(25):3173-3177.

14. Mahadeva S, Wee HL, Goh KL, et al. Quality of life in South East Asian patients who consult for dyspepsia: Validation of the short form Nepean Dyspepsia Index. Health Qual Life Outcomes 2009;7:45. [http://dx.doi.org/10.1186/1477-7525-7-45] 15. Bytzer P, Talley NJ. Dyspepsia. Ann Intern Med 2001;134(9):815-822. [http://dx.doi.org/10.7326/00034819-134-9_Part_2-200105011-00004] 16. Mirbagheri SS, Mirbagheri SA, Nabavizadeh B, et al. Impact of microscopic duodenitis on symptomatic response to Helicobacter pylori eradication in functional dyspepsia. Dig Dis Sci 2015;60(1):163-167. [http://dx.doi.org/10.1007/s10620-014-3285-1] 17. Triantafillidis JK, Gikas A, Hyphantis T, et al. Helicobacter pylori infection in hospital workers over a 5-year period: Correlation with demographic and clinical parameters. J Gastroenterol 2002;37(12):1005-1013.

18. Talley NJ, Meineche-Schmidt V, Pare P, et al. Efficacy of omeprazole in functional dyspepsia: Doubleblind, randomized, placebo-controlled trials (the Bond and Opera studies). Aliment Pharmacol Ther 1998;12(11):1055-1065.

19. Ford AC, Forman D, Bailey AG, et al. Initial poor quality of life and new onset of dyspepsia: Results from a longitudinal 10-year follow-up study. Gut 2007;56(3):321-327. [http://dx.doi.org/10.1136/ gut.2006.099846]

Accepted 5 October 2015.

December 2015, Vol. 105, No. 12

GUEST EDITORIAL

Musculoskeletal disorders – disease burden and challenges in the developing world Recent advances in rheumatology have contributed to elucidate the complex pathogenic processes that underlie the development and progression of rheumatic diseases. This has led to the advent of new therapies to treat these conditions, including the biologic therapies. The use of synthetic disease-modifying anti-rheumatic drugs (DMARDs) together with biologic therapies has increased dramatically across a range of diseases, and resulted in improved outcomes for patients. In a study done in Spain, the overall age-standardised mortality rate for systemic lupus erythematosus (SLE) increased during 1981 - 1999 and stabilised during 2000 - 2010.[1] The mean age at death increased with time, from 42 years in 1981 to 61 years in 2010.[1] Similar mortality trends have been observed in patients with rheumatoid arthritis (RA), even though mortality still remains higher in RA patients compared with the general population.[2] The overall SLE survival rates have increased significantly between the 1950s and 2000s, from 74.8% to 94.8% and 63.2% to 91.4% for the overall 5-year and 10-year survival, respectively.[3] These improved outcomes are thought to be due to a combination of earlier recognition of mild disease and better approaches to therapy.

The European League Against Rheumatism (EULAR) and the American College of Rheumatology (ACR) have recently joined forces and contributed significantly to improved outcomes in rheumatic diseases by revising the classification criteria for most of these diseases, with the new criteria having higher sensitivity and specificity, which contribute to an early diagnosis. The latest contribution was the 2015 ACR/EULAR classification criteria for gout.[4] Diagnostic imaging with magnetic resonance imaging (MRI) and ultrasonography has provided a new perspective to the management of arthritis, revealing subclinical inflammation and predicting progression of joint damage – thus contributing to early detection.[5] Therefore, much more can be done for patients before the development of irreversible damage.

However, despite this improvement in outcomes, musculoskeletal (MSK) disorders still rank highest in prevalence as the cause of chronic ill-health, long-term disability, and consultation with healthcare professionals, as was shown in the Burden of Global Disease 2010 study.[6] This is against the background of MSK disorders contributing only 3.4% and 1.7% of the total disease burden in the developed and developing world, respectively.[6] Osteoarthritis and low back pain remain the largest contributors to the global disability burden.[6] The Bone and Joint Decade 2000 2010, endorsed by many organisations including the World Health Organization (WHO) and many governments, has acknowledged the rising burden of MSK disorders.[7] In 2013, the Global Burden of Disease (GBD) study showed that the proportion of disabilityadjusted life-years (DALYs) caused by years lost due to disability (YLD) increased globally from 21.1% in 1990 to 31.2% in 2013.[8] Furthermore, the burden of MSK disorders in terms of DALYs in the developing world (21 076 000 DALYs) is estimated to be almost 2.5 times that in the developed world (8 723 000 DALYs).[6]

1070

For SLE, survival rates in developing countries are significantly lower than those reported in developed countries such as the USA, Western Europe and Canada, where 5- and 10-year survival rates surpass 90%. [9] In South Africa (SA), the 5-year survival rate was shown to be between 57% and 72% (1986 - 2003) in a case series of 226 SLE patients. [9] These studies show that MSK disorders are the largest contributors to disability and chronic ill-health, and further indicate the wide gap between developing and developed countries.

Developing countries are faced with several challenges in relation to reducing the burden of MSK disorders. In Africa, rheumatology as a specialty is considerably neglected and under-funded. It has to compete for scarce resources, which are allocated to communicable diseases such as tuberculosis, HIV and malaria, all of which are life threatening compared with the causes of disability. A systematic review carried out to address the prevalence of arthritis in Africa identified the paucity of prevalence data in Africa. [10] Funding for rheumatologyrelated research is inadequate and, in addition, the ratio of rheumatologists to population is high, in one study ranging from 1:35 000 to 1:1 600 000.[9] Training of rheumatologists is insufficient and there is difficulty accessing them; this leads to delays in appropriate treatment and further contributes to disability, as the window of opportunity to start treatment has been missed. In SA, some provinces, such as Limpopo, do not have rheumatologists and some, such as the Eastern Cape, have one rheumatologist serving the entire population of about 6.9 million.[11] In developed countries, nurses are trained to deal with MSK disorders; they are key in managing these disorders. One other challenge is that of limited medication options due to unaffordability and/ or unavailability.

The major contributor to the GBD is the increase in the ageing population. As people become older, their likelihood of suffering from MSK disorders increases and quality of life deteriorates. To improve outcomes for MSK disorders in developing countries, there needs to be a change in emphasis, so that larger resources are allocated to non-communicable diseases. Medical schools have to introduce students to the diagnosis and treatment of MSK disorders early, general physicians and other specialists need to have greater exposure to these conditions and primary care workers should be trained to manage these disorders early with DMARD therapy. Resources should be allocated for the training of more rheumatologists and, more importantly, rheumatology nurses.

CME could play a vital role in the dissemination of information to practitioners. Organisations such as the Arthritis Foundation of SA, a patient-orientated service, need to be established in other subSaharan countries and patients informed about new developments relating to MSK disorders. The use of MRI and ultrasonography has to be encouraged and funds have to be invested to provide these services in state-owned medical facilities. The 21st century hails a new era in the management of MSK disorders and it is hoped that the GBD from MSK disorders will decrease as people live longer.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

1. Ruiz E, Ramalle-Gómara E, Elena Á, et al. Trends in systemic lupus erythematosus mortality in Spain from 1981 to 2010. Lupus 2014;23(4): 431-435. [http://dx.doi. org/10.1177/0961203313517015] 2. Widdiefield J, Bernatsky S, Paterson JM, et al. Trends in excess mortality among patients with rheumatoid arthritis in Ontario, Canada. Arthritis Care Res (Hoboken) 2015;67(8):1047-1053. [http:// dx.doi.org/10.1002/acr.22553] 3. Mak A, Cheung MW, Chiew HJ, et al. Global trend of survival and damage of systemic lupus erythematosus: Meta-analysis and meta-regression of observational studies from the 1950s to 2000s. Semin Arthritis Rheum 2012;41(6):830-839. [http://dx.doi.org/10.1016/j. semarthrit.2011.11.002] 4. Neogi T, Jansen TLTA, Dalbeth N, et al. 2015 Gout Classification Criteria: An American College of Rheumatology/European League Against Rheumatism Collaborative Initiative. Arthritis Rheum 2015;67(10):2557-2568. [http://dx.doi.org/10.1002/art.39254] 5. Filippucci E, Geso LD, Grassi W. Progress in imaging in rheumatology. Nat Rev Rheumatol 2014;10:628-634. [http://dx.doi.org/10.1038/nrrheum.2014.145] 6. Adebajo A, Gabriel SE. Addressing musculoskeletal health inequity in Africa. Arthritis Care Res 2010;62(4):439-441. [http://dx.doi.org/10.1002/acr.20032] 7. Weinstein SL. 2000 - 2010: The Bone and Joint Decade. J Bone Joint Surg Am 2000;82(1):1-3.

8. Vos T, Barber RM, Bell B, et al. Global, regional, and national incidence, prevalence, and years lived with disability for 301 acute and chronic diseases and injuries in 188 countries, 1990 - 2013: A systematic analysis for the Global Burden of Disease Study 2013. Lancet 2015;22:386(9995):743-800. [http://dx.doi.org/10.1016/S0140-6736(15)60692-4] 9. Wadee S, Tikly M, Hopley M. Causes and predictors of death in South Africans with systemic lupus erythematosus. Rheumatology (Oxford) 2007;46:1487-1491.

10. Usenbo A, Kramer V, Young T, et al. Prevalence of arthritis in Africa: A systematic review and metaanalysis. PLoS One 2015;10(8):e0133858. [http://dx.doi.org/10.1371/journal.pone.0133858] 11. Mid-year population estimates 2015. www.statssa.gov.za (accessed 12 November 2015).

Ayanda Gcelu Guest editor ayanda.gcelu@uct.ac.za

Asgar Ali Kalla Guest editor kallaasgar.kalla@uct.ac.za

S Afr Med J 2015;105(12):1070-1071. DOI:10.7196/SAMJ.2015.v105i12.10260

REVIEW

Lupus nephritis: A simplified approach to diagnosis and treatment in South Africa I G Okpechi,1 MBBS, FWACP, PhD, Cert Nephrology (SA); A Gcelu,2 MB ChB, FCP (SA), Cert Rheumatology (SA); O I Ameh,1 MBBS, FMCP Neph (Nigeria), Cert Nephrology (SA) 1 Division of Nephrology and Hypertension, Department of Medicine, Faculty of Health Sciences, Groote Schuur Hospital and University of Cape Town, South Africa 2 Division of Rheumatology, Department of Medicine, Faculty of Health Sciences, Groote Schuur Hospital and University of Cape Town, South Africa

Corresponding author: I G Okpechi (ikechi.okpechi@uct.ac.za)

Lupus nephritis (LN) is a significant cause of morbidity and mortality in patients with systemic lupus erythematosus. Delayed recognition and diagnosis of LN may be a common cause of chronic kidney disease among South Africans. Renal biopsy is the gold standard of diagnosing LN; however, this service is not available in many centres and the use of urinalysis, urine microscopic examination and other serological tests can be useful in identifying patients with proliferative LN. Proliferative types of LN (class III, class IV and mixed class V) comprise the larger proportion of patients with this condition. Patients receiving immunosuppressive therapy need to be monitored closely for side-effects and drug-related toxicities. LN patients with end-stage renal disease (class VI) need to be prepared for renal replacement therapy (dialysis and renal transplantation). In all patients, treatment should include adjunctive therapies such as renin angiotensin aldosterone system blockade, bone protection (with calcium supplements and vitamin D), blood pressure control and chloroquine – all of which help to retard the progression of kidney disease.

S Afr Med J 2015;105(12):1071-1074. DOI:10.7196/SAMJ.2015.v105i12.10224

Definition and epidemiology of lupus nephritis

Systemic lupus erythematosus (SLE) is a chronic multi-systemic autoimmune disorder with a pre­ dilection for young females. Kidney disease in SLE (also known as lupus nephritis (LN)) is a common manifestation of SLE and constitutes an important prognostic factor for such patients.

Up to 50% of SLE patients have abnormalities of renal function or urine (proteinuria, haematuria or cellular casts) early in the course of the disease, whereas approximately 80% may later develop overt

1071

abnormalities of renal function.[1] According to the 2012 Systemic Lupus International Collaborating Clinics Classification (SLICC) criteria for the diagnosis of SLE, kidney disease is present when a patient with SLE presents with persistent proteinuria (>0.5 g/24 h) or cellular red cell casts.[2] LN is a major determinant of morbidity and mortality in SLE patients. A South African (SA) study has shown that over half of 226 SLE patients from a lupus clinic had either died or been lost to follow-up at 55 months, and LN was the only significant factor associated with mortality on multivariate analysis, with a 5-year survival rate of 60%.[3]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Classification

The classification of LN is based on histological features, using the International Society of Nephrology (ISN) and Renal Pathology Society (RPS) criteria developed in 2003 (Table 1).[4] Although the classifi­ cation is mainly glomerulocentric, it includes features of tubulo-interstitial disease, from which features of chronicity can be determined. The relationship between the histological class of LN and clinical course of the disease is well recog­nised. Patients with class II and class V (pure membranous LN) disease usually have a slow decline in renal function over long periods of observation. In contrast, patients with class III and class IV (or those with mixed class V) disease mostly have a more aggressive course of disease. Various studies have shown that the proliferative forms of LN (i.e. class III, class IV and mixed class V) occur more frequently than the other histological morphologies. In Cape Town, of 251 patients with biopsy-proven LN, 63% had proliferative LN.[5]

Diagnosis

An unmet need in SLE is the delay in diagnosis. Many physicians assume that SLE is a rare condition in Africa – it is therefore seldom considered as a differential diagnosis, except when patients present with classic features, such as malar rash and swollen painful joints of the hands and feet.

Hence, many patients tend to remain ill for prolonged periods before the diagnosis is made. In some instances, chronic damage to organs including the kidneys would have occurred.

correlated with the presence of proliferative class LN.[5] Therefore, every SLE patient should have a urinalysis performed at every clinic visit.

Role of lupus auto-antibodies (antinuclear antibody and dsDNA) and complements (C3/C4)

Auto-antibodies in SLE and complements (C3/C4) are known to be elevated or lower­ ed, respectively, in patients with increased disease activity, especially in those with proliferative LN (class III, class IV and mixed class V). One study found proliferative LN to be significantly correlated with haematuria on dipstick (p<0.0001), proteinuria on dipstick (p=0.042), low complement C3 (p<0.0001), low complement C4 (p=0.009) and positive dsDNA (p=0.039).[5]

Role of renal biopsy

The definitive diagnosis of LN requires a kidney biopsy. Renal histology also enables classification of LN and assists in the prognosis.

All guidelines recommend a renal biopsy when

there is a suspicion of renal involvement, as clinical and laboratory parameters, although useful, cannot accurately predict the histolo­ gical class. The indications for a renal biopsy in SLE patients includes persistent decline in renal function, proteinuria (≥1.0 g/24 h) or proteinuria (≥0.5 g/24 h) if associated with haematuria (5 red blood cells (RBCs)/high-power field) and active urinary sediment (granular casts, white blood cell (WBC) casts, RBC casts). It is recommended that the biopsy be examined by light microscopy, immunofluorescence (or immunohistochemistry) and where possible by electron microscopy.[6] Quantification of activity and chronicity indices and description of vascular and interstitial lesions are also recommended. A repeat renal biopsy is indi­ cated if there is evidence of worsening of the disease or disease refractory to treatment, evidence of relapse (to show transformation or progression in histological class or change in activity and chronicity scores) and to demonstrate other pathologies. Fig. 1 shows the renal histology in a patient with class IV LN.

Table 1. Abbreviated International Society of Nephrology/Renal Pathology Society classification of lupus nephritis (2003)[4] Class I

Minimal mesangial lupus nephritis

Class II

Mesangial proliferative lupus nephritis

Class III

Focal lupus nephritis (<50% involvement)

Class IV

Diffuse segmental or diffuse global lupus nephritis (≥50% involvement)

Class V

Membranous lupus nephritis*

Class VI

Advanced sclerosing lupus nephritis

* Can be pure membranous lupus nephritis or mixed class V if combined with class III or class IV.

Role of urinalysis and urine microscopy

LN is unlikely to present alone – it often manifests with other extrarenal features such as joint pain, malar rash, oral ulcers and photosensitivity. The patient with LN is likely to present with neph­ritic syndrome (oliguria, minimal proteinuria, haematuria, hypertension and azotaemia) or with features of nephrotic syndrome (anasarca, heavy proteinuria and hypoalbuminaemia).

Urinalysis (dipstick and microscopic exam­ ination) presents the best opportunity for early identification of LN as a dipstick is likely to show the presence of blood and protein in the urine and urine microscopy enables identification of various urinary casts (red cells, granular, hyaline). LN must be strongly suspected in any SLE patient with high titres of double-stranded DNA (dsDNA) and a positive dipstick for blood.

Urinalysis features have been shown to be

Fig. 1. Renal histology of a patient with class IV lupus nephritis (white arrow shows a glomerulus with cellular crescent; black broken arrows show adjacent tubules with red cell casts).

1072

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Treatment

The treatment of LN is dictated by the class of the disease and degree of activity and chronicity indices. All patients should receive adjuvant therapies as indicated and if tolerated. There should be a riskbenefit evaluation when deciding whether to use immunosuppression in patients with increased chronicity indices (i.e. glomerular sclerosis with tubulo-interstitial fibrosis) because of the increased risk of side-effects of treatment. The approach to treatment often involves two phases for patients with proliferative LN (class III, class IV and mixed class V).

Induction therapy

Fig. 2 summarises the common approaches used for induction for the different classes of LN.[7,8] Induction therapy is not used for patients with class I, II, V (pure class V with sub-nephrotic range proteinuria) and VI LN. The approach to induction involves the use of 3 consecutive pulses of intravenous methylprednisolone (500 - 750 mg daily) together with another immunosuppressive: cyclophosphamide (CYC) (daily oral or monthly intravenous pulse therapy) or myco­ phenolate mofetil (MMF). The patient should continue on oral prednisone (1 mg/kg/day) after completing the pulse treatment with methyl­ prednisolone. CYC is often the agent of choice for many clinicians owing to easy accessibility and cost; however, the use of MMF is increasing. Various studies have assessed the efficacy and safety of CYC with MMF or placebo for induction therapy in patients with LN (reviewed in depth by Chan[9]). The recommended duration of induction therapy is 6 months; during this time, the dose of oral corticosteroid should be weaned.

Maintenance therapy

Treatment administered during the induction phase of therapy is de-escalated in the main­ tenance phase. The goal of the latter phase is

of immunosuppression, therapy should be withdrawn.

to maintain the response (remission) gained during the induction phase and therefore to retard progression of chronic kidney disease.

Immunosuppressive agents commonly used include MMF, azathioprine (AZA), and cortico­ steroids. Calcineurin inhi­ bitors may be used in special circumstances, such as in cases of intolerance to MMF or AZA or in patients with persistent heavy proteinuria (Fig. 2). There is currently no consensus on the duration of maintenance therapy. Nonetheless, the decision to withdraw maintenance immuno­suppression should be guided by sustained complete clinical response over a period of at least 2 years.

Withdrawal should be done gradually, starting with glucocorticoids before with­ drawing immunosuppressive agents.[8] In debilitating or life-threatening complications

Adjunctive therapies

Adjunctive therapies are usually started during the induction phase of treatment and although some need to be discontinued after completing this therapy, others will need to be continued during the maintenance phase. Commonly recommended adjunctive therapies in LN include: • Renin angiotensin aldosterone system (RAAS) inhibition for proteinuria and blood pressure treatment (target <130/80 mmHg).

• Bone protection with calcium and vitamin D supplements.

• Chloroquine for all patients (unless contraindicated, e.g. visual disturbance).

Biopsy-confirmed lupus nephritis

INDUCTION

Class I

Class II

None*

None*

Class III

Class IV

CS + cyclophosphamide OR CS + MMF

Class V

Non-nephrotic: • ACE-I/ARB • Blood pressure control

Class VI

None†

Nephrotic: • CS + CYC/MMF/AZA MAINTENANCE

None

CS or CNI

Low-dose CS + AZA/MMF

Persistent nephrotic proteinuria: CS + CYC/MMF/CNI/AZA

None†

ACE-I/ARB (antiproteinuric and blood pressure effects) Blood pressure control Chloroquine Statins Vitamin D and calcium supplements (for bone protection) Aspirin (for CV protection) Anticoagulation for those at high risk of DVT or APLS

ADJUNCTIVE THERAPIES

Fig. 2. Treatment approach for patients with lupus nephritis (APLS = antiphospholipid syndrome; AZA = azathioprine; ACE-I = angiotensin converting enzyme inhibitor; ARB = angiotensin receptor blocker; CNI = calcineurin inhibitor; CS = corticosteroid; CYC = cyclophosphamide; DVT = deep-vein thrombosis; MMF = mycophenolate mofetil; CV = cardiovascular). * Immunosuppression to be dictated by extrarenal manifestations. † Patients should be prepared for renal replacement therapy (dialysis/ transplantation).

Table 2. Adverse effects of drugs and approach to monitoring in patients with lupus nephritis Medication

Adverse effect

Monitoring approach

Glucocorticoids

Glucose intolerance/diabetes mellitus, osteoporosis, hypertension, gastritis, cataracts, avascular necrosis of femur, cushingoid appearance

Blood glucose measurement, bone mineral density assessment, blood pressure monitoring, weight monitoring

Cyclophosphamide

Leukopenia, menstrual disorders, gonadal failure, haemorrhagic cystitis

Full blood count, urinalysis

Mycophenolate mofetil/ mycophenolic acid

Leukopenia, hypercholesterolaemia

Full blood count, serum cholesterol, gastrointestinal disturbances and neurotoxicity assessment

Azathioprine

Leukopenia, hepatotoxicity, pancreatitis

Full blood count, liver function tests, dose adjustment for concomitant allopurinol use

Chloroquine

Retinopathy

Annual ophthalmology examination

1073

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

• Treatment of hyperlipidaemia with statins (target low-density lipoprotein <2.6 mmol/L).

• Low-dose acetylsalicylic acid in patients with antiphospholipid syndrome.

• Anticoagulant to be considered in patients with nephrotic syndrome and albumin <20 g/L. • Avoid vaccination with live or attenuated viruses during immune suppression.

• Tuberculosis prophylaxis with isoniazid (for those in highly endemic TB regions).

Treatment of refractory LN

Fewer than 50% of patients are able to achieve complete remission during the 6 months of induction therapy. It may take up to 2 years to reach remission in many patients. Switching to an alternative agent is recommended for patients who fail to improve within 3 - 4 months, or do not achieve a partial response after 6 - 12 months or a complete response after 2 years of treatment. Treatment options include switching from MMF to CYC or from CYC to MMF; rituximab may be given as add-on treatment or monotherapy.

Other options include the use of calcineurin inhibitors, intravenous immunoglobulin and plasma exchange for patients with rapidly progressive glomerulonephritis.

Treatment of class VI LN

Immunosuppression for class VI patients must be dictated by extrarenal manifestations of SLE. These patients should be prepared for renal replacement therapy (haemodialysis, peritoneal dialysis or transplantation). Treat­ ment and prevention of cardiovascular risk factors (e.g. blood pressure control, statins for dyslipidaemia) should be continued.

Monitoring for drug toxicities and disease activity

It is recommended that body weight, blood pressure, serum creatinine, urinalysis (for proteinuria and urinary sediment), C3/C4, anti-dsDNA, serum albumin and full blood count be performed at each clinic visit.

Patients with active nephritis should be seen monthly or more frequently, while those with no active disease should be seen twice yearly or quarterly. This ensures monitoring of disease activity. Useful approaches to monitoring for drug toxicities/side-effects are summarised in Table 2.

Treatment options for pregnant LN patients

Pregnant LN patients often present a challenge to the clinician, as pregnancy can be a trigger for increased disease activity. Some guidelines therefore recommend that pregnancy should not be planned until remission has been achieved and maintained for at least 6 months.[7,8] Preg­

Table 3. Use of immunosuppressive and adjunctive agents in pregnancy Drug

May the drug be used in pregnancy?

Glucocorticoids

Yes

High risk of gestational diabetes and PROM

Cyclophosphamide

No

Increased fetal loss and abnormalities

Azathioprine

Side-effects

Cytotoxic agents Yes

-

Mycophenolate mofetil

No

May cause congenital abnormalities

Chloroquine

Yes

-

Yes

Increased risk of obstetric cholestasis

Calcineurin inhibitors Cyclosporin

Yes

Increased risk of gestational diabetes

Rituximab

Tacrolimus

No

Lack of data

RAAS blockade

No

May cause congenital defects in the renal, pulmonary, cardiac, skeletal and nervous systems

PROM = premature rupture of membranes; RAAS = renin angiotensin aldosterone system. Adapted from Day CJ, et al.[10]

nant patients with LN have an increased risk of pre-eclampsia, preterm delivery and fetal loss. They should therefore be managed by a multidisciplinary team of clinicians (obstetricians, rheumatologists and nephrologists). Angiotensin converting enzyme inhibitors, angiotensin receptor blockers, MMF and CYC are prohibited during pregnancy (Table 3).[10] Prednisone, AZA and calcineurin inhibitors may be continued during pregnancy. Labetalol, methyldopa and nifedipine may be used for control of blood pressure, and low-dose acetylsalicylic acid should be considered to reduce the risk of pre-eclampsia.

Definitions of response to treatment and flares in LN

There is consensus for defining a complete response as inactive urinary sediment, a decrease in proteinuria to ≤0.2 g/day and normal or stable renal function (within 10% of normal glomerular filtration rate (GFR) if previously abnormal).[11] Partial response is taken as improvement of renal function, marked by inactive sediment, proteinuria ≤0.5 g/day, with normal GFR or stable renal function. A flare is defined as an increase in disease activity requiring more intensive therapy. It is indicated by an increase in proteinuria or serum creatinine, abnormal urinary sediment or a reduction in creatinine clearance due to active disease. There are two main types of flare: • Nephrotic flare – proteinuria >2 g/day.

• Nephritic flare typified by an increasing anti-dsDNA, low C3/C4, active urine sediment, and worsening serum creatinine.

1074

December 2015, Vol. 105, No. 12

LN flare surveillance during visits includes urinanalysis (dipstick and microscopy) for proteinuria and cellular casts such as RBC casts, WBC casts, and serum creatinine determination. Significant proteinuria on dipstick analysis should be followed by a quantitative protein analysis.

References 1. Cameron JS. Lupus nephritis. J Am Soc Nephrol 1999;10:413424.

2. Petri M, Orbai AM, Alarcón GS, et al. Derivation and validation of the Systemic Lupus International Collaborating Clinics classification criteria for systemic lupus erythematosus.

Arthritis Rheum 2012;64:2677-2686. [http://dx.doi.org/10.1002/ art.34473] 3. Wadee S, Tikly M, Hopley M. Causes and predictors of death in South Africans with systemic lupus erythematosus.

Rheumatology 2007;46:1487-1491. [http://dx.doi.org/10.1093/ rheumatology/kem180] 4. Weening JJ, D’Agati VD, Schwartz MM, et al. The classification of glomerulonephritis in systemic lupus erythematosus revisited. J Am Soc Nephrol 2004;15:241-250. [http://dx.doi.org/10.1097/01.

ASN.0000108969.21691.5D] 5. Okpechi IG, Swanepoel CR, Tiffin N, et al. Clinicopathological insights into lupus nephritis in South Africans: A study of 251 patients. Lupus 2012;21:1017-1024. [http://dx.doi. org/10.1177/0961203312441981] 6. Wilhelmus S, Bajema IM, Bertsias GK, et al. Lupus nephritis management guidelines compared. Nephrol Dial Transplant 2015, 28 April. [Epub ahead of print] [http://dx.doi.org/10.1093/ ndt/gfv102] 7. Kidney Disease: Improving Global Outcomes (KDIGO) Glomerulonephritis Work Group. KDIGO Clinical Practice Guideline for Glomerulonephritis. Kidney Int 2012;2:139274.

8. Bertsias GK, Tektonidou M, Amoura Z, et al. Joint European League Against Rheumatism and European Renal Association-European Dialysis and Transplant Association (EULAR/ERA-EDTA) recommendations for the management of adult and paediatric lupus nephritis. Ann Rheum Dis 2012;71:1771-1782. [http://dx.doi.org/10.1136/ annrheumdis-2012-201940] 9. Chan TM. Treatment of severe lupus nephritis: The new horizon.

Nat Rev Nephrol 2015;11:46-61. [http://dx.doi.org/10.1038/ nrneph.2014.215] 10. Day CJ, Lipkin GW, Savage CO. Lupus nephritis and pregnancy in the 21st century. Nephrol Dial Transplant 2009;24:344-347. [http://dx.doi.org/10.1093/ndt/gfn651] 11. Gordon C, Jayne D, Pusey C, et al. European consensus statement on the terminology used in the management of lupus glomerulonephritis. Lupus 2009;18:257-263. [http://dx.doi. org/10.1177/0961203308100481]

CONTINUING MEDICAL EDUCATION

ARTICLE

Evidence-based treatment of systemic lupus erythematosus and its complications B Hodkinson,1,2 MB BCh, PhD, FCP (SA), Cert Rheumatology (SA); M A Makda,2 MB BCh, FCP (SA), Cert Rheumatology (SA), MMed (Int Med) Department of Medicine, Faculty of Health Sciences, Groote Schuur Hospital and University of Cape Town, South Africa Division of Rheumatology, Department of Internal Medicine, Chris Hani Baragwanath Academic Hospital, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa

1 2

Corresponding author: B Hodkinson (drbridget@gmail.com)

Outcomes for patients with systemic lupus erythematosus (SLE) have improved during the last two decades as our understanding of the disease expands. In particular, the importance of antimalarial therapy for addressing and preventing a host of complications in SLE has emerged. Furthermore, evidence is mounting that corticosteroids, while offering excellent control of disease activity, are responsible for many of the late complications of SLE and need to be prescribed in modest doses for the shortest time possible. To achieve this, an understanding of the available ‘steroid-sparing’ immunosuppressants is useful. Specific attention needs to be paid to the two most important complications of SLE, i.e. infections and atherosclerotic cardiovascular events. Awareness of, screening for and aggressive management of risk factors for these comorbidities are paramount.

S Afr Med J 2015;105(12):1075. DOI:10.7196/SAMJ.2015.v105i12.10221

Rationale for this review

Ideally, all systemic lupus erythematosus (SLE) patients should be reviewed by a specialist. Early referral to a rheu­matologist has been associated with faster treatment modification and better outcomes. However, primary care doctors are the first point of care for new SLE patients or those presenting with a new complication. Moreover, given the shortage of rheumatologists in South Africa (SA) and elsewhere in Africa, primary care clinicians and general physicians are often faced with sick SLE patients and are required to make rapid therapeutic decisions. This review summarises current evidence for the treatment of SLE and its complications. We prepared this review after a PubMed search using the words ‘systemic lupus erythematosus’ and ‘therapy’.

early, and the AM is discontinued, the maculopathy is reversible.

Therefore, patients on AMs should undergo ophthalmological assessment including fundoscopy, visual field tests and optical coherence tomography at baseline and annually after 5 years of CQ use.

Corticosteroids – less is more

Corticosteroids (CS) offer excellent control of active disease, but are responsible for most of the irreversible organ damage in SLE Table 1. Clinical effects of antimalarial therapy in systemic lupus erythematosus SLE disease and survival

↓ Number and severity of lupus flares Particularly useful for joint, skin and renal involvement

General principles of management Education and support

↓ Damage scores

At diagnosis, patients should be offered counselling and educational material, preferably by a rheumatology nurse. Lupus support groups are very beneficial. Patients should avoid sun exposure and use a daily sunscreen (sun protection factor (SPF) >50).

SLE onset in lupus-like disease

Delay time to fulfilment of SLE criteria

Thrombosis

Antimalarial therapy

↓ Antiphospholipid-induced thrombosis

Lipid profile

↓ Dyslipidaemia (↓ TG, ↓ VLDL, ↓ TC)

The antimalarial (AM) drugs chloroquine (CQ) and hydroxy­chloro­ quine (HQ) have been used in the treat­ment of SLE for >50 years, with CQ being much more readily available in SA than HQ. Recent studies demonstrate their anti-inflammatory, antithrombotic and antilipidaemic effects via multiple molecular pathways, resulting in better control of disease activity and fewer complications (Table 1).[1] Given the current evidence, all SLE patients should be prescribed an AM, and clinicians should encourage compliance. The common side-effects of AM drugs are gastrointestinal, but these are usually mild and transient. More worrisome are skin hyperpigmentation and maculopathy. The latter is uncommon, affecting 2.5% of patients treated with CQ for 10 years (and 0.1% of patients using HQ); the major risk factor seems to be the cumulative dose of an AM.[2] If diagnosed

↑ Long-term survival

↓ Atherosclerosis, ↓ CV events Glycaemic status

↓ I nsulin resistance and ↓ risk of diabetes, improves glucose control in diabetics

Infections

Antimicrobial: ↓ infections ↓ Bone mass loss

Pregnancy

↓ R isk of congenital heart block in infants ↓ Number and severity of lupus flares

TG = triglycerides; VLDL = very low-density lipoproteins; TC = total cholesterol; CV = cardiovascular.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 2. Immunosuppressants used in SLE Indication

Dose/route

Important adverse effects

Monitoring

AM (CQ)

• SLE • Lupus-like syndromes

4 mg/kg/day ideal body weight (or by height in number of 200 mg tablets/week: <154 cm, 4/week; 154 - 174 cm, 5/week; >174 cm, 6/week)

• Skin hyperpigmentation • Maculopathy

Screen for maculopathy annually after 5 years of use or annually in elderly

CS

Severe organ involvement

IV methylprednisolone or oral prednisone 0.5 - 1 mg/kg

Numerous comorbidities (Table 3)

Lowest dose possible, taper rapidly

MTX

Skin, joint

7.5 - 25 mg/week

• BM toxicity • Hepatotoxicity, teratogenic

FBC, AST

CYC

• Nephritis • NPSLE • Vasculitis • Other severe organ involvement

IVI pulse 10 - 20 mg/kg monthly (less toxic than oral CYC) Euro-lupus regimen 500 mg IVI

• Teratogenic • Premature ovarian failure • BM toxicity, infection • Malignancies

• FBC before infusion • Co-prescribe with MESNA to ↓ bladder toxicity

AZA

• Haem • Skin • Nephritis maintenance

1 - 5 mg/kg/day po

• BM toxicity, infection • Hepatotoxicity

? TPMT test before initiating, FBC in first 3 - 4 weeks of therapy, 4-monthly FBC and AST

MMF

• Haem • Skin • Nephritis induction and maintenance

2 g/day po in 2 divided doses

• Teratogenic • GI disturbance (↓ dose and co-prescribe with H2-receptor antagonist) • BM toxicity, infection

FBC, AST

CYA

Haem

3 - 5 mg/kg/day po

• Hypertension • Renal dysfunction • Impaired glucose tolerance • Hirsutism

• Blood pressure monitoring • Creatinine

IVIG

Haem (ITP/TTP)

2 g/kg for 5 consecutive days

• Thrombosis • Flu-like symproms

Rituximab

Refractory nephritis, severe haematological disease and NPSLE (off-label uses)

500 - 1 000 mg/day 1 and day 15, IV 6-monthly or at relapse

• Serious infections: • Hepatitis B reactivation • Progressive multifocal leukoencephalopathy

epatitis B serology prior to H infusion

AM = antimalarial; CQ = chloroquine; CS = corticosteroids; MTX = methotrexate; CYC = cyclophosphamide; Haem = haematological SLE complications; AZA = azathioprine; MMF = mycophenylate mofetil; CYA = cyclosporin A; IVIG = intravenous immunoglobulins; NPSLE = neuropsychiatric lupus; IVI = intravenous infusion; BM = bone marrow; FBC = full blood count; AST = aspartate aminotransferase; MESNA = mercapto-ethanesulphonic acid; TPMT = thiopurine methyltransferase; ITP = immune thrombocytopenia; TTP = thrombotic thrombocytopenic purpura.

patients 15 years after diagnosis.[3] The damage is propor­tional to both the cumulative dose of CS and the average daily dose, and even low doses (<7.5 mg daily) are associated with a risk of cataracts, cardiovascular (CV) disease and osteoporosis.[4] The best practice is to prescribe CS only to patients with severe organ involvement at the lowest effective dose for the shortest duration of time possible.

A recent study demonstrated that moderate doses (≤30 mg/day) of CS for severe non-renal SLE were as effective and associated with fewer adverse effects than high doses.[5] Another study demonstrated that after pulse methylprednisolone, oral CS may be omitted from an induction immunosuppressive regimen for nephritis.[6] An understanding of currently available immunosuppressant drugs such as methotrexate (MTX), azathioprine (AZA), cyclophosphamide (CYC) and mycophenylate mofetil (MMF) is vital in a steroid-sparing approach (Table 2).

Monitoring SLE patients

For patients with inactive disease, 4-monthly visits should include a clinical examination, blood pressure measurement,

urine dipstick test, full blood count, and liver transaminase for those using potentially hepatotoxic medication. Other serum markers of active disease such as complement (C3 and C4), double-stranded DNA (dsDNA), and C-reactive protein may be useful for follow-up, but do not accurately predict flares.

An annual lipogram, creatinine measurement, and HIV test are recommended. Screening for antiphospholipid antibodies at diagnosis is useful. As therapy of acute SLE improves, patients live longer. Therefore, comorbidities of the disease or complications of therapy have emerged as important causes of morbidity and mortality. Preventive and therapeutic strategies are summarised in Table 3.

Infections

The combination of inherent immune dysfunction and immuno­ suppressant therapy, in particular CS, puts SLE patients at high risk of community-acquired and opportunistic infections.[7] These infections contribute significantly to the hospitalisation and mortality of SLE patients, and need to be distinguished from

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 3. Complications and comorbidities in SLE: Prevention and therapy Comorbidity

Comments

Associations

Prevention/therapy

Infections

Bacterial and opportunistic respiratory and urinary tract infections

• CS dose • Disease activity

• Pneumococcal (5-yearly) and influenza vaccine (annually) • Vigilance by patient and healthcare team • AM may be protective

Tuberculosis

Pulmonary and extrapulmonary

• CS dose

• INH prophylaxis if moderate dose (≥15 mg/day) CS prescribed

Atherosclerotic CV disease

Premature CV events

• CS dose • Traditional and other risk factors (APLS, inflammation)

• Physical exercise • Stop smoking • Low-dose aspirin • Statin and AM therapy

Hypertension

• CS dose • Nephritis

• Target: <130/80 mmHg if nephritis is present) • ACEi or ARB if proteinuria

Dyslipidaemia

• CS dose • Nephrotic syndrome

• Low threshold for intervention: SLE patients are a high-risk category • Target LDL cholesterol <2.5 mmol/L • Statins and AM

Diabetes mellitus

• CS dose • Obestity and other features of the metabolic syndrome

• AM may be protective • Oral hypoglycaemic or insulin therapy

Osteoporosis

• CS dose

• Calcium and vitamin D supplement to any patient receiving CS • DEXA scan 5-yearly in postmenopausal women • Bisphosphonate therapy if osteoporosis

• CS dose • APL antibodies

• Bisphosphonates or core decompression if early • Joint replacement if late

• CYC

• HPV vaccine • Annual Pap smears

Avascular bone necrosis

Suspect if hip or knee pain, MRI to detect early

Uterine cervix carcinoma Lymphoma

3-fold increase in SLE

• Thorough clinical examination

CV = cardiovascular; MRI = magnetic resonance imaging; CS = corticosteroid; APLS = antiphospholipid antibody syndrome; AM = antimalarial; INH = isoniazid; ACEi = angiotensin-converting enzyme inhibitor; ARB = angiotensin receptor blocker; DEXA = dual-energy X-ray absorptiometry; HPV = human papillomavirus.

an SLE flare, bearing in mind that infections may also occur together with flares. Vaccination, vigilance, easy access to wellinformed clinicians and prompt antibiotic therapy are important measures. Moreover, SLE patients are at higher risk of pulmonary and extrapulmonary tuberculosis (TB); this risk is related to CS use, lymphopenia, and lupus disease itself.[8] Clinicians need to consider the possibility of TB in any ill SLE patient.

Atherosclerosis

Patients with SLE have a 2 - 5-fold increased risk of cardiac, cerebral or peripheral ar­terial atherosclerosic events, and CV events are the leading cause of mortality in SLE.[9] Traditional Framingham CV risk factors do not fully explain the extent of the risk, as inflam­matory and prothrombotic mechanisms underlie this premature atherosclerosis. Encouragingly, the CV risk may be reduced by regular exercise, statin therapy and possibly low-dose aspirin for any patient with ≥1 traditional risk factors for atherosclerotic disease, or with antiphospholipid antibodies. [10,11]

Antiphospholipid syndrome

Antiphospholipid antibodies are commonly encountered in SLE patients and are associated with a 50% risk of thromboembolism.[12] Despite the lack of evidence for primary prevention

of thombosis and pregnancy loss, experts recommend lowdose aspirin and AMs for SLE patients with anti­phospholipid antibodies, especially when other risk factors for thrombosis coexist.[13] With regard to secondary prevention, patients with previous venous thrombosis, moderate-intensity warfarin therapy (target international normalised ratio (INR) 2.0 - 3.0) is appropriate. In the case of previous arterial thrombosis or stroke, high-intensity warfarin therapy (target INR 3.1 - 4.0) is preferable. Very recently it has been shown that non-vitamin K antagonist oral anticoagulants may be safe and effective alternatives to warfarin in antiphospholipid patients with previous venous events.[14]

Management of major organ involvement Nephritis

Nephritis is one of the most severe mani­festations of SLE and one of the major predictors of poor prognosis. A urine dipstick test at each assessment is mandatory. An abnormal test warrants urine microscopy and a urine protein:creatinine ratio. Renal biopsy is indicated in any patient with active urinary sediment or significant proteinuria.

Treatment of lupus nephritis consists of induction followed by a maintenance phase. Induction therapy for proliferative or membranous nephritis with CS combined with an immunosuppressive agent prevents progression to end-stage renal disease. CS may be given as pulse

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

methylprednisolone, or as oral CS, tapered over a few weeks to the lowest effective oral dose.[15] There is a high rate of relapse in patients treated with CS alone.[16] The current first-line choice of immunosuppressant is either CYC or MMF. High-dose, intermittent CYC (‘the NIH regimen’) or lower dose CYC (the Euro-Lupus regimen) are acceptable approaches, but in patients with severe disease (nephrotic-range proteinuria or renal impairment), and in black or mixed-ancestry patients, the high-dose CYC regimen may be preferable.[17] In young females who have not yet completed their families, MMF may be more suitable than CYC. Rituximab or tacrolimus may be useful in cases refractory or intolerant to conven­tional therapies.[18,19] Importantly, early response to therapy predicts long-term renal outcome; therefore, patients with ongoing proteinuria and active urinary sediment at 6 months should be switched to another regimen.[20] Maintenance therapy should be with AZA or MMF for at least 3 years. Relapses are common, and diligent follow-up is important.

Neuropsychiatric lupus

Neuropsychiatric lupus (NPSLE) is another of the serious manifestations of SLE, and may be secondary to sepsis, metabolic abnormalities, and drug side-effects, or may be directly related to the SLE (primary NPSLE). Nineteen NPSLE syndromes have been recognised, including seizures, psychosis, stroke, mood disorder, transverse myelitis, cognitive dysfunction, and peripheral neuropathy. The pathogenesis of primary NPSLE is thought to be either (i) immune-mediated inflammation or demyelination, and/ or (ii) ischaemic injury due to microangiopathy, thrombosis or emboli, frequently associated with antiphospholipid antibodies.

Magnetic resonance imaging (MRI) is usually considered to be the gold standard imaging modality in the evaluation of cerebral lesions in patients with SLE, and a recent study showed that diffuse cortical MRI lesions are likely to be associated with immune-mediated inflammation, whereas focal white or grey matter hyperintensities are more likely to be ischaemic or related to vasculitis.[21] Inflammatory syndromes are best managed with immunosuppressive therapy, whereas ischaemic events may require anticoagulation.

Moreover, SLE is a well-known risk factor for depres­sion, anxiety and fatigue, which tend to be poorly addressed by physicians. Several studies highlight the impor­ tance of focusing on and addressing individual patient’s psychosocial situations.

Heart

Myocarditis (best detected by MRI) and endocarditis are uncommon but serious complications of SLE, while pericarditis may lead to tamponade and is treated with moderate-dose CS and AMs. Refractory disease may respond to AZA, MMF, MTX, belimumab or rituximab.

Cytopenias

Anaemia is common in SLE, and may be due to anaemia of chronic disease, iron deficiency, chronic renal insufficiency or autoimmune haemolytic anaemia (AIHA). AIHA must be treated with oral CS or pulse methylprednisolone, and if refractory may require AZA, CYC, MMF or splenectomy.

Immune thrombocytopenia is an independent risk factor for increased mortality in SLE and should be treated with oral CS or pulse methylprednisolone and AMs. In refractory cases, AZA, cyclosporin, intravenous immunoglobulins (IVIGs), MMF, danazol, CYC or splenectomy may be considered.

Thrombotic thrombocytopenic purpura is a rare but lifethreatening complication of SLE, characterised by severe thrombo­

cytopenia, microangiopathic haemolytic anaemia, neurological abnormalities, renal insufficiency and fever with fragmented red blood cells on peripheral blood smear. Plasmapheresis is the mainstay of treatment. Other therapies that have been used include high-dose CS, CYC, IVIGs and rituximab.

Skin

Acute and chronic skin lesions are very common, affecting 70 - 85% of patients, and are frequently of great concern to patients. Prompt therapy is necessary to avoid irreversible scarring, alopecia and depigmentation. All SLE patients should wear daily sunscreen (SPF ≥50). Treatment with AMs and topical CS is very effective.

Small studies support the use of MTX, AZA, MMF, retinoids and dapsone for refractory cases.[22]

Arthritis

Arthritis is a common presenting feature of SLE, and may be under-recognised. A recent MRI study showed a high incidence of subclinical hand and wrist arthritis, with erosions not infrequently seen, which may offer an explanation for the high prevalence of arthralgias in SLE patients.[23] Arthritis in SLE should be treated with AMs, short-term non-steroidal anti-inflammatory drugs, and low-dose (<10 mg) CS. Patients with ongoing arthritis may benefit from MTX.

Pregnancy

Because SLE is frequently a disease affecting women of childbearing age, fertility and pregnancy may be important issues. Patients should be reassured that successful full-term pregnancies are possible, and that the best time to conceive is once SLE is inactive. Pregnancy, particularly if it occurs in a patient with active SLE, may cause flares, especially worsening of lupus nephritis. CYC may affect fertility, and the risks are greatest if high cumulative doses are used (>15 g) and when given to women >30 years of age. Antiphospholipid antibodies are a risk factor for miscarriage, stillbirth, pre-eclampsia and premature delivery.

Fetal congenital heart block is associated with anti-Ro/SSA or anti-La/SSB antibodies.

In pregnant SLE patients, AMs prevent flares and reduce the occurrence of congenital heart block. The incidence of fetal abnormalities is very low (although most studies have evaluated HQ, which may be safer than CQ). Hence, most experts believe that, after a detailed conversation with each patient, AMs should be continued during pregnancy and lactation. Glucocorticoids, AZA, and low-dose aspirin are considered safe in pregnancy, whereas MMF, CYC and MTX are contraindicated. Low-molecular-weight heparin with aspirin is indicated in patients with antiphospholipid antibodies and previous miscarriage to reduce the risk of pregnancy loss.[24]

Contraception and hormone replacement therapy

Because of concerns of flares precipitated by exogenous oestrogens, women with SLE have traditionally been counselled against the use of hormonal oral contraceptives (OCs). Recent randomised controlled trials, however, have confirmed the safety of OCs in SLE.[25] Because of the risk of thrombosis (both venous thrombosis with thrombo-embolism and myocardial infarction), OCs should be avoided in patients with antiphospholipid antibodies. Longterm hormone replacement therapy, although seemingly desirable in patients with premature menopause or osteoporosis, should be avoided because of the risk of mild to moderate flares and thrombosis.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Newer therapies

Improved understanding of the pathogenesis of SLE has paved the way for the development of new biologic agents. Rituximab, a humanised monoclo­nal antibody targeting CD-20 recep­tors on B lymphocytes, is useful in refractory nephritis, severe haematological disease and NPSLE. Belimumab inhibits B-lymphocyte stimulator and has recently been approved in the USA for mild to moderate disease.

Several novel agents are currently being evaluated for safety and efficacy in lupus.

References 1. Wallace DJ, Gudsoorkar VS, Weisman MH, et al. New insights into mechanisms of therapeutic effects of antimalarial agents in SLE. Nat Rev Rheumatol 2012;8:522-533. [http://dx.doi.org/10.1038/ nrrheum.2012.106] 2. Ruiz-Irastorza G, Ramos-Casals M, Brito-Zeron P, et al. Clinical efficacy and side effects of antimalarials in systemic lupus erythematosus: A systematic review. Ann Rheum Dis 2010;69:20-28. [http://dx.doi.org/10.1136/ard.2008.101766] 3. Gladman DD, Urowitz MB, Rahman P, et al. Accrual of organ damage over time in patients with systemic lupus erythematosus. J Rheumatol 2003;30:1955-1959.

4. Zonana-Nacach A, Barr SG, Magder LS, et al. Damage in systemic lupus erythematosus and its association with corticosteroids. Arthritis Rheum 2000;43:1801-1808. [http://dx.doi.org/10.1002/15290131(200008)43:8<1801::AID-ANR16>3.0.CO;2-O] 5. Ruiz-Arruza I, Barbosa C, Ugarte A, et al. Comparison of high versus low-medium prednisone doses for the treatment of systemic lupus erythematosus patients with high activity at diagnosis. Autoimmun Rev 2015;14(10):875-879. [http://dx.doi.org/10.1016/j.autrev.2015.05.011] 6. Condon MB, Ashby D, Pepper RJ, et al. Prospective observational single-centre cohort study to evaluate the effectiveness of treating lupus nephritis with rituximab and mycophenolate mofetil but no oral steroids. Ann Rheum Dis 2013;72:1280-1286. [http://dx.doi.org/10.1136/annrheumdis-2012-202844] 7. Dubula T, Mody GM. Spectrum of infections and outcome among hospitalized South Africans with systemic lupus erythematosus. Clin Rheumatol 2015;34:479-488. [http://dx.doi.org/10.1007/s10067014-2847-0] 8. Hodkinson B, Musenge E, Tikly M. Osteoarticular tuberculosis in patients with systemic lupus erythematosus. QJM 2009;102:321-328. [http://dx.doi.org/10.1093/qjmed/hcp015] 9. Bartels CM, Buhr KA, Goldberg JW, et al. Mortality and cardiovascular burden of systemic lupus erythematosus in a US population-based cohort. J Rheumatol 2014;41:680-687. [http://dx.doi. org/10.3899/jrheum.130874] 10. Barnes JN, Nualnim N, Dhindsa M, et al. Macro- and microvascular function in habitually exercising systemic lupus erythematosus patients. Scand J Rheumatol 2014;43:209-216. [http://dx.doi.org/10.31 09/03009742.2013.846408] 11. Willis R, Seif AM, McGwin G, Jr, et al. Effects of statins on proinflammatory/prothrombotic biomarkers and on disease activity scores in SLE patients: Data from LUMINA (LXXVI), a multi-ethnic US cohort.

Clin Exp Rheumatol 2014;32:162-167.

12. Somers E, Magder LS, Petri M. Antiphospholipid antibodies and incidence of venous thrombosis in a cohort of patients with systemic lupus erythematosus. J Rheumatol 2002;29:2531-2536.

13. Bertsias G, Ioannidis JP, Boletis J, et al. EULAR recommendations for the management of systemic lupus erythematosus. Report of a Task Force of the EULAR Standing Committee for International Clinical Studies Including Therapeutics. Ann Rheum Dis 2008;67:195-205. [http://dx.doi.org/10.1136/ ard.2007.070367] 14. Cohen H, Dore CJ, Clawson S, et al. Rivaroxaban in antiphospholipid syndrome (RAPS) protocol: A prospective, randomized controlled phase II/III clinical trial of rivaroxaban versus warfarin in patients with thrombotic antiphospholipid syndrome, with or without SLE. Lupus 2015;24(10):1087-1094. [http://dx.doi.org/10.1177/0961203315581207] 15. Hahn BH, McMahon MA, Wilkinson A, et al. American College of Rheumatology guidelines for screening, treatment, and management of lupus nephritis. Arthritis Care Res (Hoboken) 2012;64:797808. [http://dx.doi.org/10.1002/acr.21664] 16. Austin HA, 3rd, Klippel JH, Balow JE, et al. Therapy of lupus nephritis. Controlled trial of prednisone and cytotoxic drugs. N Engl J Med 1986;314:614-619. [http://dx.doi.org/10.1056/NEJM198603063141004] 17. Houssiau FA. Therapy of lupus nephritis: Lessons learned from clinical research and daily care of patients. Arthritis Res Ther 2012;14:202. [http://dx.doi.org/10.1186/ar3656] 18. Moroni G, Gallelli B, Sinico RA, et al. Rituximab versus oral cyclophosphamide for treatment of relapses of proliferative lupus nephritis: A clinical observational study. Ann Rheum Dis 2012;71:17511752. [http://dx.doi.org/10.1136/annrheumdis-2012-201442] 19. Mok CC, Ying KY, Yim CW, et al. Tacrolimus versus mycophenolate mofetil for induction therapy of lupus nephritis: A randomised controlled trial and long-term follow-up. Ann Rheum Dis 2014; 30 December. [Epub ahead of print] [http://dx.doi.org/10.1136/annrheumdis-2014-206456] 20. Houssiau FA, Vasconcelos C, D’Cruz D, et al. Early response to immunosuppressive therapy predicts good renal outcome in lupus nephritis: Lessons from long-term followup of patients in the Euro-Lupus Nephritis Trial. Arthritis Rheum 2004;50:3934-3940. [http://dx.doi.org/10.1002/ art.20666] 21. Luyendijk J, Steens SC, Ouwendijk WJ, et al. Neuropsychiatric systemic lupus erythematosus: Lessons learned from magnetic resonance imaging. Arthritis Rheum 2011;63:722-732. [http://dx.doi. org/10.1002/art.30157] 22. Winkelmann RR, Kim GK, Del Rosso JQ. Treatment of cutaneous lupus erythematosus: Review and assessment of treatment benefits based on Oxford centre for evidence-based medicine criteria. J Clin Aesthet Dermatol 2013;6:27-38.

23. Ball EM, Tan AL, Fukuba E, et al. A study of erosive phenotypes in lupus arthritis using magnetic resonance imaging and anti-citrullinated protein antibody, anti-RA33 and RF autoantibody status.

Rheumatology 2014;53:1835-1843. [http://dx.doi.org/10.1093/rheumatology/keu215] 24. Empson M, Lassere M, Craig J, et al. Prevention of recurrent miscarriage for women with antiphospholipid antibody or lupus anticoagulant. Cochrane Database Syst Rev 2005;(2):CD002859. [http://dx.doi.org/10.1002/14651858.cd002859.pub2] 25. Lateef A, Petri M. Hormone replacement and contraceptive therapy in autoimmune diseases. J Autoimmun 2012;38:J170-J176. [http://dx.doi.org/10.1016/j.jaut.2011.11.002]

Patient information websites Arthritis Foundation: http://www.arthritis.org.za/ Winelands SLE Support Group: http://wrc-lupus-support.co.za/ Two useful US lupus websites with particularly good information: https://www.hss.edu/lupus-programs.asp http://www.lupusny.org A lupus social media site: http://www.mylupusteam.com

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

A clinical update on paediatric lupus G W Spittal,1 MB ChB (Glasgow, UK), MRCPCH (UK), FCPaed (SA), MMed Paed, Dip HIV Man; L B Lewandowski,2 MD, MS; C Scott,1 MB ChB, FCPaed (SA), Grad Cert Paed Rheum (UWA) 1

Paediatric Rheumatology, Red Cross War Memorial Children’s Hospital, University of Cape Town, South Africa Pediatric Rheumatology, Duke University Medical Center, Durham, NC, USA

2

Corresponding author: G W Spittal (gspittal@hotmail.com)

Systemic lupus erythematosus in children is a life-threatening chronic disease that is being increasingly recognised. More black African children are being diagnosed and the proportion of males affected is much higher than in adult-onset lupus. The presenting manifestations of childhood-onset lupus are variable and many systems are involved. Children with lupus often present late with severe disease, and in South African (SA) children severe lupus nephritis occurs commonly at presentation. The investigations for lupus should be performed in a three-step process – initial essential investigations, antibody and serological tests, and supplementary investigations.

The most important factor in the management is to involve a multidisciplinary team as soon as possible. All cases of lupus in SA should be discussed with a paediatric specialist so that a tailored management plan can be made, depending on the presenting features and course of the disease.

S Afr Med J 2015;105(12):. DOI:10.7196/SAMJ.v105i12.10341

Systemic lupus erythematosus (SLE) is a multisystem, inflammatory, autoimmune disease characterised by the formation of antinuclear antibodies.[1] It is one of the most common autoimmune diseases, with an estimated incidence of 2.0 - 7.6 per 100 000.[2,3] Because SLE can present in a multitude of ways that mimic other diseases, early diagnosis can be difficult.

Methods

• A literature review from the first author’s MMed dissertation was used as the main reference source.

• PubMed and Google scholar searches were conducted to identify more recent publications. Abstracts from 2014 and 2015 were reviewed and relevant full-text articles were read and crossreferenced.

• Keywords were the following: Systemic Lupus Erythematosus; SLE; Children; Update; Management; and Autoantibodies.

• Personal reference lists of the 3 authors were used in this update.

• Most of the data were either level B or level C.

Who presents with the disease?

Although more commonly present in adults, childhood-onset SLE (cSLE) is becoming increasingly recognised, with approximately 15 - 20% of SLE occurring before the age of 19 years.[1,4] The presentation of SLE differs, not only with regard to age, but also depending on the ethnic background and gender of the patient.[2,5] The disease has been reported to be more common in Europe, Asia and the USA than in Africa; yet, patients of African ancestry living in these regions have the highest rates of SLE.[6] There is increasing recognition that SLE is not as rare in Africa as previously thought.

The discrepancy may be related to many factors, including underdiagnosis due to poor access to healthcare and under-recognition of the disease.[7] More females than males are affected with SLE at all ages, but the male to female ratio varies. The highest incidence is among women of childbearing age, with the female to male ratio from puberty to menopause being about 9:1. However, in prepubertal and postmenopausal patients, this ratio is about 4:1.[2,4]

What causes lupus?

The aetiology of SLE is not fully understood. Genetic, environmental, immunological and infective factors are all thought to play a role.[1] It is hypothesised that a trigger acts on genetically susceptible indivi­ duals, and complex immune dysregulation of multiple components of the immune system as well as disordered apoptosis result in the production of autoantibodies that are particularly active against proteins in the cell nucleus. Recent evidence is emerging to illustrate the intertwined roles of the adaptive and innate immune system in this disease, and type 1 interferon has been shown to play a prominent role in the development of SLE.[8]

What diagnostic criteria exist?

SLE is diagnosed clinically and in the laboratory. It is based on the American College of Rheumatology (ACR) Classification Criteria for SLE, which were revised in 1997.[9] Four of the 11 criteria are required to make the diagnosis. These criteria were established mainly for use in scientific research; therefore many children, especially those with lupus nephritis (LN) or antiphospholipid syndrome, might have SLE without fulfilling four of the criteria.

The Systemic Lupus International Collaborating Clinics (SLICC) Classification Criteria for SLE have recently been proposed and validated in adults with lupus, and have been shown to have greater sensitivity but lower specificity compared with the ACR criteria. It requires four criteria with at least one clinical and one immunological criterion to be present to make the diagnosis.[10]

How do children with lupus present?

Globally, the presenting features differ, which is one of the reasons that SLE can be difficult to diagnose. It remains problematic to establish whether a specific symptom or sign will occur in any individual or any group of patients, although cSLE is known to be more severe at diagnosis when compared with adult-onset SLE. In 2005, a cohort of 36 patients from Gauteng, including 14 black African children, was reported on, concluding that SLE is being increasingly recognised in black SA children.[11] A recent study from Cape Town reports on 68 patients, with a median age of 12.2 years and an approximate female to male ratio of 5:1. The

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

study included a larger proportion of black and coloured patients than previous studies.

This cohort of patients presented with severe disease at diagnosis, with most of them having LN. Preliminary findings show these children presenting with high disease activity and progression to end-organ damage at higher rates than in developed nations.[12] Table 1 summarises the common clinical features of cSLE. Almost all children present with constitutional symptoms, e.g. fever, lymphadeno­ pathy and weight loss, mimicking tuberculosis (TB) and HIV in our setting.[13] Worldwide, common presenting features in cSLE are arthritis, malar rash and renal involvement.[4,13,14] In SA, cutaneous (77%) and constitutional (55.5%) features as well as renal involvement (44 - 50%) have been shown to be common presenting features. Other presenting features in SA children included serositis and Raynaud’s phenomenon.[11,12] SLE presenting in childhood seems to have more frequent renal and neurological organ involvement, which heavily influences prognosis and therapy. It is essential to screen all children with SLE for these major manifestations.[4,11]

Which investigations should be performed?

When investigating children with suspected SLE, the ACR criteria may be used to guide the initial investigations. Table 2 gives an out­line of the investigations in a stepwise pattern.

Antinuclear antibody (ANA) testing and anti-extractable nuclear antigen form the mainstay of serological testing for SLE. Autoantibodies directed to nuclear antigens consist of various types of antibodies characterised by different antigen speci­ ficities. These nuclear antigens include single- and double-stranded DNA (ds DNA), histone proteins (histone DNA complex), nucleosome, centromere proteins and extractable nuclear antigens (including antiSmith, Ro, La, ribonucleoprotein). Under­ standing the specificities of the antibodies is useful in clinical practice to further classify patients with lupus and help predict their disease course.[15,16]

Management

The management of cSLE is difficult and referral to specialists in this field is essential.

While there is no single cure for the disease, the aim of therapy at all stages of cSLE is to maximise the therapeutic effect while minimising disease activity and adverse effects. It is important to base treatment decisions on the systems/organs involved and the severity of the disease. SA is still

Table 1. Common clinical features of cSLE Estimated presence of involvement, % Clinical feature

Paediatric SLE literature[4,13,14]

South Africa [11,12]

Any constitutional feature

100

55.5

Fever

39

Lymphadenopathy

11 - 20

33.3

Arthritis

61 - 64

38.8

Nephritis

28 - 62

44.4

Mucocutaneous

77

Malar rash

55 - 62

47

Neuropsychiatric

15 - 20

19

trying to recover from the apartheid system and its inequalities in healthcare provision.[17] Recommendations can be made to offer our children the most appropriate management.

The approach to management can be thought of as a 6-step process: using the multidisciplinary team (MDT), initial induction treatment, maintenance therapy, adjuvant therapy, managing disease flares, and disease monitoring.[8,18,19]

Multidisciplinary team

All children with SLE should be managed in a specialist paediatric centre, preferably with access to paediatric rheumatologists, paediatric nephrologists and appropriate support staff. A comprehensive MDT is essential. Patients should be assessed individually and their specific needs addressed on a patient-to-patient basis.

SLE is a life-long condition with a natural course of chronicity, with disease flares and accumulation of organ damage. Anticipating potential problems and planning for these in advance can help to reduce the impact of the disease on the patient and the child’s family.

Adolescence is a dangerous time for all patients with chronic medical conditions, and lupus is no exception. There are many potential pitfalls at this time, including non-compliance, recreational drug use, psychosocial issues and pregnancy, which should be addressed. The transitional process through adolescence into adulthood should be carefully planned, with the involvement of the patient, their family and the MDT.

Initial induction treatment

Induction treatment should only be given after discussion with paediatric specialists, preferably those with knowledge of cSLE. This usually occurs in the first 6 - 12 months after diagnosis and is based on the use of high-dose immunosuppressive therapy to achieve disease stabilisation. Currently this is done initially with intravenous

December 2015, Vol. 105, No. 12

methylprednisolone (30 mg/kg per dose for 3 days), together with immunosuppressive therapy and disease-modifying drugs.

Weaning of the corticosteroid dose must be gradual and supervised carefully by an experienced team.

Although the use of corticosteroids remains the first line of treatment, it is essential that every effort be made to minimise the dosage because of the extensive adverse effect profile. Steroid-free induction regimens are being developed and show some early promise as an appropriate treatment option, while reducing sideeffects.[8,18,19] Long-term efficacy has been demonstrated for intravenous cyclophosphamide-based regimens (500 - 750 mg/m2 per month for 6 months). It can be particularly useful in patients with neurological, renal or systemic vasculitis and is more readily available in SA compared with some of the other immunosuppressive medications.[8,19] Mycophenolate mofetil (MMF) is an alternative treatment option and recent trials have demonstrated similar efficacy to cyclophosphamide, especially in patients with moderate to severe forms of LN, with a more favourable toxicity profile.[8,19] Azathioprine and methotrexate are other options available in SA. They are both used with corticosteroids in patients with mild to moderate disease. Azathioprine is useful in maintenance therapy for patients with LN and can be used to delay the presentation of neuropsychiatric manifestations of SLE. Methotrexate has been shown to be an effective agent in controlling cutaneous and articular manifestations of the condition.[19] Newer biologics are currently being used for the treatment of cSLE, but are not readily available in SA.[20] Belimumab is the only biologic drug registered by the US Food and Drug Administration for use in SLE. It is a monoclonal antibody to the soluble human B lymphocyte stimulator protein and is the

CONTINUING MEDICAL EDUCATION

Table 2. Outline of investigations in stepwise pattern Investigation

Explanation

Initial essential investigations Full blood count

For anaemia, leucopenia and thrombocytopenia

Electrolytes, urea and creatinine

Assess the renal function

Urine dipstick, microscopy, protein: creatinine ratio and urinary red blood cell casts

Check for both haematuria and proteinuria. LN is commonly present at diagnosis in children, especially in African children, and impacts on the initial management and long-term morbidity and mortality

Complement levels – C3, C4 and total complement levels

Often reduced in SLE

ESR or CRP

Indicates current inflammation The level of ESR elevation may show a discrepancy relative to a normal CRP level in flares; if both markers are elevated, suspect the presence of an infective process

Autoantibody and serological tests – immunological tests looking for autoantibodies should be performed ANA

These are the common autoantibodies found in patients with SLE – used as a screening test.

By definition, all patients should be ANA positive at diagnosis. However, there are a small proportion of patients who are negative at diagnosis and become positive later in the disease.

Not specific for SLE, as up to 30% of the population are low-titre positive

Anti-ds DNA antibody

High specificity but sensitivity only 70%. Level varies depending on disease activity, so can be used to monitor the clinical course. Shown to be increased in patients with LN and in neuropsychiatric lupus

Anti-Smith antibody

Specific but not sensitive marker of SLE. Reactivity is not described in other diseases

Antiphospholipid antibodies: anticardiolipin, β2-glycoprotein-1 and lupus anticoagulant

Associated with the anti-phospholipid syndrome, cerebral vascular disease and neuropsychiatric lupus

Antinucleosome antibodies

The first serological marker of SLE described and considered a major autoantigen in SLE – positive in about 85%. An excellent marker for SLE, playing an important role in pathogenesis.

A good predictor of flares

Anti-Ro and anti-La antibody

Particularly relevant in female adolescents who are considering having children. Known to play a role in the cardiac manifestations of neonatal lupus and photosensitivity

Syphilis test

A false-positive serological test for syphilis is also in the ACR diagnostic criteria for SLE

Supplementary investigations, depending on history, examination and presenting clinical features Liver function tests

May be mildly elevated in acute SLE

Haemolysis work-up – includes a reticulocyte count, lactate dehydrogenase, haptoglobin, blood smear and a direct Coombs test

Perform if the haemoglobin level is low and/or haemolysis is suspected

Renal biopsy

If renal involvement is present, a renal biopsy may be necessary. These should be classified according to the International Society of Nephrology and the Renal Pathology Society staging score

Chest radiograph

For pericardial or pleural effusion, evidence of pericarditis, interstitial lung disease, pneumonitis and pulmonary embolism. In SA it is useful to look specifically for any radiological signs of tuberculosis

Electrocardiogram

For evidence of pericarditis or pericardial effusion

Echocardiography

For pericardial effusion or pulmonary hypertension

Tuberculin skin test

Can be used mainly in younger patients to screen for tuberculosis

Ophthalmological examination

For evidence of optic neuritis

Lumbar puncture

To exclude infection with fever or neurological symptoms or signs. Nonspecific elevations in cell count and protein level and a decrease in glucose level may be found in the cerebrospinal fluid of patients with CNS lupus

Brain magnetic resonance imaging/magnetic resonance angiography

To evaluate for CNS lupus white matter changes, vasculitis or stroke

Skin biopsy

Can be helpful in diagnosing SLE in patients with unusual skin rashes. Many different rashes may indicate SLE and review by a dermatologist is important

CK

May be elevated in myositis

ESR = erythrocyte sedimentation rate; CRP = C-reactive protein; ANA = antinuclear antibody; CNS = central nervous system; CK = creatinine kinase; LN = lupus nephritis.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

only biologic agent to demonstrate efficacy in adult SLE randomised controlled trials. Studies involving children are currently underway.

Rituximab is currently being used off-label for select patients in the SA public health sector. It is commonly used for patients with SLE, despite the optimal dose of administration and indications of treatment being uncertain.[8,20] Although not routine, plasma exchange and intravenous immuno­globulin therapy are sometimes used by specialist physicians with experience of cSLE for specific indications. The main indications are in rapidly progressive life-threatening disease, neuropsychiatric lupus refractory to conventional treatment and idiopathic thrombocytopenic purpura.[19]

Managing disease flares

Maintenance therapy

Disease monitoring

Ongoing maintenance therapy is usually with weaning doses of oral corticosteroids in conjunction with disease-modifying agents as discussed above. Cyclophosphamide, MMF, azathioprine and rituximab are used, depending on disease severity and systems involved. Maintenance therapy has to be continued for several years to achieve ongoing disease remission and prevent steroid toxicity.[8,18,19]

Adjuvant therapy

An often overlooked key factor in the care of children with SLE is the importance of adjuvant therapy (Table 3).

Disease flares are a common occurrence in cSLE. They should be screened for and managed aggressively according to the severity of presentation and organ system involved. It is important to address compliance, changes in the social situation, as well as patient and family psychosocial well-being.

Drug doses should be reviewed and may need to be altered according to the child’s growth. There is often a problem of accessing healthcare and medication in SA. These problems, although not always easy to solve, must be addressed in patients presenting with disease flares.[17] SLE patients are at an increased risk of infections – these should be actively sought for in any patient presenting with a disease flare.

Deciding whether a child with SLE has a greater or lesser degree of disease activity and determining how to avoid disease damage are essential for patient management. It is not possible to use one individual clinical sign or laboratory value to measure the progression of the disease. To help with this, indices of disease activity and damage have been developed for use in adults with SLE; the same indices are being used in children.[14,22] Disease damage can be evaluated using the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) and the British Isles Lupus Assessment Group (BILAG) score.[23,24] The only available instrument for measuring disease damage is the SLICC/ACR Damage Index, which looks at both disease-specific

Table 3. Adjuvant therapy Therapy

Explanation

Antimalarials, e.g. hydroxychloroquine

One of the most important recent advances in SLE management has been that all children with the condition must be treated with hydroxychloroquine. It plays a role in disease modification, helps with steroid sparing and can reduce the risk of disease flares. It is also associated with higher rates of renal response and fewer renal relapses[8,18,19]

NSAIDs

NSAIDs have a role in reducing inflammation and giving symptomatic pain relief, especially for those with predominant musculoskeletal involvement. Care must be taken due to the adverse side-effect profile, particularly when dealing with children with LN, where these drugs may exacerbate renal disease[18]

Skin protection

Skin protection from sunlight with specific clothing and high-factor sunscreen is critical, especially in a climate as in SA, and will reduce symptoms and long-term skin damage[18,19]

Vitamin and mineral supplementation, especially vitamin D

Essential to the general health of the patient. Vitamin D is most important in patients with photosensitivity, but should be given to all children with SLE, as it has recently been shown to have immunomodulatory effects[18,19]

Aspirin/anticoagulation

Patients with SLE and positive antiphospholid antibodies but without a previous thrombotic event should receive low-dose aspirin. Patients with definite antiphospholipid syndrome and a previous thrombotic event require anticoagulation therapy, targeting an international normalised ratio of 2.0 - 3.0[19]

Angiotensin-converting enzyme inhibitors

Should be used to manage hypertension and proteinuria to reduce the risk of further organ damage[18]

Vaccinations

Routine vaccination schedules should be used to keep children up to date with their immunisations, although caution is advised with regard to live vaccines in severely immunosuppressed children. Infections are the most common cause of death in patients with lupus, and pneumococcal infection is particularly prevalent. Therefore, pneumococcal and annual influenza vaccination should be encouraged[21]

Tuberculosis screening and prevention

Tuberculosis is a highly prevalent condition in SA and a high index of suspicion is needed in lupus patients, especially if they are on immunosuppressive therapy. Regular screening may be necessary, depending on the disease prevalence and immune status of the patient. Isoniazid prophylaxis may be required in exposed at-risk patients

ESRD

Renal dialysis and renal transplantation are options for patients with ESRD and transplantation has been shown to be effective in children with LN.[19] However, this results in a huge financial strain on an already over-burdened health system, and with the previous treatment, the aim is to halt the progression to ESRD in patients with LN

ESRD = end-stage renal disease; NSAIDs = non-steroidal anti-inflammatory drugs;

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

and non-disease-specific damage and quantifies non-reversible cumulative damage that has occurred since the onset of the disease.[22]

Mortality

In SLE, there is a bimodal pattern of mortality, either from initial disease activity or from complications relating to either the disease itself or therapies used in the treatment of the disease.[25] Renal disease is one of the major poor prognostic factors.[4] Recent improvements in early diagnosis, recognition of milder forms and improved management strategies account for the improvement in mortality in cSLE. In 1981, the 5-year survival rate for cSLE was reported as 82%, but in some more recent studies this figure has increased to 95%.[13] According to Wadee et al.,[26] the 5-year survival probability was between 57% and 72% in SA adults. This was thought to be due to an inherently more aggressive disease pattern in black Africans.

When to refer children with lupus

All SA children with SLE should be referred to a paediatric specialist.

If the distance to travel is too far, a telephonic management plan should be made with a paediatric rheumatologist or nephrologist. A paediatric rheumatologist, nephrologist or paediatric specialist with an interest in lupus should see the child as soon as is feasible.

Summary

• Lupus in children is a rare but serious condition. Recent updates have shown that SLE is being increasingly recognised in southern Africa, particularly in black African children. In childhood SLE, there is a higher proportion of males affected than in adult-onset disease.

• In SA, children present with severe disease, and renal involvement is common.

• The management of cSLE needs to have early specialist input, and there should be access to a MDT.

Key points

• SLE is becoming increasingly recognised in black SA children.

• In SA, children present with severe disease, particularly with renal disease.

• Every patient with suspected lupus should have their urine analysed for protein and blood.

• A structured approach to investigation and management can help the overall care of the child.

• All children with SLE should be referred to a paediatric rheumatologist, nephrologist or paediatric specialist with know­ ledge of cSLE. • A multidisciplinary approach to management is essential.

References 1. Cassidy JT, Petty RE, Laxer RM, Lindsley L.Textbook of Pediatric Rheumatology. 6th ed. Philadelphia: WB Saunders, 2011:315-318.

2. Danchenko N, Satia JA, Anthony MS. Epidemiology of systemic lupus erythematosus: A comparison of worldwide disease burden. Lupus 2006;15:308-318. [http://dx.doi.org/10.1191/0961203306lu2305xx] 3. Pons-Estel GJ, Alarcón GS, Scofield L, Reinlib L, Cooper GS. Understanding the epidemiology and progression of systemic lupus erythematosus. Semin Arthritis Rheum 2010;39:257-268. [http://dx.doi. org/10.1016/j.seminarthrit.2008.10.007] 4. Cervera R, Khamashta MA, Font J, et al., and the European Working Party on Systemic Lupus Erythematosus. Systemic lupus erythematosus: Clinical and immunologic patterns of disease expression in a cohort of 1000 patients. Medicine 1993;72:113-124.

5. Hiraki LT, Benseler SM, Tyrell PN, Harvey E, Hebert D, Silverman E. Ethnic differences in pediatric systemic lupus erythematosus. J Rheumatol 2009;36:2539-2546. [http://dx.doi.org/10.3899/jrheum.081141] 6. Khuffash FA, Majeed HA, Lubani MM, Najdi KN, Gunawardana SS, Bushnaq R. Epidemiology of juvenile chronic arthritis and other connective tissue diseases among children in Kuwait. Ann Trop Paediatr 1990;10:255-259.

7. Tiffin N, Hodkinson B, Okpechi I. Lupus in Africa: Can we dispel the myths and face the challenges?

Lupus [Epub 30 October 2013] [http://dx.doi.org/10.1177/0961203313509296] 8. Midgley A, Watson L, Beresford MW. New insights into the pathogenesis and management of lupus in children. Arch Dis Child 2014;99:563-567. [http://dx.doi.org/10.1136/archdischild-2013-304397] 9. Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum 1997;40:1725. [http://dx.doi.org/10.1002/art.1780400928] 10. Petri M, Orbai A-M, Alarcon GS, et al. Derivation and validation of the systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum 2012;64:2677-2686. [http://dx.doi.org/10.1002/art.34473] 11. Faller G, Thomson PD, Kala UK, Hahn D. Demographics and presenting clinical features of childhood systemic lupus erythematosus. S Afr Med J 2005;95:424-427.

12. Lewandowski L, Schanberg L, Thielman N, Scott C. PULSE – Pediatric Update on Lupus in South Africa: Epidemiology and Management. American College of Rheumatology meeting, November 2014, Boston, MA, USA. 13. Gonzalez B, Hernandez P, Olguin H, et al. Changes in the survival of patients with systemic lupus erythematosus in childhood: 30 years experience in Chile. Lupus 2005;14:918-923. [http://dx.doi. org/10.1191/0961203303lu2183xx] 14. Hiraki LT, Benseler SM, Tyrrell PN, Hebert D, Harvey E, Silverman ED. Clinical and laboratory characteristics and long-term outcome of pediatric systemic lupus erythematosus: A longitudinal study. J Pediatr 2008;152:550-556. [http://dx.doi.org/10.1016/j.jpeds.2007.09.019] 15. Cozzani E, Drosera M, Gasparini G, Parodi A. Serology of lupus erythematosus: Correlation between immunopathological features and clinical aspects. Autoimmune Dis 2014;2014:321359. [http://dx.doi. org/10.1155/2014/321359] [Epub 6 February 2014] 16. Yaniv G, Twig G, Shor DB, et al. A volcanic explosion of autoantibodies in systemic lupus erythematosus: A diversity of 180 different antibodies found in SLE patients. Autoimmun Rev 2015;14: 75-79. [http://dx.doi.org/10.1016/j.autrev.2014.10.003] 17. Lewandowski LB, Scott C. Apartheid and healthcare access for paediatric systemic lupus erythematosus patients in South Africa. S Afr J Child Health 2015;9:36-37. [http://dx.doi.org/10.7196/sajch.869] 18. Bertsias G, Ioannidis JPA, Boletis J, et al. EULAR recommendations for the management of systemic lupus erythematosus. Report of a Task Force of the EULAR Standing Committee for International Clinical Studies Including Therapeutics. Ann Rheum Dis 2008;67: 195-205. [http://dx.doi.org/10.1136/ard.2007.070367] 19. Arici ZS, Batu ED, Ozen S. Reviewing the recommendations for lupus in children. Curr Rheumatol Rep 2015;17(3):17. [http://dx.doi.org/10.1007/s11926-014-0489-5] 20. Tarr G, Hodkinson B, Reuter H. Superheroes in autoimmune warfare: Biologic therapies in current South African practice. S Afr Med J 2014;104:787-791. [http://dx.doi.org/10.7196/SAMJ.8947] 21. Heijstek MW, de Bruin LMO, Bijl M, et al. EULAR recommendations for vaccination in paediatric patients with rheumatic diseases. Ann Rheum Dis 2011;70:1704-1712. [http://dx.doi.org/10.1136/ard.2011.150193] 22. Gladman DD, Ginzler E, Goldsmith C, et al. The development and initial validation of the Systemic Lupus International Collaborating Clinics/American College of Rheumatology Damage Index for systemic lupus erythematosus. Arthritis Rheum 1996;39:363-369. [http://dx.doi.org/10.1002/art.1780390303] 23. Bombardier C, Gladman DD, Urowitz MB, Caron D, Chang CH. Derivation of the SLEDAI: A disease activity index for lupus patients. Arthritis Rheum 1992;35:630-640. [http://dx.doi.org/10.1002/art.1780350606] 24. Brunner HI, Feldman BM, Bombardier C, Silverman ED. Sensitivity of the Systemic Lupus Erythematosus Disease Activity Index, British Isles Lupus Assessment Group Index, and Systemic Lupus Activity Measure in the evaluation of clinical change in childhood onset systemic lupus erythematosus.

Arthritis Rheum 1999;42:1354-1360. [http://dx.doi.org/10.1002/1529-0131(199907)42:7] 25. Urowitz MB, Bookman AA, Koehler BE, Gordon D, Smythe HA, Ogryzlo MA. The bimodal pattern of systemic lupus erythematosus. Am J Med 1976;60:221-225. [http://dx.doi.org/10.1016/0002-9343(76)90431-9] 26. Wadee S, Tikly M, Hopley M. Causes and predictors of death in South Africans with systemic lupus erythematosus. Rheumatology 2007;46:1487-1491. [http://dx.doi.org/10.1093/rheumatology/kem180]

Continuing medical education resources ACR criteria. http://www.rheumatology.org/Portals/0/Files/1997%20Update%20of%201982%20Revised. pdf (accessed 13 November 2015).

SLICC criteria. http://www.rheumtutor.com/2012-slicc-sle-criteria/ (accessed 13 November 2015).

SLICC/ACR Damage Index. http://www.ncbi.nlm.nih.gov/pubmed/10685799 (accessed 13 November 2015).

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

Infections in the management of rheumatic diseases: An update S A Botha-Scheepers, MD, PhD (The Netherlands); B Sarembock, MB ChB, FCP (SA), Cert Rheumatology (SA) Division of Rheumatology, Department of Medicine, Faculty of Health Sciences, Groote Schuur Hospital and University of Cape Town, South Africa Corresponding author: S A Botha-Scheepers (stella.botha@uct.ac.za)

Patients with inflammatory rheumatic conditions have an increased risk of infection. While this could be the result of the underlying disease, it may also be caused by the use of immunosuppressive therapies, which are needed to treat these disorders. An increasing number of patients with rheumatoid arthritis or other rheumatic diseases are using biologic therapies (biologics) in addition to the synthetic diseasemodifying anti-rheumatic drugs. The side-effects and complications of these relatively new agents are unknown to many specialists (outside of rheumatology) and general practitioners. This article highlights updates on the most important infections encountered in the daily management of patients with rheumatic diseases and discusses how these may be prevented.

S Afr Med J 2015;105(12):1076. DOI:10.7196/SAMJ.2015.v105i12.10220

Viral infections

Patients with inflammatory rheumatic conditions have an increased risk of infection, including viral infections.[1] Rheumatological manifestations, such as arthritis, are also relatively common occurrences with viral infections.

Hepatitis B

The prevalence of hepatitis B virus (HBV) in rheumatic patients has recently been reported at ~3% in a large cross-sectional study on comorbidities, which included almost 4 000 rheumatoid arthritis (RA) patients at 17 centres worldwide.[2] The prevalence differed according to geographical area – more infections in Asia and fewer in Europe and the USA. However, it demonstrates this common problem in daily rheumatological practice owing to the risk of hepatitis B reactivation through immunosuppressive therapy.

According to the American College of Rheumatology (ACR) guidelines and the views of experts, RA patients should be screened for HBV before initiation of methotrexate, leflunomide and biologic therapies.[3] Patients with chronic hepatitis B should receive treatment with oral antivirals before starting therapy. Those with significant liver damage should, however, not receive these immunosuppressive drugs.

There are no guidelines with regard to the use of synthetic disease-modifying anti-rheumatic drugs (sDMARDs) and biologics in patients with a history of hepatitis B infection (hepatitis B core antibody positive). A significant population of those who were exposed to HBV, have cleared the virus. Depending on the prevalence of chronic HBV infection, the prevalence of past HBV infection varies between 5% and 80% worldwide. In the literature on haematology (lymphomas), rituximab-containing chemotherapy regimens lead to reactivation in 3 - 25% of patients with past HBV infection.[4] As data are limited, it is not clear if pre-emptive antiviral prophylaxis is needed in a rheumatological setting, but recently a large prospective study in >1 200 RA patients demonstrated a risk of reactivation in cases of previous HBV infection (15%) treated with biologics.[5] The majority were treated with anti-tumour necrosis factor (antiTNF), but rituximab and other biologics were also used. It was reassuring that there were no observed cases of HBV reactivation

during biologic treatment. This confirms the results of previous studies that the risk of HBV reactivation in patients with rheumatic diseases and a history of HBV infection treated with anti-TNF and rituximab is very low.[6] However, more studies should be done to assess the need for pre-emptive antiviral prophylaxis in patients with past HBV infection. In practice, regular monitoring for viral reactivation during therapy, particularly in patients lacking evidence of immunity (HBsAb negative), is necessary. If the transaminase levels are increased, HBV DNA should be checked and antiviral therapy initiated if reactivation occurs.

Hepatitis C

Hepatitis C virus (HCV) infection is a major global health problem, with a prevalence of 2.8%. Universal screening for individuals between the ages of 45 and 65 years is recommended by the US Centers for Disease Control and Prevention (CDC).[7] HCV can be associated with rheumatic syndromes, such as the potentially serious rheumatic complication of HCV-associated cryoglobulinaemic vasculitis (CV).

To treat HCV, interferon alpha (IFNα)-based regimens can achieve viral clearance in about 50% of patients, but it has many side-effects (e.g. cytopenias, depression, flu-like symptoms) and renal impairment is a contraindication. New oral direct-acting antivirals (DAAs) are being introduced into clinical practice. A prospective cohort study on treatment with a combination of first-generation DAAs with PegIFNα and ribavirin in 30 patients with severe refractory CV, who were not responding to standard treatment with antiviral therapy, was published recently.[8] After 1 year of treatment, 67% of these patients showed a clinical response, with total clearance of the virus. However, there were many side-effects, such as cytopenias and infections.

Fortunately, the newer DAAs, which target specific proteins such as non-structural protein 3b/4A/5A, will it is hoped signal the end of interferon use in HCV patients in the future.[9,10] These new drugs could possibly cure the disease in >90% of patients, with fewer side-effects. They are extremely expensive and only administered to patients with the highest risk of complications, such as those with CV with end-organ manifestations.[11] Despite the high cost, they are considered to be cost-effective.[12] Data on these new drugs in patients with rheumatic diseases are confined to a few case reports, but several trials are currently underway.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Data on the use of biologics in patients with hepatitis C infections are scarce. Biologics are contraindicated in cases of acute or chronic HCV infection with significant liver damage, as progression of HCV has been described in such patients who receive biologics. In RA patients with chronic HCV infection without significant liver damage, rituximab and anti-TNF (the ACR suggests etanercept as the preferred anti-TNF) may be used, but monitoring of serum transaminases is advised.

Herpes zoster

Reactivation of the latent varicella zoster virus causes herpes zoster (HZ), a painful vesicular skin rash that could be complicated by chronic pain and post-herpetic neuralgia. In patients with rheumatic disease, the incidence of HZ is almost 12 times higher in RA, 20 times higher in systemic lupus erythematosus (SLE) and 45 times higher in Wegener’s granulomatosus.[13] This increased risk of HZ is caused by the underlying disease, especially in those receiving immunosuppressive therapy.[14] A recent review showed that there was some increased risk with the use of biologics (anti-TNF) and sDMARDs,[15] but that high-dose corticosteroids and cyclophosphamide led to the highest increase in risk.

HIV

HIV can cause several rheumatological manifestations, including an inflammatory polyarthritis mimicking RA. Therefore, an HIV test may be useful in patients presenting with inflammatory arthritis. HIV can also result in several challenges in the management of patients with rheumatic diseases, who are also HIV-positive, especially if not on antiretroviral treatment. Data on the safety of immunosuppressive drugs in HIV-positive patients are limited, but there have been reports on the use of sDMARDs and TNF-α inhibitors to treat RA or other inflammatory conditions in HIV infection.[16,17] In general, these reports suggest that DMARDs such as methotrexate and antiTNF are tolerated well by HIV-positive patients, provided that the patients are on an effective antiretroviral regimen before the start of therapy.

Vaccinations

According to the latest recommendations by the CDC, immuno­ compromised patients such as those with rheumatic diseases should receive killed (pneumococcal, annual intramuscular influenza and hepatitis B) and recombinant (human papillomavirus (HPV)) vaccines before starting an sDMARD or a biologic.[18] It also recommends that, if not previously done, vaccination with pneumococcal, intramuscular influenza, HBV and HPV vaccines should be done in patients already taking an sDMARD or a biologic.

All vaccines should be given based on age and risk, and physicians should refer to vaccine instructions and CDC recommendations for details about dosing and timing. Importantly, both the pneumococcal polysaccharide vaccine (PPSV23) and the 13-valent conjugate pneumococcal vaccine (PCV13) should be given. In non-immunised patients, one should start with the PCV13, then wait for 2 months, and thereafter administer the PPSV23 vaccine. In patients <65 years of age, a repeat dose of the PPSV23 should be given after 5 years. Live virus vaccines (such as the live attenuated influenza vaccine; measles, mumps, rubella) should not be administered to immunosuppressed patients with rheumatic diseases.

The COMORA study showed how often patients with rheumatic diseases were being vaccinated.[2,19] This study was performed at 17 centres worldwide, where 25% of RA patients had received an influenza vaccination in the past year, 17% a pneumococcal vacci­ nation in the past 5 years, and only 10% both vaccinations. It is

not known how often South African (SA) patients with rheumatic diseases are vaccinated, but this shows that clinicians, especially rheumatologists, must do more to ensure adequate vaccination in these patients.

Efficacy and safety of the HZ vaccine

In immunocompetent individuals the risk of HZ can be reduced by 50 70% with a live attenuated vaccine.[20] According to the ACR guidelines, the live HZ vaccine may be given to all patients with rheumatic diseases before starting immunosuppressive therapy.[3] Once on such therapy, patients may receive the vaccine if treated with sDMARDs (monoor combination therapy), but it is contraindicated in those receiving biologics or high-dose steroids (prednisone >20 mg/day) owing to a concern of developing a varicella infection from the vaccine virus strain.

Recently a study on the association between HZ vaccination and the risk of HZ infection in patients with immune-mediated diseases such as RA, psoriatic arthritis and ankylosing spondylitis was published.[21] Of the 465 000 patients, <5% were vaccinated against HZ. The vaccine, however, showed a similar efficacy in healthy individuals, with a decreased risk of HZ (adjusted hazard ratio (HR) 0.61) and an 80% decrease in post-herpetic neuralgia. Interestingly, in the 633 patients who were treated with biologics (87% on antiTNF), there were no cases of varicella or HZ. The ACR published an update suggesting that it may be reasonable to discontinue a biologic for a period, administer the HZ vaccine and then resume the biologic after 30 days.

Tuberculosis

The 2012 ACR guidelines recommend screening for latent tuber­ culosis (TB) infection (LTBI) in all patients with rheumatic diseases being considered for biologic therapy, regardless of the presence of risk factors.[3] Doctors should assess the patient’s medical history to identify other risk factors (such as smoking and corticosteroid use) for TB and perform the tuberculin skin test (TST) or interferon-gammarelease assays (IGRAs) initially in all patients starting biologic agents.

Patients should have a chest radiograph and, if suggestive of active TB, a sputum examination should be done to test for the presence of active TB. In a high-prevalence TB setting such as SA, these screening tests are not always reliable and there is little consensus on the most appropriate test,[22] but a TST and/or an IGRA (if deemed appropriate by the clinician) may be performed. If both tests are used, they should be done at the same time, as TST could boost IGRA responses, which may confound the interpretation of the results.

Chemoprophylactic drugs for LTBI may be either isoniazid (INH) for 9 months or rifampicin combined with INH for 3 months.

Treatment with biologic agents can be initiated or resumed after 1 month of LTBI treatment and after completion of the treatment of active TB. Some experts and studies suggest that non-TNF biologic therapies, such as rituximab and abatacept, are safer and better choices as firstline biologics in patients in high-burden settings.[23] It remains uncertain how to manage RA patients with a negative initial screening for TST or IGRA on chronic biologic therapy.

In low-prevalence TB settings patients may not need further evaluation in the absence of risk factors and/or clinical suspicion for TB. However, patients may have false-negative TST or IGRA results owing to immunosuppression. Therefore, a negative TST or IGRA does not exclude the possibility that a patient has LTBI. An updated consensus statement by the ACR recommends that repeat screening should be considered in areas of high TB risk populations or in the case of potential TB exposure. Recent studies, however, have shown that TB conversions may occur during anti-TNF therapy in ~10% of RA patients.[24] It is unclear

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

if these conversions always represent ‘true conversions’. More data are needed to make recommendations regarding rescreening in the absence of definite TB exposure.

Serious infections in RA

It is not well understood why patients with RA have an increased prevalence of other serious infections, particularly pulmonary, urinary tract, skin, and joint infections. Factors that may contribute include immunosuppression by the disease, treatment of the disease, presence of inflammatory lung disease, or factors associated with disability and immobility. Compared with the increased risk of infection associated with the use of corticosteroids and biologics, the sDMARDs do not appear to be associated with such a risk.

Biologics have been used in RA for almost 15 years and rheuma­ tologists have gained much experience with these drugs. A large number of randomised controlled trials have been published on their efficacy and safety, and data exist from national registries worldwide. An important question that often arises with regard to a patient taking these drugs is: ‘What is the risk of a serious infection when on biologic therapy compared with being on sDMARDs?’ A number of meta-analyses have assessed this risk.[25-27] Recently, the largest meta-analysis to date (>42 000 patients) assessed the rate of serious infection in RA.[28] The authors found that if the rate of serious infection on standard doses of biologic therapy (with or without sDMARDs) is compared with that of sDMARD mono­therapy, the risk is increased by 30% (odds ratio 1.31). It is important to understand what this means in absolute numbers. The absolute annual risk for serious infections when using sDMARD monotherapy is 2%. Therefore, 2% of the RA population on sDMARDs experience a serious infection every year. The risk was increased by 30% when using biologic therapy, resulting in an absolute risk of 2.6%. The absolute increase in the number of serious infections compared with traditional DMARDs was 6/1 000 patients per year for standard-dose biologic therapy with or without traditional DMARDs. One would therefore have to treat 1 000 RA patients with biologic therapy to cause 6 more serious infections compared with traditional DMARDs.

Serious infections in SLE

The risk of serious infections in cases of SLE was reviewed recently.[29] In SLE, 20 - 30% of deaths are caused by infections. In a US study, the rate of serious infections in SLE was ~10.8/100 patient-years, which is approximately 5 times higher than in RA patients.[30] In lupus nephritis (LN) this risk was almost 12 times higher than in RA patients, i.e. 23.9/100 patient-years. Men and black patients with SLE were found to have an increased risk of serious infection. In this study, traditional immunosuppressive therapy in SLE, such as azathioprine, mycophenolate mofetil and cyclophosphamide, showed a 10% increased risk (HR 1.11), but not in the LN group (HR 0.92). With the use of corticosteroids there was an increased risk of >50% (HR 1.51) in SLE and almost 25% in LN patients (HR 1.23).

Interestingly, the rate of serious infections was decreased by almost 30% in SLE and 20% in LN when using chloroquine. The most common serious infections in SLE are bacterial, such as pneumonia, urinary tract infection, opportunistic infection, sepsis and skin infections.[31] These studies confirm the importance of limiting the dose of corticosteroids in SLE patients.

Conclusion

Patients with rheumatic diseases have an increased risk of infections owing to their condition and immunosuppressive therapies. This article highlights the latest research findings with regard to the

most important infections encountered in the daily management of patients with rheumatic diseases. This knowledge can be used when balancing the potential harm and the clinically important benefits of sDMARDs and biologics and will assist patients and their physicians to make evidence-based decisions.

References 1. Falagas ME, Manta KG, Betsi GI, Pappas G. Infection-related morbidity and mortality in patients with connective tissue diseases: A systematic review. Clin Rheumatol 2007;26(5):663-670. [http://dx.doi. org/10.1007/s10067-006-0441-9] 2. Dougados M, Soubrier M, Antunez A, et al. Prevalence of comorbidities in rheumatoid arthritis and evaluation of their monitoring: Results of an international, cross-sectional study (COMORA). Ann Rheum Dis 2014;73(1):62-68. [http://dx.doi.org/10.1136/annrheumdis-2013-204223] 3. Singh JA, Furst DE, Bharat A, et al. 2012 update of the 2008 American College of Rheumatology recommendations for the use of disease-modifying antirheumatic drugs and biologic agents in the treatment of rheumatoid arthritis. Arthritis Care Res 2012; 64(5):625-639. [http://dx.doi.org/10.1002/ acr.21641] 4. Kim HY, Kim W. Chemotherapy-related reactivation of hepatitis B infection: Updates in 2013. World J Gastroenterol 2014;20(40):14581-14588. [http://dx.doi.org/10.3748/wjg.v20.i40.14581] 5. Barone M, Notarnicola A, Lopalco G, et al. Safety of long-term biologic therapy in rheumatologic patients with a previously resolved hepatitis B viral infection. Hepatology 2015;62(1):40-46. [http:// dx.doi.org/10.1002/hep.27716] 6. Caporali R, Bobbio-Pallavicini F, Atzeni F, et al. Safety of tumor necrosis factor alpha blockers in hepatitis B virus occult carriers (hepatitis B surface antigen negative/anti-hepatitis B core antigen positive) with rheumatic diseases. Arthritis Care Res (Hoboken) 2010;62(6):749-754. [http://dx.doi. org/10.1002/acr.20130] 7. Smith BD, Morgan RL, Beckett GA, et al. Recommendations for the identification of chronic hepatitis C virus infection among persons born during 1945 - 1965. MMWR Recomm Rep 2012;61(RR-4):1-32.

8. Saadoun D, Resche Rigon M, Pol S, et al. PegIFNα/ribavirin/protease inhibitor combination in severe hepatitis C virus-associated mixed cryoglobulinemia vasculitis. J Hepatol 2015;62(1):24-30. [http:// dx.doi.org/10.1016/j.jhep.2014.08.015] 9. Kowdley KV, Lawitz E, Poordad F, et al. Phase 2b trial of interferon-free therapy for hepatitis C virus genotype 1. N Engl J Med 2014;370(3):222-232. [http://dx.doi.org/10.1056/NEJMoa1306227] 10. Afdhal N, Zeuzem S, Kwo P, et al. Ledipasvir and sofosbuvir for untreated HCV genotype 1 infection.

N Engl J Med 2014;370(20):1889-1898. [http://dx.doi.org/10.1056/NEJMoa1402454] 11. AASLD/IDSA HCV Guidance Panel. Hepatitis C guidance: AASLD-IDSA recommendations for testing, managing, and treating adults infected with hepatitis C virus. Hepatology 2015;62(3):932-954. [http://dx.doi.org/10.1002/hep.27950] 12. Najafzadeh M, Andersson K, Shrank WH, et al. Cost-effectiveness of novel regimens for the treatment of hepatitis C virus. Ann Intern Med 2015;17;162(6):407-419. [http://dx.doi.org/10.7326/M14-1152] 13. Cohen JI. Clinical practice: Herpes zoster. N Engl J Med 2013;369(3):255-263. [http://dx.doi.org/10.1056/ NEJMcp1302674] 14. Strangfeld A, Listing J, Herzer P, et al. Risk of herpes zoster in patients with rheumatoid arthritis treated with anti-TNF-alpha agents. JAMA 2009;301(7):737-744. [http://dx.doi.org/10.1001/jama.2009.146] 15. Westra J, Rondaan C, van Assen S, Bijl M. Vaccination of patients with autoimmune inflammatory rheumatic diseases. Nat Rev Rheumatol 2015;11(3):135-145. [http://dx.doi.org/10.1038/nrrheum.2014.206] 16. Kaur PP, Chan VC, Berney SN. Successful etanercept use in an HIV-positive patient with rheumatoid arthritis. J Clin Rheumatol 2007;13(2):79-80. [http://dx.doi.org/10.1097/01.rhu.0000260411.75599.39] 17. Cepeda EJ, Williams FM, Ishimori ML, Weisman MH, Reveille JD. The use of anti-tumour necrosis factor therapy in HIV-positive individuals with rheumatic disease. Ann Rheum Dis 2008;67(5):710712. [http://dx.doi.org/10.1136/ard.2007.081513] 18. Kim DK, Bridges CB, Harriman KH, Centers for Disease Control and Prevention (CDC), Advisory Committee on Immunization Practices (ACIP), ACIP Adult Immunization Work Group. Advisory committee on immunization practices recommended immunization schedule for adults aged 19 years or older – United States, 2015. MMWR Morb Mortal Wkly Rep 2015;64(4):91922. [http://dx.doi. org/10.7326/m14-2755] 19. Hmamouchi I, Winthrop K, Launay O, Dougados M. Low rate of influenza and pneumococcal vaccine coverage in rheumatoid arthritis: Data from the international COMORA cohort. Vaccine 2015;33(12):1446-1452. [http://dx.doi.org/10.1016/j.vaccine.2015.01.065] 20. Schmader KE, Levin MJ, Gnann JW, et al. Efficacy, safety, and tolerability of herpes zoster vaccine in persons aged 50 - 59 years. Clin Infect Dis 2012;54(7):922-928. [http://dx.doi.org/10.1093/cid/cir970] 21. Zhang J, Xie F, Delzell E, et al. Association between vaccination for herpes zoster and risk of herpes zoster infection among older patients with selected immune-mediated diseases. JAMA 2012;308(1):4349. [http://dx.doi.org/10.1001/jama.2012.7304] 22. Hodkinson B, van Duuren E, Pettipher C, Kalla A, South African Rheumatism and Arthritis Association. South African recommendations for the management of rheumatoid arthritis: An algorithm for the standard of care in 2013. S Afr Med J 2013;103(8):576-585. [http://dx.doi.org/10.7196/samj.7047] 23. Tikly M, Hodkinson B, Dheda K. Biologic therapy for rheumatoid arthritis in developing countries – a place for non-TNF inhibitors as first-line treatment? Rheumatology 2015;54(2):208-209. [http:// dx.doi.org/10.1093/rheumatology/keu040] 24. Hatzara C, Hadziyannis E, Kandili A, et al. Frequent conversion of tuberculosis screening tests during anti-tumour necrosis factor therapy in patients with rheumatic diseases. Ann Rheum Dis 2014;74(10):1848-1853.

25. Leombruno JP, Einarson TR, Keystone EC. The safety of anti-tumour necrosis factor treatments in rheumatoid arthritis: Meta and exposure-adjusted pooled analyses of serious adverse events. Ann Rheum Dis 2009;68(7):1136-1145. [http://dx.doi.org/10.1136/ard.2008.091025] 26. Salliot C, Dougados M, Gossec L. Risk of serious infections during rituximab, abatacept and anakinra treatments for rheumatoid arthritis: Meta-analyses of randomised placebo-controlled trials. Ann Rheum Dis 2009;68(1):25-32. [http://dx.doi.org/10.1136/ard.2007.083188] 27. Thompson AE, Rieder SW, Pope JE. Tumor necrosis factor therapy and the risk of serious infection and malignancy in patients with early rheumatoid arthritis: A meta-analysis of randomized controlled trials. Arthritis Rheum 2011;63(6):1479-1485. [http://dx.doi.org/10.1002/art.30310] 28. Singh JA, Cameron C, Noorbaloochi S, et al. Risk of serious infection in biological treatment of patients with rheumatoid arthritis: A systematic review and meta-analysis. Lancet 2015;386(9990):258-265. [http://dx.doi.org/10.1016/S0140-6736(14)61704-9] 29. Widdifield J, Bernatsky S. Connective tissue diseases: The burden of serious infections in SLE. Nat Rev Rheumatol 2015;11(6):326-327. [http://dx.doi.org/10.1038/nrrheum.2015.55] 30. Feldman CH, Hiraki LT, Winkelmayer WC, et al. Serious infections among adult Medicaid beneficiaries with systemic lupus erythematosus and lupus nephritis. Arthritis Rheumatol 2015;67(6):1577-1585. [http://dx.doi.org/10.1002/art.39070] 31. Tektonidou MG, Wang Z, Dasgupta A, Ward MM. Burden of serious infections in adults with systemic lupus erythematosus: A national population-based study, 1996 - 2011. Arthritis Care Res 2015;67(8):1078-1085. [http://dx.doi.org/10.1002/acr.22575]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

Meeting the challenges in the diagnosis of inflammatory myopathies M Manie, MB ChB, FCP (SA), MMed, Cert Rheumatology (SA) Division of Rheumatology, Department of Medicine, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa Corresponding author: M Manie (mou@sun.ac.za)

Inflammatory myopathy (IM) is a rubric term to describe a heterogeneous group of muscle diseases typified by dermatomyositis and polymyositis. The current classifications are unsatisfactory, but IM associated with other connective tissue diseases (CTDs), such as systemic lupus erythematosus, underlying malignancy and HIV, should also be included. Although uncommon, IM should always be considered in a patient who presents with proximal weakness of gradual onset and has raised serum muscle enzymes.

The diagnosis may be obvious if the patient has diagnostic skin signs such as heliotropic rash (peri-orbital discoloration) and Gottron’s lesions (typically on the extensor surfaces of the fingers). In the absence of obvious skin manifestations, other features of a CTD such as Raynaud’s phenomenon, abnormal capilloroscopy and the presence of serum antinuclear factor antibody should be searched for.

Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting.

Appropriate investigations include a chest radiograph indicating interstitial lung disease or malignancy. Electromyography and muscle biopsy are useful in cases where other diagnoses are suspected.

S Afr Med J 2015;105(12):1076. DOI:10.7196/SAMJ.2015.v105i12.10226

Inflammatory myopathy (IM) is an umbrella term for a group of muscle diseases exemplified by dermatomyositis (DM) and polymyositis (PM). Collectively, these conditions were considered to be rare, but seem to be more common than previously thought. Making an incorrect diagnosis may be costly, as delays in initiating treatment may result in morbidity and mortality. As a disease entity IM is generally poorly understood compared with other connective tissue diseases (CTDs).[1,2]

auto-immune aetiology. Therefore, inclusion body myositis (IBM) would probably not find a place in this sub-classification. A useful classification of IM is the following: 1. DM. 2. PM. 3. D M and PM overlapping with a CTD, such as systemic lupus erythematosus (SLE)/scleroderma.

4. Points 1 - 3 have another cause, such as malignancy or HIV. 5. ‘Undifferentiated’ IM, such as necrotising autoimmune inflammatory myopathy (NAM).

Diagnosis

1. Dermatomyositis The diagnosis of DM is generally based on the features of proximal muscle weakness of gradual onset, raised muscle enzymes, e.g. creatinine kinase (CK), and cutaneous features. The skin manifesta­tions of DM may range from highly typical to subtle.[6] Pathognomonic features are the heliotropic rash and Gottron’s lesions. The heliotropic rash

Fig. 2. Gottron’s lesions.

Fig. 1. Heliotropic rash.

Fig. 3. The V sign.

The Bohan and Peter criteria[3,4] for diagnosing IM are listed below. Initially published in 1975, these are still commonly referred to but have limited usefulness in clinical practice: • Symmetric proximal muscle weakness.

• Elevated serum muscle enzymes.

• Myopathic changes on electromyography (EMG).

• Typical cutaneous manifestations of DM (the clinical feature distinguishing DM from PM).

• Characteristic muscle biopsy abnormalities and the absence of histopathological signs of other muscle diseases.

(Fig. 1) is characterised by peri-orbital swelling and violaceous discoloration. This may be very severe and conspicuous, or subtle and transient, and may have disappeared when the patient presents with weakness. Gottron’s lesions (Fig. 2) are violaceous papules or scaly plaques on the extensor surfaces of the fingers, e.g. the knuckles.

Very suspicious features include welldefined areas of erythematous swelling in a typical distribution, resulting in the V (Fig. 3) and shawl (Fig. 4) signs.

Classification

Current classifications of IM are fraught with problems.[5] From a rheumatologist’s point of view it may be prudent to view IMs as being associated with a CTD or having a definite

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Fig. 4. The shawl sign.

Less specific, but not uncommon skin manifestations include poikiloderma, seborrhoeic dermatitis/psoriasiform changes of the scalp and diffuse erythroderma.

Amyopathic DM is a variant of DM that spares muscle and does not present with weakness, but may manifest with weakness in the course of the disease. The diagnosis is made on the findings of diagnostic cutaneous signs, such as the heliotropic rash referred to above.

In cases where the cutaneous signs are not convincing, a skin biopsy may be performed.

The finding of an interface dermatitis is fairly specific for DM but also occurs in SLE. 2. Polymyositis PM lacks the skin characteristics of DM but is suspected if there are other features of a CTD.[6] These include Raynaud’s phenomenon, peri-ungual swelling or erythema, ‘raggedy’ cuticles or other features of the antisynthetase syndrome. This syndrome refers to a patient with PM or DM with the typical findings of constitutional symptoms such as fever, polyarthritis, mechanic’s hands (Fig. 5), interstitial lung disease and the presence of anti-Jo-1 antibody in the serum.

Fig. 5. Mechanic’s hands.

The diagnosis of PM is more challenging because of the paucity of cutaneous clues.

PM is currently considered a rare cause of IM. Previously, the diagnosis was largely clinical and the condition was probably overdiagnosed. In retrospect, in many patients labelled as having PM, there were other causes for the proximal weakness, such as those mentioned in the differential diagnosis below.[7] When taking a history, the astute physician should look for clues, such as Raynaud’s

phenomenon and inflammatory pain affecting the joints. On examination, one should look for other features of a CTD, such as abnormal capillaroscopy, puffy hands and interstitial lung disease. A dermatoscope, if available, is a preferred alternative to an ophthalmoscope to identify vascular abnormalities such as tortuosity and loss of capillaries in the nail bed. Occasionally, the diagnosis may lean heavily on the absence of another cause of the myopathy.

3. Inflammatory myopathy partially overlapping with another connective tissue disease DM or PM may overlap with a CTD such as SLE, scleroderma or mixed CTD. However, deciding whether the IM is part of the underlying CTD and not necessarily overlapping with the IM may be difficult.

4. Inflammatory myopathy with underlying malignancy or HIV It is well known that DM (up to 15%) and to a lesser extent PM are often associated with an underlying malignancy such as carcinoma of the breast or lung. IM associated with HIV is discussed below.

5. ‘Undifferentiated inflammatory myopathy’, e.g. necrotising auto-immune myopathy (discussed below)

Differential diagnosis

Reviews of the histopathology of patients clinically diagnosed with IM not infrequently result in an alternative diagnosis.[8] These include: • Inclusion body myositis Some clinicians, in particular neurologists, include IBM as a subtype of IM, but the underlying aetiopathogenesis is a degenerative muscle disorder with little underlying inflammation, akin to an ‘Alzheimer’s’ of muscle. It is characterised by slow onset of action, characteristically over many years, and atypical features such as distal muscle weakness, asymmetrical involvement, muscle atrophy and a poor response to steroids. The condition was previously regarded as exceedingly rare, but may be more common as retrospective reviews have uncovered many cases originally diagnosed as PM. It is also a rare cause of myopathy in individuals with HIV. • Endocrine/electrolyte disorders It is important to exclude hyper- and hypothyroidism. The latter, apart from causing proximal weakness, may also cause elevation of the serum CK. In the realm of the ‘metabolic’ myopathies, it is important to rule out hypokalaemia, hypo- and hyper­

December 2015, Vol. 105, No. 12

calcaemia, osteomalacia and Cushing’s syn­ drome.

• Adverse effects of medication Steroid-induced myopathy has to be consi­ dered in patients on maintenance oral steroids, e.g. those with poorly controlled asthma. Muscle weakness may occur in the absence of other features of Cushing’s syndrome.

Although myalgia is a common symptom associated with the use of statins, weakness is rare. The mechanism is poorly understood but may be due to dose-related direct muscle toxicity and may very rarely be immune mediated[9] (discussed below).

Colchicine may cause the feared sideeffect of a myoneuropathy, which may be irreversible. Patients particularly at risk of this rare complication are those with underlying renal impairment and the concomitant use of a macrolide antibiotic, e.g. clarithromycin.

Chloroquine is frequently used in rheumatic diseases such as rheumatoid arthritis and SLE, but fortunately the myopathy associated with its use is very rare.

Zidovudine is a well-known cause of HIV-associated muscle weakness owing to a mitochondrial myopathy.

• Diseases with pathology arising from the neuromuscular junction Myasthenia gravis is a rare condition always worth considering, as the clues such as facial muscle weakness, ptosis and fatiguability may not always be obvious.

The Lambert-Eaton myasthenic syndrome is a disorder occurring in the setting of an underlying malignancy such as bronchus carcinoma.

• Muscle dystrophies Limb girdle dystrophy. A family history and muscle atrophy involving the shoulder and pelvic girdle may be important clues.

Myotonic dystrophy. This is characterised by myotonia and additional findings of a family history, cataracts, cognitive impair­ ment and impaired glucose tolerance.

• Metabolic myopathies These conditions usually have a hereditary component and noteworthy features are episodes of acute myalgia with associated myoglobinuria and accompanying darkcoloured urine.

Atypical features that should suggest alternative diagnoses

Severe muscle pain. Myalgia occurs in half of patients with an IM and is generally not a prominent feature. Severe pain suggests an

CONTINUING MEDICAL EDUCATION

infection or a metabolic cause. Pain mimics weakness, e.g. a typical patient with polymyalgia rheumatica may have shoulder girdle pain but present with ‘weakness’ rather than pain.

Acute onset. This should raise suspicion of an infective cause.

Normal or only slightly raised muscle enzymes. Although occa­ sionally found in IM, this is unusual.

Constitutional symptoms such as fever and weight loss. These occur more frequently in patients whose IM partially overlaps with another CTD such as SLE. If present, this should also prompt a search for an underlying malignancy or HIV. Wasting, asymmetrical weakness and disproportionate distal weakness. These suggest a neurological cause such as motor neuron disease or IBM. Global areflexia. This should raise suspicion of chronic demye­ linating polyneuropathy, which may uncommonly present with prox­ imal rather than distal weakness.

Myopathies due to HIV and NAM

These diseases may cause IM, but are worthwhile highlighting as they may cause weakness via other mechanisms.

HIV may cause a clinical picture indistinguishable from PM clinically and histologically, usually occurs relatively early in the disease, and usually responds well to steroids. HIV may also cause muscle weakness on the basis of ‘non-immune’ mechanisms.[10-12] The nucleotide reverse transcriptase inhibitors may cause a mitochondrial myopathy with the diagnostic ragged red fibres on muscle histology.

The chronic HIV wasting syndrome is the most common cause of muscle weakness in this illness and occurs in the late stages of the disease – it is usually not amenable to immunosuppressive therapy. IBM is a rare disease and may also occur in the setting of HIV. Myasthenia gravis and NAM (discussed below) are other rare illnesses linked to HIV. NAM is a rare but important cause of myopathy.[13,14] It is associated with (i) CTDs such as SLE, scleroderma and mixed CTD; (ii) malignancy, such as carcinoma of the bronchus; (iii) statin use, although the myopathy caused by statins is generally via direct muscle toxicity and not immune mediated; and (iv) HIV or other viral infections. Knowledge about this condition is important as it requires treatment with immunosuppressive therapy such as that conventionally used for the treatment of IM. Anti-signal recognition particle antibody is a myositis-specific antibody associated with NAM, but is generally only used in research settings.

Appropriate investigations

With regard to the involvement of organ systems other than muscle and skin it is worthwhile trying to identify interstitial lung disease as it is reasonably common – in some studies affecting >50% of patients with IM. Cardiac involvement is rare.

Serological tests. The antinuclear factor test is useful as a screening test to detect underlying CTD. The anti-Jo-1 antibody test, although not sensitive, is relatively specific for interstitial lung disease and the antisynthetase syndrome mentioned above. Myositis-specific anti­ bodies other than anti-Jo-1 have a very small role in current clinical practice.

Magnetic resonance imaging (MRI). MRI of muscle may help to distinguish between active inflammation and muscle necrosis, but its future role is unclear.

EMG. This is reserved for patients where there is doubt about the presence of active muscle necrosis, such as those with a normal or slightly raised CK.

Histopathology. Although there are characteristic differences in the pattern of the inflammatory infiltrate between DM and PM, a muscle biopsy for histology is not routine practice. A more compelling indication for muscle biopsy is to shed light on the diagnosis of patients who cannot be confidently diagnosed as having IM. A muscle biopsy is an invasive procedure and it may be prudent to subject likely cases to a trial of immunosuppressive therapy, with a satisfactory response to therapy supporting the diagnosis of IM. Advocates of improved access to muscle histopathology feel that this will result in more accurate diagnoses and better decisions with regard to therapy.[15]

Conclusion

IM, although uncommon, is an important cause of myopathy, which should always be considered in the differential diagnosis of a patient who presents with proximal weakness. The clinical context, particularly the possible presence of CTD or other systemic illnesses, is an important guide to the diagnosis.

Summary

• IM should always be considered in a patient who presents with proximal weakness of gradual onset.

• In the absence of obvious skin manifestations, other features of CTDs such as Raynaud’s phenomenon, abnormal capilloroscopy and the presence of serum antinuclear factor antibody should be searched for.

• Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness, areflexia and wasting.

• EMG is useful to distinguish neurological from myopathic causes.

• Muscle biopsy is mandatory to distinguish between IM and other myopathies in the absence of obvious characteristic features.

Acknowledgements. I wish to thank Prof. Razeen Davids for proofreading the manuscript. Special thanks to the Division of Dermatology, Faculty of Medicine and Health Sciences, Stellenbosch University, for providing some of the figures.

References 1. Dalakas MC. Inflammatory muscle diseases. N Engl J Med 2015;372:1734-1747. [http://dx.doi. org/10.1056/NEJMra1402225] 2. Dalakas MC, Hohlfeld R. Polymyositis and dermatomyositis. Lancet 2003;362:971-982. [http://dx.doi. org/10.1016/S0140-6736(03)14368-1] 3. Bohan A, Peter JB. Polymyositis and dermatomyositis. N Engl J Med 1975;292:344-347. [http://dx.doi. org/10.1056/NEJM197502132920706] 4. Bohan A, Peter JB. Polymyositis and dermatomyositis. N Engl J Med 1975;292:403-407. [http://dx.doi. org/10.1056/NEJM197502202920807] 5. Christopher-Stine L. Neurologists are from Mars. Rheumatologists are from Venus: Differences in approach to classifying the idiopathic inflammatory myopathies. Curr Opin Rheumatol 2010;22:623626. [http://dx.doi.org/10.1097/BOR.0b013e32833f8f72] 6. Wortmann RL. Myopathies. Rheum Dis Clin N Am 2011;37(2). [http://dx.doi.org/10.1016/j. rdc.2011.02.001] 7. Van der Meulen MFG, Bronner IM, Hoogendijk JE, et al. Polymyositis: An overdiagnosed entity.

Neurology 2003;61:316-321. [http://dx.doi.org/10.1212/WNL.61.3.316] 8. Michelle EH, Mammen AL. Myositis mimics. Curr Rheumatol Rep 2015;17: 1-8. [http://dx.doi. org/10.1007/s11926-015-0541-0] 9. Mammen AL, Amato AA. Statin myopathy: A review of recent progress. Curr Opin Rheumatol 2010;22:644-650. [http://dx.doi.org/10.1097/BOR.0b013e32833f0fc7] 10. Heckmann JM, Pillay K, Hearn AP, Kenyon C. Polymyositis in African HIV-infected subjects.

Neuromuscul Disord 2010;20:735-739. [http://dx.doi.org/10.1016/j.nmd.2010.06.007] 11. Nguyen BY, Reveille JD. Rheumatic manifestations associated with HIV in the highly active antiretroviral therapy era. Curr Opin Rheumatol 2009;21:404-410. [http://dx.doi.org/10.1097/ BOR.0b013e32832c9d04] 12. Louthrenoo W. Rheumatic manifestations of human immunodeficiency virus infection. Curr Opin Rheumatol 2008;20:92-99. [http://dx.doi.org/10.1097/BOR.0b013e3282f1fea7] 13. Liang C, Needham M. Necrotizing autoimmune myopathy. Curr Opin Rheumatol 2011;23:612-619. [http://dx.doi.org/10.1097/BOR.0b013e32834b324b] 14. Hengstman GJD, ter Laak HJ, Vree Egberts WT, et al. Anti-signal recognition particle autoantibodies: Marker of a necrotising myopathy. Ann Rheum Dis 2006;65:1635-1638. [http://dx.doi.org/10.1136/ ard.2006.052191] 15. Pestronk A. Acquired immune and inflammatory myopathies: Pathologic classification. Curr Opin Rheumatol 2011;23:595-604. [http://dx.doi.org/10.1097/BOR.0b013e32834bab42]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

Juvenile idiopathic arthritis – an update on its diagnosis and management C Scott, MB ChB, FCPaed (SA), Grad Cert Paed Rheum (UWA); N Brice, MB ChB, Dip HIV Man (SA), FCPaed (SA) Paediatric Rheumatology, Institute of Child Health, Red Cross War Memorial Children’s Hospital and University of Cape Town, South Africa Corresponding author: C Scott (chris.scott@uct.ac.za)

Juvenile idiopathic arthritis (JIA) is the most common form of chronic arthritis in children and the most common cause of musculoskeletal disability in children. Early diagnosis may be challenging, but it is essential to ensure good outcomes. This review proposes an approach to the investigation and diagnosis of JIA. It also gives a summary of the latest available evidence-based treatment for this disease.

S Afr Med J 2015;105(12):1077. DOI:10.7196/SAMJ.2015.v105i12.10223

Musculoskeletal (MSK) complaints are very common in children, who present to general practitioners, paediatricians and orthopaedic surgeons. Studies have reported that they may occur in 4 - 30% of the community. A Scottish study showed that 1 in every 58 children presenting to a paediatric accident and emergency unit had limping as their primary complaint, and a survey of adolescents in British Columbia revealed that MSK complaints were viewed as the most common health concern after acne.[1-4] The differential diagnosis for a child presenting with MSK pain ranges from dreadful to completely benign (Table 1).

An accurate diagnosis of juvenile idiopathic arthritis (JIA) depends on a good clinical approach, clues derived from the history and examination, and pattern recognition, which will assist the clinician in making the diagnosis. A thorough history and examination are the most important tools to make the diagnosis of JIA, where early diagnosis and treatment have been shown to directly improve outcomes.[5] Children are constantly growing and developing, and changing milestones, anatomy and physiology increase the difficulty of making the diagnosis of JIA.

Methods

This brief review summarises the available and relevant evidence on the diagnosis and management of JIA in the South African (SA) context and is intended to assist the non-specialist in the identification,

management and referral of these patients. Sources of relevance were drawn from published medical literature (searched via Medline), authoritative texts and online resources on paediatric rheumatology.

Table 2. Juvenile idiopathic arthritis subtypes JIA subtype

Characteristics

Oligoarticular

Younger child More common in females than in males 1 - 4 affected joints in first 6 months ANA positive in up to 70% Uveitis – common

Extended oligoarticular

>4 joints after first 6 months

Polyarticular RF negative

≥5 affected joints in first 6 months RF negative Younger child More common in females than in males ANA positive in ~40%

Polyarticular RF positive

≥5 joints in first 6 months RF positive × 2 (3 months apart) More common in females than in males Adolescents

Enthesitis-related arthritis

HLA B27 positive Sacroiliitis Inflammatory backache Family history of HLA B27-related disease Usually older boys (>7 years)

Psoriatic arthritis

Psoriasis Dactylitis Psoriasis in 1st-degree relative Nail pitting

Systemic arthritis

Fever – daily Rash Hepatosplenomegaly Serositis Raised ferritin Complicated by macrophage activation syndrome

Table 1. Common causes of joint pain • • • • • • • • • •

Reactive arthritis Juvenile idiopathic arthritis Septic arthritis/osteomyelitis Haemarthrosis (e.g. haemophilia) Infections (e.g. tuberculosis) Malignancy (e.g. acute lymphoblastic leukaemia) Rheumatic fever Benign nocturnal MSK pains of childhood (growing pains) Benign hypermobility syndrome Mechanical, e.g. Osgood-Schlatter disease, slipped upper-femoral epiphysis • Avascular necrosis (e.g. Perthes disease) • Trauma

HLA = human leukocyte antigen; ANA = antinuclear antibody; RF = rheumatoid factor.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Epidemiology

JIA is the most common chronic MSK condition in children and the most common cause of MSK disability. Although it is perceived as a rare disease it is no less common than many other childhood diseases such as epilepsy and diabetes, and community-based studies indicate that a prevalence of between 1 and 4 per 1 000 children is affected.[6] The wide variation in prevalence rates between studies could in part be accounted for by differences in study design and lack of standardised definitions of JIA in earlier studies. Underdiagnosis and delays in presentation are thought to account for the low prevalence in hospital- and clinic-based studies.

Terminology and classification

JIA is the World Health Organization (WHO)’s accepted terminology for children <16 years of age who have chronic arthritis (lasting >6 weeks) and in whom no other specific cause of arthritis can be identified.[7] The terms juvenile chronic arthritis and juvenile rheumatoid arthritis are outdated and no longer preferred. Studies from developing countries such as SA and India appear to suggest that polyarticular JIA is more prevalent in these populations than oligoarticular JIA, which predominates in populations in Europe and the USA.[8]

For the purpose of classification, JIA is divided into 7 heterogeneous subtypes with specific clinical and pathophysiological characteristics (Table 2). Knowledge of patterns of JIA is useful in making an accurate diagnosis. A swollen knee and uveitis in a young girl, for instance, is typical of oligoarticular JIA. An older boy with Achilles insertion pain or arthritis of the first metatarsophalangeal joint is typical of juvenile enthesitis-related arthrtitis (ERA). Dactylitis and asymmetrical largeand small-joint arthritis are seen in patients with psoriatic arthritis, whereas symmetrical small-joint involvement in an older girl is typical of rheumatoid factor (RF)-positive polyarticular JIA.

Pathophysiology

The cause of JIA is not known, although it is accepted that some type of interplay between environmental factors (e.g. infections or the gut microbiome) and complex genetic factors leads to a disturbance in the balance between immune tolerance and inflammation. Certain human leukocyte antigen (HLA) (class I and II) and non-HLA genes have been associated with different types of JIA.[9] Some subtypes of JIA appear to be more autoimmune in their pathophysiology than others, with adaptive and humoral immunity playing a major part.

RF-positive polyarticular JIA, for instance, is strongly associated with the presence of antibodies against RF and cyclic-citrullinated peptide

Table 3. Taking a history in suspected juvenile idiopathic arthritis Onset of pain

Pain with sudden onset suggests acute conditions such as an injury or septic arthritis. JIA often has a very indolent onset and it is sometimes difficult for the child or parent to remember when the pain started. It is very important to note that the absence of reported pain does not exclude arthritis.

Timing of pain

Early-morning stiffness and so-called ‘gelling’ suggest inflammatory pain. The child only limps first thing in the morning and recovers for the rest of the day.

Pain that improves with rest and worsens with activity is usually mechanical.

Nocturnal pain, commonly in the lower limbs, which disappears by morning, never occurs during the day and is not associated with any other symptom, is typical of benign nocturnal limb pains of childhood, also known as growing pains.

Nocturnal bone pain associated with fever, malaise, pallor and petechiae would obviously suggest haematological malignancy. These patients have persistent constitutional or MSK complaints during the day.

Patients with benign hypermobility suffer from pain in the evening after an active day, while their symptoms may improve with rest.

Intensity of pain

The pain caused by JIA is not frequently reported as severe. Entheseal inflammation or tenosynovitis, however, can be acutely painful despite a relative absence of clinical signs of swelling or joint limitation.

The pain in amplified pain syndromes or complex regional pain syndromes can be extremely intense and persist throughout the day, causing major disability.

Septic arthritis is also acutely painful, frequently resulting in a frozen joint, where the child expresses anxiety at the prospect of motion of the joint.

Disability

Children with early JIA frequently find ways to continue their activities of daily living, and function relatively well.

Children with amplified pain syndromes may have severe functional impairment, despite minor clinical findings.

Response to medication

Children with JIA or osteoid osteomas frequently respond well to non-steroidal anti-inflammatory drugs. This is not the case with conditions such as amplified pain or bone pain caused by malignancy.

Other systemic features

Raynaud’s phenomenon, which is common in children with scleroderma and SLE, is frequently not reported until direct enquiry. The presence of psoriasis, gastrointestinal symptoms, fever, rash or a bleeding tendency can all point in the direction of an underlying cause for arthritis.

Family history

A family history of psoriasis is essential. Similarly, a family history of ankylosing spondylitis, inflammatory bowel disease and SLE may increase the risk of these conditions.

A family history of sickle cell disease is important, especially in a child presenting with dactylitis, septic arthritis or avascular necrosis.

Social history and exposure to infectious diseases

A social history of infections such as HIV or TB is an essential component. A preceding history of infection, especially viral or dysenteric, is crucial.

SLE = systemic lupus erythematosus; TB = tuberculosis.

3

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

(CCP), and CD4 T-cells play a role in propagating the inflammatory response. Systemic JIA, however, is an autoinflammatory disease driven by abnormalities of the innate immune system, with neutrophils and macrophages playing the major pathogenic roles.

Approach to diagnosis

Taking a history in a child with suspected JIA

A good history with appropriate focus on the relevant symptoms and signs of JIA and other conditions in the differential diagnosis is very important in diagnosing JIA. Table 3 summarises the relevant aspects of history-taking in a patient with suspected JIA.

Examination

A child presenting with joint pain or MSK symptoms should have a full examination of all systems and not just of the MSK system. A basic paediatric examination, including anthropometry and vital signs (as well as blood pressure), is crucial. This not only helps to diagnose or exclude non-rheumatic illnesses that may present with MSK pain, but also to find signs associated with many of the rheumatic diseases. Red flag signs for malignancy include the following: fever, malaise, weight loss, pallor, petechiae, nocturnal bone pain, constant symptoms, unexplained bruising and lymphadenopathy.

It is important to note that children with JIA (or their parents) do not always report pain or limitation in their joints, especially the younger age groups. It is crucial that a thorough examination is undertaken to identify all active joints.

The MSK examination should start with the screening examination known as the paediatric gait arms legs spine (PGALS). This validated screening tool has been designed to facilitate the rapid initial assessment of a child with MSK pain. It is quick and easy to do and easily accepted by patients. The PGALS starts with 3 screening questions and moves to several manoeuvres that are specifically choreographed to reveal abnormalities in the MSK system in children. It is summarised in Table 4 and is published here with permission from the authors.[10] If an abnormality is identified on PGALS, a full MSK examination should be undertaken, including a thorough examination of all joints. Guidelines on specific joint examinations can be viewed online (see Online resources below). This web-based resource is focused on providing information to non-rheumatologists on the examination and management of rheumatic diseases. Specific points of interest in the examination of children with JIA are given in Table 5.

Laboratory investigations

Laboratory investigations in JIA are used mainly to exclude other diagnoses or to investigate complications of JIA or its treatment. The minimum investigations are given in Table 6.

Conventional radiography

Radiographs in children with MSK disease are a standard firstline investigation that is widely available and affordable. In the context of the diagnosis of JIA, radiographs are useful in Table 5. The examination of a child with juvenile idiopathic arthritis

Table 4. Paediatric gait, arms, legs, spine screening examination Screening questions

Do you (or does your child) have any pain or stiffness in the joints, muscles or back?

Do you (or does your child) have any difficulty getting dressed without any help?

Gait

Do you (or does your child) have any difficulty going up and down stairs?

Observe the child walking and turning.

‘Walk on your tip-toes/walk on your heels.’

Arms

‘Put your hands out in front of you.’

‘Turn your hands over and make a fist.’

‘Pinch your index finger and thumb together.’

‘Touch the tips of your fingers with your thumb.’

Squeeze metacarpophalangeal joints.

‘Put your hands together/put your hands back-to-back.’

‘Reach up and touch the sky.’

‘Look up at the ceiling.’

‘Put your hands behind your neck.’

Legs

Feel for effusion at the knee.

‘Bend and then straighten your knee.’ (Active movement of knees and examiner feels for crepitus.)

Passive flexion (90°) with internal rotation of the hip.

Spine

‘Open your mouth and put three of your fingers in your mouth.’

Lateral flexion of the spine: ‘Try to touch your shoulder with your ear.’

Observe spine from behind.

‘Can you bend and touch your toes?’: observe curve of spine from side and behind.

Further details are available, with a video demonstration of PGALS performed on a normal child, at www.arthritisresearchuk.org/health-professionals

Pain

Extreme pain with motion could indicate a fracture or septic arthritis.

Mild pain with swelling or loss of range of motion is usual for JIA. Amplified pain syndromes may have severe hyperaesthesia.

Range of motion

A child should have a full range of motion in all joints.

Significant and longstanding arthritis will frequently cause deviations from the full range of motion.

Swelling

Swelling may be hard to assess, especially in the elbows, shoulders and ankles of younger children.

When swelling is identified, it is important to consider the nature of the swelling: fluid is fluctuant, synovium boggy and compressible.

Atrophy

Atrophy can be subtle and a sign of functional loss in a limb.

Colour

Joints are frequently warm in chronic and acute arthritis, but a red joint is highly suggestive of septic arthritis or osteomyelitis.

Localised growth disturbances

Longstanding arthritis causes localised growth disturbances. The affected limb grows longer and thicker than the unaffected limb. Leg length discrepancy is a useful marker of chronic arthritis. Evaluating the child from behind for pelvic tilt can assess this.

Eye examination

Certain types of JIA are associated with uveitis.

While a painful red eye is associated with enthesitisrelated arthritis, the uveitis of JIA can be completely asymptomatic. Initially, slit lamp examination is required to identify uveitis. Later in the disease, a distorted pupil (caused by posterior synechiae), glaucoma or cataracts may be present

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 6. Special investigations in juvenile idiopathic arthritis Full blood count

Useful in differentiating the inflammatory from the non-inflammatory disease.

Thrombocytopenia and peripheral blood smear may identify haematological malignancies.

ESR

Fibrinogen produced by the liver in response to cytokine stimulation causes high ESR seen in inflammation. Nonspecific inflammatory marker, more useful in monitoring of inflammatory diseases than diagnosis.

CRP

Produced in the liver in response to cytokine stimulation (IL-6, IL-1 and TNF). The advantages of CRP measurement: it is not influenced by as many variables as the ESR.

ANA/ANF

Although they are generally ubiquitous and present in many individuals who do not have autoimmune disease, high titres are associated with autoimmune conditions. Some subtypes of JIA are associated with positive tests for ANA.

RF and anti-CCP

HLA B27

This is the most over-requested and overinterpreted test in children suspected of having a rheumatic disease. As a screening test for JIA it is of virtually no value. A small subgroup of children with RF-positive polyarticular disease will have a positive RF; this test is useful in classifying this cohort.

This major histocompatibility complex type 1 antigen is strongly associated with enthesitisrelated arthritis. It also occurs with greater frequency in children with psoriatic arthritis, inflammatory bowel disease, reactive arthritis and acute anterior uveitis. It is a useful test if one of these conditions is suspected on clinical grounds, but not a good screening tool in the general population.

ESR = erythrocyte sedimentation rate; CRP = C-reactive protein; ANA = antinuclear antibodies; ANF = antinuclear factor; RF = rheumatoid factor; anti-CCP = cyclic citrullinated peptide antibodies; TNF = tumour necrosis factor; IL = interleukin.

excluding other causes of MSK pain, e.g. fractures or other bony lesions such as osteomyelitis or tumours. They can also give specific information on joint space narrowing, bone erosions, joint alignment, subluxation or ankylosis. It is important to note that the absence of abnormalities on X-ray examination does not exclude acute or chronic arthritis.

Other imaging modalities are summarised in Table 7.

Treatment of JIA

Early recognition of JIA and referral to specialist and multidisciplinary services for management improves the prognosis. In all cases the goal of treatment is complete disease remission and normal physical and social development. The many new medications currently available for the treatment of JIA make this achievable.

Non-pharmacological therapy

Physiotherapy and occupational therapy are essential in the management of JIA. These therapies improve joint range of motion

5

Table 7. Ultrasound and magnetic resonance imaging in juvenile idiopathic arthritis Ultrasound

Useful in the diagnosis of children suspected of having inflammatory joint disease. Gives good anatomical detail; can also reliably show joint effusions, synovial hypertrophy, inflammation and inflamed tendon sheaths and entheses. Early erosions and osteophytes can be identified. Quality depends on experience and training of ultrasonographer.

MRI

MRI gives very accurate information on bone and soft-tissue structure of the joint. Sensitive tool for assessing inflammation and oedema. Utility limited by cost and availability as well as the need for sedation or anaesthetic in young children.

Gold standard examination in terms of detail and accuracy.

MRI = magnetic resonance imaging.

and mobility and thereby prevent permanent deformity. They can help manage pain and encourage children to exercise within the limits of their abilities. This physical activity is safe and important in improving the quality of life of children with JIA. Social workers and mental health experts are often also needed to address the psychosocial impact of pain and chronic illness on the child and family unit.

Pharmacological therapy

Non-steroidal anti-inflammatory drugs (NSAIDs) NSAIDs are used for the management of joint pain and stiffness. All NSAIDs are equally effective and choice depends on cost, tolerability, dosing schedule and formulation. Gastrointestinal side-effects are common and patients requiring long-term NSAIDs should have regular renal and liver function monitoring.

Corticosteroids Systemic oral and parenteral corticosteroids are used in the treatment of JIA, usually as bridging therapy while disease-modifying antirheumatic drug (DMARD) regimens take effect. They are particularly useful in severe polyarthritis and systemic JIA. Importantly, they do not induce remission, and care should always be taken to minimise exposure, given the potential side-effects of long-term use.

Concurrent calcium and vitamin D supplementation is necessary to prevent osteopenia.

Intra-articular steroid (IAS) injections have been shown to induce sustained remission when used as monotherapy or in conjunction with methotrexate.[11] Triamcinolone hexocetonide is thought to have superior efficacy to methylprednisolone acetate. IAS injections are usually well tolerated, but in young children should preferably be done under sedation or general anaesthetic. Subcutaneous atrophy at the injection site can occur in approximately 2% of cases.[12] Disease modifying anti-rheumatic drugs DMARDs are used as maintenance therapy to control disease activity.

They are safe and effective in children and their use ideally limits the need for long-term NSAIDs and corticosteroids. Early introduction of DMARDs has been shown to decrease disease severity and improve prognosis. Table 8 summarises the important prescribing details of synthetic DMARDs.[13-15]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 8. Synthetic disease-modifying anti-rheumatic drugs DMARD

Dosing

Common side-effects

Monitoring

Comments

MTX

15 mg/m2 weekly po or subcutaneously

Nausea and vomiting, mouth ulcers, transient transaminitis

FBC and LFTs every 3 months

Folic acid supplementation prevents GIT side-effects and ulcers Subcutaneous dosing can overcome poor response to oral therapy or GIT side-effects

Sulphasalazine

20 - 25 mg/kg twice daily po

Rash, GIT upset, myelosuppression, liver function abnormalities

FBC and LFTs every 3 months

Possible additive hepatotoxicity with MTX

Chloroquine

5.0 - 6.5 mg/kg daily po

GIT upset, rash, headache, visual changes

FBC, LFTs and U and E every 3 months

Test visual acuity annually

Leflunomide

Loading dose: 100 mg daily × 3 doses po Maintenance dose: 20 mg daily po

GIT upset, headache, rash, alopecia

FBC and LFTs every 3 months

Consider when MTX is not tolerated

GIT = gastrointestinal; FBC = full blood count; LFT = liver function test; U and E = urea and electrolytes; MTX = methotrexate.

Table 9. Biologic disease-modifying anti-rheumatic drugs Class

Drugs

Administration

Common side-effects

Precautions

Monitoring

TNF inhibitors

Etanercept

Etanercept S/C once weekly Adalimumab S/C every 2 weeks Infliximab IV 2 - 8-weekly Golimumab S/C monthly

Hypersensitivity infusion reactions

For all biologics: omit biologic during active infections Avoid in TB

For all biologics: TB screening before starting, then annually FBC, LFT, U and E every 3 months

Anakinra S/C daily Tocilizumab IV every 2 weeks Canakinumab S/C monthy

Injection site or infusion reactions

Avoid live vaccines

Use MTX concomitantly to prevent immunogenicity

Adalimumab Infliximab Golimumab IL inhibitors

Anakinra (IL-1) Tocilizumab (IL-6) Canakinumab (IL-1β)

B-cell inhibitor

Rituximab

IV every week × 2 doses

Infusion reactions

T-cell co-stimulatory modulator

Abatacept

IV once monthly

Infusion reactions uncommon

CD19 count for rituximab

IL = interleukin; IV = intravenous; S/C = subcutaneous.

Biologic agents The advent of biologic agents has significantly enhanced the treatment options for children with JIA and made complete disease remission an achievable outcome. The choice of agent depends on JIA subtype, but patient preference with regard to route and frequency of admission should also be considered. These agents are expensive and access to them requires careful motivation to the healthcare system involved. Table 9 summarises the important prescribing details of biologic DMARDs.[16-21]

Conclusion

JIA is not a rare disease and the complications of untreated JIA are significant. All physicians dealing with children should know when to suspect or diagnose this condition and perform the relevant investigations. Early appropriate referral will improve outcomes in patients with this disease. The modern arsenal of investigations and management greatly improves the outcome of patients with JIA. Other causes of joint pain or MSK morbidity in children range from benign to potentially life threatening.

Practice points

• MSK complaints are very common in children.

• Early and correct diagnosis and referral of patients with JIA are important.

• JIA is predominantly a clinical diagnosis based on pattern recog­ nition.

• RF has no value in screening for patients with JIA. • Remission can be achieved in the majority of patients using traditional DMARD therapy.

• Targeted cytokine therapy such as tumour necrosis factor inhibitors offers good therapeutic options to those not responding to traditional DMARDs. References 1. De Inocencio J. Epidemiology of musculoskeletal pain in primary care. Arch Dis Child 2004;89(5):431434. [http://dx.doi.org/10.1136/adc.2003.028860] 2. Foster HE, Cabral DA. Is musculoskeletal history and examination so different in paediatrics? Best Pract Res Clin Rheumatol 2006;20(2):241-262. [http://dx.doi.org/10.1016/j.berh.2005.11.001] 3. Goodman J, McGrath P. The epidemiology of pain in children and adolescents: A review. Pain 1991;46(3):247-264. [http://dx.doi.org/10.1016/0304-3959(91)90108-A] 4. Fischer S, Beattie T. The limping child: Epidemiology, assessment and outcome. J Bone Joint Surg Br 1999;81(6):1029-1034. [http://dx.doi.org/10.1302/0301-620X.81B6.9607]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

5. Albers HM, Wessels JA, van der Straaten RJ, et al. Time to treatment as an important factor for the response to methotrexate in juvenile idiopathic arthritis. Arthritis Rheum 2009;61(1):46-51. [http:// dx.doi.org/10.1002/art.24087] 6. Manners PJ, Bower C. Worldwide prevalence of juvenile arthritis: Why does it vary so much? J Rheumatol 2002;29(7):1520-1530.

7. Petty RE, Southwood TR, Manners P, et al. International League of Associations for Rheumatology classification of juvenile idiopathic arthritis: Second revision, Edmonton, 2001. J Rheumatol 2004;31(2):390-392.

8. Weakley K, Esser M, Scott C. Juvenile idiopathic arthritis in two tertiary centres in the Western Cape, South Africa: University of Cape Town; 2011. Pediatr Rheumatol Online J 2012;10(1):35. [http:// dx.doi.org/10.1186/1546-0096-10-35] 9. Prakken B, Albani S, Martini A. Juvenile idiopathic arthritis. Lancet 2011;377(9783):2138-2149. [http://dx.doi.org/10.1016/S0140-6736(11)60244-4] 10. Foster HE, Kay LJ, Friswell M, Coady D, Myers A. Musculoskeletal screening examination (pGALS) for school-age children based on the adult GALS screen. Arthritis Rheum 2006;55(5):709-716. [http:// dx.doi.org/10.1002/art.22230] 11. Zulian F, Martini G, Gobber D, Agosto C, Gigante C, Zacchello F. Comparison of intra-articular triamcinolone hexacetonide and triamcinolone acetonide in oligoarticular juvenile idiopathic arthritis.

Rheumatology (Oxford) 2003;42(10):1254-1259. [http://dx.doi.org/10.1093/rheumatology/keg358] 12. Scott C, Meiorin S, Filocamo G, et al. A reappraisal of intra-articular corticosteroid therapy in juvenile idiopathic arthritis. Clin Exp Rheumatol 2010;28(5):774-781.

13. Beresford M, Baildam E. New advances in the management of juvenile idiopathic arthritis – 1: Nonbiological therapy. Arch Dis Child Educ Pract Ed 2009;94(5):144-150. [http://dx.doi.org/10.1136/ adc.2008.144576] 14. Gowdie PJ, Shirley M. Juvenile idiopathic arthritis. Pediatr Clin North Am 2012;59(2):301-327. [http:// dx.doi.org/10.1016/j.pcl.2012.03.014]

7

15. Takken T, van der Net JJ, Helders PP. Methotrexate for treating juvenile idiopathic arthritis. Cochrane Database Syst Rev 2001;(4):CD003129. [http://dx.doi.org/10.1002/14651858.cd003129] 16. Beresford M, Baildam E. New advances in the management of juvenile idiopathic arthritis – 2: The era of biologicals. Arch Dis Child Educ Pract Ed 2009;94(5):151-156. [http://dx.doi.org/10.1136/ adc.2009.170860] 17. Giannini E, Ilowite N, Lovell D, et al. Long‐term safety and effectiveness of etanercept in children with selected categories of juvenile idiopathic arthritis. Arthritis Rheum 2009;60(9):2794-2804. [http:// dx.doi.org/10.1002/art.24777] 18. Katsicas MM, Russo RA. Use of adalimumab in patients with juvenile idiopathic arthritis refractory to etanercept and/or infliximab. Clin Rheumatol 2009;28(8):985-988. [http://dx.doi.org/10.1007/s10067009-1162-7] 19. Quartier P, Allantaz F, Cimaz R, et al. A multicentre, randomised, double-blind, placebo-controlled trial with the interleukin-1 receptor antagonist anakinra in patients with systemic-onset juvenile idiopathic arthritis (ANAJIS trial). Ann Rheum Dis 2011;70(5):747-754. [http://dx.doi.org/10.1136/ ard.2010.134254] 20. De Benedetti F, Brunner H, Ruperto N, et al. Efficacy and safety of tocilizumab (TCZ) in patients with systemic juvenile idiopathic arthritis (SJIA): Tender 52-week data. Pediatr Rheumatol 2011;9(Suppl 1):164. [http://dx.doi.org/10.1186/1546-0096-9-S1-P164] 21. Lovell DJ. Long-term efficacy and safety of adalimumab for up to 6 years in patients with juvenile idiopathic arthritis. ACR/ARHP scientific meeting, November 2011, Chicago, USA.

Online resources Paediatric musculoskeletal matters. User-friendly and elegant resource on paediatric musculoskeletal conditions for students or medical personnel working with children. Developed by Prof. Helen Foster from Newcastle University, UK: www.pmmonline.org

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

Approach to lower back pain F Moosajee, MB ChB, FCP (SA); A A Kalla, MB ChB, FCP (SA), MD Division of Rheumatology, Department of Medicine, Faculty of Health Sciences, University of Cape Town and Groote Schuur Hospital, Cape Town, South Africa Corresponding author: F Moosajee (farzana_moosajee@yahoo.com)

Lower back pain is one of the most common symptoms – and the most common musculoskeletal problem – seen by general practitioners. It is also a common cause of disability and an expensive condition in terms of economic impact because of absenteeism. This article discusses an approach to this common symptom and how to distinguish the benign, mechanical type of back pain from the more sinister, but less frequently encountered, inflammatory back pain.

S Afr Med J 2015;105(12):1077. DOI:10.7196/SAMJ.2015.v105i12.10249

Lower back pain (LBP) is the most common musculo­ skeletal problem seen by general practitioners and remains the most common cause of disability in US patients <45 years of age.[1-3] It is the most expensive benign condition in industrialised countries owing to the number of work days lost. LBP, by definition, includes pain below the costal margin but above the inferior gluteal folds.[1-3] Definitions are given in Table 1. These include pain with and without nonneuropathic leg pain. Various studies have indicated that 80% of US adults experience LBP in their lifetime.[3,4] In clinical practice, most practitioners have a superficial approach to this important clinical problem. Specific causes for LBP are uncommon and account for <15% of all such cases. In 85% of cases LBP is nonspecific; it will improve within 6 weeks, irrespective of treatment.

The medical practitioner should try to establish whether the pain is mechanical or inflammatory. This distinction can often be made with the use of ‘diagnostic red flags’ (Table 2). Mechanical (nonspecific) LBP includes orthopaedic and neurosurgical causes, which may require surgical intervention. Epidemiological evidence suggests several risk factors for the development of LBP, including smoking, obesity and physically strenuous work. However, sedentary work and psychologically taxing work are also risk factors. Inflammatory back pain (IBP) is the hallmark symptom of spondyloarthritis. The features of IBP are listed in Table 3.

Assessment of a patient with lower back pain

There are multiple causes for LBP. It is important to note, however, that in a primary care setting the majority of patents have nonspecific LBP. Some important causes are outlined in Table 4.

The physical examination of the patient with LBP is important to distinguish benign from more serious causes of the pain. This includes inspection of the spine from multiple angles. Palpate along the spine for tenderness or abnormal ‘steps’, sometimes indicative of spondylolisthesis. The assessment of movement of the spine includes flexion, extension and lateral and rotational movement in two directions. A straight leg-raising test with the patient supine is deemed positive if pain is elicited between 10° and 60° and is indicative of compression at L4/L5. The Schober test is also important to assess the flexibility of the lumbar spine, which essentially measures stretch of the spine rather than the flexion angle (Fig. 1). The ‘capsular pattern’ of limitation at the lumbar spine is

Table 1. Definitions • Acute lower back pain: an episode of lower back pain that resolves within 6 weeks • Subacute lower back pain: pain persisting for 6 - 12 weeks • Chronic lower back pain: persistent pain >12 weeks • Nonspecific lower back pain: pain not attributed to recognisable or known pathology, e.g. infection, fracture

Table 2. Red flags in lower back pain • • • • • • • • • • •

Pain in patients <20 years and >55 years Pain not relieved on rest or posture modification Pain unchanged despite 2 - 4 weeks of treatment History of malignancy Immunosuppressed status Fever/malaise/weight loss High fracture risk, e.g. osteoporosis Neurological impairment Bladder or bowel dysfunction Severe morning stiffness as the primary complaint Inability to ambulate

Table 3. Features of inflammatory back pain • • • • • • •

Insidious onset Age <45 years Nocturnal pain Alternating buttock pain Pain with associated early morning stiffness lasting >1 hour Pain not relieved by rest Pain improving with exercise or activity

characterised by a limitation of movement in all planes, while at the neck flexion is usually not affected. This pattern of limitation of movement is generally associated with IBP. Mechanical causes of LBP will usually only limit movement in one plane. A discrepancy between the physi­ cal findings and anatomical or physiological principles is a way of identifying patients with major psychological factors. This should alert the clinician to the ‘yellow flags’ (Table 5).

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 4. Important causes of lower back pain Mechanical

Neurological

Systemic

Disc herniation

Radiculopathy

Inflammatory spondyloarthropathy

Spinal canal stenosis

Myelopathy

Metabolic bone diseases

Disc and segmental degradation, e.g. facet arthropathy

Neuropathy

Neoplasia, including myeloma

Soft-tissue injuries

Myopathy

Infections of bone, disc or epidura

Lumbosacral plexopathy

Referred pain

Fig. 1. The Schober test.

Table 5. Yellow flags • • • • • •

Dissociation between verbal and non-verbal pain behaviour Compensable cause of injury Psychological or emotional factors, e.g. depression, anxiety, abusive relationships Narcotic drug requests Repeated failure of both medical and surgical therapy Disability or inability to return to work (unwillingness)

Imaging

Appropriate imaging of the spine is an essen­ tial part of the evaluation when a specific cause of LBP is suspected. Anteroposterior and lateral plain radiographs are helpful in assessing gross bone density, disc and vertebral body height and alignment. These should include a view of the pelvis. The characteristic

radiographic feature of IBP is the presence of sacro-iliitis (Fig. 2). The classification criteria for ankylosing spondylitis (AS) are heavily weighted on the finding of sacro-iliitis on radiography.[5] However, recent evidence has demonstrated that radiographs are not sensitive in the detection of early sacro-iliitis and newer criteria include other imaging modalities,

December 2015, Vol. 105, No. 12

Fig. 2. Radiograph of patient with sacro-iliitis.

such as computed tomography (CT) scanning and magnetic resonance imaging (MRI), to diagnose IBP (non-radiographic inflammatory back pain).[6] CT scanning is effective for assess­ ing foraminal and extraforaminal nerve roots. It is thus most helpful if bony pathology is suspected. MRI is superior to CT for spinal imaging, but is more expensive. It is very effective for spinal cord or soft-tissue imaging, especially to diagnose sacro-iliitis.

Other features of IBP include the presence of syndesmophytes, representing calcification of the spinal ligaments and culminating in the ‘bamboo’ spine, characteristic of longstanding AS. There may also be ankylosis of the posterior components of the vertebrae, and ultimately neglected patients with AS will develop a ‘question mark posture’.

While the spondyloarthritides character­ istically affect the spine, there are situations where the inflammation affects the entheses around peripheral joints rather than those around the spine (peripheral spondylo­ arthritis).[6] This is often the case in reactive arthritis, where plantar fasciitis leads to development of a calcaneal spur, and Achilles tendinitis results in calcification of the Achilles tendon insertion (enthesis).

Psoriatic arthritis usually affects the peri­ pheral joints rather than the sacro-iliac joint. Spondyloarthritides, other than AS, often results in unilateral sacro-iliitis. Tuber­ culosis (TB) is an important cause of the latter included in the differential diagnosis.

There is a strong relationship between the presence of HLA B27 and sacro-iliitis in patients with spondyloarthritis.[5,6]

Approach to management

Therapy or management of chronic LBP involves a multidisciplinary approach. The aim is to prevent a chronic vicious cycle by means of positive changes in the patient’s beliefs, coping mechanism and physical ability. The team employs pharmacological and non-pharmacological strategies to realise the goal.

CONTINUING MEDICAL EDUCATION

Worldwide, the most commonly prescribed drugs for nonspecific LBP are the non-steroidal anti-inflammatory drugs (NSAIDs). There is evidence that they are more efficacious than placebo in the short term.[7] Because of their side-effects, it is recommended that in chronic LBP they should be used for short periods during pain exacerbations only. The best available evidence recommends the use of both analgesia and an antidepressant in nonspecific (mechanical) chronic LBP. The most widely studied are the tricyclic antidepressants. They modulate pain sensation through blockage of the reuptake of neurotransmitters.

Non-pharmacological therapy includes information and reassurance. This is an essential component of therapy. The use of the biopsychosocial model to change a patient’s beliefs around chronic LBP is important. Exercise therapy and avoidance of bed rest are also part of the management of LBP. Cognitive and behavioural therapy are helpful to change the patient’s response to pain.

In the treatment of IBP the goal is to suppress the inflammation of the enthesis in an effort to prevent calcification, probably as a healing response after inflammation. Regular use of NSAIDs has been shown to prevent syndesmophyte formation.[8] The current recommendation for the treatment of AS is that continuation of symptoms with persistent elevation of inflammatory markers after 3 months of NSAID use is an indication for specific targeted therapy against tumour necrosis factor (TNF).[9] These agents are highly effective, but extremely expensive, making them unavailable for general use. Another disadvantage of this class of therapy is the risk of reactivating latent TB.

Summary

Chronic LBP is a common condition, usually with a nonspecific cause. A diagnostic algorithm can be used to identify patients with non-mechanical back pain. The assessment should also include prognostic yellow flags to identify patients who are at risk. It is very important to differentiate IBP and to identify its cause. The management of such patients involves a multidisciplinary team approach, employing pharmacological and nonpharmacological strategies. IBP management has advanced considerably in recent years and usually requires the regular use of NSAIDs. Biological monoclonal antibodies directed against TNF should be used if NSAIDs have not resulted in improvement within 3 months and there is persistent elevation of inflammatory markers.

References 1. Deyo RA, Tsui-Wu YJ. Descriptive epidemiology of low-back pain and its related medical care in the United States. Spine (Phila Pa 1976) 1987;12:264.

2. Cassidy JD, Carroll LJ, Côté P. The Saskatchewan health and back pain survey. The prevalence of low back pain and related disability in Saskatchewan adults. Spine (Phila Pa 1976) 1998;23:1860.

3. Kelsey JL, White AA. Epidemiology of low back pain. Spine 1980;6:133-142.

4. Chou R, Qaseem A, Snow V, et al. Diagnosis and treatment of low back pain: A joint clinical practice guideline from the American College of Physicians and the American Pain Society. Ann Intern Med 2007;147:478.

5. Van der Linden S, Valkenburg HA, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis.

A proposal for modification of the New York criteria. Arthritis Rheum 1984;27:361-368.

6. Rudwaleit M, van der Heijde D, Landewé R, et al. The development of Assessment of SpondyloArthritis International Society classification criteria for axial spondyloarthritis (part II): Validation and final selection. Ann Rheum Dis 2009;68:777.

7. Rudwaleit M, van der Heijde D, Landewé R, et al. The Assessment of SpondyloArthritis International Society classification criteria for peripheral spondyloarthritis and for spondyloarthritis in general. Ann Rheum Dis 2011;70:25.

8. Wanders A, Heijde Dv, Landewé R, et al. Nonsteroidal antiinflammatory drugs reduce radiographic progression in patients with ankylosing spondylitis: A randomized clinical trial. Arthritis Rheum 2005;52:1756-1765.

9. Braun J, van den Berg R, Baraliakos X, et al. 2010 update of the ASAS/EULAR recommendations for the management of ankylosing spondylitis. Ann Rheum Dis 2011;70:896-904. [http://dx.doi. org/10.1136/ard.2011.151027]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

ARTICLE

Gout and hyperuricaemia M N Abrahams, MB ChB, FCP (SA), Cert Rheumatology (SA) Division of Rheumatology, Department of Medicine, Faculty of Health Sciences, Groote Schuur Hospital and University of Cape Town, and Gatesville Medical Centre, Cape Town, South Africa Corresponding author: M N Abrahams (nur.abrahams@me.com)

Gout is the most common crystal arthritis and its prevalence is rising. It is associated with the metabolic syndrome, and hyperuricaemia may be an independent risk factor for cardiovascular disease. The acute presentation of gout is easily managed, but the underlying cause is seldom addressed.

Indications for initiating uric acid therapy have been clearly established. The classification criteria for gout have been reviewed and are presented here.

Lifestyle modification is key to the management of gout. The clinician must screen for diabetes, hypertension and hypercholesterolaemia when the diagnosis of gout is made. The management of asymptomatic hyperuricaemia is still being researched. As yet, there is no indication to start urate-lowering therapy in such patients. Allopurinol remains the first line of treatment, but there are newer drugs being researched in various clinical trials. Probenecid is the alternative in patients with preserved renal function, who do not have a history of renal calculi.

S Afr Med J 2015;105(12):1078. DOI:10.7196/SAMJ.2015.v105i12.10225

Gout is the most common inflammatory arthritis.

Worldwide, gout and hyperuricaemia are on the rise owing mainly to dietary changes, obesity, the metabolic syndrome and increasing age. In the past 2 decades the prevalence of gout has doubled owing mostly to changes in diet. Western diets rich in meat, seafood, fructose-sweetened drinks and beer have especially been identified.[1] Gout has two clinical presentations that affect the musculoskeletal system – acute arthritis and chronic tophaceous gout. The acute attack results in the person experiencing severe pain and swelling of the affected joint, which impairs quality of life. In between attacks patients are asymptomatic.

In tophaceous gout, patients develop a chronic debilitating arthritis with loss of function. Tophi cause erosions of joints, but also deposit in the skin and soft tissue, including the bursae, tendons and articular cartilage. Tophi are the pathognomonic features of gout.

Renal manifestations include kidney stones and rarely an interstitial nephritis.

The acute attack can be very easily managed by using non-steroidal anti-inflammatory drugs (NSAIDs), colchicine or glucocortico­ steroids, followed up by lifestyle modification and, if appropriate, urate-lowering therapy (ULT). The indications to commence ULT are: • Recurrent attacks (≥2).

• Tophaceous gout.

• Radiological evidence of erosive disease.

Pathogenesis

Gout results from the accumulation of uric acid, which is formed as the end result of purine metabolism. Xanthine oxidase is an import enzyme in the purine pathway, which ultimately results in the formation of uric acid. The majority of purines are endogenous, while diet is a source of exogenous purines. High fructose results in hyperuricaemia via the fructose phosphokinase shunt.

The body regulates uric acid primarily in the kidneys. After uric acid is filtered by the glomerulus, almost all of it is reabsorbed in the proximal convoluted tubule. This is followed by secretion of uric acid back into the tubules before being reabsorbed again. The net effect

is that only 5 - 10% of filtered uric acid is lost through the kidneys.

There are various transporters within the tubules that are involved in this complex uric acid transport. Uric acid transporter 1 (URAT1) and organic anion transporter 4 (OAT4) are transporters in the proximal tubules that reabsorb uric acid and have been identified as targets for future treatments.

When the serum concentration of uric acid rises above the saturation point to >0.42 mmol/L, uric acid crystallises. These are deposited into joints and various tissues, forming tophi. The microtophi are sealed off by proteins, and consequently do not cause an inflammatory response. The tophi may rupture, exposing the monosodium urate (MSU) crystals to circulating macrophages. Joint damage, dehydration and cool peripheral temperatures may cause the microtophi to rupture, thus exposing the MSU to tissue macrophages.

MSU crystals are then engulfed by macrophages, which set off an inflammatory response where interleukin 1 beta, among other pro-inflammatory cytokines, is activated. This results in an acute inflammatory process with swelling, redness, warmth and tenderness of the affected joint.[2]

Diagnosis

The definitive diagnosis of gout is made when MSU crystals are observed in a joint aspirate. Any patient who presents with an acute monoarthritis needs the joint aspirated to exclude sepsis and has to be assessed for crystals. A history of recurrent self-limiting joint pain is suggestive of gout. When one includes podagra and the presence of tophi, the specificity increases. Serum urate is often helpful with the diagnosis, but it cannot be the only criterion on which the diagnosis is based. The urate level may be normal in an acute attack and conversely may be elevated in asymptomatic individuals.[3] The demonstration of MSU does not exclude the possibility of another cause of monoarthritis. Importantly, sepsis and trauma may coexist in an inflamed joint.

Once a diagnosis of gout is made, the modifiable risk factors must be assessed.

The American College of Rheumatology/European League Against Rheumatism (ACR/EULAR) 2015 gout classification criteria (Table 1) have recently been published. They propose a 3-step process for making the diagnosis of gout:[4]

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

Table 1. The ACR/EULAR 2015 gout classification criteria Pattern of joint involvement

Ankle or mid-foot (1)

Podagra (2)

Characteristics • Erythema overlying the joint • Cannot bear touch or pressure • Difficulty walking/using the joint

One characteristic (1)

Two characteristics (2)

Time course of typical episode (≥2) • Maximal pain within 24 hours • Resolution of symptoms within 14 days • Complete resolution between attacks

One typical episode (1)

Recurrent typical episodes (2)

Clinical evidence of a tophus

Present (4)

Serum uric acid level

<0.24 mmol/L (−4)

Synovial fluid analysis

MSU negative (−2)

Imaging • Ultrasound detection of tophi • X-ray: erosions

Present (4)

• Step 1. Entry criterion: at least 1 episode of swelling or tenderness in a peripheral joint or bursa.

• Step 2. Sufficient clinical criteria (if met, can classify as gout; then step 3 is not necessary): presence of MSU crystals in a symptomatic joint or bursa or the presence of tophus.

• Step 3. If Step 2 does not confirm the diagnosis, then use the given scoring system in Table 1. A score of ≥8 is sufficient for the diagnosis of gout.

Treatment

The acute attack

The management of the acute attack is very effective and may be a contributing factor as to why gout is poorly managed. The effectiveness of the acute management may make the patient forget about the more important ULT. NSAIDs, colchicine and corticosteroids are all effective in managing the acute attack. The choice of anti-inflammatory drug will depend on the risk of side-effects and comorbidities. Patients do report that early treatment at the first sign of pain may abort a full attack. Once established, the acute attack will last for several days before it resolves.

Colchicine is particularly effective in the acute attack, but the therapeutic window is very narrow. Gastrointestinal side-effects are especially common and may cause unwanted problems in patients who are immobilised as a result of the acute attack. Oral corticosteroids are equally effective; however, patient selection is important, e.g. corticosteroids are more effective than NSAIDs in patients with renal disease but not ideal in diabetics with sepsis. The patient profile will determine the agent of choice.[5-7] Intra-articular steroids are also effective in the acute attack, but have not been well studied. They are favoured in acute monoarthritis after aspirating the joint to dryness.

Lifestyle modification

Lifestyle modification and dietary changes should be addressed at the first attack of gout. One should screen for comorbidities because of the strong association with the metabolic syndrome.

Hypertension, diabetes and dyslipidaemia should be considered.

Chronic medication should be reviewed to ensure that there are no drugs that will cause hyperuricaemia. Alternatives to thiazide

0.36 - 0.48 mmol/L (2) 0.48 - 0.60 mmol/L (3)

Three characteristics (3)

>0.6 mmol/L (4)

diuretics should be selected and low-dose aspirin indications scrutinised. Weight reduction should be advised and alcohol intake reduced. Beer must be avoided at all costs. Foods high in purines should be avoided. Most people are aware that offal and oily fish are sources of purines, but certain vegetables are also high in purines. Mushrooms, broccoli and spinach have a moderate content of purines and may also need to be avoided. High-fructose corn syrup (HFCS) is an artificial sweetener that is used in many different food products. A high fructose intake will increase uric acid production via the phosphokinase shunt. The ingredients of fruit juices, cereals, sauces, syrups and even breads may include HFCS. Angiotensin receptor blockers have a mild uricosuric effect and may help with lowering uric acid levels.

Urate-lowering therapy

The goal of ULT is to decrease the uric acid level below the saturation point. A treat-to-target strategy should be started with the goal of lowering the urate level to 0.35 mmol/L. In tophaceous gout the target should be lower.

Allopurinol is the first line of treatment for gout. It is a xanthine oxidase inhibitor and decreases uric acid production. It has been shown to be effective in both under-excretors (under-secretors) and over-producers of uric acid. Ideally, allopurinol should be started once the acute attack has settled. Twenty percent of patients will experience the acute attack when starting allopurinol. Colchicine should be used as prophylaxis to prevent acute flares when starting daily allopurinol – up to at least 3 months.

Allopurinol should be started at 100 mg daily and the uric acid levels checked every 4 weeks. Allopurinol should be increased by 100 mg until the target is reached. Allopurinol hypersensitivity syndrome (AHS) is a rare side-effect in 0.1% of patients. It entails a desquamating rash, fever and hepatitis and is potentially life threatening. Pre-existing renal disease is the main risk factor for AHS. Patients should be advised to discontinue allopurinol if they develop a rash and seek urgent medical attention.[6-8] Febuxostat is another xanthine oxidase inhibitor that is used to lower uric acid.

Probenecid is a uricosuric agent and an alternative to allopurinol.

It inhibits urate reabsorption in the proximal convoluted tubule.

December 2015, Vol. 105, No. 12

CONTINUING MEDICAL EDUCATION

It is contraindicated in renal failure and in patients who have urolithiasis. Probenecid is not as effective as allopurinol.

Losartan and fenofibrate both have mild uricosuric effects and may be used in combination with the conventional therapies to lower uric acid levels.

Pegloticase is a pegylated recombinant uricase that converts uric acid to allopurinol. It has been licensed by the US Food and Drug Administration (FDA) for refractory tophaceous gout. It is associated with transfusion reactions and immunogenicity.

Asymptomatic hyperuricaemia

Hyperuricaemia has been shown to be associated with the metabolic syndrome. However, only a third of patients with hyperuricaemia develop gout. It is still not clear whether hyperuricaemia is an independent risk factor for cardiovascular disease and whether initiating therapy in patients with asymptomatic hyperuricaemia will be beneficial. Currently, ULT is not indicated in these patients. This is an area of ongoing research.[7]

Conclusion

Gout and hyperuricaemia are becoming more common. Gout can be effectively managed by targeting serum acid and aggressively

lowering the level to 0.35 mmol/L. Comorbid diseases and other drugs provide challenges in managing gout. Lifestyle modification is an essential component in the management of gout, particularly dietary changes, maintaining a normal weight and a reduction/ avoidance of alcohol. The management of asymptomatic hyper足 uricaemia and its role in cardiovascular disease are areas of ongoing research.

References 1. Hak AE, Choi HK. Lifestyle and gout. Curr Opin Rheumatol 2008;20:178-186. [http://dx.doi. org/10.1097/BOR.0b013e3282f524a2] 2. Terkeltaub R. Update on gout: New therapeutic strategies and options. Nat Rev Rheumatol 2010;6:3038. [http://dx.doi.org/10.1038/nrrheum.2009.236] 3. Malik A, Schumacher HR, Dinnella JE. Clinical diagnostic criteria for gout: Comparison with the gold standard of synovial fluid crystals. J Clin Rheumatol 2009;15:22-24. [http://dx.doi.org/10.1097/ RHU.0b013e3181945b79] 4. Neogi T, Jansen TL, Dalbeth N, et al. 2015 Gout Classification Criteria. Arthritis Rheumatol 2015;67(10):2557-2568. [http://dx.doi.org/10.1002/art.39254] 5. Baker JF, Schumaker H. Update of gout and hyperuricaemia. Int J Clin Pract 2010;64(3):371-377. [http://dx.doi.org/10.1111/j.1742-1241.2009.02188.x] 6. Neogi T. Clinical practice of gout. N Engl J Med 2011;364:443-452. [http://dx.doi.org/10.1056/ NEJMcp1001124] 7. Weisman M. Targeted Treatment of the Rheumatic Diseases. Philadelphia: Saunders Elsevier, 2010:293-302.

8. Khanna D, Fitzgerald J, Khanna P, et al. 2012 American College of Rheumatology guidelines for the management of gout. Part 1: Systematic non-pharmacological and pharmacologic therapeutic approaches to hyperuricaemia. Arthritis Care Research 2012;64(10):1431-1446. [http://dx.doi.org/10.1002/acr]

December 2015, Vol. 105, No. 12

CAREERS & CLASSIFIEDS Tel: 012 481 2121 | E-mail: ladinev@hmpg.co.za www.hmpg.co.za We accept credit card payments - Visa or MasterCard.

CONSULTANT HISTOPATHOLOGISTS Rustenburg & Pretoria

GENERAL PRACTITIONER REQUIRED

These positions would suit energetic histopathologists registered with the HPCSA, who would like to join the histopathology departments of Drs Du Buisson, Kramer, Swart, Bouwer Inc. (Ampath group) in Rustenburg or Pretoria.

A competitive salary package will be negotiated.

Well-established Family Practice in Johannesburg South requires a General Practitioner to become part of our team. The practice, situated in Meredale, Is very well positioned and offers a comprehensive range of medical Services. Very good long term prospects with apartnership option.

Contact: Anli Coetzer (012) 678 1805 or e-mail your CV and references to coetzera@ampath.co.za

TEL: 011 680 5684 FAX: 011 680 5315 Email: hannelie@mondeormed.co.za

Locum/Assistant- Randburg

CAPE TOWN - SOUTHERN SUBURBS – GENERAL PRACTITIONER

General practitioners required for a busy family practice.

Short/long term locums available.

Rare opportunity for General Practioner to join well-established, successful practice in Claremont Medical Village on 1 March 2016

Please send CV to Harriet at: admin@cosmed.co.za Tel no: +27 11 024 0500

Contact Dr Peter Sandell Drs Louw Sandell & DeLaHarpe Email: petejan@yebo.co.za Telephone: 021 – 683 6810

General Practitioner Locum

QUALIFIED DERMATOLOGIST REQUIRED

General Practitioner locum needed for a well established dispensing Practice, from 03 February 2016 – 14 February 2016, no after hours required.

To find out more, please contact: byrne@drsmareesmit.co.za for more information.

In a fully established Dermatology Practice in Nieuw Muckleneuk, Pretoria.

Currently immediate sessional hours available.

Prospect of permanent full-time position within 2 to 3 months. Excellent long-term possibilities.

Please send your details to: Ursula: u.lamprecht@mweb.co.za

CAREERS & CLASSIFIEDS

Besige Algemene Praktyk in Hermanus benodig n assistant met oog op vennootskap.

E-pos kort CV na: pslapa@telkomsa.net Busy General Practice in Hermanus looking for an assistant with view of partnership.

E-mail short CV to: pslapa@telkomsa.et

Practice for sale 30 Year old established dispensing GP practice for sale in Bellville,Cape Town. Practice is administered by Medicross HealthCare Group.

No after hours work.

DOCTORS ROOMS TO RENT Secure rooms to let in new MEDICAL CENTRE in LINDEN. Negotiable rentals and lease terms.

For more info contact yoni@nonyaprop.co.za or 082-339-2358

GENERAL PRACTICE IN CAPE TOWN FOR SALE Incorporated singleton general practice of standing for sale in central Cape Peninsula

Contact:0828072793 e-mail:dewald.strydom@medicross.co.za

For a detailed report contact : Geoff Hatt email : geoff@aldes.co.za Cell : 082 828 7785

TRANSFUSION MEDICINE SPECIALIST • Auckland, New Zealand • Full-time The New Zealand Blood Service was established in 1998 to provide a national vein to vein service in transfusion.

The Auckland Area is responsible for collecting and processing approximately 55,000 donations each year and is also responsible for provision of hospital blood banking services at Auckland City Hospital. The Area includes the National Red Cell Reference and Tissue Typing laboratories and an active apheresis unit including a clinical apheresis programme.

A vacancy now exists for a Transfusion Medicine Specialist to join a team of three transfusion specialists who are together responsible for both provision of a clinical transfusion medicine service to Auckland Hospitals and also clinical management of issues within the collection and production facilities of the Auckland Centre. Candidates with appropriate interest and experience may be able to focus on the delivery of clinical transfusion services to Auckland City Hospital (the largest hospital in New Zealand). To be successful in securing this position, you will have a qualification which will enable you to become vocationally registered with the New Zealand Medical Council.

For further information and to apply for this role, please visit our careers site at www.careers.nzblood.co.nz If you have any specific questions in relation to the position, please feel free to contact Amanda Stewart email: Amanda.stewart@nzblood.co.nz Applications close: Friday, 11th December 2015 All applications will be treated in the strictest confidence.

NZBS is an Equal Opportunity Employer

careers.nzblood.co.nz

CPD

DECEMBER 2015

The CPD programme for SAMJ is administered by Medical Practice Consulting.

CPD questionnaires must be completed online at www.mpconsulting.co.za.

True (A) or false (B): SAMJ Climate change, public health and COP21 1. Climate trends projections for SA suggest that average temperatures will increase by approximately 2°C more than the predicted average global increase of 2°C by 2100.

2. Diarrhoeal infections have been linked to anomalously dry seasons and increases in monthly average maximum temperatures in subSaharan Africa.

3. Malaria in Limpopo is more significantly associated with rainfall than temperature.

4. Water scarcity will threaten the production of staple food crops at both subsistence and commercial levels.

5. Food insecurity and extreme events could also lead to mass popu­ lation migration impacting disease transmission patterns, burdening healthcare systems and pressurising demand for local services.

Measurement of viral load by the automated Abbott real-time HIV-1 assay using dried blood spots 6. Measuring the HIV-1 burden from whole blood dried on filter paper provides a suitable alternative for low-technology settings with limited access to laboratory facilities, such as sub-Saharan Africa.

Diagnostic accuracy of integrated positron emission tomography/ computed tomography in the evaluation of pulmonary mass lesions in a tuberculosis-endemic area 7. Integrated positron emission tomography/computed tomography (PET-CT) is a well-validated modality for assessing pulmonary mass lesions and specifically for estimating the risk of malig­ nancy.

8. PET-CT is found to have a poor diagnostic accuracy in an area, such as SA, with a very high incidence of TB. An electronic colonoscopy record system enables detailed quality assessment and benchmarking of an endoscopic service 9.

Flexible fibreoptic colonoscopy is the current gold standard investigation for diseases of the colon, as it allows direct visualisation of the entire colon, and for several therapeutic interventions.

10.

According to guidelines of the American Society of Gastro­ enterology, the rate of complete colonoscopy should be >90% for diagnostic colonoscopy, and >95% for screening colonoscopy.

CME Lupus nephritis: A simplified approach to diagnosis and treatment in SA 11. As many as 80% of patients with systemic lupus erythematosus (SLE) may develop overt abnormalities of renal function late in the course of the disease.

12. SLE is a rare condition in Africa.

Evidence-based treatment of SLE and its complications 13. On current evidence, all SLE patients should be prescribed an antimalarial drug.

14.

Corticosteroids are responsible for most irreversible organ damage in SLE patients 15 years after diagnosis.

Infections in the management of rheumatic diseases: An update 15.

Patients with rheumatoid arthritis should be screened for hepatitis B virus before initiation of methotrexate, leflunomide and biologic therapies.

Meeting the challenges in the diagnosis of inflammatory myo­ pathies 16. Inflammatory myopathies is an umbrella term for a group of muscle diseases exemplified by dermatomyositis and polymyo­ sitis.

17. It is important to exclude hyper- and hypothyroidism in the differential diagnosis of inflammatory myopathy.

Juvenile idiopathic arthritis – an update on its diagnosis and management 18. Juvenile idiopathic arthritis is the most common form of chronic arthritis in children and the most common form of musculo­ skeletal disability in children.

Approach to lower back pain 19. Lower back pain is the most expensive benign condition in industrialised countries owing to the number of work days lost.

Gout and hyperuricaemia 20. Gout has two clinical presentations affecting the musculoskeletal system – acute arthritis and chronic tophaceous gout.

Readers please note: articles may appear in summary/abstract form in the print edition of the journal, with the full article available online via www.samj.org.za

A maximum of 3 CEUs will be awarded per correctly completed test.

INSTRUCTIONS 1. Read the journal. All the answers will be found there, in print or online.

2. Go to www.mpconsulting.co.za to answer the questions.

Accreditation number: MDB015/167/02/2015

December 2015, Vol. 105, No. 12

Beta Pharmaceuticals trusted products…

• Skin Scripts MSM Rub with 30% MSM and natural oils for pain relief, arthritis and sore muscles

Beta Pharmaceuticals Beta Pharmaceuti trusted products…

Picoprep makes colon cleansing plain sailing

• Quatroflora because not all probiotics are the same •

trusted products

Sodium Picosulphate, Oral Powder for Solution.

• Skin Scripts MSM Rub with 30% MSM and natural oils for pain relief, arthritis and •sore muscles Skin Scripts MSM Rub with 30% MSM a

pain relief,with arthritis sore muscles • Beta-Gel to provide constantforlubrication theand same •pHQuatroflora because not all probiotics are the same as the body

• Quatroflora because not all probiotics are

• X-Uberance Gold with Vitex agnus-castus (Chasteberry) • X-Uberance Gold with Vitex to help balance hormones during PMS and menopause and agnus-castu All products NAPPI coded to help balance hormones during PMS and m ease polycystic ovary syndrome and endometriosis

ease polycystic ovary syndrome and endome

• Beta-Gel to provide constant lubrication with the same pH • Beta-Gel to provide constant lubrication w as the body All products NAPPI coded

as the body

All products NAPPI coded

Tel: 041 3781189

Tel: 041 3781189 sales@betapharm.co.za Available from sales@betapharm.co.za www.betapharm.co.za Pharmacies www.betapharm.co.za

A

P

OBC