SAMJ Vol 107, No 3 (2017) by HMPG

MARCH 2017

PRINT EDITION

GUEST EDITORIAL Understanding antibiotic resistance at the population level CME Prevention of childhood injuries (part 1) IN PRACTICE Preventing iatrogenic infections in neonates and children RESEARCH Efficacy of intravitreal anti-VEGF for retinopathy of prematurity Trends in admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital Accuracy of nurse triage in an academic emergency department in Gauteng

MARCH 2017 PRINT EDITION

GUEST EDITORIALS 3 Improving our understanding of antibiotic resistance: The relevance of surveillance at the population level P O Bessong, R L Guerrant 4

Rapidly changing mortality profiles in South Africa in its nine provinces V Pillay-van Wyk, R E Dorrington, D Bradshaw

EDITOR’S CHOICE

CORRESPONDENCE

8 Reliable systematic review of low-carbohydrate diets shows similar weight loss effects compared to balanced diets and no cardiovascular risk benefits: Response to methodological criticisms C E Naude, A Schoonees, M Senekal, P Garner, T Young, J Volmink 10

Chronic kidney disease at primary care level: Significant challenges remain J Bovijn ERRATUM Immunisation coverage in the rural Eastern Cape – are we getting the basics of primary care right? Results from a longitudinal prospective cohort study

IZINDABA 12

EDITOR Bridget Farham, BSc (Hons), PhD, MB ChB EDITORS EMERITUS Daniel J Ncayiyana, MD (Groningen), FACOG, MD (Hon), FCM (Hon) JP de V van Niekerk, MD, FRCR ASSOCIATE EDITORS Q Abdool Karim, A Dhai, N Khumalo, R C Pattinson, A Rothberg, A A Stulting, J Surka, B Taylor, M Blockman, J M Pettifor, W Edridge, R P Abratt HMPG CEO AND PUBLISHER Hannah Kikaya | Email: hannahk@hmpg.co.za MANAGING EDITORS Ingrid Nye Claudia Naidu TECHNICAL EDITORS Emma Buchanan Kirsten Morreira Naadia van der Bergh Paula van der Bijl

30 days in medicine B Farham

PRODUCTION MANAGER Emma Jane Couzens

BOOK REVIEW Dr James Barry: A Woman Ahead of Her Time

DTP AND DESIGN Clinton Griffin Travis Arendse

EDITORIALS 16 Carpe diem (‘Seize the day’): Building on the findings of the 2015 World Health Organization evaluation of the multidrug-resistant tuberculosis (MDR-TB) programme to make the most of shortened MDR-TB treatment in South Africa M Loveday, H Cox 20

Bevacizumab treatment for retinopathy of prematurity in South Africa T Pollock

Childhood injuries: A commission for human responsibilities is needed A B van As, A Dhai

CONTINUING MEDICAL EDUCATION

GUEST EDITORIAL Prevention of childhood injuries A B van As, A van Niekerk

ARTICLES Prevention of ingestion injuries in children M Arnold, A B van As, A Numanoglu

CHIEF OPERATING OFFICER Diane Smith | Tel. 012 481 2069 Email: dianes@hmpg.co.za SALES MANAGER (CAPE TOWN) Azad Yusuf JOURNAL ADVERTISING Charles William Duke Reneé Hinze Ladine van Heerden Makhadzi Mulaudzi Charmalin Simpson Ismail Davids ONLINE SUPPORT Gertrude Fani FINANCE Tshepiso Mokoena

29 Schoolbus driver performance can be improved with driver training, safety incentivisation, and vehicle roadworthy modifications A van Niekerk, R Govender, R Jacobs, A B van As

HMPG BOARD OF DIRECTORS Prof. M Lukhele (Chair), Dr M R Abbas, Dr M J Grootboom, Mrs H Kikaya, Prof. E L Mazwai, Dr M Mbokota, Dr G Wolvaardt ISSN 0256-9574 SAMA website: www.samedical.org Journal website: www.samj.org.za

IN PRACTICE

CLINICAL UPDATE A framework for preventing healthcare-associated infection in neonates and children in South Africa A Dramowski, M F Cotton, A Whitelaw

MEDICINE AND THE LAW Ownership and human tissue – the legal conundrum: A response to Jordaan’s critique S Mahomed, M Nöthling-Slabbert, M S Pepper

40 An imaginary legal conundrum: A reply to the response by Mahomed, Nöthling-Slabbert and Pepper D W Jordaan

March 2017, Print edition

RESEARCH 42

The eﬃcacy of intravitreal antivascular endothelial growth factor as primary treatment of retinopathy of prematurity: Experience from a tertiary hospital H Kana, I Mayet, D Soma, H Dawood Alli, S Biddulph

Trends in admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital, Cape Town, 2004 - 2013* Y Isaacs-Long, L Myer, H J Zar

A review of blood transfusions in a trauma unit for young children* M Salverda, N Ketharanathan, M van Dijk, E Beltchev, H Buys, A Numanoglu, A B van As

Single-centre experience of allogeneic haemopoietic stem cell transplant in paediatric patients in Cape Town, South Africa* A van Eyssen, N Novitsky, P de Witt, T Schlaphoﬀ, V Thomas, D Pillay, M Hendricks, A Davidson

The accuracy of nurse performance of the triage process in a tertiary hospital emergency department in Gauteng Province, South Africa L N Goldstein, L M Morrow, T A Sallie, K Gathoo, K Alli, T M M Mothopeng, F Samodien

The impact of a modified World Health Organization surgical safety checklist on maternal outcomes in a South African setting: A stratified cluster-randomised controlled trial* M Naidoo, J Moodley, P Gathiram, B Sartorius

A randomised trial comparing laparoscopy with laparotomy in the management of women with ruptured ectopic pregnancy* L C Snyman, T Makulana, J D Makin *Abstract only, full article available online.

SAMJ SUBSCRIPTION RATES Local subscriptions ZAR1 488.00 p.a. Foreign subscriptions ZAR3 408.00 p.a. Single copies ZAR124.00 local, ZAR284.00 foreign Members of the South African Medical Association receive the SAMJ only on request, as part of their membership benefit. Subscriptions: Tel. 012 481 2071 Email: members@samedical.org The SAMJ is published monthly by the Health and Medical Publishing Group (Pty) Ltd, Co. registration 2004/0220 32/07, a subsidiary of SAMA. HEAD OFFICE Health and Medical Publishing Group (Pty) Ltd Block F, Castle Walk Corporate Park, Nossob Street, Erasmuskloof Ext. 3, Pretoria, 0181 Tel. 012 481 2069 Email: dianes@hmpg.co.za EDITORIAL OFFICE Suite 11, Lonsdale Building, Lonsdale Way, Pinelands, 7405 Tel. 021 532 1281 | Cell. 072 635 9825 Email: publishing@hmpg.co.za Please submit all letters and articles for publication online at http://www.editorialmanager.com/samj © Copyright: Health and Medical Publishing Group (Pty) Ltd, a subsidiary of the South African Medical Association

CAREERS & CLASSIFIEDS CPD QUESTIONS

Use of editorial material is subject to the Creative Commons Attribution – Non-commercial Works Licence. https://creativecommons.org/licenses/bync/4.0

The following articles appear in the full, online issue only:

CORRESPONDENCE 172

ONLINE CONTENTS LISTED IN Index Medicus (Medline) Excerpta Medica (EMBASE) Biological Abstracts (BIOSIS) Science Citation Index (SciSearch) Directory of Open Access Journals (DOAJ) Current Contents/Clinical Medicine

Patients in whom surgical closure of terminal branches of external carotid arteries for migraine treatment resulted in reduced frequency of epileptic attacks I Derakhshan

Printed by TANDYM PRINT

IN PRACTICE 201

CASE REPORT A review of patients with glutaric aciduria type 1 at Inkosi Albert Luthuli Central Hospital, Durban, South Africa R Govender, A Mitha, L Mubaiwa

RESEARCH

MARCH 2017

264

The prevalence of HIV seropositivity and associated cytopenias in full blood counts processed at an academic laboratory in Soweto, South Africa J L Vaughan, T M Wiggill, N Alli, K Hodkinson

270

Electrophoresis test prevalence, requesting patterns, yield and related bone marrow biopsy findings at a South African tertiary hospital: A 5-year retrospective audit N Naidoo, R T Erasmus, R Grewal, A E Zemlin

Background photo: Bongekile Simelane holds her conjoined twin daughters for the first time since their landmark separation procedure | Netcare Unitas Hospital Box photos: Antibiotics | borgogniels; Child playing with cleaning products | Red pepper; Red Cross War Memorial Children’s Hospital | Western Cape Government Health

March 2017, Print edition

PRINT EDITION

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

GUEST EDITORIAL

Improving our understanding of antibiotic resistance: The relevance of surveillance at the population level Bacterial infections are primarily treated with antibiotics. However, bacteria develop mechanisms enabling them to thrive in the presence of therapeutic doses of antibiotics, leading to antibiotic resistance, and to broad antibiotic resistance when a bacterium is not susceptible to more than one class of antibiotics. The level of antibiotic resistance is on the rise globally to an alarming extent, including in South Africa (SA), and calls for strategies to mitigate the decline in the effectiveness of antibiotics have grown louder.[1,2] For example, new insights from research and policy development on antibiotic resistance continue to feature prominently in international meetings, such as the recently held global Grand Challenges meeting in October 2016. Proposals to establish a framework aimed at the judicious use of antibiotics, as a measure to mitigate antibiotic resistance, include production and distribution of quality drugs, correct diagnosis, appropriate prescription of drugs and channels for their distribution, and the involvement of all health professionals for viable antibiotic stewardship.[3-5] Our knowledge about optimal antibiotic usage and the scope and diversity of circulating antibiotic-resistant bacteria in apparently healthy individuals is limited. This editorial is intended to highlight the importance of antibiotic resistance surveillance at population level as part of an approach to improve our understanding of the complexity and dynamics of the antibiotic resistance landscape in SA. Recent data from the Etiology, Risk Factors, and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Development (MAL-ED) project[6] revealed varying degrees of antibiotic use in different countries, including SA, and evidence for overuse and underuse in children <24 months old. Data were collected through twice-weekly home visits and from examination of clinic/hospital treatment records. MAL-ED is a multicountry, prospective, observational birth cohort study carried out to improve understanding of the interactions of enteric infections, childhood illnesses, vaccine responses, environmental enteropathy, physical growth and cognitive development.[7] In this edition of the SAMJ, DeFrancesco et al.[8] demonstrate that strains of Escherichia coli, a common cause of bacterial gastroenteritis, produce extended-spectrum beta-lactamase (ESBL). The production of ESBL allows bacteria to thrive in the presence of therapeutic doses of several clinically important antibiotics, potentially complicating management. Clones of E. coli (each bacterial colony emanating from a single genome) were obtained from normal (non-diarrhoeal) stools of young children enrolled in MAL-ED SA, followed by antibiotic susceptibility and minimum inhibitory testing, and detection of genes coding for antibiotic resistance. Worthy of note is the fact that E. coliproducing ESBL was observed prospectively in children as young as 4 months of age, and who had never received antibiotics. A previous report highlighted quinolone-resistant bacteria in young Peruvian children naive to antibiotics and the fact that antibiotic-resistant bacteria are increasingly becoming part of our normal microbiota,[9] suggesting carriage and transmission of multidrug-resistant bacteria at the population level from early in life. Questions that arise are: what is the burden of antibiotic resistance in apparently healthy individuals, and how does this burden affect the formulation of strategies to minimise the spread of antibioticresistant bacteria? We propose that it is worthwhile to understand

the burden and carriage of drug-resistant bacteria at the population level. Data obtained from this approach, in addition to hospitalbased and environmental observations, will contribute enormously to our understanding of the scope, ecology and transmission dynamics of antibiotic resistance in SA. This is relevant for advocacy, policy development and practice. The approach of understanding the microbial resistance levels in the general population is not new: for example, it is being applied in HIV drug resistance sur veillance.[10] In view of the enormous challenge posed by the surge in antibiotic resistance in SA and globally, new strategies are needed to improve our understanding of the antibiotic resistance landscape. Pascal O Bessong Professor of Microbiology and Director, HIV/AIDS & Global Health Research Programme, Department of Microbiology, School of Mathematical and Natural Sciences, University of Venda, Thohoyandou, Limpopo, South Africa bessong@univen.ac.za

Richard L Guerrant Professor of International Medicine, Division of Infectious Diseases and International Health, School of Medicine, University of Virginia; and Founding Director, Center for Global Health, University of Virginia, Charlottesville, USA 1. Laxminarayan R, Duse A, Wattal C, et al. Antibiotic resistance – the need for global solutions. Lancet Infect Dis 2013;13(12):1057-1098. http://dx.doi.org/10.1016/S1473-3099(13)70318-9 2. Chioro A, Coll-Seck AM, Høie B, et al. Antimicrobial resistance: A priority for global health action. Bull World Health Organ 2015;93(7):439. http://dx.doi.org/10.2471/BLT.15.158998 3. O’Donnell LA, Guarascio AJ. The intersection of antimicrobial stewardship and microbiology: Educating the next generation of health care professionals. FEMS Microbiol Lett 2017;364(1)fnw281. http://dx.doi.org/10.1093/femsle/fnw281 4. Goff DA, Kullar R, Goldstein EJ, et al. A global call from five countries to collaborate in antibiotic stewardship: United we succeed, divided we might fail. Lancet Infect Dis 2016;17(2):e56-e63. http:// dx.doi.org/10.1016/S1473-3099(16)30386-3 5. Levy Hara G, Kanj SS, Pagani L, et al. Ten key points for the appropriate use of antibiotics in hospitalised patients: A consensus from the Antimicrobial Stewardship and Resistance Working Groups of the International Society of Chemotherapy. Int J Antimicrob Agents 2016;48(3):239-246. http://dx.doi. org/10.1016/j.ijantimicag.2016.06.015 6. Rogawski EA, Platts-Mills JA, Seidman JC, et al. Diverse antibiotic use practices in the first two years of life across 8 sites in the MAL-ED birth cohort study. Bull World Health Organ 2017;95(1):49-61. http:// dx.doi.org/10.2471/BLT.16.176123 7. MAL-ED Network Investigators. The MAL-ED study: A multinational and multidisciplinary approach to understand the relationship between enteric pathogens, malnutrition, gut physiology, physical growth, cognitive development, and immune responses in infants and children up to 2 years of age in resource-poor environments. Clin Infect Dis 2014;59(suppl 4):S193-S206. http://dx.doi.org/10.1093/ cid/ciu653 8. DeFrancesco AS, Tanih NF, Samie A, Guerrant RL, Bessong PO. Antibiotic resistance patterns and β-lactamase identification in E. coli isolated from young children in rural Limpopo, South Africa: The MAL-ED cohort. S Afr Med J 2017;107(3):205-214. http://dx.doi.org/10.7196/SAMJ.2017.v107i3.12111 9. Mathers AJ, Guerrant RL. Dissecting the evolutionary stealth of our flora against antibiotics. Trans R Soc Trop Med Hyg 2014;108(3):121-122. http://dx.doi.org/10.1093/trstmh/tru002 10. Steegen K, Carmona S, Bronze M, et al. Moderate levels of pre-treatment HIV-1 antiretroviral drug resistance detected in the first South African national survey. PLoS One 2016;11(12):e0166305. http:// dx.doi.org/10.1371/journal.pone.0166305

S Afr Med J 2017;107(3):167. DOI:10.7196/SAMJ.2017.v107i3.12357

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

GUEST EDITORIAL

The Second National Burden of Disease Study[1,2] has confronted the data-quality issues associated with vital registration of cause of death[3-5] and derived updated estimates of the levels and causes of mortality for 1997 - 2012 for 140 specific causes, 23 categories and four broad cause groups.[6] Estimates have been produced by age, sex, province and population group, providing unparalleled information about disease trends and health disparities in the country. Our results show a number of successes where the health of the population has improved.[1] HIV/AIDS deaths dropped from just over 306 000 in 2006 to 154 000 in 2012 (Fig. 1). This decline in the number of deaths corresponds with the rollout of antiretroviral treatment. Even with these gains, HIV/AIDS is still the single leading cause of death in South Africa (SA), and the prevention of the spread of HIV and the provision of access to treatment are of paramount importance. The study also highlights the fact that there are a considerable number of deaths from non-communicable diseases, exceeding the number from HIV/AIDS and tuberculosis combined by 2012.[1] Cardiovascular conditions including stroke, ischaemic heart disease and hypertensive heart disease constitute the leading category of non-communicable disease deaths in SA. However, different trends in cause-specific non-communicable diseases were observed; for example, tobacco-related mortality has declined, while deaths from diabetes and renal disease have increased.[1,7] Furthermore, injury deaths have declined since the late 1990s, with a 52% decrease in agestandardised death rates between 1997 and 2012.[1] Interestingly, the top ten single causes of death have not changed over the 16-year period, and include causes from all four broad cause groupings, i.e. HIV/AIDS and tuberculosis, other type 1 conditions (other communicable diseases, maternal causes, perinatal conditions and nutritional deficiencies), non-communicable diseases and injuries.[1] Although the proportions and rankings of the top causes have shifted, this finding reflects a continuing quadruple burden that has characterised the disease profile in SA since the late 1990s.[8] In addition to cause-of-death information, national and provincial reports can be found at http://www.mrc.ac.za/bod/reports.htm and provide trends in four key demographic indicators that reflect the status of development and health. Estimates of the infant mortality rate, the under-five mortality rate, the adult mortality rate (the probability of a 15-year-old dying before reaching 60 years) and life expectancy at birth are provided for the years 2000, 2005, 2010 and

Deaths, n

Rapidly changing mortality profiles in South Africa in its nine provinces 2012. The infant mortality rate, under-five mortality rate and adult mortality rate decreased between 2005 and 2012, and life expectancy at birth increased from 2005 onwards, consistent with the trends obtained from the Rapid Mortality Surveillance system established by the South African Medical Research Council.[9] 800 000 Our study measured premature mortality by counting the years of life 700 lost000 depending on the age at which a death occurs compared with a standard 600 000 life expectancy, and estimated over 10 million years of life lost due to premature mortality in 2012. Much of this premature loss 500 000 of life can be avoided if appropriate action is taken, and the different 400 000 profiles of the causes of premature mortality should be provincial used guide strategies to improve health in each province. The 300to000 leading causes of premature mortality for Gauteng and Limpopo 200 000 provinces are shown in Fig. 2 to illustrate that while HIV/AIDS 100 000as the leading cause, Gauteng Province needs to emphasise dominates intersectoral 0 actions in order to address the mortality of young people due to1997 interpersonal violence, and2003 Limpopo needs to focus 1998 1999 2000 2001 2002 2004 2005 2006 2007 2008 on 2009 2010 2011 2012 improving the quality of care in health services and access to water Years and sanitation by communities to address the preventable burden from infectious diseases. Non-communicable disease Injuries HIV/AIDS and TB Other type 1 Our study has produced a wealth of information that warrants further exploration and interpretation, within acknowledged limiÂ tations related to the sources of data and methodologies.[1] The Burden of Disease Research Unit invites researchers and experts Gauteng (N=1 946 000* years of life lost (YLLS)), % 0

HIV/AIDS

40 34.9

Interpersonal violence

5.8

Road injuries

5.3

Cerebrovascular disease

4.3

Lower respiratory disease

3.6

Limpopo (N=879 000* YLLS), % 0

800 000 700 000

Deaths, n

35.5

HIV/AIDS

600 000 500 000 400 000 300 000 200 000

Lower respiratory infections

7.6

Diarrhoeal diseases

6.6

Road injuries

5.4

Tuberculosis

4.4

100 000 0 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012

Years Non-communicable disease

HIV/AIDS and TB

Other type 1

Fig. 1. Number of deaths by broad cause group, 1997 - 2012.

Injuries

Fig. 2. Top five causes of premature mortality for selected provinces, 2012. (*Note: Numbers rounded to the nearest thousands.)

Gauteng (N=1 946 000* years of life lost (YLLS)), % 0

HIV/AIDS Interpersonal violence

40 34.9

5.8

March 2017, Print edition

GUEST EDITORIAL

interested in collaborating on further investigations to contact Dr Victoria Pillay-van Wyk. Acknowledgements. We thank Statistics South Africa for providing causeof-death data; the Second National Burden of Disease Study team including William Msemburi, Ria Laubscher, Pam Groenewald, Beatrice Nojilana, Jané D Joubert, Richard Matzopoulos, Megan Prinsloo, Nadine Nannan, Theo Vos, Nontuthuzelo Somdyala, Nomfuneko Sithole, Ian Neethling, and Edward Nicol for generation and review of estimates; and Elize de Kock, Sulaiman Abrahams, Claudette Garnie and Monique Fourie for admini strative support. This research and the publication thereof were partly funded by the South African Medical Research Council’s Flagships Awards Project (SAMRC-RFA-IFSP-01-2013/SA CRA 2).

V Pillay-van Wyk Burden of Disease Research Unit, South African Medical Research Council, Cape Town, South Africa victoria.pillayvanwyk@mrc.ac.za R E Dorrington Centre for Actuarial Research, Faculty of Commerce, University of Cape Town, South Africa

D Bradshaw Burden of Disease Research Unit, South African Medical Research Council, Cape Town, South Africa 1. Pillay-van Wyk V, Msemburi W, Laubscher R, et al. Mortality trends and differentials in South Africa from 1997 to 2012: Second National Burden of Disease Study. Lancet Glob Health 2016;4:e642-653. http://dx.doi.org/10.1016/S2214-109X(16)30113-9 2. Msemburi W, Pillay-van Wyk V, Dorrington RE, et al. Second national burden of disease study for South Africa: Cause-of-death profile for South Africa, 1997 - 2012. Cape Town: South African Medical Research Council, 2016. http://www.mrc.ac.za/bod/SouthAfrica2012.pdf (accessed 21 Dec 2016). 3. Joubert J, Rao C, Bradshaw D, Vos T, Lopez AD. Evaluating the quality of national mortality statistics from civil registration in South Africa, 1997 - 2007. PLoS One 2013;8:e64592. http://dx.doi. org/10.1371/journal.pone.0064592 4. Pillay-van Wyk V, Bradshaw D, Groenewald P, Laubscher R. Improving the quality of medical certification of cause of death: The time is now! S Afr Med J 2011;101:626. http://dx.doi.org/10.7196/ SAMJ.5047 5. Bradshaw D, Msemburi W, Dorrington R, Pillay-van Wyk V, Laubscher R, Groenewald P, for the South African National Burden of Disease team. HIV/AIDS in South Africa: How many people died from the disease between 1997 and 2010? AIDS 2016;30:771–778. http://dx.doi.org/10.1097/ QAD.0000000000000947 6. Pillay-Van Wyk V, Laubscher R, Msemburi W, et al. Second South African National Burden of Disease Study: Data cleaning, validation and SANBD list. Cape Town: Medical Research Council, 2014. http:// www.mrc.ac.za/bod/SANBDReport.pdf (accessed 21 Dec 2016). 7. Nojilana B, Bradshaw D, Pillay-van Wyk V, et al. Emerging trends in non-communicable disease mortality in South Africa, 1997 - 2010. S Afr Med J 2016;106(5):477-484. http://dx.doi.org/10.7196/ SAMJ.2016.v106i4.10674 8. Bradshaw D, Groenewald P, Laubscher R, et al. Initial burden of disease estimates for South Africa, 2000. S Afr Med J 2003;93:682-688. 9. Dorrington RE, Bradshaw D, Laubscher R, Nannan N. Rapid mortality surveillance report 2015. Cape Town: South African Medical Research Council, 2016. http://www.mrc.ac.za/bod/ RapidMortalitySurveillanceReport2015.pdf (accessed 21 Dec 2016).

S Afr Med J 2017;107(3):168-169. DOI:10.7196/SAMJ.2017.v107i3.12344

Conﬁdence Through Clinical and Real World Experience1-3 #1 NOAC prescribed by Cardiologists* Millions of Patients Treated Across Multiple Indications4 References: 1. Patel M.R., Mahaffey K.W., Garg J. et al. Rivaroxaban versus warfarin in non-valvular atrial fibrillation. N Engl J Med. 2011;365(10):883–91. 2. Tamayo S., Peacock W.F., Patel M.R., et al. Characterizing major bleeding in patients with nonvalvular atrial fibrillation: A pharmacovigilance study of 27 467 patients taking rivaroxaban. Clin Cardiol. 2015;38(2):63–8. 3. Camm A.J., Amarenco P., Haas S. et al. XANTUS: A Real-World, Prospective, Observational Study. 4. Calculation based on IMS Health MIDAS, Database: Monthly Sales December 2015. For full prescribing information, refer to the package insert approved by the Medicines Regulatory Authority (MCC). S4 XARELTO ® 10 (Film-coated tablets). Reg. No.: 42/8.2/1046. Each film-coated tablet contains rivaroxaban 10 mg. PHARMACOLOGICAL CLASSIFICATION: A.8.2 Anticoagulants. INDICATION: Prevention of venous thromboembolism (VTE) in patients undergoing major orthopaedic surgery of the lower limbs. S4 XARELTO ® 15 and XARELTO ® 20 (Film-coated tablets). Reg. No.: XARELTO ® 15: 46/8.2/0111; XARELTO ® 20: 46/8.2/0112. Each film-coated tablet contains rivaroxaban 15 mg (XARELTO ® 15) or 20 mg (XARELTO ® 20). PHARMACOLOGICAL CLASSIFICATION: A.8.2 Anticoagulants. INDICATIONS: (1) Prevention of stroke and systemic embolism in patients with non-valvular atrial fibrillation (SPAF); (2) Treatment of deep vein thrombosis (DVT) and for the prevention of recurrent deep vein thrombosis (DVT) and pulmonary embolism (PE); (3) Treatment of pulmonary embolism (PE) and for the prevention of recurrent pulmonary embolism (PE) and deep vein thrombosis (DVT). HCR: Bayer (Pty) Ltd, Reg. No.: 1968/011192/07, 27 Wrench Road, Isando, 1609. Tel: 011 921 5044 Fax: 011 921 5041. L.ZA.MKT.GM.01.2016.1265 *Impact RX Data Oct - Dec 2015 NOAC: Non Vitamin K Oral Anticoagulant

March 2017, Print edition

EDITOR’S CHOICE

CME: Childhood injuries (part 1)

Trauma has always accompanied humankind, but has only been recognised as a significant health issue for the last half-century. Its burden in South Africa (SA) has been described as unprecedented, and children, representing an estimated 40% of the SA population, are a vulnerable group. The impact of childhood trauma, whether intentionally (through interpersonal violence, homicide or suicide) or unintentionally inflicted (especially through road traffic crashes, drowning, burns, poisoning or falls), has become a major health and social problem. Childhood injuries may impact hugely on childhood health in terms of disability and can have grim psychological, educational, social and economic consequences. Since 1983 trauma has officially been globally called ‘the number one killer of children’, and SA is no exception. Unfortunately, child hood injuries have still not been included on national health priority lists, especially with regard to their preventability. We are therefore delighted to present this issue of CME with specific reference to the preventability of various types of childhood injury.

Antibiotic resistance patterns and betalactamase identification in E. coli

The problem of antibiotic resistance is not a new one; multiple drug resistance in Escherichia coli was first observed in the 1950s. Considering that intestinal infectious diseases are the leading cause of death in children aged <14 years in Limpopo Province, South Africa (SA), and that resistance genes can be geographically distinct, identification and monitoring of resistance mechanisms is important in order to foster appropriate treatment regimens. This study[1] focuses on community isolates from children as opposed to clinical isolates. The Etiology, Risk Factors, and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Develop ment (MAL-ED) project was designed to look for correlations between factors present during childhood in developing regions, focusing on the relationship between enteric pathogen presence and growth and development outcomes. When deciding which antibiotics to test in the disc diffusion assays, the most frequently used antibiotics in the SA site MAL-ED participant group were considered. This provided useful information on the local clinical usage of various classes of antibiotics, with the penicillin class being most common, followed by sulfonamides, macrolides and others. With penicillin-class antibiotics being most commonly employed in treatment of illness, resistance to this class would have the most negative impact, so the focus was on resistance mechanisms to this class. Penicillin resistance was the second most prevalent in the study after co-trimoxazole resistance, which is a worrying trend considering the common use of penicillin in the management of bacterial infections. The study adds to the body of evidence on the spread of antibiotic resistance in rural communities, and supports the increasing need for reduction in the frequency of empirically prescribing antibiotics, a common practice in communities without diagnostic laboratory support. In conclusion, clinicians and public health practitioners should bear in mind that transmission of extended-spectrum beta-lactamaseresistant E. coli exists at the community level and that children as young as 2 years, even without prior exposure to antibiotics, may be harbouring these resistant phenotypes, an awareness that should guide prescription practices.

Accuracy of nurse performance of the triage process

Triage in the emergency department is necessary in order to prioritise and assign relatively scarce resources to the medical needs of patients for efficient and timeous treatment according to the severity of their condition on presentation. In 2004, the South African Triage Scale

(SATS) was developed to be used as a nurse-led, in-hospital triage tool. It categorises patients into different colour groups depending on the severity of their condition, the aim being for patients triaged red to be evaluated immediately, orange within 10 minutes of arrival, yellow within 1 hour and green within 4 hours. Few studies have been done to determine the validity of the SATS with regard to over- or under-triage of patients. Over-triage will result in unnecessarily assigning resources to a patient, and under-triage could mean potential morbidity or mortality as a result of time delays. Goldstein et al.[2] aimed to determine how often patients were allocated to the correct triage category, the extent to which they were incorrectly promoted or demoted within a triage category and the main reasons for promotion and demotion, and to compare error rates for each category of triage in a nurse-led triage system. It was not the accuracy of the SATS tool itself that was evaluated, but the accuracy of its use by nurses. The study showed that patients were correctly triaged 68.3% of the time. There was no difference in the correct triage rate between trauma and non-trauma patients, but non-trauma patients were more likely to be incorrectly demoted when incorrectly triaged, whereas trauma patients were more likely to be promoted. Incorrect triaging mostly resulted in the promotion of patients who should have been in the green category and demotion of patients who should have been in the orange category. Mis-triaging can be attributed to incorrect or lack of discriminator use, numerical miscalculations and other human errors. Quality control and quality assurance measures must target training in these areas to minimise mis-triage in the ED.

Admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital, Cape Town, 2004 - 2013

Red Cross War Memorial Children’s Hospital (RCWMCH) collects routine hospital information in an administrative database. The objective of this study by Isaacs-Long et al.[3] was to examine mortality and morbidity trends and outcomes at RCWMCH as indicators of child health of the local population. In addition, the impact of recent changes in healthcare practices on child health at RCWMCH was assessed. From 2004 to 2013, there was a total of 215 536 admissions to RCWMCH, accounted for by 129 733 patients. Overall admissions increased by almost 10% over this period. This increase could be the result of growth in the child population or increased referrals from surrounding health facilities. However, a concurrent fall in the number of new patients indicates an increase in readmissions. Significant increases in admissions to medical specialty wards, intensive care and the burns unit suggest increasing prevalences of complex or chronic conditions. Two striking observations are the preponderance of male admissions during the decade and an increase in the median age of admissions and the median age of death across the decade. Pneumonia and diarrhoea are still the most common reasons for medical admissions, in spite of a reduction in the number of cases across the study period. The introduction of pneumococcal conjugate vaccine and rotavirus vaccine is clearly having a beneficial effect. Hospital administrative databases are prone to error, but remain valuable data sources for high-quality health information. BF 1. DeFrancesco AS, Tanih NF, Samie A, Guerrant RL, Bessong PO. Antibiotic resistance patterns and betalactamase identification in Escherichia coli isolated from young children in rural Limpopo Province, South Africa: The MAL-ED cohort. S Afr Med J 2017;107(3):205-214. http://dx.doi.org/10.7196/ SAMJ.2017.v107i3.12111 2. Goldstein, LN, Morrow LM, Sallie TA, et al. The accuracy of nurse performance of the triage process in a tertiary hospital emergency department in Gauteng Province, South Africa. S Afr Med J 2017;107(3):243247. http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11118 3. Isaacs-Long Y, Myer L, Zar HJ. Trends in admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital, Cape Town, 2004 - 2013. S Afr Med J 2017;107(3):219-226. http://dx.doi. org/10.7196/SAMJ.2017.v107i3.11364

March 2017, Print edition

Bio-Oil_medical_print_ad_297x210.indd 1

2016/06/07 9:19 AM

These open-access articles are distributed under Creative Commons licence CC-BY-NC 4.0.

CORRESPONDENCE

Reliable systematic review of lowcarbohydrate diets shows similar weight-loss effects compared with balanced diets and no cardiovascular risk benefits: Response to methodo logical criticisms

To the Editor: Harcombe and Noakes[1] have raised some concerns about our systematic review[2] with questions about the protocol, data extraction and statistical analyses, and the findings. We started our review by writing a protocol, and defining the question, eligibility criteria and subgroups.[2] This is standard evidence synthesis practice to avoid post-hoc alterations that can create bias. As there are numerous definitions of low-carbohydrate diets, we defined our dietary eligibility criteria by drawing on online advocacy information,[3-6] our structured summary of 50 existing systematic reviews,[2] and national macronutrient recommendations (Australia, USA, Nordic countries, Europe).[7-11] We stated clearly in the paper that we did not intend to investigate macronutrient quality, such as dietary saturated fat content. The subgroups intended were predefined, as protocols should differentiate qualitatively different interventions to help data interpretation and to explore heterogeneity in meta-analysis.[12] Harcombe and Noakes[1] note that one included trial was a duplicate of another trial already included. As the publications did not reference each other, we have subsequently notified the journal editors of this duplication, and have also carried out a sensitivity analysis excluding the duplicate. This made no material difference to the effect estimate. Harcombe and Noakes[1] criticise various specifics in our data extraction and their comments suggest they did not refer to our protocol, and show lack of understanding of current methods in evidence synthesis. We used data from intention-to-treat analyses (and only if not reported, we used data from per-protocol analyses), and did not report values the wrong way around. Data in the De Luis trials[13,14] can be meta-analysed – there is no problem with combining change and end values in a meta-analysis of randomised controlled trials.[12] Harcombe and Noakes’[1] use of standardised mean difference (SMD) is inappropriate as all trials reported weight in the same unit (kilograms). SMDs are functionally unclear and the meaning of differences and measures of variance have limited interpretability.[15] Harcombe and Noakes[1] use the SMD and various post-hoc adjustments to produce a metaanalysis, at an unspecified time point, on one outcome. They then use statistical significance to claim that low-carbohydrate diets produce greater weight loss. Concluding material benefit based on statistical tests of significance with clinically unimportant effects, rather than on the size of the effect, is a common mistake. Our results show that the estimated average weight loss after 3 6 months in overweight and obese non-diabetics in 13 individual trials ranged from a loss of 2.65 - 10.20 kg in people randomised to low-carbohydrate diets, and ranged from a loss of 2.65 - 9.40 kg with isoenergetic balanced diets. After 3 - 6 months, the average difference in weight loss between the dietary groups was 780 g (adjusted from 740 g in our PLoS One[2] article following exclusion of the duplicate publication), a clinically unimportant difference,[16] as was the average difference of 480 g after 1 - 2 years. Harcombe and Noakes[1] do not provide clear methods, rationale and time points for their partial re-analysis. We welcome scrutiny and comments. Having considered these carefully, we stand by our analysis and results. We also report that in overweight and obese adults randomised to low-carbohydrate diets or iso-energetic balanced diets, there is probably little or no clinically

important difference in average changes in cardiovascular risk factors for up to 2 years.[2] Declarations. Our review[2] was funded by the South African Medical Research Council, and the Effective Health Care Research Consortium (funded by UKaid from the UK Government Department for International Development). Authors (CEN, AS, TY, PG, JV) of this letter work for a charity committed to using scientifically defensible methods to prepare and update systematic reviews of the effects of health interventions. None of the authors are financially conflicted.

C E Naude, A Schoonees Centre for Evidence-based Health Care, Department of Global Health, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa cenaude@sun.ac.za

M Senekal Division of Human Nutrition, Department of Human Biology, Faculty of Health Sciences, University of Cape Town, South Africa

P Garner Centre for Evidence Synthesis, Department of Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, UK

T Young, J Volmink Centre for Evidence-based Health Care, Department of Global Health, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa; Cochrane South Africa, South African Medical Research Council, Cape Town, South Africa 1. Harcombe Z, Noakes TD. The universities of Stellenbosch/Cape Town low-carbohydrate diet review: Mistake or mischief? S Afr Med J 2016;106(12):1179-1182. https://doi.org/10.7196/samj.2016.v106. i12.12072 2. Naude CE, Schoonees A, Young T, Senekal M, Garner P, Volmink J. Low carbohydrate versus isoenergetic balanced diets for reducing weight and cardiovascular risk: A systematic review and metaanalysis. PLoS One 2014;9(7):e100652. https://doi.org/10.1371/journal.pone.0100652 3. Atkins Nutritionals. New Atkins. Atkins Nutritionals, 2011. http://sa.atkins.com/ (accessed 10 August 2012). 4. WebMD. The Atkins Diet. WebMD, 2012. http://www.webmd.com/diet/atkins-diet-what-it-is (accessed 10 August 2012). 5. Zone Labs. Dr Sears Zone Diet. Zone Labs Inc., 2012. http://www.zonediet.com/ (accessed 10 August 2012). 6. Barnett J. The Zone Diet Explained. Crossfit Impulse, 2009. http://crossfitimpulse.com/the-zone-dietexplained-edited (accessed 10 August 2012). 7. Institute of Medicine Food and Nutrition Board. Dietary Reference Intakes for Energy, Carbohydrate, Fiber, Fat, Fatty Acids, Cholesterol, Protein, and Amino Acids (Macronutrients). Washington, DC: National Academies Press, 2005. 8. Australian National Health and Medical Research Council and the New Zealand Ministry of Health. Nutrient Reference Values for Australia and New Zealand: Including Recommended Dietary Intakes. Canberra: Australian National Health and Medical Research Council and the New Zealand Ministry of Health, 2006. 9. Becker W, Lyhne N, Pedersen AN, et al. Nordic Nutrition Recommendations 2004 – integrating nutrition and physical activity. Scand J Nutr 2004;48(4):178-187. https://dx.doi. org/10.1080%2F1102680410003794 10. Nordic Council of Ministers. Nordic Nutrition Recommendations 2004. Copenhagen: Nordic Council of Ministers, 2004. 11. EFSA Panel on Dietetic Products Nutrition and Allergies (NDA). Dietary Reference Values. Parma: European Food Safety Authority (EFSA), 2010. 12. Higgins D, Green S, eds. Cochrane Handbook for Systematic Reviews of Interventions Version 5.1.1 (updated March 2011). London: John Wiley & Sons Ltd, 2011. 13. De Luis DA, Aller R, Izaola O, et al. Evaluation of weight loss and adipocytokines levels after two hypocaloric diets with different macronutrient distribution in obese subjects with rs9939609 gene variant. Diabetes Metab Res Rev 2012;28(8):663-668. https://dx.doi.org/10.1002/dmrr.2323 14. De Luis DA, Sagrado MG, Conde R, Aller R, Izaola O. The effects of two different hypocaloric diets on glucagon-like peptide 1 in obese adults, relation with insulin response after weight loss. J Diabetes Complications 2009;23(4):239-243. https://dx.doi.org/10.1016/j.jdiacomp.2007.12.006 15. Egger M, Smith GD, Altman D. Systematic Reviews in Health Care: Meta-Analysis in Context. 2008. http://olabout.wiley.com/WileyCDA/Section/id-397493.html (accessed 20 January 2017). 16. Jensen MD, Ryan DH, Apovian CM, et al. 2013 AHA/ACC/TOS guideline for the management of overweight and obesity in adults: A report of the American College of Cardiology/American Heart Association Task Force on practice guidelines and the obesity society. Circulation 2014;129(25 Suppl 2):S102-S138. https://dx.doi.org/10.1161/01.cir.0000437739.71477.ee

S Afr Med J 2017;107(3):170. DOI:10.7196/SAMJ.2017.v107i3.12382

March 2017, Print edition

Makes colon cleansing plain sailing...

Sodium Picosulphate Oral Powder for Solution. For bowel cleansing in conjunction with: Intravenous Pyelograms (IVP) Bowel Evacuation Abdominal X-Ray Examinations Surgery Colonoscopy S0 Each sachet contains: Sodium Picosulphate 10mg, Magnesium Oxide Ph Eur 3.5g, Citric Acid Ph Eur 12.0g, Aspartame 36mg. Reg.No A38/11.5/0389.

CORRESPONDENCE

Chronic kidney disease at primary care level: Significant challenges remain

To the Editor: Chronic kidney disease (CKD) remains a poorly recognised and ill-managed clinical entity.[1] I reflect on three recent patient encounters at primary care level, hoping that these vignettes will serve to improve our clinical care of patients with, and at risk of developing, CKD. Case 1. A 41-year-old man presented for routine 6-monthly followup of his hypertension and diabetes mellitus. His blood pressure (BP) had been significantly elevated on previous visits, and he was currently on four different antihypertensive agents. His serum creatinine level had been 120 µmol/L when last measured more than 2 years previously. He complained about worsening fatigue and occasional epigastric discomfort. Examination revealed a BP of 165/105 mmHg, conjuctival pallor and mild bipedal oedema. On evaluation of his renal function, his serum creatinine level was found to be >2 000 µmol/L. Case 2. A 46-year-old man complained of epigastric pain for 2 weeks. Further history taking revealed admission to an intensive care unit 18 months earlier, although no clinical information was available regarding that admission. Review of blood results from that time showed that he had presented with a serum creatinine level of 379 µmol/L, which had improved to 305 µmol/L by the time of discharge. Blood tests had not been repeated since then. On systematic enquiry, the patient noted that he had recently been passing decreasing volumes of urine. Examination revealed a tender epigastrium but was otherwise unremarkable. His current serum creatinine level was 988 µmol/L. Case 3. A 40-year-old man presented with headaches, severe hyper tension and a serum creatinine level of 886 µmol/L. The clinical record showed that he had been seen 3 months earlier with the same clinical presentation. Although the creatinine level at that time had been 541 µmol/L, this had not been acted on. Likewise, a creatinine level of 134 µmol/L 2 years earlier had gone unnoticed. All three patients were referred to the internal medicine department for further work-up and management. There are several issues common to these three cases. • Recognition of individuals at high risk for developing CKD and end-stage renal failure (ESRF) remains poor. Those with poorly controlled/resistant hypertension, poorly controlled dia betes mellitus and pre-existing episode(s) of acute kidney injury constitute a particularly high-risk group, and their renal function should be followed up diligently. This highlights the importance of

following evidence-based guidelines for the management of such high-risk conditions. The 2014 South African (SA) hypertension practice guideline[2] states that serum creatinine should be checked at least annually in hypertensive patients. None of the above patients had received such annual investigation, and the critical opportunity to detect and possibly delay the progression of their CKD had been missed. • CKD progresses insidiously, and most patients are asymptomatic or present with ‘minor’ symptoms such as fatigue, swelling, weight loss and abdominal discomfort. This further highlights the importance of diligently screening for and appropriately managing CKD. • Previous laboratory results should be routinely reviewed, as these may reveal important clinical information, e.g. previous renal dysfunction. • Patients with abnormal renal function should ideally be considered for specialist referral – in all three of the cases described above, there had been significantly abnormal renal function in the preceding 18 - 24 months, yet none of the patients had been referred to an internist. Earlier detection of CKD, and appropriate referral, could aid in delaying the onset of ESRF. In view of the fact that SA is currently able to offer renal replace ment therapy to only ~20% of patients requiring it,[1] the early detection and prevention of ESRF is paramount. This places an important responsibility in the hands of primary care practitioners. Guidance previously published in the SAMJ[3-5] and elsewhere[6] presents simple and useful approaches to the management and prevention of CKD. Following such guidance should aid in decreasing the burden of CKD and ESRF in SA communities. J Bovijn

Community Service Medical Officer, South Africa jonasbovijn@gmail.com 1. Meyers AM. Chronic kidney disease. S Afr Med J 2015;105(3):232. http://dx.doi.org/10.7196/ SAMJ.9444 2. Seedat YK, Rayner BL, Veriava Y. South African hypertension practice guideline 2014. Cardiovasc J Afr 2014;25(6):288-294. http://dx.doi.org/10.5830/CVJA-2014-062 3. Van Rensburg B, Meyer AM. Clinical aspects of chronic kidney disease. S Afr Med J 2015;105(3):237. http://dx.doi.org/10.7196/SAMJ.9413 4. Gerntholtz T, Paget G, Hsu P, Meyers AM. Management of patients with chronic kidney disease. S Afr Med J 2015;105(3):237. http://dx.doi.org/10.7196/SAMJ.9417 5. Moosa MR, Meyers AM, Gottlich E, Naicker S. An effective approach to chronic kidney disease in South Africa. S Afr Med J 2016;106(2):156-159. http://dx.doi.org/10.7196/SAMJ.2016.v106i2.9928 6. Kidney Disease: Improving Global Outcomes (KDIGO) CKD Work Group. KDIGO 2012 Clinical Practice Guideline for the Evaluation and Management of Chronic Kidney Disease. Kidney Int Suppl 2013;3:1-150.

S Afr Med J 2017;107(3):171. DOI:10.7196/SAMJ.2017.v107i3.12292

Erratum Immunisation coverage in the rural Eastern Cape – are we getting the basics of primary care right? Results from a longitudinal prospective cohort study

In the article ‘Immunisation coverage in the rural Eastern Cape – are we getting the basics of primary care right? Results from a longitudinal prospective cohort study’ by Le Roux et al., which appeared on pp. 52 - 55 of the January 2017 SAMJ, the last three bars on the right in Fig. 1 were incorrectly labelled as MCV1, PCV3, RV2. The correct labels are RV2, MCV1, PCV3. The online version of the article (http:// dx.doi.org/10.7196/SAMJ.2017.v107i1.11242) was corrected on 15 February 2017. S Afr Med J 2017;107(3):274. DOI:10.7196/SAMJ.2017.v107i3.12400

March 2017, Print edition

SAVE THE DATE

ASSA SAGES 2017 BOARDWALK CONVENTION CENTRE PORT ELIZABETH SOUTH AFRICA 5 - 8 AUGUST 2017 www.assasages.co.za

Congress Management: Eastern Sun Events Phone: +27 (0)41 374 5654 l Email: assasages@easternsun.co.za

Conferencing with a view... ...see you in Port Elizabeth 2017!

ENT CONGRESS 28 - 30 October 2017 Boardwalk Convention Centre Port Elizabeth

EASTERN SUN EVENTS Tel: +27 41 374 5654 Email: ent@easternsun.co.za Web: www.entcongress.co.za

These open-access articles are distributed under Creative Commons licence CC-BY-NC 4.0.

IZINDABA

30 days in medicine Keep mentally active to prevent cognitive decline

Playing games, using a computer, or doing crafts such as knitting regularly will help to prevent mild cognitive impairment in healthy older people, according to a study published recently in JAMA Neurology. The prospective trial followed up 1 929 people aged ≥70 years who were cognitively normal at baseline for 4 years. They underwent neurocognitive assessment every 15 months, providing information on how often they took part in mentally stimulating activities during the year before the study began, including reading, crafts, using a computer, playing games, and social activities such as going to the cinema or theatre. Individuals who engaged in these activities at least twice a week had a 22% lower risk of developing mild cognitive impairment than those who did so only two or three times a month. This reduced risk of mild cognitive impairment with mentally stimulating activities remained after the researchers further adjusted the study findings to take account of participants’ comorbidities, depression and apolipoprotein E (APOE) ε4 genotype. Stratified analysis by APOE ε4 carrier status suggested that people without this genotype who engaged in mentally stimulating activities regularly had the lowest risk of developing new-onset mild cognitive impairment (for example, hazard ratio 0.73 with frequent computer use). APOE ε4 carriers who did not take part in these activities had the highest risk (1.74 among those not using a computer regularly). Krell-Roesch J, Vemuri P, Pink A, et al. Association between mentally stimulating activities in late life and the outcome of incident mild cognitive impairment, with an analysis of the APOE ε4 genotype. JAMA Neurol 2017. http://dx.doi.org/10.1001/jamaneurol.2016.3822 (published online 30 January 2017).

No obesity risk among children of pregnant women with a high BMI

Popular wisdom has it that women who are overweight or obese during pregnancy predispose their children to obesity in later life, but this longitudinal study suggests that this is not the case. While being overweight or obese during pregnancy does result in larger babies at birth, it seems that the tendency does not remain later in life. The study, reported in PloS Medicine, analysed information from 6 057 pairs of mothers and children from two prospective birth cohort studies. Researchers investigated whether women who had genetic variants shown to be associated with obesity and who had a high body mass index (BMI) during pregnancy were more likely to have babies who went on to be overweight or obese in childhood and adolescence than would be expected from genetic transmission of BMI-associated genes alone. This included looking at genotype results in mothers and repeat measurements of BMI in children from age 7 to 18 years in the Avon Longitudinal Study of Parents and Children and then replicating findings on BMI at age 6 in children from the Generation R study. Results showed little evidence to support the long-term impact of maternal BMI in pregnancy on a child’s risk of obesity in childhood and adolescence. Instead, most of the association between a mother’s BMI in pregnancy and her child’s obesity was explained by genetic transmission of BMI-associated variants. The authors suggest that public health messages need to be aimed at a healthy weight before and after pregnancy, and not simply during. Richmond RC, Timpson NJ, Felix JF, et al. Using genetic variation to explore the causal effect of maternal pregnancy adiposity on future offspring adiposity: A Mendelian randomisation study. PLoS Med 2017;356:e1002221. http://dx.doi.org/10.1371/journal.pmed.1002221

No difference in outcomes with partial meniscectomy for traumatic or degenerative meniscal tears

Knee arthroscopy for meniscal tear is one of the most commonly performed orthopaedic procedures, in spite of findings that such surgery has no better effect than placebo surgery or exercise for middle-aged and older patients with degenerative meniscal tears. This study, however, compared traumatic and degenerative meniscal tears, the former usually occurring in younger sports-active individuals and attributed to specific sport-related trauma. Degenerative meniscal tears are found in older people and attributed to incipient knee osteoarthritis. Despite these differences, the same surgery is offered to both groups of patients. Previous studies have provided equivocal results, with some suggesting worse outcomes in individuals with degenerative changes than in those with traumatic tears. This comparative cohort study, published in the BMJ, compared patientreported outcomes from before surgery to 52 weeks after surgery between individuals undergoing arthroscopic partial meniscectomy for traumatic meniscal tears and for degenerative tears. Individuals aged 18 - 55 years were selected from four public Danish orthopaedic departments. Patient outcomes were reported via online questionnaires, and the primary outcome was the average between-group difference in change on four of five subscales of the knee injury and osteoarthritis outcome scores, covering pain, symptoms, sport and recreational function and quality of life. Although there were better self-reported outcomes in participants with degenerative tears, the difference between groups was not significant. This calls into question the idea that patients with traumatic meniscal tears experience greater improvement in outcomes after surgery than those with degenerative meniscal tears. Thorlund JB, Englund, M, Christensen R, et al. Patient reported outcomes in patients undergoing arthroscopic partial meniscectomy for traumatic or degenerative meniscal tears: Comparative prospective cohort study. BMJ 2017;356:j356. http://dx.doi.org/10.1136/bmj.j356

Assisted partner services in Kenya increase HIV testing and case-finding

Assisted partner services for index patients with HIV infection involve finding information about sex partners and contacting them to ensure that they test for HIV and link to care. Assisted partner services are not widely available in Africa. This study, published in Lancet HIV, aimed to establish whether or not assisted partner services increase HIV testing, diagnoses, and linkage to care among sex partners of people with HIV infections in Kenya. Non-pregnant adults aged at least 18 years with newly or recently diagnosed HIV and without a recent history of intimate partner violence who had not yet or had only recently linked to HIV care from 18 HIV testing services clinics in Kenya were recruited for a cluster randomised controlled trial, enrolling 1 305 participants. Primary outcomes were the number of partners tested for HIV, the number who tested HIV-positive and the number enrolled in HIV care, in those who were interviewed at 6 weeks’ follow-up. Participants in each cluster received the same intervention. Eighteen clusters were allocated to immediate and delayed HIV assisted partner services (nine in each group), 625 (48%) in the immediate group and 680 (52%) in the delayed group. Six weeks after

March 2017, Print edition

Reg no. A40/13.2/0756

Permethrin 5% Lotion Parasites that live on the outside of the host, either on the skin or the outgrowth of the skin, are called ECTOPARASITES

WHAT IS SCABIES? Scabies is an ectoparasite infestation caused by Sarcoptes Scabiei – human itch mite and can affect the whole body.

PREVALENCE  Treatment of Choice Worldwide for more than 10 years  Estimated global prevalence of 300 million per year  Estimated prevalence in South Africa of 2 million per year  Common in disadvantaged socio-economic groups  Common in overcrowded living conditions

LIFE CYCLE OF THE SARCOPTES SCABIEI MITE Why SKABI-RID lotion should be your first choice for the topical treatment of ECTOPARASITES SIMPLE  One single application  Non-greasy lotion  Washes off with soap and water  Odourless

SAFE  Low toxicity  Less irritation than benzyl benzoate or lindane1

Ltd ma (Pty) r a h P C NT: M toria APPLICA andi, Pre n M , e u n e antia Av 62 Const 9 ) 668 301 .za Tel: (012 arma.co h p c m @ armacist Email: ph

TREATMENT OF CHOICE FOR:  Pregnant women in the US and UK2,3  Scabies in AIDS patients4,5  Lactating women2,3  Children from the age of two months7

EFFECTIVE  First line treatment for Scabies, Worldwide  Prevents re-infestation longer  Residual effect  As effective as benzyl benzoate1  Cochrane Review: Most effective scabies treatment currently available  Effective in resistant lice infestation6

References: 12 Peer reviewed Scientific Journals available on request. 1. Acta Derm Venereol. 1989;69(4):348-51

6. West J Med. 2000 May; 172 (5): 342-345

2. CDC. 1998 Guidelines of treatment of sexually transmitted diseases. MMWR 1998; 47:1116

7. Peadiatric Dermatology. 2008; 11 (3): 264-266

3. Clinical Effectiveness Group (Association of Genitourinary Medicines and the Medical Society of the Study of Venereal Diseases). National guideline of the management of scabies. Sex Transm Inf 1999; 75 (suppl): S767 4. Semin Dermatol. 1993 Dec;12 (4): 296-300 5. Anon: New information for pharmacists on treatment of parasitic diseases (letter) 18th World Congress for Dermatology, New York 1992

PACK SIZE: 100ml NAPPI CODE: 713148-001 WHOLESALE PRICE excl VAT: R68.00 PACK SIZE: 50ml NAPPI CODE: 713148-002 WHOLESALE PRICE excl VAT: R47.00

IZINDABA

enrolment of index patients, 392 (67%) of 586 partners had tested for HIV in the immediate group and 85 (13%) of 680 had tested in the delayed group. Of the partners, 136 (23%) had new HIV diagnoses in the immediate group compared with 28 (4%) in the delayed group, and 88 (15%) v. 19 (3%) were newly enrolled in care. Assisted partner services did not increase intimate partner violence (one intimate partner violence event related to partner notification or study procedures occurred in each group). The conclusion was that assisted partner services are safe and increase HIV testing and case-finding; implementation at the population level could enhance linkage to care and antiretroviral therapy initiation and substantially decrease HIV transmission. Cherutich P, Golden MR, Wamuti B, et al. Assisted partner services for HIV in Kenya: A cluster randomised controlled trial. Lancet HIV 2017;4(2):e74-e82. http://dx.doi.org/10.1016/S2352-3018(16)30214-4

Little point in taking NSAIDs for back pain

Non-steroidal anti-inflammatory drugs (NSAIDs) such as ibuprofen are little better than placebo for back pain, according to a systematic

review and meta-analysis published in the Annals of Rheumatic Diseases. The review of 35 randomised placebo-controlled trials involving 6 065 people found that NSAIDs did provide some relief from pain and disability, but little evidence that they were better than placebo. Six patients needed to be treated for one to benefit. Patients taking NSAIDs were also more likely to experience side-effects, such as gastrointestinal events, than those taking placebo. These findings are significant, because spinal pain is a leading cause of disability worldwide and is commonly managed by general practitioners with prescription medication. Clinical guidelines generally recommend NSAIDs as a second-line analgesic after paracetamol – which has also been shown to be ineffective in recent studies. Even the third-line treatment, opioids, have been shown to be of little benefit. The authors suggest that the focus should be on prevention and new treatments. Machado G, Maher C, Ferreira P, et al. Non-steroidal anti-inflammatory drugs for spinal pain: A systematic review and meta-analysis. Ann Rheum Dis 2017;2. http://dx.doi.org/10.1136/annrheumdis-2016-210597 (published online 2 February 2017).

BOOK REVIEW Dr James Barry: A Woman Ahead of Her Time

By Michael du Preez and Jeremy Dronfield. London: Oneworld Publications, 2016. ISBN: 9781780743141

Dr James Barry, on dying, was discovered to be a woman. The transformation of the young woman, Margaret Bulkely, into a man – a disguise that she was able to maintain throughout her long and eventful medical career – was uncovered by Michael du Preez and first published in the SAMJ.[1] Through extensive research, this story has now unfolded into a fascinating tale of the full life and times of this remarkable woman. But this is not a dry scientific document; it reads like a novel, enabling one to appreciate the times, many places, and the people that had an impact on Barry’s life and career. The reasons for her to take on the guise of a man represent a whodunit of political and social intrigue. Although her earliest years were in Cork, Ireland, she was aided by her intellectual connections in London at a time when women were expected either to marry well or to take on limiting careers. Women could not study medicine in Great Britain at the time. However, Dr Barry implemented and successfully carried off her disguise at Edinburgh University, and for the rest of her life thereafter. Dr Barry’s professional career as a wellqualified military surgeon took him all over the world and continually up the ranks through promotions. He had a long and

March 2017, Print edition

eventful stay at the Cape of Good Hope – most of his life was eventful! His personality, drive and vision resulted in improvements to medical services wherever he was posted. At the Cape he developed a close relationship with the Governor, Lord Charles Somerset, performed the first successful caesarean section in Africa (both the mother and child survived, the child being named James Barry Munnik), and took part in a duel against Captain Josias Cloete at Alphen. His other appointments included Mauri tius, Jamaica, St Helena, Antigua, Barbados, Trinidad, Malta, Corfu and Canada. We have a sideshow of Barry at the Crimean war and with Florence Nightingale. Barry’s fiery temper and intolerance of fools resulted in many scenes which often required the intervention of his friends in high places to rescue him from his folly. Apart from the full story of the extra ordinary life of Dr James Barry, the book provides a fascinating glimpse into the life of the people during those times. J P de V van Niekerk Emeritus Editor, SAMJ jpvn@iafrica.com 1. D u Preez HM. Dr James Barry: The early years revealed. S Afr Med J 2008;98(1):52-58.

Medical Practice Consulting

Inge Erasmus 0861 111 335 | werner@mpconsulting.co.za MPC offers SAMA members FREE access to the MPC Online Medical Education platform. SAMA members further have access to Medical Scholarships through MPC for online CPD, CME and Short Courses as well as the attendance of international conferences. For more information, please visit www.mpconsulting.co.za

Mercedes-Benz South Africa (MBSA) Refilwe Makete 012 673-6608 refilwe.makete@daimler.com

Mercedes-Benz offers SAMA members a special benefit through their participating dealer network in South Africa. The offer includes a minimum recommended discount of 3%. In addition SAMA members qualify for preferential service bookings and other after market benefits.

SAMA eMDCM

Zandile Dube 012 481 2057 | coding@samedical.org 67% discount on the first copy of the electronic Medical Doctors Coding Manual (previously known as the electronic Doctor’s Billing Manual).

SAMA CCSA

CCSA: 50% discount of the first copy of the Complete CPT® for South Africa book.

Tempest Car Hire

Corinne Grobler 083 463 0882 | cgrobler@tempestcarhire.co.za SAMA members can enjoy discounted car hire rates with Tempest Car Hire.

V Professional Services

Gert Viljoen 012 348 3567 | gert@vprof.co.za 10% discount on medical practice bureau service through V Professional Services.

Xpedient

Andre Pronk +27 83 555 2885 Sales – 086 1973 343 | andre@xpedient.co.za Xpedient’s goal is to enable Medical Specialists to focus on their core competencies and allow us to assist them in making their business a success. As a SAMA member you qualify for a complimentary preliminary business assessment specific to your practice to the value of R 5000

MEMBER BENEFITS

Zandile Dube 012 481 2057 | leoniem@samedical.org

16/01/2017

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

EDITORIAL

Carpe diem (‘Seize the day’): Building on the findings of the 2015 World Health Organization evaluation of the multidrugresistant tuberculosis (MDR-TB) programme to make the most of shortened MDR-TB treatment in South Africa South Africa (SA) has a high burden of multidrug-resistant tuberculosis (MDR-TB), i.e. TB resistant to isoniazid and rifampicin, the most effective TB drugs.[1] The current MDR-TB regimen requires the use of multiple, toxic, poorly efficacious and expensive secondline drugs for 18 - 24 months. As a consequence of the often severe side-effects and lengthy unpleasant treatment, adherence is poor and failure to complete treatment common.[2] Overall, treatment is successful in only half the patients treated.[3] Until 2008 SA, together with many countries in the world, adopted an inpatient model of care in which patients were hospitalised for the initial 6-month injectable phase of treatment in a centralised specialised hospital to facilitate daily injections and allow close monitoring of adverse events and adherence. Following discharge, for the remaining treatment period (18 months) patients were expected to return to the centralised hospital for monthly outpatient visits. However, by 2008 the escalating burden of MDR-TB and limited bed capacity resulted in long waiting lists, high mortality while patients waited to access treatment, and nosocomial transmission.[4-6] Furthermore, as the facilities to which patients were discharged were unfamiliar with MDR-TB management, continuity of care was poor and many patients were lost to follow-up.[7,8] To address these problems, alternative models of care for MDR-TB patients were introduced,[9,10] and in August 2011 a policy framework on decentralised and deinstitutionalised management of MDR-TB was launched by the National Department of Health (NDoH).[11] In late 2015, the World Health Organization (WHO) led a review to assess the performance and outcomes of the MDR-TB programme and the implementation of alternative models of care.[3] The review applauded recent efforts by the NDoH to address the TB and MDRTB burden in SA, but also highlighted areas in which MDR-TB programme performance could be improved. For the first time in the modern history of TB control, a shortened regimen and new drugs have been become available for the treatment of MDR-TB.[12] These advances have revived hope for improved patient outcomes and for stopping ongoing transmission of MDRTB.[13] In 2013, the WHO recommended the use of a new drug, bedaquiline, for MDR-TB, followed by a similar recommendation in 2014 for the use of delamanid.[14,15] In addition, the use of repurposed drugs such as linezolid and clofazimine is being encouraged. These new drugs are primarily reserved for MDR-TB patients who have additional resistance to second-line drugs or respond poorly to the current treatment regimen. However, treatment outcomes are also poor for MDR-TB patients without second-line resistance. For these patients, hope comes in the form of a shortened standardised treatment regimen, conditionally recommended by the WHO in May 2016.[16] Subsequently, the NDoH announced that this shorter 9 12-month regimen using existing drugs and repurposed clofazimine will be available in SA in the first half of 2017. Given concern about the development of resistance to new drugs and logistical issues in the introduction of new regimen approaches, the tendency will be to centralise the provision and management of both these initiatives. However, given the burden of MDR-TB in SA together with the previous poor performance of centralised care, both the new drugs and shortened treatment regimen need to be available

at centralised and decentralised hospitals and deinstitutionalised treatment sites to ensure universal access to effective treatment. Although MDR-TB is treatable and curable, its programmatic management has long been characterised by multiple problems and inefficient health systems that fail the patient.[13,17] To ‘seize the day’ and capitalise on the window of opportunity afforded by the introduction of the shortened regimen and new and repurposed drugs, these interventions must be optimally implemented. In this editorial we identify the key findings and recommendations from the WHO review that need to be addressed to ensure optimal implementation of the shortened regimen and new drugs.

Summary of the WHO review findings

While the WHO review of decentralised and deinstitutionalised MDR-TB treatment was wide ranging, several key issues were identified pertinent to implementation of the shortened regimen and new drugs. The review found that, for a number of reasons, the extent and co-ordination of decentralised MDR-TB service implementation varied across the provinces. Firstly, the MDR-TB programme was not closely aligned to the TB programme or recent NDoH initiatives such as re-engineering of primary healthcare (PHC) services or the ‘ideal clinic’ initiative. Secondly, different policy and strategy documents do not always ‘talk to each other’, and MDR-TB management and the decentralisation policy framework are not consistently referred to. Importantly, as the framework was not costed, districts were expected to implement the framework with no extra resources. As a result, implementation and co-ordination of decentralised services varied, the framework was seldom included in district operational plans, and staffing was often inadequate. Finally, district and provincial level support and supervision for framework implementation were inadequate. Quality of clinical care is important both for individual patient care and for stewardship of second-line drugs. The review found that clinical management was good and had improved over time. However, inadequate linkages to care and unclear referral pathways contributed to a loss of patients between different levels of care, and suboptimal integration of MDR-TB and HIV services compromised treatment. Monitoring of adverse events was inadequate, and in 29% of the medical records reviewed, patients were not regularly asked about adverse events. Adherence support was inadequate, with up to 90% of patients reviewed missing doses in both the injectable and continuation phases. Ongoing staff training with proper and regular supervision was often lacking, and there were no policies for patients failing to respond to treatment. Several inadequacies in monitoring and evaluation of the MDR-TB programme were highlighted in the review. The electronic data management system used to monitor the programme is a vertical system and data bypass districts. With limited opportunities for data validation or feedback at facility and district levels, there is little ownership of the data at facilities and data quality is poor. The low use of ID numbers as unique identifiers compromises attempts to monitor patients between different levels of care, facilities and laboratory services. Laboratory service support for the MDR-TB programme was well managed. The introduction of the GeneXpert MTB/RIF diagnostic test reduced the time of MDR-TB diagnosis to <48 hours in >90% of the

March 2017, Print edition

Alexander Forbes

MEMBER BENEFITS

Herman Steyn 012 452 7121 / 083 519 3631 | steynher@aforbes.co.za Oﬀers SAMA members a 20% discount on motor and household insurance premiums.

Automobile AssociaSon of South Africa (AA) AA Customer Care Centre 0861 000 234 | kdeyzel@aasa.co.za The AA oﬀers a 12.5% discount to SAMA members on the AA Advantage and AA Advantage Plus Membership packages.

Barloworld

Lebo Matlala (External Accounts Manager: EVC) 011 052 0167 084 803 0435 | LeboM@bwmr.co.za Barloworld Retail Digital Channels oﬀers compePPve pricing on New vehicles; negoPated pricing on demo and pre-owned vehicles; Trade in’s; Test Drives and Vehicle Finance.

BMW

Nicci Barry (Corporate Sales Manager) 083 200 4555 | nicolene.barry@bmwdealer.co.za SAMA members qualify for a minimum of 8% discount on selected BMW & MINI models. All Members also receive compePPve pricing on Lifestyle items and accessories as well as a Motorplan that can be extended up to 200 000km’s.

FORD/KIA CENTURION

Burger Genis (New Vehicle Sales Manager – Ford Centurion) 012 678 0000 | burger@laz.co.za Nico Smit (New vehicle Sales Manager – Kia Centurion) 012 678 5220 | nico@kiacenturion.co.za Lazarus Ford/Kia Centurion, as part of the Lazarus Motor Company group, sells and services the full range of Ford and Kia passenger and commercial vehicles. SAMA Members qualify for agreed minimum discounts on selected Ford and Kia vehicles sourced from Lazarus Ford / Kia Centurion. SAMA members who own a Ford/Kia vehicle also qualify for preferenPal servicing arrangements. We will structure a transacPon to suit your needs.

Hertz Rent a Car

Lorick Barlow 072 308 8516 | lorick@hertz.co.za Hertz is proud to offer preferential car rental rates to SAMA members. A range of value-add product and service options also available. No cost to register as a Gold Plus Rewards member to enjoy a host of exclusive benefits.

Legacy Lifestyle

Allan Mclellan 0861 925 538 / 011 806 6800 |info@legacylifestyle.co.za SAMA members qualify for complimentary GOLD Legacy Lifestyle membership. Gold membership enPtles you to earn rewards at over 250 retail stores as well as preferred rates and privileges at all Legacy Lifestyle partnered hotels and further rewards back on accommodaPon and extras.

17/02/17

EDITORIAL

cases reviewed. However, the capacity for second-line drug sensitivity testing is limited, and drug sensitivity testing for moxifloxacin, the key fluoroquinolone in both the current and shortened regimens, was not conducted. While the shortened regimen is expected to reduce the proportion of patients who do not adhere to treatment, support for patients throughout the 9 - 12 months of the shortened regimen is still essential. Among patients interviewed during the review, 25% interrupted treatment for socioeconomic or treatment-related reasons. Community-level support was undermined by poor alignment of the decentralisation programme with the PHC re-engineering initiative.

Recommendations in light of the introduction of the shortened MDR-TB regimen

Based on the review, a number of recommendations relevant for effective implementation of both the shortened regimen and more widespread use of new and repurposed drugs were proposed. The key recommendation for programme management and co-ordination was acceleration of decentralised and deinstitutionalised MDR-TB care through a more patient-centred approach. Recognising that different models of care are required to provide universal access to MDR-TB treatment, the review recommends that different packages, based on needs and local context, be piloted and scaled up. For each model of care, resource requirements at each level need to be clearly articulated, detailed costs determined and mechanisms to fund implementation determined. The review recommended integration of the MDR-TB programme into other aspects of the health system. Integration of the MDR-TB programme with PHC re-engineering will facilitate patient support in the community from community health workers working in ward-based outreach teams.[18-19] At a PHC level, MDR-TB management must be integrated into all guidelines. And, to ensure correct implementation of guidelines, human resource needs have to be defined and facility level staff trained, supported and guided by clinicians and district and provincial TB co-ordinators. Some but not all provinces have provincial MDR-TB clinical management teams to provide clinical expertise, guidance and oversight on the clinical management of patients. With the introduction of new therapies, these teams need to be functioning optimally in all provinces to provide clinical oversight and support. Implementation of the shortened regimen will require rapid identification of second-line drug resistance status with rapid feedback to clinicians. For optimal clinical care and adherence, the shortcomings in referral pathways, adverse event monitoring and pharmacovigilance reported in the review need to be addressed. Similarly, alignment of the health services to adaptations required by the shortened regimen, such as administration of the injectable 7 days a week, need to be addressed prior to implementation. At a district level, MDR-TB treatment must be integrated into district-level services. To improve data quality, management and programme monitoring, the review recommended the alignment and incorporation of the MDR-TB data management system into the District Health Information System[20] and implementation of a unique patient identifier system.

Conclusion

The WHO-led review highlighted a range of measures to improve patient care and health system functioning. Central among these are strategies to accelerate decentralised and deinstitutionalised MDRTB care. However, the management of MDR-TB is not simple, and the introduction of a new regimen and new and repurposed drugs brings additional complications. There is a risk that implementing new inter-

ventions will roll back the gains made through decentralisation to date. If these new interventions are to reach the greatest number of patients and improve patient outcomes, implementation of the review recommendations and improved service delivery at centralised, decentralised and deinstitutionalised treatment sites are required. Increasing access to treatment for MDR-TB and improving patient outcomes will result in a greater proportion of successfully treated patients, reduced transmission, and ultimately a reduction in the MDR-TB burden. Funding. ML is funded by a United Way Worldwide grant made possible by the Lilly Foundation on behalf of the Lilly MDR-TB Partnership. HC is supported by a fellowship from the Wellcome Trust, UK. Disclaimer. The content of the article is the responsibility of the authors and not the official position of the institutions to which they are affiliated.

Marian Loveday Health Systems Research Unit, South African Medical Research Council, Cape Town, South Africa Helen Cox Division of Medical Microbiology and Institute of Infectious Disease and Molecular Medicine, Faculty of Health Sciences, University of Cape Town, South Africa Corresponding author: M Loveday (marian.loveday@mrc.ac.za) 1. World Health Organization. Global Tuberculosis Control Report 2016. Geneva: WHO, 2016. http://apps. who.int/iris/bitstream/10665/250441/1/9789241565394-eng.pdf?ua=1 (accessed 3 February 2017). 2. Toczek A, Cox H, du Cros P, Cooke G, Ford N. Strategies for reducing treatment default in drug-resistant tuberculosis: Systematic review and meta-analysis. Int J Tuberc Lung Dis 2013;17(3):299-307. http:// dx.doi.org/10.5588/ijtld.12.0537 3. World Health Organization. Towards Universal Health Coverage: Report of the Evaluation of South Africa Drug Resistant TB Programme and Its Implementation of the Policy Framework on Decentralised and Deinstitutionalised Management of Multidrug Resistant TB. Pretoria: WHO, 2016. 4. Wallengren K, Scano F, Margot B, et al. Resistance to TB drugs in KwaZulu-Natal: Causes and prospects for control. 2011. http://arxiv.org/abs/1107.1800 (accessed 25 July 2015). 5. Gandhi N, Moll A, Sturm A, et al. Extensively drug-resistant tuberculosis as a cause of death in patients co-infected with tuberculosis and HIV in a rural area of South Africa. Lancet 2006;368(9547):1575-1580. http://dx.doi.org/10.1016/S0140- 6736(06)69573-1 6. Basu S, Andrews JR, Poolman EM, et al. Prevention of nosocomial transmission of extensively drugresistant tuberculosis in rural South African district hospitals: An epidemiological modelling study. Lancet 2007;370(9597):1500-1507. http://dx.doi.org/10.1016/S0140-6736(07)61636-5 7. Loveday M, Wallengren K, Brust J, et al. Community-based care vs. centralised hospitalisation for MDRTB patients in KwaZulu-Natal, South Africa. Int J Tuberc Lung Dis 2015;19(2):163-171. http://dx.doi. org/10.5588/ijtld.14.0369 8. Brust J, Gandhi N, Carrara H, Osburn G, Padayatchi N. High treatment failure and default rates for patients with multidrug-resistant tuberculosis in KwaZulu-Natal, South Africa, 2000 - 2003. Int J Tuberc Lung Dis 2010;14(4):413-419. https://www.ncbi.nlm.nih.gov/pubmed/20202298 (accessed 3 February 2017). 9. Cox H, Hughes J, Daniels J, et al. Community-based treatment of drug-resistant tuberculosis in Khayelitsha, South Africa. Int J Tuberc Lung Dis 2014;18(4):441-448. http://dx.doi.org/10.5588/ ijtld.13.0742 10. Brust J, Shah N, Scott M, et al. Integrated, home-based treatment for MDR-TB and HIV in rural South Africa: An alternate model of care. Int J Tuberc Lung Dis 2012;16(8):998-1004. http://dx.doi.org/10.5588/ ijtld.11.0713 11. National Department of Health, South Africa. Multi-drug Resistant Tuberculosis: A Policy Framework on Decentralised and Deinstitutionalised Managment for South Africa. Pretoria: NDoH, 2011. http:// www.tbfacts.org/wp-content/uploads/2015/08/SA-MDR-TB-Policy.pdf (accessed 3 February 2017). 12. Field S, Fisher D, Jarand J. New treatment options for multidrug-resistant tuberculosis. Ther Adv Respir Dis 2012;6(5):255-268. http://dx.doi.org/10.1177/1753465812452193 13. Furin J, Brigden G, Lessem E, Rich M, Vaughan L, Lynch S. Global progress and challenges in implementing mew medications for treating multidrug-resistant tuberculosis. Emerg Infect Dis 2016:22(3):e1-e7. http://dx.doi.org/10.3201/eid2203.151430 14. World Health Organization. The Use of Bedaquiline in the Treatment of Multidrug-resistant Tuberculosis: Interim Policy Guidance. Geneva: WHO, 2013. 9789241505482_eng.pdf (accessed 3 February 2017). 15. World Health Organization. The Use of Delamanid in the Treatment of Multidrug-resistant Tuberculosis: Interim Policy Guidance. Geneva: WHO, 2014. WHO_HTM_TB_2014.23 eng.pdf (accessed 3 February 2017). 16. World Health Organization. The shorter MDR-TB regimen. May 2016. http://www.who.int/tb/Short_ MDR_regimen_factsheet.pdf (accessed 2 November 2016). 17. Loveday M, Padayatchi N, Voce A, Brust J, Wallengren K. The treatment journey of a patient with multidrug-resistant tuberculosis in South Africa: Is it patient-centred? Int J Tuberc Lung Dis 2013;17(10):S56-S59. http://dx.doi.org/10.5588/ijtld.13.0101 18. Pillay Y. The implementation of PHC re-engineering in South Africa. 2012. http://www.phasa.org.za/wpcontent/uploads/2011/11/Pillay-The-implementation-of-PHC.pdf (accessed 16 July 2016). 19. Naledi T, Barron P, Schneider H. Primary health care in SA since 1994 and implications of the new vision for PHC re-engineering. In: Padarath A, English R, eds. South African Health Review. Durban: Health Systems Trust, 2011. http://www.hst.org.za/sites/default/files/Chap%202%20PHC%20Reengineering%20pgs%2017-28%20.pdf (accessed 3 February 2017). 20. National Department of Health, South Africa. District Health Information System (DHIS) Database. Pretoria: NDoH, 2015.

S Afr Med J 2017;107(3):176-177. DOI:10.7196/SAMJ.2017.v107i3.12203

March 2017, Print edition

SAMF

Guidance

ribing

on Presc

and ry Tract Alimentaism ol b Meta g -Formin nd Blood Blood a s Organ stem scular Sy Cardiova logicals

Dermato

d stem an rinary Sy Genitou mones Sex Hor al Hormon Systemictions ra a p re P r ctives fo Anti-Infe Generalic Use em st Sy nd plastic a gents Antineo omodulating A Immun em Syst skeletal Musculo System Nervous Central ducts sitic Pro Antipara em tory Syst

iation, ical Assoc an Med lishing Group, 40 ic fr A th 0 b The Sou nd Medical Pu ge, Pretoria 0 Health a 9, Lynnwood Rid 7478 X-XX-X PO Box 8-1-XXXXX ISBN 97

Respira

Sensory

Organs

Media Contrast

F M SA

frican South A nes Medici ry Formula

frican South A ormulary es F Medicin

ines n Medic ritten w th Africa The Sou researched and Clinical n of ry is Formula rs of the Divisio ersity of niv be by mem cology of the U tion with Pharma n, in collabora als. n w Cape To care professio health ican outh Afr by the S e formulary d e sh li b th Pu on, rmacists, Associati Medical at doctors, pha concerned d rs e e im th a is e and o -effectiv dentists nurses, e safe and cost ines. ic th d h e it m w ing of prescrib

12th n Editio

n Edity oiftCaipeoTown’se h t 2 1ve of the Univers mcology and th ,

itiati roup l Phara A joint in ision of Clinica al Publishing G on. Div ociati Medic ss d A n l a a h ic d Healt ican Me outh Afr for the S rs e sh li b pu

oning

t of Pois

Treatmen

The REFERENCE MEDICAL REFERENCE ESSENTIAL MEDICAL The ESSENTIAL for professional! healthcare professional! every healthcare for every

The convenient pocket-sized design enables you to fit it comfortably into your hospital bag or coat pocket, so it The convenient pocket-sized design enables you to fit it comfortably into your hospital bag or coat pocket, so it can always be at hand for ready reference. South African Medicines Formulary (SAMF), a joint initiative of the can always be at hand for ready reference. South African Medicines Formulary (SAMF), a joint initiative of the University of Cape Town’s Division of Clinical Pharmacologyyand the Health and Medical Publishing Group, University of Cape Town’s Division of Clinical Pharmacolog and the Health and Medical Publishing Group, publishers for the South African Medical Association, provides easy access to the latest, scientifically accurate publishers for the South African Medical Association, provides easy access to the latest, scientifically accurate information, including full drug profiles, clinical notes and special prescriber’s points. The thoroughly updated information, including full drug profiles, clinical notes and special prescriber’s points. The thoroughly updated 12th edition of SAMF is your essential reference to the rational, cost-effective and safe use of medicines. 12th edition of SAMF is your essential reference to the rational, cost-effective and safe use of medicines.

Go to www.samf12.org to download the order form or contact

Smith DianeSmith Please direct all order queries to:Diane Medical and Health Health and Medical Group Publishing Publishing Group

2069 4812069 012481 Tel:012 Tel: dianes@hmpg.co.za Email:dianes@hmpg.co.za Email: order dispatchofoforder postedonondispatch invoicetotobebeposted Taxinvoice Tax

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

EDITORIAL

Bevacizumab treatment for retinopathy of prematurity in South Africa ROP in the developing world

Retinopathy of prematurity (ROP) is a growing problem in South Africa (SA), as it is in many parts of the developing world. The so-called ‘third epidemic’ of ROP is caused by a combination of high preterm birth rates, relatively good infant survival and inadequate oxygen monitoring in neonatal facilities.[1] Increasing ROP incidence (due to these factors) has been identified particularly in Latin America and Eastern Europe. SA is generally accepted as having similar challenges in the care of preterm neonates, both in the private and public sectors. ROP is a fibrovascular complication of poorly vascularised premature retinal tissue. It is mediated by vascular endothelial growth factor (VEGF) and insulin-like growth factor, among others. The main complication of untreated advanced ROP is retinal detachment, leading to blindness in one or both eyes, with potentially major impacts on the health, education and economic potential of the affected individual. ROP occurs exclusively in premature infants, and the SA guidelines recommend screening of all neonates born prior to 32 weeks’ gestation and all preterm neonates weighing <1 500 g.[2]

Conventional treatment

Treatment of advanced ROP has traditionally involved laser photocoagulation of the avascular peripheral retinal tissue, thus reducing the stimulus to retinal neovascularisation as well as fibrosis and scarring. Unfortunately, laser treatment is not without its risks – it is associated with high myopia (often noted many years after the laser treatment), visual field constriction and retinal detachment. The general anaesthesia (GA) typically required for conventional laser treatment carries its own attendant risks in the premature infant. And then, even with optimal laser treatment, visual outcomes are less than ideal. In the ‘ETROP’[3] study, application of retinal laser for prethreshold disease showed better outcomes than cryotherapy, but the final visual outcomes were still less than ideal – 25% of treated eyes having vision worse than 20/200 and 65% having vision not good enough for a driver’s licence.[3]

Anti-VEGF treatment

With this background in mind, it is not surprising that anti-VEGF agents have become so popular in recent years. A single intravitreal injection of anti-VEGF agent, performed under local anaesthesia alone (i.e. without sedation or GA), effectively reverses the ROP neovascularisation process in most cases. The most commonly used agent, bevacizumab (Avastin, Genentech, USA) is a monoclonal anti-VEGF antibody. It has been shown to be better than conventional laser treatment for posterior (zone I) disease, and equal to laser for so-called ‘threshold’ disease. [4] The article by Kana et al.[5] demonstrates the effectiveness of bevacizumab in a local SA state hospital setting with an admirable success rate of 95% in patients with ‘threshold disease’ (2 failures progressing to retinal detachment out of 43 treated eyes). The main drivers behind the increasing use of bevacizumab internationally are cost and ease of use. Both are mentioned in the Kana et al.[5] article. In settings where funding is limited, where experienced ophthalmologists are in short supply or where neonatal theatre and high-care facilities are scarce, it makes sense that an

option that allows safe, effective, rapid treatment at the bedside is gaining popularity.

Current management of ROP in SA

Currently, ~50% of ophthalmologists involved in ROP management in SA report making use of bevacizumab to treat ROP in their practice. A growing number (up to 30%) make use of anti-VEGF agents as their primary treatment modality (email survey presented at World Society of Paediatric Ophthalmology & Strabismus Meeting, 2015). The reasons given for use of bevacizumab included ‘ease of use’ and ‘efficacy’ as well as ‘cost’. Several treating units have no laser device available, and therefore would not be able to treat infants with ROP were it not for the availability of bevacizumab. Each year, ~24 000 infants are born in SA at risk of ROP (roughly 1 million live births per year, of whom 2.4% are preterm <32 weeks). Each of these infants should ideally have retinal screening performed 2 or 3 times to rule out ROP. As the number of preterm infants born and surviving in SA continues to rise, the burden of ROP screening and treatment can be expected to follow suit, and the use of antiVEGF agents to treat threshold ROP is likely to gather momentum.

Safety concerns

Intravitreal anti-VEGF treatment is, however, not without potential problems. The treatment is relatively new and there are still questions about its safety profile. Normal angiogenesis is a key component in the development of the eye as well as other vital systems (lung and brain especially). Intravitreal anti-VEGF causes regression of the ROP process, but also causes slowing or stalling of the peripheral retinal vascularisation, leaving a permanent avascular zone in some treated infants, with serious concerns that this may lead to later retinal detachment.[6] Also, the slow resolution mandates prolonged weekly surveillance to ensure that there are no late ROP recurrences (up to 60 weeks in some cases). Underlining fears about systemic safety, bevacizumab has been detected in the serum of both infants and adults after intraocular injection,[7] leading to ongoing debate around appropriate dosage and the best anti-VEGF agent. The dose used by Kana et al.[5] (0.625 mg) is the same as used by most authors in the current literature, although some have recommended a lower dose of 0.25 mg.[8,9] A lower dose would be expected to reduce systemic complications at the expense of a higher risk of recurrence. Conversely, a larger molecule size would be expected to reduce transit out of the eye and therefore also theoretically reduce systemic interactions. This helps to explain why another anti-VEGF agent (ranibizumab; Lucentis, Genentech & Novartis, USA) with a smaller molecule has not found favour among treating ophthalmologists. Finally, the risk of endophthalmitis – caused by organisms introduced into the eye at the time of transconjunctival/transscleral injection – is a major concern. This has been shown clearly in the use of anti-VEGF agents to treat macular degeneration, diabetic retinopathy and other forms of macular oedema in adults. Meticulous sterile technique and medication preparation is required to keep this risk as low as possible.[10]

Medico-legal implications

It is unlikely that anti-VEGF agents will become licensed in SA for ROP treatment in the near future (since the number of cases involved

March 2017, Print edition

EDITORIAL

is insufficient). Therefore, as with any new and developing area, using a so-called ‘off-label’ medication should be approached with caution. There is a growing body of evidence that anti-VEGF treatment is both effective and safe, but practitioners entering into this arena are advised to carefully document, among other things, available options, informed consent, dosage used, safety precautions employed and follow-up arrangements. T Pollock Division of Ophthalmology, Red Cross War Memorial Children’s Hospital and University of Cape Town, South Africa travis.pollock@uct.ac.za 1. Gilbert C. Retinopathy of prematurity: A global perspective of the epidemics, population of babies at risk and implications for control. Hum Dev 2008;84(2):77-82. http://dx.doi.org/10.1016/j.earlhumdev.2007.11.009 2. Visser L, Singh R, Young M, Lewis H, McKerrow N. Guideline for the prevention, screening and treatment of retinopathy of prematurity (ROP). S Afr Med J 2013;103(2):116-125. http://dx.doi.org/10.7196/SAMJ.6305

This open-access article is distributed under CC-BY-NC 4.0.

3. Early Treatment for Retinopathy of Prematurity Cooperative Group, Good WV, Hardy RJ, et al. Final visual acuity results in the early treatment for retinopathy of prematurity study. Arch Ophthalmol 2010;128(6):663671. http://dx.doi.org/10.1001/archophthalmol.2010.34 4. Mintz-Hittner HA, Kennedy KA, Chuang AZ, BEAT-ROP Cooperative Group. Efficacy of intravitreal bevacizumab for stage 3+ retinopathy of prematurity. N Engl J Med 2011;364(7):603-615. http://dx.doi. org/10.1056/NEJMoa1007374 5. Kana H, Mayet I, Soma D, Dawood Alli H, Biddulph S. The efficacy of intravitreal antivascular endothelial growth factor as primary treatment of retinopathy of prematurity: Experience from a tertiary hospital. S Afr Med J 2017;107(3):215-218. http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11080 6. Isaac M, Tehrani N, Mireskandari K. Involution patterns of retinopathy of prematurity after treatment with intravitreal bevacizumab: Implications for follow-up. Eye (Lond) 2016;30(3):333-341. http://dx.doi. org/10.1038/eye.2015.289 7. Wu W-C, Lien R, Liao P-J, et al. Serum levels of vascular endothelial growth factor and related factors after intravitreous bevacizumab injection for retinopathy of prematurity. JAMA Ophthalmol 2015;133(4):391397. http://dx.doi.org/10.1001/jamaophthalmol.2014.5373 8. Avery RL. Extrapolating anti-vascular endothelial growth factor therapy into paediatric ophthalmology: Promise and concern. J AAPOS 2009;13(4):329-331. https://doi.org/10.1016%2Fj.jaapos.2009.06.003 9. Han J, Kim S, Lee S, Lee C. Low dose versus conventional dose of intravitreal bevacizumab injection for retinopathy of prematurity: a case series with paired-eye comparison. Acta Ophthalmol. Published online: 24 March 2016. http://dx.doi.org/10.1111/aos.13004 10. Mintz-Hittner H. Intravitreal injections of bevacizumab: Timing, technique, and outcomes. J AAPOS 2016;20(6):478-480. http://dx.doi.org/10.1016/j.jaapos.2016.10.002

S Afr Med J 2017;107(3):178-179. DOI:10.7196/SAMJ.2017.v107i3.12388

Childhood injuries: A commission for human responsibilities is needed

A discussion at an Ethics Alive symposium raised the issue of a commission for human responsibilities. Human rights are constantly discussed in South Africa (SA). However, the focus is often on rights, while little attention is paid to corresponding duties and responsi bilities. The United Nations (UN) adopted the Universal Declaration of Human Rights (UDHR) >50 years ago. It is now time to reflect on a universal declaration of human responsibilities that would complement and strengthen the UDHR, with the objective of making this a better world. We consider the 1998 Declaration of Human Duties and Responsibilities (DHDR) in the context of violence against children in SA and call for a commission on human duties and responsibilities to complement and strengthen our Human Rights Commission.

Declaration of Human Duties and Responsibilities

The DHDR document was completed by global experts, including Nobel Prize laureates, with the assistance of the UN Organization for Education, Science and Culture (UNESCO) and the UN high commissioner for human rights, to revitalise the implementation of human rights. This was partly to celebrate the 50th anniversary of the UDHR. Justice Richard Goldstone, from SA, chaired this diverse group of scientists, artists and philosophers.[1] Goldstone noted that the occasion was strongly motivated by the urgent need of the transition from a ‘formal equality’ to a ‘substantial equality’, in view of the desperate condition of so many unnoticed and disregarded people in the world: ‘The recognition of human rights is insufficient, … if such rights are to be realized it is necessary that they are enforceable … . There must be a duty on all relevant authorities and individuals to enforce those rights.’[1]

Childhood trauma

Children worldwide are often the main victims of injury and violence, with >1 million succumbing to trauma annually, according to the World Health Organization (WHO)’s Global Burden of Disease

2004.[2] Accidental injuries comprise the vast majority of the trauma, while the remainder constitutes violence aimed against children. Childhood deaths are only the tip of the iceberg, with vast numbers of children being left with physical and mental scarring, mutilation and disability. As expected, the greatest burden is carried by low- and middle-income countries and regions, where >95% of all deaths of injured children occur. Unfortunately, child safety is poorly defined and there is a dire need to expand on the various categories. The main causes of child mortality from ‘accidental’ injury are road traffic accidents (32%), drowning (17%) and burns (9%),[2] which are all highly preventable. Young children, especially, require continuous supervision, as they are not neurodevelopmentally mature to take care of their own safety. Risk factors that influence the likelihood of childhood injuries include an absent father, alcohol or substance abuse among caregivers, multiple siblings, and a large family,[2] which are often present in previously disadvantaged areas. Therefore, it is vital to contextualise childhood injuries geographically and historically, even though child safety should be a priority in all societies. Creative and feasible interventions have been developed to mitigate child death and disability from injury.[3] Very young children are the most vulnerable, as they lack the ability to assess dangerous objects or situations in their environment that they are unable to avoid, and for which they require the protection of mature individuals. Insufficient supervision of young children results in high levels of childhood morbidity and mortality. In many countries where children form the greater part of the population their special needs and interests are rarely considered. The WHO defines violence as ‘the intentional use of physical force or power, threatened or actual, against oneself, another person, or against a group or community that either results in or has a high likelihood of resulting in injury, death, psychological harm, maldevelopment or deprivation’.[4] This definition revolves around the intentionality of the act and is not dependent on the injury it causes. WHO definitions of child abuse or maltreatment are much wider, including physical and/or emotional ill-treatment, sexual abuse, neglect or negligent treatment, and commercial or other exploitation

March 2017, Print edition

EDITORIAL

that results in actual or potential harm to the child’s health, survival, development or dignity in the context of the relationship of responsibility, trust and power.[4] At Red Cross War Memorial Children’s Hospital, Cape Town, SA ~10 000 injured children ≤13 years of age are treated annually, including those who are physically and/or sexually abused. Infants and very young children are at the greatest risk of being murdered.[2] The single most important protection against exposure to violence is a robust relationship with a competent, caring, positive adult, usually a parent. However, such a person is often absent in previously disadvantaged communities and the carers frequently cannot be present owing to long hours in low-income jobs, which may be far from their communities.[5] These care providers may have been victimised and scarred by emotional trauma and cannot protect their children and keep them secure. People from communities where excessive violence takes place are often caught up in a web of helplessness and frustration, resulting in failure to safeguard their own children.[6] During the 21st century, violence has taken the format of a ‘public health epidemic’.[2] Many young children are constantly exposed to violence in their families, communities, and the social media, which indulge children with violence. Children in developed countries are exposed to ~16 000 simulated murders and 200 000 acts of violence in the media before reaching adulthood.[5] A compounding factor is that the committed violence is usually associated with so-called positive role models, with little sympathy for the victim and attention to the dire consequences of the inflicted injuries. Infants and toddlers who continuously witness violence in their environment display excessive irritability, immature behaviour, sleep disturbances, emotional distress, fear of being alone and regression in toileting and language.[6] Almost two decades ago, the public health community in the USA, including a wide range of paediatricians, psychiatrists and psychologists, found that there were >1 000 studies indicating a causal relationship between media (television, films, video games) violence and aggressive behaviour in certain children.[7] The Childsafe Child Injury Surveillance System at Red Cross War Memorial Children’s Hospital indicates that the vast majority of injuries in young children occur in and around the home, while older school-going children are the most vulnerable on their way to and from school. Most societies abhor violence against young child ren, and abused children often receive sensational media attention. However, it is thought provoking to realise that so-called accidental injuries and maltreatment of children have many identical risk and resilience factors.[8] Violence prevention strategies have typically targeted people and behaviour, while strategies directed at accidental injuries have usually focused on promoting a change in materials and environment. Child safety will only advance with close collaboration of both these approaches. Many risk factors for childhood injury are amenable to prevention strategies, including community factors comprising, inter alia, poverty, social capital and other societal factors.[2] In SA, alcohol is a major risk factor for many types of trauma, accidental and non-accidental, with studies indicating that alcohol plays a role in up to 70% of any sustained injuries. Many well-proven strategies can prevent and diminish the negative effects of substance abuse among children; early intervention is a key component of successful programmes.[9]

Discussion

Many programmes address childhood infectious diseases, malnutrition and dehydration. However, childhood injury remains neglected, which is particularly sad as it is largely preventable.[3] Many childhood injury risk factors can be easily addressed, creating awareness.

Interventions require participation of all role players to pressurise political will to make child safety-promoting changes. Vigorous promotion of awareness of the plight of so many children is essential to reduce the enormous burden of childhood injuries.

A prudent time for a commission on human responsibilities

There is a substantial difference between duty and responsibility as defined in the DHDR.[1] Duty refers to an ethical or moral obligation, while responsibility refers to a legally binding obligation under international law. The DHDR details a wide range of responsibilities. All members of the global community have individual and collective duties and responsibilities aimed at promoting human rights and fundamental freedoms. The most crucial article in the declaration (chapter 2) is that of the right to life and human safety.[1] Everyone has the right to life, liberty and safety of person. In particular, chapter 3 of the DHDR[1] draws attention to intergenerational responsibility. The duty and responsibility to protect each human life is stated clearly, making everyone responsible to protect all lives that are in danger, distress or need. These DHDR articles provide the ideal framework to create a commission on human duties and responsibilities in SA, which could be established as an arm of the current Human Rights Commission, but with the significant difference of focusing on what society should and can do rather than what it should receive.

Conclusion

A key element of formulating the DHDR has been the duty and responsibility for the potential consequences of our actions for future generations. ‘The rights of these future generations are the duties of present generations’, according to Federico Mayor, former Director General of UNESCO. Therefore, the right to peace and the right to live in a safe environment must be fully recognised and guaranteed. Children will never be safe as long the adult society does not act responsibly. A B van As Childsafe, Cape Town; and Trauma Unit, Red Cross War Memorial Children’s Hospital, and Division of Paediatric Surgery, Faculty of Health Sciences, University of Cape Town, South Africa sebastian.vanas@uct.ac.za A Dhai Steve Biko Centre for Bioethics, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa 1. Inter Action Council. A Universal Declaration of Human Responsibilities. http://interactioncouncil.org/ universal-declaration-human-responsibilities (accessed 15 February 2016). 2. Peden M, Oyegbite K, Ozanne-Smith J, et al., eds. World Report on Child Injury Prevention. Geneva: World Health Organization and United Nations Children’s Fund, 2008. 3. Krug EG, Dahlberg LL, Mercy JA, Zw A, Lozano, R. World Report on Violence and Health. Geneva: World Health Organization, 2002. 4. Peden M, Hyder AA. Time to keep African kids safer. S Afr Med J 2009;99(1):36-37. 5. American Psychiatric Association. Psychiatric effects of media violence. APA fact sheet series. APA online public information. http://www.psych.org/public_info_media_violence .html (accessed 18 January 2017). 6. Osofsky JD. The impact of violence on children. The future of children. Domestic Violence Child 1999;9(3):33-49. http://dx.doi.org/10.2307/1602780 7. Congressional Public Health Summit. Joint Statement on the impact of entertainment violence on children, 26 July 2000. http://www2.aap.org/advocacy/releases/jstmtevc.htm (accessed 5 February 2016). 8. Peterson L, Brown D. Integrating child injury and abuse/neglect research: Common histories, etiologies, and solutions. Psychol Bull 1993;116(2):293-315. http://dx.doi.org/10.1037/0033-2909.116.2.293 9. Cunradi CB, Caetano R, Schafer J. Alcohol-related problems, drug use, and male intimate partner violence severity among US couples. Alcohol Clin Exp Res 2002;26(4):493-500. http://dx.doi.org/10.1097/00000374200204000-00009

S Afr Med J 2017;107(3):180-181. DOI:10.7196/SAMJ.2017.v107i3.12251

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

CME

GUEST EDITORIAL

Prevention of childhood injuries Trauma has always accompanied humankind, but has only been recognised as a significant health issue for the last half a century. In South Africa (SA), the burden of trauma has been described as unprecedented, with an estimated 3.5 million people seeking healthcare for non-fatal injuries annually.[1,2] Children, representing an estimated 40% of the SA population, are a vulnerable group. The impact of childhood trauma, whether intentional (through interpersonal violence, homicide or suicide) or unintentional (especially through road traffic crashes, drowning, burns, poisoning or falls), has become a major health and social problem. Childhood injuries may impact hugely on childhood health in terms of disability and, depending on their cause, circumstances and severity, and have grim psychological, educational, social and economic consequences. With the advancement of the prominence of trauma in the burden of disease, paediatric trauma has increasingly received more attention as a major cause of morbidity and mortality. Since 1983, trauma has officially been called ‘the number 1 killer of children’ globally.[3] In SA, children continue to be threatened by injuries of various kinds, although this is often overshadowed by the impact of infectious and nutritional diseases. The greater recognition of injuries as a major challenge to childhood health has, however, stimulated concerted efforts worldwide through, for example, the adoption of the 64th World Health Assembly resolution on child injury prevention. There have consequently also been local efforts by means of strategies directed at enhancing the management of trauma through specific mechanisms, such as courses for the management of paediatric trauma (e.g. the Advanced Paediatric Life Support course). Unfortunately, childhood injuries have not yet been included in national health priority lists, especially with regard to their preventability. This is very disappointing, particularly in the light of the successes of recent prevention interventions, such as the extensive health promotion campaigns directed at the reduction of new infections of HIV/AIDS. Furthermore, the World Health Organization has estimated that trauma will increase its contribution to the burden of disease worldwide.[4] We are therefore delighted to present this issue of CME, with specific reference to the preventability of various types of childhood injury. The focus of the first article[5] is on one of the most common injuries in and around the home – ingestion and aspiration of foreign bodies. It provides a broad overview of the dangers lurking around the home for young children. While much progress has been made with legislation and community awareness globally, fostering a culture of vigilance, in SA such preventable injuries continue to contribute significantly to the national healthcare burden. Government, health authorities and non-governmental agencies all have to collaborate to identify potential hazards, legislate against commercial risks, and warn the public about how these injuries occur.

The second article[6] provides an evaluation of a promising SA intervention that promotes safe driving behaviour among school transport drivers, a vital but under-represented partner in child road safety. The roads are hazardous places for all South Africans, with children often exposed in school minibuses on their way to or from school. This article indicates that drivers and vehicles participating in the Safe Travel to School Programme recorded lower percentages of time speeding, lower harsh braking, and lower average harsh cornering and acceleration than general drivers. We hope and trust that these articles will assist in mobilising your attention to encourage you to utilise your knowledge in creating a safer world for all. It is everyone’s responsibility.[7] A B van As Childsafe, Cape Town; and Trauma Unit, Red Cross War Memorial Children’s Hospital and Division of Paediatric Surgery, Faculty of Health Sciences, University of Cape Town, South Africa sebastian.vanas@uct.ac.za

A van Niekerk Violence, Injury and Peace Research Unit, South African Medical Research Council and University of South Africa, Cape Town; and Institute for Social and Health Sciences, University of South Africa, Cape Town, South Africa 1. Seedat M, van Niekerk A, Jewkes R, Suffla S, Ratele K. Violence and injuries in South Africa: Prioritising an agenda for prevention. Lancet 2009;374(9694):68-79. http://dx.doi.org/10.1016/S01406736(09)60948-X 2. Matzopoulos R, Prinsloo M, Butchart A, Peden M, Lombard C. Estimating the South African trauma caseload. Int J Inj Contr Saf Promot 2006;13(1):49-51. http://dx.doi.org/10.1080/15660970500036382 3. Haller JA. Pediatric trauma: The No. 1 killer of children. JAMA 1983;249(1):47. http://dx.doi.org/10.1001/ jama.1983.03330250027022 4. Peden M, Oyegbite K, Ozanne-Smith J, et al., eds. World Report on Child Injury Prevention. Geneva: WHO and UNICEF, 2008. http://www.who.int/violence_injury _prevention/child/en/ (accessed 7 February 2017). 5. Arnold M, van As AB, Numanoglu A. Prevention of ingestion injuries in children. S Afr Med J 2017;107(3):183-187. http://dx.doi.org/10.7196/SAMJ.2017.v107i3.12365 6. Van Niekerk A, Govender R, Jacobs R, van As AB. Schoolbus driver performance can be improved with driver training, safety incentivisation, and vehicle roadworthy modifications. S Afr Med J 2017;107(3):188-191. http:// dx.doi.org/10.7196/SAMJ.2017.v107i3.12363 7. Van As AB, Dhai A. Childhood injuries: A commission for human responsibilities is needed. S Afr Med J 2017;107(3):180-181. http://dx.doi.org/10.7196/SAMJ.2017.v107i3.12251

S Afr Med J 2017;107(3):182. DOI:10.7196/SAMJ.2017.v107i3.12364

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

CME

Prevention of ingestion injuries in children M Arnold,1 MB ChB, DCH (SA), FCPaedSurg (SA), MMed (PaedSurg); A B van As,2 MB ChB, MMed, MBA, FCS PhD; A Numanoglu,1 MB ChB, FCS (SA) Division of Paediatric Surgery, Red Cross War Memorial Children’s Hospital and University of Cape Town, South Africa Childsafe, Cape Town; and Trauma Unit, Red Cross War Memorial Children’s Hospital and Division of Paediatric Surgery, Faculty of Health Sciences, University of Cape Town, South Africa

1 2

Corresponding author: A B van As (sebastian.vanas@uct.ac.za)

Accidental caustic and foreign body ingestion by young children lead to a high number of emergency department visits, especially in lower- and middle-income countries. Some of these cause minimal tissue injury or pass spontaneously and uneventfully through the gastrointestinal tract; others may cause major morbidity, or rarely mortality. Increased primary prevention of ingestion through community awareness and vigilant childcare in addition to legislative steps to ensure a safe environment for these vulnerable members of society are needed. Secondary prevention of long-term sequelae through timely and appropriate assessment and referral for endoscopy, laparotomy or other treatments can limit morbidity where primary prevention fails. Basic guidelines for management principles are suggested. Social lobby is required to further reform commercial risks to children in addition to creating caregiver awareness of common environmental hazards, particularly in developing countries such as South Africa. S Afr Med J 2017;107(3):183-187. DOI:10.7196/SAMJ.2017.v107i3.12365

Swallowing of non-food substances is common in toddlers and the preschool age group. Coin ingestion alone has been reported in as many as 4% of children, with 15% of their parents seeking healthcare.[1] Caustic ingestion affects 5 - 518/100 000 people per year, largely in less industrialised nations.[2,3] Distress and a healthcare consultation also occasionally result from choking on age-inappropriate food items (typically hard sweets or large chunks of meat) or bones (especially fish bones[4]), and accidental medication ingestion. At Red Cross War Memorial Children’s Hospital, nearly two of three ingested foreign bodies require endoscopic or surgical removal.[5] Endoscopic grading of injury under general anaesthesia is required in 40% of children who present with caustic ingestion.[6] Ingestion of multiple magnets results in bowel perforations in at least half of children affected.[7] Primary prevention through education and awareness is crucial to reduce the substantial healthcare burden that such incidents present. The majority of these accidental ingestions occur in the home and nearby areas.[8] Conditions that carry an increased risk of ingestion/ aspiration include attention-deficit hyperactivity syndrome,[9] low levels of parental education,[9,10] young mothers,[8] lack of parental supervision,[8] and rural abode.[11] Male gender predominance is an inconstant finding.[5,9,12-14] Curiosity, exploration of the developing oral phase, the child’s inexperience and limited understanding of the environment combined with inadequate caregiver supervision put children under-5[15] at the highest risk of injury from ingested foreign bodies and caustic substances, with a peak incidence at 3 years of age.[5] A child may present acutely with peri-oral inflammation, dysphagia, drooling, cough, stridor, hoarseness, vomiting or signs of peritonitis. A history of such ingestion may be absent, as ingestion is witnessed in as few as a quarter of all cases,[16] making timely diagnosis and treatment challenging. Peri-oral burns may cause dysphagia and drooling lasting a few hours to weeks. These external signs do not reliably predict oesophageal penetration. Other symptoms include respiratory distress, e.g. from ingestion of volatile agents (e.g. paraffin, hydrocarbons), which may require temporary oxygen support. Fullthickness oesophageal necrosis with subsequent mediastinitis and gastric necrosis with perforation and peritonitis fortunately occur

very rarely in children, as intake is usually accidental, substances are not very potent and volumes ingested are thus usually limited by the unpleasant taste. Household cleaning agents are the most common causative chemical agents, usually because of unsafe storage or use while small child ren are ill-advisedly allowed in the vicinity. The most commonly ingested chemical is an oxidising agent, such as peroxide or chloride bleach, with domestically retailed concentrations causing only superficial redness and mild oedema. These are therefore not a major risk factor for oesophageal strictures; nevertheless, they result in a significant number of visits to emergency departments although more than symptomatic treatment is usually not required.[12] More concentrated agents used in industrial or agricultural contexts may be ingested, particularly in rural areas.[11]

Complications

Ingestion of a strong alkali (pH ≥11.5), strong acid (pH ≤2) or oxidi sing agent, and mixtures of these, will cause chemical burns in 20 -40% of children.[17,18] Injury depends on the chemical concentration and volume, the tissue surface area and the duration of exposure. Among the most common serious long-term sequelae is oesophageal stricture formation (7 - 25%),[12,17] which occurs when submucosal penetration of the burn involves >50% of the lumen. Foreign body perforation and/or obstruction of the gastrointestinal tract (GIT) typically occurs proximal to normal anatomical narrowing, i.e. (i) the cricopharynx, which is the narrowest part of the child’s upper GIT (Fig. 1); (ii) the upper third of the oesophagus, where the left main bronchus and aortic arch cross anteriorly with the vertebral bodies posteriorly (Fig. 2); (iii) the oesophagogastric junction (lower oesophageal sphincter); (iv) the pylorus (Fig. 3); (v) the duodenum at the ligament of Treitz; and (vi) the ileocaecal valve. Dangerous ingested foreign bodies include sharp objects that can penetrate the GIT, and blunt objects that may cause partial or complete GIT obstruction and pressure necrosis. Ingestion of ≥2 magnets can rapidly cause entero-enteric fistulas (Fig. 4), with 85% requiring removal by means of endoscopy, laparoscopy or laparotomy.[19] Electric disc cells (commonly known as button

March 2017, Print edition

CME

Fig. 1. (A) Anteroposterior and (B) lateral low-dose radiograph (Lodox, SA), demonstrating the classic appearance of a coin stuck in the cricopharynx, the narrowest part of a child’s GIT. Although foreign bodies in both the upper oesophagus and the trachea of a child may cause stridor, compression between the C-shaped rings of the trachea anteriorly and the vertebral bodies causes the ‘face-on’ appearance on anteroposterior imaging, diﬀerentiating it from a coin in the trachea that would be ‘end-on’.

Fig. 2. Electric cell (commonly called a button battery) lodged in the upper oesophagus, which eroded into the aortic arch. The halo appearance of the battery edge diﬀerentiates it from a coin, and mandates urgent removal.

Fig. 3. (A) Anteroposterior and (B) lateral abdominal radiographs demonstrating a five rand coin (25 mm diameter) unable to pass the pylorus 2 weeks after ingestion by a 2-year-old boy. The position in the stomach rather than the transverse colon is confirmed by the lateral abdominal radiograph. Endoscopic retrieval was required.

Fig. 4. AP low-dose radiograph (Lodox, SA) of the abdomen, demonstrating multiple small magnetic balls ingested by a 2-year-old boy without his parents’ knowledge. Dilated bowel loops with a thickened bowel wall demonstrate obstruction. Endoscopic-assisted laparotomy revealed magnets in the caecum, jejunum and duodenum, with multiple bowel perforations from magnets adhering to each other through bowel loops.

batteries) can cause focal oesophageal burns within an hour in animal studies, while residual activity in used and discarded batteries can still cause significant hydrolysis of tissue.[20] If the narrow negative pole lies anteriorly, risk of perforation with mediastinitis, trachea-oesophageal fistula formation, erosion into great mediastinal vessels (e.g. oesophago-aortic fistulas) and long-term oesophageal stricture formation escalate significantly, especially when extraction is delayed >15 hours after ingestion.[21-23] Coins remain the most commonly ingested foreign body[5,24] locally and internationally, followed by other plastic and metal objects, especially toy parts. Most (>80%) round objects such as coins, marbles and button batteries are likely to pass through the rest of the GIT spontaneously and unevent-

fully if they have traversed the cricopharynx.[25,26] Fortunately, most foreign bodies (>80%) are radio-opaque.[5,16] Fluoroscopy and occasionally sonography may be useful to detect radiolucent objects, but a low index of suspicion is required for endoscopic evaluation in these cases. Oesophageal motility and patency may be impaired by previous oesophageal surgery (e.g. oesophageal atresia repair, peptic or caustic stricture dilations and gastric fundoplication) and increase the risk of a food bolus (notably meat or fibrous fruit, such as citrus) or a foreign body impacting in the oesophagus and causing dysphagia and regurgitation of food. Prolonged impaction of an unrecognised foreign body in this context can aggravate existing oesophageal strictures through pressure necrosis.

March 2017, Print edition

Preventive strategies

Public education about the importance of appropriate supervision of small children and the risks imposed in the environment is most important. Public health awareness campaigns using various media are also required to lobby governments to legislate appropriate safety regulations locally. Lobbying has led to the development and implementation of protective legislation in developed countries. While South Africa (SA) has benefited from legislation overseas, with a trickle-down effect into our local markets, consumers remain vulnerable to less scrupulous manufacturers.While this has had positive spin-offs in SA, with many local companies voluntarily implementing these steps, legislation and enforcement in SA remain limited. Examples include the following:

CME

• Child-proof bottle tops, requiring application of focal pressure in addition to unscrewing the cap, and spray-bottle safety catches on household detergents. • Limitation on pH of detergents marketed for domestic use. • Restriction of toys marketed for children ≤3 years old to a minimum of 3 cm in diameter. • Secure battery compartments for motorised toys and hearing aids.[18] • Package labelling requirements, e.g. regarding content of chemicals in household use, associated health risks with ingestion, and first-aid advice, including poison centre contact details; warning on packaging of any smaller object to prevent access by children <3 years because of aspiration or swallowing risk. • Dangerous product recall, e.g. of small (~3 - 5 mm diameter), strong rare-earth (neodymium) balls marketed as ‘executive’ toys (Fig. 4) in the USA.[19,27] Examples of unresolved challenges to primary prevention locally and elsewhere include: • Ongoing household use of strong industrial-strength caustic agents, often illegally sold or decanted and stored in nondescript containers or recycled cold-drink containers, is of great concern. Thirsty children may seek these out or be given these by unsuspecting older siblings, particularly in hot weather, with devastating consequences. • Marketing, using brightly coloured packaging, has brought new risks to the fore in the past few decades, e.g. automated dishwasher detergent pods, which have caused an upsurge in associated caustic oesophageal injuries in developed countries,[28] although fortunately significant injury occurs in <5% of cases.[2] Partnership with civil society to identify and mitigate the risks posed to children by these common environmental exposures is crucial. Organisations such as the Child Accident Prevention Foundation of Southern Africa (Childsafe) have been highly instrumental in promoting protective legislation and community awareness. Acknowledgement of the vulnerability of children and the creation of a community culture of protection have consequently grown significantly. Creative resolutions to risks exist, but require social lobby of manufacturers, retailers and government to promote implementation of suitable marketing innovations and legislative reforms. Traditional print and social media activism remains a relatively under-tapped resource in this regard. For example, retailers of magnet toys could be encouraged to enclose them in a malleable child-proof outer shell. Some retail stores have taken the initiative to promote recycling of high-voltage lithium-ion electric cells; such initiatives could be expanded to include a safety campaign regarding disposal of all discharged used batteries. Warnings of the hazards of accidental swallowing of ‘mouthed’ small non-food objects by young children could be emphasised in the national Road to Health booklet provided to all children in the government sector and at clinic visits. Major consequences of ingestion injuries are rare (<1%),[5] but children may incur major morbidity (e.g. tracheostomy, emergency thoracotomy, multiple oesophageal stricture dilatations, oesophageal replacement procedures, and bowel resection) and even mortality as a result. Secondary prevention of sequelae of caustic ingestion by caregivers and healthcare providers includes awareness of the risks posed by various items and agents, and timeous and appropriate

removal of the object where indicated, follow-up, or other treatment. A summary of important common agents of ingestion injuries and a brief guideline to their associated management are given Table 1. Early consultation with the nearest poison call centre and tertiary paediatric institution allows identification of the nature of potentially harmful chemicals and appropriate care.

Conclusion

Ingestion injuries remain extremely common in developing countries, unlike some countries in the developed world, where progressive legislation and community awareness foster a culture of vigilance against the risks of gastrointestinal injury in children by accidental injury by non-food substances. These highly preventable injuries are an unnecessary healthcare burden. Limitation of risk factors is achievable with partnership by government, health authorities and non-governmental agencies to identify potential hazards, legislate against commercial risks and warn the public about how these injuries occur. 1. Conners GP, Chamberlain JM, Weiner PR. Pediatric coin ingestion: A home-based survey. Am J Emerg Med 1995:13(6):638-640. http://dx.doi.org/10.1016/0735-6757(95)90047-0 2. Christesen HB. Epidemiology and prevention of caustic ingestion in children. Acta Paed 1994;83(2):212-215. 3. Othman N, Kendrick D. Epidemiology of burn injuries in the East Mediterranean Region: A systematic review. BMC Public Health 2010;10(1):83. http://dx.doi.org/ 10.1186/1471-2458-10-83 4. Lim CW, Park MH, Do HJ, et al. Factors associated with removal of impacted fishbone in children, suspected ingestion. Pediatr Gastroenterol Hepatol Nutr 2016;19(3):168-174. http://dx.doi.org/10.5223/ pghn.2016.19.3.168 5. Van As AB, du Toit N, Wallis L, et al. The South African experience with ingestion injury in children. Int J Pediatr Otorhinolaryngol 2003;67(Suppl 1):S175-S178. http://dx.doi.org/10.17140/EMOJ-1-105 6. Janssen TL, van Dijk M, van As AB, et al. Cost-effectiveness of the sucrulfate technetium 99m isotopelabelled esophagal scan to assess esophageal injury in children after caustic ingestion. Emerg Med Open J 2015;1(1):17-21. 7. Waters AM, Teitelbaum DH, Thorne V, et al. Surgical management and morbidity of pediatric magnet ingestions. J Surg Res 2015:199(1):137-140. http://dx.doi.org/10.1016/j.jss.2015.04.007 8. Sanchez-Ramirez CA, Larrosa-Haro A, Vasquez-Garibay EM, et al. Socio-demographic factors associated with caustic substance ingestion in children and adolescents. Int J Pediatr Otorhinolaryngol 2012;76(2):253-256. http://dx.doi.org/10.1016/j.ijporl.2011.11.015 9. Çakmak M, Göllü G, Boybeyi Ö, et al. Cognitive and behavioural aspects of children with caustic ingestion. J Pediatr Surg 2015;50(4):540-542. http://dx.doi.org/10.1016/j.jpedsurg.2014.10.052 10. Sarioglu-Buke A, Corduk N, Atesci F, et al. A different aspect of corrosive ingestion in children: Socio-demographic characteristics and effect of family functioning. Int J Pediatr Otorhinolaryngol 2006;70(10):1791-1798. http://dx.doi.org/10.1016/j.ijporl.2006.06.005 11. Neidich G. Ingestion of caustic alkali farm products. J Pediatr Gastroenterol Nutrition 1993;16(1):75-77. 12. Karaman I, Koç O, Karaman A, et al. Evaluation of 968 children with corrosive substance ingestion. Indian J Crit Care Med 2015;19(12):714-718. http://dx.doi.org/10.4103/0972-5229.171377 13. Riffat F, Cheng A. Pediatric caustic ingestion: 50 consecutive cases and a review of the literature. Diseases Esofagus 2009;22(1):89-94. http://dx.doi.org/10.1111/j.1442-2050.2008.00867.x 14. Eskander AE, Sawires HK, Ebeid BA. Foreign-body ingestion in Egyptian children: A 10-year experience of endoscopic intervention in a tertiary hospital. Minerva Pediatr 2016. 15. Rafeey M, Ghojazadeh M, Mehdizadeh A, et al. Intercontinental comparison of caustic ingestion in children. Korean J Pediatr 2015;58(12):491. http://dx.doi.org/10.3345/kjp.2015.58.12.49 16. Sink JR,Kitsko DJ, Mehta DK, et al. Diagnosis of pediatric foreign body ingestion: Clinical presentation, physical examination and radiologic findings. Ann Otol Rhinol Laryngol 2016;125(4):342-350. http:// dx.doi.org/10.1177/0003489415611128 17. Tiryaki T, Livanelioğlu Z, Atayurt H. Early bougienage for the relief of stricture formation following caustic esophageal burns. Pediatr Surg Int 2005;21(2):78-80. http://dx.doi.org/10.1007/s00383-004-1331-3 18. Millar AJ, Cox SG. Caustic injury of the oesophagus. Pediatr Surg Int 2015;31(2):111-21. http://dx.doi. org/10.1007/s00383-014-3642-3 19. Kramer RE, Lerner DG, Lin T, et al. Management of ingested foreign bodies in children: A clinical report of the NASPGHAN Endoscopy Committee J Pediatr Gastroenterol Nutrition 2015;60(4):562-574. http:// dx.doi.org/10.1097/mpg.0000000000000729 20. Jatana KR, Litovitz T, Reilly JS, et al. Pediatric button battery injuries: 2013 task force update. Int J Pediatr Otorhinolaryngol 2013;77(9):1392-1399. http://dx.doi.org/10.1016/j.ijporl.2013.06.006 21. Ettyreddy AR, Georg MW, Chi DH. Button battery injuries in the pediatric aerodigestive tract. Ear Nose Throat J 2015;94(12):486-493. 22. Buttazzoni E, Gregori D, Paoli B, et al. Symptoms associated with button batteries injuries in children: An epidemiological review 2015;12:2200-2207. http://dx.doi.org/10.1016/j.ijporl.2015.10.003 23. Leinwand K, Brumbaugh DE, Kramer RE. Button battery ingestion in children: A paradigm for management of severe pediatric foreign body ingestions. Gastrointest Endosc Clin N Am 2016;26(1):99-118. http://dx.doi.org/10.1016/j.giec.2015.08.003 24. Panieri E, Bass DH. The management of ingested foreign bodies in children: A review of 663 cases. Eur J Emerg Med 1995;2(2):83-87. 25. Pugmire BS, Lin TK, Pentiuk S, et al. Imaging button battery ingestions and insertions in children: A 15-year single center review. Pediatr Radiol 2017;47(2):178-185. http://dx.doi.org/10.1007/s00247016-3751-3 26. Litovitz T, Whitaker N, Clark L. Preventing battery ingestions: An analysis of 8648 cases. Pediatrics 2010;125(6):1178-1183. http://dx.doi.org/10.1542/peds.2009-3038 27. Alfonzo MJ, Baum CR. Magnetic foreign body ingestions. Pediatr Emerg Care 2016;32(10):698-702. http://dx.doi.org/10.1097/PEC.0000000000000927 28. Nuutinen M, Uhari M, Karvali T. Consequences of caustic ingestions in children. Acta Paediatr 1994;83(11):1200-1205. http://dx.doi.org/10.1111/j.1651-2227.1994.tb18281.x

March 2017, Print edition

CME

Table 1. Commonly ingested and potentially harmful non-food items and management principles[19,20,26] High-risk features for tissue Ingested object/agent injury Unknown Any stridor or history of cyanosis after ingestion of a foreign body.

Initial management Referral criteria Bronchoscopy in addition to Sudden-onset stridor or oesophagoscopy should be cyanotic episode. considered even if there are no clinical signs or there is no radiological evidence of a foreign body; more than one foreign body may have been ingested.

Sharp objects

Objects >50 - 60 mm (consider in under-5 children); non-linear shape (e.g. open safety pin: risk for obstruction at pylorus or ileocaecal valve).

Blunt objects

Objects >20 - â&#x2030;¤25 mm (especially in under-5 children); or oesophageal position, e.g. coin lodged at cricopharynx (level of ~6th cervical vertebra on X-ray).

Magnet

More than one ingested or ingested with other metal object(s). High-voltage lithium-ion cell; oesophageal impaction may lead to full-thickness electrical oesophageal burn within 2 - 3 hours; narrow negative pole anterior (risk of perforation into aortic arch, trachea).

Electric cell (button battery)

Urgent endoscopic removal if oesophageal or gastric position. Observe in hospital if asymptomatic and beyond stomach; for small subdiaphragmatic objects patient may be discharged on advice to return if any symptoms develop (likely to disappear on own). Osmotic laxatives (e.g. lactulose, sorbitol) may be prescribed but are of no proven benefit. Oesophageal: remove urgently (e.g. within 24 hours if coin; within next hour if button battery). Subdiaphragmatic: observe if asymptomatic; expect passage in stools within ~3 days. Refer for urgent endoscopic removal/laparotomy, even if asymptomatic. May be admitted and observed as inpatient if subdiaphragmatic on X-ray; gentle laxative may be given (e.g. lactulose/sorbitol).

Any symptoms, including abdominal pain, tenderness or peritonism; signs of bowel obstruction or thickened bowel loops on plain-film abdominal X-ray; urgent endoscopic removal required if lodged above level of diaphragm on chest X-ray or pneumoperitoneum.

Follow-up Advise parents to return if pyrexia present, any respiratory symptoms (e.g. stridor, lower-respiratory tract infection) or signs of chest/abdominal pain or vomiting/drooling if radiological investigations and endoscopy negative. Repeat X-ray imaging for radio-opaque objects not observed in the stool in 3 days. Consider more frequent imaging for riskier large/ longer items.

As described above.

As described above; may be unnecessary if object <20 mm.

All patients.

As per endoscopic/ laparotomy findings.

Urgent endoscopic removal if symptomatic, if supradiaphragmatic or remains in stomach on follow-up imaging >24 hours; laparotomy required if any signs of peritonism; thoracotomy with cardiac bypass if comorbid upper GIT bleeding.

Abdominal X-rays 8 12-hourly, with clinical review till confirmed to have passed out of rectum if infradiaphragmatic.

Continued â&#x20AC;Ś

March 2017, Print edition

CME

Table 1. (continued) Commonly ingested and potentially harmful non-food items and management principles[19,20,26] High-risk features for tissue Ingested object/agent injury Strong alkali High risk for oesophageal injury with stricture formation, gastric injury uncommon (e.g. â&#x20AC;&#x2DC;lyeâ&#x20AC;&#x2122;/caustic soda/oven cleaner/hair relaxant/industrial bleaching agent of unknown strength).

Strong acid

Reducing/oxidising reagent

Volatile agent

Examples: car battery acid, industrial agent; higher risk for gastric perforation with acids, but oesophageal injury may also occur. Potassium permanganate; hydrogen peroxide, bleaching agents (e.g. sodium hypochlorite, calcium hypochlorite). Hydrocarbons (e.g. paraffin, paint thinners, household cleaning agents).

Initial management Keep nil by mouth (avoid any neutralising agent); exothermic reaction increases tissue injury; do not give activated charcoal. Clear fluids may be given as tolerated after grading depth of mucosal injury, and progress to a normal diet as symptoms permit. A chest X-ray may identify concomitant aspiration pneumonia, or rarely pneumomediastinum or pneumoperitoneum.

Referral criteria Any symptoms (e.g. oral burns, absence of oral burns), but dysphagia/ drooling and abdominal pain with a history of pH >11 ingestion mandate evaluation for mucosal injury with technetium99-radiolabelled sucralfate scinitigraphy and/or endoscopic grading of injury, ideally within 24 - 48 hours. Grading of injury to identify patients at risk for oesophageal stricture to identify erosions/slough/ eschar involving >50% of circumference allows stratified follow-up with surveillance endoscopy. Negative technetium-99 sucralfate scintigraphy where available averts endoscopy. Proton-pump inhibitor and oral antifungal therapy may help mitigate secondary injury to burnt oesophageal mucosa. Antibiotics only indicated in full-thickness perforation.

Follow-up Endoscopically placed nasogastric feeds may be required until drooling resolves and oral burns allow oral intake. Liquefactive necrosis leads to rapid penetration into tissue; submucosal fibrosis may lead to luminal narrowing within 3 - 6 weeks. Early programme of oesophageal dilations crucial for endoscopically visualised injuries affecting >50% of lumen and causing erosions/slough; contrast oesophagogram in 3 weeks if window for early endoscopy is missed to assess for oesophageal irregularities suggestive of early stricture formation. Weekly dilations for strictures may initially be required, lasting for several months; treatment-refractory strictures may require oesophageal replacement surgery.

As described above.

Respiratory distress, Oxygen therapy and rarely pulmonary crepitations, mechanical ventilator tachypnoea; radiological support may be required. findings may lag behind clinical features of aspiration pneumonitis. Central nervous system and cardiac depression less common. Abdominal pain and nausea common, but endoscopy not indicated if substance is known.

March 2017, Print edition

Resolution in 48 hours 1 week.

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

CME

Schoolbus driver performance can be improved with driver training, safety incentivisation, and vehicle roadworthy modifications A van Niekerk,1,2 PhD; R Govender,1,2,3 PhD; R Jacobs,1,2 MA; A B van As,4 MB ChB, MMed, MBA, FCS, PhD Violence, Injury and Peace Research Unit, South African Medical Research Council and University of South Africa, Cape Town, South Africa 2 Institute for Social and Health Sciences, University of South Africa, Cape Town, South Africa 3 Department of Sociology, Faculty of Humanities, University of Cape Town, South Africa 4 Childsafe, Cape Town; and Trauma Unit, Red Cross War Memorial Children’s Hospital and Division of Paediatric Surgery, Faculty of Health Sciences, University of Cape Town, South Africa 1

Corresponding author: A van Niekerk (ashley.vanniekerk@mrc.ac.za)

In South Africa (SA), the school transport industry provides millions of children with a means of travelling to and from school. The industry has, however, been reported to be plagued by widespread safety concerns. The consequent road traffic incidents have often been attributed to driver factors, including driving in excess of legal speeds or at inappropriate speeds; driving while under the influence of alcohol, while sleepy or fatigued; or driving without using protective equipment for vehicle occupants. There are currently very few SA interventions that specifically target this important industry role-player. The Safe Travel to School Programme was recently implemented by a national child safety agency, with a focus on driver road safety awareness, defensive driver training, eye-testing, vehicle roadworthy inspections with selected upgrades, incentives for safe performance, and implementation of a vehicle telematics tracking system with regular, individual driving behaviour information updates. This quasi-experimental study offers an evaluation of the initial impact on safety performance of this telematics-based driver and vehicle safety intervention in terms of speeding, acceleration, braking, cornering, and time-of-day driving, and compares the school transport driver performance with that of general motorists. Despite concerns that some school transport vehicles are used for multiple purposes outside of school transport duties, at night, and for longer distances, overall these vehicles recorded lower percentages of speeding, lower harsh braking, and lower average harsh cornering and acceleration than general drivers. S Afr Med J 2017;107(3):188-191. DOI:10.7196/SAMJ.2017.v107i3.12363

The United Nations Decade of Action for Road Safety under threat in South Africa

The United Nations (UN) Decade of Action for Road Safety 2011 2020 has identified road traffic crashes as a leading cause of death worldwide, with road traffic injuries cited among the three foremost causes of death for people between 5 and 44 years of age. South Africa (SA)’s road traffic mortality rate, currently at 36.1/100 000, has remained at high levels for the last decade, with no significant reduction.[1] More than 14 000 fatalities per year occur owing to road traffic accidents, with a further 7 500 people left permanently disabled.[2] Pedestrians account for the largest percentage of traffic-related deaths (37.6%), followed by vehicle passengers (32.7%).[2] In SA, these widespread passenger casualties, many involving young passengers, are attributed to combinations of infrastructure problems, poor transport systems, unroadworthy school transport vehicles (i.e. school buses and minibuses), and unpredictable driver behaviour. There is significant international evidence of the role and impact of these factors, e.g. half or more of vehicles in low-income and middle-income countries may lack functioning seat belts.[3] Driver factors that have been highlighted include driving in excess of legal or safe speeds, driving while under the influence of alcohol or while fatigued, or driving without passenger protective gear, such as seat belts, child restraints and helmets. All of these factors are highly indicated as major contributors to road crashes, deaths and serious injuries.[4]

The minibus industry and scholar transportation

The minibus industry in SA has emerged as a major public transport role-player and a significant component of school transport. This is especially true for learners from under-resourced communities, who may reside far from schools and consequently have to travel great distances to access their education. Despite the reliance of learners on minibus transportation, the industry has often been criticised for using substandard vehicles, for overloading, and for high-risk driving behaviour, such as speeding.[5] Commuters in under-resourced communities, who are often most dependent on such transportation, are therefore at an increased risk of injury and mortality. Estimates for the number of collisions per vehicle type per 100 million kilometres travelled include a staggering 1 106 collisions for minibus taxis, followed by 916 for passenger vehicles, and 571 for buses.[5] These lend considerable support to greater focus and effort being directed towards these vehicles and their drivers. The research on school transport drivers’ knowledge, attitudes and behaviours towards road safety is quite limited. General driver research indicates that only 8% of them were found to have sufficient knowledge to drive cars, suggesting improvements to the quality of driver training courses.[6] In terms of driver attitude, factors such as drunk driving, compliance with traffic rules, driving a technically unacceptable vehicle, driving experience, and use of seat belts have a significant impact on incidents and injuries.[7] Even though the

March 2017, Print edition

CME

majority of drivers (90%) recognise the importance of seat belt use, a significant proportion (17 - 27%) don’t use seat belts.[6] Moreover, although half of drivers report compliance with seat belt use, 40% considered it irrelevant should they drive cautiously, and 17% felt it hindered their safety in extreme situations, such as during a hijacking or an accident. Interestingly, drivers with extensive driving experience were more likely to wear seat belts.[6] Other common driver violations include talking on a phone while driving, with 71% of drivers admitting to responding to calls as often as 8.5 times per day. Worryingly, the majority of such violations are by those responsible for the largest passenger loads, i.e. bus drivers.[6] To address these challenges, practical interventions are required, especially to promote the child’s safe travel to and from school in SA and further afield. These include the protection of vehicle occupants by means of functioning seat belts and use thereof, airbag use and adequate passenger compartment design.[3,8] In addition to the protection of vehicle occupants, there is a need for advocacy for greater compliance with road safety rules.[7] The enforcement of compliance is considered key to deterring major contributors to road crashes, deaths and serious injuries; however, laws alone are insufficient to encourage appropriate behaviourial compliance.

Evaluation of an emerging Safe Travel to School Programme

Research on the school transport industry in SA is sparse. A national child safety agency in 2014 implemented the Safe Travel to School Programme in partnership with a national medical insurance company, with the overall objective of making a contribution to safer minibus school travel for children. The Safe Travel to School Programme sought to stimulate better driver safety performance and compliance with road safety practices through greater road safety awareness, defensive driver training, eye-testing, vehicle roadworthy inspections with selected upgrades, incentives for safe performance, and implementation of a vehicle telematics tracking system with regular, individual driving behaviour information updates. The vehicle tracking system and devices were supplied by the national insurance company, which uses it to monitor and reward good driving behaviour by clients of their vehicle insurance policies. The current study provided an evaluation of this intervention on school transport driver safety behaviour. The specific aims and objectives of the study were: • To evaluate Safe Travel to School Programme driver safety perfor mance over time in terms of speeding, acceleration, braking, cornering, and time-of-day driving. • To compare Safe Travel to School Programme driver safety performance with general motorist performance on same metrics.

Methods

This evaluation comprised two main components. Firstly, a descriptive trend analysis is provided of the safety behaviour of the initial cohort of school transport drivers, from January 2014 to January 2015, with descriptive data obtained from the vehicle tracking system. Secondly, a quasi-experimental, non-equivalent group design was employed wherein the driving performance of school transport drivers was compared with that of general motorists from September 2014 to January 2015 (Fig. 1). The study population comprised school transport drivers recruited for the Safe Travel to School Programme. Participants were purposively recruited from three of the main public transport hubs in Cape Town, specifically Athlone, Bellville, and Cape Town Central. The telematics devices were installed in their vehicles. Drivers from

Comparative trend analysis Review period Jan. 2014 - Jan. 2015 Learner transport drivers (n=51; Sept. 2014 - Jan. 2015)

General motorists (n=354)

Drivers in programme since inception (n=13; Jan. 2014 - Jan. 2015)

Matched control sample for comparison (n=51; Sept. 2014 - Jan. 2015)

Fig. 1. Comparative trend analysis.

the general motorist group were selected from the national medical insurance company’s register of Cape Town drivers, using the same telematics devices, which were matched for age and gender to the Safe Travel to School Programme drivers. For the two evaluation analyses driver safety performance was assessed over time in terms of speeding in excess of 10% of the speed limit, acceleration, braking and cornering above designated g-force thresholds, and time of day or night driving. Data for these variables were extracted from the vehicle tracking devices.

Data analysis

Driver safety performance: Vehicle tracking device data Trend and comparative analyses were conducted using SPSS Version 22 (IBM Corp., USA) software (e.g. inferential t-tests, p<0.05) to identify emerging patterns and trends in driver safety performance behaviours across the variables of interest. As only 13 drivers were identified from January 2014 to January 2015, descriptive statistics were used to examine their driving characteristics with the data obtained from the DQ devices (Discovery, SA). This analysis was expanded from September 2014 to January 2015, for which data were available for 51 school transport drivers. The performance of the Safe Travel to School Programme drivers was then compared with that of 51 general drivers, matched for age and gender, and sourced from the national insurance company’s database.

Results

School transport driver safety performance: January 2014 - January 2015

The analysis of speeding, acceleration, braking, cornering and night driving performance suggests that the majority of Safe Travel to School Programme drivers were performing in an appropriate, safe manner, i.e. below the designated threshold for each metric. There were some exceptions observed, which may reflect: (i) habitual serial offenders for the review period; or alternatively (ii) use of the vehicle by more than one driver, therefore accounting for different driving conditions and multiple driver performance styles. Habitual offending among the drivers was not limited to speeding and was also observed for accelerations, braking and cornering. However, observed trends in individual performance were confounded in some instances by excessive night-time use of vehicles, as it is difficult – if not impossible – to differentiate driving performance of school transport drivers during school runs from other forms of driving utilising the same vehicle outside the school transport hours and with different passengers. This confound is a consequence of the telematics device recording driving behaviour of a specific vehicle rather than that of a specific driver.

March 2017, Print edition

When comparing the Safe Travel to School Program me drivers with the insurance company policy holder drivers from September 2014 to January 2015, it was found that the programme drivers performed significantly better (t=3.28, p<0.01) on the percentage of time at which their speed exceeded the speed limit by 10% (n=102). With the exception of January 2015 (a vacation period) travel, the programme drivers were found to speed less often (Fig. 2) than the policy holder drivers. As speed is positively correlated with unsafe driving behaviours, the reduced speed for programme drivers could be argued to translate into safer driving behaviours compared with the comparison group. The programme drivers also performed better than general drivers in terms of their recorded accelerations (Fig. 3). However, these differences were not statistically significant (t=1.84, p>0.05). Driver braking above a set g-force threshold was higher in September and October 2014, but lower in November - January 2015 (Fig. 4). The reasons for the notable decline in braking above the g-force threshold between October and September 2014 are unknown, as data on the implementation of the individual Safe Travel to School Programme interventions were not available to test possible effects on driving performance. However, the lower levels observed from November 2014 to January 2015 could be explained by the likely long-distance travelling on vacation routes, for which braking is required less often than when driving in urban and high-density areas. Safer driving performance of Safe Travel to School Programme drivers was also reflected in the average monthly cornering above the designated g-force threshold (Fig. 5). These noticeable differences between the programme and general drivers could nevertheless be explained by differences in cornering thresholds for vehicle type, i.e. sedans compared with minibus vehicles. Benchmarking for specific vehicle types is required for more meaningful comparisons. On average, the programme drivers were found to engage in more night driving during weekdays and weekends than the comparison group. The marginally higher rates of speeding of >10% above the speed limit of drivers undertaking night drives suggests: (i) qualitative differences in driving conditions during this period compared with daytime driving; and/or (ii) different drivers for the same vehicle for daytime compared with night-time driving. In summary, although the Safe Travel to School Programme vehicles may well have been used outside of school transport duties, at night and for longer distances, overall the vehicles participating in the safety programme recorded lower percentages of time speeding, lower harsh braking, and lower average harsh cornering and acceleration than general drivers.

3.0 3.5 2.5 3.0 2.0 2.5 1.5 3.5 2.0 1.0 3.0 3.5 1.5 0.5 2.5 3.0 1.0 0.0 2.0 2.5 0.5 1.5 2.0 0.0 1.0 1.5 0.5 1.0 0.0 0.5 0.0

Average monthly Average braking, Average monthly % monthly braking,braking, % % Average Average monthly Average accelerations, Average monthly accelerations, % accelerations, % % Average monthly braking, % monthly accelerations, %monthly

Safety performance of Safe Travel to School Programme drivers compared with insurance company policy holder drivers

CME 2.9 2.9 1.3 2.9 1.3 2.9

2.7

2.5

2.7

2.7 1.4

2.5 1.4

2.7 1.7

2.0 2.7

2.7 1.4

2.7 Nov. 2014 2.5 Oct. 2014

Sept. 2014

1.3Control 1.4 Sept. 2014

1.3

Control

2.5

1.4

2.0 2.7 2.0

2.7 Dec. 1.7 2014

Jan. 2.7 2015

Dec. 1.7 2014

Jan. 2015

1.4 School transport driver2.0

Oct. 2014 Nov. 2014

Sept. 2014 Sept. 2014

2.5 1.4

1.7 2.7

1.4

School transport driver

Oct. 2014 Nov. 2014

Dec. 2014

Jan. 2015

School transport driver Control Oct. 2014 Nov. 2014 Dec. 2014 Jan. 2015 School transport driver

Control

2.0 Fig. 2. Percentage of time that speed exceeded 10% of the 2.0limit (n=102). 1.9 2.5 1.5 1.8 1.8 1.8 2.0 1.0 1.5 0.5 2.5 1.0 0.0 2.0 2.5 0.5 1.5 2.0 0.0 1.0 1.5 0.5 1.0 0.0 0.5 0.0

1.8 0.8

1.8 0.5

Sept. 2014 0.8 1.8

1.8 0.6

Oct.1.8 2014 Nov.1.8 2014

0.5

0.6

2.0 0.2 0.2

2.02014 Dec.

1.9 0.3 1.92015 Jan. 0.3

School transport driver

Control 1.8 Sept. 2014 Oct.1.8 2014 Nov.1.8 2014

0.8

2.0 0.2

Dec. 2014

1.9

Jan. 2015

0.6School transport driver0.3 0.2 0.3 Sept.0.8 2014 Oct. 0.5 2014 Nov.0.6 2014 Dec. 2014 Jan. 2015 Control0.5

School transport driver Control Sept. 2014 Oct. 2014 Nov. 2014 Dec. 2014 Jan. 2015

Fig. 3. Average monthly accelerations above g-force threshold (n=102). School transport driver Control

1.2 1.0 1.2 0.8

1.0 0.6 0.8 0.4 1.2 0.6 0.2 1.0 1.2 0.4 0.0 0.8 1.0 0.2 0.6 0.8 0.0 0.4 0.6 0.2 0.4 0.0 0.2

1.0

0.4 1.0

0.4 1.0 0.4

Sept.1.0 2014

0.4

0.4 0.3

0.3 0.4

0.4 1.0

Oct. 2014 Nov. 2014 0.3 0.4

Dec. 2014 0.3

0.4

Jan. 0.3 2015

0.4

School transport driver Control 0.4 Nov. 2014 Sept.0.4 2014 Oct. 2014 2015 0.4 Dec. 2014 0.4 Jan. 0.4

0.4

Control

0.4

0.3

School transport driver

0.3

0.3 0.3 Jan. 2015 2014braking Oct. 2014 Nov. 2014 Dec.(n=102). 2014 Fig. 4. AverageSept. monthly above g-force threshold

Average monthly Average cornering, Average monthly cornering, % cornering, % % Average monthly cornering, % monthly

Age In general, the evaluation indicated that school transport drivers aged ≤35 years exceed the speed limit (by 10%) four times more often than drivers >35 years. This study therefore suggests that the different age groups, i.e. ≤30; 31 - 44; and ≥45 years, would appear to have different safety and performance profiles and driving styles, of which age is arguably only one indicator.

Time speeding, % Time speeding, % % Time speeding, %Time speeding,

3.5

0.0

School transport driver Control Sept. 2014 Oct. 2014 Nov. 2014 Dec. 2014 Jan. 2015 Control

1.0 0.8 1.0 0.6

0.8

0.9

School transport driver

0.8

0.7 0.6 0.8 0.4 0.9 0.8 0.8 0.6 0.7 0.2 0.6 1.0 0.0 0.0 0.0 0.0 0.0 Conclusions and recommendations 0.4 0.0 0.8 The results of this first evaluation of the Safe Travel to School 0.9 0.8 1.0 0.2 0.8 2014 Oct.0.0 2014 Nov. 2014 2014 Jan.0.0 2015 0.6 Sept.0.0 0.0 Dec. 0.0 0.7 Programme are promising. School transport drivers appear to 0.6 0.8 0.0 perform relatively better than general motorists with regard to key 0.8 Control0.9 School transport driver 0.4 0.8 0.6 Sept. 2014 Oct. 2014 Nov. 2014 driving performance indicators (speeding, acceleration, braking and Dec. 0.7 2014 Jan.0.6 2015 0.2 cornering) for the particular review period. Fig. 5. 0.4 Average monthly (n=102). 0.0 0.0 cornering 0.0above g-force 0.0 threshold0.0 School transport driver Control 0.0 0.2 0.0 Dec. 0.0 Sept.0.0 2014 Oct. 0.0 2014 Nov. 2014 2014 Jan.0.0 2015 31 March 2017, Print 0.0 edition Sept. 2014

School transport driver Control Oct. 2014 Nov. 2014 Dec. 2014 Jan. 2015 Control

School transport driver

CME

Driver demographics

Regardless of the differences in driver behaviours, age and gender (male)[9-11] are highly significant contributors to unsafe driving behaviours and should be considered and accounted for in the design of driver safety interventions. Further interventions should consider a staggered programme that takes driver age (at least differentiated for <35 years), but preferably the different capacities, experiences and needs of the ≤30, 31 - 44, and ≥45-year groups into account. There is, however, a need to collect information relevant to each driver, beyond demographic information, e.g. driver history and psychosocial characteristics. This information is critical for two broad reasons: (i) to provide better contextual information for the analysis and explanation of individual driving performance; and (ii) to ensure a better fit of designed safety interventions to specific drivers or cohorts of drivers.

Persistent defaulters

This study has implications for other interventions that may be considered in this sector. For instance, there is good reason to suggest remedial action interventions based on observed performance of drivers and identified lapses in specific driving behaviours. This is essential to mitigate the prolonged impact of repeat or serious road traffic offenders on such driver programmes and on the learners being transported in vehicles, who are part of the programme. The purpose of such a remedial component would be to identify such participants timeously and intentionally modify their driving behaviours to ensure their continued participation in the programme. Participants who fail to respond to such remedial action should be removed from the programme to minimise the potential of likely harm to learners and to limit legal and other liability for programme partners and sponsors.

Sustainable long-term intervention impacts

The Safe Travel to School Programme applied an incentive-based token economy system, which may not be sustainable for long-term behavioural modification, especially in resource-strapped settings. In general, such a system is known to produce changes in behaviour that are transient or easily altered, given the absence of the token economy.[12] Therefore, incentives should be awarded on good or improved driving behaviours over sustained periods of time. More cogently, long-term behaviour modification is best obtained through internalisation of relevant attitudes and behaviours by drivers themselves, and the token economy is therefore most appropriately utilised to augment and not replace this aspect of behavioural change.

Road safety and child injury prevention

The findings of this study reflect the need for further holistic evaluations of driver performance, interventions directed at driver health, safety and wellbeing (in a competitive, unprotected industry), and rigorous

screening of potential drivers.[13] Children are safer with older, more experienced drivers. It is, however, the collective social responsibility of the transportation sector, parents, broader communities, and child safety practitioners to mobilise and support efforts to enable the rigorous screening, training and remediation of school transport drivers. The SA government has recognised the challenges faced with the transportation of learners to and from schools, and has drafted the National Learner Transport Policy in collaboration with the Department of Basic Education and other stakeholders with the aim to fulfil the constitutional mandate to provide safe and efficient transportation for learners.[14] However, the implementation of this policy across privately dedicated school transport operations has proved to be challenging, as critiques lodged at this policy demand guidelines and firmer regulation of the industry to ensure that every child benefits from the available, although restrictive, funding structures (i.e. subsidies),[15] and a broader social responsibility for child safety on our roads. Acknowledgements. This project is a Childsafe South Africa project, which has been financially supported by the Discovery Trust. The authors acknowledge the Discovery Foundation and Discovery Insure for their ongoing support during the project.

1. Matzopoulos R, Prinsloo M, Pillay-van Wyk V, et al. Injury-related mortality in South Africa: A retrospective descriptive study of postmortem investigations. Bull World Health Organ 2015;93(5):303-313. http://dx.doi.org/10.2471/blt.14.145771 2. Road Traffic Management Corporation. Road Traffic Report: Calendar 1 January - 31 December 2015. Pretoria: RTMC, 2016. http://www.rtmc.co.za/index.php/reports/traffic-reports (accessed 20 January 2017). 3. Forjuoh SN. Traffic-related injury prevention interventions for low-income countries. Int J Injury Control Safety Promotion 2003;10(1-2):109-118. http://dx.doi.org/10.1076/icsp.10.1.109.14115 4. European Transport Safety Council. Police Enforcement Strategies to Reduce Traffic Casualties in Europe. Brussels: ETSC, 1999. 5. Sukhai A, Noah M, Prinsloo M. Road traffic injury in South Africa: An epidemiological overview for 2001. In: Suffla S, van Niekerk A, Duncan N, eds. Crime, Violence and Injury Prevention in South Africa: Developments and Challenges. Tygerberg: South African Medical Research Council, 2004:114-127. 6. Demberelsuren J. Knowledge, Attitudes and Practices of Pedestrians, Drivers and Traffic Policemen on Traffic Safety Related Issues. Mongolia: Millennium Challenge Corporation, 2010. 7. World Health Organization. World Report on Road Traffic Injury Prevention: Summary. Geneva: WHO, 2004. 8. Cummings P, McKnight B, Rivara FP, Grossman DC. Association of driver air bags with driver fatality: A matched cohort study. BMJ 2002;324(7346):1119-1122. http://dx.doi.org/10.1136/bmj.324.7346.1119 9. Rhodes N, Pivik K. Age and gender differences in risky driving: The roles of positive affect and risk perception. Accident Anal Prevent 2011;43(3):923-931. http://dx.doi.org/10.1016/j.aap.2010.11.015 10. Tabibi Z, Borzabadi HH, Stavrinos D, Mashhadi A. Predicting aberrant driving behaviour: The role of executive function. Transportation Research Part F. Traffic Psychol Behav 2015;34:18-28. http://dx.doi. org/10.1016/j.trf.2015.07.015 11. Cheng ASK, Lee HC. Risk-taking behavior and response inhibition of commuter motorcyclists with different levels of impulsivity. Transportation Research Part F. Traffic Psychol Behav 2012;15(5):535-543. http://dx.doi. org/10.1016/j.trf.2012.05.005 12. Levine FM, Fasnacht G. Token rewards may lead to token learning. Am Psychol 1974;29(11):816-820. http://dx.doi.org/10.1037/h0037474 13. Machin MA, de Souza JMD. Predicting health outcomes and safety behaviour in taxi drivers. Transportation Research Part F. Traffic Psychol Behav 2004;7(4-5):257-270. http://dx.doi.org/10.1016/j.trf.2004.09.004 14. Department of Transport. National Learner Transport Policy. Pretoria: DoT, 2015. http://www.gov.za/sites/www. gov.za/files/39314_gon997.pdf (accessed 27 May 2016). 15. Essop R. Opposition hits out at learner transport policy. Eyewitness News, 2015. http://ewn.co.za/2015/06/01/ Opposition-hits-out-at-learner-transport-policy (accessed 19 May 2016).

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

IN PRACTICE

CLINICAL UPDATE

A framework for preventing healthcare-associated infection in neonates and children in South Africa A Dramowski,1 MB ChB, DCH, FCPaed (SA), Cert Paed ID, PhD; M F Cotton,1 MB ChB, DCH, FCPaed (SA), PhD; A Whitelaw,2 MB ChB, MSc, FCPath (SA) (Micro) Department of Paediatrics and Child Health, Division of Paediatric Infectious Diseases, Faculty of Medicine and Health Sciences, Stellenbosch University, Cape Town, South Africa 2 Department of Medical Microbiology, Faculty of Medicine and Health Sciences, Stellenbosch University and National Health Laboratory Service (NHLS), Tygerberg Hospital, Cape Town, South Africa 1

Corresponding author: A Dramowski (dramowski@sun.ac.za)

Healthcare-associated infection (HAI) is a frequent and serious complication affecting 4 - 8% of hospitalised children and neonates in high-income countries. The burden of HAI in South African (SA) paediatric and neonatal wards is substantial but underappreciated, owing to a lack of HAI surveillance and reporting. Maternal and child health and infection prevention are priority areas for healthcare quality improvement in the National Core Standards programme. Despite increasing recognition in SA, infection prevention efforts targeting hospitalised children and neonates are hampered by health system, institutional and individual patient factors. To ensure safe healthcare delivery to children, a co-ordinated HAI prevention strategy should promote development of infection prevention norms and policies, education, patient safety advocacy, healthcare infrastructure, surveillance and research. We present a framework for SA to develop and expand HAI prevention in hospitalised neonates and children. S Afr Med J 2017;107(3):192-195. DOI:10.7196/SAMJ.2017.v107i3.12035

Healthcare-associated infection (HAI) is the most frequent complication of hospitalisation, contributing to morbidity, excess mortality and increased healthcare costs.[1-3] Although the neonatal and paediatric HAI burden is well described in high-income settings (4 - 8% prevalence),[4,5] the HAI burden in most African countries is unquantified. In a meta-analysis of HAI in low-middle-income countries (LMIC), the World Health Organization (WHO) identified only three studies of neonatal/paediatric HAI from Africa between 1995 and 2008 (none from South Africa (SA)).[6] Prior and subsequent to the WHO meta-analysis, five publications have established HAI risk factors for hospitalised children in African settings, including malnutrition,[7-9] prolonged hospital stay,[7,10] use of indwelling devices,[9,11] paediatric intensive care unit (PICU) admission,[9] blood transfusion,[8,9] young age,[7,10] underlying comorbid diseases, HIV infection, and HIVexposed, uninfected status.[9]

HAI epidemiology in hospitalised SA children and neonates

The epidemiology of paediatric and neonatal HAI in SA is poorly documented. Literature describing neonatal HAI is extremely limi ted, reporting healthcare-associated bloodstream infection (HA-BSI) only; an HA-BSI incidence of 4/1 000 and 14/1 000 patient days was reported from two tertiary hospitals – in Cape Town and Johannesburg, respectively.[12,13] Among paediatric inpatients in Cape Town, HA-BSI rates of 1.6/1 000 patient days were recorded, with excess mortality attributable to hospital- v. community-acquired BSI (25% v. 16%).[14] In 1987, prospective surveillance of two paediatric wards at Chris Hani Baragwanath Hospital, Johannesburg established an HAI prevalence of 14.3%, with a predominance of gastrointestinal and respiratory tract infections.[7] At the PICU at King Edward Hospital, Durban, SA, an HAI prevalence of 43% was reported in 1992.[10] A 1-day point

prevalence study of 2 652 adults and children at six Gauteng hospitals established a pooled HAI prevalence of 9.7% for BSI, urinary tract, respiratory tract and surgical site infections. Children had higher HAI rates overall (16.5%), and a greater prevalence of BSI and respiratory tract infections.[15,16] Recent prospective clinical surveillance at Tygerberg Children’s Hospital paediatric wards and the PICU documented an HAI prevalence of 24%, with hospital-acquired pneumonia and HA-BSI predominating. HAI incidence density was highest in the PICU (94 v. 22/1 000 patient days in wards).[9] PICU device-associated infection densities were double those reported from PICUs in other LMIC.[9,17] Two-thirds of all in-patient mortality occurred in association with HAI, with crude mortality 6-fold higher (7.4%) than among HAI-unaffected hospitalisations. HAI-affected patients also had three-fold higher rates of hospital readmission within 30 days. HAI events incurred substantial direct costs (ZAR5.6 million) and an excess of 2 275 hospitalisation days, 2 365 antimicrobial days, and 3 575 laboratory investigations in four wards over 6 months.[9]

The changing landscape of HAI prevention in SA

A national healthcare quality improvement programme launched in 2012 introduced annual facility audits to benchmark public and private institutions against ‘national core standards (NCS) for healthcare establishments’.[18] In addition, the Office of Health Standards Compliance was established to guide NCS implementation and to act as a national healthcare licensing and accreditation body. Despite a renewed focus on infection prevention (IP) and HAI surveillance, data on HAI burden and epidemiology in SA are extremely limited. Although the development of IP standards is laudable, much greater resources and technical expertise (in healthcare epidemiology, IP and data management) are required

March 2017, Print edition

IN PRACTICE

to achieve data-driven improvement in HAI prevention services. Furthermore, implementation of HAI prevention in the SA healthcare context is complex, with multiple challenges to IP programmes at health system, institutional and patient level (Table 1).

A proposed framework for neonatal and paediatric HAI prevention in SA

Programmes to establish safe and high-quality delivery of healthcare to SA children require a co-ordinated HAI prevention strategy, informed by local surveillance and research. An important goal is to ensure that limited IP resources (at national, provincial and institutional level) are directed at the most common HAI events and populations at greatest risk. Prevention should employ a holistic, integrated approach incorporating policy development, IP education, patient safety advocacy, infrastructure development, surveillance and research. Table 2 outlines the major components and proposed content of a paediatric/neonatal HAI prevention framework for SA. Table 3 lists the key national, provincial and institutional partners for developing and implementing the proposed framework.

HAI prevention policies and guidelines

Given their vulnerability to infection and the burden of communityacquired infection in hospitalised neonates and children, explicit recom-

mendations on IP norms and standards are needed. Locally adapted IP guidelines and policies would assist paediatric and neonatal clinical managers to ensure implementation of best practices. One example where HAI prevention guidance is needed is for cleaning and disinfecting the healthcare environment, e.g. isolation rooms, incubators, and shared equipment. The risk of pathogen transmission and hospital outbreaks after ineffective cleaning of the patient environment is well recognised.[20-22] Despite widespread implementation in high-income settings, few SA healthcare facilities have guidelines on environmental cleaning and even fewer perform routine assessment of cleaning adequacy.[23] A study comparing methods for evaluation of paediatric isolation room terminal cleaning, identified fluorescent markers as an inexpensive option for cleaning assessment, which also allows for provision of immediate visual feedback to cleaning personnel.[23] Other important topics include: staffing norms for IP and paediatric staff; management of patient isolation facilities; hand hygiene and personal protective equipment; HAI surveillance and reporting; outbreak investigation recommendations and reporting; antimicrobial usage and restriction; and staff vaccination.

Education, training and advocacy for patient safety

Surveys of SA healthcare workers and data from the first NCS audit show the need for improved in-service and undergraduate health

Table 1. Challenges to HAI prevention in hospitalised children and neonates* Health systems factors

Healthcare environment factors

Patient factors

Competing health priorities High burden of community-acquired infections Few resources for IP implementation Lack of HAI surveillance programmes and reporting Lack of IP policies Lack of IP training for healthcare workers Lack of a co-ordinated research agenda for HAI prevention

Overcrowding High patient-to-staff ratios Lack of IP provisions and consumables Lack of isolation facilities Ageing infrastructure Inadequate environmental cleaning Re-use and sharing of devices and equipment Lack of a patient safety focus and institutional culture

Malnutrition HIV exposure and HIV infection Prematurity Chronic diseases High device utilisation rates High antimicrobial usage

*Adapted from Rothe et al.[19]

Table 2. Framework for HAI prevention in SA child health services Component

Example of core content

Policies and guidelines

IP norms and standards for outpatient and inpatient settings, with a specific focus on paediatric and neonatal populations; guideline documents for paediatric/neonatal wards and clinics, e.g. patient isolation recommendations, guidelines on personal protective equipment use, environmental cleaning methods and assessment, antimicrobial restriction policies

Education, training and advocacy for patient safety

A national core curriculum on IP and HAI prevention for undergraduate health science and nursing students (with additional neonatal/paediatric content); minimum topics/frequency of in-service training for all healthcare workers; standard in-hospital instructions for caregivers on basic IP control measures; national and provincial IP champions to lead education, advocacy and research; institutional buy-in from managers and departmental heads of department to prioritise safe care of children; collaboration within existing structures, e.g. IP and quality improvement committees

Provisions and infrastructure

Building norms for new and renovated neonatal and paediatric services, including consensus on a recommended ratio of single (isolation) to cohort beds, e.g. 1:2, and requirement for negative-pressure ventilation (with either natural or mechanical ventilation to achieve at least 12 air changes per hour); basic provisions for HAI prevention, e.g. soap, water, alcohol handrub, personal protective equipment

Surveillance and research

Develop recommendations for HAI surveillance methods, frequency and targets, e.g. HAI burden, spectrum, risk factors, distribution by ward/facility type and associated antimicrobial use; outbreak reporting; addition of HAI to existing morbidity and mortality registers; identification of key research questions to improve HAI implementation

March 2017, Print edition

IN PRACTICE

Table 3. Key partners for HAI prevention framework development and implemen tation Level

Key stakeholders and partners

National

The National Department of Health, Quality Assurance Directorate and Office of Health Standards Compliance South African Society for Paediatric Infectious Diseases South African Paediatric Association Infection Control Society of Southern Africa National Institute of Communicable Diseases (soon to be the National Public Health Institute of South Africa) United South African Neonatal Association (USANA) The Neonatal Nurses Association of South Africa (NNASA) The Society of Midwives of South Africa (SOMSA) The South African Antibiotic Stewardship Programme (SAASP) Best Care … Always (BCA) campaign National Health Laboratory Service (NHLS) and other laboratories MRC Burden of Disease Unit

Provincial

Department of Health’s provincial communicable disease teams Department of Health’s provincial mother and child health (MCH) directorates District Health specialist teams (in obstetrics and paediatrics) University departments of paediatrics and child health, public health, infectious diseases, microbiology, virology and infection prevention

Institutional

Facility medical and nursing managers Infection prevention and control committees Antimicrobial stewardship committees Health and safety teams Quality improvement structures Primary healthcare networks (using existing structures for PMTCT, TB, EPI)

MRC = Medical Research Council; PMTCT = prevention of mother-to-child transmission of HIV; EPI = expanded programme on immunisation.

science training in IP.[24-27] Development of harmonised IP curricula for all cadres of SA healthcare workers is needed, including recommendations on minimum training duration, core topics and competency evaluation. As risks and routes of infection transmission vary by population, additional content on paediatric and neonatal-specific risks would be needed, e.g. infant feeding. In a recent survey of 200 paediatric/neonatal medical and nursing staff at Tygerberg Children’s Hospital, several important misconceptions about infection transmission routes and hand hygiene methods were identified.[26] Although 48% of participants considered HAI to be inevitable, there was broad support for punitive measures for staff ignoring infection control recommendations (89%) and for reporting of HAI episodes as adverse events (76%). Multiple opportunities were identified for improvement, including poor uptake of annual influenza vaccination (25%); low rates of N95 respirator fit-testing (28%); and very high presenteeism among doctors (95%), despite the risk of infection transmission to their patients. Participants required greater leadership and shared accountability for IP,

acknowledging a weak institutional patient safety culture and climate.[26] From this singlecentre study it is clear that there is scope for improved IP education for paediatric/neonatal staff. Moreover, identification of named ‘infection prevention champions’ in paediatric and neonatal departments who ‘model’ desired IP attitudes and behaviours, could assist with implementation of best practices and institutional culture change. Basic IP teaching packages and information packs for non-healthcare workers with regular patient contact (volunteers, visitors and caregivers) should also be developed.

Provisions and infra structure for IP in paediatric/neonatal facilities

In many high-income countries, paediatric wards are designed with single rooms and en-suite facilities to reduce the risk of infection transmission. Ironically, in resourcelimited settings, where the infection burden is highest, few or no patient isolation facilities exist.[19] The IP indications for patient isolation are also likely to differ across SA.

March 2017, Print edition

At Tygerberg Children’s Hospital, where isolation room demand consistently exceeded availability, airborne isolation for children with pulmonary TB was the predominant requirement (52%) (with 26% of patients suffering from drug-resistant TB).[28] To date, there are no data on availability of patient isolation facilities or negative-pressure ventilation rooms elsewhere in SA. In renovating and building new children’s hospitals in SA, recommendations for the ratio of single to cohort beds, and numbers of airborne isolation beds (whether naturally or mechanically ventilated negative-pressure rooms), must be established. In addition, IP building norms for bed spacing, workflows, provision of handwash basins and sluice rooms, and guidance on other engineering and ventilation issues for neonatal/paediatric wards should be developed.

HAI surveillance and research

HAI surveillance is a key component of effective IP programmes and allows for comparison or ‘benchmarking’ between healthcare facilities. Despite the NCS requirement for HAI reporting since 2012, few SA healthcare facilities have the resources and expertise to perform comprehensive HAI surveillance.[29] Futhermore, the lack of consensus on HAI surveillance methods in SA prevents direct comparison of data across healthcare facilities. The paucity of data on incidence, spectrum and local determinants of HAI also hampers development of appropriate IP interventions. Given these constraints and variable laboratory investigation testing rates, some feasible alternative surveillance options include use of routinely collected datasets (e.g. discharge coding, microbiology results or antibiotic prescriptions for HAI). A combination of laboratory and antimicrobial usage data at Tygerberg Children’s Hospital achieved high sensitivity (85%) and positive predictive values (97%) for HAI determination, requiring substantially less time to collect/analyse than clinical surveillance data.[30] Additional options to improve HAI surveillance and research in neonatal/paediatric wards include mandatory coding of HAI on patient discharge, transfer or death; and mandatory outbreak reporting and explicit inclusion of HAI in morbidity and mortality estimates (both institutional and provincial, e.g. the Perinatal and Child Healthcare Problem Identification Programmes). It is unlikely that a one-size-fits-all approach to paediatric HAI surveillance in SA will be successful. However, surveillance, even of only one or two parameters, must begin as

IN PRACTICE

soon as possible and be gradually expanded. Undoubtedly, development and maintenance of paediatric HAI surveillance and research networks will be challenging, but the data yielded on disease burden, spectrum, distribution, risk factors and outcome will be invaluable.

Conclusion

The lack of data on neonatal and paediatric HAI in SA has contributed to an underappreciation of the burden and impact of these infections by clinicians, healthcare managers, policymakers and the public. From the limited local data available, HAI causes considerable suffering, mortality and increased healthcare cost in all age groups. To ensure safe and high-quality healthcare for SA children, a framework for a nationally endorsed HAI prevention strategy is needed. The following should be addressed: IP policy and infrastructure development; healthcare worker education; patient safety advocacy; surveillance; and research. Key national, provincial and local stakeholder partners should be actively engaged to develop and implement HAI prevention programmes for hospitalised SA children and neonates. Funding. Funding has been received from the South African Medical Research Councilâ&#x20AC;&#x2122;s Clinician Researcher Programme and the Discovery Foundationâ&#x20AC;&#x2122;s Academic Fellowship Award. 1. Marchetti A, Rossiter R. Economic burden of healthcare-associated infection in US acute care hospitals: Societal perspective. J Med Econ 2013;16(12):1399-1404. http://dx.doi.org/10.3111/13696998.2013.842922 2. Zimlichman E, Henderson D, Tamir O, et al. Health care-associated infections: A meta-analysis of costs and financial impact on the US health care system. JAMA Intern Med 2013;173(22):2039-2046. http:// dx.doi.org/10.1001/jamainternmed.2013.9763 3. Januel JM, Harbarth S, Allard R, et al. Estimating attributable mortality due to nosocomial infections acquired in intensive care units. Infect Control Hosp Epidemiol 2010;31(4):388-394. http://dx.doi. org/10.1086/650754 4. Magill SS, Edwards JR, Bamberg W, et al. Emerging Infections Program Healthcare-Associated Infections and Antimicrobial Use Prevalence Survey Team. Multistate point-prevalence survey of health careassociated infections. N Engl J Med 2014;370(13):1198-1208. http://dx.doi.org/10.1056/nejmoa1306801 5. European Centre for Disease Prevention and Control (ECDC). Point Prevalence Survey of Healthcareassociated Infections and Antimicrobial Use in European Acute Care Hospitals. Stockholm: ECDC, 2013. https://epidemio.wiv-sp.be/.../EU%20Point%20Prevalence%20Survey.pdf (accessed 1 May 2016). 6. Allegranzi B, Bagheri Nejad S, Combescure C, et al. Burden of endemic health-care-associated infection in developing countries: Systematic review and meta-analysis. Lancet 2011;377(9761):228-241. http:// dx.doi.org/10.1016/s0140-6736(10)61458-4 7. Cotton MF, Berkowitz FE, Berkowitz Z, et al. Nosocomial infections in black South African children. Pediatr Infect Dis J 1989;8(10):676-683. http://dx.doi.org/10.1097/00006454-198910000-00003 8. Aiken AM, Mturi N, Njuguna P, et al. Kilifi Bacteraemia Surveillance Group. Risk and causes of pediatric hospital-acquired bacteraemia in Kilifi District Hospital, Kenya: A prospective cohort study. Lancet 2011;378(9808):2021-2027. http://dx.doi.org/10.1016/s0140-6736(11)61622-x 9. Dramowski A, Whitelaw A, Cotton MF. Burden, spectrum and impact of healthcare-associated infection at a South African children's hospital. J Hosp Infect 2016;94(4):364-372. http://dx.doi.org/10.1016/j. jhin.2016.08.022

10. Bowen-Jones J, Wesley A, van den Ende J. Nosocomial colonisation and infection in a pediatric respiratory intensive care unit. S Afr Med J 1992;82(5):309-313. 11. Greco D, Magombe I. Hospital acquired infections in a large north Ugandan hospital. J Prev Med Hyg 2011;52(2):55-58. 12. Dramowski A, Madide A, Bekker A. Neonatal nosocomial bloodstream infections at a referral hospital in a middle-income country: Burden, pathogens, antimicrobial resistance and mortality. Paediatr Int Child Health 2015;35(3):265-272. http://dx.doi.org/10.1179/2046905515y.0000000029 13. Ballot DE, Nana T, Sriruttan C, Cooper PA. Bacterial bloodstream infections in neonates in a developing country. ISRN Pediatr 2012;508512. http://dx.doi.org/10.5402/2012/508512 14. Dramowski A, Cotton MF, Rabie H, et al. Trends in pediatric bloodstream infections at a South African referral hospital. BMC Pediatr 2015;15:33. http://dx.doi.org/10.1186/s12887-015-0354-3 15. Duse AG. Surveillance of healthcare-associated infections (HCAIs) South Africa. http://www.cddep. org/sites/default/files/prof_adriano_duse-2_0.pdf (accessed 1 May 2016). 16. Durlach R, McIlvenny G, Newcombe RG, et al. Prevalence survey of healthcare-associated infections in Argentina; comparison with England, Wales, Northern Ireland and South Africa. J Hosp Infect 2012;80(3):217-223. http://dx.doi.org/10.1016/j.jhin.2011.12.001 17. Rosenthal VD, Jarvis WR, Jamulitrat S, et al., International Nosocomial Infection Control Members. Socioeconomic impact on device-associated infections in pediatric intensive care units of 16 limited-resource countries. Pediatr Crit Care Med 2012;3(4):399-406. http://dx.doi.org/10.1097/ pcc.0b013e318238b260 18. National Department of Health. National Core Standards for Health Establishments in South Africa. Pretoria: NDoH, 2011. http://www.rhap.org.za/wp-content/uploads/2014/05/National-CoreStandards-2011-1.pdf (accessed 3 May 2016). 19. Rothe C, Schlaich C, Thompson S. Healthcare-associated infections in Sub-Saharan Africa. J Hosp Infect 2013;85(4):257-267. http://dx.doi.org/10.1016/j.jhin.2013.09.008 20. Otter J, Yezli S, Salkeld J, French G. Evidence that contaminated surfaces contribute to the transmission of hospital pathogens and an overview of strategies to address contaminated surfaces in hospital settings. Am J Infect Control 2013;41(5):6-11. http://dx.doi.org/10.1016/j.ajic.2012.12.004 21. Kramer A, Schwebke I, Kampf G. How long do nosocomial pathogens persist on inanimate surfaces? A systematic review. BMC Infect Dis 2006:6:130. http://dx.doi.org/10.1186/1471-2334-6-130 22. Boyce J. Environmental contamination makes an important contribution to hospital infection. J Hosp Infect 2013;65:50-54. http://dx.doi.org/10.1016/s0195-6701(07)60015-2 23. Dramowski A, Whitelaw A, Cotton MF. Assessment of terminal cleaning in pediatric isolation rooms: Options for low-resource settings. Am J Infect Control 2016;44(12):1558-1564. http://dx.doi. org/10.1016/j.ajic.2016.05.026 24. Dramowski A, Marais F, Willems B, Mehtar S; the SURMEPI curriculum review working group. Does undergraduate teaching of infection prevention and control adequately equip graduates for medical practice? Afr J Health Professions Educ 2015;7(1 Suppl 1):105-110. http://dx.doi.org/10.7196/ AJHPE.500 25. Dramowski A, Marais F, Goliath C, Mehtar S. Impact of a quality improvement project to strengthen infection prevention and control training at rural healthcare facilities. Afr J Health Professions Educ 2015;7(1 Suppl 1):73-75. http://dx.doi.org/10.7196/AJHPE.499. 26. Dramowski A, Whitelaw A, Cotton MF. Healthcare-associated infections in children: Knowledge, attitudes and practice of paediatric healthcare providers at Tygerberg Hospital, Cape Town. Paediatr Int Child Health 2016;36(3):225-231. http://dx.doi.org/10.1080/20469047.2015.1109264 27. Health Systems Trust. National Health Care Facilities Baseline Audit: National summary report. Durban: Health Systems Trust, 2012. https://www.health-e.org.za/wp-content/uploads/2013/09/National-HealthFacilities-Audit.pdf (accessed 1 May 2016). 28. Dramowski A, Cotton MF, Whitelaw A. Utilization of paediatric isolation facilities in a TB-endemic setting. Antimicrob Resist Infect Control 2015;4:36. http://dx.doi.org/10.1186/s13756-015-0078-z 29. Visser A, Moore DP, Whitelaw A, et al. Part VII. GARP: Interventions. S Afr Med J 2011;101(8):587-595. http://dx.doi.org/10.5402/2012/50851210.7196/SAMJ.5106 30. Dramowski A, Cotton MF, Whitelaw A. Surveillance of healthcare-associated infection in hospitalized South African children: Which method performs best? S Afr Med J 2017;107(1):56-63. http://dx.doi. org/10.7196/SAMJ.2017.v107i1.11431

Accepted 19 December 2016.

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

IN PRACTICE

MEDICINE AND THE LAW

Ownership and human tissue – the legal conundrum: A response to Jordaan’s critique S Mahomed,1 BCom, LLB, LLM, PhD Candidate; M Nöthling-Slabbert,2 BA Hons, MA, DLitt, LLB, LLD; M S Pepper,3 MB ChB, PhD, MD epartment of Jurisprudence, College of Law, University of South Africa D College of Law, University of South Africa 3 Institute for Cellular and Molecular Medicine; South African Medical Research Council Extramural Unit for Stem Cell Research and Therapy; and Department of Immunology, Faculty of Health Sciences, University of Pretoria, South Africa 1 2

Corresponding author: S Mahomed (mahoms1@unisa.ac.za)

The debate over whether there should be a property or non-property approach with regard to human tissue is only the tip of the iceberg, because the issues involved are very complex, reflecting profound considerations on the nature of the self and the structuring of society; the balance of power between the citizen, the government and commercial interests; and human beings’ perceptions of themselves and their bodies. This article responds to a publication by Donrich Jordaan titled ‘Social justice and research using human biological material: A response to Mahomed, Nöthling-Slabbert and Pepper’ in the July 2016 SAMJ. The original article to which Jordaan’s critique refers and that provides the source for his response appeared in the South African Journal of Bioethics and Law in 2013, titled ‘The legal position on the classification of human tissue in South Africa: Can tissues be owned?’. It is our contention that Jordaan’s critique is based on a misinterpretation of the issues raised relating to the ownership of human tissue, an issue extensively debated in the academic sphere for many years. Jordaan’s critique focuses on selected aspects of the original article and draws unjustifiable inferences from these. The purpose of this article is to contextualise Jordaan’s critique and reaffirm the validity of the arguments made in the original article in 2013. There are, however, certain aspects of Jordaan’s critique that we as authors of the original article acknowledge and appreciate in the spirit of academic discourse. S Afr Med J 2017;107(3):196-198. DOI:10.7196/SAMJ.2017.v107i3.12062

This article has been written in response to a publication by Donrich Jordaan titled ‘Social justice and research using human biological material: A response to Mahomed, Nöthling-Slabbert and Pepper’[1] in the July 2016 SAMJ (hereinafter referred to as Jordaan’s critique). The original article to which Jordaan’s critique refers and that provides the source for his response appeared in the South African Journal of Bioethics and Law in 2013, titled ‘The legal position on the classification of human tissue in South Africa: Can tissues be owned?’[2] (hereinafter referred to as the original article). Jordaan’s critique[1] mainly attempts to highlight weaknesses in the original article’s purported challenge to current healthcare public policy; contend that the original article’s conclusion regarding the legal ambivalence characterising ownership of human biological materials is incorrect; indicate that the original article’s alleged shift away from altruism lends no support to such shift; and purport that profit-sharing is not the only alternative to altruism. It is our contention that Jordaan’s critique is based on a misinterpretation of the issues raised relating to the ownership of human tissue, an issue extensively debated in the academic sphere for many years. Jordaan’s critique focuses on selected aspects of the original article and draws unjustifiable inferences from these. The purpose of this article is to contextualise Jordaan’s critique and reaffirm the validity of the arguments made in the original article in 2013. There are, however, certain aspects of Jordaan’s critique that we as authors of the original article acknowledge and appreciate in the spirit of academic discourse.

The original article’s alleged challenge to current healthcare public policy

It was never the intention of the original article to challenge current healthcare policy, as Jordaan suggests. The intention was to provide an outline of the legislative framework regarding the ownership of human tissue in South Africa (SA) and to comment broadly on whether it provides sufficient and consistent guidance in this regard. The purpose was to highlight further, by analysing relevant international case law (as the position remains untested in SA courts), differing views on ownership of human tissue, with specific emphasis on medical research. In addition, the original article argues that the use of the word ‘ownership’ as referred to in the Regulations to the National Health Act 61 of 2003 (hereinafter referred to as the NHA) is problematic and that it should be substituted with a ‘proprietary interest’, which denotes something different from the legal understanding of ownership.[2] It is trite that conclusion validity inter alia requires scientific conclusions to be reasonable, which, with regard to Jordaan’s observations, appears to fall short of this requirement, as his critique selectively analyses certain issues in the original article, without regard to the entire context thereof. This, in our view as authors of the original article, has created confusion and misperception which this article aims to address. The legal principles highlighted in this article relate to the ownership of removed human tissue or human biological materials for medical research, therapeutics or diagnostic purposes. Human tissue and human biological materials are used interchangeably.

March 2017, Print edition

IN PRACTICE

One should not overlook the fact that advances in medicine, ranging from transplant surgery to in vitro fertilisation, nanotechnology and neuroscience, have radically changed the way in which human bodies are perceived. There are abundant examples in law showing the law’s uneasiness in making sense of the human body in the context of ownership and property, as the notion of owning oneself (and one’s tissues) implies that persons are able to objectify their selves, and in the process become susceptible to objectification by others.[2] Furthermore, the question of the human body as property involves complicated ethical and philosophical dimensions that cannot be dealt with exhaustively within the scope of a legislative framework. There are very real issues with regard to who owns human tissue, especially in the research context.

Terminology

Jordaan criticises the original article’s reference to the terms ‘human tissue’ and ‘tissue donors’ and suggests that ‘human biological material’ and ‘research participant’ are more appropriate terms for the SA context. The original article draws attention to the fact that, owing to inconsistencies and contradictions between the definitions relating to human tissue,[3] human biological material,[4] tissue,[5] substance[6] and body specimen[7] in the NHA and the different sets of Regulations thereto, ambiguity should be avoided as these terms essentially relate to one another. The original article also argues that the NHA and its Regulations do not provide for a legal classification of human tissue, and to this end cause imprecision and uncertainty. Jordaan’s critique, in fact, incorrectly references definitions from the first edition of the National Department of Health’s ethics guidelines,[8] these having subsequently been updated by the publication of a second edition[9] in 2015.

Is ownership of human tissue certain?

The original article contends that there are currently no firm rules per se in respect of ownership of human biological materials, as far as medical research is concerned. This is particularly relevant when secondary uses of materials and third-party transfers relevant to biobank research are considered. Jordaan’s differing opinion and argument in support of such opinion hinges on the original article’s perceived misunderstanding of the common law position in SA, misguidance in respect of the interpretation of legislation, and relevance of foreign case law alluded to. The original article’s interpretation of the common law understanding of the human body is in fact similar to the position expressed in Jordaan’s critique. The human body and its parts are traditionally classified as res extra commercium (things outside the commercial sphere). Separated bodily materials present a problematic category, as the law has traditionally regarded separated bodily materials as res nullius, belonging to no one, until brought under the control of the first person who obtains possession of the separated human tissue.[2,10] The universal legal prohibition on the sale or trade of human tissue, embodied globally, and various statutory regulations on the use of human tissue, are equally ambiguous, as these statutory prohibitions paradoxically reinforce a construction of the human body as a commodity (property), subject to regulation. It is unfortunate that Jordaan, in taking exception to the original article’s reference to the NHA Regulations Relating to Artificial Fertilisation,[11] selects one paragraph specific to the ownership of gametes, without considering the original article’s position that underlines the ambiguity created in respect of the operational definitions of an embryo in the NHA and the 2012 Regulations.[6] The original article emphasises that current legislation does not provide any guidance on whether an embryo may fulfil the requirements to

be categorised as property. In contradiction to Jordaan’s assumption that the original article relies on one specific set of Regulations[11] to further a general position regarding uncertainty of ownership of human biological material, its intent in this instance was to highlight that the exact characterisation of an embryo in SA law remains unknown and will have to be dealt with on a case-by-case basis, taking into consideration all relevant factors.[2] Jordaan’s critique questions the relevance in the original article of Washington University v Catalona.[12] This specific case was selected to highlight how courts have struggled to reconcile legal tradition and precedent with novel ethical and legal challenges arising from the use of human tissue in the biotechnology era. This case illustrates that even though samples were donated to the university for the purpose of cancer research, the institution could not use the samples as they pleased without any regard to the rights of the participants. It is not uncommon for international case law to be cited in instances where domestic law is untested, silent or ambiguous with regard to a specific legal issue. Even though, as Jordaan points out, human biological materials are a proper object of ownership in Missouri, the participants in this case still retained rights as to how their tissues would be used and were provided with the opportunity to disallow the use of their tissues for future research purposes, despite the fact that the institution was regarded as the owner of the tissues.[13] We agree, in part, with Jordaan’s interpretation of the California Supreme Court judgment in Moore v Regents of the University of California.[14] However, the California Supreme Court in Moore cautioned that ‘we do not purport to hold that excised cells can never be property for any purpose whatsoever …’.[14] The settlement between the members of the Havasupai tribe and Arizona State University[15] suggests that the defendants and their counsel in this matter applied the qualifying language as set out in Moore seriously.[16] The Havasupai tribe alleged that researchers from Arizona State University had collected blood samples to study the prevalence of diabetes in their tribe; however, subsequently and without their permission, the researchers used the blood samples to study genetic markers for other disorders, including schizophrenia and alcoholism.[16] In order to remedy the problematic situation, Arizona State University agreed to compensate members of the tribe monetarily, return the blood samples and provide other forms of assistance to the disadvantaged Havasupai. The significance of this settlement highlights that the rights of participants can indeed be violated when they are not fully informed about how their samples, in this case blood samples, might be used. By questioning the honesty of researchers from Arizona State University and probing whether they had been involved in exploiting a vulnerable population, this case cast a negative image on the university, which portrayed itself as a respectable institution for American Indian studies.[15] Genetics experts and civil rights advocates assert that the continuous and growing debate over a researcher’s responsibility to communicate the range of personal information that may be sourced from DNA at the time it is initially collected may be further fuelled by the outcomes of this case.[15] We may only speculate on the outcome of this matter, had it been litigated in court. The university’s decision to settle, however, possibly indicates apprehension on the part of the university that litigation would have been successful. In a 2014 Canadian judgment, the Ontario Superior Court of Justice decided, as a preliminary issue, that tissue removed from a body for diagnostic medical tests is ‘personal property’ belonging to the hospital where the procedure was performed.[17] This case involved an action of medical negligence instituted by the estate of a deceased patient against two doctors for failing to diagnose colorectal cancer of the deceased, who died in

March 2017, Print edition

IN PRACTICE

2011. The doctors requested to have access to the liver tissue biopsied from the deceased. Before considering whether the defendant doctors had a right to access the liver tissue to determine whether the deceased patient had hereditary non-polyposis colorectal cancer, the court had to address the issue of ownership of the relevant tissue. An earlier UK judgment that has made reference to ownership of male gametes is Yearworth v North Bristol NHS Trust,[18] which involved the negligent destruction of the sperm of six men that had been stored prior to their cancer treatment. In this case, the Court of Appeal for England and Wales held that, for the purposes of the negligence claim, the men ‘owned’ their sperm as the sperm was deposited solely for their own benefit. ‘Ownership’ of human tissue or human biological materials, although possible in certain circumstances, is therefore not as clear cut as Jordaan proposes. What these cases may point to is that although the position that all human biological material is not property remains the status quo, some courts seem willing to deal with novel cases on an ad hoc basis, which over time may extend the circumstances under which human biological material could be viewed as legal property. This supports the contention in the original article that there may be some instances where a case-by-case approach is more appropriate, as the specific facts of a matter do have significant bearing on the outcomes, as seen above.[2]

The original article’s alleged shift away from altruism towards a model of profit-sharing

Contrary to Jordaan’s critique, which suggests that the original article proposes that the current altruistic research paradigm be replaced by profit-sharing by participants, the original article introduces the proposition of compensation for research participants as a means to benefit the most vulnerable in society. In fact, the ‘altruistic paradigm’ to which Jordaan refers is in itself questionable, as the historical exploitation of research participants in Africa is a glaring reality.[19-21] The fact that Troug et al.[22] do not specifically advocate a profit-sharing model is not a point that the authors of the original article were trying to make. Truog et al.[22] recommend, in light of the Moore decision[14] and other legal precedents, that individuals do not retain property ownership over removed tissues:[2] ‘a plausible rationale for justifying such payments is that they are made in exchange for the performance of a service, rather than for the transfer of property’.[22] Furthermore, if human tissues are afforded a proprietary interest, they would be protected from unauthorised use. The holders of the proprietary right (i.e. the research subject) would have to consent to any use of their tissue in the research phase and any subsequent future use thereof. This would also ensure that the proceeds of any therapy developed from the tissue would be distributed, in part, to the participants.[2] A mandatory agreement stipulating the terms and conditions of such distribution should be enforced. In this way, unscrupulous activities could be minimised and vulnerable individuals, in particular, could benefit from the use of their tissues.[2] The authors of the original article did not claim that this is the only form of ‘benefit sharing’, as Jordaan’s critique asserts.[1] The original article merely suggests that monetary compensation should not be overlooked. Jordaan’s critique furthermore contends that ‘In the absence of an exhaustive and convincing rationale for replacing the existing altruistic paradigm with a paradigm of benefit sharing by research participants, any discussion of benefits for research participants is driftwood in the legal-ethical ocean.’[1] It is prudent to note that the original article does not advance the view that one model be replaced with another. The recommendation of profit-sharing in no way

precludes other possible or viable benefit-sharing mechanisms from being considered.

Conclusion

It is imperative that legislation in SA relating to the regulation of human tissue be amended to provide a clear and consistent message regarding any proprietary claims in respect of human tissue.[2] In the present context, researchers and academics working in the field of human tissue frequently express their confusion regarding the meaning and practical implications of possession, custodianship, [23,24] owner ship, database rights and intellectual property. The conflicting descriptions in statute and regulations relating to the regulation of human tissues add to this confusion.[25] In light of the above, we stand by the arguments developed in our original article and assert that to apply a blanket ‘no property rights’ rule to all cases in which removed human tissue is involved would amount to a careless and reckless application. In fact, as Goold et al.[26] correctly observe, the debate over whether there should be a property or nonproperty approach with regard to human tissue is only the tip of the iceberg, because the issues involved are very complex, reflecting profound debates on the nature of the self and the structuring of society; the balance of power between the citizen, the government and commercial interests; and human beings’ perceptions of themselves and their bodies. 1. Jordaan DW. Social justice and research using human biological material: A response to Mahomed, Nöthling-Slabbert and Pepper. S Afr Med J 2016;106(7):678-680. http://dx.doi.org/10.7196/SAMJ.2016. v106i7.10552 2. Mahomed S, Nöthling-Slabbert M, Pepper MS. The legal position on the classification of human tissue in South Africa: Can tissues be owned? S Afr J Bioethics Law 2013;6(1):16-20. http://dx.doi.org/10.7196/ SAJBL.258 3. South Africa. National Health Act 61 of 2003. Regulations: Relating to the Import and Export of Human Tissue, Blood, Blood Products, Cultured Cells, Stem Cells, Embryos, Foetal Tissue, Zygotes and Gametes. Government Gazette No. 35099, 2012 (published under Government Notice R181). 4. South Africa. National Health Act 61 of 2003. Regulations: Relating to the use of Human Biological Material. Government Gazette No. 35099, 2012 (published under Government Notice R177). 5. South Africa. National Health Act 61 of 2003. Regulations: Relating to Tissue Banks. Government Gazette No. 35099, 2012 (published under Government Notice R182). 6. South Africa. National Health Act No 61 of 2003. 7. South Africa. National Health Act 61 of 2003. Regulations: Rendering of Clinical Forensic Medicine Services. Government Gazette No. 35099, 2012 (published under Government Notice R176). 8. National Department of Health, South Africa. Ethics in Health Research: Principles, Structures and Processes. Pretoria: NDoH, 2004. 9. National Department of Health, South Africa. Ethics in Health Research: Principles, Processes and Structures. Pretoria: NDoH, 2015. 10. Nöthling-Slabbert MN. Human bodies in law: Arbitrary discursive constructions? Stellenbosch Law Rev 2008;19(1):71-100. 11. South Africa. National Health Act 61 of 2003. Regulations: Relating to Artificial Fertilisation of Persons. Government Gazette No. 35099, 2012 (published under Government Notice R175). 12. Washington University v Catalona 490 F 3d 667 – Court of Appeals, 8th Circuit 2007. 13. Gibson SF. Washington University v Catalona: Determining ownership of genetic samples. Jurimetrics J 2008;48(2):167-191. 14. Moore v Regents of the University of California 51 Cal. 3d 120;271 Cal. Rptr. 146; 793 P 2d 479. 15. Harmon A. Indian tribe wins fight to limit research of its DNA. New York Times, 22 April 2010. http:// archive.boston.com/news/education/k_12/articles/2010/04/22/arizona_state_settles_dna_case_with_ tribe/ (accessed 2 September 2016). 16. Baulig LT. Are there property rights in human tissue? The law ‘lacks’ definitive answers. J Lancaster Gen Hosp 2010;5(3):87-90. 17. Piljak Estate v. Abraham, 2014 Ontario Superior Court of Justice 2893 (CanLII). 18. Yearworth v North Bristol NHS Trust 2010 Queen’s Bench. 19. Arnason G, Schroeder D. Exploring central philosophical concepts in benefit sharing: Vulnerability, exploitation and undue inducement. In: Schroeder D, Lucas JC. Benefit Sharing: From Biodiversity to Human Genetics. New York: Springer, 2013:9-31. 20. Lucas JC, Schroeder D, Arnason G, et al. Donating human samples: Who benefits? Cases from Iceland, Kenya and Indonesia. In: Schroeder D, Lucas JC. Benefit Sharing: From Biodiversity to Human Genetics. New York: Springer, 2013:95-128. 21. Lucas JC, Schroeder D, Chennells R, et al. Sharing traditional knowledge: Who benefits? Cases from India, Nigeria, Mexico and South Africa. In: Schroeder D, Lucas JC. Benefit Sharing: From Biodiversity to Human Genetics. New York: Springer, 2013:65-93. 22. Troug RD, Kesselheim AS, Joffe S. Paying patients for their tissue: The legacy of Henrietta Lacks. Science 2012;337(6):37-38. http://dx.doi.org/10.1126/science.1216888 23. Slabbert MN, Pepper MS. ‘A room of our own?’ Legal lacunae regarding genomic sovereignty in South Africa. Tydskrif vir Hedendaagse Romeins-Hollandse Reg (Journal of Contemporary South African Roman-Dutch Law) 2010;73:432-450. 24. De Vries J, Pepper MS. Genomic sovereignty and the African promise: Mining the African genome for the benefit of Africa. J Med Ethics 2012;38(8):474-478. http://dx.doi.org/10.1136/medethics-2011-100448 25. Knoppers BM, Saginur M, Cash H. Ethical issues in secondary uses in human biological materials from mass disasters. J Law Med Ethics 2006:34(2):352-365. http://dx.doi.org/10.1111/j.1748-720x.2006.00040.x 26. Goold I, Greasley K, Herring J, Skene L, eds. Persons, Parts and Property: How Should We Regulate Human Tissue in the 21st Century? Oxford and Portland, Ore.: Hart Publishing, 2014:298-299.

Accepted 3 October 2016.

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

IN PRACTICE

MEDICINE AND THE LAW

An imaginary legal conundrum: A reply to the response by Mahomed, Nöthling-Slabbert and Pepper D W Jordaan, PhD School of Law, Howard College, University of KwaZulu-Natal, Durban Corresponding author: D W Jordaan (jordaand@ukzn.ac.za)

In their original article on the subject of research using human biological material, Mahomed, Nöthling-Slabbert and Pepper advanced the notion that the law regarding ownership of human biological material is uncertain, and proposed that our country’s healthcare policy of altruism be changed to mandatory profit-sharing by research participants. In my critique article, I took issue with the notion that the relevant law is uncertain, and suggested that Mahomed et al. failed to present a convincing argument in support of the proposed policy change from altruism to profit-sharing. In their response to my critique article, Mahomed et al. persist with the notion that the relevant law is uncertain; I suggest that this notion is erroneous, as our common law in this regard is well established, and as the authors base their argument exclusively on foreign case law. The authors further fail to make use of the opportunity to augment their argument in support of their proposed policy change from altruism to profit-sharing – in fact, they contradict themselves by disavowing their proposed policy change. S Afr Med J 2017;107(3):199-200. DOI:10.7196/SAMJ.2017.v107i3.12337

I am disappointed by the aggressive tone adopted by Mahomed, Nöthling-Slabbert and Pepper in their letter to the editor[1] and in their response article.[2] I am also disappointed that they make a number of vague allegations against me, such as that I misinterpret the issues, and that my conclusions are not reasonable, without substantiating these allegations with any specific examples. Suffice it to say that there is no merit in these vague allegations. The reader is invited to read the original article by Mahomed et al.[3] and my critique article,[4] and to be the judge. In this response, I will briefly address the following main themes: (i) the issue of ownership of human biological material; (ii) profitsharing by research participants; and (iii) terminology.

The issue of ownership of human biological material

Our law provides that human biological material cannot be owned,[5,6] with the exception of gametes and embryos in vitro.[7] However, Mahomed et al. persist in their argument that there are no firm rules, and that each situation will have to be determined on its own facts. In support of their argument that there is uncertainty regarding ownership of human biological material, Mahomed et al. in their response article refer extensively to foreign case law. However, cases in foreign jurisdictions do not change South African (SA) law, or make SA law uncertain. Accordingly, the argument made by Mahomed et al. that there is uncertainty regarding ownership of human biological material, and that such uncertainty calls for legislative amendment, does not hold water. Ownership is a species of proprietary rights. In both their ginal article and their response article, Mahomed et al. use ori the concept ‘proprietary right’ interchangeably with ‘proprietary interest’. This is incorrect and confusing, as a ‘right’ is not the same as an ‘interest’ in our law. In their original article, Mahomed et al. propose the following definition of ‘proprietary rights’: ‘Proprietary rights are property rights of an owner of proprietary information

that may be protected under law.’ In a footnote reference, they rely on BusinessDictionary.com as the source of this definition of ‘proprietary rights’. The BusinessDictionary.com definition is manifestly incorrect. In our law, proprietary rights encompass not only rights that have information as object, but a whole array of rights that have a patrimonial element, such as personal rights to performance in terms of a contract, and real rights in tangible objects. In their response article, Mahomed et al. express the opinion that there is ‘confusion’ among ‘researchers and academics working in the field’ regarding ownership of human biological material and a series of other legal concepts. The two sources cited for such purported ‘confusion’ are articles co-authored by inter alia Pepper and NöthlingSlabbert on the application of the concept ‘genomic sovereignty’ to human biological material. In this context, Pepper and NöthlingSlabbert indeed express the opinion that there is confusion in the law. However, self-referencing to one’s own opinion regarding the state of the law cannot logically be generalised to ‘confusion’ among ‘researchers and academics working in the field’.

Profit-sharing by research participants

Our law upholds an altruistic paradigm for participation in research and outlaws any form of remuneration of the research participant over and above reimbursement for reasonable expenses.[8] In their original article, Mahomed et al. clearly challenge the altruistic paradigm and propose profit-sharing by research participants. For instance, they state as follows: ‘This [a proprietary interest vested in the research participant] would ensure that the proceeds of any therapy developed from the tissues [biological material] would be distributed, in part, to the subject [research participant]. A mandatory agreement stipulating the terms and conditions of such distribution should be required.’ (My emphases.) I concluded my critique article by suggesting that there is a broad array of ethical and legal ramifications that must be considered if the altruistic paradigm is to be replaced with a new paradigm of benefit-

March 2017, Print edition

IN PRACTICE

sharing (which includes profit-sharing) by research participants. Despite having the opportunity to respond, Mahomed et al. failed to address any of these ethical and legal ramifications. In my critique article, I also highlighted the absence of a convincing rationale for replacing the altruistic paradigm with a paradigm of benefit-sharing. Again, despite having the opportunity to respond, Mahomed et al. failed to attempt to make a case for the paradigm change that they advocate in their original article. Instead of picking up the gauntlet and defending their proposal of profit-sharing, Mahomed et al. attempt to avoid the issue by denying that they proposed that the current altruistic paradigm be replaced with profit-sharing by research participants. However, paradoxically, in the same paragraph of their response article they propose that research participants be afforded a ‘proprietary interest’ in the human biological material that they contribute to research, in order to ensure that the ‘proceeds’ of any therapy that is developed through such research would be ‘distributed, in part, to the participants’. The distribution of proceeds from commercial research to research participants is plainly a mode of profit-sharing, and a clear departure from the altruistic paradigm of SA’s current healthcare policy. Yet, again paradoxically, Mahomed et al. in their response article maintain that it was never their intention to challenge current healthcare policy. These self-contradictory avoidance attempts employed by Mahomed et al. frustrate proper discourse on the subject. Lastly, Mahomed et al. still fail to give an accurate representation of Truog et al.[9] In their original article, they state that ‘Truog et al. have suggested that there are three distinct obligations that an investigator who seeks access to tissue might have towards an individual whose tissues, upon removal from the body, might have value for biomedical research. These include … rights to revenue streams.’ (My emphases.) In their response article, Mahomed et al. state as follows: ‘The fact that Truog et al. do not specifically advocate a profit-sharing model is not a point that the authors of the original article were trying to make.’ In fact, Truog et al.[9] specifically argue against profit-sharing by research participants. The reader is invited to read the comprehensive arguments by Truog et al. against profit-sharing.

Terminology

In their original article, Mahomed et al. use the terms ‘donor’ and ‘subject’. In my critique article, I suggested that the term ‘research participant’ is preferable to ‘donor’, given that ‘donor’ has a legaltechnical meaning that implies ownership; in contrast, the term ‘research participant’ is not shackled by a similar implication, and is sufficiently broad to include participation in activities that go beyond allowing biological material to be withdrawn and used in research, but that are also integral to the research project. In their response article, Mahomed et al. appear to adopt my suggestion of rather employing the term ‘participant’.

The definition of ‘research participant’ that I proposed in my critique article is based on the first edition of the health ethics guidelines[10] by the Department of Health. In their response article, Mahomed et al. point out that a second edition of the health ethics guidelines[11] has since been published, and express the opinion that my reference to the first edition’s definition is incorrect. While a second edition of the health ethics guidelines has indeed been published, it uses the terms ‘donor’ and ‘research participant’ interchangeably, and fails to provide a definition of ‘research participant’. Given this omission in the second edition, I suggest that it is reasonable to rely on the definition provided in the first edition, as I did. Accordingly, there is no merit in the opinion of Mahomed et al. that my reference to the first edition’s definition is ‘incorrect’. They fail to provide any detail as to why they take issue with the definition of ‘research participant’ that I proposed.

Conclusion

Social justice in the context of research using human biological material is an important contemporary legal-ethical issue. The stated purpose of my critique article was to stimulate debate on this important issue. Academic discourse on this issue would have been assisted had Mahomed et al. in their response article attempted to appreciate and answer the main points that I made in my critique article. Rather, they attacked my critique article with vague rhetoric and contradicted themselves in an attempt to avoid defending their proposal of profit-sharing. Furthermore, they persisted with legal errors, and relied on self-referencing to aver ‘confusion’ about ownership of human biological material where there are in fact wellestablished rules. Accordingly, I suggest that the ‘legal conundrum’ regarding the ownership of human biological material that Mahomed et al. proclaim is sensationalist and not real. 1. Mahomed S, Nöthling-Slabbert M, Pepper MS. Social justice and research using human biological material: A right to respond. S Afr Med J 2016;106(9):841-841. http://dx.doi.org/10.7196/SAMJ.2016. v106i9.11379 2. Mahomed S, Nöthling-Slabbert M, Pepper MS. Ownership and human tissue – the legal conundrum: A response to Jordaan’s critique. S Afr Med J 2017;107(3):196-198. http://dx.doi.org/10.7196/ SAMJ.2017.v107i3.12062 3. Mahomed S, Nöthling-Slabbert M, Pepper MS. The legal position on the classification of human tissue in South Africa: Can tissues be owned? S Afr J Bioethics Law 2013;6(1):16-20. http://dx.doi. org/10.7196/SAJBL.258 4. Jordaan DW. Social justice and research using human biological material: A response to Mahomed, Nöthling-Slabbert and Pepper. S Afr Med J 2016;106(7):678-680. http://dx.doi.org/10.7196/SAMJ.2016. v106i7.10552. 5. Grotius. Inleidinge tot de Hollandsche Rechts-Geleerdheid. 2.1.3. 6. Digesta 9.2.13 pr. 7. South Africa. National Health Act 61 of 2003. Regulations: Relating to Artificial Fertilisation of Persons. Government Gazette No. 35099, 2012 (published under Government Notice R175). 8. South Africa. National Health Act 61 of 2003. Regulations: Relating to the use of Human Biological Material. Government Gazette No. 35099, 2012 (published under Government Notice R177). 9. Truog RD, Kesselheim AS, Joffe S. Paying tissue donors: The legacy of Henrietta Lacks. Science 2012;337(6090):37-38. http://dx.doi.org/10.1126/science.1216888 10. National Department of Health, South Africa. Ethics in Health Research: Principles, Structures and Processes. Pretoria: NDoH, 2004. 11. National Department of Health, South Africa. Ethics in Health Research: Principles, Processes and Structures. Pretoria: NDoH, 2015.

Accepted 23 January 2017.

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

RESEARCH

Antibiotic resistance patterns and beta-lactamase identification in Escherichia coli isolated from young children in rural Limpopo Province, South Africa: The MAL-ED cohort A S DeFrancesco,1,2 BSc, MA; N F Tanih,2,3 PhD; A Samie,2 PhD; R L Guerrant,4 MD; P O Bessong,2 PhD, MSc epartment of Molecular and Cellular Biology, Harvard University, Cambridge, Mass., USA D HIV/AIDS & Global Health Research Programme, Department of Microbiology, School of Mathematical and Natural Sciences, University of Venda, Thohoyandou, Limpopo, South Africa 3 Present address: Medical Research Council Unit, Fajara, The Gambia 4 Division of Infectious Diseases and International Health, University of Virginia, Charlottesville, Va., USA 1 2

Corresponding author: P O Bessong (bessong@univen.ac.za) Background. Antibiotic resistance is a growing problem worldwide. Mechanisms of resistance vary, and some can confer resistance to multiple classes of antibiotics. Objective. To characterise the antibiotic resistance profiles of Escherichia coli isolates obtained from stool samples of young rural children exposed or unexposed to antibiotics. Methodology. The samples were collected from children aged 4 - 12 months who were participants in the Etiology, Risk Factors, and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Development (MAL-ED) project at the South Africa research site. We isolated 87 E. coli samples (clones) from 65 individual participants, all of which were subjected to disc diffusion assay to determine resistance. We characterised the minimum inhibitory concentration of antibiotics in a subset of strains as well as the mechanism by which these strains were resistant to beta-lactam antibiotics. Results. Our results revealed high resistance rates to co-trimoxazole (54.0%), penicillin (47.1%) and tetracycline (44.8%) in our isolates, and indicated that the beta-lactamase TEM-1 is a prevalent source of beta-lactam resistance. We also identified two isolates with the extendedspectrum beta-lactamase CTX-M-14. Conclusions. This study identified antibiotic-resistant E. coli in children with and without prior exposure to antibiotics, with some isolates showing resistance to multiple classes of antibiotics. Clinicians should bear in mind that transmission of extended-spectrum betalactamase-resistant E. coli exists at the community level, and that children as young as 2 years may be harbouring these resistant phenotypes. S Afr Med J 2017;107(3):205-214. DOI:10.7196/SAMJ.2017.v107i3.12111

The problem of antibiotic resistance is not a new one. Multiple drug resistance in Escherichia coli was first observed in the 1950s. Transfer of resistance between species had also been observed by this time.[1] There has been evidence for the transfer of resistance genes between members of the human microbiota, as well as from livestock-associated bacteria to human-associated bacteria.[2] The presence of antimicrobial resistance genes even in non-pathogenic isolates therefore represents a problem, as these genes can easily be transferred to a pathogen. Children acquire bacteria from their mother during birth,[3,4] and their gut microbiomes then undergo maturation during the first 3 years of life.[5] The early colonisation and development of this dynamic environment may predispose individuals to differences in disease incidence and outcomes. Considering that intestinal infectious diseases are the leading cause of death in children aged <14 years in Limpopo Province, South Africa (SA),[6] and that resistance genes can be geographically distinct, identification and monitoring of resistance mechanisms is important in order to foster appropriate treatment regimens. We therefore decided to focus on community isolates from children as opposed to clinical isolates, which are often the source of strains in studies focused on resistant organisms.

The Etiology, Risk Factors, and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Development (MAL-ED) project was designed to look for correlations between factors present during childhood in developing regions, focusing on the relationship between enteric pathogen presence and growth and development outcomes. Each participant in MALED had stool samples taken on at least a monthly basis from birth until age 2 years, and information on health events such as the incidence of diarrhoea and exposure to antibiotics was collected. In addition, developmental milestone data for each participant were recorded, such as height, weight and cognitive ability. This rich data set allowed us to consider which antibiotics were most relevant to the community, as we had details of exposure for all the study participants (supplementary Table 1: Appendix 1, available in the online version of this article). Penicillin-class antibiotics are the most frequently administered, so resistance to this class would be most detrimental to health outcomes; we therefore determined that betalactamase genes would be an appropriate area of focus.

Objective

To present data on E. coli strains isolated from stool samples collected as part of the MAL-ED study. The children from whom the strains

March 2017, Print edition

RESEARCH

were isolated ranged in age from 4 to 12 months and had varying histories in terms of antibiotic exposure and diarrhoeal events. The antibiotic susceptibilities of the isolates were characterised, along with their minimum inhibitory concentrations (MICs) and identification of some of the beta-lactamase genes responsible. For beta-lactamresistant isolates, we tested for variants of several narrow-spectrum beta-lactamases (TEM, SHV and OXA), as well as some variants of the CTX-M extended-spectrum beta-lactamase (ESBL) type.

Methods

Ethical considerations

The study protocol was approved by the Research Ethics Committee of the University of Venda, SA (ref. no. SMNS/09/MBY/004). Permission was obtained from the Department of Health, Limpopo Province (ref. no. 4/2/2), SA. Signed informed consent was obtained from the parents or legal guardians of all study subjects prior to enrolment and sample collection.

Strain isolation and growth

E. coli strains were isolated from stool samples collected as part of the MAL-ED study, and in addition E. coli ATCC 25922 (Microbiologics, USA) was maintained as a control strain. Initial isolation of lactose fermenters (pink colonies) was performed on MacConkey agar (Neogen, USA), followed by screening on EMB agar (Neogen, USA), on which E. coli produce a characteristic green sheen. In total, 87 strains were isolated from 65 study participants. Cultures were maintained in nutrient broth (Oxoid, UK) or on nutrient agar (Neogen, USA) at 37°C.

Antibiotic susceptibility testing

Antibiotic susceptibility testing was performed using the disc diffusion assay.[7] Briefly, colonies were resuspended in sterile saline to a McFarland standard of 0.5, and were uniformly spread on MuellerHinton agar (Mast Diagnostics, UK) using sterile cotton swabs. Antibiotic discs (Mast Diagnostics, UK) were dispensed using the Discmaster 3 Dispenser (Mast Diagnostics, UK), and plates were incubated overnight at 37°C. Zones of inhibition were then measured against a black, non-reflecting background. E. coli ATCC 25922 was utilised as a control strain to ensure that zones of inhibition were within an appropriate range, according to Clinical and Laboratory Standards Institute (CLSI) standards.[7] The CLSI zone diameter interpretive criteria for Enterobacteriaceae were used for interpretation of all antibiotic inhibitory zones except those of the macrolides. For azithromycin, a zone ≤13 mm was considered to indicate resistance, a zone of 14 - 17 mm was considered the intermediate range, and a zone ≥18 mm was considered to indicate sensitivity.

Detection and identification of beta-lactamases

Multiplex polymerase chain reactions (PCRs) for detection of betalactamase genes were designed by Dallenne et al.[8] The first multiplex PCR amplified blaTEM/blaSHV/blaOXA-1-like genes using the follow ing primers: MultiTSO-T_for CATTTCCGTGTCGCCCTTATTC (0.4 µM)/MultiTSO-T_rev CGTTCATCCATAGTTGCCTGAC (0.4 µM) – product size 800 bp, MultiTSO-S_for AGCCGCTTGAGCAAATTAAAC (0.4 µM)/MultiTSO-S_rev ATCCCGCAGATAAATCACCAC (0.4 µM) – product size 713 bp, and MultiTSO-O_for GGCACCAGATTCAACTTTCAAG (0.4 µM)/ MultiTSO-O_rev GACCCCAAGTTTCCTGTAAGTG (0.4 µM) – product size 564 bp. The second amplified blaCTX-M phylogenetic groups 1, 2 and 9 using the following primers: MultiCTXMGp1_for TTAGGAARTGTGCCGCTGYA (0.4 µM)/MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCAT (0.2 µM) – product size 688

bp, MultiCTXMGp2_for CGTTAACGGCACGATGAC (0.2 µM)/MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCAT (0.2 µM) – product size 404 bp, and MultiCTXMGp9_for TCAAGCCTGCCGATCTGGT (0.4 µM)/MultiCTXMGp9_rev TGATTCTCGCCGCTGAAG (0.4 µM) – product size 561 bp. PCRs were performed in duplicate, one replicate using DNA isolated with the GeneJET Plasmid Miniprep Kit (Thermo Scientific, USA) and one using colonies resuspended in 100 µL of water and subjected to heating at 95ºC for 10 minutes. PCRs were performed using DreamTaq Green Master Mix (Thermo Scientific, USA) in 50 µL reactions, using the primer concentrations specified above. The amplification reaction was performed as in Dallenne et al.:[8] 94°C for 10 minutes; [94°C for 40 seconds, 60°C for 40 seconds and 72°C for 1 minute] × 30 cycles; 72°C for 7 minutes. Amplified beta-lactamase genes were visualised under ultraviolet light following separation on a 2% agarose gel containing ethidium bromide, along with a GeneRuler 100 bp Plus ladder (Thermo Scientific, USA). Products were purified using the GeneJET PCR Purification Kit (Thermo Scientific, USA) and sent for sequencing (Inqaba Biotec, SA). Sequencing results were analysed using Geneious 7 (http:// www.geneious.com), and the data were searched using the NCBI Nucleotide BLAST Megablast tool (http://blast.ncbi.nlm.nih.gov/), optimised for highly similar sequences.

Minimum inhibitory concentrations

MICs were determined using MIC Test Strips (Liofilchem, Italy). Antimicrobial susceptibility testing was performed according to the manufacturer’s guidelines. Briefly, colonies of each strain were suspended in sterile saline solution to achieve a 0.5 McFarland standard turbidity level, and were uniformly spread on MuellerHinton agar (Mast Diagnostics, UK) using sterile cotton swabs. Once the agar surface was completely dry, an MIC test strip was applied to each plate with sterile forceps and the plates were incubated at 37°C for 18 - 24 hours. The MIC was read where inhibition of growth intersected the strip.

Results

Antibiotic susceptibility of isolates

Each E. coli clone was tested for susceptibility to 13 antibiotics or combination therapies using the disc diffusion method.[7] Results of testing are shown in Table 1. The highest incidence of resistance was to the trimethoprim-sulfamethoxazole combination antibiotic (co-trimoxazole), with 54.0% of isolates showing resistance. The second highest incidence of resistance was towards penicillin-class antibiotics, with 47.1% of isolates showing resistance to ampicillin and amoxicillin. Much of this resistance appeared to be reversed by the inclusion of a beta-lactamase inhibitor, clavulanic acid. We did not observe resistance to several antibiotics including imipenem, ciprofloxacin, and both aminoglycosides tested. Although not typically included in Gramnegative susceptibility studies owing to their inefficient penetration of the cell wall,[9] a macrolide antibiotic was tested, as E. coli has been shown to be a potential reservoir for macrolide resistance genes.[10] The azithromycin results are reported in Table 1, and indicate that ~20% of isolates show some enhanced resistance to this class. Isolates showing no resistance were most abundant (n=29), whereas the second-largest subset of isolates (n=24) showed resistance to three antibiotics, indicating that resistance to more than one antibiotic is more common than resistance to one (n=14 isolates) or two (n=7). Additional information detailing which resistances were observed in which clones can be found in supplementary Table 2 (Appendix 2, available in the online version of this article).

March 2017, Print edition

RESEARCH

Table 1. Results of disc diffusion tests for antimicrobial resistance Class of antibiotic

Antibiotic (μg*)

Resistant, n (%)†

Intermediate, n (%)†

Sensitive, n (%)†

Penicillins

Ampicillin (10) or amoxicillin (10)‡

41 (47.1)

46 (52.9)

Amoxicillin (20) + clavulanic acid (10)

1 (1.2)

85 (97.7)

Cephalosporins

Cefotaxime (30)

2 (2.3)

85 (97.7)

Carbapenems

Imipenem (10)

87 (100)

Quinolones

Nalidixic acid (30)

5 (5.7)

4 (4.6)

78 (89.7)

Fluoroquinolones

Ciprofloxacin (5)

87 (100)

Folate pathway inhibitor/ sulfonamides

Trimethoprim (1.25) + sulfamethoxazole (23.75)

47 (54.0)

40 (46.0)

Phenicols

Chloramphenicol (30)

9 (10.3)

78 (89.7)

Tetracyclines

Tetracycline (30)

39 (44.8)

48 (55.2)

Aminoglycosides Macrolides

Gentamicin (10)

87 (100)

Amikacin (30)

87 (100)

Azithromycin (15)

10 (11.5)

7 (8.1)

70 (80.5)

*The mass of the antibiotic, or the mass of each component for mixtures. † Number of clones that exhibit a given phenotype, and percentage of all clones showing this phenotype. ‡ Although results of ampicillin testing can be used to predict results for amoxicillin,[7] both were included. The results for the two were identical.

Table 2. Beta-lactamases present in penicillin-resistant strains Beta-lactamase gene*

Positive clones, n (%)

TEM (includes TEM-1, TEM-2)

39 (95.1)

18/39 tested, all TEM-1

CTX-M group 9 (includes CTX-M-9 and CTX-M-14)

2 (4.9)

2/2 tested, both CTX-M-14

Gene identity

*Other beta-lactamases tested but not identified in these samples include variants of SHV, OXA, and CTX-M groups 1 and 2.

Presence and identity of beta-lactamase genes

All strains resistant to penicillins were subjected to multiplex PCR amplification to determine which beta-lactamases were present. The multiplex PCRs, originally designed by Dallenne et al.,[8] can identify the presence of certain TEM, SHV, OXA and CTX-M variants. TEM, SHV and OXA are narrow-spectrum beta-lactamases, whereas CTX-M is an ESBL. The 41 strains tested included one isolate with resistance to the combination treatment of amoxicillin + clavulanic acid. Results of multiplex PCR are shown in Table 2. A subset of the PCR products were sequenced and analysed by BLAST, which revealed that both of the CTX-M group 9 beta-lactamases present were in fact CTX-M-14. As for the samples positive for TEM, products from 18 clones were sent for sequencing, which revealed that all 18 were TEM-1. This result is not surprising considering that this is the most frequently observed resistance gene in enterobacteria.[11] The sequences of the amplified regions can be found in supplementary Table 3 (Appendix 3, available in the online version of this article).

Minimum inhibitory concentrations

MIC ranges were 0.016 - 0.094 μg/mL for ciprofloxacin, 0.125 4.0 μg/mL for imipenem, 0.38 - 2 μg/mL for gentamicin, 1.5 - 3 μg/ mL for amikacin, 1.0 - 24.0 μg/mL for amoxicillin + clavulanic

acid, 1.5 - 32 μg/mL for azithromycin, 0.047 - 0.125 μg/mL for cefotaxime, 4.0 - 48 μg/mL for chloramphenicol and 0.125 - 24.0 μg/ mL for nalidixic acid (Table 3). Some MIC values outside the test range were observed for a subset of strains tested when exposed to chloramphenicol and nalidixic acid. Strains showing resistance phenotypes to beta-lactam antibiotics were subjected to multiplex PCR to determine the presence of specific beta-lactamase genes. A subset of these products was sequenced, allowing identification of the specific beta-lactamase gene using BLAST.

Discussion and conclusion

When deciding which antibiotics to test in the disc diffusion assays, we considered the most frequently used antibiotics in the SA site MAL-ED participant group (supplementary Table 1). This provided useful information on the local clinical usage of various classes of antibiotics, with the penicillin class being most common, followed by sulfonamides, macrolides and others. With penicillin-class antibiotics being most commonly employed in treatment of illness, resistance to this class would have the most negative impact, so we chose to focus on resistance mechanisms to this class. Penicillin resistance was in fact the second most prevalent in our study, after co-trimoxazole resistance, which is a worrying trend considering the common use of penicillin in the management of bacterial infections. Multidrug resistance is resistance to multiple classes of antibiotics. Of the 87 isolates tested, 2 showed resistance to five antibiotics (ampicillin/amoxicillin, co-trimoxazole, chloramphenicol, tetra cycline and nalidixic acid) and 11 showed resistance to four antibiotics. Interestingly, the two most multidrug-resistant isolates were from individuals with no reported exposure to antibiotics. The two strains that harbour the CTX-M-14 resistance gene both show resistance to three antibiotics: cefotaxime, ampicillin/amoxicillin and tetracycline. Although antibiotic exposure increases the selective pressure for organisms to develop and maintain antibiotic-resistant elements, the presence of resistance genes apparently does not necessarily correlate with prior exposure to antimicrobial agents.

March 2017, Print edition

RESEARCH

Table 3. MIC (μg/mL) of different antibiotics against E. coli clones Clone no.

CIP

IMI

AUG

AZM

CTX

0.023

0.5

0.75

256

0.047

0.023

0.19

0.75

0.094

0.023

0.125

0.75

1.5

0.064

0.094

0.38

0.5

0.047

102

0.023

0.25

0.75

256

0.094

111

0.023

0.25

0.5

0.094

112

0.016

0.094

256

115

0.019

0.75

0.064

256

116.1

0.023

0.19

0.75

1.5

0.064

116.2

0.023

0.19

0.75

1.5

0.094

120

0.016

0.25

1.5

256

0.125

121

0.023

0.75

0.047

127

0.023

0.75

0.094

130

0.023

0.047

131

0.094

0.75

0.125

132

0.023

0.75

0.064

133

0.023

0.25

0.75

0.064

138

0.023

0.38

0.75

0.064

140

0.023

0.75

0.094

141

0.023

0.25

0.75

1.5

0.094

145

0.023

0.25

0.75

0.047

151

0.023

0.19

0.75

0.064

158.1

0.032

0.5

0.094

158.2

0.047

0.75

0.094

159

0.023

1.5

0.75

0.064

163

0.012

0.25

1.5

0.064

167

0.023

1.5

256

0.125

172

0.023

0.38

0.75

0.064

173

0.016

1.5

256

0.125

181

0.016

0.38

0.75

1.5

0.125

CIP = ciprofloxacin; IMI = imipenem; CN = gentamicin; AK = amikacin; AUG = amoxicillin + clavulanic acid; AZM = azithromycin; CTX = cefotaxime; C = chloramphenicol; NA= nalidixic acid.

To characterise the range of MICs for our isolates, a subset was tested using MIC test strips. Results for amikacin, amoxicillin + clavulanic acid, chloramphenicol, cipro floxacin, cefotaxime, gentamicin and nalidixic acid were all consistent with the disc diffusion assay results. For imipenem, ~16% of the MIC results indicated resistance where the disc diffusion assay had not indicated this, as did ~7% for azithromycin. This indicates that the proportion of resistant isolates may actually be higher than we reported. There was also one azithromycin test that showed resistance in the disc diffusion and sensitivity in the MIC testing.

Some participants in the MAL-ED study went on to develop severe acute mal nutrition. Treatment for this condition often involves administration of antibiotics, as recommended by the W orld Health Organization (WHO); however, there is no strong evidence that this is the best course of action.[12] Considering our evidence that even without antibiotic exposure, children at risk of malnutrition often harbour resistance genes, it seems that the introduction of additional selective pressure could actually contribute to ill health rather than recovery. A 2014 study[13] found that the diversity of antibiotic resistance genes in the human

March 2017, Print edition

gut microbiota appears to increase with age, although they did not look at individuals <3 years of age. This would indicate that even without antibiotic administration, the burden of resistance would increase over time. The diversity of beta-lactamases is high, and many novel variants are reported year after year. In the early 1990s there were fewer than 150 known beta-lactamases, and by 2009, over 890 unique beta-lactamase sequences had been identified.[14] New enzymes often emerge in isolated areas and go on to expand their host range and also their geographical range. TEM-1, which we observed in a majority of penicillinresistant isolates, is the most commonly found secondary beta-lactamase in ampi cillin-resistant E. coli,[11] with much greater prevalence than TEM-2, SHV and OXA-1 (the other narrow-spectrum beta-lactamases that we tested for).[15] ESBLs are betalactamases with enhanced activity against cephalosporins, early examples of which were similar to TEM and SHV. The CTXM-type ESBL was first observed in the late 1980s, and is not TEM- or SHV-derived.[16] Although previous studies in SA found examples of multiple ESBLs being produced by clinical isolates,[17-20] the first report of CTX-M-type ESBLs was not until 2003, where CTX-M-2 and CTX-M-3 were found in Klebsiella pneumoniae.[21] Since then, other CTX-M types have been found in SA, including CTX-M-14, CTX-M-15 and CTX-M-37.[22-25] The WHO reports that in the African Region there are insufficient data concerning antibiotic resistance,[26] so additional reports such as this are important in this regard. The data presented are limited to the MAL-ED SA Dzimauli community study site of Limpopo Province.[27] However, our identification of the CTX-M-14 ESBL in community E. coli isolates, even in young children who have not received antibiotics, adds to the greater picture of the antibiotic resistance landscape in SA and in the African Region. The prescribing patterns of antibiotics, either through excessive use or through sub-therapeutic doses, in addition to the use of antibiotics in animal production, are factors known to contribute to the development and spread of antibiotic resis tance at community level. Our finding has clinical relevance. Firstly, it adds to the body of evidence on the spread of antibiotic resistance in rural communities, and secon dly, it supports the increasing need for a reduction in the frequency of empirically prescribing antibiotics, a common practice

RESEARCH

in communities without diagnostic laboratory support. Discouraging empirical prescription has been proposed in the SA national approach to ‘antibiotic stewardship’.[28] In conclusion, clinicians and public health practitioners should bear in mind that transmission of ESBL-resistant E. coli exists at the community level and that children as young as 2 years, even without prior exposure to antibiotics, may be harbouring these resistant phenotypes, an awareness that should guide prescription practices. Acknowledgements. The authors thank the staff and participants of the MAL-ED network for their important contributions. MAL-ED is carried out as a collaborative project supported by the Bill & Melinda Gates Foundation, the Foundation for the National Institutes of Health and the National Institutes of Health, Fogarty International Center. Funding for ASD was provided by the NSF GROW with USAID programme. NFT was supported by award no. D43 TW009359 from the Fogarty International Center/National Institutes of Health. Disclaimer. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health, the Foundation for the National Institutes of Health or the Bill & Melinda Gates Foundation. Study sponsors were not involved in the study design, collection, analysis or interpretation of data, writing of the manuscript, or the decision to submit the manuscript for publication. Author contributions. POB, RLG and ASD conceived and designed the study, ASD and NFT carried out laboratory analysis, and ASD analysed the data and prepared the first draft. All authors made significant intellectual contributions in finalising the manuscript, and read and approved the final version for submission. 1. Watanabe T. Infective heredity of multiple drug resistance in bacteria. Bacteriol Rev 1963;27(1):87-115. http://dx.doi.org/10.1101/sqb.1953.018.01.037 2. Smillie CS, Smith MB, Friedman J, Cordero OX, David LA, Alm EJ. Ecology drives a global network of gene exchange connecting the human microbiome. Nature 2011;480(7376):241-244. http://dx.doi. org/10.1038/nature10571 3. Schultz M, Gottl C, Young RJ, Iwen P, Vanderhoof JA. Administration of oral probiotic bacteria to pregnant women causes temporary infantile colonization. J Pediatr Gastroenterol Nutr 2004;38(3):293297. http://dx.doi.org/10.1097/00005176-200403000-00012 4. Dominguez-Bello MG, Costello EK, Contreras M, et al. Delivery mode shapes the acquisition and structure of the initial microbiota across multiple body habitats in newborns. Proc Natl Acad Sci U S A 2010;107(26):11971-11975. http://dx.doi.org/10.1073/pnas.1002601107 5. Yatsunenko T, Rey FE, Manary MJ, et al. Human gut microbiome viewed across age and geography. Nature 2012;486(7402):222-227. http://dx.doi.org/10.1038/nature11053 6. Statistics South Africa. Mortality and Causes of Death in South Africa, 2013: Findings from Death Notification. Pretoria: Statistics South Africa, 2014. 7. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: 22nd Informational Supplement. CLSI document M100-S22. Wayne, Penn.: CLSI, 2012.

8. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J Antimicrob Chemother 2010;65(3):490-495. http://dx.doi.org/10.1093/jac/dkp498 9. Vaara M. Outer membrane permeability barrier to azithromycin, clarithromycin, and roxithromycin in Gram-negative enteric bacteria. Antimicrob Agents Chemother 1993;37(2):354-356. http://dx.doi. org/10.1128/AAC.37.2.354 10. Phuc Nguyen MC, Woerther PL, Bouvet M, Andremont A, Leclercq R, Canu A. Escherichia coli as reservoir for macrolide resistance genes. Emerg Infect Dis 2009;15(10):1648-1650. http://dx.doi. org/10.3201/eid1510.090696 11. Livermore DM. Beta-lactamases in laboratory and clinical resistance. Clin Microbiol Rev 1995;8(4):557-584. 12. Alcoba G, Kerac M, Breysse S, et al. Do children with uncomplicated severe acute malnutrition need antibiotics? A systematic review and meta-analysis. PLoS One 2013;8:e53184. http://dx.doi. org/10.1371/journal.pone.0053184 13. Lu N, Hu Y, Zhu L, et al. DNA microarray analysis reveals that antibiotic resistance-gene diversity in human gut microbiota is age related. Sci Rep 2014;4:4302. http://dx.doi.org/10.1038/srep04302 14. Bush K, Jacoby GA. Updated functional classification of beta-lactamases. Antimicrob Agents Chemother 2010;54(3):969-976. http://dx.doi.org/10.1128/AAC.01009-09 15. Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: A clinical update. Clin Microbiol Rev 2005;18(4):657-686. http://dx.doi.org/10.1128/CMR.18.4.657-686.2005 16. Bonnet R. Growing group of extended-spectrum beta-lactamases: The CTX-M enzymes. Antimicrob Agents Chemother 2004;48(1):1-14. http://dx.doi.org/10.1128/AAC.48.1.1-14.2004 17. Pitout JD, Thomson KS, Hanson ND, Ehrhardt AF, Moland ES, Sanders CC. Beta-lactamases responsible for resistance to expanded-spectrum cephalosporins in Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis isolates recovered in South Africa. Antimicrob Agents Chemother 1998;42(6):1350-1354. 18. Hanson ND, Smith Moland E, Pitout JD. Enzymatic characterization of TEM-63, a TEM-type extended spectrum beta-lactamase expressed in three different genera of Enterobacteriaceae from South Africa. Diagn Microbiol Infect Dis 2001;40(4):199-201. http://dx.doi.org/10.1016/S0732-8893(01)00266-8 19. Essack SY, Hall LM, Pillay DG, McFadyen ML, Livermore DM. Complexity and diversity of Klebsiella pneumoniae strains with extended-spectrum beta-lactamases isolated in 1994 and 1996 at a teaching hospital in Durban, South Africa. Antimicrob Agents Chemother 2001;45(1):88-95. http://dx.doi. org/10.1128/AAC.45.1.88-95.2001 20. Pitout JDD, Reisbig MD, Venter EC, Church DL, Hanson ND. Modification of the double-disk test for detection of Enterobacteriaceae producing extended-spectrum and AmpC-lactamases. J Clin Microbiol 2003;41(8):3933-3935. http://dx.doi.org/10.1128/JCM.41.8.3933-3935.2003 21. Paterson DL, Hujer KM, Hujer AM, et al. Extended-spectrum beta-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries: Dominance and widespread prevalence of SHV- and CTX-M-type beta-lactamases. Antimicrob Agents Chemother 2003;47(11):3554-3560. http://dx.doi.org/10.1128/AAC.47.11.3554-3560.2003 22. Segal H, Elisha BG. Resistance to β-lactams, and reduced susceptibility to carbapenems, in clinical isolates of Klebsiella pneumoniae due to interplay between CTX-M-15 and altered outer membrane permeability. South Afr J Epidemiol Infect 2006;21(2):41-44. http://dx.doi.org/10.1080/10158782.20 06.11441262 23. Govinden U, Mocktar C, Moodley P, Sturm AW, Essack SY. CTX-M-37 in Salmonella enterica serotype Isangi from Durban, South Africa. Int J Antimicrob Agents 2006;28(4):288-291. http://dx.doi. org/10.1016/j.ijantimicag.2006.05.028 24. Usha G, Chunderika M, Prashini M, Willem SA, Yusuf ES. Characterization of extended-spectrum beta-lactamases in Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn Microbiol Infect Dis 2008;62(1):86-91. http://dx.doi.org/10.1016/j.diagmicrobio.2008.04.014 25. Peirano G, van Greune CH, Pitout JD. Characteristics of infections caused by extended-spectrum betalactamase-producing Escherichia coli from community hospitals in South Africa. Diagn Microbiol Infect Dis 2011;69(4):449-453. http://dx.doi.org/10.1016/j.diagmicrobio.2010.11.011 26. World Health Organization. Antimicrobial Resistance: Global Report on Surveillance. Geneva: WHO, 2014. 27. Bessong PO, Nyathi E, Mahopo TC, Netshandama V; MAL-ED South Africa. Development of the Dzimauli community in Vhembe District, Limpopo province of South Africa, for the MAL-ED cohort study. Clin Infect Dis 2014;59(Suppl 4):S317-S324. http://dx.doi.org/10.1093/cid/ciu418 28. Goff DA, Kullar R, Goldstein EJ, et al. A global call from five countries to collaborate in antibiotic stewardship: United we succeed, divided we might fail. Lancet Infect Dis 2016;17(2):e56-e63. http:// dx.doi.org/10.1016/S1473-3099(16)30386-3

Accepted 10 January 2017.

Appendices 1 - 3 are available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.12111

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

RESEARCH

The efficacy of intravitreal antivascular endothelial growth factor as primary treatment of retinopathy of prematurity: Experience from a tertiary hospital H Kana, MB BCh, FC Ophth; I Mayet, MB ChB, FC Ophth, FCS (Edin); D Soma, MB ChB, FC Ophth, MMed (Ophth); H Dawood Alli, MB BCh, FC Ophth, MMed (Ophth); S Biddulph, MB BCh, FC Ophth St John Eye Hospital-Chris Hani Baragwanath Academic Hospital and Department of Ophthalmology, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa Corresponding author: H Kana (dockana@gmail.com) Background. Retinopathy of prematurity (ROP) is a vasoproliferative disease affecting premature babies and a major cause of blindness in childhood. Appropriate screening and treatment can prevent blindness. Objective. To report on the efficacy of using antivascular endothelial growth factor (bevacizumab) as first-line therapy in ROP. Methods. This was a retrospective analysis of patients with ROP treated at St John Eye Hospital, Johannesburg, South Africa, over a 3-year period. Outcome measures were the clinical response to intravitreal bevacizumab (IVB) as well as the economic impact of IVB therapy. Results. Twenty-three patients were treated for active ROP or type 1 disease, in 44 eyes. Two patients required treatment in one eye only. The mean birth weight of these patients was 1 074 g (range 810 - 1 480). Response to treatment outcome was available for 22 patients (43 eyes). The mean follow-up period was 9 months (range 1 - 18). Forty-one eyes (95.3%) showed complete regression or non-progression of the disease. Two eyes (one eye each in two patients) progressed to advanced disease. There were no short-term adverse events. A cost-effective model showed that IVB treatment was much more economical than laser therapy. Conclusion. IVB is a safe and effective first-line treatment for ROP and should be considered in resource-limited centres. S Afr Med J 2017;107(3):215-218. DOI:10.7196/SAMJ.2017.v107i3.11080

Retinopathy of prematurity (ROP) is a vasoproliferative retinal disorder affecting premature, low-birth-weight infants and accounts for 10.2% of children admitted to schools for the blind in South Africa (SA).[1] The World Health Organization’s VISION 2020 mission has recognised ROP as an important and preventable cause of childhood blindness.[2] Screening and appropriate treatment are imperative in this endeavour. The findings of a multicentre trial of cryotherapy for ROP (CRYOROP)[3] have shown the benefit of treatment with cryotherapy in reducing unfavourable visual outcome by 50% in infants at risk of proliferative retinopathy. Subsequently, the Early Treatment of ROP (ETROP) study[4] showed laser ablation to be superior to cryotherapy. Laser treatment remains the gold standard in treating threshold disease in ROP. The discovery of antivascular endothelial growth factor (anti-VEGF) in the treatment of colonic cancer[5] and its subsequent use in various proliferative vascular retinal conditions such as retinal vein occlusion[6] and diabetic retinopathy[7] have led to a paradigm shift in the management of these conditions. As an extension of this, anti-VEGF (bevacizumab) therapy has been used in treating ROP, initially as an adjunct to laser therapy and subsequently as primary treatment. Several case studies have reported favourable outcomes using bevacizumab therapy.[8-10] In our hospital laser treatment, when indicated, is performed under general anaesthesia and although effective, it is time consuming and necessitates overnight observation in a high-care facility. Availability of beds in high care is often problematic. Intravitreal bevacizumab (IVB) can be administered under local anaesthesia, and high-care monitoring is not necessary.

Objective

To report our experience with the use of IVB injections as primary treatment of ROP.

Methods

This retrospective observational study analysed the efficacy of IVB in the treatment of ROP. The records of all patients with ROP who were treated with IVB injections over a 3-year period (2013 - 2015) at St John Eye Hospital, Johannesburg, SA, were reviewed. During that period, all infants were treated exclusively with IVB and none with laser photocoagulation. The hospital screens ~640 premature infants per year, using the screening guidelines recommended by the Royal College of Ophthalmology (UK) (Table 1). Indication for treatment is active disease as defined in the ETROP study[4] (Table 2). After informed consent had been obtained from the parents, all patients were given an intravitreal injection of bevacizumab (Avastin; Genentech), a monoclonal anti-VEGF antibody, as an off-label but accepted treatment method. The drug was drawn from a standard multidose vial (100 mg/4 mL ampoule). Topical anaesthesia and povidone iodine drops were instilled into the eyes before the injection. No sedation was given. An anaesthetist is always available in theatre, but was not required. A dose of 0.625 mg (0.025 mL) bevacizumab was injected with a 30-gauge insulin syringe placed 1.5 mm from the limbus, under sterile conditions. None of the patients required high-care observation, and all were discharged, home or to the referring hospital where they were being treated for other comorbidities not related to the IVB procedure, several hours after the injection.

March 2017, Print edition

RESEARCH

All patients were seen 5 days after the injection, and the follow-up period was doubled at each consecutive visit until the retina was fully vascularised (or up to 60 weeks’ gestational age if the retinopathy responded favourably). If neovascularisation was still evident, laser treatment was given. Outcome measures were complete regression of the proliferative phase and complete vascularisation of the retina. A cost-effectiveness model was used to compare the cost of laser therapy with IVB. The cost was extrapolated from charges in a private hospital for the two procedures as well as current medical rates for follow-up visits. Public health sector costing was not possible. The preoperative preparation, intraoperative time and equipment used, postoperative need for high-care observation and length of follow-up were all calculated for the two groups. Results were entered onto an Excel spreadsheet (2011, Microsoft, USA). Descriptive statistics were used for demographics. Table 1. Screening criteria for ROP Who to screen: All neonates born <32 weeks’ gestation All preterm neonates weighing <1 500 g When to screen: t 6 weeks’ chronological age or 31 - 33 weeks’ post-conceptual A age (whichever comes later) I f gestational age is inaccurate, neonates <28 weeks’ postconceptual age should be screened 6 weeks after birth and neonates >28 weeks’ post-conceptual age should be screened 4 weeks after birth

Ethics approval was obtained from the Hospital Advisory Board (no reference number) and the Human Research Ethics Committee of the University of the Witwatersrand, Johannesburg (ref. no. M160306).

Results

Of 1 911 patients screened over the study period, 23 (1.2%) required treatment (Table 3). A total of 44 eyes received IVB injections, two patients requiring injections in only one eye. None of the infants required repeat injections for recurrences. The mean birth weight was 1 074 g (range 810 - 1 480) and the mean gestational age 28 weeks (range 26 - 32). Only two infants had birth weights of >1 250 g. There were 13 males and 10 females. Fourteen eyes had threshold disease and 28 had pre-threshold disease with plus disease (Table 3). Eighteen eyes had zone 1 disease and 26 had zone 2 disease requiring treatment. The outcome of treatment was available for 22 patients (43 eyes); patient 10, with unilateral disease, defaulted (Table 3). Forty-one (95.3%) of 43 eyes showed complete regression or non-progression of ROP. Two patients (two eyes) showed progression, patient 11 in one eye and patient 5 with unilateral disease (Table 3). Both developed retinal detachment within 1 week after injection. None of the infants required laser intervention. No short-term adverse events were noted during a mean follow-up of 9 months (range 1 - 18). When considering the economic aspects of treating patients with IVB compared with laser ablation, the cost of the injection was ZAR12 529.83 (with the potential maximum number of visits) and the cost of laser therapy was ZAR25 916.03 (Table 4). The difference was mainly due to theatre time and the need for overnight high-care monitoring associated with laser treatment. IVB-treated neonates require more follow-up visits.

Table 2. Indications to treat ROP (based on international classification of ROP) Stage of ROP

Zone

Plus disease

CRYO-ROP criteria[3] (threshold disease)

3 (new vessels in 5 contiguous or 8 non-contiguous clock hours)

1 or 2

Present

ETROP criteria[4] (type 1 ROP – pre-threshold disease)

Any

Present

Present or absent

2 or 3

Present

Table 3. Patient details

Patient no.

Sex

Birth weight (g)

810

Zone 1 stage 3 with plus

1 480

910

5 (unilateral)

Gestational age (wk)

Stage at presentation, OD

Stage at presentation, OS

Response to IVB

Follow-up (mo)

Vasularised

Zone 1 stage 3 with plus

Yes

Yes, within 3 mo

Zone 1 threshold with plus

Yes

Yes, within 3 mo

Zone 1 stage 3 with plus

Yes

Yes, within 2 mo

Zone 2 stage 3 with plus

Zone 2 stage 3 threshold with plus

Yes

Improved but still not vascularised at last follow-up

960

Zone 2 stage 1, no plus

Zone 1 stage 3 with plus

No, OS total retinal detachment within 1 wk (Rush disease)

Continued ...

March 2017, Print edition

RESEARCH

Table 3. (continued) Patient details

Patient no.

Sex

Birth weight (g)

1 100

Zone 2 stage 3 with plus

1 250

1 160

10 (unilateral)

Gestational age (wk)

Stage at presentation, OD

Stage at presentation, OS

Response to IVB

Follow-up (mo)

Vasularised

Zone 1 stage 3 with plus

Yes

Yes, within 3 mo

Zone 1 stage 3 with plus

Zone 1 threshold with plus

Yes

Yes, within 4 mo

Zone 1 stage 3 with plus

Yes

Yes, within 2 mo

840

Zone 2 stage 2 with plus

Zone 1 stage 3 threshold with plus

Yes

Lost to follow-up

885

Zone 2 threshold with plus

Zone 2 stage 2, no plus

Given OD only, lost to follow-up

Lost to follow-up

1 340

Zone 1 stage 3 threshold with plus

Zone 2 stage 3 with plus

OD yes/OS Rush disease stage 4b

OD yes

875

Zone 2 stage 3 with plus

Yes

Yes, within 3 mo

1 390

Zone 1 stage 3 with plus

Yes

No, lost to followup

1 040

Zone 1 stage 3 with plus

Yes

No, demarcation line peripheral zone 2

1 250

Zone 2 stage 3 with plus

Zone 2 stage 1, no plus

Yes

Yes, within 2 mo

1 085

Zone 2 stage 3 with plus

Yes

Yes, within 2 mo

1 195

Zone 2 stage 3 threshold with plus

Yes

Yes, within 3 mo

1 200

Zone 2 stage 3 with plus

Yes

Yes, within 1 mo

840

Zone 2 stage 3 with plus

Zone 2 stage 3 with pre-plus

Yes

No, lost to followup

825

Zone 2 stage 3 with plus

Yes

Yes, within 1 mo

1 180

Zone 2 stage 3 threshold with plus

Zone 2 stage 3 threshold with plus and vitreous haemorrhage

Yes

Lost to followup (followed up elsewhere)

829

Zone 2 threshold with plus

Yes

Yes, within 4 mo

1 190

Zone 2 stage 3 with plus

Zone 2 stage 3 threshold with plus

Yes

No, not vascularised at last follow-up

M = male; F = female; OD = right eye; OS = left eye.

March 2017, Print edition

RESEARCH

Table 4. Cost analysis comparing laser therapy with IVB (ZAR) Laser

IVB

Theatre fee

16 182.00 (1.5 h)

1 798.00 (10 min)

Medical stock

7 281.90

1 231.83

Neonatal high care

7 452.13

Laser hire fee

1 500.00

Cost of bevacizumab

1 000.00

Follow-up visits (ZAR700.00/visit)

3 500.00 (average 5 visits)

8 400.00 (average 12 visits)

Total

25 916.03

12 529.83

Discussion

Study limitations

Limitations of the study are its retrospective nature and the lack of fluorescein angiography to document full vascularisation, as well as loss to follow-up of 2 patients.

Our findings highlight several important issues regarding ROP in SA. Our study confirms previous findings that the incidence of severe ROP is low and that the current criteria of screening babies with a birth weight of <1 500 g are valid.[11] Notwithstanding the potential risk factors, screening heavier babies would place an unnecessary burden on the limited pool of ophthalmologists screening for ROP. Laser ablation is still the mainstay of treatment. The ETROP study showed the advantage of treating high-risk infants earlier with laser, reducing the risk of an unfavourable outcome from 15.6% to 9% compared with the initial CRYO-ROP recommendations.[12] While laser therapy has been the treatment of choice for a number of years in our institution, every treatment event has a huge impact on our regular theatre list. A senior anaesthetist is needed, the procedure is time consuming, a special ambulance to transport the infant to a high-care facility is required, and high-care facility beds are not always available when they are needed. Anti-VEGF injections have mainly been used for zone 1 disease, with good outcome. In a meta-analysis study, Alba et al.[13] concluded that an anti-VEGF agent was more beneficial than laser therapy in stage 3+ ROP in zone 1, but that there was no difference between the two in stage 3+ ROP in zone 2.[13] In a study of 23 patients, Isaac et al.[14] showed similar outcomes between laser therapy and anti-VEGF. The BEAT-ROP study was the first prospective randomised study to compare laser with IVB therapy. The findings showed a comparable outcome in the two groups with regard to efficacy and safety.[8] We treated zone 1 and zone 2 type 1 disease with IVB, with favourable short-term outcomes. In our study 95.3% of patients showed complete regression with one injection. The BEAT-ROP study[8] showed a recurrence of 6% at a mean of 16 weeks after the injection. In a Canadian study on involutional pattern of ROP following IVB injections, Isaac et al.[15] reported recurrence in 61% of their patients. However, recurrences were stage 1 or 2 and none required retreatment. We did not observe any recurrence of the disease in our patients. The majority of our patients had complete vascularisation, only two patients showing incomplete vascularisation in zone 3 even after 6 months of follow-up. The two eyes with unfavourable results had aggressive posterior disease that progressed within 1 week of the injection. The safety profile of anti-VEGF use in ROP is still of concern. IVB has been reported to suppress serum levels of VEGF for up to

2 months after the injection.[16] In another study, Menke et al.[17] attributed upper respiratory infection in one patient as a possible complication. The BEAT-ROP study established the safety profile of IVB, finding no systemic side-effects at the 3-year follow up. However, long-term side-effects have not been established. None of our patients developed short-term complications attributed to IVB. There has been no report on the logistical advantage of IVB therapy over laser, in terms of resources or cost. Our study shows a clear benefit of IVB over laser, the cost of laser therapy being twice as high, although follow-up visits are more frequent with IVB.

Conclusion

Our study demonstrates that the use of IVB as an anti-VEGF agent in the treatment of ROP is effective and safe. In resource-limited centres, the use of IVB as first-line therapy in all type 1 disease may be more practical than laser therapy with regard to both clinical management and the economic burden of treatment. 1. O’Sullivan J, Gilbert C, Foster A. The causes of childhood blindness in South Africa. S Afr Med J 1997;87(12):1691-1695. 2. Gilbert C, Foster A. Childhood blindness in the context of VISION 2020 – the right to sight. Bull World Health Organ 2001;79(3):227-232. 3. Cryotherapy for Retinopathy of Prematurity Cooperative Group. Multicenter trial of cryotherapy for retinopathy of prematurity: Natural history ROP: Ocular outcome at 5(1/2) years in premature infants with birth weights less than 1251 g. Arch Ophthalmol 2002;120(5):595-599. 4. Early Treatment for Retinopathy of Prematurity Cooperative Group, Good WV, Hardy RJ, Dobson V, et al. Final visual acuity results in the early treatment for retinopathy of prematurity study. Arch Ophthalmol 2010;128(6):663-671. http://dx.doi.org/10.1001/archophthalmol.2010.34 5. Ferrara N, Hillan KJ, Gerber H-P, Novotny W. Discovery and development of bevacizumab, an anti-VEGF antibody for treating cancer. Nat Rev Drug Discov 2004;3(5):391-400. http://dx.doi. org/10.1038/nrd1381 6. Brown DM, Campochiaro PA, Singh RP, et al. Ranibizumab for macular edema following central retinal vein occlusion: Six-month primary end point results of a phase III study. Ophthalmology 2010;117(6):1124-1133. http://dx.doi.org/10.1016/j.ophtha.2010.02.022 7. Jampol LM, Glassman AR, Bressler NM. Comparative effectiveness trial for diabetic macular edema: Three comparisons for the price of 1 study from the Diabetic Retinopathy Clinical Research Network. JAMA Ophthalmol 2015;133(9):983-984. http://dx.doi.org/10.1001/jamaophthalmol.2015.1880 8. Mintz-Hittner HA, Kennedy KA, Chuang AZ, BEAT-ROP Cooperative Group. Efficacy of intravitreal bevacizumab for stage 3+ retinopathy of prematurity. N Engl J Med 2011;364(7):603615. http://dx.doi.org/10.1056/NEJMoa1007374 9. Bancalari MA, Schade YR, Peña ZR, Pavez PN. [Intravitreal bevacizumab as single drug therapy for retinopathy of prematurity in 12 patients.] Arch Argent Pediatr 2014;112(2):160-163. http://dx.doi. org/10.5546/aap.2014.160 10. Baumal CR, Goldberg RA, Fein JG. Primary intravitreal ranibizumab for high-risk retinopathy of prematurity. Ophthalmic Surg Lasers Imaging Retina 2015;46(4):432-438. http://dx.doi. org/10.3928/23258160-20150422-5 11. Mayet I, Cockinos C. Retinopathy of prematurity in South Africans at a tertiary hospital: A pro spective study. Eye (Lond) 2006;20(1):29-31. http://dx.doi.org/10.1038/sj.eye.6701779 12. Good WV, Early Treatment for Retinopathy of Prematurity Cooperative Group. Final results of the Early Treatment for Retinopathy of Prematurity (ETROP) randomized trial. Trans Am Ophthalmol Soc 2004;102:233-250. 13. Alba LE, Zaldua RA, Masini RA. [Off-label use of intravitreal bevacizumab for severe retinopathy of prematurity.] Arch Soc Esp Oftalmol 2015;90(2):81-86. http://dx.doi.org/10.1016/j.oftal.2014.09.011 14. Isaac M, Mireskandari K, Tehrani N. Treatment of type 1 retinopathy of prematurity with bevacizumab versus laser. J AAPOS 2015;19(2):140-144. http://dx.doi.org/10.1016/j.jaapos.2015.01.009 15. Isaac M, Tehrani N, Mireskandari K. Involution patterns of retinopathy of prematurity after treatment with intravitreal bevacizumab: Implications for follow-up. Eye (Lond) 2016;30(3):333-341. http:// dx.doi.org/10.1038/eye.2015.289 16. Wu W-C, Lien R, Liao P-J, et al. Serum levels of vascular endothelial growth factor and related factors after intravitreous bevacizumab injection for retinopathy of prematurity. JAMA Ophthalmol 2015;133(4):391-397. http://dx.doi.org/10.1001/jamaophthalmol.2014.5373 17. Menke MN, Framme C, Nelle M, et al. Intravitreal ranibizumab monotherapy to treat retinopathy of prematurity zone II, stage 3 with plus disease. BMC Ophthalmol 2015;15:20. http://dx.doi. org/10.1186/s12886-015-0001-7

Accepted 20 September 2016.

March 2017, Print edition

These open-access articles are distributed under Creative Commons licence CC-BY-NC 4.0.

RESEARCH

Trends in admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital, Cape Town, 2004 - 2013 Y Isaacs-Long,1 MB ChB, MPH; L Myer,2 MA, MPhil, MB ChB, PhD; H J Zar,3 MB BCh, FCPaed (SA), PhD ivision of Epidemiology and Biostatistics, School of Public Health and Family Medicine, Faculty of Health Sciences, University of Cape Town, D South Africa 2 Division of Epidemiology and Biostatistics and Centre for Infectious Diseases Epidemiology and Research, School of Public Health and Family Medicine, Faculty of Health Sciences, University of Cape Town, South Africa 3 Department of Paediatrics and Child Health, Red Cross War Memorial Children’s Hospital and MRC Unit on Child and Adolescent Health, University of Cape Town, South Africa 1

Corresponding author: Y Isaacs-Long (yumnah_isaacs@hotmail.com) Background. Routinely collected patient information has the potential to yield valuable information about health systems and population health, but there have been few comprehensive analyses of paediatric admissions at South African (SA) hospitals. Objectives. To investigate trends in hospitalisation and outcomes at Red Cross War Memorial Children’s Hospital (RCCH), a major referral hospital for children in the Western Cape and SA. Methods. Using routinely collected observational health data from the hospital informatics system, we investigated admissions between 2004 and 2013. Clinical classification software was used to group International Statistical Classification of Diseases and Related Health Problems 10th Revision (ICD-10) codes to rank causes during 2008 - 2013, when ICD-10 codes were widely available. Analyses examined trends in medical and surgical admissions over time. Results. There were 215 536 admissions over 10 years of 129 733 patients. Admissions increased by 9.3%, with increases in the general medical wards (5%), medical specialty wards (74%), the burns unit (73%), and the intensive care unit (16%). In contrast, admissions decreased in the trauma unit (21%) and short-stay medical wards (1%). In-hospital mortality decreased by 54% (p-trend <0.001) over 10 years. Diarrhoea and lower-respiratory tract illness were the most common causes for medical admissions, although admissions and deaths due to these conditions decreased between 2008 and 2013, which coincided with the national introduction of related vaccines. Similarly, tuberculosis admissions and deaths decreased over this period. These trends could be due to a concurrent decrease in HIV comorbidity (p-trend <0.001). Trauma was the most common reason for surgical admission. Conclusion. Paediatric in-hospital mortality decreased consistently over a decade, despite an overall increase in admissions. Pneumonia and diarrhoea admissions decreased markedly over a 6-year period, but remain the most important causes of hospitalisation. S Afr Med J 2017;107(3):219-226. DOI:10.7196/SAMJ.2017.v107i3.11364

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11364

A review of blood transfusions in a trauma unit for young children M Salverda,1 MB ChB; N Ketharanathan,1 MD; M van Dijk,1,2 PhD; E Beltchev,3 MB ChB; H Buys,3 FCP; A Numanoglu,2 FSC; A B van As,2 PhD epartment of Intensive Care and Pediatric Surgery, Erasmus MC Sophia Children’s Hospital, Rotterdam, Netherlands D Department of Paediatric Surgery, Faculty of Health Sciences, University of Cape Town and Red Cross War Memorial Children’s Hospital, Cape Town, South Africa 3 Department of Paediatrics and Child Health, Faculty of Health Sciences, University of Cape Town and Red Cross War Memorial Children’s Hospital, Cape Town, South Africa 1 2

Corresponding author: A B van As (sebastian.vanas@uct.ac.za) Background. Trauma is the leading cause of mortality and morbidity worldwide. Blood transfusions play an incremental role in the acute phase, yet practice varies owing to variations in transfusion thresholds and concerns about potential complications, especially in children.

March 2017, Print edition

RESEARCH

Objectives. To evaluate protocol adherence to blood transfusion thresholds in paediatric trauma patients and determine the degree of blood product wastage, as defined by discarded units. Methods. A retrospective, descriptive study of trauma patients (age 0 - 13 years) who received a blood transfusion in the trauma unit at Red Cross War Memorial Children’s Hospital, Cape Town, South Africa, over a 5.5-year period (1 January 2009 - 1 July 2014). Haemoglobin (Hb) transfusion thresholds were defined as 10 g/dL for neurotrauma patients and patients requiring skin grafting or a musculocutaneous flap (group 1). All other trauma patients had an Hb transfusion threshold of 7 g/dL (group 2). Results. A total of 144 patients were included (mean age 5.2 years (standard deviation (SD) 3.3), 68.1% male). The mean Hb increase after transfusion was 3.5 g/dL (SD 1.7). Adherence to the transfusion Hb threshold protocol was 96.7% for group 1 v. 34.0% for group 2. No complications were reported. Average blood wastage was 3.5 units per year during the study period. Conclusions. Adherence to paediatric blood transfusion protocol was low in the Hb threshold group <7 g/dL. However, transfusion-related complications and wastage were minimal. Further prospective research is required to determine optimal blood transfusion guidelines for paediatric trauma patients. S Afr Med J 2017;107(3):227-231. DOI:10.7196/SAMJ.2017.v107i3.11307

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11307

Single-centre experience of allogeneic haemopoietic stem cell transplant in paediatric patients in Cape Town, South Africa A van Eyssen,1 MB ChB, DCH (SA), FC Paed (SA), Cert Medical Oncology Paediatrics (SA); N Novitsky,2 FCP (SA), PhD; P de Witt,2 MB ChB, FCP (SA), MMedSc (Critical Care), Cert Clinical Haematology (SA) Phys; T Schlaphoff,3 MDipTech (Med Tech); V Thomas,2 ND Med Tech; D Pillay,2 MDipTech (Med Tech); M Hendricks,1 MB ChB, Dip PEC (SA), DCH (SA), FC Paed (SA), Cert Medical Oncology Paediatrics (SA); A Davidson,1 MB ChB, DCH (SA), FC Paed (SA), Cert Medical Oncology Paediatrics (SA), MPhil aematology Oncology Service, Department of Paediatrics and Child Health, Red Cross War Memorial Children’s Hospital and Faculty of H Health Sciences, University of Cape Town, South Africa 2 Division of Haematology/Bone Marrow Transplantation Service, Department of Medicine, Groote Schuur Hospital, University of Cape Town Private Academic Hospital and Faculty of Health Sciences, University of Cape Town, South Africa 3 South African Bone Marrow Registry, Cape Town, South Africa 1

Corresponding author: A van Eyssen (ann.vaneyssen@uct.ac.za) Background. Allogeneic haemopoietic stem cell transplant (Allo-HSCT) is a specialised and costly intervention, associated with significant morbidity and mortality. It is used to treat a broad range of paediatric conditions. South Africa (SA) is an upper middle-income country with limitations on healthcare spending. The role of paediatric Allo-HSCT in this setting is reviewed. Objectives. To review paediatric patients who underwent Allo-HSCT at the Groote Schuur Hospital/University of Cape Town Private Academic Hospital transplant unit in Cape Town, South Africa, and received post-transplant care at Red Cross War Memorial Children’s Hospital, over the period January 2006 - December 2014 in respect of indications for the transplant, donor sources, conditioning regimens, treatment-related morbidity and overall survival (OS). Methods. A retrospective analysis of patient records was performed and a database was created in Microsoft Access. Descriptive analyses of relevant demographic, clinical and laboratory data were performed. Summary statistics of demographic and clinical parameters were derived with Excel. OS was calculated from the date of transplant to the date of an event (death) or last follow-up using the Kaplan-Meier method in Statistica. Results. A total of 48 children received Allo-HSCT: 24 for haematological malignancies, 20 for non-oncological haematological conditions, 3 for immune disorders and 1 for adrenoleukodystrophy. There were 28 boys (median age 7.5 years) and 20 girls (8.5 years). There were 31 sibling matched peripheral-blood stem cell (PBSC) transplants and 1 maternal haploidentical PBSC transplant. Stem cells were mobilised from bone marrow into peripheral blood by administering granulocyte-colony stimulating factor to donors. PBSCs were harvested by apheresis. Eight patients received 10/10 HLA-matched grafts from unrelated donors. Six were PBSC grafts and 2 were bone marrow grafts. Three of the unrelated PBSC grafts were from SA donors. Eight transplants used umbilical cord blood from international registries. OS for patients with non-oncological disorders was 91.3% (median follow-up 3.9 years), while that for oncology patients was 56.8% (1.9 years). Two of the survivors developed chronic graft-versus-host disease.

March 2017, Print edition

RESEARCH

Conclusions. OS for non-oncological conditions was excellent, while outcomes for oncological disorders were on par with those in highincome settings. Transplantation offers many patients the opportunity for long-term survival and has been shown to be both feasible and rewarding in a less well-resourced environment servicing an economically diverse population. S Afr Med J 2017;107(3):232-238. DOI:10.7196/SAMJ.2017.v107i3.11313

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11313

Provision of an emergency theatre in tertiary hospitals is cost-effective: Audit and cost of cancelled planned elective general surgical operations at Pietersburg Hospital, Limpopo Province, South Africa M M Z U Bhuiyan, FRCSG, MMed; R Mavhungu, BSc (Med Sci); A Machowski, MD, PhD Department of General Surgery, Pietersburg Hospital and Faculty of Health Sciences, University of Limpopo, South Africa Corresponding author: M M Z U Bhuiyan (bhuiyanmirza@gmail.com) Background. Cancellations of planned elective surgical operations increase financial cost to the patient and the hospital. Objectives. To determine the rate and reasons for cancellations, estimate the cost incurred by such cancellations and recommend possible solutions. Methods. We did a prospective descriptive study of cancellations of elective general surgical operations over the 1-year period January December 2014 in the main theatre at Pietersburg (PTB) Hospital, Limpopo Province, South Africa. All patients listed on the theatre booking slate for elective general surgical operations before the cut-off time of 13h00 on the day before the anticipated operation were included. Epi Info version 7 was used to analyse the data and derive the descriptive statistics. Results. There were 537 booked patients (median age 47 years, range 1 - 94); a total of 298 operations were performed, and 239 were cancelled (cancellation rate 44.5%). Reasons for cancellation were as follows: theatre needed for an emergency n=154 (64.4%), theatre equipment failure and lack of consumables n=17 (7.1%), non-theatre equipment failure n=10 (4.2%), prolonged time of operations n=13 (5.4%), abnormal blood results n=8 (3.3%), patient comorbidity and poor general condition n=9 (3.8%), patients absent from the ward n=8 (3.3%), patients not starved n=2 (0.8%), patients’ condition improved significantly n=3 (1.3%), nurses’ strike n=5 (2.1%), rebooking of cases for senior surgeons or other specialty n=2 (0.8%), and other reasons n=8 (3.3%). The cost per inpatient per day was estimated at ZAR4 890 at PTB Hospital and ZAR2 100 at district hospitals, and the total cost per cancelled operation was ZAR25 860. Conclusions. Over the 1-year period 44.5% of elective operations at PTB Hospital were cancelled, 64.4% because the theatre was needed for an emergency operation. We recommend that a theatre dedicated to emergencies be opened at PTB Hospital. The cost incurred due to cancellations was about ZAR6 million for the hospital, with additional cost and emotional trauma for the patients. S Afr Med J 2017;107(3):239-242. DOI:10.7196/SAMJ.2017.v107i3.10687

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.10687

March 2017, Print edition

This open-access article is distributed under Creative Commons licence CC-BY-NC 4.0.

RESEARCH

The accuracy of nurse performance of the triage process in a tertiary hospital emergency department in Gauteng Province, South Africa L N Goldstein,1 MB BCh, MMed, FCEM (SA), Cert Critical Care (SA); L M Morrow,2 BDiet; T A Sallie,3 BHSc; K Gathoo,3 BHSc; K Alli,3 BHSc; T M M Mothopeng,3 BHSc; F Samodien,3 BHSc ivision of Emergency Medicine, School of Clinical Medicine, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, D South Africa 2 Emergency Department, Helen Joseph Hospital, Johannesburg, South Africa 3 Department of Family Medicine, School of Clinical Medicine, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa 1

Corresponding author: L N Goldstein (drg666@gmail.com) Background. Triage in the emergency department (ED) is necessary to prioritise management according to the severity of a patient’s condition. The South African Triage Scale (SATS) is a hospital-based triage tool that has been adopted by numerous EDs countrywide. Many factors can influence the outcome of a patient’s triage result, and evaluation of performance is therefore pivotal. Objectives. To determine how often patients were allocated to the correct triage category and the extent to which they were incorrectly promoted or demoted, and to determine the main reasons for errors in a nurse-led triage system. Methods. Triage forms from a tertiary hospital ED in Gauteng Province, South Africa, were collected over a 1-week period and reviewed retrospectively. Results. A total of 1 091 triage forms were reviewed. Triage category allocations were correct 68.3% of the time. Of the incorrect category assignments, 44.4% of patients were promoted and 55.6% demoted. Patients in the green category were most commonly promoted (29.4%) and patients who should have been in orange were most commonly demoted (35.0%). Trauma patients were more likely to be incorrectly promoted and non-trauma patients to be incorrectly demoted. Mistakes were mainly due to discriminator errors (57.8%), followed by numerical miscalculations (21.5%). The leading omitted discriminators were ‘abdominal pain’, ‘chest pain’ and ‘shortness of breath’. Conclusions. Mis-triaging using the SATS can be attributed to incorrect or lack of discriminator use, numerical miscalculations and other human errors. Quality control and quality assurance measures must target training in these areas to minimise mis-triage in the ED. S Afr Med J 2017;107(3):243-247. DOI:10.7196/SAMJ.2017.v107i3.11118

Triage in the emergency department (ED) is necessary in order to prioritise and assign relatively scarce resources to the medical needs of patients for efficient and timeous treatment according to the severity of their condition or acuity on presentation.[1] Triage systems should ideally allow for patient care to be given within an acceptable time, thus decreasing overcrowding, increasing patient satisfaction, allowing urgent patients to receive appropriate care, and preventing non-urgent patients from receiving unnecessary treatment.[2] In 2004, the South African Triage Scale (SATS) was developed to be used as a nurse-led, in-hospital triage tool. It has since been adopted by numerous EDs.[3] The SATS categorises patients into different colour groups depending on the severity of their condition. This categorisation is based on vital signs that are used to constitute the Triage Early Warning Score (TEWS), as well as a discriminator list of conditions that acts as a safety net for certain time-critical conditions where patients may present with normal or near-normal vital signs. The aim is for healthcare providers to evaluate patients triaged red immediately, orange within 10 minutes of arrival, yellow within 1 hour and green within 4 hours. The discriminator may be used to upgrade a patient’s triage category.

Validity of the SATS

Few studies have been done to determine the validity of the SATS with regard to over- or under-triage of patients. Over- and under-

triage is determined by comparing the triage tool assessment with the ultimate outcome of the patient. Over-triage will result in unnecessarily assigning resources to a patient, and under-triage could mean potential morbidity or mortality as a result of time delays. Rosedale et al.[4] prospectively evaluated the SATS in a hospital in rural KwaZulu-Natal Province, South Africa (SA). The results showed an under-triage rate of 4.4% and an over-triage rate of 4.3%. In a validation study,[5] the SATS had an average over-triage rate of 15% and an under-triage rate of 10%. A classroom-based study by Dalwai et al.[3] assessed the reliability and accuracy of the SATS when used by ED nursing staff in Pakistan. Their reference standard was based on the triage category assigned to case vignettes that had been evaluated by an expert panel (surrogate end-point). The study found a similar average over-triage result (15%) and a slightly higher average under-triage result of 22%. It was noted that 66% of emergency cases (red) were under-triaged, but fortunately only by one acuity level, to orange.[3] However, the expert panel in the study were mostly based in high-income rather than low- and middleincome healthcare settings, which may have affected their opinion of the patients’ acuity level, leading to a tendency to over-rate patients. The authors also suggested that nurses may tend to under-rate a patient’s acuity level when only given a paper-based vignette. Both the abovementioned factors may have contributed to the high undertriage results, especially in the emergency cases. However, overall it

March 2017, Print edition

RESEARCH

was concluded that the SATS is reliable and can be used by nursing staff in Pakistan.[3] It has come to our attention that studies assessing triage tools compare their over- and under-triage rates with the so-called ‘acceptable ranges’ developed by the American College of Surgeons Committee on Trauma (ACSCOT).[6] This is not a valid comparator, however, as the ACSCOT triage guidelines were developed for prehospital (in-field) use in trauma patients only.

Factors that affect the outcome of a patient’s triage score

Many factors can influence the outcome of a patient’s triage result, but these have not been comprehensively explored in the literature. Triage errors are commonly ascribed to understaffing. Burstrom et al.’s[7] study comparing three hospital triage systems found that a physician-led triage system resulted in improved efficiency and quality of patient care. Similarly, Molyneux et al.[8] emphasised the need for well-trained nurses who are able to triage and assist in resuscitation, as this could increase treatment efficacy. Unfortunately, in the SA environment, human resource constraints do not readily allow for a physician-led triage system, or for the most-qualified nurses always to be available to perform triage. To compensate for this, the SATS was designed to be used by enrolled nursing assistants. High staff turnover sometimes results in expertise being lost, so training of new staff needs to occur on a regular basis.[5,8] The SATS was introduced in 2010 in our ED in a tertiary hospital in Gauteng Province, SA. Induction training was offered to all enrolled nurses and enrolled nursing assistants in the ED, all of whom are responsible for triaging patients. Since then, monthly in-service training has been given. Self-evaluation of our triage performance is pivotal, not only as part of quality assurance but to ensure timely institution of patient management in the ED.

Objectives

To determine how often patients were allocated to the correct triage category and the extent to which they were incorrectly promoted or demoted within a triage category, to determine the main reasons for promotion and demotion within triage categories, and to compare error rates for each category of triage in our nurse-led triage system.

Methods

Study design and study setting

Triage forms from a tertiary hospital ED in a metropolitan area of Gauteng, SA, were retrospectively reviewed. The ED sees approximately 65 000 patients annually. Most patients have non-traumatic pathologies (~70%), the remainder being trauma-related. Paediatric and obstetric and gynaecology patients are mainly seen at the nearby sister hospital, but children needing resuscitation and women with ectopic pregnancies or in active labour sometimes present to the ED.

Data collection

Data were collected over the 1-week period 10 - 17 May 2015. As nursing shifts change every Wednesday, the data were representative of all four day and night shifts in the ED. Patients aged <12 years were not subject to the 2008 adult SATS guidelines and were therefore excluded from the study. An experienced ED doctor and a triage researcher formed the expert panel that delivered the consensus on the correct triage categories. Permission to conduct the study was granted by the Human Research Ethics Committee of the University of the Witwatersrand (ref. no. M150473).

Results

A total of 1 091 triage forms were reviewed. Table 1 shows the overall triage performance. There was no statistically significant difference between trauma and non-trauma patients with regard to overall correct triages performed (Fisher’s exact test p=0.23); however, non-trauma patients were more likely to be incorrectly demoted (Fisher’s exact test p=0.0439), with an odds ratio of 1.697 (95% confidence interval 1.025 - 2.753) and trauma patients were more likely to be incorrectly promoted. Table 2 shows the numbers of patients correctly triaged (darker blue), incorrectly promoted (grey) and incorrectly demoted (lighter blue), and Fig. 1 the numbers of patients who were triaged correctly and incorrectly (promoted or demoted) according to triage category. Table 3 sets out the main reasons for errors made during triage, namely discriminator errors, numerical miscalculation and ‘other’. Discriminator errors were either ‘incorrect discriminator usage’ (the nurse used a discriminator that was not correct or does not exist) or ‘failure to record a discriminator’ (no discriminator recorded where there should have been one). The numerical miscalculations were either attributable to human error (incorrect addition of the TEWS score) or to transposition error (choosing an incorrect TEWS category, which then resulted in an incorrect TEWS score). ‘Other’ refers to cases in which the nurse calculated the correct TEWS score and/or selected the correct discriminator, but still selected the incorrect triage category. Table 4 shows the common reasons for errors in triage and whether they ultimately resulted in a correct or incorrect overall triage result. Table 5 demonstrates the discriminators most often omitted and the effects thereof.

Discussion

We did not assess the accuracy of the SATS tool itself in this study, but rather the accuracy of its use by nurses in the ED. We therefore could not use the terms over- and under-triage, instead using promotion and demotion, respectively. To our knowledge no other studies have made use of these terms when referring to triage results. Only triage data were evaluated and not the ultimate outcome of the patients; an incorrect triage categorisation from the nurses may therefore still have resulted in the correct and timeous treatment of the patient.

Table 1. Triage performance Trauma, n (%)

Non-trauma, n (%)

Total, N (%)

Patients triaged

301 (29.0)

737 (71.0)

1 038 (100)*

Triages performed correctly

214/301 (71.1)

495/737 (67.2)

709 (68.3)

Triages performed incorrectly

87/301 (28.9)

242/737 (32.8)

329 (31.7)

Promoted patients

47/87 (54.0)

99/242 (40.9)

146/329 (44.4)

Demoted patients

40/87 (46.0)

143/242 (59.1)

183/329 (55.6)

*53/1 091 triage forms (4.9%) were considered to be indeterminate, i.e. the triage category could not be correctly assigned owing to insufficient information being documented.

March 2017, Print edition

RESEARCH

Table 2. Triage assessment per triage category, n Study Nurse assessment

Indeterminate

Green

Yellow

Orange

Red

Total

Indeterminate

Green

243

328

Yellow

289

459

Orange

168

229

Red

Total

361

413

287

1 091

Darker blue = correctly triaged; grey = incorrectly promoted; lighter blue = incorrectly demoted.

289

300

Patients, n

250

Correct

Promoted

Demoted

Table 3. Main reasons for errors made during triage

243

200 168

Reasons for errors in triage

Errors, n (%)

Discriminator errors

369 (57.8)

Incorrect discriminator usage

150 100

101

Failure to record a discriminator

96 71

35 10

0 Green

Yellow

Orange

Red

Triage category

Fig. 1. Numbers of patients who were triaged correctly and incorrectly according to triage category.

The SATS itself does not have performance indicator guidelines on triage accuracy standards to determine whether or not the EDâ&#x20AC;&#x2122;s triage accuracy rate is acceptable.

Trauma v. non-trauma patients

The majority (71.0%) of patients presenting to the ED had nontraumatic pathologies. There was no statistically significant difference in the correct triage rate between trauma and non-trauma patients. However, non-trauma patients were more likely to be incorrectly demoted when incorrectly triaged, whereas trauma patients were more likely to be promoted. This may be related to visual differentiation â&#x20AC;&#x201C; e.g. a bleeding trauma patient may be interpreted as needing more urgent attention than a patient with chest pain, who may be having a myocardial infarction that cannot be seen with the naked eye.

Promoted and demoted patients

When looking at promotion, patients in the green category were most commonly promoted â&#x20AC;&#x201C; almost one-third (29.4%) of patients

78/369 (21.1) 291/369 (78.9)

Numerical miscalculations (miscalculation due to addition or transposition error)

137 (21.5)

Other (incorrect triage placement despite correct TEWS score, and/or correct discriminator usage)

132 (20.7)

Total

638 (100)*

*A total of 638 errors were made even though only 329 patients were triaged incorrectly, i.e. in some cases more than one error was made per patient, and some of the errors also did not result in an incorrect triage result.

who should have been in this routine category were placed in yellow or above. Of incorrectly demoted patients, one-third of patients in the orange category (very urgent) were placed in the yellow or green categories. Mis-triaging patients, whether by incorrectly promoting or demoting them, can have detrimental effects. Incorrect promotion increases the number of patients who need to be seen urgently and puts further strain on an already under-resourced and under-staffed system, which may also lead to correctly triaged and more critical patients not receiving treatment within the recommended time. Incorrectly demoting a patient potentially has even more serious consequences. In our study, 82 patients who should have been triaged orange were triaged yellow (Table 2). This means that a patient who should have been evaluated within 10 minutes of arrival in the ED could theoretically have waited for up to an hour, which could be detrimental or even fatal.

Table 4. Mechanisms of errors resulting in a correct or incorrect triage result Errors resulting in an incorrect triage result, n (%)

Errors nevertheless resulting in a correct triage result, n (%)

Incorrect discriminator usage

38/78 (48.7)

40/78 (51.3)

Failure to record a discriminator

133/291 (45.7)

158/291 (54.3)

Numerical miscalculation (miscalculation due to addition or transposition error)

68/137 (49.6)

69/137 (50.4)

Other (incorrect triage placement, despite correct TEWS score, and/or correct discriminator usage)

132/132 (100)

0 (0)

Total

371/638 (58.2)

267/638 (41.8)

Reasons for errors in triage Discriminator errors

March 2017, Print edition

RESEARCH

Table 5. Discriminators most often omitted* Discriminator omitted

Total, n (%) (N=291)

Correctly triaged, n (%)† Promotion, n (%)

Demotion, n (%)

Abdominal pain

88 (30.2)

39 (44.3)

2 (2.2)

47 (53.4)

Chest pain

48 (16.5)

25 (52.1)

23 (47.9)

Shortness of breath

44 (15.1)

11 (25.0)

2 (4.5)

31 (70.5)

Vomiting

22 (7.6)

13 (59.1)

1 (4.5)

8 (36.4)

Reduced level of consciousness

17 (5.8)

13 (76.5)

4 (23.5)

Psychosis/aggression

17 (5.8)

17 (100)

*Pain was the least commonly used discriminator (0.18%). † Patients who were still correctly triaged despite omission of the correct discriminator.

Patients in the red category are of the highest priority and therefore at greatest risk of morbidity and mortality if under-triaged. In this study, 16/25 patients (64.0%) who should have been triaged red were incorrectly demoted to orange, which is similar to the 66% undertriage result for the red category found by Dalwai et al.[3] Although we cannot directly compare these results, we can speculate that a similar under-triage result might have been achieved had true acuity levels been determined. When looking at the reasons for mis-triage in the red category, the primary errors were miscalculation and errors in the ‘other’ category (TEWS were calculated correctly and/ or the correct discriminator was used, but the incorrect category was still chosen).

Reasons for incorrect triaging

Discriminator errors The main reason for errors in triaging was failure to record a discriminator (Table 3). This refers to circumstances in which patients presented with a problem on the discriminator list, but it was not recorded. Other reasons written by the nurse that were not on the list also constituted an ‘incorrect discriminator’. Discriminators allow a patient, regardless of their TEWS score, to be placed immediately into a higher triage category based on the severity of their pathology. Not recording a valid discriminator or using the incorrect discriminator will therefore result in incorrect promotion or demotion. The leading omitted discriminators were ‘abdominal pain’, ‘chest pain’ and ‘shortness of breath’ (Table 5). Patients with abdominal and chest pain were still correctly triaged half of the time when one of these symptoms was present in the main complaint, even when this were not documented as a discriminator per se. It may be that the discriminator was in fact recognised by the nurse, who triaged the patient appropriately but just did not document it as a discriminator on the triage form itself. The inter- and intra-reliability of the SATS have been found to have acceptable accuracy.[3] Our findings indicate that certain discriminators may need more explicit guidelines that could improve their utility. It may be especially beneficial to develop such a guideline for the ‘pain’ discriminator, which was only used twice in the 1 091 forms reviewed. This may be due to nurses’ lack of confidence in their ability to differentiate between mild, moderate and severe pain, the pain severity discriminator not actually changing the triage category, or, sadly, staff becoming immune to patients’ complaints of pain (pain is one of the most common reasons for presentation to the ED).[9] All patients who presented with, or had a history of, psychosis or aggression were triaged orange, even if the patient did not have active ‘psychosis or aggression’ at the time of presentation to the ED. Triage training should therefore emphasise that a history of psychosis does

not necessarily imply current psychosis, and the patient should not be triaged orange on the basis of their psychiatric history alone. The discriminators most often cited that were not on the SATS list included ‘low oxygen saturation’, ‘increased or decreased blood pressure’, ‘chronic chest pain’, ‘abscess’ and ‘head injury’. These symptoms or vital signs must have been of concern to the triage nurses, but would have been picked up by the TEWS or other discriminators. The use of ‘low oxygen saturation’ as a discriminator may have originated from this ED’s policy that nurses should ‘notify a doctor’ if it is present. The use of non-existent discriminators nevertheless resulted in the correct triage result 51.3% of the time. As the aim of this study was to assess the accuracy rate according to the 2008 SATS guidelines specifically, cases where ED-specific rules were used and/or changed the ultimate triage outcome were regarded as incorrect. Numerical miscalculations Triage errors due to numerical miscalculations occurred because of incorrect addition of the TEWS score even when the correct TEWS column was selected. Miscalculations were also due to incorrect TEWS columns being chosen, resulting in a TEWS score that was an inaccurate representation of the patient’s actual condition. Thirty patients had numerical miscalculations that still resulted in the correct triage result, i.e. a TEWS score of 3 still placed the patient correctly in the yellow category, even when the correct TEWS score should have been 4 (also yellow). Other In 132 cases the TEWS score was correct, the correct discriminator was chosen and no incorrect discriminators were used, but the incorrect triage category was still selected. This was the second most common reason for triage errors, yet the explanation for it is uncertain. It appears to be equivalent to correctly calculating a complex mathematical problem in a test and obtaining the correct answer, but transferring an incorrect answer to the answer sheet. The result is wrong, and in the case of patient care may be detrimental.

Study limitations

In assessing the accuracy of triage performance, the notion of human error is a central contributing factor. All human beings, including healthcare practitioners who are responsible for the triaging of patients, are vulnerable to error. This can include inaccurately recording a patient’s physiological vital signs, e.g. blood pressure or respiratory rate, transposing them incorrectly, miscalculating the TEWS, and incorrectly using or not using a discriminator. All these determine the ultimate correctness of the triage outcome. Some errors cannot be accounted for in this study, and evaluating them would require a prospective, observational study.

March 2017, Print edition

RESEARCH

As this was a retrospective study making use of the triage forms, it was not possible to evaluate whether the consequences of promotion or demotion mis-triage had an impact on individual patient outcome or the healthcare system and functionality of the ED.

Recommendations

• Further quality assurance measures for triage need to be instituted. Triage courses or refresher training for all nurses and doctors, not just those involved in triage, should be offered on a continuous basis throughout the year. Training should include the use of case studies (such as validated vignettes) where skills can be practised and timeous feedback delivered. This will increase self-efficacy and, it is hoped, triage accuracy in the ED. • Quality control measures need to be evaluated regularly. The correct use of the triage tool needs to be monitored by performing ‘spot checks’ on triage forms to determine whether patients have been triaged correctly.

Conclusions

Our study showed that patients were correctly triaged 68.3% of the time. There was no difference in the correct triage rate between trauma and non-trauma patients, but non-trauma patients were more likely to be incorrectly demoted when incorrectly triaged, whereas trauma patients were more likely to be promoted. Incorrect triaging mostly resulted in the promotion of patients who should have been in the green category and demotion of patients who should have been in the orange category. Mis-triaging can be attributed to incorrect or lack of discriminator use, numerical miscalculations and other human errors.

These open-access articles are distributed under CC-BY-NC 4.0.

Quality control and quality assurance measures must target training in these areas to minimise mis-triage in the ED. Disclaimer. The views expressed in the submitted article are those of the authors, and not an official position of the University of the Witwatersrand. Sources of support. No financial support was given for this study, and any costs incurred were covered by the authors. 1. FitzGerald G, Jelinek GA, Scott D, Gerdtz MF. Emergency department triage revisited. Emerg Med J 2010;27(2):86-92. http://dx.doi.org/10.1136/emj.2009.077081 2. Scheutz P, Hausfater P, Amin D. Optimizing triage and hospitalization in adult general medical emergency patients: The triage project. BMC Emerg Med 2013;13(12):1-11. http://dx.doi. org/10.1186/1471-227X-13-12 3. Dalwai MK, Twomey M, Maikere J, et al. Reliability and accuracy of the South African Triage Scale when used by nurses in the emergency department of Timergara Hospital, Pakistan. S Afr Med J 2014;104(5):372-375. http://dx.doi.org/10.7196/SAMJ.7604 4. Rosedale K, Smith ZA, Davies H, Wood D. The effectiveness of the South African Triage Score (SATS) in a rural emergency department. S Afr Med J 2011;101(8):537-540. 5. Twomey M, Wallis LA, Thompson ML, Myers JE. The South African triage scale (adult version) provides valid acuity ratings when used by doctors and enrolled nursing assistants. Afr J Emerg Med 2012;2(1):3-12. http://dx.doi.org/10.1016/j.afjem.2011.08.014 6. American College of Surgeons Committee on Trauma. Resources for Optimal Care of the Injured Patient. Chicago: American College of Surgeons, 2014. https://www.facs.org/quality-programs/ trauma/vrc/resources (accessed 19 October 2016). 7. Burstrom L, Nordberg M, Ornung G, et al. Physician-led team triage based on lean principles may be superior for efficiency and quality? A comparison of three emergency departments with different triage models. Scand J Trauma Resusc Emerg Med 2012;20:57. http://dx.doi.org/10.1186/1757-7241-20-57 8. Molyneux E, Ahmad S, Robertson A. Improved triage and emergency care for children reduces inpatient mortality in a resource-constrained setting. Bull World Health Organ 2006;84(4):314-319. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2627321/pdf/16628305.pdf (accessed 5 February 2017). 9. Kapoor S, White J, Thorn BE, et al. Patients presenting to the emergency department with acute pain: The significant role of pain catastrophizing and state anxiety. Pain Med 2015;17(6):1069-1078. http:// dx.doi.org/10.1093/pm/pnv034

Accepted 25 November 2016.

The impact of a modified World Health Organization surgical safety checklist on maternal outcomes in a South African setting: A stratified cluster-randomised controlled trial

M Naidoo,1 FCFP, PhD; J Moodley,2 FCOG, FRCOG, MD; P Gathiram,1 PhD; B Sartorius,3 PhD iscipline of Family Medicine, School of Nursing and Public Health, College of Health Sciences, Nelson R Mandela School of Medicine, D University of KwaZulu-Natal, Durban, South Africa 2 Women’s Health and HIV Research Group, School of Clinical Medicine, College of Health Sciences, Nelson R Mandela School of Medicine, University of KwaZulu-Natal, Durban, South Africa 3 Discipline of Public Health Medicine, School of Nursing and Public Health, College of Health Sciences, Nelson R Mandela School of Medicine, University of KwaZulu-Natal, Durban, South Africa 1

Corresponding author: M Naidoo (naidoom@ukzn.ac.za) Background. In South Africa (SA), the Saving Mothers Reports have shown an alarming increase in deaths during or after caesarean delivery. Objective. To improve maternal surgical safety in KwaZulu-Natal Province, SA, by implementing the modified World Health Organization surgical safety checklist for maternity care (MSSCL) in maternity operating theatres. Methods. The study was a stratified cluster-randomised controlled trial conducted from March to November 2013. Study sites were 18 hospitals offering maternal surgical services in the public health sector. Patients requiring maternal surgical intervention at the study sites were included. Pre-intervention surgical outcomes were assessed. Training of healthcare personnel took place over 1 month, after which the MSSCL was implemented. Post-intervention surgical outcomes were assessed and compared with the pre-intervention findings and the control arm. The main outcome measure was the mean incidence rate ratios (IRRs) of adverse incidents associated with surgery.

March 2017, Print edition

RESEARCH

Results. Significant improvements in the adverse incident rate per 1â&#x20AC;&#x201E;000 procedures occurred with combined outcomes (IRR 0.805, 95% confidence interval (CI) 0.706 - 0.917), postoperative sepsis (IRR 0.619, 95% CI 0.451 - 0.849), referral to higher levels of care (IRRÂ 1.409, 95% CI 1.066 - 1.862) and unscheduled return to the operating theatre (IRR 0.719, 95% CI 0.574 - 0.899) in the intervention arm. Subgroup analysis based on the quality of implementation demonstrated greater reductions in maternal mortality in hospitals that were good implementers of the MSSCL. Conclusions. Incorporation of the MSSCL into routine surgical practice has now been recommended for all public sector hospitals in SA, and emphasis should be placed on improving the quality of implementation. S Afr Med J 2017;107(3):248-257. DOI:10.7196/SAMJ.2017.v107i3.11320

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11320

A randomised trial comparing laparoscopy with laparotomy in the management of women with ruptured ectopic pregnancy L C Snyman, BMedSci, MB ChB, MPraxMed, MMed (O&G), FCOG (SA); T Makulana, MB ChB, MMed (O&G), FCOG (SA); J D Makin, MB ChB, BSc Hons (Epi) Department of Obstetrics and Gynaecology, Faculty of Health Sciences, School of Medicine, University of Pretoria and Kalafong Provincial Tertiary Hospital, Pretoria, South Africa Corresponding author: L C Snyman (leon.snyman@up.ac.za) Background. Ruptured ectopic pregnancy (REP) is a common gynaecological emergency in resource-poor settings, where laparotomy is the standard treatment despite laparoscopic surgery being regarded as the optimal treatment. There is a lack of prospective randomised data comparing laparoscopic surgery with laparotomy in the surgical management of women with REP. Objective. To compare operative laparoscopy with laparotomy in women with REP. Methods. This was a randomised parallel study. One hundred and forty women with suspected REP were randomised to undergo operative laparoscopy or laparotomy. The outcome measures were operating time, hospital stay, pain scores and analgesic requirements, blood transfusion, time to return to work, and time to full recovery. Results. Operating time was significantly longer in the laparoscopy group (67.3 v. 30.5 minutes, p<0.001). Duration of hospital stay, pain scores and need for analgesia were significantly less in the laparoscopy group. Women in this group returned to work 8 days earlier and their time to full recovery was significantly shorter compared with those in the laparotomy group. Significantly more women undergoing laparotomy required blood transfusion than women in the laparoscopy group. In the latter group, 14.5% of women required blood transfusion compared with 26.5% in the laparotomy group (p=0.01). Conclusion. Operative laparoscopy in women treated for REP is feasible in a resource-poor setting and is associated with significantly less morbidity and a quicker return to economic activity. S Afr Med J 2017;107(3):258-263. DOI:10.7196/SAMJ.2017.v107i3.11447

Full article available online at http://dx.doi.org/10.7196/SAMJ.2017.v107i3.11447

March 2017, Print edition

CAREERS & CLASSIFIEDS Ladine Van Heerden Tel: 012 481 2121 | E-mail: ladinev@hmpg.co.za Makhadzi Mulaudzi Tel: 012 481 2156 | E-mail: makhadzim@hmpg.co.za We accept credit card payments - Visa or MasterCard.

Radiologist required – Limpopo The services of a full-time radiologist assistant, with a view to partnership, is required for a well-established multisite practice in Limpopo. Prior private practice experience would be advantageous but is not essential.

For enquiries: Craig Tudhope on ctudhope@alt.co.za

MED SERVE PLACEMENTS NATIONAL RECRUITMENT AND PLACEMENT OF • Locum General Practitioners • After-hour cover at hospitals/clinics • Permanent placement of Medical and Non-medical personnel Phone Lélane for your recruitment needs at the lowest rates.

MEDICAL OFFICER Standards and Governance About Liberty Liberty is a progressive African wealth management group which, for more than fifty years, has delivered innovative long-term solutions that assist customers to achieve financial stability in their chosen lifestyles and throughout their life cycles. As a group of companies Liberty offers an extensive, market-leading range of products and services to help customers build and protect long-term wealth. These include life and health-related insurance, investment management and retirement income facilitation. Customers have flexible choices and the input provided by Liberty’s advisers equips them with the knowledge and expert advice they need to make the right decisions with confidence, no matter what their stage of life. “Our vision is to lead by being the most trusted insurance and investment company in Africa.”

Overview A very exciting opportunity is available for a business oriented medical officer in the Individual Arrangements Standards and Governance team. This team is primarily responsible for positioning the Liberty risk product proposition as the leader in the industry, both from a sales and risk management perspective. A key part of this is the effective translation of cutting edge clinical knowledge into optimal decision making.

Key Responsibilities: The candidate will be responsible for the following: • Specifying, developing, prioritizing and leading projects to improve: • Efficiency of the underwriting and claims process • Consistency of underwriting and claims decisions reached • Margins associated with the retail risk business. • In particular, close attention needs to be paid to automation opportunities • Interaction with sales force, medical professionals, Liberty staff across various business units, and reinsurers. • Providing consultant type support to operational matters on an as and when basis for both underwriting and claims teams. • Responsible for projects relating to Standards and Governance function of developing and implementing practice guides across the Fulfilment business unit. • Assisting the Standards and Governance team with any medical input that they maybe require on their projects. • Assisting to maintain practices across the Fulfilment business unit that adapt to competitive trends, new medical developments, and feedback from distribution force while continuing to maintain and improve risk management. • ECG interpretation skills will be a plus • Medical and technical training of both underwriters and claims assessors • Insurance medical examinations on insurance applicants

Qualifications:

Cell : 082 92 106 92 Tel : 061 4844 611 email: info@medserve.co.za

Medical Degree A diploma in occupational medicine would be preferable

Experience: • •

At least 5 years general medical experience At least 2 years medical advisory experience in an insurance environment would be preferable

Competencies:

CALL LADINE OR

• Building strong teams • Conceptual thinking • Communication • Customer Service and quality focused • Influential and motivational • Innovative • Planning and organising If you meet the requirements and are interested in applying for this position, please send your CV to Candice.Royan@liberty.co.za. The closing date for the applications is the 31th March 2017.

MAKHADZI FOR ALL YOUR ADVERTISING NEEDS! You can reach over 15 500 Doctors just by advertising with us. LADINE, TEL: +27 (12) 481 2121 EMAIL: ladinev@hmpg.co.za

OR MAKHADZI, TEL: +27 (12) 481 2156 EMAIL: makhadzim@hmpg.co.za

Liberty Group Ltd – an Authorised Financial Services Provider in terms of the FAIS Act (Licence No. 2409).

Midlands Medical Centre PRIVATE HOSPITAL

MIDLANDS MEDICAL CENTRE PRIVATE HOSPITAL OPPORTUNITY FOR SPECIALISTS Midlands Medical Centre (MMC) – established in 1988 as an independent private hospital based in Pietermaritzburg – is in the process of further expansion and growth. MMC is inviting specialist doctors to join the hospital in creating a ‘medical precinct’ in the heart of the capital city of KwaZulu-Natal. With the increasing need for specialist facilities, MMC will soon be launching a state-of-the-art cardiac unit. The hospital’s exciting growth-oriented initiatives include:

The following specialists are encouraged to join our team:

a cardiac catheterisation lab

cardiothoracic surgeons

a cardiac theatre

orthopaedic surgeons

a 12-bed cardiac ICU

neurosurgeons

a 30-bed cardiac ward

obstetricians and gynaecologists

a caesarian theatre

paediatric surgeons

a 23-bed new adult general ward

plastic surgeons

36 new doctors’ consulting suites

urologists

a newly expanded radiology department

cardiologists

a recently launched GI unit

neurologists

further refurbishments of the existing hospital.

paediatricians

infertility specialists.

To take advantage of this opportunity, contact MMC Private Hospital: Tel: 033 341 5158 Email: info@midmedic.co.za Website: www.midlandsmedicalcentre.co.za

CPD

MARCH 2017 The CPD programme for SAMJ is administered by Medical Practice Consulting. CPD questionnaires must be completed online at www.mpconsulting.co.za.

True (A) or false (B): SAMJ A framework for preventing healthcare-associated infection (HAI) in neonates and children in South Africa (SA) 1. HAI is the most frequent complication of hospitalisation. 2. Despite widespread implementation in high-income settings, few SA healthcare facilities have guidelines on environmental cleaning and even fewer perform routine assessment of cleaning adequacy. Antibiotic resistance patterns and beta-lactamase identification in Escherichia coli isolated from young children in rural Limpopo Province, South Africa: The MAL-ED cohort 3. Beta-lactamase genes were the focus of the MAL-ED study because penicillin-class antibiotics are the most frequently administered. 4. Multidrug resistance is resistance to multiple classes of antibiotics. Trends in admissions, morbidity and outcomes at Red Cross War Memorial Children’s Hospital, Cape Town, 2004 - 2013 5. Pneumonia and diarrhoea admissions decreased markedly over a 6-year period, but remain the most important causes of hospitalisation. The accuracy of nurse performance of the triage process in a tertiary hospital emergency department in Gauteng Province, SA 6. The South African Triage Scale categorises patients into different colour groups depending on the severity of their condition. 7. Most patients presenting to the emergency department in this study had non-traumatic pathology. 8. Non-trauma patients were more likely to be incorrectly demoted when incorrectly triaged, whereas trauma patients were more likely to be promoted.

CME Prevention of ingestion injuries in children 11. Coins are the most commonly ingested foreign body in SA children. 12. Ingestion of concentrations of bleach retailed for household use frequently leads to oesophageal stricture formation. 13. Ingestion of multiple small strong rare-earth (neodymium) magnetic balls presents a high risk of enterocutaneous fistula formation, even if no other metal objects are swallowed. 14. An old, spent ‘button battery’ in the oesophagus may be allowed 24 hours to pass spontaneously before considering endoscopic removal, as the risk of morbidity is low. 15. Major consequences of ingestion injuries are rare. Schoolbus driver performance can be improved with driver training, safety incentivisation, and vehicle roadworthy modifications 16. Road traffic accidents in the school transport industry in SA are often attributed to driver factors. There has been no significant reduction in SA’s road traffic 17. mortality rate in the past decade. 18. General driver research indicates that only 8% of school transport drivers were found to have sufficient knowledge to drive cars. School transport drivers appear to perform relatively better 19. than general motorists with regard to key driving performance indicators (speeding, acceleration, braking and cornering) for the particular review period. 20. Age and gender (male) are highly significant contributors to unsafe driving behaviours.

A randomised trial comparing laparoscopy with laparotomy in the management of women with ruptured ectopic pregnancy 9. Ruptured or bleeding tubal pregancies are generally the result of poor contraception services, high numbers of unintended pregnancies and few early pregnancy confirmation visits. 10. In this study, operating time was significantly longer for laparoscopic surgery compared with laparotomy.

Readers please note: articles may appear in summary/abstract form in the print edition of the Journal, with the full article available online at www.samj.org.za

A maximum of 3 CEUs will be awarded per correctly completed test.

INSTRUCTIONS 1. Read the journal. All the answers will be found there, in print or online. 2. Go to www.mpconsulting.co.za to answer the questions. Accreditation number: MDB015/047/01/2017

March 2017, Print edition

Oxytocin/Ergometrine

Syntometrine AD Medical Mags.indd 2

2015/12/08 12:16 PM

1016-4849 AI Ebatine 2017 A4 Advert.qxp_Layout 1 2017/02/17 7:49 AM Page 1

ti Ebi

Ebitine MEMANTINE HYDROCHLORIDE

The ART of HOLDING ONTO MEMORIES S4

Ebitine 10 mg. Each film-coated tablet contains memantine hydrochloride 10 mg. Contains sugar: Lactose monohydrate 151, 91 mg. Reg. No. 45/32.16/0496

For full prescribing information, refer to the package insert approved by the medicines regulatory authority. 1021476 02/2017. Adcock Ingram Limited. Reg. No. 1949/034385/06. Private Bag X69, Bryanston, 2021. Tel. +27 11 635 0000 www.adcock.com