I'M INSIDE MEDICINE MAGAZINE by Inside Medicine

The comprehensive guide to medical resources

Medical Advancements

HUMANinterest Provider awareness

Surgical

technology

Health&Wellness

Research

patient testimonials

appreciation for our

CONTRIBUTORS whosharewith Purpose

M EDICAL DISCIPLINES orthopaedic neurology mental health infertility urology ENT spine surgery rehabilitation dentistry pain management anesthesia dermatology endocrinology

cardiology podiatry oncology internal medicine family medicine pediatrics lifestyle medicine critical care infectious disease pathology radiology vascular

Join our mission to establish and grow an alliance among our community and healthcare providers. Together, we can change the way healthcare information has been and will be distributed for years to come. To reach our readers, whether through editorial contribution or advertising, please contact Kelly Reese at kellyreese.im@gmail.com or 256.652.8089 The information and opinions contained in this publication constitute general medical information only and should not be construed as medical advice. Before making important medical decisions, readers should consult with a physician or trained medical provider of their choice and have their needs and concerns assessed in a clinical setting appropriate for their problem.

Adam Weiger Amber Davis, R.N. Anne C. Jewell Ashleigh L. McKenzie Belinda Maples, M.D. Ben Macklin Bobi Jo Creel, MSN, CRNP Brett Davenport, MD Brian Baer Cameron Smith Page Carmen Moyers RD, LD Christen Burns Bridges Cobb Alexander, MD Crystal Barber, MBA Curt Freudenberger, MD D Kishore Yellumahanthi, MD, MPH David B. Engle, MD, MS, FACOG David Kumbroch Donald Aulds, MD Elisa Brooks Elizabeth McCleskey, DO George Faison, MD Greg Brown Heather Mendez Heather Morse, MS, ATC, OTC Jackie Makowski Jarrod Roussel, PA-C Jason Lockette, MD, MBA Jill Windham John Johnson, M.D. Jonathan Ramsey, MD Josh Woods Julie Drzewiecki, MS, RD, CDE Kaki Morrow Kari Kingsley, MSN, CRNP Kelly Reese Kimberly Waldrop, MA Kristin Scroggin LaChara Fletcher Larry Parker, MD Margetta Thomas Marilyn Ligon, MD Mark Beaird, LPC, NCC Matthew Clayton, M.D. Michael Beuoy, PT, Cert. MDT Michael Potter Michael Salter, MD Neeta Kohli-Dang, M.D. Neil Lamb, PhD Nick Thomas Nikki Rohling Nisha Mailapur Noel C. Estopinal, MD Patricia Hartley Patti Hutchison Paul J. Fry, M.D. Paul Vandiver, OD Philip B. Adamson, MD, MSc, FACC Rachel Sullivan, MFTA, CFLE-P Ragan Bailey, MA, ALC Ray Sheppard, Jr., MD Rodney Farmer Salpy Pamboukian, MD Shelly Rich, R.N., LBSW Shivani Malhotra, MD Stephanie Perez, PT, DPT Sydney Taylor Teairah Wilder Tiernan O'Neill Traci McCormick, MD Victor Chin, MD William T. Budd, Ph.D Winston T. Capel, M.D., MBA, FACS, FAANS

Dear Readers-

consumer Guide to HealthCare

If eating an apple a day kept the doctor away, we would invest in an orchard, right? Better, if we understood our human make-up as rare and complex, could we outrun illness all together? At Inside Medicine, it is our desire to compile information that provides educational tools to act as a guide during healthcare challenges. As we face the uncertainty of a global pandemic, we can be encouraged by the revolutionary breakthroughs that are taking place in medicine. And while we cannot outrun the social and economic impacts of COVID, and future unknown healthcare concerns, we can make it easier for people to access educational articles that will satisfy their need for additional medical education. The practice of medicine has certainly evolved over the years. Physicians have now recognized the importance of sub-specialties. Medical facilities are categorized by area of primary focus; cardiology, spine and neuro, vascular, mental health, lifestyle medicine, orthopedics, endocrinology. Many trending specialty centers have popped up around communities to better serve patients and their families. For example, dialysis treatment centers are on the rise across the country. Cancer patients are now given IV chemotherapy among a community of peers, instead of being treated in an isolated environment. These type of changes in medicine allow patients to be encouraged by friends and family, as they walk away with new found hope and faith. In many ways, that is why Inside Medicine exist. As you read articles by our qualified and experienced contributors, many of which are some of the best in the industry, you will be encouraged to keep fighting through the healthcare challenges that all of us will face at some point or another. You will also have access to practical content from how to create nutritious eating habits on a budget, to editorial pieces concerning wellness strategies for every lifestyle. Our editorial is diverse but our focus and overall theme remains the same â&#x20AC;&#x201C; Godâ&#x20AC;&#x2122;s goodness and the promise that we have a hope and a future. With faith, we need not worry. It is a blessing to deliver this information!! We invite you to join us and enjoy all that comes from being encouraged that you are not alone. We are all in this together and we are honored to be a part of your journey.

eese Kelly R

by, Jason Lockette, MD, MBA

HEALTHCARE INNOVATION COMES TO HUNTSVILLE

The U.S. spends more per capita on healthcare than any other country in the world yet we do not have outcomes to support those huge expenditures. We all know this, yet healthcare costs continue to outpace inflation. Why is this, and what can we do to be more responsible with our healthcare resources? I believe empowering consumers with information through technology is an important component of any solution. Let me explain.

How it works

Download the app and chat with K whenever you don’t feel right. She’ll show you what to expect based on people like you who felt the same.

EVERYONE NEEDS ACCESS TO INFORMATION

In a system as complex as medicine where only the providers have the information we all need to make informed decisions, it’s hard for patients to know when and where to go for care, which often leads to over-utilization. As professionals, we’re paid for this, and our payment is often increased if we decide to do additional testing or treatment, whether or not it’s needed or has any measurable impact on the patient’s health. Every year we see overcrowding in emergency departments and urgent care centers during flu season. Very few of those patients receive any measurable benefit from their visit. They are diagnosed with influenza and experience a few days of fever, chills, and body aches regardless of whether they take any medication. This over-utilization adds cost and decreases access to healthcare for patients whose outcomes we can actually affect.

REPLACING “DR GOOGLE”

Meanwhile, online health content is overly general and sometimes incredibly misleading. At Integrity Family Care, we partnered with a new AI powered health app, called K, to give our patients access to information that is based on real cases from similar people who had similar symptoms. K is not intended to replace a provider but, rather, to replace “Dr. Google.” K recognizes the difference, for example, in the significance of a particular symptom in someone who is 25 years old versus someone who is 75 years old, so the app provides users with information that’s actually relevant to their age, gender, and symptoms. In addition, our partnership with K allows our patients to share their K report with their provider if they choose.

When we review patients’ K reports, we see detailed information about their symptoms as well as important symptoms they don’t have. We’re able to reassure patients who might not benefit from a visit while expediting the care of those who may have more emergent conditions. K leaves both patient and doctor more informed, which helps us collaborate faster on developing the right care plan for the patient. Our intent is to decrease the number of unnecessary and costly visits while increasing access for patients who really need to be seen. Wouldn’t it be better if we could devote more of our time as providers to helping patients manage dangerous chronic diseases such as diabetes and hypertension? Better control of these conditions results in fewer hospitalizations and a longer, more productive life. Meanwhile the majority of patients with non-emergent acute issues have enjoyed being able to monitor symptoms at home or pick up a prescription without an in person visit. The feedback has been overwhelmingly positive.

EMPOWERING PATIENTS WITH TECHNOLOGY

Wouldn’t it also be nice if you could see how patients just like you with symptoms just like yours were diagnosed and treated? With this information in hand, patients are reassured to see the kind of care they might expect to need, avoiding

unnecessary visits, the total cost of which can be upwards of $500. We have also seen that by having the ability to share your information with your provider, we can arrange for more timely and efficient access for patients whose conditions warrant further evaluation. K works for adults 18-85 and the app is free in the app store and Google Play. Try it out and see what it is like to use a health app that actually provides relevant, reliable health information. Think about what it would be like to read a K report before walking into an appointment. In fact the vast majority of patients who have shared their reports with us so far have been reassured to rest at home or prescribed medication that they can pick up at the pharmacy without a visit. This is just the beginning of how we can begin to provide practical solutions by empowering consumers with information through technology.

HOW INTEGRITY + K CAN HELP:

K can provide you with information from patients just like you who have had the same symptoms. By having this information, you can then make an educated decision as to whether or not you want to visit your provider. If you aren’t sure, and are a patient of Integrity Family Care, you can elect to share the information with us and we will respond. We might reassure you, expedite your visit, electronically send medication, or coordinate additional testing prior to your visit if needed. Jason Lockette MD, MBA, President, Integrity Family Care 1041 Balch Rd #300, Madison, AL 35758 256-325-1540 www.integrityfamilycare.com

EXAMPLES OF OVER-UTILIZATION AND UNNECESSARY CARE ANTIBIOTICS FOR VIRAL INFECTIONS:

It is estimated that only about 2% of viral upper respiratory infections (common colds) progress to bacterial sinusitis. Even if you are unlucky enough to get a bacterial infection, antibiotics will decrease the length of symptoms by only about one day. Yes, that is correct. Patients spend hours in an urgent care center or ER, pay their copay and deductible, buy an antibiotic, deal with the side effects, all for one day less of symptoms. Consider, also, the added risk of potential allergic reactions, Clostridium difficile infection, and antibiotic resistance and you have to wonder why we continue to do this to our patients.

Send us your results.

Share your report with us when you see the prompt. If we get it before 2pm, you’ll hear back same day. After 2pm, we’ll reply by 10am the next morning.

We’ll fast track your care.

You’ll get a message with suggested next steps. We might recommend rest, medication, a test, or a priority appointment.

Inside Medicine | Late Summer Issue 2018

Telemedicine

By Sanat Dixit, MD, MBA

& the Blockbuster Video Experience

Movies. Seems like we’ve all been streaming lots of movies recently because of the lockdown. On Demand. Rent and watch now. Download and watch later. Sheltering in place has been good for digital media companies. (We have to stay entertained to not go Covid-crazy.) Now recall what the experience of renting a movie was like, not even twenty years ago. You went to the corner Blockbuster, walked the aisles and sifted through hard plastic DVD boxes or (if you were really old-school) VHS cassette tapes; looking for a copy of Gladiator or that movie where Tom Hanks kept talking to a volleyball. Our movie selection experience centered around driving, parking, sifting, waiting, eyeballing microwave popcorn, paying, driving back and hopefully remembering to return the movie in 48 hours. It was what we expected – it was normal, and quite frankly, it stunk. Blockbuster was a huge, $8.4 billion dollar business but then Reed Hastings started a company to redefine the video rental market in 1997. They had a simple idea – make video rental convenient, and skip the store. They had no idea how much they were about to redefine the new normal. Some people would say this is a great comparison to telemedicine and the “typical” venue of healthcare. This is almost true, but not quite. COVID-19 has starkly reshaped what’s normal in healthcare. Social distancing bred a near complete standstill of most hospital operations. Clinics and physician offices saw a drop in patient visits. (Waiting rooms became less popular than Nick Saban loitering at Toomer’s Corner.) But, in reality, doctors and patients still needed to see each other. In a moment that can be considered monumentally novel, the Centers for Medicare & Medicaid Services slashed the red tape associated with telemedicine visits, enabling access and ensuring reimbursement for services previously not covered. The scope of technology approved to allow virtual visits between providers and patients was also expanded; allowing for Facetime and Skype to be used for video chats, at least temporarily. What is telemedicine, exactly? Simply put, it’s a way of sharing health information and providing care using modern telecommunication devices, when the doctor and patient are not physically together. The most commonly used is video

“

chat, but other examples include use of secure messaging and remote patient monitoring. I think of it as a supplement to the traditional doctor visit, not a replacement. I’ve used virtual visits in some way, shape or form for the better part of 6 years. I quickly learned that most of the sales pitches around telemedicine centered around technology solutions geared to hospitals, like robots that made hospital rounds, and less around allowing physicians to provide better care. I started my first telemedicine company in 2014 with a focus on managing avoidable hospital readmissions from nursing homes and rehab facilities. (One in four nursing home Medicare patients were readmitted to the hospital and those readmissions cost Medicare in excess of $11 billion in 2011 alone.) We discovered the most valuable element wasn’t the technology, it was the ability to keep the onsite nurses and offsite doctors connected. Empowering front line care staff allowed for better patient care. Patients liked being looked inon by their doctors; while their family members found it reassuring. What we also discovered was that even though we were solving a significant healthcare problem, the nursing homes didn’t want to adopt the service because the status quo was good enough. (It wasn’t.) I also used telemedicine as a neurosurgeon to help triage offsite patients at community hospitals where a neurosurgeon wasn’t readily available. This enabled us to provide more appropriate care closer to home for most patients, who most definitely did not need to be airlifted 100 miles from home to have me say they wouldn’t need surgery. The democratization of tele-health came out of necessity; but the services have been available for many years. Many health plans offer tele-health visits through established provider platforms like Teladoc and American Well. Many large health systems offer their own tele-health services for things like front line triage of acute stroke patients. The promise of increased access and improved efficiencies fostered an uptick in telemedicine companies; offering up everything from generic HIPAA compliant video chat platforms, to well funded startup companies offering direct-to-consumer healthcare services. Patient focused telemedicine has also become associated with technology - and that is both a good and bad thing. Many of you may

COVID-19 has starkly reshaped what’s normal in healthcare.

have already had your first telemedicine encounter, running the gambit from being a great visit to a frustrating placeholder until you could physically be seen in the office. The reality is telemedicine is not about what device, app or gadget you’re using. It’s about allowing patients and doctors more direct access with each other, and about delivering a better healthcare experience. By the time you read this, we will hopefully be well past the peak of the COVID curve. Everyone has been clamoring for a return to normalcy. Hospitals and physician clinics may return to something close to normal, but it will never quite be the same. The pandemic forced the system to adapt and evolve. Another spike in cases may be on the horizon very soon. We discovered there were some unique benefits and efficiencies to telemedicine and it’s not going away. Let me say that again - IT’S NOT GOING AWAY! Before the COVID pandemic, we ran a pilot at SportsMED using telemedicine to interact with post surgical patients. We found patients enjoyed the convenience of a virtual visit, stayed more engaged with their post operative care plans, and described a better experience overall. We’re working on the next phase to minimize wait times and improve access to our providers. (I cannot imagine anything more frustrating than taking time off work and wasting 4 hours of the day, to have a 5 minute check-in with your doctor.) Some people still want the status quo, because it’s familiar and waiting is what they’ve come to expect. I would argue if you’re spending 4 hours in a waiting room to see a doctor, maybe neither one of you is doing it right. Not every telemedicine visit is going to be the same. Some providers will use it more effectively than others. Done poorly, it adds little value - sort of like putting a drive thru window in a video store. Done correctly, it becomes a game changer for healthcare. Then again, some things will never change - some doctors will expect patients to wait to see them, and some patients won’t feel comfortable unless they are seen in a hospital or clinic for every healthcare visit. Things evolve and tastes change, especially when something like Netflix comes along and shows us how much easier and better it can be to accomplish certain things. Blockbuster Video declared bankruptcy in 2010. Netflix grew to an enterprise value of over $201 billion because they delivered what was really important to their customers improved access and offered a better experience. Nowadays, no one should settle for the Blockbuster experience from 20 years ago, even in healthcare - especially in healthcare.

Dr Dixit is a neurosurgeon with SportsMED Orthopedic & Spine Center. He is the founder of two tele-health 1companies. He enjoys movies but always paid a late fee when renting DVD’s at Blockbuster.

Simplifying Healthcare Access: by Nemil Shah, M.D.

Timeliness in providing access to health care varies widely. Delays in access to health care have multiple consequences, including negative effects on health outcomes, patient satisfaction with care, health care utilization, and organizational reputation. Patients typically face long wait times to both make and get appointments. At the same time, providers cannot easily fill no shows, cancellations, or off-peak appointment times in their clinics. Mismatched supply and demand and a provider-focused approach to scheduling play a large role and barrier to timely health care access. Increasing numbers of patients are also opting for convenient care facilities or clinics for treatment of medical conditions requiring non-emergency or non-urgent care. However, information to enable potential patients to make informed decisions in selecting a particular convenient care facility is also limited. To find useful information (e.g. “in network”, “procedures performed”, “consumer rating”, “hours of operation”, “right provider for right problem”, “finding a convenient care location close to patient’s location”, “wait times”), patients generally have to do some digging, check multiple sites, and waste time waiting. I created ApproXie out of the necessity to bridge the healthcare access and scheduling gap to improve healthcare delivery, reduce wasted time, and to empower both patients and physicians. Not only does improved access to care prevent disease, but it has far-reaching downstream effects. The intangible benefits of optimizing access and scheduling include improvements in quality of care, lower healthcare costs, and improving the utilization of care centers. ApproXie matches underutilized provider supply with patient demand to facilitate same day visits and referrals in two ways: a mobile on-demand app and a web-based telemedicine application. In a society increasingly reliant on smartphones, ApproXie leverages digital technology to raise brand-awareness for care providers, fill vacancies and no shows while making it easy for patients to access information about health care, their options, and save time. Our mobile app also eliminates waiting on the dreaded automated telephony service when booking an appointment. In layman’s terms, if Uber, Task Rabbit, and OpenTable had a beautiful baby, then you would have ApproXie. For added convenience, ApproXie also lets patients utilize a facetime-like system that enables patients and providers to connect over video. Whichever option you choose, ApproXie is ultimately THE solution for efficiency in a health care system that deploys its most valuable resource—highly trained personnel—inefficiently. We hope to transform access by working with you and for you.

www.approxie.com

•

Ear, Nose & Throat DoctOf{ENT)

Cardiologist

EwlcamjmegqrĀ

Neurologist

Mnfrf_jkmjmegq/Ā

Dermatologist

Psych1atr1st

Surgery

PrimarylUrgentlER

'"" Seclect Provider Book first Available

****'

NinaO.Tony

(5-45) 1910Clrroe!BldcAc9llu!A.OIC7'1

BOOK NOW

Day 1

in Medicine by Nemil Shah, M.D.

It’s clear that Amazon’s meteoric rise didn’t happen by mistake. Jeff Bezos in his “Day 1” letter to shareholders outlines the importance of executing an unparalleled customer experience. By treating each day at Amazon as his first day, he has been able to create a platform for all sorts of independent retailers and services while passing the savings along to us, the consumer. Amazon makes accessing virtually anything, convenient! Amazon’s marketplace, true to it’s name, enables natural selection through the survival of the fittest. Why can’t we treat every day as our first day in practice in medicine? Competition fundamentally reduces costs while improving quality. Instead of arguing that Amazon monopolizes the retail industry, we should look at it as a platform that has transformed the retail industry. It reduces the barrier to entry for independent retailers and enables access to consumer-reviewed products which we otherwise may have never even known about. Amazon’s competitive e-commerce marketplace emphasizes quality in the customer experience and the online retailer experience. Quality care, or the lack thereof, in the healthcare system needs an “AMAZONing”: improvement in quality while reducing costs. Unattached and non-relational patient care is becoming a standard in the healthcare industry. There appears to be a shift from a once sacred doctor-patient relationship to one in which there has been a growing trend of patients who have determined the doctor-patient relationship is not a good use of their time. The growth of retail clinics, convenient care options, and telemedicine has enabled patients the opportunity to find care when they need it most: when they are sick! Independent clinic operators and private practice physicians should ask themselves why convenient care options are growing instead of giving up on their careers and practices. It’s obvious, these services exist in part because of the poor patient experience in healthcare. How many times have you called your doctor’s office and waited 10-15 minutes on an automated telephony system only to be told by the secretary “sorry please come in tomorrow or next week”? How many times have you had to wait to get an appointment, wait in the waiting room, wait in the clinic room, and been completely exhausted after completing your appointment? How many times have you been referred out to another specialist, lab/imaging, and/or ancillary service and faced similar waits and wasted time?

The â&#x20AC;&#x153;doctorâ&#x20AC;? appointment experience has been terrible for years. Today, we are experiencing a boom in on-demand care services addressing that problem. Greater access to care through new models, however, is stressing an already-stressed healthcare system. Greater access means greater utilization of care away from the once sacred doctor-patient relationship. Without the tools to facilitate convenience, primary care practices now consist mainly of elderly patients with multiple medical problems who need more support and attention. The younger, healthier, and more tech saavy patients are seeking episodic and convenient care options. The system needs a great re-balance of the patients to ensure the future quality of care, but how? Providers NEED the RIGHT tools to adapt to the new healthcare landscape in order to stay competitive. Practice operators NEED to RECAPTURE and RECONVERT patients while reducing the barrier of high real-estate costs and marketing expenses. What is the solution? A competitive marketplace platform that provides an unparalleled patient care experience while enabling physicians reduced barriers and greater opportunities to access new and existing patients: ApproXie Share your thoughts with me on twitter @nemils or @approxiehealth or visit us at approxie.com

Preventing Provider BurnOUT

by Kari Kingsley, MSN, CRNP

Dr. Lowery: Throwing back his third cup of lukewarm 3-hourold coffee as he’s running over an hour behind in clinic, the good doctor rolls his eyes as he picks up the chart to Room 7. It’s involuntary. His body becomes rigid and he struggles to put on his best fake smile as he enters the room. Like a psychic reading Tarot cards, he predicts the seemingly never-ending barrage of questions that await him as soon as he opens the door. His patient doesn’t disappoint. She is holding an entire page and a half of college-ruled hand written questions to go over… in detail… Ethel Flannergan: Nervously moving her eyes from her watch to the back of the door in Room 7 and to the list of questions and symptom log she diligently poured herself into the night before, Ethel waits the hour and sixteen minutes to see Dr. Lowery. She has carefully addressed each symptom she’s had over the last few weeks, months, even years, in an effort to help her doctor sort out the debilitating fatigue she’s been experiencing. She’s been waiting over an hour, first in a waiting room with sick people coughing, and now in a cold and sterile room. She paid a $50 copay, but it’s worth that and more for a chance at regaining her quality of life. These different perspectives are two sides of the same coin. The fictional Dr. Lowery is hands down one of the best in his field. He is an excellent physician but the strain of owning and operating a private practice is taking its toll. The hiring, firing, and staffing issues, along with insurance reimbursement, broken EMR systems, taxes, malpractice insurance, and the ever-present pressure that his patients’ lives are in his hands weighs heavily on his mind. He loses sleep over medical traumas he has seen in his career; he knows that losing a patient can put a permanent mark on a person’s soul. Ms. Flannergan on the other hand is a pleasant person who wants answers (and appropriate treatments) to get her life back on track. Physicians, nurses, medical assistants, scrub techs, nurse practitioners, CRNAs, phlebotomy techs… you name it, provider burnout is real. And it is becoming a real problem. Burnout is the culmination of emotional bankruptcy, disconnection from patients and coworkers, declining career satisfaction, self confidence in your scope of practice, overall exhaustion, and a diminished sense of personal accomplishment. In today’s modern go-go-go society, it is becoming an epidemic. Medical schools and nursing programs train us to strive for excellence. Anything less than superhero status is unacceptable. That can be a lot of pressure. Most of us can’t leap tall buildings in a single bound. We are just human. Oftentimes in medicine, decisions have to be made in the blink of an eye that can save (or cost) someone their life. Medicine, while very rewarding, is a stressful career path. Chances are high you know someone in the medical field that can attest to their rigorous schedules. Increasing workloads, long hours, emotionally and physically challenging patients, high accountability, demanding family members, and a legal environment in which every other interstate billboard is a lawyer offering a big payout, takes its toll. Medical providers are at higher risk to abuse alcohol and drugs, and oftentimes have a higher rate of anxiety, depression, and even suicide. The numbers are shocking. According to the American Foundation for Suicide Prevention (AFSP), 28% of medical residents experience a major depressive episode during training compared to 8% of similarly aged individuals in the general U.S. population. The suicide rate

among male physicians is 1.41 times higher than the general male population and among female physicians, the relative risk is 2.27 times greater than the general female population. In one study, 23 percent of interns had suicidal thoughts. So, what’s the solution? AFSP suggests that physicians and healthcare workers who proactively address their mental health needs are better able to optimally care for patients and sustain their resilience in the face of stress. “Mental health problems are best addressed by combining healthy self-care strategies (which should not include self-medicating) along with effective treatment for mental health conditions.” Regular exercise, a healthy diet with proper nutrition, yoga, meditation, rest, and vacations are just a start. Addressing the emotional needs of the providers is crucial. Perhaps the most important step to addressing provider burnout is talking to someone about their mental health issues. Consider changing work hours, or even positions depending upon the level of stress and anxiety. Nurturing healthy relationships with family, friends, and colleagues is also integral in preventing provider burnout. In a perfect world, Dr. Lowery would be able to take hours to address Ethel’s ailments, but in the real-world providers must manage their time to best serve patients while also preventing their own burnout. Providers aren’t superheroes, but most are compassionate caregivers that entered the medical arena in the hopes of helping others. Providers take a Hippocratic oath to do no harm. They are sworn to uphold specific medical ethics and to put the health of the patient above all else. But they also have a responsibility with that oath to take care of themselves. With a little self-preservation and self-kindness, they will be able to go on treating patients while treating themselves as well. Helpful resources for providers in distress: • Acumen Institute: Specializes in acute distress assessments and education for medical professional. www.acumeninstitute.org • Depression and Bipolar Support Alliance: An advocacy group that provides support, resources and information for people living with depression and bipolar diagnoses. www.dbsalliance.org • National Suicide Prevention Lifeline: Provides confidential support to people in suicidal crisis or emotional distress. 1-800-273-TALK (8255) suicidepreventionlifeline.org • Vanderbilt University Program for Distressed Physicians: Offers a 3-day course that provides help for distressed physicians in a confidential environment. • The American Foundation for Suicide Prevention: Medical provider-specific suicide information, including the documentary Struggling in Silence. www.afsp.org

Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.

if Tuberville gets elected to the Senate, he has decided to donate his salary to the veterans in the State of Alabama.Â

“Organization is the Key to Winning” Interviewed by Greg Brown, Co-CEO & CFO of Brown Precision, Inc.

Tommy Tuberville is best known in our area as the former head football coach at Auburn University. He led the tigers from 1999-2008. During his time there, Coach Tuberville and his team were very successful. They had eight consecutive bowl appearances, five SEC Western Division titles, one SEC Championship, and a 13-0 season in 2004 that lead to Coach Tuberville being named AP’s SEC Coach of the Year. Also during that perfect season, Tuberville was named Paul “Bear” Bryant Coach of the Year, Walter Camp Coach of the Year, Sporting News Coach of the Year, and AFCA Coach of the Year, among other awards. Coach Tuberville has received many accolades and has achieved much success on and off the football field. But he feels it is now time to “give back”. Although he served the public through working with students in public education, he believes he has always had a void of desiring to give back to his country. He wasn’t in the military but he has the desire to serve the people of our country through serving in another way. Tuberville said his father instilled the love of the United States into their family. “This country is the greatest country on earth and gives us so much”. His father Charles Tuberville was a decorated World War II Veteran, landing at Normandy at age 18. Charles Tuberville received 5 bronze stars and a purple heart. He passed away in the military at age 53. The admiration for his father is so apparent when Tuberville speaks of him. This is a big part of the reason that if Tuberville gets elected to the Senate, he has decided he will not take a salary but will donate it to the veterans in the State of Alabama. So that’s where Tuberville is today, running for the US Senate. He has quite the platform and a list of “issues” he is focusing on. For the purpose of Inside Medicine, we were interested in what he had to say about healthcare. Obviously, Tommy Tuberville knows how it feels to be successful.

He has a belief that the United States has a “great structure to be successful, we just need to be organized and the Federal Government has to be involved” in the issues surrounding the increasing cost, delivery and evolution of healthcare. He asserts that healthcare and healthcare costs are on everyone’s minds and everyone’s agendas. He believes the system in place is still good, compared to other countries, but it is almost in peril. Tuberville states, “We have a good structure but need to work on the organization”. He adds, “We need answers to the prices of healthcare and drug costs because people are getting to where they can’t afford it.” Obviously, this is a problem he wants to work on. Although he is against Big Government, he definitely thinks the Federal Government should be “all in” when it comes to healthcare and healthcare reform. “America has the money and resources to be at the forefront and that’s exactly where we should be”. Tuberville told us about a recent study at UAB that President Trump is supporting. He is excited to see the initiative and that the President is on the front lines. With the research they are providing (customized medical treatment on a per patient basis), they are hoping to see a decrease in premiums and an even higher success rate for patients and patient providers. When asked what role the federal government should play in supporting Bio-Tech research, Tubberville responded that “Bio-Tech is what the future of healthcare is all about and the United States should be at the forefront.” In his opinion customized medicine and healthcare on an individual basis is the way to lower the cost of healthcare across the board. Tommy Tuberville is hoping to represent the people of Alabama. He wants to be a voice for people and not for special interests. We are thankful for the opportunity and time he gave us in order to hear his opinions. Find out more about Tommy Tuberville’s stance at www.tommyforsenate.com.

WHY WE NEED ETHNIC DIVERSITY IN MEDICAL RESEARCH by, Victor Chin, MD

Imagine you are being treated for cancer with a chemotherapeutic drug. You assume the drug is approved by the U.S. Food and Drug Administration (FDA) to be safe and effective for your particular cancer condition based upon results from medical research trials. Did you know if you are a person of color your cancer drug may have never been tested in your unique ethnic or racial group? In essence, you could be an unwitting participant in an unregistered medical experiment. MINORITIES ARE UNDERREPRESENTED IN RESEARCH STUDIES: Cancer specialist Dr. Jonathan Loree and colleagues in the August 15, 2019 edition of Journal of the American Medical Association Oncology reviewed 230 cancer drug trials conducted from 2008-2018 that involved over 112,293 participants. Only 7.8% of the 230 studies documented participants from the 4 major races in the United States (white, Hispanic, black, Asian). The percentage of trials including participants from different racial groups did not change significantly over the 10 year period. The percentage of Hispanic and black participants in the cancer studies was far lower than the proportion of Hispanic and black patients who would have disease in the general population. The burden of disease among minority groups was not addressed in the makeup of participants in cancer research studies. THE EFFICACY OF A MEDICATION CAN VARY IN DIFFERENT RACIAL GROUPS: Why is it important to study medications in various racial/ethnic populations? A particular medication’s efficacy may vary depending on the patient population. For example, current guidelines from the American Heart Association recommend that for treatment of hypertension in black patients a physician start with a thiazide-type diuretic or a calcium channel blocker. In research studies, these medications have shown relative greater efficacy in blacks for hypertension as opposed to an angiotensin converting enzyme (ACE) inhibitor, which is often used first-line in other patients. THE ARGUMENT FOR SOCIAL JUSTICE IN MEDICAL RESEARCH: Numerous advocates raise the issue of social justice in medicine - the idea that racial group disparities in the delivery of healthcare and outcomes in health should be eliminated. The inclusion of people of color in medical research is crucial to improving health for all people in our society. The FDA has recognized the importance of diversity in medical research and in 2016 issued a non-legally-binding guidance statement encouraging study sponsors to include more racially/ethnically diverse participants in trials:

“FDA expectations are that sponsors enroll participants who reflect the demographics for clinically relevant populations with regard to age, gender, race, and ethnicity.” In June 2019 the FDA released a new draft guidance statement furthering its encouragement of diversity in medical research in which it stated: “Broadening eligibility criteria and adopting more inclusive enrollment practices will open clinical trials to a diverse participant population reflective of the population that will use the drug if the drug is approved.”

Personalized healthcare and medicine have brought this issue front and center. The keyword here is ‘personal’ which for me involves the reality that every male on my biological father’s side of the family died from cancer. The fact that I have sons that may be affected by the lack of racial diversity in medical research hits home. I could no longer be a bystander when witnessing the lack of ethnic diversity in both genomic research and clinical trials. I thought that if government and policymakers will not address this form of health disparity and health inequality, then it is up to me to intervene and make a positive impact. I want to ensure the treatments of the future apply to people of color.” -Delmonize “Del” Smith, founder and CEO of Acclinate Genetics explaining his inspiration to diversify medical research.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

A CALLTO ACTION FROM ACCLINATE GENETICS: Calls for social justice alone in medicine have resulted in inadequate results. It is time to utilize the unique problem-solving abilities of the world of business to reduce racial differences in health. More than just a headhunter to match people of color to medical trials, Acclinate Genetics aims to build and maintain relationships with college graduates of color. Acclinate Genetics serves as a liaison between the medical research industry and well-educated patients of color by vetting research opportunities and educating its participants about medical research. Acclinate Genetics strives to bridge the lack of trust many minority patients have in the medical research system. By having well-educated active participants of color in research trials, pharmaceutical companies can produce better quality research trials with fewer patients lost to follow-up. By testing in a diverse population, unique efficacies/toxicities of drugs may be found in specific racial/ Acclinate Genetics ethnic groups that would go undiscovered if only a white 601 Genome Way Huntsville, AL 35806 acclinategenetics.com male study population were used.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8

by Jeffrey Hull, M.D.

fter practicing pediatric medicine for 35 years, I was looking forward to the approach of retirement. About five months before the date for my retirement, I was experiencing some mild but puzzling symptoms. Thinking back, these symptoms had been very subtle for about 12-18 months or so. I was noticeably weaker and had a mild tremor (shaking) in my hand when holding a fork at meals. I also had a couple of other mild but mystifying experiences, such as loss, years earlier, of my sense of smell. I literally could not smell a dirty diaper that mothers would instantly notice. Another common symptom was writing very small, no matter how hard I tried to write larger. However, it was a sharp eyed nurse, and problems playing pool that motivated me to go to a neurologist. I felt sure that my tremor and other symptoms were simply age related. My wife went with me to see the neurologist and left an hour and a half later. The neurologist diagnosed Parkinson disease, confirming my worst fears. I was numb. Gradually, shock changed to sadness, anxiety, and depression. By about three months after my diagnosis, I was at a low point, physically and emotionally. I was on anti-Parkinson medication, which seemed to help to some degree with the symptoms of mild tremor and weakness, but I felt depressed and alone. It did not help that while I worried about my illness I was very busy with the closing of my medical practice. I thought there must be something to do more than waiting for new tremors.

Then one day the local newspaper printed a human interest story about the Rock Steady Boxing therapy for Parkinson disease. A group was just forming in Decatur. I called the contact number right away, and I have been in the program for six months. What is Parkinson disease? Parkinson (or Parkinson’s) disease, or Parkinsonism, is a chronic degenerative disease of the brain for which there is so far no cure. It is caused by death of certain types of brain cells which manufacture a substance, dopamine, which is essential for normal function of muscles. Progressive loss of dopamine proceeds over a typical course of 10 to 15 years, although some patients have much slower progression of symptoms. The disease most often affects people 50 years or older, but may appear in younger persons as well. Physical findings in Parkinson disease include a characteristic stooped, shuffling gait; facial weakness (called “mask face” that makes one appear to be angry); eventual trouble swallowing properly; and most characteristic the tremor. This shaking often involves one hand first, and will eventually affect all muscles of the body after a number of years. The Rock Steady program The main method of treatment of Parkinson disease has largely been the use of drugs. Chief among these medicines is L-dopa, a pill that can relieve tremor and other symptoms temporarily, but does not alter

the underlying and ongoing deterioration that remains. Side effects are common, requiring careful monitoring and medication adjustments. Parkinson patients have generally been encouraged to exercise to stay as limber as possible. But in the last few years, research has been found that a program of more strenuous exercise combined with fine motor drills, gait training, and a variety of similar drills targeting significantly extend better well-being. The program is called Rock Steady Boxing. As the name implies, it is centered around non-contact boxing drills, meaning that participants do not hit each other, but spend time practicing flexibility and balance, then fitness and strength, and finally boxing moves and punches on the heavy bags, speed bags, shadow boxing, and a variety of boxing moves that teach the body to restore movement, and reduce tremor. Since beginning the program, Rock Steady Boxing has been a Godsend for me. Rock Steady is a physical

more fluid. Ask us what we are doing, and we say: fighting back! ................................................................

training program to retrain the nervous system to cope with long term effects, but it is a lot more than that. It is a close knit group from diverse backgrounds and different stages in the disease but bound by a common enemy, Parkinson disease. It is about group members helping one another, encouraging, listening - more like a “family” than I ever expected. And most importantly, the program works. Muscle strength increases, balance improves, and joint movements are

Rock Steady Boxing is a nationwide program with programs scattered throughout the country. In our area there are local groups in Decatur and Huntsville. Each leader has been trained at the national headquarters in Indianapolis, Indiana. In Decatur, sessions are from Noon to 1:30pm on Monday, Wednesday, and Friday at Bender’s Gym where they generously provide the use of the gym space at no charge. In Huntsville, sessions are from 9:15 – 10:30am on Monday, Tuesday, and Thursday at a local gym located at 3228 Leeman Ferry Road, Hunstville, AL (Behind Matrix Gym). The phone number for the Decatur location is 256-303-0710, or visit their website at www.decatur@rsbaffiliate.com. For the Hunstville location, the phone number is 256-513-8164, or visit their website at www.rocketcity.rsbaffiliate.com.

[

Eric used a voice computer to speak to a United States Senate hearing— ultimately helping to convince Congress to approve a National ALS patient registry to gather critical data on ALS patients.

by Jill Homan

President, Deep Target

he baby pictures hanging in the hallway reminded me of my own toddler – big smile, chubby cheeks, tiny creases at his wrists and ankles to connect his plump hands and feet … the picture of health. My mind flashed to that day my co-worker and friend stood in my office, chin quivering and voice cracking as he explained to me that the diagnosis was an “atypical form of ALS”. ALS? My mind raced as my then-mentor and CEO further clarified that ALS was “Lou Gehrig’s Disease” and that there was no cure. I recall feeling numb as my mind tried to process that diagnosis, what this family was about to experience, and the last few months leading up to this news. Now, here I stood … looking at these hallway photos and remembering Eric. Eric, was an 18-year-old honor student with perfect SAT scores in Math and Science, had a Georgia Tech academic scholarship in hand, accolades too numerous to list for his musical talents, and an invitation to play in the Georgia Tech Symphonic Band. His speech had suddenly begun to slur, prompting college interviewers to ask him to repeat himself. I recalled my friend asking me if I had noticed and me chastising him for being too hard on Eric … pointing out that he was just a teenager, not a seasoned executive. We both decided it was the laziness and haphazardness of a teen, ready to be done with high school and move on to an amazing college experience …. That was wishful thinking. Eric was one of the youngest people ever diagnosed with ALS and he would end up battling this imprisoning disease over the next ten years, twice the expected lifespan of a person living with ALS. Eric would leave a lasting impact on many over the next ten years. Eric, along with his parents Marcia and Stuart Obermann,

would go on to become tireless advocates for people suffering from ALS. Even after losing his ability to speak, move or even breathe without assistance, Eric used a voice computer to speak at the United States Senate hearing – ultimately helping to convince Congress to approve a National ALS patient registry to gather critical data on ALS patients. Eric also influenced Senator Richard Shelby to champion ALS Research – leading to the eventual acquisition of over $100 million in funding. Eric’s motivation and initiative also helped with the formation of the ALS Association Alabama Chapter and the eventual opening of the Crestwood ALS Care Clinic, an ALS Association Treatment Center of Excellence. The Crestwood Clinic allows ALS patients to see multiple medical disciplines all on one clinic day. Patients have access to a neurologist, physical therapist, registered dietician, speech therapist, respiratory therapist, and social worker. Consultation is also available by referral with other specialists, including pulmonologists, gastroenterologists, ENTs, and psychiatrists/psychologists. ALS patients who are registered with the ALS Association Alabama Chapter may visit the clinic by appointment. Fast forward now seven years since Eric’s passing, my chubby toddler is now 18 and getting ready to leave for college. Indeed, Eric influenced how we raised our son Reid – teaching us to cherish each moment and to realize we are not promised tomorrow. Eric influenced our entire family and taught us that some causes are much greater than ourselves. Eric’s tremendous impact in his short time here serves as motivation for me to continue to keep up the fight for

those living with ALS. I serve as Secretary of the Board for the ALS Association Alabama Chapter, raising funds and awareness and promoting research to find a cure for this terrible disease. Eric’s influence over my thinking and actions continues. My current role in an exciting local tech company has given me another opportunity to question where else we can add value to our community. DeepTarget is a local FinTech (Financial Technology) company that enables banks and credit unions across the U.S. to connect, engage and cross-sell to their account holders using business intelligence and digital marketing. Today, more than 260 DeepTarget digital marketing solutions are in use by credit unions and banks across the country. By automating the use of customer information, these solutions deliver targeted product offers and pinpointed one-to-one messaging to banking customers through mobile and online banking, web and email - wherever, whenever and however they bank. Our mission is being further fueled by financial institutions getting outstanding results in the form of leads and new loans or other transactions by using our solutions, and those still looking for easier and smarter ways to connect to their diverse customer base in a way that is both personal and relevant. We are fortunate to have our base in the wonderful technology and innovation hub of Huntsville and see this as a real competitive

advantage towards driving our accelerated growth. As I said earlier, Eric’s influence continues. It is now serving as a catalyst for me to develop our new DeepTarget Cares program - one where our team works within the Huntsville community to do what we can to make a difference, with an objective to grow our span of care and influence as our company and team expand. .................................................................................................... At HudsonAlpha Institute for Biotechnology right here in Huntsville, scientists are applying their extensive expertise in genomics to untangling ALS and other neurodegenerative diseases in the hopes of identifying better treatments for these conditions. To advance the research into ALS and other neurodegenerative diseases, HudsonAlpha created the Memory and Mobility Fund as part of the scientific advancement fund. “HudsonAlpha is uniquely positioned to identify new ways to prevent and treat ALS. Our experience and expertise, along with our scientific approaches, are providing new hope for patients and families,” said Rick Myers, PhD, HudsonAlpha president and science director.

To learn more and contribute, visit: hudsonalpha.org/memory-and-mobility-fund

Inside Medicine | Holiday Issue 2017

Researchers identify new candidate genetic risk factor for type of dementia by David Kumbroch

We deeply value all contributions we can make to the understanding of dementia. The scientific community is making strides in understanding the genetic underpinnings of a number of neurodegenerative disorders. - Richard M. Myers, PhD, HudsonAlpha Faculty Investigator

Inside Medicine | W inter Issue 2019

Scientists from the Myers Lab at the HudsonAlpha Institute for Biotechnology contributed to finding a newly-identified risk factor for one of the more common forms of early-onset dementia. The finding will help researchers by narrowing the focus for potential diagnostics and one day even treatments. The researchers found that variation in the MFSD8 gene associates with a greater risk of developing frontotemporal lobar degeneration (FTLD), a disease that often has an early age of onset, and which can include difficult-to-manage symptoms, ranging from inappropriate social behaviors to speech problems. The data collected in this new research, which was published in the scientific journal Acta Neuropathologica, suggests that rare MFSD8 variants make it harder for cells to dispose of their waste, which may lead to a toxic buildup of aggregated proteins associated with FTLD. The University of California, San Francisco (UCSF) was the driving force behind the research, while scientists at the Albert Einstein College of Medicine also significantly contributed. HudsonAlpha assisted with the computational efforts as part of the Institute’s first work with the Memory and Mobility Program. “Identifying the risk factors that accompany rare and early-onset forms of dementia gives us a better chance to understand neurodegenerative disorders as a whole,” noted Nick Cochran, PhD, a postdoctoral fellow in the Myers Lab. “With early-onset cases, we can more successfully isolate the genetic factors that go along with a variety of symptoms, which helps us build our knowledge base for the entire field.” Bruce Miller, MD, director of the UCSF Memory and Aging Center, said, “Our continuing efforts to identify the genetic determinants of neurodegeneration will open new doors for predicting, diagnosing and treating these diseases. We are constantly adding to that knowledge bank, and this work is expedited by our collaboration with partners such as HudsonAlpha.” Primary support for this study was provided by the Rainwater Charitable Foundation. Additional support was provided by the Memory and Mobility Program through the HudsonAlpha Foundation. HudsonAlpha Institute for Biotechnology 601 Genome Way, Huntsville, AL 35806 www.hudsonalpha.org

hudsonalpha.org/foundation

HudsonAlpha: Impacting by Maureen Mack

HudsonAlpha Institute for Biotechnology

The statistics surrounding Alzheimer disease are staggering and frightening. More than five million Americans have Alzheimer disease. The cost of Alzheimer: $259 billion in 2017 alone. The human cost of Alzheimer and other dementias also continues to grow. According to the Alzheimer Association, the number of deaths from Alzheimer has increased 89% since 2000. At HudsonAlpha Institute for Biotechnology, scientists are on the forefront of leading technology to help us better understand Alzheimer disease and other neurological diseases.

Disease samples to learn more about the genetic causes of Alzheimer disease and related disorders. Identifying New Causes This unique group of patient samples is comprised of a mix of early onset Alzheimer disease patients, typical Alzheimer patients, those suffering from other dementias and “control” cases. The early onset cases are of particular interest to the science team at HudsonAlpha.

“We know there is a significant genetic component to Alzheimer and related dementias,” said Rick Myers, PhD, president and science director of HudsonAlpha. “Now, we can truly begin to explore those root causes and search for new therapies and prevention strategies.”

“Researching early onset cases increases chances of finding new, causative genes at a lower cost and less time. Hopefully with this large group of rare, early onset patient samples, we can more quickly identify new genes associated with Alzheimer disease in a more cost effective manner,” explained Dr. Myers.

HudsonAlpha scientists will apply a number of different methodologies and experimental processes to a large set of patient

Using a collaborative approach, HudsonAlpha will share findings with the entire research community, which will increase the power to

identify new genes with confidence. This will aid in developing new, targeted medicines that benefit patients. “This is a huge opportunity to advance our knowledge of why some people get these diseases and others don’t,” said Dr. Myers. “Our findings could lead to better screening tools, early detection, prevention, improved medicines and possibly cures.”

Using knowledge from their successful program with another neurological disease, they will explore the potential for gene regulation with Alzheimer disease by identifying all the “on/off ” switches for known Alzheimer disease genes. By learning how to turn off the abnormal genes, research may lead to completely new therapeutic approaches that could significantly slow or stop progression of Alzheimer disease.

Early Detection Based on recent research, it is known that the underlying disease process starts decades before symptoms. If the process can be targeted before symptoms that would be a much better option as early detection of Alzheimer disease is known to improve treatment outcomes. HudsonAlpha will apply its expertise in immunogenomics (applying genomic technologies to better understand the immune system) to help identify the earliest onset of Alzheimer disease. By analyzing the immune response found in the blood of Alzheimer patients, HudsonAlpha can generate a picture of health – called the immune repertoire – that may allow clinicians to detect disease long before symptoms appear or are recognized, making early drug therapies more effective. If successful, this new diagnostic test could offer patients alternatives to the current more expensive tests. Discovering New Therapeutic Approaches All genes have an “on/off ”switch. Controlling how genes are turned on and off is an important process called gene regulation. HudsonAlpha scientists are experts in this method and have experienced positive results.

Live cells from human skin cells that have been grown in the lab as neurons. Watching the cells while they are alive provides valuable insight, such as reaction to treatment. Photo credit: Nick Cochran, PhD

“Often what people really want to know is how close we are to effective therapies, which can be almost as good as a cure,” said Nick Cochran, PhD, a postdoctoral fellow in the Myers lab at HudsonAlpha. “The first key idea is that prevention is going to be the name of the game.” To learn more and support HudsonAlpha’s Alzheimer disease research, visit http://hudsonalpha.org/memory-and-mobility-fund.

By the Numbers: (Alzheimer’s Association) More than

5 million

Americans are living with Alzheimer disease today; that number will triple by 2050

Dr. Myers

Every

66 Seconds

someone in the U.S. develops Alzheimer disease

$259 billion cost for people with Alzheimer

and other dementias to the nation

Nick Cochran, PhD

HudsonAlpha Institute for Biotechnology and Crestwood Medical Center

COLLABORATIVE ALS PROJECT UNDERWAY by Nikki Rohling

Inside Medicine | Spring Issue 2019

Helping patients AND FURTHERING GENOMIC RESEARCH As many as 20,000 Americans live with ALS, and 15 new cases are diagnosed in this country every day. A new HudsonAlpha Institute for Biotechnology project is just underway in collaboration with Crestwood ALS Care Clinic, a National ALS Association Treatment Center of Excellence in Huntsville, Ala. In this project, HudsonAlpha scientists will conduct genomic sequencing and analysis of ALS patients to better understand the underlying cause of the disease. The project is funded through donations made to Impacting ALS, which is part of the HudsonAlpha Foundation’s Memory and Mobility Program. ALS (amyotrophic lateral sclerosis), also known as Lou Gehrig’s disease, is a progressive neurodegenerative disease that affects nerve cells in the brain and the spinal cord. Michelle Amaral, PhD, a senior scientist in the HudsonAlpha Myers Lab, is leading the project. “Through genomic sequencing and analysis, we hope to identify genetic variants that contribute to ALS,” said Amaral. “We want to understand the mechanisms that cause the disease as well as the differences between sporadic and familial ALS. The ultimate goal is to discover biological targets that may be useful for the development of new treatments and therapeutics.” Sherry Kolodziejczak, an occupational therapist and Director of the Crestwood ALS Care Clinic/Cardiac Rehab/Therapy Services/Workers Program, said patients treated at the clinic report a higher quality of life and longer life expectancy. “Our clinic manages each ALS patient case throughout the course of the illness. We have to prevent the crisis before they come, not when they get here, and that's how we can prolong life and give good quality of life,” she said. Led by co-medical directors David White, MD, and Aruna Arora, MD (both neurologists), the Crestwood ALS Care Clinic is the only ALS Association Treatment Center of Excellence in the state of Alabama. The Crestwood ALS Care Clinic is also a Northeast ALS Consortium (NEALS) site. The mission of NEALS is to rapidly translate scientific advances into clinical re-

search and new treatments for people with ALS and motor neuron disease. ALS patient Bryan Stone of Sylacauga, Ala., a NEALS ambassador for the Crestwood ALS Care Clinic, is happy to see that research is happening right here in Huntsville. “It’s exciting to see the testing and the collaboration done here at home and that we can take part in it,” said Stone. “ALS has forced me into retirement and there are a lot of activities that I’m not able to do, but then again, it’s opened up other avenues for me to work with the ALS community and help others.” “Crestwood ALS Clinic physicians and staff really go above and beyond to take care of patients,” said Pam Hudson, MD, CEO of Crestwood Medical Center. “This hopefully will get to the cause of the disease so we don’t have to solely focus on the treatment.”

HudsonAlpha collaborates with institutions all over the world. It is especially exciting to be working on a project like this in Huntsville, so we appreciate Crestwood ’s support and look forward to making even more advances in ALS. – Rick Myers, PhD, HudsonAlpha president and science director

Additional donations are being accepted and will be used to enroll even more patients who are battling ALS. Donations to Impacting ALS can be made at hudsonalpha.org/donate or to the HudsonAlpha Foundation at 601 Genome Way, NW, Huntsville, AL 35806. Inside Medicine | Spring Issue 2019

HudsonAlpha receives $40,000 grant for ALS sequencing project by HudsonAlpha and Crestwood ALS Care Clinic

HudsonAlpha Institute for Biotechnology has been awarded a $40,000 grant from the Crestwood ALS Care Clinic, a National ALS Association Treatment Center of Excellence in Huntsville, Ala. In this collaborative project, called Impacting ALS, HudsonAlpha scientists will conduct genomic sequencing and analysis of ALS patients to better understand the underlying cause of the disease.

ALS (amyotrophic lateral sclerosis), also known as Lou Gehrig’s disease, is a progressive neurodegenerative disease that affects nerve cells in the brain and the spinal cord. Michelle Amaral, PhD, a senior scientist in the HudsonAlpha Myers lab, is leading the project. “Through genomic sequencing and analysis, we hope to identify genetic variants that contribute to ALS,” said Amaral. “We want to understand the mechanisms that cause the disease as well as the differences between sporadic and familial ALS. The ultimate goal is to discover biological targets that may be useful for the development of new treatments and therapeutics.” In the beginning stages, the project will enroll patients that are currently being treated at the Crestwood ALS Care Clinic, where physicians and researchers will collaborate to return and discuss results with families. Sherry Kolodziejczak, an occupational therapist and Director of the Crestwood ALS Care Clinic/Cardiac Rehab/Therapy Services/Workers Program, said patients treated at the clinic report a higher quality of life and longer life expectancy. “Our clinic manages each ALS patient case throughout the course of the illness. We have to prevent the crisis before they come, not when they get here, and that’s how we can prolong life and give good quality of life,” she said. Led by co-medical directors David White, MD, and Aruna Arora, MD (both neurologists), the Crestwood ALS Care Clinic is the only ALS Association Treatment Center of Excellence in the state of Alabama. The Crestwood ALS Care Clinic is also a Northeast ALS Consortium (NEALS) site. The mission of NEALS is to rapidly translate scientific advances into clinical research and new treatments for people with ALS and motor neuron disease.

ALS patient Bryan Stone of Sylacauga, Ala., a NEALS ambassador for the Crestwood ALS Care Clinic, is happy to see that research is happening right here in Huntsville. “It’s exciting to see the testing and the collaboration done here at home and that we can take part in it,” said Stone. “ALS has forced me into retirement and there are a lot of activities that I’m not able to do, but then again, it’s opened up other avenues for me to work with the ALS community and help others.” “Crestwood has had a strong clinical relationship with the ALS chapter, our patients, and physicians and staff who really go above and beyond to take care of patients, but this project is the next step,” said Pam Hudson, MD, CEO of Crestwood Medical Center. “We need to get to the cause of the disease, and not solely focus on the treatment.” The $40,000 grant from the Crestwood ALS Care Clinic will be used to launch the Impacting ALS project, which will start enrolling patients in March. Additional gifts are being accepted and will be used to enroll even more patients who are battling ALS. Donations to Impacting ALS can be made to the HudsonAlpha Foundation at 601 Genome Way, Huntsville, AL 35806.

HudsonAlpha collaborates with institutions all over the world. It is especially exciting to be working on a project like this in Huntsville, so we appreciate Crestwood’s support and look forward to making even more advances in ALS. - Rick Myers, PhD, HudsonAlpha president and science director From left to right: Michelle Amaral, Rick Myers, Pam Hudson, Sherry Kolodziejczak

GENOMICS 101 ON CAPITOL HILL by HudsonAlpha Institute for Biotechnology

We were honored for the opportunity to have a collaborative discussion about how genomics is improving human health and solving key challenges in agriculture. - Neil Lamb, PhD, Vice President for Educational Outreach

Leaders from the HudsonAlpha Institute for Biotechnology, a nonprofit research institute in Huntsville, Ala., were invited to present, “Genomics 101: Exploring the Basics,” on Capitol Hill in June. The educational session was held at the Capitol Visitors Center, SVC 203-2. “It is more important than ever to enhance our understanding of genetics and genomics and the important role they can play as legislation is offered and debated in Congress,” said Sen. Doug Jones, who coordinated the Congressional briefing Legislators and Congressional staffers heard Dr. Neil Lamb, vice president for Educational Outreach, discuss how genetic and genomic information is being utilized in medicine and agriculture to improve human health and secure food supplies. “HudsonAlpha hosts a number of educational seminars for students, teachers, researchers, medical professionals and the public,” said Lamb, “and it was exciting to bring that outreach to legislators on a national stage.” With new discoveries being made every day, “Genomics 101” is an opportunity to give an update on the latest advances and challenges in these fields.

“HudsonAlpha’s mission of Educational Outreach impacts students, educators and decision-makers across the country,” said Richard M. Myers, PhD, president and science director at HudsonAlpha.

We are truly grateful to Senator Richard Shelby and Senator Doug Jones for their interest and support for HudsonAlpha’s work in creating a more genomically-aware public.

Sen. Richard Shelby is chairman of the Senate Appropriations Committee, which has jurisdiction over genetics, genomics, agriculture and other topics discussed today at “Genomics 101”. Sen. Doug Jones is an emerging leader on the Health, Education, Labor and Pensions Committee. HudsonAlpha Institute for Biotechnology 601 Genome Way, Huntsville, AL 35806 www.hudsonalpha.org

Check out the “Genomics 101” session live streamed on the HudsonAlpha Facebook page: www.facebook.com/HudsonAlpha/.

Making sense of it all HOW TO MAKE SENSE OF MEDICAL STUDIES IN THE NEWS Tips from cancer.org It’s not uncommon to turn on the news or browse the web and find headlines promising exciting news about cancer or another medical condition. Headlines like these make it seem like a miracle cure is just within reach: • Breakthrough in cancer research could spawn new treatments • The Promising Cancer Cure That’s Not Available to Americans • Exciting blood test spots cancer a year early • Cancer: The mysterious miracle cases inspiring doctors Many stories like these are based on medical studies, but they often exaggerate benefits, minimize risks, ignore relevant information, or just plain get it wrong. According to the watchdog organization HealthNewsReview, on average media news story about health care interventions merits a score of just 55% out of 100: a failing grade. Answering these four questions help you better judge health care claims you may come across:

1. Did the study involve people? Research studies often start in a lab where scientists develop and test new ideas. If an approach seems promising, it may be tested on animals, often mice. But an approach that works well in the lab or on animals doesn’t always work well in people. Clinical trials are studies that test whether a treatment, device, or other medical strategy is safe and effective for people. Clinical trials are conducted in a series of phases that build on one another, and are designed to answer certain questions. Earlier phases are to find out if a treatment is safe, if it works, or what its side effects are. Later phases test whether a treatment is better than what is already available and may lead to approval by the US Food and Drug Administration (FDA).

According to the watchdog organization HealthNewsReview, on average media news story about health care interventions merits a score of just 55% out of 100: a failing grade.

Only some trials are designed to test the things that matter most to people: whether a treatment helps people live longer, or improves their quality of life.

2. How many people were involved? In general, the earlier the phase of a clinical trial, the fewer people are involved in the testing. The most trustworthy scientific evidence comes from a later phase clinical trial that involves hundreds or thousands of people. Some studies – called case studies – are as small as just one person. News stories about an individual’s successful outcome are interesting and exciting. But they don’t tell us much about the treatment being studied or how it will work in most people.

3. Does the story jump to conclusions? Many studies are observational. They look for a link between a behavior and an outcome. For example, in some studies, people who drank red wine were less likely to die from heart disease. But no one knows if the benefit came from the wine or from something else the wine drinkers had in common. Maybe they also ate more vegetables, or exercised more. Just

statistics

Tips for searching online

because two things happen at the same time doesn’t mean one caused the other. The only way to know for sure would be to conduct a randomized, controlled study, in which two groups of people were treated the same except for the one factor being studied.

4. Does the story add up?

headlines

Numbers can be used to make a result sound more impressive than it really is. For example, a story might say that taking a certain drug lowers your risk of stroke by 50%. That sounds very impressive. But if the risk of stroke among the study population was only 2% and the drug lowered it to 1%, that’s less impressive. And if the drug is expensive or has side effects, taking it may not be worth it to you.

A good online search can help you find answers to your questions and connect you with people and resources to help when you need it most. But a bad search can get you wrong or outdated facts, medical information that may not apply to you, or even worse, an invitation to be scammed when you’re most vulnerable. •

•

Look for trustworthy and reliable websites as your sources. Sites affiliated with groups you already know and trust are often the best places to find quality medical information. This includes nonprofit organizations, government agencies, major medical organizations, and prominent academic health centers. Check with the Health on the Net Foundation (HON). HON is an organization based in Switzerland whose mission is to guide people to useful and reliable online medical and health information. Participating websites must agree to abide by an ethical code of conduct, which covers things like authorship, documentation of materials, and sponsorship of the site. Be suspicious of websites that make claims of “miraculous cures” or “secret ingredients” only available from one company, sites that feature stories of people who have had amazing results from a product without showing clear scientific data, and sites that make it hard to connect with the person or business running the site. Such sites may contain information that is not based on careful science and may deliver misleading information in order to sell you a product.

When it comes to finding out reliable, trustworthy medical information – especially if it’s because you have a health-related problem – your best bet is always to talk to a health care professional who can examine you, your health history, and your unique medical situation.

Genetics for the rest of us Human “blueprint” offers a peek into the future 4 What if the medication you take isn’t working, but you don’t know it? 4 What if you carry potentially devastating diseases you could pass down to your children? 4 What if you, yourself, have an increased risk of cancer? 4 Would you want to know?

Maureen Mack

HudsonAlpha Institute for Biotechnology

The HudsonAlpha Institute for Biotechnology, a nonprofit genomics research powerhouse located in Huntsville, Ala., debuted a new program called Insight Genome in March. Insight Genome decodes individuals’ blueprint - DNA to look for answers that could help predict future health and help people make decisions about their care. “This is information not found in one comprehensive tool elsewhere,” says Howard Jacob, PhD, HudsonAlpha’s executive vice president for genomic medicine. Genomic medicine is the use of an individual’s genomic sequence-the entire set of DNA that makes you unique-- to deliver personalized and precise medical care. “By using whole genome sequencing-- basically spelling out the entire genetic code for an individual-- we can look at genetic changes that make you unique, and identify specific changes to your DNA that put you at risk,” Jacob explains. The genomic medicine program at HudsonAlpha isn’t new; previously, the institute has focused on rare and undiagnosed diseases. More than 130 children with rare disease have been diagnosed through the institute’s collaborative research and clinical work, and new genes linked to previously unknown conditions have been identified. Insight Genome, however, is the Institute’s first foray into genomics “for the rest of us.” “One question that I am continually asked is when can I sequence my genome?” says Neil Lamb, PhD, HudsonAlpha vice president for educational outreach. “We are now able to explore how whole genome sequencing can become transformative for clinical care, and also engage both physicians and patients.” The Insight Genome process is fairly simple. A small vial of blood is drawn and sequenced. Sequencing involves spelling out all the “letters” (remember A-C-G-T from middle school?) in a patient’s DNA — about six billion of them. While humans are eerily similar scientifically, they do vary at about four to six million spots in their DNA. Many of those changes are just simple variation, such as eye color or height. Other changes to the DNA, or variants, are medically meaningful.

“Those are the ones we’re concerned with,” says David Bick, MD, a clinical geneticist at the Smith Family Clinic for Genomic Medicine in Huntsville. “Of the variants linked to disease, some are well-established as pathogenic. That means we know there is a high likelihood of them causing disease. Think of changes to the wellknown breast cancer gene BRCA1 as an example. Other variants indicate you carry a disease. While you may not have it — like a cystic fibrosis or sickle cell — you have a chance of passing it along to your children. There are also variants of unknown significance. We think they may be harmful, but simply don’t know enough them. Yet. “The more genomes we sequence, the more we are learning about human variation and what DNA changes increase risk. We’ve come so far since the first genome was sequenced less than 20 years ago. Projects like Insight Genome are accelerating our discovery,” Bick continues excitedly. Insight Genome is comprised of two genomic clinical tests and must be ordered by a physician: * A clinical report.This is medical information you and your physician can use. Pathogenic variants and carrier status are included in this report. * Pharmacogenomic report from Kailos Genetics, a HudsonAlpha associate company (pharmacogenomics are how your genes impact your response to medications). The test explores more than 100 different medications and how your body will react to them.

Patients are seen at the Smith Family Clinic for Genomic Medicine, which is on the HudsonAlpha campus. Dr. Bick and a team of experienced genetic counselors get a medical history and provide pretesting counseling to explain the nuances of genetic testing.

“It’s important to remember that what you learn about your genome isn’t just yours, it impacts your whole family,” Bick reminds patients. “Before undergoing this testing, we encourage open conversation with family members around just what they would and would not want to know about their potential futures.” Delivering that type of information is part of Kelly East’s role. She is a certified genetic counselor who helps patients understand just what they’re getting into. “Not only what their family will want to know, but just what will the patients themselves be comfortable with? Some people don’t want to know about particular disease risk, such as Alzheimer disease. Others want to know absolutely everything. It’s our job to make sure they understand what information they will get, and how it could impact them,” explains East. For example, while federal law protects people from having their health insurance impacted by genetic testing, those same protections don’t extend to life and long-term disability insurance. And while it is protected health information like any other doctor visit or medical test… “In this era of social media, people self-disclose a great deal more information than the generations before them. So while it’s not legal for a potential workplace to surf Facebook and learn about

your genomic testing and that you may be at higher risk for a certain disease and then not hire you because of it, there’s no absolute guar-antee that might not happen,” warns Jacob. People who decide to do the Insight Genome also have the op-portunity to participate in a unique research study about the impact of genomic sequencing. In the study, researchers at HudsonAlpha hope to learn how the return of genomic sequencing information impacts participants in terms of utility for health, and its perceived utility. Participants in the study will receive a personalized research report from their genome sequence which contains risks variants in their DNA that are linked through studies to common disease risk. Examples include some types of cancer, heart disease, and musculo-skeletal conditions. The research report provided to participants also will give information on specific traits, a noted example being whether one is able to smell asparagus in their urine (not a joke). So who is likely to do Insight Genome? Howard Jacob explains. “I’ve had my own genome done. Several other researchers at Hud-sonAlpha have also been sequenced. Others are discussing it. While I’m lucky and didn’t learn anything catastrophic, I learned very valuable information about medications I take and how one just wasn’t working. That was very useful for me. Adults who want to have children. Who want to empower themselves to engage in better prevention strategies. Who want to do everything they can to be healthy,” Jacob believes. “We have had people of child-bearing age, and people up into their 80’s. This is a very inquisitive, smart city and there is a lot of interest in science. The reasons people decide to do Insight Genome vary, but we are hearing the same feedback regardless of those rea-sons: they found it useful.” While a physician referral isn’t necessary, Dr. Bick encourages people thinking about genomic testing to have a conversation with their primary care doctor anyway. “This works best in a triad of care: you, your doctor, and your ge-nome. The information you learn, that your physician learns, is best explored and acted upon with sound medical knowledge,” Bick says. While physicians are becoming more comfortable with the inte-gration of genomics in the clinic, some feel they need more training. For that reason, HudsonAlpha held a Genomic Medicine Conference in summer 2016, and plans to hold another in March of 2018. “I truly believe this is a better way to practice medicine. I believe we are saving lives already through diagnostics, and will make lives better through genome sequencing for ‘the rest of us.’” -- Howard Jacob, PhD The cost of Insight Genome, which includes the pre- and post-testing physician visits, genomic counseling and the tests, is approxi-mately $7000. For more information on Insight Genome, visit www. smithfamilyclinic.org/insight-genome. To learn more about the In-sight Genome research study, visit hudsonalpha.org/insightgenome.

GeneMatchers

Dr. Greg Cooper

HudsonAlpha Faculty Investigator

HudsonAlpha researchers identify genetic variants that cause intellectual delay in children Matchmaking website helped connect international research team for project Researchers at the HudsonAlpha Institute for Biotechnology, a nonprofit genetics and genomics research institute in Huntsville, AL, along with an international team of collaborators from six countries, have identified a new genetic disorder that causes intellectual and developmental delay in children. GeneMatcher, an online “matchmaking” system for scientists researching rare genetic variants, connected the team members. The research is published online December 22 in the American Journal of Human Genetics (AJHG). “Essentially, we did experiments to understand how variants in the EBF3 gene might change its function during development,” said Drew Hardigan, a graduate student in the Myers Lab at HudsonAlpha and a co-lead author. “The role of EBF3 had been studied in terms of neural development, but had not been previously described as a gene in which mutations cause intellectual and developmental delay. We were able to demonstrate that changes to the gene are the cause of a clinical disorder.” EBF3 was identified at HudsonAlpha as an interesting gene for research through a pediatric genomics program led by Greg Cooper, PhD, a faculty investigator at HudsonAlpha and a senior author for the AJHG publication. Through genomic sequencing and analysis, Cooper’s lab had identified two patients with changes to EBF3. However, his team could not find any similar cases or publications on the gene to confirm the variants were causing the patients’ symptoms. The genetic changes were labeled variants of uncertain significance, or VUSs. The group turned to the website GeneMatcher, which operates like a matchmaker site for scientists interested in genetic variants. Using the online system, Cooper’s team was able to contact researchers around the world who were also interested in VUSs in EBF3. Once connected, the international group performed a statistical analysis confirming the gene was very likely the cause of the symptoms for 10 patients located on three continents. The group then used a variety of genomic assays to investigate the function of the variants.

“It’s an honor to be able to help in even a small way with these significant medical challenges.” “Our experiments help support the statistical data biologically,” Hardigan said, “providing clues to further understand the role of this transcription factor for normal neuronal function.” As the group explain in their paper, the experiments demonstrated that the genetic changes to EBF3 – the same changes found in those 10 patients – disrupt important functions required for normal development. They also found that changes in this gene were likely the cause of about one in every 1,000 patients with unexplained neurodevelopmental disorders. “We were able to combine statistical and computational analyses of genetic data with the results of biological experiments to provide these 10 patients with an answer,” said Cooper, the HudsonAlpha investigator whose pediatric genomics research began this scientific journey. “While this particular diagnosis may not have a simple treatment, these families can stop the often long and costly process of medical testing and specialist visits that accompanies having an undiagnosed disease. It’s an honor to be able to help in even a small way with these significant medical challenges.”

The HudsonAlpha Institute for Biotechnology is a nonprofit research institute, but also has more than 30 for-profit biotech companies on its campus. One company in particular is Serina Therapeutics, a pharmaceutical company that has developed a proprietary, patented polymer technology for drug development. Using this Randall Moreadith, MD, PhD President and CEO of Serina Therapeutics

technology, the company developed a oncea-week injection, called SER-214, which may not only reduce the amount of needed treatments, but it may also become an alternative to levodopa—a common Parkinson’s drug which causes a well-known side effect associated with the disease.

How common is Parkinson disease in the U.S.? As many as one million Americans in the US are presently diagnosed with Parkinson disease, and approximately 60,000 new patients are diagnosed every year. It is one of the most common and debilitating neurological diseases in the US and worldwide, with as many as 10 million patients worldwide.

If a family member has Parkinson disease, what is the likelihood that I will also receive diagnosis? Most patients who are diagnosed with Parkinson disease have the non-familial form of the disease, which means they do not have a genetic predisposition to developing the

disorder. Only about 5 % of Parkinson disease is inherited. That means 95% of the patients who are diagnosed, generally at an age over 50, do not have an identifiable genetic link to developing the disease. There is much work being done to identify genetic links to the disease, and in the future it may be possible to diagnose the disease with a genetic test before one even begins to develop signs or symptoms of the disease.

What types of treatment options are available? There are many treatment options for patients with Parkinson disease, both pharmacological – meaning drugs – to nonpharmacological such as dance and exercise, and finally even surgery. The most commonly prescribed drug for Parkinson disease is levodopa given as an oral formulation

in combination with another drug that inhibits the breakdown of levodopa before it can enter the brain. Once levodopa enters the brain, it is converted to the missing chemical in the brain that leads to the disorder – dopamine. Dopamine is a neurotransmitter that is required for normal coordination … if it is deficient, then one begins to develop the common manifestations of the disorder including tremors, bradykinesia and gait disturbance such as imbalance. There are other drugs that act like dopamine in the brain – we call those dopamine agonists. Commonly employed dopamine agonists include rotigotine – which is available in a transdermal patch, and ropinirole and pramipexole, which are available as oral drugs. All of these drugs can be used to control the symptoms in Parkinson disease, but like many drugs, they have side effects including nausea, somnolence, pathologic gambling, onset of involuntary motor fluctuations known as dyskinesia, and hypersexuality. Other classes of drugs include those that prevent the normal metabolism of dopamine by inhibiting the enzymes that convert dopamine to its metabolic end products in the brain (MAO-B inhibitors), as well as those that inhibit it’s breakdown in the blood (COMT inhibtors). Finally, if the options described above do not provide symptomatic relief, then surgical options are available including an intestinal catheter that delivers levodopa continuously into the small intestive, and an invasive procedure known as deep brain stimulation (DBS). The latter approach involves implantation of electrodes within the brain that provide tiny pulses of electrical stimulation that can provide dramatic improvements in some patients – but there can be complications with the surgical procedure. The intestinal catheter and surgery are generally reserved for patients with significantly advanced disease.

What is SER-214? SER-214 is an injectable candidate drug that can be taken just like you take an insulin shot, except that you would take it once a week. We programmed this pharmacokinetic profile using our polymer drug platform, which allows drugs to be delivered as a single injection. The drug attached to the polymer is rotigotine, which is a known safe and effective drug that can be delivered as a transdermal patch on a daily basis (Neupro). The advantages of SER214 over the patch are significant – you have to shave your body to apply the patch, it often causes significant skin ir-

ritation and itching, and it can fall off if you sweat. There are chemical components in the patch that can also cause an acute allergic reaction. SER-214 goes into the blood directly following the injection – no shaving, no skin irritation, no significant side effects, and it delivers rotigotine continuously over a one-week period. There is no product like this right now, and we are in Phase I development now in Parkinson disease patients.

Have you started clinical trials? We are in the earliest phase of clinical development now known as Phase I. Our Phase I study is being conducted in Parkinson disease patients, and you can read more about this on our website at www.serinatherapeutics.com. On the website, you can pull down a fact sheet as well as the entire description of the trial on ClinicalTrials.gov site.

How far away are we from a cure? That is a great question, and it is the mission of organizations like the Michael J Fox Foundation who want to achieve that. We may be years away from curing the disorder, but in the meantime there are effective treatment options that are available to control the symptoms of the disorder while we work diligently to find a cure for this very common and often debilitating disease.

Alzheimer disease Q&A with Nick Cochran, PhD

ll neurological diseases are interconnected. At HudsonAlpha Institute for Biotechnology, scientists are using cutting-edge technology to better understand neurological diseases, such as Alzheimer disease and frontotemporal dementia. While some advances have been made in treating the symptoms of these conditions, it is critical that we learn more about the genetic factors involved in these devastating and debilitating diseases. Above: Live cells from human skin cells that have been grown in the lab as neurons. Watching the cells while they are alive provides valuable insight, such as reaction to treatment.

Photo credit: Nick Cochran, PhD Above right: Nicholas Cochran, PhD, is a postdoctoral fellow in the Myers lab at HudsonAlpha where he investigates the genetic risk factors or causes of neurological diseases.

Finding answers about one neurological disease may lead to answers about many of them. To help speed discovery, HudsonAlpha has established the Memory and Mobility Fund (M&M Fund) to support new projects and continue existing work in a variety of neurological diseases. One project in particular aims to sequence the genomes of more than 1,500 patients with Alzheimer disease and frontotemporal dementia.

How common is Alzheimer disease in the U.S.? More than five million Americans have Alzheimer disease. Every 66 seconds, someone new is diagnosed with the disease. If a family member has Alzheimer disease, what is the likelihood that I will also receive diagnosis? Estimates for this vary widely, and it is likely because the answer depends largely on the age of onset for the family member. For example, if your sibling or parent had Alzheimer disease and was diagnosed between ages 65 and 85, risk of a diagnosis with earlier onset Alzheimer disease is lower for you. However, if family members happen to have onset before age 65 in multiple generations, itâ&#x20AC;&#x2122;s a good idea to contact a neurologist and/or geneticist, because this is rare and could have a very strong genetic component.

What types of treatment options are available? There are currently two treatments for Alzheimer disease. Neither addresses the underlying cause of the disease. Both can “plateau” progression for about 6 months. Together, they can delay nursing home placement by about two years, so they do have a measureable benefit, but there is a lot of room for improvement.

What advancements have been made so far in Alzheimer disease at HudsonAlpha? At HudsonAlpha, we have been positioning ourselves to analyze whole genomes for Alzheimer disease and other types of dementia. The word “analyze” is important here because there are a few other places that have been sequencing whole genomes for Alzheimer disease and other types of dementia, but the expertise at HudsonAlpha is really top-notch for analyzing the whole genome, and not just the part coding for proteins. The other thing we’ve gotten off the ground recently is cultures of human brain cells – neurons, as well as supporting cells. We’re not doing anything scary to get the human brain cells – we are simply using cells that were re-programmed from an adult’s skin cells. Having this type of culture available allows us to mimic the types of genomic changes we find in patients, which can help provide evidence for or against a given genomic change being associated with disease.

How is studying the genomes of Alzheimer patients going to advance our knowledge of the disease? With science we can never guarantee anything going in, but what we can do is position ourselves for success as well as possible given what’s worked well in the past. So, we’ve done that with Alzheimer disease and related dementias by selecting a group of samples from patients that are highly likely to have one underlying cause of their disease. Specifically, these are earlier onset and/or atypical cases of Alzheimer disease and frontotemporal dementia. Earlier onset cases are more likely to be strongly genetic. We could learn a few different things from these data. One critical thing is that we could find new genes that have variants that cause disease. This is critical because it’s only by knowing what genes have variants that cause disease that we can take any kind of rational approach for therapeutic development. Another key set of observations we could gain from these are identifying biomarkers of disease. We will be making measurements of immune response, which has come into the limelight in the research field recently as being very important.

How far away are we from a cure? Often what people really want to know is how close we are to effective therapies, which can be almost as good as a cure. The first key idea is that prevention is going to be the name of the game. There has been a lot of work lately showing that the most effective therapies in development are performing the best in people who have very mild symptoms. This is probably due to the fact that based on work done recently, we now know that the underlying disease process starts decades before symptoms. So, if we can target that process before symptoms, that would be even better and screening tools are in active development (and some are already approved) with the hope of doing just that. For Alzheimer disease, I would speculate if we could get to two or three effective therapies, targeting underlying disease process, we could make an impact on prevention that is very tangible. Some of these are close to completion, and more and more will read out over the next 5 to 10 years.

What other neurological disease research is happening at HudsonAlpha? We are doing and have done quite a lot of work in different neurologic diseases, from childhood intellectual disability and developmental delay, to major depression and schizophrenia, to other adult-onset neurologic diseases like Huntington disease, Parkinson disease and ALS. I think we gain a lot of synergy by doing this, because while these are distinct diseases, we can often learn things about one disease from another, both from commonalities and differences between them.

HudsonAlpha expands Information is Power initiative HudsonAlpha, Kailos Genetics and Redstone Federal Credit Union team up to bring free breast and ovarian cancer genetic testing to North Alabama

HudsonAlpha Institute for Biotechnology announced today that it will extend its unique breast and ovarian cancer genetic risk testing initiative Information is Power for another year. The announcement was made at HudsonAlpha’s annual Tie the Ribbons luncheon to support breast and ovarian cancer research. Information is Power is a collaborative effort between HudsonAlpha and genetic testing company Kailos Genetics, a HudsonAlpha associate company and developer of the genetic screening tool. The initiative was set to wrap up in October of this year, but thanks to a generous sponsorship from Redstone Federal Credit Union, the initiative will be extended and expanded. Free testing will be available through October 2017 to 30-year-old women and men who reside in Madison, Jackson, Limestone, Marshall and Morgan Counties. Redstone Federal Credit Union said sponsoring the initiative was important to them because of the positive impact that it will have on the community. “We understand the importance of being knowledgeable about your health and risks to your health,” said Joseph Newberry, President and CEO of RFCU. “We also understand that for many in our community, access to such information can be challenging. This is Redstone Federal Credit Union’s way of helping to build a healthy and strong community and we are happy to do it.’’ The test screens for mutations in the well-known BRCA1 and BRCA2 genes, as well as additional genes linked to other cancers. If you are 19 or older and reside in the five counties included in the initiative, the test will be available at a reduced cost of $129. “This type of testing is traditionally done in a context where a person has a family history of cancer, and this initiative makes testing available to people in the community regardless of family history,” said Kimberly Strong, PhD, HudsonAlpha faculty investigator and director of the Ethics and Genomics Program. “Now with Redstone’s support, we are able to offer free testing to 30-year old women and men in the surrounding counties as well.” Kailos said offering free testing to residents in five counties is one step closer to achieving their goal of population-wide genetic testing, which would allow everyone to have access to information about their genes. “Our mission is to give people insight into their genetic data to help them make smarter, more informed decisions for their health,” said Troy Moore, chief scientific officer of Kailos Genetics. “Now that we’ve started to see the life changing impacts of the Information is Power initiative, we are excited to give even more people access to these benefits by extending that opportunity not only for another year, but to all 30-year olds in North Alabama.” Phase two of Information is Power will begin October 29, 2016, at which time 30-year-old men and women who reside in the five counties will be able to order a free test kit. To learn more, visit http://www.hudsonalpha.org/information-is-power.

About HudsonAlpha: HudsonAlpha Institute for Biotechnology is a nonprofit institute dedicated to innovating in the field of genomic technology and sciences across a spectrum of biological challenges. Opened in 2008, its mission is four-fold: sparking scientific discoveries that can impact human health and well-being; bringing genomic medicine into clinical care; fostering life sciences entrepreneurship and business growth; and encouraging the creation of a genomics-literate workforce and society. The HudsonAlpha biotechnology campus consists of 152 acres nestled within Cummings Research Park, the nation’s second largest research park. Designed to be a hothouse of biotech economic development, HudsonAlpha’s state-of-the-art facilities colocate nonprofit scientific researchers with entrepreneurs and educators. The relationships formed on the HudsonAlpha campus encourage collaborations that produce advances in medicine and agriculture. Under the leadership of Dr. Richard M. Myers, a key collaborator on the Human Genome Project, HudsonAlpha has become a national and international leader in genetics and genomics research and biotech education, and includes 32 diverse biotech companies on campus. To learn more about HudsonAlpha, visit: http://hudsonalpha.org/.

About Kailos: Kailos Genetics is a trusted provider of personalized health information. Addressing unmet needs of healthcare consumers and their families is Kailos’ primary reason for being. With its proprietary and robust DNA sequencing enrichment and laboratory information system, TargetRichTM, Kailos helps make personalized medicine affordable and accessible for everyone through the PraxisTM test. Founded in 2010, and based in Huntsville’s HudsonAlpha Institute for Biotechnology, Kailos is committed to providing a simple, trusted and affordable way to help individuals understand what’s in their genes. To learn more, visit www.praxiscanhelp.com/about-kailos. About Redstone: With more than $4.4 billion in assets, Redstone Federal Credit Union is the largest member-owned financial institution in Alabama and Tennessee and one of the 25 largest federal credit unions in the nation by assets. Based in Huntsville, Alabama, Redstone Federal Credit Union serves nearly 388,000 members. Chartered on November 28, 1951, Redstone Federal Credit Union has proudly served its members in the Tennessee Valley area for 65 years and has 25 conveniently located branches across North Alabama and Tennessee. Redstone Federal Credit Union provides a level of service that is not generally available at other financial institutions through its philosophy of - People Helping People.

HudsonAlpha receives $150,000 Alabama Power Foundation grant for bioinformatics program

by Margetta Thomas

HudsonAlpha Institute for Biotechnology has been awarded a $150,000 grant from the Alabama Power Foundation to in-troduce bioinformatics to students across the state. Through a new Charprogram, acterizing Our Exceptions DNA (CODE), HudsonAlpha will engage small groups of college students with authentic genomic research. Students will work to computationally analyze DNA variants – a practice known as bioinformatics – from realworld, anonymous clinical samples. Current sequencing technologies make it possible to obtain the entire genetic code of an individual in a matter of days. Often, the process detects DNA variants, or genetic changes, that are not well understood be-cause they have not been studied. These changes are known as variants of uncertain significance, or a VUS. “A VUS undergoes extensive analysis and testing to deter-mine whether it has a role in the development of a trait or disease, a process that is very time consuming,” said Michele Morris, workforce development lead at HudsonAlpha. “Because of this, VUS interpretation has historically been conducted in larger universities. Through CODE, we want to lower those access barriers.” In doing so, HudsonAlpha is collaborating with five Ala-bama colleges and universities across a broader scope of academia. Schools range from nonprofit, t o l arge c ommunity colleges, historically black colleges and universities (HBCUs), and liberal arts: • Alabama College of Osteopathic Medicine • Alabama State University • Birmingham Southern College • Lawson State Community College • Wallace State Community College

Each school will select a faculty member to serve as program adviser who will then select five to ten students to participate in CODE. HudsonAlpha re-searchers and educators are hosting a two-day work-shop for advisers May 14-15. “It has always been the mission of the Alabama Power Foundation to support advances in our state. As technology continues to evolve and innovation is more vital than ever, it is important that we continue to expose Alabama’s students to cutting-edge initiatives to ensure their success,” said Myla Calhoun, president of the Alabama Power Foundation. “Pro-grams like this one can be real game changers for these students, and we are proud to provide support.”

Pilot schools will participate in CODE for the 2018-2019 academic year. Students will present their work at a pilot group symposium in March 2019. Following the initial experience, pilot schools will be eligible to continue participation for a second year and this fall, HudsonAlpha will begin recruiting 25 more schools. “Enormous amounts of genomic data are being gen-erated on a daily basis, so CODE participants will have access to that data and work to characterize newly identified DNA variants,” said Neil Lamb, PhD, vice president for Educational Outreach at HudsonAlpha. “We hope this experience will inspire more Alabama students to pursue a career in the STM fields such as genomics and bioinformatics.”

The HudsonAlpha Institute for Biotechnology hosted the eighth annual Tie the Ribbons luncheon to a sellout crowd of 1,400 on September 22 at the Von Braun. The event raises funds and awareness for the Breakthrough Breast and Ovarian Cancer Research Team, a group of scientists committed to the goal of using genomic science and HudsonAlphaâ&#x20AC;&#x2122;s state-of-the-art technology to make new discoveries in breast and ovarian cancers. Through collaborations with scientists around the nation, the team is working to find biomarkers that lead to earlier, more accurate diagnoses and new pathways for more effective and targeted treatments.

Faculty Investigator Sara Cooper, PhD, gave an update on the team’s latest research at the event. “The problems we’re trying to tackle are very personal,” said Cooper. “When I see my friends and family facing cancer, it makes me feel ever so slightly better to say I’m working on solving it.” Attendees also heard from Kimberly Strong, PhD, HudsonAlpha faculty investigator and director of the Ethics and Genomics program. Strong gave an update on the Information is Power initiative, a unique initiative launched in October 2015. Thanks to a generous sponsorship from Redstone Federal Credit Union, the initiative will now offer free breast and ovarian cancer risk genetic testing to 30-year-old women and men who reside in Madison, Jackson, Limestone, Marshall and Morgan Counties. HudsonAlpha is collaborating with genetic testing company Kailos Genetics, a HudsonAlpha associate company. “We’ve processed test kits for close to 400 30-year-old women,” said Strong. “Overall, around four percent of the tests have been positive, which means there is a mutation in one of the genes linked to breast and ovarian cancer.” The genetic screening tool was created by Kailos. It screens for mutations in the well-known BRCA1 and BRCA2 genes, as well as additional genes linked to other cancers. “It is our goal to make genetic testing available to all people,” said Troy Moore, chief scientific officer of Kailos Genetics. “Understanding what’s in one’s DNA can help people and their doctors make more informed health decisions.” Phase two of Information is Power will begin October 29, 2016, at which time 30-year-old men and women who reside in the five counties will be able to order a free test kit. To learn more, visit: www.hudsonalpha.org/information-is-power.

About HudsonAlpha: HudsonAlpha Institute for Biotechnology is a nonprofit institute dedicated to innovating in the field of genomic technology and sciences across a spectrum of biological challenges. Opened in 2008, its mission is four-fold: sparking scientific discoveries that can impact human health and well-being; bringing genomic medicine into clinical care; fostering life sciences entrepreneurship and business growth; and encouraging the creation of a genomics-literate workforce and society. The HudsonAlpha biotechnology campus consists of 152 acres nestled within Cummings Research Park, the nation’s second largest research park. Designed to be a hothouse of biotech economic development, HudsonAlpha’s state-of-the-art facilities co-locate nonprofit scientific researchers with entrepreneurs and educators. The relationships formed on the HudsonAlpha campus encourage collaborations that produce advances in medicine and agriculture. Under the leadership of Dr. Richard M. Myers, a key collaborator on the Human Genome Project, HudsonAlpha has become a national and international leader in genetics and genomics research and biotech education, and includes more than 30 diverse biotech companies on campus. To learn more about HudsonAlpha, visit: http://hudsonalpha.org/.

For better or worse HOW GENETICS CAN AFFECT RELATIONSHIPS

Marriage requires working as a team, tackling challenges like joint finances, work-life balance and parenthood. Navigating these challenges impacts how satisfied a couple is in their relationship. Successful problem solving is shaped by factors like communication style, level of trust and a couple’s prior history. Now scientists say genetics might also be a player. Social support – feeling that one partner understands the views, opinions and abilities of the other – is an important measure of marital satisfaction. Another is attachment security, the feeling of emotional safety that comes from others being responsive to our needs. Two scientific publications – one in the Journal of Family Psychology and the other in PLOS One – illustrate how variations in a gene previously linked to personality can also be associated with patterns of behavior and emotional response that ease or increase marital pressures. However, before you conclude that genetics predetermines the fate of our relationships, let’s dig a little deeper in the findings. HOW GENETICS CAN AFFECT OUR RELATIONSHIPS The most recent papers build on already-published research into the effect of variations in OXTR, the Oxytocin Receptor gene. The receptors can modify a range of responses to social stimuli, such as stress or anxiety. DNA changes in OXTR have been connected with several personality traits associated with sociability and bonding. For example, a 2009 paper found people with one specific variation in the OXTR gene thought and behaved less empathetically. That same variation also led people to have a stronger stress response, both mentally and physically. As you can imagine, people with less empathy and higher stress relate differently to other folks and the world at

by Neil Lamb, PhD

large. Intuitively, those effects would carry over to marriage. Now researchers can demonstrate that carry-over through careful study. THE ROLE OF GENETICS IN MARRIAGE The team of scientists leading the Journal of Family Psychology study recruited 79 couples and asked each partner to come up with a pressing issue to discuss with the other – a personal problem not linked to their partner or partner’s family. For example, they might discuss a problem with a coworker. The scientists recorded ten minutes of conversation on the subject then analyzed the interaction to see how the partners supported and accepted support from one another. They also surveyed the individual partners to get a broader sense of each spouse’s perceptions about their marriage and obtained saliva samples for genetic testing. Variation along the OXTR gene influenced both the actions and the perception of those actions for men and women. That said, husbands with a specific genetic change (defined as the TT genotype at SNPrs1042778) reported less satisfaction with the recorded interaction with their wives, and lower marital satisfaction overall. The scientists hypothesize that husbands with this variant may have trouble identifying and interpreting the social support signals coming from their partners, and therefore perceive them as being less responsive. The PLOS One study examined 178 midlife and older married couples. Here too, participants provided saliva samples for genetic testing and completed surveys about their feelings of marital security and satisfaction. The study focused on the OXTR variant described above in the 2009 paper (rs53576). When at least one partner had the GG genotype – the opposite of the variation that led to less empathy

and more stress – the couple reported higher satisfaction and security in their marriage than couples without this variant. Individuals with the GG genotype also reported lower levels of anxious attachment, which prior research has shown to be associated with a lower likelihood of jealousy and better relationship quality. Of course, this is still just a small portion of the marriage equation. OUR GENES, OUR BEHAVIORS Genes may have an influence on marriage, but that impact shouldn’t be overstated. The researchers found that the genotypes of both partners combined to account for about 4% of the variance in marital satisfaction. Because both studies analyzed relatively homogeneous populations of caucasian couples, it’s important to replicate these experiments using larger, more diverse populations. However, it’s worth noting that this gene shapes both behaviors and perception of a partner’s behaviors. The authors of the PLOS One study even suggest that the patterns of each partner can rub off on one another over time.

Further research could examine how those same genetic variants shape our interactions with positive and negative relationship experiences. After all, marriage often revolves around understanding and context. The genetics likely do as well. HOW WE LOVE The way we love stems from all kinds of factors, from our upbringing to our genome to the way we respond to the large and small stressors of the moment. Some pieces of our genetic code influence how we process feelings like empathy. So it’s understandable that our DNA recipes play a role in our most important relationships. It’s interesting that we can link genetic variation to how supported a partner feels in a marriage. That certainly seems like a factor that could boost relationship satisfaction. Still, it’s important to realize that the science isn’t saying two people are genetically incompatible because of this one variation — or any other genetic information for that matter. Love, marriage and long-term relationships are complex and we’re just starting to learn more about how genetics play into the way we relate to others.

To see more stories like this, visit www.shareablescience.org

HUDSONALPHA

GLQRGRSRCĀ DMPĀ@GMRCAFLMJMEWĀ

Developing genetic-based

OVARIAN CANCER TREATMENTS by

Annually, more than 20,000 women are diagnosed with ovarian cancer. O f those, the disease is fatal to more than half. HudsonAlpha Institute for Biotechnology is attacking ovarian cancer in numerous ways in an effort to lower those numbers and save lives.

LET'S BEAT BREAST AND OVARIAN CANCER! OVARIAN CANCER IS DIFFICULT TO DETECT EARLY AND CHALLENGING TO TREAT. UTILIZING GENETICS AND GENOMICS TO IDENTIFY NEW SCREENING MECHANISMS AND THERAPIES WILL ULTIMATELY ENHANCE OUR ABILITY TO BETTER CARE FOR PATIENTS AND SAVE LIVES. -Richard Myers, PhD, HudsonAlpha president and science director

A t HudsonAlpha, scientists are marking nonresponsive cells in chemotherapy, investigating an agent that targets pathways known to be important in ovarian cancer development, testing possible therapies with collaborators and using epigenetic approaches. Cancer therapy is moving beyond classical chemotherapy to include epigenetic approaches. Epigenetics research examines gene expression regulation in response to environmental indicators. HudsonAlpha scientists are studying the epigenome o f the immune system. HudsonAlpha is on the forefront o f researching the ways that the immune system can work for targeted cancer therapies. " W e are applying what we know about epigenetics to our work with ovarian cancer," said Devin Absher, PhD, a faculty investigator at HudsonAlpha. "It is a particularly compelling cancer to study. Early detection is paramount. The approaches we are investigating may lead to new therapies. "

In addition to investigating the epigenetic implications o f ovarian cancer, scientists are studying the immune response in tumor cells. Using this approach, scientists hope to understand the role that the immune system has with tumor cell development and how it might be reversed or slowed. HudsonAlpha scientists are also targeting chemotherapy cells to indicate a response, investigating a treatment that targets a known pathway to be important in ovarian cancer development and testing new therapies to treat ovarian cancer. This work is all part o f HudsonAlpha's Breakthrough Breast and Ovarian Cancer team. This group o f scientists is committed to the goal o f using genomic science and HudsonAlpha's state-of-the-art technology to find new breakthroughs in breast and ovarian cancers. This team is working to find biomarkers that lead to earlier, more accurate diagnoses and new pathways for more effective and targeted treatments.

Breast and ovarian cancers are complicated diseases but through the power o f genomic research and medicine, HudsonAlpha is working to find answers that make a difference. Each da y HudsonAlpha's scientists strive to find new breakthroughs that will bring health, healing, and hope to our mothers, wives, sisters and daughters.

For more inf ormation a b o u t HudsonAlpha's Breakthrough Breast a n d Ovarian C a n c e r t e a m , p l e a s e visit fsbqml_jnf_,mpe-`pc_irfpmsef+`pc_qr+a_lacp,Ä&#x20AC;Toattend HudsonAlpha's annual Tie the Ribbons luncheon a t t h e Von Braun Center, visit fsbqml_jnf_,mpe-rgcrfcpg``mlq,Ä&#x20AC; The N o v e m b e r 8th e v e n t benefits breast a n d ovarian c a n c e r research.

your GenE•erosity MAKEs IT POSSIBLE to help those in need Jim Wall has struggled with back problems for more than 20 years, but just ignored the pain and accepted it as a part of life. “My sister used to tell me I had the ‘back walk’ and my wife used to tell me I walked around the house like Frankenstein,” said Jim. “Those were probably early symptoms.” In addition, Jim had swallowing issues – even with the tiniest amounts of food–and balance problems. Little did he know, there was a larger issue at hand.

Taking action After the death of his wife in 2007, Jim decided it was time to take control of his own health, and he began his search for a diagnosis at Emory University in Atlanta, Ga. He saw nearly ten different doctors. “I went to Emory for my back problem and I saw a bunch of different specialists in the neurology department. I saw swallowing specialists, balance specialists and a lot of other specialists. You name it, I saw it.” Jim was diagnosed with primary lateral sclerosis or PLS. Similar to ALS, PLS is a type of motor neuron disease that causes muscle nerve cells to slowly break down, causing weakness in your voluntary muscles, such as those you use to control legs, arms and tongue. “It mainly affects the muscle tone in the lower half of the body,” he said. “It also affects swallowing and anything connected to the neurological system. The prognosis is long-term and you never get better but in most cases, it isn’t fatal.”

PLS explained most of Jim’s symptoms, but not all of them. He also didn’t know what caused his disease, or if it could potentially affect other members of his family. Nine years later, Jim moved back to his hometown of Huntsville, Ala., where his sister, familiar with HudsonAlpha and teaches Project Lead the Way classes at Bob Jones High School, suggested he visit Smith Family Clinic for Genomic Medicine. “She always thought that I had something similar to what my grandfather had,” said Jim, “So she thought it was probably genetic. That’s when I decided to contact the clinic.” Smith Family Clinic, powered by HudsonAlpha, Children’s of Alabama and UAB Medicine, is located on HudsonAlpha’s campus. The clinic uses whole genome sequencing to diagnose rare, undiagnosed and misdiagnosed disease. “These individuals have often gone to physicians all over the country with the question, what do I have?” said David Bick, MD, a clinical geneticist and the medical director for Smith Family Clinic. “One thing that we always try to do is use the simplest possible test to reach an answer. We ﬁnd, however, that approach, while it can solve some of the cases, doesn’t solve all of them. That’s why we use whole genome sequencing, which is a test that allows us to examine all of the genes at once to help those individuals ﬁnd a diagnosis.”

Whole genome sequencing is a comprehensive test, but it is so new, it isn’t often covered by insurance. Cost was an issue for Jim. He knew he needed the test. Now… how to pay for it?

He found his answer through the Hero Fund. The right diagnosis, thanks to your “gene-erosity” The Hero Fund was established to provide financial assistance to qualified Smith Family Clinic patients who need access to genomic medicine. Thanks to an anonymous donation to the HudsonAlpha Foundation, patients have the opportunity to find answers without the financial burden. “When I’m able to call someone back and let them know that they’re approved, it brings tears to their eyes,” said Carol Aiken, clinical operations administrator for Smith Family Clinic, “because they knew they needed to have whole genome sequencing, but the financial means were not within reach. I can’t express to you in words what it means to make that phone call.” After two decades of unexplained symptoms and appointments with countless specialists and clinics, Jim finally had a complete answer. “Dr. Bick diagnosed me with spastic paraplegia type 7 (SPG7),” said Jim. “The symptoms are very similar to PLS but there was one symptom that had no explanation...slight hearing loss. So it was nice to find

out exactly what was wrong. Without the Hero Fund, I would have never gone through this and found out the true diagnosis.” Although there are currently no treatment options for SPG7, or any other form of hereditary spastic paraplegia, Jim said he is just happy to have an answer. “I’ve accepted the fact that I am never going to get better, but it does get me a little clarity to know what it exactly is,” he said. “I just wish I had this done ten years ago.” “We named it the Hero Fund because in our world, those individuals who have these rare conditions really are ﬁghting that problem every day,” said Dr. Bick. “They are the sort of day-to-day heroes of what we are doing so when we ﬁnd answers for these patients, it’s one of the greatest satisfactions of working here at the clinic.”

Your donation could make a huge difference in someone’s life.

Give to the Hero Fund today

www.hudsonalpha.org/hero.

Bringing Back the Disappearing Doctor: Giving Control Back to the Patients by: Crystal Barber MBA & Heather Morse MS, ATC, OTC

There’s little doubt that the front line of medicine — the traditional family or primary care doctor and the patient relationship— has been under siege for years. Choice is what we all want, as most would say. There is a growing cognizance that patients can and should play an important role in deciding their own care, in defining optimal care, and in improving healthcare delivery. There is much growing evidence that engaging patients in treatment decisions and supporting their efforts at self-care and preventative care, can lead to more beneficial long-term outcomes. Patients who are active participants in a shared decision-making process have a better knowledge of treatment options and more realistic perceptions of treatment effects.

The resulting treatment choices are more likely to concur with their preferences, lifestyles, and attitudes to risk. Actively engaged patients are also more likely to adhere to treatment recommendations, and less likely to select expensive procedures.

The Modern Primary Care Model One would assume all of the above benefits would shape a modern, successful model of healthcare. Yet this is not the model patients are exposed to in this modern era. Higher healthcare costs, skyrocketing drug prices, and lower reimbursements for physicians have created an environment that does not support a patient-centered model of care. Doctors are working under more pressure than ever before. Recent changes in health care – such as ramped-up productivity requirements,increased documentation, and new quality metrics have left physicians scrambling to see more patients on a daily basis to cover rising supply costs, higher malpractice rates, and increased staff costs. Even so, patients deserve their undivided attention. These conditions have many patients feeling dissatisfied by the quality of the office visits with their physicians due to time restraints and longer wait times. While the ballpark office visit time is about 11-15 minutes, patients are not getting as much time as they need to address healthcare concerns. By all accounts, shorter visit times take a toll on the doctor-patient relationship and may represent a missed opportunity for getting patients more actively involved in their own health. There is less of a dialogue between patient and doctor, studies show, increasing the odds patients will leave with a prescription for medication, rather than a behavioral or lifestyle change — like trying to lose a few pounds, going to the gym, or electing alternative forpharmaceutical treatments.

What We Can Learn From Old School Practices The term “old school” in many facets of life has negative connotations. We live in a modern, technologically advanced and fastpaced world — and there’s no room for things that hold us back.How did we get to the stage where a genuine and caring doctor has become the odd one out? The old school physician pulled up a chair, took the time to sit face-to-face with their patient, maintained eye contact, and asked open-ended questions. They allowed the patient to express genuine healthcare concerns, directing them when necessary towards the questions that need to be asked to benefit them as an individual. It included some good old-fashioned talking and learning about the patient’s lifestyle and choices. At the end of the encounter, they were given a chance to ask any questions, offered education, and given multiple treatments options. In the former healthcare era, herbs and alternative medicine treatments were offered along with education to help the patient understand all the options available. The treatments were then used in conjunction to offer the patient the best outcome possible. The modern era of medicine has lost some of the key components that made medicine successful in the first place. Methods like house calls and alternative forms of medicine offered patients options to get involved with their healthcare, alternatives medicines that would not cause additional addiction and further harm the body, and face to face time to be educated and heard.

"In 1930, about 40% of doctorpatient interactions were performed through house calls, but by 1980, the rate was down to only 1%." Physician House Calls: An Old Model with a Modern-Day Twist The concept of a doctor coming to a patient rather than a patient going to a doctor is hardly a revolutionary concept yet could be the answer the modern era of healthcare is looking for. In 1930, about 40% of doctor-patient interactions were performed through house calls, but by 1980, the rate was down to only 1%. We now live in a time of convenience and speed. We have grown so accustomed to instant information, feedback, entertainment and more, that we’ve grown impatient with waiting. This transition to an easy access and fast pace life has actually helped to bring back the nostalgic house call.

The new era has also brought the ability to reach information quickly about better healthcare choices that are now being offered to patients via concierge medicine. While we want instant access to our doctor, we also want more time with them to discuss all of our health and wellness concerns.

However, TFM does not fall into the trap of all-or-nothing thinking, expecting patients only to see their providers either in the office or remotely. With a little creativity, we can envision mobile health technologies such as telemedicine leading to the restoration of an almost forgotten medical tradition: The House Call. Imagine the connected provider traveling to patients as needed, with a portfolio of cloud-enabled diagnostic, therapeutic, and decision-support tools at their disposal. Blending the importance of conventional medicine, as you know it today, with the proven results of traditional (the old ways) we can truly bring healthcare back to the patient. Simply managing treatments is no longer acceptable for many in our population. Patients want answers, they want options, and they want to know they are being heard when they voice their concerns.

A New Spin on Healthcare for Your Lifestyle

You can learn more about Traditional Family Medical Center on their website:

The young adult population is very tech-savvy. They are accustomed to using apps and quickly scheduling appointments with a few clicks. They are also very busy working and caring for young children, so a model that doesn’t require them to leave their homes when they have a sick child is very appealing. The search for affordable, convenient healthcare has now brought advancements such as tele-med visits and house calls to the forefront. Patients want healthcare options that suit their lifestyle and are of a higher quality of care. Patients are now seeking out practices that offer not only technology based patient interaction for more affordable rates, but also practices that offer a more patient-centered approach. Services such as house calls and same day telemedicine visits from the comfort of their own home are now what patients are seeking the most.

Traditional Medicine Concepts Meet New Age Lifestyles in North Alabama Old school traditional medicine concepts work. These concepts help patients feel more at ease with treatments, obtain better long-term outcomes, and cut individual healthcare costs. With this knowledge and experience in mind, the owners of Traditional Family Medical Center will open its first location in Huntsville Alabama, in late March 2020. The vision started with traditional family medicine concepts and has grown to include a long list of services including holistic, integrative medicine. This service puts patients at the forefront of their healthcare again. Traditional Family Medical Center offers patients the choice of conventional pharmaceutical treatment options as well as an avenue where patients can choose to treat illnesses with holistic options. Their goal is to truly get to the root problem and not only manage symptoms but work on a reversal of the problem. One very valuable service that will implemented is telehealth, whereby providers use email, phone, text, or video for consultations, reducing the need for time-consuming inoffice visits.

WWW.TFAMILYMEDICINE.COM

Crystal Barber, MBA, is a co-owner of Traditional Family Medical Center & Heather Morse MS, ATC, OTC owner of Salt on the Rocks and co-owner of Traditional Family Medical Center

time has changed medicine

TO THE YOUNG GIRL THINKING OF

Becoming a Nurse... (a note to myself at 17) The world will speak at you in many ways. You will read how the medical world is full of red tape, rules, ratios and never ending charting, but there are a few things they are missing. The world needs good nurses called into the profession; and you, girl, can make a difference. Here is what no one tells you...

by Bobi Jo Creel, MSN, CRNP

No one tells you that you will be scared– Of the pressure. Of messing up. Of not knowing something. Of doing the wrong thing. Of letting down your medical team. No one tells you this will make you a better nurse. No one tells you the ways patients will affect you– With their struggles. With their stories. With their faith. With their determination. With their fight. No one tells you this will make you fight harder. No one tells you there will be days when your faith becomes shaken– When you don’t think you can. When you don’t know what to do next. When you just want to walk out of the patient’s room. When you think, “Why am I here and how do I fight harder for this life?” No one tells you that you will start to believe in you. No one tells you that patients and families will change you– With their harsh words as they are at their worst. With their loss as if it’s your own. With their happiness in the successes of small daily battles. With their joys in new beginnings and the

miracle of life. No one tells you that your character will strengthen through empathy and grace. No one tells you how your coworkers will influence you– To want to be a part of a work family. To understand sometimes all there is left to do is pray. To learn to be a better listener and supporter. To realize that you are not in control. To realize who is. No one tells you that you will learn another side of the meaning of love. No one tells you that you will have days when you feel the fragile flicker of mortality– When a patient gets better and then back to worse in the blink of an eye. When you code a patient for the first time. When you have your hands on a chest praying for that life to stay grounded. When that life breaks it’s earthly chains. No one tells you that you will, in these moments, recognize that there are two types of patients–those who should be able to be saved, and despite all medical resources, aren’t. Those that shouldn’t have a chance to survive, and by divine medicine, do. No one tells you that you will go to church in a patient’s room– When your patient just needs to talk or hold your hand. When your patient’s family members want answers you don’t, and won’t ever, have. When you and your team have exhausted

all efforts and you gather around the bed and pray...and cry. No one tells you you will find your beliefs in those walls because you finally understand He is never far away. No one tells you of the days when– You find peace in your calling. You finally see why you are in this role. You realize that you are a tool and an avenue for great work to be done. You understand that you are human and your best IS good enough. You believe. No one tells you that you’ll look back at your journey with a heavy heart at the ones who branded it and are no longer with you, of the ones who stay with you for all the best reasons, or the days when you felt like you were right where you needed to be. No one tells you that when you are doing what is your calling, that it is all that matters and, most importantly, all that ever will. No one tells you that you will find peace in your work because it is far more than just a job. No one tells you that sometime later you will look back at how it all started, with tears in your eyes, and realize– That the days of doubt were trials and you passed, not always prettily, but you did it and you have built character as a result. That the positive far outweighed the negative. That the days of not knowing your purpose are over. That you are the mother, daughter, sister, and spouse you are because you endured. That the pieces of all these experiences you have carried with you now quilt your being. And, lastly–that even on those long days and nights over the years when you felt your heart breaking and healing, that those on this adventure with you saved a piece of you as well. You’re journey is not over, it has only begun; the trail is merely better marked now as a result of your experiences. It can only make your footprints clearer for those who travel along it with you and for those who follow after you.

In 2014, world-renowned geneticist Dr. Mary-Claire King challenged the HudsonAlpha Institute for Biotechnology to offer free and reduced cost genetic cancer risk screening, regardless of family history.

Alabama men & women learn their cancer risk through Information is Power by Margetta Thomas

HudsonAlpha accepted that challenge and launched the Information is Power initiative in 2015, which has continued to expand. Now in its fourth year, Information is Power has given 4,200 individuals more information about their cancer risk. The test, offered by genetic testing company Kailos Genetics, tests the well-known BRCA1 and BRCA2 genes, as well as several dozen other genes linked to breast, ovarian, colon and other cancers. Jill Howell, a native of Huntsville, Ala. lost her mother to ovarian cancer 35 years ago. After turning 50 – the same age as her mother was when she passed away – Jill made the decision to undergo genetic testing to learn her ovarian cancer risk. Through Information is Power, Jill learned she was at a higher risk of getting breast cancer than ovarian cancer and underwent both a hysterectomy and a mastectomy. "By having the positive results, I was able to qualify to have a hysterectomy," she said, "The surprise was, I didn't know I was going to have a mastectomy, too. "I could have waited for the mastectomy for a year or even two years because the doctors would say we could find that early, but I didn't want them to find it, ever." The test is offered for free to women and men 28-30 years of age who reside in Madison, Morgan, Limestone, Jackson and Marshall county. Other adults, 19 and older residing in those counties, may take the test for a reduced cost of $129. Brad Garland of Decatur, Ala. wanted to learn more bout his health risks and see what he could potentially pass on to his children. When he heard about Information is Power, he decided to add it to his Christmas list. “I have two children, so as an adoptee, it’s great to know that I found out a little bit more about my health history," said Brad. Three percent of participants have received a positive result, which means they have an increased risk of cancer. However, a negative result does not does not guarantee that you will never develop cancer. Hannah Ward – who now lives in Birmingham but was a Huntsville reporter at the time of testing – said after watching her mother and grandmother battle breast cancer, she began to wonder, “Was I next?” This uncertainty drew her towards Information is Power. Although her results were negative, she still plans to frequently see and talk to her doctors about her family history. "The most important part of the initiative is that it starts a conversation,” said Hannah. “I chose to take the test because I knew it was actionable information that would only help me prepare for the future.”

Jill Howell

Hannah Ward

Brad Garland

Information is Power is made possible by support from the Russel Hill Cancer Foundation, community partnerships and philanthropic support. To order a test or gift a test to a loved one, visit information-is-power.org.

STOP

...in the name of love!!! Everybody has heard of mammogram screening for breast cancer. Everybody has heard of Pap smear screening for cervical cancer. Everyone probably knows about screening for colon and prostate cancer. What you might not have heard about is screening for lung cancer. Why is this important? Lung cancer kills more men and women than any other type of cancer. It accounts for 27% of all cancer deaths–more than deaths from cancers of the breast, prostate, and colon combined. Yet, until recently, there was no screening test for lung cancer. Being diagnosed with lung cancer is scary. However, lung cancer does not have to be a death sentence. In 2011 the National Lung Screening Trial reported that individuals who were screened for lung cancer with a low dose CT scan had a 20% lower risk of dying from lung cancer than those individuals who were screened with a standard chest x-ray. This study was finally proof that early detection of lung cancer can result in increased cure. For lung cancer screening to be effective, it is important that only those persons at high risk be screened. High risk is defined by age, years of smoking, duration or years since the person may have stopped, as well as by other possible exposures. Simplified – anyone between 55-74 who has smoked the equivalent of 30 pack years is at high risk (# of packs you smoke per day times # of years smoked = pack years). If someone who has smoked at least 30 pack years has quit smoking within the last 15 years, that person is still at sufficient risk to be screened. Additional risks may also play a role. If a person

is 50 or older, with at least 20 pack years of smoking and any other exposure or factor that adds to their risk such as a previous malignancy, radon exposure, or asbestos or other occupational exposure – he has sufficient risk to be screened. The program involved in the screening is important. Clearview Cancer Institute launched its lung screening program in 2012 after seeing the devastating effects of diagnosing lung cancer in its later stages. We really felt we had a mission and obligation to the community to make lung cancer screening as universally accepted as mammography is for breast cancer. We were joined by our colleagues involved in the diagnosis and care of patients with possible lung cancer, as well as the Huntsville Hospital Health System. With support and effort of all and additional funding from the Russel Hill Cancer Foundation and the Alpha Foundation, we developed the Southeast Lung Alliance. This is a program dedicated to increasing the awareness of Lung Cancer Screening and supporting tobacco cessation as the mainstay in prevention of this most lethal disease. In our community hundreds of your family, friends, and co-workers have already been screened and, yes, some have had their lives saved by finding a unsuspected cancer early enough to be cured. If you or any of your loved ones smoke – stop! But whether you stop now or not, enroll in a screening program for early detection of lung cancer. It could save your life or the life of the one you love.

For more information, go to www.selungalliance.org or www.clearviewcancer.com or discuss lung cancer screening with your physician.

by Marshall T. Schreeder, MD , MPH Clearview Cancer Institute

Cancer Warrior Not all of us will be presented with the opportunity to look death in the face and rise up to fight.

Pammie Eagle Jimmar is the Vice Vice President President of of Small Small Business & Events at the the Huntsville-Madison Huntsville-Madison County County Chamber of Commerce. She would would like like to to especially especially thank the amazing team at at Clearview Clearview Cancer Cancer Institute Institute and Hudson Alpha for continuing their their fight fight to to cure cure cancer. She would also like to to thank thank Inside Inside Medicine Medicine for affording her the opportunity to share share her her journey. journey. 8

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

by, Kari Kingsley, MSN, CRNP

Life always gives you a choice. Lay down and die or stand up and fight. Fighting is not a given. It’s a choice. A choice to become a warrior. But we are not born warriors. Life presents challenges and obstacles, and we make the choice to go to war. Webster’s Dictonary defines a warrior as a person engaged in struggle or conflict. But it is how that person enters into battle that makes them a true warrior. Rather than fighting out of obedience or allegiance, a true warrior engages in battle out of personal choice. On February 21, 2019, Pammie Eagle Jimmar was faced with the battle of her life. On that day, she heard the one word that would change her life forever. Cancer. Through all the amazing advancements in medical science, this one word can shake a person to their core. Pammie was diagnosed with Stage 2 Invasive Ductal Carcinoma. A million thoughts went through her mind as her doctor laid out the unnerving news. “I am human. All kinds of things were going through my mind. I cried and cried and I cried!” Pammie’s thoughts immediately jumped to those she loved. “How would I tell my family and friends? Should I just keep silent?” After crying for what seemed like an eternity, Pammie drove home and told her Mom. Together they decided that this was just a bump in the road and that she, with the help of her family, would get through this. “I remember saying God’s got my back and I’ve got so much FAITH, so let’s get this battle started!” Rather than taking her new diagnosis lying down, Pammie took on this fight with grace, passion, intensity, and intelligence. She had unwavering faith that God’s grace and mercy would see her through. Pammie chose to become a warrior. The next few days were a blur. MRIs, CTs, Bone Density Scans, lab work and doctor appointments flooded Pammie’s schedule. She remembers the fear that came with each test. “It was scary because the machines were so huge, sterile and cold.” Pammie recalls crying at every doctor’s visit in the beginning because of fear of the unknown. This was a new diagnosis. New terminology. She had no idea what to expect. Luckily, she was placed in the care of a compassionate oncologist at Clearview Cancer Institute. The physician immediately told Pammie that together they would win this fight. His main goal was to keep her alive. This was music to her anxious ears. Soon after, Pammie underwent placement for a port-a-cath and began chemotherapy. She underwent a total of 4 treatments of Adriamycin to target

the tumor. Better known as the Red Devil, she renamed it the Red Angel. “This treatment drained all of the energy from me, took my appetite away, and made me sick, however I knew it was working in my favor. Next, Pammie endured an additional 16 rounds of chemotherapy and a lumpectomy, followed by 16 more rounds of treatment in combination with radiation. A series of tests were arranged to determine the amount of tumor regression. Pammie and physician were faced with difficult news. The cancer began to grow in a contained area of the breast. “He went over several options, and I decided to go with a unilateral mastectomy; coupled with 16 rounds of chemotherapy.” After the 11th round of chemo she began to develop neuropathy in her fingers and toes. Her physician again reviewed her options and together they made the decision to stop the chemo treatments. The decision paid off. On September 13,2019. Pammie was considered cancer free. Pammie says she has always had faith. “Faith is believing. I won this battle because of my faith in knowing that I would be cured of cancer coupled with lots and lots of prayer.” A dear friend and cancer survivor gave Pammie a book by Christine Caine called “Unshakable”. She read the little book during her meditation hour daily. She recalls what she calls a “golden nugget” from the book –“Unshakable faith is impossible to change, shake, or beat down. The kind of faith that is confident in knowing Jesus, our Rock and Mighty Fortress. The One who promised to never leave us nor forsake us. The One who causes us to triumph over any hurdle or situation trying to destabilize us or stop us from fulfilling our God-given purpose.” She triumphantly says “I Thank God for saving me. Because of him I am cancer free!” Pammie has been overwhelmed by the support she has received from family and friends. “They have been amazing. My mom is my HERO! She has been with me throughout this entire journey. She has never once left my side.” Pammie moved to the Huntsville area 7 years ago knowing only family members and her boss. “I’d have to say this is the best community I’ve ever lived in. Everyone rallied for me and just stepped in and helped me and my family in more ways that you could ever imagine. My heart is full just thinking about it. I never knew how much people loved and cared about me and my family. I am so blessed to have witnessed the love and support this community has given me.” Pammie says she has surrounded herself with the most positive people. “They radiate positive vibes,” Pammie feels God knew this is exactly what she needed in her life to complete this journey. Pammie is grateful to her coworkers at Huntsville-Madison County Chamber of Commerce for their tremendous moral support. When asked who the most inspirational person in her life is, she answers with grace and pride. “My beautiful mom inspires me every day of my life. “She has been my rock throughout this entire journey and my loudest cheerleader.” She never missed an appointment, scan, test, or chemo

More than 4,200 tests taken already

genetic testing for cancer risk

Pammie is a true cancer warrior.

A simple cheek swab can help empower you to make important healthcare decisions for you and your family.

Learn about your genetic risk for certain cancers including breast, ovarian, colorectal and prostate cancer. In collaboration with your physician and a genetic counselor, use the information to plan future medical care. Remember: you share genetics with your family. What you learn could potentially impact your parents, siblings, children, cousins and others. Have a conversation with your family about the Information is Photo credits: Savannah Pedersen Power initiative. Men are also at risk for breast cancer. The genes included in this test are meaningful for all.

treatment. Pammie also says that all survivors of cancer inspire her daily. “They are mighty, fierce warriors.” Cancer warriors. It is possible to fight more than one battle at a time. “I haven’t shared this with many people but not only was I about to put on all of my armor and fight the battle of my life, I was also going through a divorce. I know this sounds crazy, but I never really got the opportunity to process the divorce because so much was going on in my life. The divorce, the cancer diagnosis, preparing a house to be sold, preparing my baby boy to head off to college 1,300 miles from home, and trying to wrap my head around the changes in my life was a huge pill to swallow.” Pammie’s faith never wavered. “I just knew God would take care of me through all of this.” Pammie knew that He had a plan and purpose for all of this and if she would just have faith and know that He would not put more on her than she could bear she would be protected on this journey. Pammie has helped others by sharing her courageous battle with cancer publicly. She radiates grace and keeps faith that God is always working in her favor. “Cancer is an awful disease and I feel once people know you have it, they begin to feel sad and sorry for you. I never wanted people to feel this way about me. I wanted them to feel hopeful that I would beat this disease. Hands down, I wanted them to know that I had faith and that this too would pass. God was helping me along with their prayers to win this battle. I love this community and after a while, everyone began to see that I was strong and mighty and had faith to get through this journey.” When asked what she would tell someone with a new diagnosis of breast cancer, she replies, “I would first tell them that I am on the battlefield with them, battling this disease with them and that they don’t have to go through this alone. Let your family and friends help you on this journey. Stay positive and surround yourself with positive people, and don’t forget to sprinkle all of the above with a lot of faith.” Pammie has been chosen as the honorary guest speaker at the 2019 Tie the Ribbons Luncheon supporting Hudson Alpha’s breast and ovarian cancer research. She says she is also honored to be recognized as a Breast Cancer Survivor and to be able to share her story with others in hopes of inspiring someone who may be going through the same journey. When she meets those she has encouraged, she calls it receiving Golden Nuggets. “Going through this journey, these were very powerful for me to receive – little blessings from God.” Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.

Pammie is the most courageous of warriors. Not only has she taken onthe battle to save her own life and beat breast cancer, she has also taken on the battle of bringing awareness to her journey in the hopes of supporting and helping others. Blessed be the LORD, my rock, who trains my hands for war, and my fingers for battle – Psalm 144:1.

Head

Neck Cancer by, Noel C. Estopinal, MD

A sore throat is usually a sign of a relatively minor problem like spring allergies or the common cold. But if you have a sore throat that lasts for more than two weeks, you should make an appointment to go see your family physician.

That’s because persistent sore throat can also be a sign of head and neck cancer, according to Dr. Noel C. Estopinal, a radiation oncologist with Alliance Cancer Care in Huntsville. Head and neck cancer, which includes cancers of the mouth, throat (pharynx), voicebox (larynx), sinuses, nasal cavity and salivary glands, accounts for about 5-7 percent of cancer cases nationally. But Dr. Estopinal said it’s more common in states with the highest rates of smoking, smokeless tobacco and alcohol use – including Alabama. “It weighs more heavily in the South than in other parts of the country,” he said. Tobacco smoke contains more than 70 chemicals that have been shown to cause or promote cancer. Meanwhile, alcohol irritates the mucous-covered surfaces of the mouth and throat, making them more vulnerable to those carcinogens. Not all head and neck cancers are linked to cigarette and alcohol use. Dr. Estopinal said human papillomavirus (HPV ) is now a leading cause of oropharyngeal cancer affecting the base of the tongue, soft palate, tonsils and side and back walls of the throat. HPV can be spread through sexual contact, including oral sex. In addition to persistent sore throat, head and neck cancer warning signs include persistent difficulty swallowing, a growing lump in the neck, chronic hoarseness, sores in the mouth that won’t heal, changes in how your voice sounds, and unexplained weight loss. Early detection is the key to successful treatment of head and neck cancers, so get to your doctor if you have any of the above symptoms that last for more than a couple of weeks. “When the disease is caught in the earliest stages, we can often achieve excellent long-term control with less aggressive therapy,” said Dr. Estopinal. “For patients with very small lesions on the vocal cords, a short course of radiation alone can result in a cure rate of better than 90 percent. Other patients may only need to have the tumor surgically removed with no further treatment. If your doctor suspects you have head and neck cancer, the first step is usually a tissue biopsy of the affected area. Once the diagnosis is confirmed, the radiation oncologists at Alliance Cancer Care can develop a customized treatment plan. In addition to Dr. Estopinal, the Alliance physician team includes Drs. Harry James McCarty III, Elizabeth Falkenberg, Hoyt A. “Tres”

Childs III, John F. “Jack” Gleason Jr., Traci McCormick and Stanley Clarke. Depending on the stage and location of the disease, the treatment plan for head and neck cancer may include surgical removal of the tumor by an ear, nose and throat specialist, targeted radiation therapy at one of Alliance’s six locations across North Alabama, and chemotherapy overseen by a medical oncologist.

“Head and neck cancer is one of the most intensive multi-disciplinary cancers that we treat,” said Dr. Estopinal. “We’re fortunate in Huntsville to be staffed with many experienced surgeons, radiation and medical oncologists who have successfully treated head and neck cancer.” If radiation is recommended, Alliance Cancer Care uses Intensity Modulated Radiation Therapy (IMRT) and Image Guided Radiation Therapy (IGRT) to deliver the treatment. A CT scan of the patient is taken before and during treatment to make sure the radiation beam hits only the tumor and not the surrounding healthy tissue. The standard regimen for head and neck cancer is 25-35 radiation therapy treatments over a period of five to seven weeks. Side effects may include fatigue, dry mouth, skin irritation in the treated area, pain or difficulty swallowing, and loss of appetite due to changes in the way food tastes. “With IMRT and IGRT, we’re able to steer the radiation dose around the salivary glands, jaw bone, spinal cord and other sensitive organs while targeting the tumor,” said Dr. Estopinal. “That helps to minimize any side effects from treatment and improves the opportunity for cure.”

by Kaki Morrow Development Manager of Distinguished Events for the American Cancer Society

Imagine

a world free of cancer... a world where no one ever has to hear the news of a life-changing cancer diagnosis. Imagine if a cancer-free world was a reality.

In 1947, the first successful chemotherapy treatment for cancer was discovered by American Cancer Society-funded researcher Sidney Farber, MD. He demonstrated that aminopterin, a compound related to the vitamin folic acid, produced remissions in children with acute leukemia. Aminopterin blocked a critical chemical reaction needed for DNA replication. That drug was the predecessor of methotrexate, a cancer treatment drug used commonly today. Shown above in 1961, Farber also served on the Society’s board as president. Below,the image of Dr. Farber, the photo of the Saturn V first stage (S-1C). This stage was assembled at the Manufacturing Engineering Laboratory at NASA’s Marshall Space Flight Center. With assistance by the Boeing Company, the manufacturer, this first stage was assembled using components made by Boeing in Wichita, Kansas and New Orleans. Finally, the image to the right shows former American Cancer Society grantee Brian Druker, MD. Druker reported stunning success in treating chronic myelogenous leukemia (CML) with a molecularly targeted drug (Gleevec), launching a new era of molecularly targeted treatments. In 2000, the first use of molecularly targeted therapy to treat cancer was successful.

What does the Space Race have in common with cancer research? More than you might think.

At a quick glance, the link between sending a man to the moon and curing cancer might be an easy one to overlook. We live in a country that sent a man to the moon, and this city’s history is so intricately intertwined with the defining moment on May 25, 1961 when President Kennedy challenged the country to put a man on the moon before the decade was finished. At that point there wasn’t a clear course of action to get there, just an undeniable willpower to unite to make it happen. Many technological advancements that had not even been imagined yet had to be made before this challenge could become a reality; from the development of the Saturn V rocket to entire computers and the method for manned orbital rendezvous. This was all new territory, but members right here in our community, the “Rocket City,” banded together to turn what was once science fiction into an undeniable actuality. Like the Space Race and the Moonshot so many decades ago, a cancer-free world is also possible. We, again, as a community and as a nation can achieve the seemingly impossible, and while treatment has come a very long way, the fight is not over, yet. On a daily basis, there are people right here in our community involved in the fight against cancer. Whether it’s the fighters on the front lines, the caregivers and physicians, or even the community activists who directly support the mission to save and celebrate lives, no one walks alone in the fight against cancer. Here in Huntsville, on August 19th under the rocket at the US Space & Rocket Center, the American Cancer Society will be honoring those who are involved in the fight against cancer at the Belles & Beaus Ball. Join the American Cancer Society in imagining a world that is free from cancer, and join us in doing what it takes to make this a reality. Meet the honorees. >>

formerly Summer Lights Celebration

by Traci McCormick, MD

1. EAT 8 TO 10 COLORFUL FRUIT AND VEGETABLE SERVINGS DAILY.

8. EAT CHIA SEEDS AND GROUND FLAX DAILY - 1 TO 2 TABLESPOONS PER DAY.

This should include two to three pieces o f fruit, one cup or more o f vegetables with lunch and dinner and 8-fluid-ounces o f vegetable juice. There is extensive and consistent evidence that diets high in fruits and vegetables are associated with decreased risk of many cancers.

Chia and ground flax are excellent plant-based sources of omega-3 fatty acids.

2.CONSUME 30 TO 40 GRAMS OF FIBER DAILY. You are likely to meet your fiber goal i f you eat 8 to 10 servings o f fruits and vegetables plus one serving o f beans/legumes, one serving o f chia and/or flax seed, or at least two servings o f whole grains daily. Fiber binds to toxic compounds and carcinogens and helps eliminate them from the body.

3.AVOID PROCESSED AND REFINED GRAINS, FLOURS AND SUGARS. Keep white off your plate: bread, pasta, rice, cream sauces, cakes, and more. High sugar foods are usually highly processed and refined, low in nutrient value, and low in dietary fiber. These foods also increase serum insulin and serum insulin-like growth factor, which stimulate cancer growth.

4.LEAN PROTEIN WITH EVERY MEAL AND PLANT PROTEIN DAILY.

By including a lean protein with each meal, insulin levels will be kept more steady. Studies, however, have linked the consumption o f animal protein to breast cancer, so plant based protein is ideal.

5. LIMIT FATTY AND PROCESSED MEATS AND LIMIT DAIRY. Studies have found that a reduced fat intake decreases the risk of breast cancer and o f breast cancer recurrence.

6. INCUJDE HEALTHY FATS LIKE COLD-WATER FISH, CHIA SEEDS, FLAXSEEDS, WALNUTS, SOYBEANS, OLIVE OIL AND AVOCADOS. These foods are high in omega-3 fatty acids. Research is growing supporting a protective relationship between omega-3 fatty acids against the risk o f breast cancer.

9. CONSUME HERBS AND SPICES DAILY. Herbs and spices are full o f anti-inflammatory nutrients that have been shown to reduce cancer risk.

10. LIMIT ALCOHOL CONSUMPTION. As little as 1 serving o f alcohol per day has been shown to increase breast cancer risk.

11. DRINK 1 TO 4 CUPS OF GREEN TEA DAILY. Green tea contains phytonutrients known as poly p henols that provide antioxidant and anticancer properties.

12. ASK YOUR DOCTOR ABOUT HAVING A VITAMIN D BLOOD TEST. Maintain your level above 40 ng/ml through diet and, i f needed, supplements.

13. DRINK PLENTY OF FLUIDS, WATER OR NON-CAFFEINATED BEVERAGES, DAILY TO HELP MEET FLUID NEEDS. Adequate fluids are needed for the body to function optimally.

14. ENGAGE IN DAILY PHYSICAL ACTIVITY TO HELP ACHIEVE AND/OR MAINTAIN A HEALTHY WEIGHT. Excess body weight, as well as low levels o f physical activity, have been linked to an increased risk o f breast cancer in multiple studies.

colon cancer Dr. Michael Dohrenwend Center for Digestive Health 256.430.4427

Karen Fox, CRNP

Are you 50 years or older? Time to get screened for colon cancer... Rectal bleeding, change of bowel habits, abdominal pain? Please feel free to call our office for an appointment or visit our website cdhhsv.com. We are happy to help with questions, concerns, and screenings. Center for Digestive Health 7738 B Madison Blvd. | Huntsville, AL 35806 256.430.4427 | cdhhsv.com

–Benjamin Franklin, 1736

Franklin’s famous quote originally was addressing fire safety, however it has been adopted by most as a reference to health care. The goal of preventive medicine is to avoid an undesirable outcome from happening rather than treating an illness once it has happened. A little prevention is worth a pound of cure. Keeping a problem from happening is much better than fixing one. We live in a busy society. We are saturated with family, careers, always somewhere to be and the to-do list is never ending. We are challenged to find time for taking care of ourselves. It seems like there is always an appointment, a child’s function, a deadline at work or a family obligation that competes with time we need to care for ourselves. However, if we don’t take the time to invest in our own health (an ounce of prevention) then we may be faced with a burdensome diagnosis (requiring a pound of cure). March is Colon Cancer awareness month. Colorectal cancer (or just colon cancer) is a cancer that occurs in the large intestine. Colon cancer is one of the most preventable types of cancer. There are currently more than one million colon cancer survivors in the United States. Most of us know someone that has been diagnosed or affected by colon cancer. Colon cancer affects men and women equally. Ninety percent of colon cancer occurs in people over age 50, the risk does increase with age. The National Cancer Institute reports colon cancer is the 2nd leading cause of cancer deaths in men and women in the United States. The lifetime risk of getting colon cancer, according to the Colon Cancer Alliance, is 5% or 1 out of 20 persons. The American Cancer Society estimated 136,830 new cases of colon cancer in the U.S. were diagnosed in 2014. Who is at risk? Anybody age 50 or over is at “Average Risk”. People with a personal history of colon polyps or colon cancer, inflammatory bowel disease such as ulcerative colitis or Crohn’s disease, a genetic condition such as familial adenomatous polyposis or a first degree relative (parent or sibling) with a history of colon cancer are considered at “High Risk” for colon cancer. The U.S. Preventive Services Task Force report of 2016 recommends colon cancer screening for average risk individuals beginning at age 50 years and continuing until age 75.The decision to screen for colon cancer in adults age 76 to 85 years should be an individual one, taking into account the patient’s overall health and prior screening history. The American College of Gastroenterology reports the development of 90 percent of colon cancer can be avoided through early detection and removal of precancerous polyps.

The risk and benefits of different colon cancer screening methods vary. Alternative methods include flexible sigmoidoscopy, stool based test (Hemoccult, FIT, Cologuard), ACBE and CT Colonography. The decision on which screening method is best can be made between you and your health care provider. The American College of Gastroenterology Practice Guidelines of 2009 recommend colonoscopy as the preferred colon cancer prevention method. This screening should occur every 10 years for average risk individuals. Colonoscopy is a comprehensive method to examine the entire colon. It is performed by a health care provider who has been specially trained in performing colonoscopies. A colonoscopy is usually an outpatient procedure performed under sedation that takes less than 30 minutes. During a colonoscopy, the health care provider examines the colon looking for polyps or other abnormalities of the colon with an endoscope. A colon polyp is a growth on the lining of the large intestines. Colon polyps can be the forerunner to colon cancer and are therefore removed when found during the colonoscopy. Often there are no obvious symptoms when colon cancer or colon polyps are detected during a screening colonoscopy. A colonoscopy can detect and remove polyps before they develop into cancer. In addition, colon cancer detection at an early stage leads to better outcomes. Remember, “An ounce of prevention is worth a pound of cure”. Warning signs and symptoms of colon cancer are rectal bleeding, change of bowel habits and unexplained abdominal pain. These would be symptoms that would warrant a diagnostic evaluation. A common scenario we see in our office is a person with signs and symptoms they assume are “nothing” but are actually from a serious medical condition. The interval between surveillance colonoscopies is dependent on the results of your prior colonoscopies. Surveillance colonoscopy intervals are based on the number, size and character of the colon polyps found on a prior exam. If you are unfortunate enough to be diagnosed with colon cancer at the time of your colonoscopy, do not despair. Earlier stages of colon cancer are very curable and currently most colon surgeries can be performed laparoscopically. Our office has witnessed several success stories thru early detection. When a patient returns to our office and recognizes how their colonoscopy saved their life, we celebrate together. Getting cancer screening is an investment in your health. All adults should discuss with their health care provider appropriate timing and age of all cancer screenings. Cancer screening is recommended for breast, cervical, colon and lung cancers by the U.S. Preventive Services Task Force in 2016. Take the time for yourself and get screened for cancer. Early detection saves lives and may shorten a treatment plan compared to cancers detected at later stages. The short time it takes to be screened for cancer is a wise investment toward longevity.

esophageal

cancer

Dr. Michael Dohrenwend Board Certified, Gastroenterology Center for Digestive Health 256.430.4427

Karen Fox, CRNP

Are you 50 years old or older? Do you get heartburn weekly or more? Consider Esophageal Cancer or Barrettâ&#x20AC;&#x2122;s Esophagus Screening Please feel free to call our office for an appointment or visit our website cdhhsv.com. We are happy to help with questions, concerns, and screenings. Center for Digestive Health 7738 B Madison Blvd. | Huntsville, AL 35806 256.430.4427 | cdhhsv.com

Do you have heartburn? Are you at risk for Esophageal Cancer? Awareness…Education….Early Detection through age appropriate screening … is the best defense against illness. “The best defense is a good offense”. A good offense is being proactive instead of taking a passive role in your health. April is Esophageal Cancer Awareness Month. Know the facts so you are aware.

What is heartburn?

Heartburn is the most common symptom of gastroesophageal reflux (GERD). It usually feels like a burning sensation in the lower chest area. The burning sensation is caused by acid regurgitation into the esophagus. GERD is when food and/or liquids from the stomach travel back up into the esophagus. This movement of stomach contents into the esophagus causes irritation to the lining of the esophagus. Acid and other digestive juices from the stomach can cause damage to the lining of the esophagus. Some other or atypical symptoms people may experience from GERD include: regurgitation, sour taste in mouth, cough, difficulty swallowing, chest pain and hoarseness. It is important to note there are often no classic symptoms of GERD and some people have only minor symptoms.

Why is it important to pay attention to heartburn?

The most common symptoms of GERD is heartburn. According to the American Society for Gastrointestinal Endoscopy (ASGE) 20% of Americans experience heartburn. People with GERD are at an increased risk of developing esophageal cancer. According to American College of Gastroenterology (ACG) the diagnosis of GERD is associated with a 10-15% risk of Barrett’s esophagus (BE). Barrett’s esophagus is a condition where the esophageal lining changes to become similar to the tissue that lines the stomach. Barrett’s Esophagus is named after Dr. Norman Barrett, an Australian born British thoracic surgeon. In 1950 he described the term reflux esophagitis and the correlation of reflux to changes in the lining of the esophagus. The risk of cancer progression for Barrett’s Esophagus is based on the degree of dysplasia seen on biopsies and ranges from 0.5% to 7% per year.

Who is at risk for Barrett’s Esophagus?

Esophageal cancer is three times more common in men as opposed to women. The highest rate is found in middle aged Caucasian males with a history of heartburn for many years. The risk factors according to ACG include: male gender, age >50 years, Caucasian race, presence of central obesity, Chronic (>5 years) GERD symptoms, current or past history of tobacco smoking, and a confirmed family history of Barrett’s Esophagus or Esophageal Cancer (in a first-degree relative).

How is Barrett’s Esophagus Diagnosed?

A trained physician will perform an upper endoscopy (EGD)

for diagnosis. The patient is sedated for the procedure. A flexible tube with a light and camera on the end is passed through the mouth, into the esophagus and stomach. The outpatient procedure itself is usually less than 10 minutes. The physician will take multiple biopsies to confirm the diagnosis if it appears to be present.

Can Barrett’s Esophagus be treated?

Barrett’s can be successfully ablated by a specially trained doctor. Endoscopic ablation currently is recommended if Barrett’s Esophagus develops dysplasia. The goal is to ablate the Barrett’s and restore a normal esophageal lining. This procedure has a low complication rate and is done in an outpatient setting. Treatment does reduce one’s risk of the likelihood of progression to esophageal cancer. According to Esophageal Cancer Awareness Network (ECAN) the type of esophageal cancer caused by reflux disease (Adenocarcinoma) is increasing at a faster rate than any other cancer in the USA since the 1970’s. Only 1 in 5 people diagnosed with esophageal cancer will survive 5 years because it is most often discovered in late stages. The key to surviving esophageal cancer is early detection. Know the facts. Early detection saves lives. It is important to talk to your health care provider if you have symptoms of GERD.

What is Esophageal Cancer? There are two types of Esophageal Cancers: 1. Adenocarcinoma is the most common in the Western world and usually results from long standing GERD, persistent heartburn or reflux, and can be from progression of Barrett’s Esophagus. 2. Squamous cell carcinoma risk factors are tobacco use and excessive alcohol intake. Many cases of adenocarcinoma of the esophagus begin with Barrett’s tissue. Esophageal cancer is when cancer cells form in the esophagus. The esophagus is the muscular tube that moves food from the mouth to the stomach. Esophageal cancer starts at the inside lining and spreads outward. Surveillance Epidemiology and End Results (SEER) reports esophageal cancer is one of the most aggressive cancers with only a 17% survival rate of 5 years after diagnosis. Esophageal cancer diagnosed in early stages or even before it becomes cancer, such as Barrett’s Esophagus has a high survival rate.

Are you at risk for Esophageal Cancer?

If you have a history of heartburn greater than once per week, difficulty swallowing or chest pain, you should discuss these symptoms with your health care provider. Awareness…Education….Early Detection … Your best defense is a good offense with risk factor appropriate screening.

GET YOUR

BUTT

IN GEAR

Written by Kaki Morrow, Senior Community Development Manager

If you’re 45 or older, have a family history of colorectal cancer, or are showing symtpoms of colorectal cancer, it’s time to get your butt in gear.

the most successfully treated cancers if detected early. The five-year survival rate for colorectal cancers caught in their earliest stage is around 90 percent.

March is recognized as Colorectal Cancer Awareness Month. According to the American Cancer Society, this year more than 135,000 people will be diagnosed with colorectal cancer and over 50,000 will die from the disease. In fact, colorectal cancer is the nation’s third leading cause of cancerrelated deaths for both men and women and the second leading cause of death when sexes are combined.

Regular screening is one of the most powerful weapons for preventing colorectal cancer. If polyps are found during screening, they can be removed before they have the chance to turn into cancer. Screening can also catch colorectal cancer in its earliest stages when it is most treatable and curable.

While a combination of earlier detection, changing patterns in risk factors, and better treatments have led to a 51 percent decline in colorectal cancer death over the past four decades, about 1 in 3 adults who fall within the recommended screening guidelines are still not being tested for colorectal cancer. The good news? Screening can help find and prevent colorectal cancer. It is one of

Major strides have been made with screening rates in the United States, but we can do better. Members of The National Colorectal Cancer Roundtable, an organization cofounded by the American Cancer Society and Centers for Disease Control and Prevention have adopted a shared goal to increase the nation’s screening rate to at least 80% in every community. Nonetheless, myths and excuses abound. Don’t let the myths and excuses stop you from making your health a priority! See

common myths on the following page. Join the American Cancer Society in spreading the word this March and beyond. If you haven’t been tested, talk to your care provider. If you have been tested, talk to your family and friends. Make sure that you and your loved ones are equipped with the facts. Together, we can help reduce colorectal cases and colorectal cancer deaths.

Colorectal Cancer At-A-Glance: Prevention

Myth: A colonoscopy is the only reliable way to be screened for colorectal cancer. Fact: A colonoscopy is considered standard for detecting cancer and precancerous polyps, there are several different tests that effectively screen for colon cancer, including stool tests, which can be done at home and sent to a lab. A study found that certain at-home tests are able to spot nearly 80 percent of colorectal cancers.

Myth: Getting screened for colorectal cancer is embarrassing and painful.

Fact: There are a number of different tests and screening methods for colorectal cancer, including simple, take-home options. Each have benefits and limitations. A discussion with your care provider can help determine which option is best for you.

Myth: I’m 36 years old, have no family history of colorectal cancer, but I am having symptoms. I should wait until I’m 45 to be screened.

Fact: While 90% of colorectal cancer cases occur in adults ages 45 and older, if you have symptoms (bloody stools or rectal bleeding, persistent abdominal discomfort, persistent fatigue, unexplained weight loss) you should discuss these with your primary care physician as soon as possible.

• Colorectal cancer is the third most common cancer in both men and women. • Colorectal cancer is a leading cause of cancer deaths in the United States. • Even though the exact cause of most colorectal cancers are unknown, prevention and early detection are possible because most colorectal cancers develop from polyps. • Risk may further be reduced by regular physical activity, getting to and staying at a healthy body weight, limiting intake of high saturatedfat foods – especially red meat and processed meats, not smoking, limiting alcohol intake, eating plenty of fruits, vegetables and whole-grain foods.

Detection

• Colorectal cancers are more successfully treated when detected early. • If you are 45 or have a family history of colorectal cancer, you should be screened for colorectal cancer.

Treatment

• Surgery is the most common treatment for colorectal cancer, usually cancer that has not spread. • Chemotherapy or chemotherapy plus radiation is given before or after surgery for patients whose cancer has spread beyond the colon.

Don’t hesitate to reach out. Help and hope is available 24/7/365. 800.227.2345 | cancer.org

Want to join the fight against cancer? Get involved through one of these fun events! Rocket City Best Fest // 06.08.19 // Big Spring Park

Join the fun in our Inaugural Rocket City Best Fest. The June 8th festival will kick off summer with a sizzle. This outdoor event, hosted in Big Spring Park, will engage community members from all walks of life. Enjoy burger & beer tastings, live entertainment, family fun, kid-friendly activities, and more.

Belles & Beaus Ball // 08.24.19 // VBC

Join the fun at the Belles & Beaus Ball on August 24, 2019 from 5:30 – 11:00pm at the VBC North Hall for a one-of-a-kind evening featuring great food, dancing,

live entertainment, spectacular auctions, and much more.

Real Men Wear Pink // September & October

Real Men Wear Pink is an executivelevel campaign in which men from the Tennessee Valley are hand-selected to wear pink while raising funds & awareness for breast cancer research.

Go Show // 09.14.19 // Huntsville International Airport Attendees of all ages can sit, stand and get behind the wheels of several giant trucks, large vehicles, construction equipment, and more at this inaugural event supporting the fight against

childhood cancer. Along with fire trucks, military vehicles, combines and unusual trucks, a variety of other family-friendly activities will be featured. This event is FREE to the public.

Golf for Life // 10.14.19 // The Ledges

The 34th Annual Golf for Life Tournament is a well-supported community event. This event will offer the best in customer and client entertainment, exclusive club play, unparalleled hospitality, a wonderful lunch, outstanding silent auction items, and an awards reception.

For more information on how to become involved in these events, please contact kaki.morrow@cancer.org or call 256-536-1863.

How to Prevent Prostate Cancer by Traci McCormick, MD

]

Many of you have been eating a typical American diet since the day you were born. It can be really hard to implement change in your life, but you can do it. Just take one step at a time.

***To all the female readers: If you are considering skipping this article because prostate cancer is a man’s issue— I beg you to keep reading. If you have any men (or boys) in your life—especially if you buy their food or cook their meals—this is important information for you to know.

Did you know that you could fill two college football stadiums with the men that are diagnosed with prostate cancer in our country each year? That’s 180,000 men. 180,000 of our friends, neighbors, and loved ones. 180,000 of our husbands, fathers, and sons. 180,000 men that have been struck by a disease that most people believe cannot be prevented.

Can You Prevent Prostate Cancer? What if I told you that there is a diet that has not only been proven to prevent prostate cancer but has also been proven to slow or even reverse its growth? What if I told you that there is an overwhelming amount of evidence in the medical literature supporting this claim? I bet, if such a diet exists, that you’d expect to be able to ask your doctor and hear all about it, right? Wrong. Despite the enormity of data that is available, the vast majority of physicians know nothing about the connection between this diet and prostate cancer. Although there is plenty of evidence to the contrary, most physicians are taught that prostate cancer is not preventable. Miracle Diet? One of the most infamous studies to prove that prostate cancer can be affected by lifestyle modification was completed by the famous Dr. Dean Ornish and was published in the Journal of Urology in 2005. This study included men who had been diagnosed with prostate cancer and who had opted not to do traditional treatment. The men were assigned randomly into one of two groups. The first group of men underwent intense lifestyle modification with a special diet. The second group of men continued with their usual diet and exercise habits. When the study concluded, the researchers found the cancer had progressed so much in some of the men that they had to undergo surgery or radiation to treat the disease. All of these men were in the group that had been eating their usual diet. Within the group assigned to lifestyle modification, there was not a single man that required surgery or radiation at the conclusion of the study. What’s even more impressive is that the blood marker used to detect prostate cancer, called the PSA, decreased in the group of men who underwent lifestyle modification, while the PSA increased in the group of men

who continued their usual way of life. This means that the prostate cancer regressed in the group who ate this special diet and progressed in the men that continued their typical diets. The researchers also found that when they placed blood from the men who modified their lifestyle into a petri dish with prostate cancer cells, their blood stopped or slowed the growth of 70% of the cancer cells. As a responsible physician, I want to emphasize that this special diet did NOT get rid of their cancer, but it was certainly able to slow it down! The Diet that “Stopped” Prostate Cancer What were these men doing in the lifestyle modification piece of Dr. Ornish’s study? What was the miracle diet? What magic herbs were they taking? It turns out what they did was fairly simple.

• They ate a low-fat vegan diet full of vegetables, fruits, whole grains, nuts, seeds, and legumes. • They walked 30 minutes, six times per week. • They did some form of stress reduction through meditation, deep breathing, or yoga for one hour each day. • They took supplements of soy, vitamin E, vitamin C, and selenium.

The Evidence is Overwhelming There are dozens upon dozens of studies connecting animal protein, saturated fat, and refined grains to an increased risk of prostate cancer. There are even more studies that show that you can decrease your prostate cancer risk by eating a variety of plant-based foods. The best prostate cancer prevention diet is a plant-based diet with a variety of fruits, vegetables, whole grains, legumes, seeds, and nuts. Animal products should be consumed sparingly. Refined carbohydrates should be avoided as much as possible. I hope this post has motivated you to take a hard look at your diet and make the changes necessary to live your healthiest life and give the healthiest diet to the males in your lives. We truly hold the power to change our lives by making wise decisions about the food we put in our bodies.

Radiation

Oncology

Thanks to powerful new technology at Alliance Cancer Care in Huntsville, radiation treatment for certain brain tumors that used to take six weeks can now be completed in minutes.

Photo Credit: Steve Babin

The Alliance office on the Huntsville Hospital campus is the first medical practice in Alabama, and one of only 10 nationwide, to pair a latest-generation Versa HD linear accelerator with ExacTrac advanced image guidance. Radiation oncologist Dr. John F. “Jack” Gleason Jr., medical director of Alliance’s radiosurgery program, said the new system improves both the speed and the effectiveness of radiation therapy for certain tumors. The advanced image guidance ensures that the radiation beam hits only the tumor, Dr. Gleason said, which better preserves the surrounding healthy tissue. And because the new linear accelerator delivers radiation in higher doses than conventional radiation therapy, it can kill a brain tumor in a fraction of the time. Instead of 30 or more visits spread across six weeks, Dr. Gleason said many patients treated with the new radiosurgery system will need a single non-invasive treatment lasting about half an hour. “If we deliver all the radiation to a tumor in one day, it’s harder on the tumor than spreading the same dose over

several weeks,” he said. “So this is a more clinically effective dose.” Alliance Cancer Care has three Huntsville locations – at Huntsville Hospital, Crestwood Medical Center and Clearview Cancer Institute – plus offices in Decatur and Florence. The Huntsville physician team includes Dr. Gleason, Dr. Hoyt A. “Tres” Childs III, Dr. Noel C. Estopinal, Dr. Elizabeth Falkenberg and Dr. Harry James McCarty III. Dr. Traci McCormick and Dr. Stanley Clarke see patients at Alliance’s Decatur and Florence offices, respectively. The new system in Huntsville eliminates the need for one of the most unpleasant parts of radiosurgery: head frames. With many older systems, a large frame would be attached to the patient’s skull with bone screws. The frame provided the coordinates needed to direct the radiation beam to the tumor lurking inside the brain, but it could be painful.

Photo Credit: Steve Babin

Physicians now instead use image guidance from MRI and CT scans of the patient both before and during treatment, along with the ExacTrac system which gives instantaneous feedback on patient position in all six dimensions, to make sure the radiation beam hits the target with an accuracy of less than a millimeter. No frame necessary. If a patient has more complicated brain lesions or a condition like trigeminal neuralgia that can be treat-ed with either radiation or surgery, Alliance physi-cians and the neurosurgeons at Huntsville Hospital Spine & Neuro Center collaborate on a treatment plan. Dr. Holly Zywicke is medical director of the neurosurgery side of the partnership. The multidisciplinary approach “improves the safe-ty and quality of treatment, and it spares the patient from having to go see two different physicians,” said Dr. Zywicke.

Photo Credit: Elekta 10 Inside Medicine | Spring Issue 2018

The term “radiosurgery” is a bit of a misnomer since it’s not a surgical procedure. There are no incisions, and the patient remains awake while the radiation attacks the tumor. “Patients don’t even feel the treat-ment,” said Dr. Gleason. Alliance Cancer Care’s radiosurgery program can treat these cancerous and non-cancerous conditions: • Brain metastasis Trigeminal neuralgia • • Meningioma • Acoustic neuroma Recurrent glioma • • Lung Stereotactic Body Radiotherapy (SBRT) • Liver SBRT • Spinal SBRT • Bone metastasis

Lifestyle Medicine

VS. CANCER by Elizabeth McCleskey, DO

An illness may result in the loss of something of greatest value, namely some aspect of one’s health. When considering cancer, you may think “I am at risk of losing my health and there is nothing to be done about it.” But, is this really true? According to research by Mingyang Song, MD, ScD and Edward Giovannucci, MD, ScD, “about 20-40% of cancer cases and about half of cancer deaths can be potentially prevented through lifestyle modification.”1 Yet, individuals continue to believe there is nothing preventative to be done under the mistaken notion that cancer is about non-modifiable–“nothing I can do about them–risk factors such as genetics, age, or race. Enter the good news, Lifestyle Medicine has evidence-based information on modifiable risk factors and the actions you can take to help counter them: What you put in or on your body, and what you do for your body. Someone is already thinking, “If that were true, then why do picture-of-heath individuals get cancer”? Generally speaking, information about disease and its etiology, complications, etc., fill medical school libraries and is profoundly beyond the scope of this article. Further, certain details of an individual’s life, e.g., childhood and workplace environmental exposures, may never be known and therefore impossible to factor into the individual’s equation. However, it is generally agreed that 40% of cancer diagnoses are preventable with changes to lifestyle. Before you write off lifestyle consider the following: EXPOSURE Smoking has long been linked to lung cancer, sun exposure to melanoma, radiation to thyroid cancer, and Human Papilloma Virus (HPV) to cervical and other cancers. And, have you seen the legal advertisements on TV with regard to asbestos exposure and Mesothelioma? Most of us are aware of at least some cancer/exposure links. Lesser known associations include alcohol’s link with six different kinds of cancer. Another is Diethylstilbestrol (DES), a synthetic estrogen used during pregnancy between 19401971, which resulted in cancer in some of these women and their offspring. Studies are now ongoing in their

grandchildren. So, the message here is avoidance of exposure to limit your risks. IMMUNITY Think of the immune system as your body’s own little army of “soldiers.” A “foreign invader” such as bacteria, a virus, or even an abnormal cell forming inside the body sends the “soldiers” into action to prevent invasion, replication and dispersion. But, as with certain illnesses like HIV/AIDS, impairment of the immune system can occur. Transplant recipients require immunosuppressive medication to prevent the “soldier” cells from mistakenly attacking the new organ. These “soldiers” also may not be able to destroy unrelated cancer-causing infections or cancer cells, hence the restrictions placed upon these patients regarding crowd exposure, etc. INFLAMMATION When an injury occurs, the body’s immune system sends white blood cells and chemicals to heal the area. This will present as a warm, red area around the wound. However, sometimes after the injury is healed, the inflammation remains. It is even possible to have inflammation without an injury or infection; this chronic inflammation can damage healthy cells and weaken the immune system, leading to development and growth of cancer cells. EXAMPLES FROM EACH OF THREE AREAS Viruses, bacteria, and parasites are all part of the problem. By exposure, they enter the body. Some disrupt the cell communications; others weaken the immune system, decreasing the body’s ability to defend itself against other cancer-causing infections; and a few lead to chronic inflammation. Some like H. pylori (best known as causing stomach ulcers) and Hepatitis C have treatments available. Others such as Hepatitis B and HPV have vaccines available for prevention before exposure. Your doctor will guide you regarding appropriateness of vaccines for yourself and your family. When traveling, educate yourself about the geographic area and the preventive measures you can take to reduce exposure to pathogens.

GENETICS But, what about genes? “If I am programmed this way, I will get cancer.” Not necessarily. There is an exciting area called epigenetics. Let’s explain it this way: DNA is a molecule composed of two strings of building blocks.

CCAAGGCTACTTAGGACTACGGTGA GGTTCCGATGAATCCTGATGCCACT

Genes are certain segments on the DNA that instruct the body by making proteins or performing certain functions.

CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT Protein 1

Function 1

Protein 2

Protein 3

Protein 4 Function 2

Not all of these instructions are working at the same time. The genes that are not working are “off ” and the ones that are working are “on.”

CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT OFF

ON Function 1

ON Protein 2

OFF

ON Protein 4

ON Function 2

One way cancer can develop is when the DNA is exposed to something such as radiation that causes damage.

XXXX GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT NonFunctional

Function 1

Protein 2

Protein 3

Protein 4

Function 2

But in epigenetics, the DNA is normal. It is how the genes are turned on and off that can initiate cancer. The exciting part is a healthy lifestyle may turn off health damaging genes and turn on the health promoting ones. CCAA GGCTAC TTA GGACTA CG GTGA GGTT CCGATG AAT CCTGAT GC CACT ON Protein 1

ON Function 1

OFF

ON Protein 3

OFF

ON Function 2

Another way to look at this is a house that is wired with electricity. The lights may be on in three rooms in the morning, two during the afternoon, and one at night. The wiring (DNA) does not change, just how we use it. Turning a light off may be bad (there is a monster under the bed) or good (a romantic evening by the fire). In the same way, genes turning on or off may be good or bad. SO, HOW TO AFFECT THESE AREAS Every time you eat, it is an opportunity to put something into your body to make it function better. Does

this mean supplements? No, real food! Blueberries for example, are showing amazing potential in studies to not only prevent cancer from forming but to assist in cancer therapy by making the cancer cell more susceptible to treatment. To see other ways foods can positively affect your health refer to the “The Nutrition Rainbow”2. So, what else can I do? Shown below are other activities you can incorporate and their cancer-busting potential.

Hopefully, this article has given you a brief introduction to the relationship between lifestyle changes and their ability to perhaps lessen potential cancer risks, all presented in a way that is understandable to those not seated at the science nerd table. Or, maybe you are still caught up in the “this is too much trouble; this is too unlikely; this is not do-able in a family of five; this isn’t going to mitigate the strong history of “x” cancer in my family,” etc. But, you read the article…all the way to the end. In a nutshell, Motivational Interviewing, a counseling technique, defines five stages of change:

Remember, you read the article…all the way to the end, so you may well be at Stage 2 or even 3. Continue to digest the information and maybe even look up some additional sources online or chat with your primary care doctor or Lifestyle Medicine physician. Should you undertake to make changes, remember perfection isn’t expected or being broadcast on social media. Any change, however small, you undertake to promote better health can only help.

(1) Pre-contemplation – “Leave me alone.” (2) Contemplation – “I’m thinking about it, but on the fence.” (3) Preparation – “I’m going to do it.” (4) Action – Do it. (5) Maintenance – Ongoing monitoring.

References: 1. Song M and Giovannucci E. JAMA Oncol. 2016;doi:10.1001/jamaoncol.2016.0843. 2. “The Nutrition Rainbow” by The Physician’s Committee for Responsible Medicine. Dr. Elizabeth McCleskey Board Certified in Family and Lifestyle Medicine 103 Intercom Drive , Suite B Madison, AL 35758 Phone: 256-280-3990 Fax: 256-280-3991 HealthStylesDr.com

Tips: The more naturally colorful your meal is, the more likely it is to have an abundance of cancer-fighting nutrients. Pigments that give fruits and vegetables their bright colors represent a variety of protective compounds. The chart below shows the cancer-fighting and immune-boosting power of different-hued foods.

www.PhysiciansCommittee.org â&#x20AC;˘ 202-686-2210

17246-NTR â&#x20AC;˘ 20171102

Huntsvil e,

VALVE REPLACEMENT Without Open Heart Surgery b y Alex Vasquez, MD

AORTIC STENOSIS Aortic stenosis is the second most common valvular heart disorder found in clinical practice. The term refers to a gradual narrowing o f the aortic valve that affects the outflow of blood from the heart's left ventricle into the aorta. The main cause for the narrowing is degenerative, as a result of thickening and calcification of the valve components, and as such it increases with age.

More than one in eight persons age 75 and older have moderate or severe aortic stenosis; a rate that will only continue to increase as the age of our population rises. Most patients are diagnosed before symptoms appear, when a loud sound or murmur (generated by blood exiting the heart through the narrowed valve) is heard during a routine physical examination. Once the murmur is discovered, a physician will order an echocardiogram (heart ultrasound) to determine the extent of the valve narrowing. Once the narrowing becomes severe, most patients will develop symptoms, generally manifested as fatigue, chest discomfort, lightheadedness and shortness of breath.

For more information please contact: Christy Cantey, CRNP

Valve Clinic Program Coordinator 1.800.519.TAVR

TREATMENT OPTIONS Given a mortality rate as high as 500Ai only one year after the onset of symptoms, we recommend replacing the valve once the diagnosis of symptomatic aortic stenosis has been made. The traditional way to replace the valve is surgical, through an open-heart procedure known as a surgical aortic valve replacement (SAVR). Most recently, a less invasive, non open-heart, transcatheter aortic valve replacement (TAVR) option is available for patients who are considered to be at intermediate or high risk for surgical aortic valve replacement. In the vast majority ofpatients who qualify for this procedure, a new valve can be safely introduced from the leg and carefully threaded up to the heart and across the diseased valve. Once there, the new valve is expanded, pushing the native valve aside, and rapidly restoring normal function.

HEART VALVE TECHNOLOGY TA VR can be performed under strong sedatives and local anesthesia, eliminating the need for general anesthetics. That allows for a quicker recovery and dramatically shorter hospital stays. The diagnosis, clinical decision-making and treatment of the patients with complex valvular disease requires involvement of a well-structured multidisciplinary valve team. In August 2014, Huntsville Hospital's valve team performed the first TAVR in North Alabama, under the leadership of Dr. Alex Vasquez. Since then, over 525 TAVR procedures have been successfully performed. As technology and our experience have advanced, we have expanded our team as well as the clinical applications to treat other major structural heart problems with less invasive techniques.

TAVR with the SAPIEN 3 Valve

Life Is Waiting

“ I can share special moments with my grandkids again.”

“ I have much more energy to cook with my daughter.”

Learn more at SAPIEN3.com

CAUTION: Federal (United States) law restricts these devices to sale by or on the order of a physician. Please see the Important Risk Information on the accompanying page. Edwards, Edwards Lifesciences, the stylized E logo, Edwards SAPIEN, Edwards SAPIEN 3, SAPIEN, and SAPIEN 3 are trademarks of Edwards Lifesciences Corporation. © 2017 Edwards Lifesciences Corporation. All rights reserved. PP--US-2469 v1.0 Edwards Lifesciences • One Edwards Way, Irvine CA 92614 USA • edwards.com

SAPIEN 3 Transcatheter Heart Valve Important Risk Information

Indications: The Edwards SAPIEN 3 transcatheter heart valve, model 9600TFX, and accessories are indicated for relief of aortic stenosis in patients with symptomatic heart disease due to severe native calcific aortic stenosis who are judged by a Heart Team, including a cardiac surgeon, to be at intermediate or greater risk for open surgical therapy (i.e., predicted risk of surgical mortality ≥ 3% at 30 days, based on the Society of Thoracic Surgeons (STS) risk score and other clinical co-morbidities unmeasured by the STS risk calculator). The Edwards SAPIEN 3 transcatheter heart valve, model 9600TFX, and accessories are indicated for patients with symptomatic heart disease due to failure (stenosed, insufficient, or combined) of a surgical bioprosthetic aortic or mitral valve who are judged by a heart team, including a cardiac surgeon, to be at high or greater risk for open surgical therapy (i.e., predicted risk of surgical mortality ≥ 8% at 30 days, based on the STS risk score and other clinical co-morbidities unmeasured by the STS risk calculator). Contraindications (Who should not use): The Edwards SAPIEN 3 transcatheter heart valve and delivery system should not be used in patients who: • Cannot tolerate medications that thin the blood or prevent blood clots from forming. • Have an active infection in the heart or elsewhere. Warnings: • There may be an increased risk of stroke in transcatheter aortic valve replacement procedures, compared to other standard treatments for aortic stenosis in the high or greater risk population. • If an incorrect valve size for your anatomy is used, it may lead to heart injury, valve leakage, movement, or dislodgement. • Patients should talk to their doctor if they have significant heart disease, a mitral valve device or are allergic to chromium, nickel, molybdenum, manganese, copper, silicon, and/or polymeric materials. • The SAPIEN 3 valve may not last as long in patients whose bodies do not process calcium normally. • During the procedure, your doctors should monitor the dye used in the body; if used in excess it could lead to kidney damage. X-ray guidance used during the procedure may cause injury to the skin, which may be painful, damaging, and long-lasting. • Transcatheter aortic heart valve patients should take medications that thin the blood or prevent blood clots from forming, except when likely to have an adverse reaction, as determined by their physician. The Edwards SAPIEN 3 transcatheter heart valve has not been tested for use without medications that thin the blood or prevent blood clots from forming. Precautions: The long-term durability of the Edwards SAPIEN 3 transcatheter heart valve is not known at this time. Regular medical follow-up is recommended to evaluate how well a patient’s heart valve is performing. Safety, performance, and durability of the SAPIEN 3 valve has not been established for placement inside a previously implanted transcatheter valve. The safety and effectiveness of the transcatheter heart valve is also not known for patients who have:

• An aortic heart valve that is not calcified, contains only one or two leaflets, has leaflets with large pieces of calcium that may block the vessels that supply blood to the heart or in which the main problem is that the valve leaks. • Previous prosthetic ring in any position. • Previous atrial septal occlude. • A heart that does not pump well, has thickening of the heart muscle, with or without blockage, unusual ultrasound images of the heart that could represent irregularities such as a blood clot, a diseased mitral valve that is calcified or leaking, or Gorlin syndrome, a condition that affects many areas of the body and increases the risk of developing various cancers and tumors. • Low white, red or platelet blood cell counts, or history of bleeding because the blood does not clot properly. • Diseased, abnormal or irregularly shaped vessels leading to the heart. Vessels which are heavily diseased or too small for associated delivery devices, or a large amount of calcification at the point of entry. • Allergies to blood-thinning medications or dye injected during the procedure. • For a valve in valve procedure, there is a risk of leakage if the previously implanted tissue valve is not securely in place or if it is damaged. There is also the possibility that a partially detached valve leaflet from the previously implanted valve could block a blood vessel. • Additional pre-procedure imaging will be completed to evaluate proper sizing. Potential risks associated with the procedure include: • Death, stroke, paralysis (loss of muscle function), permanent disability, or severe bleeding. • Risks to the heart, including heart attack or heart failure, a heart that does not pump well, irregular heartbeat that may result in a need for a permanent pacemaker, chest pain, heart murmur, false aneurysm, recurring aortic stenosis(narrowing), too much fluid around the heart, injury to the structure of the heart. • Risks to your lungs or breathing, including difficulty breathing, fainting, buildup of fluid in or around the lungs, weakness or inability to exercise. • Risks involving bleeding or your blood supply, including formation of a blood clot, high or low blood pressure, limited blood supply, a decrease in red blood cells, or abnormal lab values, bleeding in the abdominal cavity, collection of blood under the skin. • Additional risks, including life-threatening infection, dislodgement of calcified material, air embolism (air bubbles in the blood vessels), poor kidney function or failure, nerve injury, fever, allergic reaction to anesthesia or dye, reoperation, pain, infection or bleeding at incision sites, or swelling. Additional potential risks specifically associated with the use of the heart valve include: • Valve movement after deployment, blockage or disruption of blood flow through the heart, need for additional heart surgery and possible removal of the SAPIEN 3 valve, a blood clot that requires treatment, damage to the valve (e.g., wear, breakage, recurring aortic stenosis), nonstructural valve dysfunction (e.g., leakage, inappropriate sizing or positioning, blockage, excess tissue in growth, blood cell damage, etc.) or mechanical failure of the delivery system and/or accessories.

CAUTION: Federal (United States) law restricts these devices to sale by or on the order of a physician. Edwards, Edwards Lifesciences, the stylized E logo, Edwards SAPIEN, Edwards SAPIEN 3, SAPIEN, and SAPIEN 3 are trademarks of Edwards Lifesciences Corporation. All other trademarks are the property of their respective owners. © 2017 Edwards Lifesciences Corporation. All rights reserved. PP--US-2469 v1.0 Edwards Lifesciences • One Edwards Way, Irvine CA 92614 USA • edwards.com

by Salpy Pamboukian, MD

Director, Mechanical Circulatory Support Device Program and Womenâ&#x20AC;&#x2122;s Heart Health Clinic The University of Alabama at Birmingham

IMFall'19.indd 28

8/28/19 2:38 PM

Option 4: Even your options have options! Try a combination of the three. Many people elect to have a small nasal procedure combined with quitting Afrin, or using short-term oral steroids and/or switching to non-addictive medications like nasal steroid sprays as well as safer herbal remedies like Xylitol sprays. Be sure to discuss your treatment options as well as alternative with 10,000 your primary care doctor or With medications approximately ENT. Patient expectation CRUCIAL. When using practicing physiciansis in the intranasal steroid and antihistamine state of Alabama, there is a sprays, vast a butter knife is not going to cut of likedoctors a machete! But how do you eat an community dedicated to providing superior care and elephant? One bite at a time!

striving to improve outcomes to an estimated 5 million Alabamans.1At times, health conditions mayCRNP ariseis an otolarâ&#x20AC;&#x153;Kari Kingsley, MSN, that require a yngology patientnurse to be referredwith over 8 practitioner years of ENToutside experience who currently to a medical specialist works at such Huntsville of their community, as ENT a (256-882-0165). cardiologist. She is a medical writing consultant for In-

side Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront medicine.â&#x20AC;? Given the close and trustingof nature of physicianpatient relationships, it can be a difficult but necessary decision to refer a patient to a colleague for treatment of more advanced or complex conditions. Itâ&#x20AC;&#x2122;s important to recognize that referring a patient is not a negative reflection on the referring physician, instead quite the opposite: understanding that a patient might need more integrated or specialized care. Quite simply, a referral can help a patient not only get a second opinion, but an additional assessment could also offer highly specialized treatment options that could be the difference between life and death. According to a report in the Annals of Family Medicine, every year 45% of physicians receive new patients through referrals. In my role as a cardiologist at The University of Alabama at Birmingham, I work with a team who sees patients daily with advanced stage heart failure and were referred by other physicians. Frequently, these patients need treatment options or interventions that go beyond what can be provided by their primary care physician or general cardiologist. Unfortunately, heart failure is prevalent in Alabama, with heart disease being the leading cause of death throughout the state.2The good news is that many new treatment options have emerged in the last decade that can positively impact on both survival and quality of life. Consultation with a specialized advanced heart failure cardiologist like myself can determine which treatments are right for a particular patient. It is important to remember we are not taking the place of the local physician. We partner with referring doctors to make sure patients are receiving the most up to date treatments.

Inside Medicine | Spring Issue 2019

IMFall'19.indd 29

8/28/19 2:38 PM

Heart Failure: A Common Killer Advanced heart failure patients may experience shortness of breath, fatigue and other symptoms, usually with activity, but sometimes even at rest. Of the approximately 6 million American adults living with heart failure, about 10% have an advanced form of the disease where their hearts are not strong enough to adequately pump blood through the body.3 Heart failure is often diagnosed only when it begins to have serious health consequences. In a worst-case scenario, the disease goes unrecognized and advances to the point where a referral to a specialist is too late. This is because heart failure is largely misunderstood (even within the medical community) and often the risk factors are not identified or treated early enough. Patients in an advanced stage of the disease can require significant interventions to extend their life expectancy – but often require a patient be healthy enough to complete and recover from the Options for Advanced Heart Failure Patients As a specialist, I depend on referrals to ensure I’m seeing heart failure patients early and often, as this allows for comprehensive care and medical intervention options that can offer the best possible patient outcomes. When advanced heart failure patients visit me, my primary focus is to provide the patient with a treatment plan that can potentially extend the patient’s life and improve the quality of that life. Heart failure progressively becomes more difficult to treat, meaning treatments that had been used in the past often no longer work. At this point in the treatment journey, intravenous medications may be an option, as well as implanted devices and heart transplants.4 While a heart transplant may seem like an ideal option to get a “new” heart, it’s important to acknowledge that it’s not an immediate or appropriate option for all patients. Some patients may be too ill to qualify for or survive the transplant surgery, and the transplant list is long with a limited amount of donor hearts. Consider this: despite the prevalence of heart failure, in 2018, only 3,400 heart transplant procedures were done in the United States.5 A mechanical heart pump can be a life-saving option for the thousands of patients currently waiting for a heart transplant (known as “bridge to transplant” patients), or for those who are not candidates for heart transplant surgery (“destination therapy”). A mechanical heart pump, such as the Abbott HeartMate 3TM (www.heartmate.com), can help restore blood flow throughout the body. This option, as well as other available life-saving techniques, can help improve a patient’s length and quality of life, but requires commitment from the patient, as well as their support network and other physicians, to ensure a safe recovery and longterm survival. Advocate for the Referral As physicians, it is our duty to provide patients with the education necessary to understand various risk factors and diagnoses, and to ensure we have an awareness of the available physician network, including the myriad of specialties that can diagnose and treat complex, advanced or rare conditions. We can improve the likelihood of a referral if we are educated about the diagnosis and treatment options that a specialist may present to our patient, as we help prepare and educate the patient about the potential path forward. Ultimately, we want to help patients feel empowered to make informed decisions about their health. Additionally, patients need to take an active role in their own health care and communicate with their doctor if they feel the time has come to seek a second opinion or specialized care. It is also critical that a referral comes when the patient is stable and not experiencing a medical emergency as this allows the doctor and the patient to make the most informed decision possible. As a physician community comprised of various specialties, it’s our collective responsibility to embrace the old adage that two minds are better than one, and sometimes an outside opinion or expertise is necessary to ensure quality patient outcomes. Strong relationships connecting the physician community can further help improve interdisciplinary care for patients. It’s important to remember that the right referral at the right time can dramatically change the course of a patient’s treatment, as I’ve witnessed numerous times with my heart failure patients. REFERENCES 1 Association of American Medical Colleges. Alabama Physician Workforce Profile. Retrieved from: https://www.aamc.org/download/484510/data/alabamaprofile.pdf 2 Alabama Public Health. Cardiovascular Diseases. Retrieved from: https://www.alabamapublichealth.gov/healthrankings/cardiovascular.html 3 American Heart Association. Living With Heart Failure and Managing Advanced Heart Failure. Retrieved from: https://www.heart.org/en/health-topics/heart-failure/living-with-heart-failure-and-managing-advanced-hf 4 WebMD. Treatment Options for End-Stage Heart Failure. Retrieved from: https://www.webmd.com/heart-disease/heart-failure/end-stage-heart-failure-treatments#1 5 United Network for Organ Sharing. Transplant Trends. Retrieved from: https://unos.org/data/transplant-trends/

IMFall'19.indd 31

Empowering the

TRANSFORMATION OF HEART FAILURE Innovating with product solutions that set new standards of care across the heart failure continuum

Abbott One St. Jude Medical Dr., St. Paul, MN 55117 USA Tel: 1 651 756 2000 SJM.com/Beat-As-One St. Jude Medical is now Abbott. Rx Only Brief Summary: Prior to using these devices, please review the Instructions for Use for a complete listing of indications, contraindications, warnings, precautions, potential adverse events and directions for use. ™ Indicates a trademark of the Abbott group of companies. © 2018 Abbott. All Rights Reserved. 29521-SJM-HGEN-0918-0060 Item approved for global use.

8/28/19 2:38 PM

A powerful pledge by Kaki Morrow

Development Manager of Distinguished Events, American Cancer Society

March has come and gone, but it doesn’t mean that we should forget about everything that was included in that month. March brought on crazy weather, St. Patrick’s Day, and National Colorectal Cancer Awareness Month. With March came an opportunity to don both summer outfits and winter coats, wear green and attend Huntsville’s St. Patrick’s Day parade, and to bring attention to potentially lifesaving actions people can take. So while March may now be a distant memory, commit to continuing March’s mission and spreading awareness of colorectal cancer. With the American Cancer Society’s and CDC’s collaborative 80x’18 initiative, raising awareness, spreading the news about colorectal cancer and preventing colon cancer is becoming a more attainable goal to reach. The National Colorectal Cancer Roundtable, cofounded by the American Cancer Society and the CDC, is working toward a shared goal of 80% of adults aged 50 and older being regularly screened for colorectal cancer by 2018. According to the American Cancer Society, more than 135,000 people will be diagnosed with colorectal cancer in the United States this year, and over 50,000 will die from the disease. In fact, colorectal cancer is the nation’s third-leading cause of cancer-related deaths for both men and women and secondleading cause of cancer-related deaths when both sexes are combined, accounting for about 8 percent of all cancer deaths. And while a combination of earlier detection, changing patterns in risk factors, and better treatments have yielded a 51% decline in the colorectal cancer death rate over the past 40 years, about 1 in 3 adults in the United States who fall within recommended screening guidelines are still not being tested for colorectal cancer. The good news? Screening can help find and prevent colorectal cancer. It is one of the most successfully treated cancers if diagnosed early. The five-year survival rate is around 90 percent for colorectal cancers caught in their earliest stage. Chip Moore, a 2017 Belles & Beaus Ball Honoree, who is also currently fighting colon cancer shares, “Some people may not want to be screened because of the time and inconvenience. But if you think that’s an inconvenience, it’s really nothing compared to not catching/preventing the disease and having to attend multiple doctors’ office visits, PET scans, and CT scans. Being screened years ago would have drastically altered the course my life has taken. Take control of your life and get screened, or life will take control of you.” Despite that course, Chip has remained energetic,

and cancer hasn’t taken his positive outlook of life away from him. The American Cancer Society recommends that most people begin regular screening at age 50, as about 90 percent of cases are diagnosed in individuals 50 and older. People at higher risk, such as those with a family history of the disease, may need to start screening earlier. Obesity, physical inactivity, smoking, heavy alcohol use, and eating a diet high in red or processed meat also increases your chance of having colorectal cancer. Regular screening is one of the most powerful weapons for preventing colorectal cancer. If polyps are found during colorectal screening, they can often be removed before they have the chance to turn into cancer. Screening can also result in finding cancer early, when it is easier to treat and more likely to be curable. There are a number of myths about colorectal cancer that people use as excuses to avoid getting tested. One myth is that the tests are embarrassing and painful. The fact is there are a number of different tests for colorectal cancer, including simple take home options. Each have benefits and limitations. A discussion with your doctor can help you figure out what may be best for you. So, what can you do about it? So far, over 1,300 organizations have signed the 80 percent by 2018 pledge, committing to help reach this public health goal. Join these organizations and American Cancer Society in spreading the word beyond March and into 2018. If you haven’t been tested, talk to your doctor. If you have been tested, talk to your family and friends. Make sure they know the facts and encourage them to get tested. Together we can help reduce the number of adults who develop and die from colorectal cancer.

Take the pledge (on upper right corner of page)

Follow Chip’s Cancer Journey via Instagram @lewismoore31 ....................................................................................................... For more information on how to get involved in the American Cancer Society’s life-saving mission, contact Kaki via email kaki.morrow@cancer.org

An Innovative Approach to

HEART FAILURE MANAGEMENT by, Philip B. Adamson, MD, MSc, FACC

Despite medical advancements, heart failure is a worsening epidemic. 8

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8

The number of people in the United States with a diagnosis of chronic heart failure is expected to double in the next 15 years–forcing physicians to face the significant challenge of delivering quality health care for a growing population. There are many medications and devices focused on heart failure management that bring great hope for clinical improvement–and the potential for recovery. Even still, there is a significant gap in treatment options. For example, half of the approximately six million people living in the United States with symptomatic heart failure have a normal ejection fraction. While there has historically been limited medical therapies to improve patient outcomes, new innovations are allowing us to identify advanced heart failure patients earlier in their progression, resulting in improved survival and quality of life.

REMOTE HIGH-TECH MONITORING

As a heart failure cardiologist, I can attest to the emotional and physical burden that this disease brings to patients and their caregivers, especially when hospitalization is needed. Heart failure remains the leading cause of hospitalization in Medicare beneficiaries, and accounts for a large percentage of the overall $40 billion cost of expenditures. In fact, clinical evi-

Courtesy of Abbott

dence shows that increased hospitalizations can actually compound challenges for patients and lead to worsening cardiac function and even mortality. This is important since hospitalizations for advanced heart failure patients tend to be recurrent with 25 percent of patients readmitted within 30 days and 50 percent within six months. While Medicare penalties through the Hospitalization Readmission Reduction Program appear effective in lowering 30-day readmissions, recent analyses suggest that increased mortality is associated with the national trend for reduced readmissions. This phenomenon does not appear to be the case with other targeted reasons for hospitalizations, such as myocardial infarction and pneumonia. One major challenge in clinical management of patients with heart failure is that most of the patients’ lives are spent away from their health care provider, leaving physicians to rely on a reactive approach for managing their patients once symptoms present. Many patients also feel very anxious when they are not in the general proximity of their care team, which limits their ability to travel or enjoy visiting loved-ones who do not live nearby. Traditional methods of tracking have not overcome this issue, since relying on changes in physical symptoms simply does not help keep patients from developing acute decompensation. One novel solution to this problem is the, Abbott CardioMEMS HF System™, which consists of a tiny permanently implanted pressure sensor in the pulmonary artery (PA) with the ability to remotely measure PA pressures daily

Courtesy of Abbott

from the patient’s home. This continuous monitoring alerts the patient’s care team when PA pressures are rising. This is critical as PA pressures increase long before patients develop worsen-ing symptoms or changes in weight. The automatic notification process, coupled with the ability for providers to routinely re-view patients’ PA pressures, has revolutionized the heart failure disease management paradigm by providing an early warning system for physicians to more proactively manage the care of their patients. The CardioMEMS HF System™ also allows patients to know that, no matter where they are, they can be monitored with clinically actionable information. In fact, the information provided by PA pressure monitoring takes the guess-work out of managing symptoms, weight changes and even estimation of disease progression by physical examination. Instead of a gross approximation of PA pressure–this technology provides the ac-tual number to inform personalized remote management.

FDA APPROVED, ON THE MARKET AND BACKED BY CLINICAL DATA

The CardioMEMS HF System™ is the first and only FDA-ap-proved heart failure monitoring device of its kind to significant-ly reduce hospital admissions for NYHA class III heart failure patients who have been hospitalized in the previous 12 months. The technology has been proven to reduce hospital admissions by 37 percent when used by physicians to manage patients with previously hospitalized and persistently symptomatic heart fail-ure after 15 months of follow-up. Approximately 10,000 patients have been implanted with the device as of September 2018. While this marks a major milestone, we know the potential for greater adoption is high. The GUIDE-HF trial, the largest heart failure medical device trial in history, is now underway and builds on previous clinical trials to study whether the CardioMEMS HF System™ can improve survival and quality of life while reducing heart failure hospitalizations for people living with NYHA class II-IV heart failure. The five-year investigational study launched in March 2018 and is open to hospitals and eligible to patients nationwide.

REDEFINING HEART FAILURE MANAGEMENT

Managing the oppressive morbidity and mortality associated with heart failure is a daunting challenge for patients and health care providers. Innovative sensor technologies, such as remote PA pressure monitoring, represent a tangible tool to help manage the pandemic of heart failure. This technology is available and ready for integration into routine clinical practice for patients living with advanced heart failure.

Philip B. Adamson, MD, MSc, FACC is a Heart Failure Cardiologist and Medical Director at Abbott. Prior to his work at Abbott he served as director of the Heart Failure Treatment Programs at the University of Oklahoma Health Sciences Center and The Oklahoma Heart Hospital in Oklahoma City.

listen to your

HEART

in a

heartbeat by Shelly Rich, RN, LBSW

Why are newborns not being screened for CHDs when 1 in 110 newborns are born with a CHD?

November 16, 2015,

started like any other typical day, off to school and work for everyone. By mid-day, a text came from Rachel, our 13-year-old, saying, “I don’t feel good. I think I am getting sick.” By midnight that night, she had a low grade temperature. The next morning, she stayed home from school, and when she woke, she felt nauseated. She soon became unconscious, turned gray in color, and her hands drew up. We quickly called 911.Upon the arrival of emergency responders, she was alert and talking. In the emergency room, several labs were taken and tests were performed. The visit concluded with a diagnosis of vasovagal syncope, or fainting. Due to this diagnosis, a routine follow-up visit was scheduled with cardiology. November 24, 2015, we presented to the pediatric cardiologist for our “routine” follow-up appointment. An electrocardiogram, a test to monitor the electrical rhythm of the heart, was performed. An echocardiogram (ECHO), an ultrasound that produces images of the heart, was performed as well. And then, all in a heartbeat, everything changed. The cardiologist proceeded to tell us that the good news was the syncope or fainting was due to a vasovagal response and nothing to do with her heart. He said this was common in young teenage girls. Very uncommon, however, was the fact that the echocardiogram revealed a Sinus Venosus Atrial Septal Defect (SVASD) with Anomalous Pulmonary Venous Connection (APVC) or a large hole between the two upper chambers of her heart with 3 pulmonary veins in the wrong location. What?! How could this be? Never had there been even a mention of a heart murmur! We sat frozen and numb at what we had just been told. He said an ASD is one form of Congenital Heart Disease (CHD) and that this birth defect would have happened about the second week of gestation. A CHD is defined as a problem of the heart’s structure that is present at birth. There

are various forms of CHD, some considered critical, which means they have to be repaired soon after birth, and others that are just as serious, such as this one, but do not require immediate repair. CHDs are the most common birth defect. The cardiologist went on to explain to us that ASDs are a common CHD, but not often found until adulthood. He also stated the most common ASD is the Secundum ASD, and it often does not require surgical intervention because it can sometimes close on its own. Rachel, however, had the rarest form of ASD, Sinus Venosus Atrial Septal Defect with Anomalous Pulmonary Venous Connection. This would require open heart surgery to repair. We sat speechless and in total shock. How could this have been missed? According to multiple cardiologists, if she had not fainted and presented to the ER, this would have went undetected until her mid 20’s or early 30’s, but by then her heart and lungs would have been damaged. Left undiagnosed until adulthood, this could lead to right heart failure, arrhythmias, stroke, and pulmonary hypertension. My question then became, “Why are newborns not being screened for CHDs when 1 in 110 newborns are born with a CHD?” I was given a couple of answers, but one answer was dominant. Money and availability of technicians to perform ECHOs was the number one answer among 5 cardiologists. How can the cost of an ECHO be more important than the damage that is created by an undiagnosed CHD left to rear its ugly head in adulthood? The second answer was that some states perform newborn screenings using pulse oximetry. Pulse oximetry estimates the level of oxygen in the blood by using sensors placed on the skin. While pulse oximetry detects some CHDs it does not detect others. ASDs are one of those it does not detect. Currently, Alabama does not require pulse oximetry as part of the required

newborn screening. Rather the Alabama Health Department provides guidelines and asks hospitals to “partner with us to voluntarily implement CHD screening in the newborn nursery.” Again, how can this be? In a country where the American Heart Association is so large and active, how can there be no set standards? We have Heart Walks, Jump Rope for Heart, and many things to raise awareness of other heart diseases, but not this. There needs to be change! According to the Center for Disease Control (CDC), “no tracking system exists to look at the growing population of older children and adults with heart defects.” Currently, researchers have only estimated the number of older children and adults with CHD based on healthcare databases in Canada. Once again, how can this be? It is just unacceptable. More must be done to record the incidence of CHD and to identify them earlier to avoid irreversible, costly, long term effects. Because, all in a heartbeat, it could be your child, your grandchild, or even yourself !

Littlemendedhearts.org Alabama Department of Public Health Adph.org Center for Disease Control Cdc.gov

by Amber Davis, R.N. Hypertension does not discriminate. It affects around 70 million people in the United States alone, and that number does not include the undiagnosed cases. Many people go years without getting their high blood pressure diagnosed. Sometimes, this is due to the fact that hypertension often has no symptoms at all. Some people are unaware of this diagnosis until they reach a hypertensive crisis. This is a condition where your blood pressure reaches such unsafe levels, it’s extremely hard to control and often requires hospitalization. Hypertension that goes untreated can lead to many serious health issues such as a heart attack, stroke, aneurysm, heart failure, and kidney damage or kidney failure. When hypertension causes thickening and hardening of your artery walls, it is a condition called atherosclerosis. The longer that high blood pressure goes untreated, the worse the damage can become. Your age, race and even family history play a major role in this health risk. Therefore, it is important to know your family history and risk for hypertension and heart disease. Knowing this will help make you aware and hopefully push you to educate yourself on the risk factors for high blood pressure. Remember, you know your body better than anyone. If you think something is not right, or you haven’t been feeling well lately, do not just push it aside! Get in to see your doctor, or the next time you could be going to the emergency room for something much more severe! It is very important to be informed on possible health issues in which you are at risk. Therefore, here are some risk factors for hypertension.

Do any of these apply to you? Age – The older you are, the higher the risk. However, you can be diagnosed with high blood pressure at any age. Being young does not exclude you. Family history – If you have a history of hypertension or heart disease in your family, then you are at risk. It does tend to be a hereditary condition. Overweight and lack of physical activity – The healthier you are, inside and out, the less risk you will have of hypertension. Tobacco and alcohol – The risk of hypertension can increase for those who consume higher levels of alcohol and tobacco products. Sodium – High levels of sodium in your diet may increase your risk of hypertension. Stress – Stress can cause your blood pressure to temporarily spike. Over time, this could play a role in long-term hypertension.

We all need to be more informed about hypertension. So many people have this medical condition; yet, so many people understand nothing about it. Hypertension is sometimes hard to control and hard to manage. Compliance with your medications is the first step in getting your hypertension under control. Yes, medications can have side effects, but that is just part of it. The risk of heart damage and/or disease significantly outweigh the risk of side effects from medication. However, discuss this with your doctor. He may need to adjust your medications and try something new if there is a great concern. Open the lines of communication with your doctor and be honest on how you are feeling. Do not let this condition go untreated. This is your life, live it well!

Reference High Blood Pressure (Hypertension). Mayo Clinic. http://www.mayoclinic.org/diseases-conditions/high-blood-pressure/basics/definition/con-20019580. Accessed August 8, 2016.

FOR A STRONG RECOVERY,

patient attitude is paramount by Steve Burcham, Vice President, Digium & Heart Disease Survivor

Steve, your heart is shot. It’s done. You need a new one. I’m transferring you to the University of Alabama, Birmingham Hospital tonight for treatment. Laying on the operating room table in the catheterization lab at The Heart Center in Huntsville, Alabama, I couldn’t believe the words that just came out of the physician’s mouth. “A heart transplant,” I repeated the doctor’s declaration silently to myself. How could that be true? Yes, I had struggled with heart disease for a few years. Shortness of breath, exercise intolerance and missing heartbeats had already led to implantation of a cardiac pacemaker, but I really thought I was on the mend, not on the road to endstage heart disease. What I didn’t know laying there waiting for the medevac team to air-lift me to the University of Alabama, Birmingham Hospital was that the pressure readings the doctor measured & recorded inside the 4 chambers of my heart were deemed “incompatible with life.” The fact that I was still alive, awake and conversing with the doctors was amazing if not miraculous. Internally though, I wasn’t rattled. Besides having a strong faith, I simply never believed for one minute that my health was that bad nor did I believe that my life was nearly over. Fast forward time to 2017: On Valentine’s Day, I celebrated my 5th anniversary after receiving a full heart transplant in 2012. Since heart transplant surgery, I have: • Played over 50 rounds of golf • Run more 5K foot races than before heart transplant • Traveled to China for business & to Hawaii on vacation • Walked my daughter Anna down the aisle on her wedding day, • Welcomed my new granddaughter into the world, and • Have spent some quality time with Cindy, my wife of over 30 years.

My strong recovery got started by the challenge my medical team gave me which, simply stated: “Set for yourself a post recovery goal.” Knowing that the Cotton Row foot races were scheduled for late May, I figured that I would gain my doctor’s permission & train to run the 5k race on May 27, 2012. My father, sister, brother, nieces & I crossed the finish line, not with record times but with a lot of joy knowing that they were there with me to celebrate my full recovery. So now, I would like to share some of my “lessons learned” with those that are dealing with disease, treatment & recovery. First and foremost is attitude. Consider yourself a member of the medical team (not just a patient). Teams huddle together to plan & execute to win, not to lose. So right up front, put you yourself “in the game” as a team player set on winning the battle of survival! That also means that whining and complaining are not allowed. A good example of participating as a team member was when my life was hanging in the balance with complete heart failure. After the doctors recorded those readings “incompatible with life,” they asked me if I wanted to be sedated for the trip to Birmingham. I said no. I figured that if I continued to be stable, then I wanted to be awake for the arrival so that I could speak to the doctors about what I had been experiencing. Turns out, that was a good idea, because when I arrived in Birmingham, I discussed all the available options to me with the doctors & surgeons, including the immediate implantation

My results were outstanding. I was up and walking around the ICU 48 hours after heart transplant.

of a Left-Ventricle-Assist-Device (LVAD) to sustain me until I could be qual-ified for a heart transplant. As a team, we chose less invasive intravenous drug treatments in lieu of the LVAD which allowed me to avoid one trip through the Operating Room and associated recovery time. I was released on life support and returned to Madison to continue working until a donor heart could be found for me. I continued to work at Digium with an IV bag of medication, pump, and batteries by my side 24 hours a day. Rather than walking around with an IV pole, I repurposed a Camelbak backpack (made for athletes to stay hydrated during exercise) by removing the water bladder & refilling it with my medicine, batteries and pump. Most people I encountered during the day had no idea that I was so sick and on 24 hour per day medications to sustain me until heart transplant. It wasn’t long until we got “the call” from the heart transplant coordina-tor that a donor heart was available to me. Cindy and I behaved much the way a couple does when they are expecting their first child, except it was me that was going to the hospital and my wife running around the house, calling the neighbors making all the final preparations to leave for Birmingham for my heart transplant! When I arrived in the ICU in Birmingham, I remember one nurse talking to me like I was a kid at Christmas time. She said, “How do you feel? Are you excited? Tomorrow you’re going to wake up with a new heart and feel better than you have in years!” She was right, my results were outstanding. I was up and walking around the ICU 48 hours after heart transplant, I walked a mile inside the hospital 3 days after transplant, and was discharged a week later. My team members at Digium “gave me a hard time” because in their view, by answering emails via my laptop, I “worked” the day before & day after my heart transplant – overachieving for sure!

It’s been 5 years since receiving that wonderful gift of a new heart. I’ve learned that sustaining my new heart requires daily attention and work. I maintain a running EXCEL spreadsheet that tracks daily readings on my vital signs, plus any reactions to medications, feelings I’m experiencing, issues navigating life, etc. When issues do arise, like an allergy to a particular medicine, the team and I compare notes and come up with solutions rather quickly. For example, due to developed intolerances to some medications, I’m on my second cocktail of antirejection medications and the team and I continue to monitor and tweak the medication doses used to control my blood pressure. Set-backs and challenges go more smoothly and result in better outcomes when you and your medical team can candidly discuss data & facts about your condition. Secondly, staying physically fit is on top of my priority list. I use a Fitbit to track my daily steps, exercise and sleep patterns. I also use website MyMedSchedule.com to help me keep track of my medications and to remind me to take them three times daily. I think it’s a great idea to use technology, in many cases free technology, to help patient’s recovery and to provide valuable data to doctors when needed. Finally, my wife, Cindy is the closest physician I have! She encourages me, helps me keep notes & schedules on treatment plans, results and next steps. For sure, she deserves the caregiver’s gold medal for all her love, support and tenacity. To celebrate the fifth anniversary of my heart transplant, Cindy and I will be joining our friends for a week of snow skiing in Park City, Utah. As the saying goes, Life is Good. If Life is Good, then Life Post-Transplant is Great! I hope that my experience may encourage and lead you or someone you know to an abundant recovery! About the Author: Steve Burcham is VP of Manufacturing & Quality for Digium a Unified Communications company headquartered in Huntsville, Alabama. Living in Madison, Alabama, he and Cindy have three adult daughters and one granddaughter. An engineer by profession, he is an inventor, and contributing author to Old Huntsville Magazine and published his autobiography, Prayer and Grace, My Journey to a New Heart in 2012.

GetCPRcertified by Kimberly Waldrop, M.A.

Imagine walking through the mall, minding your own business, when you hear someone yelling for help. You turn around to see a young woman bent down next to an older man. The woman is crying for help and shaking the man, who seems unresponsive. Immediately, you are hit with the urge to provide assistance, nobody else is doing anything. Your brain starts working overtime… trying to remember anything you can from that medical care class you took in high school. Maybe you can pull out some memories of CPR training…how to find a pulse…should you call 9-1-1 first??? The best thing we all can do is become certified in CPR training. Since that medical care class in high school, recommendations for performing CPR have been revised. The training keeps you updated and will also enable you to be comfortable actually helping and reacting in a crisis situation. It can also protect you by being covered by the Good Samaritan Law. You can receive training at local hospitals, fire departments, and even online.

www.nationalcprfoundation.com

TO MASK OR NOT TO MASK? By Kari Kingsley, MSN, CRNP

COVID-19 is changing the way we live our lives from the ground up. The new (and sometimes incorrect) recommendations circulating can leave us in a tailspin. Most people get the basics. Wash your hands. No, really, wash your hands. Sing “Happy Birthday” … count to twenty… do whatever you have to do to make sure your hands get the just came off a fishing charter, changed a baby diaper, and then cut raw chicken deep scrubbing they deserve. Or use an alcohol-based hand sanitizer. Don’t touch your face. Ok, louder, for those of you in the back. DON’T TOUCH YOUR FACE. Easier said than done. The average person touches their face up to 3000 times a day. That’s a little over 2-3 times a minute. Avoid sick people. Like the plague. If you get sick, don’t panic. Get a COVID-19 test if you meet the requirements (fever, cough, shortness of breath, you get the gist). Then avoid people like the plague. Stay home from work, school, and for

the love of all things healthy, stay out of Walmart. Practice good manners and cover that cough. Use proper etiquette by coughing into your elbow. Maintain social distancing measures, especially in areas of potential community-based transmission. While this remedial information may seem like COVID 101, there is still a lot of confusion circulating on when to mask and when not to mask. Recommendations seem to change rapidly and casual grocery store people watching reveals we may not all be acting as we should. At the present time, the Center for Disease Control has recommended using simple cloth face coverings to slow the spread of the COVID-19 and prevent asymptomatic carriers from transmitting the virus. What are the appropriate recommendations for when and where to wear a mask? We asked a local Infectious Disease Specialist, Ali Hassoun, MD, FACP, AAHIVS, FIDSA, to weigh in.

Should you wear a mask at home? No, unless you are taking care of someone who is sick with COVID. Should you wear a mask in the car? No. Should you wear a mask while visiting a friend? Yes, if you cannot maintain physical distancing. Should you wear dentist’s office? Yes.

mask

the

doctor’s

Should you wear a mask while getting your hair or nails done? Yes. Should you wear a mask to the grocery store and other crowded areas? Yes. Should you wear a mask during a run or while exercising outside? No. Should you wear gloves? No. Thoughts on hand sanitizer vs. washing hands? Hand sanitizer containing 60% alcohol used for 20 seconds is the best way as its more accessible. You should keep hand sanitizer in your car, home, office etc,. Washing your hands with water and soap is also an option but you need several minutes for it to be effective. Additional general recommendations to prevent the spread of COVID-19: Physical distancing and hand hygiene are the most important aspects in prevention. Wearing a mask in public is an additional measure that can help.

Surgical or procedural face masks are a better option than cloth masks in prevention. The face mask is mainly beneficial when you are in an enclosed space and near other people when you can’t maintain physical distancing of 6 feet or more. If you use face masks, please remember these can get contaminated easily, so don’t touch the mask. If you take them off place them in a brown or plastic bag. If they are soiled or dirty, get a new one. Cloth masks should be washed with hot water and soap regularly. Dr. Ali Hassoun is Board Certified in Internal Medicine and Infectious Diseases. He has been serving the Huntsville - Madison community for more than 15 years. He completed his Internal Medicine Residency from NY Medical College and completed an Infectious Diseases Fellowship at Albert Einstein School of Medicine in Long Island Jewish Medical Center in New York. He has also practiced in Auckland, New Zealand with the Australasian College of Physicians. Currently he is a Clinical Assistant Professor with UAB School of Medicine - Huntsville campus, an adjunct Faculty with UAH nursing school, Director of Infection Control for Huntsville Hospital, Madison Hospital, and Crestwood Medical Center. Dr. Hassoun also has extensive research experience including presenting manuscripts at local and national scientific meetings as well as writing book chapters. Information and recommendations regarding COVID-19 are updated almost daily as new scientific data becomes available. Please continue to check the CDC website for additional updates on COVID-19.

A Time To Shine Infection Control During a Pandemic By Macy Magnusson, MS

Hospitals are a place of healing and recovery. Unfortunately, they are also a place where infections can spread rapidly if proper precautions are not taken. According to the Centers for Disease Control and Prevention (CDC), 1 in 25 hospitalized patients will get an infection as a result of the care that they receive, and an estimated 75,000 patients with healthcare-associated infections will die each year. Because these infections pose a major threat to patient safety and in turn the safety of the community, hospitals have made the prevention and reduction of infections a top priority, depending upon their Infection Control teams to lead the charge. At Crestwood Medical Center, a lot of time, hard work, research, and education goes into preventing the spread of infection. Crestwood’s Infection Control Team is made up of 2 Infection Preventionists, Amy Stephens, RN, and Roslyn Richardson, RN. Infection Preventionists are experts on practical methods of preventing and controlling the spread of infectious diseases. They tend to wear many hats. They look for patterns of infection within the facility; provide education to patients and staff members; audit practices; develop, review, and update the facility’s protocols and procedures for infection control; investigate infections and outbreaks; advise hospital leaders and other professionals; and coordinate with local and national public health agencies. Their roles and responsibilities require expertise in microbiology, epidemiology, statistics, human resources, education, public policy, and clinical practice. Most of the work Stephens and Richardson do is typically done behind the scenes. When COVID-19 hit, they found themselves in the spotlight, their roles proving to be more critical than ever before. Their primary roles immediately shifted to the hospital’s preparation and response to potential COVID-19 cases. Each day, Stephens and Richardson are responsible for reviewing the guidelines and recommendations on safely caring for patients with suspected and confirmed COVID from governing bodies like the Centers for Disease Control and Prevention (CDC), Centers for Medicare and Medicaid Services (CMS), World Health Organization (WHO), and Alabama Department of Public Health (ADPH). From those guidelines, they

Roslyn Richardson, RN, & Amy Stephens, RN

have written and implemented policies and procedures for preventing the transmission of COVID-19 within the facility. They have been involved in key decision-making and planning with regard to issues like personal protective equipment (PPE) supply and use, to ensure that all staff members had appropriate PPE at all times, and helping to optimize infection control in the design and set up of Crestwood’s COVID units. In addition to researching and planning, Stephens and Richardson have worked closely with the clinical staff, educating them on hand hygiene and appropriate PPE usage and addressing any issues that the staff encountered along the way. Because of the excellent job that Stephens and Richardson have done, as of the date of this publication, Crestwood has been able to keep 100% of its team members healthy, provide appropriate PPE to all of its staff during the country’s PPE shortage, and continue to give excellent care to all patients. Their hard work and dedication to keeping everyone safe also reduced the risk of spread within the community. In moments of crisis, there are always helpers and heroes. For Infection Preventionists like Stephens and Richardson, this pandemic has been their time to shine. They have shown our community just how important infection control is and the positive effects infection control can have on keeping everyone safe and healthy.

Teaching During A Pandemic By Kimberly Waldrop, MA

If you ask any teacher why they got into the profession, more than likely, they will answer the same. Teachers love the interaction with their students. They love the classroom community and the school environment. They look forward to seeing their students face to face, day to day. They are involved in their lives and care about their students as much as any family member. This year, teachers have been faced with something so outside of their control and comfort zone. A profession that is based around human contact and social interaction has been turned upside down. No longer are teachers using their creativity, their true skills, and their true desire but they have been forced to become facilitators of online learning. Something none of them chose. I spoke with several local teachers just to get an idea of what they think… Teaching is a great honor. I still remember our last day together on March 13th. I am so grateful that I can see their faces online, but having to close the building early has left an ache in my heart. I miss the every-day things that happen in a classroom setting. I miss watching them play and hearing them talk with each other. I miss seeing their creativity in action. I miss getting to share stories and books with them face-to-face. I miss their hugs and giggles. I miss getting to celebrate their wins as they

“To teach is to touch a life forever...”

learn new things. I miss hearing their perspective on any and everything. I miss them. My children and this time have taught me not to take one single day of teaching for granted. Every day we get to spend together is a gift. Children are a gift. The connection with students in the classroom is what fuels the desire and drive to teach. While days in the classroom can be long and tedious, the rewards from smiles, hugs, and those “aha” moments when students have a breakthrough make challenging days worth it. E-learning has been difficult, mostly because the connection between student and teacher is different and disjointed. There are not as many close conversations and the lack of human contact can make even the best online sessions feel somewhat sterile and empty. At the same time, I realize that for some students their daily dose of e-learning may be a bright spot in an otherwise challenging and lonely day. I can’t wait to be back in the classroom with my students in the near future! I am stressed and anxious. I worry even more about my students than I did before. Do they understand the assignment? Are they eating? Are they safe? What do they need? That is why I gave out my cell number and told them to call me anytime. Teaching during this time is putting more stress on me than ever before. I need to see my students, hug them and look into their eyes to know for certain they are ok.

Teaching has been my dream ever since I was a little girl who was inspired by so many wonderful teachers. I have seen many changes in education throughout the years, but none quite compares to this year. This year, I did not get all my time with my precious students. A part of me has felt broken because we have not been able to return to our classroom. However, through this experience I had to give myself, my students and their parents grace. This has been a learning experience for us all. I have had to be forced out of my comfort zone to create videos of me teaching and trying to create fun, yet meaningful lessons that my students can complete independently at home. I have had to balance all of this while also teaching my own children. In return, my student’s parents have been grateful and supportive while continuing their child’s learning at home. Teaching through e-learning, I have been extremely blessed to work and collaborate virtually with some of the best educators. While this is not how I wanted our school year to end, I have been grateful for this experience. Teaching has always been my dream job. As a first year teacher, I’ve only just begun my teaching journey and this is not how I imagined closing out the school year. However, I have been encouraged to see every teacher really together to continue to provide the best education for our children. I am grateful more than ever for my colleagues. We truly are a team! We build off each other’s strengths, shared ideas, and compiled resources to create virtual lessons and assignments. The transition to distance learning has taught me more about technology than I ever thought I’d know. It was definitely a challenge and steep learning curve at the beginning when I was learning google classroom and simultaneously trying to teach my students and families how to use it. Thankfully, the overwhelming feeling of being a google help desk lessened each week as the students learned to navigate google slides and turn in their assignments. Google meets with elementary students are an adventure. It warms my hear to see their smiling faces and hear their sweet voices. The screen is a constant swirl of activity. I miss the random hugs, stories, celebrating loose teeth, and aha moments. My heart hurts that we said goodbye that last day with no warning, preparation, or idea it would be the last time we were together this year in a classroom. Being a quarantine teacher has impacted my teaching career for the better. Grace, flexibility, and collaboration quickly became the running themes of distance teaching. I am very fortunate to be a teacher! I have been able to work from home and continue to pay my bills. I terribly miss my morning hugs, my students’ sweet faces and “you can’t make this stuff up” things they do and say during a school day. I am thankful for the wonderful support I have had from my administration, my grade level team, office staff and my amazing parents.

Take time to thank a teacher. These unprecedented times are opening all of our eyes to many things we’ve always taken for granted. From veteran teachers to first year teachers, they are doing the best they can with what they have been dealt. Our teachers love our children and miss them.

New Year Your Mental Health Welcome to the New Year! This is a time for new beginnings, a fresh start, and a clean slate. But what if you do not feel that way? While many people are channeling the excitement and making New Year’s resolutions, others are just surviving. If the thought of a new year does not bring feelings of excitement and opportunity, you are not alone. An often overlooked part of turning the calendar’s page is an inventory of your mental health. Mental health is a vital aspect of overall wellness, a critical piece that not only compliments your physical wellbeing, but often contributes to it. Yet, all too often we brush aside taking care of that essential part of ourselves. Why is that? While there are any number of factors, I believe it is partially due to the ongoing stigma surrounding mental health care. I also believe it is because many are unaware of the importance of mental health. Lastly, I believe there is a general lack of knowledge about where to start when it comes to taking care of one’s mental health. Let’s take a moment and unpack these points a bit.

Mental health is not just for people with problems. Surely you have heard the comments “therapy is just for crazy people”, “how is a stranger going to help me, this has been a problem in my family for generations”, or how about “only weak people get therapy”. Ouch. That last one stings. The reality is, strong people attend therapy. Struggling people attend therapy. Accomplished, well-off people attend therapy. Broken, hopeless people attend therapy. You see, therapy is, in its very nature, designed to help people exactly where they are starting from, regardless of the factors that bring them in. Therapy can even be used as a tool to increase satisfaction in your life and relationships, even if there is not an immediate problem! Mental health awareness is important, and benefits everyone. Mental health literally means the health of your mental status. For some people, that status is great, they are flourishing. For others, they need more assistance. Regardless of your current state of mental health, being aware is important. Caring for our brain, which plays a big part in our emotional wellbeing as well as our physical welfare, is vital to operating at our optimal levels. Our brain and body work in tandem

by Rachel Sullivan, MFTA

throughout our life span. When one of these components is unhealthy, it directly affects the other. For example, when we feel depressed our body has physical symptoms which often lead to a decreased desire to be physically active. A study published in The Journal of Clinical Psychiatry explains this in turn can cause complications with multiple body systems. Persistent anxiety can lead to alterations in brain functioning, which may affect social and work environments. The truly scary part? Often these mental health issues show up in physical form first so they may be difficult to recognize. Maybe you have repeatedly felt just blah, but chalked it up to being overly tired. Or had an increased heart beat in social situations, but assumed your gut is telling you there must be something to keep an eye out for. Sound familiar? You are not alone, but where do you even start?

Start a conversation. According to the National Institute of Mental Health nearly one in five U.S. adults live with a mental illness. It is estimated that only half of those people receive treatment. That is a lot of people going without much needed assistance. Talking with a trusted friend about where you are at with life is a great starting place. There is power in personal connection. You can also speak with your primary care physician. They are aware of how mental and physical health complement each other and can get you in touch with a mental health care provider. These trained professionals are equipped to assess symptoms and develop a course of treatment that best suits your needs. Some of these professionals will even be able to help your family learn how to best support you in your journey to wellness. Wherever you fall on the mental health spectrum, be mindful of you. The New Year does not have to feel like more chances to fail or fall short. 2019 can be the time you finally get serious about taking care of your mental health and start working on the best version of you. Rachel Sullivan Marriage and Family Therapy Associate Solid Ground Counseling Center 9694 Madison Boulevard, Suite A7 Madison, AL 35758 256-503-8586

Finding Ourselves.. NO MATTER THE SEASON By Elisa Brooks

We are smack dab in the middle of a season most of us did not expect to find ourselves in. Life continues in the middle of a pandemic … but at the same time, life is not the same. Have you felt that way? I often go for walks outside. The sky is still blue, the birds are still chirping, the grass is still growing, and life at that moment feels “normal.” And then I return to my house and my four kids are home when they would normally be at school, I livestream my classes from my living room instead of teaching inside the gym, and friends that I spent time with in person, I now connect with over the phone. And I often wonder, who am I in the middle of this? What am I supposed to be doing? What am I not supposed to be doing? Can I thrive, even in a season of unknowns? Yes. Absolutely yes! I can and you can. There are lots of ways we can continue to become the person we long to be. Ways to continue to grow relationships with others and to thrive, in any season. I want to share one simple thing that has helped me immensely in my personal life to experience abundant life - both in “normal” seasons of life and even in this unprecedented time. Quit dying to the wrong things. You read that right. Quit dying to the wrong things. Do you ever feel like you are juggling five million things? Have you ever wanted five minutes of silence but it seems like you can’t find it? Do you ever say

“yes” to things, when on the inside you were wishing you could say “no”? Do you truly enjoy the things that you do each day? We often walk along the pathway of life, adding things to our to-do lists, adding events to our calendar, responding to more emails and more texts, but we are left feeling unfulfilled. Even resentful. If you can relate to any of that, it might be because you are dying to the wrong things. Geri Scazzero, in her book The Emotionally Healthy Woman says it this way: “You die to the wrong things when you set aside or devalue activities that cause your soul to feel fully alive (music, dance, writing, art, astronomy, outdoors); when you ignore important relationships; when you care for others to the detriment of yourself; and when you fail to honestly state your preferences, always deferring to others.” In my own personal life, I realized a few years ago that I I felt constantly exhausted. Occasional migraines, which I have dealt with since college, became regular occurrences each week. I felt like every request from family, friends, and church were obligations I had to fulfill and I was saying “no” to nothing. I was dying to the wrong things. My body was giving me a wake-up call with the migraines. I had four children under the age of 11. I rarely set aside time for myself. I love to read … but I never gave myself time to read.

I crave moments of solitude because that is how I re-fuel. Yet I never asked for time alone. Working out is one of my greatest joys, but I kept sacrificing my own workout time to work more hours at the gym. I was dying to the wrong things. There are things in life that we have to do that might not be our preference. I do not enjoy doing dishes. It always feels like a chore! The dishes still have to be done. Yet there are many other things in life I still have the choice to say “yes”, “no”, or “not now”. Are you, am I, saying yes to the right things? Over about a 9 month period, I began to adjust my schedule. My husband helped me create better boundaries because he recognized the exhausted wife, mother, and person I had become. He helped me commit to not taking on a second early morning class at the gym and made me promise to him I would only do one early morning each week. We re-worked our budget in order for me to have more time at home. I gave myself permission to say “no” to lunch meetings if I needed some solitude - and refused to feel guilty about it! I prioritized getting my own personal workouts each week. And in the middle of this pandemic - spring 2020??? I reminded myself that I love to read. I love it! Since fitness centers are still closed and my work hours are different, I have given myself permission to pick up some fictional novels that I have wanted to read for a long time. I continue to find that when I say yes to things that bring life to my soul, I am a better mother, wife, and friend. I have a fullness of life to share with others, instead of little bits of leftovers. One simple but profound way to help find out if you are dying to the wrong things is to make two simple lists. Make a list of the things that fill you up. Bring you joy. Maybe it is time in nature, or time with friends. Whatever those things are - write them down! Then write a second list of things that drain you. Be honest on both. Then compare. Our pastor suggested doing this as we look at our Sabbath days, the day we need to take rest. Rest is not doing nothing! Rest is taking time for what fills you up! Ask yourself: is my life filled more with things that energize me? Or is it filled with things that drain me? If you find yourself constantly exhausted and irritable, perhaps it is time to begin to make adjustments. Adjustments take time. You and I cannot wave a magic wand over our schedule and repair what we have been overcrowding for years. But we can take one step at a time to make a difference so that we enjoy fullness of life. Each small step of weeding out something that drains you and creating space for people and activities that fill your soul to the brim matters. I promise that you will find yourself as you do it! The girl inside me that laughs, jokes, hugs more, is patient, silly, energetic … she comes out more and more when I am careful to live for the right things and give myself freedom to die to the wrong things. Each season of life provides us moments of growth if we are willing to embrace growth and change. Sometimes change can feel scary or simply unknown! This season is no exception: the opportunity lies before you. Don’t sit and wait for COVID-19 to disappear and life to return to “normal”. You can find life and beauty even right now - make the choice to live for those things!

A Mom’s Perspective on

by Amy Fruchnicht and Connie McGougan

You walk hand in hand over the obstacles until you’ve

conquered every single one

for that day, and start over again the next.

I’ve been living in the autism world for 8 years now and my perspective changes daily, sometimes hourly. The world I live in is unlike the life of most people I know. Autism controls every facet of my life, and I’d be lying if I told you otherwise. Autism controls what time we get up in the morning and what time we go to bed at night. It controls where we go in public and which way we drive to get somewhere. Autism controls who we can visit and where we go to eat. It controls what we have in our home and what therapies we have to schedule. It controls the numerous specialists we see, the daily battles we fight, and the sleepless nights. Autism controls the inconsolable crying, head-banging, hand-flapping and screaming. It controls the medication, the behavior plans, the public stares, and the angry glares. It steals the smiles, the dreams, and the happily ever after. In the beginning, it is hard to see anything else. It feels as though you’re drowning and you can’t come up for air no matter how hard you fight. It’s suffocating, lonely, depressing and heart wrenching. Hope is lost and fear takes over. You long for the life you’ve always dreamed of while being stuck in a horrifying place. You lie awake at night weeping and wonder what you did wrong in life to deserve such a painful sentence for your child. Why them? Why not me? Why did autism have to steal my child from me? It’s a long, dark and terrifying road. You’re just trying to make it from minute to minute, hour to hour, day to day. Everything in life comes to a standstill except finding the help your child needs to have the best life pos-

You learn to slow down and enjoy life at your child’s speed, and constantly love and praise every single success.

sible. You start learning the ropes of talking to other parents who have traveled the same path and getting advice on therapies, doctors, play groups, support groups and any other thing that will help you along your new path. You start finding little bits of hope along the way and you cling to them with all your might. You find that as you surround yourself with support, things start looking brighter. You find hope again. You no longer feel so lost. You even find yourself smiling and laughing again, and are startled at the realization. Soon, you will see your child is starting to make small gains. You learn to cherish the tiny pieces of hope and progress. You start to retrain your brain and truly celebrate every single success. No success is ever too small to celebrate! When your child communicates a need for something as simple as a cup, you jump up and can’t contain your delight at such a wondrous thing. Your life is starting to replace the fear, depression and pain with hope, joy and happiness. You see your child laugh and smile as they find joy in learning something new and you beam from ear to ear. Life is good and you start seeing the good in so many things you’ve never seen before. Your beautiful and perfect child teaches you to see the beauty in everything. You learn to slow down and enjoy life at your child’s speed, and constantly love and praise every single success. You cheer for your child and help them with every struggle; for there will be many. You walk hand in hand over the obstacles until you’ve conquered every single one for that day, and start over again the next. You are a beautiful team, mother and child. You can’t imagine your life any other way, and you see the beauty of autism and cherish the many things that make your child so special. There will always be struggles, but with an endless supply of hope, love and perseverance, there will never be a battle you can’t win. – Amy Fruchtnicht

Autism affects 1 in 68 children in the U.S. It is 4-5 times more common in boys according to the Center for Disease Control. Autism and Autism Spectrum disorder are both general terms for a group of complex disorders of brain development. The disorders are characterized by difficulties in social skills, verbal and nonverbal communication and repetitive behaviors. Individuals with autism often suffer from numerous co-morbid medical conditions which may include: Fragile X, allergies, asthma, epilepsy, bowel disease, gastrointestinal/digestive disorders, persistent viral infections, PANDAS, feeding disorders, anxiety disorder, bipolar disorder, ADHD, Tourette Syndrome, OCD, sensory integration dysfunction, sleeping disorders, immune disorders, autoimmune disorders, and neuroinflammation. Autism is the fastest growing developmental disorder, yet most underfunded. Currently there is no cure for autism, though with early intervention and treatment, the diverse symptoms related to autism can be greatly improved, and in some cases, completely overcome. -National Autism Association

ADHD My son is smart

Have you ever considered therapy for you or your children? Read Jennifer’s story and maybe you can relate. When I found out I was pregnant for the first time I was so excited! My personality is one that always wants to be prepared, in control and a planner. I naturally read all the books to educate myself and my husband so we could be the best parents to our first son. I talked to all my friends about what delivery would be like and what it was like to care for a newborn. I was confident with what kind of mom I was going to be and had the “I got this” kind of attitude. Deep down I was scared! What if I wasn’t ready? What if I mess up? What if I miss something?

My son is now about to turn 9 and boy have I learned so much since then! I think my story is like so many other moms who live day in and day out wanting the best for their kids. When Chris was 2 years old my mommy instinct put up a red flag. Chris was not even making sounds or even babbling. Of course I googled and the word, “autism” im-mediately popped up. I began paying more attention to things and realized Chris did not have many of the descrip-tions. I talked to my doctor about it and he said that autistic kids can’t point. Chris could point though! I felt relieved. 4 months later he started to say 20 words in a day and I felt like he was making up for lost time. Still I felt something was off. We called him our “runner”. I would see little boys stand-ing nicely with their moms in the grocery store and wonder when will Chris be like that? Here I am chasing after him in the frozen food aisle. He would want to touch everything and get into everything. My husband would always say he is just a “boy” and he is fine. In preschool they would joke with me about how distracted he would get and how he was very smart. Fast forward to Kindergarten. I believe this is where those “ mommy instincts” or red flags started to pop out more. He was having a hard time staying on task and stay-ing focused. His grades were good and academically was right where he needed to be. But, his behavior was subpar at best. His teacher said she could tell he fights so hard to not make wrong choices but his impulsiveness always got the best of him. In April of 2014, when Chris was 6, I felt enough was enough. The “he is just a boy” phrase had expired and I was tired! I was tired of getting bad reports at school, I was tired of yelling at him at home for not sitting still and to stop be-ing so “wild” and I was tired of feeling like I was failing him!! I called my insurance company to find out what services they offer and what doctor was covered. I found out that my in-surance only covers a psychologist with a PH.D. I was told that there were only 2 doctors in the Huntsville area. We chose our doctor and made our first appointment. I was excited to go, I think so many people are afraid of psycholo-gist, but not this girl! I wanted answers, I wanted help. No one gives you a manual on parenting. I didn’t have time to read books and surf the web. I wanted face to face contact. I think I cried the first 6 visits talking about how I felt Chris was not your “typical” boy and how we had gone through so

many daily struggles together. I cried over thinking I wasn’t a good mom and how maybe my kid just needed a good spanking and more discipline. I cried over all the times of “looks” I got when out in public or how many times he did something he wasn’t supposed to do in school. I will never forget one of her first questions to me was “tell me 3 posi-tive qualities about Chris”. I was not prepared for that question at all. I thought I was here to talk about all the stuff going wrong. That moment was eye opening to me. I am a positive person by nature. I try to find the positive in any negative situation except for this one. Therapy has been life changing for me, my son and our family! We go every 3 months now to check in and talk about different behaviors or different ways to parent and help our son excel in life. I learned positive reinforcement techniques, different ways to talk to Chris when it came to discipline and most impor-tantly how to love my son for who he was and how we turn the negatives into positives. I’m sure your wondering what his diagnoses was and what was wrong with him. The answer is... nothing! He is an impulsive, has a hard time sitting still, high energy boy who wants nothing more than to be loved and accepted by oth-ers. For insurance purposes, he is “labeled” with attention deficit/hyperactivity disorder. I knew our Doctor was a great fit for us when she said she does not care for labels. For me, therapy is about asking for help when you need it, not being in denial about who our kids are and love them the way they are. I’m a parent who doesn’t have all the answers but I can sleep well at night knowing that my husband and I are doing everything we can to give our son the best version of us and experiences in life. My son is smart, he loves making others around him laugh, and he has a sensitive warm and caring heart. Parenting is hard but with a little extra help it can be great. Don’t look at therapy as a negative thing. It can take such a weight off your shoulders. It has helped our son, and our family, tremendously! Now, can you name 3 positives about your son or daughter?

Finding Mindfulness

by Ragan Bailey, MA, ALC

So many of us run our lives in an autopilot mode and actually become detached from the world and people around us. Mindfulness is an excellent therapeutic technique that is used in the counseling field. Practicing Mindfulness helps an individual become more conscious or aware of the present moment all the while calmly acknowledging and accepting the personâ&#x20AC;&#x2122;s thoughts, feelings, and sensations. You can find Mindfulness apps on your smart phone or tablet to practice with, but I have also constructed a daily approach. Take the time to slow down and enjoy your life, even the un-enjoyable moments can be used as learning opportunities. Take note how hard implementing this routine is, because the harder it seems, the more disconnected you may actually feel.

Mindfulness Approaches to Your Day

MORNINGS: Open your eyes and lie in the quietness of your room. Let your mind relax and push all of the day’s needs and happenings from your thoughts. Notice the feel of your room: temperature, lights, and what your body is saying. Take 5 deep breaths. Before breakfast, drink a full glass of water with fresh squeezed lemon to detox. While you fix your coffee or breakfast, pay attention to each task as you prepare it- don’t think about other things, just focus on your task at hand. While you sit to drink your coffee or eat breakfast, don’t look at your phone or read the newspaper- just be. Be present with yourself and what you are doing at the moment. As you leave for the day and step outside, feel the temperature- how your body reacts to it: the sun on your face or the raindrop in your hand. Take in the sounds and the smells of nature around you. If it is a summer day and you can walk barefoot in the grass then do so! These things ground us and connect us with the earth LUNCH: Don’t skip lunch, everyone needs a break in the day. Multi-tasking during lunch causes burnout. Take the time for yourself before finishing the day’s tasks. Even if it is only 15 minutes. Before diving back into the work, take a moment to realign your body, sit with good posture and concentrate on your breathing- when your mind drifts away, re-center it back to breathing. This allows for a calm refocus on what needs to be done. It helps us to feel less anxious and rushed to complete tasks, and it gives clarity of mind to focus on the rest of the day’s tasks EVENING: As you come home in the evening and start shedding the day’s armor (coat, purse, briefcase, shoes) imagine also that you are shedding cares and worries from your day at the same time. For every physical item you remove, remove an emotional one as well. As you prepare or eat dinner take in the smells and tastes from the food. With each bite be mindful of chewing, swallowing, and tasting. At least one hour before bed, put away all electronics and turn off the televisions and radios. This allows your mind to be quiet and helps relaxation and sleep. Leave the noise of the day behind and reflect on all your progress. Take time to be grateful for blessings and protection Ragan Bailey, MA, ALC Foundations Counseling Center, Inc. 725 Market Street Athens, AL 35611 (256) 497-3147

By Victor Chin, MD

WORDS REALLY DO

HURT

Inside Medicine | Spring Issue 2019

IMFall'19.indd 26

8/28/19 2:38 PM

STICKS & STONES MAY BREAK YOUR BONES We all learn this rhyme in our youth. It implies a distinction between pain arising from a physical attack and pain associated with language. We are challenged to remain stoic in the face of insulting words; to not allow language to crush us. For centuries we have believed the physical and the mental are separate spheres of our existence. Brain research in the past 15 years, however, has started to reveal both physical stimuli and language affect the brain in similar ways. Language can touch our deepest neuronal reality. Functional magnetic resonance imaging (fMRI) is a scanning technique that detects brain blood flow changes associated with increased neuronal activity. Functional MRI has been used to reveal regions of the brain activated by a painful stimulus, areas that have been collectively termed the “pain matrix.” Imaging studies [1] have revealed the pain matrix is stimulated not only by painful physical events, such as laceration with a knife, but also by words describing pain such as “excruciating,” “grueling,” and “paralyzing.” In another experiment [2], these same pain words versus neutral words were shown to people before an electric shock was applied. Increased pain ratings were reported following an electric shock if the participant was primed with a pain word as opposed to a neutral word such as “cubic.” These results confirm the popular intuition that a pre-existing negative attitude can tinge our perception and experience of an event. In colloquial terms, everything in the world is darker if you perpetually wear sunglasses. Chronic back pain is one of the most common conditions seen in a pain management clinic. A research study [3] revealed chronic back pain patients have

IMFall'19.indd 27

an increased response in the brain pain matrix on fMRI to pain words compared to normal people without back pain. Those tortured by chronic pain are more vulnerable to piercing words than those without the affliction. There is a vicious circle regarding physical pain and pain language. Both stimulate the brain pain matrix. Pain words preceding physical pain can increase the intensity of pain. Chronic physical pain can amplify the reaction to pain words. The pen and the sword; each alone can cause suffering and together they can perpetuate it. As a pain management physician, I wonder how can we interrupt the cycle and release the patient from the vortex of suffering? Cognitive behavioral therapy (CBT) is a psychological technique that draws upon the ancient philosophy of Stoicism. Epictetus, a famous stoic philosopher, once said “Men are disturbed not by things, but by the views which they take of them.” CBT aims to shift the locus of control to the patient herself; to empower her to recognize and change distorted and destructive thoughts in the here and now that affect her behavior and pain response. CBT can help a patient reframe her chronic pain and relationship with it. An imaging study [4] using fMRI indicated that CBT can change the brain pain matrix and decrease pain. So we return to the last part of the above childhood rhyme: “…but words can never hurt me.” Perhaps with the aid of CBT and Stoic philosophy we can change how language affects pain. The following quote is attributed to the Nazi concentration camp survivor Dr. Viktor Frankl:

“Between stimulus and response, there is a space. In that space is our power to choose our response. In our response lies our growth and our freedom.” References 1. Richter M, Eck J, Straube T, et al. Do words hurt? Brain activation during the processing of pain-related words. Pain. 2010 Feb;148(2):198-205. doi: 10.1016/j.pain.2009.08.009. Epub 2009 Oct 28. 2. Richter M, Schroeter C, Puensch T, et al. Pain-related and negative semantic priming enhances perceived pain intensity. Pain Res Manag. 2014;19(2):69–74. doi:10.1155/2014/425321 3. Ritter A, Franz M, Puta C, Dietrich C, Miltner WH, Weiss T. Enhanced Brain Responses to Pain-Related Words in Chronic Back Pain Patients and Their Modulation by Current Pain. Healthcare (Basel). 2016;4(3):54. Published 2016 Aug 10. doi:10.3390/healthcare4030054 4. Shpaner M, Kelly C, Lieberman G, et al. Unlearning chronic pain: A randomized controlled trial to investigate changes in intrinsic brain connectivity following Cognitive Behavioral Therapy. Neuroimage Clin. 2014;5:365–376. Published 2014 Jul 23. doi:10.1016/j.nicl.2014.07.008

8/28/19 2:38 PM

OTC MEDS AND EMOTIONAL pain by Victor Chin, MD

Victor Chin, MD is an anesthesiologist specializing in chronic pain management at SportsMED in the Huntsville, Madison, and Athens AL locations. He graduated from medical school at Johns Hopkins and completed his residency in anesthesiology and fellowship in pain medicine at Harvard â&#x20AC;&#x201C; Massachusetts General Hospital.

CAN OVER THE COUNTER DRUGS TREAT EMOTIONAL PAIN?

IMFall'19.indd 50

8/28/19 2:38 PM

(continued from p. 31) As Earth’s an anesthesiologist in the electrons operating room, purpose wasthe to al-need the crust. These willmy then satisfy ter a patient’s consciousness and enable her to tolerate the trauma of required by the radicals that theyanesthesiologist, do not produce surgical healing. As free an outpatient painso management I commonly people withThis chronic spine pain joint pain. My pa- or any furthertreat damage. concept isand called “Earthing” tients seek alleviation of pain to improve their function and enjoyment “grounding”. While it may not be widely accepted by evof life. Most people distinguish between emotional pain and one physical pain.from Get all the tantalizing eryone, no one can dispute the pleasure feels We have all experienced these in our lives. Who amongst us has esstanding warm caustic sand or grassy patch ofabrupt dirt. smells, tastes and textures caped the on unmitigated painaofcool, romantic rejection or the piercing pain is of being kickedtrue, in the shinbone? paineven If this indeed we will Although spend emotional hours or of your Newk’s favorites, and physical pain seem distinct, we also sense they overlap. Many days while at the emotional beach with direct connection to the patients acknowledge stress a exacerbates their chronic pain delivered wherever you conditions and chronic pain engenders a depressed mood with hopeocean water or wet sand. This extended time may give need them. Our catering lessness. The emotional and physical are linked hand in hand in a a “chicken-and-egg” boost to our relationship. overall health that presents with a quick specialists will deliver, set Medical research in the past 15 years, however, has started to reveal improvement in our sense ofinvolved well-being. common brain mechanisms may be in both emotional and up and everything in between. physical pain.aImaging studies usingbe functional (fMRI) to scan pa- orWhile vacation may “just MRI what the doctor All you have to do is relax and tients’ brains suggest similar brain regions may be involved during the dered”, it may not practical experience of these twobe types of pain. or possible to just relocate enjoy the food! peoplebeach. who haveGood taken opioid medications for acute to Anecdotally, your favorite news, however, youordon’t chronic pain report a medication such as oxycodone often affects the have to move to enjoy some of these benefits. emotions in addition to their physical pain. Somesame of my patients note Getoxycodone evokes a euphoric sensation. Others report it worsens ting regular sun exposure will produce the same their effects.Reference Ratner, K. G., Kaczmarek, A. R., & Hong, Y. (2017). mood. Due to the growing knowledge of the dangers of chronic opioid Over-the-Counter Pain Medications Influence Our Studies show that 10-15 minutes ofhas sunlight on ex-Can therapy and our nation’s currentfifteen opioid crisis, attention refocused Thoughts and Emotinos? Policy Insights From the on non-opioid analgesics for acute and chronic pain. and Brain Sciences, 5(1), 82-89. posed arms and legs can produce 10,000 IUs in fair skin. Behavioral http://doi.org/10.1177/2372732217748965 Over-the-counter analgesics such as acetaminophen (Tylenol) and ibuprofen (Motrin, Advil) are Walking barefooted on grass or dirt can give you thehttps://journals.sagepub.com/doi/pdf/10.1177/2372732217748965 commonly used to treat physical pain. We consider these first-line same for grounding thatas the beachstrain gives agentseffect for treating “minor” pains such a muscle or you. a mild One headache. Webe believe these relievetreatments physical pain only, caveat is to aware ofmedications any chemical applied but what if they have an effect on our emotions in addition? Medical toresearch the grass. One recommendation 45 minutes a indicates common brain areas may be stated involved in both emotionalof and physical pain and that over-the-counter analgesics are useful can day barefoot exposure to the ground. Concrete for physical pain. It then seems reasonable to conclude over-the-countalso providesuch a direct link as well. may not practier analgesics as acetaminophen and This ibuprofen may alsobe affect our but emotional pain. regular exposure may make you feel betcal, getting Psychologist Dr. Kyle Ratner and colleagues at the University of Caliter. Staying indoors and an wearing shoes outside insulate fornia, Santa Barbara published article (Can Over-the-Counter Pain Influence Our Thoughts and Emotions? Policy Insights usMedications from that connection. I still encourage you, however, from the Behavioral and Brain Sciences) reviewing research on how analgesicsplenty affect ourof emotions. In one study toover-the-counter regularly consume fresh fruits andreviewed vegetables by Dr. Ratner, subjects given acetaminophen reported less hurt feeltoings supply your body with antioxidants as well other compared to those taking a placebo without differences inas positive emotions between the groups. In another study, subjects taking vital nutrients. ibuprofen reported less social rejection pain in an experimental task Seth Godin is quoted asDr.saying, “Instead ofpossibility wondering compared to those taking placebo. Ratner muses on the of using acetaminophen for emotional pain: “One could imagine when your next vacation is, maybe you should settaking up a life acetaminophen after a flubbed work presentation or after a spousal you don’t need to escape from.” Again, it may not be practidisagreement.” In my chronic pain clinic, I see many patients who suffer not only from cal to just up and permanently leave our lives, but I think physical pain but also emotional pain. I have in mind a young well-edwe canman all who findsees ways to chronic eitherlow reduce stress orsuffers find betucated me for back pain who also a subacute romantic schism occurring 5 months ago. He relates to me ter ways to cope with them. As for today, you can start by being torn asunder and his relentless pining for his erstwhile female beloved.going His chronic low back painsome is markedly increased. simply outside to get fresh air andPersistent sunshine. depressed mood is a common consequence of the loss of a romantic partner or family loved-one. Many physicians would start an antidepressant and refer him to psychological counseling. I wonder if taking acetaminophen or ibuprofen would alleviate his emotional suffering just as using these medications often help people with chronic low back pain? In pain medicine clinicians generally use an “analgesic ladder” and start by treating pain utilizing medications with less risks such as acetaminophen or ibuprofen. If initial treatment with these medications is ineffective, one may utilize analgesics on a higher rung of the ladder such as opioids, which involve greater risks. I can imagine the above sophisticated patient reading the research on analgesics and emotional pain. He says, “Doctor I understand emotional pain and physical pain involve similar neural mechanisms and areas of the brain. What works for physical pain should therefore work for emotional pain. I have tried the safer acetaminophen and ibuprofen for my emotional pain but I can’t stop thinking of her. Can you prescribe a stronger pain medication such as oxycodone to relieve my emotional distress?” In the operating room I anesthetized patients so they could endure surgical trauma. Now I wonder if patients ask me to anesthetize them to the “slings and arrows of outrageous fortune” in life.

IMFall'19.indd 51

8/28/19 2:38 PM

THE STIGMA OF

Mental Illness

by, Rachel Sullivan, MFTA

What if we talked about mental health as openly as physical health? Imagine what our communities would look like if individuals affected by a mental illness were able to gain support from their family and neighbors for their depression, the same as when they are post-op from a heart surgery. There is such a stigma surrounding mental health. A stigma is defined as “a mark of disgrace associated with a particular circumstance, quality, or person.” Layer that over mental health, and specifically mental illness and now the definition reads “a mark of disgrace associated with mental illness.” Ouch. It breaks my heart that mental illness continues to carry a mark of disgrace with it, especially with the high prevalence in our communities.

IMFall'19.indd 52

8/28/19 2:38 PM

Did you know that an estimated 1 in 5 adults struggle with a mental illness? When we include youth and children in this estimate, the percentage rises. With such significant numbers, the fact that mental health is still discussed minimally, if at all, is discouraging. We know that individuals with a mental health diagnosis are at a greater risk for social isolation, have greater difficulty developing fulfilling relationships, and that there is a correlation between untreated mental illness and suicide risk. Despite the known complications, as well as the known benefits of treatment, conversations about mental illness continue to happen below the threshold necessary to encourage change. Wouldn’t it be wonderful if we talked about mental health as openly as physical health? It would be so helpful if individuals affected by a mental illness were able to gain support from their family and neighbors for their struggles, the same as when they are discharged from the hospital after a procedure. Consider what the recovery process for mental illness would look like if when someone disclosed their struggle and their journey to wellness they were accepted and encouraged! Do you think that kind of support would affect whether people with mental illnesses reach out for help? I think so, and I believe this kind of change is possible, with some shifts in how society thinks about mental health. How do we begin to unravel the stigma? I believe the first step is to get educated! Almost without exception, when I have a judgment about a topic, it is due to a lack of information about that subject. Mental health is no different. In my opinion one issue that prevents people from being educated about mental health includes the lack of open discussions regarding the prevalence and impact of mental illness. Due in large part to stigma, many individuals who struggle with mental illness feel unable to talk as openly as someone who is battling cancer – and yet mental illness can be just as detrimental. When we hear personal testimonies about how mental illness affects people, we can connect our hearts with the importance of the cause. As I see it when we become educated, through real people accounts, our understanding and compassion provides the catalyst for reducing the stigma and normalizing mental health care. To begin changing the conversations surrounding mental health I have unpacked some points I believe are important. 1. Understand mental illness is not a choice. Depression, Anxiety, Bi-Polar Disorder, PTSD, Anorexia, Oppositional Defiant Disorder. These diagnoses, like so many others, involve a reaction in the brain that the afflicted individual has difficulty controlling without outside assistance. The behaviors, thoughts, reactions, and effects are not something the person would choose for themselves. Unfortunately, because of a lack of information, society sometimes paints a picture that people who are mentally ill choose to live this way. The truth is that even if they felt comfortable doing so, many people do not know where to turn to for help, or even that something is “wrong”. Mental illness tells lies like “You are the only one that feels this way”, it is from this isolating place that the person struggling keeps their battles tucked away, lest they seem “crazy”.

IMFall'19.indd 53

2. Mental illness can be treated. The field of psychiatry and therapy has grown tremendously over the past few decades. What we now know about the brain allows clinicians and physicians more opportunities to assist individuals diagnosed with mental illnesses. Previously, a schizophrenia diagnosis would almost certainly mean hospitalization. Fortunately, the advances in medicine and psychiatry have allowed a more comprehensive approach, providing platforms for many individuals with schizophrenia to live full, independent lives. These advances have positively impacted the field of mental health in many ways. Understanding the possibility of treatment can encourage those struggling to get help, which means more people on the road to wellness. 3. People with mental illness are not their diagnosis. Mental illness does NOT define an individual. We do not say “That bi-polar woman”, but rather “the woman with bi-polar disorder”, because the diagnosis does not define the person. It is a struggle they are walking through, not a definition of their being. Can you imagine calling the mom battling breast cancer “the cancer lady”? Absolutely not, and yet society has normalized the labeling of people struggling with mental illness by their diagnosis. In my opinion, this reinforces the stigma, rather than creating space for safe, open conversation about the struggle. Realizing that mental illness is something that affects the individual, rather than who they are, is key in updating how we view mental illness. 4. People with mental health diagnoses are capable. Individuals with a mental health diagnosis are just as capable of living abundant lives, raising families, and working fulfilling jobs as people who do not struggle with mental illness. It is true that some diagnoses will require more intense, or even long-term care for symptom management, but this does not prohibit productivity or decrease the value of the individual. Some of the most resilient people I know have battled mental illness and come out with more grit, tenacity, and compassion for others than individuals who have never dealt with mental health issues. So, what do we do with all of this? The reality is mental illness is not going away, a fact we cannot change. What we can change is the way we perceive mental health as well as the individuals who struggle with mental illness. We can set into motion a snowball effect of acceptance, and thus facilitate dialogue for healing. I believe when we do so the stigma decreases, and the topic of mental health care becomes a more normal conversation. People who are struggling feel more safe reaching out for help, and a shift begins. I am ready to be a part of the change, are you?

8/28/19 2:38 PM

Expectations & Brain Power by, Rachel Sullivan, MFTA

An expectation, as defined by dictionary.com, is “a strong belief that something will happen or be the case in the future.”

I would wager that you have been expectant at some point in your life. Expected a good test score. Expected a certain response from a friend. Expected a specific outcome from a medical test. You have also likely felt disappointment when those expectations were not fulfilled. Expectations are an interesting thing. They can certainly benefit us in our journey of life, helping us along as we set goals and aspirations for ourselves. However, expectations are not always positive, and that tends to be where this subject gets tricky. When we have had multiple negative experiences in our life, especially surrounding the same circumstance or person, our expectations can begin to be primarily negative. Although this typically takes a long period of time, and many encounters with disappointing outcomes, it can happen relatively quickly as well. Let us look at an example. Perhaps you have had surgery on your right knee, and the prognosis was originally positive. You begin attending follow-up appointments with a positive outlook, expecting good news. Unfortunately, at the first appointment you receive information that sets back your recovery time. No worries, you shake it off and attend the next appointment. More bad news. After several appointments with this same outcome, you may begin to make assumptions that the appointments will result in unfavorable reports. Your expectation is negative, and understandably so. At this point what has happened in your brain is that neural pathways have been formed surrounding this area of your life. These pathways contain data, based on your experiences, that inform you that these appointments are inherently negative. Whether this has happened in just one aspect of life, but especially when this pattern is repeated across several areas of life, we can begin to have a negative perspective. When this is the case it becomes very difficult to see any positive, regardless of how much may be there. Figuratively speaking we have a negative filter over our eyes. So, what is the prognosis? How do we prevent turning into those people we avoid because they always bring the dark clouds with them? The good news, there is hope in this situation. As mentioned, our brain creates neural pathways, forming information superhighways for the experiences we have during our lifetime. Fortunately, what neuroscience has revealed over the past few decades is that the brain is “plastic”, or capable of updating what scientists used to think was fixed, hard-wired information. We now know that with the use of

therapeutic techniques an individual can rewrite the neural pathways and change the way they think about and react to previously negative situations. Incredible, right? Following are three things we can do to interrupt this pattern. 1. BE MINDFUL. This process begins with noticing how we are feeling in our bodies. During moments of negative thinking when we can identify that automatic response as it is happening in our physical self, we can interrupt the information it is sending us about how to react. For example, returning to a follow-up appointment for your knee you notice that dread is setting in, the heavy anticipation of more bad news. In your state of mindfulness, you recognize this feeling and pay attention to how it affects your body. Is it a tightening in your chest or a difficulty to take a full breath? Or does it feel like a knot in your stomach, throat, or elsewhere? Whatever the feeling, take note of where and how it affects your physical self. Recognizing this sensation is important in interrupting it. 2. IDENTIFY A POSITIVE. Once you understand what your physical reaction is, when it begins to manifest, finding something positive about your situation is crucial. Rather than following the emotions and mindset that typically follow your physical response, instead take a few deep breaths and draw attention to that fact that since your last appointment you have noticed increased mobility in your knee. Although this step may be difficult at first, purposefully shifting your mind away from the negative onto a positive sends signals to the brain to change its focus. Do not The Stigma this step, it is crucial, so search hard for a positive if you must!

3. CREATE NEW RESPONSES. When we recognize how our body has been programmed to react to negative situations, we can begin to retrain it. New neural pathways are formed when we catch the automatic response of dread and replace it with thankfulness, or acknowledgement of positive in the situation. If we apply this to our knee appointment scenario, we have been mindful of how our body felt when the negativity started creeping in. Then we took a moment to identify a positive, and now we add the step of being thankful for the positive item. When we can repeat this process over time, we have the capability to update those superhighways. This may seem fairly simple, and in all transparency the description here is certainly scaled down. While there are hours of work that go into rewriting the brains responses, it is possible, and worth it! Now is a great time to start, and you have the tools you need already. If you are interested in more information about this topic, please reach out! Rachel Sullivan, MFTA Solid Ground Counseling Center 256-503-8586 www.solidgroundmadison.com

COPING IN Unusual Times By Rachel Sullivan, MFTA, CFLE

Coping mechanisms are the tools we draw upon to help us combat stress. It is no surprise that stress can do strange things to our bodies and minds. It can induce lethargy, intense anxiety, high blood pressure, depression, and change the way our brain makes decisions, all of which can make coping exceedingly difficult. Most people have some identified coping mechanisms that assist with striking a balance between the stressful event or circumstance, and a healthier state of functioning. Unfortunately, when stress happens during nonnormative times there can be additional factors at play including a decrease or complete lack of our usual coping options or an inability to gather support from the people we normally would. Regardless of the change in factors, there are some tools that are helpful for coping, even when times are unusual. Understanding your triggers. We have talked about triggers before, and likely will again – because they are important! These are those situations or people that poke some internal part of our emotions or memory and stir us to feeling out of control, or unsafe. The result of feeling out of control or unsafe usually begins a spiral of thoughts and behaviors that are unhelpful to us regaining the peace we are seeking. When we work to identify our triggers then the situations that would cause them to become less surprising, and thus our reaction to them changes. Triggers during times of unusual stress may include feeling helpless, hopeless, optionless, isolated, or stuck in a certain circumstance. Understanding a trigger can take some work and may not be something achievable without professional help. Resource List. This is a tool that frequents my clinical practice. A good resource list helps an individual outline what their resources are during a time of peace or neutrality, with the intent to be drawn upon during times of stress. Recall that stress forces the brain to make decisions about what functioning it will focus on – and typically logical thought gets excluded at some point in the process. So, creating a resource list during times of low to no stress is best. A good resource list should contain items, such as: •

Indicators you may be feeling excessively overwhelmed (you may be surprised at how difficult it is to recognize this when you are in this state!). Note the behaviors, feelings, and physical characteristics that you exhibit when your stress is high, and you are not at your best.

•

Coping mechanisms that can be utilized without outside assistance. These are things such as exercise, journaling, listening to music, taking a bath/ shower, or meditation. The items here

should be actual activities that you know are helpful, this is not the time to try out new things! The key here is productive coping, so any action that is unhealthy or self-injurious should not make the cut. •

People you can turn to in the event the above items do not work. The individuals on this list should be reliable and know enough about you to know what is helpful for assisting you in times of need.

•

Signs your stress levels are decreasing. This is important because being able to identify what is happening when you are starting to function more effectively gives you feedback that what you are doing is helpful. So, outline what you are doing and how are you feeling when you find yourself more balanced.

•

A list of local emergency numbers. Although no one enjoys thinking about what happens when our stress is so high we cannot handle it anymore, the fact is that everyone has that threshold. Having a list of your local emergency room number and location can be helpful in the event your situation escalates to an unsafe level and you need to reach out for medical help to stay safe.

Professional help. While there are plenty of ways that we can assist ourselves, sometimes the best option is to seek professional help. During unusual times of stress our resources may look different, our triggers may be stronger, and our coping strategies may not be working as effectively as they do during more normal times. When that is the case, there is nothing wrong with using outside assistance. Mental health professionals are trained to help people through difficult seasons and circumstances. Counseling may be the best option if you find yourself unable to regulate your emotions, your stress level remains consistently elevated, or none of the typical ways you cope are helping. It may be helpful to know that everyone has a certain threshold for dealing with stress. How we cope may look different, the tools we draw on likely vary, but the reality is all of us are coping with stress on a continual basis. How effectively we do so depends greatly on how much we are required to deal with at one time, and how well equipped we are to tackle the task. My hope is that utilizing the coping resources listed here will give you the advantage the next time you are faced with high stress. Stay well friends! Rachel Sullivan, MFTA, CFLE Solid Ground Counseling Center 256-503-8586 www.solidgroundmadison.com

let's look TO THE BEST

By Elizabeth McCleskey, DO

I “ t was the best of times; it was the worst of times...” to quote Dickens.

othing like a national emergency to help us sort the wheat from the chaff within our lives. Times of trial bring opportunities for new reflections on our lives. For years, people have been living “busy” lives. Now, many people have been brought face-to-face with the reality of what the effects of their lifestyle priorities have produced, and some of the “best” include: • Volunteers using their time, talent, and materials to make protective equipment for first responders and healthcare workers. (As a recipient, let me say thank you!) • Researchers posting tasty recipes from 1930- depressionera cookbooks that require minimal ingredients. • Family members exercising, dusting off and teaching the kids board games, defining and working on home projects, schooling, or just talking TOGETHER. • Young people helping older folks with shopping, yard work, errands, and even pitching in from their own pockets when seniors come up short in paying at the grocery store. • First responders and medical professionals with limited resources and an unknown enemy, swallowing their fear and finding their strength to attend the sick and dying. • Truckers, grocers, utility workers, local government employees, waste disposal workers, order pickers shippers, and all the others who work to keep us fed and our households running because of their integrity and work ethic. On the flip side, change may also reveal the negatives in our lives. Sometimes these are things that we may not have even noticed creeping in because there is a comfort and security with “routine.” While stress can bring out the good, it can also lead us to acknowledge dissatisfaction with the realities in our lives. Recent examples include: • Parents report they don’t like their kids. • Numbers of runaways are increasing. While some are due to domestic violence, many do so because they are mad, bored, or just want to see their friends. • Some are complaining about anything and everything, although they still have a home, loved ones, a job, food, toilet paper, and other creature comforts • Over consumption of processed food has led to weight gain and worsening diabetes and hypertension in others. Despite having time to cook, they chose this path because cooking is “hard and boring.” • Many are reporting tales of incessant social media, Netflix binges, and 24-7 news programs (much of which is designed to arouse negative emotions) leading to lack of time to accomplish anything meaningful. So, as with any challenge, there is also opportunity. As people are reporting feeling unmoored during this time, they believe there is nothing they can do to help themselves. This is far from the truth. Now is the time you can step up

to the challenge and reclaim your life. This is not a time to become self-critical, but to become insightful. As humans, we make mistakes. Sometimes by choice, sometimes based on poor information, and sometimes because of what has been modeled for us as the “right” way. Don’t waste time on fault and put aside blame and guilt. Instead, put your energy into evaluation and change. To start, ask yourself what has been important in your life that has been stripped away or changed? What do you or did you like to spend your time on? Did it help or harm your health/relationships? Flesh out your responses with the five Ws—who, what, where, when, why, and don’t forget “how.” Some starting-point examples might be: • If you don’t like your children or your teen won’t stay home, who has been assuming the responsibility to raise them? • What can’t or won’t you face at home that requires you to consistently want to escape? • Where did your practice of disparaging others or blanketly excusing others come from? • Why don’t you want to learn to cook? • When did watching media become more important to you than a hobby, learning something new, interacting with family, etc.? The common denominator here is EFFORT. Over the years, we have all brought “so” into our lives to justify our decisions. We wear it as a badge—I’m so busy, so tired, so discouraged, so important, so overextended, so indispensable, etc. No wonder there’s no time or energy for a mundane chore like, for example, cooking. (By the way, these folks likely eat many of their meals out and otherwise fill in with processed foods; eventually their health will reflect these poor choices.) So, what about you? Now that some of the busy-ness has been stripped away from your days, take the time to reevaluate what needs to come back. Do you want to maintain the status quo with the possibility of chronic disease and chronic medication, or do you want to take this time to build a healthy infrastructure to your days and improve your physical and mental health along with your relationships? Healthy relationships positively impact your health. Stress hormones increase your risk for several chronic diseases. If your relationship with your children is stressful, think about why. Have you unknowingly allowed teachers, coaches, music instructors, daycare workers, and others to usurp you as the parent? How can you better engage with your family and get to know each other as individuals? Couples in supportive relationships have better health outcomes. Has this time together brought you closer to your significant other? Sometimes we use busy-ness to avoid looking at how things really are. Do you have a contentious relationship which has been ignored? Have you settled into a routine with very little support or interaction? Are you ready to make some decisions about how you want the relationship to move forward?

Helping others increases positive brain chemicals. Why do you find it hard to stay home? If you are a natural extrovert who thrives on interaction, try phone or video chat to check on others that may not have family available. What about a volunteer organization or even getting to know a neighbor who may need you to run an errand? Let’s put your strength as an extrovert to work and boost those brain chemicals. Tidy environments reduce stress and improve sleep. Is your home or yard so out of control you don’t know where to start? Start with admitting there is a problem with where to begin. Maybe a peek at a website or a call to someone whose home/yard you admire can provide suggestions and motivation. But if push comes to shove, just pick up that sock and into the hamper it goes. Make the bed. Then fold that basket of clothes and put them away. Next, pull all those clothes off the pseudo clothes rack (i.e., exercise bike) and get them sorted and into the washing machine. One task at a time will lead to a much tidier room, and tidier rooms lead to a tidier home. Reducing negative exposure reduces overall depression and anxiety. Limit news watching to no more than 30 minutes twice a day. Too much bad news increases your stress hormones driving up blood pressure and blood sugar. Counteract negative thoughts by recording a daily gratitude list and spend an equal amount of time (i.e, one hour) enjoying hobbies, music, etc. Picking up a new healthy habit can reduce or prevent chronic diseases. Binge watching and eating junk food can result in weight gain and chronic diseases not limited to those of the brain like dementia or addiction. Let’s look at some healthy habits you can establish over time which support the brain or reduce the progression of debilitating disease. • Get plenty of sleep; it builds neurons and restores the body. • Learn to cook healthy meals; they contain the body’s building blocks which originate in unprocessed foods. • Get moving. No need to join a gym; a 30-minute walk after a meal can decrease blood sugars and improve mood and sleep. • Learn something new through a self-improvement program that teaches you to play an instrument, master a new language, explore your genealogy, pursue a new hobby or learn new skills related to an old one. You will be helping your body to build neurons, reducing stress, and maybe making new friends. While none of us has asked for this challenge, let’s try to use it advantageously. It is an opportunity, so let’s come out of it on the other side better and brighter and filled with the hope of the “best of times.” Dr. Elizabeth McCleskey Board Certified in Family and Lifestyle Medicine Madison, AL 256-280-3990 HealthStylesDr.com

Most of us have not experienced loss, empty store shelves, empty wallets, or stay-at-home orders. If you experience worsening depression, anxiety, substance use, hunger, suicidal thoughts, or are a victim of abuse, please contact one of these national organizations for referral to resources local to your area. For Emergencies 911 Boys Town for Kids, Teens, & Parents 1-800-448-3000 Substance Abuse & Mental Health Services Administration National Helpline 1-800-662-HELP (4357) National Suicide Prevention Line 1-800-273-TALK (8255) Veterans’ Crisis Line 1-800-273-8255 National Domestic Violence Hotline 1-800-799-7233 or 1-800-787-3224 (TTY for the Deaf) Disaster Distress Helpline 1-800-985-5990 National Alliance on Mental Illness 1-800-950-NAMI (6264) | Nami.org Feeding America FeedingAmerica.org

SMART-O GOALS by Rachel Sullivan, MFTA

Ahh. Another new year. I do not know about anyone else, but 2019 flew by. It seemed that as soon as I gained solid footing, it was already time to start writing 2020 on everything. Despite the year passing quickly, I was able to achieve several goals I had set for myself. I prefer to set goals instead of resolutions. Neurologically the words we choose make a noticeable impact on how we respond to them. For example, when we set a New Year’s “resolution” we are making a firm decision to do or not to do something. When we fail to resolve the identified thing, mentally we file that as a fail. Conversely, when we set ourselves a “goal” we identify something as the object of our ambition or effort and determine our desired result. It creates an end point we gradually work towards rather than a pass or fail. Did you mentally register those words differently as you read them? Me too. So, when you are setting goals, where do you start? I am sure you are familiar with the S.M.A.R.T. acronym, Specific, Measurable, Achievable, Relevant, Time-Limited. I use this outline, with a small addition of my own, to establish goals

for myself since it allows me to structure backwards from my desired result. In therapy I use this same concept to help clients work towards their therapeutic goals. Something important to keep in mind when setting goals, they should always be framed in the positive. This helps your brain focus on what you DO want, rather than what you DO NOT. Look at these examples: Eating less junk food and no more lethargy vs. Living a healthier lifestyle with more physical activity and smarter food choices. The first example contains words like “less” and “no more” which are negative phrases the brain picks up on, setting you behind before you begin. The second example tells the brain “more” and “smarter”, helping the brain identify positives that you are aiming for. Positive words create a shift in the brain and help us as we work towards our desired result. Let us look at some examples of how this plays out practically, using an example of “increasing positive selftalk”.

Are you 50 years old or older?

Do you get heartburn weekly or more?

SPECIFIC: When we set a goal for ourselves the item needs to be specific enough that we know exactly how we are directing our efforts. Essentially, we need a target. When I work with clients, we take time during our first sessions to discuss goals. As we talk, we unfold what is important to them, and begin to pull out some specific items that we can use as our target. The bullseye in the middle represents the desired result, with the outer rings representing other areas of life that will benefit from us hitting that center. If we identify “increasing positive self-talk” as our goal, this becomes the specific object of our ambition. MEASURABLE: A goal must be measurable. In other words, you need to be able to see how your ambitions are paying off. While increasing positive self-talk you should see some benefits (the other rings on the bullseye) of your efforts. Perhaps you see your efforts paying off as you feel more confident a few weeks into your new practice. Or, your attitude is more pleasant because you are being kinder to yourself. Identifying some ways to measure your efforts up front will help keep you motivated as you work hard.

ACHIEVABLE: The goal you set needs to be something you can achieve. Determining to grow 8” if you are already full grown is not achievable. Ensuring your goal is realistically achievable helps set you up for success. Our example goal, increasing positive self-talk, is entirely possible to achieve. RELEVANT: Your chosen goal should be something relevant to you. Frequently, I see people who identify goals that someone else would like them to achieve. This is a fast pass to failure. The goal needs to be yours, and it needs to mean something to you. When we set a goal that is relevant to our current season in life, it creates a sense of accomplishment when we obtain it. However, a goal we are working towards that is someone else’s idea will neither motivate us nor fill us with accomplishment. If it is relevant to you, increasing your positive self-talk will be something you are motivated to work towards. More than that, it will feel great when you achieve it. TIME-LIMITED: Goals that are limited by a timeframe help keep us on track. Say we begin our positive self-talk journey March 1st and determine to increase the ways in which we speak positively to ourselves for 90 days. By the end of

those 90 days we have created a new habit, formed new connections in our brain, and made a positive impact on our mental health. Additionally, when we have a finishdate we can work backwards from there to structure our measurement markers so we can see our progress. This continues to signal our brain to identify the growth, and acknowledging the growth keeps us motivated. See the cycle?

OUTSIDE HELP: Here is where my addition shows up. There is no “O” in the original SMART goal acronym. However, many goals I have set for myself included resources outside of my scope of expertise. So, taking inventory at the beginning of goal setting to identify outside help you may need boosts your chances of obtaining your desired result. The truth is none of us have all the tools and skills necessary to obtain every goal we set. Thus, acknowledging the need for, and enlisting help when necessary is smart, and practical. Perhaps for your self-talk goal you will need a book of positive confessions, or an accountability partner. A bigger goal may require professional help in the form of an academic institution, fitness facility, medical professional, or lending agent. As you begin to think about this new year laid out before you, I want to challenge you to consider where you would like to be by December 31st. What looks different in your life? How are you relating to people in a way that is an improvement from right now? If _________ were better, what would that change? 2020 is a blank slate. You have a lot more power over the outcome than you might think. It may require some outside help. Likely it will take some SMART goal setting. Whatever the course, whatever the goal, I hope your year is as amazing as you dream it can be. Happy New Year!

Rachel Sullivan, MFTA Solid Ground Counseling Center 9694 Madison Blvd St A7 Madison, AL 35758 256-503-8586 www.solidgroundmadison.com

' ' the S word

by, Kari Kingsley, MSN, CRNP

As an adult, I’ve tragically happened upon another ‘s’ word that many seem reluctant to say. Suicide affected my family in 2012 when we shockingly lost my younger brother, Ben.

Riding on the school bus as a middle school kid, I clearly remember hearing my first curse word. Actually, I clearly remember saying my first curse word (sorry Mom). Adolescents routinely push boundaries and limits as they grow into adulthood. As an adult, I’ve tragically happened upon another ‘s’ word that many seem reluctant to say. Suicide affected my family in 2012 when we shockingly lost my younger brother, Ben. For months, my small remaining nuclear family survived on the kindness and love of others. The outpouring of support was astonishing. When the fog cleared, it became very apparent that losing a loved one to suicide was very different than other deaths. While many people became the crutch that held us up, others shied away. A few noticeable occasions stood out. Suicide was described to me as a cowardly thing to do. Concerns were raised of where my brother would spend his afterlife. People in the grocery store wouldn’t know what to say and situations became uncomfortable. Suicide carries with it a stigma seemingly insurmountable to change. Stigma is defined by Webster’s dictionary as “a mark of disgrace or infamy; a stain or reproach to one’s reputation.” Perhaps I was part of the stigma before July 24, 2012. I could sympathize for those who had lost loved ones to suicide, but not empathize with someone who was in such a hopeless place that they would take their own life. A good friend who had lost her mother to suicide came to visit me not long after my brother’s death. She changed the way I would look at suicide and mental health forever. She told me that Ben had the equivalence of cancer in his brain. Depression, anxiety, schizophrenia, bipolar mood disorders, personality disorders, trauma-related mental illnesses and eating disorders are all very real diseases. The problem is, you’ll never detect them on a CAT scan or MRI. Because they are not “real” tangible diseases that can be treated with chemotherapy, radiation, or surgery, many in our society do not recognize them as “real”. Buck up, Pull yourself together, Snap out of it, Get it together, Turn that frown upside down… How many times have we heard these sayings? These phrases are perfect for many situations. But for someone dealing with debilitating depression, this is equivocal to throwing a penny in a well and hoping your

cancer will go away. If you broke your arm, you wouldn’t hesitate to go to a hospital. You wouldn’t care about what others would think. After your discharge from the hospital, you wouldn’t hide from your friends and family and refuse loved one’s phone calls wishing you a speedy recovery. Why is a mental health diagnosis so different? The stigma of suicide prevents many people from voicing their symptoms and asking for help. For many, it becomes too late. What’s our solution? Talk about suicide. Say the ‘s’ word. And remember these conditions are just as “real” and serious as cancer. Examine your own views of these topics and try to remove insensitivities regarding these conditions from your mind. Suicide is now the 10th leading cause of death in the United States. Top Ten. It takes a minute for that to sink in. The first time I heard this statistic I was dumbfounded. I could talk statistics and numbers for hours. But until you have lived the nightmare of losing a loved one to suicide, it will never fully sink in. Suicide touches so many of our friends and family members and if we are able to change ONE life as a result of our actions, it will be worth it. I was humbled to have been approached in 2016 by the American Society for Suicide Prevention to Chair their annual "Out of the Darkness" Community Walk in Huntsville, Alabama to raise awareness and support for suicide prevention. This year’s event took place October 21, 2018 (the day before Ben's birthday) from 2-4 pm at Ditto Landing Marina in Huntsville, AL. The American Foundation for Suicide Prevention (AFSP) is the leading national non-profit organization exclusively dedicated to understanding and preventing suicide through research, education, and advocacy. They are also actively reaching out to people with mental disorders and those impacted by suicide.

Please, help remove the stigma from suicide… say the ‘s’ word. “Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.”

Live Like Christ by Ben Macklin

If you pay attention to the national news, use social media, or follow politics in any capacity, one can’t help but notice the polarization of ideas that are driving people apart. The social framework of our culture is changing. Society wants to define who you are based on race, wealth, beliefs, or how you vote. God’s Word no longer defines who we are, what we’re worth, what’s right or wrong; society does. Society tells us who we can and cannot hang out with, society tells us that happiness comes from materialism and self-righteousness, and society can be aggressive and violent in pursuing its deceptions. This isn’t unique to us in 2018. It has always been this way and it will always be this way. It’s one of the great lies of Satan that plagues humanity. There are times when I think about how much better life would be if we had Jesus walking with us today. I think to myself, “He would know what to do…Jesus would fix all of our problems.” But the truth is that’s not the picture of Jesus we see throughout the Gospels. Jesus was, without a doubt, one of the most socially frustrating people to ever walk the face of the earth. That’s why I love Jesus, because there is no one like Him. Jesus spent three and a half years breaking down social barriers in His pursuit of bringing salvation to a fallen creation. Think about it… Devout Jewish men of God were minding their own business, trying to do all the things God had commanded them to do, until one day a carpenter for Nazareth walked into a synagogue, read from the Book of Isaiah, and declared that He was the Messiah. Jesus, that’s blasphemy! You cannot say things like that. Who do you think you are? Jesus walked into the temple during the Passover celebration, and sent the place into chaos. He scattered the coins of the money-changers, He flipped over tables, and He drove every man out with a whip. He even drove out the sheep and oxen. Jesus, what are you doing? You cannot act like that in the temple. And what was all that talk about, “Destroy this temple, and I will raise it up in three days?” People are going to think you’re crazy. Jesus constantly called out the religious leaders for being hypocrites, He performed miracles on the Sabbath, and He challenged the hundreds of man-made rules the Jews had devised for interpreting God’s Law. Jesus, you can’t keep challenging our religious leaders. If you don’t stop, they will kill you. Jesus hung out with the poor, the sick, the lame, the blind, the oppressed…

Jesus, why are you always hanging around with outcasts? They aren’t worthy of your time or energy. And in case you didn’t know, people don’t touch lepers, and they certainly don’t rub spit in someone’s eyes…that’s gross. Jesus surrounded Himself with sinners, He fellowshipped with a despised tax collector, and He had a life-changing conversation with a desperate housewife at a well. Even His closest friends were uneducated fisherman with bad attitudes and cowardly tendencies. Jesus, religious teachers don’t associate with these kinds of people, and they certainly don’t speak to women in public. Jesus knows what it’s like to live in a polarized political environment. He experienced it Himself, so did the Disciples. He faced the criticism and violence, He endured the lies and false accusations, and He suffered the hatred and punishment from the world around Him. But through it all, Jesus remained obedient to the will of His heavenly Father. With the power of the Holy Spirit, Jesus broke through the social structures and division within society with love, compassion, and grace. Jesus didn’t condemn sinners, He set them free. He stepped into the lives of people to show them that His love was more powerful than their mess. Jesus used parables to show us just how much we are loved and how precious we are to God. He used His gifts and abilities to serve and bless others. He brought heaven to earth and restored the relationship between God and man. But most importantly, Jesus went to the cross on our behalf and endured the punishment that we deserve, so that we can be forgiven for our sins and receive the free gift of eternal life. The only thing Jesus asked for in return was that we believe Him. Let your life be a reflection and extension of the love, mercy, and grace you received through Jesus.

God shows his love for us in that while we were still sinners, Christ dies for us - ROMANS 5:8 Beltline Church of Christ 2159 Beltline Rd SW, Decatur, AL 35601 256-353-1876 www.beltlinechurchofchrist.org

The Power of Prayer John and Cara Greco are both physicians in Huntsville. Dr. John Greco is a Sports Orthopedist with TOC and Dr. Cara Greco is an anesthesiologist at the Surgery Center Huntsville.

by Dr. Cara Greco

It’s amazing how your world can stop spinning in a single moment. All the hectic, hustle and bustle of our busy lives just comes to a halt when you are facing a major health crisis with a loved one. Especially if your loved one is your child. I remember that moment very well. It was April 4, 2004. Our youngest child, Cole, was a normal rambunctious five- year old boy. He was always outside playing, climbing trees, riding his bike and throwing the football. He had just started T-ball that spring. We had noticed during one of his practices that he seemed to be running a little strange. He didn’t complain of any pain. His dad performed a thorough orthopedic exam and found nothing wrong. We thought maybe he was just going through the normal stages of a growth spurt and decided there was nothing to worry about. We paid close enough attention and John examined him every few days, but he had no complaints or obvious abnormalities. A few weeks later, he started having a slight limp. Again, he had no complaints of pain. On that fateful April day, I picked him up from preschool and noticed the limp seemed more pronounced in just walking to the car. I was sure there was nothing to worry about, but just to be certain, I took him to his dad’s office and asked for an X-Ray of both hips and legs. I was not prepared for what it revealed. Cole had a very large defect in his right hip. It was so large that he had little hip joint remaining. The X-Ray couldn’t tell us what process was causing the defect, just that his hip joint was almost gone.

didn’t know if it was benign or malignant, but we knew that our sweet boy would not walk again for at least 3 months. In surgery, the defect was found to be a unicameral bone cyst. This type of cyst is benign, but can still grow aggressively, displacing normal compact bone with fluid. Cole’s cyst was extremely large and located in the neck of the femur, which put his hip joint at risk. It was so large in fact, that Dr. Killian said he was steps away from having total collapse of his hip. We were so thankful that it was benign, but we still had a long road to recovery. Cole was placed in a body cast for six weeks, then in a wheel chair for another four weeks, then needed a walker for another three weeks. Telling a five -year old boy that he couldn’t walk for three months was very painful, but Cole never complained. His positive, loving spirit was an inspiration to us all. He even tried to comfort me. I will never forget the time that he grabbed my hand and said, “Mommy, don’t worry. I’m going to be OK.”

“Mommy, don’t worry. I’m going to be OK.”

My first action after driving home and settling Cole down for a nap, was to fall to my knees and pray. John was in the middle of an operation in Scottsboro when I called to tell him what the X-Ray revealed. He also sat down, bowed his head and prayed. I will never forget that despite both of us being physicians, with immediate access to medical care, radiology equipment, and orthopedic specialists, we both turned to our Lord first. The next 24 hours was heart wrenching. Afte r consulting with Dr. Ken Jaffe and Dr. John Killian in Birmingham, it was decided that Cole needed immediate surgery to stabilize his hip and determine what this process was. At this point we

The outpouring of love and support from our family and friends sustained us through that time. We had multiple prayer groups and churches praying for Cole. We even had a prayer group from a church other than our own come to our home to pray by Cole’s bedside. His sweet friends came to visit often. Cole healed over the summer and started kindergarten on time with the use of a walker. Unfortunately, the cyst would come back twice over the next five years. Each time Cole had to undergo surgery again, and be non- weight bearing for weeks, requiring him to use a wheel chair and crutches. But, he never complained. After 5 years, the cyst finally quit reforming and we were able to stop the constant worry and follow-up X-rays. Today, he is a strong, athletic teenager who plays football and baseball. He barely remembers his ordeal. We will always be grateful for the support and love received from our family and friends, and most of all, for God’s precious gift of healing.

The Voice of the Valley by Kari Kingsley, MSN, CRNP

Many of us know him as the quick-witted baritone voice hosting WZYP’s morning show, bringing us real time updates on news, traffic, and weather, with a healthy and colorful splash of today’s current events. He mixes things up with audience call-ins and hilarious recurring segments such as Dear Naked Morning Guy (because he has nothing to hide), Making Headlines, and Random Facts. But what most don’t know is the Man behind the voice has a heart the size of Texas and a passion for philanthropy. Although he would never outright admit it, Mo “Mojo” Jones has done more for the Tennessee Valley by volunteering, advocating, and raising awareness for important issues than most anyone else. I am honored to write about my friend Mojo. But like any novice writer, also a little intimidated. This guy is sharp. He’s adept at cultivating and constructing conversation both on and off the air. Words are his career. And to top it off, he’s a great writer. (I feel like there’s probably an emoji that captures my insecure face perfectly…) In my early attempts to name Mojo’s article, I stuck to my love of alliteration and came up with The Valley’s Voice for Volunteerism, Veterans, and Various Vocations. Okay… que the circus music. That was a bit cheesy, even for me. Even though all of these things are true. As I sounded out the original title, all I could picture was the circus ringleader making introductions as a guy cracked a whip and a tiger jumped onto a ball. Well, I assure you, Mo Jones is anything but a circus act. I met Mojo in 2016 at a charity event called 22 Won’t Do. He emceed this event to raise awareness of the 22 U. S.military veterans a day that take their own lives. Twenty-two pushups in 2 minutes at 10:22 on October 22. Slightly star struck, and shy in general, I worked up the nerve to approach Mr. Jones to ask him if he would be willing to emcee the American Foundation for Suicide Prevention’s Out of Darkness Walk. I had recently signed on to chair the event for the North Alabama Chapter and was more than a little overwhelmed. Fully expecting him to graciously bow out, he accepted my request

Although he would never outright admit it, Mo “Mojo” Jones has done more for the Tennessee Valley by volunteering, advocating, and raising awareness for important issues than most anyone else.

with open arms. I never told him that the day I asked him to do this was my late brother’s birthday who we had lost to suicide. With his help, we have managed to grow our walk each year to over 500 participants and we raised $25,000 for suicide prevention in 2017 alone. When I contacted Mojo to tell him these amazing numbers, and how ecstatic I was, he was excited. But he said, “It’s not enough. Next year we’re going for $50,000.” Like many of us, there are times when Mojo questions his career path and asks himself whether he’s made the right decisions. In those moments, he reaches into a small cedar box and pulls out a letter he received from a young girl early in his career… Years ago, while doing his show at Kiss FM in Boise, Idaho, Mojo received a call from a man who told him that his daughter, Chelsi, had a terminal illness and didn’t have long to live. The father explained that the family had spent all of their savings on medical expenses for their daughter and that they had nothing left. Chelsi had heard Mojo announce on his show that Nelly was coming to town. Chelsi wanted to go so badly but she knew her family couldn’t afford tickets. She wouldn’t burden her dad any further other than telling him how amazing this experience would be before she passed. Her dad called to see if Mojo could help. Mojo said he would see what he could do. After hanging up with the man, Mojo and his producer went to work. They set aside tickets for her and called a limo company to arrange for Chelsi and her closest friends to arrive in style. They called Nelly’s record label. When Nelly found out Chelsi’s story, he sent a pair of his Air Force One tennis shoes complete with his autograph and instructed Mojo to bring Chelsi backstage the night of the show. Mojo called her dad back and told him the good news and made plans for Chelsi and her friends to be surprised when they were picked up for the show.

About a week after the show Chelsi’s father called Mojo to thank him for what he had done for his little girl and to break the news that she had passed away. A few days later, Mojo received a letter in the mail. It was from Chelsi… the last letter she ever wrote. As Mojo read that letter, tears flowed down his face as he realized, if not for his job, he would not have been in a position to put together this experience for this wonderful young lady. To this day, if Mojo ever questions his path in life, he pulls out that letter, reads it again, and thanks God for blessing him with this career. Mojo has utilized the opportunities his vocation has provided throughout his life. In 2004, after recently moving to the Tennessee Valley, he pitched the idea to WZYP to build an entire house (floors to roof ) in 24 hours for a family in need. They told him it couldn’t be done. But Mojo’s mentality was: challenge accepted. He helped construct a team of subcontractors who worked through the wee-hours like perfectly choreographed dancers. Drywallers, electricians, carpenters, painters, and roofers moved seamlessly, each knowing their exact time frame and role. At 10 A.M. sharp the next morning (former) Mayor Loretta Spencer turned the key and the new house was presented to the grateful family. Mojo and his team were again brainstorming ideas for how to help their community. A team member proposed raising 104 bicycles in 104 hours so that children in need would wake up on Christmas morning to a brand-new bike. Mojo said, “Why stop at 104 bikes? Let’s use the entire 104 hours and try for 500 bikes.” No one (other than Mojo) thought this was possible. So, for 5 days and 4 nights, Mojo climbed onto a scissor lift 40 feet in the air in November with only a cot, a sleeping bag, and a port-a-potty. With only his voice and dedication to this cause, he encouraged WZYP followers to bring out bikes. Mojo’s Marine Core Reserve experience served him well and he completed the hours. He blew the top of his numbers the first year with over 600 donated bikes. He laughs that he eats better during that week than any other time because of the generous meals brought to him by local businesses. Since the start of Bikes or Bust fifteen years ago they have raised over 27,000 bikes. Monetarily that is $1,350,000. Mojo has made multiple cross-country trips to help those in need. During the Flint Water Crisis in 2014, Mojo was able to partner with Toni Terrell from WZYP’s sister-station WHRP and organize a semi-truck of water to be delivered to those in need. Being a Detroit native, this cause became near and dear to his heart. He followed behind with his team in an RV to help unload. When tornados devastated Moore, Oklahoma in 2013 he and his team went on the airwaves and were able to have 5 trucks donated from a local dealership which, with the help of our listening area, were loaded down with supplies and then convoyed out to help those affected by the tornados. Mojo toured the site of a school demolished by the tornados. Seven crosses stood in memory of the seven children that lost their lives. A baseball helmet hung

on a fence post along with letters, stuffed animals, and memorabilia. When Mojo was a coach for his son’s baseball team, he had a habit of walking up to each player in the batter’s box and placing a hand on top of their helmet. He would kneel down, eye-to-eye with the player, and give them words of encouragement. Mojo instinctively placed his hand on top of the helmet hanging on the fence post and cried. His son was nearly the age of the boy who had passed. Recently, Mojo was contacted by a 5th Grade student from Monte Sano Elementary. She and her classmates wanted to find a way to transport the school supplies they had collected to be delivered to Houston after Hurricane Harvey had demolished parts of the city. The students were only seeking donations for shipping. Mojo said, “I can do better than that, we’ll drive the supplies there.” With his cohost Ricky Fernandez, they made the 765 mile trek to Houston. I visibly cringed when I thought about Mojo reading the circus comment. Mojo is one of the most non-judgmental people I know, yet the thought of summing up his accomplishments and doing justice to his advocacy work seemed a staggering task. Full disclosure: I had honestly thought about handing him a pen and paper and asking him to write his own article. The problem with that? He’s too modest. He would leave out important details like the emotional toll performing difficult charity work can take on your soul. Mojo takes it in stride. He is quick to tell you he wouldn’t be able to do any of it without the local support of our amazing community. Reflecting on his own mortality, Mojo said, “I’ve lost several friends and relatives over the past several years. I watch as people share their own memories of each one on social media and think to myself ‘I wonder if they knew they had this kind of impact on others before they passed?’ When I do go, I’d like to think that I’ve made a difference. But I question myself, as well as others....” While I am appreciative of the ab work-out I get from

laughing as I listen to Mojo each morning with his perfectly-timed voice inflections and anecdotal references as he chats with his hilarious co-hosts Ricky Fernandez and DeeDee Morgan, I am much more appreciative of the advocacy my friend does for the Tennessee Valley. Any one of his kind acts would be enough to call him a hero. But Mojo doesn’t stop at one. Or ten. Or even twenty. He keeps giving. And something tells me that will never change. I’ll leave you with my favorite Mojo quote…… “Robin Williams once said ‘I used to think the worst thing in life was to end up all alone, it’s not. The worst thing in life is to end up with people that make you feel all alone’. This is one of the most profound statements I may have ever heard. Each of us, more than likely, have people in our lives who are feeling all alone... We may not know why, we may not understand how, but if you love someone, don’t let them feel all alone... Listen… without judgement. Pray with them that God would heal their inner pain. Spend time with them in person, not over text or social media. Today’s society has made it easy to disconnect from real feelings and emotions and has made it easy to think that if we just hit the ‘like’ button that person will know ‘I’m here for them’... Humans were built to love and be loved..... It’s time we love each other a little more.

Kari Kingsley and Mo Jones in 2017 at the Out of Darkness Walk for Suicide Prevention at Ditto Landing

“Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.”

be the reason a kid

smiles

Jamal’s St ry By Valeria McConnell

Jamal’s Helping Hands, Inc. Poised to Fight Rare Disease One Resource at Time

eurofibromatosis (NF) 1 stopped being a rare disease to me after my son, McKinley Jamal Thomas was diagnosed with this rare disease at the age of nine. There are an estimated 7,000 rare diseases in the world. In the United States, approximately 25-35 million Americans are living with NF1. The Orphan Drug Act of 1983 defines a rare disease as a condition that affects fewer than 200,000 people. What about my one person…Jamal? Most parents would ask this question after receiving such devastating news about their child. Unfortunately, healthcare providers and parents struggle to answer the multitude of questions that come after diagnosis. An adequate amount of medical research and treatment information are often non-existent - keeping rare disease obscure and unknown. The journey with Jamal began with finding a nearby specialist that understood his condition and could help educate me enough to consider effective treatment options. NF is a genetic disorder that causes tumors to grow on the nerve tissue. There are three (3) types – NF1 usually appears in childhood; NF2 and NF3 appear in early adulthood. NF1 did not prevent Jamal from achieving his goals, as he graduated from the University of South Carolina with a Master’s in Social Work and a certificate in Drug Addiction Studies. Jamal was an extremely special person who never met a stranger. His people map spanned from doctors to pastors to toddlers. On March 28, 2017, the world lost Jamal at the young age of 31. Scripture tells me that God will make beauty out of ashes, thus Jamal’s Helping Hands, Inc. was birthed to help other families affected by rare disease. Our journey, while challenging,

made me resourceful, knowledgeable and resilient in championing the fight against rare disease. On November 20, 2017, Jamal’s Helping Hands was incorporated with the vision of creating a non-profit organization to enhance the quality of life for patients, with chronic illnesses or rare diseases, and their families. Families like mine. We provide clientfocused support to patients and their families by providing a variety of services and educating them about resources readily accessible in their surrounding community. These services include, but are not limited to providing caregiver information, educational workshops, outreach and awareness, emergency care scholarships, lodging assistance and other resources in an effort to make the experience of rare disease easier. These include: • Healthcare Coach helps patients and families navigate the daunting healthcare system to get quicker diagnosis and effective treatment. • Support Groups welcomes caregivers to participate in a collaborative and supportive environment based on trust, understanding and empathy. • Educational Workshops deals with a variety of important topics such as critical questions to ask doctors, how to balance work and caregiving and finding resources. • Financial Assistance to families to pay for medical appointments, diagnostics and travel to out-ofstate specialists. Jamal’s Helping Hands, Inc. is linking our hands together with each community to help fight rare disease one resource at a time. We will win with Hope, Help and Hands. Please join us in this fight.

Providing hope & help to your health care

“Our journey, while challenging, made me resourceful, knowledgeable and resilient in championing the fight against rare disease.”

If you would like more information on Jamal’s Helping Hands, Inc., visit JamalsHelpingHands.org. You can also find them on Facebook at @JamalsHelpingHandsInc

‘Paws’itive Reinforcement

by Kari Kingsley, MSN, CRNP

I love when people ask me how many kids I have. Ten. I have 10 kids. They just happen to have fur and feathers. A horse, a dog, two cats, and six chickens. While not exactly Noah’s ark, I’m getting there. I consider them family (even the fluffy chickens) because they are such an important part of my life. My entire day revolves around when to feed them, when to let them outside, when to ride the horse, when to gather the eggs, and when to take my rambunctious Labrador puppy on a walk to burn off some of that crazy puppy energy… The domestication of animals perhaps started as a symbiotic relationship long ago. Wolves moved into nearby campgrounds of hunter-gatherer communities to scavenge for bones and scraps thrown out by humans. In turn, humans began feeding the wolves as the wolves began providing protection and assisting in the capture of prey. I’ll scratch your back and you scratch mine (literally). From there, the friendship grew. Similarly, cats were attracted to rodents thriving around human settlements. They killed mice that carried disease and became an important part of humans’ lives. The Health Sciences department at the University of California, Los Angeles, published a study in May of 1999 that said that people with AIDS who owned pets were less likely to suffer from depression. Even with the increased risks associated with this immunocompromising disease, the positive outcomes provided by pets many times outweighed the risk. Additional medical research has linked positive physical and psychological research to owning a pet. The Center for Disease Control reports lower blood pressure, lower cholesterol, and an overall reduction in stress and anxiety among those who own pets. Pets give us the opportunity to exercise, socialize, and to manage loneliness. Our pets never judge us and always provide unconditional love. Reductions in cortisol, the stress hormone, which can negatively affect the immune system have been noted. On the other hand, increases of serotonin and dopamine are seen, promoting a calmer and more relaxed state. Newport academy has reported that people with furry friends have increased self-esteem, are less fearful, are more extroverted and generally more conscientious and less preoccupied. The CDC is currently studying the role of animal interactions in kids with autism and conditions like ADHD. Service dogs are frequently trained to assist those with physical and emotional disabilities.

With all the positives that pets provide us, we should be asking what we can do for them. According to the Insurance Information Institute, approximately 67% of U.S. homes have pets. But sadly 6.5 million companion animals enter shelters each year according to the ASPCA. Of those, 3.3 million are dogs and 3.2 million are cats. Approximately 1.5 million shelter animals are euthanized yearly. But that number is on the decline, largely in part to animal rescue efforts. Enter Huntsville’s newest animal rescue: Furget Me Not Animal Rescue Inc. and its founder, director, and CEO, Michelle Underwood. The organization came about as more and more unwanted, abandoned, and abused animals found their way into shelters through no fault of their own. Michelle and her team at Furget Me Not are motivated by the animals that have had humans let them down. “Alabama does not have spay or neuter laws and too many people in Alabama don’t see the need to fix their animals, so, rescues have to become the voice for homeless animals.” Michelle says that the volunteers at Forget Me Not Animal Rescue have long histories with rescue and have collectively saved thousands of animals and will work diligently to save thousands more. “FMN volunteers strive to educate people on the reasons to adopt and not shop. There are lots of great animals in the shelters. Many area shelters are forced to euthanize if the shelter becomes overcrowded. Furget Me Not works daily to see that this doesn’t happen.” Michelle and her team have seen the absolute best and worst in people. “We have seen horrific hoarding cases, animals abandoned in structures with no heat or food, and mom dogs left to have puppies in freezing temperatures. Puppies and kittens are closed up in bags or boxes and thrown into trash bins, fields, or ditches. These animals are starving animals and sometimes have no hair because of mites or severe allergies. Some animals come in with life threatening infections that cause them to have organs and limbs removed. Dogs and cats are bred over and over again, never receiving medical care, baths, brushing, nail care, or even love. We see so many animals that are terrified from abuse or having never been socialized.” Michelle says that rescue is not without its rewards. “The happy side of rescue is watching the volunteers that work tirelessly to save animals. One of the happiest moments in rescue is when a terrified dog or cat who bites out of fear lets

you pet them. It’s the best feeling to be the human they trust for the first time. It takes a great amount of patience and can take days, weeks, or sometimes months but it worth every minute to watch their transformation. It’s even better when they become part of a great family.” Furget Me Not needs your help. Michelle says “We are a brand-new animal rescue and we need help getting the word out about us. We are 100% volunteer based which means 100% of all donations go toward vet bills for the animals. All the animals we pull are placed in foster homes so we have no overhead, no utilities, no salaries, etc., so people can feel better knowing every penny goes to save animals. We are looking for people that would like to become donors or sponsors to support our cause. Without donations for vet bills, we can’t

exist and help animals. FMN takes in seniors, injured, sick, and heartworm positive animals that require surgery in addition to healthy animals. The adoption fees don’t cover the vet bills so we have to rely on donations.” Furget Me Not also needs dog and cat fosters. An animal can only be pulled from a shelter with a foster commitment. Pets are our family. Without them, hard days would be harder. Our pets provide companionship, friendship, and studies suggest the benefits of pet ownership have positive effects on health and wellness. They bring joy and abundant love to our lives and we owe it to them to do more. Please visit Furget Me Not at their website at www.fmnanimalrescue. org, like them on Facebook at Forget Me Not Animal Rescue Huntsville, and follow them on Instagram at fmnanimalrescue.

furget me n t A N I M A L R E S CU E

why we exist With all the positives that pets provide us, we should be asking what we can do for them. According to the Insurance Information Institute, approximately 67% of U.S. homes have pets. But sadly 6.5 million companion animals enter shelters each year according to the ASPCA. Of those, 3.3 million are dogs and 3.2 million are cats. Approximately 1.5 million shelter animals are euthanized yearly. But that number is on the decline, largely in part to animal rescue efforts. organization or cause and which is distributed to members of the media for promotional use, and designed to be sent to a newspaper or magazine as part.

why we need

3.3M

DOGS SHELTERED YEARLY

3.2M

CATS SHELTERED YEARLY

All the animals we pull are placed in foster homes so we have no overhead, no utilities, no salaries, etc., so people can feel better knowing every penny goes to save animals. We are looking for people that would like to become donors or sponsors to support our cause. Without donations for vet bills, we can’t exist Michelle Underwood, Founder, Director, and CEO of Furget Me Not Animal Rescue Inc. and help animals. FMN takes in seniors, injured, sick, and heartworm positive animals that require surgery in addition to healthy animals. The adoption fees don’t our request cover the vet bills so we have to rely on donations.” Furget Me Not also needs dog and cat fosters. An Furget Me Not needs your help. Michelle says “We are a brand-new animal animal can only be pulled from a shelter with a foster rescue and we need help getting the word out about us. We are 100% volunteer based which means 100% of all donations go toward vet bills for the animals. commitment.

1.5M

SHELTER ANIMALS ARE EUTHANIZED YEARLY

COMPANION ANIMALS ENTER SHELTERS EACH YEAR

6.5M

Please visit Furget Me Not We at their website at www.fmnanimalrescue.org, like them on Facebook at Forget Me Not Animal Rescue Huntsville, and follow them on Instagram at fmnanimalrescue.

Real Estate: Good Offense, Better Defense Whether your favorite sport is football, foosball or fútbol, you can’t win the game unless you have both a good offense and good defense. Bear Bryant echoed this by saying “Offense sells tickets, but defense wins championships.” The same can be said about winning in business and personal finance. In the classic personal-finance book, “The Millionaire Next Door,” Thomas Stanley and William Danko liken offense to income and defense to how you spend (or do not spend) that income. Their premise is that to win at personal finance and become wealthy, you must be excellent at producing income (offense) and even better at retaining it (defense). Clearly, it takes money to make money and some expenses are unavoidable. However, it is important to focus your attention on saving money the right way and looking at big ticket items. That focus can have a huge impact on your personal finance and financial well-being of your healthcare practice. We recently had two clients who were excellent practitioners; able to produce high revenue for their practice and create significant take-home income. They were great at offense, bringing in income; however, upon reviewing their leases, we found their defense to be lacking.

Client #1

Our client was leasing space in a multi-tenant building. Her lease was set to expire in just over twelve months, so she was considering relocating her practice or purchasing her existing leased space. After reviewing her lease, we noticed she was paying rent on the entire building (nearly 6,000 square feet), rather than her 4,000 square foot space she was practicing in. She was paying for 2,000 square feet that her practice was not occupying, while the landlord was collecting double rent on the adjoining 2,000 square foot leased space. Consider the ramifications of this. For the sake of round numbers, let’s use a fifteen-dollar per square foot lease rate over a ten-year term. $15 x 6,000 sf = $90,000 (annual rent) x 10 years = $900,000 total rent vs. $15 x 4,000 sf = $60,000 (annual rent) x 10 years = $600,000 total rent The difference in this scenario is $300,000 over a ten-year lease term. It turns out, there was no malicious conduct or deceptive intent on the part of the landlord (just an honest mistake), but this lease was reviewed by a practice broker, an attorney, two or more doctors and others before it was signed. The space was a part of a practice purchase, so the lease unfortunately was an afterthought. How long would it take to make up for a mistake like this by cutting back on supplies? The reality is, no matter how many pennies you pinch on cotton rolls or materials, it’s unlikely you could make up for this type of an oversight. Simply assuming that the math on a lease will work out fairly or believing that it is not worth the time or money to have a professional review the terms of a deal may end up being the costliest mistake of your professional career. This is an example of poor defense: not having someone there to protect your bottom line.

Client #2

The other client was nearing the expiration of his lease, so we reviewed the negotiable terms; namely tenant improvement allowance, free rent, lease rate, operating costs and escalations. The one that stood out the most was the tenant improvement allowance. On the past lease, the landlord’s terms were at least ten dollars lower than what the client should have achieved. Doing the math here ($10 per SF x 3,500 SF = $35,000). Another example of poor defense. One negotiable term that seems minor or even “fair” could cost you tens of thousands of dollars. The hard part about these transactions is that you want to believe you are being treated fairly. The reality is, your definition of fair is most likely very different than that of an opposing party. You must realize you have competing interests with the landlord, broker or investor that is a professional negotiator with full knowledge of their trade. You could say, a landlord’s offense is better than an unrepresented tenant’s defense. Real estate is the second highest expense for most practices. With this much at stake, it’s not something you want to take a risk on. The good news is that buyers and tenants have every opportunity to create a good defense by seeking professional help. Often times healthcare professionals will have an attorney review the legal ramifications and consequences of a lease, but the legal side of a lease and the fair-market-value side of a lease are completely different. Very few attorneys know the going rate for tenant improvement allowance, free rent, escalations or lease rates in a healthcare-real-estate transaction. Another common mistake is hiring the wrong real estate professional. Be sure to hire a broker or agent with healthcare real estate experience. Failing to understand the electrical, mechanical and plumbing needs of a healthcare practice on the front end can be extremely costly. Additionally, there are many other business deal

points that are vastly different in healthcare real estate vs. general commercial real estate. In summary, a successful practice focuses on production to increase revenue while investing in resources that drive business without neglecting to protect what has been earned or could be lost. Professional representation protects your interests and the valuable revenue you work so hard to attain. You don’t have to choose between having a good offense or better defense; you can have both.

CARR Inc. is the nation’s leading provider of commercial real estate services for healthcare tenants and buyers. Every year, thousands of healthcare practices trust CARR to achieve the most favorable terms on their lease and purchase negotiations. CARR’s team of experts assist with start-ups, lease renewals, expansions, relocations, additional offices, purchases, and practice transitions. Healthcare practices choose CARR to save them a substantial amount of time and money; while ensuring their interests are always first. Visit CARR.US to learn more and find an expert agent representing healthcare practices in your area.

By Adam Weiger Agent | Alabama 256.836.4473 adam.weiger@carr.us

CHECK OUT SOME OF THE BENEFITS OF STRONG GLUTES: Reduce Back Pain Reduced back pain: your glute muscles help stabilize and control your pelvis, hips, torso, and trunk. Keeping them strong helps provide strength through your pelvis and helps prevent over-rounding through your lumbar spine. It simply helps support your lower back!

Prevents Knee Pain Prevents Knee Pain: that stabilization mentioned above through your hips affects your legs. If there is imbalance in the hips, your knees may start talking to you and you won’t like what they have to say!

RECRUIT YOUR GLUTES by Elisa Brooks, ACE Certified Personal Trainer & ACE Certified Sports and Fitness Nutrition Specialist

Injury Prevention Injury Prevention: when a muscle group in the body is not strong and doing what it is supposed to be doing, other muscles will jump in to help out. But it is typically at a cost. They may, in turn, become stressed because they’re doing functions they aren’t designed to do! Pain in the lower back, knees, groin, and hamstrings may indicate stress in those areas due to weak glutes. Training strong glutes helps to prevent those injuries.

It’s pretty trendy right now in the world of fitness and in the world of beauty to flaunt a well-rounded backside. You don’t even have to be someone that follows fitness bloggers or Instagramers to know that female celebrities like to show off glutes that are in good shape. The truth is, a well-exercised and trained posterior chain can mean a great looking tush. However, there are several reasons why everyone, not just celebrities, should be training strong glutes - and looks aren’t one of them. First off, there are three different glute muscles: gluteus maximus; gluteus medius; and the gluteus minimus. The gluteus maximus is the largest of the three and helps to shape your booty. The medius and the minimus are smaller muscles that partner to help movement. The three muscles work together for hip extension, along with rotation and abduction of the hip. Giving these muscles some attention and learning to train them can help you move more efficiently and live pain free.

Functional Movement Functional movement: in everyday life we might squat down to get at eye level with a child, or to pick something up off the kitchen floor. We help a friend or spouse move a piece of furniture. Many of us walk up and down stairs in our homes or places of work. Strengthening your glutes can help you to do daily activities with confidence and without straining other muscles in your body.

Athletic Power Athletic Power: these power muscles literally are just that … power muscles. When glutes are strong, you can jump higher, accelerate faster, deccelerate quickly, and lift heavier.

Whether or not you are an athlete, avid exerciser, young, old, or somewhere in between all those, your overall health can benefit from building stronger glute muscles. Many exercises can be done at home or at the gym and can be progressed from beginning to advanced. Examples of great movements to strengthen this group of important muscles include: •

Lunges

•

Deadlifts

•

Single-Leg Deadlifts

•

Hip Bridges

•

Single-Leg Hip Bridges

•

Weighted Hip Thrusters

•

Clamshells

•

Step Ups

•

Quadraped Hip Extensions

All of these exercises (and MANY more!) can easily be found online. You’ll find videos, how-to’s, and methods of working a movement from beginner level up to advanced exercises. Due to many Americans living a fairly sedentary lifestyle, or working hours at desks, your backside most likely could use some attention. And not just so it looks great in your jeans, but in order to make you stronger and give you a better quality of life. Time to get working!

Mental Health the Holidays by Rachel Sullivan, MFTA

Perhaps you experience stress around the holidays or have heard of people that do. We see it advertised as this amazing time of thankfulness and joy, and while it can be, the reality is it does not always feel that way. Family members we do not care to see, houses that bring back awful memories, the constant obligation to be â&#x20AC;&#x153;merry and brightâ&#x20AC;?. Ugh.

external stimuli that presents a challenge or demand. It manifests as a feeling of emotional or physical tension and results from any event that creates feelings of anger, frustration, nervousness, and even motivation. information. In a nutshell, stress is the way we describe the feeling we get when are faced with something that seems out of our control or beyond our abilities. Combatting stress, especially around the holidays can be helpful since lower stress levels equates to a higher likelihood to enjoy the present. Relishing in the hereand-now triggers our brain to transmit positive neural signals which assist in creating new, happier memories. This process is crucial in rewriting negative or unhelpful memories from the past. How do we execute this on a practical level?

This narrative is all too familiar in my office this time of year. Individuals who are functioning optimally throughout the year but mid-October hits and so does the dread. They share how the pit begins in their stomach and they just cannot shake it. Or they feel their blood pressure is through the roof 24/7 until after December 31st. They begin experiencing panic attacks, overwhelming anxiety, and high levels of stress, all because they are thinking about the impending holiday season. The range of symptoms that result from compromised mental health during the holidays is serious. We are aware that high levels of stress can affect you physically in many ways, this season is a prime time for those issues to arise. I invite you to discover why we feel this stress and what we can do about it. Stress is not inherently bad. There are many benefits of the stress response when we are properly managing the effects and input. Think about how you use to stress to finish that assignment at the last moment or push through a tough workout. However, stress becomes a negative when we are struggling to process the received

1. RECOGNIZE WHAT YOUR TRIGGERS ARE. Stress tends to present itself in similar situations. For example, you may experience the same feelings from hanging out with family who do not communicate clearly and frequently leave you struggling to be heard as well as in a work setting where your coworkers are not listening to your input. The trigger here is the reality, or anticipation, of being unheard. The physical tension grows in your body as it recalls the defeat in past engagements with these people. The physical may be joined by emotional anguish from feeling so desperately voiceless. Your stress response in this moment is informing you of how your system was unable to find a solution in the past. That deficit is trying to warn you to avoid the situation in order to prevent experiencing those feelings again. Recognizing the trigger helps you understand BEFORE the event that you may need to consider your options before jumping in. 2. UNDERSTAND YOU CAN SET BOUNDARIES FOR YOURSELF. Boundaries are often misrepresented as a bad thing but should be a part of all relationships. Boundaries allow an individual the opportunity to take their beliefs, needs, and limitations into account in order to advocate for and protect themselves from situations or people who cannot or will not bring them life. As humans we all have limits, recognizing what those are and establishing safeguards that keep us protected from harm is a normal part of relating with oth-

ers. While boundaries are not cutting off everyone who makes us feel uncomfortable, you may have a need to cease contact with certain people in your life. As individuals, the limits we have look vastly different from person to person. Thus, it is crucial we establish personal boundaries that are based on our own unique needs. Discovering what those necessary boundaries are will require some mindfulness about how we feel in those stressful life moments. Healthy boundaries include: deciding to take a step back from a toxic relationship, not participating in a holiday at a certain family members house, or choosing to protect a specific night of the week for your family. The process of implementing boundaries is often stressful. It can be helpful to remember the following: You see a need for this boundary for a reason. Not everyone has to understand the need, they are not managing your stress around this situation. When you implement and respect your own boundaries, others are more likely to follow suit. 3. SCHEDULE TIME FOR ENJOYABLE THINGS. The pressure is on to be at all the mandatory events and celebrations. The stress creeps in when we are not purposeful about taking time to engage in activities we enjoy. During the holidays it can be especially difficult to carve out time for ourselves. However, if we want to reduce our stress levels and increase the enjoyability of the season, doing so should be non-negotiable. Self-care through personal time and hand-picked activities can reset our stress levels and help us approach the must-dos with more patience and strength. A key here is knowing ahead of time what we really enjoy and how much time those activities will take so we can pencil them in accordingly. 30 minutes on a Thursday afternoon? Have your current book ready for reading. One hour on a Saturday? Enjoy that walk around your neighborhood. Remember that self-care is necessary, not selfish. As with all matters of mental health, techniques to reduce stress are not a one-size fits all. However, these tips can be a great starting place in the journey toward a healthier mental state. I encourage you to take the time to be mindful, identify your triggers, recognize what your stress response looks like, and consider what healthy boundaries need to be in place in your life. Give yourself some grace, enjoy the delicious food, and have a Happy Holiday season! Rachel Sullivan, MFTA Solid Ground Counseling Center 9694 Madison Blvd Suite A7 Madison, AL 35758 256-503-8586 solidgroundmadison.com

GIVE YOURSELF SOME

grace

beyond the skin by Paul J Fry, MD

If God had only made us with transparent skin? When there is a pain or dysfunction, all one has to do was look at the problem. Alas, as we know, the skin is opaque, a barrier to observation. Doctors have used the physical exam and history to determine possible diagnoses. Much of a doctor’s education, a college degree followed by four years of Medical School, is devoted to learning the science, anatomy, and pathophysiology of the disease process. The year following Medical School, the intern year, is mostly devoted to refining the art of the physical exam and history. The next three to five years, and depending on the specialty, sometimes up to six or seven years, is devoted to specialization within the medical field, learning further how to diagnose and then treat any disease that may exist. Despite the years of training, doctors would still be basically guessing, albeit an educated guess, what is occurring wrong beneath the skin. There must be a better way. How can we peer below the skin surface and actually see the disease? Beginning with the discovery of X-Rays by Wilhelm Roentgen in1896, doctors have been able to see beyond the skin, into the body, and improve the accuracy of their diagnosis. Through the years many other discoveries have paved the way for further forms of imaging. The first imaging was by X-Rays, basically a high energy radiation. These X-Rays pass through the body exposing film on the other side. Early on only the very dense structures such as bone could visualized. Objects that didn’t belong such as metal could also be seen. [As a side note, it was at Davidson College, my Alma Mater, where the first documented use of X-Rays were used as a diagnostic tool to visualize, amongst other things, a .22 caliber bullet.] To see structures other than bone [and bullets], various metals were introduced into the body such as iodine in the blood and barium in the GI Tract. With the advent of computers these X-Ray images could be digitally manipulated, the rudimentary explanation of Computed Axial Tomography, CT, and Digital Radiography, DR. Over the years other forms of energy have been used to image the body. Sonar, first used in underwater naval applica-

tions, was refined to see not just below the surface of the water but the surface of the body. Ultrasound has had many many uses, none as important as its use in Obstetrics. Magnetic Resonance Imaging, MRI, is a computer manipulation of data obtained from the body utilizing strong magnetic fields and it’s interaction with electricity. Some 120 years following the discovery of X-Ray, Radiologists and other Medical specialties have amongst their arsenal for diagnosis: X-Ray, DR, Fluoroscopy, CT, MRI, Ultrasound, Doppler Ultrasound, Nuclear Medicine, Single Photon Emission Tomography (SPECT), Positron Emission Tomography (PET), Angiography, Duel Energy X-Ray Absortometry (DEXA), and now Molecular Imaging. Individuals trained to actually perform these studies are Radiologic Technologists. This requires two to four years to master with vigorous certification and credentialing criteria. The medical specialty devoted to imaging is Diagnostic Radiology. Radiology is a four year residency following one’s intern year. This is followed by one to two years of further fellowship sub-specialization. The radiologist helps supervise the performance of imaging, interprets the results, and then communicates with the patient’s doctor the results of the studies. The radiologist is available for consultation with a patient’s doctor concerning the proper imaging to order, the implications of the results, and if needed any imaging guided treatment that can be offered. Though the skin remains opaque, it is no longer a barrier to visualization of what is occuring beneath its surface. Medical Imaging and it’s specialist, the Radiologist, can supplement the history and physical and provide the medical practitioner a more accurate diagnosis. With more accurate diagnoses, better treatment can ensue improving the health care of the patient. Dr. Fry is a Board Certified Radiologist, a partner in Radiology of Huntsville (ROH). ROH provides radiologic services at multiple facilities throughout the Tennessee Valley including Huntsville Hospital and Crestwood Medical Center. He currently serves as the Imaging Medical Director at Athens-Limestone Hospital.

The Perfect Home by Rodney Farmer

Searching for a new home evokes excitement and anxiety. The average family seeks an intellectually rigorous school district for their children, a community of engaging neighbors, close proximity to work, and safety to flourish. These challenges can be daunting for the average family but imagine finding an ideal home for an intellectually disabled loved one that requires support beyond what you can give them. Where to start? What are the resources available in our area?

My brother is intellectually disabled and my mother and I faced these same decisions a few years ago. The small town of Fayetteville, TN, was lacking in resources for special needs individuals. My mother developed health issues and we began searching for a group home to assist my brother. He struggles with mental health (it’s not uncommon for special needs people to have mental health problems) and before a group home would consider him, a hospital psychiatric evaluation was required. A case management worker informed us there was only one group home with an available bed 45 minutes north in rural Shelbyville. We hoped for the best. Unfortunately, over time we realized this home did not meet my brother’s needs as he was the only intellectually disabled resident. His opportunities to socialize in the community at this home were limited to an occasional trip to Walmart, the bowling alley, or a Chinese restaurant. I conducted an exhaustive search lasting over a year and eventually found a privately-owned group home in Huntsville with several intellectually and developmentally challenged residents. Although my brother was already receiving Social Security Disability benefits, he was unable to qualify for the Alabama Medicaid waiver for the intellectually disabled due to not yet being a resident of the state. Eventually this problem was resolved. At this second home my brother experienced semi-independent living, shared a small home with one roommate, and lived directly across the street from the main home where meals were offered and entertainment was provided. He was able to participate in a variety of community outings such as bowling and going to church. Sadly, after a few months, it was mutually determined between the home and our family the semi-independent living arrangement was not in his best interest due to his mental health struggles and a more closely supervised setting was deemed necessary. Frustratingly, my brother was admitted to the local hospital for yet another mental health evaluation. After two weeks in the hospital, my brother finally received the Medicaid waiver. Immediately thereafter, case management notified us of a few available homes in the Huntsville area. I spent many hours touring each of these homes and meeting with each facility manager. Eventually my mother and I settled on a third group home for my brother. Three years later, my brother is prospering in this home. He lives in an apartment with supportive group home staff available around-the-clock. He functions independently, cooking and cleaning for himself as well as exercising at the gym. Transportation is provided to all doctor appointments, his place of employment, and to any events in which he wishes to participate. He also lives closer to my wife, newborn daughter, and I, as well as our mother who has since relocated to Huntsville. After 3 attempts and several years, my family finally found the environment in which my brother now thrives. I wish

to reduce the stress other families endure when searching for an intellectually/developmentally-disabled group home endure when searching for a group home by sharing what I have learned about our resources in North Alabama: A 1975 Alabama state law designated Act 310 provides for the formation of public corporations to contract with the Alabama Department of Mental Health to construct facilities and operate programs for mental health services. Such entities are commonly referred to as “310 Boards.” The Madison County 310 Board’s website, madisoncounty310board.org , lists several requirements for the intellectually disabled applicant: • In order to qualify for placement on the wait list, you must FIRST call 1-800-361-4491. An intake coordinator will contact the parents or guardian and schedule an intake appointment to obtain all documentation to support waitlist placement. The application is then forwarded to the Department of Mental Health, Region One Community Services, who ultimately determines eligibility and approves placement on the waitlist. • An I.Q. less than 70 in order to be eligible for services (this test can be performed by a psychologist). • Applicant must demonstrate significant or substantial functional limitations in three or more of the following major life activities: self-care, receptive and expressive language, learning, self-direction, mobility, and capacity for independent living; these must occur prior to the age of 18. • Once awarded, the intellectual disabilities waiver provides a variety of services including but not limited to: residential living, day habilitation, pre-vocational services, job coaching, physical therapy, behavioral therapy, personal care transportation, skilled nursing, crisis intervention and more. North Alabama offers those with intellectual and developmental disabilities several areas of employment, cultural events, and educational opportunities. Many disabled people are employed at the Arc of Madison County, Publix, and the YMCA. Huntsville has been one of many host cities yearly for The Night to Shine prom, sponsored by former University of Florida and NFL quarterback Tim Tebow to provide a unique experience for those with special needs. Merrimack Hall Performing Arts Center in Huntsville has a mission to provide visual and performing arts education and cultural activities to children and adults with special needs. Several athletes represent Huntsville and north Alabama every

“The Madison County 310 Board provides support coordination and case management services to the citizens of Madison County who are diagnosed with an Intellectual Disability (ID) and/or Developmental Disabilities. It is the mission of Madison County 310 Board to ensure provision of a system of effective and efficient services The system of services shall be person- and family-driven, provided in the least restrictive setting, promote and protect a person's rights, maximize person and family input, and use existing support systems whenever possible. Our staff advocate for the wants and needs of persons served, follow through to assist them in accessing and obtaining services, and follow up to ensure the needs are met. Every person served should always be treated with dignity and respect; and our goal is to work to ensure this basic human right is met.” -Kate DuBois, Support Coordinator Supervisor, Madison County 310 Board

“I will have been with The Arc of Madison County for 16 years this November. During this time The Arc has experienced a lot of changes in how services are provided to individuals with intellectual and/or developmental disabilities. We have transitioned from a program that only provides day habilitation services to one that provides opportunities for community employment, volunteering, community exploration and experience, early intervention and transition services for high school students, to include 2 Project Search sites which provide internships for high school and young adults. In addition, The Arc recently was awarded certification by the Commission on Accreditation of Rehabilitation Facilities which opens the door for us to be able to provide employment services to a more diverse population.” -Terri Haisten, Work Programs Coordinator, Arc of Madison County

year in the state Special Olympics held annually in Troy. As of September 5, 2018, there were 5,260 slots available to those with Intellectual Disabilities in the state of Alabama. A 2014 article written on al.com stated there were over 3,100 individuals on the waiting list for services through the state’s Medicaid Waiver. The l ack o f s lots for those in need is unfortunately an issue not unique to Alabama. In 2015, an estimated 2,100 were waiting for group home placement in Connecticut. From 2015 to 2018, the numbers rose from 2,000 to nearly 3,000 in Colorado. Presently, over 13,000 intellectually disabled individuals are currently waiting for services in Pennsylvania. My one word of advice to families of special needs individuals is to be persistent in obtaining waiver support and group home placement. I also hope to encourage everyone to support and advocate the broadening of resources for intellectually and developmentally disabled people in north Alabama. Mr. Farmer is a 3rd-year medical student at the Edward Via College of Osteopathic Medicine, Auburn Campus.

UTI by William T. Budd; Ph.D

Acute urinary tract infections (UTI) are one of the most commonly diagnosed bacterial infections in the US accounting for over 10 million physician visits annually. Over the last decade, the economic burden associated with these infections has increased due to the high rate of recurrence and increased frequency of antimicrobial resistance. The standard diagnostic test to identify organisms causing infection is the standard urine culture. However, recent studies have revealed that less than 5% of bacteria can be cultured under normal laboratory conditions. This is referred to as culture bias. Additionally, there exists a large variability in the physical collection of culture material that affects downstream analysis. For these reasons, traditional culture techniques often fail to identify the individual components that make up these infections. It is also well understood that culture results are incorrect/ incomplete approximately 25% of the time. Elderly and persons that have undergone a urinary tract procedure are at a high risk for complicated infections that contain several bacteria. It is estimated that 33% of urine cultures derived from samples collected from the elderly are poly-microbial and fall within this category. It not uncommon for clinicians to receive a report describing the sample as a mixed flora with unknown constituents as the current diagnostic standard is to not report bacteria from samples containing three or more bacterial species. In properly collected samples, the assumption that urine containing more than three organisms is contaminated is false. The inability to work up these samples and provide clinicians with an appropriate therapeutic regimen increases the likelihood of the use of an empirically prescribed broad-spectrum antibiotic contributing to increased microbial resistance of the organisms. Armed with knowledge of the offending bacteria, physicians can tailor a specific therapeutic regimen to eradicate each organism decreasing the likelihood of infection recurrence.

In addition to the inability to report constituents of polymicrobial infections, urine cultures have a significant by Belinda Maples, false negative rate. Studies show that manyM.D. symptomatic women (25-30%) will have a negative urine culture. These patients have been traditionally classified as having urethral syndrome (symptomatic abacteriuria). The presence of urethral syndrome has been a point of contention for several decades with many physicians dismissing the syndrome in its entirety. Because of this debate, physicians will often initiate antibiotic therapy despite a negative urine culture. Recent studies proved that women presenting with symptoms of a UTI that were culture negative frequently had E.coli and/or Staphylococcus saprophyticus (>90%) that were detectable by polymerase chain reaction (PCR). PCR is highly accurate and able to detect bacteria at lower levels than traditional urine culture. Therefore, this technology can ensure that providers are not making clinical decisions with limited information. Urinary tract infections are a common menace to clinicians. Complicated UTIs can progress to sepsis and ultimately lead to death. This is especially true in the elderly and immunocompromised patient populations. Providers face opposing forces when deciding to treat a UTI. On one hand, the awareness of the deadly potential of a UTI suggests providers should aggressively treat an infection but the increased virulence and resistance associated with overtreatment necessitates accurate diagnosis. Culture and sensitivity have been the gold standard employed for nearly 100 years. The inability to accurately diagnose poly-microbial infections along with the high rate of falsely negative results has created the need for a more accurate diagnostic method. The use of highly specific, multiplexed PCR assays may offer clinicians a better alternative for identification of uropathogens. The panel described in this manuscript is based on empirical results from our community with a high degree of clinical sensitivity and specificity.

The 6th Sense of Clinical Practice: Medical Intuition by Kari Kingsley, MSN,CRNP Merriam Webster defines intuition as, “quick and ready insight; immediate apprehension or cognition; or the power or faculty of attaining to direct knowledge or cognition without rational thought and inference.”That’s fancy wording, but what does that really tell us about medical intuition? As a patient, would we prefer care from the newly graduated straight-A summa cum laude med student….or the seasoned physician with years of experience under his or her belt, but whose medical books harbor millimeters of dust? How does a greenhorn medical provider make split second judgment calls with limited experience to back it up? What makes someone a good provider? Does it all boil down to book smarts, experience, or a combination of both? Some would say medicine should be considered a foreign language. Every drug calculation, medical abbreviation, and short hand symbol for what felt like every adjective, adverb, and preposition in the English language was thrown at us in the first few weeks of school. Almost as if the powers that be were using scare-tactics to weed out the weak! Deciphering physicians’ handwriting felt comparable to reading hieroglyphics. Oh, and pimping! (Mom, it’s not what you think!) Pimping is a word used in the medical community describing a teaching tool used in clinical rounds in which the student is asked a question on the spot. A really hard question. In front of their peers. Like, “Which Biblical character was most likely to have a pituitary adenoma and why?” It can be mortifying in front of your instructor and cohorts to miss the answer. Although, take it from my personal experience (and chaffed backside from the tongue lashing I received), that you’ll never forget why Mrs. Smith in room 217 needed lactated ringers instead of normal saline. In nursing school, I remember silently chanting to myself, “C” equals R.N. Just get through this test, this clinical hour, this procedural check-off. That’s something no patient wants to hear from their nurse. But the truth is, nursing school is tough. It should be! I prefer that the person sticking my Dad with a hypodermic needle full of medicine knows their stuff! And while I ultimately graduated with a B+ average in undergraduate studies, I still remember thinking I would be the first person in my class to flunk out after bombing a pathophysiology test. As a graduate level provider, I had to up the ante. Mediocre grades and blasé mindset wouldn’t cut the mustard. One medication error or temporary lapse in judgement could end in a deleterious event, forever changing (or ending) the life of my patient, not to mention my own. Even after pouring myself into my studies and graduating nurse practitioner school with a 4.0, I felt like I knew NOTHING. (Yes, I am bragging about my 4.0… especially after spilling my “C = RN” mantra). Forever being my own worst critic, I reluctantly joined the work force, con-

stantly second-guessing myself and running to my collaborating physician for guidance. But with each passing year, something exciting began to happen. I was slowly loosening the reigns on my self-depreciating tendencies and becoming more confident and comfortable with the clinical decisions I was making. Foreign and aloof medical conditions gave way to familiar and recognizable human ailments. Just like Pinocchio shouting, I’m a real boy!!, I started to feel like I could yell to the world that I knew what the heck I was doing! Every profession has a margin of error. It just so happens that in medicine, this margin is very small. Humans make mistakes. That’s a fundamental part of what makes us human rather than divine. Medicine is a career path similar to space flight where one tiny miscalculation can get a person killed. Plenty of other professions carry this weight. I envy the professions that seem to have a larger margin for error. Having spent a large portion of my life with a computer programmer, I’ll pick on them. I can recall hearing that after spending a day typing lines of code only to find a program won’t run, programmers have the opportunity to go back over their work and “de-bug” the problem. Something as simple as changing a misplaced colon for a comma has the whole operation running seamlessly. In medicine, we don’t get these do-overs. We are asked to make high-pressure, critical decisions, sometimes in the blink of an eye, using only our toolbox of clinical expertise and experience. If you’re lucky, no one gets hurt. My pilot father says, “any landing you can walk away from is a good landing” even if you crumpled your plane like a Coke can. But good landings in medicine aren’t enough. Our margin for error is paper thin. Multiple advanced practice journals have published critical reviews and professional papers studying the role of medical intuition in practice. My layman synopsis is that medical intuition is a combination of using evidence-based medicine with what you’ve seen in your own experience. Of course, each of these journal entries are open to interpretation but I see it as “Monkey see, Monkey do, but then Monkey, don’t forget to think for yourself!” Intelligent people are able to extrapolate and implement wisdom over intelligence in their daily actions. I like to think intuition is when your brain, your heart, and your gut are urging you in a similar direction. Apparently, Goliath likely had a pituitary adenoma causing acromegaly and bitemporal hemianopia (fancy talk for a giant with poor vision) as he was described in the Bible. Mercifully, no physician ever pimped me this question. And thank goodness for Google or else you fine folks would still be wondering.

Do You Really Need a

PRIMARY CARE PHYSICIAN? by, Jason Lockette, MD, MBA

When trying to decide which healthcare provider is best for you, it can be confusing sorting through all of the different medical terminology. Do you need an Emergency Room, an Urgent Care Center, a specialist, or a Primary Care Physician? Urgent Care Centers and Emergency Rooms serve an important role by providing extended hours access. Emergency Rooms, in particular, are equipped to handle most any life-threatening injury or illness. An unfortunate consequence, though, is that patients with non-life-threatening conditions often experience lengthy wait times. In addition, there is a separate facility fee associated with using an Emergency Room, which is why most patients will experience significantly higher costs. Urgent Care Centers have come along to fill the void between the Emergency Room and your Primary Care Physician. They are more cost-effective than the ER but are often staffed with many different physician and non-physician providers meaning that you seldom get to see the same team of providers. Where do you go, then, if you have a chronic condition such as high blood pressure, diabetes, or high cholesterol? These conditions are best managed when you have a relationship with the same provider or team of providers. After all, we stick with the same people who cut our hair and repair our car. Why should our healthcare be any different? But, what if you have a new symptom or problem that needs immediate attention? It can be hard to know how best to handle a new problem and traditional Primary Care cannot usually accommodate same day appointments. Why is this? Providers are being asked to do more and more administrative tasks that take away from their time with patients. The result is decreased job satisfaction, increased stress, early retirement, and, in some cases, depression and anxiety. Todayâ&#x20AC;&#x2122;s increasingly complicated healthcare system requires a level of expertise and time that most physicians simply do not have. Lessening the administrative burden on providers, for example, requires a team of billing/coding professionals, scribes, legal/compliance experts, and a whole team of administrative/clerical personnel, something small and even medium sized Primary Care practices simply cannot afford. At Integrity Family Care, we have created a different, more friendly and usable Primary Care experience. Patients have access to the same team of providers every visit and, if needed, we can accommodate same day appointments for most acute problems.

AT INTEGRITY FAMILY CARE, WE HOPE TO HELP YOU...

Live Life Well

Jason Lockette MD, MBA, President, Integrity Family Care 1041 Balch Rd #300, Madison, AL 35758 256-325-1540 www.integrityfamilycare.com

WHAT CAN I EXPECT FROM MY PRIMARY CARE CLINIC WHEN SCHEDULING AN APPOINTMENT? by Tiernan O’Neill ne of the most common concerns of both patients and doctors alike seems to be what can they both reasonably expect when an appointment is made at their clinic. As premiums and deductibles rise for patients there can be greater frustration when they don’t believe their money has been sufficiently spent. And for clinics and providers as workload, administrative burden and lastly patient expectations become more and more cumbersome they too wish to find a happy balance between desire and reali-ty. This article is meant to address scheduling, problems covered, financial responsibilities and follow-up and how each directly affects patients as well as providers. SCHEDULING A patient should expect timely access to their primary care provider, and rightfully so. This generally means a routine acute or chronic condition appointment availability with-in 24-48 hours (business days). Access is one of the main reason patients will or won’t establish themselves with a primary care physician over utilizing urgent care services instead. As an established patient at a clinic, that clinic holds detailed historical information on a patient that can expedite and ease scheduling. Now from the clinic’s perspective, a timely appointment is typically determined by three major components and each of them is heavi-ly influenced by reasonable expectations. There actually has to be an opening on the schedule. No clinic can or should schedule a patient quickly thereby inconvenienc-ing other patients who have had the foresight and orga-nization to plan ahead. Additionally, patients need to be flexible. Should you be unwilling to budge from a specific day or time you need to understand that availability on the schedule could be problematic through no fault of the clinic; as well it is typically not the best way to work with the scheduler so they work with you. Finally, the nature and range of issues wished to discuss within that appoint-ment should be reasonable and practical to fit within the confines and limitations of the clinic’s schedule. Specialty appointments (new patients, physicals, procedures) tend to take more time on the schedule and thus they have lim-ited availability and tend to book out farther in the future.

PROBLEMS COVERED A patient should expect to cover the issues they have been scheduled for. When a patient is clear and detailed in the problems they wish to cover in an appointment, every reasonable effort should be made by the clinic and provider to meet those expectations. Within the appoint-ment itself, it is incumbent on the patient to be organized and satisfied with the care they receive. It is often helpful to have your thoughts, issues and possible refills written down to reference throughout the appointment. It does little good other than scheduling a second appointment to call back later and say you forgot something. I wouldalso highly recommend when you are dealing with a new issue, a health issue that is potentially life changing that you bring a friend or family member along with you to the appointment. Many people are often surprised what a second set of ears can hear when your mind is racing with possible implications of news you are receiving. From the provider side, you often hear clinics complain about the “oh by the way” factor. Patients will often add issues with-in their appointments, which can be the main cause of primary clinics running behind from their preset sched-ule. To this, I generally respond by saying “tough.” Primary care has been, is and always will be affected by these issues. It is the nature of the beast. When these issues present themselves a clinic should have a schedule or method al-lotted to handle this problem. Now, since primary care clinics have vast histories and tendencies of their patients they should also have a system to recognize, deal with and deter patients who chronically abuse this accommodation on purpose. Ultimately a patient, within reason, can expect to have their concerns and issues covered. A second issue that is worth discussing within this top-ic is what a patient can expect to get out of their annual physical. A routine physical is for screening purposes only. While it is possibly intended to find health problems that are not normally obvious, it is not designed to coincide with acute issues, known chronic problems, or the possi-bility of abnormal findings. While some offices will allow patients to coincide annual physicals or preventative visits with diagnostic appointments, patients need to be aware this will add, specifically to the cost, of the encounter. Many people misunderstood the inception of free yearly physicals as a chance to address all of their health prob-lems in one visit without charges. Billing guidelines set forth by the American Medical Association and endorsed by every insurance company clearly allow for clinics to bill for a diagnostic visit (and procedures) along with the physical charges as well.

FINANCIAL RESPONSIBILITIES A patient should rightfully expect to satisfy their financial responsibilities in a manner as dictated by the guidelines of the clinic. This is probably an issue or a stance most patients don’t want to hear. But if a clinic is clear and con-sistent with their guidelines, patients need to follow them. It has been extremely unfortunate the business of health care has for so long and continues to be viewed as a cred-it industry. Whereby patients or really in fact consumers believe they should receive services and pay at a later date when it feels appropriate to them. You would never imag-ine a scenario where you buy food at your local grocery store now a days and simply say bill me later. In response to ever escalating costs and collections, many clinics have countered by collecting charges, coinsurances, and deductibles at time of service. Additionally, there has be-come a greater trend lately to keep patient financial credit cards on file for money collecting purposes after insurance determinations.Rather than arguing or even refusing to make such payments, you are best advised to find either an insurance plan or clinic where you can feel most comfort-able with your financial responsibilities at time of service. FOLLOW-UP A patient should rightfully expect for timely and complete follow-up from their appointment. Test results, medica-tion refills, and answers to your questions close the loop and should be considered an integral part of the appoint-ment yourself. Providers have a reasonable expectation for their method of choice in delivery to such components to be respected and valued by their patients. Clinics will use a wide array of methods from lower staff relaying infor-mation to electronic portal communication to their pa-tients. In cases of other staff relaying information (medi-cal assistants or nurses), as long as the communication is provided by a competent and well versed professional a patient shouldn’t expect relay of information by the pro-vider over the phone directly. Requests that contradict the clinic’s model will often be met with a need for a second appointment and you should understand there are addi-tional scheduling, coverage and financial concerns associ-ated with such. CONCLUSION Both a patient and a provider have every reason to have their above rights to be met. Reasonable expectations contained within should always be granted. Ultimately, no clinic is one size fits all. Should a patient feel they are not getting what they value they can feel free to search out an-other clinic that will better serve their needs. But patients should be forewarned if your expectations are not reason-able or clear you will likely find yourself bouncing from clinic to clinic and never find the continuity you search for in a primary care clinic. Conversely, no clinic should feel they have to alter their operations or reasonable expecta-tions to meet the needs of every individual patient and their differing desires; and in these cases it is not wrong to suggest a patient they should go elsewhere. However, clinics should also be aware and responsive to popular ex-pectations or they will quickly see their patient panel size shrink below a sustainable level.

YOU ARE

Worth it all by Elisa Brooks

"Quietly I heard a whisper to my own heart, Elisa, you are My workmanship."

IMFall'19.indd 8

8/28/19 2:38 PM

There’s a lot out there on social media, blogs, and various forms of communication about self-love. The idea that perhaps we inherently don’t love ourselves and need to practice the art of loving yourself. I’m guessing that perhaps you have seen these thoughts and ideas out there as well, in the form of writings, memes, and who knows what else. And then, something that happened in my own daily life, made this whole idea come full circle for me. I teach a variety of fitness classes, and though I’m not currently doing personal training, I’ve been a certified personal trainer for a number of years. I was going about my normal daily routine, and was teaching an hour class at the gym. In the first few minutes of class, two other instructors slid in the doors to take the class. Normally, that does not affect me much. However, these two just have never happened to have taken any of my classes because our schedules don’t cross, and something about them walking in made me nervous. Would they think I did the right safety cues? Do they think I’m great instructor? And so forth. As I’m literally coaching class, these thoughts and more are spiraling through the back of my mind. About halfway through the class, I made a mistake that to me botched up a significant few minutes. I’ll attribute it to the fact that 1) I’m not perfect; and 2) I was nervous, knew I was nervous, and I allowed that to get the best of me. I got myself back on track, but was SO frustrated with myself for that mistake! Driving home all I could think of was what their perception of me might be … they probably thought I was ridiculous! Maybe they were sorry they ever walked in those doors tonight. And on and on and on. Mind you, I would NEVER let my husband, my mom, my kids, my friends, anyone I know berate themselves with such negative talk if I could help it! But I was laying it on thick to my own self at that moment. Quietly I heard a whisper to my own heart, Elisa, you are My workmanship. I don’t know what point you are at in your life, whether or not you believe in God, whether or not you believe in a God that speaks to you. But I do. I believe that the Creator of the entire world is a loving God who cares for me and speaks to me. In that moment He quickly set things straight. What He spoke to me lines right up with a verse in Ephesians 2:10 which says, “For we are his (God’s) workmanship, created in Christ Jesus for good works, which God prepared beforehand that we should walk in them.” Another translation puts it this way, “For we are God’s masterpiece.” What God calls His workmanship and His masterpiece is definitely not a mistake, a failure, or ridiculous. He made me. He made you. And in the Bible when the story of creation is concluding, God says that what He made is good. That includes us. We’re made in His image. Because of that, you and I have worth. We’re not worthless, like some people might say, like sometimes you or I might have felt at times in our lives. A masterpiece is priceless. We’re the masterpiece of God. How does this tie in to self-love? I think we are missing the point. This is not about self-love. You can try and love yourself to pieces, but it won’t solve any of your problems. You’ll still make mistakes. So will I. You might look in the mirror and still be frustrated with the reflection. So will I at times. I don’t need to practice self-love. I need to know and believe down in the deepest places of my soul that I have worth. Not because I can necessarily produce anything worthwhile, but because the One who made me says I have worth. That I was created with purpose and destiny written in my heart. Because I am HIS masterpiece, HIS workmanship, and what He makes is good! I have inherent value because I was created by the Creator!

IMFall'19.indd 9

When moments come like the mistake in the class? The times when I wish I wouldn’t have said something I said? When I look back and am disappointed with myself? That’s when I need to remember, when you need to remember that we have worth. That we were not a mistake. That a good God has good plans for our life (Jeremiah 29:11). When I settle into that heart attitude and that trust in God that He loves me no matter what, I can lose the negative self-talk. I can move forward from mistakes and they don’t hang on me like a weighted backpack that I can’t seem to get rid of. You might be facing tough circumstances at home, at work, in life, in health, etc. And if you aren’t right now, you will be at some point. That’s life. It has ups and downs. I believe it is no accident that at this very moment God is planting the truth in your heart that you have worth. When life feels rough, it can be so hard to hang on to that truth! But begin to settle it now. Ask Him how He sees you. Let Him tell you about the masterpiece that He created you to be. Look in the mirror and remember that you are the workmanship of God. And though ups and downs, that foundation of Whose you are will carry you through.

8/28/19 2:38 PM

Enjoyable splendor of the holidays fills the city of Huntsville as we bring in the New Year. Our community is lit with elaborate décor and elegant sounds of cheer; both which are captivating to the audience. But to those millions of Americans suffering from cataracts, enjoying the beauty of our finest celebrations is nearly impossible. Cataracts are a very common condition. By age 80, more than half of all Americans are affected by the problem. In-dividuals under the age of 65 help account for the nearly 4 million cataract surgeries that are performed yearly. New on the market this year is the TECNIS® Symfony lens made by Abbott Medical Optics. After Abbott won FDA approval in July of 2016, Dr. William Mitchell with Maynor & Mitchell Eye Center became the first Surgeon in Alabama to perform this state of the art procedure. Dr. Mitchell expresses, “The Symfony lens

entirely

new

de-sign,

revolution to our generation of intraocular lenses. A

lens

providing seamless,

high-quality

Dr. Mitchell is known for always staying on the cutting edge of technology in the area of cataract surgery, using the most modern techniques available today. He was the first physician in Alabama to offer the Tecnis Symfony Intraocular Lens.

New Intraocular Lens enhances options for cataract patients

day-to-night

vision,

vision, extended depths of focus and

demonstrates a low in-cidence of halo and glare compared to other corrective sur-geries for cataracts. The Symfony is our market’s first lens offering the patient to see both distance and up close. My patients with active lifestyles can enjoy their vision without the hassle of corrective lenses.” The Symfony lens also enhances colors and is available to a wider range of patients than other multifocal lenses. the

Dr.

Mitchell

has

experienced

patient benefits of utilizing this new technology. Dr. Mitchell and his staff are dedicated to the families

in our community. Don’t let blurriness, glares, or difficulty of seeing bright lights hinder the enjoyment of your holiday season. Bring in the New Year with a new lens that will allow you to appreciate the lit streets and homes in our community. A “symphony” to consider. To find out if you’re a candidate for this newest available cataract surgery, contact the office of Maynor & Mitchell Eye Center.

Maynor & Mitchell Eye Center www.maynorandmitchell.com 256.533.0315

Your Vision Is Worth Protecting by Dr. Neena Singhal James, Optometrist

Many of us take the proper precautions when it comes to financial security, home security and the safety of our families, but what if you were already having something stolen and you didn’t even know it? Many ocular diseases, left untreated, may be slowly “stealing your vision”. This theft may be slow and unnoticed, but the damage can be irreversible. Ocular diseases are not uncommon; people with “perfect vision” can also be susceptible without any symptoms or forewarning. When caught early, many ocular diseases can be managed by less invasive treatment such as eye drops and vitamin therapy at the discretion of an eye doctor. The health of our eyes is something that is often taken for granted. Working with my patients and my time volunteering at the Perkins School for the Blind, I have been able to see first-hand how devastating and life changing vision loss can be. Vision loss can also often impact the entire family’s way of life and quality of life in many ways. Glaucoma affects o ver 3 m illion p eople in the United States. This disease can first take the peripheral vision, making daily tasks such as driving a car, working, and active sports and hobbies nearly impossible. Macular degeneration causes distortions in your central vision making watching TV, reading a book, or simply eating dinner difficult tasks to overcome. Children cannot always tell us what is wrong and often times signs are very difficult for parents to detect. Diseases like Amblyopia, also known as “lazy eye”, can result in uncorrectable vision loss if not treated during early childhood. A simple check-up can result in detection and help. During dilated eye health exams, doctors are able to see ocular diseases such as glaucoma and macular degeneration as well as detect cataracts, dry eye disease, retinal detachments, signs of diabetes and even hypertension. Imagine how your world would be changed if your vision was compromised. Don’t get left “in the dark”! Make sure to take time each year for a simple visit to your eye doctor. Isn’t it worth taking some security measures to protect your eyes?

Pediatric Myopia: an Epidemic? by Paul F. Vandiver, OD

Things have changed since I was a kid. We played outside till dark, explored in the woods, got dirty, built forts, watched the occasional “after school specials” and who could forget the cartoon Saturdays. Today kids have visual stimulating gadgets everywhere. Of course, we had the Atari, Nintendo and its Game Boy in the 90s, paving the way to the XBOX, Playstation and others. But its a different world today for sure – driven by handheld devices that are constantly drawing attention from most every kid, whether in restaurants or a big box store keeping Johnny hypnotized while mommy or daddy gets the shopping done. Is the “technogadget, information at your fingertips world” we live in today effecting our youngsters eyes? I would say absolutely, and the evidence is in the research. 40

Inside Medicine | Late Summer Issue 2018

According to the journal Ophthalmology (2016), “Half of the worlds population (nearly 5 billion) will be myopic by 2050, with up to one-fifth of them (1 billion) at a significantly increased risk of blindness if current trends continue.”1 Nearsightedness, or myopia, is a condition of the eye where light focuses in front of instead of on the retina. This causes distance objects to become blurry while close objects remain clear. Eyestrain as a result of squinting improves the clarity of distance objects, and over time the focusing system of the eye becomes weak from exhausting this mechanism. The decrease in distance vision over time and headaches are a result. Eyestrain is also a result of excessive near work — reading for hours a day or using computers or phones excessively (where the definition of “excessive” is debatable). The fact that distance vision becomes worse over time is just part of the problem with this eyestrain epidemic. The eye’s ability to focus like a camera is also degraded. We’ve all heard the phrase “my arms aren’t long enough” or “the print keeps getting smaller” etc. due to inability to focus on objects nearby after forty or so birthdays. This complaint is now being heard or revealed in a comprehensive eye examination by much younger patients. I believe in part to the over-stimulation and constant use without breaks. This near demand on our eyes today is worsening compared to ten years ago. To be realistic, there seems to be no way around the world of electronic communication and the social network phenomenon – desired or not. It is widely accepted and frankly not debatable that myopic progression is a high priority. Seeing that the tech world is only becoming the rule and not the exception, we should be aware of its effects on our eyes. Often I am asked “What restrictions should I place on my child’s screen time?” or “How can we prevent his/her eyes from worsening?” These are good questions and with the evidence produced from collective myopic control studies we now have at our fingertips optimum guidelines and treatment interventions to slow down the progression of these myopic changes. To date there is no actual cure for myopia. There are ways to improve myopic vision degradation up to the time it is corrected, but vision can and most likely will change over time. The human eye will stop growing at or around puberty, but very little change in the length of the eye can cause significant change in myopia. This is why refractive surgeries like LASIK can only be considered when the length of the eye is less likely to change. So therefore contact lenses, spectacles, or the various refractive surgeries may not be the only

treatment needed throughout ones life, but with the myopic “epidemic” we are seeing today, combinations of the above treatments are needed. This is where MYOPIC CONTROL comes on the scene. We have desperately needed an intervention plan for decreasing the PROGRESSION of vision loss from myopia in children so that they will not be at a higher risk for myopia induced ocular disease, let alone the poor vision and the lifestyle changes it accompanies. What Are Some Causes of Myopic Progression? There isn’t necessarily one cause of myopic progression but rather a combination of factors. Parents that are nearsighted are more likely to have myopic offspring, but not always. It’s certainly a predestination NOT a destiny. It may be that parents who preferred to read a lot have kids that prefer the same activity. We do know that there are factors that contribute but how they vary from one child to another is difficult to gage. Factors like excessive reading (2-3 hours at a time), long term computer use, and some evidence that diet may be a variable. For the purpose of this article we will discuss some interventions. Independent of the causes, the facts are that myopia and its progression over shorter time intervals are worsening. Just like you don’t have to understand the physics of how a bike works to actually ride one, we’ll focus on how to decrease this problem at hand. Why is Myopic Control Important? There are considerable health risk with significant myopic changes, especially if at a high rate. As mentioned, the axial length — or length from front to the back of the eye — is the most influential variable in myopia besides the curvature of the cornea. When the axial length of the retina becomes elongated, there are areas that become stretched and ultimately too thin. Imagine blowing up a balloon. The more air that is blown in, the longer and thinner the balloon becomes. Like all organs the retina’s growth is reg lated by homeostatic control mechanisms and unlike other organs the eye relies on vision as a principal input to guide growth. This thinning of the retina tissue causes significant fall out. The retina is in a way the circuit board encompassing a complex network of nerve fibers and cells that together make up an enormous grid for delicate chemical reactions that produce vision as we know it. Vision Threatening Ocular Disease and Disorders Associated with Myopia Degenerative Myopia – When the elongation of the axial length reaches a certain level or lengthens at a high rate it can become pathological. The risk for retinal detachment is higher due to thinning retina at a rate the eye cannot repair or control its repair mechanism quickly enough. Degenerative myopia can be detected with a dilated exam and there are particular changes the eye care

specialist will detect. This includes macular edema (fluid build up in the center of the retina), “stretch marks” or lattice, holes within the outer segments of the retina, pigment changes called “lacquer cracks” and large optic nerve disc which appear to be tilted with loss of tissue around the nerves. Retinal tears and retinal detachments – This is a painless separation of the retina, particularly the layer responsible for converting light to image. A retinal detachment can be repaired in most cases if medical attention is achieved in a timely manner. Symptoms of retinal tear and /or detachment are flashes of light that are sudden and profound, subsequent floaters, distorted images that do not return to normal within seconds, and most dire the “veil” or “curtain” affect producing dark visual field loss that increases with time. Cataracts – Filmy vision over time that worsens in magnitude is most common symptom of a cataract. A longer eye causes entering light to scatter and in turn causes the lens in the eye to become more dense. This increased density scatters light and ultimately allows UV light to change the lens by distorting polymer chains. Additionally, the elongation of the retina deprives the posterior lens of nutrients and therefore clouding the back surface. Glaucoma – This is an ocular disease which causes one to lose peripheral vision. There are a few ways this can occur. The common finding in each mechanism is the thinning or loss of retinal nerve fiber and retinal ganglion cell complex (GCC). There have been several studies that relate risk of myopia and glaucoma. The most agreed is that the GCC is altered, again from being stretched. The GCC is synonymous with a complex wiring system that connects the all important optic nerve with the macula. If this layer is stressed the macular framework will be unable to remain stable. The exact pathology of how the ganglion complex is altered by stretching of retinal layers is not known but the risk of glaucoma increases as the

...cont’d from page 36

axial length increases. Many studies have established that relationship most notably The Beaver Dam Eye Study. Methods for Myopic Control Research in this area of myopic control has become a global urgency. As more information and facts are determined, professionals on the clinical level are implementing and monitoring the results. As we stand today there are currently five general clinical techniques that are universally accepted as “control methods”. At Schaeffer Eye Center (a MyEyeDr affiliate) our very own Dr. Nicholas Onken, pediatric specialist, has experience with the latest methods. 1. Getting outdoors more. This one seems almost like its not a real treatment but actually does make sense. A little vitamin D and getting dirty with some tree climbing and fort building never hurt a kid (too bad). This kind of activity relieves the eye from over focusing. There is truth to “avoiding the stressor” just like a newly discovered allergy or the co-worker that causes a blood pressure spike. 2. Bifocal or progressive glasses. This idea is centered around the theory that assisting the child’s accommodation mechanism by doing a little of the “work” up close will eliminate some of the stress, and also to cause a “peripheral retinal blur” which prevents the stimulus for the retina to grow or stretch. Executive design lenses (bifocals measured at the center of the pupil) have shown more reduction in myopic progression than progressive lenses – 33% reduction in one study2. Each case will have its unique story as we are all very different and research is not biased concerning a personality or a child’s likes and dislikes. Results from a study may say “x” but compliance with a line vs no-line progressive lens may become a real concern for one individual and not another. Convincing a twelve year old to start wearing a bifocal may be a hard sell and all the years of being the cool doctor are on the line. This can be combated by the fact that an executive lens is actually easier to use since there is no image jump and the child can operate the design almost immediately.3 Dr. Onken points out “many adults are hesitant to use multifocal glasses because they’ve heard that it’s hard to adjust to them. This has never been a problem with kids – they just roll with it!” 3. Multifocal Soft Contact Lenses. This is my personal favorite. For those kids who show a mature character – the overachievers – this seems to be a great option. It’s also very effective as the latest results published to date is a 48% reduction in myopia vs the control group of the same age4. The contacts used in this method are multifocal with a specific design for distance and near separated within the lens. This design can be alternating concentric rings, distance in the middle and near on outside, or translating as near in the bottom and distance on top. This is an example of how the myopic control studies have

changed the paradigm and more options are available than once thought. This premise is consistent with the spectacles as well. The design discourages axial length growth by blurring the outer retina. In the clinic I reside, all cases have shown an obvious decrease in myopia progression compared to those in their age group, even in the more myopic youngsters. A couple mind boggling case studies where we fit multifocal contacts, one age 6 and one 7, come to mind. When these patients reached their three year visit, the resulting myopic magnitude was half that of kids at the same age and refractive error with no treatment. Once a child masters the daily insertion and removal routine and maintains appropriate hygiene, they are usually bought in. Dr. Onken’s experience with fitting kids confirms this. “With contact lens wearers, children are the lowest risk population for eye infections related to contact lens wear. My youngest contact lens wearer is 3 years old, because contact lenses work better than glasses for many visual problems, including the control of myopia”. 4. Ortho-K, Kerotology. This is a rigid gas permeable lens that is specifically designed to reshape the outer portion of the eye (cornea) while one sleeps. The patient then removes the lens and the vision has been corrected secondary to flattening. The cornea is spongelike and will revert back to its original shape over time if the lens is not worn. This is a more advanced method for myopia control as it requires a certification and many patient encounters to reach expert level. This is becoming a more accepted control both professionally and from the patients perspective. The peripheral retina blur is constant throughout waking hours and the corneal epithelium is the only layer of cornea “changed” – making this method low risk for any permanent damage to the cornea if lens is ill-fitting or not ideal. After seven days the corneal epithelium is completely turned over. One downside to ortho-k is the difficulty for some to adapt to the initial fitting, especially with a younger child. The lens material is more difficult to adjust to initially but if educated thoroughly and properly, motivation and dedication will drive the patient to success. This method does yield a healthy 45% reduction in myopic control, similar to multifocal contact lenses5. 5. Atropine. This is a pharmacological method that involves the use of a drop with cycloplegia effects. Cycloplegia is the paralyzing of the ciliary muscle in the eye resulting in the loss of focusing ability. This method of myopic control is using a pharmacological intervention – one drop in each of the eye daily. The temporary paralyzation of the lens prevents accommodation and in doing so decreasing the stimulus to elongate. Statistically this method is the most rewarding but carries a few concerns8. A couple drawbacks are most people and especially children wouldn’t line up for drops that cause a little blur and the drop is off label – requiring very careful attention to pharmacological interactions to medicines since this

is a longterm regiment. There are possible central nervous system and cardiovascular implications to be aware of although many atropine supporters suggest very little concern. As a pro argument the most effective concentration was determined to be 0.01%, diluted significantly from the 0.5 - 1% atropine used in optometric exams to treat some injuries with inflammation. The appropriate concentration of 0.01% when used 1 drop a day, can effectively decrease progression of myopia by 68% over a 5 year span.5 Additionally, this method must be adhered to and constant positive reinforcement is necessary. Dr. Onken agrees that “the hardest part is remembering to do them consistently — and a way to keep consistency is putting the drops in when the child is asleep, as it often reduces the stress of the event”. Conclusion There is no doubt that myopia progression rates are on the rise globally. We must be aware of the risk these rates cause on our eyes – specifically our children. We need to ensure that our children are receiving comprehensive eye examinations and creating a dialogue with parents about the risk of myopic progression and intervention possibilities. Optometrist must not only realize the severity of this nearsighted world but get on board with treatment options. Dr. Onken, and many others, are making efforts to improve this concern. Dr. Onken expressed his passion stating, “As a pediatric specialist, one of my biggest concerns is the rapid progression of myopia in today’s kids. Both genetics and our modern day lifestyle contribute to this alarming trend. Fortunately we have tools available to us that did not exist 10 years ago, that give us a fighting chance against myopia”. Being that I am a myopic optometrist and father of 7 year old twins with genetic predisposition – I am in.

1. Brien Holden, Timothy R. Frickie, David A. Wilson, Monica Jong, Kevin S Naidoo, Padmaja SanKaridurg, Tren Y. Wong Cited Ophthalmology, 2016; DOI: 10,1016 j.ophtha a.2016.01.006 Thomas J. Naduvilath, Serge Resnikoff 2. Myopa Control: A Review Walline JJ Eye Contact Lens, 2016 3. Effect of bifocal and prismatic bifocals on progression of myopia in chidren: three-year results of a randomized clinical trial Cheng D, Woo GC, Drobe B, Schmid KL JAMA Ophthamol.,2014 4. Controlling Myopia progression in children and adolescents Smith MJ, Walline JJ Adolesc. Health Med. There., 2015 5. Current approaches to myopia control Leo SW Curr. Opin. Ophthalmol., 2017 6. Five-year clinical trial on atropine for the treatment of myopia 2 Myopia Control with Atropine 0.01% Eyedrops Audrey Chia, FRANZCO, PhD, Qing-Shu Lu, PhD. Donald Tan, FRCOphth Published Online: August 11, 2015 PlumX Metrics

GLAUCOMA AND THE IMPROVEMENT OF SURGICAL INTERVENTION by Michael Salter, MD

Until recently we have been relying on the same surgical techniques to manage glaucoma that were created over 50 years ago. What if we continued cataract surgery the same way for the past 50 years? Many complications existed then like large incisions, higher complications of edema and reti-nal detachment, and long recovery times.

A timeline and synopsis glaucoma surgeries

Conventional Penetrating Glaucoma Surgery

1960’s to present This form of surgery bypasses the eye’s natural drainage pathways and is considered the “gold standard” to-day. The older surgery model involved a tube. High risk of erosion and exposure led to infection with tubes and this led to trabeculectomy or “trab”, “filter” or “express shunt”. “Trabs” can get eye pressure very low and may be option for end stage glaucoma cases, but downside is longer recovery, high incidence of of bleb leaks, shallow anterior chamber, hypotony, and choroidal detachments.

Laser Surgery

Surgical techniques are starting to “get with the times.” There are only 4 current targets in glaucoma treatment. 1. Create an alternate way for aqueous to get out of the eye (artificial drain) 2. Decrease the production of aqueous humor at ciliary body.

3. Better facilitate flow through the trabecular meshwork and into Schlemms Canal. 4. Better facilitate flow through the eveoscleral pathway.

Argon Laser Trabeculoplasty (ALT) 1974 Selective Laser Trabuloplasty (SLT) 1998 SLT is considered a first line surgical option. It works well, and arguably safer than using drops. It has been compared to prostaglandin drop treatment with similar efficacy. Most glaucoma specialist would prefer to begin treatment with SLT over drop therapy. ALT is not utilized much as it is considered more difficult and requires more precise treatment areas with less room for error.

Laser Iridotomy

This is offered to those patients with a narrow angle (where cornea and iris meet). Asians are at highest risk, followed by whites and African Americans. This procedure should be offered to those with a very narrow angle and without evidence of glaucoma as a preventative. Transscleral Cyclophotocoagulation Pros of this procedure are that it is noninvasive (no risk of infection), it is quick to do (in office), and repeat-able. The cons are if too aggressive a robust inflammatory response can occur postoperatively. This surgery must be done under a retrobulbar block (injection of anesthesia behind the globe of the eye). Micropulse CPC This is a new CPC using the Micro Pulse G6 Laser System. It has been shown to cause very little tissue dam-age with no incision and a safe procedure for mild moderate and severe cases of glaucoma.

Microinvasive Glaucoma Surgery (MIGS)

2004 to present MIGS is a no stitch glaucoma surgery that can be pe formed through a small clear cornea cataract incision and is commonly done in combination with cataract extraction. Trabectome – a cauterizing tool that targets and removes the trabecular meshwork. Kahook Duel Blade – a sharp device that “shaves” the trabecular meshwork. iStent by Glaukos – the smallest device to be implanted in the human body and FDA approved for mid and moderate stage open angle glaucoma in 2012. Only FDA approved if implanted with cataract surgery. Studies have shown no increase in complications compared to cataract surgery alone. There is some risk with IOP spike and hyphema.

Second Generation iStent Inject

This could be approved by the end of 2018 and is considered to be easier to place than the original iStent. It also allows for 2 stents instead of 1. Cypass Stent – only approved with cataract surgery and creates a “cleft”. Risk are myopic shift, hyphema, hypotony and IOP spikes. iStent Supra – a suprachoroidal stent FDA approval by 2018-2019. Hydrus Stent – larger than iStent it bypasses the trabe ular network. Not yet approved by FDA.

SURGICAL MANAGEMENT OF

ASTIGMATISM

by Jonathan Ramsey, MD

Many people are familiar with myopia (nearsightedness) and hyperopia (farsightedness), but fewer recognize the term astigmatism. Astigmatism refers to an irregular shape of the cornea (the clear front cover of the eye), a lower order aberration. Rather than the cornea being round – like the side of a basketball – it is steeper in one direction – like the side of a football. This causes light to be bent irregularly, so that it focuses to multiple focal points, rather than focusing to a single crisp point on the retina. Astigmatism of 1.00 D is relatively common in adults over age 40, with an incidence of 31%1. There are many options available for astigmatism management, both surgical and non-surgical. A primary eye care provider will typically start a patient in glasses or astigmatism-correcting contact lenses called toric lenses. This is a good treatment with low risk. However, glasses and contacts don’t fit into every patient’s lifestyle. There

are surgical options available for those who desire independence from glasses or contacts. Surgical options for astigmatism management include corneal-based and lens-based procedures. LASIK and PRK are procedures that can treat low to moderate amounts of astigmatism by reshaping the cornea. Modern all-laser LASIK uses a femtosecond laser to create a flap in the surface of the cornea, then an excimer laser is used to reshape the corneal tissue and the flap is replaced. Traditional LASIK could manage small amounts of astigmatism, but may create higher-order aberrations, which limit the quality of vision. Custom wavefront-guided LASIK uses wavefront analysis to create a map of the optical system of the eye. A treatment based on this map can reduce higher order aberrations and improve the quality of vision,

including improved quality of vision under dim lighting conditions compared to traditional LASIK. Not everyone is a good candidate for LASIK and it carries a small risk of complications, such as increased dry eye. Astigmatism can also be treated at the time of cataract surgery. For patients who have cataracts limiting their ability to read small print or see to drive, cataract surgery can improve the vision. Research has shown that patients are 34 times more likely to need glasses for every diopter of astigmatism in the better seeing eye2.

An astigmatism-correcting lens, or toric intraocular lens (IOL), can be placed in the eye at the time of cataract surgery to minimize or eliminate the need for distance glasses after surgery. New technology, such as the ORA, uses real-time wavefront analysis to allow the cataract surgeon to align the toric IOL with greater precision. The newest IOLs allow treatment of both astigmatism and presbyopia at the time of cataract surgery, to significantly reduce the need for glasses both at distance and near. Although astigmatism affects many people, there are many good options for treatment. Technology continues to improve and allow greater options for surgical management. Those interested in treatment of astigmatism can discuss which option is best for them with their primary eye care provider.

1. Vitale S, Ellwein L, Cotch MF, Ferris FL 3rd, Sperduto R. Prevalence of refractive error in the United States, 1999-2004. Arch Ophthalmol. 2008 Aug;126(8):1111-9. 2. Wilkins MR, Allan B, Rubin G; Moorfields IOL Study Group. Spectacle use after routine cataract surgery. Br J Ophthalmol. 2009 Oct;93(10):1307-12.

BARBARA

A Beacon of Hope by Ashleigh L. McKenzie

One might say the landscape of the medical field has evolved tremendously over the years. Itâ&#x20AC;&#x2122;s always interesting to listen to those who have watched, and been a part of, these changesâ&#x20AC;&#x201C;such as my mother, Barbara Ledbetter.

As a 17-year-old student, she walked into the Mobile Infirmary in 1962 to work and remained there as a continuous employee for more than 50 years. Today, she passionately speaks of her service in the medical industry and her love of her profession. I can tell you that her constructive skills bleed over from her career to our family. The values she holds have greatly impacted our own values, traditions, and beliefs.

It is very encouraging to have an influencer who inherently shares her work experiences and passion in a way that positively contributes to her daughter’s career choice. I’ve always felt unrestricted and able to have my own independent thoughts, and as such, I have created my own way. But, my mother has absolutely been a true mentor in my personal and professional life. Entrepreneurs are often challenged with obstacles, and the foundation of their success hinges on the values they bring to their company. My mother’s persistent attitude, determination, and work ethic have been a shining example and saving grace to many, especially me. We’ve all heard how some people have “a childlike love for something.” Without fail, I relate this analogy to many of my childhood experiences. A little one’s eyes eagerly await the evidence that there is hope in the world and that good deeds come out of their work. My mother seems to speak of her career in the same manner. In 1962, she entered into the radiology program at Mobile Infirmary. At the time, it was the second largest hospital in Alabama. She proudly began to grow her role, carrying many responsibilities. She recounts her feelings of pride when she would don the white nurse uniform that came with such distinction. Her uniform was a symbol of having loyalty, being ready to face challenge after challenge, and displaying a love and care for others in a time when helping others was so purposeful. During this era, war was prevalent and periods of deficit affected the economy, but the world of medicine and patient care was a world-

class phenomenon. The white coats and uniforms were signs of hope and reminders that the ones who wore them had the best interest of the patients they served. It was meaningful! If we look at a timeline over many decades, it is quite amazing to see the evolution of any subject, including medicine. Barbara recalls many events from her career that have changed and improved over time, such as going from allowing smoking in the waiting rooms to being a smoke-free campus, and dark rooms where films were developed have been replaced with imaging rooms that pop up instantaneously. Time-saving streamlined processes, technology, and patient care have all seen vast improvements over the last fifty years, but each generation has developed its own landscape built on the previous notions from a past generation. Even the white uniforms of old have been replaced with scrubs. Decades of research and innovation have brought advancements spanning from medical imaging to pharmaceuticals and surgical procedures. The medical industry is an ever-changing market space. My mother would tell you it continues to impress her as she still carries out her calling in the profession she chose long ago. She now works with new orders that come with oncology improvements and marvels at the success rates of the patients who benefit from the never-ending medical revolution. Barbara Ledbetter has dedicated a life to service and continues to be deliberate in her care of others. This has carried over in value as it influences me and has changed the direction of my heart to love and serve others. As a child looking up to her mother and equipped with optimism, I was ready to take in all life could offer. I have been deeply influenced by my mother and have always looked up to her knowing God had called her to hold patientsâ&#x20AC;&#x2122; hands as they received a diagnostic report. She continues to do so even though the paper charting reports have since been replaced with computer-generated data that is so advanced it is accessible electronically. Medical professionals, clinical staff members, and technology companies around the world strive to improve the lives of patients everywhere. I feel blessed to have a mother who has used her love for her career to be a beacon of direction and hope for me, as well as all the people she has come into contact with throughout the years.

Ashleigh McKenzie is president of MDreferralPRO. MDreferralPRO.com

Inside Medicine | Late Summer Issue 2018

Screenings the

importance of

This is a tale of good news and bad news. The bad news: most women can quote the statistics, 1 in 8 women will develop breast cancer. Let us look a little closer at these statistics to find some good news. It is true that 1 in 8 women will develop breast cancer, but that is in the span of a lifetime. By age 20, the risk is 1 in 1,760, by age 30 it rises to 1 in 229, and by age 40 it goes up to 1 in 69. Though not zero risk, these are not statistics one should be overly concerned about. It does start to rise to 1 out of 42 at age 50, 1 out of 29 at age 60, and 1 out of 27 by age 70. The lifetime risk is 1 out of 8. Clearly, breast cancer risk rises with age. The significant rise begins between the ages of 40-50. More bad news: the main risk factor for developing breast cancer is one’s sex followed by one’s age. These are both things women have no control over. Other factors include early menarche, late menopause, and increasing times of unopposed estrogen from fewer children and then choosing not to nurse. These are factors in which today’s women still have little control over. There have been studies linking obesity, alcohol, tobacco, and lack of exercise to breast cancer. Though not statistically relevant, living a healthy lifestyle is always helpful. There is some good news that has been found over the last decade, 10% of breast cancer is genetic in origin. The BRC-1 and BRC-2 genes can be tested for and if present, can lead to lifestyle choices and further strategies to detect and treat. Breast cancer is the second most common cancer in women just behind skin cancer. Breast cancer accounts for 1 out of every 4 cancers detected in women. It is no longer a death sentence diagnosis. Cancer survival is statistically monitored by what is called 5 year survival by which one colloquially can call a ‘cure”. Depending on the staging of breast cancer, the difference in survival is primarily a factor of the size of the tumor. Ductal carcinoma-in-situ, kind of like a pre-cancer, has a 100% 5 year survival with proper surgical treatment. Remarkably a tumor up to 2 cm or

by Paul Fry, MD

a Stage 1 Cancer also has a 100% 5 year survival. A tumor up to 5 cm, about the size one would start to palpate a “lump”, the 5 year survival is near as high, 97%. Stage 3 Cancer, usually a tumor larger than 5 cm or with lymph node involvement, the 5 year survival is still good, 72%. Sadly, once metastatic, the 5 year survival falls to 22%. These statistics are indeed a tale of good and bad news. Compared to other cancers, the survival rate is much better. For instance, Lung Cancer 5 year survival is only 10-15%. Colon Cancer is at 40-50% but falls to only 5% if metastatic. Pancreatic Cancer has only a 5% 5 year survival. Clearly the earlier and ultimately smaller the tumor is detected, the better the survival. The key is early detection. The goal is to detect a tumor before it could be detected by self-exam or physician exam. Screening mammography is the main tool for this early detection. Screening mammography began to be implemented in the late 1980s to the 1990s. Since 1990 there has been a 38% decline in mortality from carcinoma. Though beyond the scope of this article there have been studies directly linking the decrease in mortality to the increasing utilization of screening mammography. Though one of the most common cancers, we are fortunate in that breast cancer is one of the slowest growing cancers. This has allowed us to implement a screening program with a frequency calculated to detect new cancers or changes in size of a cancer between screening tests. The average breast cancer “doubling rate”, the time to double the number of cancer cells, is 282 days, this is just under one year. This is the amount of time one should be able to see interval changes in breast densities or to first detect new lesions. Ideally, with yearly mammograms, a new or growing tumor would be detected in this interval. Mammography is a low dose X-Ray of the breasts. Mammograms are only performed at special facilities that meet both government regulatory and professional society accreditation. A radiologist who is specially

certified in mammography interprets these images. If there is a suspicious finding on the screening mammogram, this can happen up to 10% of the time, the patient returns for further imaging. This does not in and of itself mean one has breast cancer, this is important as it is a common misunderstanding not only of patients but of other medical personnel. It does mean that further imaging is needed. This may mean further compression or magnification views or the utilization of ultrasound and even MRI. The large majority of patients that return for further imaging are shown to not have suspicious abnormality. They are shown to be benign findings or simply artifacts usually from “overlapping” glandular tissues. If there is a finding on the mammogram that cannot be proven as benign, a biopsy may be needed. All mammograms are placed into a category called the BIRADS (Breast Imaging Recording and Data System). If BIRADS 4, “possibly” cancer, the chance of cancer is 30%; If BIRADS 5, “probably” cancer, the risk is 95%. Most suspicious findings are in the BIRADS 4 classification so a minimally invasive biopsy can be performed to detect cancer without resorting to more invasive surgical excision biopsies. If a cancer is indeed detected by mammography, it is usually early and therefore small enough to receive near complete cure rate treatment. The advancements in surgery, chemotherapy, hormonal therapy and breast reconstruction, have made it so even advanced breast tumors or even metastatic tumors have better 5 year survival rates than most other cancers. Clearly, this is good news when faced with the bad news of breast cancer in general. Many, if not most, women given a diagnosis of breast cancer can now expect to live. The American College of Radiology is tasked with certifying facilities and those radiologists that interpret screening mammograms. What follows is the latest Position Statement by The ACR concerning Screening Mammography: “The American College of Radiology recommends

annual screening mammography for women starting at age 40. This affords the maximum benefits of reduced breast cancer deaths, less extensive treatments for cancers that are found, decreased chance of advanced disease at diagnosis, and discovery and treatment of high risk lesions. Breast cancer incidence increases substantially around age 40 and even earlier for high risk women and women of color. All health insurers, including the Centers for Medicare and Medicaid Services, should cover women ages 40 and older for annual mammograms as a preventative service, without additional cost sharing or co-payments. Extensive scientific research shows a 40 % reduction of breast cancer deaths with regular screening mammography screening. The greatest mortality reduction, the most lives saved and the most life years gained occur with yearly mammograms starting at age 40. There is no established age for women to stop screening as long as they are healthy and desire to remain so. Therefore, health care coverage for screening should not have an upper limit.” The Good news of mammography is indeed remarkable. The bad news is in the State of Alabama, the utilization of mammography is still not ideal. From age 40-49 only 63% of women have had a mammogram. From age 50-64, only 72% of women have had a mammogram over the last two years. This falls to only 64% after 65. If you have not had a mammogram, please do. If you know someone who has not had a mammogram, please encourage them. Let us turn bad news into good news.

Paul J Fry, MD is Board Certified in Diagnostic Radiology and is a full partner with Radiology of Huntsville. He presently serves as Medical Director of the Department of Radiology at Athens-Limestone Hospital.

NAVIGATING THE

World of Dieting By Tara Vardaman, MS, RDN, LD

As many of you know, trying to diet comes with a lot of confusion and frustration. But it doesn’t have to be that way. Many diets that are heavily promoted today are what dietitians consider “fad diets”. They offer quick results with dietary changes that are almost impossible to maintain long term. These fad diets also often lead to the yoyo effect – weight loss and gain that continues to repeat without any last effect of continuous weight loss. The key to dieting is to actually not “diet” at all. Achieving great health comes down to simply making dietary and lifestyle modifications that you can sustain for life. Consuming a diet that is full of fruits, vegetables, and unrefined grains, as well as lean proteins in moderation will provide your body a large variety of vitamins and minerals that are needed for the body to function properly. Additionally, consuming a highly plant-based diet helps to reduce the risk of developing chronic health conditions, and can even help with the treatment of many health conditions (heart diseases, high blood pressure, diabetes, high cholesterol, etc.). Now I’m sure as you read the words “plant-based diet” I lost some of your attention. The truth is, you do not have to become vegetarian or vegan, but consuming a diet that has a strong foundation of whole, plant-based foods is likely to drastically reduce the intake of refined sugar, total cholesterol, saturated fats, and sodium, all of which have been linked in some way to increasing the risk of developing the health conditions outlined above. In addition to diet modification, lifestyle modification is the other major component to achieving great health. This includes everything from physical activity to where and how you eat your food. Lifestyle modification can be broken down into three categories. The first lifestyle modification category is physical activity. It is recommended to engage in a minimum of 30 minutes of moderateactivity (brisk walking, biking, sports, etc.) 5 days a week, while also participating in resistance exercises (Pilates, weights, yoga, boxing, etc.) at least 2 days a week.

The best way to achieve physical activity modification is to set SMART (Specific, Measurable, Attainable, Relevant, and Time-based) goals or yourself and gradually increase your activity level each time you reach your goal. The second lifestyle modification category is mindful eating. Mindful eating essentially means that you are putting primary focus on your plate while eating. This involves ensuring that you are in a minimally distracting environment while eating. This includes avoiding visual distractions such as screens (TVs, phones, tablets, computers), books, and even eating while driving. Additionally mindful eating also focuses on staying in tune with your body and its hunger level throughout the eating process. Ideally, you want to start eating when you start to become hungry (not when we are starving) and stop eating as soon as your hunger has resolved. The idea behind mindful eating is that it will help prevent over eating. The third lifestyle modification category is eating habits. Eating habits play a huge role in how much we eat at meals. Due to the fast-pace culture that we live in, many of us tend to eat fairly quickly. The reality is, eating quickly often results in overeating due to the delayed signaling from the stomach to the brain to let us know that we are full. To help slow down the eating process, follow three simple steps: Take small bites, chew foods thoroughly, and set down utensils between each bite. As you can see, achieving great health takes work but it doesn’t have to be overly complicated. Consuming a diet that is focused on whole-foods, engaging in physical activity regularly, ensuring that you practice mindful eating, and modifying your eating habits will help you achieve the health you want and deserve. It is also important to remember that results are not going to appear overnight. It takes time, sometimes a lot of time. Be willing to find gratitude in the smallest achievements, as those small achievements are what lead you to your greatest success.

“LET FOOD BE

THY MEDICINE

AND MEDICINE BE THY FOOD”

– HIPPOCRATES

Topical calcineurin inhibitors and newer phosphodiesterase 4 inhibitor creams are the other topical medications that can help reduce inflammation.

Role of Allergy testing and food restriction:

Often the general misconception is AD is caused by some allergy to foods or allergens in the environment. While it could be true that some of the allergens can irritate the skin and cause flare ups of AD, they are not responsible for causing it in the first place. Therefore, allergy testing and dietary restriction is not routinely needed in all atopic dermatitis patients.

Anti-microbial therapy & Bleach baths:

Routine antibiotic therapy is not warranted in all AD patients. As presence of infection can cause flare ups of AD, treatment with topical or systemic antibiotics may be appropriate, if there are any signs of infection. However, rather than treating once an infection occurs, it appears that the key in AD is to decrease nasal staphylococcal carriage pre-emptively and to keep the skin decolonized from Staphylococcus. From this aspect, bleach bathes have rapidly become a mainstay in AD patients. Physician, if thinks bleach baths are appropriate for any patient, will discuss with parents as to how they need to be carried out.

Prognosis

AD often becomes milder with age. About 50% of the children who get AD may have it as an adult. Some of the risk factors for disease to progress to adult stage include the degree of severity of AD, its persistence into adolescence, presence of other atopic diseases such as asthma and hay fever, a family history of AD in parents or siblings and early age of onset.

Reference: 1. Textbook of Neonatal dermatology Lawrence Eichenfield, Ilona Frieden, Nancy Esterly 2. Textbook of Pediatric Dermatology Edited by Lawrence Schachner, Ronald Hansen 3. Harper’s Textbook of Pediatric Dermatology edited by Alan Irvine, Peter Hoeger, Albert Yan 4. Textbook of Andrew’s disease of the skin 5. aad.org 6. https://nationaleczema.org/eczema/types-of-eczema/atopic-dermatitis/ 7. Rook’s textbook of dermatology

TAILGATING

with a healthy diet

by Carmen Moyers RD, LD

Welcome Fall!

Everyone is hitting the ballpark, hanging out with friends, watching football, gearing up for the holidays, all while trying to keep a healthy diet. Snacks are part of a healthy eating pattern but it’s easy to fall prey to good marketing and healthy sounding foods. For any meal or snack, reading the ingredient label will help you decide if it is a healthy snack. Snacks with fiber, health fats, and proteins can help you stay full between meals or be a healthy appetizer to curb hunger before a tempting autumn get together or buffet. Fiber is found in whole grains, fruits, and vegetables. Focus on whole grains by making sure the first ingredient is whole wheat, not enriched flour. Whole grain carbohydrates will leave you feeling full. Reducing unnecessary sugars will keep you away from a quick pick me up follow by a crash, leaving you hungrier than before. Look for ingredients including sugar, sucrose, glucose, dextrose, high fructose corn syrup, syrup, honey, and nectar. While there are others, these are the most common. It’s okay to have a little added sugar, just shy away from those with sugar in the first few ingredients or multiple forms of sugar. Don’t fear fats. But, remember, not all fats are created equal. Reach for foods with unsaturated fats like nuts, avocados, and oils. Nuts and nut butters can be easy to pack and quick to eat while providing protein, vitamins, minerals, and healthy fats. Salt comes along with many snacks and shelf stable foods. While tailgating, hanging outside and playing means sweating, most people get plenty of sodium and don’t need to add salt to their snacks. Try and find low sodium versions of your favorite options like unsalted nuts and limit high sodium foods like beef jerky.

HERE ARE A FEW IDEAS ON CHOOSING ON-THE-GO FALL SNACKS. • Yogurt high in protein and probiotics are a bonus, just be cautious on sugar content • Trail Mix aim for whole grains and unsalted nuts. • Granola read your labels carefully. Most granola products have a great deal of added sugar. • Fruit choose whole fruit, not snacks or juice as you miss out on many vitamins, minerals, and fiber. • Vegetable dip Dipping veggies can be a great way to make them fun. Hummus is high in healthy fats and includes fiber and protein. Tzatziki dip is a greek yogurt dip with a lot of flavor added with some spices. Bean dip is a great way to enjoy veggies, especially peppers, for a high fiber high protein snack.

Helping kids avoid

ChildhoodObesity by Traci McCormick, MD

As the mom of five kids, this is a subject very close to my heart and close to the hearts of millions of others. One out of five children is obese and many more are overweight. We are seeing diabetes, high blood pressure, and the start of heart disease at younger ages than ever before. This generation of children is expected to be the first generation ever to have a shorter life expectancy than their parents. It doesn’t have to stay this way. There are things we can do to reverse this health crisis. Let’s start with how we can shape young children’s tastes so they will naturally choose to eat healthier foods.

Breastfeed as Often and For as Long as Possible Let me first say—fed is best! I never want to see a new mom struggling to feed her baby and feeling like a failure if she needs to formula feed. I was one of those moms. Five kids and I could never get the hang of breastfeeding. Despite multiple consults with lactation specialists, breastfeeding was always extremely painful for me. But I gave it a go, pumped for as long as I could, then eventually had to switch to for-mula. With that said, breastmilk is the absolute best nutrition you can give your baby. The longer and more exclusively you breastfeed your children, the greater the health benefits. Serve Fresh or Frozen Baby and Toddler Food When toddlers eat fresh food, they learn what real food tastes like. hey learn to enjoy the flavor and texture of real food, and they are more likely to reject salty, sugar-sweetened junk foods. Babies do have an inherent sweet-tooth that should be satisfied with real fruits, like bananas. Graze on Grow Foods Children should be taught to graze on small portions of real food, eat-ing 6 small meals through the day. By doing this, they learn what it feels like to eat “enough” without overfilling their stomachs. Did you know that your child’s stomach is about the size of their fists? Portions don’t need to be any larger than this. Avoid the Terrible Threes There are three artificial additives you should always avoid serving your children. They are high fructose corn syrup, hydrogenated oils or trans fats, and any color additive with a number symbol attached to it (e.g. blue #1, red #40, etc.). Serve Nutrient-Dense Foods Your child’s diet should consist of lots of “grow foods”. These are fresh foods or packaged foods that have undergone minimal amounts of

processing. Young children that are served nutrient-dense foods from an early age learn to prefer these foods.

Model Healthy Eating Habits Studies show that children tend to develop food preferences and eating habits similar to their mothers. Shape, Don’t Control Studies show that rigidly restricting children’s access to certain foods focuses more attention on these foods and increases children’s desire to eat them. Rather than restricting what your older children eat, you should provide your child with opportunities to make wise choices, and direct and redirect behavior in ways that help your child learn to be in charge of himself. Surround Your Child with Nutritious Foods Make healthy food readily accessible to your children. Keep a bowl of fresh fruit on the counter or place a plate of fresh veggies out as snack food. Expose Your Child to a Variety of New Foods It is normal for children to be averse to new foods, but you can help them accept new tastes by starting to introduce new foods early. And if your child won’t eat something the first time, don’t give up! Studies have shown that most children will accept new foods after repeated exposure—usually between 10 and 20 times. Enjoy Happy Meals Make mealtime a special time for family. Create a friendly, pleasurable atmosphere around the table. This will help your child establish healthy feelings about mealtimes. Advice for Parents with Older Kids What about those of you that feel like you’ve missed the boat? Your children already eat poorly and won’t touch a vegetable to save their life. What are you to do? First of all, remember that you are the parent and you get to make the decisions about what food is allowed in your house. Second, know that your children will grumble and complain and probably eat less during the transition to healthier food—but they will come around. Third, be proud that you are shap-ing their future eating habits and helping them prevent heart dis-ease, diabetes, high blood pressure, cancer, and a whole host of other chronic diseases.

Do You Have a Hidden Gluten Sensitivity? The Trouble with Gluten by Traci McCormick, MD

Are you tired? Moody? Irritable? Maybe you’re a little depressed or anxious? Maybe you have joint pain? Chronic headaches? A little bloating or tummy trouble? Trouble sleeping? Perhaps you’re having trouble losing weight? Or maybe you can’t seem to gain weight no matter how much you try? Thinning hair? Bumps on the back of your arms? Acne? Hormonal issues? Trouble getting pregnant? Multiple miscarriages? Thyroid problems? Chronic headaches? Migraines? Are you saying yes, yes, yes to any of these? If so, you could be suffering from a gluten-related disorder. Gluten—the tiny little protein that is part of wheat, barley, and rye can really cause all of this damage to your body. It seems impossible, but it is true! For people who are sensitive to gluten, the ingestion of gluten-containing foods sets off an immune response in the body that can affect everything from the gut to the brain. You could be living with a gluten sensitivity and have no idea anything is wrong. It happens all the time and definitely happened to me. I had symptoms that I thought were normal for all human beings—until I went gluten-free and discovered that what I was experiencing wasn’t normal at all. It compares to knowing people who have had diarrhea their entire life and had no idea that it was abnormal because it’s the only thing they ever knew. It is also much like someone who gets glasses and sees the world as it is supposed to be seen for the first time in their life. They never knew how much they couldn’t see until they could. If you think you may have a sensitivity to gluten, visit my blog and identify some concerns. www.tracimccormickmd.com

Jennifer’s Story My friend Jennifer had “tummy trouble” for years. She had a sensitive stomach and was prone to alternating bouts of diarrhea and constipation. She often had

stomach cramps and bloating, but nothing she thought was abnormal. She casually mentioned her issues to her doctor. He told her it was all perfectly normal and she might have a touch of IBS (irritable bowel syndrome). He said there was nothing to be done about it—she just had a sensitive stomach. A few years later, Jennifer read an article about how to lose weight by eliminating grain from her diet. To her surprise, not only did she lose 20 pounds, but all of her “normal” tummy troubles disappeared.

Steve’s Story Steve had been low on energy for quite some time. His doctor diagnosed him with iron deficiency anemia. He was also going in once a month for Vitamin B12 injections because his levels were abnormally low. When Steve asked why he would have low iron and low B12, his doctor just shook his head and said: “it just happens sometimes”. A few months later, Steve’s wife put them on a gluten-free diet because she had heard it was healthy from some of her friends. Steve immediately began to have more energy and within just a few months, Steve’s anemia resolved and he no longer had to take iron or B12.

Samantha’s Story Samantha had chronic headaches that kept her from feeling her best. Sometimes they were full-blown migraines, but most days the headaches were just bad enough that she wasn’t fully present. I bet by now you can guess what happened. Yes, she went on a gluten-free diet and the headaches went away. There are dozens of stories like these!! People who have had life-changing results from going gluten-free. I know multiple women who were having trouble getting pregnant until they went on a gluten-free diet. I know several people with children that had eczema that disappeared after going gluten-free. Just yesterday, someone was telling me that they went gluten-free a few weeks ago. They already feel like a fog has been lifted and they feel much more energetic.

An Important Message

Neurological and Mental Health Symptoms

I am determined to spread the message that, for a large group of people, gluten can have a serious impact on health, happiness, and quality of life. I’m passionate about this because I know there are people out there that are suffering needlessly, much like I was before my diagnosis. There are mothers that are too tired to interact with their kids or ache so much they can’t get down on the floor to play. There are people who are in the depths of depression who might be helped by changing the way they eat. There are relationships that are deteriorating because of the irritability and moodiness that gluten can cause. There are children that are not growing and developing to their full potential because gluten is stealing their nutrients away. Now, I’m not claiming that going gluten-free is the answer for everyone. But I am certain that it is the answer for a lot of people. I’m definitely not the only one that knows this to be true. The leading experts estimate that 97% of Americans suffering from a gluten-related disorder have no idea they have it. There are over 350 symptoms and signs of gluten sensitivity. Some of the most common are listed below.

Neurological symptoms can include chronic headaches, migraines, seizures, ataxia, peripheral neuropathy, and autistic-like behavior. Poor memory and brain fog are very, very, common. I’ve seen this improve dramatically when people are placed on a gluten-free diet. Other mental health symptoms include depression, anxiety, moodiness, irritability, anger, and ADHD.

Gastrointestinal symptoms I want you to know that people with celiac disease or non-celiac gluten sensitivity do not always have gastrointestinal symptoms. In reality, only 35% of people have diarrhea at the time of diagnosis despite the fact that most people (even doctors) believe that diarrhea must be present if you have a gluten-related disorder. I delayed my own diagnosis for at least a year because I was taught in medical school that the only gluten-related disorder was celiac disease and that celiac disease always shows up with gastrointestinal symptoms. This is simply not true. Gastrointestinal problems include diarrhea, constipation, bloating, gas, abdominal pain, steatorrhea (pale, foul-smelling stool that floats and is hard to flush), vomiting, reflux or heartburn, lactose intolerance, irritable bowel syndrome, or inflammatory bowel disease.

Nutritional Deficiencies The damage gluten causes in the gut can also cause nutritional deficiencies. We can see decreased absorption of iron and folate, which often shows as anemia. We can also see deficiencies of calcium, vitamin B12, and the fat-soluble vitamins—A, D, E, and K.

Inside Medicine | summer 2017

Hormonal Issues Gluten-related disorders are known to cause hormone imbalances that can lead to premenstrual syndrome, premenstrual dysphoric disorder, infertility, hot flashes, menstrual irregularities, delayed puberty, and even miscarriages.

Autoimmune Conditions Almost all autoimmune conditions are made worse by gluten. There are many documented cases of people who were able to cure themselves of their own autoimmune conditions by following a gluten-free diet. These disorders include Hashimoto’s thyroiditis, Graves’ disease, lupus, rheumatoid arthritis, endometriosis, juvenile diabetes, multiple sclerosis, psoriasis, eosinophilic esophagitis, and 150 other autoimmune conditions.

Musculoskeletal Pain Gluten can cause or worsen fibromyalgia, arthritis, joint pain, bone pain, and muscle tenderness. Joint pain is one of the most common of all the gluten-related symptoms.

Skin and Teeth Recurrent canker sores, mouth ulcers, thinning of the hair, bone loss, eczema, psoriasis, acne, hair loss, keratosis pilaris (tiny bumps on the back of the arms), skin rashes, discolored teeth, and enamel loss can all be symptoms of a gluten-related disorder.

Growth and Weight Weight gain, weight loss, muscle wasting, short stature, developmental delay, and poor growth are all commonly seen with celiac disease or gluten sensitivity.

Energy Celiac disease and gluten-sensitivity can commonly cause chronic fatigue, hypothyroidism, and exhaustion. The road to getting diagnosed with celiac disease or non-celiac gluten sensitivity can be a long and complicated one. There are resources available to help!

PTSD

It was a normal night and I was sound asleep. Out of nowhere, I was awakened with shortness of breath, chest pains, arm pain, and nausea. I definitely thought I was having a heart attack. I immediately knew I needed to get myself to the hospital. Knowing I shouldn’t drive myself, I was thankful my sister was in town to take me. We needed to get there fast….I was just sleeping soundly…I am glad she’s here to help. All of these thoughts were racing through my head as I battled to keep calm and make rational decisions. This was the first night I ever experienced an episode of this nature. I was told it was a panic attack. Panic? While I’m sleeping? You must be kidding! This was no joke. I was, in fact, having a panic attack. Why? I had no idea. The emergency room doctor advised me to follow up with my family doctor and gave me some medicine to help keep me calm. In the summer of 2012, that’s exactly what happened.

I remember what triggered the panic attack. A teenager had taken his life. I was the “on call” detective. I made a call to a friend of mine, who worked in the medical field, and learned his son had taken his life in a similar fashion. I never knew and I was crippled by this news. I felt terrible for having reminded a by Christie Gover dear friend of mine of a terrible event. Those events weighed on my subconscious more than I was aware. After my ER visit, I stopped eating. I was nauseous for weeks and therefore I lived off of diet soda and crackers.

job duties result in traumatic effect on the physical psyche

In most cases, weight loss is great for self-esteem and a goal for most. But it was happening to me, out of my control, and a bad diet such as this can be detrimental to our bodies, both mentally and physically. It wasn’t until I saw my orthopedic surgeon that I realized something was wrong. During a routine visit, my doctor had a concerned look on his face. He said, “Are you okay? Because you look sick. Very sick. You are skin and bones.” I told him what had happened and again, I was urged me to see my family doctor.

PTSD? That isn’t possible! I’m not a war veteran! There has to be something else. Apparently, the six years I served as a crime scene detective did little good for my mind. Recurring images of death haunted me day and night. I had no outlet for the negative input. I kept telling myself I was tough and could handle it. I’m a police officer. If I tell anyone at work I’m having a problem, they’re going to commit me! I had no one I could trust to tell at work and I convinced myself that I didn’t need help. I could not have been more wrong. I finally sought treatment from local psychiatrists. I ended my treatment with a rather interesting session involving hypnotherapy. I was no longer haunted by a troublesome case, but I was so “freaked out” by the session that I did not return. It wasn’t the doctor performing the therapy, it was my choice and personal discomfort level of the whole experience that prevented my return. Medication after medication was doled out as a cure all. Most things I tried had the opposite effect. It wasn’t until 2017 that I realized I needed to treat the problems plaguing me. It is difficult to find fault in ourselves; moreover, it’s most difficult to seek help for those faults. Since I had a traumatic brain injury in 1996 as a result of a car accident, I elected to undergo neuropsychological evaluations. My doctor and his staff were amazing. I am happy to say that I have no significant neurological deficits! However, I do have lingering issues that need to be addressed in order for me to continue on my path towards recovery. During my testing the symptoms of PTSD reared their ugly head resulting in the grand appearance of anxiety and depression.

My doctor recommended I see a specialist for treatment. He said he would be the one who could both help me and interpret my test results. I have since visited him multiple times and he is allowing me to take things at my own pace. I’m eager to see progress. I don’t expect to be healed overnight, nor am I excited about having to take any medication. But, I will work with my physicians and help them find the best course of treatment for me. I am no longer embarrassed by my diagnosis. It is relatively impossible to battle this alone. The problem has been identified and now we will work towards a solution. If you, or someone you know, is battling mental illness, please seek help. It is not a “quick fix”. From recognizing and admitting that something is not right, to seeking help and getting a proper course of treatment, expect a long journey. You have to identify what is broken in order to fix it. That is the first step to healing. I waited and suffered long enough, but it is better than not getting help at all. I look forward to everything that life holds for me, and I will take one day at a time. I appreciate all of the help I have been given. I am truly thankful there is a wealth of knowledge and information out there and medical professionals are learning more about these mental conditions every day.

E CR RI IME S M E S CENE CE CR NE IM ES CR CEN IM E ES CR IM CE ES N

I delayed the appointment long enough, but when I finally saw my family physician, he looked at me and said some words I was not prepared to hear: “You have post-traumatic stress disorder.”

Christie Gover is a law enforcement officer with 18 years of experience with Madison Police Department. She has served as a patrol officer and crime scene investigator. She is currently assigned to the Investigations Division, where she specializes in crimes against children. As part of her duties, she has held the certification of Rape Aggression Defense Systems, Inc., instructor since 2001. She is a decorated officer and an advocate for the safety and wellness of children.

S E M

I CR

N CE

I CR

S E M

DREAM BIG Chapter 1:

Dream-walking, the start

by Nemil Shah, M.D.

Steve Jobs once said, “The people who are crazy enough to think they can change the world are the ones who do.” Everything we see in the world around us has been created by people who believed it possible. The majority is comprised of naysayers. The thinkers, the dreamers, and the DO-ers represent such as small fraction of all of us. Most people wait until their head rests comfortably on their pillow tops to dream big. We all have dreams or thoughts to make life a little bit easier, a little bit better. I’m not any different. One of my mother’s fondest memories of my childhood is asking her “Mom, everything already exists, what is left for me to invent?” Nearly three decades later I still hear her proudly retelling the story at community dinner parties, “there is a lot in this world that is left to invent and you still have a lot of time to think about those things, Nemil.” It seems even as a child, I dreamed to discover and make things just a little easier. The nurturing and influence of my parents and my older sister led to a successful graduation from UAB’s prestigious medical program. However, like many of us, I still found myself dreaming to reach my potential as a human-being. And things aren’t always so easy having a vivid imagination. At times, I find

my mind obsessing trying to find simple solutions to seemingly difficult problems. My soul gravitates towards bringing those simple solutions to the world to experience like a proud star chef at their restaurants. This self-awareness brought me to the conclusion that I would never be happy with the status quo. Thus, began action from years of inaction. During my first year of medical school at UAB, I became a patient after being diagnosed with a major health issue. I experienced high wait times to both make and get appointments, long wait times in the healthcare facility lobbies after getting an appointment, and still more waiting alone in the clinical exam room. I hated going to the doctor then -- and I hate going to the doctor now. Yes. It’s true. Even doctors need doctors. The inefficient, frustrating healthcare access barrier, is why many patients, like myself, alienate patients from their doctor. The poor customer experience for a simple health check-up is one major reason why many patients suffer from conditions that can be easily managed. The system is broken for physicians as well. As a physician, we are emotionally tied to the wellness of our patients, and on most nights, we think about the patients we care for. We want our patients to be

able to access us when they are vulnerable to sickness or need comfort. However, the treacherous road through the healthcare system needs a better solution for us, all of us: the patients and those of us who provide their care. It was not until my last year of internal medicine training when I lost my best friend to suicide that something changed. I didn’t know it at the time but his passing would have a profound impact on the trajectory of my life. There are so many questions that one asks in the untimely demise of a loved one. Could earlier inter-vention to depression and easier access to healthcare have saved him? After his passing, the thought occurred to me, life is short. It is way too short to wait on the world to change. In the very recent past, you would have met a very different version of who I am today. Someone with the tendency to take the path with the least amount of resistance and friction. Thus, I embarked on the journey of bridging the healthcare access gap through ApproXie, a digital healthcare start-up. Although, tough and lonely, at times, I fear having a rocking chair moment with regret. I dream that my thoughts on a rocking chair will feel similar to Andy Dufrense’s blissful “sud’s on the rooftop” from Shawshank. I’m not sure where this journey will end but I do know that the first and most import-ant step of the journey was the decision to start. With faith and courage, you too, can free your mind to dream big.

KIDNEY

STONE by Kelly Reese

The pain from a kidney stone can take you to your knees. Besides tooth pain, it is said “the pressure from a kidney stone is the closest thing to the pain of child birth.” Many times, it comes on with no symptoms to prepare you. Some people are just unlucky and seem to be susceptible to developing kidney stones. Often times, it may be from various other factors. Specialists have concluded the primary factors that cause kidney stones include dehydration, excessive caffeine, loss of fluids, intake of dark liquids, diets rich in salt and protein, and inherited conditions. What we put into our body is as important as what the kidneys remove. We rely on our kidneys to take away waste products from our bodies. It is a strenuous and important filtering job performed by our kidneys. Besides staying away from the obvious, drinking clear liquids, such as water, can help contribute to healthy kidney function. If there aren’t enough clear fluids flowing through our system to help break down chemicals and minerals that we ingest, kidney stones can develop. Good kidney function is also needed to allow our body to fight the infection and bacteria we come in contact with. Again, it is through the failing attempts of the kidneys to work appropriately that lead to kidney stones. Obstruction of the kidneys occurs when a stone has developed and becomes lodged within the ureter. This blocks urine flow to the bladder. When our kidneys

don’t work correctly, we feel it! Symptoms seem to be most present in a patient’s lower back. The bacterial infection caused by the blockage may also show up in the form of a fever. Another symptom, hematuria, is the presence of blood in the urine. Once symptoms occur, a diagnosis is needed. Kidney stones can often be detected by a simple X-ray of the abdomen. A urine sample is usually used to determine if there is an infection, but follow up blood work can give an analysis of kidney function. Present symptoms that are non-conclusive may indicate a concern for further evaluation, such as an intravenous pyelogram (IVP). If the kidney has blockage due to a stone, the dye will not be able to pass, causing the kidney to appear large. Finally, a CT scan may be performed to detect urinary stones with more sensitive imaging. This information will help the urologist indicate the best form of treatment. There are several procedures available that do not require a traditional open surgery. Treatment options are usually based on size, location and number of stones involved. Shock Wave Lithotripsy (SWL) is a non-invasive treatment where an energy source generates a shock wave directly at the stone within the kidney or ureter. This treatment acts in dissipating the stones into small fragments. Some stones (cystine, calcium oxalate monohydrate) could remain resistant to SWL, requiring another treatment. Larger stones (generally greater than 2.5 centimeters) are also known to break into pieces that can still block the kidney. The stones located in the lower portion of the kidney will also have a decreased chance of passage. Another treatment option is Ureteroscopy (URS). This procedure involves the use of a very

small, fiber-optic instrument called a ureteroscope. This allows the urologist the capability to access to the ureter or kidney stones visually through the ureter via the bladder. Once located visually, a small basket-like device will grasp the stone for removal. In the event a stone is too large to remove, a spark-generating laser probe or air-driven (pneumatic) probe can pass through by way of the ureteroscope and the stone can be fragmented. The final treatment option is percutaneous nephrolithotomy (PNL). PNL is the treatment of choice for large stones located within the kidney, not suggestive for SWL or URS. The main advantage of this approach is that only a small incision (about one centimeter) is required in the flank. The urologist will place a guide wire through the incision. Under fluoroscopic guidance, the wire is placed within the kidney and directed down the ureter. A nephroscope is then passed into the kidney to visualize the stone. Fragmentation is done using an ultrasonic probe or a laser. Because the tract allows passage of larger instruments, suction or grasp of stone fragments can be removed. This procedure results in a higher clearance of stone fragments than that of a SWL or URS procedure. It is encouraging to know the pain of a kidney stone can be treated. With medical technology, these non invasive treatments are highly suggested. If you or a loved one suffers from kidney stones, it is encouraged that you seek a urologist or nephrologist for the appropriate treatment for your condition.

GallBladder by Ray Sheppard, Jr., MD

Do you know anyone who has undergone gallbladder surgery? Chances are you do! There are an estimated 750,000 gallbladder surgeries per year in the United States. Gallbladder problems are a very common reason to visit a family doctor or GI doctor (gastroenterologist). Usually people are experiencing episodes of abdominal pain or nausea and are looking for answers to why they feel bad. Here are some frequently asked questions about gallbladder disease.

What is a gallbladder? The gallbladder is an egg-sized hollow organ that stores bile which is produced in the liver. In fact the gallbladder is partially attached to the liver and joins the duct system that exits the liver. Where in your body is the gallbladder located? The gallbladder is located in the right side of the upper abdomen. Can it ever be located somewhere else? Yes. A condition named situs inversus is present in 1/100,000 people. In these situations the personâ&#x20AC;&#x2122;s organs are located on the opposite side of normal. I have encountered this twice during my career. What does the gallbladder do? The purpose of the gallbladder is to store bile and then eject the bile into the intestine when you eat. Why is bile important? Bile acts as a detergent to break fatty foods into smaller particles which are more easily digested. Does the gallbladder make bile? No. The gallbladder only stores the bile. The bile is actually produced in the liver. A duct system exits the liver and a small channel between the gallbladder and this duct system allows the passage of bile into and out of the gallbladder. How does the gallbladder know to send bile into the intestine? Sensors in the lining of the stomach are activated by fat molecules that you eat. Those sensors release a chemical into your blood stream call CCK (cholecystokinin). The CCK travels to the gallbladder and tells it to push the bile into the duct system that ends in the intestine.

What are gallstones? Sometimes a crystal forms within the stored bile of the gallbladder and slowly a stone grows. This is similar to a pearl forming within an oyster. Stones can figure grow 2quite large or they may remain small like sand particles. How do gallstones affect you? At times, these stones or particles can obstruct the outlet of the gallbladder. If an obstruction is present while the gallbladder contracts to eject bile, a person will generally feel a sharp attack of pain and possibly nausea and vomiting. Some people only sense nausea but no pain. These attacks are generally after eating. Where is the pain located? The location of the pain varies from patient to patient. Most frequently the pain is in the middle of the upper abdomen (the epigastrium). Others experience pain in the right side of the abdomen. Some will relate pain from both locations. Often this pain radiates to the back or shoulder blade. Rarely the pain is in the right side of the lower abdomen or left side of the upper abdomen. How long does the pain last? Fortunately, most gallbladder attacks will fade away with a few minutes to hours. Some attacks are minor and others create severe pain. Once a person has developed a gallbladder attack, they will probably have additional attacks in the future. Can more serious problems occur? Sometimes a gallbladder becomes completely obstructed to the point that infection is produced. This requires immediate attention. In rare cases a gallbladder may actually rupture. How do you know if you have gallstones? The best test to look for gallstones is an ultrasound of the abdomen. This will not detect all gallstones, however ultrasound is about 95% accurate. A CT scan is not as good at finding gallstones as an ultrasound, but it is sometimes helpful. What if I have gallbladder symptoms but I do not have gallstones? The bile within the gallbladder can become thick like motor oil. When this happens, it can be difficult for the gallbladder to eject the fluid through its outlet. Imagine trying to suck thick syrup through a straw? The gallbladder will send your brain the same signals as if it were obstructed.

How do you know if your gallbladder is having trouble ejecting the bile? A gallbladder test called the HIDA scan can measure the ability of the gallbladder to eject the bile. A special tracer is placed through an IV that accumulates in the bile. The messenger chemical, CCK, is then injected through your IV to stimulate gallbladder contractions. The scanner will watch the gallbladder and calculate how well it ejects the bile (ejection fraction). Normally, the ejection fraction is 70-90%. When the ejection fraction approaches 35%, it is likely that symptoms are due to a dysfunctional gallbladder. This condition is also known as biliary dyskinesia.

What is the treatment for biliary dyskinesia? The only treatment is gallbladder removal (cholecystectomy). Biliary dyskinesia is not life-threatening, so a person can decide that their symptoms are not severe enough to warrant surgery. Very few people are willing to volunteer to be subjects of gallbladder surgery research, so scientific data is limited and conclusions of studies vary. We do know that greater than 90% of patients will feel better after gallbladder removal. We know that many patients will experience miserable episodes until their gallbladder is removed. We also know that some patients may experience many years of normal life in between attacks. Overall, it depends upon how bad a person feels. What if my HIDA scan is normal but I experience gallbladder symptoms? If CCK administration recreated your gallbladder symptoms, then gallbladder removal will be beneficial in 90% of cases. If CCK did not recreate your symptoms, then we need to look for other causes of pain such as ulcers, Crohnâ&#x20AC;&#x2122;s disease, ulcerative colitis, irritable bowel syndrome, or more rare disorders. In some situations, no cause for the symptoms can be identified and gallbladder removal has been helpful for these patients.

Can gallstones pass through the channel out of the gallbladder? Yes. This is a less common but more serious problem. After gallstones leave the gallbladder, they may obstruct the ducts between the liver and the intestine. This can produce a severe life-threatening infection called ascending cholangitis. I have heard that gallstones can cause pancreatitis. This is true. The duct of the pancreas joins the duct that passes from the liver to the intestine. When a gallstone travels through the bile duct, it may temporarily obstruct the pancreas duct and lead to inflammation of the pancreas. How are gallstones treated? Since there is no easy way to get of rid of the gallstones, surgery to remove the gallbladder (cholecystectomy) is the treatment of choice. A medicine to dissolve gallstones exists, but it does not work very well and is reserved for patients that can not safely undergo gallbladder surgery. Can sound waves be used to destroy gallstones? This is a useful technique for some kidney stones, but it is more complicated for gallstones. First, as the gallstones are fragmented they are likely to leave the gallbladder and clump together in the bile duct that passes between the liver and the intestine. This obstruction can, in turn, create life-threatening complications of liver infection or pancreatitis. When kidney stones are fragmented, a stent is placed in the urine passageways to prevent obstruction. Stenting of the major bile duct is much more difficult and carries its own risks. In addition, a person who forms gallstones is likely to form more in the future. That patient would have to face this same problem once again. Have you ever known a person that has suffered from multiple kidney stone attacks? I know someone who had a drain placed in their gallbladder. This can useful if someone has developed a gallbladder infection and is so severely ill that surgery is not safe. After numbing the abdominal wall, a drain is placed through the skin into the gallbladder with X-ray or ultrasound guiding the doctor. This is called a cholecystostomy tube. The drain will need to stay in place for 6 weeks and then surgery can be performed when it is safer. What happens if a gallstone is lodged in the bile duct between the liver and the intestine? Usually these stones can be retrieved through tiny instruments that are passed through a special scope which is placed through the mouth, down the esophagus and stomach, into the intestine. This is called endoscopic retrograde cholangiopancreatography or ERCP for short. In rare circumstances ERCP is not possible and the bile duct must be approached through a surgical procedure.

Ray Sheppard, MD - General Surgery raysheppardsurgery.com

IS MY HERNIA

Dangerous? by Ray Sheppard, Jr., MD

There are two short answers to that question. The first is: “Maybe”. The second is: “It is complex and needs to be answered in consultation with a hernia surgeon”.

Now for a longer answer. It depends on what type of hernia as well as other factors. In fact, hernia surgery has become a science all of its own. Even the definition of a hernia can be confusing. It actually means something slightly different depending on the region of the body that one is discussing. For this particular discussion, we will only concern ourselves with hernias of the abdominal cavity. Even at that, our discussion can only be very limited (see the second short answer above). The most common hernias that arise are hiatal hernias, umbilical hernias, inguinal hernias, incisional hernias, and ventral hernias. Hiatal Hernia - These are quite common and occur in more than one variety. The most frequently encountered is known as the sliding hiatal hernia, and it is rarely more than an annoyance. The less common paraesophageal hiatal hernia is actually a cause for concern. In this type of hiatal hernia, all or part of the stomach =passes through a defect in the muscular diaphragm which separates the abdominal cavity from the chest or thoracic cavity. The stomach can become twisted upon itself and subsequently rupture or develop gangrene. This is a lifethreatening condition. Symptoms include chest pain and can mimic the pain of a heart attack. Other symptoms include inability to eat more than small amounts of food, anemia, or shortness of breath. Generally this type of hiatal hernia should be surgically repaired, depending on the overall health of the patient. Umbilical Hernia - This hernia is located at your bellybutton or umbilicus. These are very common especially in babies. As the abdominal wall forms, the muscles of the abdomen close around the umbilical cord. A hernia is present when these muscles fail to close completely. This is noticeable as bulging umbilicus or an “outie bellybutton”. Fortunately, most babies that

are born with umbilical hernias will continue to develop so that the hernia closes on its own by the age of 4. Adults may develop a hernia later in life due to heavy lifting, obesity, excessive coughing, or pregnancy. Initially, your body will plug this defect with fatty tissue. This may be noticeable as a bulge in part of your umbilicus. You may actually feel this tissue push in and out through the hernia defect. Over time, these hernias will generally enlarge and intestine can begin to pass through the hernia defect creating a bigger bulge at the umbilicus. This can lead to an emergency with obstruction of the intestine or gangrene of the intestine. Surgery is usually recommended to repair these hernias. In select situations, observation without surgery may be an option. Inguinal Hernia - These hernias are created by muscular defects in the groin or inguinal region. They are very common in men but not common in women. There are two types of inguinal hernias. They are known as direct and indirect inguinal hernias. The two different types occur in different locations of the groin and are caused by slightly different factors. The earliest symptom is groin pain. Some people may not notice anything abnormal until a lump develops. Eventually, the defect in the muscular wall enlarges and allows intestine to protrude out of the abdominal cavity. Often the intestine will then become obstructed or even develop gangrene. This is an emergency situation. Incisional Hernia - As the name implies, these hernias occur at the site of previous surgical incisions which have passed through all of the layers of the abdominal wall. Similar to the other types of hernias, these defects in the muscular wall generally increase in size

over time. The same emergencies of bowel obstruction or gangrene can occur. A bulge or pain in a previous incision site warrants evaluation to search for this type of hernia. Since these hernias form in a portion of the abdominal wall that did not heal optimally after the initial surgical procedure, they are subject to higher recurrence rates after surgical repair than other types of abdominal wall hernias. For that reason, these often-challenging hernias need to be approached with diligence and special attention to every detail. This includes both the surgeon and the patient. Ventral Hernia - This term refers to a hernia of the abdominal wall that is not in the site of a previous incision and is separate from the umbilicus and groin. These are not common but may occur in the midline between the sternum and umbilicus. Rarely, they occur toward the lateral portions of the abdominal wall. Often ventral hernias produce discomfort before a bulge is noticeable. As with other types of hernias, emergencies of bowel obstruction or gangrene can develop. A final word of caution is in order: I have, on occasion, seen small hernias allow intestines through the abdominal wall and lead to emergencies. So if you are wondering if your hernia is dangerous, I would tell you, â&#x20AC;&#x153;Maybe. That question needs to be answered in consultation with a hernia surgeon.â&#x20AC;? Ray Sheppard, MD - General Surgery raysheppardsurgery.com

Hernia Mesh Is it Good or Bad? by Ray Sheppard, Jr., MD

If you watch TV, you have seen them-advertisements by lawyers warning you of “dangerous” hernia mesh. Since more than 1,000,000 hernias are surgically repaired each year with mesh, literally millions of Americans are wondering, “Should mesh be used to fix hernias?”

Since the early 1990’s, nearly all hernia repairs have utilized hernia mesh. Mesh based repairs have become the “gold standard” because surgeons observed significant problems with tissue based repairs. The most common hernia is the inguinal or groin hernia. Over 70 different types of nonmesh or tissue based repairs have been reported in the surgical literature. The large number of different repairs is a clue to the fact that a good, reliable repair has been difficult to discover. Hernia recurrence following these tissue based repairs is routinely reported as high as 35%. Techniques to reduce these recurrence rates have incorporated multiple suture lines of permanent suture (which may actually be similar to a mesh) and frequently are associated with prolonged post-operative pain. Alarmingly, even such efforts are associated with unacceptable hernia recurrence rates. The story is even worse when one considers the type of hernia that is seen in an old incision from a patient’s previous abdominal surgery. Hernia recurrence rates with non-mesh repairs for this type of hernia are commonly in the 50% range. With such poor results of tissue based repairs, a desire emerged to find a better way. During the past 25 years, different styles of mesh and different methods for utilization of mesh

have been employed. A drastic reduction in recurrence rates has been observed. In manycases, post-operative pain has been reduced with a faster return to the normal activities of life. If this is the case, then why do we see these â&#x20AC;&#x153;bad meshâ&#x20AC;? ads? One thing which is important to understand is that risk is associated with every choice that we make. Everyone understands the risks involved with sky-diving. Most decide to never take that risk. On the other hand, we all know that thousands of people are killed in automobile accidents every year, yet we take that risk every day. When it comes to driving our cars, we have judged the risk to be low compared to the benefits. There are some adverse events that can occur after a mesh repair, but these occur only a small percentage of the time. Alternatively, the risks of hernia recurrence are much more frequent and carry life-threatening consequences. Hernia experts have carefully analyzed these outcomes and have judged that the risk of hernia mesh is actually very low compared to the great benefits. Another critical fact is that mesh must be used wisely and with a safe technique. There are actually inappropriate methods of deploying mesh. This has led some patients to experience mesh complications. The main cause for this concern has been in procedures that are not related to abdominal wall hernia surgery. These complications have been primarily found in surgical repairs of the pelvic floor for women suffering from pelvic prolapse. For more information please visit the

FDA website: fda.gov/MedicalDevices/ProductsandMedicalProcedures/ImplantsandProsthetics/UroGynSurgicalMesh/default.htm. This highlights why hernia patients are best served by surgeons who are wellversed in the best practices for mesh utilization, as well as in a variety of hernia repair techniques. Although our current results with mesh repairs for abdominal wall hernias are better than has ever been seen in the history of mankind, we are always searching for improvements. Many of us who are most involved in hernia surgery have joined forces in the Americas Hernia Society Quality Collaborative. This is an effort to pool our experiences and identify strategies to obtain better results for our patients. Despite the fact that complication rates from hernia mesh have been occurring at a very low rate, the medical device industry has expended and continues to spend millions of dollars to research even better mesh and bring the complication rate as close to zero as possible. Together, surgeons and researchers are working to make our already outstanding outcomes even better. So, is mesh good or bad? Once you have more of the information, hopefully you can see that hernia mesh is not as bad as TV commercials would have you believe. Iâ&#x20AC;&#x2122;m a hernia surgeon, and I wouldn't have my hernia repaired without it! Ray Sheppard, MD - General Surgery raysheppardsurgery.com

Ovarian Cancer

in the Days of Genetic Testing by David B. Engle, MD, MS, FACOG In 2018 it is estimated that there’ll be over 22,000 new cases of ovarian cancer in the United States. Additionally, there will be over 14,000 deaths from the disease. A women’s lifetime risk of developing ovarian cancer is between 1.5-2%. While it is not the most common gynecologic malignancy it is the most fatal. This high fatality rate is due to the fact that most cases of the disease are found in later stages. In fact, approximately 75% of all cases are found in stage III and IV.

SIGNS AND SYMPTOMS Ovarian cancer was once considered the silent killer. Now, it is referred to as “the cancer that whispers.” This is due to the fact that many of the symptoms of ovarian cancer are nonspecific. They often mimic symptoms associated with either the urinary or gastrointestinal tract. The most common symptoms are: Bloating, pelvic/abdominal pain, urinary frequency or urgency, filling full quickly with eating. Other symptoms can include: nausea, constipation, and fatigue.

SYMPTOMS OF OVARIAN CANCER • Bloating • Pelvic or abdominal pain • Difficulty eating or feeling full quickly • Urinary symptoms (urgency or frequency) The symptoms often start very gradually, and often are not reported as severe in intensity. It is very common for patients with ovarian cancer to report they have been treated for common GI conditions such as GERD or constipation or even received more than 1 course of an antibiotic for a suspected bladder infection. Eventually, as the symptoms do not abate, additional testing will reveal the real culprit. CAUSES/ GENETICS The majority of ovarian cancer cases are sporadic. However, approximately 25% of all cases have a genetic predisposition. This is one of the highest, if not the highest, genetic associated malignancy. Compare this to breast cancer where 10% of all cases are associated with a genetic link. The most common genetic cause of ovarian cancer is the BRCA mutation (Hereditary Breast and Ovarian Can-

cer Syndrome). The BRCA mutations actually account for deleterious mutations in a group of two genes called BRCA-1 and BRCA-2. These genes, when working properly, are associated with repairing DNA damage. Unfortunately, when these genes are not working properly, they allow DNA damage to accumulate in the cell and increase the risk of developing certain malignancy. BRCA is most commonly associated with Breast and Ovarian cancer. However, it can also be associated with other cancers such as pancreatic, prostate and even melanoma. Approximately 40% of patients with a BRCA-1 mutation and 20% of patients with a BRCA-2 mutation will develop ovarian cancer. While the BRCA mutation is the most common genetic mutation for ovarian cancer, it is not the only one. The second most common germline mutation associated with ovarian cancer is Lynch Syndrome. While Lynch Syndrome is more often associated with colon and uterine cancer, it is also associated with ovarian cancer. Lynch Syndrome is responsible for approximately 10% of hereditary ovarian cancer. Numerous other genetic mutations have been associated with ovarian cancer, to varying degrees. As genetic research continues, our knowledge of which genes are associated with cancer will continue to increase. We are very fortunate to have a research facility right here in Huntsville doing groundbreaking genetic research. Researchers at the HudsonAlpha Institute for Biotechnology will continue to expand our understanding of the genetic code. This knowledge will lead to new treatments and improved patient outcomes. Visit www.information-is-power.org to learn more about HudsonAlpha's Information is Power initiative. PREVENTION Women who have a known family history of a malignant mutation, or a strong family history that has never been tested should be evaluated by a clinic comfortable with genetic testing. In the last decade the cost of genetic testing has decreased to 5 – 10% of the original cost or less. Additionally, most patients are now undergoing a more comprehensive testing panel, as we continue to expand our knowledge of genes associated with certain cancers. For those patients that test positive for a deleterious (harmful) mutation there are often different treatment or screening strate-

gies. The strategies are designed to reduce the risk of cancer, or possible detect them in the earliest most curable stages. Included in these recommendations can be risk-reducing surgery, to remove certain organs before they become involved with malignancy. Other strategies focus on more intense or frequent screening of certain organ systems. For example, women with a BRCA mutation can be offered risk-reducing bilateral salpingoophorectomy (removal of both ovaries and fallopian tubes) surgery after the age of 35, or when childbearing is complete. Risk reducing surgery may decrease the chance of ovarian malignancy by as much as 95%. TREATMENT Several factors must weigh in on the treatment of ovarian cancer. Age, future fertility desires, medical co-morbidities, etcâ&#x20AC;Ś With the exception of very early stage I disease, the mainstay of ovarian cancer treatment is a combination of surgery and chemotherapy. Studies have shown, the best patient outcomes for ovarian cancer is when a Gynecologic Oncologist directs care. A Gynecologic Oncologist is a sub-specialist who is trained in the diagnosis and treatment, both with surgery and chemotherapy, of cancers arising from the female reproductive tract. Currently in Alabama only Huntsville, Mobile, and Birmingham have Gynecologic Oncology Practices. CLOSING A significant percentage of ovarian cancers are from an inherited mutation. Luckily, we now have the tools to screen high risk patients for known mutations. Those found to have an increased risk of ovarian cancer can be offered increased screening or risk reducing surgery. For those patients found or suspected to have ovarian cancer, they should first be evaluated by a Gynecologic Oncologist to direct their treatment plan.

David B. Engle, MD, MS, FACOG Gynecologic Oncologist Tennessee Valley Gynecologic Oncology 256-265-4600 office

Inside Medicine interviewed Dr. Brett Davenport, a reproductive endocrinology and fertility specialist in Huntsville. We asked the most common patient questions about infertility and conception.

AM I INFERTILE? The definition changes slightly, based on the woman’s age. Women less than 35 years old are considered infertile if they have not conceived a pregnancy after 1 year of trying to conceive with regular intercourse in the absence of contraception. However, for women 35 years or older, infertility is the absence of pregnancy after only 6 months of regular intercourse with no contraception. Infertility can be the result of either male or female disorders, and oftentimes both. It can also occur due to a simple lack of understanding regarding the most optimal timing of a woman’s menstrual cycle. WHAT ARE MY CHANCES OF CONCEPTION EACH MONTH? Pregnancy oftentimes will not happen “on demand.” The average healthy couple has only a 15-20% chance of conceiving each month. This means that patience may be necessary. However, if a man or woman has a known cause or high suspicion for infertility (see below), it is very prudent to seek help from a specialist (OB/GYN or Reproductive Endocrinologist). OVULATING OR NOT? Although there are many causes of infertility, a woman must be ovulating for spontaneous conception to occur. Therefore, this is the first question that a woman should ask herself when she is ready to conceive. A woman is likely ovulating if she has regular predictable menses. There are also other simple but less reliable ways to determine if ovulation is occurring (e.g. basal body temperature testing and ovulation prediction testing). Sometimes, even with the above, it is not clear whether or not ovulation is occurring. This should prompt a consultation with a reproductive specialist to help her determine her ovulatory status. HEALTHY EGGS? There are many factors that can cause a woman’s eggs to be unhealthy and more unlikely to fertilize. Common causes of poor egg quality that can often be modified/prevented are obesity, smoking, excess alcohol, narcotics, and poor diet. Other common causes that usually cannot be avoided are medical conditions such as polycystic ovary syndrome, endometriosis, prior radiation/chemotherapy, and age alone.

WHAT ABOUT THE SPERM? Men must be aware that the health, numbers, and function of their sperm are just as important as their female partner’s egg count and function. Many of the same modifiable factors that cause poor egg health also cause a decrease in quantity and quality of sperm, including excess alcohol, smoking, narcotics, and obesity. Additionally, a common cause of low/no sperm is the use of steroids. Like women’s eggs, men’s sperm can be adversely affected by radiation/ chemotherapy. Several unavoidable causes of low/no sperm can be present from

birth and/or acquired throughout life. It is important for men to be open to lifestyle changes that will optimize their sperm health. AM I TOO OLD TO HAVE A CHILD USING MY OWN EGGS? In general, couples in the U.S. are waiting longer and longer to have children. It is important that a couple does not lose sight of the fact that a woman’s chances of conceiving with her own eggs begins to decrease around age 34-35. Women also have a higher risk of chromosomal abnormalities as they age above 35, which may increase miscarriage and birth defect chances as well. However, don’t lose hope! This does not mean women above 35 cannot have a healthy child. Statistics indicate the decline is gradual, averaging a 6-7% decline in fertility rate per year when compared to the year before. This simply means that if you are over 35, time is not on your side. You should speak with a reproductive specialist in order to help expedite the pregnancy process if conception has not occurred within 6 months of attempts. Further, the higher above age 35 that you climb, the more urgently you should seek assistance if you wish to conceive using your own eggs. For example, your chances of conception and delivery of a child with your own eggs has declined to <10% by age 42, even with the most aggressive therapies available. Age matters for male fertility also. Miscarriage rates are twice as high for male partners over age 45 when compared to male partners under 25. Older males also have been found to be at greater risk of having offspring with learning and mental difficulties. WE ARE NOT READY TO CONCEIVE NOW. HOW DO I KNOW IF WE WILL HAVE A FERTILITY ISSUE AND/OR WILL HAVE DIFFICULTY LATER ON? It is true that the best way to know you are infertile is to try to conceive, and that many times you cannot predict this until failed attempts have been made. However, there are clues that may indicate potential fertility problems for you or your partner. Is the female partner menstruating irregularly and unpredictably without the use of hormonal contraceptives? Does she have super painful periods, or pain in her pelvis when she is not having a period? Are her periods super heavy? Does she have any pain with intercourse? For men and women, are either of you grossly overweight or underweight (body mass index >30 mg/kg2 or <20 mg/kg2)? Are you a smoker? Do you consume alcohol in excess (>1 drink per day)? Have you had any sexually transmitted diseases in the past? Do you work closely with chemicals? Is there an immediate family history of genetic defects or birth defects? Have you ever had to receive chemotherapy or radiation? Have you had to have surgery at your genitals, pelvis, or inguinal

regions in the past (below your belly button, above your legs)? This is not an exhaustive list of red flags, but if the answer to any of these is yes, you should consider appropriate lifestyle/preventative measures and/or a consultation with a specialist sooner rather than later when you are ready to conceive. WHAT IF I AM GETTING OLDER, BUT WOULD STILL LIKE TO CONCEIVE IN THE FUTURE? A few different options exist. Techniques to freeze reproductive tissue (called vitrification) are very advanced. A woman can freeze her eggs at any age, allowing the aging process of the egg to “freeze in time.” This is a good option for a single woman who does not have an intimate partner. A couple can also undergo IVF even prior to their desire to have a child with the ability to freeze their embryos in time. These options can help take the stress of aging off of a couple. WHAT IF I AM ALREADY AT AN ADVANCED REPRODUCTIVE AGE WITH A LOW CHANCE OF FERTILITY? It is also possible for a couple to use eggs that are donated from a younger female. This process requires in vitro fertilization, but is an excellent option for women who would like to carry a pregnancy but are unable to conceive using their own eggs. Also, please don’t forget about the option for adoption! Your reproductive specialist can help you sort through the facts and costs of this decision. WHAT SHOULD I EXPECT FROM A SPECIALIST? If you meet the criteria for an infertility diagnosis and have confirmed ovulation, a reproductive specialist will go on to look for a myriad of other causes through history, examination, and testing. Some of the recommended interventions may include stimulation of the woman’s ovaries with medicine and/or medicine to help induce ovulation. Intrauterine inseminations (placing the sperm into the back of the uterus with a catheter at the time of ovulation), and/or in vitro fertilization are other common interventions. Couples with some diagnoses can expect to gradually move sequentially from more conservative to more aggressive therapies as needed, while couples with other diagnoses might need to move quickly toward more aggressive therapies such as in vitro fertilization. Indications that would call for a couple to move more quickly toward in vitro fertilization are tubal blockages/diseases, severe sperm deficiencies, severe endometriosis, very advanced reproductive age, or desire/need to perform pregenetic testing. HOW CAN I MAKE IT SIMPLE AND KEEP IT FUN? If you are a couple that has not met the definition of infertility above and do not have a high suspicion or risk for infertility, try to keep your conception attempts simple and fun. A few things to remember: 1) Many lubricants can hurt conception chances by hindering sperm movement. The best lubricant (short of natural lubrication) when a couple is trying to conceive is mineral oil (yes, from the grocery store isle). Saliva can also hinder sperm function. 2) A couple must have intercourse regularly around the time of ovulation, but even daily intercourse is not necessary. If you know when you are ovulating, 1-2 attempts around that time should suffice, given that the timing and sperm health are adequate. Intercourse multiple times daily does not increase chances of

conception, and rather makes couples grow tired of the process more quickly. 3) After intercourse, nothing else is necessary. A woman standing on her head, placing a pillow under her back, or lying down for an extended period of time has not been shown to assist with successful conception. 4) If a woman decides to time her ovulation, she can find the approximate cycle day on which she ovulates by performing daily urine ovulation predictor tests until she receives a positive. However, once a regularly-menstruating woman knows the proper timing, she should let it go and time intercourse according to her initial findings during future cycles. By removing the hassle and stress of daily testing, this will help to make the process more enjoyable.

532 MADISON STREET HUNTSVILLE, AL 35801 (256) 217-9613 FERTILITYALABAMA.COM

Life

really does matter

by, Cameron Smith Page

Our son was going to be born and there was nothing our doctor could do to stop it and at twenty-one weeks and two days my son was too young to survive. All year long we see people raising awareness for different causes. They sport ribbons, change their social media avatars, participate in marches, and just about every month has a particular cause tied to it. While I have supported efforts for various issues and illnesses until recently I have never been intimately tied to any cause. I have been blessed with health and happiness, but unfortunately life doesn’t always go as planned, so here I sit writing this story…my story. My story began in late January of this year when my husband and I found out we were expecting. We were early in our marriage and eager to grow our family, which already included my husband’s five-year-old son. We could not have been happier. Everything was going well. We learned at thirteen weeks we would be welcoming a little boy. We wanted to give him a name that had meaning so we chose to name him Robert Craig after the important men in his life. Robert is my husband and father-in-law’s name and Craig is my dad and brother’s name. Now that we knew who our little baby was going to be we kept trucking along and preparing for this season of our lives.

Everything continued to go well for us until I went in for my twenty-week appointment. It was during that appointment that I was told my cervix had shortened. This was my first pregnancy, so I did not really know anything about potential risks and my doctor did not seem too concerned. He prescribed me daily progesterone and recommended that I reduce my activity. I trusted him, so I left eager to follow his orders and continue moving forward. I was scheduled to see him back in three weeks. Unfortunately I never made it in for that appointment. Instead everything changed a little over a week later on June 3rd. That morning I woke up really early with intense lower back pain. I decided to get up to go to the restroom and walk around for a minute to see if it would stop. That is when I realized I was bleeding. I immediately woke my husband who then rushed me to the hospital where I was sent to labor and delivery triage. At first the nurse did not seem too concerned, but when she decided to check my cervix her expression quickly changed. I knew it was bad. She informed me that my cervix was almost fully dilated and that my membranes were bulging. I was in labor. Just about this time my doctor who happened to be on call walked in. He proceeded to check my cervix for himself and confirmed what the nurse had told us. He then delivered the news my husband and I were not prepared for. Our son was going to be born and there was nothing he could do to stop it and at twenty-one weeks and two days my son was too young to survive. I was told it was hospital policy not to intervene and take a baby to the neonatal intensive care unit until twenty-three weeks. In that moment my world stopped. Thinking back on that moment it is a blur. All I remember is my husband and I holding each other and crying. He kept telling me, “I’m so sorry. I’m so sorry I can’t fix this.” I am not sure how long we sat there crying, but at some point I managed to text my parents who showed up not long after along with more of my family. After my parents, brother, and sister-in-law arrived we all decided it was in the best interest to transfer to a hospital with high-risk specialists. So I was taken by ambulance to another hospital in town. The ambulance ride felt like an eternity. They would not let my husband ride with me, so I rode alone. I was so incredibly scared, but I tried to be brave for my family. When I got settled into the new hospital and finally met with the specialist he confirmed what my doctor had told me, but he did not want to give up on us. He agreed to attempt a procedure called a heroic cerclage in which he would push the bulging sac back in and stitch my cervix closed. He informed us that this would be the most controversial one that he had ever attempted and that it would likely end with him breaking my water or the stitch rupturing, but if we were on board he would try. My husband and I gave it no thought and told him to go for it. At this point we knew the outcome was certain if we did nothing, so we felt like we had nothing to lose and

everything to gain. The doctor informed us that he would put us on the OR schedule for noon the next day and proceed with the procedure as long as my amniocentesis came back good. We made it through that night and the next morning I had the amnio done. By this point I was in horrible pain and I cried and moaned as I gripped my husband’s hand with every contraction awaiting the results of the amnio. When the nurse came in and informed me that they were about to come take me to the OR I felt hopeful, but then the doctor came in with the bad news face. He did not like my amnio results and was calling the procedure off. He told us he was not comfortable risking my health because the results indicated an infection. Just like at the other hospital the doctor told us that they would not intervene with our son and even if they tried and he managed to survive he would have a terrible quality of life. So that was it. My son was going to die and there was nothing I could do. The doctor made the decision to send me upstairs to labor and delivery, order an epidural for me, and let me wait for my son’s arrival. I was wheeled upstairs to a room marked by a leaf on the door letting everyone who worked there know that this was a sad room. A room where hearts break and people’s lives change forever. In that room we waited. No one could tell us how long it would be before my water broke. Family took turns visiting and keeping us occupied. Somehow we managed to make it through another day. The evening of the 5th I listened to my son’s heartbeat on the monitor one last time and went to sleep with the hope that the doctors were wrong and we could hang in there just a little longer so he had a chance. That did not happen. I awoke around 5:00am on June 6th as my water broke. My room was quiet and my husband was asleep on the couch. I woke him up and we paged the nurse. As nurses and doctors entered our room f or the delivery I just remember thinking I am not ready f or this, but it was happening and I could not stop it. Af ter f our pushes my son entered this world at 5:40am weighing one pound and one point eight ounces. He was twelve and one-f ourth inches long. There was not a dry eye in the room and in that moment a f lood of all the dif f erent emotions I was f eeling f lowed out and I cried out like I have never cried in my lif e as they placed him on my chest. My heart was so overjoyed and in love with this beautif ul little boy that my husband and I had created, but at the same time my heart shattered because I knew he was not going to stay. As I held him tight against my heart he moved his little legs and opened his mouth trying to breath on his own. He made noises and his heart-beat was strong. He was very much alive.

During our time with him we dressed him in his first outfit, we had him baptized, we prayed over him, rocked him, I told him how beautiful he was, and we loved him fiercely.

During our time with him we dressed him in his first outfit, we had him baptized, we prayed over him, rocked him, I told him how beautiful he was, and we loved him fiercely. Around 9:00am his little heart stopped. When it was time for him to go I looked my son over once more committing every little detail I could to memory. I held his little hand, which by now had gone cold then I gave him one last kiss on the forehead. After that I did the hardest thing I have ever done. I handed my son and a piece of my heart over to the nurses, so he could be taken to the funeral home were I would get to see him one more time to help dress him for his funeral five days later. As I reflect back on my story there are just no words to accurately describe what it is like as a mother to watch your childâ&#x20AC;&#x2122;s life begin and end in your arms. I had to let go of every hope and dream I had for my sonâ&#x20AC;Śall the birthdays, holidays, first days of school. There is not a minute that goes by where I am not aware of his absence. I miss him more than I ever thought it was possible to miss someone. In the three short hours I had with him he changed my life in the most incredible way and I am so glad I got the opportunity to meet him. I will always strive to live my life in a way that he would have been proud of. My hope in sharing my story with you all in honor of Pregnancy and Infant Loss Awareness Month is that some of the silence and stigma around pregnancy and infant loss will be broken. It is real and it can happen to anyone and it does happen. According to statistics one out of every four pregnancies will result in miscarriage, stillbirth, or neonatal death. What us loss parents need is not silence. We need conversation. We need support. We need advancements in medicine. We need people to ask about our babies. We need our childrenâ&#x20AC;&#x2122;s lives to matter no matter how short. Robert Craig matters, as do all the other babies that left this world too soon.

Ask Anesthesia

by, George Faison, MD

When you are pregnant and about to deliver your baby, you more than likely will be faced with the decision, “Do I get an epidural or have natural childbirth?” Personally, I think any type of vaginal delivery is natural childbirth, no matter what kind of pain control is used. But, for the purposes of this article, I will describe “natural” childbirth as labor and delivery with no epidural. “Natural” childbirth could mean one of two things: (1) the patient receives no analgesia (relief of pain) or (2) the patient receives an alternative pain medicine, usually intravenous (IV) narcotics. The effectiveness of analgesia in this form depends on one’s particular pain of labor, one’s pain tolerance, and one’s tolerance to the narcotic itself. A pleasurable experience of labor and delivery can be obtained if these factors are in the patient’s favor. Unfortunately, most of the time, at least one or more of these factors is not, and the experience can be a bit unpleasant. Another major drawback to IV narcotics is that these drugs cross the placenta and go into the baby’s bloodstream. When this happens, they can cause excessive sleepiness and slowed, or even absence of, breathing in the baby. These effects can also be seen in mom as well, but typically to a lesser extent. Often, the obstetrician will not give IV pain medicines after a certain point in the progression of labor to avoid these problems in the newborn. Unfortunately again, the later period of labor and the delivery itself tends to be the most painful time for mom. An epidural avoids these issues since little, if any, narcotics are used, and only the smallest amounts of the medicine are absorbed into mom’s bloodstream; this means that essentially none crosses the placenta into the baby’s circulation. An epidural is primarily a local anesthetic (numbing medicine) that is placed around and absorbed directly into the nerves that are involved with the transmission of pain impulses, causing them to stop transmitting those impulses and resulting in the loss of the perception of pain. The epidural is done most often by continuous infusion, so it doesn’t wear off like IV narcotics do. The side effects of the epidural are minimal, but include numbness and weakness in the lower extremities, difficulty urinating, and initial drop in mom’s blood pressure. But these side effects are easily managed. The blood pressure can be stabilized with IV fluids and medicines. The bladder dysfunction is not an issue because a urinary catheter is used during labor to keep the bladder empty and out of the way of the baby’s path through the birth canal. All of the side effects go away soon after the epidural is discontinued. Epidurals sound pretty fantastic, and they are; but they aren’t perfect. The nerves involved in feeling pressure are resistant to the anesthetic medicine, and that pressure can get very uncomfortable at times. Furthermore, the nerves involved with actual delivery are much thicker and more difficult to numb. As you can imagine, the stretching of tissue at delivery can be profound. This often causes the patient to think that her epidural is wearing off. Believe me, that pain would be much, much worse without the epidural. The medicine given by the epidural can also spread unevenly throughout the epidural space

for reasons not well understood, leading to â&#x20AC;&#x153;hot spotsâ&#x20AC;? of pain or even one-sided analgesia. These things can usually be resolved with extra dosing, epidural catheter manipulation, or even catheter replacement (repeated procedure). Another common issue is that the baby, which is supposed to travel through the birth canal head first and face down, will often turn face sideways or even face up. When this happens, the pain of labor is greatly increased and sometimes less controllable than we would like; but again, it is controlled much better than without the epidural. Finally, the two most common concerns of patients regarding epidurals are whether the epidural puts them at risk for chronic back pain or even paralysis. All medical procedures carry risk, but the risk of permanent paralysis from an epidural is extremely low. The causes of paralysis can primarily be narrowed down to two factors: infection and bleeding. They can cause epidural abscess or hematoma, respectively. Both produce high pressure around the spinal cord and can compromise blood flow, leading to spinal cord damage. Early diagnosis and emergent surgery are essential to prevent the damage. Epidurals are performed using sterile technique and carry an extremely low risk of infection. Patients with depressed immune systems, however, are not good candidates for epidural. Significant bleeding is extremely rare as well. Patients with bleeding disorders or who are on strong blood thinners are not candidates either. Sometimes the obstetric condition often referred to as toxemia can lead to low platelets, a blood component involved with early blood clot formation. Patients with this condition are also often not candidates. Aspirin therapy does not disqualify one for epidural placement. This may sound

scary, but I have been practicing anesthesia for 24 years now and have yet to see a patient develop an epidural abscess or hematoma. Chronic back pain is more common than paralysis, of course, but is still very rare. It is difficult to distinguish whether or not back pain is the result of an epidural, especially since the weight of the pregnant tummy is very stressful to the lower back. Typically, the patient will experience mild to moderate soreness for a few days but then it goes away.

I hope this information helps you make your decision. Of course, I am probably a bit biased, but in my experience, the epidural is usually the better choice because it works directly on the pain carrying nerves, is continuous, and the medicines remain outside of the bloodstream, resulting in better pain control with fewer serious side effects in both mom and the baby. George Faison, MD 201 7th Street SE, Decatur, AL 35601 256.341.2000

Hormones

TALKING ABOUT

by, Donald Aulds, MD

WHAT ARE HORMONES? Hormones are chemicals produced in certain organs of the body and released into the blood stream to act on other areas of the body. Some hormones may have mainly a single action while other such as estrogen may act on multiple areas of the body and produce multiple actions in the body.

Hormones are probably one of the most misunderstood chemicals in the body. The term hormones can stand for multiple chemicals including those from the thyroid gland, adrenal gland, pancreas and of course the ovaries or testes. I will try to approach this from the standpoint of a question and answer approach.

HOW DO HORMONES WORK? Hormones act on areas of the cell called receptor sites. The receptor site in the presence of the hormone releases some response in the cell to produce the response that is intended to occur. Some of the receptor sites may be blocked by other chemicals to reduce the response to the hormone. Also, synthetic hormones may incompletely act on the receptor site and not produce the expected response. WHY DO I BEGIN TO HAVE SYMPTOMS RELATED TO HORMONE CHANGES? This is a complicated question, but in order to try to simplify the answer, you must understand that each hormone in the body has a time in which maximum production of the hormone is achieved and production will begin to decrease beyond this point. As a good example, testosterone production peaks in a woman in her later 20’s and in a man in the early 30’s. After this point of life, testosterone will drop in production and symptoms of decreased testosterone can begin. Some conditions or diseases will accelerate the loss of certain hormones. WHY DO I FEEL TIRED OR CAN’T SLEEP? These two problems are often two of the most common complaints that I hear from patients. The can be multifactorial and can not be helped often without measuring hormone levels. These studies can include evaluation of sex hormones, thyroid hormones, and stress hormones. IF HORMONES LEVELS ARE NORMAL, WHY DO I STILL HAVE PROBLEM? Reactions to hormones are also affected by other chemicals of the body particularly vitamin D. Vitamin D is con-

sidered a prohormone meaning the it has to be present for the hormone to produce the response that is expected of the hormone. Without adequate levels of vitamins and minerals in the body, the body just does not respond the way it was intended to work. An example, thyroid hormones must have such chemicals as selenium and boron present to work on certain tissues. WHERE DO THESE CHEMICALS COME FROM? Mainly from foods that we consume or by supplements taken as directed by your physician. The World Health Organization recommends a low caloric diet such as the Mediterranean diet and exercise to boost response of healthy function of our bodies. WHEN DO SYMPTOMS OF DECREASED HORMONES TYPICALLY OCCUR? For most women and men, symptoms usually start or become significant in the 40’s to 50’s. Some symptoms may show up earlier in certain individuals, but some may not occur until later in life. WHAT CAN BE DONE FOR THE SYMPTOMS? I always try to select therapies based on a combination of symptoms reported by the patient and the results of lab tests of the hormones. Specific panels of test of hormones are based on the sex of the person. When lab test results are available approaches of therapy can be planned based on the individual’s needs. AREN’T HORMONES BAD FOR ME? Multiple studies done mainly in Europe have shown that bioidentical hormones (naturally derived hormones) are safe compared to synthetic hormones. One result of a French study showed that testosterone in a woman helps protect against breast cancer along with other benefits to the body. These must be discussed with a physician. HOW LONG WILL I HAVE TO BE ON HORMONE THERAPY? As long as you are getting benefits from the therapy. There are no studies on naturally derived hormones that show or suggest a time limit for therapy. I tell patient daily that length of therapy is a personal choice, but whenever hormones are stopped, symptoms may return. It all depends on how well you feel, if the hormones are helping control the symptoms, and whether you desire to do everything you can to maintain your health. Dr. Donald Aulds is an obstetrician-gynecologist in Huntsville, Alabama and is affiliated with Huntsville Hospital for Women and Children. He received his medical degree from Louisiana State University School of Medicine in New Orleans and has been in practice for more than 25 years.

WARNING by Traci McCormick, MD

SIGNS OF HYPOTHYROIDISM

Hypothyroidism affects over 20 million Americans and 1 out of 8 women. Amazingly, it is estimated that 60% of people with a low thyroid remain undiagnosed. Undiagnosed hypothyroidism can lead to serious health consequences including infertility, heart problems, severe mental health issues, and nerve damage. When functioning properly, the thyroid gland secretes just the right amount of thyroid hormone. Thyroid h o rmone c o ntrols y o ur b o dy’s metabolism—the rate at which nutrients and oxygen are converted into energy. Too much thyroid hormone causes your metabolic rate to be too high. Too little thyroid hormone causes your metabolism to slow way down. That slow metabolism can create havoc on your body. Here are ten signs of hypothyroidism that you should look for. You do NOT have to have all of these symptoms but the more you have, the more likely it is that you would be identified as suffer-ing from hypothyroidism.

5. Dry Skin

1. Fatigue

9. Low or No Sex Drive

Exhausted? Too tired to peel yourself off t he c ouch after working all day? A low thyroid can make you tired, even when you have adequate rest. You may wake up tired or run out of energy early in the day.

Lost that lovin’ feeling? It’s very common for an under-functioning thyroid to cause a decrease in your sex drive.

2. You Are Cold All the Time

10. Poor Memory or Brain Fog

Do you often feel cold when everyone else in the room is comfortable? Have cold hands or feet? If you have a low thyroid, you are likely to have a low body temperature that keeps you feel-ing cold even when the thermostat says you shouldn’t.

Feeling forgetful or having a hard time concentrating? Your thyroid may be the cause. When your body’s metabolic rate is low, the brain does not function as best as it could.

3. Weight Gain

See Your Doctor If you think you have any of these signs of hypothyroidism, please consult your doctor. Make a list of the signs and symptoms you have a give it to your physician.

Are you gaining weight or are you unable to lose weight despite watching your calories? This is a classic sign of thyroid trouble.

4. Thinning Hair Is your hair thinning or are you losing more hair than normal? You may notice more hair in your hairbrush or hair loss when you shampoo. If so, it’s time to get your thyroid checked.

Should you own stock in skin lotions? Dry skin, especially of the legs and feet, is a very common sign of hypothyroidism.

6. Constipation Slow to go? A low thyroid causes everything in your body to slow down, including your bowels. If you are frequently constipated, your thyroid could definitely be the problem.

7. Depression Feeling down? If your thyroid is low, it can affect your mood. Depression is one of the most common signs of hypothyroidism.

8. Muscle or Joint Pain Do you have tender places in your muscles or joints that are swollen and achy? It could be because of a low thyroid.

Unfortunately, hypothyroidism can often be difficult to diagnose. A lot of doctors only do one or two common tests that frequently miss the problem. If you have been told your thyroid is normal, but you still suspect you may have a thyroid problem, you should ask for advanced thyroid testing, including free T3 and thyroid antibodies.

NATURAL APPROACH TO HORMONAL THERAPY by Donald Aulds, MD

Hormones have been used in medicine dating back thousands of years. These hormones were plant derived not manufactured in a laboratory and a manufacturing facility.

A Chinese book dating back over twenty-five hundred years describes using soy for control of bleeding and menstrual problems. The drawings on the Mayan temples and teaching by tribal medicine practitioners of Native Americans describe the use of the Mexican yam root as a source to help women after childbirth and control of menstration. The plants were steeped as teas and drank by the women. Throughout the ages, man has sought the fountain of youth, while it exists in our own bodies. As we age, the hair may get thinner, our waist gets larger, more wrinkles appear and our energy decreases. Our bodies are complicated instruments with all 37 trillion cells for this function. As aging advances, the hormones in the body decrease and diseases will begin. As a women begins to get into the forties, there is a transition toward permanent infertility and sex hormone decrease called menopause. Men undergo a similar event called andropause in which he may have muscle loss, decrease ability to perform sexually and loss of interest in family and spouse. Synthetic hormones produce an inflammatory response which is due to the chemical being different from our bodies own hormones. Any time inflammation is present, there can be development of diseases especially autoimmune disorders. Bioidentical hormones (BHRT or naturally derived hormones) have the same chemical structure to our hormones and do not increase inflammation thereby in many cases may be protective to developing diseases. Menopause and perimenopause is the time in a womanâ&#x20AC;&#x2122;s life when the hormones decrease leading to the final stoppage of periods. Estrogen, progesterone and testosterone decrease in concentration in the body and the signs of the decrease can be identified ten to fifteen years before the last period occurs. The women may have changes in the frequency and severity of flow of her periods. As estrogen decreases, she may experience hot flashes, vaginal dryness and sleep disturbance. As testosterone levels go donw, the common symptoms include anxiety, depression, muscle aches, weight gain, decreased sexual response and drive, memory loss, night sweats and fatigue. Progesterone decrease can produce joint pain, loss of bone mass, insomnia, depression and anxiety and increased cholesterol levels.

Men undergo a form of menopause referred to by many as andropause with a decline especially in testtosterone and DHEA. These can lead to a decrease in libido and sexual performance, muscle and strength loss, fatigue, sleep disturbance, weight gain and decreased immune system function. Another problem that can occur is now referred to as thyropause with a decline in thyroid production and can occur at any age sometimes as early as late teens or twenties. This can be a problem leading to fatigue, sleep disturbances, difficulty in temperature regulation, thinning or loss of hair, weight gain, fatigue, and loss of cognition, memory and changes in mood. So these problems can each lead to a decreased sense of well-being, and disease. BHRT can be used in the right combination, the right dosage and with the right method of administration to improve quality of life, reverse symptoms and prevent diseases. Testosterone is protective for brain, heart, bones, and breast. Testosterone production in women declines beginning in the twenties and in men in their thirties. The deficiencies can be reversed with administration of testosterone and decrease the risk of heart disease, Alzheimerâ&#x20AC;&#x2122;s disease, osteoporosis, diabetes, and breast cancer in women and prostate cancer in men. Estrogen protects the skin, heart, bone and metabolism. Progesterone is fairly inactive in men but in women, it helps protect bone, uterus, breast and brain. Thyroid hormone helps with metabolism, brain function, heart, skin and muscle. It has been estimated that approximately 40% of all Americans have low thyroid function. These hormones can all be replaced with bioidentical approaches given the person the best form of therapy. These must be discussed with a physician trained in using the bioidentical approach in the best forms for the individual. Donald Aulds, MD OBGYN drauldsobgyn.com 256.533.1244 401 Lowell Drive SE #9 Huntsville, AL 35801

what might be lurking

IN YOUR THYROID GLAND by, Kari Kingsley, MSN, CRNP

Ah, the joys of heredity! My mom is the youngest of 11 siblings. Her 5 older sisters give her a chronological idea of what she will look like in the years to come. Genetics and ancestral similarities run strong in our family. I am basically a Xerox copy of my mom at 35. Her sisters are stair-step cookie cutters of one another with only subtle differences such as a touch more grey hair here or a tad more smile lines there. They have a lighthearted spirit when they joke about the Aldridge family genes and what we have in store for us.

Human genomics is currently at the forefront of medicine. We are not yet born with an expiration date, but is the day coming that a single drop of blood from a baby's foot will stamp the date they will leave this world? My genetics tell me I’m in line to develop a few things: a bunion, glaucoma, and thyroid issues. Not the worst gauntlet to walk through in the world of blood lines. I am diligent to get my eye pressures checked, and thankfully my feet don’t hurt, but I have a palpable suspicion that something sinister is lurking in my DNA, specifically in my throat. My mother underwent a thyroidectomy for a what she thought was a benign thyroid nodule in 2009. Surgical pathology came back as a surprise confirming papillary thyroid carcinoma. Thankfully, surgical margins were clear and she required no further treatments.

Being the ever-hypochondriac that I am, I diligently went in for a thyroid ultrasound. After a few squirts of squishy jelly and a few passes from an ultrasound probe, it was apparent my thyroid was in perfect structural order. No nodules. No large lobes. No cancer. Pleased with the results, I assumed I could check off thyroid cancer from my “To-Do” list for the time being. But my provider suggested thyroid labs. My thyroid function tests came back normal, ruling out chemical thyroid issues such as hyperthyroidism or hypothyroidism. But my Thyroid Peroxidase Antibody (TPO-Antibody) was elevated. I did what any logical thirty-five-year old would do… I opened my laptop and googled all the horrible things elevated TPO could entail. Basically, an elevated TPO suggests high antibodies. Antibodies are the gunships your immune system sends when it is anticipating a fight. Well that didn’t sound good. Why was my thyroid preparing for battle? So, with a very confused look on my face, I asked my doctor, “So you’re telling me that I don’t have thyroid problems now, but I will?” The test is suggestive she told me. The idea of a dormant-thyroid-attacking-monster lurking in my throat doesn’t exactly sit well, especially when coupled with my Mom’s history. But it isn’t the end of the world; and it has certainly made me more diligent about my thyroid health.

Thyroid structure and function can get down right complicating. Perhaps because that’s just it…. It’s two processes to treat: Structure and Function. Further complicated by each is treated by its own specialty. Endocrinologists focus on the hormonal function of the thyroid whereas ENT physicians focus more on the structure (i.e. nodules, enlarged lobes, and cancer). But there are a few things you should know to help optimize the health of your thyroid. As an Ear Nose and Throat Nurse Practitioner, I wish I had a dollar for every patient that thought their thyroid was the root of their fatigue. I am definitely no hypocrite and I’ve had mine drawn a time or two, (or 20), hoping I had found an explanation for why the snooze button keeps hitting itself each morning. But fatigue is a huge indicator of thyroid dysfunction. Abnormal hormone secretion in the thyroid will affect regulation of our metabolism. Thyroid dysfunction to detect hypothyroidism and hyperthyroidism can be evaluated with simple blood tests to measure how well the thyroid gland is performing. But function is only part of what can go awry in the thyroid gland. Structural abnormalities should also be on our radar. Thyroid nodules are small solid or fluid-filled masses that can develop inside the thyroid gland. The majority of nodules aren’t serious, however, they should always be evaluated and monitored for enlargement with thyroid ultrasound and occasionally CT imaging of the neck. A small portion of thyroid nodules do contain thyroid cancer (right Mom?). Many times, ENT physicians, Endocrinologists, and some family practice providers will recommend a biopsy of a nodule(s) called a fine needle aspirate to detect cancer cells. Risk factors for thyroid cancer include a known family history of thyroid cancer, prior head and radiation exposure, being female, and having a history of breast cancer. Thyroid goiter is an abnormal enlargement of the thyroid gland that can be associated with many thyroid diseases. Abnormal signaling of hormones can cause increased vascularity and increased size of the gland itself. As the thyroid gland gets larger, compression to surrounding vital structures in the neck occur. Symptoms include hoarseness, difficulty swallowing, lump sensation, or pressure within the neck. Screening evaluation of the thyroid with thyroid palpation by a trained professional is important. Thyroid ultrasound is critical in evaluating nodules and thyroid size. Biopsy is crucial if suspicious nodules are noted. Screening thyroid labs will help detect thyroid dysfunction. Other lab investigations and scans may be warranted once initial screening tests are performed. Treatment depends on the underlying cause. I am grateful to know my family history and what I'll (possibly) have in store for me in the years to come. It is somewhat disconcerting to think about all the cute shoes my future bunion will prevent me from wearing, but I am glad to know to keep a close eye on my thyroid and what may be lying dormant inside.

SIGNS OF THYROID DYSFUNCTION CAN INCLUDE: Hypothyroidism • Fatigue or tiredness • Weight gain • Elevated cholesterol level • Cold intolerance • Constipation • Dry skin • Hoarseness • Muscle weakness • Aching joints and muscles • Dry hair or hair loss • Itchy and dry skin • Concentration and memory issues • Depression • Irregular or heavy menstruation Hyperthyroidism • Swelling of the thyroid gland • Prominent or bulging eyes • Irregular or rapid heartbeat • Heat Intolerance • Tremors or shaking hands • Increased sweating • Irritability and restlessness • Anxiety • Increased bowel movements or diarrhea • Weight loss • Weakness • Sleep dysfunction • Brittle hair and or hair loss • Irregular menstrual cycles in women

BALANCE IN HEALTH by William T. Budd, PhD

What does it mean to have balance in terms of health? In biology and healthcare, the term homeostasis is used to describe the equilibrium maintained by our bodyâ&#x20AC;&#x2122;s systems.

An important component of our body’s ability to maintain this stable state are the bacteria that live in us and on us. Typically, we only think of bacteria when they make us ill. However, the majority of bacteria are not capable of making a healthy person sick. In fact, there are many species of bacteria that are fundamental for healthy living. In 2008, the National Institute of Health launched the Human Microbiome Project (HMP) to understand the role of bacteria in health and disease. Studies show that humans are composed of 10 bacteria for every human cell and that composition/ function of your microbiome is essential for your health.As an example,bacteria in the gut have been linked to a number of diseases such as diabetes and inflammatory bowel disease.

VAGINAL BALANCE

Of particular concern to women is vaginal health. Bacterial vaginosis (BV) is one of the most common gynecological diagnoses and is a disorder caused by an imbalance in the bacteria of the reproductive tract. One in three women currently have bacterial vaginosis and in fact, almost every woman will suffer from at least one incidence of this condition during her lifetime. The diagnosis was once thought to be a mere inconvenience but is now known to be a major health concern that can lead to preterm child birth, pelvic inflammatory disease and an increase in the incidence of sexually transmitted infections. Symptoms of bacterial vaginosis include; abnormal vaginal discharge (white/ gray), itching, painful intercourse, and odor (fishy smell) that worsens after intercourse. Traditional therapy for BV is administration of an antibiotic, most commonly Metronidazole. The exact cause of bacterial vaginosis is not understood. There are a number of factors that increase one’s likelihood of contracting the disorder; such as, increased number of sexual partners, unprotected sex and cigarette smoking.The clinical treatment of BV is difficult as the recurrence rate is extremely high (~60% within a month) despite the use of oral and intravaginal antibiotics. Failure to eradicate BV is frustrating to clinicians and patients. Women suffering from this disorder often describe a lack of sexual interest, low self-esteem and depression. Under normal conditions, vaginal flora is a relatively stable environment dominated by a single Lactobacilli species. One milliliter of vaginal fluid contains over 100 million bacteria, over 99% are Lactobacillus crispatus and are responsible for keeping other organisms at bay by maintaining an acidic pH. During the development of bacterial vaginosis, Lactobacillus crispatus organisms begin to die off setting off a chemical cascade (inflammatory response) that changes the environment allowing other organisms to take hold. The inflammatory response associated with BV is increased during pregnancy and exacerbates the risks of the disorder. Unprotected sex, oral sex with a partner with poor oral health, or use of an antibiotic can cause the initial loss of protective organisms. Loss of the protective bacteria allow other organisms to establish residence. The complexity of the microbial community evolves. It shifts from a homogenous environment dominated by a single organism to a heterogeneous community creating a tough physical structure similar to dental plaque.The structure protects the bacteria allowing them to escape immune system response and antibiotic

therapy. For these reasons, BV is difficult to eradicate and will often recur. In fact, current literature shows once a woman has BV her flora is permanently altered, and the healthy Lactobacillus species is replaced by a non-protective member of the family knows as Lactobacillus iners. The permanent loss of this organism creates a situation in which a woman can swing into and out of BV frequently with some women reporting up to ten occurrences per year.

DIAGNOSIS

There is not a consensus approach on the diagnosis of BV. BV is often a diagnosis of exclusion. Clinical examination for the presence of vaginal discharge and microscopic examination for “clue cells” are often used to diagnose BV. However, studies show these methods are not always accurate. The human microbiome project has created a set of tools that can be used clinically to evaluate the flora of the vagina and provide physicians with a more accurate depiction of the vaginal flora. Using molecular signatures, clinicians can, for the first time, evaluate the balance of the vaginal flora and accurately diagnose the presence of bacterial vaginosis. Accurate diagnosis is essential as studies show that presumptive treatment leads to more problems.

TREATMENT

For some women, the symptoms of BV may resolve on their own but for most treatment by a clinician is required. Antibiotic therapy (Metronidazole) is often required to kill off the non-resident organisms that have taken hold. Studies show that alternative natural therapies may be more effective than antibiotics. Garlic produces a strong antibacterial compound known as allicin. Clinical trials conclude the use of a garlic tablet during a BV episode is more effective than Metronidazole and results in a faster reduction in symptoms. Boric acid suppositories can be purchased over the counter and are also as effective as Metronidazole. It is important to consult a clinician prior to initiating therapy as there is an overlap in symptoms between BV and other infectious syndromes. Accurate clinical diagnosis is important as there is risk in elimination of the healthy flora. The greatest challenge in permanently eliminating BV is replacement of the protective organism. The use of a probiotic composed of Lactobacillus can restore bacterial balance and reduce the rate of recurrence. The overall treatment goal is to reduce the number of non-resident organisms and increase the number of healthy Lactobacilli.

CONCLUSION

Bacteria are a key component of a healthy lifestyle. However, there exists a delicate balance in the numbers and types of organisms. Prevention and treatment are necessary to help maintain the correct balance. Please contact your physician if you ever have questions concerning your balance. William T. Budd, PhD Chief Scientific Officer of Madison Core Laboratories www.madisoncorelabs.com I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8

Pelvic Rehabilitation:

More than Just Kegels by, Stephanie Perez, PT, DPT

Pelvic rehab is starting to become more of a “hot topic,” but many people are still unaware of this group of muscles and how they affect our everyday lives. The pelvic floor is a muscular hammock that sits in the bottom of our pelvis and helps to hold our organs up. They are present in men and women. Just like any other muscle in the body, injuries can occur, weakness can develop, or tension and trigger points can build resulting in pain and dysfunction. Pelvic floor dysfunction can take on various presentations in different populations. One of the most common symptoms is urinary leakage. It has almost become mainstream to think it is normal to “pee a little” when you sneeze, cough, laugh, or jump. Stress incontinence is a symptom that there is a problem with the pressure system in your body. We all have a normal resting intra-abdominal (inside the abdomen) pressure and we manage this pressure during activity with proper breathing, core activation, and pelvic floor activation. If we do not have adequate awareness of these integral pieces, the system becomes imbalanced and symptoms occur. Another common, yet incorrect, belief is that kegels are the answer to pelvic floor problems. Women are instructed to perform kegels all day to strengthen the pelvic floor. As stated previously, the pelvic floor is a group of muscles, just like other muscles in our body. We would not walk around all day performing bicep curls if we had a problem with our arm! Symptoms could be a sign of weakness OR a sign of excessive tension or tightness in the system. Due to this discrepancy, it is of upmost importance to go see a pelvic PT and get an assessment, so you know exactly what the problem is and how to fix it! Common populations where pelvic dysfunction occur are in pre and post-partum women and the elderly, but ANYONE can experience these problems. Many athletes, even elite men and women will encounter leakage (urinary or fecal) with their specific activity. Getting instruction by a physical therapist on proper breathing mechanics and muscle coordination during activity is a great way to keep healthy pressures in your system to prevent problems while exercising. Aftercredit: pregnancy andPregnancy delivery, a woman attends a Image PACN Community Assistance Center North www.pacncommunity.org 6-8-week post-partum follow-up appointment with an

OBGYN to assess healing and be released for return to activity. This is a great time to talk with your OBGYN about getting a referral to see a physical therapist to help you ease back into exercise safely. During pregnancy there is a lot of shifting and stretching of muscles that could potentially lead to discoordination and problems on return to exercise. You may have developed some diastasis recti (abdominal separation). During the birthing process, tearing can occur that can lead to restrictive and painful scarring. A physical therapist can assess the extent of the diastasis recti, strength and coordination of the core and pelvic floor, and help develop strategies to improve posture and alignment so that safe and optimum return to activity can be achieved. Pelvic floor dysfunction also presents itself in the form of pain. Some women experience pain with intercourse, inserting a tampon, or during an internal medical exam. This pain and tension can be a result of hormone imbalances, scar tissue, muscle tension or weakness, or impaired posture. This is a real problem that a physical therapist can address and help improve so you can feel better! Pelvic floor dysfunction is a real diagnosis with many treatments available. You have a voice! You don’t need to live another day with pain or incontinence. We need to remove the normalcy that has been labeled to these issues and empower each other to get help and feel better. We need to eliminate the shame and embarrassment and open-up the lines of communication between patients and physicians. We have to take care of our bodies and be our own advocate. A physical therapist can help. I am here for you!

THE EMOTIONAL pLIGHT OF INFERTILITY:

YOU ARE NOT ALONE by: Brett Davenport, MD

“My husband and I have stopped using birth control, why aren’t we getting pregnant?” This is a common sentiment that I encounter each week in my clinic as couples struggle with a roller coaster of emotions. It comes natural for most to dream of a future with children. Because conception is a natural expectation it becomes quite frustrating and disappointing when plans do not become reality on demand. Many couples will uniquely relay to me the heartaches of a lonely struggle. As they are surrounded by friends, family, neighbors, and co-workers who conceive easily, the frequent refrain is “what’s wrong with me?” The struggle all too often becomes personal. Many approach fertility with unrealistic expectations, and still more lack an understanding of just how common infertility is. Below are a few general observations from my daily clinical encounters with infertile couples.

The Loneliness of Infertility For most couples, attempting to conceive a child is a very intimate process that is clothed in privacy…and rightly so. But because of the quiet nature of this process, those who are unable to voluntarily conceive often suffer in private as well. Infertility is spoken of far too seldom in our society, which makes those couples that are experiencing infertility feel as if they are on an island. Even more, the relationship between intimate partners is often greatly affected by infertility.

Reactions of Men vs. Women In general, men and women deal with infertility in different ways. It has been shown that women are quicker to become distressed about infertility than their male partner, and often struggle with jealousy when another person around them conceives. My experience supports this data. Additionally, both men and women tend to have lowered self-esteem if the diagnosis or perception of the problem is related to his/her body, respectively. Men frequently even deny that they could be a contributing factor until it has been demonstrated to them objectively. All of these differences place a strain on the ability of a couple to empathize with one another appropriately during a time that they desperately need each other’s support.

Sex Strains During a couple’s struggle with infertility, it is very common to see sex become a chore rather than a show of intimacy. The mental association that a woman may develop between sex and failure may make it to where she is only interested in sex around the time of ovulation. Conversely, misconceptions about the optimal frequency and timing of intercourse in order to conceive often results in couples having intercourse much more frequently than is even enjoyable for either of them.

Misdirected Expectations I also commonly see couples who have unrealistic expectations about how soon they should conceive. If there is a reason to think that there is a problem, professional help should absolutely be sought. But if there are no physical or historical reasons to explain why fertility may be difficult, where should a couple’s expectations lie? Most couples don’t realize: • The average couple in their 20’s with no fertility disorder has around a 20% chance of conceiving each month with regular random intercourse in the absence of contraception. • The overall chances of pregnancy after 1 year of regular random intercourse in the absence of contraception is approximately 80%. • Infertility is the absence of a pregnancy after 1 year of trying to conceive with regular intercourse in the absence of contraception if you are less than 35 years old. • If you are 35 years or older, infertility is the absence of pregnancy after only 6 months while still meeting the same criteria above. • Approximately 10-15% of all couples in the United States struggle with infertility. That’s approximately 1 out of 8 couples!

We have to help each other! If you are struggling with infertility, here are some tips to stay mentally strong: • Know that it is normal to have sad and disappointed feelings. This is not something to feel guilty about, but rather a normal response to a real problem. Allow yourself to express your emotions. • Getting mentally connected and understood is a huge step toward healthy coping. Find a friend to confide in. If you have not yet told anybody but your partner about your struggle, you need to! Even if that person has not undergone infertility, they are now on the journey with you. • Find a support group: whether online or locally, this will allow you to hear of what other couples are going through or went through and will validate your emotions. It will make you feel less isolated and will empower you with knowledge. • Journaling: this has been shown to provide clarity of thought as to what you are feeling. It will allow you to understand yourself even more. • Exercise. If you do not already have one, pick up a regular exercise routine. You will find that your hyper-focus on fertility can be re-directed toward a workout, and your stress greatly reduced as a byproduct. Technology has come a long way to help couples reach their pregnancy goals so that there is much hope for those struggling. The above are just a few tips that may help couples feel less lonely and endure the emotional roller coaster of infertility. Our infertility clinic is also designed to personally assist you through this tough time. Don’t hesitate to call if we can help!

Preemie Strong The NICU Family You Never Knew by, Teairah Wilder

Pregnancy is an amazing blessing and each baby is a little miracle. When you get pregnant there is rarely a thought of the Neo-Intensive Care Unit (NICU). The NICU is a place that no one wants their baby to be, but for some of us, that is exactly where they end up. No one can ever prepare themselves for the NICU, nor should anyone have to. The NICU can be a very terrifying place. There are machines and tubes. Some babies have open cribs while others are in enclosed looking machines. There are people everywhere; with nurses and doctors filling your ears with terms that don’t even make sense. All you know is that your baby is in the NICU and not in your arms. The fear, the unknown, the guilt, the everything sets in…But know that YOU are NOT ALONE! There are millions of people out there who have gone through what you are going through. You will hear alarms from everything. Alarms for your baby’s heartbeat, their breathing, their oxygen level, their feedings, their IV, their blood pressure, and their breathing machines. You will sit by your baby’s bed just staring at them or reading their monitor and hoping and praying for everything to be ok. There are times where you may hear that you cannot hold nor touch your baby. “Your baby can not handle the stimulation,” the doctor may say. I am a mom of not one, not two, but three preemie babies. My first son was born at 36 weeks and spent 7 days in the NICU. I started preterm labor at 28 weeks and as a result was in and out of the hospital until they kept me for four weeks on Magnesium. I was sent home at 32 weeks even though I continued to have contractions. The doctor felt the baby and I would be ok to be home at this point. At 36 weeks my contractions became very painful and I knew this was it. Three hours after arriving to the hospital my water broke and the nurse nor I knew it because I had

been leaking fluid. We found this out by my baby’s heartrate dropping into the 40’s and it was discovered I had a prolapse cord. I was rushed to an emergency c-section and Rowan was born at 5 pounds 14 ounces. The twins were a much longer and harder road. I started preterm labor at 23 weeks and was in and out of the hospital for 4 weeks. At 27 weeks Jonas was born at 2 pounds 1 ounce (910 grams) and Rosalie at 2 pounds 2 ounces (935 grams). Both were put on the ventilator within a couple of hours of being born. We knew we had a long road ahead of us but had no idea what was in store. With Jonas, we went through 2 pulmonary bleeds which meant multiple intubations throughout the shifts and the doctors and nurses not thinking that he would make it. Once we got past the pulmonary bleeds we found out on day 10 that he had grade 3 bilateral brain bleed. (Bleeds are on a scale of 1-4, 4 being the worst) I broke down

yet again on this day after being told that he had a 70% chance of having major deficits. After a long day of crying, my husband and I told ourselves that God has them and whatever happens, happens. We turned our faith over to God, the nurses, and doctors. It was 14 long days before we were able to hold Jonas. With Rosalie, we seemingly had it a little easier. She was only on the ventilator for 5 days and we got to hold her on day 10. On day 10 we also found out that she suffered from a grade 4 brain bleed and was told that she had a 70% chance of having cerebral palsy due to where her bleed was in her brain. Needless to say, I lost it! I do not believe that God makes bad things happen to us, but I do believe that God uses what does happen to us in a way to not only teach us but help and teach others as well. God had a plan for us when we ended up in the NICU, I have no doubt about this. I guess you could say the NICU to us was a blessing in disguise. Don't get me wrong, I would have loved not to have been in the NICU but it has made my family the people we are today. The NICU blessed us with a family that we never knew about. This family will forever be there for us and understands every struggle and every success. God took a bad situation for us and turned it into a gift. We have the ability to help other families that are going through what we went through and be able to speak the word of God. I want to thank everyone at Huntsville Hospital who helped keep my babies alive and treated them like their own babies. They all showed love and care towards my babies. They cared for my micro-preemies when I couldn't be there! They are all our Heroes. About 6 months after the twins were born I knew that I needed to write a book to help others through this journey. It took a little over 2 years to do it but I’m glad I did. There were so many times that I didn’t know anyone who went through what we were going through and wished that I had someone who understood. Our families did not really grasp what we were going through. They got to take their baby home, they did not have to leave them at the hospital. They did not have to watch their baby fight for their life.

I decided to write “Preemie Strong,” to help others going through the NICU hopefully not feel so lost. Also, to help those who know someone that is going through the NICU and to understand what they are going through. I hope and pray that this book can bring some comfort and/or understanding to others. $1 of book purchases goes to give back to the current NICU families.

REVIEWS ON AMAZON: Standfield wrote: “I purchased this book to help me understand what some friends had been through. It opened my eyes to a world that no parent ever wants to experience. I'd guess the book will never fully put you in the understanding of what it would be like to be a NICU parent, but it definitely would prepare you or help you to empathize with your loved ones. I'm glad this book was written, and I appreciate the intimate, vulnerable moments that were shared in it.” Arlene Key wrote: “I loved this book for its raw and personal touch. It’s an honest look at the world of NICU with the ups and downs, fears, tears and joys that come with an unplanned, early delivery.” Michelle Solari wrote: “This book is absolutely amazing. If you or any of your family members or friends have had a NICU journey or are going through one now, READ THIS BOOK! So inspiring and encouraging!”

DOvarian I M I N IReserve SHED }

by Brett Davenport, MD

The biological clock. Every woman feels it to some degree. For some women it is a soft whispering reminder that can be drowned out by life’s boisterous pace. Others may hit the ‘snooze’ button in hopes that the reminder doesn’t resurface too soon. Still for others it is like a deafening smoke alarm that may trigger panic. Regardless, it is a call that should be heard and understood in order for a woman to make a good decision regarding her plans for a family.

WHY IS AGING IMPORTANT TO THE OVARIES? Age is an important factor when talking about fertility because it inversely correlates with a woman’s chances of conception and live birth. Even though the average woman’s reproductive window is quite broad, the overall chances of conceiving begins declining much more rapidly around age 34. In other words, the hill down towards infertility becomes steeper. But it’s important to recognize that it is indeed a hill not a cliff (Figure 1). So, what does that mean? Most of the declining live birth rates as a woman ages are due to the aging of her eggs. Aging has several effects on the eggs, including a steadily diminishing number of eggs, decreasing egg health, and an overall increase in the number of eggs that are genetically abnormal when ovulated. This all translates into a decreased ability to get pregnant (decreased pregnancy rate), stay pregnant (increased miscarriage rate), and deliver a baby (decreased live birth rate).

Figure 1

EGG QUANTITY It may be a sobering fact that a woman who is of reproductive age loses a group of 15-20 eggs each day on average. In fact, by the time a woman is 30 years old, only 12% of her egg population that she had at birth remains. By the time she is 40, she has only 3% of this population remaining. As a result of declining egg quantity, many women will begin to have more frequent periods as their ovarian reserve begins to deplete. This can sometimes mean that an egg will ovulate prior to it being fully mature. It is also not uncommon to skip ovulation cycles as egg reserve becomes very depleted. EGG QUALITY Just as the rest of our organs suffer from ‘wear and tear’ as we age, the ovaries are no exception. In an ovary each egg depends on a cluster of cells around it called the cumulus complex for nourishment. These cumulus cells allow the essential nutrients and hormones from a woman’s bloodstream to reach an egg. As a woman ages, this group of nourishing cells begins to become smaller and smaller, causing each remaining egg to be less healthy than in younger eggs.

Inside Medicine | Spring Issue 2019

INCREASED ANEUPLOIDY OF EGGS Just prior to an egg ovulating it undergoes an equal division of chromosomes (the genetic material passed on to your offspring). If an equal division of these chromosomes does not occur, the egg is said to be aneuploid because it will have one too many or one too few chromosomes. An unequal division can occur in women of all ages. However, with age comes an increasing frequency of unequal division and a greater percentage of a woman’s eggs being aneuploid (figure 2). The large majority of aneuploid eggs will not be able to result in a viable pregnancy due to inability to fertilize or implant, or due to miscarriage. For the rare occurrence that an aneuploid egg does result in pregnancy, the child will usually have a syndrome (Down’s syndrome, etc.). Although a woman’s overall chances of having a baby with an aneuploidy increase with age, the absolute risk for a woman who is less than 40 is only 1.5%. • You are already on your way to the most

important step which is gaining an awareness that time is of the essence. If you are in a life position to have children, do it while you can! • If you are 35 or over and have been trying to conceive

Figure 2

HOW DOES A WOMAN KNOW IF SHE HAS DIMINISED OVARIAN RESERVE? If a woman who is less than 35 years old has regular menstrual cycles, she has no reason to be concerned about her ovarian reserve since it is more than likely adequate. However, around age 35 a woman’s level of concern about diminished ovarian reserve should certainly increase. Even though menstrual cycles may remain normal, ovarian reserve is reaching its limits in these women. Several tests exist that will hint at how many and/or the quality of eggs remaining. Antimullerian hormone is a substance secreted by the cumulus cells around the egg, and is a good indicator about the number and/or quality of eggs. FSH during the first few days of a menstrual cycle is also a good indicator of the degree of egg depletion. Finally, an ultrasound can be performed to check the ‘antral follicle count’. This is a snapshot in time of the follicles that are next in the cue to grow and mature, but also hints at how many eggs remain. No test exists that predicts your specific risk of aneuploidy. Aneuploidy rate must be assumed based on your age alone. WHAT IF I DO HAVE DIMINISHED OVARIAN RESERVE? If the above tests do indicate that your ovarian reserve is diminished, here are some things to keep in mind:

unsuc-cessfully for 6 months or greater, it is prudent to allow for an infertility specialist to perform a thorough infertility work-up that will detect any

other potential fertility issues that might further delay or hinder your ability to conceive or carry a child. • An infertility specialist can also help you stimulate

multiple eggs each cycle, which will act to increase your overall chances to conceive each cycle.

• Because time is of the essence, in vitro fertilization (IVF) may be recommended to you in certain situations or if your DOR is severe. IVF will give you the highest chanc-es for pregnancy in the shortest amount of time. This can also allow you to freeze embryos for future use while you still have eggs left. • Your infertility specialist may recommend antioxidants, which may slow the aging process and possibly decrease the aneuploidy rate of your eggs. • Other supplements like DHEA, growth hormone, trans-dermal testosterone, and vitamin D have to date been shown to be possibly beneficial in certain patients with DOR. These should be discussed with an infertility specialist to see if any are right for you.

CAN I DO ANYTHING TO SLOW OR PREVENT THE AGING OF MY EGGS? In short, ovarian aging cannot be prevented, and the most powerful determinant in ovarian reserve and aging are your genetics. However, as with the rest of our organs in our body, the ovaries age slower when they are subjected to less stress. Healthy eating and exercise are the best place to start. Avoiding stressors like smoking, excessive alcohol, and environmental toxins, and minimizing lifestyle stressors are all good ways to maximize the potential of your ovaries. Antioxidants can also help slow this process and can be found in many dietary sources or supplemented in pill form (e.g. CoQ10). WHAT IF I’M NOT READY TO HAVE CHILDREN UNTIL IT IS TOO LATE? For women who are planning to have children later in life, it might be wise to consider the freezing of some of her eggs while she is in her 20s or early 30s. Even women in their late 30’s who are not yet desiring children may opt for egg freezing before their ovarian reserve is depleted. Cryopreservation of her eggs allows for better pregnancy that are consistent with the age of when the eggs were frozen rather than a patient’s current age. This process is called elective egg freezing.

CONCLUSION No need to panic, but also don’t wait until it’s too late to listen to your biological clock. Several ways exist to test your ovarian reserve, and several interventions are available that may help if your reserve is diminished. Anticipate when you might plan for a family and consider freezing your eggs or embryos if you think you may be older and still desiring to have kids. Lastly, don’t hesitate to call an infertility specialist to help you assess your situation! We are here to help! Brett Davenport, M.D., Practice Director Fertility Institute of North Alabama 532 Madison Street, Huntsville, AL 35801 Phone: 256-217-9613 Fax: 256-217-9618

I was a young, first year OB/GYN resident-in-training in a busy hospital in India. It was an exciting environment. I was eager to learn. I enjoyed the constant challenge of learning the art of medicine. Malpractice insurance, medical marketing companies and encounters with lawyers were rare. Physician’s skills were dependent on close observation, careful history taking, learning to “see” with all the senses, and listening to the patient with open heart and mind. The wonders of ultrasound and pregnancy tests were reserved for patients in whom they were considered crucial; ordering them routinely would have caused raised eyebrows among one’s colleagues. Patients were simply pleased with the opportunity to be seen by a doctor. Some of them had to travel for several hours by train, bus and foot to reach the hospital. One of my assignments was a primigravida (a woman who is pregnant for the first time) in her early 20’s in her third trimester. I had diagnosed her baby as an extended breach. The young woman came for her prenatal check-ups with a sparkle in her eyes. Late one afternoon according to schedule, her labor pains began, and she came to the hospital. She progressed through the first stage of labor and began the second stage as the sun went down. I was not worried about the delivery as my attending had assured me that she would be there to supervise me. The nurse on duty and I encouraged the patient to push. My patient complied. The delivery of the body of the baby was textbookperfect. Suddenly, the longest 20 seconds of my career began when the electricity went off. It was so dark in the delivery room that I knew I must see with my hands if this baby was to survive. I palpated the baby’s head and felt the umbilical cord around

by Dr. Sunita Puri

MedCare + 8075 Madison Blvd., Suite 106 Madison, AL 35758

the neck. Groping in the dark, I found a hemostat and scissors while telling the nurse to open the window curtains. A glimmer of moonlight entered the room. I managed to cut the umbilical cord and remain outwardly calm. However, my pulse was racing as I delivered the head without any problem. I stimulated the baby in the dark delivery room and was relieved to hear its first cry. As if it was on cue, the power was restored with the baby’s cry, and the room was suddenly flooded with the modern miracle of electric light. Even today, recalling that special delivery so many years ago causes my heart to race and the proverbial goose bumps to return.

Cancer and Cryopreservation

with Brett Davenport, MD

“I’ve been diagnosed with cancer and will have to start chemotherapy and radiation within a month. I still want to have children, but my oncologist says that the chemotherapy and radiation may permanently damage my eggs. What should I do?” A devastating dilemma surrounded by so many unknowns. Yet far too few females with cancer ever have this conversation. The answer: consider freezing your eggs or embryos prior to undergoing radiation and chemotherapy. FREEZING IS AN OPTION? Although temporary freezing, also called cryopreservation, of eggs and embryos has been around for over 30 years, it has not been until the last decade that these options could be relied upon with much confidence. It was at this time that vitrification, an almost instantaneous method of freezing, became widely available. Even until very recently, only embryos rather than eggs had a good enough rate of survival through a freeze/thaw process to offer the process as a viable option. WHY SHOULD CRYOPRESERVATION BE CONSIDERED? Cryopreservation of eggs and embryos is a way to prevent eggs and embryos from further aging by dehydrating them and storing them in liquid nitrogen. This allows a woman’s reproductive potential to be preserved at the age in which her eggs or embryos are frozen. It also allows a group of a woman's eggs to remain unaffected by future cancer treatments and by further aging. Eggs and embryos can then be thawed and fertilized at a later time when the woman is ready. WHO ARE CANDIDATES FOR EMBRYO STORAGE? Embryo cryopreservation began as a means of storing left over embryos that were formed but not transferred during an IVF cycle. This has allowed a couple to draw from these embryos for future attempts if an IVF cycle is unsuccessful, and for subsequent children even when IVF is successful. Additionally, the ability to preserve embryos has been a blessing to many women who are already with their life partner at the time of cancer diagnosis. It has also been a good option for the stable couple who wishes to electively prolong childbearing.

BUT WHAT IF I DON'T HAVE A PARTNER AT THE TIME THAT I'M DIAGNOSED WITH CANCER. Even 5 years ago the woman with cancer and no partner was left with limited viable options to have a biological child. They would be forced to use a donor's eggs or adopt if their ovaries became damaged by their cancer treatment. However, as techniques have greatly improved egg survival rates after a freeze/thaw cycle, egg cryopreservation is now a viable option that can be offered with much greater confidence. As such, not only cancer patients without a partner, but also other patients in their 20's and 30's are opting to electively cryopreserve their eggs as an insurance against running out of eggs before their desired childbearing is complete. SO HOW DOES IT WORK? Let’s start with some background: A woman is born with every egg that she will ever have, with an average of 300,000 eggs remaining when she starts puberty. Each day of her reproductive life, a small number of a woman’s eggs die. In fact, it is only a very small percentage of a woman’s eggs that will be stimulated and grow during her reproductive life, and even a fewer number that will ovulate and have a chance at being fertilized. In order to cryopreserve one’s eggs, the group of eggs at that given time, most of which would otherwise die, are stimulated with medications that allow them to grow to the necessary size. The woman is then given another medication that matures the stimulated eggs, making them capable of being fertilized. The eggs are retrieved from the ovaries at this time through a vaginal needle with a vacuum.

The process up until this point is identical to in vitro fertilization. However, during IVF the eggs that have successfully matured would be fertilized by sperm and the resulting embryos cultured and grown in a very controlled environment, all of which must be completed before the embryos can be cryopreserved. Contrast this to egg cryopreservation, where the mature eggs that are retrieved can be immediately frozen. Egg cryopreservation not only eliminates the need for sperm availability in order to be able to freeze a woman’s reproductive potential in time, but it also temporarily eliminates the costs of egg fertilization and embryo culturing, allowing this option to become a viable option to so many more individuals. ARE THESE OPTIONS AFFORDABLE? In vitro fertilization costs $9,000-$12,000 with an additional cost of medication being $3000-$6,000. Cost is the biggest limiting factor to most couples. Consider that this factor is even more magnified for the cancer patient who is simultaneously learning about her necessary cancer treatments, which can tally tens of thousands of dollars. Contrast these IVF costs to egg cryopreservation, which allows the procedure, and thereby costs, to truncate once the eggs have been obtained and frozen. Because of this egg cryopreservation costs $5,000 to $7,000 less than IVF. Although the costs of fertilization, embryo culturing and growth, and eventually embryo transfer eventually be necessary, the patient with an immediate need to preserve her eggs and limited means will appreciate the reduced immediate costs. WHAT IS THE TIMELINE FOR CRYOPRESERVATION? It’s important to have an understanding of the timeline that can be expected for egg and/or embryo freezing. It should be noted that each plan can be specially crafted to meet the limited time constraints of a cancer patient awaiting radiation or chemotherapy. From onset of stimulation, medication until retrieval of eggs takes anywhere from 10 to 16 days. The egg stimulation process will only require 4-6 brief visits to your fertility doctor to monitor the growth of your eggs, followed by a visit for the actual retrieval of the eggs. Sometimes, if time allows, the patient may benefit from an individually-crafted priming protocol prior to stimulation that might help to increase her overall egg yield during the retrieval. However this priming period usually is not essential if time does not permit. SO WHAT DETERMINES IF A NEWLY-DIAGNOSED CANCER PATIENT IS A CANDIDATE FOR EMBRYO OR EGG CRYOPRESERVATION? It is essential that the patient and her fertility specialist coordinate with her oncologist to determine if egg cryo-

preservation is recommended and right for her, and how quickly it must be performed in light of the specific cancer diagnosis and individualized situation. These answers will be determined by the specific type and aggression of cancer along with the necessary treatment modality, intensity, and location that is recommended by the oncologist. For example radiation is only a threat if the radiation is focused at a region of the body that is near the ovaries. Conversely, chemotherapy will reach every region of the body since it works through the bloodstream. Chemotherapy’s threat to the ovaries is solely dependent on the type of chemotherapy, with certain types being detrimental to egg survival while other types having relatively little effect on egg health. These concepts undermine the importance of excellent communication between the patient and her multi-specialty team as soon as possible after a cancer diagnosis. ARE THERE OTHER FACTORS TO CONSIDER PRIOR TO EGG/EMBRYO CRYOPRESERVATION? Many cancer patients might be concerned about the additional stress of egg cryopreservation amidst the many other worries that have been cast upon them by this life-altering diagnosis. Will it hurt? Will it alter my energy levels? Will it affect my ability to respond to my cancer treatment? When communicating with your team of doctors, your doctors will outline the risks that must be weighed against the benefits of preserving your reproductive potential. However, usually these risks are minimal. Modern protocols have almost eliminated the risks associated with stimulation. Aside from occasional emotional lability for the 1-2 weeks of stimulation, most patients tolerate the stimulation medications well. During the egg retrieval the patient is heavily sedated so that they do not feel or remember the procedure. Usually the ovaries return to normal size within 1-2 weeks. There has been no evidence that stimulating the ovaries prior to cancer treatment affects the cancer prognosis in any way. CONCLUSION Knowledge is power. Knowledge of the ability to preserve one's reproductive potential against aging and imminent damage translates into the power to preserve one's ability for childbearing, or to electively delay childbearing where appropriate. Sharing this information with your friends and colleagues is a way to help ensure that no healthy woman misses the sacred opportunity to conceive children due to aging or a cancer. It allows more women to have the right conversation at the appropriate time before it is too late. Brett Davenport, M.D., Practice Director Fertility Institute of North Alabama 532 Madison Street, Huntsville, AL 35801 Phone: 256-217-9613 Fax: 256-217-9618

Infant loss is such a sad topic. It is hard to find the goodness when you hear these words. But, praise the LORD, there can be goodness within the sadness. I have much gratitude to God for allowing good and bad things to happen within the last few years. My story is like many others. I am finding strength in my pain, living my life through my sadness, and making the unbearable become bearable. The only way I can do this is with my relationship with God. I was almost 18 weeks pregnant with my second child, a baby boy, when I was told at a routine obstetrician checkup that my baby’s heart had stopped. With a broken spirit, I was sent home to wait until my scheduled induction. That was the longest, worst three days ever. The day of the induction is such a blur. The doctors started my labor early in the day and I finally delivered the baby early that evening. A fifteen hour labor led me to see him, to feel him. He was perfect. He had ten fingers, ten toes. He was supposed to be healthy, but he wasn’t. We had an autopsy that concluded nothing was wrong. Heartbroken doesn’t even begin to explain how I felt. My family gave him a funeral, and then we tried to get on with our lives. The pain in this actually gave me strength to go on. I believe I am blessed to have seen him, to feel the pain in delivering him and then to tell him goodbye. These emotions were and are so real, as was Dalton. Fast forward through rounds of tests and even a exploratory surgery to make certain I didn’t have a medical condition. Again, everything came back normal and I was told I had a healthy body. For two years, I struggled with so many emotions. I held tight to my “heart healing” daughter but longed for the brother we lost. Along the way, my only hope was found in my Savior. The most important thing I did was make sure my relationship with Him was strong. A little over two years from the date I lost my baby, I delivered a healthy “rainbow baby”. He has helped heal my heart more than I can describe. I realize, through this journey, everything is a blessing in disguise. God doesn’t allow things to happen to us but for us. The pain I endured with my loss is definitely hard to handle. But, GOD is there!! He is here!! The closer I am to Him, the easier life is to face every day. I can actually talk, love, trust, and obey the One and Only that holds my sweet baby. I encourage any woman feeling the sadness of infant or child loss to think this way. The closer you are to God and the better the relationship you have with Him, the closer you are to your lost loved one. God is the One who is walking with you through your circumstance, and He is also the One holding your baby for you until He is ready to call you home. I encourage you to find the hidden blessings, find the closeness to God that seems unreal, and look at the loss as an honor. My heart goes out to anyone going through such pain. I love you and I’m truly praying for you all!!

Lullaby

…and Good night! 1. Aim for a bedtime that allows your

child to get at least 9 to 11 hours of sleep. If your child is not going to bed early enough, start moving bedtime up two weeks prior to the start of school, if possible. Move it up 15 to 20 minutes every few days.

The National Sleep Association recommends school age children (6-13) get between 9-11 hours of sleep per night while teenagers (14-17) should aim for 8-10 hours a night. Back to school time typically means back to our regular rou-tine time. This includes afterschool activities, weekend events, and most importantly, bed time routines. During the summer, most of us drift from the normal and allow our children to go to bed later and get up when they want. But, with the new school year starting, it’s important to back the bed time up to ensure children get the recommended hours of sleep they need to function properly. Studies indicate when children do not get enough sleep be-havior problems increase. This includes ADHD symptoms, mood swings, and hyperactivity. It also seems to lead to over eating and obesity. So, getting enough sleep should decrease these things and help create a happy, healthier student/child! Sara Lappe, MD with U.S. News and World Report has eight recommendations to help you and your child become school ready and sleep fulfilled.

2. Set a regular sleep schedule. Your child’s

bedtime and wake up time shouldn’t vary by more than 30 to 45 minutes between weeknights and weekends.

3. Start scheduling a regular wake up time one week before school starts.

4. Create a bedtime routine – yes, even

for older children – that is calming and sets the mind for sleep.

5. Turn off electronic devices at least 60 minutes prior to bedtime.

6. Avoid caffeine and sugary drinks, particularly in the second half of the day.

7. Help your child get ready for sleep by making sure he or she is getting enough physical activity throughout the day. Aim for at least one full hour of physical activity. Outdoor play, particularly in the morning, is helpful because exposure to natural light helps keep your child’s circadian rhythm in sync. 8. As with many habits, it’s essential to

set a good example by making sleep a priority for yourself.

October 13, 2015 by LeChara Fletcher

The events of that day stroll across my mind with untold frequency. Untold, because although those events are familiar to some, the story beneath the story is held dear to my heart and rarely uttered. October 13, 2015 became a milestone day in my life. It was when heartbreak and hope came crashing together. It was the day when my doubts, once buried, resurfaced and presented me with a reality that I thought I had escaped. It was the same narrative with different narrators. Doctor after doctor said the same thing. ‘It’s unlikely that you will be able to conceive naturally.’ I was disappointed but not devastated. I had hope. Doubt would creep in occasionally but I had hope. I had hope for healing but diagnosis remained unchanged. But on a sunny summer day in 2010, change did come. The diagnosis remained unchanged but the pregnancy test was positive. The doctor stared at me for a few moments. I still remember it clearly. He looked at me and said, “Well, congratulations.” He was surprised and so was I. I was on edge; trying to catch up with the reality that this actually happened but also preparing myself for the possibilities. The possibility that something may go wrong, the possibility that this may end abruptly, the possibility of complications, and yes, the possibility of a person, the possibility of being a mom. The healing did not come but the person came. Nothing went wrong and there were no complications. And again in 2014. Nothing went wrong and there were no complications. And there came another person.

The next year had it’s challenges but nothing that seemed insurmountable. One day a dear friend was praying with me and she said, “The grace of God is resting on you.” And again she said, “The grace of God is resting on you.” She said it was so heavy that she could feel it. But since nothing seemed insurmountable I didn’t know what to make of it, but I did think about it from time to time. That year ended up being one of the most difficult of my life. My sighs were of relief and I began to give little thought to the medical condition that still lingered with me. So on October 13, 2015, I was excited and expecting person number three. Everything seemed to be going fine; the fatigue, the morning sickness, all of the usual things. One morning I woke up and felt nauseous, as usual, so I went downstairs to get some crackers. That was around 5:00am. Before I could finish the crackers, my stomach began to cramp severely. It was so severe, that I was not sure I could get back upstairs. I kept watching the clock because I was supposed to take my son to the dentist that morning. As the time approached 7:00am, I knew I had to do something because the dentist appointment was at 8:00. I was able to make it upstairs to get ready. My plan was to take my son to the dentist and then return home to lie down. While sitting in the dentist office, the hygienist was cleaning my son's teeth, but I noticed that she kept looking at me. She asked me if I was okay and I told her that I was not feeling well but I was fine. After this

short conversation, I got up and went to the restroom; I was leaning over the sink praying for the strength to complete what needed to be done that day. I felt light headed, like I was going to faint. So over the sink, I continued to pray for strength. And God was faithful. After we were done at the dentist, we got in the car and went to school. When his teacher saw me she walked out to greet me. She said I didn't look well and asked if I was okay. I told her the same thing I told the dental hygienist, that I was not feeling well but I was fine. She urged me to sit down; she got one chair for me to sit in and pulled another chair in front of me so that I could put my feet up. The pain was so bad that I could not lift my leg so she lifted both my legs and put them in the chair that was in front of me. She began to encourage me to see a doctor. I told her that I was fine and just needed to go home and lie down. She kept insisting that I see a doctor and I kept insisting that I was fine and needed to leave. I knew she meant well, but I didn't want to hear what she had to say. I knew. I knew something was wrong and I knew I was likely loosing the baby, but the pain was so bad that the thought of going to the doctor and having them poke and prod me was almost unbearable. And I didn’t want to go to the doctor and hear those words that I dreaded hearing. The words that I pushed out of my head because everything went so well with the first two pregnancies. I could not process this failure after two successes. I thought I was past that; I thought the hard part was over. I thought that even though the healing did not come, God was showing Himself to be greater than the diagnosis and showing His power in my life. And I was correct. But His power on this day, on October 13, 2015, came in a different way. It was an unexpected way and surely a way that I would not have chosen for myself. But indeed, He showed Himself powerful. My son’s teacher had someone call my husband at work and ask him to come pick me up. My husband came to

I had to make a decision. I had to decide whether to face this moment or not. Her words would not leave me, so I faced the moment.

the school to pick me up. The teacher walked out to the parking lot with us. She stood between the passenger seat and the door, looked me directly in my eyes and said, 'I know you want to go home but I really think you need to see a doctor.' When the doctor examined me he told me that he thought the pregnancy was ectopic and that the fallopian tube had ruptured but he was not sure because there was so much blood on the ultrasound. That same day I had emergency surgery. Yes, the pregnancy was ectopic; yes, the fallopian tube did rupture; no, there was no person number three. Pain in my stomach and pain in my heart. Questions in my mind and torment inside of me. Was there something that I could have done differently? If I had gone to the hospital at 5:00am would it have made a difference? Is the span of this child’s life six short weeks and then thrown out with medical waste? Could this be? These are the moments I had to face. These are the questions I didn’t utter. When the doctor did his rounds and came to my room, he noted that I looked better than when he saw me in his office a few hours before. And I lightly responded that I was not planning to come in to his office that day, but I was going home to lie down. He told me that if I had not come in, I would have bled to death in my house that same day. He said as soon as he opened my stomach, blood began to gush out of me and he collected three bottles of blood from my stomach. He also said that my blood pressure began to drop while I was on the operating table. The tube ruptured around 5:00am when I was downstairs getting crackers. I was in surgery around noon or so. I had been bleeding internally for about seven hours. And it was at that moment, that I had clarity on the bigger picture and saw the evidence of the grace of God resting upon me as was stated in the prayer a few months earlier. He used that teacher and her persistence to save my life!!!! After I was discharged from the hospital, I called the school and told the teacher everything. I thanked her for her persistence. She told me she knew I didn't want to do what she said and that she also knew it needed to be done and that's why she wouldn't let up. My heart still hurts. I am still silent about it more than I am vocal. But I take comfort in this, the body is just a shell and the earth is just a temporary place. I long to know what my baby looks like or acts like. I long to know who he or she is. But this one thing I do know, he or she did not have to experience the weight of humanity but got to skip the earth and rest in the comfort of God. The powerful One, the faithful One, the One who saved my life on October 13, 2015.

What is my DIAGNOSIS? by, Shivani Malhotra, MD

A 28 year-old man presented to an outpatient clinic with a four day history of low grade fever and red spots on his toes and fingers. Symptoms began two days prior to the onset of the blisters with a fever of 100.6, chills, and muscle pain. Lesions started on his left hand and over the next 24 hours, similar lesions appeared on the palm of his right hand as well as the plantar surface of the left and right feet, more prominently on the tips of the toes. He stated lesions burn and hurt to touch. Lesions stopped spreading after two days and he denied experiencing any lesions on the trunk, face, or inside his mouth. As a side note, he noted his brotherâ&#x20AC;&#x2122;s one year old son whom he spent the prior weekend had painful ulcers in his mouth.

Diagnosis: Hand, Foot and Mouth Disease.

WHAT IS HAND, FOOT AND MOUTH DISEASE? Hand, Foot, and Mouth Disease (HFMD) is a viral syndrome most commonly caused by the Coxsackievirus that is characterized by a painful maculopapular or vesicular rash often affecting the hands, feet, and oral mucosa (lining of the mouth). Associated symptoms include fever, sore throat, and an overall feeling of being unwell (malaise). Various strains of Coxsackievirus have been shown to cause HFMD but the most common strain is the Coxsackievirus A16 followed by Enterovirus 71. Since 2008, a novel coxsackievirus A6 genotype has been associated with atypical features and more severe disease in both children and adults than generally occurs with "typical" HFMD, including high fever, a wider distribution of rash, longer duration of illness, palmar and plantar desquamation one to three weeks after HFMD, and nail dystrophy one to two months after HFMD. TRANSMISSION OF THE VIRUS: The viruses that cause Hand, Foot, and Mouth Disease (HFMD) are usually transmitted from person to person by fecal-oral route. However they can be transmitted by contact with oral, respiratory secretions and vesicle fluid. WHO IS TYPICALLY AFFECTED? It is primarily a childhood disease so outbreaks are commonly seen in schools and daycare settings. Coxsackievirus however can also affect adults with some strains affecting a higher percentage of adults than others. HFMD is typically seen in summer and early autumn and often occurs in outbreaks. INCUBATION PERIOD AND COURSE OF ILLNESS? The usual incubation period is 3-5 days, respiratory shedding of the virus is often limited to 1 week. Resolution of symptoms takes from 7-10 days although blistering can persist well beyond this period. DIAGNOSIS? Diagnosis is mostly clinical based on location of lesions in mouth and extremities. For definitive diagnosis, culture from the vesicle can be taken to detect the virus.

COMPLICATIONS? Hand, Foot, and Mouth Disease (HFMD) is usually a mild illness and self-resolving. However in rare cases it can cause severe symptoms such as aseptic meningitis, acute flaccid paralysis, or pulmonary edema. TREATMENT? Treatment for Hand, Foot, and Mouth Disease (HFMD) is mainly supportive treatment. Things you can do to alleviate symptoms include over-the-counter medications to relieve pain and fever (Caution: Aspirin should not be given to children) topical oral anesthetics to help relieve the pain of mouth sores. Cool liquids, sucking on ice pops /ice chips, also avoiding salty and acidic foods help with mouth symptoms. In severe cases, where oral intake is limited, intravenous hydration may be necessary.

PREVENTION? Wash your hands often with soap and water, especially after changing diapers and using the toilet. Clean and disinfect frequently touched surfaces and soiled items, including toys. Avoid close contact such as kissing, hugging, or sharing eating utensils or cups with people with hand, foot, and mouth disease. ARE ANY VACCINES AVAILABLE TO PREVENT HAND, FOOT AND MOUTH DISEASE? There is no current vaccine available in The United States but research is ongoing to develop vaccines to help prevent hand, foot, and mouth disease in the future. SUMMARY: Hand, Foot, and Mouth Disease (HFMD) may often go undiagnosed and lead to over diagnosis and treatment specially if is atypical presentation. Therefore, it is important for the physicians to be familiar with manifestations of common childhood illnesses in adults. Reference: CDC.gov www.cdc.gov/mmwr/preview/mmwrhtml/mm6112a5.htm www.aap.org/en-us/advocacy-and-policy/aap-health-initiatives/healthy-child-care/ Documents/M3_HandFoot.pdf www.uptodate.com/contents/hand-foot-and-mouth-disease-and-herpangina?search=hand%20foot%20and%20mouth%20disease&source=search_result&selectedTitle=1~24&usage_type=default&display_rank=1#H456270599

Shivani Malhotra, MD Assistant Professor, Associate Program Director UAB FAMILY MEDICINE UAB Medicine | Huntsville Regional Medical Campus Alexander McQueen PGY-3 Resident Physician UAB FAMILY MEDICINE UAB Medicine | Huntsville Regional Medical Campus

Improving Indoor

AIR Quality

This month we are asking Joe Knoch a certified ASCS (air systems cleaning specialist—one of only 21 in the state of Alabama ) and also CVI ( certified ventilation inspector)—how would someone know if they need their air ducts cleaned? One of the simplest ways to help determine if you need cleaning is asking yourself a series of questions.

Do you or anyone in your family suffer from the following when indoors? 1. Allergies 2. Asthma 3. Headaches 4. Sore Eyes 5. Sore Throat 6. Flu-Like Symptoms Indoors 7. Constant fatigue

Does your home seem to have the following issues? 8. Dust or dust balls 9. Excess dirt 10. Fur balls 11. Cold/hot spots 12. Discoloration of carpets, drapes or furnishings 13. Musty odors 14. Mice or rodent problems 15. Smokers or previous smokers in the house 16. Pets or previous Pets in the home 17. Previous Fire or Water damage

Have you had any of the following home improvements done? 18. New Home construction 19. Renovations 20. Drywall or painting 21. New carpet or flooring The rule of thumb is if you answered “yes” to more than 5 of these questions, chances are you could very well benefit from a professional air duct cleaning service. If after answering yes to these questions, you still have some questions regarding cleaning, it might be prudent to arrange an inspection of your duct system and HVAC unit with a professional. A word of caution though. Joe explains the term “air

by Joe Knoch

duct cleaning” can be a little misleading as cleaning the air ducts alone in the home is usually not enough. You should look for a service that cleans both the HVAC Unit and the ductwork at the same time. The reason for this is that a lot of mold, dirt and debris sits near or actually can start at or inside the unit and spread right back over or re-contaminate any cleaned ductwork. State law actually requires any company that offers air duct cleaning to carry a certified HVAC license perhaps for this very reason. You can verify if a company is in compliance with state regulations by visiting the AL Board of Heating and Air Conditioning. You should also check out the credentials of a company with NADCA - www.NADCA.com as well as your local BBB. Joe Knoch, President Air Essentials Inc. 256-217-2273 | www.airessentials.com

Trying To Be

AIR HEALTHY

The Tennessee Valley is a beautiful part of this great country, and I am proud to call it my home. Almost anywhere you go, you will see beautiful landscapes of rolling hills, farmland and mountainous regions. This beautiful valley that we live in is also known to hold the pollen and other airborne substances that seem to wreak havoc on many of our nasal passages during certain times of the year. You know, those seasonal allergies that always seem to be “in season” to many of us. Unfortunately, these particles in the air don’t just hang around outdoors. They seem to find their way into our homes and into our lives with no escape. While we can’t walk around outside in an airtight bubble every day to avoid contact with these natural born “enemies”, it is important to our families to minimize these allergens from inside our home the best we can. Not only do our homes become the final resting place to particles originating from our natural environment, they are also the dormitory of many other substances that can be harmful to our health. Dust is the primary ma-

by Brandon Reese

terial that circulates and settles within our homes. This fine powder of earth and waste is usually made up of the plant pollen previously mentioned, human and animal hairs, textile fibers, paper fibers, minerals from soil, human skin cells, and other materials found in the environment. It is hard to imagine that our lungs have to attempt to filter clean air out of this disgusting combination. While our bodies are remarkable machines, protecting it comes with a price and can unfortunately be limited. Allergic reactions to pollen and other airborne particles can, at some level, be managed. Unfortunately, exposure to certain environmental toxins like mold can arguably lead to more severe health conditions. These health conditions are believed by some to range anywhere from respiratory infections to cancer. While it is still hard to prove if and what environmental circumstances could lead to cancer, it shouldn’t be ignored. As we journey into the New Year, it is important to have our homes prepared to protect our loved ones against these potential harmful substances. Many of these preparations are simple and inexpensive measures that shouldn’t be shrugged off as not being a big deal. Things like replacing air filters every 30 days or ensuring ductwork is free of dust and residue build-up are just a couple of preventative measures. Another important precaution is to have your home inspected for mold and unsatisfactory moisture levels. Our southern heat can make attics and crawl spaces seem to sweat with moisture if proper ventilation systems are not in place. We are always looking for help to rid our homes of unwanted pests. Air pollution is a big one! In upcoming issues, we will have expert advice providing tips, tricks and recommendations. There are companies in the area that provide this wonderful service! When it comes to making the air in your home the healthiest it can be, look for a certified Air Systems Cleaning Specialist to help you. www.airessentials.com

Sweet Dreams Additional information: sleepfoundation.org/bedroom/index.php Dr. Elizabeth McCleskey Board Certified in Family and Lifestyle Medicine 103 Intercom Drive, Suite B, Madison, AL 35758 256-280-3990 HealthStylesDr.com

CBD }MISSIONS

What is it really?

There is a ton of buzz about CBD since the legalization of industrial hemp on the federal level. However, for many this doesn’t explain the true nature of the plant, its benefits and how it can help thousands of people. Many people are very confused about CBD, THC and all the other acronyms being tossed around. Breaking it down into very simple terms is important to understand the good behind this plant. Think of this as a beginner’s guide. Marijuana verses hemp. They are different species of the same plant, Cannabis. The basics of the plant are the same, but the resulting outcomes are very different when they are produced (or grown) differently. Their function, cultivation and production are different. The plants themselves, even look different. One produces a higher content of THC (tetrahydrocannabinol) which is what can produce the psychoactive properties or “high”, this is Marijuana. It can contain anywhere from 5-25% THC. Hemp on the other hand contains typically less than 0.3%. Don’t get me wrong, there is some valid use for the psychoactive nature of this plant as well. It is suggested it can help stabilize those with PTSD and several other psychiatric related issues. We won’t dive too deep into this arena here though as it is more detailed than a beginner’s guide. Hemp on the other hand, while it does contain trace amount of THC, not enough to produce any type of psychoactive behavior, is used in more industrial settings. Think of lotions, food supplements and yes even medical uses. It has more than 28,000 uses. Paper, clothing and construction supplies are examples of other applications. It has also been found to have analgesic, anti-inflammatory and anti-anxiety properties*. It really is so much more and to fully understand this, you must know some basic definitions. CANNABINOID any of a group of closely related compounds that include cannabinol and the active constituents of cannabis. CANNABIDIOL (CBD) a major Phyto cannabinoid (naturally occurring cannabinoid) that accounts for 80% of the plant’s extract CANNABIGEROL (CBG) is a parent molecule from which many other CBD’s are made CANNABIDIVARIN (CBDV) homolog of CBD that has reports of anti-convulsive effects*

by Heather Morse, MS, ATC, OTC CANNABINOL (CBN) non-psychoactive cannabinoid with analgesic properties that aids in sleep and appetite regulation* TETRAHYDROCANNABIVARIN (THCV) non-psychoactive precursor and regulator of various key Phyto cannabinoids CANNABICHROMENE (CBC) contributes an overall analgesic, anti-inflammatory and anti-fungal effect* ENDOCANNABINOID SYSTEM (ECS) you have heard of the Digestive System, the Endocrine System, the Neuromuscular system, but you have more than likely never heard of this system. This newly discovered system is found in every animal and regulates a broad range of biological functions. In simple terms it’s a biochemical control system of neruomodulatory lipids and other receptors that can accept certain cannabinoids. Think of this as a specific key needed to open a specific lock. There are special receptors throughout the body. When a specific cannabinoid or combination thereof binds to these receptors the cell is triggered to change its activity. These receptors are so named Cannabinoid type 1 (CB1-R) and Cannabinoid type 2 (CB2-R), located all over the body. For example, the brain has CB1 and our immune system has CB2 receptors. There are three different types of cannabinoids that can unlock these receptors and contribute to promote homeostasis in overall health and wellness. THE BODY'S ENDOCANNABINOID SYSTEM

ENDOCANNABINOIDS endogenous-fatty-acid cannabinoids produced naturally in the body PHYTO CANNABINOIDS concentrated in the oily resin of the buds and leaves of plants such as cannabis (remember Cannabis is a plant, marijuana and hemp are species). SYNTHETIC CANNABINOIDS manufacture by artificial means in a laboratory (this type has been prescribed to patients needing appetite stimulation) It is important to note that the cannabis plant contains over 113 different cannabinoids, but the main two are CBD and THC. Now that you have a basic chemistry and definitions lesson under your belt, letâ&#x20AC;&#x2122;s talk about the differences between CBD and THC. Both interact with the endocannabinoid system (ECS). THC is the main psychoactive ingredient in marijuana. This compound works by imitating the effects of anandamide, a neurotransmitter produced naturally by the body to help modulate sleeping and eating habits, as well as the perception of pain. It binds to the CB1-R and CB2-R receptors in the body. For this reason, it has been used successfully to help with discomforts associated with chemotherapy, multiple sclerosis, glaucoma, AIDS, spinal injuries and more.* The amount of THC produced by the plant can also dictate the psychoactive effects. Low doses can trigger the appetite, while large doses can trigger paranoia. CBD has the same chemical formula as THC, but the atoms are arranged differently, thus giving it non-psychoactive effects. CBD does not bind with CB1 or CB2 receptors, it signals the bodyâ&#x20AC;&#x2122;s naturally occurring cannabinoids to do what they naturally do. This too has proved to help with discomforts associated with anxiety, depression, muscle spasms, pain, inflammatory conditions and more.* CBD can counter act the effects of THC. It is worth noting that isolate CBD versus full spectrum will give differing results. Most CBD is made from industrial hemp, thus having minimal THC and has been processed at high temperature eliminating the spectrum of other cannabinoids. CBD oils made from marijuana would have to have the THC processed out, thus becoming an isolate. This process degrades the quality and effectiveness of the CBD itself. But when CBD is made from industrial hemp (continuing less than 0.3% THC) the need to isolate it out is not necessary, unless you live in a state that it is all illegal. Federally CBD made from industrial hemp is legal in all 50 states. CBD made from marijuana EVEN when the THC is processed out is only legal in states that medical or recreational marijuana is currently legal. There are challenges in each state as the confusion over the plant

itself, its medicinal uses and frankly its impact on the pharmaceutical, cotton, paper and other industries come into concern. Salt on the Rocks offers ECN (Enhanced Clinical Nutrition) products for many reasons; mainly because of the pain managements physicians we work with trust this product for their chronic pain patients. ECN uses a proprietary extraction technology that allows for high levels of Phyto cannabinoids, while eliminating unwanted amounts of THC. This process leaves the full spectrum profile of non-psychoactive Phyto cannabinoids and synergistic compounds like CBG, CBN, CBC and over 40 terpenes intact. ECN 3rd party tests their product to ensure there are no traces of THC and only full, rich oil with no solvents, heavy metals or pesticides remains. Each batch we sell has its own lab reports that we are happy to provide to anyone. You can find ECN products at Salt on the Rocks. ECN products are not a MLM product line and are only available in our store.

Heather Morse is the owner of Salt on the Rocks, a new destination experience with Salt Therapy. The Remedy Room inside Salt on the Rocks offers a variety of natural remedies for the beginner, including herbs, oils, teas and tinctures. You can find them at the corner of Bob Wallace and Whitesburg Drive. Visit SaltontheRocksHuntsville.com for more information.

Salt on the Rocks also offers educational classes in CBD. Visit their website at www.saltontherockshuntsville.com to learn more about upcoming classes and events. *These statements have not been evaluated by the FDA. This product or claims are not intended to diagnose, treat, prevent or cure any disease. Content source: MedicalJane.com and Enhanced Clinical Nutrition LLC, 820 W Danforth Rd #A-52, Edmond, OK 73025

Bidding on the

"HOT HORSE" by, Kristen Scroggin

During a trip to Louisville, Kentucky, I went to my first horse race and “bet on some ponies.” Don’t get excited, it was $5.00, but I learned an important lesson. When you get a tip about a “hot horse,” you should bid more on it.

I’m not saying buy a racehorse. I’m not saying abandon your job and bet on horses from now on. I’m saying, bet a $20 instead of a $5 because when it wins, you’ll win. In December of 2017, while researching new US census projections, I found some unusual patterns emerging. First, 47% of the American population is UNDER 33 YEARS OLD! How will that impact your current company succession plan? Next, Millennials, ages 14-33, are the largest generation in US history (86 million people) and will stay between 43%-41% of the eligible workforce for the next 30 years. There are so many of them that the birth rate and death rate balances. This information makes the Millennials a “hot horse” you should definitely bid on. Let me put the next 30 years into perspective for you. • As the economy turns around (as history predicts), many of those Baby Boomers (ages 65-74) who are already retirement age, but haven’t retired due to MONEY (not because they are panicked about not having anything to do), will actually retire. • 2030: ALL Baby Boomers are officially “retirement age.” While the first ten years of the generation has been clinging to their corner office, the second ten years, aka “flower children” ages 53-64, are not quite as obsessed with work. IF they have the money, and their kid finally move out of the basement, they will retire. That’s only 12 years from now! • 2040: The majority of your current upper-middle management, (ages 43-53) WILL be retiring. Hear me on this, genX will be getting out the MOMENT they can, which means for ten years you will lose people rapidly. Our recent genX focus group told us most don’t plan on waiting until 66 to retire, they’re aiming for 57 and we hear this number consistently. Estimate: 22 years •2050: ALL of the genX/Xennials (ages 33-43) are “retirement age.” Assuming they haven’t already cashed in their 401K’s and bolted, you will likely lose all of your middle management if you aren’t steadily bringing in, and promoting, Millennials as of 2018. Estimate: 30 years +/This data becomes more significant considering US companies are having a difficult time RETAINING Millennial employees for longer than 18 months.

Our research shows this is partially due to the current design of the American workplace, which is utterly unappealing to this generation. Quite honestly, it’s unappealing to most genXers & Xennials too, but they don’t have the numbers (only 40 million, half the size of Boomers or Millennials) to force significant changes. Additionally, Boomers aren’t retiring from policy-making positions, so genXers don’t have the power to make the changes that often appeal to Millennials unless they start their own companies. In a 2017 Forbes survey about companies where Millennials most want to work, most of the top 10 are either run, or founded by, genXers. Amazon Founder Jeff Bezos is 54; Google Founders, Larry Page, and Sergey Brin are 44; and Apple’s CEO Tim Cook is 57, just to name a few. However, companies implementing benefits M illennials want not only are attracting the best of the generation (we call them the “Rockstar Employees”, but they are retaining them, thus ensuring their companies live past the next 30 years.

Kristin Scroggin genthempodcast.com

the power of people

Benefits of joining professional organizations by, Kari Kingsley, MSN, CRNP

No matter your f ield of study, joining a professional organization can be a win-win. Humans are social creatures (yes, even you Mr. Introvert). People thrive on acceptance and being part of a group. We naturally seek the approval and companionship of others to improve our well-being. Take it from me, literally, the girl who was always picked last for kickball in elementary school. But besides the benefits to our self-esteem and our sense of morale, professional organizations provide so much more. At the request of a mentor, I signed up to become a monitor at the 2008 North Alabama Nurse Practitioner (NANPA) Symposium. She asked me dress up as a cowboy in keeping with that year’s theme. As a baby nurse practitioner student, I was mortified to go around fellow students and future colleagues in such a ridiculous outfit. But the entire event was inspiring. I was in awe of our local organization and the amount of comradery, laughter, and information that was circulated. I volunteered again at the next year’s symposium and by graduation of 2010, not only did I have a job, I had a seat on the Board. To this day, I find myself dressing up each year to suit our theme. Regional, state, and national professional organizations are a great venue to acquire knowledge about your field. Monthly meetings and yearly symposiums provide valuable information on industry standards, codes of ethics, and what’s being done on a legislative level to improve your profession (as well as your life). Professional organizations provide avenues for advocacy on the things you feel are important in your field. Nurse practitioners have fought their way from the ground up to be able to see and treat patients. Their scope of practice has filled giant gaps and provided thousands of patients with competent healthcare. For many careers, public relations are crucial. I would have never considered myself a “networker”. Yet it is amazing the connections I have acquired over the years. As a nurse practitioner, it is beneficial to my patients to have so many colleagues available for their diverse and complex conditions. It’s like being in a really safe, really polite mafia! Not to mention, if you

are on the market for a new job, local organizations are a great place to hear through the “grape-vine” about positions that are available as well as places you would love (or not love) to work. For those that don’t work, consider joining a charity. The rewards of helping others are huge. Volunteerism forces virtues out of us that might otherwise remain locked away. Kindness is contagious. It creates a ripple effect that improves humanity. Always pay it forward. Charity doesn’t have to mean opening your checkbook. It can come in the form of physically moving sand bags as flood waters approach or through guiding a loved one through a difficult situation. Charity isn’t an involuntary action. It’s a conscious decision made to help others. The psychological ramifications to both the giver and the recipient create a feeling of belonging desperately sought after by our species. Our local nurse practitioner organization provides monthly meetings hosted at nice restaurants with up-to-date talks on pertinent medical information. Wait.Let me get this straight…. You’re going to feed me steak and lobster while I learn about something pertaining to my field of study and I get to drink a glass of wine and hang out with my friends? Sign me up! Our yearly symposium provides nurse practitioners and medical professionals from all over the southeast an opportunity to sharpen their skill set with up-to-date lectures provided by knowledgeable presenters, all while gaining continuing education credits and eating gourmet cuisine (yeah, food is kind of a big deal for me). But a few words of caution before you go plunging headlong into 10 different professional development organizations. Do it right. Start small. Don’t run for office until you’ve dipped your toes in the pool. Don’t over commit in an effort to become part of the gang. Remember why you are joining. The goal is symbiosis: you get from the group what the group gets from you. Anytime the balance shifts, readjust. Whether that

means establishing boundaries and saying no, or pulling your share of the rope. And remember to be accepting of others. Although humans are social creatures, we wouldnâ&#x20AC;&#x2122;t live in a house with of our 50 closest relatives. Personality types differ. Everyone marches to their own drum. Remember to listen to others in the hopes they will listen to you. My professional organization has provided me with more confidence as a nurse practitioner. I have acquired many lifelong friends and learned more about the field of medicine. I blame them for a gradual 10-pound weight gain over the years, but itâ&#x20AC;&#x2122;s been totally worth it.

Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 10 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine

Live like a S.H.A.R.K.

Depression Recovery by Mark Beaird, LPC, NCC

Depression is a common ailment noticed more during the winter months, perhaps because of the gloominess of winter and reduced hours of sunshine. Just the same, people of all ages experience depression year-round. Unfortunately, many of them will have struggled for years before seeking help. Misunderstandings about depression that stigmatize individuals who admit to being depressed are being “just lazy” or as having a negative attitude or they just need to “cheer up.” None of these are true. Depression is not an attitude; it is a physical ailment that can greatly affect one’s attitude. According to the National Institute of Mental Health, symptoms include: • Persistent sad, anxious, or “empty” mood • Feelings of hopelessness, or pessimism • Irritability • Feelings of guilt, worthlessness, or helplessness • Loss of interest or pleasure in hobbies and activities • Decreased energy or fatigue • Moving or talking more slowly • Feeling restless or having trouble sitting still • Difficulty concentrating, remembering, or making decisions • Difficulty sleeping, early-morning awakening, or oversleeping • Appetite and/or weight changes • Thoughts of death or suicide, or suicide attempts • Aches or pains, headaches, cramps, or digestive problems without a clear physical cause and/or that do not ease even with treatment Not all of these symptoms have to be present for a person to be depressed. For example, many people who have depression never experience a desire to harm themselves. Depression can also be at a mild, moderate or severe level. Some levels of depression require medical treatment and some do not. See a qualified professional. Those dealing with depression usually have the tendency to withdraw, isolate and become inactive. Having suffered from depression myself in years past, I’m well aware of how enthusiasm runs low. Commitment can waiver. Isolating feels natural. These and many other temptations can lead a person to give in to the darkness of depression.

One day when thinking on this issue, I thought about sharks needing to constantly move to stay alive. As it turns out, the shark needs to keep oxygen-rich water constantly flowing over the gills. My analogy for those battling depression is to be like a shark. Keep moving. To become motionless threatens our survival.

To illustrate my point and to give some concrete steps to take, let’s use the acronym, S.H.A.R.K.

Set a pace of life you can maintain. Often, I encounter people

suffering with depression who have overextended themselves in both time and commitments to others. These are often the people who also do not feel they are depressed, but rationalize their feelings as being ill-tempered or stressed because of their busy pace of life. Reasonable expectations for activity, productivity and socialization each day are essential to dealing with depression. Instead of trying to reach big goals, focus on developing consistency in activity and productivity throughout each week.

Hold to your purpose. For the person working to recover from depression, it is important to remember to stay focused on achieving your goal of feeling better emotionally and physically. Trying to set your mind on achieving too many additional goals can increase your difficulty. Simplifying your life and narrowing your focus to what is really important can yield better results. Your purpose is to move forward in life productively—not to impress or please others. Becoming physically and emotionally healthy is essential to beating depression. Simple actions can help. For instance, in spite of the desire to isolate oneself, resolve to stay in touch and active with supportive individuals or social groups. Have as much “fun” as possible. Talk with your doctor about an exercise plan. Eat healthy and work to improve your sleep quality. Alternate between tasks. Motivation can run low when one is depressed. Life can easily feel like a rut. While maintaining a routine can be helpful, most people need more than one task or activity in which they can invest themselves. When energy runs low for one, switch to the other and vice versa. Alternating between defined and prioritized tasks—not purposes—provides variety. A variety of experiences each day will help one stay out of a “rut.” In each day, plan to include a mix of tasks, enjoyment, and exercise. Reward yourself. Periodic times of enjoyment, even in a

busy hectic life, are necessary for good mental health. As long as the reward is physically and emotionally healthy, take time to indulge yourself. Of course, this excludes excessive eating, alcohol use or other substance abuse or behaviors that can become addictive. Reward yourself in a healthy way for your healthy behavior by getting a massage, having a meal at your favorite restaurant, going to a movie with a friend, take a day off work to go do something you enjoy. Celebrate your progress, speak positively to and about yourself and stay away from negative people.

Keep moving. There doesn’t have to be monumental prog-

ress every day, but there needs to be progress or sustained effort. During times when we are tempted to become inactive, I often suggest that people resort to using an egg timer or a timer on your phone to create active time periods which have a clear beginning and end. The idea is to designate a beginning and an end to activities we have low enthusiasm for, such as cleaning house, doing paperwork, and other necessary chores and commitments. For example, set a timer for 20 minutes and do whatever needs to be done nonstop for 20 minutes. At the end of the 20 minutes you can stop. If a person does this three-times-a-day, they will have at least one hour of productivity per day. Obviously that 20-minute period of time can be repeated throughout the day as many times as you wish. There are many resources as well as medication that is not addictive and can’t be abused. Medication is not always required; nonetheless, an acceptance of what you are experiencing will be required before the healing can begin. Let today be the day your healing begins! Mark is a therapist and co-owner of Covenant Counseling and Consulting www.covenantcc.co

by Bradford Meythaler

Aging-in-Place Guide: How to Stay in Your Home in Later Life The number of Americans who first grew up with rock ‘n’ roll, astronauts and McDonald’s is off the charts. The late 1940s through early 1960s were marked by a boom in the U.S. economy, suburban living and especially, babies. Lots of babies were born during this time period— some 76.4 million notes the U.S. Census Bureau.

These boys and girls who lived through the Cold War and cold cuts on Wonder Bread® are now aging individuals who almost all agree on one thing: living in their own home later in life. Nearly 90 percent of the nation’s aging baby boomers want to age in place. The American Association of Retired Persons (AARP) reports that 75 percent of adult children and 69 percent of the parents think about the parents’ ability to live independently as they get older. But how will these aging seniors remain comfortable and safe at home? What proactive steps can help safeguard everyday activities for older adults inside and outside the home? “As loved ones age, certain conditions like visual changes and weaker muscles can affect balance, or some diseases and medications can cause cognitive issues,” said Bradford Meythaler, President of Right at Home Huntsville. “When seniors face health concerns as a result of aging, their risk of falls and injuries escalates, and sometimes their home itself is hazardous. This is why it’s essential to assess regularly a senior’s health and anything in the home that might be a safety concern”. To reduce potential home hazards for older adults, Meythaler recommends the free Aging-in-Place Guide developed by Right at Home with Dr. Rein Tideiksaar, a leading gerontologist and geriatric physician assistant who specializes in fall prevention for the elderly. The Aging-in-Place Guide helps senior adults and their families spot home safety concerns and create an individualized plan around the elder’s functional abilities, including getting out of bed and bathing. The guide includes a checklist of risks for home accidents and tips for making a home safe again if health or environmental factors arise.

For more information about home safety for older adults and to

receive a copy of the

Aging-in-Place Guide, contact 256-585-3140 or www.rahhsv.com

The safety solutions can be as simple as adding brighter lightbulbs and more light fixtures to solve inadequate lighting. Adding carpet tape can smooth out curled carpet edges. For more extensive fixes, the guide outlines home modifications and remodeling such as installing bathroom grab bars, widening doorways and enlarging rooms. The Right at Home resource also highlights home-monitoring technology that is becoming more user-friendly and affordable to protect seniors at home and provide families with greater peace of mind. These secure-at-home options include updating the home with smart auto-set devices to simplify daily tasks such as opening or securing windows and doors, turning off appliances, and lowering countertops and shelves. Typically, older adults accept only two or three modifications to their home at a time, so Meythaler advises that families create a priority list and together work from that. “Sometimes, a simple adjustment like removing clutter from pathways or changing out hard-to-grasp doorknobs with handles is an easy fix and all that is needed to protect a senior at home,” said Meythaler. “The Aging-in-Place Guide identifies specific home hazards and clear-cut solutions. It’s also important to include the elders in health and home safety conversations and to give them a choice of the best living space options. With the right planning, living enjoyably and safely at home is fully possible for most of America’s seniors.” ................................................................................................................................. About Right at Home Founded in 1995, Right at Home offers in-home companionship and personal care and assistance to seniors and adults with a disability who want to continue to live independently. Local Right at Home offices are independently owned and operated and directly employ and supervise all caregiving staff, each of whom is thoroughly screened, trained, and bonded/insured prior to entering a client’s home. Right at Home’s global office is based in Omaha, Nebraska, with franchise offices located in 45 states nationwide and throughout the world. For more information on Right at Home, visit About Right at Home at http://www. rightathome.net/about-us or read the Right at Home caregiving blog at http:// www.rightathome.net/blog. To sign up for Right at Home’s free adult caregiving e-newsletter, Caring Right at Home, visit http://caringnews.com. About Right at Home of Huntsville The Huntsville, Alabama office of Right at Home is a locally owned and operated franchise office of Right at Home, LLC, serving the communities in Northern Alabama. For more information, contact Right at Home of Huntsville at www. RAHHSV.com, 256-585-3140 or by email at bradford@rahhsv.com.

Improving the Quality of Life for Those we Serve

G E N E R A T I ONS

X IS

TNERRUC

90 74 55 39 19 0

IMFall'19.indd 10

1901- 1926

ATURE

1927- 1945

ABY BOOMERS

1946- 1964

GENER

1965- 1980

ATION X

MI LLENNI

ALS

1981- 2000

GENER

ATION Z

2001- p r esent

Nalin Dang

8/28/19 2:38 PM

MOVE OVER MILLENNIALS...

There's a New Generation on the Block by Kari Kingsley, MSN, CRNP A generation of people is regarded as all of the people born and living at about the same time, regarded collectively. But there is so much more to it! Each generation has its own culture… its own fashion, music, and vernacular lingo. There are currently six generations still alive in America today. The oldest of which is the GI generation: those born from 1901-1926 to children of World War I who went on to live through World War II. They remember living through the Great Depression and have generally been regarded as community-minded, strong individuals with deep loyalties. The Mature (or Silent) Generation were those born between 1927-1945 growing up in a world of conformity and structure but later embracing postwar peace. This generation is known for their strong morality and near-absolute standards of right and wrong. Baby Boomers arrived on the scene between 1946 through 1964 and embraced peace, love, and happiness with optimistic and opened minded personalities. Generation X was born from 1965 to 1980. History will remember them as entrepreneurial and very individualistic. Enter Millennials. Those born between 19812000. Born in 1983, I guess that makes me a millennial, although, truth be told, I have never identified as such. From birth, we have been told we are special and we expect the world to treat us that way. Each generation wonders whether or not the generation before them was the best. I contemplate frequently about my parent’s generation. Baby boomers…. hippies and freelove seem to speak to the soul. My parents idolize their World War II parents, calling them “the greatest generation” ever to live. America is also a melting pot, with immigrants reshaping our cultural and generational landscape for the better. To hear the word millennial nowadays is almost associated with a bad connotation. But what if these millennials were evolving into quite possibly one of the best generations to come? Meet Generation Z. Look out millennials… we may be in for a run for our money. Generation Z-ers have grown up with computers and web-based learning. Five-year-olds now know more about cellphones and laptops than we did finishing college. As each generation contemplates the impact they will leave on society and the world,

IMFall'19.indd 11

it helps to see those working so hard to make a difference. One such young man is Nalin Dang. Nalin is a senior at Randolph High School with aspirations of helping to reshape not just our community but quite possibly the world. Nalin became inspired by his grandmother’s journey to find, not just adequate, but exemplary memory care for dementia. As his family pulled together to find effective treatment, particularly at home for an affordable price, Nalin, at 17-years-old, realized the Tennessee Valley did not yet have such a program in place. Most teenagers would have acknowledged this and moved on. Struggles of homework and teenage responsibilities are enough to keep any high school student busy, right? But Nalin decided to build his own in-home memory care program when his grandfather was later diagnosed. Nalin’s grandfather thrived with the program. The family was thrilled with the results, so Nalin then made the choice to dedicate more time and energy into creating a program to offer memory care assistance to others in need, free-of-charge. In 2017 Nalin launched We Can Remember HSV. We Can Remember is a non-profit organization created to help those in need to maintain or improve their memory function over time. Memory loss affects the majority of our society’s elders. These members of society are some of our greatest national resources. They hold stories and information that educate us on our history, helping us understand just why we are the way we are. Nalin sees them as national treasures and works tirelessly to ensure their mental capacities and strengths are optimized. He appreciates that some of our greatest lessons can be learned from these older generations. We Can Remember is an eight-week program offering specialized memory care exercises based on the severity of impairment. Nalin’s goal throughout the program is to help the individual recall more of their memory. Ongoing in-person memory exercises will continue to minimize forgetfulness and aid in maintaining function. Nalin and his team of volunteers strive to complete the program in four weeks, but work as long as it takes to achieve improvement in their patients. Each patient session has various memory exercises. A volunteer from We Can Remember is sent to the elder’s house to work on improving memory skills through specific games and activities, making the lesson both helpful and enjoyable for the participant. I made the (wrong) assumption that Nalin had created We Can Remember as part of a school project or extra-credit assignment. That will teach me to assume. Nalin dedicates countless hours of his free time to work for those with memory impairment. He is a family oriented young man with hobbies not unlike those of other

8/28/19 2:38 PM

teenagers. He enjoys hanging out with his friends and several extra-curricular activities. His role models are his parents, Paul and Neeta Dang, both local physicians. He is quick to say he is not exactly sure what direction his college ambitions will take him, but that he is intrigued by neuro-science and hopes one day this passion will manifest into a career. He is also inspired by Stephen Hawkins and both his physical and intellectual journey through life. Nalin finds it admirable that he never let his physical impairments, with all the struggles and doubts they entail, derail him from studying the origins of the universe. Nalin is also greatly inspired by his older siblings, Rajan, Sumeet, and Sabina: a physician completing his ENT residence at Washington University in St. Louis, a Harvard law graduate, and a medical student at Vanderbilt respectively. Nalin tutors piano in his spare time. He has also volunteered at Clearview Cancer Institute and Manna House. Clearview later brought him on as a medical assistant to help in a research study involving Multiple Myeloma. George Santayana once said, â&#x20AC;&#x153;Those who do not learn history are doomed to repeat itâ&#x20AC;?. After getting to know Nalin Dang, I think he not only embraces this concept, but is actively making strides to ensure that our generations with the most knowledge of our history are able to access the great gift they bestow. In this age of coming into our own and creating makeshift confidence, itâ&#x20AC;&#x2122;s refreshing to see a young man use not only his intellectuality, but also his free time to make the world a better place. Nalin Dang and the Generation Z he represents is serving up some pretty stiff competition for the rest of us.

For more information on We Can Remember please visit www.wecanremember.com.

IMFall'19.indd 12

8/28/19 2:38 PM

Inside Medicine | Holiday Issue 2017

by Anne Jewell President, Cox Associates, Inc.

long-term care

and Your Future

Former First Lady Rosalynn Carter

said it first:

“There are only four kinds

of people in the world: those who have been caregivers, those who are currently caregivers, those who will be caregivers, and those who will need caregivers.”

Rosalynn Carter was perhaps the first public figure to champion the cause of those Americans— now more than 65 million — who care for those who are older, chronically ill or disabled, or live with special needs or mental illness. Long Term Care (LTC) is pervasive in today’s world. More than 50% of all Americans will need long term care in their lifetime. LTC includes a wide range of medical and support services for people with

cognitive disorders, prolonged illness, degenerative conditions, or the result of trauma or accidents. If these numbers make you think that long term care affects older individuals, you are correct. But younger people also need to consider long term care as part of their overall risk-management plans because accidents and illnesses prey on younger people, not just the aging. To better understand, think

of LTC as not only medical care but also “custodial care.” This can involve providing assistance with activities of daily living such as eating, dressing, bathing, transportation or supervision of someone who is physically or cognitively impaired, or both. Long term care can be provided in many settings including your own home, adult day care programs, assisted living facilities and nursing homes. The need to make plans for Long Term Care coverage is real, and there are many reasons to consider products that offer such coverage. Most importantly among these is to preserve your independence and freedom of choice to stay at home or move to a specified care facility. LTC coverage removes the burden of your care from your family members, it can preserve a spouse’s standard of living, it can preserve and protect assets. Longer life expectancy and rising health care costs are trends that will continue to increase the value of a good LTC plan. And the list goes on.

As Clint Eastwood might say, “Are ya feeling lucky?” We’d rather say, “Isn’t it smart to do a little planning... just in case.” .......................................................................................................

So what’s your plan for living a long life? Into your 80s or 90s? Maybe even longer? Today, long term care is the greatest uninsured risk Americans face. Planning now - while you are younger and still in good health–is a critical step to protecting your financial Independence, your retirement assets and your future choices.

I urge you to call for a no-cost consultation as an

opportunity to learn more about the potential risks, costs, and options available. Anne C. Jewell | 256-533-0001 Some data provided by the American Association for Long Term Care

A New Phase in Life...

“The longer I live the more beautiful life becomes.”

It has been more than 17 years since I entered a new phase in life and journeyed into the world of senior living. Like many seniors who plan to retire but not for senior living, I prepared for a career in healthcare but not in senior living. However, once I discovered the joys of senior living, I found myself saying like so many seniors who make the choice for assisted living do, “Oh, how I wish I had done this sooner!” I found so much more than a career. I found my calling; I found my passion…serving seniors and their families through this new phase of their life. What does this new phase look like for seniors? Independence! When a senior chooses assisted living, they often find more of the one thing they fear losing the most – their independence. Because the support system is built in to the assisted living community, a resident has the support for things they may need like meals, housekeeping, maintenance, transportation and activities of

daily living such as bathing, dressing, grooming, and medication assistance if needed. Sometimes, it is just the simple peace of mind that someone is there. I do not make light of the transition of moving from your home into an assisted living community. However, I can tell you what hundreds of residents and families have shared with me over nearly two decades. On the other side of the move, there is so much more than housekeeping and meals, more than birthdays and bingo! Residents find meaning and purpose, renewed hobbies and perhaps the discovery of new ones. There is conversation, laughter and friendship. There are precious memories being made, every day. Independence. That is what this new phase in life looks like for the senior who chooses assisted living. As I have served seniors in many wonderful communities and had incredible mentors along the way, I am thrilled that today

Frank Lloyd Wright

my new phase in life brings me to a fantastic new senior living community just around the corner from my alma mater (Grissom High School) and the church where I was baptized (Willowbrook). A new community where our founder was raised with excellent customer service principles and in 2008 decided to bring a new, innovative approach to assisted living. A community where our President was a Resident…a community where it is truly Assisted Living Like You’ve Never Seen Before! With this new phase in life, I am Thriving! As Robert Browning said “Grow old along with me! The best is yet to be.” Do you have questions about Senior Living Options? Please call to explore the options available in the North Alabama area. Michelle Herrin-Anderson 256.429.0038 michelle.anderson@thriveatjonesfarm.com

Long Term Care Benefits And Features

Women today have a greater risk of needing Long Term Care services. It's very important for women to develop a Long Term Care strategy to help preserve their family, career, lifestyle, health and total financial future. Long Term Care protection can save a by Anne C. Jewell woman from the high costs of care. It also People have become and independence more aware of the need for provides them withmore choice, Long Term Care. It is imprtant to understand the and most importantly, to not befora you burden on benefits andBy features that the policies provide. loved ones. arranging Long Term CareLong Term care policies cover the insured for home care services, nursprotection for others, women can stay on ing home services, assisted living, adult daycare, alternate track protect savings theirHome care care,to hospice andtheir respite care forand thekeep caregiver. career. services can be skilled or non-skilled nursing care, physical Chances are that youaides. have experienced therapy, and home health These services must be provided for by state licensed certified health agencaring a loved one and/or at some point home in your cies. In a state licensed nursing home, the care life, so you know how demanding it can be. provided may love be skilled, intermediate, custodial Your for others is whyand/or you should docare. Alternative Care is most often for home modifications. Respite something bold and begin planning for care is temporary care for the insured to provide relief for Long Term Care now. their usual caregivers.

Long Term Care benefits may vary from carrier to carrier but there are two criteria you must meet for benefits to be received: the Benefits Trigger and the Elimination Period. The benefit triggers are used to determine if you are eligible for long term care benefits. Typically, not being able to perform 2 of 6 activities of daily living or a cognitive impairment, such as Dementia or Alzheimer’s, will qualify an individual. The “activities of daily living” (ADL’S) include eating, bathing, dressing, toileting, transferring (getting form a chair to the bed), and continence. A board certified physician has to document that the patient is not able to perform these basic daily functions. Once you are deemed eligible, the insurance company will approve a Plan of Care, on your behalf, that outlines the benefits for which your plan will provide. The elimination period is the amount of time that must pass after a benefit trigger occurs. This is typically 30-90 days from the time care is needed. During the elimination period, the insured is required to pay the cost of all services received. The longer the elimination period, the lower the premium, although this longer period requires more out of pocket costs. There are many features in a Long Term Care contract. This includes daily benefit, length of elimination periCall your local Long Termbenefits Carefor inflation, od, duration of benefits, indexing waiver of premium, non-forfeiture, renewability and professional for more information. shared care, just to name a few. All of these features will Anne C. Jewell, 256-533-0001 play a role in the policy premium. When considering the purchase of a Long Term Care contract you will need to review all the features. I urge you to call for a no cost consultation as an opportunity to learn more about the potential risks, costs, and options available.

Care for yourself the same way you care for others.

YOUR FUTURE AND YOUR CARE: PLANNING AHEAD FOR YOUR FAMILYâ&#x20AC;&#x2122;S FINANCIAL SECURITY by Anne C. Jewell

You have worked hard to support your family and to en-sure their bright futures. You have worked hard to help them grow into independent people. And, if you are like the rest of us â&#x20AC;&#x201C; you can help them stay that way. No one wants to think about the possibility of needing care for an extended period of time. Have you considered the fact that 70 percent of people turning 65 today will eventually need some form of long term care in their life-times? 20 percent will require LTC for more than 5 years. With a little planning, you can have options to receive the care that you need and desire. This includes Home Health Care, Nursing Home Care, Assisted Living and Adult Day Care. By planning before retirement, you can elim-inate the emotional stress and financial stress associated with finding and maintain the care that is needed. In the event that you need Long Term Care you will want to maintain your independence, control your care, protect your family and lastly, preserve your assets. We all want to preserve our dignity, control the type of care we need, and leave a lasting legacy to our family. Long Term Care services are expensive. Paying for the care yourself can be very overwhelming, even if you have insurance cov-erage. Long Term coverage can help offset the cost of care.

THE AGELESS

Prescription by Anne C. Jewell

Numerous medical journals and studies identify the best actions you can take to achieve a longer, fuller life. We know there are no guarantees. We tend to think we are healthy and will remain that way, even as we “age”. But it is never too late to start on the right path to longevity. With this collection of some of the most important longevity tips, you’ll have the path you need to get to age 80, 90, or even 100. Here are 8 ideas to remaining ageless:

1. MINDSET Keep a good attitude. Stay optimistic, hopeful, confident, positive, cheerful, bright, and buoyant. Live life to the fullest. 2. PREVENTION Stay current with preventative care and screenings. Follow your physicians’ advice for any current medical conditions. 3. EXERCISE Take the stairs, park far away at the store, take a walk at lunch. “There is no pill that comes close to what exercise can do,” says Claude Bouchard, director of the human genomics laboratory at Pennington Biomedical Research Center in Louisiana. It benefits your brain, heart, skin, mood and metabolism. Move, move, move. If you want to keep your bones young, use them. Find an activity you enjoy. A University of Maryland study found that Amish men live longer than typical Caucasian men in the United States, and both Amish men and women have lower rates of hospitalization. What are the Amish ways? Lots of physical activity, less smoking and drinking, and a supportive social structure involving family and community.

4. CHALLENGE YOUR BRAIN Your brain is amazing; your brain is you. It defines who you are. Your brain holds every memory and emotion of your life. Every effort should be made to keep your brain young and healthy. Keep your brain challenged, especially with new things. Replace routine with new learning. Seek out new experiences. Your brain thrives on challenges and learning. 5. SLEEP Consistently sleeping less than six hours a night nearly doubles your risk of heart attack and stroke, according to a review of 15 studies published in the European Heart Journal. Another study found that consistently sleep-deprived people were 12 percent more likely to die over the 25-year study period than those who got six to eight hours of sleep a night. Don’t allow yourself to use electronic devices before bedtime as this can stimulate the brain. 6. SOCIALIZATION Studies show that sadness, unhappiness and solitude increase the risk of early death by 45 percent. The immune system can weaken. Blood pressure can increase thus increasing the risk of heart attacks and stroke. By contrast, people with strong ties to friends and family have as much as a 50 percent lower risk of dying, according to a study in PLOS Medicine. A 2016 study by researchers at the University of California, San Diego found that those who use Facebook also live longer, but only when online interactions don’t completely supplant faceto-face social interaction. 7. NUTRITION Food is one of the basics joys of life. Eat often and healthy, lots of vegetables and fruits. Discipline yourself. 8. FAITH The 17th century philosopher, Blaise Pascal, once said, “All of humanity’s problems stem from man’s inability to sit quietly in a room alone.” Our body, mind and spirit need moments of silence. It can be prayer, meditation or just undisturbed silence. These moments can help to comfort and simplify our busy lives. The Bible recognizes that “No discipline seems pleasant at the time, but painful.” (Hebrews 12:11).

Anne Jewell 115 Manning Dr. Ste. 202B Huntsville, AL 35801 256.533.0001 ccox@hiwaay.net coxassociatesinc.com Reference: Guideposts Outreach Publications has a great free eBook by Pastor Kahlil Carmichael “Living Longer, Living Better, Body, Mind, and Spirit” available at: guideposts.org/how-we-help/ outreach-publications/free-ebooks/living-longer

Understanding Long Term Care Planning Options

Care for yourself the same way you care for others. Call your local Long Term Care professional for more information. Anne C. Jewell, 256-533-0001

There is one thing, as a long term care consultant, that I cannot fathom. There are people who don't blink at paying home-owners, automobile, and life insurance policies, that they may never make a claim on, but cannot justify purchasing Long Term Care Insurance. This is their choice even though the numbers are out there, if they are over age 65, there is al-most a 75 percent chance that they will need some form of Long Term Care.One of the most common state ments from friends, prospects or existing lients c is "Why shou ld I buy and pay for a policy when I may never need it? I don't want to waste my money." Since it is important for you to make fully informed decisions about your financial m atters I w ould l ike t o s hare with you about relatively new and innovative products, often called hybrid products. These hybrid p roducts i nclude Life Insurance with Long Term Care and Chronic Illness Riders, Annuity Products with Long Term Care Riders and Life Insurance with Accelerated Benefits R iders. ( Whole

or universal life insurance policy with rider being the most popular.) Consumers can typically pay a single up-front premium, and if they never need long-term care, their heirs will receive the death benefit. By paying a single premium or series of set premiums, you avoid the risk of future premium increases—an issue that has plagued traditional long-termcare policies. Another advantage of the hybrid policy is that you may be able to purchase an "extension" or "benefit rider" which would allow you to receive monthly benefits after the base amount has been exhausted. This could double the time frame for receiving long term care benefits. The annuity products allow for the value of the contract to be spent down for long term care costs. And if the policy is Pension Protection Act (2006) qualified, t he v alue c an b e p aid o ut tax free if used for long term care. The Annuity Product has another advantage, it typically requires very little underwriting. Also, life insurance with accelerated benefits rider allows the insured to access the death benefits while living. Many consumers have balked at the “use it or lose it” nature of traditional long-term-care policies; the hybrid’s po tential death benefit removes that concern. The questiowhat is it going n is not whether yto cost your ou wilfamily, pl needhysically, emotionally, and financially and how are you going to plan for that? I urge you to call for a no cost consultation as an opportunity to learn more about the potential risks and costs...and the op-tions available.

by Anne Jewell

Why is Long Term Care important to Women? Could it be that women live longer than men? Do women become disabled more often? Do women end up with more chronic illnesses? Could women become impoverished as they age as widows? It has a lot to do with: "Longevity and Caregiving". Statistically, women outlive men. Therefore, they are far more likely to need care when they get older. Women are natural and lifelong caregivers. They take care of their spouses, kids, grandparents, grandchildren, and even the family pets. Informal unpaid caregiving falls on women heavily. This includes the stress when taking care of sick children and later in life, most commonly, taking care of their elderly parents. Women are masters at multitasking and they keep everyone on their toes and moving like a straight arrow. Mothers, sisters, wives, daughters and friends care for others, indefinitely. They put aside their own needs and allow their health to fail. The burden they often carry, financially, emotionally, physically and spiritually, can break a woman's soul and pocketbook. If you think about all the people in your life who are â&#x20AC;&#x153;made to lastâ&#x20AC;? I believe the obvious answer would include the women in your life.

Care Care for for yourself yourself the the same same way way you you care care for for others. others. Call Callyour yourlocal localLong LongTerm TermCare Care professional professionalfor formore moreinformation. information. Anne AnneC. C.Jewell, Jewell,256-533-0001 256-533-0001

Women Womentoday todayhave havea agreater greaterrisk riskofofneeding needing Long LongTerm TermCare Careservices. services.It's It'svery veryimportant important for forwomen womentotodevelop developa aLong LongTerm TermCare Care strategy strategytotohelp helppreserve preservetheir theirfamily, family,career, career, lifestyle, lifestyle,health healthand andtotal totalfinancial financialfuture. future. Long LongTerm TermCare Careprotection protectioncan cansave savea a woman womanfrom fromthe thehigh highcosts costsofofcare. care.ItItalso also provides providesthem themwith withchoice, choice,independence independence and andmost mostimportantly, importantly,totonot notbebea aburden burdenonon loved lovedones. ones.By Byarranging arrangingLong LongTerm TermCare Care protection protectionfor forothers, others,women womencan canstay stayonon track tracktotoprotect protecttheir theirsavings savingsand andkeep keeptheir their career. career. Chances Chancesare arethat thatyou youhave haveexperienced experienced caring caringfor fora aloved lovedone oneatatsome somepoint pointininyour your life, life,sosoyou youknow knowhow howdemanding demandingititcan canbe. be. Your Yourlove lovefor forothers othersisiswhy whyyou youshould shoulddodo something somethingbold boldand andbegin beginplanning planningfor for Long LongTerm TermCare Carenow. now.

COX ASSOCIATES, INC.

Whitehead

Papule

Blackhead

Cysts

Nodule

acne

Pustule

By D Kishore Yellumahanthi, MD, MPH, FAAFP

Acne, also commonly known as Pimples, is the most common skin condition seen in the United States. It is estimated that at any given time, about 40 to 50 million Americans have acne. The most common age of onset of acne is teenage. However, acne can occur at any age. It can occur in both men and women. Below, is summarized briefly the causes of acne, its clinical presentation, prevention and management.

What actually causes acne? Acne appears when a pore in the skin clogs. This clog begins with dead skin cells. Normally, dead skin cells rise to the surface of the pore, and the body sheds these cells. However, if the body starts to make lots of sebum, oil that keeps the skin from drying out, the dead skin cells can stick together inside the pore. Instead of rising to the surface, the cells become trapped inside the pore. Sometimes a type of bacteria that lives on the skin called Propionobacterium acnes (P acnes), also gets inside the clogged pore. Inside this clogged pore, P acnes, has an ideal environment for multiplying quickly. The clogged pore becomes inflamed when it is filled with loads of bacteria

inside and this leads to its red and bumpy appearance. If the inflammation goes deep into the skin, an acne cyst or nodule appears.

How does acne manifest as? A person who has acne can have any of the following: • Blackheads • Whiteheads • Papules • Pustules (what many people call pimples) • Cysts • Nodules Although face is the most common site for acne, it can appear on the back, chest, neck, shoulders, upper arms and buttocks. Often, the treatment of acne depends on the type of acne lesions that are seen. For example, if one has only blackheads, a topical retinoid is more appropriate than other treatments. Therefore, it is important to know how each of the acne lesions appear. White heads: If a pore in the skin is clogged with bacteria,

dead skin cells and with excess oil, it can close the pore and form a tiny white or flesh colored bump. This is called a whitehead. Blackheads (dark spots): If the pore fills with debris but stays open, a blackhead is noticed. Papules (Early pimples): When excess oil, dead skin cells and bacteria push deeper into the skin and cause inflammation (redness and swelling), small, red bumps are formed. The medical word for these are papules. They feel hard. If the inflammation goes deep into the skin, an acne cyst or nodule develops. There is no universally accepted scale for grading acne severity. Mild acne is classically defined by the presence of clogged skin follicles (either black heads or white heads) limited to the face with occasional papular or pustular lesions. Does mild acne need to be treated? Given the fact that in most cases, acne is supposed to be self limiting once the patient matures through adolescence into adulthood, many patients with acne and their parents, do not seek treatment for it either at all or when the symptoms are mild. However, early and prompt treatment of acne has several advantages. For example, if treatment is sought when acne is mild, one can relatively get faster relief from their acne. It also minimizes the likelihood of having scars and also reduces the need for using stronger medications that have a potential for severe side effects. It is also worthy to remember that treating mild acne promptly could also help in maintaining one’s self esteem. Research shows that acne can take a toll on the psyche. Many patients seemed to have mentioned that their self-esteem suffered after developing acne. Some had reported of having depression and suicidal ideations as well. It is also important to note that the severity of the acne doesn’t seem to matter - Acne can have negative effect on self-esteem whether one has mild or severe acne. Therefore, every effort needs to be made to get acne treated as early as possible regardless of its severity.

care of. The following are some tips for good skin care to help with acne. •

Do NOT try a new acne treatment every week or so. Give an acne treatment time to work. Use a product for 6 to 8 weeks. It takes that long to see some improvement. If no improvement is appreciated by then, at that time, another product can be tried. Complete clearing generally takes 3 to 4 months.

•

Do NOT apply acne medication just only to the acne lesions. To prevent new acne lesions, spread a thin layer of the acne medication evenly over your acne-prone skin.

•

Use makeup, skin care products, and hair care products that are labeled “non-comedogenic” or “won’t clog pores.” These products don’t cause breakouts in most people.

•

Do NOT share makeup, makeup brushes, or makeup applicators. Even if one uses only non-comedogenic products, sharing makeup can lead to new acne formation. Acne isn’t contagious, however, sharing makeup, makeup brushes, or applicators, can result in transfer of the acne-causing bacteria, oil, and dead skin cells. These can clog the pores, leading to breakouts.

•

Do NOT sleep with makeup. Even non-comedogenic makeup can cause acne if you sleep with it. Therefore, please make sure the makeup is removed before going to bed.

•

Wash face twice a day & after finishing any activity that causes sweating but do NOT wash multiple times a day.

•

Do NOT dry out your skin. Skin with acne is oily, so it can be tempting to apply astringent and acne treatments until the face feels dry. However, dry skin is an irritated skin and is more prone for acne. Therefore, use acne treatments only as directed. If it still makes the skin feels dry, applying a moisturizer helps.

•

Do NOT scrub the skin. To get rid of acne, one could be tempted to scrub one’s skin clean. But, scrubbing can irritate the skin, causing acne to flare. Therefore, be gentle when washing the face or other acne prone skin. Usage of a mild, non-comedogenic cleanser is recommended. Apply the cleanser lightly with the fingertips, using a circular motion. Gently rinse it off with warm water, using only the fingers. Then pat the skin dry with a clean towel.

•

Do NOT Pop or squeeze breakouts. When acne is popped or squeezed, there is a possibility of pushing some of what’s inside (e.g., bacteria or pus or dead skin cells) deeper into the skin. When this happens, inflammation increases. This can lead to more-noticeable acne and sometimes scarring and pain.

How to treat whiteheads and blackheads? Topical retinoid is usually recommended to unclog the pores. Adapalene is a type of retinoid available without a prescription. In addition to using a topical retinoid, using a benzoyl peroxide wash can also help. It can help get rid of the excess P. acnes bacteria on the skin. What about treating papules? Try washing face twice daily with an acne face wash that contains benzoyl peroxide or salicylic acid. If lot of papules are present, it may require a consultation with a healthcare provider. Any presence of acne cysts or nodules, in general, would require an appointment with a healthcare provider for their management. For best results of acne, along with using the right medications, general skin care also needs to be taken

Role of Diet: Results from small studies suggest that following a low-glycemic diet may reduce the amount of acne. Low-glycemic foods include most fresh vegetables. One mechanism that is thought by which low-glycemic diet may reduce acne is that it eliminates spikes in the blood sugar. When blood sugar spikes, it causes inflammation throughout the body. These spikes also cause the body to make more sebum, an oily substance in the skin. Both inflammation and excess sebum can lead to acne. While some studies showed that following a low-glycemic diet can lead to fewer breakouts, other studies have not found a connection between a high-glycemic diet and acne. Therefore, more research is needed to know for sure. What about Milk? Some studies suggest that drinking milk may be linked to an increase in acne breakouts. In these studies, all types of milk (whole, low-fat, and skim) have been linked to acne. It is not exactly known how milk can worsen acne. One theory is that some of the hormones in milk cause inflammation inside the body. Inflammation can clog the pores, leading to acne. However, more research is needed to know for sure. While milk may increase the risk of developing acne, no studies have found that products made from milk, such as yogurt or cheese, lead to more breakouts. Given this kind of uncertainty surrounding the role of diet, I recommend more of an individually tailored advice to my patients - To avoid any food substances that they know for sure had flared up their acne. In summary, acne is the most common skin disease seen in the US. The health impacts of acne extend beyond the skin as it is known to have caused depression and loss of self esteem in some individuals. We reiterate that acne, regardless of its severity, be treated at the earliest. OTC medications could help in treating mild acne. Reference: https://www.aad.org

D Kishore Yellumahanthi, MD, MPH, FAAFP, works as Family Physician for Huntsville Hospital in Huntsville, AL and also as a Clinical Assistant Professor at the Department of Family Medicine, University of Alabama at Birmingham (UAB), Huntsville Regional Medical Center, AL. Dr. Yellumahanthiâ&#x20AC;&#x2122;s educational background is unique in that he has formal training in both Family Medicine and Dermatology.

KNOW YOUR ABCDE's of Skin Cancer by, Traci McCormick, MD

Almost every adult has at least a few moles. Moles that appear in childhood grow along with your body. They can get darker over time. Or lighter. That’s normal. But other changes can be signs of melanoma, the most serious type of skin cancer. Because melanomas can develop quickly, Traci Cole McCormick, MD, a radiation oncologist with Alliance Cancer Care in Decatur, recommends self-examining your moles at home every month following the ABCDE rule:

Asymmetrical: does one half match the other?

Border: is it irregular, with ragged or notched edges? Color: is it the same all over?

Diameter: is it larger than about ¼ inch?

Evolution: is it growing, itching or bleeding? If you answered “yes” to one or more of those questions, or have a sore on your skin that does not seem to be healing, Dr. McCormick says you should go see a physician right away for a more thorough evaluation. Skin cancers that are found early and removed are almost always curable, but they can be deadly if allowed to grow and spread to other parts of the body. It is estimated that one in five Americans will develop some form of skin cancer by age 70, making it the most frequently diagnosed type of cancer. Basal cell carcinoma is the most common form of skin cancer, which more than four million cases diagnosed every year, followed by squamous cell carcinoma and melanoma. Many cases of skin cancer can be linked to ultraviolet radiation – either from sunlight or commercial tanning beds. Other skin cancer risk factors include fair skin, abnormal moles, family history of skin cancer, and living in a sunny or high-altitude climate. “In hot, sunny climates like Alabama, you really need to take precautions if you’re going to be outside for any length of time,” Dr. McCormick said. “Always apply a broad spectrum sunscreen with an SPF (sun protection factor) of 30 or higher. Protective clothing, wide-brimmed hats and UV-blocking sunglasses are also smart ideas.” Let’s take a closer look at the three most common types of skin cancer. Basal cell carcinoma begins in the basal cells – a type of cell that produces new skin cells as old ones die. It often first appears as a

bump on the skin in a part of the body that is regularly exposed to the sun, such as the head or neck. Basal cell carcinomas are easily treated if caught early and rarely spread, or metastasize, beyond the tumor site. Squamous cell carcinoma develops in the squamous cells that make up the middle and outer layers of skin. While it can occur anywhere on the body, it is most often found in areas that get frequent sun exposure such as the face, ears, scalp, lower lip, neck, hands, arms and legs. Squamous cell carcinomas are more common in men, but women under 40 are increasingly affected. Many experts attribute this to use of commercial tanning beds. Melanoma, the most serious type of skin cancer, develops in the cells (melanocytes) that produce melanin, the pigment that gives your skin its color. Melanomas often resemble moles and sometimes develop from existing moles. Like basal and squamous cell carcinomas, early detection is the key to successful treatment. Melanomas are much harder to treat, and often fatal, if the disease reaches the lymph nodes or metastasizes to distant organs. Physicians consider a number of factors when deciding how to treat skin cancer, including the location, type and stage of the disease, the patient’s age and overall health, and potential side effects. “Some cancers are better treated with radiation therapy and others with surgical removal of the tumor,” Dr. McCormick said. “Each case is individual and requires a conversation with your doctor.”

Alliance Cancer Care uses external beam radiation therapy (EBRT) to safely and painlessly deliver high-energy X-rays to skin cancer cells while preserving the surrounding, healthy tissue. The X-rays damage the cancer cells so they cannot multiply. The treatments take only about 15 minutes and are offered at all six Alliance locations across Alabama.

ATOPIC DERMATITIS by D. Kishore Yellumahanthi, MD, MPH

Atopic Dermatitis is the most common type of eczema. Eczema is a clinical and histological pattern of inflammation of the skin seen in a variety of dermatoses with widely diverse causes. Depending on whether the cause of the eczema is from within the body or outside the body, eczema can be classified as endogenous and exogenous eczema respectively. AD is a type of endogenous eczema. Therefore, although AD in colloquial language is often called as eczema, in reality it is only ONE type of eczema. AD affects 15-20% of the children and 1-3% of adults worldwide. It is a chronic skin condition that is characterized by red, itchy, dry and inflamed skin. It manifests during the first year of life in about 60% of patients and usually in 90% will present by 5 years of age. AD is the first manifestation of the atopic triad - AD, asthma, and hay fever. About 50% of the people with severe AD will get asthma and about two-thirds (66%) will get hay fever. AD imposes an enormous burden on the social, personal, emotional, and financial resources of patients and their families. It is a major cause of morbidity in children in the Western world. The annual costs are similar or higher than other chronic diseases, including diabetes, asthma, emphysema and arthritis.

What causes Atopic dermatitis? The exact cause of AD is not known yet. It could be multifactorial. So far the research shows that it is not contagious and that it runs in families. People who get AD usually have family members who have AD, asthma, or hay fever. This means that genes do play a role in causing AD. Children are more likely to develop AD if one or both parents have AD, asthma, or hay fever.

What does Atopic dermatitis look like? The appearance of AD depends on age of the patient. There are three distinct clinical age-related stages of atopic dermatitis: infantile, childhood, and adulthood. During each of these stages both the appearance and site of the lesions change, although the stages often overlap. The infantile phase usually lasts until 2–3 years of age, the childhood phase from 2 years until puberty, and the adult phase from puberty onward. The rash in infancy characteristically begins on the cheeks and scalp and evolves over time to involve the front and outer sides of the legs and arms (figure 1). The trunk may be involved. The rash is generally symmetric, scaly with red patches within which crusting is common. During late infancy to the childhood phase, the flexural surfaces of the extremities become the most commonly involved sites, particularly the front of elbows and back of knees (figure 2). Other frequently involved sites include the neck, front of wrist and back of ankles, and the creases between the thighs and buttocks. In the adult phase, the distribution is generally less characteristic, and

predominantly present as localized dermatitis, like hand dermatitis, nipple, or eyelid eczema.

Management of Atopic Dermatitis Given the chronicity of AD, having a child with moderate to severe AD could have a profound impact on the social, emotional, and financial perspectives of families. Effective treatment not only improves the quality of the child’s life but also helps the entire family as a whole. Education, excellent skin care, avoidance of irritants and allergens, and treating inflammation are the key components of the management.

Education:

Education has a pivotal role to play in its management. It is important for parents to get educated on the nature of the disease and the goals of therapy. Understanding the chronic, relapsing nature of AD is important, as is counseling on the prognosis and natural history. If possible, parents should try to clarify all their questions with their healthcare provider’s office than try to find solutions to their questions and concerns through other resources such as internet as they may not always be reliable.

Skin care:

Emolients: The gist of basic skin care is to make sure skin is well hydrated. Numerous emollients are available that are suitable for use on atopic dry skin. In general, ointments and creams are more effective than lotions. Lactic acid and Urea based creams are beneficial for dry skin but could cause stinging, when applied to areas of eczema. Some children may be more prone to the sensation of stinging and, in such a situation, petroleum jelly or petrolatum-based ointment could be beneficial.

Applying emollients needs to be a fun act: Also it is important to keep in mind that, children, being children, would let the adults apply the moisturizer if the application of emollients is an enjoyable act for them. Therefore, in infants, it could be applied as a gentle massage at the time of changing the nappy. In older children, making pictures or dotting on the cream could be fun. As they grow up it is important that children are involved in their own treatment and encourage them to apply the emollients themselves. Bathing - yes or no: Regarding bathing of AD children, over the years there has been conflicting advice. This is because detergents and ordinary soaps can irritate and aggravate eczema. Current recommendation is to encourage carers to bathe children with eczema daily. Indeed, bathing in lukewarm water for no more than 15 minutes has the potential to rehydrate the outer layer of the skin. Also, bathing once or twice daily is soothing during a flare up of eczema, aids in decreasing bacterial counts, and helps in penetration of topical steroids applied after the bath. A mild, unscented, moisturizing soap or soap substitute or emollient can be used if needed. Excessive exposure to soap, detergents and shampoo aggravate dryness and should be discouraged.

Avoidance of Irritants and Allergens:

In the AD patients, the list of allergens and skin irritants can be quite exhaustive. It is imperative that they avoid them to prevent any flare ups. Stress, heat, sweating, and external irritants like hand and dish soap, laundry detergent, shampoo are some of the irritants. Seasonal pollen, dust mites, pet dander and mold are examples of some of the common allergens. Addressing these triggers may improve the AD.

Anti-inflammatory agents:

Topical steroids are usually the first drugs of choice prescribed by physicians to reduce the inflammation/eczema. Concerns regarding the side effects of topical steroid use is common; in one study 24% of families reported non-compliance with topical steroids due to safety concerns. The actual magnitude of the underuse of topical steroids could be much higher. Another small study revealed that only onethird of patients had proper compliance with topical steroid use. The word ‘sparingly’ often used on prescriptions of topical steroids can also be misinterpreted and lead to under-usage. At this juncture, it is worth to remember that the word ‘sparingly’ in prescription is often meant not to scare the parents about its usage but it is to let them know that it only needs to be applied in sufficient quantity only to the affected area. Topical steroids are being used for more than 50 years and studies clearly show that if used appropriately under supervision, ill effects are rare, and they are an effective treatment for eczema. Therefore, they need to be used as directed when needed to avoid any risks of under treatment such as chronically inflamed skin and diminished sleep quality with the associated detrimental effects on growth and development.

There are several types of skin cancer. The three common types of skin cancer are:

Skin cancer occurs as a result of uncontrolled growth of abnormal cells. Skin cancer occurs when mutations or errors occur in the DNA of skin cells. Often this is the result of exposure to UV radiation either from sunshine or tanning beds. These mutations in turn cause the cells to rapidly multiply and form malignant tumors. Skin cancer is the most common cancer in the US.

>>>

One in five Americans will develop skin cancer in the course of lifetime.

by D Kishore Yellumahanthi, MD, MPH

Basal cell carcinoma Squamous cell carcinoma Melanoma Basal cell carcinoma (BCC):

Epidermis is the top layer of the skin. The epidermis has four layers. BCCs are abnormal, uncontrolled growths that arise in the skinâ&#x20AC;&#x2122;s basal cells, which line the deepest layer of the epidermis. It is believed that long-term sun exposure over the lifetime as well as occasional extended, intense exposure (typically leading to sunburn) combine to cause damage that can lead to BCC. The risk factors for the development of BCC include, intermittent intense sun exposure (as identified by prior sunburns), radiation therapy, immunosuppression, a fair complexion, red hair and a positive family history of BCC. The clinical presentation of BCC is variable. For instance, it can present as open sores, red patches, pink growths, shiny bumps or scars. It has the least potential to spread from the primary tumor site. However, that does not mean it should be taken lightly as the treatment in the advanced stage may need a large excision that can be disfiguring at times. Given its variable presentation, it is often not easy for a common man to diagnose them by looking at them. Therefore, any new spot or bump or any other lesion on the body, should be brought to the attention of a physician immediately.

Squamous cell carcinoma (SCC):

SCC in an uncontrolled growth of abnormal cells arising in the squamous cells, which compose most of the skinâ&#x20AC;&#x2122;s epidermis. It is the second most common skin cancer. It is caused most commonly due to chronic sun exposure. Anyone with a history of substantial sun exposure is at increased risk although people with light hair, fair skin and blue, green, or gray eyes are

at highest risk of developing the disease. Usage of indoor tanning beds is also a risk factor for SCC. The number of women under 40 years diagnosed with SCC is on the rise and it is largely believed due to their greater use of indoor tanning. Unlike BCC, in about 0.5 -5% of cases, it can spread and can become fatal if untreated. Similar to BCC, it can also have varying appearance. One clue to differentiate between the two, although not absolute, is often the skin around an SCC reveals telltale signs of chronic sun damage such as wrinkles, loss of elasticity, age spots, or broken blood vessels.

Melanoma:

This is the most dangerous form of skin cancer. It arises from melanocytes, which are pigment producing cells present in the basal layer of the epidermis. Most melanomas are black or brown in color. However, they can also be skin colored, pink, red, blue or purple. Melanoma also has various morphological/clinical presentations. Melanoma is caused by intense, occasional UV exposure more so in genetically predisposed individuals. Besides genetic predisposition, the strongest risk factors include light complexion, light eyes, blond or red hair, heavy freckling, the occurrence of blistering sunburns in childhood, a tendency to sunburn easily and tan poorly. If melanoma is diagnosed and treated early, it is almost always curable. However, if it is not recognized early, it can spread to the other parts of the body and can lead to death. Therefore, it is very important that it is diagnosed early.

What are ABCDE of melanoma? Melanoma can occur either in an existing mole or can present as a new lesion. It is very important for everybody to know their skin very well and to recognize any changes in the moles. Look for the ABCDE signs of melanoma.

A B C D E

Asymmetry: When symmetrical, if you draw a line through the middle, the two sides match. On the other hand, if you draw a line through a mole, the two halves do not match, it means it is asymmetrical, a warning sign for melanoma. Borders: A benign mole has smooth, even borders, unlike melanomas. The borders of an early melanoma tend to be uneven. Color: Most benign moles are all one color â&#x20AC;&#x201D; often a single shade of brown. Having a variety of colors is another warning signal. Diameter: Benign moles usually have a smaller diameter than malignant ones. Melanomas usually are larger in diameter than 6mm, but they may sometimes be smaller when first detected. Evolving: Common, benign moles look the same over time. Be on the alert when a mole starts to evolve or change in any way. Any change â&#x20AC;&#x201D; in color, shape, size, elevation, or another trait, or any new symptom such as bleeding or crusting â&#x20AC;&#x201D; points to danger. Noticing one or more of the above, would warrant an appointment with a physician.

Skin cancer and color of the skin The general misconception is that people with dark color skin are not at risk of skin cancer. It is important to know that skin cancer can occur in people with colored skin as well, although their overall incidence among them is far lower than that among Caucasian population. Studies show that African Americans and other ethnic groups often have more advanced disease of melanoma at initial diagnosis and higher mortality rates than Caucasians. Also squamous cell carcinoma that tends to spread is more common among dark skinned individuals. Therefore, while it is true that skin cancer is much more common in lighter-skinned individuals (Caucasians), it tends to be more deadly among individuals of color.

Prevention of Skin cancer Sun protection plays a key role in prevention of skin cancer. Listed below are some of the skin cancer prevention tips. • Seek the shade, especially between 10 AM and 4 PM. • Avoid tanning and never use UV tanning beds. • Avoid Sunburn • Cover up with clothing, a broad-brimmed hat and UV-blocking sunglasses. • Use a water resistant, broad spectrum (UVA/UVB) sunscreen with an SPF of 30 or higher every day. • Apply 1 ounce (2 tablespoons) of sunscreen to your entire body 30 minutes before going outside. Reapply every two hours or immediately after swimming or excessive sweating. • Examine your skin head-to-toe every month. Scalp and nails also need to be examined carefully. Make it a habit to ask your hair dresser at the time of your haircut if any spots are seen on the scalp as scalp melanomas carry a bad prognosis. • See your physician every year for a professional skin exam.

In summary, skin cancer is the most common cancer in the US. BCC is the most common type of skin cancer and it is usually localized. However, it needs to be treated early to prevent wide spread excision which can look disfiguring at times. SCC is the second most common skin cancer and it is both locally destructive and has a potential to spread to other organs. Melanoma is the most dangerous type of skin cancer causing death invariably if not treated. Remember, ABCDE rule of melanoma. It is to be remembered that people of all skin types are at risk of skin cancer, though naturally dark-skinned people are less likely than fair-skinned people to get skin cancer. Therefore, it is very imperative for people with all skin colors to practice sun protection. Sun protection plays an essential role in prevention of skin cancer. Any new skin lesion(s) or changes to any existing lesion(s) needs to be brought to the attention of your physician immediately. Reference: 1. http://www.skincancer.org 2. Melanoma in Non-Caucasian: Jonathan Stubblefield BS and Brent Kelly MD Surgical Clinics of North America, 2014-10-01, Volume 94, Issue 5, Pages 1115-1126 3. Text book of Andrew’s Disease of the skin

sunscreens

And their role in prevention of skin cancer by D Kishore Yellumahanthi, MD, MPH

Skin cancer is the most common form of cancer in the United States. One out of every five Americans will get skin cancer at some point in their life span. The risk of developing skin cancer, about 90% of time, is directly related to the amount and intensity of ultraviolet (UV) light exposure. Fortunately, with regular use of sun protection, UV exposure can easily be minimized. Sunscreen is an important part of this protection. Sunscreens are products that combine several ingredients to help prevent sun’s UV radiation from reaching the skin. Sunscreens can be both chemical and physical substances. Physical sunscreens, such as zinc oxide and titanium dioxide, deflect and scatter the UV rays before they penetrate the skin. Chemical sunscreen ingredients, such as PABA (para-aminobenzoic acid) and cinnamates, absorb UV rays and convert the sun’s radiation into heat energy. Both types of sunscreen can be effective and safe if used properly. UVA and UVB are the two types of UV radiation that damage the skin and can increase the risk of skin cancer. UVA can also cause premature ageing of skin, causing wrinkles and age spots. It can even pass through window glass. On the other hand, UVB rays primarily cause sunburn and are blocked by window glass.

What is SPF?

The strength of the sunscreen is determined by its sun protection factor (SPF). It is a measure of the sunscreen’s ability to prevent UVB from damaging the skin. For example, if it takes 1 hour for unprotected skin to start turning red, using a SPF 30 sunscreen theoretically prevents reddening 30 times longer, which would be about 30 hours.

What is an ideal Sunscreen to use?

Given that both UVA and UVB are harmful, broad spectrum sunscreen that protects against both UVA and UVB needs to be used. The American Academy of Dermatology recommends that everyone use a broad spectrum sunscreen with SPF 30 or higher that is water resistant. The sunscreen with SPF 30 blocks around 97% of the sun’s rays. Higher- number SPFs block slightly more of the sun’s rays. Unfortunately, no sunscreen can block 100% of the sun’s rays. Currently, there is not any scientific evidence that indicates using a sunscreen with an SPF higher than 50 offers any protection better than a sunscreen with an SPF of 50. It is also important to remember that high- number SPFs last the same amount of time as low number SPFs. Therefore, a high-number SPF does not mean that one can spend additional time outdoors without reapplication.

There are different kinds of sunscreens available – lotions, creams, gels, ointments, sprays and wax sticks. The kind of sunscreen to be used is a matter of personal choice and may vary depending upon the area of the body applied. For instance, gels may be better for hairy areas and creams for dry skin and the face. Regardless of the type of sunscreen used, the key is to use adequate amounts at recommended frequency - to ensure that the full SPF of a sunscreen is accomplished, about 1 oz of sunscreen needs to be applied 15-30 minutes BEFORE sun exposure. Reapplication is as important as putting it on in the first place, so reapply the same amount every two hours. It is often thought that one would not need a sunscreen on a cold or cloudy day. Up to 40% of the sun’s UV radiation reaches the earth on a completely cloudy day. Therefore, sunscreens are needed to be applied on cloudy days as well. Following the same logic, one can also be exposed to sundamaging UV rays when indoors or even in a car. Remember, UVA passes through window glass which means one can acquire skin damage while driving or in any room windows. This is one of the reasons why skin cancer in the US is more common on left side of the face which is the driving side. Therefore, it is recommended that one use sunscreen every day, all year along regardless of whether one is outdoors or indoors. A sunscreen, in addition to offering protection from skin cancer, also offers protection from sun burn and early skin ageing. However, one should not rely on sunscreen alone to protect the skin against UV rays. In addition to using sunscreen, seeking shade when appropriate and wearing protective clothing is also important. Avoiding tanning beds is also vital. A tan, whether it is acquired on the beach or in a bed is not good as it is caused by harmful UV radiation and thus over a period of time can lead to premature skin ageing as well as skin cancer. Included with the plan of taking care of your skin using a comprehensive skin protection program and early diagnosis of skin cancer, self-examination of the skin needs to be done at least annually. If there happens to be any spot on the skin that is changing, bleeding or itching, medical advice needs to be sought immediately to confirm or rule out skin cancer.

Smells

So good by Neeta Kohli Dang M.D.

“Jason” suffered from recurrent sinus infections for years. We discussed surgery on a few occasions, and eventually decided to proceed. Surgery confirmed severe disease and the sinuses were carefully and thoroughly cleaned. After months of regular follow-up and more treatment, Jason joyously announced that he had regained his sense of smell. Imagine our delight when he started bringing in absolutely delicious homemade cakes to the office. Their quality would have put a seasoned baker to shame. As well, his family was thrilled to have Dad in the kitchen again making delicious food with wonderful aromas. Alas, what about our low calorie and cholesterol diet? FAT CHANCE – cakes like these don’t walk into your office every day. Jason and I have since become good friends and I wish him continued good health and success. SINUS disease is rampant in the United States affecting millions of children and adults. It is estimated that approximately 150 per 100,000 people in the general population are affected by chronic sinusitis. The incidence appears to be increasing every year with the disease becoming more common in patients with AIDS, common variable immune deficiency, diabetes, polyps, and severe allergies. There are about 20 million physician visits in the United States each year for chronic sinus issues. We usually have eight fully developed sinuses with bilateral frontal, sphenoid, maxillary, and ethmoid cavities. Acute symptoms may include dull mid-facial pain, frontal headaches, thick discolored postnasal drainage, nasal congestion, sore throat, poor sense of smell, bad breath, dental pain, and fatigue. A variety of organisms can be responsible for sinus disease. These may include viral, bacterial (Staphylococcus aureus, Hemophilus Influenza, Moraxella catarrhalis, Strep pneumoniae, Pseudomonas aeruginosa, anaerobic bacteria), and fungi (Aspergillus, Alter32

Inside Medicine | winter 2016

naria). Initial treatment includes appropriate antibiotics, steroids, cortisone nasal sprays, decongestants, and saline nasal rinses. However, in patients with recurrent sinusitis an underlying etiology needs to be determined. This may include environmental allergies, structural changes (as evident on CAT scan), polyps, immunodeficiency, ciliary dysfunction, bony spurs, and chronic mold exposure. CAT scan of the sinuses is considered the gold standard to evaluate individual sinus cavities in more detail and assess ostiomeatal units as well as transitional spaces. Further options include surgical intervention with endoscopic sinus surgery. No longer do we use external excisions or extensive nasal packing. There is no facial bruising or swelling, and patients can often return to work within a few days. Balloon sinuplasty is a new technique that is becoming increasingly popular and very helpful in selected individuals. This procedure can also be performed in our office utilizing state-of-the-art equipment including a stereotactic computerized navigational CAT scan that allows access to diseased and obstructed sinuses in a safe and effective manner. Balloon sinuplasty is especially helpful in older patients who may prefer to undergo the procedure under local anesthesia rather than receiving general anesthesia at the hospital. Untreated chronic sinusitis can sometimes lead to serious complications with extension of

disease into the orbit and intracranial cavity. Fortunately, these cases are very rare. Patients with asthma often note significant reduction in the severity of their disease when chronic sinusitis is appropriately treated. We strive to provide compassion along with exemplary medical and surgical care. Should you or your family wish further evaluation, please feel free to contact our office so that we may recommend a tailored plan of management to suit your ear, nose, and throat concerns. ................................................................ Neeta Kohli Dang M.D. F.R.C.S (C) Huntsville Ear, Nose, and Throat Physicians, P.C. www.huntsvilleearnosethroat.com 256-882-0165 285 Chateau Drive, Huntsville, 35801 ..............................................................

Sinus disease is rampant in the United States affecting millions of children and adults. It is estimated that approximately 150 per 100,000 people in the general population are affected by chronic sinusitis.

Dr. Neeta Kohli-Dang is a board-certified otolaryngologist and a Fellow of the Royal College of Physicians

and Surgeons. She has been practicing in Huntsville for about 20 years with regional and international patients. She was selected to participate in a national multi-centric study involving chronic sinusitis and balloon sinuplasty with subsequent publication regarding its efficacy.

Inside Medicine | winter 2016

Defeating Drainage: A Look at the Newest Options for Combating Your Drippy Nose By Kari Kingsley, MSN, CRNP

Drip. Drip. Sniff. Sniff. Most of us are familiar with the neverending cycle of sinus drainage that is associated with living in the Tennessee Valley. Having worked in the Ear, Nose, and Throat field in Huntsville for the past 11 years, I’ve come across many patients that say Native Americans called our area the “Valley of Death”. While most of us aren’t dying from sinus drainage, we are seriously annoyed. Drainage falls into two categories: allergic and non-allergic rhinitis. Spring is beautiful in the South. Blooming dogwoods, hikes on the Land Trust, and Panoply are just a few of the things that make our area unique. Not so unique, but still a major part of Spring in our area, is the overabundance of pollen. Lots of pollen. Patients call it Sneezing Season. My black car becomes a Horse of a Different Color with streaks of yellow pollen rainbows across the windshield. Summer is warm in the South. Most of us enjoy watermelon, fireworks, and sunny days by the pool. But allergy sufferers don’t enjoy the ever-green and ever-growing grass. I learned long ago that it was worth outsourcing my grass-cutting to a professional. After the boxes of Kleenex, Zyrtec, and Sudafed, I basically break even. Fall in Alabama has a vibe unlike any other. Dazzling foliage, football, and the crisp night air seem like an almost fair trade for newly sprayed cotton fields, ragweed, and leaf mold. While the winter months bring holiday cheer and moderate temperatures, they also bring indoor heat, fireplaces, and damp outside environments to further irritate already cranky noses.

NORMAL NASAL CAVITY

CHRONIC RHINITIS

CLARIFIX CRYOTHERAPY

Nasal nerves help regulate the nasal activity

Out-of-balance nasal nerves may send too many signals, contributing to congestion and runny nose symptoms

Nerve signals are interrupted to reduce congestion and runny nose symptoms

When you Google best places to live for sinus sufferers it is no surprise that saline misted beach towns in Florida and California dominate most lists. Each summer, I have patients tell me that their sinuses did ‘great’ while they vacationed on the beach. Their drippy nose returned once they were home. While the beach is a great place to visit, North Alabama is my home. And I want my home to be as comfortable as possible. Anything to reduce the drip and sniff is well appreciated. The Allergy and Asthma Foundation of America’s 2019 National Spring Rankings list of most challenging places to live with allergies looks at the 100 most populated metropolitan areas. A number is assigned based on the seasonal pollen, allergy medication use, and the number of allergy specialists. Huntsville isn’t included on this list. It’s possible with our size, we didn’t make the cut. Obviously, they haven’t read the latest census that we’re on track to be the largest Alabama city by 2022. Birmingham came in at # 33. Our neighbors in Jackson, Mississippi came in 2nd place and Memphis came in 4th. There is another section of the population that suffers from nonallergic rhinitis or sinus drainage that is not related to allergies. Triggers of nonallergic rhinitis include environmental irritants, foods and beverages, hormone fluctuations, sleep apnea, and reflux. While some think overly fragrant perfumes are attractive and pleasant, there are an equal number of people in the population that would prefer you not take a Chanel Shower. For others, the simple trade-off of a comforting warm bowl of soup on a cold winter day isn’t worth the nasal faucet that ensues. Just as our cars require oil to run properly, mucus is a normal biological lubricant that plays an important role in our health, protecting us from fungi, viruses, and bacteria. We have all heard the expression too much of a good thing... Overproduction of nasal mucus triggered by allergies, upper respiratory infections, as well as dry and cold environments can initiate a myriad of annoying symptoms. Excessive mucus accumulates in the back of the nasal cavity and eventually begins dripping down the back of the throat, causing an

aggravating cough sure to solicit sharp glances from those in closest proximity. In our evolving instant-gratification-society and Amazon delivered it yesterday world, it’s only natural we want a quick and easy fix to one of the most annoying nasal issues. What are our treatment options? Staying hydrated is important. You are, after all, producing about a liter and a half of mucus a day. (Ew; I cringed when I first read those stats). Avoid alcohol, caffeine, and cigarettes as these things tend to exacerbate sinus and allergy issues. Saline irrigations and sprays help lubricate irritated nasal passageways. Over the counter antihistamines, decongestants, steroid-based nasal sprays, as well as prescription anticholinergics and leukotriene modifiers work by blocking mucus production or by drying existing mucus. While these treatments can manage the symptoms of a runny nose and postnasal drip, oftentimes they are not enough and are required daily in most cases. They also have multiple side effects. Avoidance of environmental triggers is also important. As a pet-mom to a horse, a dog, 2 cats, and 6 chickens, that isn’t always feasible. Allergy shots or immunotherapy is an option for some but can be pricey, depending upon insurance coverage. They also include a hefty time commitment. So, what other options are there? One of the newest innovations to sinus health is intranasal cryotherapy. The exact cause of chronic rhinitis is unknown. It is thought to be related to overactive nasal nerves, specifically the parasympathetic posterior nasal nerve. Cryotherapy applied in the nose offers a minimally-invasive approach that interrupts the signals from these nerves to decrease nasal drainage. ClariFix® cryotherapy is the first and only FDA approved medical device used to treat chronic rhinitis in adults. How does it work? Intranasal cryotherapy uses a state-ofthe-art wand that applied nitrous oxide cryogen through a small balloon tip to freeze nerve fibers at the back of the

“Approximately 80% of patients notice a significant reduction in nasal drainage within the first 3 to 6 weeks.”

the nose that contribute to excessive mucus production. Downtime is minimal. Side effects are mild and include temporary headache and congestion, usually for a day. Approximately 80% of patients notice a significant reduction in nasal drainage within the first 3 to 6 weeks. Dr. Neeta Kohli-Dang (whom I lovingly call, Boss) has done more cryoablations than any other physician in the Southeast. She says, “We have the procedure down to a fine art.” Topical anesthetics are used in the nose and then a cooling probe is applied which takes less than a minute. Patients enjoy a latte or coffee and then go home. Start to finish, the entire appointment can last less than an hour, most of which is spent numbing the nasal cavity. For some, the option of snorting medications every day may not be the best option. If you are tired of the constant drip and sniff, consider intranasal cryotherapy for a more permanent solution.

Dr. Neeta Kohli-Dang and Kari Kingsley, MSN, CRNP share nearly forty years of ENT experience. Please visit Kari and Dr. Dang at their practice website: huntsvilleearnosethroat.com or call (256) 882-0165 to schedule an appointment.

Dr. Neeta Kohli Dang performing minimally invasive in-office cryotherapy to improve a patient’s nasal drainage.

TRIGEMINAL NEURALGIA Article content provided by Alliance

Kathy Cooper’s facial pain started when undergoing a dental procedure. She believes the procedure aggravated her trigeminal nerve, which runs along the jaw and is responsible for sensation in the face as well as motor functions like chewing and biting. For the next two years, the left side of Cooper’s face basically ached 24-7. “Talking was one of the biggest triggers,” said Cooper, a certified nurse anesthetist at Decatur Morgan Hospitals. “If we went out to eat and laughed and talked, I’d have to go home and put a heating pad on my jaw. I spent many nights like that.” Cooper consulted with an ear, nose and throat specialist, a neurologist, dentist and an oral surgeon to try to pinpoint the cause of her pain, but it was her family doctor who finally solved the riddle and diagnosed her with trigeminal neuralgia – a chronic pain condition that affects the trigeminal nerve. Most sufferers experience brief, intense pain triggered by facial stimulation. Cooper’s

was more of a continual ache. In addition to a heating pad, Icy Hot cream, Tylenol and ibuprofen provided some relief. “Cold weather on my face made the pain much worse, so winter was a real drag,” she said. In 2018, Cooper’s neurologist referred her to Dr. Jack Gleason at Alliance Cancer Care in Huntsville. Dr. Gleason treats trigeminal neuralgia using stereotactic radiosurgery (SRS) –basically, a high dose of radiation delivered precisely to the patient’s trigeminal nerve to break the pain cycle. SRS typically requires a single outpatient treatment lasting an hour or less. Cooper had read about other trigeminal neuralgia patients getting relief through SRS and was excited to learn that the treatment is now available in Huntsville. “Dr. Gleason told me he expected that my pain would be reduced by about 60 percent after the procedure, and he was right on the money,” Cooper said. “I still have to take Tegretol (a prescription anticonvulsant used to treat nerve pain) twice a day, but no more heating pad.” “I can’t say enough good things about stereotactic radiosurgery and what it’s done for me,” she said.

see BEYOND THE

WHITE COAT

by Bobi Jo Creel, RN, MSN, CRNP

Every time another month falls off the calendar, so are we closer to another year, another adventure and, sometimes, another challenge. As a nurse practitioner in a busy internal medicine practice, I learn and am challenged daily by this. Sometimes a diagnosis comes out of left field and it is not something you ever would have predicted. Sometimes you have patients who do not want a challenge and choose not to fight. Sometimes you have one who has all the fight in the world, but God no longer needs them here. All of these have one thing in common—they are outside of my (the medical provider’s) control. These are some things that as a patient, you may never know or see. The line in the sand prevents this. You see your provider as just that—a provider—but, they are much more than that. Providers are there to help you achieve your optimal level of health, but care about more than your physical being. We see YOU. This is an inside look in the heart and mind of the person sitting on the stool. We see you. We feel for you. Some of us pray for you. We are more than doing a job for you.

There are days that are completely monotonous — Managing chronic, and often complex illnesses Refilling medications Ordering and reviewing labs Ordering screening tests and administering preventative care. Then, there are days that wreck us — When there are not enough hours in the day When there is not a clear answer When there is a looming diagnosis When we are not sure how we are going to have the heartbreaking conversations with those we have come to care for.

There are appointments — When everything goes as planned When there are no new problems to discuss When the hot topic is the big game and not anything medical When you get to give the good news. Then, there are appointments — When nothing expected occurs When families with nowhere to turn show up broken in our exam room When minutes and quick recall matter most When life-threatening emergencies lay on our exam tables. There are lessons instilled in us through our training — That tell us this is a provider-client relationship That we are to prevent, diagnose and treat illness That we can treat the physical and mental, but not the spiritual That our empathetic sides have no place in our calling. Then, there are lessons imparted to us through our practice — That challenge our faith with their own That force us to place ourselves in the trenches with them to win the battle That compel us to open-up to them when they need a bigger piece of us That break down our institutional walls to show them they are never alone. There are patients — Who push us Who are do not give away trust easily, if ever Who want a little more of us than we have been taught to give Who do not want to battle a diagnosis we see as a potential victory. Then, there are patients — Who embrace us Who put all their trust in us—earned or not Who pull parts of us into their lives that we were not prepared to give Who have the will to conquer a mountain and still care for us even when it is not one that can be climbed.

There are moments when — We have had our faith shaken when we could not see the big picture We did not understand why the patient did not see the way out We pondered how to do our job and not care for the people we serve We questioned why a perfect God would gift us with things we cannot use in our calling. Then, there are moments when — We grow in our faith through every rocky day We learn to care about people the way they want to be cared for and take the formality out of the equation We seek to treat patients with our whole hearts We see that God wants our empathy to pour over the ones who trust us to care for them.

You see, the white coat has more to give. They see all sides of you—from the grandmother who dotes on her flock to the single dad who just needs someone to listen. We see the one who is so scared that they lash out at the one they know can take it. We see the one who has only tears and not words. We see beyond the diagnoses you carry to the heart of the one who sits scared on our table. We know that you find our rooms cold, but our hearts are not. We have shared burden where you are concerned. See this. See that we want more for you—even if our goals for you are not something you think are obtainable. We see the big picture. We see your potential. We will fight with you in the battle you choose and sometimes will just be a cheerleader when you need that most. We want you to see that. Look beyond the white coat. The bottom line is that we see you and all of you. Your provider is not an enemy… they are your best soldier.

Bobi Jo Creel, RN, MSN, CRNP CULLMAN

INTERNAL

MEDICINE

*The words in this article reflect my personal opinion and do not reflect the opinion of the medical community as a whole. I follow all rules and regulations set forth by the ABN and governing bodies for proper client/provider relationships and roles.

FEELING FOGGY? A look at how your inner ear can affect the brain and cognitive thinking. by, Kari Kingsley, MSN, CRNP

Several years ago, I developed intermittent bouts of what I would later term brain fog in which I experienced nonlucid moments, similar to waking up after anesthesia. The first and most memorable of these occurred while I was driving on I-565 to work one morning. While not exactly dizzy, I recall feeling so strange that I pulled the car over on the interstate and waited for the spell to pass. After a few minutes, the episode subsided and I went on with my busy day, forgetting about the strange incident. Months later, similar spells began occurring more frequently, heightening my preexisting hypochondriac tendencies that I had developed from years of reading medical books and watching TV programs about the rarest medical conditions in the world.

The spells would come on suddenly, without warning, and felt like a cloud engulfing my consciousness. I had a really hard time explaining the symptoms to my family practitioner at the time. “You know that feeling… where you’re having a dream… and then you start to fall… but then you don’t fall… but the ground is moving… and your thoughts don’t come as crisply or clearly…” Gosh, I sounded crazy even to myself. I further tried to explain that words sometimes did not come easily, decision making became more difficult, and my concentration span seemed shortened. After some routine blood work, I was reassured that my symptoms were likely from fatigue with an added dash of anxiety. But something felt wrong. The foggy spells progressed and I began experiencing pressure in my head, although the entire myriad of symptoms remained very non-specific. Being in my late 20s and a medical provider with just enough medical insight into her own health to be unbiased, I did what any circumspect and logical person would do: I Googled it. After hours of pouring over medical articles, researching medical websites and reading the rantings of a few passionate bloggers, I settled on a very rational explanation for my symptoms…I had a brain eating amoeba. My family practice provider referred me to a neurologist where I was subjected (at my insistent request) to nearly every test known to man…MRI scans, toxicology, blood tests, nerve studies…you name it! The only time he laughed at me was when I asked him (only half-jokingly) if he would do a brain biopsy to make sure the large amounts of sushi I had been consuming hadn’t left an uninvited parasite swimming in my gray matter. The testing came back completely normal. No multiple sclerosis, no brain tumor, no lead poisoning, and certainly, no brain-eating amoeba. I was the picture of health. Now, if you’re like me, there is nothing in the world more frustrating than knowing something is wrong and not having an explanation. What I’ve failed to mention thus far is that at this point in my life, I was working as an Ear, Nose, and Throat nurse practitioner, specializing in dizzy patients. As I continued to see patients day-after-day and listened to the way they described their symptoms, something clicked for me. My patients with inner ear conditions, specifically Meniere’s Disease, complained of dizziness, lightheadedness, vertigo and a feeling of being “foggy headed”. Eureka! But I wouldn’t describe my spells as dizziness exactly, more like a deviation from my normal clear thinking. About this time, I began noticing the pressure in my head was centered over my right ear and that I had developed a faint humming and roaring tone. Feeling a bit silly to have struggled for so long with what was quickly becoming a familiar ENT scenario, I asked our audiologist to check my hearing and run a simple sound test for Meniere’s Disease. It was positive in my right ear. Suddenly the brain eating amoeba had a name!

But I had been treating patients with inner ear conditions for years and was completely oblivious to the fact that I had developed Meniere’s Disease! I laughingly tell my patients how I came to realize I had Meniere’s Disease. They too are generally relieved to have a diagnosis; especially one that is treatable. My best advice as a Meniere’s patient (and as their provider): STAY OFF GOOGLE! Dr. Google is the most dangerous physician in the world because he plays on the fears of uncertainty lurking in the dark parts of our (amoeba eaten) brain. Meniere’s Disease is an inner ear condition usually characterized by dizziness, ear fullness, tinnitus (or noise in the ear), and hearing loss. You can have a combination of symptoms or all of the symptoms which can vary case-by-case. Meniere’s Disease is thought to arise from genetic and environmental factors, although the exact etiology is unknown. Pathophysiology is not fully understood, but thought to be related to a variety of events that lead to elevated pressure in the endolymph fluid causing a condition known as hydrops. Although dizziness can be Pandora’s Box in terms of differential diagnoses, inner-ear should always be a consideration once acute issues such as cardiac, vascular, and neurological conditions have been excluded. The history is critical. Find an ENT team (hint, hint) that will take the time to listen to your symptoms. Standard workup includes a hearing test (or audiogram) along with simple sound tests to measure inner ear pressure. Not to brag (cough, cough) but our practice recently upgraded to stateof-the-art inner ear test equipment that is second to none. As advances in technology continue to grow, we work closely with our audiological team to interpret results so that we can appropriately treat our patients. Upon confirmation of a Meniere’s Disease diagnosis, treatments include initiating a low-salt, low-caffeine diet and medications such as diuretics, steroids, anti-nausea pills and drying agents (anticholinergics) depending upon the individual patient. Trans-tympanic steroid perfusion therapy offers a minimally invasive, in-office procedure that provides significant lasting relief for most patients. Some of the more invasive procedures and surgeries such as endolymphatic sac decompression should be reserved for more severe cases and are generally performed by board-certified neuro-otologists at universities in larger cities such as Birmingham and Nashville. Destructive procedures, such as gentamycin perfusions and labyrinthectomy can cause irreversible effects such as permanent hearing loss and are reserved for dire cases. (These are the Dr. Google recommendations we try very hard to stay away from). Most patients respond well to steroid perfusion therapy and rarely require further action.

Balance therapy may be indicated for some, but for the majority of patients based on our clinical experience, this is generally not necessary. Theories exist as to why a condition within the ear affects brain consciousness creating the sensation of fogginess. After pouring over the literature, my professional opinion is: no one knows. My personal opinion, having suffered this condition for many years, is that Meniere’s Disease creates a constant symptom of imbalance in which the body fights tirelessly to try to “right itself ”. This constant exertion probably tires you, not only physically, but also mentally, creating a murkiness in your daily thoughts. Severity ranges from a mild brain mist all the way to a giant wall cloud. Foggy-headedness can also arise from a number of additional medical conditions. Medications, migraine headaches, fibromyalgia, anxiety, s inus i nfections, a llergies, multiple sclerosis, attention deficit disorders (and probably brain-eating amoebas) make the list. Accompanying symptoms such as nausea, vomiting, blurred vision, headaches, chest pain, syncope and of course ear symptoms will help your medical team zone in on which appropriate tests, procedures and referrals to order. Many patients ask, “How do I fight the fog?” For me, achieving a low-salt, low caffeine diet (although I frequently cheat), and responding to ear steroid perfusions fought most of the battle. Staying physically active with aerobics such as, horseback riding, and waterskiing has also helped… not that I am graceful or even good at these activities! For older patients, other recommendations include walking, water aerobics, and staying active in general can help to improve vestibular function, physical health, and emotional wellbeing. I read (and write) as much as possible and practice sudoku puzzles to help improve my mental acuity. “Use it or lose it”, we often hear. Practicing mentally challenging activities has been helpful for me. I am often reluctant to tell patients how well I’ve done from treatments because I would hate for them to have a less effective result and compare themselves to my experiences. Nearly all of them appreciate the candidness and understand that each patient can have a different outcome. However, the vast majority of our patients do respond well to treatment and their quality of life improves vastly. I am fortunate to work with one of the most knowledgeable ENT physicians in North Alabama. Dr. Neeta Kohli-Dang and I share a passion for diagnosing and treating dizziness in addition to a multitude of other ENT conditions. We’ve had numerous patients visit us over the years with symptoms similar to mine. When I was initially diagnosed, I was embarrassed that I had ig-

nored my own signs of inner ear. What kind of a provider doesn’t realize she has the very condition that she treats? But after seeing Meniere’s patients for the majority of my nurse practitioner career, I’ve come to the realization that one size certainly does not fit all. I am able to chalk it up to the vagueness of my clinical presentation. Once clear-cut Meniere’s symptoms arose, I jumped on it like a duck on a June bug. And I certainly have no trouble telling my story, no matter how self-deprecating; if it helps someone lift the fog.

Kari Kingsley, MSN, CRNP works as an otolaryngology nurse practitioner in collaboration with Dr. Neeta Kohli-Dang. Together they share nearly forty years of ENT experience. They treat dizziness, ear infections, hearing loss, nasal congestion, sinus infections, thyroid nodules, tonsillitis, neck masses, hoarseness, trouble swallowing, and a multitude of other ear nose and throat conditions. Please call 256-882-0165 to schedule an appointment with Dr. Neeta Kohli-Dang and Kari Kingsley.

using a mirror placed at the back of the tongue or with a flexible laryngoscope. The latter procedure utilizes a tiny fiber-optic scope that is slowly passed through the nose and down towards the larynx to visualize the vocal cords in more detail. We take the time to numb the patient well with nasal and throat sprays. “Trust me, I’m a wimp and I’ve had it done” is usually the first thing I tell my patients that are tough guys when their eyes get wide at the first sight of our tiny scope. We even pass out our popular candy lollypops to help clear the taste of the numbing sprays, like in the good ‘ole days. Appropriate treatment is recommended based upon visualization of the vocal cords. We sometimes have our speech pathologist perform a video stroboscopy in the office which displays the vocal cords on a large TV monitor allowing slow motion assessment for better visualization and understanding of vocal cord mobility. This is especially useful in patients with vocal cord dysfunction, laryngospasm, muscle tension dysphonia, and vocal cord nodules. Our speech pathologist’s name is Bambi and she’s actually cuter than a zorce! In the primary care world, prevention is critical. Teaching your patients to quit smoking, stay hydrated, and to treat allergies and reflux certainly helps. Encourage patients with hoarseness to use a microphone for public speaking, or avoid speaking or singing all together if the voice is weak or hoarse. And if ever you are concerned that you might have a zorce on your hands, lasso that baby, and send them over to ENT!

Kari Kingsley is a board certified acute nurse practitioner, having worked in otolaryngology since January 2010. She is a UAH graduate with a Master’s of Science in Nursing. She maintained a 4.0 GPA throughout her training and graduated with honors. Kari currently works for Dr. Neeta Kohli-Dang at Huntsville Ear, Nose, and Throat. She serves on the Board of the North Alabama Nurse Practitioner Association, the Angel of Hope Memorial Group, and is the Chair-person for the Huntsville Chapter of the American Foundation for Suicide Prevention. Dr. Neeta Kohli-Dang is a board-certified otolaryngologist and a Fellow of the Royal College of Physicians and Surgeons. She has been practicing in Huntsville for about 20 years with regional and international patients. She was selected to participate in a national multi-centric study involving chronic sinusitis and balloon sinuplasty with subsequent publication regarding its efficacy.

Tissue

PASS ME A by, Kari Kingsley, MSN, CRNP

Do you consider yourself to be open-minded or closed-minded? Open-minded people are considered to be more willing to embrace change and generally have a higher level of curiosity. They try new things, live in the present, and often times seem less judgmental. While it is often perceived as a good thing to have an open mind, you don't want to be so open-minded that your brains leak out of your nose! In today's culture, it is possible that our thoughts leak too freely; however, there is a true medical condition in which your mind lubricant literally drips out of your nose… cerebrospinal fluid rhinorrhea or CSF rhinorrhea. It’s important to know when to dive for a tissue and when to call your nearest ENT. Most of us have suffered the embarrassment of talking to a close friend or loved one only for your nose to begin running like a sieve. Perhaps triggered by a blooming Bradford pear tree, the outdated perfume of the sweet elderly lady who sits close to you in church, or even a hot bowl of your favorite chicken noodle soup. We quickly dart our eyes around the room to make sure no one is watching, then hightail it to the nearest box of tissues before our sleeve is saturated. Clear nasal dripping can be one of the most aggravating and embarrassing

issues to deal with. Each year, millions of Americans are seen at walk-in clinics, primary care offices, and by otolaryngologists and allergists for nasal discharge. Common causes of nasal drainage include seasonal or non-seasonal allergies, upper respiratory tract infections such as rhinovirus and cold temperatures. Crying (or trying not to cry) during your favorite Nicholas Sparks book can sometimes cause a drippy nose. Rebound congestion after prolonged use of topical decongestant drugs such as Afrin, chronic sinusitis, nasal polyps and cluster headaches can also be to blame. However, cerebrospinal fluid rhinorrhea is a rare and potentially life-threating condition that also presents with clear nasal discharge. CSF rhinorrhea occurs when the meninges (the membrane barrier that lines the skull and vertebrae to protect the brain and spinal cord) is torn and cerebrospinal fluid drips down the nose. Ascending infection can lead to meningitis and in some cases death. The cause of common rhinorrhea or drippy nose is characterized by overabundance of mucin produced by mucous membranes that line our nasal cavities. With rhinorrhea, mucus is created faster than the body is able to process it, leading to clogging in the nasal cavities. Gravity takes over, causing nasal discharge. Accompanying symptoms generally vary based on the underlying cause, but can include nasal congestion, facial pain, headache, nosebleeds, sneezing, ear pressure, sometimes ear infection and even sinusitis. As excess mucus drips down the back of the throat, excoriation can occur causing sore throat and coughing. Generally, nasal drainage is evaluated by medical providers with a thorough history to elicit the exact cause so that they can treat you accordingly. Many cases are self-limiting, such as the common cold, and do not require treatment. For allergic and non-allergic rhinitis, medications can be helpful including cortisone nasal sprays, antihistamines, vasoconstrictors, and sometimes antibiotics if a bacterial infection is suspected. Many claim that natural treatments like saline sprays and herbal oils can also be helpful. New in-office treatment options are available to alleviate nasal drainage. And then of course there’s honkin’ your schnoz (nose blowing) for which the Kleenex family greatly appreciates your business. Allergy testing and immunotherapy are helpful for some. Evaluation by an Ear, Nose, and Throat provider can be valuable to rule

out underlying co-morbidities such as sinusitis, nasal polyps, and additional upper respiratory disease. Sometimes what you may think is good-old-fashioned snot can actually be something far more deadly. Cerebrospinal fluid rhinorrhea is a rare malady that can occur traumatically or spontaneously. Classic nasal CSF leak presents with unilateral (one-sided) clear nasal drainage that often worsens when bending forward. Sufferers sometimes complain of a metallic or salty taste. Predisposing conditions include obesity causing increased intracranial pressure, severe sleep apnea, congenital skull bone malformations, hyper-pneumatization of the sphenoid sinus, and a condition called empty sella turcica. Accompanying symptoms can include headache, lack of smell, nasal congestion, weakness, dehydration, and night cough. Severely symptomatic patients present with symptoms of meningitis including nuchal rigidity, sudden high fever, altered mental status, photophobia, phonophobia, and even seizures. Traumatic CSF rhinorrhea is a sign of basal skull fracture related to head trauma and can have devastating complications. CSF leak is also a very rare complication of sinus surgery. Evaluation and diagnosis are centered around a thorough history, sampling of collected nasal discharge which is sent for β-2-transferrin assay, nasal endoscopic examination to visually identify the place of leak, and radiological diagnosis with skull CT scans. MRI helps in detecting hernial protrusion of the brain in the skull found in encephalocele. Treatment options include watchful waiting as some CSF leaks will heal spontaneously. Surgical intervention includes a type of bypass surgery in which an overlay lumbo-peritoneal shunt is placed. Moderate failure rate is expected and surgeons then perform transcranial and trans-nasal approach surgery with osteoplastic craniotomy with closing of the defect using the patient’s own donor tissue. Timing is critical. Risk of meningitis in patients with persistent CSF rhinorrhea may be as high as 20%. Meningitis is a life-threatening condition in which the meninges becomes infected leading to fever, headache and neck stiffness. Untreated meningitis is almost always fatal. If you or a loved one suspect you may have CSF rhinorrhea, don’t delay evaluation by an otolaryngologist (ENT). Most of the time, clear nasal drainage is a nuisance rather than a life-threating situation. But it’s important to know the warning signs of CSF rhinorrhea and seek immediate medical help. While I would normally encourage everyone to “keep an open mind”, please don’t keep it so open that your thoughts (or spinal fluid) leak out on to your shirt. “Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.”

The Zorces of Hoarseness by Kari Kingsley, MSN, CRNP and Neeta Kohli-Dang, M.D. In nurse practitioner school, we were taught to identify the zebras in medicine. While most of what we come across on a day-to-day basis as medical providers will be a variety of horses (sinus infection, UTI, or hypertension). Rarely we’ll catch a once in a life-time diagnosis, a zebra, causing us to call in our collaborative teammates to marvel at the medical complexities while appropriately treating this unique patient. Basically, the medical community is trained to identify the zebras, but expect to catch the horses. A while back, I had a lovely experience visiting a local drive-through animal zoo. Sometime between the man-sized emu ripping the food cup from my hand (as I shrieked like a 5-year-old girl) and before the giant water buffalo licked my steering wheel, I came across an unusual creature that appeared to be half zebra and half horse. A zorce. Knowing that I have an immense passion for writing and for treating ENT conditions, this peculiar little creature peaked not only my equine-passion (my dad didn’t get me a horse for my 13th birthday and I’m still not over it) but also fired up my left-brain hamster-wheel motor neurons alerting me that my article on hoarseness should include the theory

that not all hoarseness equals common horses. While zebras are rare, we are seeing more and more zorces. Hoarseness is a medical symptom described as a harsh, raspy, breathy, or strained voice caused by a multitude of conditions. Generally, hoarseness stems from a problem involving the vocal cords or “voice box”. The most common “horses” we find in otolaryngology include reflux, irritant laryngitis, and post nasal drip with allergies. Laryngopharyngeal reflux (or LPR) is a common condition found in the ENT world and involves stomach acid that refluxes up the esophagus and through the upper esophageal sphincter causing backflow onto the voice box. Associated symptoms include dry cough, globus (sensation of a lump in the throat), and repeated throat clearing. Postnasal drainage from allergic and nonallergic rhinitis can also cause laryngitis with thick mucus irritating the delicate vocal cord mucosa. Other common primary causes of hoarseness include acute laryngitis, sinusitis, and vocal cord strain. Most of these conditions, once identified, can be treated appropriately based upon diagnosis.

Now let’s delve into horses of a different color: the zorces and sometimes zebras of hoarseness. Vocal hemorrhage, laryngeal cancer, vocal polyps, thyroid cancer, post-surgical vocal cord paralysis, lung cancer, esophageal cancer, neurological diseases, and neck trauma are the causes of hoarseness you don’t want to miss as a clinician. As a provider, the appropriate question is, “When do I refer a patient with hoarseness to the ENT for further evaluation?” According to the American Academy of Otolaryngology – Head and Neck Surgery, hoarseness that persists beyond three weeks should be evaluated. Smokers are at particularly high risk and so consider referral sooner. Hoarseness with difficulty breathing warrants urgent intervention. Additional symptoms such as coughing up blood, difficulty swallowing, neck mass, and pain when speaking or swallowing are suggestive of malignancy. What should you and your patients expect when coming to an ENT for evaluation of hoarseness? A detailed history of present illness is crucial, followed by a thorough ENT head and neck examination. ENTs can visualize the vocal cords via indirect examination

Afrin Addiction:

by, Kari Kingsley, MSN, CRNP

I never meant to become a nasal spray junkie! As our population grows, more and more people are becoming addicted to Afrin. What starts out as a couple of squirts of an over-the-counter decongestant during a head cold can lead to years (and sometimes a lifetime) of dependence. Common decongestant vasoconstrictors like Afrin, Dristan, and Vicks Sinex containing oxymetazoline are to blame. Most nasal decongestant sprays come without a prescription and provide temporary relief of nasal congestion caused by conditions such as hay fever, sinusitis, deviated septum, and the common cold. Afrin works by shrinking the blood vessels in the nasal area to reduce swelling and congestion. It’s not a prescription, so it must be safe, right? Sure. If you use it as directed. But using Afrin-like products past the 3- to 4-day mark create a condition of rebound congestion called rhinitis medicamentosa, which is a fancy way of saying, you got yourself hooked on Afrin.

Afrin creates vasoconstriction (shrinkage of the blood vessels) which, over time, depletes healthy nasal tissue of vital oxygen rich blood and nutrients. Your nose tries to compensate for this deficiency by enlarging veins and capillaries. Once the Afrin wears off, rebound congestion occurs. As we use more nasal spray, we develop a tolerance, requiring more and more spray to achieve the initial amount of relief. Rebound congestion leads to a vicious cycle of Afrin dependency. Sort of like a body builder beefing up on steroids, Afrin use over time works to enlarge tissue in the nose, creating a serious problem for users. While Afrin is not considered a drug of abuse, chronic Afrin use can create both a physical and psychological

addiction. Blogs and online support groups are filled with people looking for help. “I got myself back on Afrin May of last year and have been using it twice a day since….” “I’ve tried every prescription and herbal remedy known to man, but nothing works like Afrin….” “I’m desperate! Does anyone have experience with hypnosis curing decongestant addiction?” While Afrin addiction is not exactly a gate way drug to heroin, it can make you miserable both physically and mentally when you try to “hit it and quit it”. Symptoms of Afrin addiction or rhinitis medicamentosa include rebound congestion, nasal drainage, and sneezing. Rebound congestion associated with rhinitis medicamentosa generally occurs after about 5-7 days of continuous use. Instead of your bottled friend helping you to breath better, it begins to severely irritate the lining in the nose. Chronic Afrin use can also lead to structural changes in the nose, eventually leading to permanent turbinate hypertrophy. Tips to trash the Afrin….and no, I won’t say the best way to get off it is to never start it…. (don’t you want to smack people like that?) As with any addiction, treatment for Afrin overuse involves one key process: withdrawal. But you have options (my dad always says “Options are the key to happiness!”. Option 1: Cold Turkey. (I shiver just thinking about it) Benefits to cold turkey are that it’s fast and you’ve eliminated to cause of the problem. Downsides: IT’S COLD TURKEY! As soon as your last hit of Afrin wears off, you’ll be dealing with severe nasal congestion. And depending on the chronicity of use, you may be left with permanent structural issues. Option 2: Weaning. Gradually cut down the amount you are using. Just like with any dependent medication, titration is key. Option 3: Turbinate reduction: an easy procedure to reduce stuffy tissue in the nasal cavity.

Option 4: Even your options have options! Try a combination of the three. Many people elect to have a small nasal procedure combined with quitting Afrin, or using short-term oral steroids and/or switching to non-addictive medications like nasal steroid sprays as well as safer herbal remedies like Xylitol sprays. Be sure to discuss your treatment options as well as alternative medications with your primary care doctor or ENT. Patient expectation is CRUCIAL. When using intranasal steroid and antihistamine sprays, a butter knife is not going to cut like a machete! But how do you eat an elephant? One bite at a time! â&#x20AC;&#x153;Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.â&#x20AC;?

understanding

dizziness by Kari Kingsley, MSN, CRNP

Define dizzy. It’s not as easy as it sounds. What one person may describe as an intermittent spinning sensation may be described as lightheadedness to the point of almost passing out by another. Others may feel they are experiencing a constant drunk and staggering feeling at all times. Dizziness is a catch-all term for a variety of different sensations caused by many medical problems. Because dizziness is subjective rather than objective, it can be difficult for patients to describe. For those of us on the frontline of medicine, it can be Pandora’s box in terms of evaluation and differential diagnoses. That one simple sentence, “I’m dizzy”, could range from a simple ear infection to a brain tumor. Our job as clinicians is to know the difference.

ebster defines dizzy as an adjective that causes “a feeling that you are turning around in circles and are going to fall even though you are standing still”. The term can also mean mentally or emotionally upset. Rising co-payments and deductibles are making me maddeningly dizzy! Dizzy also has a connotation of “feeling silly” or “tending to forget things”. Public misconception and stigma of the word sometimes delay those who want to receive help for fear of scrutiny of hypochondriasis and psychological conditions such as anxiety. Dizziness is a symptom of a medical condition and not a disease by itself. Dizziness can be classified as peripheral and central. Peripheral dizziness is caused by conditions affecting the ears. Central dizziness arises from conditions affecting the brain and central nervous system such as a lesion in the brainstem or cerebellum. So, what qualifies someone to write an article on dizziness? Well, if you remember the 1980’s infomercial: “I’m not only the president of Hair Club for Men, I’m also a customer!”; that pretty much sums up my perceived knowledge-base and repertoire on the subject. I have worked in Otolaryngology as a Nurse Practitioner for the last 7 years. For the last 3 years, I’ve had the privilege of working alongside Dr. Neeta Kohli-Dang at Huntsville Ear, Nose, and Throat. We devote a large portion of our practice to diagnosing and treating dizziness. Having been diagnosed with Meniere’s disease myself 6 years ago, I have developed a passion for treating dizziness and feel like I could write a novel on the subject. I’ll save you the time (and associated papercuts) and give you the Cliff Notes version so that the next time you or a loved one is experiencing dizziness, you’ll have an idea of how to get off the merry-go-round. Patients probably wonder, how does a provider assess, diagnose, and treat a dizzy patient? The secret to delineating a proper dizzy diagnosis begins with obtaining a proper and thorough his-

tory. You must be able to recognize which key words in a patient’s history that scream abracadabra! You are on the right track! The goal of this article is to provide you with the ammunition to delineate symptomatology of dizziness in more detail so that you will obtain a proper diagnosis quicker and begin treatment sooner. If we pretend that all of the many medical conditions causing or contributing to dizziness are represented by flowers on a dogwood tree, seeking the proper diagnosis seem like finding a needle in a haystack. But if you think of the word dizziness as the trunk of a tree, with certain key phrases (or “abracadabra” words) directing you down varying branches, the job gets much easier. Let’s start with the most common conditions and work our way on to the “zebra’s”, as we in the medical field like to call those rare conditions that news shows love to cover (e.g. Brain eating amoeba causes dizziness in 33-year-old nurse practitioner). For your edification, I’ve notated key “abracadabra” words in bold. Perhaps one of the most common causes of dizziness and least dangerous is Benign Paroxysmal Positional Vertigo. However, if you ask anyone who has ever suffered from BPPV, they will tell you this condition is anything but benign. Positional vertigo is condition arising from the inner ear in which people experience brief, repeatable spells of a spinning sensation when changing position. The condition can be acute and chronic as well as atypical (not responding to common therapy, although this is rare). Tiny calcified otoliths (or “crystals”) that have come loose in the vestibular canals create the sensation of a true vertigo (sensation of spinning) when the head is reoriented relative to gravity. The condition is diagnosed based on the Dix-Hallpike maneuver eliciting nystagmus (specific eye movements). Treatment of BPPV consists of a simple procedure called an Epley maneuver, which moves the otolith crystals out of the balance canals to be reabsorbed by the body. “PLEASE do your Voo-doo maneuver” is a request I frequently get from several patients when symptoms recur. Many of them get a good chuckle at the fact that, yes indeed, their rocks have come loose and they’ve temporarily lost their marbles. Brandt-Daroff exercises can also be helpful. Medications are rarely needed for this condition and in fact, can sometimes hinder progress. One of the next common inner ear conditions is Meniere’s disease, which is probably my favorite condition as a clinician to treat. If I were to “speak” all dizzy languages, then this would be my native tongue. Probably because I have this condition and relate to those with it. Sadly, what I experience is only a fraction of what other patients feel. Picture yourself on a seemingly never ending tilt-a-whirl in which your right ear feels as

if it might explode from pressure as a car horn blares roaring tinnitus in your ear. Just about any medical provider assessing a patient with these classic symptoms would suspect an inner ear issue. Classic Meniere’s patients present with bouts of dizziness that can be described as an “off-balance sensation” all the way to true “spinning-vertigo” usually coming in spells that can last several hours. Generally, there is significant ear pressure and fullness in one or both ears accompanied by ringing or roaring tinnitus. Patients may also have low-frequency hearing impairment. But you can also have atypical forms of Meniere’s, with only some of these symptoms. Diagnosis is based on the patient’s history, audiogram, and vestibular testing. Magnetic resonance imaging (MRI) should be conducted to exclude transient ischemic attack (TIA), stroke, acoustic neuroma, or a tumor of the endolymphatic sac. Treatment of Meniere’s disease generally begins with a step-wise approach. Patients are advised to lower their sodium intake and also eliminate other triggers such as caffeine, tobacco, and alcohol. As a full-time working nurse practitioner student being told to limit my caffeine intake, I literally spewed coffee from my mouth, laughing, as I spilled Mountain Dew in my lap. Mediations such as diuretics, steroids, anti-emetics, and vestibular suppressants can be helpful for some patients. Physical therapy and an exercise regimen are advised for many. Transtympanic dexamethasone perfusion therapy provides a minimally invasive, in-office procedure that provides significant lasting relief for most patients. Invasive procedures such as endolymphatic sac decompression and shunt placement should be reserved for more severe cases. Destructive procedures, such as gentamycin perfusions, labyrinthectomy, and vestibular neurectomy can cause irreversible effects such as permanent hearing loss and are reserved for dire cases. Most patients respond well to steroid perfusion therapy and very rarely require further action. I am grateful to work for an ENT that uses cutting-edge technology and the safest techniques possible to perform these procedures on myself and her patients. And likewise, I think she is grateful NOT to have a staggering and stumbling nurse practitioner wobbling around her office! Infectious processes such as vestibular neuritis result from inflammation in the inner ear thought to be bacterial or viral in origin. Symptoms can be precipitated by a head cold and are generally described as severe vertigo in which the patient is unable to walk without assistance. Labyrithitis is suspected when symptoms are accompanied by unilateral sudden hearing loss. Patients usually experience associated nausea, anxiety, and malaise as the brain receives distorted balance signals from the inner ear. Treatment in

the acute phase consists of vestibular suppressants such as Valium or Meclizine, however, patients are encouraged to wean these as soon as possible to avoid potential addiction. Physical therapy and specific vestibular rehabilitation is crucial for some patients. Physical therapy combines repetitive head, eye, and postural changes with walking exercises in the hopes of achieving permanent compensatory changes in the brain. Patients that complain of lightheadedness should be evaluated for syncope and near syncope. Although sometimes these symptoms can be descriptive of otogenic causes, more often the culprit is vascular. Workup for orthostatic hypotension, poor blood circulation, TIA, cardiomyopathy, heart attack, and heart arrhythmia should be considerations for patients that present with dizziness. Syncope work-up can be extensive but necessary for some. Laboratory considerations should include serum glucose, complete blood count, electrolyte levels, renal function tests, cardiac enzymes, creatine kinase, and urinalysis. Imaging studies are also critical. Again, use your “tree branch” methodology to elicit a proper diagnosis. If a patient is dizzy with fever, leukocytosis, and cough, consider a chest x-ray to rule out pneumonia. Other etiologies that can present with lightheadedness include congestive heart failure and pulmonary masses. CT head, chest, and abdomen are considerations when accompanying symptoms warrant them. Rather than a shot-gun approach to medicine, ask as many questions as possible and try to narrow your target range. MRI and MRA are helpful in delineating brain and neck structures to assess for abnormal vertebrobasilar vasculature. Ventilation-perfusion scanning is appropriate for patients presenting with symptoms of a pulmonary embolism. Echocardiogram is helpful in evaluating mechanical cardiac causes of lightheadedness. EKG, Holter/Event monitoring, and stress testing can be helpful (and sometimes critical) to diagnosing arrhythmias, myocardial infarctions, or myocardial ischemia. Don’t panic! If you are a clinician, know your scope of practice and call in outside resources. Consult otolaryngology, neurology, neurosurgery, cardiology, pulmonology, nephrology, or endocrinology. You are not alone! A multitude of neurological conditions can present with dizziness. Migrainous vertigo or vestibular migraine is a type of migraine causing dizziness associated with severe headaches. Additional neurological conditions causing disequilibrium include multiple sclerosis and Parkinson’s disease. These processes generally cause deconditioning which can lead to progressive loss of balance. Cerebellar ataxia can be caused by a wide variety of infectious, immune mediated, metabolic, toxic, and degenerative etiologies. Discussion of any serious head injuries should always be included in the work-up of a dizzy patient. Brain tumors can also cause dizziness. Again, consult neurology or neurosurgery as needed.

Medications. Here’s a biggie! Run and grab 4 pill bottles from your medicine cabinet. I’ll bet you a dollar to a donut that somewhere on that long list of “possible side effects” you’ll find dizziness. Many medications can cause dizziness. Common culprits are blood pressure medications, antidepressants, sedatives, tranquilizers, and stimulants. However, in clinical trials, the FDA requires manufacturers to list side effects that occurred more often among patients taking the drug than those receiving placebo. Some companies even choose to list symptoms reported in the experimental AND control groups. Thus, common conditions like headaches, nausea, and dizziness will commonly show up on medication side effect profiles. Polypharmacy is another major contributor to dizziness. Polypharmacy is the use of four or more medications and can affect as many as 40% of elderly adults living at home. When assessing dizziness, always take in to consideration a person’s medication list. As I mentioned above, numerous medications can lead to dizziness. Adding medications that cause dizziness to medications that cause dizziness is a recipe for disaster! Many people have multifactorial dizziness or a combination of factors contributing to their symptoms. Balance requires a person’s eyes, ears, sensory nerves, and proprioception to work properly. When one’s equilibrioception has a kink in the chain, the bicycle won’t work properly. All of these components work together to tell a person where they are in space and time. Let’s take a classic diabetic male patient for example. Chronically elevated blood glucose levels have caused permanent damage to the microvascular blood supply in a person’s feet (peripheral neuropathy). Suddenly he no longer has sensory feedback to tell him where he is standing. The same high blood sugar has affected his eyesight causing diabetic retinopathy. Now he can’t see. Lastly, his fluctuating blood glucose levels are sending signals to his brain that “something’s not right” causing disequilibrium and lightheadedness. A break down in one of the critical faculties for balance can cause an issue. A break down in them all can mean big trouble. Ok, now the zebras. These conditions are rare but do exist (remember, I said zebras, not unicorns). Arnold Chiari Malfomation is a neurological condition in which brain tissue extends into the spinal cord. Patients often times present with headaches and dizziness described as a bouncing sensation when walking. Treatment varies based on the severity of prolapse and symptomatology. Mal de Debarquement Syndrome is a rare neuro-vestibular condition that occurs when a person exits a sustained motion event such as a cruise or aircraft flight. A major diagnostic indicator is that patients may feel better while in passive motion such as driving or riding in a car. Medications such as vestibular suppressants and vestibular rehabilitation are the mainstay of therapy. A perilymph fistula or labyrinthine fistula is an abnor-

mal opening in the bony capsule of the inner ear causing perilymph fluid to leak from the semicircular canals into the middle ear. PLF is usually caused by trauma although can be congenital or a complication of some ear surgeries. Middle ear exploration is often required for diagnosis. Treatment usually includes watchful waiting and avoidance of activities that increase intracranial pressure (weightlifting, scuba diving, etc). Again, vestibular rehabilitation may be indicated for some. Superior semicircular canal dehiscence syndrome is a rare thinning or complete absence of part of the temporal bone overlying the superior semicircular canal portion of the vestibular system. Patients often present with dizziness, autophony (hearing one’s own self-generated noises such as speech, eye movements, heartbeats, etc.), and positive Tullio’s phenomenon (sound induced dizziness). Diagnosis is made through coronal CT scan of the temporal bone. Treatment again depends on severity of symptoms but can include middle fossa craniotomy with soft tissue grafting or use of bone cement to surgically resurface the affected bone. Vestibular schwannoma or acoustic neuroma is a benign tumor growing along the vestibulocochlear nerve. Incidence is thought to be 1 to 2 people per 100,000 per year. Symptoms generally include asymmetrical hearing loss with speech discrimination impairment along with tinnitus and dizziness. Any patient presenting with these symptoms should undergo a MRI contrast with specific cuts through the internal auditory canal. Treatment options vary based on symptoms and patient’s age but include watchful waiting, surgical resection, and radiation treatment. Dizziness can be an overwhelming symptom unless you know what key phrases in a person’s history to watch for. Ask questions. Look for the “abracadabras” and Ah-hah! moments! Don’t become overwhelmed. Use your resources. Consult ENT. The goal of treating dizziness is to find the underlying cause and manage the condition effectively. There is nothing more gratifying as a clinician than properly diagnosing a patient, starting the proper treatment regimen, and having your patient come back to me and say, “THANK-YOU, I’M MUCH BETTER”. So… after reading this article, if you weren’t dizzy before… You probably are by now! J And yes, brain eating amoebas probably cause dizziness. I’ll let you know when I see a case. Please call 256-882-0165 to schedule an appointment with Kari at Huntsville Ear, Nose, and Throat. Kari Kingsley is a board certified acute nurse practitioner. She graduated from the University of Alabama in Huntsville with a Master of Science in Nursing. She maintained a 4.0 GPA throughout her training and graduated with honors. Kari is licensed by the Alabama Board of Nursing and certified by the American Nurses Credentialing Center. She currently serves on the Board of the North Alabama Nurse Practitioner Association and is the Huntsville Chair-person for the American Foundation for Suicide Prevention.

Before Hayfever Goes Haywire by Jarrod Roussel, PA-C

It’s that time of year again. The sun peeks over the horizon a little earlier. The birds sing a little louder. The temperature is a bit warmer to the point that you dare to cast off pants in favor of shorts. Coffee in your favorite mug even just seems to taste better.

That’s right - it’s spring!

This morning starts like every other morning, however, something is different, a little off. You can’t place your finger on it, but you just know it’s there. Peering out the window, you catch a glimpse, and then you realize why. There is a yellowish-green haze that blankets everything as far as the eye can see. And then it happens, “ACHOO!” Allergy season has descended upon you just like the pollen on the hood of your car. You know that a trip to the pharmacy or your doctor’s office seems eminent, but you want to try something natural to ward off the sneezing, running nose, and watery eyes. You begin to wonder if there’s something that fits the bill. I have great news for you. The answer is, “yes!” Here is a list of a few oils, herbs, and supplements that have been shown through many years of use, and even clinical studies, to be helpful with seasonal allergies.

Peppermint

Using peppermint essential oil in a diffuser is very helpful to open the airways, act as an expectorant, and numb sore throats. If you don’t have a diffuser, you could simple place a few drops on a cotton ball and breathe in a few whiffs that way. You can mix a drop or two of the oil with a carrier oil, such as almond, coconut, or rosehip, and rub it directly onto your chest. Peppermint oil has been clinically shown to have airway opening properties in animal model studies. I have personally found this one to be very beneficial.

Eucalyptus

Eucalyptus essential oil has similar benefits to that of peppermint essential oil, although, there are different compounds found in each. It has been shown to have anti-inflammatory and antispasmodic activity within the airway. It can be mixed and applied just like peppermint oil.

Boswellia

Boswellia is known to be a natural anti-inflammatory with properties that can inhibit airway congestion. It is reported to inhibit leukotriene formation ; it works similarly to the popular asthma and allergy medication montelukast. It has numerous other reported health benefits as well. My wife and I have personally used boswellia with great success for inflammation and pain. It is important to note that boswellia can also thin your blood like aspirin so you should consult with your PCP if you are on blood thinners. Boswellia is available as a powdered herb in a capsule. For dosage recommendations, consult the directions on the packaging.

Stinging nettle

Stinging nettle may sound familiar if you ever spend any time in the woods. The herb that packs quite an annoying sting

if brushed across your skin also has histamine blocking properties as well as blocking other pro-inflammatory enzyme activity . It is available as a loose powder, in capsule form, or as a tea.

Mullein

Mullein is an herb native to Europe from which a tea can be made. It is shown to have potent anti-inflammatory activity thus easing symptoms associated with seasonal allergies. Mullein is also touted as an expectorant.

Magnesium

This is a mineral that is necessary within the human body for over 300 biochemical reactions. It plays an important role in normal nerve and muscle cell function, helps to maintain strong bones, and assists in the regulation of blood sugar just to name a few. Increasing our intake of magnesium may help to reduce airway overreaction to allergens Magnesium deficiency can actually exacerbate the release of histamines by mast cells, which are part of the white blood cells that deal with our allergic responses. A large portion of the population in general is deficient in magnesium to some degree. You can purchase it as a supplement from your preferred vitamin supplier. Generally, 400mg of magnesium per day is recommended per current guidelines.

Quercetin

This is a flavonoid found in many different natural foods such as fruits, vegetables, leafy greens, berries, and grains. Typically, it can be purchased in capsule form from your vitamin supplier. Clinical studies on animal models showed significant decrease in the level of histamines in the blood stream when taking Quercetin.

Local Raw Honey

The principle behind this remedy is believed that it works like allergy injections such that your body is exposed to local pollens. Your body then becomes desensitized to those pollens. One short-term study showed no effect, but studies with higher dose exposures over a course of eight weeks showed significant reduction in allergy symptoms. Honey has also been shown to contain quercetin, which may add to the therapeutic effect. Now, anything that works to support your immune system can also help with your allergies since allergies are an overactive response to substances in the environment that are otherwise harmless.

So there you have it! We have only scratched the surface of potential ways to naturally treat your seasonal allergies, and these just happen to be some of our favorites. The next time springtime hits and you start to feel that familiar twinge in your nose, like a sneeze about to sneak attack you, reach for your favorite remedy. Never fear the pollen again! For more information on feeling better and living longer, be sure to tune into www.thecrunchycouple.com *As always, consult with your primary healthcare provider before starting these or any other natural remedies, especially if you take medications or have a history of any medical conditions. Remember that herbs can potentially cross react with medications. Never stop a medication or take a medication in any manner other than prescribed without consulting your doctor, PA, or NP. If you have a serious or life-threatening allergic reaction, seek immediate medical attention. Jarrod Roussel, PA-C is Co-founder of The Crunchy Couple, LLC www.crunchycouple.com Reference: 1. J Ethnopharmacol. 2011 Oct 11;137(3):1528-32 2. J Nat Prod. 2002 Dec;65(12):1939-41 3. Adv Exp Med Biol. 2016;928:291-327 4. Phytother Res. 2009 Jul;23(7):920-6 5. Phytother Res. 2012 Nov;26(11):1681-7 6. Lancet. 1994 Aug 6;344(8919):357-6 7. J Allergy Clin Immunol. 2005 Jan;115(1):171-8

TIPS FROM THE DOC:

Controlling Allergies Whether it is spring or fall in Alabama, allergies seem to be a problem. You may be packing away the past season’s clothes, bringing out the garden tools, or visiting a cotton field but you also better be preparing for the billions of allergen molecules in the Tennessee Valley. Just for reference, in 2012, Alabama was ranked as number two in the country when it comes to the pollen index. If you greet the arrival of spring or fall with watery eyes, sneezing, dark circles under the eyes, and a stuffy nose, it's time to learn a few tricks about coping with seasonal allergies. The most common allergy triggers, according to the Asthma and Allergy Foundation of America, are listed below: • Trees, grass and weed pollen • Mold spores • Dust mite and cockroach allergens • Cat, dog and rodent dander

HOW DO WE CREATE A PERFECTLY GOOD SEASON WHEN IT COMES TO ALLERGIES? TREAT ALLERGIES EARLY • start the medications early to prevent a snowball effect of your symptoms KNOW YOUR OTC (OVER-THE-COUNTER) MEDICATIONS • be careful with some of the oral decongestants which can cause elevated blood pressure, palpitations, or elevated liver enzymes

by Marilyn Ligon, MD

POLLEN COUNTER • know what type of pollen is swirling around in your area today WASH YOUR HAIR BEFORE BED • so that pollen collected on your hair won't rub off on your pillow LEAVE YOUR SHOES AT THE DOOR • lessens the amount of allergens in the home CONTROL YOUR ENVIRONMENT • use protective allergy masks for tasks like washing the car, mowing the grass, or raking the leaves USE THE RECIRCULATE OPTION IN THE CAR • service the filters in your furnace and air conditioner for better breathing ADJUST THE INDOOR HUMIDITY LEVEL • if your allergies are from spores of mold, aim for a humidity level of less than 50% AVOID SITTING OUTDOORS AROUND FRESH CUT GRASS • this can cause sensitivity for some IMMUNOTHERAPY / ALLERGY SHOTS • proven to provide long-term relief of allergic rhinitis symptoms

I hope you and your sinuses both enjoy the outdoors this year

Finding the Problem with

ALLERGY TESTING by Kimberly Waldrop, M.A.

Allergiesâ&#x20AC;Śthat word we often hear when we are dealing with headaches, scratchy throats, and itchy eyes. Sometimes an over the counter medicine helps aid in getting through the seasons and problems. Other times, a doctor is needed to give something stronger to combat the illness. Allergies affect more than 50 million people in the United States alone. Doctors are available to help decipher what allergies exist in order to accurately treat them. Allergy testing can be performed by an allergy specialist as skin tests or blood tests. These tests can be performed on adults and children. Most often, a skin test is used unless a patient suffers from a skin condition, is taking medicine that can interfere with testing, or is worried for a severe reaction from the skin testing. Also, for younger children and babies, a needle prick may be easier than the several skin pricks used in skin tests. A skin test is performed on the patientâ&#x20AC;&#x2122;s back or forearm. A drop or suspected allergen is pricked or scratched on the surface of the skin. Many allergens are tested at the same time. A reaction typically appears within 20 minutes but can take up to several hours after the skin testing. The skin test is not necessarily painful but positive reactions cause annoying (sometimes itching) red bumps. Thankfully, the itching and bumps are usually gone in a few minutes or hours. From the results of the allergy test, the allergy specialist can determine what type of treatment is needed. Medicines are given by mouth or via injections. There are also new treatments that involve immunotherapy.

SEASON

by Kelly Reese

allergies

It has often been said that a person who suffers from eczema will also suffer from asthma. Well, there was truth in this for us.

Seasonal allergies affect nearly the entire population which resides beneath the peaks of some well-known mountains. Green Mountain towers the southern portion of our community, providing a beautiful landscape of rich colors. Monte Santo Mountain, the most central border to our hill-topped valley, is the home to some our finest communities. Yet, we all reside in what has been known or learned to be a factor to the painful symptoms of our environmental allergies, The Tennessee Valley. I’ll find myself reaching for a tissue, yet denying any reality my drainage may have a relative correlation to the air in which I breathe. My children suffer from allergies and have since they were young. My daughter was only a few weeks old when she started developing skin rashes and irritations that soon grew into a severe case of eczema. It has often been said that a person that suffers from eczema will also suffer from asthma. Well, there was truth in this for us. However, the asthma seemed to begin as our eczema trials disappeared. We had filled many lobbies of specialists with laughter, tears, fears and the unfortunate outbursts of a mother at her wits end with two children suffering from painful, irritating, itchy conditions that I hope we as parents don’t accept merely for a place we like to call home. After trying every prescription and over-the-counter medication known for relief without success, I desperately began to wonder if a solution could ever be found. Then suddenly, she grew out of it! Yes! Now, what do I tell my child whom I had convinced over time that her eczema made her special? I had always tried to comfort her by explaining that everyone was made special; and in this case, her skin made her special. Little did we know, this part of her description would disappear and quickly replace itself with her airways that would keep her home nearly an entire month from the school year. As mothers, we become desperate when we cannot meet the needs of our children. The sense of delusion can betray us of our initial assessment of timely encounters. Just like the moment you arrive at the hospital in hopes to get some sort of relief for your child, you realize that you have forgotten the very symptomatic sequence of events needed to help diagnose the issue. The same occurred with the pulmonologist who needed accurate information to best treat my children for their symptoms. I then discovered the phone would create a diary if I would just take a picture at the pediatrician’s office. Needless to say, my phone’s photo library is now full of these similar events to help with my children’s allergy patterns. I have often thought about what I haven’t tried and what else in our circumstance can be done in a considerable manner. We are just a few of the many people suffering with the same issues. Our daughter has now been under the care of a pulmonologist for over a year. Since his specialty is to understand and treat her type of condition, his management plan has helped her to significantly improve. He regularly monitors her symptoms and recommends treatment that allows her to live a normal healthy life.

Shingles

by D. Kishore Yellumahanthi, MD, MPH

& Post-herpetic Neuralgia

Herpes Zoster or Shingles is caused by the same virus that causes chicken pox â&#x20AC;&#x201C; Varicella Zoster Virus. After a person gets chicken pox, the rash resolves after few weeks but the virus remains inside the body for the rest of the life. At a later point, this virus, could get activated and manifest as shingles.

It is not clearly known what actually causes this activation. It could be spontaneous or associated with factors like stress, immunosuppression or radiation therapy and so on. Although Shingles can occur at any age, the risk increases sharply after 50 years of age. The incidence for herpes zoster is approximately 4 cases per 1,000 U.S. population annually, age-adjusted to the 2000 U.S. population. The incidence among people 60 years of age and older is about 10 cases per 1,000 U.S. population annually. HOW DOES THE RASH OF SHINGLES LOOKS LIKE? • Rash looks like groups of blisters arranged in a ribbon like shape. • Burning pain usually precedes the rash by few days. • The rash can occur anywhere – Lower extremity or Upper extremity or Trunk or Belly or Face. • The rash characteristically occurs on only one side of the body. • Never crosses the midline.

ARE ANY VACCINES AVAILABLE TO PREVENT SHINGLES? Currently there are two vaccines available that can prevent shingles. They are Zostavax and Shingrix. Both vaccines can be administered after 50 years old. Zostavax has been in the market since 2006. It is administered as a single shot (Intramuscular injection). No second dose is required. It reduces the risk of developing shingles by about 51% and PHN by about 67%. On the other hand, Shingrix which has been introduced in October 2017, is administered as two doses, 2 to 6 months apart. Two doses of Shingrix is supposed to be about more than 90% effective at preventing Shingles. The efficacy of two doses of Shingrix for prevention of PHN was about 91% for adults 50years and older and 88.8% in adults age 70 years and older.

WHO ARE SUSCEPTIBLE TO SHINGLES? All those who had chicken pox disease and also chicken pox vaccine are susceptible to shingles. It is to be noted that, people who had chicken pox vaccine are also prone to shingles just as people who had chicken pox disease, although the chances are less. For most part, shingles occurs only one time in lifetime. Second and subsequent attacks are rare. WHAT IS POST-HERPETIC NEURALGIA? The dreaded complication of shingles is ‘Post - herpetic Neuralgia’ or PHN. Unfortunately, it is the most common complication of shingles. Generally, if pain in the area of shingles persists beyond 3 months, it is categorized as PHN. This complication, which occurs in approximately 20% of patients who had shingles, can severely affect the quality of life of that individual, as it can cause severe pain and can last for several years. It would not be an exaggeration to state that, PHN can diminish quality of life to the same extent as that of congestive heart failure, heart attack, type II diabetes and major depression. It is worthy to note that 80% of PHN cases occur in patients 50 years or older. TREATMENT OF SHINGLES: Anti viral drugs like Acyclovir or Famciclovir or Valacyclovir, if taken within 72hrs of onset of shingles, can help in faster healing. It is not exactly clear if these drugs have any role in reducing the chances of PHN or not.

WHAT DOES FUTURE HOLD FOR SHINGLES AND PHN? Given that vaccine is the only way to prevent shingles and the subsequent PHN, it is certainly very exciting to know that there is a vaccine available in the market, that is more than 90% effective in preventing shingles. Since shingles is more common in people above 50 years, effective vaccination is going to significantly reduce the number of new cases of shingles, which in turn is going to reduce the number of PHN cases. Also, the severe long lasting PHN is more common in patients who are affected with shingles after 50 years. Keeping this in view, I believe that with effective vaccination, we can not only drastically reduce the incidence of shingles and PHN but also make the severe debilitating type of PHN, a rare case scenario. In the words of a patient of mine who is suffering with severe PHN, the pain of PHN is a very agonizing pain that she does not want to wish even her deadliest foes to suffer with. Would it not be a great

accomplishment, if we can make such an entity a rare one? Therefore, if you are 50 years and above, please contact your healthcare provider to discuss about shingles vaccine. SUMMARY Please keep your eyes open for shingles in any painful rash and seek medical advice as soon as possible - Remember, antivirals, if taken within 72hrs after the onset of the rash, can help in faster healing. Given shingles can cause PHN, a dreaded complication that can cause significant long lasting pain, every effort needs to be made to prevent shingles occurring in the first place through vaccination. Vaccine, Zostavax, reduces the risk of developing shingles by about 51% and PHN by about 67%. Another vaccine, Shingrix, introduced in October 2017, is supposed to be about more than 90% effective in preventing Shingles. It prevents PHN by about 91% for adults 50years and older and 88.8% in adults age 70 years and older. Both vaccines can be administered for all adults 50 years and above unless contraindicated. If you are 50 years and above, please contact your healthcare provider to discuss about shingles vaccine. Reference: CDC.gov Saquil A, Kane S, Mercado M, Lauters R Herpes Zoster and Postherpetic-Neuralgia: Prevention and Management. Am Fam Physician. 2017 Nov 15;96(10):656-663. www.nfid.org/publications/factsheets/varicellaadult.pdf

ANTIBIOTIC Prophylaxis by Emily McIntosh, DMD

When to Premedicate for Dental Treatment?

As dentists, we meet patients daily who have medical conditions or have had medical procedures that may put them in a risk category for needing an antibiotic before dental work. However most patients do not know if they need to premedicate, and often they are hearing about it from their dentist for the first time after a change in their medical history. Guidelines have changed considerably over the years which has contributed to the confusion, but below are some of the most up-to-date indications developed by the American Dental Association, American Association of Orthopedic Surgeons, and the American Heart Association. Antibiotic prophylaxis, or premedication, is the act of taking antibiotics one hour prior to certain dental procedures and dental cleanings. We all have normal levels of bacteria in our mouths, and a number of dental treatments can allow bacteria to enter the bloodstream. For someone with a healthy immune system, this bacteria isn’t a problem. However, for those with a weakened or compromised immunity, there is concern that the bacteria can cause an infection elsewhere in the body. The most common types of patients that may need to follow an antibiotic guideline are those with prosthetic joints/orthopedic implants, and those with certain heart conditions.

Heart Conditions

In 2008 the AHA (American Heart Association) changed the guidelines for premedication to a smaller group of patients with specific heart conditions: • Artificial Heart Valves • A history of infective endocarditis (an infection of the lining of the heart or heart valves) • A heart transplant in which a problem developed with one of the valves • Heart conditions present from birth such as: o Unrepaired cyanotic congenital heart disease o Defects repaired with a prosthetic material or device o Repairs with partial defects still present

Prosthetic Joints/Orthopedic Implants:

In the past, premedication was necessary for any patient with prosthetic joints, however as of January 2015, the American Dental Association’s Council on Scientific Affairs determined that most patients are not at a high risk for developing joint infections, and therefore, should not have to take an antibiotic prior to dental treatment. However the new guideline does indicate that some patients may still be at risk to develop infection and are candidates to premedicate based on their medical status. An increased risk of infection is possible with: • Compromised immune system due to diabetes (primarily Type 1) • Rheumatoid arthritis, systemic lupus • Cancer • Chemotherapy • Chronic steroid use It is important to understand that not every heart issue or prosthetic joint requires antibiotics before dental procedures. Antibiotics themselves can cause side effects, from mild stomach upset to allergic reactions. While guidelines for antibiotic prophylaxis are tremendously helpful to patients and clinicians, it is imperative to your health that you discuss with your physician, orthopedist, and dentist the best treatment for you.

Are We Flicking Lit Matches Into Hayfields? by Jarrod Roussel, PA-C

Recently, I went to a continuing medical education conference where several speakers spoke about treatment updates in internal medicine. One speaker that specifically caught my attention discussed risk classification in cardiac disease. He talked at length about what constituted the different classes and about which medications and treatments were best for each. It was clear that he was intelligent and that he knew his subject very well. As I listened, it occurred to me that the academic side of medicine has become extremely adept at acquiring and analyzing data. We can perform studies with thousands of participants and account for multiple variables so that we can be absolutely certain that the outcome is reliable. But can we truly be certain? While the lecturer spoke, I began to wonder if we have a blind spot, at least in part, within this behemoth* we call “modern medicine”. During my medical training, we received very little instruction on nutrition and how it relates to nourishing and sustaining the body. I have learned more about the healing properties of food throughout the years since my graduation. I started thinking that our lack of understanding of nutrition and our poor “food” choices contributes, sometimes heavily, to the pathology causing cardiovascular disease. The very disease this doctor was trying to control with medications. I say control, because nothing he mentioned would actually reverse the disease process; it is only modern medicine’s attempt to “contain the flames” so to speak. I had this mental imagery come to mind while I listened to the lecturer that gives an analogy for what I feel we are doing, at least as it relates to this lecturer’s topic: A person is standing on the edge of a dry hayfield lighting matches and flicking them into the dry straw lying on the ground. As small fires begin to develop, there is another person, a fireman, a few feet away analyzing these fires. The fireman is measuring the height of the flames, the diameter of the area on fire, the number of flames burning at any one time, etc. He then creates a protocol to adequately extinguish the fires to

prevent the entire field from being ruined to nothing but ash. If there is one fire less than 3 inches in diameter, he will simply stamp it out by foot. If the fire is greater than 3 inches and less than two feet in diameter and there is only one area on fire, he will use a thick wool blanket to smother it; if there is more than one area on fire, he will use a carbon dioxide fire extinguisher. We want to avoid using water because that could ruin the hay or interfere with harvesting it. If the diameter is greater than 2 feet and there are multiple fires, use a fire hose. If the whole field is ablaze, pray for rain! As a healthcare provider, I feel like we are doing this very thing with our patients. One might suggest this is our purpose. Managing the risks is what we are supposed to do. While this is true, wouldn’t it be easier to simply tell our fire starter to stop flicking lit matches onto a dry hayfield? I understand that this analogy is an oversimplification. People are far more complex than this, but I think the lesson still stands. Most will acknowledge that they don’t do the basic things they need to keep themselves healthy: exercise, proper nutrition, sufficient sleep, etc. By integrating these technically simple strategies into our daily routine, I believe that we could eliminate many of the health woes that plague people as a whole. Healthcare resources would be conserved by reducing the amount of medications required, of surgeries needed, etc. Our workforce would serve with greater vitality. People would experience greater satisfaction and add years to their lives. Medicine has inarguably made many great strides to serve the well-being of humanity, and we need to continue that momentum. However, we should never forget the basics either. We all need to educate ourselves on specific health benefits of nutrition, and then implement them. Simple choices made today will have lasting benefits for a lifetime. * something enormous, especially a big and powerful organization.

It is 5am, and you have been vomiting constantly for over 4 hours. Do you rush to the Emergency Room (ER), or do you wait and go to an Urgent Care (UC) facility at 8am? The choice may seem simple but there are factors to consider that will dictate the most appropriate location to receive the best care. If you have been vomiting the food that you ingested last night from a backyard barbecue or a fast food restaurant, then an Urgent Care is the best place to handle your current condition. However, if you are vomiting blood, it is imperative that you go directly to the Emergency Room. During this age of instantaneous information, individuals often find it difficult to spend hours sitting in an ER waiting to be evaluated. Others do not want to go to the ER and often prefer an UC because of the high cost associated with an ER. Also, some people refuse to travel via ambulance to the ER, even when it is deemed in their best interest to do so, due to cost. With the rise of so many Urgent Care facilities, which were born out of a need to stand in the gap between the Emergency Room and the Primary Care Providers (PCP) office, the UC is often seen as a convenient choice to save both time and money. But does the UC fit the needs of everyone needing urgent or emergent healthcare? Unfortunately, the answer is no. The UC will not be able to service all needs and there is still a role for the ER to play. The UC model was designed to relieve the pressure of an ER overrun by conditions that can be handled outside of the ER. For example, a sore throat with a mild to moderate fever (Temp= 99.1 to 100.9) has no place in the ER. Visiting the ER with a sore throat will cost you time and money which would be dramatically less had you gone to an UC. However, if you are experiencing a sore throat with a narrowing of your airway and have difficulty breathing as a result with or without a high fever (Temp=101-104), please proceed to the nearest ER immediately. The difference in the location of care is often determined by the severity of your symptoms. It is important to know where to go to access the best healthcare for yourself which can save time and money. From a clinical standpoint, as an Urgent Care Physician, I am poised and ready to assist you with your healthcare needs and remain equipped to handle a host of conditions: simple fractures; sutures; upper respiratory infections (bacterial or viral); atypical chest pain (ribs or musculoskeletal); sore throat; allergies; sinusitis; sexually transmitted infections; abdominal pain; dizziness (vertigo); and motor vehicle accidents (without head injury). However, I cannot and will not be a replacement for the ER. If you are having slurred speech, facial droop, mental confusion, and/or an inability to move a body part, go to the ER immediately as these are signs of a potential stroke in progress. Time is brain tissue! If caught within a 3 hour window, meds can be used to try to eliminate a clot and reduce symptoms post stroke. If you are having chest pain or shortness of breath, and have had cardiac or severe pulmonary issues, go directly to the ER and contact your Car-

diologist/Pulmonologist. Time is heart tissue! You have a better chance of survival from a Heart Attack (MI) if you go to the ER and get diagnosed and treated within 6 hours. Pulmonary Embolisms (lung clots) may not give you hours before your ultimate demise. If you visit the UC with cardiac chest pain, you will likely be sent to the ER. This approach will cost you time and money as you will be charged for the visit to the UC and then charged again at the ER. Even if the UC is equipped with tools to identify a cardiac event or the possibility of a clot in the lungs, the office is not equipped to handle these emergencies in the UC and will have to send you to an ER directly. In addition, your mode of transport will become costly as it is likely that an ambulance will take you to the ER as it is unsafe to drive or even be driven to the ER due to your condition. The only way to avoid transport via ambulance is to sign your life away via an Against Medical Advice (AMA) form. The AMA form is a costly venture as well in that it places your life and your healthcare consequences in your hands and relinquishes the physician caring for you of all accountability. I recall pleading with a few patients to go to the hospital via ambulance in an effort to save their life only to have to discuss and fill out the AMA form and pray to God that they survive the journey and get the advanced level of care that they require in time. In addition, while Urgent Care physicians are equipped to handle acute healthcare issues that can be taken care of by the Primary Care Provider who may not be present in the office, we are not a replacement for your PCP. We often work on shifts and work different schedules and in some cases different offices at any given point and time. Therefore, we will not be the best option for managing your continuity of care if you have serious chronic illnesses that require monitoring. But we can stand in the gap for your PCP, if they are out of the office or unavailable to you, to handle any Urgent or Primary Care needs as they arise acutely. While UC physicians are equipped to handle most acute care needs or even PCP tasks, we cannot be a replacement for the ER and should not be accessed for serious illnesses or conditions. So, if you have chest congestion and difficulty breathing or a cough and cold symptoms, stop by the UC for treatment, but if you have acute shortness of breath and/or chest pain associated with extreme fatigue, go to the ER immediately. If you have acid reflux, stop by the UC, if you have right lower quadrant abdominal pain and your appendix is still in, go to the ER immediately. If you have dizziness along with an ear infection, stop by the UC, but if you have dizziness with new onset of a severe headache that woke you out of bed and felt like a thunder bolt exploded in your head, go to the ER immediately. As a Family Practice Physician who is now practicing solely as an UC physician, I pray that this article allows you to prosper and be in good health, but when this is not the case, I hope that you will access the appropriate location for the level of care you require. by Marcia Mierez, DO | Highway 53 Urgent Care

The Importance of your Annual Physical by Stephanie M. Burrell, MD N AL Family Medicine, LLC

Preventative Services (per age group) It’s 07:30a.m., and I’m dropping off “Big Baby”…at Infiniti for a maintenance appointment. (Yes, I’m referring to my car. No jokes, please.) I am religious about doing this. I want to try as much as possible to “catch problems” before they cause an “epic” breakdown. It’s great because the technician tells me if he or she recognizes any problems that need to be addressed and how soon they should be taken care of. Things that should be monitored as well as those things that serve as warning signs are brought to my attention. I am given the opportunity to ask questions about different things that I may have noticed since my last visit like…why does this warning light about tire pressure keep appearing? Yes, you may have guessed where I’m going with this… Similarly, a patient’s yearly physical is a time when the patient and physician can discuss and explore a patient’s concerns and complaints, if there be any. The physician can update the patient on screening tests (whether laboratory or imaging) that are recommended for his/her age group. Vaccinations may also be discussed. In return, the patient can update the physician on his/her health status since their last appointment. Concerns can be addressed and if not diagnosed and treated on that very day, a plan of action can be developed. I have had several encounters in which major health problems were discovered during the time of the physical. What does a physical entail? It’s simply a headto-toe check of the major organ systems-i.e. skin, cardiac, etc. Physicals are covered by most (not all) insurance plans. Schedule your physical on or near your birthday–you won’t forget it! So, do you maintain your vehicle? Well, maintain your body too, after all, it is far more important! (Tables to right should serve as a guide and is not all inclusive; an individual may require other services based on his/her past medical and family history)

20’s:

30’s: 40’s: 50’s: 60’s:

Baseline labs/BP checks (yearly) Full body skin exam Self breast exam (monthly) WWE (Pap and in-office breast exam) yearly Booster Tdap (every 10 years) Influenza Vaccine (yearly) Mammogram for high risk women Mammogram Colonoscopy DEXA Scan (bone density) Zostavax (shingles) vaccine Pneumovax (pneumonia) vaccine Prevnar (pneumonia) vaccine

Preventative Services (per age group) 20’s:

30’s: 40’s: 50’s: 60’s:

Baseline labs/BP checks (yearly) Full body skin exam Booster Tdap (every 10 years) Influenza Vaccine (yearly) Baseline labs/BP checks PSA and DRE for men of ethnicity Colonoscopy PSA and DRE for non-ethnic men Zostavax (shingles) vaccine Pneumovax (pneumonia) vaccine Prevnar (pneumonia) vaccine

“Take Two Days at the Beach and Call Me in a Week”

by Jarrod Roussel, PA-C

Many of us have had beach vacations, or know someone who has, where our lives just seem to melt away the moment our toes hit that warm sand. We let the cares of our daily responsibilities disappear, and we become totally absorbed in that moment. Our bodies and our spirits feel instantly better. For some, the mere presence of the warm sunshine makes us feel completely renewed. It would make sense that decompressing makes us feel better, but I think there is more to it than just that. There are some physiologic reasons that contribute to our new onset sense of peace and balance. Being in that setting may actually replenish things that we lack physically. The first benefit is the most obvious which is temporarily removing the daily stressors in our lives. For that designated time, we don’t have to worry about our jobs, our businesses, our homes, our usual commitments, etc. We can just relax enjoying the sand, water, sunshine, and breeze. There is a hormone called cortisol that is released by our adrenal glands, which sit on top of our kidneys. There is a normal daily pattern or rhythm of cortisol release with our levels being highest in the morning after we awaken with the level slowly dropping during the day. It has a number of different functions such as controlling immune function and inflammation. Additional spikes of cortisol are released as it prepares our bodies for the physiologic demands common in stressful situation whether it is mental, physical, or both. These spikes are meant to be temporary with a quick return to baseline levels once the stressor is gone. Regretfully, many of us have filled our lives with continuous or frequent repetitive stressors so that we have chronically high cortisol levels that can have damaging health effects. Paradoxically, prolonged high stressful situations can eventually lead to very low levels of cortisol, which can also be dangerous, because our adrenal glands experience fatigue and can no longer maintain even normal cortisol levels. Spending those several days without long traffic lines, incessant phone ringing, people yelling, or whatever is relevant to you can give our adrenal glands much needed rest. Next is the ever popular sunshine. It is more widely

known that sunlight produces “Vitamin D”, or cholecalciferol, in our skin. Cholecalciferol is actually a prohormone, or precursor, that is converted to its most active form of calcitriol within the kidneys as our bodies need it. The most popular function of Vitamin D is the regulation of calcium in our bodies through absorption in our gut. This ultimately affects calcium levels not only in our bones, but also nerve and muscle tissue. Beyond this, I think we are only scratching the surface of what Vitamin D does. There are studies that show a correlation between low levels and depression. It is believed there may be a link between its deficiency and certain cancers such as colorectal cancers. Thankfully, we can supplement our diets, but I feel nothing truly beats making it naturally. When we spend that extended time in the sun, Vitamin D levels start to rise, which I believe starts to lift our mood. On a related note, some studies suggest that bright light, such as sunlight, can reduce cortisol levels, which one could deduce that this might help control cortisol elevations, but I have not seen any empirical evidence as of yet to support that. It is widely known that our bodies deal with free radicals as byproducts of metabolism and dealing with environmental pollutants such as tobacco smoke and food additives such as nitrates. Free radicals are molecules that have lost an electron in their outer shells. These free radicals are looking for “balance” so they will steal electrons from other nearby molecules which can eventually lead to structural damage of more important molecules. We can help control this with eating foods high in antioxidants, but there is some research to suggest that being physically connected with the Earth causes a flow of electrons into our bodies with the weak electrical current that is omnipresent throughout

the Earth’s crust. These electrons will then satisfy the need required by the free radicals so that they do not produce any further damage. This concept is called “Earthing” or “grounding”. While it may not be widely accepted by everyone, no one can dispute the pleasure one feels from standing on warm sand or a cool, grassy patch of dirt. If this is indeed true, we will spend hours or even days while at the beach with a direct connection to the ocean water or wet sand. This extended time may give a boost to our overall health that presents with a quick improvement in our sense of well-being. While a vacation may be “just what the doctor ordered”, it may not be practical or possible to just relocate to your favorite beach. Good news, however, you don’t have to move to enjoy some of these same benefits. Getting regular sun exposure will produce the same effects. Studies show that 10-15 fifteen minutes of sunlight on exposed arms and legs can produce 10,000 IUs in fair skin. Walking barefooted on grass or dirt can give you the same effect for grounding that the beach gives you. One caveat is to be aware of any chemical treatments applied to the grass. One recommendation stated 45 minutes a day of barefoot exposure to the ground. Concrete can also provide a direct link as well. This may not be practical, but getting regular exposure may make you feel better. Staying indoors and wearing shoes outside insulate us from that connection. I still encourage you, however, to regularly consume plenty of fresh fruits and vegetables to supply your body with antioxidants as well as other vital nutrients. Seth Godin is quoted as saying, “Instead of wondering when your next vacation is, maybe you should set up a life you don’t need to escape from.” Again, it may not be practical to just up and permanently leave our lives, but I think we can all find ways to either reduce stress or find better ways to cope with them. As for today, you can start by simply going outside to get some fresh air and sunshine.

The Lymphatic System

I t 's Role in Wellness by Heather Morse, MS, ATC, OTC

Your lymphatic system plays a huge role in protecting you from disease. We will take a look from a general perspective on what exactly the lymphatic system does and why its important.

part of the immune system, helping the body fight infections. Simply put, it’s our body’s sanitation system. If the lymph or white blood cells don’t flow freely through the body, the waste and toxins build up, causing a severely weakened immune system, chronic disease and severe health complications. When the lymphatic system becomes compromised (your lymphatic system is not working properly) toxic liquid fails to filtrate properly. The liquid congeals until it becomes thick, creamy and poisonous. This means toxic cells, which could potentially include cancer cells, get stuck in your body because the body doesn’t have a pump to loosen the congealed substance. Symptoms can include brain fog, poor bowel function, bloating, dry The Internet is full of questionable information about skin, acne breakouts, fatigue, water retention, chronthe body and how to care for its various systems and ic pain, stiffness, swelling, chronic colds, sore throats, organs—and the lymphatic system is no exception. weight gain and even cellulite. A quick Google search brings up articles claiming it needs to be detoxed for optimal body function and bet- HOW DOES THE LYMPHATIC SYSTEM ter overall health and wellness. Bloggers advise doing WORK? things like taking special herbs, dry brushing your skin, When your heart pumps blood to the capillaries, ditching your underwire bra, and yes, even hanging up- the lymph fluid—the watery, nutritious fluid in the side down on an "inversion table" to flush your system blood—needs to go outside the blood vessels into the of toxins—and they claim if you neglect your lymph soft tissues of the body to “feed” them. Once that fluid system, you risk eczema, arthritis, chronic sinusitis, is there, it can’t return through the veins to the heart; chronic pain, cancer and other health issues with vary- it’s up to the lymph system to move the fluid back through the body. The lymph fluid filters through ing degrees of severity. The lymphatic system is a nexus, or series, of ves- lymph nodes. If the lymph nodes detect foreign bodies sels similar to that of the circulatory system—the like bacteria and viruses in the lymph fluid, the nodes branching vessels move vital bodily fluid through- trap the intruders and produce more infection-fightout the body. The lymphatic system is comprised of ing white blood cells to destroy them. From there, the tissues and organs — vessels, ducts, lymph nodes, the lymph travels through the thoracic duct in the chest spleen, the thymus, the adenoids and the tonsils — that or the right lymphatic duct, and then to an area on the help to store, produce and carry white blood cells also side of the neck near the jugular vein, where it joins known as lymphocytes. The lymphatic vessels that run the blood system again. Some lymph also transports throughout the body (with the largest vessel being the fats from your GI tract to your bloodstream. In other thoracic duct, which collects a large portion of the words, the lymph system is a powerful tool for nourbody's lymph); lymph nodes, located in the neck, arm- ishing our tissues and helping our immune system by pit, groin, and inside the center of the chest and abdo- cleaning up bacteria and pathogens. When functioning optimally, the lymphatic system men; the tonsils and adenoids, which are collections of lymphoid tissue similar to lymph nodes; and the spleen defends our bodies against infection and helps mainand thymus, which are lymphoid organs are an integral tain homeostasis, which is the body’s way of managing

a continual internal environment when dealing with changes. To sustain homeostasis, the body has two types of immunity—innate immunity and adaptive immunity. Innate immunity consists of alert immune cells ready to fight microbes, and the body’s adaptive immunity gets called into action when the innate immune system is overwhelmed. When the adaptive immune system encounters a pathogen, it remembers it to prevent future encounters of the same bacteria and viruses from becoming problematic. When functioning properly lymph vessels and lymph nodes are the transport system for extracellular fluid that doesn’t return with the blood through the venous circulation. Extracellular fluid is the fluid that flows between cells in the interstitial spaces of bodily tissues—it contains white blood cells (WBCs), lipids (fats), proteins, salts, and water. The interstitial spaces are the narrow areas between tissues and organs. The lymphatic system is often mentioned, but its importance is not always understood. This unique system is absolutely pivotal for optimal health. Additionally, if your diet contains a lot of processed foods, sugar, and chemicals, this adds more for the system to detoxify and can make you nutrient deficient. However, remember if you are not leading an active lifestyle, it is harder for the lymph to move. If the lymph becomes

The Lymphatic System

overloaded it can lead to more stagnation and chronic disease. When treating the lymphatic system, it is important to address it from many different angles. Diet and exercise are the two major keys to proper drainage and a healthy lymphatic system. Consuming an organic diet whenever possible and incorporating lots of anti-inflammatory leafy greens along with antioxidant rich foods (like berries) can be very helpful. When choosing your diet, make sure to incorporate omega-rich food like wild salmon, free radical scavengers, fiber rich foods like flax and chia, as well as cherries and colorful foods such as beets and pomegranates. Salt on the Rocks utilizes the knowledge and expertise of our Certified Nutrition Counselor, Jessa Hicks. You can find more about her at www.jessahicks.com Exercise plays a vital role in lymphatic health. Movement acts as a natural pump to help stimulate the lymphatic system. The system depends largely on large muscle activity in the body for its circulation. Therefore, stagnation from sitting all day can become a major problem. People who sit at their computers without taking breaks develop a sluggish lymph system because they do not move. The good news is any exercise helps – move around for one to two minutes every 15 – 20 minutes. Small strides such as knee bends, going for a walk during lunch, and stretching throughout the day can help you develop a regular exercise routine. You can also apply gentle exercises like walking, yoga, Pilates, and swimming are great for getting your lymph moving. Overall, exercise is pivotal for moving lymph stagnation. WHAT CAN I DO TO HELP WITH MY “SLUGGISH” LYMPHATIC SYSTEM? 1. Lymphatic drainage massage and lymphatic facials The power of a simple lymph massage must not be overlooked. They do for the entire body what facials do for the face. Manual lymph drainage uses gentle, rhythmic strokes, creating a wave-like sensation in the body that follows the paths towards the lymph nodes where toxins are then filtered out. The specific pumping strokes circulate immune cells through the body and can reduce inflammation. A simple lymphatic self-massage sequence a few nights a week can help reduce breast tenderness and improve digestion. 2. Movement The lymph system depends on muscle movement to pump and decongest stagnant lymph fluid, acting as a natural lymph flush. In other words: exercise is key to lymphatic health. Yoga is a great way to get your move-

ment on because it utilizes your entire muscle network, which pumps lymph through the one-way vessels. 3. Use clean skincare, and reduce environmental and emotional toxins A large percentage of what you put on your body gets absorbed into the lymph system, and chemicals in household products and perfumes should be avoided whenever possible. You can lighten the lymphatic processing load by choosing non-toxic, clean beauty products for your body and home. 4. Make healthy food choices Gut health = lymph health! Eating an anti-inflammatory diet rich in antioxidants and vegetables is optimal. Reduce salt and alcohol intake, find a healthy food plan you can maintain, avoid chemicals in diet foods, and consult with an herbalist about herbs and probiotics to boost your gut health and immunity. 5. Hydrate WATER WATER WATER. You can increase fluid flow and flush out toxins and pathogens by bathing fluids in antioxidants. Additionally, drinking plenty of water with lemon and electrolytes throughout the day will help circulate and nourish your lymph cells. Simples Tonics in Los Angeles has a gently brewed tea that’s specifically designed to support immunity and is super hydrating. 6. Dry brushing Dry brushing is an excellent way to remove dead cells from the surface of your skin so your lymph system doesn’t have to process the extra cellular waste. Brush lightly and towards your heart, but if you have radiated skin or open wounds, avoid the area completely until you’ve consulted with a trained lymphatic practitioner. by Nick Thomas 7. Herbs for Lymph Stimulation Herbs that can help stimulate the lymphatic system include: Chickweed (yes like the weed you have in your yard), bayberry, black walnut, cleavers (also often found in your yard), Echinacea, Fennel and many others. Many of these can be found as an herbal supplement in your health food store or teas in your local Remedy Room. There are many tools that can help to clean up the complicated lymph system. At Salt On The Rocks

Wellness Spa & Remedies we use a combination of lymphatic drainage massage and facials, vibration therapy, and a machine designed specifically for lymphatic drainage called the Delfin. Our detox services help your body to drain harmful toxins, assist with inch-loss, and to contour the body using its own natural drainage processes. Clients immediately see drastic results in the shape of their body and the overall condition of health. To learn more about these or our other new wellness spa services contact 256.429.9160 or visit www.saltontherockshuntsville.com

THE COMEBACK OF ELDERBERRY IN FIGHTING THE FLU by, Heather L. Morse MS, ATC, OTC

After this last flu season, it seems everyone has heard of people flocking to find their fix of Elderberry Syrup. Most people have likely read some interesting articles or snippets on social media as well. What is elderberry? Where did it come from and why is it making a comeback? Interestingly enough, it was once a staple long before conventional, allopathic medicine. Elderberry (Sambucus Nigra) can be traced back to Hippocrates, although there is also some evidence of recipes as far back as Ancient Egypt. Hippocrates touted elderberry as the plant of his “medicine chest” for treating many aliments. In modern times, it has been used to treat colds, flus, fever, burns, sinus pain, cuts, allergies and more than 80 other ailments. What exactly is elderberry? In short, it is a berry that grows in clusters and can usually be found along streambanks, moist woody areas and power line cuts. Elderberry is challenging to forage on your own as the berries are loved by birds. It is likely that you have some elderberry growing in your yard or neighborhood (assuming you have some spots that are not manicured). I would also bet that your grandmother made elderberry jam that you have eaten – or maybe she made wine! Elderberry has many health benefits including reducing symptoms and duration of the flu when employed within 48 hours of the onset of symptoms. Sound familiar? Luckily there is no evidence of anyone jumping off buildings or in front of cars with the use of elderberry, unlike some conventional medicines, especially in children. In our house, we have long used elderberry syrup to ward off flu symptoms, even when the boys were young. In fact, in 1995 the Panamanian government used Elderberry to fight off the epidemic ( Journal of Alternative and Complementary Medicine Vol. 1, #4, 1995). Interestingly enough, there have been several studies done on the effectiveness of elderberry in fighting the flu. In a study published in the Journal of International Medical Research in 2004, it was concluded that elderberry is effective at reducing symptoms and duration of both A and B strains of the flu and unlike some antiviral drugs it can be administered to the whole population (Zakay-

Rones. Et.al 2004). It is considered one of the top antiviral herbs on the planet. How does it work? Simply speaking, it boosts your immune function to fight better. The most common threat to our immune system is from viruses. Your body is exposed to many types of viruses, creates antibodies to fight those viruses and remembers them for next time. However, during the actual “fight” your immune system is busy creating soldiers to fight against the latest virus that is gets worn down and susceptible to other culprits. Think about how many people you know who had the flu and did fine, but then a few days later had something else, pneumonia, strep, or bronchitis? This is where elderberry can help. The contents are rich in powerful antioxidants, much higher than any other berry and almost 5 times the amount found in blueberries. This helps attack the viruses and defend the immune system. Now understand, this is a very, very simple explanation of how the immune system works and how elderberry can help influence. Other benefits of elderberry include anti-inflammatory properties. One example of reducing inflammation, it helps slow the body’s histamine response, therefore reducing symptoms of allergies. This alone is a benefit for the Tennessee Valley that any allergy sufferer can appreciate. How exactly do you use elderberry? We use it in many different forms. This includes tea, syrup, tincture, wine (yes, wine), jellies, capsules, juices and more. My favorite is to make elderberry syrup. I use local honey and local elderberries (when I can get them harvested locally). It has long been understood by south-

ern folk, medicine teachers, and herbalists alike that using plants from your geographical region will have better benefit on your outcome. It is advised to only take elderberry up to five days and not use it long term. If you have any autoimmune diseases that may be related to over active immune function you should discuss the use of elderberry with our medical professional. Because elderberry can also be used as a laxative in higher doses it is advised to be mindful of how much you take. Elderberries should never be consumed raw as they contain a cyanide-inducing chemical which can cause diarrhea and vomiting. You can find locally made elderberry syrup and tinctures at Salt on the Rocks. These preparations are made from high quality organic elderberries and local honey. The staff is happy to help explain further how to use Elderberry safe and effectively.

Randomized Study of the Efficacy and Saftey of Oral Elderberry Extract in the Treatment of Influenza A &B Virus Infections. Zakay-Rones, E Thom, T Wollan and J Wadstein, 2004; Journal of International Medical Research Inhibition of Several Strains of Influenza Virus in Vitro and Reduction of Symptoms by an Elderberry Extract (Sambucus Nigra) during an Outbreak of Influenza B Panama. Z Zakay-Rones, N Varsan, M Zlotnik, O Manor, L Regev, M Schlesinger and M Mumcuoglu 1995; Journal of Alternative and Complementary Medicine

Lifestyle Medicine

by Elizabeth McCleskey, DO

The old expression – ”there is nothing new under the sun” – may indeed be true. But, old ideas sometimes can be explained in a new way.

Many people are already aware that their habits can affect their health. The news is full of “don’t eat this,” or a new study on exercise. And, yet, we as a nation appear to be getting sicker. It is difficult for doctors to discuss health given our current illness-based insurance model. With genuinely caring physicians having such limited time with each patient, the recommendation for a one-size-fits-all diet and exercise approach is often the norm. Fortunately, out of established research a new branch of medicine has emerged with the focus on helping people improve their health and prevent chronic diseases. Based on improving six areas of health, Lifestyle Medicine uses many non-drug modalities to treat, improve, and sometimes even reverse chronic health conditions. Medication, while still used, becomes the supplement to these lifestyle changes. These six areas are: 1. Nutrition – getting vitamins, minerals, protein, fiber, phytonutrients, etc., from a predominately whole-food, plant-based diet 2. Movement – consistent daily movement that works all the muscles, including the heart 3. Sleep – improving the quality of rest 4. Substance use – eliminating the use of tobacco and other potentially harmful substances 5. Relationships – establishing and nurturing supportive social connections 6. Stress management – leading to improved health and productivity

Why focus on so many things? In addition to the fact that individually each of these areas can produce health issues (e.g., tobacco and cancer), they also can affect each other. Improved sleep may assist in weight loss. Moving may reduce stress. And, if you don’t fuel your body with a good quality diet, it’s little wonder you don’t feel like getting off the couch. Would you like to feel better about your health? The process starts by deciding what your goal is and perhaps even writing it down. Maybe you would like to run a 5K or simply be able to play on the floor with your grandchildren. Next is to identify areas you are willing to change. Maybe the coffee creamer will not be eliminated, but you will eat an extra serving of a green vegetable each day. An earlier bedtime is not feasible, but you are willing to encourage deeper sleep by turning off your phone and leaving it in the kitchen overnight. Successes are celebrated and failures are put to good use as you learn to analyze, re-adjust, and overcome. So, while the message is not new–your mother may have told you to eat your vegetables and get plenty of sleep–life has a way of intervening and sending us down another path. Now is the time to learn how to manage that stress, get some quality rest, develop a strong emotional support system, avoid substance use, and become active while being mindful of your food choices. It may just be exactly what the doctor ordered! Elizabeth McCleskey, DO Board Certified Family Medicine Physician Member, American College of Lifestyle Medicine HealthStylesDr.com

Comfort

...in your own home

Death is Coming by Belinda Maples, M.D.

The hospice philosophy focuses on a death with dignity without pain or suffering. There comes a point in time when a treatment is worse than the disease, when medications and procedures do not help and physical and emotional suffering is not relieved. Many people find death is too disturbing to discuss and therefore avoid talking about it. Talking openly about death and dying may be considered disrespectful and some believe that it will lead to despair or even accelerate the process of dying. Some patients fear that entering hospice care represents that they have been given up on, hastens death

or shortens oneâ&#x20AC;&#x2122;s life. This is misconception and studies demonstrate a 100-day survival advantage with end stage heart failure patients. Such attitudes in the general public can cause delayed treatment with palliative care services and increase the amount of suffering. Discussions on death, palliative care, and hospice need to be made early in any terminal disease process between a patient and their health care provider. Hospice care provides medical care and support to patients with a life limiting illness and focuses on quality of life rather

than curing the illness. The hospice philosophy focuses on a death with dignity without pain or suffering. The care and treatment provided are based on the patient’s and family’s goals and values. This holistic approach focuses on symptom management, support, and assistance by way of communication and providing coordination of care. Hospice is appropriate when patients are entering the last months to weeks of life and when decisions are made to stop disease modifying therapies and focus on maximizing comfort and quality of life. The World Health Organization has identified the most common conditions that require palliative care for adults and include dementia, cancer, cardiovascular disease, cirrhosis, COPD, diabetes, HIV/AIDS, kidney failure, multiple sclerosis, ALS, Parkinson’s disease, stroke, lupus, rheumatoid arthritis. and drug resistant tuberculosis. An individual is referred to hospice when the life expectancy is less than 6 months and it is especially important if the goals of care are comfort, being at home, and staying in control. This timeline is difficult to estimate in advanced illness due to effective new therapies, psychological reasons to maintain hope, and the clinician’s overly optimistic desire to cure disease. It becomes easier to predict death when the end is closer and usually less than 3 weeks. These individuals can benefit from hospice care as long as they continue to exhibit a decline consistent with the progression of the disease process. Many symptoms are demonstrated in the last phase of life. These can be disturbing to family members and health care providers alike. A decrease in heart function and blood volume leads to diminished or increased heart rate, low blood pressure, cooling in the extremities, discoloration of the skin, and loss of peripheral pulses. Families cannot rely on vital signs alone to determine impending death. Infections and febrile episodes are among the most common acute complications by terminally ill patients and may represent the end. Neurological changes such as decreasing levels of consciousness leading to coma, delirium with confusion, restlessness, agitation, and day to night reversal may also occur. Moaning, groaning, and grimacing may accompany the delirium, but may be misinterpreted as uncontrolled pain. Some will have hallucinations that involve deceased individuals from the past and make references to “going home” or dying. Breathing may become shallow and labored with periods of absent breathing where family members perceive this pattern as holding her breath or breathlessness. Breathing difficulties may be reduced with oxygen through a nasal cannula or face mask and bedside fan may relieve the sensation of being short of breath. The buildup of saliva and secretions may lead to gurgling, crackling or rattling sounds with each breath, which is sometimes referred to as the death rattle. This can lead to inability to rest, worsening shortness of breath, coughing spells, predispose to infections, and increase distress to family. Proper positioning, cleansing the mouth with sponge sticks, and suctioning to clear secretions are appropriate for short term benefits. As patients near death, they spend more time in bed or a chair and one of the most significant milestones of functional decline is the loss of ability to independently transfer from bed to chair. Assis-

Family is encouraged to stay with patients to improve comfort and safety and one on one sitters may be needed.

tive equipment with lifts, wheelchairs, and hospital beds become necessary since patients become at high risk for falls and serious injuries. Education regarding transfers, turning, changing, feeding, and other personal care issues may be given to caregivers to ensure safety for the patient and themselves. Family is encouraged to stay with patients to improve comfort and safety and one on one sitters may be needed. Call buttons, bells to alert caregivers, and bed alarms may help respond to needs promptly. Cushioning on beds will improve comfort and reduce risks for skin breakdown and pain. Some aspects of personal hygiene such as bathing or help with toileting may be socially uncomfortable for some family members and home health aides may become a major resource. Decreased oral intake is common in the dying process with impaired swallowing due to severe weakness, increased sedation or metabolic disturbances. Family members exhibit distress when the patient becomes unable to take food and fluids orally and do not want their loved ones to “starve” or become “dehydrated”. There is no evidence that improving caloric intake with feeding tubes or intravenous nutrition will improve strength, energy, functional state, or prolong survival. Case reports support the view that dehydration actually reduces distressing symptoms like choking and drowning sensations, less cough and chest congestion, decreased urinary incontinence/ bedwetting due to decreased urinary output, less swelling in arms and legs, less abdominal discomfort from bloating, vomiting and diarrhea due to decreased GI fluid. Loss of sphincter

control in the last hours of life may lead to urine or stool incontinence. This can be managed with absorbent pads or urinary catheter may be placed to reduce frequency of changing bed linens, clothes and reduce demand and distress to caregivers. Weight loss leads to loss of fat behind the eye and causes the orbit to fall within the socket. The eyelids may not be able to fully close and they appear to be asleep with their eyes open. It is often observed that a familiar voice, touch, and music have a calming effect on dying patients. Family is often encouraged to comfort their loved ones, express their thoughts, and touch their loved ones, even though they cannot communicate response back. After all, touch and hearing are thought to be the last senses to be lost in the dying process. Care for the actively dying patient should be redirected from procedures and other aggressive treatments to an emphasis on reducing suffering and improving comfort. Many patients in the terminal stages of a serious life threatening illness die in settings where they do not receive care designed to address suffering in the last hours/days of life. Patients require careful symptom management and families need support and coaching as death approaches. Hospice medicine focuses on preventing and relieving suffering and supporting the best possible quality of life for patients and their families facing serious illness. Ì

Get Rid of the Blues for a

Good Night s Sleep by Jarrod Roussel, PA-C

Seems like these days that we would be lost without our computers and smart devices; checking email, watching YouTube, scanning the latest on Facebook, and the list goes on. Add to that larger TV screen sizes with brighter image contrast, and we spend hours a day from morning to night in front of a screen that shines more light than ever before directly into our eyes. It seems innocent enough, but could all this screen time be negatively impacting your health?

I want to introduce you to the hormone melatonin. Likely, you have heard of it, but you may not be familiar with exactly what it does. Melatonin is released by a small gland in the brain called the pineal gland. This gland sits at the base of our brain and has multiple functions, one of which is controlling our normal daily sleep/wake cycles. The signal for releasing melatonin is actually controlled by the light that enters our eyes. There are special sensors in our eyes that detect blue light and send a signal to the pineal gland telling it that it is “daytime”, thus preventing the release of melatonin. Until recently, the only blue light that we saw was in sunlight. As the sun approaches sundown, the blue light is filtered out by the atmosphere leaving the remaining light with a predominantly reddish hue. Even after sundown, lamps, candles, and fires are reddish in color, plus the brightness is significantly lower than sunlight. This change in the light would stimulate the pineal gland to release melatonin which signals the brain that it is time for sleep. Incidentally, there are other health benefits attributed to melatonin besides regulating sleep. With bright large screen TVs, computer screens, smartphones, etc., we are exposed to an excessive amount of blue light, sometimes well into the wee hours of the morning. This causes a delayed release of melatonin, which then confuses our brain. We “know” that we should be asleep, but we can’t seem to fall asleep. To put it another way, when you have that moment at 2am that you want desperately to be asleep, but try as hard as you might, it just doesn’t happen. And, your body just doesn’t even feel ready for sleep. This is caused by the delayed melatonin release. Ultimately, this can have a domino effect causing even more sleep issues.

Okay, you just had your umpteenth night of tossing and turning. So, what can you do about it? The obvious first step is to reduce or even eliminate the amount of blue light entering our eyes. In an ideal world, you could simply do away with the need for all screened devices after sundown. While this would give the best outcome, it isn’t always practical since many of us rely on our smart devices and computers as tools for work and study. I recommend trying to reduce the total amount of screen time as much as possible to only necessary activities. Restrict computer gaming, television watching, etc. to early evening hours. When you must use a screened device, turn down the brightness level. Some computers and smartphones will even do this automatically depending on the ambient lighting in the room.

Reducing the brightness of the lights in your environment can also be extremely beneficial, especially for young children. You can simply turn off unused lights or switch from overhead lighting to smaller lamps. An effective strategy I have used is installing dimmer switches in your main living spaces so that you can progressively decrease the light levels as bedtime approaches. Use light bulbs that have a warmer tone in the 2000-3000 Kelvin rating, especially in bedrooms and living spaces. This will help reduce the blue light in your home. The Kelvin rating is usually found in a label on the side of the box. Lights that are in the 5000-6000K range are considered more crisp and “invigorating” so are better for work spaces such as garages, laundry rooms, etc. More recently, computers and smart devices have an added feature that shift the colors on the screen to more reddish tones, which is achieved by decreasing the amount of blue used in the screen image. This allows us to still use our devices but still avoid some of the blue light influence. Even with this feature, it is best to limit usage as much as possible.

The issue with blue light exposure is a more recent modern problem, and it is ultimately something we can control. I do want to mention, however, that sleep is a complex process. There are numerous factors that can contribute to poor sleep. If you find that you continue to have significant sleep issues that last for more than a few days, please see your healthcare provider for a more thorough evaluation and work-up. Effective treatments are available for a wide range of sleep conditions. Jarrod Roussel, PA-C Co-founder, The Crunchy Couple, LLC For more information on feeling better and living longer, be sure to check out thecrunchycouple.com or go over to the Facebook page at: facebook.com/TheCrunchyCouple

The New Arms Race: superbugs by Nemil Shah, M.D.

Death; quite often the result of once common bacterial infections. Over 20,000 deaths can be attributed to people infected with bacteria that do not respond to antibiotics. Bacterial machinery and human defenses are at an all-time epic battle. Just as quickly as humans find defenses against their pathogenic adversaries, these bacteria mutate and become resistant to common antibiotics that are used to treat them. More and more bacterial species, and even fungal species such as yeast, are finding mechanisms of resistance to treatment options. Therefore, the so called â&#x20AC;&#x153;super bugsâ&#x20AC;? are becoming more prevalent. Who is to blame for the birth of these killers? We are all responsible for the rise of these multi-drug resistant bacterial pathogens from years of misusing antibiotics. This includes the over or under dosing of the medication, using antibiotics for viral illness such as the common cold which do not respond to antibiotics, or not

finishing the recommended dosing schedule prescribed for the illness. What can we do to help fight in this arms race? As humans, we need to educate ourselves on appropriate uses for antibiotics. As physicians, we need to be more judicious in prescribing them and helping patients understand the different symptoms commonly due to viral illnesses versus bacterial illness. For example, a simple cough and sinus congestion DO NOT initially warrant antibiotics. If the symptoms continue for 7 days or worsen with yellow/green saliva/mucus with fever, only then do antibiotics become a reasonable option. Having the artillery to combat sickness is comforting. However, letâ&#x20AC;&#x2122;s refrain from dropping bombs on our friendly invaders when we can help it. Who do you think is to blame for our growing bug drug resistance problem? Those who demand the antibiotics or those who prescribe them?

* DID YOU KNOW: More germs are transferred shaking hands than kissing.

â&#x20AC;&#x153;Yersinia pestis bacteria on the fleaâ&#x20AC;?

Photo credit: Centers for Disease Control and Prevention website: https://phil.cdc.gov/phil/details.asp?pid=18130

1918 epidemic

The Importance of Vaccinations by, William T. Budd, PhD

“It takes special trains to carry away the dead. For several days there were no coffins and the bodies piled up something fierce”, wrote a US Army physician. One can imagine a number of situations in which an Army physician would encounter such a horrific experience. In this case, the physician was stateside serving as resident physician for Ft. Devens Massachusetts in 1918. The deaths described were not casualties of war but were deaths from influenza. During that flu season, over 500 million people would become infected and at least 50 million would die from the illness. The world was fighting two simultaneous wars, World War I and the Spanish Flu. Referring to the influenza outbreak of 1918 as the Spanish Flu was the result of wartime censorship as governments wanted to maintain soldier morale by limiting their understanding of the infectious outbreak. Ultimately, influenza would claim more lives than World War I and affected nearly every country. This influenza outbreak differed than most. Typically, persons over the age of 65 are more likely to die from influenza related complications and in the early stage of the pandemic this was the case. However, as the outbreak progressed the virus mutated. It is hypothesized that conditions associated with the war favored selection of a deadlier virus. Crowded conditions in military camps and hospitals in combination with poor sanitation allowed the virus to spread more rapidly. Even though there have been tremendous advancements in our understanding and treatments for influenza, the virus continues to pose a significant risk for the overall public health. Each year there exists the possibility that another large outbreak of influenza can emerge that has the potential to claim millions of lives. The winter months mark the begin-

ning of respiratory infection season including influenza. After Christmas, the rate of influenza diagnosis grows exponentially in North America and will peak around Valentine’s Day. Many people confuse a variety of viral infections with influenza. During an average year, influenza infects approximately 10% of the population and can be deadly, especially to the very young and old. There are years in which the incidence of infection spikes (epidemic/ pandemic). There have been multiple pandemic outbreaks from influenza in the last century. None compare to the 1918 Spanish Flu epidemic. The most recent occurred in 2009 in which approximately 61 million persons were infected with the illness and deaths were more common in younger and middle- aged persons. In April of 2009, a novel influenza virus appeared containing a unique combination of genes not previously observed. This novel influenza virus was commonly reported as the Swine Flu due to a close relation to other influenza viruses found in pigs. However, there was no evidence that the virus originated in pigs. It is estimated that over 60 million people were infected with the virus and approximately 15,000 died from the infection. Much of the hype associated with the 2009 epidemic was due to the novelty of the virus and its similarity to the 1918 strain. Scientists did not have pre-existing data required to predict the severity of the outbreak and responses were based upon worst case assumptions. Thankfully, the virus was able to be

contained and the death rate was limited. The 2009 influenza (H1N1) virus continues to circulate and is in fact the dominant strain so far this season (2018-2019). What is and what is not the flu? The flu is not a bad cold or gastrointestinal distress (stomach flu). The flu is a respiratory infection and is a serious illness characterized by high fevers, cough and body aches that can lead to life threatening pneumonia. The flu is caused by a virus known as the influenza virus. There are four main types of influenza viruses Type A- D but only two pose significant health risks to humans. The most serious type of influenza is Type A, which can cause devastating outbreaks and is the strain most often associated with death. Type B influenza is the second most common cause of flu. However, it is generally not as severe as Influenza A and rarely causes large outbreaks. Typically, an influenza infection will occur within 48 hours of exposure to the virus and last approximately 7 days. The virus is spread through contact with infected respiratory droplets. Direct contact occurs when you inhale respiratory droplets from someone that has sneezed or coughed. Viruses are non-living entities and as such can remain infectious on contaminated surfaces for several days, making indirect contact the most common method of exposure. Indirect contact occurs through an intermediary device that the infected person has touched after sneezing, coughing or touching their nose/ mouth. It is for these reasons that surfaces should be frequently cleaned and disinfected during flu season.

The best treatment is prevention. The Centers for Disease Control (CDC) recommend that everyone above the age of 6 months get vaccinated for influenza. It is highly recommended that children under the age of 5, adults over 65, pregnant women, persons living in long term care facilities and persons with any of the following health conditions; asthma, heart disease, COPD, diabetes, kidney failure, liver failure, HIV, or have a body mass index over 40 as the incidence of complications is much higher in these individuals. As in all vaccines there are associated side effects including low grade fever, injection site soreness and general body aches. Some people are hesitant to vaccinate against influenza due to fears about the safety of the vaccine. Many of these fears stem from the 1976 swine flu vaccine which was associated with a slightly increased

risk of Guillen-Barre syndrome (neurological disorder). 450 people developed the disorder after vaccination, however there were over 45 million vaccines administered. Subsequent studies have shown that the rate of GBS was only marginally higher (1 per 100,000 people vaccinated) than normal. Influenza vaccines are safe and subjected to strict clinical trials. After vaccination, handwashing is the second most important practice to prevent influenza. Each day, we all touch thousands of items, many of which have been handled by others and are potentially infectious. Recent studies should that only 70% of people wash their hands after using the restroom and most are ineffective. Handwashing using soap and vigorous friction for at least 20 seconds is effective at destroying the influenza virus and preventing infection. It is recommended to wash your hands every time you use the restroom, prior to eating, and after each sneeze/cough.

Treatment of influenza is largely management of symptoms. Avoid dehydration by drinking lots of water. Give your immune system the energy it requires by getting rest and limiting activity. Use pain relievers such as acetaminophen and ibuprofen to combat body aches. Protect your community by isolating yourself. Medications such as Tamiflu or Relenza may limit the duration of the illness if started within 24 hours of symptom onset. Over the counter substances such as elderberry syrups have been shown to be as effective as prescription medications at limiting the duration of the illness. It has been 100 years since the deadly outbreak of influenza. Despite the advancements in healthcare, influenza remains a global concern and pandemic outbreaks are always a possibility. Vaccination and handwashing are the most effective methods at preventing infection. Rest and isolation are essential once the illness has taken hold. William T. Budd, PhD Chief Scientific Officer of Madison Core Laboratories www.madisoncorelabs.com

A Family

by Kim Aaron

in God’s will

Ryan and I have been married for almost 14 years. Within those 14 years, we have learned a lot and grown a lot… We were married Ryan’s first year of medical school. I remember a conversation we had before we walked down the aisle in which we acknowledged the fact that half of all marriages end in divorce. We realized that his school and training were going to be a difficult road to travel for us both. We made a decision that we would always strive to keep God at the center of our marriage and the center of our lives. Abundant life is in Him, and if left to our own efforts we would likely not make it. With that said, we have not always succeed in this because we are only human. We have made our share of mistakes. But, the Lord has been faithful to gently pursue us back to His will during those seasons.

We also discussed early on that as a physician we would be blessed with much. We know that all good things come from Him and that we are “blessed to be a blessing”. We decided in those early years that it would be our prayer that the Lord would lead us to use those blessings for His glory and for His purpose. We did not know then, it would be through adoption that we could serve out this plan.

Adoption is not a fairy

10 years ago, when I was pregnant with our first child, we heard a

tale. It is full of loss,

sermon on James 1:24. It was that day we first heard His call to adopt a child.

pain, and grief. But,

For a long time we tried to talk ourselves out of adoption with thoughts like “maybe God really didn’t call us to do this”….”We can fulfill the call to care for the orphan in other ways”….”this is too hard, maybe we are not supposed to do this”. These were all lies to keep us from doing the Lord’s will. After a season of running, The Lord brought us both to the same conclusion at the same time that adoption was His will for us. We pursued our options, and over the years everything fell into place. Adoption is not a fairy tale. It is full of loss, pain, and grief. But, our God is greater than all of these and He is a redeemer. Our baby girl’s story is heartbreaking from the beginning. She is definitely our miracle. She was born weighing 2.2 lbs and fought for her life for several months. By His amazing grace, he brought us together and completed our family. On December 14, 2015 we met our beautiful daughter and we arrived home with her on American soil on Christmas Eve of last year. We are now working at being a family. A family in God’s will. We have three beautiful children, Sydney Ann is now nine, William Michael is seven, and Gabriella Rose is our two year old miracle from China. We realize they are each a gift from the Lord. Adoption is now a big part of our “story”. The main lesson I have learned in our journey is that I can fully trust God and His plan for my life. You can trust God and His plan for your life! He is our creator and our Redeemer and He gave His only Son that we might live! Believe me when I say that a God like that can be trusted. So when He leads you to do something, do it and fear not for He is with you! Another lesson that I have learned is that God’s ultimate goal for the Christian is to make us holy, not happy. Please do not misunderstand me when I tell you this, I do believe that He wants us to be happy, but this is not His ultimate goal. His ultimate goal is to transform us into His likeness. As I look back, I can be thankful for the tremendously joyful times and the painful ones, for He is still working on us to make us more like Him.

our God is greater than all of these and He is a redeemer.

I CAN’T love them.

I don’t TRUST them. by, Jill Windham

I’ve heard this over and over and over through the years. And while I completely get and agree that trust plays a mighty part in a healthy relationship, Love has no pre-requisite attached to it in order for it to work. God didn’t tell us that our mandate is to trust people.

He told us, and in fact, SHOWED us that our mandate is to LOVE them. Love says, “I see your shortcomings and crappy track record. I don’t trust you with my heart, but I can love you by my actions.” Jesus understood this when He chose a master manipulator who would sell Him to the police to be one of His 12 disciples. We act like Judas caught the Son of God off guard. Jesus knew at the front of the relationship that Judas couldn’t be trusted. But Jesus knew Judas could be loved. What does that look like? What does it look like when you know someone and all their sketchy baggage, but God said for you to love them? It looks like how Jesus loved people. He was sent to a planet that was filled with brokenness. He gave His best physical years to washing the feet of the friends who would be nowhere to be found when He took His last labored breath, naked and alone on a splintered cross. Jesus saw value, not issues. Jesus saw PEOPLE. See, love doesn’t mean a whole lot when it’s only given to the people who make our lives a piece of cake. Love says, “I see you. And even though I don’t like what I see, I choose you.” You can love without being taken advantage of. You can love without agreeing or validating someone’s destructive choices. You can love without enabling. You can love without being sucked in to their cycle. Jesus did it every day. By setting boundaries. By withdrawing. By pushing ahead. By fervently praying for them. By keeping His eyes on the Father’s mandate. Love. Them. Love is a part of trust. But trust isn’t always a part of love.

Inside Medicine | Spring Issue 2019

The gift of a

NEW YEAR by Elisa Brooks

If you are like me, by the time you are reading this article, you will have most likely been asked more than once if you have made any new year’s resolutions. For one, it’s an easy conversation topic. And two, at least half of Americans truly embrace making resolutions. Forbes.com estimates that around 40% of Americans make New Year’s resolutions. The promise of a fresh start is so appealing! You’ve heard the slogans, right? New Year, New You! We could create a long list of similar sayings. The idea of a new beginning, a strong beginning, a better year … it sounds so good! I never make resolutions at the start of the New Year. It’s not because I dislike the idea of a clean slate. It’s not because I don’t set goals for myself. I know there are opportunities for growth in my life, my fitness, my relationships, my family, etc.! I am more than willing to admit there is space in my life for improvement. However, I have seen that resolutions tend to focus on one person. YOU.

I will lose 10 pounds this year. I will stop biting my nails this year. I will eat healthier this year. I will save more money this year. Do you see what I’m seeing? All of these start with “I”. The focus is often on yourself as you make a resolution. I have worked in a gym setting for many years, and it never fails that clients approach me at the beginning of a year because “this year I want to really make changes”. I get it! Just by showing up at the gym to train and engage and workout, they are already well on their way. I also know that the times in my life that I experience the most fulfillment and the most joy are not when I am focused on myself. They occur when my focus shifts to others. It is like the old adage “it is more blessed to give than to receive” REALLY is true! If I stare at myself in the mirror too long, I notice the gray hairs starting to shine or the acne that is worse in my thirties than it was in my teens. I think to myself, better keep working on those squats, girl, so that your legs will look good. The focus is on me and what all I need to work on. What happens when the focus is off me and on others? I notice that my second born son needs a little extra snuggle time after a hard day at school. I see that my friend’s smile looks

weary when I talk to her, and I can make the extra effort to remind her that she is loved and offer a helping hand. I listen to voices in the community that share a way to assist those in need and become a part of the solution to a problem. I remember that my husband has a long week ahead and make his favorite apple pie to remind him how proud I am of him and all he does. There is a huge difference in the two paragraphs. One is self-focused. The other? Well, it puts others first. It might be true, you might be able eat healthier, exercise more, and need to save more money this new year. But serving yourself leads to a dead end. Serving others, though, widens your circle and your eye gaze. It lifts your sights up off yourself to see a bigger picture and be a part of it! Each New Year is a gift! A fresh start. A new opportunity. Perhaps it is not just an opportunity to make an improvement for yourself. Maybe, just maybe, it is a moment to think about what really matters. Relationships. People. Being present in the moment. I believe that you will find what I have found to be true. When I’m less focused on myself, I become my best self. It just naturally happens when I ask God to help me love the one He puts in front of me throughout the day. So maybe this year? Leave the resolutions behind and take notice of the chance to invest in others - you’ll find that you begin to grow without having to tell yourself to improve. Elisa Brooks, ACE Certified Personal Trainer, ACE Certified Sports and Fitness Nutrition Specialist

JESUS IS OUR by Steve Smith

Match

We hosted a “Be the Match” bone marrow drive at the church where I serve. One of our members is an amazing young man who is a great husband, father, and friend and in need of a bone marrow transplant. On the day of the drive, the church stepped up, and many from the community came and swabbed their cheeks and agreed to be a bone marrow donor if they “matched” this young man or anyone else who might need a transplant in the future. The turnout was amazing. We were told that most drives are only able to add about 25 potential bone marrow donors to the world wide registry. We had 175 people added to the registry that day. Praise the Lord!

For Christ also suffered once for sins, the righteous for the unrighteous, that he might bring us to God… 1 Peter 3:18 As I sat there welcoming people as they came in and went through this process, God was working on my heart. I was reminded of something…every one of us needs someone to be our “match.” We have all been diagnosed with the terminal disease called SIN. Romans 3 reminds us that the “Wages of sin is death.” Our hope for a cure is NOT found in trying harder, it is NOT found in being better than the other people around us, it is NOT found in doing more good than bad, or having a more positive mental attitude. Our only hope is for someone to step in to donate to us, someone who has not been infected by the same SIN disease. Romans 3:10, however, gives us some pretty grim news “there are none who are righteous, not even one.” No match is available for us. Swab every person on planet earth and there would still be no match for us. We are hopeless for a cure and unable to save ourselves. UNTIL God decided to do for us what we could not do for ourselves. Enter Jesus Christ. Emmanuel. God “with” us. He is the only One in the history of the world not corrupted by SIN. Every thought he had was in tune with God’s. Every decision he made…right. Every temptation (and he was tempted in every way like every one of us are

tempted) never led him once to giving in or giving up. Yes, he was God’s son, yes He was divine but He emptied himself of all of that and took on flesh and experienced everything we experienced with ONE gigantic difference. He NEVER sinned. Never. When He saw our condition, when He saw our hopelessness, when he saw that there were no matches to be found…He “swabbed” himself on the cross and became THE blood donor for all of us. When we unite with Him…the sin that infected us is CURED. The disease called “SIN” that threatened our lives…gone. But Jesus takes it a step further…he doesn’t just cure our sin problem…He gives His perfect righteousness to us. Paul says it this way, “God made him who knew no sin to be sin for us that we might become the righteousness of God in him.” Thank you Jesus! The young man we hosted the drive for and his extended family were all at the drive the entire day. They thanked every person that came in. They hugged the necks of strangers who came to support them. To put it mildly, it was an emotional day. That got my mind racing some more. How do you thank someone who is willing to do whatever they can to possibly save your life? Great question. That is really our question too, isn’t it? How do we thank God for allowing His only Son to “be our match” and sacrifice so much for us? • We thank Him every day. • We remember what He did every day. • We cherish the new life that we have and make the most of it. • We point others to the cure that we have found. Steve Smith, Pulpit Minister Beltline Church of Christ 2159 Beltline Rd SW, Decatur, AL 35601 256-353-1876 www.beltlinechurchofchrist.org

TALK IS CHEAP A few moments in your life are you able to go back and relive with such clarity that you can remember what you were wearing, what your hands were touching, or how the air smelled. Traumatic events have a way of permanently marking synapses in the brain that survive Alzheimer’s and even amnesia. Perhaps this is why our Post Traumatic Stress patients are so challenging to treat. Many friends have told me over the years that they can remember exactly what they were doing when the planes hit the World Trade Center. I remember my grandmother telling me what she was doing the moment she found out Pearl Harbor was bombed. For me, I’ll never forget the moment I learned my younger brother, Ben, had committed suicide. That day is burned so deeply into my memory that it will probably be there with me until I die. Dressed in scrubs, seeing my 7th patient of the afternoon, sipping cold coffee, I picked up the phone and learned that he had shot himself in my backyard garden, using the revolver I kept for safety in my night stand. Physical torture was more welcome than the squeeze put on my heart in that moment. Recently laid off from his job and grieving over a close friend’s death, Ben had moved in with me. Falsely, I felt a sense of security that he was under my roof, and I could watch him. Not all suicide victims present with the classic warning symptoms: hopelessness, excessive sadness, withdrawal, changes in appearance, dangerous behavior, or plans to get their affairs in order. Ben was acollege-educated, well-dressed, handsome, charismatic person up until the day he died. This can make acceptance as hard as not recognizing the warning signs. Suicide leaves more questions than answers, and closure is almost completely out of the question. If you are lucky, you are ableto find peace and move forward. Florence Nightingale once told us, “I think one’s feelings waste themselves in words; they ought all to be distilled into actions which bring results.” My dad would say it more directly: “Talk is Cheap.” Ben and I were blessed to have two supportive parents, but anytime I would begin

by Kari Kingsley, MSN,CRNP

spouting typical teenage delusions of grandeur, my father had an earnest way of reminding me that our actions speak louder than words. It is easy in modern times with the constant bombardment of political lobbyists or incessant infomercials, all promising a better life, to forget the truth in that statement. Talk is cheap; so cheap, it’s free. At times, you would pay not to hear it. Rather than talking about what we can do to combat the staggeringly high (and ever increasing) incidence of suicide, I began to feel it was time for action. Be kind to those around you; something as simple as not jumping into the gossip at work, or doing something for someone else without getting something in return. These are easy behaviors that we sometimes forget. Since my brother passed away July 24, 2012, the outpouring of love and support has been astonishing. For a long time, I survived on the kindness and love of others. From the moment he died, I knew I would never be able to move forward unless I could find some form of good to come out of my family’s darkest moment. I was humbled to have been approached by the American Foundation for Suicide Prevention to chair their annual “Out of Darkness” Community Walk in Huntsville to raise awareness and support for suicide victims. The event is set to take place, Sunday, November 6, 2016 at Ditto Marina in Huntsville. This is the way I plan to move forward. I encourage each of you to find yours. If you are blessed enough to have not suffered a devastating tragedy, please don’t wait for one like I did to feel the need to make a difference. Volunteer. Cut an elderly neighbor’s grass. Call your parents. Join a charity. Do something instead of Talking…because, talk is cheap. As Florence Nightingale reminds us, actions speak louder than words. We get one life. All that is left after we are gone is the mark we leave. I want my actions to speak volumes.

MODERN DAY SLAVERY

-an estimated 27 million people are considered slaves with the average victim being between 12 and 14 years of age.

IMFall'19.indd 32

8/28/19 2:38 PM

HUMAN TRAFFICKING IN

America

IMFall'19.indd 33

8/28/19 2:38 PM

IMFall'19.indd 34

8/28/19 2:38 PM

READY TO FEEL

BETTER?

WHAT ARE YOU WAITING FOR? There’s no time like the start of a new year to work on a new you! TherapySouth can help you heal, move better and overcome the challenges of your physical life. If you haven’t tried physical therapy for the things that keep you from moving without pain—we’re here for you! We can help you get back to the things you love.

Start now and make 2019 your best year ever! TherapySouth is an outpatient physical therapy practice with a fun, family-oriented environment. Our experienced physical therapists know our patients by name and strive to help you achieve your physical goals. You don’t need a doctor’s referral to see a PT, so give us a call today!

Huntsville 6485 University Drive, Suite C | 256.513.8280 www.therapysouth.com

Drop by and meet Clinic Director Michael Beuoy and his team in Huntsville!

"Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine."

WHO IS

YOUR

PT?

Inside Medicine | W inter Issue 2019

Weight

upon my

by Dawson Willford

n July 7, 2016 at 12:13 AM my wife was dying. She just had an emergency C-section and went into shock. I stood by her head while she was bleeding out and remembered every fight we ever had and the things I never did for her. I couldn’t let her know how scared I was. I stood in front of my wife saying my final good bye! What do you say to someone knowing it’s going to be the last time you talk to them? I tried so hard to comfort her and tell her everything is okay. I tried to smile and pretend that it’s all part of the operation. They called a code blue and people started rushing into the room. She was shaking so much!!! I kissed her and asked God “please don’t take her home.” I thought about all the times I missed church at Way of Life. I thought about how to tell my new family the bad news. So much was going through my mind that I had no time to enjoy my son. I had to be strong for my family. I had to put the weight upon my shoulders and walk with this load of having my wife pass in the operating room. I didn’t know what to say. I didn’t want to pray because I thought God would shun me for not being a good Christian. I was so sorry and asked God if somehow he could just hear this last request. I was rushed to a different room and waited for about 10 minutes. Jackie finally showed up and my heart was so so so so heavy with grief. I wanted to pick her up and carry her out of the hospital as if everything would be fine. I wanted to leave and have this nightmare be over! I stood with Jackie for about 3 minutes and the worst happened. She lost about 1 litter of blood in a couple seconds. I didn’t say anything, I was so scared. I just looked at my wife and couldn’t utter a word. I wanted to say I love you and tell her it’s okay. I wanted to help her as much as I could. I wanted to stop everything and start all over again. I knew she was dying in front of me. They called another code blue! This time my heart stopped. I thought why didn’t I pray every night! Why didn’t I love her like God has loved me! I died in that room! I truly died! I didn’t know what to do again. I watched helplessly as they tried to save my wife. People were running and pushing me farther away from her. She finally uttered a word and it was like the room went silent. She asked for some water and I knew she was leaving earth. They took me and my newborn son to another room. As we were walking I saw my mom and family. I wanted so hard for someone to hold me. I wanted someone to carry me like a kid and tell me it’s gonna be okay. I didn’t want to be a man anymore. I wanted

shoulders to cry! I wanted to cry out to God and ask him why! I stood by my family for about 2 minutes looking at everyone and holding back all of my emotions. My mother asked me “How is Jackie?” I almost lost it and cried like a baby. I just shrugged my shoulders and said I don’t know yet. I was lying, I knew she was in really bad shape. I wanted to run back in the room and hold her but I had to take care of my son now. He had to be given antibiotics to prevent an infection from starting. After about 5 minutes I asked the nurses if I can go see my wife and they reluctantly said yes. The hallway to where my wife was is about 40 yards. I walked about 5 yards and started crying alone. I couldn’t keep up this persona for much longer. I was scared to walk back and hear the news. I wanted my dad to comfort me! I’m still his little boy! I had around 30 something yards to walk and God spoke to me. Gabriel my son I love you more than you can imagine. I heard you and I was there! I saw the c section. I helped the doctors find the problem. I saw when she hemorrhaged and made sure they caught it really quick. I was waiting for you in this hallway when you wanted your father. It’s okay to call on me. I will always love you. Just as you asked to save your wife. I’ve been asking my father to save yours. I walked with more love in my heart for everything in that moment. My wife and son are doing great and will be discharged Sunday. If you see me at church don’t ask me where I have been. Just say I’m glad to see you’re home!!’

The Faceless

Soldier by, Kari Kingsley, MSN, CRNP

Recognizing those whose identity can’t always be shared.

Settling snugly into my bed with its memory foam mattress and fleece blanket, I gently lay my head on my orthopedic pillow and listen to the hum of my air purifier. My 3-year-old tabby cat, Moxie, is curled around my ankles and a cool air diffuser lightly mists the room with an essential oil blend touting “stress relief”. After an appropriate 15 minutes silently reenacting and pontificating the days stressful events and anxieties in my life, I smoothly drift into a deep and restful sleep. Now, this opening paragraph reads like the diary of a very spoiled young woman; but the attempt is to set the stage for the stark contrast to the lives (and bedtime routines) of the men and women sworn to protect our country so that we can take for granted just how great we really have it.

I recently approached an Army Ranger with 10 years of combat experience and asked him to discuss his story. Having known him briefly, I was already aware he had sustained several life-threatening injuries over the course of his service. The nature of his profession prevents us from knowing his real name. For the purpose of telling his story, we’ll call him Sam… (perhaps a Freudian slip in reference to Uncle Sam). Sam began his military career in 2007. He is quick to acknowledge his reasons for joining are not necessarily the reasons that drive him today. After falling in with a “bad crowd” forcing him to hustle to make ends meet, he left his home country of Puerto Rico and moved to the United States to enlist in the military. With English as his second language, Sam admits that his bilingual shortcomings actually served to help promote his career. He passed verbal aptitude tests that most Americans failed because it took him a split second longer to discern the meaning of the actual words rather than rushing to solve timed puzzles presented to test ingenuity. Say the word “RED”….. Now spell it….. R-E-D….. Now say it 5 times.............RED. RED. RED. RED. RED. Spell it................ R-E-D. Say it........RED........ Now, what do you do at a green light? YOU STOP. Or, at least, that’s what I said when Sam asked me. Oops. Green light. Go. My excellent understanding of the English vernacular and need to answer his question as quickly and efficiently as possible made me stumble. Several more brain teasers convinced me that I was interviewing no lightweight. Sam jokes that while in basic training, an Army Ranger recruitment group visited his platoon asking, “Who wants to join Ranger School?” Sam was the only one in the room who raised his hand. All eyes immediately locked on his. Power Rangers looked like such a cool vocation on TV, who wouldn’t want to join? Some words just don’t translate outright. Although Sam didn’t know exactly what he had signed on for, he didn’t look back. After months of parachute jumps, rappelling off of skyscraper sized towers, survival training consisting of eating bugs… or not eating at all, daily physical training, and mental acuity testing, all while being expected to operate effectively under extreme mental and physical stress, Sam was deemed fit to serve as an Army Ranger. Similarly, Sam raised his hand for SERE training: Survival, Evasion, Resistance, and Escape. He was hoping for a raise, but to his disappointment, it was only more torture school. And again, Sam volunteered for level 3 Army Combative School. He jokes that, in his mind, he pictured himself as Chuck Norris, standing over his aggressors with a smirk on his face. Reality usually had him lying on the floor….. bleeding. Assignments sent him to Afghanistan, Korea, Kuwait, Spain, Germany, and Africa, (that he can confirm anyway). Sam’s first major injury came in 2007. Sam was required to engage the enemy in close combat quarters when a “bogie” got the jump on him. A 6-inch blade (likely a homemade shank) was thrust deep into his right forearm just between the ulna and radius. To save his life, Sam used his biceps muscle

to pull his assailant away, breaking his own ulna and radium in the process. Sam recalls very little after the Medivac arrived and airlifted him back to the forward operating base in Afghanistan. He was given several ampules of morphine and recalls hearing the Smashing Pumpkins play The World is a Vampire on the flight and eating peanut M&Ms. With local anesthesia, (meaning twilight sedation but not fully under), a metal rod was inserted with 4 titanium screws placed in his forearm and 26 stitches placed to put him back together. He told me that doctors told him his bones grew so fast that removal wouldn’t be an option. Six months later, Sam was back in action and ready to save the world. The second major injury occurred in 2009 when Sam was shot in the right upper thoracic area with an AR15 5.56 round. Sam was fortunate enough to have his ceramic body armor in place but unlucky enough to sustain a right pneumothorax with bruising covering most of his upper torso. Sam states that he felt like he was on fire. He jokingly quotes the movie, Talladega nights, in which Ricky Bobby thought he was on fire and insisted on stripping down to his tidy whiteys and running around telling his crew-mates he was on fire. Apparently, that happened; leaving his comrades to give him all kinds of nicknames. Talladega, Salsa-verde, and Sriracha. After his injury he was sent to Kuwait and later to Germany for his recovery. Again, 4 months later, Sam was back on the front lines. Later in 2009, Sam was traveling in an Army convoy to Kabul, Afghanistan when a daisy chain IED exploded underneath their vehicle (which ironically was a MRAP- Mine-Resistant Ambush Protected vehicle specifically designed to ((in theory)) withstand explosive devises) sending a piece of shrapnel into Sam’s right groin, nicking his femoral artery. Not realizing the implications, Sam dislodged the shrapnel from his upper thigh, further potentiating the bleeding. Sam

was in a dangerous situation as rapid blood loss depleted vital organs of necessary oxygen perfusion, a condition known as hypovolemic or hemorrhagic shock. Sam received 3 units of blood, in addition to plasma, platelets and other clotting products within minutes through as a Level 1 Rapid Infuser sending 1100mL/min of warmed blood back in to his exsanguinating body. Sam has permanent varicose veins on his lower extremities following the rapid transfusions. He told me had no idea that blood coagulated so quickly, but recalls squeezing one of the medical sponges lying near his hand and clots forming on the bedsheets. He was told multiple times by surgeons and medical staff that he was lucky to be alive. Sam’s most recent injury came in 2016 when he was hit in the right eyebrow causing bruising and a small facial laceration when he was hit with the butt of an enemy assailant’s AK 47. He recalls being dizzy but being able to reengage and neutralize his opponent. I asked Sam several questions about his life and mindset involving his experiences. Humbling to say the least. How do you feel about risking your life? – “Everyone risks their life every day. Whether it’s driving a car or crossing enemy lines. To me, what makes life is living every moment. The good and the bad. When you feel pain, it’s good. You know you’re still alive.” How do you feel about taking a life? – “I’m defending what’s important. Important to me. Important to those like me.” Tell me about the first time you took a life. – “I was in Afghanistan. We try to honor our enemies in death. We wrap their bodies and they go through mortuary affairs. Th ey ar e th en pl aced in gr een zone for their loved ones to retrieve. I waited 4 hours to see who came. I watched a woman drop to her knees when she approached his body.” Sam’s story trailed off after saying this. How hard is it to transition to and from the civilian world after deployment? – I have a rule that I don’t drive my first d ay b ack. L ooking a round a t e veryone a nd s eeing them having a normal life…. Arguing with a sales clerk at Wal-Mart…. Drinking cappuccino at Starbucks and talking about their previous night’s events… Everything is perspective. Small problems are big to some people. And vice versa. Once back in the states, I always go to a local brewery and order a local beer. I drink all but the last sip and leave the rest for the fallen. I always go to a Chik-fil-A and order a Spicy Deluxe Chicken Sandwich. I sit there and eat it and watch the people converse and think, ‘you’re welcome’.” Sam is not a braggadocios or arrogant person. He said “you’re welcome” in the most non-condescending or resentful way. He genuinely means, “you are welcome”. Sam is unassuming, somewhat hesitant to talk, and carefully chooses his words. He tells his story in a humble and sometimes jokingly self-deprecating way. He has a casual almost non-acknowledgement of past events. What was

your worst night’s sleep you ever had? “The worst night’s sleep came sleeping in a building where my enemies lay dead. The emotional and physical exhaustion of the day’s events unfolding in my head.” As he told me this, my mind briefly flashed to my comfy bed with oversized comforter and fluffy Tabby cat. Night and day, it would seem. Sam wears a bracelet in honor of a dear friend that died in his arms during combat. Although he is reluctant to share details of this event, the mental burdens he carries is palpable in the room as he tells his story. Ironically, all of the injuries he has sustained have been on the right side; his bracelet is worn on his right arm, just below his forearm scar, silently signifying his mental, not only physical injuries. While the reasons Sam joined the armed forces are no longer the reasons that drive him, he has a deep appreciation and bond with his fellow soldiers. My last question to Sam was: What keeps you going when you want to quit? He told me, “Three things: Comradery, brotherhood, and the support I have back home. And when he says the support back home, he means the support of his friends, family and those that love him. They are able to accept him for who his is and what he does. He feels that the less people know about him and the cause he serves, the better. Not only for him but for the bigger picture at large. Sometimes as a writer, it becomes difficult to differentiate subjectivity from objectivity. While most

nonfiction writers strive for fair and impartial journalism, chronicling a story like Sam’s becomes difficult because of the deep visceral response it elicits. Hearing first hand an Army Ranger’s courageous stories and near-death experiences make it particularly difficult to remain unbiased and prepossessed. A brief glimpse through the eyes of an active combat soldier leaves a mark on your soul. As a thank-you, I gave Sam a small Saint Christopher medallion. Saint Christopher is the guardian saint of travelers. It seemed appropriate to bestow a small token of appreciation for this man who risks so much to travel the world to protect us from those that wish to harm us. I later received a text picture from an undisclosed location of the charm, covered in sand, but hopefully doing its job to protect one of America’s 1% elite. Our military veterans are honored with one holiday a year. Veteran’s Day. They honor us for a full 365 days. Sam has changed many lives for the better; mostly by protecting people that will never know his actions. I feel very fortunate to lay my head down at night, and be complacent….. to worry about relatively small non-life-or-death things and sleep soundly. Thanks to men and women like Sam, we all can.

In memory and forever grateful

to our military.

by Regina Mobbs, R.N.

Lean Not

On Your Own Understanding As a candy striper at the age of 14, I knew that my place in life was to be a nurse. I found a sense of purpose when I entered a hospital or medical facility and knew that God was calling me to serve in that field. I made a vow to God while in nursing school that if He would get me through, I would serve Him in any way He saw fit. Since that time I have traveled internationally and domestically serving Him in medical missions. Each trip I’ve taken has brought me a little closer to Him and His sovereignty, His purpose, and His plan. A few years ago while planning for a trip to Guatemala, other nurses and I were gathering supplies and medications to take for our medical clinics. I always found myself in awe of God’s provisions for each trip I had taken and this one was no different. The multiple boxes and bottles of vitamins, pain relievers, fever reducers, and GI meds had been abundantly donated. Of course the restriction on the weight of luggage placed by the airlines limited our ability to take the donations in their original containers. I, along with the other nurses would work our day jobs, care for our families and then before bed, we would each count out individual doses of the medications from their containers and place them in their own zip top bags and label them. This allowed us to pack many more medicines since the original packaging was bulky and heavy. I often saw bottles of Tylenol and Ibuprofen tablets as I drifted off to sleep. Counting thousands of pills for several weeks prior to our departure was tiresome, monotonous, and time consuming. You can imagine my surprise when a sweet little old lady from church came to me one Sunday and handed me a large garbage bag full of medicine bottles that she had laboriously saved, cleaned, and made label free. While keeping a grateful smile on my face I was thinking to myself, “how am I going to tell her I can’t possible fit those bottles into our luggage”? After all, I had just spent weeks counting pills into small baggies to eliminate bulky bottles. I accepted her gift of 100 medicine bottles and prayed I would find a way to pack them. As luck would have it,

Trust in the LORD with all your heart and lean not on your own understanding; in all your ways sumbit to him, and he will make your paths straight. Proverbs 3:5

the same Sunday at church an older man approached me to give me 100 insulin syringes. He said “I know there must be someone who needs these in Guatemala and I want to donate them”. There I was again, forced to smile and extend gratitude for something I knew I would have a challenge getting to Guatemala. As the time approached for us to pack and depart, I managed to squeeze a bottle here and there and tuck in the syringes in various places as well. My shoes and socks had syringes in them and the pockets of my clothes all held medicine bottles, all along thinking it was a useless task. When we arrived at our mission site we gathered for planning, prayer and to set the agenda for the week. We had planned 4 clinics for the people there and would simultaneously hold Bible stories and crafts for the children. The missionaries shared how the greatest challenge in the lives of the people there was clean water for drinking and cooking. They went on to share that the people did not often have the resources to boil the water, nor did they have the means to purchase water purifiers, filters, or bottled water. The missionary then shared how they had tried to teach the people to put Clorox in the water to purify it because it did not involve having electricity or fire to boil and it was accessible to all. The problem was that they didn’t have the money to buy the Clorox. Well you know how the Holy Spirit just falls all over you and opens your eye to His plan? That’s when it hit me. We can put Clorox in the medicine bottles and give each family a bottle and a syringe. Our time in Guatemala was then spent holding classes about proper hygiene and handwashing, along with sharing the gospel. We showed the people how to use the insulin syringe to draw up .2 cc’s of Clorox and drop into 2 liters of water and allow it to sit for 6 hours to kill all of the unseen parasites and make it suitable for use. We were able to give 100 families the means to purify their water and take one step closer to healthier living. While we had the attention of the people we used the analogy of how we can’t see the sin in our lives but we know it’s there. We can’t expect to continue to drink and cook with dirty water and expect not to have a poor outcome and illness. That’s how sin is in our life. It’s in many of our actions, words, and works and we don’t often realize it. We used the opportunity to share how we can be delivered from the illness of sin and the consequences of sin. Following up with the revelation that only the blood of Jesus can purify us. I’ve reflected on that experience many times. Often when I am given an insurmountable challenge, something tangible for no known reason, or find myself having an unexpected encounter with someone, I think about all of those medicine bottles and syringes. I have to remind myself to “not lean on my own understanding” but know that He will direct me as long as I seek Him and His purpose. Proverbs 3:5-6 Lean not on your own understanding, but in all your ways acknowledge Him and He will direct your path. Regina Mobbs, RN Missionary Nurse Liaison for Baptist Nursing Fellowship www.mwu.org/BNF

Christmas Reflections taken from the WORD “STABLE” …What a COMFORT! As I woke up from the fog of surgery, I heard snippets of my surgeon’s voice telling my husband how things went. He said one word that triumphed all other words,” STABLE”. “She was ‘stable’ through the whole process.” Fears vanished into air, and I knew that I could go on into my medicated state at rest with the world. Chuck told me he was able to get updates through the surgery by phone from the nurse, Lauren. She told him 3 hours into the process that everything was stable. So, ‘stable’ was not new news to him. He knew how things were all along until he hit about 3:30 and there was not any more news until late that evening. That must have been hard! I am happy to be on the other side of surgery and now with Christmas just behind us too, I can sit and contemplate a few things… with the computer on my lap, fire in the fire-place and my favorite blanket on my lap (Thanks, Kim! And of course my Dad for the coffee!). So, back to the word ‘stable.’ Being a teacher, I love words, and I love the use of words. I even love puns on words; I just can’t help it. The word ‘stable’ hit me… ‘Stable’ can be 3 parts of speech; a noun, a verb, and an adjective.

‘Sta-ble.’ 1. Noun: a building by which domestic animals are sheltered and fed. 2. verb: to put or keep in a stable, to dwell in (… hmmm, let’s keep this in mind) 3. adjective: firmly established, not changing or fluctuating, steady in purpose, firm resolution not subject to insecurity or emotional illness

by Wanda Mullins

I remember all of the stories and “possibilities” that swamped my thoughts the months before surgery. I was reminded of them again the hour before they began to cut me open as the parades of professionals came to speak to Chuck and me. It was really un-nerving. But, they have to give the info. They were so professional and so great! I had a couple of options: I could panic and run, or I could trust the physicians that are knowledgeable in their field and rest, knowing that they know what they are doing. I chose the latter. In fact, I hardly got out the door on the way to surgery, and I was out like a light. Now, being on the other side of surgery and on the other side of the calm, beautiful day of Christmas, I still have “stable” on my brain. Every time I get up, I have that word wobbling around somewhere... “alright now…Stable...Stable…you can do this…stable...one foot in front of the other...” When they removed the tumor, they also took the balance mechanism in the right side of the brain, so I have to be able to compensate as time goes by. I will never forget the first time I went to get up. It was a grand trip to the bathroom. Yes, a major success! Everything seemed unsteady, insecure and fearful. Every time I got a “new” nurse, I had to explain to her that it was okay for her to stay in the bathroom with me. Just the comfort of her voice, her touch and her presence really helped! It moved me along, for a lack of better words, ha-ha! I couldn’t resist! Now, I could have been very prideful and pushed her out, but the comfort of knowing she was there was priceless.

That’s it! That is like the ‘stable.’ My nurse, physically with me. Our God, physically with me and us! His voice… “Do not be afraid…I am here…I love you…You are going to be alright!” He is God, Emmanuel… God WITH US! I want so much for God to stay IN my world WITH me. Don’t you? The ‘stable’ of life can be a very prideful place. We want to do it all on our own. We want to think that we do not need anyone or anything. As I reflect, I can just sit back and close my eyes in beauty, because I did not resist her help or her loving care. She did not force me to receive her help. It just beautifully came, and I received. I know I could turn on the TV at any moment and get back to the chaos of the world. It will not stop. Satan knows he is on a timeline, and he knows it is getting shorter. He wants to steal your STABLE. He wants to put you in a place of PRIDE, so you are so unable to receive what is offered in the STABLE. I can’t think of a better way for a true King to come into the world than through a low, humble STABLE. He is HIGH and LIFTED UP! He has come to breathe the beauty of life into the stench of DEATH, conquering it FOREVER! Thanks for letting me contemplate my new word. How I loved hearing the word ‘stable’ just coming out of surgery from the lips of my surgeon! How I love peering into the ‘stable’, living in a world that is nothing but…and finding my God right here with me, through the power of the resurrection and the Holy Spirit. “Take Heart…for I Have overcome the WORLD! ~John 16:33. That is straight from the Healer’s lips, the Greatest Physician of all. Now, that is STABLE!

Wanda Mullins was diagnosed in 2013 with Acoustic Neuromas, which are benign slow-growing tumors in the brain. She has had a long but blessed journey through the diagnosis, surgery, and continued recovery of her condition. More information regarding her testimony and journey can be found at www.underthebrainbow.com

Kenya Relief by Lisa Layton

Approximately 7,993 miles away from Huntsville, Alabama there is a place where people have the ability to thrive on scarcity. They battle with disease, injuries and physical impairments, but amid their hardships, it is a place where love abounds, joy is prevalent, and smiles are bright. It is a place where a piece of a Huntsville couple’s hearts will live forever. This place is Migori, Kenya and the loving hearts belong to Amy and Julian Billings. Amy and Julian met while attending UAB Medical School. Amy specialized in pediatrics and Julian chose gastroenterology. Once they finished their training, they began their busy lives in Huntsville as practicing physicians and parents to their three sons, Grant, Jackson and Charlie. They became active members of Cove Church where missions are greatly supported. Amy and Julian always felt their calling to missions was more on the local level until Julian had the opportunity to meet Steve James, the founder of Kenya Relief, a missions organization originally dedicated to providing better health care in Kenya. After hearing him speak at Cove Church, Julian asked about the capability to do GI work in Kenya and quickly discovered that type of treatment was too expensive, and unfortunately, many patients who suffer from severe GI problems there do not survive. The phrase “we can only do what we can do” did not sit well with the Billings and their quest to change this situation soon began…Julian felt the nudge, the calling, the God whisper that it was time to make a difference. A couple of years passed and a team from Cove Church planned a mission trip with Kenya Relief. Julian was on his way to Migori and an experience that would change him, and would soon change Amy, forever. His first trip was in 2015 and he went, not just as a gastroenterologist, but as a multi-specialty internist. He treated many medical issues outside of his specialty that he had not seen in years. He had to rely on his faith, and with no internet access, medical books, to guide him and to refresh his knowledge from the early years of medical training. While in Kenya, Julian “fell in love with the idea of just practicing medicine in this kind of pure way that is not encumbered with managed care and paperwork and the pressures”. He went on to say “this is why you wanted to be a doctor” and in Kenya, this is the way you were able to practice medicine. “You were there to help people and to love on people”. He was so passionate about his trip that he met again with Steve James about doing

more. He set his sights on finding a way to help those afflicted with GI problems. Julian spent the next twelve months trying to find medical equipment to take back with him on his second mission trip which would take place in 2016. He was able to get the needed equipment donated by Madison Surgery Center, medical equipment reps, and Huntsville Endoscopy Center. He also found pieces of equipment which were donated from across the country. He was determined to have the means to do endoscopy procedures as the nearest facility with that capability was six to eight hours away. It was God at work again as he was able to acquire and send over $400,000 worth of donated equipment to Migori to enable him to perform GI procedures to properly treat this community of people. Now, Crestwood Hospital as well as other facilities, are contacting Julian with a surplus of supplies and equipment to send. When Steve James first started the medical portion of Kenya Relief in 2002, he ran a clinic in the back of a pick-up truck. Since then, it has grown into a facility with two exam rooms, two functional operating rooms, a room for ophthalmology and dentistry, a lab and a recovery area. A 20 bed hospital is currently being built to accommodate in-patient care. The Billings’ calling and determination along with God’s help has played a part in expanding the medical care being offered. A year prior to Julian’s first trip, the Billings family began to sponsor two children through Kenya Relief. One of the most touching experiences during the mission trip was the time spent getting to know the children that they sponsor. Julian loved that you get to love them and hug them and “let them know their life is of value”. You get to tell them they have a God who cares greatly for them. When Julian came home after the first trip, Amy said that “he was just transformed, he was not the same person. He just left part of his heart in Kenya and was obsessed and enmeshed with this place”. She shared in his excitement, however she just did not feel the call upon her heart to join him. She could not go “on her own strength” and if God were going to call her, he would have to equip her to do it. She felt the responsibility of her two sons at home, (oldest son Grant is now serving as a full time missionary), and having both parents leave them for two weeks for a mission trip posed its own challenges. In God’s perfect timing, things were soon to change for Amy…

Not only has Kenya Relief grown the medical portion of their organization, but they also have created an orphanage that houses 50 boys and 50 girls. They have started Kenya Relief Academy, which is a K-8 school for 700 students with over a 400 student waiting list. “The birth of Kenya Relief is a testimony to one life leaving a lasting impact in the world.” To learn more about Steve James and Kenya Relief, please visit www.kenyarelief.org

“I see the work of Your hands Galaxies spin in a Heavenly dance oh God All that You are is so overwhelming” “Overwhelmed” by Big Daddy Weave

Amy knew that when she got to the clinic she would be treating adults, and that was intimidating as she had not treated adults in 17 years. The first day she felt overwhelmed, but by the second day, she realized what she had to offer was better than what they had. Again, she leaned on her faith that “if God calls you, he is going to equip you and it will be spectacular”. While there, Amy realized this was the first time that she and Julian had ever had the opportunity to team up and practice medicine together, and she felt that experience actually enriched their marriage. Looking back now, Amy cannot believe it took her so long to get to Kenya and when her time came to leave, she said it was “gut wrenching”. Kenya is like a “joy we don’t have here, even in the face of such extreme poverty and overwhelming needs, they have a joy that we don’t have and you just realize in some ways we feel sorry for them, but we are the ones to be pitied. We have so much stuff here and we don’t feel real joy”. Amy said she would go back tomorrow if she had the opportunity. It is in her soul. In fact, she said they are going back in June, 2018 and that date cannot get here soon enough. When asked about their most profound Kenyan experience aside from medicine, they both agreed it was the children. At 4:30 am the children would be washing their two articles of clothing before school. Amy said they would wake up to the children at the water pump actually singing! “The children also don’t know selfishness. If one of them gets a candy bar, they are going to take it and break it into tiny pieces and share with everyone. There is not a tiny cell in their being that says this is mine”. They were both amazed that the children and adults as well have such an unselfish ability to love, harboring no bitterness, despite their horrific conditions. They are completely joyful and thankful for their good fortune. Once back home, Amy said she would wake up in the morning and still hear the singing, the voices, and the laughter and she would miss it so much. “The whole experience of what Kenya Relief is doing is so special and such a beautiful thing”.

No matter what the Billings have planned for their future, this experience has shown them that God’s plans are so much bigger. They will go back and their work will continue, but the work that takes place in the hearts of Amy and Julian is a far greater gift than they could ever have imagined. I want to personally thank Amy and Julian Billings for sharing their experience and their hearts with “Inside Medicine”. It was truly an honor and privilege to spend time with them and see God’s light shine through them.

KENYA

One day while Julian was away on his second mission to Kenya, Amy dropped her sons off at school and she heard a song by Big Daddy Weave called “Overwhelmed”. The lyrics had such an impact on her that she went home and found the video and lyrics online. Little did she know, the actual music video was filmed in Tanzania which was about 20 miles from Migori, where Julian was serving. Everything that Julian had described to Amy about his experience was being played out before her eyes while watching this video. She said, “I wept and felt like my heart was there with him [Julian], and I could understand and get a sense of what captured him”. Amy said, “It was just crazy the way God knit our hearts together from across the world in a way I could understand how it [Kenya] gripped him so much”. Despite this, she still did not feel the calling, because she felt she had every reason not to go. Events started happening and Julian needed Amy to go as another doctor to help carry out the plan for his third trip. Amy realized for her to go would be an act of obedience. “God does not call us to live a faith of comfort, He wants us to be bold, He wants us to step out”, so the time had come, and Amy agreed to go to Africa.

UNITY in Worship by Ben Murray

Corporate worship is one of the most enriching aspects of the Christian life. In moments of corporate worship one may be encouraged, healed, delivered, forgiven, or simply reminded of God’s grace and mercy. That is because God shows up in a powerful way when His children come together in His name. Please understand that God can also do wonderful things during your time of private worship when it’s just you and God. So what’s the difference? UNITY with other believers! One of the things that makes Daystar Church unique is that there are worshippers from every denominational background. We’re like one big melting pot. It is wonderful to see Lutherans, Methodists, Catholics, former Atheists, Baptists, Nazarenes, and Pentecostals worshipping the same God under one roof. However, one of the challenges within congregational worship at Daystar Church is that there are worshippers from every denominational background. If we are not careful we could allow traditions to prevent us from engaging in unified worship. One person may be outwardly expressive in their worship (shouting, clapping, and lifting hands, dancing) while another may internalize the moment with God (hands folded, standing still). Unity in worship is not measured by whether everyone is expressing their love of God in the same manner. The most important matter isn’t how you express your love to God, but it’s the posture of your heart. 2 Chronicles 5:11-14 offers us an inside look into what happens when we worship in UNITY. Take a moment to read that scripture from your Bible. Here are some key factors for unity in worship. First, give thanks to God. One of the best ways to start your worship experience is to honor God for all of His goodness in your life. We often say thanks, but we seldom acknowledge the individual blessings that he's given us. When is the last time you thanked God for your eye-

balls, your vehicle, and your lungs? You can name stuff for a lifetime, but it's not for God's benefit, it's for yours. Thanking God reminds us of his goodness to us. Sometimes giving a general thanks is interpreted as, "Thanks for Nothing." Secondly, purify yourself. We know that sin and impurity separates us from God. When you come before God in worship, either publicly or privately, search your heart and ask the Holy Spirit to shine His light on anything that doesn’t belong in your life. When He shows you these things, it is up to you to repent and purify yourself. Third, Worship TOGETHER. The scripture says they, “performed together.” One may be distracted when there are hundreds of people around. Unity in worship require focus. Choose not to be consumed with the days plans, the roast in the crockpot, or the man singing off key nearby. We believe that worship is love expressed God’s way. Some common ways we can corporately express worship to God are singing, clapping, bowing on our knees, shouting, lifting our hands, and posturing our heart in submission to God. Be a participator in the worship experience. Finally, corporate praise invokes God’s presence. The result of unity in worship is the presence of God. Did you notice in the scripture how they raised their voices and praised God with a song? They did not raise their voice in protest. They did not raise their voice to be heard. They didn't cause division with their voices. They didn't gossip with their voices. Their goal was very simple - to praise the Lord. Zach Neese of Gateway Worship in Southlake, TX, says, “Praise has a purpose. Praise is to acknowledge or declare what God has done, what God is doing, and what God will do. Praise is birthed out of an experience and is grounded in expectancy. Praise affects what we see. Praise sets things in motion. Praise is a weapon...someone has to pull the trigger. That person is you.” When we worship together in unity, the presence of God shows up.

Ben Murray is the campus pastor of Daystar Church in Madison. Daystar Church meets at Horizon Elementary School on Sundays at 10:30 am. Visit Daystar Church online at www.daystarchurch.tv.

Tough Mudders:

Helping to Serve AHERO’s Purpose by Ashleigh McKenzie

When I was asked to write an article around the partnership between AHERO and Tough Mudder, my initial thought was, “Sure, why not?” As the deadline loomed, though, my thought changed to “Why did I think this was a good idea?” It was as if someone had asked me to climb Mt Kilimanjaro. I had a college degree and the experience of running a company; yet writing a small article became something difficult for me. How could I encourage others to face challenges to help others, if I myself could not overcome the fear of writing? Much of what I live for is to help others develop the skills to overcome moments of doubt, such as these. Now, after much soul-searching, I discovered that by writing the article I could share my heart as it really is and not as comfortable as it may seem. If comfort were the case, I would have simply submitted to the editors the pictures of our Mudders and their physical challenge of a 12-mile run tackling 20 obstacles in the mud. My surreal moment of “why” I do what I do began five years ago. Only a few weeks into my father’s retirement, I learned my hero had been diagnosed with cancer. My parents had envisioned their retirement for years. It would be filled with travel and enjoyment. Instead, this new chapter in life would involve treatment facilities, doctor appointments, and scans. According to his doctors, his condition could have been caused by the drinking water at Camp Lejune back during his basic training days. I found myself distraught that the selfless act of serving in the military could so negatively impact my father's life years later. There are two types of practical reactions to such circumstances: You decide to be either the caregiver or the provider. At this point, I was just learning how to cope myself. And while my professional career is in the medical field, it has nothing to do with the clinical side, and I felt I wouldn’t be a really good caretaker. That left me with “provider.” But how do you provide support, education, and awareness not only to your own family but to others affected by disease, loss, diagnosis and disabilities? I was lucky enough to find AHERO just then, as I was reaching my tipping point. I learned I could became tough for others in the middle of being the most mentally broken I had ever been. Partnering with AHERO has helped me and others bridge the gap and provide hope to those seeking help.

When you know your "why," your "what" finds its purpose. I am uncertain how I originally learned about the Tough Mudder, but when I realized the charitable benefits it could offer AHERO, the Mudder became my “what.” My “why” had begun with coping with my father’s cancer diagnosis. Now I was able to combine the two. Consider post-traumatic stress (PTS), which has unimaginable effects on how one responds to something that, to the average person, is emotionally manageable. In a few short years, AHERO has helped many who struggle with PTS and other conditions resulting from military service. AHERO’S relationship with Tough Mudder has grown through the running of 27 courses to-date, with more than 100 participants on the "Tough for AHERO" team! Running a Tough Mudder doesn’t necessarily have to do with being in tip-top shape. It doesn’t mean that you must train for months. But many feel that they can’t do it, much as I felt I couldn’t write this article for AHERO. Yet in writing this, I realized my mission is to reveal my passion through something that at first may have caused me anxiety, fear, and doubt, but ultimately opened my heart to motivate others to find their own purpose. Given a purpose, most anyone can achieve previously unimaginable goals. It takes perseverance to see the finish line. Yet the result of knowing your efforts are giving someone else needed support is greater than happiness. It is true JOY. Joy in purpose is something we all strive for, though it is sometimes hard to find. But have faith ... and just like the tiny mustard seed, it will grow, and continue to grow.

Ashleigh McKenzie is president of MDreferralPRO and is the national coordinator for Tough Mudder events that benefit AHERO. To learn more, visit AHEROusa.com

AHERO aherousa.com

What will you leave behind? by Katie Edwards

People everywhere are coming up with ideas on how to make this year better than last. I’m not much for New Year resolutions. But today, as I spent a little time in the Word, the Lord revealed to me...

A Few Things I Need to Leave in the past... #1- Perfectionism. “Not that I have already attained all this, or have already been made perfect, but I press on to take hold of that for which Christ Jesus took hold of me.” -Philippians 3:12 Perfectionism is a huge struggle for me. It may not be a struggle for you, but before you write this off as something you are free of, consider it again. Perfectionism comes in many, many forms. Your house may not have to be perfectly clean to entertain guests, but what if someone you love very much seems disappointed in you? Is your less-than-perfect-performance (in their eyes) going to send a crushing blow to your spirit? That’s just as much perfectionism as having to have your home spotless and clean before the first guest arrives. And it can enslave you. That Paul. He just has a way with words, doesn’t he? “...I press on to take hold of that for which Christ Jesus took hold of me.” Friend, Jesus has taken hold of you! And for a very specific purpose. When you and I allow the bondage of perfectionism of any kind to take hold of us, it is taking the place of Jesus. He is the only thing that should have a hold on us.

#2- Gossip and Negativity with My Mouth. “Do not let any unwholesome talk come out of your mouths, but only what is helpful for building others up according to their needs, that it may benefit those who listen.” - Ephesians 4:29 Any unwholesome talk? Unfortunately, this verse doesn’t just apply to people who have a problem with swear words. Actually, I would venture to say that it applies much more to those of us who have a tendency to just “say what we’re thinking.” Look at it this way...What if we text it instead of saying it? That should make us look at it differently…If the thought we are about to broadcast, whether it be on social media, via text or phone call, or word of mouth...whether it be to one person or thousands...if it is not

helpful for building others up according to THEIR needs...we are to quite simply...HUSH. When we restrain ourselves in this way, Jesus is honored. I believe that is what the very next part of that sentence means... “that it may benefit those who listen.” We shouldn’t give them juicy information or something to laugh about or cause them fear or... whatever. Truly benefitting someone else means honoring Jesus. The opposite of this is found in the very next verse (v. 30 of Ephesians chapter 4)... “And do not grieve the Holy Spirit of God...” Less grieving the Holy Spirit, more building others up in 2017.

#3- Negative Thoughts. “We demolish arguments and every pretension that sets itself up against the knowledge of God, and we take captive every thought to make it obedient to Christ.” - 2 Corinthians 10:5 I’d like to start by saying that I’m not a “sending out positive vibes” kind of girl. What is a vibe? I know what a prayer is. I know what a thought is. Vibes? Not so much. It just kills me when people say they’re sending positive vibes. I literally have no clue what they’re saying. Anyway, I digress... I just want you to know that because I think that when people say, “I’m leaving behind negative thoughts” it can create the idea that somehow MY thoughts can change situations and circumstances. God clearly says “As the heavens are higher than the earth, so are my ways higher than your ways and my thoughts than your thoughts.” (Isaiah 55:9). We are to make our thoughts, His thoughts. Finding out what God says about what I’m think-ing is where I plan to start NOW.

#4- Comparison. “But, ‘Let him who boasts boast in the Lord.’ For it is not the one who commends himself who is approved, but the one whom the Lord commends.” - 2 Corinthians 10:17-18 Theodore Roosevelt said that comparison is the thief of joy. Can I get a witness? There’s not much that has to be said about this subject because we are all so familiar with it. When we seek to compare our lives, our spiritual walks, our finances, our homes, our families, our relationships, our work, our successes, our failures, our...everything...with others, we are devaluing what God

has done for us. Would you actually look in the face of Jesus and say, “Thanks, but I think You could’ve done better.” Probably not. So, let’s resolve not to say that in our hearts anymore, either. #5- Need for Human Approval. “Am I now trying to win the approval of men, or of God? Or am I trying to please men? If I were still trying to please men, I would not be a servant of Christ.” -Galatians 1:10-11 So, I saved my worst one for last. This is THE one. This has been my hang up in the past. (Who am I kidding? Many, many more years than last year.) I wonder if so-and-so enjoys being around me? I wonder if so-and-so only wants to be around me because of what I can do for her/him? Does soandso think I’m a good mom/wife/friend/worker/leader/ servant/Christ-follower/housekeeper/ the list goes on and on and on and on and on and on.... The enemy has had a FIELD DAY in this area with me this year. I have been so concerned with being hopeful that people would approve of me that I forgot that, as a follower of Jesus, I am only trying to win the approval of God...and that when I strive to please humans primarily, my service to Christ is sacrificed. That’s changing this year, too. You may not get where you want to go, unless you know where you’ve been. What are YOU leaving behind?

Fortress

by Lauren Marsh

Truly he is my rock and my salvation; He is my fortress, I will never be shaken. Psalm 62:2

A few years ago, The Weather Channel rated the top 10 cities for tornados and guess who was number 1: Huntsville. I was actually shocked when I read that; A lifetime of living in this area has cultivated a slight “normalcy” to storms for me. However, there is no doubt that we live in an area that is affected by true seasons and violent storms. It is fair to say that North Alabamians desire the peace of mind of a “fortress”. That was our intent when it came time to build our own home. My husband, Terry and I own Ridgeline Construction which focuses on roofing and exteriors for residential and commercial properties in the Huntsville and Mobile areas. Prior to Ridgeline, Terry worked for builders in Florida and Alabama. Experience has taught us a few things that we felt imperative to incorporate (and not incorporate) into our own home. 1. Invite the Holy Spirit in for protection. 2. Combine the best structurally-sound building methods. 3.Build a storm shelter (a “no-brainer”). In the words of Mark Batterson, author and pastor of National Community Church, “work like it depends on you and pray like it depends on God”. Anyone who has built a home, whether themselves or with a contractor knows that it is a labor of love. Terry was there daily watching over every detail of the building process. I made it my mission to walk thru the house writing on framework the bible verses that I hoped would infiltrate our home. In regard to structural soundness, we used poured concrete foundation and basement walls as opposed to other foundation choices. Not to say that other foundation types are not good options, but the strength that poured concrete offers a stronger house in general. Be prepared for sticker shock! If this is important to you, than you may find worth in trimming other areas of your construction budget to suffice. Engineered trusses top it off (designed by CBS).We also used Tamko Woodgate asphalt shingles. They are both beautiful and offer high

quality roof protection and have an outstanding warranty that Tamko stands behind. Of course, a storm shelter has become a staple in our storm-scarred area. For our shelter, we poured a few extra walls in the basement and added a Liberty Safe Door (provided by Haley’s Flooring and Interiors). It serves as ultimate protection and an ultimate for the “man cave”. The first sirens sounded not too long after we moved in, and I was so grateful for that room! Some other important storm tips worth noting: • After high winds, eye your roof to ensure that shingles have not blown off. • If you notice any shingles in your yard, call a professional to inspect. • Keep your gutters free of debris and clean them out regularly. • After a hail storm, look for possible hail damage. • A professional roofer is licensed and insured and is happy to produce these documents to clients. Even better, the roofer should be a part of the BBB with an A or better rating. • If a large storm comes thru, be weary of pass thru contractors. • We do not ask clients for payment prior to work being completed. If a contractor asks for payment up front, be especially weary. It is my prayer for your home to be a fortress as we prepare for the beautiful yet turbulent spring season ahead! Ridgeline Construction has locations in Athens, AL and Spanish Fort, AL. Visit us online and Facebook for more information.

bananas, watermelon, carrots and sweet potatoes are often

can also disrupt your natural hormone balance.

shunned due to their high glycemic index, but in fact have

We all know now that BPA is harmful and have actually

a low glycemic load. Eating foods with a high glycemic load

been banned from baby bottles. However, what about

(refined carbohydrates such as sugary beverages, candies,

other plastics? Many companies have replaced BPA with

cakes, pastries, cookies, white bread/crackers/cereals/rice/

BPS. About 80% of Americans have detectable levels of

pasta, etc on a regular basis can lead to weight gain, poor

BPS in their urine. Research is showing BPS is no safer than

gut bacteria, and insulin resistance. We know these factors

BPA. Exposure to these endocrine disruptors can have a

increase the risk for diabetes and metabolic syndrome and

negative effect on body weight and metabolism. Store and

all contribute to cancer risk. It’s a slippery slope!

reheat foods in glass rather than plastic and use a reusable glass or stainless steel water bottle.

Low Environmental Toxin Exposure Your best bet is to eat foods grown locally from a farmer who

In addition to eating a nutrient rich diet and keeping a

does not use pesticides/herbicides. If this isn’t an option,

healthy weight, make sure to get some exercise daily, spend

choose foods that are organically grown. Produce stickers

some time outdoors, and get eight hours of good quality

that start with a ‘9’ indicate they are organic. Check out the

sleep. Unfortunately, there just isn’t a magic bullet. It truly

Environmental Working Group’s Dirty Dozen list for the

takes an overall healthy lifestyle to ensure you are creating

twelve fruits and vegetables that have the highest amounts

an optimal environment for your body to thrive. After all,

of pesticide residue. Pesticides are known carcinogens and

you only get one body.

At His Feet

1 Peter 5:7 NIV. Cast all of your cares on Him, for he cares for you.

I recently observed my sister’s dogs at play. Thor, who was the smallest one, had some difficulty keeping up with the other dogs. Whenever he needed a rest, he would run to Avie and sit beside her feet. I imagine that he felt safe there from the rough and tumble of the other dogs and because she was someone that he trusted. After a few minutes of rest, he would resume play with the other dogs. This reminds me of many individuals mentioned in the Bible, as well as some that I know who took refuge at the feet of Jesus. A leper with a contagious and dreaded disease recognized the possibilities if he could only get close to Jesus. Defying the social norms, he made his way to Jesus and knelt at his feet. Yes, Jesus was willing to heal and restore. (Mark 1:40-45) I think of a demon possessed man who lived among the tombs of the dead and was tormented by Legion. He was found clothed and in his right mind while sitting at the feet of Jesus. What a transformation! (Mark 5:1-20) Then there was the woman who was sick with an issue of blood for longer than any of us would want to be. Her health was restored through faith in Jesus as she stooped to touch the hem of his garment. (Luke 8:43-48 NIV)

I think also of the centurion who had previously doubted that Jesus was the Son of God until he stood at the foot of the cross. (Matt 27:54 NIV) We too get tired of the pain and struggles that we go through in life. We are constantly on the go dealing with jobs, family, education, illness and even attacks from the enemy. Sometimes the more we are challenged, the more we struggle. Isn’t it time for us to take a break? What are the possibilities for you and for me today if we were to sit at the feet of Jesus. He has so much to offer us: peace, contentment, hope, healing, forgiveness, salvation and so much more. Just as Thor felt safe at Avie’s feet, we too can be assured that we will be safe at the feet of Jesus. There is a saying that a dog is a man’s best friend. I would like to suggest that Jesus is man’s best friend. He is a friend that sticks closer to us than a brother. Whatever you are in need of today, it is available at the feet of Jesus. He has invited us to come: “come unto Me all who labor and are heavy laden and I will give you rest” (Matt: 11-28 NIV) –Myrna Brandon

A Mother’s

LOVE

by Dr. Sunita Puri

MedCare + 8075 Madison Blvd., Suite 106 Madison, AL 35758

he clock read 3 a.m., and I was finishing a 24-hour shift in a remote rural emergency room when Millie came in with her child wrapped in a blanket. She was reluctant to place him on the bed. I asked her if I could peek under the blanket. When I pulled the blanket away, I saw unseeing eyes and dysmorphic facial features, but Millie smiled and looked at her son, Michael. The boy had mild respiratory distress. I touched his cheeks and said, “Michael, we will take good care of you.” Millie relaxed and allowed him to be examined. He was wheezing and had a respiratory rate of 25 per minute, with mild retractions. Other vital signs were within normal limits. Pulse oximetry was 96% on the room air. Millie sat on the bed, holding Michael’s hand and watching every move I made. Michael was treated with an aerosolized bronchodilator, to which he responded. A chest x-ray revealed right lower lobe pneumonia. When I told Millie that Michael needed to be hospitalized, the color drained from her face. She shook her head and said, “No.” I asked her to tell me more about her son. Now 14 years old, Michael had been diagnosed at age 1 with Hurler syndrome. I had noted the characteristics of this rare syndrome when Millie placed him on the bed. Michael is now three feet long and had profound growth and mental retardation. Originally, Millie was told that he would live only a few years. She refused to entrust his care to an institution. For 14 years, she had loved this child into living and observed the smallest changes in his behavior as indication of how to take care of him. It was obvious that Millie knew more about caring for Michael than anyone else did. I respected her wish to take Michael home, and we agreed to treat Michael with antibiotics as an outpatient. Since then, I have seen Michael twice for similar illnesses; we treated him and released him into his mother’s care. As a seasoned medical professional, who may be unaware of the family dynamics, we often feel our judgment is right, particularly when a child with special needs is involved. This year, Michal will celebrate his 17th birthday. I can only admire this super mom who gives all her time and energy to taking care of this youngster. Had Michael been placed in an institution and deprived of his mother’s care, he might not have lived for 17 years.

Sometimes, only mother knows best.

Carry me Safely Downstream by Andy John King Campus Pastor, Lindsay Lane East

When I was in college, my friends and I traveled to Tennessee for a weekend white water rafting trip. While I do enjoy white water rafting, I’m not much of a risk taker or an adventure seeker. Truth be told, I usually err on the side of caution, so when the river guide gave us the safety speech, I made sure to pay attention. During that speech, the guide told us that if a rapid tossed us over the side and we found ourselves under the raft and in the water to “SWIM ONE WAY”. The reason for this instruction is due to the feeling of panic. Panic would send a swimmer in that situation in all kinds of directions seeking a way out, but it would ultimately delay escape to safety. Wouldn’t you know it, half way down the river, a rapid tossed a few of us out of the raft and into the water; and when my head came to the surface of the water, the raft was on top of me. Quickly I remembered, “Swim One Way”. I began to swim like a gold medalist in a single direction and within seconds the rapids sucked me up from beneath the water and carried me safely downstream to where I shortly joined my group again. I can still remember those few seconds… sheer panic. In that brief moment, I had a choice between feeling or faith. Everything within me wanted to absolutely freak out, fall apart, and

move at random for anything that felt right; but faith said to trust the guide. Not only was the guide a knowledgeable expert, but the guide had our best interest in mind. He knew the ride would have its struggles, unexpected circumstances, and even possible falls, but he also knew how to get us to the end. I didn’t understand all of the guide’s advice and perspective, but he did and when compared to my knowledge and perspective, I chose to trust the guide. Hopefully the point is becoming clear by now. Ours is the choice to trust our feelings or to trust the Guide. In Proverbs 4:23, the Bible instructs man “guard your heart above all else, for it determines the course of your life”. This is warning towards living according to how we feel. Living by feeling is limited and does not keep perspective, leaving one to swim in circles within the here and now. Proverbs 3:5-6 suggests that we trust the Guide: “Trust in the Lord with all your heart; do not depend on your own understanding. Seek His will in all you do and He will show you which path to take.” Though living by faith can be difficult, it is dependable because the object of our faith – Jesus – is our dependable, experienced, knowledgeable, compassionate, all powerful, eternal guide.

He Cares For You

Early one morning, I decided to stop at a store to pick up a few items. While walking in the parking lot, I noticed a little sparrow on the ground attempting to fly but could not. One of its feet was stuck on a piece of sticky candy. After putting my items in the car, I bent over and gently pulled its leg free. In an instant, the sparrow took to flight and disappeared. Many of us will face challenges as we go through life with illnesses such as Cancer, Diabetes, Hypertension etc. Don’t allow fear or doubt to cripple you. Like the sparrow, never give up. Go forward each day on the wings of faith. Jesus has invited you to “cast all of your cares on Him because He cares for you” 1 Peter 5:7. There is nothing too hard for God. The prophet Nahum reminds us that “the Lord is good, a refuge in times of trouble” Na 1:7. Even when we cannot see Gods hand we can trust His heart. –Myrna Brandon

married to medicine

by Lisa Layton

I have a confession to make. Twenty six years ago, I fell in love with a married man. I fell in love with an orthopaedic resident who was married to his job. As a young wife, I had all of the hopes and dreams of any newlywed. In all reality, I was in a mostly one person marriage, and strangely, I could not have been happier. I got to see first-hand how my husband was living his dream; he was utilizing his gift. His hands were becoming tools that would serve his patients. Many people don’t realize that as medical residents, being the perfect doctor for their patients is priority; the marriage is not. That is the beauty and the beast of this occupation. It is the ‘for better and for worse’ of being married to medicine. We have two children who learned to be night owls, waiting to see their dad for just a little bit. My 16 year old son recently remembered his kindergarten teacher lending her son to be his stand-in dad on Daddy Donut Day, since his real dad was not able to attend. He said he cried and was scarred for life, or at least until recess came! While the early days could be a struggle, hearing the story of a patient whose painful quality of life was improved, or of an athlete who got a scholarship due to a full recovery from a successful surgery, made the hard days worth it. Those experiences show us there are purposes in our struggles. The rewards outweigh the sacrifices. I realize now that medicine is not a job my husband does. It is a job we both do every day. It takes 100% of everything I have to be a wife, mom and occasionally, to be a dad too. Other times that 100% is simply the effort to smile through exhaustion; but isn’t that life in general? Isn’t that all God asks of each of us every day? Some days we can give more, but every day we are to give all we have in order to finish the race. As doctors’ spouses, we may feel like our identity disappears behind the shadow of their white coat and scrubs, but to see a patient smile and tell you their story makes those of us married to medicine know it was worth it. Think about that favorite doctor of yours and know that you are not just a patient…you too are part of this journey.

by Wanda Mullins I played hooky from school today. Never in my life have I asked off for a personal da y that was free of an appointment or "reason". The Lord planted this idea in my head to get a substitute for my class two days ago. I was perplexed because I N E V E R ask off. It is like, God would have to give me a brain tumor to take time away from my classroom! I think it a "control issue" i f you ask me .. Well, I was super giddy as I made M Y plans to fill this day. I thought of the places I would go .. the people I could meet ... As quick as I made M Y plans, the Lord erased them, and He gave this sweet word to me -"ABIDE" - I f you are like me ... It is hard to sit still and abide ... especially when there are things to do and places to go! Another word he gave me during the day was "ANTICIPATE" .... as i f to sit on the edge of my seat and await what the Lord is going to say or do next! M y day was filled with an overflowing o f Himself. The sweet pleasures o f the day included a leisurely cup o f coffee and quiet time! It included making a hot breakfast for two high schoolers before they took off to school, clean sheets, a scrubbed out refrigerator, cleaned carpets, finished the last chapter of a book, crock pot full, swept off porch. This day also included the tossing o f two dried out and crispy mums (yes ... from autumn) and a changing o f the Valentine flag out front! Hey, don't judge! Life comes at us all fast .. .I was struck by the beauty of the Lord as he put a bow on the last few minutes of my alone time! I was reading from a book called 'Wonderstruck" by Margret Feinberg when I came across this sentence. ''1he abundant life begins here on earth as we choose to align our whole selves with God and continues as we abide with God forever." There was that word ... ABIDE. It is a choice to align ourselves with His agenda.Personally, I loved this alignment toda y ! So, from now on ... when the Lord tells me to play hooky from school... I am all over it! Good thing only my dog witnessed the spontaneous, shadow shenanigans on the front porch! Abiding means listening, aligning and anticipating His work in our lives!

All that and yoga pants, Me

Wanda Mullins was diagnosed in 2013 with Acoustic Neuromas, which are benign slow-growing tumors in the brain. She has had a long but blessed journey through the diagnosis, surgery, a n d continued recovery of her condition. More information regarding her testimony and journey can be found at www.undertherainbow.com

Finding Grace

by Elisa Brooks

It is no news that we live in a driven society. In all facets of life, the culture around us typically asks some more of every single one of us...more time, more exercise, more money, more success, and the list could go on and on. In reality, we only have a finite amount to give. At some point, all of these things have a limit! When we are tugged and pulled on, asked of, and pressed to do, give, say, BE more…we often over commit and end up exhausted. Or, we could even say “no” and still feel so frustrated and guilty for not doing something when we are asked. Today, I want to remind you about GRACE. It is time for you to remember to extend it to yourself. Create the space for you. What is grace? It is undeserved favor, kindness. Give yourself permission to say no, to sit with your cup of coffee for an extra five minutes, and take some deep breaths. Look at your calendar and keep an evening free from “stuff ”. Extend this grace to yourself and you’ll find it easier to extend it to others. In fact, you will find immeasurable grace when you take the time to get to know the Source of true grace. “We have seen his ( Jesus’) glory, the glory of the One and Only, who came from the Father, full of grace and truth.” John 1:14. What Jesus has, He readily offers to us. Even during the times when we least deserve grace, God extends it to us. Day by day, hour by hour, minute by minute, HE gives us grace. Soak that up for a bit and you’ll find you are able to be more kind to yourself and be willing to offer grace to others. So, instead of allowing the pressure of all that is asked of you to sit on your shoulders, take it back! You are only human and all you can do is all you can do. Revel in it. Be who you are and who God asks you to be. Say no to the things that are not necessary and find the things that truly belong. Let others do the same. Find grace in everyday and in the Giver of Grace and you will be well on your way to finding true JOY.

we learn from suffering WINSTONÂ T. CAPE L , M. D . , MB A , F A C S , F A A N S

As humans we all share common life experiences. Universal to life for all of us are: physical suffering, disease and death. There are no exemptions or immunization from these but there is much variation as to what kind and how severe our suffering and afflictions will be. It is natural to ask why this suffering takes place. I believe the Gospel of Jesus Christ does provide many of the answers to the “why” we suffer. When we view suffering through a spiritual lens our spiritual growth can increase in higher and holier ways. This growth is one of the fundamental purposes of life on earth. We all have an intrinsic spiritual need to see a divine design to life and its experiences. We know from the scriptures that Christ suffered pain, temptation and afflictions of every kind while on earth (see Hebrews 2: 17-18). It is by His own deep and very personal experience suffering “all things in the flesh” that he knows how to “succor” us perfectly. I have observed from my experiences as a neurosurgeon dealing with some of the most catastrophic diseases and injuries known to man that the Lord is involved in the details of our lives. He stands with open arms desiring to bless those who suffer and those who assist him in the care of those that suffer disease and afflictions experienced by all. In my opinion, much is learned by those who suffer and those that care them that suffer. This learning prepares us for life with the Savior for all eternity. Anything that we suffer or experience in this life that better prepares us for life without end with Him is of unfathomable value. In my opinion there are at least 5 things we learn from pain, disease and physical affliction. In the curriculum of this life, designed to prepare us for life with Him, these experiences are not meant to be Torture 101 but Discipleship 600 series. We are all involved in upper level course work in discipleship as we humbly and faithfully submit to these experiences as followers of Christ.

University of Washington’s Institute for Health Metric and Evaluation (IHME) observed: “Despite the fact that people around the world are living longer, they are also expected to spend more time suffering from diseases and other conditions.”

What We Learn from Physical Disease, Affliction and Suffering 1. We cannot cope with nor can these conditions be treated

without His help. This reliance upon Him increases our faith and trust in him in ways that only these experiences can. This increase in Faith has eternal value and consequences. This increased Faith will fortify us for future experiences. Faith is the first principle of the Gospel of Jesus Christ.

2. Our

suffering creates empathy for those who suffer around us. Empathy is earned from experience, like all elements of discipleship it is portable and is to be applied. Our application of these elements is essential as we strive to assist the Lord in the care of His children. Empathy assists us in our striving to have charity which the scriptures define as the “pure love of Christ.” Without the experience of our own personal suffering or the experienced gained when we serve those who suffer it is very difficult to have this Christ like understanding of those who suffer. Those who suffer understand those who suffer like we understand language dialects. There is a dialect of those that suffer. Our challenge is to learn this dialect (the language of suffering) so we can notice, understand and strengthen those whose hands hang low from disease and affliction. (see Hebrews 12:12) 3. Because we suffer we have a greater appreciation of the physical, emotional and spiritual suffering of Christ. Although we suffer microscopically compared to his exponential suffering it is designed to give us a reverential appreciation of His suffering for us. He suffered to redeem us (from physical death through the resurrection and from spiritual death caused by sin making repentance and thus forgiveness possible). A second reason for his suffering is the added experience of learning first hand by his sufferings, how to succor (aid and assist us) even in his perfection. He too learned from the things he experienced while on the earth even while being perfect (see Luke 2:40). He was tutored by the Father in all things (see John 5:19). It is by His grace that he helps us in ways that only he can. 4. We know that all mankind will be resurrected (see 1 Corinthians 15:22). These resurrected bodies will no longer be subject to pain, disease and death. So for the eternities we will enjoy a body without pain, disease and death. What an unimaginable blessing, a gift from God. Our appreciation of this eternal state would be impossible had we not suffered in this life. 5. For those who worry and care for those afflicted with disease there is an invitation from the Lord to be “instruments of grace.” When we are serving our fellowman we are serving Him. (see Matt 25:35-36,40). We draw closer to Him as we do what he would do if he were physically present. His life was spent in the process of healing and comforting the afflicted. Grace is divine help or strength, given through the bounteous mercy and love of Jesus Christ. Through faith in Christ we receive strength to endure and grow in His desired ways through His Grace. Grace is an enabling power to receive strength and assistance in the empathetic service to the afflicted that we otherwise would not be able to do or sustain if left to our own means. This grace also helps us in infinite ways, the majority of the help is unseen and unrecognized. We would be overwhelmed if we could see the help and assistance that comes from the Lord through his grace. It is our privilege and opportunity to assist him by faithfully enduring affliction and serving the afflicted as he did for us. Our greatest expression of our adoration for Him is our emulation of Him.

The Power of Prayer John and Cara Greco are both physicians in Huntsville. Dr. John Greco is a Sports Orthopedist with TOC and Dr. Cara Greco is an anesthesiologist at the Surgery Center Huntsville.

by Dr. Cara Greco

“Mommy, don’t worry. I’m going to be OK.”

Development Hebrews 5:12 says, “You have been believers so long now that you ought to be teaching others. Instead, you need someone to teach you again the basic things about God’s word. You are like babies who need milk and cannot eat solid food.” The author here in Hebrews is speaking to followers of Jesus and it doesn’t take a scholar to see the main idea: Christians ought to experience development until they are able to teach others what they believe. When my son first began to play baseball, I volunteered to help coach. Because of this, I was required to attend a little league baseball-coaching clinic prior to the beginning of the season. The instructor at this clinic was very knowledgeable and did a super job teaching the fundamentals of baseball. He spent two hours covering the basics of the game so many of us grew up playing. Do you know what new knowledge I left with by attending this little league baseball workshop? Absolutely None. I didn’t learn a single new thing. Why? Like many who grew up playing baseball, I’ve known the fundamentals for most of my life. And not only have I known the fundamentals, but I’ve had the opportunity to put them into practice and even help others to understand the game. Christians, your church leaders are waiting on your maturity so that more people can experience discipleship. Our churches are full of long time believers who have yet to teach, serve, and lead because they would rather sit under the teaching of the basics they’ve heard over and over again. It’s time to experience development! Spiritual life doesn’t end with a decision or baptism. That’s when our development begins and the discipleship of others depends upon it. Think with me: Can you imagine coaching a varsity baseball team and having to teach every player at every practice the basics of the game they desire to play? In a word: Frustrating. You could never field a team to actually play, because they only experience the knowledge of the basics over and over instead of development. Hear God’s Word: “You have been believers so long now that you ought to be teaching others.” Enough of the milk! People cannot benefit from immaturity. (And by the way, an unwillingness to step out faith towards discipleship or leadership is immaturity). Practice obedience, actually learn what you believe, surrender your will to the Lord, and for goodness sakes be willing to share your faith so that it will benefit someone else! Andy John King Campus Pastor Lindsay Lane East

[ Her condition does not make her ambitious; she makes herself ambitious.

Then, the idea to share our interview as a Q&A with fabulous graphics and a collage of pictures seemed appropriate. I could envision the layout perfectly. I knew her parents would be proud, the local community would enjoy the information and Sarah’s story could be read. But really, I would be taking away the beauty of what Sarah shared. The opportunity that I now feel humbled and called by God to share His love for His children through this ministry has me writing as I feel led to do. I was well-prepared for my conversation with Sarah. I had studied her portfolio, read the articles submitted in other publications and interviewed her father. Yet, nothing had me prepared for what I discovered. The mind and heart of Sarah Switzer went

by Kelly Reese While sharing my passion for advocating the Tennessee Valley’s medical resources with Jeff Hamilton, CEO of The Orthopaedic Center (TOC), we both agreed our community was full of testimonies. With excitement, he began to share a story of a girl who had accomplished so much in her lifetime. He described her journey as a “True Inspiration.”

On Sunday January 15th, 2017, I had the opportunity to interview Sarah Switzer. I hope one day soon to introduce her as “the world known Sarah Switzer” of the suburban area right here in Madison, AL. The unveiled story of Sarah’s accomplishments throughout her 17 years of life integrate patterns of an area I feel compelled to share. Initially, I wrote a story highlighting the finest points of Sarah’s life, from the history of her loving parents, to the buildup of her diagnosis, to the all exclusive tales of Sarah’s life today and her future goals. This story too would have been great.

true inspiration

much deeper than a diagnosis or a condition she would live out the rest of her life. She is truly embracing it. Sarah’s parents learned 18 weeks into their pregnancy that she would be born to the only life she would know as a human with a condition known as Spina Bifida. We are all human and our differences and unique patterns help mold us into what we become. In Sarah’s case, she was lucky to have had two parents who loved her very much and considered all obstacles as their own blessings. Sarah’s mother, Trish, underwent a risky surgery, only having been performed 50 times, in order to give their daughter the best chances for success and a better quality of life. Having been seen by several specialists, Mike and Trish entered into this world a baby they would call ‘Sarah’ who was considered “born again” since her first surgical procedure was performed through an open incision to her mother’s uterus, months before she arrived. Born twice at 4lbs. 6oz., Sarah celebrates her birthday August 22, 1999, a date 9 weeks earlier than expected. My curiosity peaked as I began to learn more about Sarah and less about her story. She was well spoken with confidence and responded to my many interruptions and direct questions as they continued to layout her almost perfect puzzle, a vision that clearly displays God’s gift in her. Before our interview, she was all the things I plan to share; but more than that, she is human. Her condition does not make her ambitious; she makes herself ambitious. Her sacrifice and work ethic come from a deeper embedded meaning within

At the US Nationals in October 2016, Sarah Switzer was selected as one of 13 athletes to represent the United States at the World Disabled Water Ski Championships in Myuna Bay, Australia.

Additional opportunities for disAbled athletes in our community... UAH Ability Sports Network UAH ASN is an adapted youth sport league focusing on Paralympic sports and intended for middle and high school students with physical function limitations. To learn more about ASN, visit: www.uah.edu/asn www.facebook.com/uahasn/

herself than one would know without asking the questions or taking the time to learn about Sarah. Born to her father’s career which supported our country’s freedom and bared all the responsibilities a Major of the US Army would carry. The Switzers, through many relocations, experienced many cool attractions while living in various places. Sarah described a childhood no different from what I remembered myself. She encountered obstacles that truly affect more children than parents are aware, being exposed to criticism by her peers who were uneducated themselves of Spina Bifida, a condition that left Sarah dependent on bracing in order to stand due to weakness in her legs. If an activity required standing for a long length of time or walking a distance was involved, she was dependent of her wheel chair. Diagnosed in utero with Spina Bifida, Sarah had undergone 3 surgeries: 1 in utero; 1 detethering; 1 successful ankle surgery (performed right here in Huntsville, AL by Dr. Buckley at TOC). With childhood memories of annual evaluations that included X-rays to monitor Sarah’s growth plates and scoliosis- a condition not uncommon for patients with Spina Bifida-, she balanced an active list of achievements, both physically and academically. At the age of seven, she was approached by a ski instructor who introduced her and her family to the idea of water skiing for the disabled, a nationally recognized sport. Naturally, her love for the water had her committed right away. Her mother’s initial response had hesitation to the idea of enlisting her in such an extreme sport. However, she ended up being her biggest cheerleader. By 2011, Sarah had begun her training in the water sport division for the disabled. By 2014, she was competing at the sport that included ski ramps as tall as 5ft with 90ft distant jumps. WOW, I replied. You are paraplegic, and you can do things that I cannot imagine overcoming the fear to try. I want to include a tag pulled from her Facebook page, when announcing this athlete with Spina Bifida, she is the youngest of 13 selected to compete in the World Championship taking place in Australia. I’m honored, humbled even, to introduce you to the youngest member of our 5-PEAT US DisAbled Water Ski TEAM, Ms. Sarah Switzer. I remember seeing her in Life Magazine in 1999 and being awed at the site of her. I asked her to send me some non skiing photos ... I was overwhelmed when I received them. Is it any surprise her hero is God? Talk about an Overcomer! WOW, WOW, WOW. And by the way ... notice her muscles and her grip ... this girl was made to be a World Champion Water Skier. This 2-week trip would include the mental and physical training of climate change, a drastic shift from training in fresh water to the buoyancy difference in Salt water, where the competition will take place. The preparation includes dry land training as well as salt water training. Sarah describes skiing as a competition against one’s own goals. It is unlike the wheel chair basketball league she competes with, where she focuses on team strategies.

Skiing is a process of achieving your own goals. Even though Sarah describes herself as a perfectionist, this has allowed her to be even more successful. The ability to see herself visually creates an awareness for her to develop change, allowing her to outperform her competitor’s, making her the youngest Champion to attend a prestigious event like Worlds. Her solo-performance at this event still involves contributors for her success. Sarah’s life goals are deeply embedded and influenced by the mentors she surrounds herself with. Sarah described how her mother has been there to support all of her dreams. Caring in-state, outof-state for training and competition, fueling her every step of the way and making sure she had all the tools she needed for success. Emotionally preparing Sarah for life’s friendships and failures. The moments that most often break a spirit had been moments her mother has used to strengthen Sarah’s heart. Trish made known the importance of understanding no one was made perfect, but Christ. Through Faith in Him, she would find a peace in what she was called to do. Sarah’s dad, Mike, has always given the advice Sarah needed to guide her future. She said through his experiences she understood the importance of the life lessons she was brought through. At such a young state in her adulthood, Mike and Trish have prepared their child for success, with the confidence to achieve her goals and the discernment to know what gives glory to God. Mike and Trish prepared Sarah for a future that would include her academic studies. Sarah’s college education had always been a primary focus in her life. She’s always had plans to attend college after high school. Although my list of personal questions during my conversation with her had not been disclosed prior to us talking, her preparation for challenging questions had an affirmative tone. With no hesitation, Sarah’s plans had been well thought out and planned. She hopes to attend The University of Alabama or Auburn University (“Roll Tide” when asked if she had a Fan Favorite) with a primary focus on the medical field. She could see herself as a veterinarian or even a psychologist with an interest in nature. With her involvement with the high school French Club, her undergrad had easily been narrowed down to foreign language studies. Until her busy schedule had her unable to stay committed to an active involvement, Sarah says she enjoyed her role in her school’s French Club. Her motivation comes from wanting to make her family proud. “I’ve always wanted to live up to what I see through them: never give up, always work your hardest, always work for God, and never worry about what people think.” One of her last statements before we finished her interview, “I

love helping people. If I could share my story to help someone else, my goals would be accomplished.” I do not believe that Sarah’s intent was more than an opportunity to help other disabled individuals to succeed, dream and accomplish their goals, as she has a proven track record for achieving. That goal alone would be inspiring, but Sarah’s story is way more than that. She has helped me realize the story had not yet been revealed of a young adult whose Faith supported her values. Her accomplishments could inspire anyone through any faucet. She was truly a miracle for more reasons than a diagnosis, and had she seen this yet beyond her parents, coaches and teacher’s eyes. Had a stranger like myself not yet peeled back her story past the medical phenomenon that her goals had well exceeded her limitations, but the heart and soul of this individual would open her doors to so many opportunities. Ones I pray my children can have. I tell you Sarah Switzer will one day be much more than a resident of our community that we are lucky to have. She will be much more than just that, because she already is. It wasn’t hard to learn Sarah’s story could be one of those people who respond to as, “Wish I could be that way…. BUT.” Given the opportunity, most people would say they couldn’t imagine their life different from what it is; so the ability to think of their response to this situation is something they could not develop. However, for Sarah, she knows nothing else, and for that, she has made the very best of her circumstances. Sarah by definition may have a handicap; but if you ask me, she allows me to see the crutch in all of us as humans. We wear this brace around our mental state that controls our physical mind. But in most of our case and unlike Sarah, this handicap comes without a definitive diagnosis. This mental state of restriction hinders us from making the most out of our circumstances and giving thanks to our blessings. We uncomfortably but almost naturally feel compelled to wrestle with the “I can’t” or “I don’t know how” more often than those who truly have a disadvantage. Sarah sets the bar high, higher than that of which we set for ourselves. She allows her mental state and the influence of her loving parents to operate her physical response, which emulates a determined and motivated inspiration for all people to be more like her, able to achieve her goals. Without limiting herself by what is unfortunate to some is truly a blessing. Without her disability, how would anyone see her reaction as glorifying to God? She allows a vision to live within her, to believe she can do all things through Christ who strengthens me. Philippians 4:13. This life is only but a small fraction of a large picture God has planned for His children.

A Diabetes story Through Faith and trust, KATHERINE jONES found her new normal

by Lisa Layton

Imagine being a parent of a seven and a half month old baby who, until now, had been a normal, happy, healthy baby. We would all count our blessings for that, but now imagine ev-erything changed in what seemed like an instant. Your baby becomes fussy and eating habits change, as most do when babies are possibly coming down with something. Eventually these symptoms turn into soaked diapers, labored breathing, low grade fever, throwing up and weight loss. As a parent, you would know something was terribly wrong, but as the parent of an infant, type 1 diabetes would not likely cross your mind as something you were facing. This was the story for Katherine Jones’ parents. At seven and a half months old, Katherine became the youngest baby in Huntsville to ever be diagnosed with type 1 diabetes. Seventeen years later and starting her senior year of high school, Katherine is a beautiful, energetic and active young lady full of life and spirit and has been living with type 1 diabetes since before she can remember. She knows no way of life other than one of hospi-talizations, needles, blood checks, constant monitoring and at times excruciating headaches that affect her ability to carry on normal activities of other of girls her age. According to the Mayo Clinic, many of the approximately 15,000 children a year who are diagnosed with type 1 diabetes, show classic symptoms of extreme thirst and hunger, frequent urination, behavioral changes, weight loss and fatigue, to name a few. Infants experience these symptoms, but obviously, with their limited communication, oftentimes the severity of their symptoms may go unnoticed or just present as a virus that needs to “run its course”. It becomes a guessing game for parents and doctors alike until the proper urinalysis and blood tests are performed. Once these labs are completed, a definitive diagnosis can be made within an hour and at that time, urgent treatment becomes vital. When Katherine was diagnosed, she spent 3 nights in the Pediatric Intensive Care Unit and 2 nights on the Pediatric Floor, both at Huntsville Hospital. When the time came for her to be released from the hospital, her mom Kristy was nervous about taking her home. “I remember taking her home and I was scared to death literally to walk in the door; worse than having a newborn for the first time. I really have to keep her alive now and I don’t know what I am doing, “ Kristy said. She described the first night home as feeling like she was being thrown into the deep end of a pool with no life preserver or swim lessons. They were not just counting carbs, they were “chasing numbers” trying to provide her nutrition and keep her blood sugar at a safe level. They did all this while trying to maintain

a normal environment for their three year old toddler son as well. Less than 1% of all children diagnosed with type 1 diabetes are diagnosed in the first year of life, and if current trends continue, the incidence of type 1 diabetes in the pediatric population will have increased by 23% by the year 2050 as stated by the CDC. Soon after beginning their “new normal” as parents of an infant with diabetes, Raymond, Katherine’s dad, walked in with bags of medicine from Medical Arts Pharmacy. Kristy said she had no idea what to do with all of the medicine, even though the family spent an extra day in the hospital just learning about Katherine’s care, which involved mixing two different kinds of insulin. Raymond and Kristy practiced giving each other saline shots so they would be ready when the time came to administer the real insulin to their baby multiple times a day. After several months, however, they realized they needed to make a change and inquired about a more suitable medical regimen for Katherine. At fifteen months, Katherine became the youngest baby in the state of Alabama to be placed on an insulin pump. An insulin pump is a small device about the size of a cell phone that administers “rapid acting” insulin. It has an internal computer that is controlled by a screen with buttons. This device pushes insulin into your body through a thin plastic tube. Kristy said she had little velcro pockets to attach the device to Katherine’s onesies. The new method of treatment lessened the need for multiple shots a day. Kristy said it was a more convenient and accurate way to maintain Katherine’s blood sugar at a healthy level. Additionally, it was a better way to manage her diabetes as she grew, completed pre-school and started kindergarten. As many parents were sending their children to kindergarten for the first day, waving goodbye, Kristy found herself spending hours with the school nurse reviewing details about how to safely care for her daughter. Sending Katherine to school full time was as much about fear and trust as it was about the nostalgia of sending her to school for the first time. Katherine said she started caring for herself around six or seven years old. It was then that she temporarily discontinued use of the pump and went back to her routine of insulin shots. After some time, she began using what is known as the Omnipod System. It is a small lightweight tubeless pump that is wireless and is controlled by a “bluetooth like” device that tests her blood sugar and communicates with a pod which contains approximately three days worth of insulin. The pod is attached to either an arm, a leg or the abdomen. Once the hand held device interacts wirelessly with the pod, a proper amount of insulin is released in the body. This system is what Katherine uses today and it allows her to swim, shower, and carry out her daily activities with minimal inconvenience. Despite the added advantage this new technology has provided Katherine, the hope for a cure is still something that weighs heavily on her. While there is still no cure in sight, Katherine has participated in HudsonAlpha’s DNA mapping in order to better understand the mutation that results in early onset diabetes. The mapping also studies the correlation between headaches and diabetes that at times rob her of some quality of life. She does this in hopes to one day get some answers that will

be useful in finding a cure. In the meantime, as her mom says, “she’s still got to get up everyday and live every moment doing what she has to do to stay alive.” Katherine is now starting to plan the next major step in life as she looks at colleges. This is an exciting time, however Kristy still has a hard time thinking about it. “Being a good parent requires knowing when to push and when to back off, when to help and when to let them make mistakes and then being strong enough to watch them go”. This is something the Jones family will face when sending Katherine to college. Her life has been a preparation for the day when she is totally self-sufficient and her work with HudsonAlpha hopefully will help make the transition to total independence an easier one. Being a normal teenager requires much more of Katherine than many of her peers. Good health is often taken for granted, but she can never take it for granted. She is very thankful for her good days and battles through the not so good days. Sometimes when a child is diagnosed with a medical problem, especially one that has no cure, a portion of their innocence is taken. To get through life requires a huge amount of trust and faith to walk a path one would never choose. Kristy says out of their family, if anyone could handle something like this, Katherine is the one with the strength to do it. The Jones’ do not understand why God chose them to carry this, but their faith assures them that one day they will know and understand the answer, and by that time, it’s fairly certain Katherine will have found a way to make a difference in someone’s life. Little does she know, she already has.

The FUTURE OF TYPE 1 DIABETES JDRF’s Promising Research Progression by Jennifer Grady Jeffers Development Coordinator for JDR

If you live with type 1diabetes (T1D), you spend a lot of time thinking about your blood-sugar levels now and worrying about the complications that T1D may one day bring. You don’t want anyone else you love to ever know the physical, emotional and financial toll this disease takes. You want a cure. So does JDRF. And we are committed to funding the development of new therapies and treatments to keep people with T1D healthier, longer, until that cure is found. That’s why we invest in multiple therapeutic approaches to cure, prevent and treat T1D. We identify and invest in promising therapies in their early stages, helping researchers pursue innovative ideas and approaches. This investment strategy ensures that the most life-changing breakthroughs can make it through the long research, development and delivery process and get to people living with T1D sooner. Currently, managing T1D is a never-ending, difficult chore because the body often defies even the most vigilant efforts to keep blood sugar normal levels. As a result, even sleep can be anxiety filled for people with T1D, because that’s often when dangerous low blood sugar episodes occur. Sim-ply enjoying a slice of pizza can require significant insulin dose planning in order to avoid high sugar and the resulting risk of serious diabetic complications. JDRF wants to remove the constant worries and burdens placed on T1D’s. Currently, JDRF is involved with over 50 clinical trials world-wide, some of which are already greatly impacting the way a T1D lives. Let me share with you how we are already positively changing the management of the disease, our plan to prevent or reverse

its impacts and finally, our path to finding a cure. Our Glucose Control and Artificial Pancreas (AP) pro-grams tackle blood-glucose control head on. Managing insulin alone won’t achieve perfect control. So we’re investigating how managing other hormones or repurposing drugs approved for other uses can work with insulin to improve control. Arti-ficial pancreas technology will improve control by automating blood-glucose sensing and insulin delivery. Tighter control re-duces complications and eliminates the need to think about blood-sugar levels, insulin dosing and carbohydrate counting. In addition, the FDA has already approved the first generation of the AP and will be available to patients sometime in April of 2017. This was a huge milestone in our efforts and gives our donors proof their dollars are making a difference. Beta cell encapsulation therapy holds the promise of eliminating the need for daily insulin treatment for up to 24 months through a small implant. The researchers and partners we support through our Beta Cell Replacement Program are testing multiple efforts to perfect cell replacement therapies, including the development of materials to protect the cells and discovery of new replacement cell sources. We think for people with T1D who are on duty all day every day just to stay alive, encapsulation will sure feel like a cure. We refuse to accept the idea that people with T1D must live in fear of life-threatening diabetic complications. Our Complications Program seeks to better understand how diabetic kidney and eye diseases start so we can stop them in their tracks. Of course, the best way to ward off complica-tions is to protect people from the disease entirely.

Our Prevention Program’s primary goal is to develop a universal childhood vaccine that prevents the autoimmune attack on insulin-producing cells. As we work toward that goal, we’re also pursuing secondary prevention therapies that will prevent people from becoming dependent on insu-lin therapy once T1D is diagnosed. Our Restoration Program is attempting to do something that has never been done before—prevent, halt or reverse an autoimmune disease and return normal function of the beta cells. For more than a decade, JDRF has funded studies to un-ravel the mysteries of T1D and develop therapeutic interven-tions to bring the body back to normal after the disease strikes. Each one has added to our understanding of what’s necessary to stop the immune system from destroying insulin-producing islets cells, keep these cells healthy and functional, and restore the body’s normal ability to produce insulin. In addition, JDRF offers a match program, Clinical Trial Con-nection, which helps both T1D’s and T2D’s be paired with spe-cific research. By participating you not only are helping yourself, but you are also contributing to the studies being done to curing, preventing and treating the disease. You have the opportunity to not only help save your life, but save the lives of others! There is no charge to participate and some studies offer financial assis-tance with your diabetic-related expenses. We know it won’t be easy. It will take time and require a significant financial investment. But we want it all: a biological cure for T1D, transformational treatments that improve lives now and prevention so that future generations never know T1D.

RED-5397 InsideMedicine_Hudson_Alpha_Ad_v2.indd 1

3/2/2017 9:24:54 AM

Pediatric

Endocrinology A physician’s homecoming benefits children with diabetes by Steve Doyle

Guntersville native Linnea Larson-Williams, MD, has returned to North Alabama to practice medicine, and that’s a very good thing for families raising children with diabetes in our community.

Last August, Dr. Larson-Williams opened Huntsville Hospital Pediatric Endocrinology, the area’s only medical practice for children with Type 1 and Type 2 diabetes, abnormal thyroid or adrenal glands, and other endocrine system problems. Her arrival means local children with diabetes and their parents will no longer have to travel 180 miles round trip to Birmingham or Nashville to see a pediatric endocrinologist. Melissa Nevitt’s 10-year-old daughter, Ainsley Faith, is one of those young patients. When the family moved to Huntsville in 2016, they were disappointed by the absence of pediatric endocrinologists. They seriously considered driving back and forth to Mobile for care before finding a childhood diabetes specialist at Children’s Hospital in Birmingham. When Dr. Larson-Williams came to Huntsville, they were relieved to have a local specialist. “Having Dr. Larson-Williams nearby is going to be great for kids with diabetes in North Alabama,” Nevitt said. “And there are a lot of them.” Dr. Larson-Williams, who graduated from UAB School of Medicine and completed her residency training in Birmingham, said she is thrilled to bring pediatric endocrinology to the Rocket City. “It’s going to be much more convenient for families,” she said. “People will no longer have to drive to UAB or Vanderbilt for quality care.” Type 1 diabetes is an autoimmune disease that causes the pancreas to stop producing insulin, a hormone that allows people to convert food into energy. It usually strikes suddenly in childhood or adolescence, and those who have it must take synthetic insulin through daily injections or infused through a pump. In Type 2 diabetes, the body does not use insulin properly – a condition known as insulin resistance. Over time, the pancreas can’t produce enough insulin to keep blood glucose levels normal. This type of diabetes is treated with lifestyle changes, oral medications and insulin. Dr. Larson-Williams will care

for children with both Type 1 and Type 2 diabetes. The Juvenile Diabetes Research Foundation estimates 200,000 young people in the U.S. are living with Type 1 diabetes. Failure to properly manage the disease can lead to a slew of complications including kidney failure, blindness, nerve damage, heart attack and stroke. The daughter of a family physician from Marshall County, Dr. Larson-Williams completed a three-year pediatric endocrinology fellowship at UAB. Before moving back to North Alabama, she spent two years as an assistant professor of pediatrics at the Medical College of Georgia in Augusta. She is board certified in general pediatrics as well as pediatric endocrinology. “My husband and I have talked for a long time about coming back to North Alabama to raise our children, and we’re so grateful this opportunity came along,” said Dr. Larson-Williams. “Because I grew up in the area, I already have a vested interest in the community and in the health of its children.” Huntsville Hospital Pediatric Endocrinology 401 Lowell Drive, Suite 5 Huntsville, AL 35801 256-265-3250

Dr. Linnea Larson-William takes a stroll with 10-year-old Ainsley Faith Nevitt on the Huntsville Hospital campus.

Are you Being Diagnosed with the Wrong form of Diabetes? Adults Just as Susceptible to Develop T1D as a Child, Based on Recent Research Findings by Jennifer Jeffers

There appears to be a rising trend of the misdiagnosis of adult type 1 diabetics (T1D) not only across the U.S. but around the world. We are finding more and more stories of adults initially being diagnosed with type 2 simply because they are over the age of 30. As a matter of fact, we are now seeing cold-hard facts from researchers that T1D is no longer consider a child-based disease. Furthermore, research by the University of Exeter Medical School found that adults are as likely to develop type 1 diabetes as children, with more than 40 percent of T1D cases occurring after the age of 30.

Now, one might say they know what the term diabetes means, but many do not understand the varying forms. More accurately many do not understand the difference between T1D and T2D. For those not aware, T1D was previously referred to as “juvenile diabetes”. It is an autoimmune disease in which the body’s own immune system sees the beta cells within the pancreas (which produces insulin) as the enemy and begins to kill off these cells until they are all gone. The pancreas no longer has the ability to produce insulin, a vital function to breaking down the food we ingest. Eventually, all T1D’s become what many refer to as “Insulin Dependent” and will die without this hormone. When you have type one diabetes the treatment regimen consists of multiple shots given daily (MDI) or with an insulin pump. A T1D must also must check their blood sugar levels by pricking their finger at least 8 to 10 times a day or more in some cases. Furthermore, there are countless trips to the doctor for checkups and multiple visits to the ER for the common cold or stomach bug that the average person can manage without medical intervention. In addition, by law, children with T1D must have a parent, nurse or caretaker with them to attend all school related functions including field trips, club meetings or sporting activities. Lastly, on top of all this, diabetics must watch and count carbs for everything they ingest. Determining the appropriate insulin amounts consists of a mathematical equation that even the best at math have trouble figuring out – it is just complicated being a T1D. All of this complexity is the reason why it is such a growing concern that adults are being diagnosed with the wrong form of diabetes and it is becoming a common trend. An example of someone wrongly diagnosed, was Prime Minister Theresa May, who initially was told she had T2D based on the fact she was in her in mid-50’s. May was initially given oral medication and told to watch her diet. After some time and little response to her blood sugar levels, doctors finally realized they were treating for the wrong form of diabetes. May is just one of the hundreds if not thousands of adults being misdiagnosed and understandably so. Not only are there many misconceptions about the disease, but a lot of doctors have been taught via their textbooks that T1D is a disease found during childhood. Its lead author Richard Oram, at the University of Exeter, said: "Diabetes textbooks for doctors say that type 1 diabetes is a childhood illness. But our study shows that it is prevalent throughout life. These miss-teachings can have serious and sometimes fatal consequences”. This is why publications such as Inside Medicine, play an integral role in the dissemination of accurate, and in some cases, life-saving, information throughout our community. One of the other reasons, which is no fault to anyone, is that both disease’s share the majority of the same symptoms: headaches, nausea, vomiting, frequent urination, extreme

thirst, wounds heal slowly, blurry vision, sleepiness, etc… Actually, one might think weight loss is just associated with T1D but in some cases, T2D’s do lose weight as well. So as you can see, it is easy to get the two confused. It’s important to understand the symptoms but there are a few signs to look for when you have been recently diagnosed with T2D: • Consistent vomiting for over two hours • Sharp stomach pains or upset belly • Breathe smells like fruit • Easily get weak, tired, confused, or dizzy • Trouble breathing While we may feel that our doctors should have the answer to everything they aren’t mind-readers. It is imperative for you to pay attention to your blood sugar levels and report them back to your doctor if you notice that the medical plan you are on is not working. It is also important to make sure you are answering questions from your doctor thoroughly and honestly as well as asking your own questions. Here are a few key things to ask yourself and discuss with your doctor if you have recently been diagnosed with T2D and have any concerns: • You are somewhat thin; • You are following the management plan and it’s not working; • You are taking multiple medications and having to increase the dose; • You or another family member has other autoimmune diseases. It is important to note that I am not a medical professional but have worked with JDRF, the world’s

leader in diabetes research for close to 6 years and I am a type 2 diabetic myself, so I understand diabetes first-hand. I also have had several of our adult T1D’s recently mention that they were initially incorrectly diagnosed with T2D in which one almost lost their life. It was his story that prompted this article. If anything, use this information as a guide on what to look for and do your homework and hopefully, it may make you aware of something you might not have known about otherwise. More importantly, talk to your doctor. Don’t be afraid to question your own health provider. I can promise most doctors will be receptive if you do it in the right way. There is nothing wrong with you tak-ing charge of your own health to ensure accurate diagnosis of any ailment.

Paying attention to your own symptoms, it just might save your life! Lastly, to help answer all your diabetes questions, JDRF is hosting our annual Walk on April 21, 2018 at 9 AM hosted at/by Redstone Federal Credit Union on Wynn Drive. We will have a vast array of diabetic-related providers on hand to answer all of your questions, including Huntsville Hospital’s Diabetes Center. In addition, we will have great kid’s activities, live entertainment and free food/beverages. There is no charge to attend this event but you must register under a Walk team, create your own team or register as an individual to participate-walk.jdrf.org/northlababama! We hope to see you there!

Knowledge Sharing

Healthcare Resources Available to You and Your Family

Managing your health in today’s health care system can be exhausting, frustrating, and expensive. Luckily, help is available and we nurses want to make sure you know we are here for you! Your health care team is interested in the person you are as a whole, and not just as a diagnosis. Employment obligations, family responsibilities, mental health issues, and nutritional concerns all contribute to the particular needs of each individual. When you attend physician appointments, do not be afraid to share a change in economic status, living condition or even a new health concern. For example, your diabetic medicine may become too expensive, or you might change jobs, get divorced/married, and your insurance coverage may change. Informing the doctor of your concern facilitates an open conversation about the possibility of changing medications or patient resource programs that might be available to you. It is also recommended that you keep important information with you at all times: your insurance card, your primary doctor’s name, and a short list of medications you take- with dosages.

Huntsville Hospital Diabetes Control Center 420 Lowell Drive, Suite 500 Huntsville, Al 35801 256-265-3069

Below, are a few resources that are available from friendly, area nurses. • Call your doctor’s office and ask about programs or medication samples • Call United Way #211 • Call the Senior Center if over 55 or disabled • Call or email the manufacturer of the drug you take • Call your insurance company • See if your medication is on the free or 7.50 supply list at Wal-Mart or Publix • Check the program familywize.org to see how prices differ depending on where your prescriptions are filled

dO YOU REALLY KNOW ABOUT TYPE 1 DIABETES? by Jennifer Grady Jeffers

In my world with JDRF (formerly the Juvenile Diabetes Research Foundation), there is rarely a day that goes by that I don’t have to explain the difference between type 1 and type 2 diabetes. Many often confuse the two, which is very normal as they do have some similarities. However they are extremely different. Many believe that when a child is diagnosed with Type 1, it is brought on by being overweight or because their parent’s allow them to eat too much sugar, but that is just not the case. Let me explain:

Type 1 diabetes (T1D) is an autoimmune disease that cannot be prevented. It occurs when a person’s pancreas stops producing insulin, a hormone that enables people to get energy from food. People with T1D experience both dangerous high and low blood sugar levels and may have potential ties to genetic and environmental factors. T1D usually strikes in childhood, adolescence, or young adulthood and lasts a lifetime. Children and adults must balance blood sugar levels (BSL) consistently as well as take multiple injections of insulin daily or continually infuse insulin through a pump to just stay alive. Counting carbs and exercise are also critical T1D management. T1D comes with lifelong complications and battling something such as a common cold can sometimes be a challenge. Another misnomer is that children with T1D cannot have sweets. People with T1D can enjoy all types of food including sweets. However, like with everyone, moderation is key. The only difference is a person with T1D has to account for the amount insulin they take in to offset whatever they eat.

Type 2 diabetes (T2D) is tied to your metabolism

and genetic factors. A person’s body still produces insulin but is unable to use it effectively. T2D is usually diagnosed in adulthood. However, increased obesity has led to a recent rise in the cases of T2D in children and young adult. People with T2D do not always require insulin injections and in many cases, T2D can be prevented or delayed with diet and exercise. Those living with T2D also rarely experience the immediate dangers associated with low blood sugar levels but do have to combat high blood sugars that can have long term effects on the entire body. As someone with type 2 myself, I can attest to the continuous uphill battle with high sugar levels. I’m at the point that if I even look at a donut, my BSL is elevated. So I do my best to stay on top of it by following my Doctor’s instructions closely. This brings me to my last point; people with T2D also need a lower carb intake versus counting carbs, so limiting those wonderful yummy treats are a must! As you can see, there is a significant difference between the two. And to clarify, taking insulin does not cure any type of diabetes, nor does it prevent the possibility of the devastating effects of the disease including kidney failure, blindness, nerve damage, heart attack, stroke, and pregnancy complications. By understanding the two diseases, hopefully people will have better insight on the significant dangers caused by both. Specifically, the damaging effects T1D has on our young children and the burden they carry every day.

JDRF has a strong presence in Alabama with a Chapter office in Birmingham and a satellite office in the Huntsville area

Before 1970, a T1D diagnosis was basically a death sentence to most. This was the premise for JDRF, founded over 40 years ago by two mothers with children diagnosed with T1D.

............................................................ If you would like more information on free diabetes education for you, your child’s school, your business and/or organization, or would like more information on how you can visit walk.jdrf.org/northalabama. Please help us create a world without type one!

When children are initially diagnosed with T1D, they usually spend a minimum of 3 days in the hospital. Many end up spending multiple days in the ICU because their tiny bodies have gone into a life-threatening condition called diabetic keto-acidosis or more commonly referred to DKA. DKA is when the body is unable to get the sugar needed for energy due to the lack of insulin. This in laymen’s terms ultimately poisons the blood stream. Through my tenure with JDRF, I have seen hundreds of children and parents terrified by this diagnosis. It’s intimidating, overwhelming and once discharged, both parent and child carry the burden of basically becoming a medical profes-sional, a necessity to keep the child alive. The entire family is impacted. Those everyday simple tasks we all take for granted become not so simple anymore. The ease of running through the drive through to pick up dinner for your family on a busy night is just not that simple anymore. Everything that a child puts in their mouth has to be accounted for as it relates to carb counts. It then has to be entered into a long and arduous math problem for a minute amount of insulin. There are days when a child cannot participate in recess due to low BSL. Chil-dren with T1D cannot attend school-related activities such as fieldtrips, sports, etc… unless a R.N. or their parent/guardian is in attendance. Their lives become complicated and turned upside down. Before 1970, a T1D diagnosis was basically a death sentence to most. This was the premise for JDRF, founded over 40 years ago by two mothers with chil-dren diagnosed with T1D. JDRF has made tremendous strides and is on a very strategic mission to not only raise money for a cure for T1D, but also use re-search dollars to develop better treatments and possible prevention, to hope-fully relieve some of the burden the families are faced with on a day to day basis. JDRF is the world’s leader in T1D research with currently more than 50 clinical trials, some of which are in the final stages and pending FDA approval. In addi-tion, we do have programs related to T2D’s as well. Our Clinical Trial Connec-tion matches children and adults all over the world with research initiatives that could ultimately and positively impact your diabetic-related medical care.

Shushing The Stigma

by Kelly Reese

Some people often say it's not the reality that creates one’s story but more the perception of what someone sees. After sitting down and talking with one of the most remarkable physicians I know, I can now attest to this thought. Dr. Dwain Woode of Diabetes and Endocrine Wellness Center in Huntsville, AL shared many stories of his life as an endocrinologist with me. There was one in particular that changed his life forever. After listening to him, my life was also changed. He admits that he was not eager to share this story. For a long time, he felt shame when he replayed this particular conversation in his head. It was shortly after he completed his endocrinology fellowship. He, along with his wife Dr. Charmaine Blake Woode, and son, moved to Huntsville and opened Diabetes and Endocrine Wellness Center. He recounts: A young patient was struggling with his diabetes. I offered him words of encouragement. In frustration, the patient said, “You don’t know what it is like to have diabetes”. Perhaps she sensed that I did know what it was like, and his mother asked: “Dr. Woode, do you have diabetes?” I wanted to keep our relationship strictly professional. I did not want to share anything personal with my patients and their families. I did not want to be known as the diabetes doctor with diabetes. So, I responded, “No.” The problem was, that was not the truth. When the patient came back for his next visit, I decided to ‘fess up. The young patient turned to his mother and said: “See, even the doctor is ashamed to have diabetes.” I can’t tell you how much that conversation impacted me and how it has stayed with me. What has been redeeming about that interaction is that I now freely share the fact that I have diabetes with my patients. They know that I understand personally what it is like to struggle with diabetes, how it feels to have to check my blood glucose levels even when I’m busy or I don’t want to. I understand what it is like to pass on certain foods when I would like nothing better than to indulge in my favorite dessert.

Dr. Dwain Woode Photo by Jourdan Ways

For many diabetic patients, treating their diabetes involves taking insulin. Unfortunately, insulin causes weight gain. Dr. Woode has experienced this himself. He embarked on his own weight loss journey and was able to discontinue his insulin. A significant portion of his patients struggle with weight, not just the patients who have diabetes. Over the past year, he has taken a closer look at the problem of weight management in his patients. He understands the stigma associated with being overweight. He asked himself these questions: "Is there an answer to this epidemic?” “What can I do to assist my patients who also struggle in this area?” The answer to the second question comes in the form of a new business focused on weight management. Dr. Woode has been helping patients with their weight and has seen many success stories. For many of his patients, success is seeing a number on the scale they have not seen in years. More importantly, for others, it means reducing the amount of medication they are taking for their diabetes, hypertension, or hyperlipidemia. With the birth of The Lighter Weigh, LLC, Dr. Woode and his team hope to

impact the Huntsville community by offering a medically supervised weight management program. This program utilizes a comprehensive approach to weight management that does not just focus on nutrition and exercise, but includes total lifestyle transformation. The program will employ a wellness coach to come along side each client and help them be successful. The program will incorporate what we know about how our emotional health, stress and fatigue impact our food choices and ultimately, our weight. Support is critical whenever we attempt to make lasting changes in our lives. Along with having a wellness coach, each client will be part of a community that supports each other on the weight management journey.

I think they appreciate that I can truly empathize with them in their struggle. I also, like many of my patients struggle with maintaining a weight that is healthy. After having a conversation with Dr. Woode and hearing his story and learning about The Lighter Weigh, it has forever changed how I want to approach living a healthier life. He emphasizes that the right tools are needed to be successful. These tools are content, coaching, and community. We can learn better ways to approach our diseases and reach out and engage with others who are there to share our victories and our setbacks. He also taught me that no matter what "disease" we might be facing...whether it is PCOS, diabetes, or obesity... "We need to control the disease, the disease does not need to control us." Diabetes and Endocrine Wellness 1 Hospital Drive Southwest Huntsville, AL 35801 256-881-2700

Diabetic Nerve Pain

Prevention and Treatment Alternatives by Jackie Makowski

The prevalence of diabetes is growing at an epidemic rate. More than 30 million Americans have diabetes and experience its associated long-term complications.

Diabetic neuropathy is one of the most common complications of both type 1 and type 2 diabetes and affects half of the diabetic population. Diabetic neuropathy is nerve damage caused by diabetes. Over time elevated blood sugar levels can cause damage to the nerves in the hands and feet. This can result in numbness and tingling as well as burning, sharp or aching nerve pain. Patients also describe diabetic nerve pain as shooting pain, sensation of pins and needles, throbbing or radiating pain or a stinging, shock-like sensation. Symptoms are usually mild initially but can worsen over time spreading up the effected extremities. These complications can affect mobility in many patients. Walking can be excruciating and even light touch can be unbearable. Diabetic nerve pain can also affect the ability to sleep, decrease the quality of life and increase the risk of depression.

“Diabetic nerve pain, or polyneuropathy, is multifaceted and can cause debilitating extremity pain or total loss of sensation substantially decreasing a patient’s quality of life,” said Dr. Morris Scherlis, Anesthesiology & Pain Management physician with Tennessee Valley Pain Consultants. “Developing a comprehensive treatment plan is important for not only treating neuropathic pain but preventing further nerve damage.” Nerve pain is more prevalent in people who have had diabetes for several years especially in those whose blood sugar is not controlled effectively. Patients experiencing painful neuropathy often decrease exercise and physical activity which are key components to increasing circulation and preventing additional damage. Unfortunately, nerve damage cannot be reversed but prevention can help reduce decline of symptoms.

Diabetic Nerve Pain Symptoms: • Shooting Pain • Burning Sensation in Hands or Feet • Pins and Needles sensation • Numbness or Tingling • Throbbing or Radiating Pain • Stinging or shock-like feeling

Prevention

There are many ways to prevent or delay nerve damage including blood sugar control, physical activity and annual foot exams.

Controlling blood sugar so damage does not progress

Uncontrolled or fluctuating blood sugar levels can cause nerve damage. The American Diabetes Association recommends A1C levels tested twice a year and a goal of 7% or lower.

Diet and exercise help decrease blood sugar to a healthier range

Regular exercise has been shown to help manage A1C levels over time. Diet is a critical component in managing blood sugar levels. Eating lean proteins, fruits and vegetables while cutting carbohydrates is a good way to reduce blood sugar levels. It is also important to monitor health risks that can worsen diabetes such as weight gain and smoking.

Annual foot exam for wound prevention

The American Diabetes Association recommends physicians perform annual diabetic foot exams. This includes assessing feet for health of skin, muscles, circulation and sensation. Some patients with diabetic neuropathy will not experience pain but rather will lose feeling in their feet. This can cause complications if a foot injury occurs and is left untreated.

Developing a Treatment Plan

The decline in overall quality of life can be debilitating when daily activities are impacted by diabetic pain. There are options for treating diabetic neuropathy which include prescription nerve medication and non-steroidal nerve blocks.

First line medications for pain relief include anticonvulsants, such as pregabalin and gabapentin and antidepressants, especially those that act to inhibit the reuptake of serotonin and noradrenaline. Medications such as gabapentin can relieve pain and reduce burning, numbness and tingling. These medications work by calming damaged or overactive nerves that cause diabetic nerve pain. Medication is only part of the treatment plan. Diet, exercise and healthy lifestyle choices assist in the reduction of diabetic nerve pain.

Non-steroidal nerve blocks

A non-steroidal lumbar sympathetic block can also provide significant relief for patients with advanced nerve pain especially in the feet. The sympathetic nerves are located on both sides of the lumbar spine. Pain signals travel to the brain via the sympathetic nerve. A mixture of anesthetic, saline and anti-inflammatory medication is injected into or around the sympathetic nerves to disrupt pain signals thus reducing pain. Lumbar Sympathetic Blocks are performed in an outpatient setting and assist patients who have moderate to severe pain. The goal of nerve blocks is to increase quality of life through reduction of pain allowing patients to resume previously limited activity. "Sympathetic nerve blocks can be helpful in a comprehensive pain management plan for diabetic polyneuropathy,” said Dr. John Roberts, Anesthesiology & Pain Management physician with Tennessee Valley Pain Consultants. “Numbing medicine and steroids injected can have a powerful effect to decease painful impulses resulting from injured nerves from diabetes that can last several months and provide lasting pain reduction and improvements in quality of life." The double board-certified Anesthesiology and Pain Management physicians at Tennessee Valley Pain Consultants, Drs. Ronald Collins, Morris Scherlis, Roddie Gantt, John Roberts and Thomas Kraus, treat patients with diabetic nerve pain. Visit tnvalleypain.com to learn more about pain relieving procedures or to request an appointment.

Lumbar Sympathetic Block Diabetic nerve pain signals travel to the brain via the sympathetic nerve. A lumbar sympathetic block disrupts pain signals at point of injection.

NOTHING CAN KEEP HIM DOWN

Meet Tom Phillips! Tom is an 84 year old guy with so much spunk in him it is contagious! You can just feel his love of life in his voice. He enjoys being active and keeping healthy. This poor guy started having what he calls, “severe knee pain”. He described it as a “bone on bone” type situation that was extremely painful. It became so bad it made it difficult to walk. Before seeking any medical advice, Tom tried all kinds of pain relievers, ice packs, gels, and even his own physical therapy. He was getting no relief and finally succumbed to going to see a professional. As soon as he hobbled into the doctor’s office, he had a diagnosis and he was not surprised, at all! First, they tried injections but they did not help enough to keep Mr. Phillips’ active lifestyle. So, the doctor recommended a total knee replacement surgery to cure his ailments. Dr. Eric Janssen, orthopaedic surgeon at SportsMED, Lee Warlick, DPT and Nathan Crawford, PTA have been a life saver for Mr. Phillips. Two weeks after total knee replacement surgery, Mr. Phillips was back on his feet. Within four weeks, he was out walking his dog to the park and enjoying life again. Mr. Tom Phillips is a remarkable success story. Nothing can keep him down and it’s exciting and encouraging to see how well he is doing! We wish him nothing but FUN in the future!

Kombucha

Take a stroll in any major grocery store, and your bound to come across some tasty ‘boock in a variety of flavors. Many are now discovering the benefits of this “elixir of life” health beverage. But, what is Kombucha? Kombucha is a fermented sweet tea beverage with a S.C.O.B.Y. (symbiotic colony of bacteria and yeast) or also known as, “The Mother” the magic ingredient! The fermentation process metabolizes the sugars and caffeine. It’s believed that Kombucha tea provides healthy bacteria (probiotics), micronutrients (including all the B vitamins), enzymes, antioxidants and organic acids. These elements combine to make Kombucha, a health promoting beverage that can be helpful for improving digestion, detoxification, immunity, weight loss, appetite control and balancing the pH of the body. Kombucha acts as an adaptogen, meaning it doesn’t cure anything, but rather help your body react to any stress. Adaptogens help balance, restore and protect the body. Fermentation has been around for thousands of years. Cultures all over the world once relied on this food preserving technique. Once refrigeration was introduced, many Western diets lack a variety of fermented foods. Kombucha may sound like the next “trendy” health food, but the first known origin of Kombucha dates back to China 221 BC. Kombucha is a great alternative for sugary sodas, if you’re curious to try for yourself find Tribal Kombucha at The Juicery Press in Madison.

Could Acupuncture

Be the Treatment You Never Knew You Needed? by Patricia Hartley

“Your body is like a car,” explains Dr. Ly. "At around 100,000 or 200,000 miles, parts start to wear out, and most all of us will have pain.” What can we do to help alleviate our pain? Your answer may just be acupuncture. Acupuncture is one component of Traditional Chinese Medicine (TCM), a holistic approach to overall wellness and health which the Chinese embraced more than 5000 years ago. Acupuncture was added to the TCM regimen of herbs, acupressure, exercise, and a healthy diet around 1000 BC. Acupuncture continues to grow in popularity today as more people experience its benefits. TCM IS BASED ON THE THREE BASIC BELIEFS: • The body can heal, • Every aspect of the body is connected, like a small universe, and • Preventive health and wellness practices will help you avoid pain and illness. WHY ACUPUNCTURE? According to Dr. Frank Ly, a fourth-generation TCM practitioner and acupuncture specialist based in Huntsville, Alabama, no one is exactly sure how or why acupuncture works so well. “There are 14 main meridians in the body that we work on, and we know acupuncture helps with any type of injury or pain,” said Dr. Ly. “For thousands of years, practitioners have talked about how acupuncture at these points opens up energy within the body. There’s still a lot of mystery about how exactly this happens.” New research at Duke University found that “energy” acupuncture releases may have something to do with endorphins and dopamine the procedure releases. Our bodies naturally produce endorphins like cortisone to alleviate and eliminate pain and inflammation, and dopamine helps our bodies relax and experience feelings of happiness — all without prescription medications or invasive procedures. “In this country, when we hurt, we take pain pills,” explained Dr. Ly. “These medicines can lead to digestion problems, and they’re usually only treating the symptoms of an issue and not the problem that led to the pain in the first place. Acupuncture works on the whole body, the whole system, not just the pain.”

A WIDE RANGE OF BENEFITS Most of Dr. Ly’s patients first visit his practice with multiple problems, and most often these include neck and back pain. He explained when we have one problem, for example, pain in one knee, our body will compensate by shifting weight to the other side of our body. This leads to more problems in the spine and hips if we wait to seek treatment. Dr. Ly recommends that patients start out with four visits, after which they can really tell the acupuncture treatments are working. Most sessions last about an hour, but can vary based on the reason for the visit. Although acupuncture can indeed fix the root cause of pain, it may come back simply because of our habits, lifestyles, or the work we do. For example, if we don’t improve our posture or continue to keep our heads down and focused on our phones, the pain that acupuncture resolved may return. The benefits of acupuncture go well beyond just treating pain, though. Dr. Ly says that he regularly treats patients for sinus and allergy problems, arthritis, fibromyalgia, and headaches. Acupuncture is also a recommended and proven treatment for infertility and immune system disorders. However, the second most popular treatment at his practice is his weight loss regimen. “Acupuncture treatments on the ears can help to shut down your appetite,” said Dr. Ly. “As part of the weight loss program, we also have natural Chinese herbal supplements that will help with metabolism.” There are so many benefits to acupuncture and so many reasons to try it. Dr. Ly and his staff personalize treatments and programs to each individual patient and his or her needs, and does not require a physician referral to schedule an appointment. Acupuncture and Wellness Center Dr. Frank Ly, DOM, C.A. and Dr. Orlando Ly, C.A. 7500 Memorial Pkwy SW, Suite 120 Huntsville, AL 35802 (256) 882-5508 lyacupuncture@att.net www.acupunctureandwellnesscenters.com

what is Do you feel clicking, popping or grinding when you are eating? Do you limit how wide you open your mouth because of pain in the jaw? Do you feel like your teeth donâ&#x20AC;&#x2122;t quite fit together right? These can all be symptoms of temporomandibular dysfunction or TMD. Headaches, ear pain and even neck pain can also be symptoms of TMD as well.

The temporomandibular joint (TMJ) is where the lower jaw attaches to the head. This hinging joint allows the lower jaw to move up and down so that we can talk, eat, and yawn. Like any other joint in the body, if it is not moving correctly it can be painful. Symptoms may be intermittent, or they may be persistent. Often, we will accommodate to the pain by altering our movement, chewing on the other side or limiting how wide we open our mouth. Overactive muscles that control the movement of the jaw are often a major source of the pain associated with TMD. Muscles that stay contracted all the time become painful. Clinching of the jaw is a problem that many people with TMD have and may not even realize it. Some people clinch or grind their teeth while sleeping. Your partner will usually let you know if you are grinding because the sound will wake them at night. But many people are clinching during the day and have no idea. Your top teeth and bottom teeth are not supposed to be in contact with each other at rest. This is a form of clinching and it keeps the muscles that control the jaw in a constant state of contraction. If you find that your teeth are in contact with each other on a regular basis, try to allow the lower jaw to relax. Make a note

IMFall'19.indd 16

TMJ?? by Michael Beuoy, PT, Cert. MDT

to gently move your jaw up and down as well as side to side for a few seconds throughout the day. The movement may help to allow the muscles to relax and limit the contact of your teeth. Popping and clicking may also be noted with TMD. Reasons for this could be related to the disc that is in the joint or possible changes to the surface of the joint. The disc plays an important role in the function of the joint and when displaced can be a source of pain as well. Headaches and neck pain are often associated with TMD due to the hyperactivity of the muscles. High stress levels and poor posturing can create further tension in the muscles of the jaw, neck, shoulder and head. Treatment for TMD comes in several forms. Your dentist may be able to make a splint that helps to position the jaw and relax the muscles. Some people may require orthodontic intervention for correction of the bite. Worst case scenarios may even require surgery, though that should always be the last option. As a physical therapist, I treat pain related to joint disorders throughout the body. The TMJ is no different. A course of physical therapy treatment for TMD pain includes a thorough evaluation to determine the best course of action. Treatment by a physical therapist for this pain should include education for posture, foods that place less stress on the jaw, and avoidance of activities that are keeping the muscles hyperactive. Manual treatments are used to help the muscles to relax and exercises are performed to normalize movement of the joint as much as possible. Modalities such as heat or ice may also be beneficial to decrease pain. The cervical spine needs to be addressed to look for abnormal movements as well. If you suffer from symptoms like this, ask your doctor, dentist or physical therapist if a course of physical therapy treatment is right for you.

8/28/19 2:38 PM

If you have had chicken pox, the Shingles virus – a painful blistering rash–is already inside you. With one in three people expected to develop Shingles in their lifetime, the healthcare community is focused on treatment and prevention. After chicken pox resolves, the virus known as varicellazoster remains in the body lying dormant inside nerve cells near the spine. The virus is suppressed by the immune system, but life factors such as stress, illness and aging increase the risk of the virus remerging as Shingles. Shingles is a blistering rash accompanied by severe burning, shooting pain which can last up to 30 days. For one in four patients like Sue Potee, the pain will persist even longer.

by Jackie Makowski

“One quarter of Shingles patients will develop postherpetic neuralgia and suffer with long-term nerve pain,” said Dr. Roddie Gantt, anesthesiology and pain management physician with Tennessee Valley Pain Consultants. “The earlier postherpetic neuralgia is treated the better the outcomes will be for resolving nerve pain.” Sue and her husband were traveling out of the country this spring when she developed a painful burning rash. While she received the Shingles vaccine, Sue knew her nerve pain was consistent with Shingles. “I had the Shingles vaccine and thought it couldn’t happen to me,” Sue Potee of Meridianville said. “The pain was so unbearable that I went to an emergency room overseas. I was prescribed medication to help with breakthrough discomfort but it never relieved the constant shooting pain.” Unfortunately for Sue, the pain persisted upon her return to the United States and while the rash had mostly resolved she was still suffering with severe penetrating pain. “A friend recommended Tennessee Valley Pain Consultants for a nerve block,” Sue said. “Dr. Gantt performed the procedure and I felt immediate relief.” Sue received a therapeutic nerve block performed to alleviate acute

Shingles pain and postherpetic neuralgia. Pain management specialists inject a corticosteroid through an epidural injection precisely targeting nerve pain. The Shingles rash typically stretches from the back around to the front of the body on one side. However, it can also occur on one side of the face, neck, chest, hands and leg. Epidural steroid injections can be performed in the cervical, thoracic and lumbar spine depending on the presentation of the rash. Therapeutic injections for Shingles pain are done in an outpatient setting with little to no downtime. “The best defense for shingles is the Zostser vaccine which is recommended for people 60 years and older,” said Dr. Thomas Kraus anesthesiology and pain management physician with Tennessee Valley Pain Consultants. “While it doesn’t prevent shingles it can reduce a patient’s risk by 50 percent as well as the severity and risk of complications if the virus does occur.” Tennessee Valley Pain Consultants offer appointments for patients with Shingles pain, both acute and long-term, within as little as two business days. “Nerve pain associated with Shingles can be very debilitating,” Dr. Kraus said. “The nerve blocks offer immediate relief bathing the nerve with medication helping patients like Sue.”

by Paul A. Dobbs, Jr. C.Ped

Plantar Fasciitis

Take care of your feet, and theyâ&#x20AC;&#x2122;ll take care of you

Like most things in life we take our feet for granted. We often give them little or no thought until we have a problem. Feet are the unsung hero of the human body. They are quite literally the foundation of our body. The average person takes between 6,000 and 10,000 steps per day. Over the course of a lifetime, that adds up to around 100,000 miles. That’s the equivalent of 4 trips around the earth. We use them, abuse them, and ignore them. Then blame them when we have a problem. I hear in my office all the time “I just have bad feet.” The truth is you probably don’t have bad feet. Your feet deserve a medal for all that you put them through. One of the most common problems I encounter in the office is heel pain. Heel pain can be caused by many things, but the most common culprit is Plantar Fasciitis. If your first step in the morning is extremely painful you may have Plantar Fasciitis. It’s an injury that affects the bottom of your foot. Basically it’s inflammation of the tough fibrous band of fascia that connects your heel to your toes. In the extremely active person, plantar fasciitis is typically associated with over use. In the sedentary person, it is often the result of weight gain. There are a number of things that put you at risk for developing plantar fasciitis. Among them are having extremely high or low arches, being overweight, or being female. Wearing bad, worn out, or just the wrong shoes for your biomechanics also increases your risk. People who have jobs that require standing on hard surfaces such as concrete or those who run or walk for exercise are also more likely to experience plantar fasciitis. In most cases your first symptom is a dull soreness similar to a bruise. You will likely feel it after a long period of standing or after exercising. Usually the pain doesn’t occur during exercise, but after. As it progresses, the pain usually becomes sharper in nature and you develop the hallmark symptom of plantar fasciitis “first step pain”. Your first step in the morning or after a long period of sitting will be very painful, but the pain typically lessens after a few minutes of walking. To ease the first step pain it’s usually helpful to sit on the side of the bed for a few minutes and get your feet warmed up before walking on them. You can do some ankle rolls to start gently loosening them up. Draw a circle with your toes then start rotating your foot in one direction and every few seconds change directions. It’s also a good idea to keep a stretching strap and a tennis ball next to the bed. You can loop the strap under your foot just behind the toes and gently pull back to stretch your foot and Achilles tendon. Rolling your foot on the tennis ball is a good way to massage your foot and get blood flowing. Start out with just the weight of your leg, and gradually increase pressure to massage deeper. If you begin treatment early most cases respond to conservative measures. Untreated plantar fasciitis can lead to knee, hip, and back pain.

This is due to the fact that sometimes you change the way you walk to try to relieve the pain. Conservative treatments include stretching, icing the sore area, anti-inflammatory medications, steroid injections, and arch supports or custom orthotics. Plantar fasciitis, like all foot injuries, require patience. Unlike injuries to other areas of the body, you have to walk on your feet and unfortunately there is no quick fix. Approximately 90% of cases respond to conservative treatment protocols, however the other 10% may require surgery. Surgery involves releasing part or all of the plantar fascia. Recovery time is generally 6-10 weeks before you’re walking comfortably and up to 3 months before you are able to run or do high impact exercises. The best way to treat plantar fasciitis is to prevent plantar fasciitis. Some of the risk factors such as the height of your arch, working a job that requires long periods of standing on hard surfaces, or being female may be beyond your control. You will have to live with those and control the things you can control. If you run or walk for exercise, try to find an unpaved trail. Your feet will thank you. This brings us to shoes. You should avoid going barefoot for long periods of time. Make sure you are wearing the right shoe for your foot and the given activity. Think of shoes as tools. You don’t use a hammer to drive in a screw, you use a screwdriver. I’m asked every day, “What’s the best shoe?” My answer is always the one that fits and functions best for your foot and is right for the activity. If you’re going to church or out to dinner dressy shoes with little or no support may be fine. But if you plan to stand for a long period or walk a long distance you will probably be better off in something more supportive. This is particularly important for shoes that you exercise or work in. It’s also a good idea to keep track of mileage on your shoes. I like to take a sharpie and write the date I begin wearing a pair of shoes under the insole. If you’re a runner it’s easy to track mileage, but for other forms of exercise or work shoes it can be more difficult. The rule of thumb for runners is to replace your shoes every 300-500 miles. If they are work shoes it’s a good idea to replace them once a year or twice a year if you work on your feet for extended periods of time. If you’re not sure what type shoe you need it is a good idea to go to a shoe store with trained staff. They can assess your feet and help guide you to the right shoes.

The key to preventing or treating plantar fasciitis is to consistently take good shoes, maintain a healthy weight, and good care of your feet. Buy and wearing flip-flops for extended periods avoid going barefoot take your feet for granted. Give them the of time. Don’t deserve. In short, take care of your feet respect they and they’ll take care of you.

by Ben Macklin

Feet are the workhorse of our bodies and an important part of a happy, healthy lifestyle. Our feet work hard considering the weight and stress we put on them every day, but we continue to give them very little respect. The average adult takes 4,000 to 6,000 steps per day. That’s enough steps to walk around the earth four times during your life. With 26 bones, 33 joints, and over 100 muscles, tendons, and ligaments making up the foot and ankle, it’s easy to see how approximately 80% of people will experience a foot related problem at some point during their life. However, most foot related issues are the result of neglect and lack of awareness for proper care.

Basic foot care takes very little effort and can be easily incorporated into your grooming routine. • Wash your feet daily to prevent fungal infections. Be sure to get between the toes as this area is more susceptible to infection. • Moisturize your feet to prevent cracking, but DO NOT put lotion between your toes. • Do not soak your feet. Foot soaks can break down skin and actually cause damage. • Trim your toenails straight across versus rounding the nail or cutting the sides to prevent ingrown toenails. • Examine your feet periodically. Make sure there are no cuts or red areas. • Tend to cuts and scratches immediately. After cleaning the wound, use a mild ointment and cover the site with gauze and a bandage. Be sure to change the bandage often. • If you have numbness in your feet from diabetes or nerve damage, examine your feet daily. • Smooth corns and calluses with a pumice stone while the foot is still damp. Rub gently, only in one direction, and treat the site gradually. There are a number of problems that can affect your feet, including: foot odor, cracked skin, fallen arches, corns, bunions, calluses, ingrown toenails, fungal infections, strains, sprains, fractures, and more. Of all the potential problems our feet encounter, heel pain is the number one complaint. Heel pain is typically the result of repetitive stress on the foot

These simple exercises can help your feet and ankles stay happy... caused by biomechanical problems (flat foot) and wearing improper footwear. Plantar Fasciitis, heel spurs, and heel fissures (cracked heels) are some of the primary causes of heel pain. Heel pain can often be prevented or treated conservatively. “Daily stretching can prevent heel pain, and good supportive shoes can prevent over 40% of future heel problems,” notes Milton Sterling, DPM, Podiatrist at SportsMED Orthopaedic Surgery and Spine Center. Preventing and managing heel pain can be accomplished by making simple modifications to your daily routine. • Proper footwear can help absorb shock and provide additional cushioning to take pressure off the heel. • A daily calf stretching routine can take pressure off the heel and relieve pain. • Wear well-fitting, activity specific shoes. • DO NOT go barefooted. • Avoid flip flops, high heels, and pointy toed shoes for extended periods of time. • Custom orthotics can help correct biomechanical issues and prevent foot, knee, and lower back pain. • Diet and exercise also play a key role in preventing foot pain. Dr. Sterling adds, “B complex vitamins accompanied with exercise can decrease neuropathic pain that affect the foot.” As we age, foot related issues tend to worsen. If foot care does not seem important now, it will be. Showing your feet a little respect and some TLC will carry you a long way in life.

Foot Stretch 1. Sit with knee straight and towel looped around involved foot. 2. Gently pull on towel until stretch is felt in calf. 3. Hold 10 seconds. 4. 5 repetitions, 2 times per day.

Calf Stretch 1. Stand with involved foot back, leg straight, forward leg bent. 2. Keep heel on floor, turned slightly out, lean into wall until stretch is felt in calf. 3. Hold 10-20 seconds. 4. 5 repetitions, 2 times per day.

Calf Raises 1. Balance on involved foot, using something sturdy to help you balance. 2. Rise up on your toes, then lower back onto your heel. 3. 20-30 repetitions, 2 times per day.

Heel Stretch 1. Standing with only the ball of the involved foot on stair, push heel down until stretch is felt through arch of foot. 2. Hold 10-20 seconds. 3. 5 repetition, 2 times per day.

Cervical Disc Replacement M6 Javier Reto, MD, was the first surgeon in Alabama to implant the M6 artificial disc replacement for the cervical spine. By Javier Reto, MD

Neck pain occurs in approximately 2 out of every 3 adults throughout their lifetime and chronically in 15% of the population at any one time. As a result, treatments for neck pain have become increasingly utilized. Thankfully, the vast majority of folks that experience neck pains recover uneventfully. For the subset that require further assistance, physical therapy and over the counter anti-inflammatory medicines, e.g. ibuprofen, naproxen may be necessary to aid in recovery. Interventions such as injections and prescription medications typically become next-step options if needed. Finally, we consider surgery for those unfortunate enough to fail all measures. There are a significant number of younger people identified, typically falling into 20-50 age range, that become surgical candidates. In the past, these folks were given the option of living with the pain, repeat injections or neck fusion surgery. Neck fusions, where two adjacent vertebra are fused together with intervening disc entirely removed, have been a time-proven and quite successful option for reducing or eliminating pain. However, these surgeries come at the expense of eliminating motion at the particular level or levels involved. In the long run, the loss of motion increases stresses at adjacent disc levels and can lead to more surgery in 20-30% of patients.

â&#x20AC;&#x153;

As a spine surgeon I am invested in finding both innovative and effective options that function best for patients in all age ranges. As such, options like the M6 device which provides accurate reproduction of motion in all planes, including compression, can be a better option than the typical fusion.â&#x20AC;?

Cervical Disc Replacement surgery is an alternative surgical option for those with little to no arthritis with the added benefit of preserving motion and thus potentially reducing the incidence of disc breakdown at adjacent levels. The last few years have seen several cervical disc replacement options come to market. While they all exhibit motion-preservation technology the manner in which this is accomplished varies and can significantly impact their overall effectiveness. Keep in mind that the ultimate goal of any disc replacement device is to reproduce normal spinal motion or kinetics. But what defines normal, and how is this measured? Luckily for us, spinal kinetics have been well-studied and a few guiding principles have been identified. A well-functioning device should have the ability to mimic normal motion in all normal anatomic parameters. It serves no good purpose for an implant to allow 360 degrees of rotation as humans are not owls! Likewise an implant that allows less than normal motion is restrictive and will result in early wear and likely failure. Normal neck motion is 80-90 degrees of forward bending, 70 degrees of backward bending, 2045 degrees of side to side bending, and up to 90 degrees of side to side rotation, as well as abc vertical distraction/ contraction. Most disc replacement options do a good job

at reproducing the majority of normal neck movements, but do not necessarily cover all the movements well. The Orthofix M6 device has been out in the European market since 2006 and in the US market recently in 2019. I was the first surgeon to implant the M6 last August and chose to use it because of its promising characteristics. Laboratory testing has shown that it does among the best at hitting all ranges of normal motion well, including the up and down distraction/contraction movement. It has a shock-absorbing center (nucleus) and outer wall (annulus) that work together to replicate the controlled range of movement and cushioning effect of the natural disc. As a spine surgeon I am invested in finding both innovative and effective options that function best for patients in all age ranges. As such, options like the M6 device which provides accurate reproduction of motion in all planes, including compression, can be a better option than the typical fusion. Ultimately the goal is to fit the surgical solution to the specific pathology as opposed to one size-fits-all approach. For those that are identified as appropriate candidates, the cervical disc replacement device can be a wonderful option. If you have on-going significant neck or arm pains it would be wise to consult with a spine specialist about the right options for you.

Pin Point Pain Relief Advanced Pain Management techniques focus on nonsurgical pain relief

Nearly 100 million people in the United States suffer with chronic pain – more than those living with diabetes, heart disease and cancer combined. This statistic has garnered considerable attention from the healthcare community. Due to its subjective nature, pain is often difficult to measure but is important to address. Pain serves as the body’s “warning signal” for a problem requiring attention. The most common conditions treated by pain management specialists include low back and neck pain, neuropathic pain, pre-and postsurgical pain, cancer and shingles-related pain. Many patients will experience acute pain which will resolve within 6 months. For patients whose pain does not improve, many develop chronic conditions and suffer with a reduction in their mobility, range of motion and overall quality of life. “The Pain Management specialty is designed to work with primary care physicians to diagnose the underlying cause of pain and determine an effective treatment plan,” says Ronald Collins, M.D., DAAPM, anesthesiology and pain management physician with Tennessee Valley Pain Consultants. “Many people can achieve pain relief without surgical intervention.” While prescription medication can be effective when utilized as part of a treatment plan, there are many advances in nonsurgical interventions available for patients. Patients suffering with pain in the spine, extremities or nerves can often benefit from a less invasive option – injection therapy. Whether used for diagnostic or therapeutic benefit, injec-

tions including nerve blocks are commonly used for treating both acute and chronic pain. Pain Management physicians utilize advanced techniques under x-ray guidance to pin point pain and relieve it. “Our goal, besides managing pain with appropriate medication is to try and change the pain at its source,” says Morris Scherlis, M.D., DAAPM, anesthesiology and pain management physician with Tennessee Valley Pain Consultants. “This often involves injections under fluoroscopy to specific and precise pain generators.” Nerve blocks relieve pain by interrupting the transmission of pain signals to the brain. Common blocks include cervical and lumbar epidural steroid injections for neck and back pain relieving both site and radiating pain. Under x-ray guidance, the physician injects a mixture of steroid and anesthetic into the epidural space, bathing the painful nerve root with soothing medication. Many patients experience significant relief from only one or two injections. Injections are also very effective for sacroiliac joint pain which is often caused by arthritis in the joint where the spine and hip bone meet. The steroid medication alleviates pain by reducing swelling and inflammation. In addition to spinal conditions, nerve blocks are also extremely effective at relieving acute Shingles pain as well as postherpetic neuralgia, the residual nerve pain lasting for several months to a year. Injection procedures are typically done

in an outpatient setting using light sedation. For some patients, a minimally invasive procedure known as facet radiofrequency is performed to disrupt nerve signals. Radiofrequency can be performed in both the neck and low back. During this procedure, a physician inserts a needle-like tube into the spine under x-ray guidance to the irritated medial branch nerves. A radiofrequency electrode is inserted through the tube to heat and cauterize the nerve blocking pain signals. Patients usually experience full relief within 30 days and enjoy lasting benefits. For pain that is unresponsive to a conservative approach, spinal cord stimulation is among the most advanced technologies in the pain management field. “These implanted devices act like pacemakers for pain and can help to significantly reduce a patient’s discomfort by inhibiting painful impulses sent to the brain,” says John Roberts, M.D., DAAPM, anesthesiology and pain management physician with Tennessee Valley Pain Consultants. Spinal cord stimulation has a high success rate and is less invasive than other surgical options. Since every patient’s pain is unique, it is important to seek an experienced board-certified pain management physician offering a multidisciplinary approach to pain relief. by Jackie Makowski Tennessee Valley Pain Consultants 201 Governors Drive, Suite 400 Huntsville, AL 35801 256.265.7246 tnvalleypain.com

Common Procedures for Pain Relief The following procedures are performed with real-time x-ray guidance. Epidural Steroid Injections: Administered in the epidural space of the spinal cord to relieve inflammation secondary to spinal disc problems or pain associated with pinched nerves. Trigger Point Injections: Performed on site of muscle pain improving blood flow and reducing pain. Selective Nerve-Root Blocks: Utilized to diagnose the specific source of nerve root pain and for therapeutic relief of low back pain and/or leg pain Facet Joint Injections: Performed for temporary joint pain relief and in preparation for more long-term treatments such as facet radiofrequecy.

Other Procedures Facet Radiofrequency: Utilized to help patients with chronic low-back and neck pain and pain related to the degeneration of joints typically from arthritis. Physician precisely inserts a needle precisely delivering heat to a specific nerve disrupting the pain signals transmitted to the brain. Pain relief may last for several months to a year. Spinal Cord Stimulation: Performed for patients with nerve root damage or failed back syndrome who have not responded to conservative treatments. This procedure involves implantation of a small, rechargeable device releasing electrode signals to the spinal cord, replacing pain with a more pleasant sensation.

Injury Awareness and Treatment

We, as parents, teachers or coaches, need to be aware of who is the best to evaluate these young but serious up-andcoming athletes...

The spotlight on overuse injuries has covered the nation with awareness. But what truly defines the responsibility? For 7-year old Sophia, her spotlight debut was going to bring her quickly to understand recovery. While performing in a competitive cheer exhibition to start off her all-star competition season, she broke her arm on stage on film and on count. In that very moment, the spotlight was on her, and her injury was in the presence of everyone. Sophia’s parents had been so supportive of her dream to one day cheer on a college football field. Little did they know that when they enrolled in such a competitive sport, she would be on her way to outperforming many collegiate-level cheerleaders at her very young age. Now, this dream was suddenly put on hold due to an injury, which came unexpectedly! Thankfully, local orthopaedic specialist Dr. Buckley of The Orthopaedic Center (TOC), who specializes in pediatric care was able to get Sophia back to what she loved most in a short amount of time. Dr. Buckley was accustomed to seeing pediatric and adolescent injuries. As an expert who is fellowship trained and board certified, treating injuries of all types has shaped his patient practice. He knows an overuse injury when he sees one. But he would also tell you that injury is a risk we all take with anything we do. Fortunately, he and other orthopaedic specialists at TOC are here for our community when these emergencies happen. Although all injuries are not avoidable, the spotlight should be focused on identifying the ones that can be prevented. Unfortunately, Sophia’s arm was one of those that could not have been prevented. Most often, injuries come with warning signs. Aches and pains that are persistent are an example and should be evaluated and not always just shrugged off as part of the training. But what about those serious athletes that are elementary or middle-school age that suffer greater injuries to bones and still-developing joints? We, as parents, teachers or coaches, need to be aware of who is the best to evaluate these young but serious up-and-coming athletes and at what point should these issues be addressed with primary care physicians or orthopaedic specialists? The Orthopaedic Center has over 30 orthopaedic specialists, and pediatric and adult Sports Medicine is their understanding. They specialize in orthopaedic care for children, high school athletes, families and senior patients. They use the latest technology in orthopaedics to diagnose and treat everything from sports injuries to fractures to knee pain to scoliosis. All TOC doctors are board certified and fellowship trained. Their teams of surgeons collaborate with physical therapists, athletic trainers and other providers to deliver the highest quality, specialized patient care for you and your family. Customized treatment plans are designed to get you back to work and play as quickly and safely as possibly. They take a conservative approach to treatment, but when surgery is necessary to replace a broken down knee or hip joint or repair a fracture to even the youngest of athletes, you can rest assured you’re in the very best surgical hands. If you are interested in learning more about TOC’s personalized treatment regimen, visit their website at www.visittoc.com.

A NEW SURGICAL APPROACH for YOUR

NEWHIP by Matthew Clayton, M.D.

It is estimated that 27% of the population above the age of 45 years old will display evidence of hip arthritis on x-ray. Hip arthritis is a common problem that often results in pain and stiffness of the hip. Most people will experience this as pain in the groin or buttock muscles. These symptoms result in limitations that drive patients to seek treatment from medical professionals. Treatment for hip arthritis can be as simple as oral medications or injections. However, a significant number of patients do require surgical intervention, often in the form of total hip replacement. Fortunately for the patients that do require surgery, there is a new surgical approach that is changing the field of hip replacement. The direct anterior approach total hip replacement offers less post-operative pain with a faster recovery. This procedure has been discussed nationally in publications like the Wall Street Journal and even on CBS News. These news outlets are showing interest because this procedure is truly changing the way medicine is practiced. This innovative surgery is now being performed for patients here in Huntsville. Total hip replacement has classically been performed through what is referred to as a posterior or direct lateral approach. Both of these surgical approaches to the hip require that muscles and tendons be cut to access the hip joint. The direct anterior approach allows the surgeon to work between muscles, rather than cutting them. This is much less traumatic for the patient, resulting in less pain after surgery. The surgeon also uses x-rays during the procedure to ensure that the implants are appropriately sized and positioned to recreate the patientâ&#x20AC;&#x2122;s natural anatomy. With all of these advantages, why is this not the standard of care for hip replacement surgery? The truth is, many surgeons were not taught this approach during their surgical training and it can be technically challenging to learn and implement. For these reasons, it is important to find a surgeon that performs a high volume of these procedures. In the hands of a well-trained hip surgeon, patients in the Huntsville area can now regain their mobility and get pain relief after a hip replacement faster than ever before.

One hip. I should sayâ&#x20AC;Ś one good hip and one bad one. That had been my entire life. Almost 48 years and counting. I was born with a deformed right hip joint. I was put in traction as a baby, then in a cast for 8 weeks. by Patti Hutchison

And though I could walk and do all the activities of daily life including exercise, I had always been in some sort of pain or discomfort.

IMFall'19.indd 38

8/28/19 2:38 PM

[ This wasn’t going to be a routine procedure, even for someone as experienced as Dr. Clayton. My husband, Kevin, and I love to travel. We love to take the children to places like New Orleans, DC, and Chicago. But that means lots and lots of walking. With each trip, it was getting harder and harder to spend the day walking. Advil wasn’t cutting it anymore. My favorite exercise is cross country cycling and even that wasn’t as easy as it used to be. I finally said enough is enough. I cannot continue living like this. I have too many things to do. That’s how I came to know Dr. Matthew Clayton. Dr. Clayton, my husband, and I talked about the options available. We knew surgery would be an eventuality, but we exhausted everything else first. We did stretching, therapy, and regular cortisone injections. The injections would work for 6-8 weeks at first, but as time went on, they grew less and less effective. It was time to talk seriously about a total hip replacement. This wasn’t going to be a routine procedure, even for someone as experienced as Dr. Clayton. With a deformed hip joint, he wasn’t going to be able to know his exact procedure until I was actually on the operating table. So, we prepared ourselves for any one of three procedures. To further complicate things, it was going to be a posterior procedure. I had been told to be prepared for less flexibility and perhaps even less mobility due to the risk of a dislocation post-surgery. (Dr. Clayton did assure me that I’d be able to return to cycling without any issues.) Tuesday morning, November 28th, 2017, was the day of surgery. Kevin and I had made all the preparations for

IMFall'19.indd 39

surgery. We had arranged the house to make room for the walker I knew I would be using for the next several weeks. My work knew I would be out for at least 2 months. (I stand for hours at my job.) We were ready to rebuild my hip. The staff at Crestwood are awesome. Dr. Clayton’s team, second to none. As for Dr. Clayton, I’ll let the rest of this speak for his skill as a surgeon. Dr. Clayton had a primary plan for my total hip replacement. But he also had two contingency plans, but as it would turn out, he didn’t need them. They tell me it took less than two hours to complete the operation. No complications during surgery except for needing just one screw to hold the hip joint cup in place. By the evening I was up walking. Not just short trips to the bathroom, but around the halls of the hospital. We weren’t setting any speed records of course, but I was moving. It took a little bit, but I began to notice something. I didn’t have any hip pain. Sure, I could feel the pain from the incision, but the pain deep in my hip was gone. 48 years of pain was gone in an instant. When Dr. Clayton came in the next morning, I asked when I could go home. After he saw how much I had been walking, he told me I could go home that day. I was ecstatic. So, 33 hours after I arrived at the hospital, I was going home. But my rapid recovery doesn’t end there. By Saturday, I was moving about the house without my walker. Still moving very slow and being very, very cautious, but sans the walker. By two weeks post-surgery, we were attending a Trans

It took a little bit, but I began to notice something. I didn’t have any hip pain. Sure, I could feel the pain from the incision, but the pain deep in my hip was gone. 48 years of pain was gone in an instant.

8/28/19 2:38 PM

It’s a 9-day, 53-mile trek around the mountain that summits at 19,341 ft. where the oxygen is half of what it is at sea level.

Siberia Orchestra concert where I had to walk up several flights of stairs. (To be transparent, that did hurt a little bit.) By Christmas, there was still a little limp from the incision site, but overall, I couldn’t have asked for better results. I knew that my life was going to be so much better. And more importantly, my husband and I would be able to continue our adventures. And in mid-January (just 6 weeks after surgery), that’s when my husband popped the question. Why don’t we go to Africa and climb Mt. Kilimanjaro? My husband had wanted to climb Kilimanjaro for years but wouldn’t do it without me. But being the eternal optimist he is, and seeing how well my recovery was going, he knew it was now a doable adventure. My first response was “I can’t climb a mountain.” But as the days went by, and I started to feel better, I was intrigued. So, I did some research. It’s a 9-day, 53-mile trek around the mountain that summits at 19,341 ft. where the oxygen is half of what it is at sea level. Though it isn’t technical, that doesn’t mean it’s easy. It is very hard for everyone who attempts to summit it. Some places are very, very steep. And there are some areas where

IMFall'19.indd 40

you have to scramble over rocks. Altitude sickness is a very real possibility. People do die attempting to summit. But as I read about it, I started to think that maybe I could do this. It took a little more prodding from my husband (along with promising a safari) to convince me to give it a try. And we’d have 11 months to build my strength up. In fact, we would spend my 49th birthday on the mountain. By late February I was able to begin the process of training for this grand adventure. We started off easy by doing simple hikes. We weren’t going to risk injury or over train. Slowly, methodically, we began to increase the mileage and elevation. And as spring arrived, we added our cycling back in. It felt so good to be able to do all these things without pain. Yeah, my glute was still an issue (I have a 9-inch incision through the muscle). But with every step or pedal stroke I was getting stronger. By May we were either doing 3-hour hikes or riding 20 miles on our bikes. By early June our cycling was up to 35 miles. The strength was back. And I could ride every day without that nagging pain from my hip. On June 30th, we rode 51 miles! And so, it continued for the summer. Except my husband was adding more and more hills for us to ride up. It was at my 6-month post-surgery visit with Dr. Clayton where we told him what we were going to do. He was so excited, we thought he was going to jump out of his shoes. In August we had a setback. Not from my hip, but my back. A disc had bulged. It was bad. So right after Labor Day, I had my L4-L5 fused by Dr. Curt Freudenberger. This pretty much brought our cycling to a stop for the year. Kilimanjaro was now a question mark. We would have to make a decision by mid-October. I rested my back. I let the fused discs recover. Mid-October came and I started to get back into hiking. Fortunately, everything felt good. Thankfully, my leg

strength was still good, and we could quickly get our hiking miles back up. My husband is a physicist and plans out every single detail to the nth degree. He spent every day of the 11 months planning our African trip. So generally, I just have him tell us what we need to plan for, or train towards. But I must say, that as November arrived, my anticipation for what we were about to attempt began to fill my thoughts throughout every day. What would it be like to go to Africa? What would it be like to camp in a tent for 8 consecutive nights? What would the food be like? Could I really climb the highest free-standing mountain in the world? Finally, the 10th of January 2019 arrived. It had been 408 days since my surgery. Time to fly to Africa. No turning back now. In 4 days, we would begin the climb. Tanzania is a beautiful country. Yes, it’s a 3rd world country. The average person earns less than $5 a day. But the people are thankful for what they have. They are a very genuine people and are happy to see tourists. They are giving of themselves. They know tourism is an important part of their economy and every person we encountered along our journey went above and beyond anything we could ask. From keeping the restaurant open late our first night so that we could have a good meal upon arriving, to giving us guided tours of the shops and markets simply because we asked to see them. We both made a very concerted effort to learn and use their language, Swahili, and that was worth more than money to the Tanzanian people. A climb such as Kilimanjaro cannot be accomplished without guides and porters. There were 15 climbers in our group and to support us, we had 2 lead guides, 5 assistant guides, and 47 porters. All the tents, food, and supplies

8/28/19 2:38 PM

are carried by the porters. We were only required to carry small backpacks with our water, snacks, and rain gear. And I’m glad that’s all we carried. When leaving the main gate to begin the climb, there is no simple, easy beginning to kind of warm your legs up. Instead, from the first step you climb a series of “steps” cut into the ground that rises at over a 20% incline. For a person who likes a few miles to warm up when cycling, this was a shock to the system. I must admit, that I was questioning my ability to make the climb within the first hour. But with the encouragement of my husband, our

IMFall'19.indd 42

guides (who became our good friends), and my fellow climbers, I trudged on. It certainly didn’t hurt to hear my husband and one our assistant guides singing traditional Kilimanjaro songs in Swahili. Day one is the shortest day. Only about 3 miles through the rainforest. But it ascends just over 2000 ft. Night one was spent at 9500 ft. (You could already tell there was less oxygen.) Day Two is very similar to Day One. A little longer, but another 2000 ft. in elevation gained. At this time, I’m still questioning my sanity. (And my husband’s!) Day two starts in the rainforest, but by

the end of the day, you emerge out of it into a more open area known as Moorland. Here is where you get your first view of the mountain. The beautiful snows of Kilimanjaro. Except it was cloud covered until right at dinner time when the clouds cleared, and you had an unobstructed view of this majestic mountain. Seeing what you’re about to ascend is beyond breathtaking. And very motivating. Day Three is a generally a very easy day. Except for us it was raining the entire way. Only 1000 feet of elevation gain. Of course, this takes you to 12,500 ft. That’s really high!

8/28/19 2:38 PM

[ You have learned to live without constant access to your phone or TV and you feel liberated. You have become a part of Kilimanjaro.

Day Four is a unique day. You climb to nearly 14,500 feet then descend back down to 13,500 feet. This is done to help acclimate yourself and keep the dreaded, and potentially lethal, altitude sickness away. It’s also on this day that you begin to think that you’re going to get a chance to summit this mountain. Day Five is the day you spend scrambling over large rocks. It’s the day I needed the most help from our guides. It’s also the day that they assigned our biggest and strongest guide, Mboyi, to my group. They all knew I had an artificial hip and would need to take extra precautions getting up (and down) over these rocky areas. At times Mboyi literally picked me up so that I wouldn’t bend my hip joint too far. Day Six is the easiest day. A slight descent over a short 5-mile hike around to the north side of the mountain. The mountain begins to loom heavily on you at this point. The apprehension of what summit night will be like. It seems like you could just reach out and touch it, but you knew the hardest was still to come. Tomorrow things would change. We woke to beautiful weather on Day Seven. After descending the past two days, today begins the continuous uphill journey to summit base camp. We started our day at 12,500 feet and would climb to 15,400 feet. Today is simply about reaching base camp. There are no rocks to scramble over. Nothing to do but place one foot in front of anoth-

IMFall'19.indd 43

8/28/19 2:38 PM

er. Kilimanjaro is a unique mountain. It makes its own weather. Though only 200 miles south of the equator, it snows yearround. It has glaciers across its summit. It also has 5 distinct ecological zones. Today we would pass through three of them. By the seventh day, you’re tired. Excited, but tired. The long hours spent walking give you ample time to reflect on life. You think about yourself and how this journey has already changed you. You appreciate life differently. You have learned to live without constant access to your phone or TV and you feel liberated. You have become a part of Kilimanjaro. You are part of the soul of the mountain. And it is part of you. Each step that takes you higher into the rarified air has meaning now. As we passed 14,700 feet we saw firsthand, the snow that had fallen on the mountain on day three. I can’t express how it felt to reach down and feel the cold of the beautiful white snow. Knowing that tomorrow we would hopefully be standing on the summit of this glorious mountain motivates you in ways that we never experience at home. It would be another two hours before we would make base camp, but the mountain had another gift for us. Snow! We walked into camp under a light snowfall. However, that wouldn’t be our last snowfall. Base Camp sits at 15,400 feet. Anything that requires effort becomes hard. There simply isn’t enough oxygen to make any kind of major exertion. Even changing clothes is harder. Walking up the few rocks to get to the upper part of camp is hard. And it only takes a couple steps to realize that. So, the best thing to do is rest. Because you will need it. Summit day doesn’t begin the next morning. It begins that night! You have to be prepared for summit night. It will be the hardest thing you’ve ever done. Our guides try to prepare us for this. They tell us what to expect. How to dress for the freezing temperatures. What to eat. (The cooks are amazing.) And finally, what to pack in

IMFall'19.indd 44

our backpack. I was able to take a short nap that afternoon with the hope of getting another short nap after dinner. Our guides told us we would be leaving camp at 10:30 that night to begin our summit attempt. The hope is to reach the summit or at least the crater rim (Kilimanjaro is a dormant volcano) by sunrise around 6:30 in the morning. Our final preparation meeting began at 5:00 that afternoon. Dinner followed at 6:15. And we were finally able to get to our tents around 7:30. We would be up in 2 hours. Well, my husband would be. I couldn’t get to sleep. I knew I needed the sleep but thought I would be ok. The plan was to leave at 10:30. Summit by 7:30-8:00, then descend to our new camp by 1:00 the next afternoon. I could stay up 24 hours. I’d done it before. But that’s now how things would play out. 9:30 came and we began to get dressed and pack up our gear. Nighttime at over 15,000 ft is cold. Freezing cold. The temps had dropped from the upper 30s to the upper 20s. At the summit they could be well below zero. So, we dressed in layers. Thermal underwear. 2 pairs of socks. Followed by a pair of hiking pants and long sleeve shirt. Followed by fleece hiking pants and another long sleeve shirt. Then add on a pair of rain pants. Your upper body is topped off by your fleece jacket and down jacket. Your rain

jacket goes into your backpack. Heavy gloves, balaclava, and fleece beanie finish out your clothing. When that’s done, you head to the mess tent to eat. Even though we had a carbohydrate loaded meal at 6:00, the cooks still prepare another light meal before we begin our summit attempt. We would learn quickly though, that this wasn’t enough. With our headlamps on, we leave camp at 10:45 p.m. It’s cold, but fortunately there isn’t much wind. Like Day One, the beginning of summit night has no “warm-up” area. Immediately leaving camp, you begin the uphill journey. The crater rim sits at 18,700 ft. That makes for 3,300 ft. of elevation and a 4-mile hike to reach it. The steepness of the climb doesn’t allow you to just take one step after another endlessly. You must take one step, slight pause, another step, and so on. And this process slows as you ascend. The path up consists of continuous switchbacks. It’s basically an 18-inchwide dirt path that thousands of people have cut out of the rocks on each side. Although we left at 10:45, most teams leave around midnight. It’s very surreal to look back toward base camp and see all the tiny lights in the distance. In fact, as you go higher and higher and it becomes steeper, you have the feeling that if you slipped and fell, you would slide all the way back to camp.

8/28/19 2:38 PM

Our first extended rest stop came around 17,500 ft. at Hans Meyer Cave. Hans Meyer was the first person to summit Kilimanjaro in 1889. It’s a great place to sit down and reflect on hard it must have been to summit at a time when the mountain was covered in ice. I was still feeling strong at this point of the climb, but that was about to change. The energy expenditure required to climb in the cold, at extreme elevations, and at ascent angles of over 40% at times, is immense. Upwards of 1000 calories an hour. Your hope is that you’ve eaten enough to have the glycogen stored nicely away and to eat enough as you’re climbing to prevent the dreaded “bonk”. I’d like to say that happened for us, but I can’t. It is that way for almost everyone. Even our guides. It’s this section from Hans Meyer Cave to the summit rim at Gilman Point where people begin to give up and turn around. Even one of our group had to abandon her climb. But we trudged on. Step by step. At 18,000 feet you can look up and see what looks like the crater rim. It’s your first moment of hope among the misery of total exhaustion that has laid waste to your body. In reality it’s an illusion. The curvature of that area hides the rim from your view. You will walk for 30 minutes and look up and see what looks exactly the same. And on it goes. 30 minutes becomes an hour, then two. Our pace had become so slow that we could walk no more than 50-100 feet at a time without leaning all our body weight on our trekking poles. We had hoped to be to the crater rim by sunrise, but that time had come and gone. It was approaching 8:00 in the morning, over 9 hours after we had left camp when we finally caught a glimpse of the rim. This is where you shed your first tears. You know you’ll at least make it to the crater rim. It would be 8:30 when we finally stood at Gilman Point. But the work is far from done. This is only 18,700 feet. We still have to navigate the crater rim past Stella Point and then onto Uhuru Point, the summit of Kilimanjaro. The hike from Gilman Point to the summit isn’t steep. Only an additional 700 feet up, except that those 700 feet will take you above 19,000 feet high. It is however a very long walk. For most people this will take about 2 hours. We were already way behind our planned schedule, so we had to move. It would take an hour and a half to reach Stella Point, halfway to the top of Africa. It was 10:00 and we hadn’t summited. We didn’t know if our guide would let us summit at this point. We could barely walk. We had absolutely no energy in our bodies. I will say that I have never been so exhausted in my entire life and I don’t believe I ever will be again. But I wanted to summit. My husband and I had come so far. This had been his dream. It had become mine. It’s amazing how the Kilimanjaro guides will

IMFall'19.indd 45

8/28/19 2:38 PM

people to the summit. Even knowing that a 6-hour descent awaited, our guide Ezekiel was going to push us to the summit. He alleviated out doubts by doing an oximeter test on us to prove we still had it in us. 50% he said and we could still summit. We were at 70%! And then the snows came. As we departed Stella Point, a snowstorm moved in. Not just any snowstorm. 30-40 mile an hour winds. Snow blowing sideways across the mountain. But we were not going to be denied. My husband kept saying “With each step, a success.” And that’s what we did. And at 11:30 a.m. on January 21st, 2019, in a blinding snowstorm, my husband and I embraced each other at the top of Africa, with tears flowing down our cheeks. It was the greatest thing I’ve ever done or will ever do. I’m so proud of my accomplishment. Of our accomplishment. But I wouldn’t have been there without the dream of my husband and the skilled hands of Dr. Clayton. Dr. Clayton had a flag made for me to carry to the summit. Unfortunately, the wind was too strong to get a good picture

IMFall'19.indd 46

at the summit but were able to get a picture at Stella Point once we returned from the summit. But it made it there with me. Our story isn’t quite over there though. We were still in the middle of the snowstorm as we began the journey to our new camp. As thrilled as we were with summiting, we still had the long, arduous descent before us. Descending Kilimanjaro isn’t like ascending. There aren’t a series of switchbacks. It’s basically a straight shot down the mountain. But whereas we started our night at 15,400 ft. and summited at 19,341 ft., we now had to find our way down to 11,000 feet. Most people think that descending is easy. It’s not. Your legs have no energy to support you. The rocks are slippery and tend to roll out from under you. (I feel a couple times.) I got to the point where Ezekiel had to literally grab me by the arm and hold me up as we hiked down the mountain. How he did this for hours is beyond me. Finally, at 7:30 p.m., in the dark, we entered camp. We had been on the mountain for nearly 21 hours! When you reach this level of exhaustion, you only have one thing you can do

When you reach this level of exhaustion, you only have one thing you can do and that’s to cry. Cry for the agony of the day. Cry for the accomplishment.

and that’s to cry. Cry for the agony of the day. Cry for the accomplishment. It’s been five months now and I still cry when I think about what we did. Something that two short years ago wasn’t a possibility. But now and for the rest of my life, I can say I conquered Mt. Kilimanjaro. No one can ever take that away from me. I need to say thanks to my husband for his vision and planning. To our guides for motivating us and their friendship. And to Dr. Clayton and staff. I have a new hip that made a dream come true.

8/28/19 2:38 PM

} SURGICAL TECHNOLOGY

&&A Q

Artificial disc replacement Artificial disc replacement Larry Parker, MD Larry Parker, MD

What exactly is an artificial disc? An artificial disc replacement, also known as arthroplasty, is the replacement of a damaged spinal disc with an artificial (manufactured) disc. When did you perform your first lumbar artificial disc replacement? “In the year 2003. I have performed many since then for both the cervical and lumbar spine.” What “levels/area/region” of the spine can this surgery be performed? “In my opinion typically the Cervical C3-C7 and Lumbar L4-L5 or L5-S1.” Who are good candidates for lumbar total disk replacement (LTDR) surgery? •Patients who have failed conservative management •Patients who have disc disease at 1 level in the lumbar spine. •Patients who lack sciatica (pain radiating down the leg related to compression of a nerve root). •Patients who do not have extreme obesity Who are good candidates for cervical total disk replacement (CTDR) surgery? Newest-generation cervical artificial discs are designed to restore physiologic motion to the spine and are indicated as an alternative to cervical fusion. An artificial cervical disc preserves motion by restoring biomechanical function at the treated level

IMFall'19.indd 48 Untitled-2 1

Untitled-2 1

after native disc removal and potentially reduces subsequent degeneration of adjacent vertebral segments. What are the benefits of a cervical disc replacement compared to the traditional ACDF procedure? Artificial disc replacement may preserve motion and may decrease adjacent level degenerative disc disease as compared to traditional ACDF procedure What are the benefits of lumbar total disk replacement (LTDR) compared to the traditional lumbar fusion procedure? • Traditional lumbar fusion restricts motion between the bones in the lumbar spine to eliminate pain at the diseased segment. This changes the stress points in the lumbar spine and may lead to adjacent level disk degeneration above and below the lumbar fusion requiring future repeat surgery. • Recovery from lumbar arthroplasty may be quicker than traditional fusion. Dr. Parker, in your 20 year experience of performing total disc replacements, how has the technology improved and changed over the years? “Like most technologies, newer generation artificial discs for the cervical and lumbar spine continue to improve as technology evolves.”

8/28/19 2:38 PM 8/21/19 1:54 PM

8/21

ABC's of Good Posture

by, Larry M. Parker, MD

As an orthopedic spine specialist, I can tell you that your posture is essential to your health. Good posture helps reduce back and neck pain, minimizes your chances of needing spine surgery, and enables you to live an active lifestyle. But how can you learn to practice good posture? It’s as simple as ABC. EXPERIENCE GOOD POSTURE Spine specialists use the term sagittal balance to describe a patient's spinal alignment or posture. The best way to learn good sagittal balance is to experience what it feels like. Here are the ABCs that I teach my patients to help them experience the feeling of good posture:

STEP A • Begin standing up with your hands by your thighs–slowly arch your lower back and elongate your stomach muscles.

• Gently pull your belly button towards your spine. In this position you should feel your lower back muscles, upper torso, and shoulders aligning over your heels. STEP B • Rotate your shoulders outward so that your thumbs are pointing away from your body.

• At the same time, draw your shoulder blades together. Adding this step should allow you to feel the muscles between your shoulder blades.

STEP C • With your neck muscles relaxed, look up until your ears line up over your shoulders.

• During this step it’s vital that you relax your jaw and breathe through your mouth and nose. After step C, you should feel your elongated stomach and lower back muscles, the strong muscles between your shoulder blades, and your supporting neck muscles. This is the feeling of good posture.

IDENTIFY POOR POSTURE HABITS On top of experiencing good posture, you can protect your spine by identifying your poor posture habits. Here are some of the posture issues I see at my practice: • In today's world of smart phones and iPads, from a young age we spend countless hours staring down at devices with our necks flexed forward and shoulders slumped. This practice is so widespread that it has led to an epidemic of back and neck pain, or “text neck,” amongst children and teenagers. • As we grow older, we enter the workforce and spend untold hours—with few breaks—sitting at our desk while staring at a computer. This unfortunate habit deconditions our postural muscles and stiffens our spines. • Towards retirement, the cumulative effect of decades of poor posture may result in postural kyphosis, or a permanent flexed-forward posture. A flexed-forward posture comprises quality of life by limiting function, inhibiting balance, and increasing the risk for spinal fractures and chronic back pain. Make posture a good habit You can quickly improve your posture by practicing the ABCs several times a day. If you feel that you need more personalized instruction and strengthening exercises, a physical therapist can evaluate your posture and provide you with additional instruction. Remember that good posture can’t prevent all health problems. If you experience severe back/neck pain or numbness in your arms/legs consult with a spine specialist—these may be symptoms of spinal stenosis or another condition. Take a break right now and practice your ABCs. Good posture can go a long way towards keeping your spine happy and healthy for a lifetime.

StandTall

Practice the ABC’s of Good Posture

by Larry Parker, MD

As an orthopaedic spine specialist, I can tell you that your posture is essential to your health. Good posture helps reduce back and neck pain, minimizes your chances of needing spine surgery, and enables you to live an active lifestyle. But how can you learn to practice good posture? It’s as simple as ABC.

Experience good posture

Spine specialists use the term sagittal balance to describe a patient’s spinal alignment or posture. The best way to learn good sagittal balance is to experience what it feels like. Here are the ABCs that I teach my patients to help them experience the feeling of good posture:

Step A

• Begin standing up with your hands by your thighs—slowly arch your lower back and elongate your stomach muscles. • Gently pull your belly button towards your spine. In this position you should feel your lower back muscles, upper torso, and shoulders aligning over your heels.

Step B

• Rotate your shoulders outward so that your thumbs are pointing away from your body. • At the same time, draw your shoulder blades together. Adding this step should allow you to feel the muscles between your shoulder blades.

Step C

• With your neck muscles relaxed, look up until your ears line up over your shoulders. • During this step it’s vital that you relax your jaw and breathe through your mouth and nose. After step C, you should feel your elongated stomach and lower back muscles, the strong muscles between your shoulder blades, and your supporting neck muscles. This is the feeling of good posture.

Identify poor posture habits

On top of experiencing good posture, you can protect your spine by identifying your poor posture habits. Here are some of the posture issues I see at my practice: • In today’s world of smart phones and iPads, from a young age we spend countless hours staring down at devices with our necks flexed forward and shoulders slumped. This practice is so widespread that it has led to an epidemic of back and neck pain, or “text neck,” amongst children and teenagers. • As we grow older, we enter the workforce and spend untold hours—with few breaks—sitting at our desk while staring at a computer. This unfortunate habit deconditions our postural muscles and stiffens our spines. • Towards retirement, the cumulative effect of decades of poor posture may result in postural kyphosis, or a permanent flexed-forward posture. A flexed-forward posture comprises quality of life by limiting function, inhibiting balance, and increasing the risk for spinal fractures and chronic back pain.

Make posture a good habit

You can quickly improve your posture by practicing the ABCs several times a day. If you feel that you need more personalized instruction and strengthening exercises, a physical therapist can evaluate your posture and provide you with additional instruction. Remember that good posture can’t prevent all health problems. If you experience severe back/neck pain or numbness in your arms/legs consult with a spine specialist— these may be symptoms of spinal stenosis or another condition. Take a break right now and practice your ABCs. Good posture can go a long way towards keeping your spine happy and healthy for a lifetime.

Back Pain & Pregnancy: The Triple Whammy of Having a Child by Larry M. Parker, MD

1. Pregnancy

We all understand that pregnancy is associated with weight gain (20 to 35 pounds is recommended) with most of the increased weight distributed in the abdomen. This increased abdominal weight creates an increase in lumbar lordosis (the amount of arch in the low back) which can strain the joints of the lumbar spine. Pregnancy is also associated with hormonal changes that relax ligaments and joints to prepare the pelvis for delivery which can further aggravate the lower spine and pelvis.

2. Delivery

You don’t need me to tell you that having a child is a life-altering experience for any young woman. But as an orthopedic spine specialist, I do see a lot of young women in their first year after delivery who were not expecting to deal with low back pain as part of their childbearing experience. In fact, a recent article published in the Journal of American Academy of Orthopaedic Surgeons reports at least a 50 percent incidence of low back pain in first-time pregnancies. So why is low back pain such a common problem for pregnant and postpartum women?

To put it simply, it has to do with what I call the “triple whammy” of having a child: • Pregnancy • Delivery • Childcare

After nine months of changes to a young woman’s body associated with full-term pregnancy the big day arrives—the delivery! Delivery may involve a vaginal delivery or a Cesarean section. A natural vaginal delivery involves a massive expansion of the pelvis to allow passage of the newborn through the birth canal. A C-section requires surgically dividing the muscles of the abdominal wall. In either case, delivery of a full-term baby (or babies in the case of twins, etc.) is very traumatic to a young woman’s body.

3. Childcare

So after nine months of pregnancy and the trauma of delivery, any young lady deserves a vacation but in fact, rarely if ever does that occur, because usually childcare starts immediately. Most new moms have very little time to rest and recover. Eight hours of sleep is uncommon. To make matters worse, childcare usually entails new strain on your back, such as hoisting the car seat with the baby in it into the car, carrying a heavy diaper bag over one shoulder, and more. The “triple whammy” of pregnancy is a reality for most new mothers, and back pain can make the experience of having a child more challenging. So what can you do to tend to your back pain? And what if you have had prior back surgery? Can you reduce the risk of back pain during pregnancy? We will look at those issues next time.

HIGH TECH PAIN RELIEF By Jacqueline Makowski

It was exhilarating and heroic work. No other group of people can say they have taken off from and landed on a naval aircraft carrier. United States Naval Flight Officer Tony DeRossett is one of the elite few. Tony served his country traveling at speeds greater than 1,300 miles per hour in the cockpit of the world’s fastest fighter jets. Tony logged more than 3,000 hours of rigorous flights, which over time took a substantial toll on his spine. The continual jarring force of flight maneuvers ultimately compromised the discs and vertebrae in his spine resulting in severe back and neck pain.

“MANY PEOPLE DON’T REALIZE THE STRAIN IT TAKES ON YOUR SPINE WHEN YOU’RE UP THERE, TWISTING AND TURNING DOING YOUR JOB,” TONY SAID. “THE LION SHARE OF MY BACK AND NECK INJURY CAME FROM PULLING G’S.” Tony would routinely catapult from 0 to 150 miles per hour off aircraft carriers at times pulling upwards of 7-Gs or 7 times the force of gravity humans are normally exposed to when on Earth. For perspective, astronauts experience a maximum G-force of approximately 3G’s during a rocket launch. While active duty, Tony received a lumbar spinal fusion for his back pain, as well as a cervical fusion for nerve damage in his neck and arms. The

surgeries allowed him to continue flying for a few years but the pain never completely dissipated. Tony retired from service but continued to work as a defense contractor. Unfortunately, Tony’s pain persisted leading to an early retirement. Tony consulted with Dr. Ronald Collins at Tennessee Valley Pain Consultants and Huntsville Hospital who developed an individualized plan of care. Dr. Collins is an anesthesiology and pain management physician specializing in the minimally-invasive treatment of common spinal, nerve and joint conditions. Dr. Collins diagnosed Tony with Degenerative Joint Disease and offered non-surgical modalities including spinal injections and nerve ablation. The treatments provided relief initially but his pain continued to return. Dr. Collins recommended trialing an innovative therapy called neuromodulation, which controls pain through a small implanted device called a neuro-stimulator. The stimulator acts like a pacemaker for the spine disrupting pain signals traveling between the spinal cord and the brain. “Impulses travel from the device to the spine over thin insulated wires called leads,” Collins said. “The leads deliver mild electrical impulses to an area near the spine interrupting pain signals.” Neuromodulation offers individualized pain relief where patients control the settings to meet their unique needs. “For the appropriate patient, a stimulator can provide long-term therapy for chronic pain conditions and can help reduce the need for oral pain medication,” said Dr. Collins. Dr. Collins coordinated with Dr. Thomas Kraus,

anesthesiology and pain management physician also at Tennessee Valley Pain Consultants, to trial Medtronic’s new Intellis stimulator. “Unlike most medical procedures, patients are able to try this technology first,” Dr. Thomas Kraus said. “The trial helps patients experience how well the neuro-stimulator relieves their pain during different daily activities.” The trial allows patients to receive stimulation therapy for up to 10 days by using an external stimulator mimicking the actual treatment. “It’s important to know the trial is available,” Tony said. “The first good night’s sleep I got, I was sold.” A few weeks later, Dr. Kraus implanted the permanent device. Implantation is similar to the trial with leads placed near the spinal cord and is an outpatient procedure. “With the stimulator, I’ve had a tremendous improvement in pain and my quality of life,” Tony said. “I have more confidence because [my back] doesn’t hurt.” Tony’s stimulator works off Bluetooth technology and is paired with a small wireless handheld device. This allows patients like Tony to increase or decrease stimulation for personalized pain relief. The Intellis system also has an adaptive technology which automatically adjusts as patients change positions such as from sitting to standing. Tony has also been able to reduce the amount of medication needed since the neuro-stimulator was implanted. He offered to share his story to help others. “I’ve improved markedly since starting care at Huntsville Hospital and Tennessee Valley Pain Consultants,” Tony said. “I was miserable for a long time, and I didn’t need to be.” Dr. John Roberts, anesthesiology and pain management physician, also with Tennessee Valley Pain Consultants implanted the first Intellis stimulator in the state at Huntsville Hospital in October 2017.

Tennessee Valley Pain Consultants offers immediate appointments for patients with acute and chronic pain. Call (256) 265-7246 to schedule an appointment with an expert in anesthesiology and pain management. For more than 20 years, Tennessee valley Pain Consultants and Huntsville Hospital have been the regional leader in nonsurgical pain relief services. The practice has the area’s only team of double-board certified physicians in anesthesiology and pain management with more than a century of combined experience. tnvalleypain.com (256) 265-7246

& Orthopaedic Surgery C VID-19 By the time this article is printed and available to read this summer, the impact and threat of the novel 2019 coronavirus pandemic will have changed - hopefully for the better! As I write this article on Monday, April 6, 2020, the coronavirus just like the weather, is in full bloom. The current projection is that the hospital admission rate will peak in 12 days on April 18, so there is hope that by the time you are reading this article our lives will be closer to some normalcy, though what was considered normal just a few weeks ago could be redefined for a long time to come. In our communities here in Huntsville and Madison, the hospitals are under a state mandated moratorium on elective surgery. Orthopaedic surgery is largely elective because patients can limp around on an arthritic knee or hip for a few extra weeks or months because their condition is not necessarily life threatening. However, several orthopaedic conditions that involve trauma and spine related conditions can be emergent or at least urgent. Hip fractures or other broken bones and disc herniations with neurologic deficits are examples of conditions that must be taken care of expeditiously. Fortunately those patients are being taken care of if surgery is needed without hesitation. I have been overwhelmingly impressed by the adjustments being made on a daily basis to provide safe surgical care. The nurses and OR technicians and anesthesia care providers are truly heroes in the effort to take care of patients. In times like these, the true heart of the healthcare worker shines brightly. The Orthopaedic Center is considered an essential business, and our clinics are open and seeing patients every day. We have implemented the practice of social distancing in the waiting rooms. Patients can sign in

By Larry M. Parker, MD

and wait in their cars then receive a text when it is time to go back into the exam room. TOC is also providing telemedicine appointments to evaluate and treat patients remotely. The coronavirus pandemic has created a huge impact on the orthopaedic community for both doctors and patients: Some of the changes that are taking place will probably change the delivery of healthcare for a long time, and some of the changes could be permanent, but I am confident that we will always be able to provide quality orthopaedic care both in the clinic and in the operating room just as we always have. I look forward to reading this article in June, and hopefully we will be in a much better position with regards to this viral pandemic here in the Tennessee Valley and around the country. Be safe! Sincerely, Dr. Larry Parker

I n s i d e M e d i c i n e | Vo l u m e 3 I s s u e 1 7

the

Surgeon

interview

Sitting down with a surgeon can create some anxiety. Obviously if you are needing to consider an operation you have a significant problem, and you are looking for some help. In an emergency setting, the problem or injury is paramount, and the gravity of the situation is the primary driving factor to proceed to the operating room.

Your surgeon will discuss the risks of surgery but generally the risks of not having the operation far outweigh the risks of delaying or avoiding the operation. Even in the emergency setting your surgeon is going to assess you as a patient to predict the potential outcome of your procedure. A surgeon will look at some obvious data like age, gender, and associated health issues. But there are some other not so obvious factors that are important to your surgeon. Let’s discuss. Most orthopedic and specifically spine conditions are chronic and involve pain and functional limitations as the primary issues. In most cases, conservative non-surgical options can be utilized successfully for a while but at some point the decision to consider a surgical approach is contemplated. From a patient’s standpoint, is it a good idea to understand the implications of having an operation. Patients want to know about the surgeon’s reputation and qualifications. How many times has the surgeon performed the procedure? What are the risks and benefits of the surgery? What is the recovery like? What can I expect as the outcome? These are all very reasonable considerations, and I would strongly recommend a patient do their homework before signing up for a surgical procedure. But it is important to understand that just as you are going to evaluate your surgeon, your surgeon is going to evaluate you as well. And this surgeon to patient evaluation is just as important in the outcome of the procedure. The first thing that I assess when I interview a patient is why is he or she here. What are the patient’s motives? What Inside Medicine | Spring Issue 2019

by Larry Parker, MD

do they need help with? Because whatever the problem and whatever the treatment is those are the primary actors that will affect the outcome of the treatment. In fact, I can perform the exact same operation for the exact same clinical problem and the outcome can be entirely different based entirely on the patient’s motives. To say it more simply, a patient is not going to perceive improvement from a procedure if he or she is not motivated to get better. Now you may be surprised by this assessment because you would assume of course every patient wants to get better. Why else would they be considering an operation? Surgeons and physicians call this variable secondary gain. Secondary gain means that patients may have extenuating circumstances that can affect the outcome of the treatment. Patients injured at work or patients who are ready to retire or may be contemplating disability would be examples. Patients injured in a car accident or present with a slip and fall injury may have incentives not to get better if they are involved in a lawsuit. It doesn’t mean that people who face these circumstances are bad folks or even that they don’t have a real problem and need help. From a surgeon’s perspective it is nothing personal against the patient to consider these factors, but it is very important in developing a treatment plan and especially if surgery is involved that THE PATIENT understands these factors may affect outcome! Patients need to understand and be counseled on these issues so that the expectations of results from surgery are understood before the procedure is done. Some more important things that I assess when interviewing a patient is what type of work someone does. If you work on an assembly line or do manual labor the timeline for returning to your regular job duties will be different than if you have a desk job. Is the patient a heavy smoker? How much alcohol or pain medication does a patient use? Does a patient exercise and what kind of physical condition is the patient in? All these variables affect surgical outcome. Sometimes making some corrections on these issues prior to surgery is important and the surgery is delayed. Insurance companies are now denying certain operations on patients who smoke or are significantly obese. To conclude, I think it is important for patients to understand a surgeon is going to interview you as a surgical candidate and that your outcome of a surgical procedure is as much about the patient as it is about the surgeon. So be ready to participate in the discussion so that you can help your surgeon help you!

LumbarFUSION What’s the best Approach? by Larry Parker, MD

Let’s say you have severe back pain or severe leg pain or even perhaps, a combination of both. It is very likely you have tried to get better with physical therapy and spinal injections. Perhaps you have had a previous back surgery to repair a disc herniation and the pain has returned. Your spine surgeon has recommended a spinal fusion. You have heard that some people have it done from the front, others from the back. You have researched spinal fusion on the internet and have seen that there are different approaches to do the surgery. So how does your surgeon decide the best approach for you? Let’s discuss… Your spine surgeon may recommend a spinal fusion as a part of your surgical plan if you have certain conditions. Recurrent disc herniation, spondylolisthesis, scoliosis, and severe degenerative disc disease are common reasons to consider a fusion to correct your condition. In the modern fusion era, spinal fusion surgery offers different techniques that are designed to limit exposure and reduce recovery time. Most patients stand and walk the day of surgery. Some patients can even go home the same day and very few patients need more than a two day hospital stay. The most common spinal fusion is done posteriorly or through the back. This method seems logical. After all the spine is in the back. Posterior approaches allow the surgeon to perform spinal nerve decompression for disc herniations and spinal stenosis. Typically pedicle screws are placed for a posterior lumbar fusion (PLF). An interbody fusion can also be done to allow fusion to occur in the disc space. Trans foraminal lumbar interbody fusion (TLIF) and posterior lumbar interbody fusion (PLIF) are well established techniques. The

bottom line is a posterior approach is best if you need direct nerve decompression for conditions like severe spinal stenosis. An anterior approach or ALIF allows for direct access to the disc space without having to displace the nerves. Usually the approach is assisted by a general surgeon or vascular surgeon to expose the front of the spine. Degenerative disc disease especially at L5-S1 and L4-5 can be addressed through the anterior approach. Restoration of disc height and placement of large surface area implant devices are advantages of the anterior approach. As a general rule, anterior approaches are less painful and easier to recover from. Anterior approaches are a good option for single level degenerative disc disease or in cases where restoration of disc space height is necessary. A newer technique known as extreme lateral lumbar interbody fusion or XLIF requires an incision on the flank. This technique offers similar advantages and has similar indications as an ALIF but can be an easier way to access the upper lumbar areas like L3-4 and above. Finally, in some cases an anterior and a posterior approach is recommended. In cases that require multi-level fusion or in patients with more complex problems a combination anterior/posterior approach may be the best choice to address the problem. An experienced spine surgeon will employ all these different techniques and provide a good opinion on what is the best choice for your case. Remember, the goal is to fix the problem with the least invasive technique that allows the fastest recovery time. Feel free to visit my website to see animations of all these techniques. www.visittoc.com

Lateral Fusion After what seems an eternity waiting, filled with angst, fear, most certainly a sense of resignation, you walk into the office of the Spine Surgeon. You have dealt with chronic severe low back pains with or without intermittent leg numbness, tingling, and again pains. The long journey that got you here included a laundry list of treatments: including enough medications you could fill a pharmacy, exercises, physical therapy, and very likely multiple epidural injections. Imaging tests, including MRI and X-rays, have identified and localized your pain generator and you resign to the idea of continuing the treatments to date ad nauseum. Like it or not, you have now been identified as a prime candidate for spinal fusion. What now? Every day for thousands of patients across the United States these circumstances are their reality. However, obtaining personally applicable information on the internet, which is easy to understand, is close to impossible. Even more difficult is obtaining information on the various surgical options and understanding the personal ramifications of each of these. This is where you rely on your spine physician. For the sake of appropriate context, it is very important to know that low back pain is nearly universal with over 80% of the population experiencing symptoms that require treatment over their lifetime. Yet just a small fraction of these patients end up requiring surgical fusion. Luckily the great majority of patients with low back pain eventually heal and do not require long-term treatment. Unfortunately, for the remaining number of people, the options become limited and significant pains become a daily reality. So what information should you know about your prospective surgery? First, any discussion of fusion surgery should involve what we as surgeons are attempting to achieve. Fusion involves bridging of a spinal level, adjacent vertebrae and intervening disc, with bone to stabilize and eliminate motion

For the Patient

across that level. Achieving successful fusion involves stabilization and removal of motion across that level, which is why we typically add screws and rods. This allows patients to be able to be ambulatory immediately after surgery without allowing gross motion that inhibits successful fusion. An added benefit of this early ambulation and activity involves reducing the incidence of complications, including blood clots and pneumonias. It is extremely common these days to achieve successful fusion not only with insertion of screws and rods, but also by adding additional stability and surface area for fusion with the use of grafts inserted into the disc space after disc excision. Traditionally, these grafts were inserted by entering the lumbar spine from the abdomen, meaning a second incision added to the back incision. As techniques evolved, we then turned to an approach that allowed insertion of a smaller graft through the very same back incision. Grafts were smaller because of limitations of the anatomy, i.e. nerve proximity, imparts to the safe access and visualization of the disc. However, with expert technique, this is a very good option for many. More recently however, the development and refinement of a newer technique marries less invasive, smallincision principles with ability to insert inherently more stable and large grafts. Spinal surgery is an ever-evolving field with the rate of progress amongst the most dynamic in all of medicine. One of the most exciting advancements in the last fifteen or so years is the development and refinement of Lateral-access fusion surgery. This involves accessing the spine and intervertebral disc through a small horizontal incision on the side of the abdomen. The offending disc can be excised and replaced with a relatively large graft, typically made of a synthetic plastic polymer. This graft, combined with screws and rod hardware, allow for the maximal strength possible in stabilization of the spinal level. There is still a requirement for a sepa-

by Javier Reto, MD rate back incision, but these incisions are typically much smaller and associated with less disruption of the lumbar musculature. There are several benefits to be had when using this type of construct. Primarily, it provides the necessary and optimum environment for local bone-forming cells to proliferate and form bone, thus leading to successful fusion. Another significant benefit includes the ability of the lateral graft to improve and often correct scoliotic curvatures and rotational deformities that so commonly occur in elderly patients. This exciting development in surgical technique is a valuable tool all spine surgeons have become aware of and truly accepted. Moreover, most spine surgeons have recently adopted this technique as part of their armamentarium in dealing with pathologies that require fusion surgery. The technique has gone through rigorous scrutiny and proven to be reliable and safe given appropriate training and experience. Where lateral access surgery was once looked at with suspicion and doubt, it has evolved on a level accepted as equal to and many times superior to that of traditional techniques. So youâ&#x20AC;&#x2122;re at the surgeonâ&#x20AC;&#x2122;s office and youâ&#x20AC;&#x2122;re about to discuss fusion surgery. Understand that for you, the correctly identified candidate, it becomes a well proven and significantly successful option. Furthermore, you have a number of techniques that help to achieve goals with success. With appropriate discussion, you should leave the office feeling more confident that the technique chosen is the one right for you.

Robotic spine surgery

by Larry Parker, MD

So you want a robot to do your surgery?

You can now sign up...well at least for robot assisted surgery! Huntsville Hospital has recently purchased the Mazor Robot for spine surgery and it is ready for action. I am sorry to disappoint you or perhaps I am happy to reassure you that a robot is not going to roll into the operating room, scrub in and replace your humanoid spine surgeon at the OR table. So exactly how does a robot help in spine Surgery? Letâ&#x20AC;&#x2122;s describe Mazorâ&#x20AC;&#x2122;s role as a very sophisticated assistant. Spine surgery involves two fundamental tasks: Decompression and Stabilization. Decompression involves the delicate process of relieving abnormal and painful pressure on compressed neural structures namely the spinal cord or spinal nerves. This abnormal pressure can be the result of a disc herniation or arthritic bone spurs that result in spinal stenosis. Even tumors, infection, or trauma can cause painful pressure on neural structures. Pain, weakness or even paralysis can occur from compression on neural structures. Well the robot is not ready to replace the experienced hands of your spine surgeon to perform decompression techniques at least not yet! Stabilization involves strengthening weak areas in the spine. In addition to causing abnormal pressure on nerves, degenerative

disease, fractures, tumors, and infection can destabilize the spine. Stabilizing a weak area of the spinal column involves fusing the weak area to relieve pain and prevent further danger to the spinal cord and spinal nerves. Fusing a weak, degenerative, or unstable segment of the spinal column can also allow the spine to support the body for ambulation. Modern spinal fusion techniques utilize spinal instrumentation. Instrumenting two or more vertebrae together is accomplished by using screws and rods. Screws placed in the spine are typically placed in a narrow tubular structure called the pedicle. This is where the Mazor robot assists the surgeon. Using preoperative imaging from a CT scan the Mazor robot can map out the exact trajectory to safely place the pedicle screw in the best location even with a very small incision. In some cases this allows the surgeon to become more efficient and use smaller incisions to instrument the spine. Patients can mobilize quicker and sometimes go home from the hospital sooner. I expect robotic techniques will continue to evolve and assist the spine surgeon in the operating room. But I assure you that a robot is no where close to replacing your spine surgeon. So if you need a spine surgery go with the advice of your surgeon. He or she may want to leave the robot in the hallway!

Lumbar Disc Herniation 101 by, Larry M. Parker, MD

The most common spine problem that leads a patient to seek medical attention involves the lumbar disc. Diagnostic problems involving the lumbar disc are complex in presentation and therefore each patient’s symptoms are somewhat unique. Some patients have back pain and some have pain in one leg or perhaps in both legs. The pain can be severe or subtle and can come on quickly or slowly. It can appear as numbness, weakness, back spasms, leg pain with no back pain. Every patient is different and a good history is fundamental in figuring out the specific disc problem and how to treat it. Patients can be really confused and certainly anxious because disc problems can cause some serious pain and dysfunction. Rest assured, if you are having some of the symptoms listed above, an experienced Spine Specialist can usually figure out the problem by just listening to you and examining you. “Is my disc ruptured or slipped”? “Do I have a herniated or a bulged disc”? “My Mom had sciatica, and got better with some emu oil”. Most patients have already received some free advice from a relative or friend before they seek a professional opinion. So let’s talk about the subtleties of the lumbar disc…. As I said before, it is all about the history. Lumbar disc problems rarely are the result of trauma, like a fall or a car wreck. Those types of injuries are more likely associated with a fracture, if severe, or perhaps a muscle strain if less severe. Most disc problems are the result of wear and tear and genetics. Most patients just kind of notice a little stiffness for a few days and then suddenly they wake up in severe pain looking for some help. The most distinguishing feature that your Spine Specialist will look for is leg pain known as radiculitis or radiculopathy and commonly known as sciatica. If that is the case, you are more likely to have a herniated or ruptured disc pinching a nerve rootlet in your back and causing the leg pain. Numbness, weakness, difficulty standing and walking, and even difficulty with your bowel and bladder can be present. In these instances, a more urgent approach may be recommended. X-rays and an MRI of your lumbar spine are important and surgery may be necessary if the symptoms are severe and associated with nerve dysfunction. Other options like an epidural injection, or physical therapy and oral medications may be the initial recommendation and can often settle things down without surgery.

If a patient presents with symptoms limited to back pain without leg pain, then a simple back strain may be the cause and the treatment is more cautious. Often times, the problem may not be a back problem at all. Diagnostic studies can be delayed to see if the symptoms will settle down over a week or two. If symptoms persist or worsen, then more aggressive options may be necessary. A degenerative disc or bulged disc that is not putting pressure on a nerve may be the diagnosis. Even these conditions can lead to surgery if they persist for many months and don’t improve with non-surgical treatment. Lumbar disc problems can truly be painful and getting some expert advice and understanding the problem helps out tremendously. Your Spine Specialist will look for the simplest and least invasive way to get you better. Just remember, it all starts with a good history and examination from an experienced professional.

the truth about by, Larry M. Parker, MD

Laser Spine Surgery

What is Laser Spine Surgery? Can spine surgery be performed more effectively and with less complications using a laser? Why is the word “laser” almost synonymous with spine surgery? Of those three questions, the last one is the easiest to answer. That answer happens to be marketing. Google anything regarding disc or spine surgery and you will immediately see advertisements about laser spine surgery. Watch daytime television and you will see countless advertisements about laser spine surgery. So what about the first two questions? What is laser spine surgery and does it make spine surgery more effective or safer? Let’s discuss. First of all, laser spine surgery is NOT a defined surgical procedure and subsequently it is not recognized specifically as a procedure by Medicare or private insurance companies. Microdiscectomy, Decompressive Laminotomy or Laminectomy are examples of defined surgical spine procedures accepted by insurers and Medicare. The confusion really comes from associating, through marketing, the word laser with the concept of Minimally Invasive Surgery. Without a doubt, microdiscectomy surgery and decompressive laminectomy or laminotomy surgery can be done successfully with minimally or least invasive techniques. So the real question is-does the laser make spine surgery less invasive or safer than using a scalpel or electrocautery? The answer is absolutely and unequivocally NO! For a sobering assessment about the subject, search laser surgery criticisms or complications and read the articles by Bloomberg or Business Week. There is a reason why the laser is not routinely used as a tool for spine surgery in peer reviewed institutions like the Mayo Clinic or UAB Hospital. This also includes our local institutions Huntsville Hospital and Crestwood Hospital, and that reason is because a laser does not make spine surgery better or safer. Let’s reset the discussion. New technology and advancing surgical procedures is one of the pillars of modern medicine. No better example of that is surgery for gall bladder disease. In the early 1980’s, cholecystectomy surgery was done with a large abdominal incision. I have some painful memories as a medical student holding a Dever Retractor with two hands while the attending surgeon removed the gallbladder with an open technique. In just a matter of a few years, with the development of minimally invasive laparoscopic techniques, the paradigm completely changed and the laparoscopic technique became the standard of care.

In Spine surgery, there has been a tremendous amount of new technology in the last few decades. Kyphoplasty, Artificial Disc Technology, and advances in fusion techniques with better instrumentation are all examples of peer reviewed technology that has been proven safe and effective and therefore incorporated into mainstream spine surgery throughput the world. You may have read recently about the Mazor Robot or the O-arm which are a couple of new technologies recently introduced into the Huntsville spine market. The laser, as a surgical tool, is not one of them. A laser is essentially a cutting tool that can be used to cut soft tissue. As a spine application, it can be used to perform a procedure called Facet or Dorsal Rhizotomy, a non-surgical pain management procedure to treat back pain, but the laser has not been shown to perform that procedure any better than radio frequency or electrocautery. Using a laser as a surgical tool to treat nerve pain related to disc herniations or spinal stenosis has not been proven safer or more effective than a scalpel or electrocautery and further does not make disc or spinal stenosis surgery anymore minimally invasive. Let’s keep it simple, if the laser was a great tool that made spine surgery better, spine surgeons all over the country, including the local spine surgical community here in Huntsville, would be using it. To conclude, most spine surgery for leg or arm pain caused by a disc herniation or spinal stenosis can be performed with a small incision as an outpatient procedure. In our community, spine surgeons perform these procedures and send people home the same day, every day. Just remember that in most cases, it is not the surgeon that makes the procedure large or small, it is the diagnosis that makes the procedure necessary to fix it “large or small”.

Inside Medicine | Spring Issue 2018

Patient Spotlight: Martha Campbell Pullen, Ph.D. Have you ever met someone who leaves you thinking, “How do they do it all?” Martha Pullen, a north Alabama native and entrepreneur since age 14, moves in one direction – forward. Martha, a leader in the heirloom sewing industry, turned her passion of sewing into a multi-million dollar company, hosting a television program on PBS, founding Sew Beautiful magazine and leading conventions locally and globally. Travel was a way of life for Martha until 2013 when she began experiencing intense back and radicular leg pain. The pain prevented her from sitting for more than 30 minutes at a time and began to significantly inhibit her work and lifestyle. “I was afraid to drive or board a plane,” Martha said. “The pain was completely affecting my way of life and ability to travel for my business.” Refusing to let pain limit her, Martha went to Tennessee Valley Pain Consultants at Huntsville Hospital for an evaluation. Martha saw anesthesiologist Dr. Ronald Collins who ordered an MRI of her lumbar spine revealing spinal stenosis. Spinal stenosis is a common spinal condition where there is narrowing of the spinal canal often presenting with radiating leg symptoms. Dr. Collins recommended a series of lumbar epidural steroid injections as well as physical therapy for her condition. Epidural steroid injections are a non-surgical treatment option for patients experiencing neck and back pain and are particularly beneficial for treating radiating pain. It was determined Martha was not a surgical candidate, which made injection therapy her pathway for pain relief. Dr. Collins pin-pointed the spinal level producing her pain using real-time fluoroscopic x-ray guidance and injected a steroid-anesthetic bathing the painful nerve with soothing medication. “Patients suffering with back and neck pain like Martha can find relief with non-surgical interventions such as injection therapy,” Dr. Collins said. “Our goal is to treat patients with a minimally invasive approach.” Martha was able to return to business travel almost immediately after receiving her first injection. She has continued traveling across the country and globe with a new focus – teaching entrepreneurship and resilience. “It was miraculous,” Martha said. “Literally, the next day I was able to get back on a plane and continue my business. One block will relieve my pain completely for 3-4 months and sometimes up to one year.” Martha’s most recent venture is authoring the book G.R.A.C.E. (God. Resilience. Action. Creativity. Enthusiasm.) Keys to Entrepreneurship. Martha personally experienced the importance of resilience after suffering with back pain. “You conquer by continuing,” Martha writes in her book. “Behind every great success story are a dozen stories about preserving through difficult times.” Pain relief is transformational for many patients who suffer with persistent spine and extremity pain as Martha did. Nearly 100 million people in the United States suffer with chronic pain – more than those living with diabetes, heart disease and cancer combined. Due to its subjective nature, pain is often difficult to measure but important to address. Pain serves as the body’s “warning signal” for a problem requiring attention. “Our goal is to treat the pain at its source,” anesthesiologist Dr. Morris Scherlis said. “This often involves injections to precise pain generators and can markedly improve a patient’s quality of life.” Tennessee Valley Pain Consultants provides the area’s most experienced and advanced non-surgical treatment options for common spinal, nerve and musculoskeletal conditions. The practice has five double board-certified anesthesiology and pain management physicians with more than 80 years combined experience. Visit tnvalleypain.com to view educational animations on conditions and treatments provided.

Dry Needling by Michael Beuoy, PT, Cert. MDT

pain should not be allowed to control your life In a society where prescription pain medication is under scrutiny, other options to help manage pain need to be explored.

Pain affects us all at some point. Many reasons for pain exist, but often the soft tissue that we are made of plays a significant role in the discomfort that we feel. This tissue includes our muscles and the connective tissue, or fascia, that hold us together. When these tissues are dysfunctional, they do not move appropriately and can restrict circulation. Tissues that do not get enough oxygen have a difficult time healing and can create limitations in motion and our ability to move or perform normal tasks that we do daily. Many options for pain relief are available. As a physical therapist, we are trained in a variety of manual techniques, corrective exercises and modality treatments to help ease pain. One such treatment that is not as well-known is called dry needling. This is a treatment performed by a skilled, trained physical therapist that involves inserting a small, solid needle into the dysfunctional tissue to release trigger points. The insertion of the needle has a local effect on the tissues around where it is inserted. It also creates a systemic response, causing the release of endorphins by the brain to give an overall analgesic effect. The result is decreased tissue tightness, increased circulation, improved mobility and pain relief. Dry needling can be performed on acute injuries such as hamstring strain or ankle sprain, but it is also effective at helping with chronic pain issues. The frequency and number of treatments necessary varies for each patient. Some patients get relief of pain with a single session, while others require multiple needling treatments combined with other physical therapy interventions to see maximal improvement. The length of the session and the number of needles used will depend on the area and number of structures that are to be treated.

The most common question about dry needling is “Is it acupuncture?” The same needles are used to perform both, but the structures being treated are different. The second most common question is “Does it hurt?” This varies from person to person. Most patients report a deep ache while the treatment is being performed. Some patients report not feeling the needle at all. Localized soreness can be reported in the hours following the treatment, but that is usually minimal and resolves by the next day. The risks associated with dry needling are few and the incidence rate of these risks is very low. These should be discussed with the patient by the therapist that is to administer the treatment prior to the initial session. “Does my insurance cover it?” This depends on your specific policy. Many insurance companies are covering the procedure, but several do not. Cash options are available if the treatment is not covered under your plan. Patients dealing with pain have often tried many forms of treatment to seek relief. Maybe it is difficulty with running a marathon. Maybe you’re unable to play with your children or grandchildren. Or maybe, you deal with constant pain. Regardless of your situation, pain should not be allowed to control your life. In a society where prescription pain medication is under scrutiny, other options to help manage pain need to be explored. Dry needling can be one of those options.

Michael Beuoy PT, Cert. MDT Partner/Director TherapySouth Huntsville 256-513-8280

Rehabilitation by Donald Lewis, LPTA

When recovering from an injury, disease, illness or surgical procedure, rehabilitation is a major step in achieving optimal health for the patient. The goal for patient rehabilitation is to gain and restore sensory and mental capabilities, as well as motor skills lost. Rehabilitation for patients includes the evaluation and diagnosis of need for short or long-term care. The consult is generated after certain types of injury, illness, or disease, including amputations, arthritis, cancer, cardiac disease, neurological problems, orthopedic injuries, spinal cord injuries, stroke, and traumatic brain injuries. The Institute of Medicine has estimated that as many as 14% of all Americans may be disabled at any given time. The definition of rehabilitation is a treatment or treatments designed to enable the patient’s recovery and consists of restoration of the patient’s physical, sensory, and mental states to compensate for deficits that cannot be reversed medically. Rehabilitation should only be carried out by qualified therapists. Patients and their physician must take into account any and all deficits the patient may present. Rehabilitation addresses the patient’s physical, psychological, and environmental needs. It is achieved by restoring the patient’s physical functions and/or modifying the patient’s physical and social environment. Types of rehabilitation include physical, occupational, and speech therapy. Patients seeking rehabilitation should have a tailored program designed to address the individual patient’s needs. The program can include one or more types The plan for patient of therapy, depending upon the deficit and desired outcome. The rehabilitation is to gain patient’s physician coordinates the efforts of the rehabilitation and and restore sensory, consults with team members on the physical, occupational, speech, or other therapeutic teams to establish consistency and the highest mental capabilities, quality of care. Many referring physicians compose a team of nurses, and loss of motor skills physiatrists (physical medicine), psychologists, and/or orthotics (indue to injury, disease dividuals making devices to straighten out curved or poorly shaped or complication. bones such as a prostheses) to coordinate the rehabilitative needs of the patient. In keeping with a physician’s commitment to assure optimal patient care, specialists in physical medicine and rehabilitation are consulted. Physical therapy helps the patient restore the use of muscles, bones, and the nervous system through the use of heat, cold, massage, whirlpool baths, ultrasound, exercise, and other techniques. It seeks to relieve pain, improve strength and mobility, and train the patient to perform important everyday tasks.

Physical therapy may be prescribed to rehabilitate a patient after any of the disease, injury or illness described previously. The duration of the physical therapy program varies based upon the deficit being treated and the patient’s response ttherapy. Exercise is the most widely used and best known type of physical therapy. Depending on the patient’s condition, exercises may be performed by the patient alone or with the therapist’s help, or even with the therapist moving the patient’s limbs. Exercise equipment for physical therapy could include an exercise table or mat, a stationary bicycle, walking aids, a wheelchair, practice stairs, parallel bars, pulleys and weights. Heat treatment, applied with hot-water compresses, infrared lamps, short-wave radiation, high frequency electrical current, ultrasound, paraffin wax, or warm baths, is used to stimulate the patient’s circulation, relax muscles, and relieve pain. Cold treatment is applied with ice packs or cold-water soaking. Soaking in a whirlpool can ease muscle spasm pain and help strengthen movements. Massage aids circulation, helps the patient relax, relieves pain and muscle spasms, and reduces swelling. Very low strength electrical currents applied through the skin stimulate muscles and cause them to contract, helping paralyzed or weakened muscles respond again. Occupational therapy helps residents regain the ability to perform daily tasks. This c an b e achieved by restoring p revious s kills o r teaching new skills to adjust to disabilities. Adaptive equipment, orthotics, and home modifications a re t ools t hat o ccupational therapist use to help residents adjust. Adaptive equipment can be used to improve self-care tasks, for instance bathing, grooming, and dressing. Occupational therapy can evaluate a resident’s home and mobility needs. After the evaluation, recommendations and assistive devices are provided to improve the resident’s safety. The duration of occupational therapy varies depending on the disability and how the patient responds to therapy services

Speech therapy aims to provide interventions to improve and maintain patient’s communication skills with treatment targeting cognition, speech, language, hearing, and voice with a variety of population groups including patients who have experienced traumatic brain injury, stroke, patients with degenerative neurological diseases, dementia, head and neck cancer, etc. Additionally speech therapy services provide swallowing interventions to strengthen and coordinate oral, pharyngeal, and laryngeal muscles for safe swallowing and decreased risk of aspiration. Therapy activities are designed to improve functional communication skills and swallowing using a variety of tools ranging from use of augmentative/alternative communication devices, techniques for improving memory, strategies to aid with intelligible speech, adjusting patient’s diet to decrease aspiration risk, use of neuromuscular stimulation in combination with strengthening exercises for improved swallowing, etc. Speech therapy collaborates with dieticians, audiologist, nursing staff, and other therapy team members to gain a holistic perspective to patient healing and progress. Audiologists help diagnose the patient’s hearing loss and recommend solutions. Dietitians provide dietary advice to help the patient recover from or avoid specific problems or diseases. Rehabilitation services are provided in a variety of settings including clinical and office practices, hospitals, skilled-care nursing homes, sports medicine clinics, and some health maintenance organizations. Some therapists even make home visits. Advice on choosing the appropriate type of therapy and therapist is provided by the patient’s medical team. Note: Information in this article was found online in the Medical Dictionary and the website for SportsMED Orthopaedic Surgery & Spine Center.

When two become one

PATIENT

Our culture and society have allowed us to become complacent with our daily activities; job, family life, friends and even our religion. Often times, we don't realize the importance of maintaining our health as it results a major impact on these categories. "Health" that has a tremendous role in our dayto-day livelihood. That is unless you become injured and for this, a couple, conquering life at its fullest was a daily and long-term goal that became quickly disrupted by a result of painful symptoms that followed in surgical intervention. Not for one but for both. Staying active and passionate about their endeavors as they encountered an interruption neither had anticipated, began with a desire for answers. Having had the opportunity to sit down with Mr. and Mrs. Dieringer of Huntsville, AL and discover their journey as they walked me through an unfavorable circumstance yet a rivaling recovery had me stunned at their positive recollection of the experience they both endured and triumphed through.

Married for decades and both still working full-time, they always treated life as if they were retired living life to the fullest staying active and holding onto their dreams.

However being accompanied by discomfort and lack of mobility, they had to rigorously train themselves to accomplish simple day-to-day activities. One painful memory for Mr. Dieringer to explain was his discomfort even driving to work. It was once a passion to drive his Harley motorcycle across the U.S. landscape, and now it was a self-medicated way for transportation to and

by Kelly Reese

from work. The wind that once flew past him at ample speed now became distant sound. It was now a relief that he could get as an alternative to driving in a vehicle with less appropriate lumbar support. Why had this couple's lives been turned from merely perfect in the American mind to now a complacency like the majority of us experience? "Getting by." This was a couple who divulged in their travels and loved life for all the versatility, yet they were troubled by unbearable pain. It was time to do something about it. Luckily like we most desire, the two shared common goals and common outcome from their decisions. One decision Mrs. Dieringer had made only weeks before her very own impromptu surgical procedure. She led into the details of her preliminary trials, difficulty completing normal daily duties she had long since been performing for decades. Something had to be done, and she was sure something was wrong. She promptly took her healthcare into her own hands and discovered a possible resolution. It started with her and the medical advice regarding what she thought to be a shoulder issue. "After my consult with our shoulder specialist, an MRI was ordered, which led me straight to the orthopaedic spine specialist, where I discovered only days later I was going to have surgery. My symptoms were a result of a pinched spinal cord; the concerns were too great." If she didn't have surgery, other possible consequences could be ahead involving possible but not probable paralyzation. I had no idea that my symptoms were so serious. At this point, all I could say was how much I loved this physician's bedside manner. He was truly wonderful. Wonderful! He made me feel like a person. I wasn't treated like a number." "When I went for surgery, he marked my site with a peace sign (I am a Hippie, she gladly proclaimed)." "Waking up was another story. Wait... I don't need a neck brace? My quality of life was drastically changed by my post-operative outcome. Immediately, I came out of anesthesia and jumped, startled to think, 'Oh no, I just had cervical surgery, and it should have hurt.' However, it did not. I had no idea how quickly I would recover. I started cleaning house and was right back to work."

Wow, what an incredible testimony by this couple. Mrs. Dieringer was overcome with joy when she shared the days after her recovery. I should probably just leave out that it was merely hours that she recalled having full mobility as if she had not undergone a cervical disc replacement, but why not share her good news. Especially when only weeks later her husband had spinal surgery by the same specialist to adamantly decline a walker. I was floored! How amazing was their testimony? Would it not be great if we all could restore our normal lives by treatment and intervention as long as we seek the appropriate medical advice? I encourage anyone after hearing this story to stop living in pain and do something about it! This sweet couple has since visited Alaska and gone biking for long periods of time. Did I mention enjoyable rides, played with their dogs, and discovered that they can conquer the daily task as well as their dreams together? I'm glad to live in a community with such amazing healthcare providers and couples that serve our community as advocates of a healthy and prosperous life! Most people dream of a lifetime spent with a spouse who can engage on all levels of interest with little that they don't find compelling to the other having common goals and interests. This is highly sought after and important to the average person. Don't let pain keep you from enjoying a healthy lifestyle.

Ride about a year and a half ago. The goal was to complete 1,000 miles by motorcycle within a 24 hour period. He and his friend completed 1,079 miles in 15.5 hours! This is a feat that would have been impossible prior to his surgery. "Would I recommend Dr. Freudenberger? H.... YES, Dr. Freudenberger comes in and sits down and talks to you just like you're talking to me now. I've since recommended multiple people to this spine specialist. Not only did he explain thoroughly what was going on, he took the time to make sure we understood. And since we both have gone back later for other concerns, it was nice knowing that he would recommend the conservative approach of injections and other non-surgical options before going straight to surgery when possible. When a surgeon actually recommends no surgery for the best possible outcome, then you know you can rest assured that you're receiving optimal care." Seeing an orthopaedic spine specialist who treats your diagnosis daily is very comforting. He commits to putting people like us back on the road again where feeling the wind as we drive into the sunset...possible. We are here to tell you that we are doing just that! Originally, I had just hoped for a good quality outcome where I could just have a range of motion to do my job. I honestly didn't expect it to be as rewarding as it was."

Women a greater risk of needing When Itoday askedhave her the simple question that I so ofLong Term Care services. It's important ten hear about do you wish youvery would have done it forsooner, women to develop Long Term My Care her response was a"Oh absolutely! quality of life was drastically changed my post-operative strategy to help preserve theirbyfamily, career, outcome. My quality of life before had been lifestyle, health and total financial future. diminished. I had gotten to aprotection point wherecan I was calling Long Term Care save a in extra help at work just to perform the duties that I woman from the high costs of care. It also was able to easily execute prior to my injury. Living provides them disc withdid choice, independence with a cadaver not keep me from skydiving and importantly, to not be a burden on or most hang-gliding!" loved By arranging Long Hey, ones. this couple is a description of Term what a Care bucket list should be. Now, for Mr.women Dieringer,can How would protection for others, stay on you relate your story to your experience. The same? track to protect their savings and keep their "During my wife's initial visit with Dr. Freudenbergcareer. er, I discussed with him how I was a disabled veteran Chances are that you have experienced with multiple back issues. Instead of dismissing these caring for and a loved at some point concerns only one focusing on my wife in (hisyour patient), life, you know it cantobe. he so addressed themhow and demanding spent time talking me. As Your love fortoothers is whyI was youquickly shouldscheduled do a follow-up my concerns, for an MRI bold and my ownbegin appointment with him. something and planning for My quality of life for years was awful. I had to sleep on a Long Term Care now. waterbed for minimal comfort.

I was taking medication and multiple epidurals a year for pain. I was told that there was nothing else I could do... until Dr. Freudenberger.

Care for yourself the same way you care for others. Fast forward years later, and I can proudly acclaim that my degenerative disc has been surgically corrected by a synthetic disc replacement. This is with no pain and no need for medicine for intervention. In fact, I must add that I carried my walker proudly through the Call local Long hallsyour of the hospital the nightTerm after the Care surgery when I was asked to move around. It was going to lead me, professional for more information. I held it. The memory of 17 years of canes, pain pills, Anne C.relaxers, Jewell, and muscle and256-533-0001 I now needed nothing! Dependent only on my now recovery." To further acknowledge how successful the surgery was for Mr. Dieringer, he participated in the Iron Butt

DISK

artificial

Replacement Living in a high-tech community,

surgery. In clinical studies, patients

surprise that our medical providers

were three times less likely to have

driven by innovation; is it’s received a lumbar in artificial disc Dr. Curt Freudenberger the no Firstwho Spine Surgeon

advancements in adjacent level problems five years Alabama todemenstrate Offer the activL® Artificial Disc Replacement their daily practice. On June 6, after their procedure than patients

About Aesculap Implant Systems, LLC Aesculap Implant Systems, LLC, a B. Braun company, is part of a 175-year-old global organization focused on meeting the needs of the changing healthcare environment. Through close collaboration with its customers, Aesculap Implant Systems develops advanced spine and orthopaedic implant technologies to treat complex disorders of the spine, hip and knee. Aesculap Implant Systems strives to deliver products and services that improve the quality of patients’ lives. For more information, call 800-234-9179 or visit aesculapimplantsystems.com.

IMFall'19.indd 19 ActiveLbadFraud.indd 2

2019 – Huntsville surgeon, Kurt who received a fusion. “Not every for Chronic Low BacktoPain Fruedenberger, MD performed patient is going be a candidate a lumbar disc replacement using for this procedure and that’s OK,” a 3rd generation activeL. This said Dr. Freudenberger. “Fusion isn’t newly introduced implant will be a bad procedure, if it is indicated. a game changer for our area spine Still it’s important that patients have surgeons. In fact, it once again puts access to providers and facilities that Huntsville on the map as the first will consider the best option for each city in Alabama to offer the latest patient’s anatomical needs.” generation Aesculap artificial lumbar The literature supports that within disc, a disc designed to address six-months of lumbar artificial disc chronic low back pain caused by surgery more than 86% of back pain degenerative disc disease. In contrast patients will go back to full-time with other treatments such as spinal employment without restrictions fusion, the activL Artificial Disc is and because of their decreased pain designed to more closely mirror the and increased function will be able natural movement of the healthy to stay off narcotics. “The activL human spine following surgery. trial found that 98.5% of lumbar disc 450,000 Americans will have spine patients are still narcotic free more surgery each year because of chronic than five years after surgery,” said Dr. low back pain. “Lost work time due to Freudenberger. chronic back pain is something that “The benefits of artificial lumbar many of my patients are significantly disc replacement have been equal concerned with and for good reason,” to my experience with cervical disc said Dr. Freudenberger. By the time replacement. My patient was up and that chronic back pain patients seek waking the same day of surgery with out surgical options for their chronic her old pain completely gone,” he said. pain, studies have shown that 30% “In addition to addressing painful are narcotic dependent and out of symptoms caused by degenerative work. disc disease, minimizing recovery “For me, the evidence for motion time, preserving disc space preserving surgery like this one made between the vertebrae, maintaining sense. I saw that there were benefits to range of motion in the spine, and the procedure that would help some reducing the possibility for future of my more active patients,” said Dr. surgeries are all key factors when Freudenberger. Fusions have been thinking about surgical options for associated with causing patients with patients. Artificial disc replacement low back pain to start experiencing accomplishes these goals and allows pain at levels adjacent to their initial patients to get back to the activities fusion several years after their they enjoy.”

8/28/19 2:383:59 PM PM 8/23/19

my story a patient's perspective BY MICHAEL T POTTER

Shortly before Christmas 2018, I was recovering very well from a lumbar procedure done in mid-October. But the day after New Year’s 2019, I began to have discomfort in my lower spine. Within two days, I was back to using a cane.

1 DIGRESSED to needing a walker SCHEDULED AN APPOINTMENT

SPINE SURGEON

By the 4th day, I had digressed to needing a walker. Our son-in-law (Justin Tarr), who works for Dr. Freudenberger at SportsMed, scheduled me an appointment for Monday the 7th of January. As we got ready to go that morning, I collapsed on our bathroom floor - my legs lost their strength. Thankfully, Patricia (my wife) had alerted several neighbors to be on standby in case we needed help. So, within minutes, she had two big guys helping me out the door and into the car. We gave Justin a heads up to meet us with a wheel chair.

2 COLLAPSED at home TRANSPORTATION TO SPECIALIST

HELP IS HERE

3 SURGICAL CONSULT MRI SURGERY WAS SCHEDULED

BOTH RARE AND SERIOUS

1 Intrathecal disc herniation occurs when disc material related to an intervertebral disc hernia penetrates the spinal thecal sack.

IMFall'19.indd 22

8/28/19 2:38 PM

[

brief consult, Justin did his SportsMed “magic” and I had Lesson 8: Loved Ones First an MRI in record time. As soon as Dr. Freudenberger

saw it,number he came in and is told that he suspected an intraLesson eight tous make family a priority. In the thecal disc herniation, but would not know have for sure “Blue Zone” communities, centenarians a until strong he operated on me. The initial plan was to do a fusion sense of duty when it comes to family. They live close toof my affected vertebrae and remove the disc material gether have established family rituals orwere traditions. - I wasand admitted to Crestwood by noon. We not Shared andtype activities play an important their awaremeals that this disc herniation was bothpart rareof and serious. lives. everyday From our experience in October, we had trust in Dr.

Lesson 9: Right Tribe Freudenberger’s skills and his intelligence – the man is

a logical thinker a brilliantyourself surgeon.with We people knew his The last lesson is and to surround that deductive reasoning would always focus on the best share “Blue Zone” values. These people are your tribe. outcome for me as a patient. “Blue Zone”morning’s communities have close affirm social that circles that Tuesday surgery did indeed I had an intrathecal and and therewith waswhom material inside they count on inherniation difficult times they create the thecal sack. However, after completing the T-LIF strong bonds of friendship.

functions. Less than 3 months post-op, I am walking without the need of a brace, nor do I need a cane all the time. I feel that I am more than 85% back to normal. The day after my 2nd surgery, I redeveloped some cardiac rhythm issues that extended my stay in Crestwood a total of 11 days! Hence, we experienced the care of both the orthopedic and cardiac staffs at Crestwood. In addition to the skills of my surgeon & his team, I, and my family, cannot adequately express our heartfelt gratitude to the hospital staff. The nurses and tech crew, the cardiac and hospitalist doctors were all customer-focused and professional. Even the facilities maintenance folks were attentive. Department managers would frequently stop by to see if we needed anything. The hospital system Crestwood has created is simply better than anything we have experienced anywhere. While I was glad to finally get out of the hospital, my wife and I truly missed the people we met and befriended. We often talk about them and how caring they were to us. Now, I am recovering as well as one could hope. Looking back on this experience is a constant reminder of how truly blessed we are. Every aspect of this “adventure” could not have been better scripted in our favor. Drs. Freudenberger and Dixit operated as a team to perform the spine surgery. Dr. Freudenberger is an orthopaedic spine surgeon specializing in degenerative spine, spine trauma, disk herniation, complex spine situations and minimally invasive surgeries. Dr. Dixit is a board certified neurosurgeon specializing in the treatment of both brain and spine disorders with an emphasis on minimally invasive therapies.

fusion, Dr. Freundenberger suspected I had additional

Live Long andstill Live Wellmy in Your Own Zone” disc matter inside spinal cord“Blue that was not

visible. He judged, however, it was not worth the risk of

If continuing you have any interest in living long and living well, I enthe operation with exploratory surgery. courage you to pick up a copy an of this It’s full offor valuTo satisfy his suspicion, MRIbook. was ordered able information and inspiring After you read Wednesday morning and morestories. disc material was in- it, deedyour discovered. Dr. Freudenberger, of share ideas ofNeither “Blue Zone” communities nor withany others. the surgeons he knew, had operated on this type herniation. But he was confident he could do the surgery and assemble thevisit right team toat make it happen. After For more information Traci’s blog tracimccormickmd.com discussing all the options available to us, we decided to have a second surgery on Thursday afternoon. It was then that the severity of my situation hit our family - potential paralysis, loss of bladder and bowel functions were all real possibilities. It would be impossible to enumerate the fear-provoking scenarios that ran through our minds. My wife and I had experienced her father becoming a paraplegic and living with that condition for 28 years. We didn’t have to work very hard to envision the negatives of being paralyzed. Our pastor happened to be paying us a visit at the moment we found out the MRI results. I’m not an emotionally religious man, but I know that at some point one must realize we are not in control of every outcome. We must lay that worry at the feet of our Maker and trust in God, as well as the medical professionals we had on our side. We had done all we could and had the best medical support for which one could hope. I’ll never be able to express the calm I felt once I simply trusted in my faith. Thankfully, the Thursday surgery was a success! I had no paralysis and full control of my bladder and bowel

100 years old

Inside Medicine | summer 2017

IMFall'19.indd 23

8/28/19 2:38 PM

BACK PAIN… a patient testimonial by Jackie Makowski

From jumping out of airplanes with a parachute strapped tight around his body to patrolling the dusty streets of postwar Iraq, Taurus Smith has had a distinguished 20-year career in the United States military. As a high school graduate, Smith had joined the ROTC as a way to pay for college. What he found in the military was a fulfilling career his family could be proud of and a powerful camaraderie of service men and women who shared his ideals. Yet some of the challenging, mandatory training in the military has led to back pain in recent years. When Smith, who is a military member stationed in Huntsville, Alabama, began experiencing excruciating back pain several years ago, he thought the military career he loved was in jeopardy. After seeing several different types of doctors, he eventually found his way to the Tennessee Valley Pain Consultants, who successfully reduced his pain and helped make it possible for him to continue serving the country. TAURUS SMITH’S PATIENT STORY There is a saying in the military that “everyone is a rifleman.” Since every serviceman can be deployed around the world at any time, the military requires every member to stay at high standards of physical fitness. For Smith, there have been challenging 12-mile road marches carrying a 40-lb rucksack on his back and a weapon in his arms. He’s jumped out of a helicopter and accidentally landed in a tree with his feet dangling six feet off the ground. He’s completed four-mile runs followed by 12-mile road marches while training lieutenants. For most of his career, Smith completed the physical fitness tests and exercises with no problems. But then the pain started a few years ago.

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

“It was really bad aching pain, a throbbing in my lower and middle back. It got to the point where I started taking all types of anti-inflammatories. W hen I was ordered to do a physical fitness test, I would take painkillers and then take more after the test was over just to reduce the pain,” Smith said. “Sometimes it would take a while to stand up straight.” “I was pretty sure that my military career was going to be over.” Smith sought treatment from a variety of doctors who couldn’t quite pinpoint the condition or provide significant relief. He first s aw a p hysical t herapist w ho worked w ith him on a program of exercises to strengthen the hip and stabilize the pelvic area – to no avail. His primary care physician referred him to a rheumatologist to examine him for rheumatoid arthritis. Another doctor examined him to see if he had a bulging disc in the spine. “No one could say specifically what the problem was,” he said. GETTING PAIN RELIEF Finally, Smith was referred to the Tennessee Valley Pain Consultants at Huntsville Hospital, where specialists in pain management pinpointed the source of his pain. They administered a series of facet joint injections, which has dramatically increased his mobility and reduced his pain. Dr. John Roberts is a double board-certified physician in anesthesiology and pain management at the Tennessee Valley Pain Consultants who has treated many patients like Taurus Smith in his career. Dr. Roberts served 12 years with the United States Air Force and was the Chief Anesthesiologist and Director of Acute and Chronic Pain Services at Keesler Air Force Base in Biloxi, Mississippi.

When patients like Mr. Smith come in with injuries and progressive pain over many years and they may not have been given discriminate information about the cause of the condition, our physicians will take an extensive patient history, conduct a physical exam, and look at the imaging to determine the source of the pain. 18

- John Roberts, MD, DABA

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

For Taurus Smith, the team at the Huntsville Hospital and Tennessee Valley Pain Consultants then administered diagnostic injections to determine the exact part of the spine that was generating the pain. Mr. Smith was diagnosed with spondylosis, a degenerative condition affecting the joints or facets in his spine. A physician administered facet joint injections which delivers anti-inflammatory steroid medication. The injections were successful and reduced Smith’s pain by 50 percent. Getting significant relief from longstanding pain means that patients like Taurus Smith can start stretching and moving the joints and muscles that have become less mobile over the years. The immobility caused by the enduring pain typically shortens the muscles and deconditions the part of the body where the pain is found, which causes even more pain and suffering. “Our goal is to break that cycle of pain,” Dr. Roberts said. Dr. Roberts emphasized that while there is no cure for degenerative problems that have caused progressive pain, “What we can do is manage the pain and improve people’s lives and their daily functioning.” Taurus Smith currently receives quarterly facet joint injections administered by his physician in Huntsville Hospital’s outpatient procedural suites located in Governors Medial Tower. The relief from his back pain has made it possible for him continue his military career, including resuming his duty of leading high intensity trainings for young lieutenants. “The pain isn’t gone but the level of intensity has been reduced from a 9 to a 5. Now it’s more manageable to stay fit,” he said. “I’ve been in military the 20 years, going on 21. It’s the only real job and career I’ve had in my life and it’s all I’ve known since I’ve been an adult. I identify with being a military member and love working with other people who have the same ideals of selfless service, protecting freedom and the Constitution,” Smith said. “It was disappointing to hear someone tell me initially that I’m medically unable to continue this career, so it was definitely great to have found a way to continue to serve without excruciating pain.”

Tennessee Valley Pain Consultants offers immediate appointments for patients with acute and chronic pain. Call (256) 2657246 to schedule an appointment with an expert in anesthesiology and pain management. For more than 20 years, Tennessee Valley Pain Consultants and Huntsville Hospital have been the regional leader in nonsurgical pain relief services. The practice has the area’s only team of double-board certified physicians in anesthesiology and pain management with more than century of combined experience. tnvalleypain.com (256) 265-7246

by, Josh Woods

ceso's mission: to equip physical therapists with the tools in healing, strengthening, and empowering people. Aceso Design was launched with the passion to intersect modern engineering and physical therapy and to advance the effectiveness of patient rehabilitation. By replacing traditional weights with a combination of a high-powered servo motor and advanced software controls, Aceso has built a system specializing in three fields of physical therapy: strength training, exercise science, and rehabilitation. Strength training with Aceso aims to offer the most intuitive and accurate workout every time. Paired with an app in the user’s device and using templated settings, Aceso automatically adjusts to ensure that each rep maximizes work within the parameters of the individual’s rehab schedule and physical ability without risk of injury or damage. Integrated micro processors in the machine evaluate each workout live in conjunction with your device to recommend new routines, helping reach your fitness goals. In the focus of exercise science, Aceso’s servo motor can process over 1,000 data points per second in real time to your connected device. From your device, the data from each workout can be clearly viewed according to the metrics you choose to focus on. Aceso specializes in gathering data sets such as range of motion, velocity of workouts, dynamic weight ranges, and many more. We believe this data will open the opportunity to more efficiently and effectively improve the performance of future users. Through the use of dynamically adjusting resistance, Aceso offers eccentric, iso-metric, and iso-kinetic routines all from one machine. Using the data from these workouts, PT’s are able to more accurately guide patients in their recovery and training. Among a myriad of workout modes and data visualization options, the machine has several “fail-safe” systems in place. Aceso uses a mechanical 3-point safety system, demanding total security in the machine’s usage. But that’s enough about the abilities and features of the machine. I believe where a company comes from is as important as where it is headed. Aceso started a few years ago when I had the privilege to work with classmates at the University of Alabama in Huntsville on a summer design project. Somehow, I convinced my friends to help build a device that could read muscle strain vs weight in a leg raise device. This experience fueled my interest in the world of physical therapy, and the more I learned the more I fell in love with creating advanced solutions to complex needs within the field. Having close friends struggle to recover after ACL surgeries, or seeing a mother with double knee surgeries unable to tie her child's shoes fueled my ambition and trajectory of my research. I knew I couldn’t ignore the call I felt and had to use my knowledge and skills in mechanical engineering to help improve the field of sports science and rehibition.

I love engineering and technology. I went to school to learn the necessary skills to build, design, and develop complex machines and systems, but I think what it is essential to ask several questions. Why? Why work hard? Why spend hours upon hours studying engineering statistics and dynamics? Why start a company with your friends and try to change the world? My answer: people.

It’s simple when I think about it. There's nothing that even begins to take precedence over my relationships with other people. It's the only thing that truly matters. My relationships with other people have been my greatest struggles and my greatest accomplishments. I can only say that I am blessed to have been given the opportunity in life to work with an amazing team, deliver to excited clients, and impact people in a meaningful way. It means the world to me.

Josh Woods CEO Aceso Designs acesodesign.com

Still hurting? Treating Chronic Pain

by Jackie Makowski

Local anesthesiologists specialize in minimally invasive procedures for pain relief

Most everyone has experienced pain and the subsequent pursuit to relieve it. Due to its subjective nature, pain is often difficult to measure but is important to address. Pain serves as the body’s “warning signal” for a problem requiring attention. Fortunately, most cases of pain resolve within a few weeks or months. But for nearly 100 million Americans their pain persists longer than six months – becoming a condition known as “chronic pain.” This statistic has garnered considerable attention from the healthcare community and for good reason. More people live with chronic pain than diabetes, cancer and heart disease combined. Within recent years, many patients suffering with chronic pain have felt a stigma surrounding their condition. Chronic pain can negatively impact a patient’s quality of life, interfering with one’s ability to work, sleep and enjoy social activities. There are safe, proven and effective treatments available to help manage pain when it does not improve with standard treatments such as aspirin or ibuprofen. “The pain management specialty is designed to work with primary care physicians to diagnose the underlying cause of pain and determine an effective treatment plan,” says Ronald Collins, M.D., an anesthesiology and pain management physician with TVPC. “Many people can achieve pain relief without surgical intervention.” The most common conditions treated by pain management specialists include low back and neck pain, neuropathic pain, pre-and post-surgical pain, cancer and shingles-related pain. In recent years, the opioid epidemic has shed light on the issue of opioid abuse. However, the media narrative has left many chronic pain patients feeling stigmatized, mislabeled and fearful of receiving treatment. Pain management physicians such as the anesthesiologists at Tennessee Valley Pain Consultants (TVPC) provide minimally invasive procedural based options for patients with chronic and acute conditions. The most common conditions treated are those of the cervical, thoracic and lumbar spine, joints or nerves.

As partners in healthcare with Huntsville Hospital, Tennessee Valley Pain Consultants has the region’s largest team of specialists double board-certified in anesthesiology and pain management. These physicians use the latest in diagnostic technology, along with medical and interventional treatments, to identify the source of pain, treat it and educate patients on how to manage it. “Our goal is to try and change the pain at its source,” says Morris Scherlis, M.D., anesthesiology and pain management physician with TVPC. “This often involves injections under fluoroscopy to specific and precise pain generators.”

Anesthesiologists have specialized training in x-ray guided interventional procedures such as epidural steroid injections, nerve blocks, radiofrequency ablation and implantable pain relief devices. These specialists also offer managed anesthesia care for procedures providing a more comfortable patient experience.

Anesthesiology and pain management physicians offer patients a variety of non-opioid based treatments as well as diagnostic and therapeutic procedures. These physicians collaborate with physical therapists, chiropractors and surgeons when necessary to comprehensively and safely treat chronic pain. “We strive to help reduce the stigma patients experiencing pain may feel and educate the community on the many advanced non-opioid, procedural options available,” says Thomas Kraus, D.O., anesthesiology and pain management physician with TVPC. Education is the best tool for reversing stigma and ultimately improving patient care and quality of life.

ANESTHESIOLOGY & PAIN MANAGEMENT: CONDITIONS TREATED Cervical, Thoracic & Lumbar Spine • Back & Neck pain • Herniated Disc pain • Radicular and Degenerative Disc pain • Pre & Post-surgical pain Joint Pain • Knee & Hip pain • Shoulder pain • Osteoarthritis • Sacroiliac Joint pain

Nerve Pain • Peripheral Neuropathy • Diabetic Neuropathy • Shingles – Acute and Post-herpetic Neuropathy • Occipital Neuralgia • Cancer Pain

Visit tnvalleypain.com to learn more about the non-surgical offerings provided.

MINIMALLY INVASIVE ALTERNATIVES FOR ACUTE AND CHRONIC PAIN

Epidural Steroid Injections: Administered in the epidural space of the spinal cord to relieve inflammation secondary to spinal disc problems or pain associated with pinched nerves. Trigger Point Injections: Performed on site of muscle pain improving blood flow and reducing pain.

Selective Nerve-Root Blocks: Utilized to diagnose the specific source of nerve root pain and for therapeutic relief of low back pain and/ or leg pain. Also, used for post-herpetic neuralgia. Facet Joint Injections: Performed for temporary joint pain relief and in preparation for more long-term treatments such as facet radiofrequecy. Sympathetic Nerve Blocks: Non-steriodal blocks often used for diabetic neuropathy.

Radiofrequency Ablation: Utilized to help patients with chronic low-back and neck pain and pain related to the degeneration of joints typically from arthritis. Physician precisely inserts a needle precisely delivering heat to a specific nerve disrupting the pain signals transmitted to the brain. Pain relief may last for several months to a year. Spinal Cord Stimulation: Performed for patients with nerve root damage or failed back syndrome who have not responded to conservative treatments. This procedure involves implantation of a small, rechargeable device releasing electrode signals to the spinal cord, replacing pain with a more pleasant sensation.

When should I have

surgery?

by Matthew Clayton, M.D.

As an orthopaedic surgeon specializing in total joint replacement, I am asked often to tell patients when they should undergo surgery. I think this subject is something with which many patients tend to struggle. Indeed, deciding to undergo a major surgery should be a well informed and thought out decision. Each person that presents to an orthopedic surgeon is coming because they are in pain and looking for relief. Often times this relief comes in the form of conservative treatments. For my patients, many of whom suffer from arthritis of the knees or hips, these conservative treatments may consist of oral anti-inflammatory medications, injections, or physical therapy. I always encourage patients to maximize their utilization of these conservative measures. This approach may extend the time before needing a major surgery for months or even years. Unfortunately, these conservative treatments may lose their effectiveness with time. As the disease of arthritis progresses, the cartilage within a joint is worn away until bone begins rubbing against bone. This results in severe joint pain and stiffness, which may worsen to a point that daily activities become difficult. Eventually, patients often find that their painful arthritic joints dictate to them what they are able to do. I often hear that my patients say that they will not shop in stores that do not have parking available by the door, or will not fly because they canâ&#x20AC;&#x2122;t move easily through the airport. I have also noticed that these limitations do not only affect the patient suffering from arthritis, but they can also rob their families of many opportunities to enjoy spending time together. If you find that you are identifying with these limitations, I would suggest to you that it is time for treatment. This treatment should begin with a full evaluation by a physician who can accurately identify the cause of your pain. If indeed arthritis is the cause of your pain and limitations, the conservative measures noted above should be attempted. If these treatments have not provided adequate relief, then this is the time to consider surgery. Joint replacement surgery has two major goals: to relieve pain and restore function. Total joint replacement is a procedure that can give a patient back their mobility and therefore has one of the highest rates of patient satisfaction in all of medicine. So, if you find your painful joints are ruling your life, now is the time to discuss treatment, armed with the knowledge that if surgery is required, you can reclaim your mobility and get back to living the life you want to live.

For most people, the end of a long work week is the beginning of rest and recovery in preparation for another Monday. For a small but growing population, the end of the workday on Friday signals the start of 1-2 days of sports or activities. These people are typically referred to as, “weekend warriors”. The “weekend warrior” means different things to different people. The generally accepted description is a 30-50 year old male attempting to compress 7 days of little activity into 1-2 days of vigorous activity. The definition is changing to now include an increasing number of females and the age is truly 20-60. A surprising find in a recent study showed that only 1-3% of Americans are truly a “weekend warrior”.

The benefits of exercise are commonly accepted but the amount is always debatable. The CDC recommends 150 minutes of vigorous activity per week. The growing population of weekend warriors are only able to get this in on Saturday and Sunday. There are risks and benefits of being a Saturday athlete. The obvious risk is physical injury due to lack of conditioning or not being in shape. We know that more injuries occur over the weekend than during the week. A commonly quoted fact is that we spend 70% more time exercising over the weekend as compared to Monday through Friday. Even more so, as the weather warms, outdoor activities increase and therefore the chance for injury goes up as well. The weekend warrior has an even higher chance of injury. Some believe this is due to increasing intensity and longer duration than seen during the week. Sports injuries are second only to the common cold as a reason for doctor visits. The weekend warrior sustains the

injury

prevention

same type of injuries I routinely see in my sports medicine practice. Some weekend warrior injuries include: 1) 2) 3) 4) 5) 6)

Ankle sprains Calf strains and Achilles ruptures Knee injuries Shoulder injuries Tennis or Golfer’s elbow Lumbar strains

All of these injuries are treatable, but the emphasis should be on prevention. The most common, but unlikely way for the Saturday athlete to lessen chance of injury would be to train more Monday through Friday. Since this rarely happens, the weekend warrior should warm-up and stretch prior to every activity. This gets the blood pumping and the muscles warm before jumping into that Sunday game. This simple 5-10 minutes would help since our muscles, tendons and bones weaken as we age. Bone density decreases yearly at a steady rate beginning around age 30. Muscle loss can decrease 1% per year starting around age 40 and tendon strength deteriorates with age as well. The positive results of exercise for the 1 in 10 Americans that regularly get the 150 minutes per week is that the risk of cardiovascular disease (and some say cancer risk) decreases. Yes, this benefit is even seen in those that compress 7 days of activity into Saturday and Sunday. The weekend warrior lifestyle has a greater risk of injury, but the benefits certainly outweigh a lifestyle of little to no activity.

knee

the forgotten

...with natural motion, you might forget it’s been replaced

by Matthew Clayton, M.D.

Multiple studies have documented that up to 95% of patients report good to excellent pain relief after undergoing a total knee replacement. Unfortunately, only about 85% of patients report that they are fully satisfied with the outcome of their new knees. This begs the question, what is the cause of these patients’ dissatisfaction despite their pain relief ? I believe that this interesting difference between pain relief and satisfaction is likely due to two important factors. The first factor is that patients may have unrealistic expectations of their surgery. One of the most important tasks that a surgeon should complete prior to performing a surgery is to fully explain the likely outcomes and expected recovery from the surgery they are recommending. When realistic expectations are set and clearly understood by the patient, they will be very unlikely to report that they are dissatisfied when the expectations are met. However, if grand expectations are presented to the patients and the outcomes, while still good, fall slightly short, patients will likely report that they are not fully satisfied with their outcomes. As the saying goes, if you promise the stars and the moon and only deliver the stars, they will still long for the moon. The second factor, which has significantly affected my personal practices in total knee replacement, is that many of the knees on the market today are designed to provide stable motion,

that often times does not recreate the natural motion of our knees. While the idea of manufacturing a total knee implant that will allow for a natural motion sounds intuitive, very few knee implants are able to accomplish this goal. It is because of this unnatural kinematic motion that I believe patients with pain free total knees may still report that they are not fully satisfied. This is also what has led me to use a knee implant that allows for the most natural kinematic motion of any knee prosthesis on the market today. The Microport Evolution total knee system was designed to mimic patients’ natural knee. It provides great stability to the inside of the knee, while allowing for rotation along the outside of the knee, which is how our knees normally function. This is commonly referred to as a “medial pivot” knee. When you provide this natural motion with a pain-free knee, I have found that you are more likely to

have a patient with what I refer to as a “forgotten knee.” This occurs when the knee replacement feels so natural that they forget it has been replaced. This is the best outcome possible after knee replacement surgery. While this is my personal goal for all of my patients, it is not what I tell them to expect. I explain that they can expect a pain-free knee. When this goal is achieved, I have a satisfied patient. Thankfully, since I have started using a knee implant that provides a natural motion, more patients are forgetting that their knee has been replaced. If you are considering a knee replacement surgery, I strongly recommend that you look for a surgeon that you trust. Don’t be afraid to ask questions about the procedure and the expected outcomes. Inquire what implant they will use and why they will use it. Once your questions have been answered and you have made the decision to move forward with surgery, be confident in your decision. A confident, positive patient in the hands of a skilled surgeon will produce a great outcome.

Sports YOUTH

too much, too soon? by H. Cobb Alexander, MD

Fifty years ago, organized youth sports were largely limited to Little League baseball and perhaps Pee Wee football. Girls in sports? Yeah, you can go cheer for the boys…. or maybe do ballet or tap. Childrens’ play tended to be much less organized—pick-up games on an empty lot or even in the street were the norm. Go outside after school; find some buddies, and just play by simple rules. In the summer it was baseball, and in autumn, flag football reigned. Playing one sport year-round, particularly an organized sport, was unthinkable. Different seasons demanded different skill sets, leading to a more holistic physical development for growing bodies.

........................................................................................................... Beginning in the 1970’s and accelerating ever since, the trend among youth has been to start organized sports at increasing younger ages, and focus on one sport ever earlier. Sports opportunities for girls have thankfully expanded greatly, and there is now a plethora of options from which to choose. Travel sports now comprise a $7 billion industry, with families expecting to spend several thousand dollars a year on fees and travel expenses. Yet, for all the time and resources expended on youth sports, there are some troubling trends. According to a survey by the Sports and Fitness Industry Association, in 2014 there were 26 million youth aged 9-14 playing team sports, down almost 4% from 2009, and an average of 10% fewer sports were being played. The physical cost of concentrating on just one sport yearround is also taking its toll. Dr. James Andrews, in his excellent book Any Given Monday, relates that almost 40 percent of ALL sports injuries seen in the Emergency Room are for children under the age of fourteen, and overuse is the cause of nearly half of all adolescent sports injuries. Many sports medicine experts are becoming increasingly alarmed at the negative effects of the trend to train children younger, harder, and more sport-specific. The problems range from being a strain on family finances—and time together—to the all-too-common scenario of a child being pushed at an early age to participate in one sport at the “elite” level—only to burn out in the early teen years and give up sports altogether. CDC statistics show that in the past 30 years, obesity rates doubled in children and quadrupled in adolescents, with more than one third of people in these age groups classified as overweight or obese. Although poor dietary habits and video games have certainly contributed to this ominous trend, a lack of exercise is clearly a major factor as well. Even worse, 75-80 percent of obese adolescents will be obese as adults, increasing the risk of everything from heart disease to diabetes to the need for joint replacement.

So how should we, as parents, respond? John O’Sullivan, former pro soccer player and author of Changing the Game, has identified some behaviors to avoid. First, resist the push to become “elite.” The odds of any child going to college on a sports scholarship are exceedingly small, and even if that elusive offer is the goal, the child will be much more likely to get there by developing a broad range of athletic skills, from gross motor to hand-eye coordination, speed, agility, strength, and flexibility. This can only be done by exposing the young athlete to a variety of sports, since each will favor the development of different skill sets. This will prove invaluable in whatever single sport the athlete may focus on later. Studies have shown that single-sport athletes are 70-90% more likely to suffer an overuse injury than those participating in multiple sports. Even college football coaches are recognizing the superiority of having multi-sport players, with one nationally-prominent program having a recent recruiting class composed of 43 multi-sport athletes and only 5 single-sports. Second, avoid the emphasis on winning at all costs. When children were surveyed about the things they found enjoyable in sports, winning was number 48 in a list of 81. Much more important to the child was the comraderie of being on a team, being respected by the coach, and having playing time. Trophies, cool uniforms, and other things parents often consider so important, barely made the list. This doesn’t mean that there should be no winners—children need to learn how to win, but also how to lose, using both to focus on improving the next time. For the same reason, giving a trophy to everyone—regardless of effort or attitude—demeans both the deserving and the undeserving. Third, sports should above all be fun for the child—not a means of gratification for the parent. The more a parent pushes a child to practice and to focus on one sport year-round, the more likely the child will burn out. The youth sports inactivity level was 20 percent in 2014, and appears to have been even higher in 2015. Also, children, especially in their younger years, should be encouraged in free play— the children decide the game, the teams and the rules with no adult interference.

Whether touch football, tag, or simply hide-and-seek, free play encourages imagination, socialization, and maturation as the players learn to settle rules and disputes among themselves, without parental hovering. For those engaged in team sports, Dr. Andrews has even more specific recommendations:

1. Proper preseason strength and conditioning. While staying fit is a full-year goal, preparation for any given sport should start two or three months before the first day of practice. The majority of injuries occur in the first few weeks of the season due to inadequate preseason preparation. 2. Young athletes need to take off a month or more each year to give their bodies a chance to rest and recover.Overtraining always increases the risk of injury, and a period of low-impact activity is necessary for the musculoskeletal recovery phase. 3. Cross training is also very beneficial, either by a deliberate regimen or by participation in a completely different sport during the off-season. 4. Follow the 10 percent rule—do not increase weight training activities, distance, or pace by more than 10 percent a week. “No pain, no gain” has no place in youth sports. 5. Strength must be balanced with flexibility. Tight muscles are more easily torn, and tight joints more easily injured than those which are supple. Studies have shown that children who participate in sports do better in school, are more likely to go to college, and are much more likely to become healthy productive adults than those who don’t participate. As parents, we should do everything we can to foster in our children a life-long love of staying active and physically fit, and to have happy memories of their time in sports. That way, they’ll be there for us when we get old!

SAVE Your KNEEs by Ben Macklin

he knee is the largest joint in the body. It is also one of the most complex and most vulnerable joints in the body. The knee is comprised of 2 joints, 4 bones, and 14 ligaments. It requires at least 12 muscles and perfect balance between the hip and ankle to function properly. While walking, our knees support 1.5 times our body weight; when climbing stairs it’s about 4 times our body weight; and when squatting it’s about 8 times our body weight. The knee joint doesn’t have much protection from the daily stress we put on them. Dr. Brett Franklin, knee specialist at SportsMED Orthopaedic Surgery and Spine center notes, “Knee pain is one of the most common complaints bringing people to the orthopaedic office. There are multiple causes including traumatic and chronic conditions.” The most common knee injuries are acute injuries, or sudden injuries resulting from a traumatic event, such as a fall, collision, or twisting motion while the foot is planted in the ground. Examples of acute injuries include: fractures and dislocations, sprains and strains, tendon tears, meniscus tears, and ligament tears. Acute injuries happen quickly, and you usually know just how bad the damage is immediately after the injury occurs.

Symptoms caused by Acute Trauma to the Knee • Significant swelling and stiffness • Pain, tenderness, and warm to the touch • Weakness or instability of the knee joint • Hear a popping or crunching noise at the time of injury • Locking, or inability to straighten the leg Treating for Knee Injuries with the R.I.C.E. Method • Rest: reduce daily activity, or take a few days off from intense activity • Ice: 20 minutes every 4 hours for 2-3 days to help with pain and swelling • Compression: use an elastic bandage or wrap to keep swelling down and add support to the knee joint • Elevation: place a pillow under your heel when you are sitting or lying down to reduce swelling Overuse injuries are another cause of knee pain. Overuse injuries are common among weekend warriors, and can be the result of the sudden changes in activity level. A pickup game of basketball or the start of a new slow-pitch softball season is a distinct change in activity level that can result in overuse injuries. Overuse injuries are easily identifiable and symptoms appear almost immediately. How to Prevent Overuse Injuries: • Warm up properly before and after any activity • Daily exercise and stretching keep muscles strong, flexible, and ready for activity • Gradually increase your activity level • Wear activity specific shoes with good arch support • Give your body time to recover Another common cause for knee pain is chronic repetitive stress. These types of injuries can be a bit of a head scratcher to diagnose, because unlike acute trauma or a sudden change in activity level, there usually isn’t a specific event that caused the issue. Repetitive stress injuries develop slowly over time, and are caused by the gradual buildup of irritation to the tissues in the knee joint. An example would be a painter who works for years with no problems, until one day notices some discomfort in their knee. Knee injuries from repetitive stress can often times be the most difficult for people to overcome. How to Reduce Knee Pain cause by Repetitive Stress • Physical Therapy program designed specifically to your needs • Exercise using low impact activities such as elliptical, bicycles, or swimming pools • Braces can help reduce pain and improve mobility • Anti-inflammatory medications • Joint injections • Surgery Dr. Brett Franklin adds, “Most knee conditions can be managed and evaluated in a conservative manner. Physical therapy, bracing and joint injections can help alleviate pain and improve daily function. If conservative treatments are unsuccessful, it might be time to consider surgical intervention.”

Do these therapy exercises regularly and

Your KNEEs will Thank you Quad Set: Slight Flexion

1. Tense muscles on top of thigh, hold 5 seconds 2. 10 repetitions per set, 1 set per session, 2 times per day

Straight Leg Raise

1. Tighten muscles on front of thigh, then lift leg 8-10” from surface, keeping knee locked 2. 30 repetitions per set, 1 set per session, 2 times per day

Wall Slide

1. Leaning on wall, slowly lower buttocks until thighs are parallel to floor 2. Hold 5 seconds 3. Tighten thigh muscles and return 4. 10-30 repetitions per set, 1 set per session, 2 times per day

Terminal Knee Extension

1. Face anchor with knee slightly bent and tubing just above the knee 2. Gently pull the knee back straight 3. Do not overextend knee 4. 30 repetitions per set, 1 set per session, 2 times per day

Heel Raise: Bilateral (standing) 1. Rise on ball of feet, lower back down 2. 30 repetitions per set, 1 set per session, 2 times per day

Inside Medicine | april-may 2017

OH MY aching... by Chad Hobbs, PT, DPT, COMT

Aches and pains often seem like a fact of life, but all too often they begin to limit our activities, our ability to perform our household or work tasks, and even impact our mood and happiness. The good news is that help is available. Regardless of what stage in the “ache and pain” process you are in, there are many great options to help you get things back in order. One great option that many of us have heard of, but may not really understand is physical therapy.

Why should I try Physical Therapy? Physical therapists are the movement specialists in the healthcare industry. It is their job to assess your movement and how it affects your pain. Pain can change the way you move. This incorrect movement can increase your pain by producing excess stress on the body, causing it to break down and start hurting. It can become a vicious cycle where pain causes incorrect movement which leads to more pain. The physical therapist’s job is to do a thorough evaluation of your movement and determine what is moving correctly and incorrectly and how that affects or is caused by your pain. The best treatment is one tailored to your weakness and deficiencies. In most cases, correcting improper movement will eliminate your pain, or at the very least, significantly decrease your pain and improve your ability to function. Physical therapy is a great option for many conditions. While we often associate physical therapy with rehabilitation after a surgery, physical therapists have the ability to help with multiple conditions. Physical therapy is a great option for any musculoskeletal issue (i.e. neck pain, shoulder pain, etc.), however; some physical therapists can also treat many other conditions, such as headaches, vertigo, dizziness, TMJ/TMD, balance issues or unsteadiness, weakness, tendonitis and even plantar fasciitis.

Why should I try Physical Therapy again? Many patients have had an unsuccessful bout of physical therapy in the past. This can often be the result if the treatment was not customized to the patient’s specific problems,

or the painful area was treated but their improper movements were not corrected. For example, if every patient with neck pain gets the same ten exercises to treat their neck, then the treatment is not being tailored effectively to get the best result. Or, if a patient has low back pain which was treated previously, but treatment neglected to correct a stiff arthritic hip, the low back pain may not resolve or the pain will likely return. Physical therapy can be highly specialized and customized to your specific condition and it should be. If physical therapy did not work the first time, it is worth trying again with a treatment plan that is personalized to your specific needs.

What is Manual Physical Therapy? With manual physical therapy, the therapist uses a handson assessment to determine your physical dysfunctions, whether it be stiff joints, muscle spasms, or poor muscle recruitment patterns. This assessment then allows the therapist to decide what treatments and exercises will be most beneficial. A specific customized plan involves the use of manual techniques, like joint mobilizations and soft tissue release, to treat limitations, such as muscle and joint stiffness, to correct movement. These treatments typically offer patients some immediate relief and allow them to tolerate specific exercises that help produce and maintain long-term corrections.

What should I expect from Physical Therapy? There are many things that make a great therapy experience, but the following list should be included in your experience. • A thorough evaluation consisting of a history, medical review, and hands on physical exam • An explanation of the findings of the evaluation and the treatment plan moving forward • Hands on techniques performed by the physical therapist • Specific exercise program consisting of exercises with reps, sets and number of times per day along with an explanation of what the exercise is accomplishing • Re-evaluation by the physical therapist each visit which assesses movement, so treatment can be adjusted or modified based on the patient’s response to the last visit. • Detailed discharge plans. Once therapy is over, the patient should know what to do to progress activities and how to respond should the patient experience a flare-up or symptom regression.

Chad Hobbs PT, DPT, COMT is the Director of Operations and partner at the local physical therapy company, Focus Physiotherapy. Chad graduated with his Doctorate of Physical Therapy from Belmont University in Nashville, TN. He currently holds the position as the Federal Affairs Liason on the Alabama Physical Therapy Association and is a current board member on the Alabama Board of Physical Therapy.

Physical Therapy

If you are having any of these aches and pains, you should discuss physical therapy with your physician, as it may be a great option for you. In the state of Alabama, you also have the ability to go straight to a physical therapist for an evaluation. Physcial therapy treatment cannot begin without the approval of a physician, but you can get a full assessment from a therapist and have that to discuss with your physician. Understanding what options are available enables you to make better choices for your body. Physical therapy is a great tool to assist with maintenance and management of your overall wellness. ...............................................................................................

HEALTHCARE COSTS by Sanat Dixit MD, FACS

juice machines and patient engagement

It’s a perplexing time to be a patient in the United States. Technologic innovations abound, yet we are reminded on a daily, if not hourly, basis about the travails afflicting our healthcare system and how something must be done to fix it. Most of the conversations focus on coverage and cost – and understandably so, as US healthcare expenditures grew 5.8% in 2015, and another 6% in 2016, reaching $3.2 trillion. Healthcare expenditures account for almost 18% of our entire economic output. The rising cost of healthcare expenditures has been shifted onto the employers and the patients, with the average premium for an employer-sponsored plan topping $17,500 annually; with workers paying almost $5000 towards the cost of coverage. In spite of the skyrocketing costs, we don’t seem to be getting healthier. The question has to be asked – what are you paying for and what are you getting?

because they didn’t deliver good juice. (Can’t say they did or didn’t as I never tried it.) They failed because they didn’t deliver something of tangible value. In essence they created a solution looking for a problem, and expected us to pay $700 to use it. What does this have to do with healthcare? Well, the system is in kind of a “Juicero” mindset, throwing buckets of money at over-engineered solutions designed to fix problems that may or may not exist; enacting an arms race of sorts. Hospitals are spending tens of millions of dollars investing in wonderful technologies looking to one-up their competition in the hopes of attracting more patients. What’s getting lost in the mix is asking what the patients actually want and making tangible investments in those things. Most patients don’t complain about their doctors not having access to the best technology – they complain about not having the attention of their doctors.

A Medical Arms Race – Healthcare’s “Juicero” Problem*

Connection is a Currency

Have you ever heard of Juicero? It was a company on a mission to make sure everyone had access to the very best cold pressed juices whenever they wanted. The company offered a state of the art juicer with internet connectivity. This $700 juicer (you read that right) cold pressed $7 juice packs (also not a typo) and could tell you if the pack had expired (because reading the packet expiration date was too simple). The idea was so ludicrous, so far fetched and so out of bounds that the company managed to raise $120 million from investors (including Google, no less). Earlier this year, someone managed to figure out that you could squeeze the juice out of your $7 juice pack with your bare hands, saving yourself $400 (did I mention they dropped the price to make it more “accessible?”). Needless to say, the company went belly-up, not *Hat tip to Kim Bellard at Tincture.io for this juicy analogy.

I became a neurosurgeon because I was enamored by the diversity and complexity of the nervous system, but also because I was intrigued by new technology. I discovered something remarkable in the early part of my 17-year career – that while patients were interested in having cutting edge therapy, they were just as interested in having a connection with their doctor. There was a clear correlation between patient satisfaction and how well I communicated with my patients, which was significant given that my practice at the time centered on vascular neurosurgery – a high risk subspecialty dealing with brain aneurysms and hemorrhagic stroke. As medical students, we start our careers with a simple exercise – learning to listen to our patients. As our knowledge base expands, most physicians listen less and talk

more. I had to re-learn the simple truth that listening was just as important as providing information. Enhancing communication enhanced my connectivity and made me a better physician. Connection is a currency in healthcare. Patient engagement is about cashing in on that currency to deliver real benefits. As patients become more empowered healthcare consumers, enhanced engagement is becoming even more of a necessity. Efforts to improve patient engagement have borne fruit in managing chronic diseases like diabetes, congestive heart failure and COPD; but have also demonstrated improvements in surgical outcomes and recovery for surgical patients with joint replacements. (I’ve seen the tangible benefits in my own practice managing brain and spine patients.) The push to enhance connectivity and communication is evident with the rollout of value based care models by the Centers for Medicare and Medicaid (CMS). These models are morphing towards outcome and merit based measures for compensation – in essence rewarding docs for doing a good job, not just doing more procedures. Part of the equation boils down to how well a patient was looked after. This is where connectivity comes in through improved communication, streamlined care coordination and a dose of good old-fashioned empathy.

Digital Empathy The most underutilized resource in achieving better outcomes are the patients themselves. We are seeing a variety of digital tools being used to augment connections between patients and their care providers. Numerous studies demonstrate the benefits of being proactive with patient engagements using digital (eHealth) products. While the world doesn’t need yet another app or convoluted patient portal, the fact that these products have come to market indicates there is a pressing need to find better ways to connect patients and providers. Incorporating a digital

platf orm f or my surgical patients to interf ace with me has been an invaluable addition to my practice. “Digital empathy” sounds like a buzzword, but its an apt description of what we strive to deliver, address-ing the biggest complaints patients have about the healthcare system outside of cost – bad experiences and poor customer service. By proactively engaging with my patient’s pre and post operatively, I found I was able to provide more effective and efficient care; resulting

in f ewer pated ER

hospital readmissions, visits, better surgical

unanticias well as delivering a very unique outcomes, patient experience. No $700 juice machine required.

1Barello S, Triberti S, Graffigna G, et al. eHealth fo r Pa tient Engagement: A Systematic Review. Frontiers in Psychology. 2015;6:2013. 2Coorey, Genevieve M et al. “Implementation of a Consumer-Focused eHealth Intervention for People with Moderate-to-High Cardiovascular Disease Risk: Protocol for a Mixed-Methods Process Evaluation.” BMJ Open 7.1 (2017): e014353. PMC. Web. 20 Sept. 2017. 3“Patients’ top complaint? It isn’t doctors or nurses, study finds.” https://www.advisory.com/daily-briefing/2016/04/28/top-patient-complaints

Dr. Sanat Dixit is a board certified neurosurgeon with SportsMED Orthopedic and Spine Center. No juice packets were harmed in the creation of this document.

I’m dizzy again, what do I do?! Ever considered a Physical Therapist? We’re all familiar with the benefits of physical therapy after surgery, when recovering from a sports injury, or when helping you gain the mobility and strength to get down on the floor to play with your grandkids. But have you ever considered seeing your Physical Therapist for your dizziness? Physical Therapists in your area are trained to evaluate, differentially diagnose, and treat many causes of dizziness. Common symptoms evaluated and successfully treated by a Physical Therapist include: ¤ ¤ ¤ ¤ ¤ ¤

Vertigo (sensation that the room is spinning about you) Lightheadedness or a floating sensation Feeling off balance Difficulty keeping words in focus when reading Difficulty walking a straight line Any time my neck hurts, I get dizzy!

A Physical Therapist is a critical and trusted member of your healthcare team that is essential for accurate diagnosis and optimal recovery from a number of diagnoses commonly associated with dizziness. Listed below are just a few of the common diagnoses that your Physical Therapist can help with: ¤ ¤ ¤ ¤ ¤ ¤ ¤

Benign Paroxysmal Positional Vertigo (BPPV) Meniere’s Disease Post-Concussion Dizziness Post-Motor Vehicle Accident Dizziness Vestibular Neuritis Labyrinthitis Cervicogenic Dizziness (related to your neck)

After a thorough hands-on evaluation and consultation with your healthcare team, your Physical Therapist will develop a complete plan of care to help you understand and overcome your dizziness. Treatment techniques utilized by your Physical Therapist may include: ¤ Corrective Maneuvers for BPPV (i.e. Epley Maneuver, BBQ Roll, Semont Maneuver, etc.) ¤ Habituation Exercises ¤ Manual Therapy (hands on treatment) ¤ Postural Correction Techniques ¤ Balance and Gait Training ¤ Mobility and Stability Exercises ¤ Work and home-related ergonomic recommendations ¤ Education to help you understand your dizziness

by Fred Gilbert, PT, DPT

The exercises your Physical Therapist will prescribe will provide a variety of benefits to help with your inner ear or neck-related dizziness. The exercises can help to even out the signal between the two sides of your inner ear, they can help you readjust to the visual blurriness when you turn your head or walk, they can improve your balance and can even help to stabilize your neck to keep certain types of dizziness from coming on! Physical Therapists are one of the many options to help you understand and overcome your dizziness. Often a Physical Therapist will be able to get you in the office the day your symptoms start, making diagnosis and treatment quick and effective. Your Physical Therapist is trained to recognize when the symptoms do not fit within our treatment scope and will always help you navigate to the best and safest practitioner to begin your treatment. You have trusted your Physical Therapist with your neck, shoulder, low back, and hip pain. The next time you experience your dizziness, know that you can trust your Physical Therapist.

Did you know... ä Doctor of Physical Therapy (DPT)...

The entry-level requirement to become a Physical Therapist is a Doctorate of Physical Therapy.

ä Direct Access...

In the state of Alabama you can be evaluated by a Physical Therapist without a referral from your physician. You can learn more at www.apta.org/ DirectAccess

ä What a Physical Therapist can

do for you... The American Physical Therapy Association’s (APTA) position: “Move Forward. Physical Therapy Brings Motion to Life.” For more details visit www.moveforwardPT.com

Dr. Gilbert is a Physical Therapist at Focus Physiotherapy in Huntsville, AL. Dr. Gilbert received his Doctor of Physical Therapy degree from the University of Alabama at Birmingham in December of 2015. In April of 2016 Dr. Gilbert completed his Competency in Vestibular Rehabilitation through Emory University, making him one of two practitioners in north Alabama to complete this rigorous training. Dr. Gilbert is also currently completing his residency in Orthopedic physical therapy with the North American Institute of Orthopedic Manual Therapy (NAIOMT).

reversed curve

“TEXT NECK” by David A. Lang, D.C. Something that is becoming a rising issue these days is the altering appearance and shape of the cervical spine in the younger population. When viewed from the side, a spine should have a smooth transition of front to back curves. This allows for shock absorption, center of balance, leverage for proper posture, and flexibility. With our society becoming a digital world, this means we spend most of the day with our heads in a forward or looking down position. This isn’t good for our spinal health. It puts added strain on the cervical joints on the front of the neck, strains the posterior cervical muscles and stresses the delicate tissues of the spinal cord. An ideal neck curve should be between 35-45 degrees, basically the shape of a banana, with the convexity of the curve facing the front. I have seen an increased population of reversed curves in children as young as 6-7 years old. We believe this is due to extended periods of looking down at a tablet, phone or other handheld electronic gaming system. For example, just go in a restaurant and look around. You will see many families looking down at their phones and not talking. For every inch the head goes forward, there is 10 lbs. of pressure exerted on the back of the neck. A standard forward head posture (FHP) in the moderate range is near 5-6 cm. The total range being from 0-6. Ideally, a person should have a FHP measurement of 0-1.5 at the most. This means that a patient with a forward head posture of 6 cm, could have over 35 lbs. of pressure constantly pulling on the back of the head, just to keep the head upright. This can cause pain, stiffness, fatigue, headaches, and many more symptoms. It is caused by the condition of reversed curve or forward head posture (FHP).

At our office we address this by first doing a de-tailed history and consultation followed by a complete physical exam. In this exam, we will determine and test posture, tenderness in the muscles, active and passive range of motion, strength and stability of joints, functional movement screens, and ortho/neuro exams. If warranted, we will take digital x-rays and measure the degree of loss of curve and or forward head posture (FHP). After careful review of the findings, we will design a specific treatment plan for the patient to address these issues. We use 2 different spinal correction techniques, Pettibon System of Spine Correction, and C.L.E.A.R. Institute of Spine and Scoliosis correction. One technique is geared toward the general condition of postural restoration and the other is geared to address those with postural de-ficiencies due to idiopathic or structural scoliosis. Both are very effective and safe to do on most peo-ple. Careful screening for the proper candidate is always a priority for us. The treatments them-selves will be a combination of active and passive range of motion techniques, specific gentle spinal adjusting, repetitive standing cervical traction, and head weighting to initiate and stimulate the involuntary postural reflexes. The patient will also have home isometrics and stretching exercises to do between treatments. We find a strong correla-tion between patients that do their homework vs. patients that do not. Working on the exercises is important and it most definitely helps determine the ideal outcome.

ROBOT I C SURGERY

by Brian Scholl, MD

Dr. Scholl is a member of The Orthopaedic Center Spine Team. He is Board Certified by the American Board of Orthopaedic Surgery. He received his training at Emory University, UAB, and Campbell Clinic. He is a published author and has written two textbook chapters regarding spine surgery. Inside Medicine sat with Dr. Scholl to discuss some recent developments as it comes to spine care. He is excited about the future of robotic technology in his field, especially the Mazor X System. Dr. Scholl shared with us that over the past 20 years, there have been just a few major advancements in spine surgery: pedicle screw instrumentation, kyphoplasty, bone morphogenic protein (BMP) and artificial disk replacement. Robotic surgery isn’t new. Intuitive Surgical’s robot “da Vinci", which revolutionized gynecology, general surgery and urology, has been around for a decade. Recently experts have been developing robotic navigation systems to assist in spine surgery, and the latest iteration of the robotic movement is the Mazor X. Right now, Dr. Scholl is the only spine surgeon in the area to provide this alternate treatment, and he is enthusiastic about it. “It’s a really slick system, and it is the only new surgical technique I have been excited about in the last 15 years,” says Dr. Scholl. There are not that many robotic systems available in the United States and most are affiliated with larger university programs, so Huntsville is lucky to have the option. He does believe that once the technology is proven to be effective and viable, other surgeons will follow his lead. The “R2D2” base unit and robotic arm of the Mazor X helps the spine surgeon know exactly where to place pedicle screws. Dr. Scholl describes the actual equipment as a

2’x3’ self-contained, box with a monitor and special eyes. The base unit is opened up, and the robotic arm is pulled out and hooked to the bottom of a standard OR table, outside the field of the surgeon. The robotic arm is then draped and the system scans the operative field of view to ensure the arm will not collide with any instrument tables or lights. The robotic arm (about the length of a human arm) then points to the exact spot where each screw needs to go. Then, the pointer zig-zags side-to-side all the way up and down the spine, and the surgeon inserts each screw. The genius behind the system is in the software, which was written by the author of the original software for CT scanners. The software combines a low-dose radiation pre-operative CT scan with standard fluoroscopy that is taken in the operating room. This allows the robot to know the exact location of each vertebra of the spine during the operation. The system does not replace the

surgeon; however, as it requires surgeon input pre-operatively and surgeon confirmation of screw placement. However, it is so accurate that if the surgeon tries to label a spine vertebra incorrectly, the robot will not allow it. Dr. Scholl believes this is the initial stage of robotic spine surgery. It is a step forward, but advancements in the future will continue to help perform surgeries. The Mazor X System is mostly used to insert pedicle screws from the cervical spine down to the pelvis. Although the new tool is not for everyone, it does help substantially with a subset of spine surgeries. With robotic precision, multiple pedicle screws can be put into place quickly, typically in about half the time of a regular scoliosis operation. Since there is no need for intraoperative CT scanning or multiple fluoroscopy images, it requires less radiation and less anesthesia making it is a safer alternative for patients. It allows more accurate positioning of implants in a patient with distorted anatomy like a patient with complex scoliosis or a revision of a previous spine surgery where a large number of screws need to be inserted. In these cases, the spine can be twisted, the patient has already possibly had a couple of surgeries, or the anatomic landmarks aren’t visible and sometimes it is a struggle to get the screws in the correct spot. This system quickly allows screws to be inserted without any anatomy being visible to the surgeon. The technology is also perfect for the patient who need minimally invasive procedures. Dr. Scholl explains that not all patients will benefit from robotic surgery. Most spine surgeries can be easily and accurately completed through a standard open incision. With routine procedures in between, he says he is still quicker and better without it. He goes on to explain a surgeon would not do an artificial disk replacement or XLIF with it. An older patient in need of a procedure such as a 2-level laminectomy and fusion would not benefit from the system. The Mazor X system can help post operatively as well. Especially in a minimally invasive procedure, it can shorten the patient’s hospital stay by a full day. For scoliosis type surgeries where there will be less time under anesthesia, it can shorten the case from 5 hours to 4 hours. The precision and guess work is completed by the technology. It’s easier to wake up from and easier to recover from. It also minimizes any complications that could be due to hardware. In short, it’s a great new technology that speeds up spine surgery, makes it more accurate, and allows the surgeon to make a smaller incision. This kind of advancement makes certain spine procedures safer. One of the best things about the Mazor X is that it is patient–centric. It is not designed to simply make more money for the doctor or hospital, it is designed to make surgery safer and more reliable for the patient.

figure 2

In figure 2, a patient with spondylolisthesis. The computer digests the CT scan and automatically segments the spine into its constituent vertebral bodies. The system allows the surgeon to adjust the mid-line and drag-n-drop the screw positions in the software. It allows the surgeon to choose the length, diameter and custom trajectory – which is customized to each individual patient. The system also allows the spine to be rotated and viewed in 3 dimensions. This technology also allows the procedure to be demonstrated to the patient before the actual surgery.

If you are interested in finding out more about Mazor X, please contact Dr. Scholl’s office at 256-539-2728.

by Lisa Layton

On a rainy day in March, Kelly Reese and I had the privilege to sit and listen to an inspiring story of a beloved Huntsville doctor whose career ended much too soon when he was forced to become the patient and have his life significantly altered. Once this man began to tell his story, we witnessed truth in the old saying “that every dark cloud has a silver lining”. We felt a gentle reminder to hold onto our faith; that even though we may not see a purpose in God’s plans and timing, it does not mean that He is not hard at work in our lives.

So begins this doctor’s story…

In the 1960’s when many of America’s youth were living out their days of freedom and self-expression, there was a young man who chose a path of discipline and focus to enable himself to live out his dream of going into the medical profession. Don Wheeler was raised in the beautiful, rural town of Pikeville, Tennessee on a dairy farm. He learned a good work ethic at a young age. He went on to receive his undergraduate degree at the University of Tennessee, and later earned his doctorate at UT Medical School. After completing his internship year, Wheeler spent two years serving his country as a flight surgeon in the Air Force. Upon finishing his time in the military, he went on to complete his residency with a specialty in Obstetrics and Gynecology. After some prompting by his medical school friends who had moved to Huntsville before him, he made the decision to follow them and establish his practice in Huntsville as well. Dr. Wheeler, with his wife Kay and their two children, John David and Beth, began their life in the Tennessee Valley. He soon became the fourth partner in the well-known practice, Clinic for Women.

Dr. Wheeler spent many years working hard, building a thriving practice and becoming a popular member of the community. He was active in various organizations, enjoyed his church and became one of four founding members of The Surgery Center of Huntsville. His days and nights were spent doing what he loved most; being a devoted family man, a loyal friend and a gifted surgeon. Through the years, Dr. Wheeler delivered approximately 3,500 babies. He occasionally sees some of these babies he delivered who are now grown men and women with children of their own, and surprisingly, he remembers the mothers of a great many of them. During our conversation, he would light up talking about his days with his patients and reflected on touching stories of the women he cared for. He spoke softly about the times when he would have to deliver devastating news to a young mother and offer comfort to families during some of their darkest moments. This man is not just a doctor, he displays a compassion for those around him and never has taken lightly the God-given responsibility he had to usher his patients through some of their most joyous and devastating times. He truly cherishes the relationships he formed with his patients and never dreamed of being faced with the obstacles that were soon to come his way.

The journey…

In 1995, Dr. Wheeler was enjoying a game of golf when he experienced a severe pain in his right shoulder during a golf swing. This one incident would re-write his future forever. He knew he had injured himself but did not realize until later the full extent of his injury. The onset of his sudden pain and partial paralysis was difficult to diagnose. After consultations with multiple specialists, Dr. Wheeler was referred to a neurosurgeon where a diagnosis of “entrapment of the suprascapular nerve” was made. Surgery was performed, and the prognosis was that full function was to be expected, but that it could take two years. A few months after surgery, Dr. Wheeler was involved in a skiing accident which resulted in a crushing injury to that same shoulder. He underwent months of physical therapy. He confirmed that doctors do not always make the best patients, and unfortunately, he was going to be a patient for quite a long time. This brought on radical changes in the way he was going to manage his busy practice. Dr. Wheeler was up for the challenge if it would enable him to return to his quality of life, both personally and professionally. Throughout this, he was optimistic this would not be a permanent condition. However, after months of physical therapy, he was told by his doctors that he needed to face his new reality. This condition was not going to improve, and decisions about his professional future would need to be made.

The road to recovery and healing…

This was quite the emotional blow to a man who never questioned that he would not be ok. Medicine is such a huge part of who a

physician is that in Dr. Wheeler’s exact words, he “was psychologically, emotionally and physically devastated”. Aside from feeling the loss of his identity, he likened it to losing a spouse. You do not know how you will live with the loss, but you realize that life goes on. However, you never quite get over the devastating disappointment of losing what was and the insecurity of not knowing what will be. You realize that you have to find new and different ways to replace and fulfill what once defined you. During this time of making sense of his situation, a friend encouraged Dr. Wheeler to attend a healing service at the Episcopal Church of the Nativity. This service involves prayer and petition to God to grant healing of the mind, body and spirit. At the time, while he was growing stronger spiritually, his body was remaining the same. He realized he was going to have to walk away from patients and a profession he had loved for 31 years. Facing the fact that a life of retirement was inevitable, he began his process of acceptance and seeking healing in ways he could never have imagined. We all face losses of many kinds, and when we are eventually able to reflect on events in our lives and find peace and joy in the memories, we see that another form of healing has begun to take place. When asked what he misses most, Dr. Wheeler quickly said that he misses the interaction with his patients and the relationships he formed. He misses working with his partners and the office staff because they were and will always remain his family. He told us that they left his name on the door for years; he still has a key and loves to visit often, although initially, these visits were emotionally difficult. When we spoke with one of his partners, he said that Dr. Wheeler’s absence was felt most in the simple day to day presence. Their camaraderie was a brotherhood, and his compassion was unmatched. Not having him readily available to mentor or offer insight and advice was a loss to his partners and medical staff. It was an adjustment for them to go to a work place where such a void was strongly felt. One of the most empowering things Dr. Wheeler said is that throughout his professional career, he has no regrets in how he treated his patients and ran his practice, even after seeing what life was like being in the patients’ shoes. He has had a good life, and he has lived it well. He has had trials and outcomes that he would not have chosen for himself or for anyone else, but he has learned to enjoy rewards that he never knew existed until he was forced to “stop and smell the roses”. God has not stopped writing Dr. Wheeler’s story and those of you who know him, or were fortunate enough to be his patients will always appreciate his warm smile, kind eyes, loving compassion and wicked sense of humor. He is a true gift to all who know him and an inspiration to anyone going through something similar.

EATING DISORDERS CAN HAPPEN TO ANYONE.

Please know you aren’t alone. I am certainly a textbook example of all the stories you read and hear about teenage girls battling an eating disorder. I come from an affluent, two parent family with one older sister. My dad was a hardworking mechanical engineer and my mom was the idealistic housewife and mommy. My mom was super supportive and also super controlling; but at the time, I never saw her as such. She was my best friend and my favorite confidante. We lived in a nice, two story home in the suburbs of Birmingham. I went to school from preschool to high school graduation with the same classmates in the same school system. I was a straight A student, and by birth, slightly a perfectionist. I was also a part of the popular crowd. Just a typical, normal teenager with typical normal teenage issues. During my junior year of high school, I realize now, I was finding my way through the angst of growing up. I watched my childhood friends change and develop and I struggled to keep up. I didn’t like the idea of losing my adolescent naivete’. I didn’t like the changes and I didn’t appreciate having to break out of my shell and become an adult. I felt I was not in control of anyone, myself, or my body. Either a teacher, a friend, or my parent seemed to dictate who I was and where I was going at all times. The summer before my senior year, I accidentally decided to “get fit”. I wasn’t necessarily overweight but I saw myself as pudgy and was becoming insecure. I was on the cheerleading squad so I was expected to maintain an athletic build. So, watching what I was eating was not something completely out of the blue. I started small….when my friends ordered French fries, I would refrain and say I wasn’t hungry. I began packing a lunch for cheer days and for lunch during my senior year. I ate a plain turkey sandwich, a few pretzels, and maybe a jar of peaches….every day, for about 10 months. I would eat a small bowl of cereal for breakfast, and typically, a somewhat complete dinner (at least in front of my parents).

Obviously, I started to drop weight, and drop weight, and drop weight. With an active schedule and my finding something I could finally control, my 5 ft 6 in frame depleted to 100 pounds. Along the way, I would get tons of compliments and encouraging words about how great I was looking, etc. It helped me to continue down the dreadful spiral. I never ended up hospitalized like many others do, but my mom did take me to the doctor and then to a counselor. She could read between the lines and knew what we were headed toward. I did not want to talk to someone about my problems and resolved to promise I would start eating more. Well, I did start eating more, which lead me to my battle with bulimia. All four years of college, I was constantly fighting the urge to eat what everyone was eating and then go throw it up. After a six year fight, in all, I truly decided that for me, the only way to get rid of my problem was to hand it over to God. He was the only one who could definitely take away the burden and demon of my eating disorder. Anytime I felt like I needed to throw up, or skip a meal, I would literally cry out to God (often times silently in my head) for Him to help me. Most days, this is the only way I would make it through. Many people are predisposed to eating disorders and other mental illnesses. Some people are just wired to have them. You can find help with prescriptions and counselors, but I truly believe my absolute way to recovery was with GOD’s help. He is the best medicine! Now, as a 36 year old mother of 3, I still have days I find myself struggling. And still, the only way I pull myself through, is with my Lord’s help. Please know you aren’t alone. Please know others deal with and hide problems just like you have. Whatever it may be, “Trust in the Lord with all your heart and lean not on your own understanding.” Proverbs 3:5

**According to the National Association of Anorexia Nervosa and Associated Disorders, 95% of all eating disorders affect children between the ages of 13 and 25. For help and further information, you can call the National Eating Disorders Association or visit their website at www.nationaleatingdisorders.org

Call our toll-free, confidential helpline 1-800-931-2237

Monday - Thursday from 9:00 am - 9:00 pm and Friday from 9:00 am - 5:00 pm (EST)

When Your Hands are Enough by, Bobi Jo Creel, RN, MSN, CRNP

Have you ever had a moment in which you thought, "Man, I wish I could have done more?" Or, perhaps, a moment in which you were present at the right place at precisely the right time and afterwards could not stop thinking "what if?" I have had many of these moments in my professional life--moments where I held someone's life in my hands with every resource within my reach. However, I had not had a situation quite like a recent experience. Whether it be a near-miss or nothing short of perfect, divine timing for an intervention, there was never a night that convinced me to write this to implore you more than a hot, humid Saturday night here in our Rocket City. Once I was home, relaxed and had all the grit from a gas station parking lot washed off me, I felt convicted to share this. No matter if you are a stay at home parent, retired, a student or employee, please make it a point to at least have taken a non-medical, bystander CPR class. You never know where or when you may be of use. You don't have to know it all or even close, but knowing enough to be someone's lifeline can really make all the difference. That night, for some reason, after keeping my son out far too late at his favorite Saturday night event (Huntsville Speedway), he and I were engaged in a conversation when my brother, his wife, and my husband noticed a person being pulled out of a car at a convenience store we were quickly passing. We all paused for a second to try and register what was happening when my sister-inlaw thought they may be in distress, so we doubled back. I never saw them. When we pulled up under the bright lights, it was clear there was a life-threatening emergency. A gentleman had helped to pull a young, unconscious man from the backseat of a car. As his friends surrounded him crying and panicking a bystander crouched down over the young man and, with shaking hands, nervously started CPR. As I practically jumped over my family to get out of the back seat of the truck, I identified myself and immediately assessed the situation to be of assistance. After a quick head-to-toe assessment of the young man, while the bystander performed high-quality CPR, I was able to assist with his airway and breathing while speaking to the 911 operator on a bystander's phone that a very nervous, distraught young lady held out to me. 20

I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 8

By this time, it was clear it would be a few minutes until EMS arrived and it also became clear to me at that moment that we were resuscitating an apparent overdose victim. Before I became a Nurse Practitioner, I cut my teeth in Critical Care, so I guess you could say that "running codes” is in my blood, but I’ve never ran one under lights, with my bare knees on gravel-covered asphalt at a gas station. This was not "my place," but it is amazing what can happen when a solution meets a need. The young man most likely had no idea at after 9pm that night, he would be under our sets of hands as we prayed and worked with no resources available to us. Pulse established, and rescue breaths delivered, thankfully, rapid response volunteers arrived. I have never been so thankful for an Ambu-Bag in all my career. The volunteers appeared to have had a long night, but they had that, a Narcan and were willing to help. After administering it, we supported him and got his breathing better established, but he did not come around in a timely manner. So, I asked them to prepare another dose. The female responder looked at her partner and I knew we were about to hear something that was not reassuring. The rapid response only had one Narcan and, once used, we were back on our own.This was the 4th or 5th OD that week for them and that was all they were granted. The new shipment was set for the next morning. I, being used to hospital resuscitation, longed to be able to get this young man an airway to aide him and ensure that we had him...but I didn’t. EMS was still on their way, but here we were, again. We were on our own. I asked if they had a stethoscope and they did! And they had an oximeter. With those, we continued CPR and support to the point his oxygen levels improved to normal range. He still required almost full assistance at that time, but we were giving him his best chance. With no more resources, we had our hands, our skill sets and God was there with us. That was more than enough. That young man may not know it, but Jesus loves him and didn’t want him to

suffer. He put that bystander and our truck (out too late and out of our normal routine) in that parking lot for a reason and showed us He was there. I witnessed strangers come together. I saw calm come over a storm. I felt peace and clarity as I helped get blue lips back to pink. As we put him in the ambulance that finally arrived, he moved for the first time in far too many countless minutes and all we could do is thank God for helping us, as well as pray that at some point the young man realizes what a gift he has been granted. When his panic-stricken, brown eyes fluttered open and locked with mine, I had peace that I had done what I had been called to do and it really had nothing to do with being a medical professional. That is why this needed to be shared. If that non-medical person who saw a need and, despite being very frightened, had not jumped in, put his hands on that man and do his best to meet a need, this story might not have ended this way. I may have been two minutes too late. If no one would Bobi Jo Creel, RN, MSN, CRNP Cullman Internal Medicine, P.C. 1890 Alabama Highway 157 Suite 300, Cullman, AL 35058 256-737-8000 www.cullmaninternalmedicine.com

have been equipped with the basic knowledge of CPR, I would not be able to share that I later found out he survived the whole ordeal. I didn’t save him. God did. He put the right people there at the right time. Please don’t judge that young man. Pray for him. God can use that mess of a night in his life for Him. He doesn’t give up and none of us did either. Friends, things happen. It’s not always self-inflicted. This is not a commentary on drug abuse and the pitfalls of addiction. It could be a cardiac event, a person choking or a near-drowning. Your preparation could help save a friend, a family member, a child at the park, a person in a restaurant or a stranger at the beach. You never know where you will be or what you will come across in this world. I simply ask one thing of you and that is to equip yourselves. First with the One who knew how my (and my family’s) night would end before we even woke up that day, and, second, with the tools you need to help save a life-your hands, a little knowledge and a whole lot of faith. "How Do I Learn More About Becoming CPR Certified" Contact local hospitals, community centers and fire departments in your area to see what class options are available for you or visit The American Heart Association's website at www.heart.org/en/cpr to find online options and class listings in your area.

livelifewell by Belinda Maples, M.D.

May is Mental Health Awareness month. The term “mental health” is commonly used in reference to mental illness, but knowledge in the field has progressed to a level that appropriately differentiates the two conditions. Although mental health and mental illness are related, they represent different psychological states. Mental health is “a state of well-being in which the individual realizes his or her own abilities, can cope with the normal stresses of life, can work productively and fruitfully, and is able to make a contribution to his or her community.” It is estimated that only about 17% of US adults are considered to be in a state of optimal mental health…that leaves 83% of adults with something to strive for. It seems the new “normal” is to have some kind of mental health issue. The indicators of mental health include emotional well-being, psychological well-being and social well-being. It is the perceived life satisfaction, happiness, peacefulness, self-acceptance, optimism, purpose in life, self-direction, social acceptance, beliefs in the potential of people and society as a whole and the personal feeling of self-worth. There is emerging evidence that positive mental health is associated with improved health outcomes.

The stigma and denial surrounding mental illness leads many people to not seek the care they most need.

]

Mental illness is defined as “collectively all diagnosable mental disorders” or “health conditions that are characterized by alterations in thinking, mood, behavior or some combination thereof associated with distress and/or impaired functioning.” This includes depression, anxiety, bipolar disorder, schizophrenia and other psychosis. Depression is the most common form of mental illness, affecting more than 26% of the US adult population. It has been estimated that by the year 2020, depression will be the second leading cause of disability throughout the world, trailing only behind heart diseases. The burden of mental illness is felt worldwide. According to the World Health Organization, depression is the third most important cause of disease burden of the world in 2004. Unipolar depression was in 8th place in low income countries and first in middle and high income countries. Bipolar disorder has been deemed the most expensive behavioral health care diagnosis, costing more than twice as much as depression per affected individual. Mental distress was measured as 14 or more days of poor mental health in the last 30 days. Almost 10% of US adults experienced frequent mental distress in the last 3 months. The Appalachian and Mississippi Valley regions displayed high and increasing prevalence of frequent mental distress, whereas the upper Midwest showed low and decreasing prevalence of mental distress. Does anyone want to move? The former surgeon general notes there are social determinants of mental health as there are social determinants to general health. Adequate housing, safe neighborhoods, equitable jobs and wages, quality educations and equity in access to health care all have some influence on our mental well-being. Alabama cut 36% of its total general fund for the mental health budget from 2009 to 2012. Alabama has fewer psychiatrists, relative to its population size, than almost any other state in the nation. “Hospitals are filled beyond capacity and shortages in acute care hospital and crisis beds have reached critical levels” according to the National Alliance on Mental Illness report. This demonstrates that not enough mental health providers are available to address the needs of the population. Timely access to care is critical! In addition, the stigma and denial surrounding mental illness leads many people to not seek the care they most need. It is common for individuals to deny

they are ill and therefore think that they do not need help or medical treatment. The patients may hide or not fully disclose essential aspects of their symptoms for fear of the consequences of their disclosure. Another layer of complication is that the federal and state laws surrounding involuntary hospitalization of individuals with mental illness, whilst designed to protect patient’s rights, often leave loved ones and medical professionals frustrated that they have no voice, minimal sway or influence over the decisions in court. In the state of Alabama, a person cannot be committed due to a drug or alcohol problem even in light of underlying mental illness. A petition has to be filed with the Probate Court with clear and convincing evidence that the person is mentally ill with a real and present threat of substantial harm to himself or others, unable to make rational decisions regarding their treatment, or continue to experience mental distress and deterioration of their ability to function independently if not treated. I have called on the Probate office many times with intentional overdoses due to severe depression and they have refused help stating that they were depressed because of alcohol or drug issues and should resolve when they quit! Misunderstanding and stigma surrounding the mental ill are widespread. Despite the existence of effective treatment for mental disorders, there is a belief that they are untreatable or that people with mental disorders are difficult, not intelligent, or incapable of making decisions. This stigma can lead to abuse, rejection, and isolation that exclude people from health care and support. 78% of adults with mental health symptoms and 89% of adults without such symptoms agreed that treatment can help persons with mental illness lead normal lives. 7% of adults without mental health symptoms believed that people are caring and sympathetic to persons with mental illness. Only 25% of adults with mental health symptoms believed that people are caring and sympathetic to persons with mental illness. This highlights the need to educate the public about how to support persons with mental illness and the need to reduce barriers for those needing or receiving treatment for mental illness.

Belinda Maples, M.D. Athens Primary Care Associates, LLC 101 Fitness Way, Ste 1200 Athens, AL 35611 | 256.232.0636

Bisphosphonate and Dental Treatment by Jonathan Threadgill, DMD Watching television, you may have come across an actress promoting Boniva to prevent osteoporosis. It is estimated 54 million Americans have osteoporosis, or a decrease in bone mass. Studies suggest approximately 1 in 2 women and 1 in 4 men over 50 will break a bone due to osteoporosis. Boniva is a Bisphosphonate medication reported to slow the loss of bone density as we age, thus preventing or decreasing the incidence of bone fractures. Unfortunately, these drugs have been shown to have a potential side effect that can cause necrosis of jaw bones, Bisphosphonate Related Necrosis of the Jaw (BRONJ) especially when undergoing dental surgery. Bisphosphonates are a class of drugs that regulate bone metabolism and help to prevent osteoporosis and reduce the incidence of fracture and pain associated with some forms of bone-related cancer. These drugs have a high affinity for hydroxyapatite, the main component to bone mineral. This strong affinity is why they play a role in disease processes that affects bone remodeling. Bisphosphonates can be taken orally or intravenously(IV). The higher potency IV forms slow or modify the progression of malignant cancer bone diseases, i.e. breast, lung and prostate cancers. Oral bisphosphonates are more commonly used to treat osteoporosis, although some injection forms are available.

List of common medications: Oral Bisphosphonates • Fosamax • Boniva • Actonel IV Bisphosphonates • Reclast • Zometa • Aredia Next generation anti-resorptive medications • Prolia • Xgeva

BRONJ can be defined as an area of bone in the jaw that has died (necrotic) and exposed in the mouth for more than 8 weeks in a person taking a bisphosphonate medication without history of radiation to the jaw. Symptoms of BRONJ may include localized jaw pain, swelling, and draining infection. This condition is most commonly seen after dental extractions. Recently the American Association of Oral and Maxillofacial Surgeons (AAOMS) has suggested to rename this process to Medication Related Osteonecrosis of the Jaw (MRONJ), because of other anti-bone restorative medications causing similar type of necrosis. While most patients on a Bisphosphonate will not develop jaw bone necrosis, patients on these drugs with other issues ie. diabetes, smoking and taking corticosteroids appear to have an increased chance of developing this condition. The type of bisphosphonate, amount of drug, and duration are the most important determining factors. Once the necrosis has developed, treatment is based on the severity of the disease.

Clinical stages of Bisphosphonate osteonecrosis of the jaw: • Stage 0: Nonspecific clinical findings and symptoms • Stage 1: No pain with presence of exposed or necrotic bone and no evidence of infection • Stage 2: Presence of exposed necrotic bone, accom panied by infection and redness around the teeth and gums • Stage 3: Presence of all stage 2 characteristics with additional features, such as jaw fracture or draining abscess Treatment may start with discontinuation of the bisphosphonate medication. Your surgeon may recommend additional measures such as antibiotic therapy, use of chlorhexidine-containing mouth rinse and conservative debridement of loose necrotic bone up to major reconstructive surgery. Early detection allows your oral and maxillofacial surgeon to diagnose and treat the condition as quickly as possible. (continued on p. 47)

How can we prevent BRONJ when I need dental work done, and is it safe for dental implants? BRONJ is in most cases manageable and can even be preventable. Frequent preventive dental examinations and maintaining optimal oral hygiene can improve outcomes and reduce the incidence of the disease. Before starting IV bisphosphonate it is recommended to have a thorough examination and all teeth with poor prognosis extracted, then allowed to properly heal. Patients wearing dentures should be examined for any mucosal irritation and make sure they are well fitted. These decisions must be made in conjunction with the treating physician and dentist if the systemic conditions allow the delay of the bisphosphonate. If you are taking oral or IV bisphosphonates, you should have a consultation with your surgeon before any invasive dental surgery. A request may be made to your physician that you take a short discontinuation from therapy before any surgery is performed. This drug “holiday” may decrease your chance of developing jaw necrosis. When taking the IV form of the medication to treat cancer, dental implants might not be possible because of the more potent dose and increased frequency. The AAOMS has established guidelines how to manage patients taking these medications. Oral Bisphosphonates: • Less than 3 years with no clinical risk factors- No delay planned in oral surgery is necessary • Less than 3 years with clinical risk factors- 3-month drug holiday is recommended • More than 3 years with or without risk factors- 3-month drug holiday is recommended • Dental implants may be possible following proper protocol and informed consent Intravenous Bisphosphonate: • Elective dental surgery should be avoided for those being treated for cancer • Emergent dental surgery: Discontinuation of the bisphos phonate in conjunction with the physician and continue with the oral surgery limiting the amount of unnecessary tissue trauma as possible; serial follow up appointments • Dental implants usually not recommended in patients being treated for cancer o Limited studies have shown success with implant placement in patients being treated for osteoporosis with IV infusions Bisphosphonates are medications that slow the progression of osteoporosis and decrease pain associated with certain types of bone cancer. Patients should be aware of the potential side effect of osteonecrosis of the jaw. It is important to discuss concerns with your treating physician and dentist before starting these medications.

hepatitis

attn:baby boomers

by Dr. Michael Dohrenwend

Board Certified, Gastroenterology Center for Digestive Health

Karen Fox, CRNP

Hepatitis C...Know the facts not the myths...not only can people with Hepatitis C be treated, they can be cured. Hepatitis C is a blood borne disease that was identified in 1989. Prior to 1989 it was labeled non A non B viral Hepatitis. Hepatitis C is a contagious disease caused by the Hepatitis C virus. The Center for Disease Control (CDC) estimates 2% of the US population or 3.5 million individuals currently have Hepatitis C in the USA. Most do not know they have the disease. The virus can be present/active for decades with little or no symptoms. According to the CDC, baby boomers are the largest group at risk, 1 in 30 have Hepatitis C. Baby Boomers are individuals who were born between1945 - 1965. Nine months after World War II ended more babies were born in 1946 than the prior year. In 1965, 3.4 million babies were born, that is 20% more babies born than in 1945. This was the beginning of the baby boom and in 1964 the birth rate began to taper off. In 1964 there were more than 76.4 million baby boomers in the USA, making up 40% of the population. The most accepted explanation for the baby boomer generation is families were confident after the war to start a family. They believed in the future and prosperity of our country. Why are baby boomers the highest risk group diagnosed with Hepatitis C? According to the CDC most baby boomers were infected in the 1970’s & 1980’s. During these decades infection control standards were not the same standards as we have today. Hepatitis C virus is spread through direct contact with infected blood. This means blood to blood transmission, such as having a cut with blood exposed and touching another person’s cut with blood exposed that is infected with the Hepatitis C virus. Most people with Hepatitis C contracted it through shared needles, snorting cocaine, sharing razors, toothbrushes, tattooing and body piercing if strict hygienic precautions were not taken. Prior to 1990, blood was not tested for the Hepatitis C virus, therefore receiving a blood transfusion prior to 1990 is a risk factor. History of HIV is also a risk factor. Keep in mind baby boomers are the highest risk group, however any one with high risk behaviors are at risk of contacting the Hepatitis C virus. Intravenous drug use is a significant risk factor, unfortunately IV drug use is on the rise. According to World Health Organization (WHO), 13 million people globally inject illicit drugs. The estimated global prevalence of Hepatitis C in people who inject illicit drugs is 67%. The CDC reports more people die from Hepatitis C than from HIV infection. Hepatitis C is NOT transmitted with sharing utensils or casual contact such as hugging, shaking hands or sneezing. The risk of spreading Hepatitis C during sex is low (3% over 20 years in monogamist couples with unprotected sex). Hepatitis C is a virus that affects the liver. It can cause acute or chronic liver disease, ranging from mild to serious liver disease. It tends to be worse or accelerated in persons with moderate to heavy alcohol use. According to the WHO approximately 71 million people globally have Hepatitis C. Approximately

399,000 people worldwide die annually from Hepatitis C, mostly from cirrhosis or liver cancer. Cirrhosis is extensive scarring of the liver. Hepatitis C is the leading cause of liver cancer and liver transplantation. Hepatitis C is diagnosed with a blood test. Ask your health care professional if Hepatitis C screening is for you. A positive Hepatitis C test doesn’t mean the virus is active, it does mean you were infected at some point. Remember it takes only one exposure to be at risk. Most people do not know exactly when they were infected. Hepatitis C antibodies remain in the blood once a person is infected with the virus for life. Another special blood test, Hepatitis C RNA is then ordered to see if one is currently infected with the virus. According to American College of Gastroenterology (ACG) approximately 15-25% of people infected with Hepatitis C spontaneously clear the virus without treatment. According to ACG, symptoms can include fatigue, abdominal discomfort, nausea or itching. Once a patient develops cirrhosis, symptoms are more prominent and can include jaundice (yellowish color of the skin), weight loss, abdominal swelling, vomiting of blood. The virus is slowly damaging the liver over years to decades. Untreated Hepatitis C can lead to liver cancer and even death. The goal of Hepatitis C treatment is to clear the Hepatitis C virus. Prior to starting treatment the health care specialist will spend time discussing Hepatitis C and develop a plan of care. Today’s Hepatitis C treatment has less side effects and is easier to take than treatment from years prior. The end goal is sustained virologic response (SVR). In other words Hepatitis C virus is cleared after treatment. Hepatitis C is treated by a specialist, such as a Gastroenterologist, Hepatologist or Infectious Disease Doctor. These health care professionals have been trained and have the knowledge to best treat and manage Hepatitis C. The first step prior to treatment is to order specific blood tests to confirm active Hepatitis C. An abdominal ultrasound is also ordered to assess the liver status. After careful review of blood test, ultrasound, current medications the specialist will come up with a treatment plan. Direct Acting Antivirals (DAA) are medications currently used to treat Hepatitis C. These medications are taken by mouth and have less side effects than prior treatments. Average treatment last 8-24 weeks, depending on the lab results, liver status and prior history of any treatments. Treatment holds 90-100% cure rates. Currently there is no vaccine for Hepatitis C. In summary it is important to discuss Hepatitis C with your health care provider. Get tested if you are at risk. If you do test positive for Hepatitis C, there is a cure with a high cure rate 90100%. The major barrier why most people avoid discussing Hepatitis C with their health care provider is the social stigma of having Hepatitis C. Also avoid high risk factors that increases risk of contracting the Hepatitis C Virus. Don’t let this prevent you from getting treatment, preventing liver cancer or liver failure. Know the facts, it can save your life or a love one’s life. If we can be of help with any questions or screening for Hepatitis C please contact our office. 256.430.4427

The Junior League of Huntsville Gives Back and Why You Should Too by Nancy Washington Vaughn Junior League of Huntsville, 2017-18 President

“What is the essence of life? To serve others and to do good.” – Aristotle Have you volunteered recently? The question is not a typical conversation starter in our society, but perhaps it should be. Volunteerism is common in our community as many individuals give their time and energy without monetary compensation. It is common knowledge that volunteerism makes an immeasurable difference in the lives of others. But did you know that you are helping yourself by giving back to our community? Volunteering has been shown to lower stress and boost selfconfidence among other health benefits. While is it important not to lose sight of the fact that the volunteerism strengthens our community and improves the lives of beneficiaries, one cannot overlook the studies concluding that those who give support through volunteering experience greater health benefits than those who receive support through these activities. Studies have found that those who give social support to others have lower rates of mortality than those who did not, even when controlling for socioeconomic status, education, marital status, age, gender, and ethnicity. The numerous benefits of volunteerism on one’s health include, but are not limited to: • Decreased risk of depression because volunteering with and for others increases social interaction and helps build a support system based on common commitment and interests—both of which have been shown to decrease depression. • Increased enjoyment of a sense of purpose and fulfillment and self-confidence. • Increased ability to stay physically and mentally active in a meaningful way. A study revealed that volunteers increased their brain functioning. Volunteer activities get you moving and thinking at the same time. • Reduced stress levels. By enjoying time spent in service to others, you’ll feel a sense of meaning and appreciation— both given and received—which can be calming. • Increased experience of happiness from a release of dopamine in the brain. Helping others has a similar effect on the release of dopamine as vigorous workout. There are numerous ways to volunteer and support volunteerism in the Greater Huntsville community. One way is to support volunteerism is to help The Junior League of Huntsville, Inc. (JLH) achieve its charitable and educational mission. The Junior League of Huntsville. Founded in 1949, JLH has developed exceptionally qualified civic leaders who collaborate with various community partners to identify Huntsville/Madison County’s most urgent needs and address them with meaningful and sustainable solutions in order to enhance the quality of life in our community. JLH’s mission is that it is “an organization

of women committed to promoting voluntarism, developing the potential of women, and improving communities through the effective action and leadership of trained volunteers.” JLH members perform approximately 50,000 volunteer hours each year and the League has donated more than $2.5 million to our local community. JLH is part of the Association of Junior Leagues International which is one of the oldest, largest, and most effective women’s volunteer nonprofit organizations in the world including more than 150,000 women in 291 Leagues in four countries. JLH’s current projects are related to its community impact focus area of improving family literacy in our Huntsville/Madison County community. The projects include activities throughout Madison County such as hosting Family Literacy Nights at designated Huntsville Housing Authority communities, hosting college readiness seminars and awarding college scholarships for female high school seniors, planning enrichment activities for pre-school students at the Downtown and Northwest YMCA Early Childhood Education Centers, and volunteering with students in Madison County’s inaugural Summer Adventures in Learning Program at elementary schools in Huntsville City, Madison City, and Madison County. Individuals and companies can support The Junior League of Huntsville’s impactful community projects by: • contacting JLH to request volunteers for events or shortterm projects (https://www.jlhuntsville.com/sos/) • making a 100 percent tax-deductible charitable donation to the 2017-18 Annual Giving Fund (https://www.jlhuntsville.com/system/donate_summary/) • purchasing nutritious fresh apples in elegant gift baskets or bulk orders of crates for delivery to your home or office to support JLH’s 46th Annual Apple Annie Fundraiser (online ticket sales will be available on August 14th at www.jlhuntsville.com) • making a 100 percent tax-deductible donation to sponsor a school, grade, or classroom to provide Pre-K, Kindergarten and First Grade students in each Huntsville City, Madison City and Madison County public elementary school a fresh apple on JLH’s 46th Apple Annie Day in October • becoming a 2017-18 Corporate Sponsor of JLH • requesting information about JLH membership To obtain additional information about The Junior League of Huntsville’s community projects, public events, fundraisers, sponsorship opportunities, and/or membership please visit www.jlhuntsville.com, email info@jlhuntsville.com or call 256881-1080. Please don’t forget to ask your friends, family, and colleagues – “have you volunteered recently?” Dietz, N., Grimm, R., and Spring, K. (2007, April). The Health Benefits of Volunteering: A Review of Recent Research. Retrieved from https://www.nationalservice. gov/pdf/07_0506_hbr.pdf. Id. Parsons, T. (2009, December 24). Brain Benefit for Seniors Who Volunteer. Retrieved from http://www.futurity.org/brain-benefit-for-seniors-who-volunteer/. Giving Back Helps Others – And You. Retrieved from http://createthegood.org/ articles/volunteeringhealth. The United Way of Madison County’s Volunteer Center of Madison County maintains an online list of local volunteer opportunities.

In search of solutions to

Bridge the Gap Physician Extenders to Close the Ranks of Emerging Healthcare Shortages by Kari Kingsley, MSN, CRNP

Legs slightly crossed, with my back posture as stiff as that of a military cadet, I nervously clear my throat as my interview for what I consider to be the cremdelacreme of nurse practitioner positions begins. Sitting across from the impeccably dressed and perspicacious otolaryngologist, I silently pray she won’t notice the bead of sweat forming on my upper lip or the faint quiver in my voice as I try to answer her straightforward questions in the most astute way my nervous 29-year-old brain could formulate. Luckily, she missed my dry heaves in the ornate Viburnum bushes landscaping her charming office parking lot, after the interview concluded. Thinking back on that moment, a smile inches across my face. My nerves got the best of me. At the time, I would have bet the entire Powerball Lottery I wouldn’t be getting the job offer. I’d never been so happy to be wrong. I now con-

sider my collaborative physician to be not only my mentor, but one of my dearest friends and confidants. I jokingly embellish the retelling of my interview story by adding that I made sure to find out Dr. Neeta Kohli-Dang’s dress style and shoe size before we agreed on terms so that I could take full advantage of her flawless taste in clothes and accessories AND her generous heart when it comes to lending me outfits for special occasions. I count my blessings daily for the working relationship I have with my boss. I have nurse practitioner and physician assistant friends at all ends of the spectrum in terms of job satisfaction and fulfillment. They range from highly salaried slave labor positions in which they work grueling hours, rarely seeing their families all the way to those seeing 5 patients a day, begging for more work. I’m happy to fall in the middle. We run a state of the art ENT practice performing cutting-edge in office surgeries using low radiation CT imaging, complete with in office neck and thyroid ultrasounds, a speech pathology department, and audiologic testing. Likewise, Dr. Dang recognizes in me a very hardworking, OCD, type-A nurse practitioner that loves to solve the puzzles human anatomy and physiology can pose. While exemplary patient care is always our top priority, we still find a few minutes here and there to laugh and sip lattes. As our aging population continues to grow and as we continue to make astonishing advancements in medicine, raising the cost of healthcare, the American medical paradigm is shifting into uncharted waters. As our Baby-Boomers retire, the growing demand for healthcare abuts our government’s dwindling reimbursement deterring many young medical school graduates from a career in primary care… or a career in medicine altogether. Reduced reimbursement also lays a heavy burden on specialists requiring heavier patient loads with less time to spend on one-on-one care. Dawn C. Joy, Accredited Practitioner and Nursing Instructor at Gannon University has said, “I feel that the healthcare system is an upside-down pyramid; we have the personnel with the most education and knowledge farthest away from the patient because of administrative and regulatory requirements.”

So, what’s the solution when you need to connect two separate forces and bring the patients at the top of the pyramid to meet physicians at the bottom? To put it simply: You build a bridge. Physician extenders such as nurse practitioners, physician assistants, and nurse midwives are specially trained individuals, licensed to perform certain tasks and procedures that might otherwise be performed by physicians themselves. They work under the direction of a supervising or collaborating physician to bridge the gap. Physician extenders are not meant to replace physicians, simply to extend highly-skilled, quality medical care such as determining differential diagnoses, implementing protocols of care, using critical thinking skills to interpret laboratory tests and medical imaging, and performing patient education regarding various treatment modalities. Physician extenders alone will not solve the tough healthcare reform changes America has to face. But they do provide a valuable solution to an accelerating need by providing competent medical care. Metaphorically (and possibly literally), nurse practitioners and physician assistants will be the bridge on which we will carry our patients from the top of Dawn Joy’s pyramid to the bottom. Bariatric physician extenders are reaching for their back braces as they read this. When I put ink to paper and list the top characteristics my “Dream Job” would entail, my position with Dr. Neeta KohliDang at Huntsville Ear, Nose, and Throat fulfills them all. She and I have formed an enthusiastic working relationship with a strong passion to provide exemplary care to our patients, which enriches both our lives. These strong interpersonal relationships between physician and physician extender are vital to support our efforts to bridge care to patients. And it doesn’t hurt that I get to borrow Dr. Dang’s Jimmy Choo’s. Kari Kingsley is a board certified acute nurse practitioner. She graduated from the University of Alabama in Huntsville with a Master of Science in Nursing. She maintained a 4.0 GPA throughout her training and graduated with honors. Kari is licensed by the Alabama Board of Nursing and certified by the American Nurses Credentialing Center. She currently serves on the Board of the North Alabama Nurse Practitioner Association and is the Huntsville Chair-person for the American Foundation for Suicide Prevention.

THE THREE SOURCES OF VERIFYING FINANCIAL RESPONSIBILITY by Tiernan Oâ&#x20AC;&#x2122;Neill

Now more than ever, patients are seeing their financial responsibilities, burdens and debts increase when receiving medical services. It is probably one of the largest complaints and frustrations of patients; especially considering the everchanging insurance guidelines and rising premiums. However, there are sources at their disposal that individuals can use to verify and possibly even lessen the money they see leaving their pockets for services received.

The first source is the insurance company itself. I always recommend patients know the limitations and benefits of their plan. While the clinics or facilities you use are aware of many guidelines, the insurance companies fail to provide a comprehensive guide; and ultimately the financial responsibility will be yours. Knowledge of your plan comes from two main sources. First, do not throw out that benefit booklet (like so many of us do) that you receive when you first enroll in your plan or anytime the group policies change. It is a fairly comprehensive and invaluable tool to understanding your benefits and limitations. But most importantly, it is sound advice to call your insurance company prior to receiving big ticket procedures. Many times, your clinic can provide you with information to include diagnosis and service codes to assist in these conversations. By calling your insurance company you can get a better sense of what your expenses may be to financially prepare for or possibly weigh the risk/benefit of having the procedure at all. But most importantly, be sure to time-date the call and know who you are talking with. I say this because regardless of your plan guidelines, and any disclaimers they make regarding a promise of benefits, insurance companies for the most part will be held responsible for any expenses which are in contradiction. I have seen many times where insurance companies, when instructed to pull the call log, will cover services a representative erroneously stated would be covered. The second source is the clinic or facility where you receive the services. While these places are knowledgeable to insurance billing, that is not to say mistakes don’t happen. What you are trying to do is simply verify whether they have processed the claim and your expenses properly. I would always recommend meeting with the person in charge of billing directly. Receptionists rarely have the full scope of what they see when it comes to viewing/understanding your insurance determinations. Also, general staff will never have the power or authority to make corrections. I strongly suggest you set a face to face meeting with the designated biller. I say this because you don’t just want to pop in and ambush them. Aside from the “confrontation” or wait, a scheduled meeting will usually allow the staff involved to have all of the pertinent information at hand and more importantly reviewed for any potential internal mistakes. In the case where they find a mistake ahead of time, this may save you a trip to discuss the problem. The third source may be the physician’s office which referred you to the external facility or clinic in the first place. Now tread lightly here because many times the referring physician’s office may have little knowledge or authority to

assist; and you most certainly don’t want to expect them to take over your responsibilities or burdens. But sometimes they may be a good resource to verify using their professional knowledge and experience if bills or other things sound correct. Also, considering they are the originating source of referrals that tends to mean they have established relationships with those external facilities and may have better contacts or credits built with those places which can help you in the process. Having said all of the above, keep this one most important thing in mind as you navigate the process and sources. It is easier to attract bees with honey, coming into any situation or approaching any other person in a confrontational or disrespectful manner will likely not produce any desired or positive results. These sources are your best contacts, and they tend to hold enormous abilities they may use at their own discretion. Also, establishing professional and mature relationships with these sources is typically not an isolated event. Your reliance, cooperation, and understanding with these individuals should always be respectful and genuine regardless of the outcome. Remember, they rarely, if ever, advised you in signing up for one plan rather than another with better coverage. Lastly, if at the end of the day you are faced with a correct bill that may be too burdensome to pay off due to any circumstance you are personally going through, communicate that with the facility promptly. Many offices will be more than happy to create payment plans, possible discounts, or direct you towards assistance programs in order to make sure all liabilities are met for services rendered. This is something that should be done promptly, as billing departments and offices are less likely to assist individuals who evade and neglect their financial responsibilities, and also have burned up the resource of the office to track them done. Ultimately, I wish all patients the best of luck as even I know this can be a difficult and confusing process. Even for those with personal/professional experience and knowledge.

What if Myths are True? Myths come in many forms. Some are symbolic narratives that attempt to grapple with lofty topics about the origin of the earth, the universe, or even life itself. Other myths are merely beliefs that have emerged as “conventional wisdom” and attempt to explain more specific or even mundane aspects of our lives. When it comes to making decisions about health care, careful consideration to separate myth from fact can be critical. Unquestioning belief in widespread myths surrounding Long Term Care (LTC) can leave individuals and families poorly prepared and with devastating consequences. While you prepare for retirement, it is a must that you review your LTC options and costs and be certain to separate myth from fact. Can you identify common myths regarding Long Term Care?

I do not need to purchase Long Term Care coverage

Many people think they can “self insure” when it comes to long term care. If we had a crystal ball to see into the future, we could be certain that we identify the assets we will need and we could set aside the funds to cover the inevitable costs. Absent that certainty, and with no LTC policy in hand, the ever-growing costs of health care and the increasing demand could easily wipe out your life savings.

Only old people need Long Term Care services

According to the US Department of Health & Human Services (www. longtermcare.gov), more than two-thirds of today’s older adults require some kind of help with the basic activities of daily living, and these needs only increase for the weeks, months, and years as they age.

Long Term Care is only for Nursing Homes

As long as I can remember, people have expressed their expectations and the sequence of events that will occur as they get older, and the scenario almost always includes moving to a nursing home when that time comes. Many years ago, assisted living and home health care did not exist, so nursing homes were the only option. Nowadays you can expect to stay longer in the comfort of your own home thanks to LTC coverage which provides you with caregiver assistance, training, respite care and even hospice care in an end-of-life scenario.

I’ve got Medicare, so I do not need Long Term Care coverage

Of all the LTC myths, this one is the most onerous. Medicare generally pays for your physician bills and hospital bills, but not for long term disability such as illness, loss of mobility or cognitive impairment. Medicaid will generally pay for long term care skilled care expenses, but it is difficult to qualify for this benefit.

I can’t afford the cost of Long Term Care coverage

Maybe you can’t NOT afford LTC coverage. Think about how improvements in technology and methods of care are extending life expectancy. So, long term care is becoming longer term care. Without protection, this can cost you much more over time, draining your savings and threatening your assets. Today’s LTC products offer many different kinds of plans to fit all pocketbook sizes.

by Anne Jewell President, Cox Associates, Inc.

We don’t need Long Term Care coverage because we have each other

Family members are the most common source of caregiving in the United States today. Husbands and wives, brothers and sisters, and sons and daughters typically step into the caregiver role. I am an example. I took care of my father for nearly 8 years prior to moving him to an assisted living facility. Although many personal sacrifices were made, and extra responsibilities were taken on, our LTC policy provided invaluable assistance in the form of on-site caregivers and medical professionals, and facilitated the quality of care I was able to deliver for him. According to Brian Harrington of Genworth Insurance LTC Division: “Health Insurance covers medical needs such as doctor visits, hospitalization and prescriptions. Life Insurance provides financial security in death. Disability Insurance provides supplemental income when employees can’t work due to illness or injury, and Retirement Plans help people build a nest egg. But none of these types of insurance covers the cost of service and support that people need when they can no longer care for themselves because of an accident, illness or cognitive disorder.” This is precisely where LTC insurance fits in. So, is the following statement a myth or a fact?

“I will become a burden to my family as I get older.” Your planning will determine the answer. Make it a myth. Call your local LTC professional for more information. Anne C. Jewell | 256-533-0001

Future of healthcare by Tiernan O’Neill

For all of the negative aspects, changes and implications the medical environment has seen since the inception of the Affordable Care Act, and there have been plenty, it could be said it hasn’t received quite the credit it deserved. Namely, the topic and details of health care under the ACA have become common place discussion. The many rules and regulations which seemed to only apply to and be concerned with by health care professionals are now being shared with patients as well. One of the greatest indicators of this fact is the growing interest and knowledge patients have about the cost of their health care. Prior to the ACA, many patients seemed oblivious to the concept of a health care deductible; even despite it being the same concept as the deductible applied to auto or home insurance. Now, not only do patients know they have a deductible and what it means, but they can also identify whether they have a high deductible plan or not. Furthermore, they are far more informed and actively pursue in network health care providers. This is just but one example, and can be easily seen in other facets of health care costs such as health reimbursement accounts, prescription savings and even as far as whether patients select certain procedures to be performed. With the current political landscape and promises of repealing and replacing the ACA, some are taking this as an opportunity to separate parts of the law which worked for people and they would like to keep. This may turn out to be very problematic when one remembers from economics 101, there is no such thing as a “free lunch”. I can speak on this subject at length having escaped the universal health care downfall that occurred in Canada. Keeping things such as pre-existing conditions or children staying on their parent’s health plans, while popular, will prove to be costly and potentially unrealistic if we are to return to a private system. Alternatively, I would say law makThe goal of the ACA, although ers, insurance companies and medical professionals should focus on missed, was to produce afford- a free concept from the ACA which could be used to expand on the able health care for patients. I health services already provided. believe this is still a goal which Customer education is key. During the ACA especially and could possibly ultimately be really throughout the years, the Primary Care Office has been left on reached even in a privatized the front lines of medicine vs finance on their own. We have had the health care system. difficult and unfortunate charge of explaining and enforcing coverage restrictions and charges to patients far before they ever visit a specialist or other health care provider. Some cooperation with this could go a long way. As patients have clearly now shown interest, comprehension and shared responsibility with the understandings of their health coverage, this would be an ideal time for insurance companies and providers subsequently expanding the base of knowledge which we provide patients in regards to their insurance coverage and limitations. The goal of the ACA, although missed, was to produce affordable health care for patients. I believe this is still a goal which could possibly ultimately be reached even in a privatized health care system.

Don’t KNOWYOURPLAN just Sign Sign here, initial here, sign on the dotted

of the upmost importance. It is necessary

you ever “signed your life away” and then

in legislation, and in our benefits. Our

line, initial where it is highlighted...Have looked back not even sure of what you

were putting your John Hancock on?

Most people in today’s world are busy.

by Kelly Reese

Over scheduled and over demanded, most of us have too much going on to pay at-

tention to the smaller details. Sometimes, this makes things get overlooked or completed incorrectly. We become hasty, ir-

rational, and impulsive. We want to get it

that we know the changes in our co-pays, employers expect us to read policies and

agree, with signature. Reading and knowing how things have altered is just as important as knowing that we are covered

under the insurance blanket. Referrals and medical emergencies will arise. We need

to have a clear understanding of our coverage and authorizations before we need to utilize our benefits.

done and move on to the next thing. This

open a business, sign our children up for

with easy accessibility. Read and re-read

occurs when we make a large purchase, things, and even at the doctor’s office. We

just trust what we are signing and turn it in without hesitation. Often times, this

quick behavior results in us missing out on something important. It makes us break rules we don’t want to break or owe more money than we want to owe.

We need to stop, slow down, and

READ! Paper after paper, we need to

make sure we know what we are signing. Medical records and insurance papers are

Insurance companies generally have

a large amount of information available your insurance policies. If you feel you

don’t clearly understand, it is encouraged

for you to ask questions and get answers. Don’t sign until you are clear on all facts!

Insurance Financial Responsibility by Tiernan Oâ&#x20AC;&#x2122;Neill

Medical insurance is often times a touchy subject. It is difficult to navigate and sometimes difficult to understand. From the perspective of health care providers, all balances following care and treatment of an individual is ultimately the responsibility of the patient. Since even before the inception of the Affordable Care Act (ACA), providers have found it extremely difficult to navigate around the insurance billing world. Insurance companies refuse to provide a clear and detailed map of covered services. They never commit to any sort of coverage stance, always referring to their pre-service statements as â&#x20AC;&#x153;not being a guarantee

of coverage or benefits.â&#x20AC;? This situation is further complicated by the wide array of insurance plans and companies patients expect providers to accept. And not all of these companies provide up to date, convenient or even standard methods of coverage verification. Finally, the ever changing landscape of billing codes and subsequent coverage determinations has also been extremely challenging; especially for smaller operations with limited resources. Since the inception of the ACA, it has been commonplace to see plans change frequently and most importantly deductibles and patient costs increase substantially each year. When you couple this fact with the above, it is easy to see why patient financial responsibility has increased over the years. While we can empathize with how complicated these factors can be to the average person, it does not change the critical problem medical practices have seen. It is a dramatic increase in their

outstanding collections. Patients are failing to accept responsibility for the plans they chose for themselves; many of whom are becoming more and more frustrated to be paying higher premiums for lesser coverage in a sluggish economy. Of course, the insurance coverage guidelines are rather dense and complicated but patients are actually provided with far more tools and information than is being provided to the medical professionals. Further, an interesting dilemma is encountered by physicians whereby they are trying to provide the health care they were trained and obligated to provide without financial restrictions. Given the factors detailed above and including the private business of medical care in this country, it is not surprising as insurance coverage changes and patient financial responsibilities increase, more and more medical facilities will have the right to shift the burden of understanding coverage to the ultimate responsibility of the patient.

Who is Actually Responsible by Tiernan Oâ&#x20AC;&#x2122;Neill

The current state of health care and the business realities of the industry have seen an ever-increasing list of certain policies enacted at many offices in recent years. These policies can often come across as strict, inconvenient or unwelcoming to many patients. These rules and regulations are more readily seen in smaller private office settings. Prior to any individual throwing an absolute fit aimed at the office or more specifically the staff enforcing such policies, it would be best to better understand the background and possible necessity of such rules. The first root of many office policies in fact stem from the unfortunate history and lessons learned from previous patient encounters. Methods by which offices deliver health care in the most efficient and conscientious way possible can often be obstructed by difficult, unreasonable or unruly patients. After such circumstances and upon further review, typically the physician and management of the office will collaborate to develop policies in the future to avoid similar problems of a specific encounter or pattern of encounters. These policies are usually well thought out and tough to adopt, as no office wants to create lists upon lists of restrictions in providing health care. Often it is also unfortunate these general blanket type changes have to be made due to isolated incidents. But they are enacted primarily to avoid repeated, disruptive and threatening events experienced in the past; it really often boils down to a classic example of a few bad apples always ruin it for the bunch. The second cause and genesis of many office policies is the office and physician are being unreasonably expected to meet demands dictated by insurance companies or others in the health care environment. Often mandates or expectations are thrust upon those providing the actual health care which they have never agreed to or have even been included in the decision making process. Typically the expectations cause major disruptions to well es-

For office policies tablished office operations and also excessive burden to its time and resources. As a result, you will see officeâ&#x20AC;&#x2122;s either unwilling to comply to expectations created but never agreed to by third parties, or more so generating additional fees and costs they will transfer on to the patient. Again, no office or physician wants to add a never ending list of additional fees to the delivery of health care as we are all too aware of the increasing cost patients encounter in receiving affordable treatment. There is one additional perceived cause of such policies, which should be adamantly debunked. That is these office policies and subsequent enforcement are generated by and the responsibility of the office staff. It is rarely the case that general staff members are ever responsible for such rules and restrictions. This is an important fact to understand as too often it is these such employees who are left to follow, enforce and receive the ire of patients when they are unhappy with such policies. Unfortunately too often patients or other individuals take out their frustrations on employees who are simply doing their job and have no way in waiving or changing office policies ordered by their employer. Furthermore, many of these hostile encounters can cause strained relationships with patients and for the most part staff who are dedicated and well intentioned in their role in delivering excellent health care. Possible solutions to the above would be the following suggestions. First fully understand where such policies come from. Second, empathize and reason whether these are necessary policies. Third, provide reasonable feedback to appropriate management or physicians. As mentioned before, these policies are typically well thought out and good intentioned. But having said that it is possible they have unintended consequences and may need to be altered or removed entirely. The majority of physicians and management professionals I have come in contact with are always

willing and eager to receive such feedback, cooperation and input from patients. But a caution should be to all there is little entertaining, progress made or ultimate satisfaction ever gained from treating staff not responsible in such decisions as whipping posts for those to take out their frustrations.

RESPECT

is everyoneâ&#x20AC;&#x2122;s responsibility

Patients Visitors Workers Doctors

HMO/

Managed Care Plans Objectives and Requirements

by Tiernan O’Neill

A popular but well bemoaned insurance coverage option for many people has been HMO Managed Care Plans offered by insurance companies. Often these products are offered through private purchase rather than employer benefits, and can almost always be found on the state exchanges in one form or another. They are popular because the premiums tend to be much lower than other options, even including high deductible plans. They are frequently bemoaned because too often patients do not understand the limitations they have now placed on their health care and can subsequently incur greater medical expenses as a result. To understand the reason why these plans exist is best explained by the insurance company’s expectation that their costs generated by patient care will be minimized and contained by the involvement of a physician involved in all health care decisions. They believe this is best served by patients identifying, coordinating and receiving authorization for all of their care by an established and long term Primary Care Physician (PCP). Basically, they expect the involvement of such a physician to be more cost effective than simply allowing patients to coordinate their health care on their own; this is especially relevant in the case of specialists the patients need or want to see.

Here are some of the misunderstood or overlooked guidelines of these plans where most patients encounter their problems:

1 2 3

4 5

The PCP you select must actively accept this role; this is not a one way decision of the patient’s and can’t be determined by the insurance company either. And this relationship needs to be established ahead of the critical times you require them Any and all referrals needed must be initiated and authorized by your PCP; most physicians will require you to see them ahead of your specialist visit in order for them to determine, justify and agree for the need of this appointment. When the term of your initial authorization expires you will need to receive a new referral or extension from your PCP; this should be done well in advance allowing for clinical and administrative timeframes. More importantly, most PCP’s will require you to see them ahead of and in order to receive a new referral. This is because it is within their discretion and responsibility you are receiving effective and appropriate follow-up from these specialists. These three mentioned stipulations need to be satisfied prior to any specialist visit. Most PCP’s will not and actually won’t be allowed by insurance plans to retroactively authorize services for other providers, whether it is an intentional act of the patient or a simple oversight. Lastly and most importantly, all four conditions above and any other not mentioned are the responsibility of the patient. Never allow or assume a third party such as a specialist or insurance company will take care of these for you. Just the same as the financial responsibility of any non-covered services will fall completely on you and you alone if the limitations of this plan are violated.

So really despite the pervasive attitudes that these plans are too difficult to adhere to, they can in fact be a good way for patients to lower their premiums and other health care costs. They do however require your attention to the limitations, expectations and responsibilities. It would be really hard to argue PCP involvement, knowledge and expertise in coordinating your health care needs/services to be a bad idea. It does however require planning and adherence by patients; all of which are reasonable and pretty common expectations for any insurance coverage plan.

A Message to Those Choosing a Career within Health Care as Support Staff? by Tiernan O’Neill In many communities there is a large population of young adults that start or who wish to start a career in the medical field. They become support staff in various medical offices in either administrative or clinical departments. With limited education they often fall within the roles of receptionists or medical assistants. These roles could be short term or could even expand to a lifetime. I have spent many previous articles defending these staff members and better explaining their job functions to the lay person. Basically, I have done this as I would in my own office, to provide cover and support for staff as they are on the brutal frontlines of the complicated and sometimes volatile environment of healthcare. But it would be shameful not to fully explain the expectations and responsibilities these staff members must assume as well. In most all interviews I have held, I would ask the prospective employee the same question; “By pursuing a job within the medical field, whom have you chosen to serve?” I can anticipate that nearly every candidate, whether they honestly mean it or not, is just trying to give the answer they think I am looking for and will answer “the patient.” In my opinion this would be the wrong answer each and every time. The answer I look for and believe is correct is “the physician.” I elaborate to explain to them that it is the physician who holds the necessary information, education, degree, license and ultimate liability to best serve the needs of the patient. And subsequently it is our role within the support staff that can assist them in making sure all of the patients’ needs and care are met. Having said that, it is important to expand on the things we can do as support staff to best assist the physician. First and foremost, we can take our position in the process as extremely important. As I said before, many of the entry level positions are being filled with young and inexperienced people, but despite that, it would be beneficial for all if these support staff members viewed their jobs as so much more than a means to earning pay. On par with the physician, we expect them to see themselves as vital professionals and dedicate themselves to a long term career in this field….as best as they can. Secondly, they should of course still hold compassion and empathy for patients who are seeing us at their most vulnerable stages in life. Thirdly however, never forgetting the whole time they must continue to serve and not circumvent their physician’s best intentions or plan of care. Most importantly, whether these medical professionals are “directly” involved in the chain of care or are providing support as “simple” as answering phones or copying paper, we need to expect and demand they take their role seriously. It can often be overlooked that each and every action they perform, on a daily basis, holds with it a potential consequence to the care of patients. As such they need to be reminded and perform these duties with the best of intentions and highest regard. Their actions and work product will certainly affect the physician’s best efforts to provide comprehensive care to the patient. Simply put, all staff should see themselves as playing vital roles within the care of patients no matter what their position, and the consequences and gravity of their actions should be fully appreciated. In short, whether they are 18, 65, full time or part time they need and are expected to behave as consummate professionals performing essential tasks that can have life or death consequences to all of those they diligently attempt to serve.

HIPAA compliance

Do you REALLY know if you are HIPAA Compliant? Do you know where your Data is stored? Is that location protected? Are you utilizing Risk Analysis, or are you adding Risk Management also?

by Jeff Olson

Risk Analysis, a single Snapshot-in-Time. It identifies problems and suggests remediations. Then What? Risk Management, a continual Risk Analysis. Identify the problems, suggest the remediations, correct the problems then do it again. Risk Analysis and Risk Management are two areas from FAR 164.308 that are to be followed to remain HIPAA Compliant. According to the “CMS White Paper Volume 2/Paper 6”, here are steps for Risk Analysis and Risk Management. Note: CMS is not recommending that all covered entities follow this approach, but rather is providing it as a frame of reference. EXAMPLE RISK ANALYSIS STEPS: 1. Identify the scope of the analysis. 2. Gather data. 3. Identify and document potential threats and vulnerabilities. 4. Assess current security measures. 5. Determine the likelihood of threat occurrence. 6. Determine the potential impact of threat occurrence. 7. Determine the level of risk. 8. Identify security measures and finalize documentation.

The time to be Compliant and Secure is now. Don’t be the example that others learn about. Be the example that others learn from.

EXAMPLE RISK MANAGEMENT STEPS: 1. Develop and implement a risk management plan. 2. Implement security measures. 3. Evaluate and maintain security measures. Cyber Security is an integral part of being HIPAA Compliant. HIPAA rules and Cyber Security are an ever-changing environment. Just as patient care is a layered approach and ever changing, so should be the security against Cyber Threats. Cyber Security is a journey, not a destination. It is not a set it and forget it. You protect the building with locks, cameras and alarms, but your data is only protected with locks that Cyber Thieves have keys to?

Technology and Medical Practices by Morgan Boone

Technology is a part of our everyday lives and we use it to complete the simplest tasks in our daily routines. Whether that is ordering our groceries through an app on our smartphones, communicating with friends and family through social media or checking our email; technology is there every minute of every day to assist us in day to day tasks to ultimately make our lives easier. While there appears to be an app for everything these days, how come we aren’t seeing more interaction between technology and our doctors’ offices? Studies show that nearly 68% of adults have smartphones that they use daily on an average of 4.7 hours a day. We utilize the technology we have to quickly find answers to questions and educate ourselves on a variety of topics. Imagine being able to use your phone to manage your healthcare, communicate directly with your provider, and be informed about multiple aspects of your care within minutes. With access to this kind of technology there would be no more calling your doctor’s office for quick questions, playing phone tag for simple refill requests and you would have the ability to schedule appointments at your convenience. This is the direction modern medicine is moving, to enable patients to be an active participant in their health care. Being a millennial myself, and being just as attached to my smartphone as the next person, I have to ask myself, why aren’t there more applications to communicate directly with our healthcare providers? I know that in most situations millennials would prefer to use the non-face to face communication approach that patient portal technology allows for. Working in healthcare I have seen the challenges first hand, and let me tell you it is hard to change the cycle of habits patients have always used. It requires time, dedicated staff and educating the patient base at hand on how to effectively communicate with their office. The family practice I am a part of introduced this technology to our patients a few years ago, and while it has been a process to educate our patients, it has allowed for more effective and efficient patient care. We are able to quickly respond to our patients directly through their portal, share their lab results with them, and even collect updated demographic documents. What

makes this so highly efficient and effective is the elimination of the paper process and the ability to directly integrate this information in with the patient’s electronic medical record. While patient centered technology such as a patient portal allows for physicians to share information with their patients, it also allows for the patient to share useful information back with their provider. There are a number of fitness trackers and health monitoring devices that have the capability to share collected data through a patient’s portal and then directly integrate back into the patient’s chart. Through this kind of technology, patients can accurately share blood pressure readings, blood glucose readings and much more. This information is beneficial to healthcare providers and patients because it allows for an active partnership in the patient’s care. This in turn allows providers to share with their patients the accountability and the patient education tools they need to reach their goals and overall improve their health. Patients who have access to this type of technology are empowered and given choices in monitoring their care. The positive comments I have heard from patients in our office have proven to me that this type of technology is making a difference in the way patients view healthcare. Physicians and their staff should join together to provide the resources that the millennial generation strives for to create lasting and trusted physician-patient relationships. In a city such as Huntsville where an abundance of knowledge and technology is available, let’s work together to continue to provide patients with the resources they need to create a positive, healthy lifestyle for many years to come.

MDVIP

by Tobin Fisher, MD

When I was asked to write this article, my first thought was, “sure, why not?”. As the deadline loomed closer my thoughts changed to, “Why did I think this was a good idea”? The truth of the matter is, I wanted to write the article to give an alternative perspective to an area of medicine that is misunderstood by most patients and the general population. I want to try to answer the question of why I transitioned my practice from a traditional one to a concierge model. The answer is complicated and I am not sure I can give a sufficient one. The many other physicians who have this type of practice would probably give different answers to this question and we all probably have different reasons for doing it. Certainly, some may have done it at the lure of greater profits but I really do think (at least I hope) that those are the vast minority. Hopefully, a brief overview of all the thoughts I went through will lead to a deeper understanding of why a physician would do this because they want to be a better doctor. A good place to start would be to explain why I wanted to be a doctor in the first place. To make a long story short, I liked it. I know that makes no sense, how would you know you liked doing something before you did it? But for me, that is how it was. Every step of my training led down a path that made me feel more like the person I wanted to be. So flash past medical school and residency and now I am working doing what I always wanted to do. I was there to see someone when they were worried and scared and reassure them they were fine. I was also there so see someone and their family when things were not fine. Things were hectic but I always tried my best to take care of the issues and problems patients brought to the office; both the ones they stated and

the ones that were there but often not stated. Things were going well. Then, through time, things started to change. More and more the care I wanted to give was interfered with or dictated by a third party such as insurance or new Federal Regulations. There was usually a way to still get what the patient needed but that took time, and in the current medical system time is not something you often have. Along with this, the pressure to see more and more patients was very high. Suddenly, I was not doing what I had always wanted to do. The increase in volume and the decrease time spent on patient care led led me to something I was no longer enjoying. This was no longer the type of medicine I had started out wanting to practice and something had to change. Around that time my partner and mentor, Dr. Garber, was looking at a new type of model-concierge medicine. He had started looking at other options as he had the same concerns I had. Concierge medicine has been seen as many things. Some things that are said about it are true and some are not. For me it signaled a way to get back to my original goal: taking care of my patients to the best of my ability and having the time to do just that. I cannot describe how guilty and how often I questioned my decision to change my practice while I was going through the process. Even now, I often wonder if it was the right thing to do. It is very difficult and sometimes painful for families to make the choice I was now requiring of them (pay the fee to stay in my practice or find another physician) and I hope they know I do understand that. But in the end, I felt this was the best option. So was it the right choice? That is a near impossible question to answer. I do still have guilt. I admit I do still question whether or not it was the right decision. But I also feel staying on the path I was on would not have led to a fulfilling practice. I think the patients that stayed with my practice would say it was the correct decision. But in the end, I guess I did the best I could to stay true to what it was I started out trying to do which is be the physician to my patients I wanted to be.

IS THE CUSTOMER ALWAYS RIGHT?

by Tiernan O’Neill

Health care will always be a service that is provided to the public. As such, we must not forget that health care is a customer service business. Delivering quality customer service is essential in the health care industry whether it is a facility or clinic looking to increase their market share or other providers simply maintaining their standing within the community. With this, medical personnel are ultimately confronted with the concept “The Customer is Always Right.”

This old adage seems to have become old, tired, and no longer applicable. I am seeing this as I work in the current climate of health care, having worked in other traditional customer service industries before my career in health care, as well as having professional and personal contacts who continue to work in traditional customer service roles. The topic of the customer ultimately being right fills many of our work conversations. Many people have come to this position recently. I believe it can stem from the appalling disrespect and civility which seems to have grown in recent years throughout the public arena. This includes the anonymous troll on the internet, the partisan and demagoguery nature of our politics, and even the clever weasel who has figured out the squeaky wheel gets the grease in most commerce situations. There has clearly been a break down of appropriate and respectful dialogue in society whether it be in this country or another. Ultimately, it is not enough to just point fingers to the other side when you try to prove the customer is not always right. A better way would be to focus on the principles and virtues of the side of the health care worker which makes them above being wrong in most typical situations. We will start with the provider. We must agree and understand they are trained professionals. They have dedicated hours, years, finances and lifetimes towards practicing the skill and their profession. Their educational base and attention to all of the information available on medical subjects nearly makes them beyond reproach on medical decision making. As well, I can speak from a position of familiarity that I have observed nearly all of these professionals possessing a care and concern for others that is not commonly found in all people. Therefore, when patients believe they know better because of suspect articles they have read online in their spare time or have interests of pure self-motivation, it would be near possible to see how they (the patient) can possibly be right. After the provider, the various support staff within the medical community need to be observed. This would include all of the nurses, technicians, medical assistants and so on who help the doctor deliver health care in the best way they see fit. Often, these staff and support members are also viewed with a skepticism that does not best acknowledge their education or skill sets as authorities on health care. Lastly, we cannot forget all of the administrative positions, clerical staff, and various other support staff that assist in health care. While they might not have all of the same qualities and wisdom the provider has, in many cases, they have at least dedicated the time towards their profession. For example, when a patient is dissatisfied or disagrees with how a prescription or insurance claim is handled, the argument which ensues is really nonsensical considering the patient has limited experience with the situation, whereas the staff in question do this sort of thing day in and day out throughout countless days, weeks, and years.

All the above mentioned health care professionals would likely (and probably rightfully) ignore and discount the notion the customer is always right. They are using their time, skills, and aptitude of their chosen profession, not to mention wisdom and years of experience, to deliver health care as they best see fit. To be met with and possibly influenced by constant objections and arguments that would delay or derail their mission based on the flippant notion of customer satisfaction would be the very definition of negligence and malpractice. However, it would still be rather foolish to completely discount, ignore, or marginalize the “customer” in these situations. Patients are not simple drones who must adhere to orders, to take services and medications they either disagree with or have yet to understand. Of course there is a place for them to question, debate, and participate in the decision making of their health care. You must also always allow for the possibility of mistakes and oversight in the jobs of the professionals and authorities as we have deemed them. As well, patients should always voice their concern or report any member of a medical team’s staff who seems to fail at the lofty objectives that are the purpose of their occupations. When finally deciding if the customer is always right, it should be well understood at this point that granting the stance of “always” would be completely misguided. Whether it be in favor of the patient, customer, or professional, “always” is a big word. Rather then, the customer/patient should always have a say in the care and treatment they receive, but it would also be expected they approach and coordinate with the professionals in the way they best see fit. The sheer sample size of their knowledge base and dedication of those individuals in health care should be respected and taken into consideration. As in any business setting, the customer can vote with their dollars and feet to best show their dissatisfaction by choosing other health care providers or facilities. This can easily be accomplished without shouting or crying about an outdated or inapplicable cliché.

Inside Medicine | Spring Issue 2018

Can you imagine going into the grocery store and telling the cashier to bill you

financial responsibility

by Tiernan O’Neill

later? It just doesn’t happen like that, does it? The healthcare industry is possibly the only industry left where people feel they should be allowed to receive services well before they pay for them. For some unknown reason, and for some time now, it seems people have been accustomed to paying the medical community well after they receive services. Or sometimes, not paying at all. It is so important for the future of health care in this country that patients meet their financial responsibilities. This includes payments and charges at the time of service but also any subsequent bills determined by the insurance company’s response to the physician’s office billing. 65-70% of family physicians are currently claiming financial hardship. With declining insurance payments, physicians have frequently began to offer more services and additional conveniences in their office as new sources of revenue and to attract new patients. Often, by the physician offering services and bypassing traditional large scale facilities (such as hospitals) they have been able to save patients money as well. However, these services require an investment of capital in staffing and resources. Physicians are left in debt when patients receive services and do not subsequently pay for them. This negatively affects all operations and services a physician can offer in the future. In response to the lack of pay outs, phy-

sicians around the country are starting

fice. There are virtually no offices I know

to adopt a stricter financial policy. Re-

of that will not be willing to work out pay-

cent trends include collecting 100% of

ment plans with patients. Typically, this is

charges at the time of service and even

reserved for patients who are open, hon-

more are requiring patients to leave

est and upfront with the situation; con-

methods (credit card) of payment on file

versely you will find little assistance when

for future collections. While physicians

you ignore bills, refuse to answer contact

offices understand additional financial

attempts, or are less than truthful.

charges can be burdensome to many

The main point to remember is take

individuals in the present economy,

responsibility for your financial obliga-

those same individuals must recog-

tions. They are a direct result of your

nize these services and personnel have

choices of the insurance you selected,

costs. When the costs arenâ&#x20AC;&#x2122;t met due to

the appointment you scheduled to see

lack of payment, these services could

the doctor you requested and the choice

be abandoned in the future.

of seeking medical treatment for your

There is a way to meet halfway! Pa-

ailments. Ignoring or not meeting these

tients must take their financial responsi-

bills is unfair, unwarranted and unwel-

bility seriously and physicianâ&#x20AC;&#x2122;s will work

come. If patients continue to abuse the

with the billing. If there is a hardship or

system they will soon find themselves

inability to pay for such services there

without well intentioned doctors, staff,

are many alternatives or solutions.

facilities or means of treatment.

First, inquire as to the cost of procedures prior to it being performed whenever possible and discuss necessity or cheaper alternatives. Second, find a health insurance plan which will reasonably cover the expenses you typically see in any given year. Third, actively search for community resources that exist to aid those in financial hardship. Last and most important, be upfront to the physician and the physicianâ&#x20AC;&#x2122;s of-

by BY CHASE PATTISON Chief Commercial Officer at ENTRADA

Over 50% of physicians now report

having at least one symptom of burnout.

A study of almost 8,000 surgeons found that

major medical errors correlated strongly to a

surgeon’s degree of burnout.On patient outcomes,

physician burnout is associated with lower patient satisfaction and longer post-discharge recovery time. In other words, burnout can make clinicians less effective.

The Advisory Board. “Physician burnout is becoming an epidemic. How do we stop it?” April 21st, 2016

Increasing federal regulatory and compliance burdens, alongside the requirements to adopt and “meaningfully use” cumbersome EHR technology, is killing productivity and making physicians rethink their career choices. In fact, 55% of surveyed physicians would not recommend medicine as a career to their children or their friends . Many doctors are choosing to retire earlier, and those who don’t have already (or plan to) reduce access to their services by reducing the number of patients they see. All of the unintended consequences of further detaching physicians from patient care is not yet known, but thought leaders from across the industry are starting to focus on how to reducing the new challenge in healthcare - physician burnout. Here are five tips to avoid physician burnout in your practice:

1. Reduce clicks and screen time. It’s easier said than done, but obsession over reducing the clicking, scrolling, and typing in an EHR can make a major difference to a physician’s work satisfaction. In fact, engaging with the EHR, particularly EHR documentation, is routinely cited as the number one driver of physician satisfaction. Automated templates, delegating EHR responsibilities, and dictation and speech-to-text solutions are just a few tools you can use to reduce the time physicians must spend staring at the computer screen. 2. Put the lives of patients in the center of your workflow. For every hour physicians spend face-to-face with patients, they spend two more hours at the end of every day documenting what they discussed into the electronic health record. Make sure that crucial time physicians get to spend with patients is maximized. Providing small details about the patient prior to the visit - such as a patient photo, clinical data, and notes from a prior encounter - can enable physicians to spend more quality time with their patients.

3. Design your patient notes with what matters first. The massive amounts of data now being captured in the EHR has created a new phenomena of “Note Bloat,” where quality narrative about the patient is buried in page after page of indecipherable data points, an overwhelming task for physicians to even understand the true patient story. By redesigning your document templates with a cover page with the most important information (e.g. HPI, Physical Exam, Assessment, and Plan) makes a better looking document that can actually be read and understood. 4. The rest of us are mobile, and physicians should be too. The mobile revolution has transformed every major industry in the US, accept for healthcare. Physicians are almost always required to be at their desk in their office to complete any necessary EHR tasks. Investing in a handful of mobile solutions can vastly improve productivity as physicians can now find new times to be productive. Imagine being able to respond securely to your nurse while you are at lunch with your spouse or being able to finish up some documentation work on the commute home. 5. Communicate with your physicians, and make sure they are heard! Nothing irks a physician more than feeling like their opinions aren’t being heard and valued. Many clinics don’t have the necessary feedback loops and communication channels to gather physician input, leading to many doctors believing they are “on their own” to fight the uphill battle of practicing medicine in the new era of EHRs, Meaningful Use, ICD-10, MACRA/MIPS, and so on. Make sure your practice has recurring meetings with not only administration and physician leadership, but also with employees throughout the practice.

What’s Your Financial Blueprint? Don’t let finances STRESS YOU by Kevin Fernandez Don’t STRESS . . . by Kimberly Waldrop Your overall health can certainly be affected by stress. Stress can be caused by relationship struggles, workload, diet, and other things. One of the main causes of stress in our society is financial worries. Chances are, at some point, you have/will experience some level of financial stress. It can cause ulcers, headaches and heart attacks. If you consume your thoughts with how much money you have, how you are going to pay a bill, or feed your family; you can develop stress-related health conditions. These conditions do not need to go unnoticed or untreated. The first step in getting the financial stress under control is to tackle it head on. Being concerned with your finances and getting a handle on them will help your worry and ease your mind. Therefore, the stress you are feeling should diminish. Our friends at Fernandez Financial Group have offered some tips to help deal with finances. We hope these ideas help you control any financial stress and moreover, help you have a healthy life.

What Is Your Money Blueprint? 5 Habits for Building a Blueprint for Financial Success For the past 6 years, I have been helping clients take the right steps toward financial freedom. A big part of my job is to help them make the right decisions with their money. I’ve helped people from all paths of life - people who are starting out their careers, just gotten married, just had kids, and people on the other end of the spectrum who are retired or are ready to retire, who are empty nesters or may have had their kids graduate college and come back home (which seems to be normal nowadays). I’ve helped people that earn $50,000 per year and I’ve helped people making over $1,000,000 per year. What I’ve found is that those on their path toward achieving true financial freedom or those who achieved true financial freedom, have done it with a very simple reason - excellent money habits. Right now, your bank account balance and your retirement account balance are a result of your habits. Are you a spender or a saver? Do you follow a strategic plan with your money? If you’re right where you’d like to be financially, that’s excellent! If you’re not, maybe you should allow me to suggest that there are some productive money habits and/or some knowledge you may be lacking. I want to give you some ideas that I wholeheartedly believe can improve your financial life immediately…if implemented.

Habit #1: Set Solid Financial Goals It may seem obvious to some, but this is absolutely critical. We all have goals whether we admit what they are or not, whether we’ve written them down or not. If you don’t take the time to figure out what true financial freedom means to you, how will you know if you’re on the right path? Everyone has a different definition of success and the same goes for financial success. Once you set your long term goals, make a decision to get started right away. Why? - Compound interest. Compound interest will work its magic in your favor; and the sooner you get started, the more powerful it will be for you. By having solid financial goals, you’ll have a reason to stop yourself from spending all your hard earned money today. Decide what true financial success means to you, and then think about how good it will feel when you achieve your goal; but also think about how painful it will be if you don’t achieve your goal. This will help you stay motivated and disciplined!

Habit #2: Pay Yourself First One of the best possible habits I’ve seen in financially successful people is the habit of paying themselves first. From every paycheck you receive, you should allocate a certain percentage towards your financial goals. Try starting with 10% of every check. If that’s truly not possible for you right now, start with whatever you can afford and build the habit of paying yourself first starting right now! If you’re already saving 10%, then stretch yourself and take it up to 15% or 20%. If your income doesn’t permit this, then find a way to increase your income. You should always be looking for ways to increase your income to match that of the lifestyle you truly desire. There’s nothing inspiring about setting low goals just to stay within our means. Now, it’s obviously important to be financially responsible, so I’m not saying that you shouldn’t live within your means; but, what I am saying is that you need to decide what you truly want and figure out a way to earn the necessary income to achieve your desired lifestyle

Habit #3: Create a Budget and Be Disciplined Once you have the end goal in mind, it’s time to create the roadmap that will get you there. This is much easier to do once you have goals and know what’s most important. You’ll be able to see where your money has been going and whatever doesn’t align with your goals can be adjusted. You can eat out less or travel less for a limited time. Again, you should always be looking for ways to increase your income. As your income increases, you will be able to allocate more money to certain things while still staying on track toward your financial freedom.

Habit #4: Build an Emergency Fund If you’re like most people, unexpected expenses happen rather regularly. Maybe there was a storm and you had some roof damage, or the AC unit broke down, or you got a flat tire, etc. All these things, however big or small they may seem, tend to add up. If you don’t have an emergency fund, you will end up having to borrow to cover these unexpected expenses and that can be costly. Credit cards can charge in excess of 20% for borrowed money, and that will be a lot of unnecessary interest you will have to pay that could have otherwise gone toward your financial goals. A small tip that I would like to give you from personal experience is to keep your emergency fund away from where you keep your checking/savings account. Why? Because with technology nowadays, it’s so easy to transfer money from your savings account to your checking account (if they’re within the same bank) on your phone. This makes it easy for people to use their “emergency fund” money for impulse purchases that they shouldn’t make. If you need to keep an item you didn’t need at a store for 3 days while you’re waiting for your money, chances are you will not go back for it and make the logical decision that aligns with your financial goals. Emotions can hurt your financial goals when you make an impulse purchase decision, so why not protect yourself from yourself by making it harder for you to access your emergency fund? While you can still get your money quickly, transferring the money from one institution to another may take 1-2 business days, which may be long enough for you to get over wanting to make that unnecessary purchase.

Habit #5: Make Logical Investment Decisions While this may sound overly simplistic, this is the biggest mistake people make when investing for their long term goals. Why? It’s simple - emotions. We all know that the secret to making money in the markets (Stock Market/Real Estate Market) is to “buy low and sell high” - to buy when the value of the stock or the property is down and sell it later when the value is up so you make as much profit as possible. However, not many people follow that advice over the long term. When the market is going down, people experience fear; therefore, they do not want to put money into the markets, and a lot of people actually get out of the market which is a big mistake since they’re “selling low.” On the other end, when the market is high and doing great people get excited and buy more. Buying more is not necessarily wrong, but remember that when the market is doing well you’re “buying high.” A simple way to make logical decisions is to use what’s called “Annual Asset Re-Allocation.” Let’s say you chose to invest your money 50% in stocks and 50% in bonds. If the market has done well, it is possible that by the end of that year your account may look more like 60% stocks and 40% bonds. Using this method, you would sell off the profits from the stocks (selling high) and invest that money in the bonds portion, bringing your asset mix back to 50/50. Conversely, when the stock market has gone down, your portfolio may look more like 40% stocks and 60% bonds. You would take 10% of the money from the bonds portion and invest it in the stocks portion (buying low) to bring your asset mix back to 50/50. Follow this approach over the long term and don’t try to time the market. Remember, it’s not about timing the market; it’s about time in the market.

Make sure to implement and build these 5 habits into your life starting right away and see how your finances change over the next few years. No matter what life throws at you financially, you will have peace of mind and confidence because your financial house has a very strong foundation. Having this foundation can also ease any financial stress you could endure. A healthy life and a healthy financial picture go hand in hand. If we can ever be of help to you with any of your financial goals, please can contact us. We would love to help you!

Why is my doctor requiring me to see them for my

prescription refill requests? by Tiernan O’Neill There are many reasons why patients call their doctor. However the majority of those reasons fall under two categories, a) they wish to schedule an appointment or b) they are calling to request refills on their medication without scheduling an appointment. The former is relatively straight forward, but the latter can often be a source of confusion and conflict when requests are denied and patients are required to see the doctor. Although not necessarily an administrative concern, it is the clerical staff falling directly in the line of fire of patient frustrations. It is important as always to keep in mind rarely does staff relay unauthorized information from the doctor nor do they make independent decisions. More times than not they are simply following the physician’s (and their employer’s) protocol and/or direct orders. But I’m sure many patients might be interested in the reasons behind such decisions. And they often fall in one of the four categories below. 1) All medications have the potential for SIDE EFFECTS. This should not necessarily come as news to people, but perhaps it is overlooked too often. Such side effects are usually provided by the pharmacy or covered by the physician when medications are first prescribed. Furthermore, these potential side effects are often detailed through all of the direct to patient commercials or even class action lawsuits surrounding nearly every medication out there. Side effects can appear anytime, regardless if a patient has been stable on them for some time and often require blood tests to determine. As well it is too often overlooked that all medications hold potential serious side effects; and this includes controlled substances, non-controlled, over the counter products and yes even so called benign nutritional supplements. 2) When a doctor prescribes any medication, whether controlled or even those that can be readily available as generic version over the counter, that doctor is assuming HEALTHCARE RESPONSIBILITY. Which means any party ranging from insurance companies, legal authorities, or even the patients directly will assume the physician is taking responsibility for their care. This responsibility, once accepted, can be assumed to include not only the medication or condition being treated, but also the patient’s overall or unrelated health conditions. If a physician blindly accepts this responsibility and neglects to care for their entire patient there can be serious repercussions for not only the physician but the patient as well.

3) By encouraging the patient to see the physician for prescription refills, the physician can also create what we will call the OH BY THE WAY phenomenon. Too often patients can be narrowly focused on their specific interest or condition, while they casually ignore other health care issues they may be experiencing. For a classic example, a male patient desires to have their erectile dysfunction medication filled. But during office visit they might add “oh by the way” I have this mole that has been problematic and possibly cancerous for some time. By the doctor eyeballing and communicating with their patients, they can often perceive or be informed of potentially serious health conditions which may have been ignored or oblivious to the patient for some time. 4) Ultimately prescribing medications falls under what is known as PHYSICIAN PRIVILEGE. With each encounter, prescription, health concern the physician is attaching their medical license to that patient in question. Now individual physicians may follow different standards by which they monitor and refuse to fill medications without seeing the patient, it is hard to fault the physician for taking an active approach towards their relationship with the patient. In fact, many physicians I am familiar with that will blindly refill medications without seeing the patient admittedly do so because they feel their schedule and office are too busy to accommodate all of the combined acute and chronic patients on a daily basis. Given the moral and legal ramifications explained above, any physician may rightfully be expected to determine their own prescribing habits and how they maintain their prescribing license. I would say all of the above explain reasonable grounds for what your physician determines as to your refill requests. But I also encourage all patients to have discussions with their physicians as to their reasoning; open communication is a cornerstone of a healthy and effective physician-patient relationship. Too often I have witnessed and heard patients complain of such scenarios to general office staff and never mention their concern once to the physician. This is always a conversation that should happen one on one during a visit deemed necessary by the physician. -Tiernan O’Neill, Panacea O’Neill Medical Group

Braces

they arenâ&#x20AC;&#x2122;t just for kids anymore!

Tooth alignment can be changed at any age if your gums and bone structure are healthy. If youâ&#x20AC;&#x2122;ve ever thought about having orthodontic or cosmetic dental work done as an adult, you are not part of the norm. Most adults donâ&#x20AC;&#x2122;t take the time to improve their smile, teeth alignment, or overall dental health. Someone deep in their career and social groups typically associate this type of correction with teenagers. Just like executing maintenance on our cars and home-improvement projects, creating and having an appropriate dental treatment plan is so important. Unfortunately, just as in my own personal experience, adults are slow to respond or come up with as many excuses as possible to avoid the inevitable. It took the wearing down of my own teeth enamel from clenching and grinding to make me jump on the chance to correct my issues. I should have listened to the advice of the orthodontist sooner. Although wearing Invisalign was simple, I was simply not the best candidate. I had no discipline and I unwillingly admitted this after months of treatment. Therefore, I am now wearing traditional braces. Regardless of title, position, and or parental role, I get to hold on to this as no heavy burden. Teeth are essential to our daily, healthy living. They need maintenance and sometimes upgrades, just as the vehicles we use for transportation. Whether you need esthetic enhance-

by, Kelly Reese

ment, have teeth deformity and/or just the normal wear and tear, I encourage you to visit an orthodontist that is knowledgeable. In my experience, I have been fortunate to have a whole team participate, along with the orthodontist, eager to see me get the results I want and need and do it successfully. There are many orthodontic treatments available and having these treatments at later stages in life can dramatically improve your personal appearance, self-esteem, and often times, overall health. Educate yourself on the provider and their ability to achieve your desired outcome. New techniques and appliances can be used to greatly reduce discomfort levels, decrease the frequency of visits, shorten treatment times, and may allow you to choose from several options. At Durham Orthodontics, you will see, a large percentage of patients are adults. Weather you have crooked teeth, a bad bite contributing to bone loss, tooth decay, abnormal wear of the tooth enamel and surfaces resulting in headaches and jaw joint pain; address your dental work now. They all agree it is never too late to improve your greatest asset - your smile! Durham Orthodontics 256.325.0078 bracesbydurham.com

3D Printing

TrueFit Dentures

by Sydney Taylor

Dentures have always been a tedious prosthetic to manufacture. From sticky impressions, to laborious fabricating, to sometimes endless perfecting, thereâ&#x20AC;&#x2122;s never a simple moment in creating this product. In addition, once this product is complete, thereâ&#x20AC;&#x2122;s always the possibility of damage, misplacement, and even total destruction, regrettably resulting in a complete do-over from step one. 3D printing, however, removes the hassle of traditional denture manufacturing and brings technology to the forefront of this task to print, yes print, a prosthetic that Oral Arts is proud to present: TrueFit, an all-new revolutionary denture.

There are no messy models, no wasted materials, and every patient’s design is stored for quick and simple reprints for any case of damage, loss or total destruction. Dentures have always been a tedious prosthetic to manufacture. From sticky impressions, to laborious fabricating, to sometimes endless perfecting, there’s never a simple moment in creating this product. In addition, once this product is complete, there’s always the possibility of damage, misplacement, and even total destruction, regrettably resulting in a complete doover from step one. 3D printing, however, removes the hassle of traditional denture manufacturing and brings technology to the forefront of this task to print, yes print, a prosthetic that Oral Arts is proud to present: TrueFit, an all-new revolutionary denture. 3D Printing is the key to the future of fabrication. Over the years, 3D printing technology has evolved into a refined and complex innovation capable of delivering products that are durable, strong, and, crazily enough, printed from computer files. Enterprises throughout the globe have fabricated their work from this invaluable technology. From printing bicycles, to generating helicopter blades, to even replicating rocket engines for NASA, 3D printing is quickly becoming the top manufacturing method for products everywhere in every field of study. In the dental field, Oral Arts Dental Laboratories have researched the success of 3D printing, and have implemented this futuristic technology into their own dental prosthetic fabrication. As a leader of the dental industry, Oral Arts researches constantly for progressive development to apply in their laboratory while performing in-house beta tests to remain abreast of all industry growth. Needless to say, 3D printing proved to be the next step of advancement for the lab. After partnering with the cutting-edge technology of Carbon, Inc. 3D Printers, Oral Arts has reinvented the fabrication process for a popular dental treatment: the denture. This digital phenomenon is not just revolutionary in its sheer fabrication. TrueFit, the new, radical 3D printed denture, illustrates a genuine way to bring patients a smile with results that far outweigh the traditional archaic denture design. TrueFit stems from being completely CAD/CAM scanned and modified, digitally achieving the perfect fit for a patient before

the product design zips to the printer. And, as a finishing touch, there’s no change required in the dental professional’s methods of attaining an impression to have these ground-breaking dentures fabricated. All chairside impression work remains up to the doctor’s preference, and once an impression is ready, Oral Arts does the rest. Additionally, by pairing elite CAD/CAM designs with the state-of-the-art engineering of the Carbon Inc. 3D Printer, TrueFit dentures are designed not just for accuracy, but for beauty and durability that lasts. Like Oral Arts, Carbon Inc. is also an industry leader whose 3D Printers are engineered with the highest resolution on the market, illustrating remarkable mi-

croscopic details in the final product. A TrueFit denture constructed from a Carbon Printer is anatomically stunning, chiseled flawlessly to exhibit a natural smile full of dynamic detail and esthetics. In addition to exquisite attraction, these dentures are also 3D Printed in the same machine as auto parts, skateboards, and even soles of Adidas running shoes, making TrueFit conditioned to withstand tough elements, embrace harsh impacts, and provide a durable, lasting smile. The future has climactically arrived at Oral Arts Dental Laboratories. With impeccable design bound to cutting-edge technology, TrueFit Dentures have redefined denture prosthetic fabrication with precision, speed, and final results that genuinely fit true. This restoration advancement has opened a plethora of possibilities not just for Oral Arts, but for the dental field as a whole. Printable dentures could be just the start of an entire dental field revolution.

Who knows what the next monumental dental innovation will be? Rest assured, Oral Arts Dental Laboratories will be on the front lines of the dental innovation movement, paving the way to bigger and better prosthetics and dental treatment for years to come. Oral Arts Dental Laboratories 2700 South Memorial Parkway, Huntsville, AL 35801 256-533-6670 www.oralartsdental.com

Fighting Obesity to Prevent the Big “C” by Adrienne Dowd, MS, RDN, RYT

The food we eat, the beverages we drink, the

High Nutrient Dense Foods

environment in which we live, all have great impacts

Calorie dense, nutrient poor foods can lead to undernourished,

on our health. Eating a healthy diet not only helps

obese individuals. A general rule of thumb is to go for foods that

prevent cancer, but other diseases too, such as diabetes, heart disease, obesity, etc. Even with this knowledge, our country is still in an obesity epidemic where one in three adults in the United States are considered obese (BMI >30) and only

are not highly processed. Avoid foods such as fast foods, most snack foods and sodas. Plant-based foods like vegetables, fruits, and whole grains have high amounts of phytonutrients to feed your body. These ‘phytonutrients’ (literally meaning the nutrients that are found in plants) contain antioxidants, flavonoids, chlorophyll, glucosinolates, carotenoids, etc. to

2.7% of Americans meet the four major healthy

help protect your cells from oxidative damage, which can

lifestyle characteristics: not smoking, getting enough

lead to cancer. A lot of “diet” foods have low calories, but

physical activity, eating a healthy diet, and not

also have few nutrients which can leave your body wanting

having over the recommended amount of body fat. Keeping a healthy weight and creating an optimal environment inside and outside your body is one of the best ways to decrease your disease risk. Below are four methods in which to keep your weight (and cancer risk) in check.

more since it has not been properly “fed”. Consider the fuel grade you put in your car…the higher quality, cleaner fuel you use, the better your car will run right? Same with the “fuel” we put in our bodies. Go for quality, not quantity.

Fiber When we are eating more plant-based foods, we naturally receive more fiber. Fiber is great for keeping you feeling full and helps with your ‘morning constitution’ (provided you are also staying hydrated!), which facilitates the removal of body waste and other toxins. Many fibers, known as prebiotics, help feed the good bacteria in your gut. This good bacteria network is known as your gut microbiome. Foods high in prebiotics include asparagus, leeks, onions, garlic, bananas, and legumes just to name a few. Having poor mircobiome diversity has been directly shown to be linked with obesity and associated diseases such as diabetes and high blood pressure. As discussed earlier, obesity is a factor in cancer risk.

Low Glycemic Load Glycemic load is different than the glycemic index as it provides a more accurate look at what effect food has on your blood sugar. Some foods that may be high on the glycemic index will actually have a low glycemic load. Grapes,

healthy

Eating ON A BUDGET

Can you really eat healthy on a budget? Absolutely! Following these tips will help you stick to your budget while eating healthy. The most important tip is to plan a 5-7 day menu and create a shopping list in advance. When planning your menu, browse through the weekly ad from your local store and choose meals which call for ingredients that are on sale. Then make sure you stick to your grocery list while shopping. “Saving money at the supermarket doesn’t mean giving up nutritious foods.” says Jill Weisenberger, MS, RDN. Choose less expensive meats such as chuck or bottom round roast which has less fat and is cheaper than sirloin. Learn to incorporate whole grains and beans! Whole grains such as brown rice and quinoa along with pinto or black beans is a tasty and inexpensive way to add fiber and protein to your diet. The more you can replace meat with beans, the more money you will save. “You can cut food costs by eating more meals at home and by making sure you feature healthy foods such as whole grains, beans and vegetables.” says Elaine Magee, MPH, RDN. Another great tip is it’s always smart to buy frozen produce or produce that’s in season. Frozen produce is just as nutritious as fresh produce. It’s available year round and is cheaper. With these simple tips, everyone on a budget can make healthy eating a reality for their family.

by Keri Matherne

IT’S NOT TOO LATE by Pat Ballew, 2015 Mr. Alabama

Do you want to live a longer, healthier, and happier life? Of course you do! Who wouldn’t want to experience all the joys and beauties of life for as long as possible.

What are some ways to better improve your health and fitness and hopefully extend your lives a little longer? The first thing I recommend is to write down a fitness goal. Don’t just think of one, actually write it down and put it somewhere you will see every day. Once something is written out it seems to become much more attainable. Additionally, you will hold yourself more accountable when you actually read and see your goal each day. Start with a simple goal. Little changes over time create greater change in the end. After you have your goal written out, decide how you will go about getting it done. This is the fun part! Yes, I said fun part. It typically involves some sort of activity or workout regime. When people think of working out they instantly picture being in a gym lifting weights or on a treadmill running to the beat of their favorite music. Well my friends, fitness can be so much more than that. Mother nature has provided us with the ultimate adult playground. There are unlimited outdoor activities that not only elevate your heart rate, but also allow you to spend time with your friends and family. Spending time with loved ones is something that none of us do enough of these days. We are all guilty of burying ourselves in technology. Go for a swim, play a game of kick ball, ride your bike around the neighborhood. All of which are simple and effective ways to burn calories and build your cardiovascular stamina while building a great foundation for improving your health. It doesn’t have to be complicated, in fact, anything that gets you moving around can be used as exercise. Lets get out of the house and get back to experiencing life. I challenge you to pick some outdoor activities and give them a try. What do you have to lose? Just don’t sit on the couch and let this beautiful life pass you by. Our time on this earth is limited enough. Lets stop doing things that make our time here even shorter.

You hold the power to creating the life you live. I believe in you!

let's get

HEALTHY by Christen Burns Bridges

Are you ready to lose weight?? It’s not easy but let me tell you, it’s worth it. Losing weight and then maintaining a healthy lifestyle is key to so many medical issues and your overall well-being. My story is like so many others. I have been overweight since puberty but never really got serious about losing weight until about three years ago. I was a 30yr old, full-time working wife and mother of two and I was sick and tired all the time. I had no energy. I was on medications for high blood pressure, was pre-diabetic and had zero motivation or willingness to do anything about it. I suffered from psoriasis as well and I knew I was unhealthy. Many doctors, including my dermatologist, would tell me that my health concerns would greatly decrease if I could lose weight. Even though I am also in the health care industry, I thought they were wrong. How could my weight truly affect my skin disorder?? Well, no matter what, I knew things weren’t going to miraculously change. I considered weight loss surgery but I knew in my heart that if I wanted to be healthy, I had to make the change myself. I wanted to get off the couch and be active with my kids. My family is a driving force behind what keeps me going with my health and fitness. I do this for them, to be able to live an adventurous and active lifestyle with my family. I want to teach them healthy habits for a longer life but also to love themselves no matter what they look like. I want them to have the confidence to do anything they want I started by changing my diet. Here in the south, every event, graduation, birthday or holiday calls for a family gathering. Every gathering in our family involves food. It was VERY hard in the beginning to see everyone eating Southern Comfort food while I ate my “diet” food, as they called it. When I first started dieting, the main thing that I cut out was bread. I began to notice that the more weight I lost (from not eating bread) the more my psoriasis cleared

up. I began doing my own research and discovered that psoriasis is an auto-immune disorder and that many auto-immune disorders are irritated or worsened by gluten. I immediately started a gluten-free diet and am happy to report that as long as I’m not consuming gluten, the psoriasis stays at bay. And, I will credit my dermatologist for trying to tell me this long ago. I started to see the weight fall off almost immediately and then I was hooked! I felt great! I began exercising. Just walking on my lunch break at first. After about 30 pounds, I hit a plateau. So I changed things up and got a gym membership! I also switched over to counting macros at this point. I increased my cardio and before you know it, another 30 pounds gone! I found that working out not only helped me to lose weight but helped to alleviate stress and allowed me to decompress after work. I’ve gone from walking on my lunch break 2-3 times a week to 6-8 workouts per week. The more I stay active, the better I feel. Today, three years later, I’ve lost and have been able to maintain about a 65-70lbs weight loss. My ultimate goal three years ago was to lose 100lbs. I am so close to that goal! The more weight you lose, the harder it is to get the weight off. I constantly have to change things up now to

keep from hitting plateaus. I have to change my diet, routines, and workouts. I also know creating goals can be a huge motivator to keep me going. Knowing what you are working for, having a plan to reach them and then crossing them off your list is the most satisfying thing ever. It helps even more than actually seeing the weight drop off. Being able to say “I did that” is so satisfying. I make yearly, monthly, weekly and daily goals in all aspects of my life. My biggest and hardest goal for 2018 was to participate in one 5k per month. I just completed #12! I will be able to say “I DID IT!” My next big goal is the Bridgestreet Half Marathon in April 2019. While I did make fitness resolutions at the beginning of 2018, it is never too soon to start your journey. Don't wait until after the holidays, until after the New Year, until after vacation. Start now. Three months from now, you will thank yourself. Unfortunately, two months ago, I was diagnosed with Poly Cystic Ovarian Syndrome. This has made the struggle to lose more weight even greater. One of the biggest side effects from PCOS is obesity. Research shows that a lowcarb diet is beneficial specifically for women with PCOS.

Going about this journey as well as seeing others navigating it, I have found the most important thing to eating healthy and staying on track is meal prepping. My favorite quote here is “fail to prepare and you have prepared to fail”. While getting to the gym and working out are not issues for me anymore, the nutrition aspects are much, much more difficult. So moving forward I will be more conscientious of what I eat. Again, a way to help create a healthy me is focusing on my weight and my nutrition. As I continue my career as a healthcare worker, I see firsthand the long-term effects of not taking care of yourself. I see how much time and money are required for medications and doctors’ appointments. My new lifestyle has

come with many sacrifices but none outweigh the benefits of being healthy. We have one life and one body and I intend on not wasting mine. I want to make the most of this life, for as long as I am able. It's so easy to change your lifestyle to prevent long-term illnesses such as Hyperlipidemia, Hypertension, Diabetes, etc. compared to having to deal with them by taking medications and using insurance or paying for different doctors to manage your care. I have brought my lunch and dinner, even out to restaurants, to ensure that I hold myself accountable. It’s not always easy, in fact sometimes it’s so hard that I have missed gatherings because I knew I would not be able to resist temptations. Staying motivated is the other key factor. When someone asks me about my motivation, aside from just being healthy, I always answer quickly with “my kids”. There are days that are hard to find my motivation but I go back to my “I don’t” attitude. I just refuse to give in to mental weakness, a bad day, a bad week, or any force of distraction trying to derail me. I started an Instagram page to hold myself accountable. I hope that by posting my progress I motivate other people to make positive changes in their lives. My husband (who has been 150% supportive of me the entire journey) has recently joined the gym and the kids are able to come and witness us working hard towards our goals together. I want you to know you can do it too!! Do it for yourself, your health, and your family!

The Joy in the Sea by Angela L. Hampton, D.P.M.

When I reflect on my early childhood, I mostly have fond memories. I was fortunate to be a member of a military family that traveled to many wonderful places. My exposure to different cultures, religions, and perspectives was vast. I enjoyed our adventures. If you asked my childhood self, “Are you happy?” the answer would be “Yes.” If I equated my early childhood to a large body of water such as the sea, I would say it was very calm and beautiful. But, I think my viewpoint of this sea of my life was what I saw as I stood on the beach at a distance. During my early adolescence, I had a wonderful time making friends, excelling in school, playing sports, and learning many new things. Life was good. Then, in my fourteenth year, my grandmother passed away suddenly. I felt like someone had punched me in the stomach. I believed in God, but I could not understand why he would let this happen. I cried until there were no more tears left. Someone tried to comfort me by saying something about sorrow may endure for the night, but joy will come in the morning. My teenage self said thank you without comprehension of that statement. I thought I would not be happy for a long time. To me, happiness and joy were one in the same. My calm sea of life now experienced its first noticeable ripple. I was no longer viewing my sea at a distance from the beach. I felt like I had stumbled to the water’s edge and disrupted the calm of my sea. The ripple of my sorrow and raw emotion eventually vanished. If I asked my adolescent self, “Are you happy?” the overall answer would be a more slowly answered, “Yes.” Young adulthood was a whirlwind. Many wonderful things such as graduations, travel, and relationships happened. Along with the good also came the bad such as broken relationships, death, stress, and unexpected detours. In my sea of life at this point, I was deep in the water. The ripples were more frequent and larger. At times, I felt like I was sinking. When I reached a point when there were more ripples than calm, I prayed. I needed saving. At this point, I officially accepted Jesus as my savior. If I asked my young adult self “Are you happy?”, the answer would be, “Is happiness really the goal?” As I grew in my faith, I remembered the comment made after my grandmother’s death. “Sorrow endures for the night, but joy comes in the morning.” I had always thought happiness and joy were the same. I was wrong. Happiness does not last. It fluctuates depending on the situation. In my faith, I have learned that true joy does not fluctuate. Joy is a constant sense of peace that God’s grace gives us. It remains in the good and bad times. I now want joy. Four years ago, the sea of my life was in a raging storm. The skies above were dark and waves were monstrous. There was nothing I could do but endure. I was not floating in this sea alone. I now had a boat…God. I survived that storm in my sea. I have yet to obtain pure joy. I still worry and try to handle things on my own sometimes. The difference is now that I have experienced moments of joy and the peace only my savior can give, I will work toward pure joy. My search for joy has now surpassed my desire for happiness.

Joy or Happiness? The word happiness originated from the word happenstance, meaning coincidence or by chance. Happiness, by definition, is dependent upon circumstance. A rainy day, a loss by your favorite sports team, or getting bad news can all rob you of your happiness. Likewise, a sunny day, a big sports victory, or a promotion at work can bring temporary happiness to your life. Happiness is not a bad thing, but happiness is fragile and inconsistent, and is often dictated by circumstances outside of your control. The Bible doesn’t promise happiness; it promises joy. Joy is an unwavering emotion that is rooted in faith in Jesus. Joy pursues the good in every situation, even the worst of situations. James 1: 2 says, “count it all joy, my brother, when you meet trials of various kinds…” Having trials of various kinds will definitely not lead to happiness. But look what James says in the next two verses, “For you know that the testing of your faith produces steadfastness. And let steadfastness have its full effect, that you may be perfect and complete, lacking in nothing.” Joy is an attitude of the heart that anticipates the spiritual growth that follows times of suffering. Joy is the Christian pursuit of being perfected and complete in Christ. Happiness comes and goes, but joy in Christ is eternal. – Ben Macklin

by Pat Ballew, 2015 Mr. Alabama

Are you ready for a better you? Then look no further! Today I’m going to share a few tips to help you start living a healthier and happier life. We are going to get started with everyone’s favorite subject, “food”. Remember healthy eating is not a diet, it’s about making better choices when it comes to the food that we put into our bodies. Most people tend to over think their food choices and make healthy eating way too complicated. What I recommend is starting with a four meal, meal plan split up throughout your day. This is a great way to spread out your food intake and speed up your metabolism in the process. I know what you are thinking. What kind of foods can you eat? In my opinion, our meals should be a combination of proteins, carbs, healthy fats and vegetables. The list of meal options is limitless. In each meal, around 50 percent of calories should come from protein and the other 50 percent should be split up evenly between your carbs, healthy fats, and vegetables. Most people find that between 2200-3200 calories per day is sufficient. However, no two people are the same, so you may need to adjust those numbers accordingly to achieve your desired outcome.

Now we get to talk about the fun stuff, fitness, aka Cardio! Cardio is one of the most important things you can do for your body. With that being said, cardio can be anything that gets your heart rate elevated to your desired target zone. It only takes 20 to 30 minutes a day, four to five times a week, to reap major benefits. Most of us spend way more time than that watching television. One of my favorite forms of cardio is what people like to call HIIT (High Intensity Interval Training). What is HIIT? HIIT is a training technique in which you give 100% max effort for a burst followed by a slower moderate pace, then back and forth until failure is reached or your desired time limit is up. This helps you burn more fat in less time. Consistency will be the key to your success. Take it one day at a time and look at it as a marathon, not a sprint. Your health is an investment, now invest wisely.

Fighting Obesity One Person at a Time by Nisha Mailapur

ALARMING Our state of Alabama ranks 3rd highest in the nation when it comes to rates of adult obesity! Add to this, childhood obesity is on the rise, nearing 35.5% of 10-17 year olds statewide. Not only is obesity unhealthy, it is also expensive. According to STOP Obesity Alliance's "Fast Facts: The Cost of Obesity," the yearly expense for an obese woman and an obese man is $4,879 and $2,646, respectively. Research from McKinsey Global Institute shows that the economic output of obesity and its consequences accounts for 4 to 8 percent of America’s gross domestic product. Obesity is the culprit of many chronic diseases such as diabetes, hypertension, liver cirrhosis, and is responsible for increased risk of some cancers, such as breast cancer. One of the most shocking facts about obesity is that it is entirely preventable and reversible with a change in lifestyle. I was first introduced to the effects of obesity after listening to multiple success and failure stories from some of my father's bariatric patients. As a runner and food lover, I am impacted by their journeys in fighting obesity. Since then, I have felt the need to increase awareness of obesity in my small community of Huntsville. I started with a simple goal: expanding the simple clichés-“be you” or “be comfortable in your own body”-past just words. Yes, we need to be comfortable in our unique body, but it is imperative that we all are aware that obesity comes with a very heavy price on our well being (physically and financially)—leading to chronic diseases that are expensive. So, for me, raising awareness about obesity is not about sculpting a perfect body; rather, it is about cul-

tivating a habit of exercise and healthy eating to maintain our own body and its needs. After ruthless brainstorming, in the summer of 2016, the took form. The goal of the Say No to Obesity 4K is to create an environment where people of any shape, size, or fitness level can come together and pass a simple thought bubble: “Hi, what’s your name? What’s your story?” or “Let’s run/walk/jog/crawl this together!” The vision of this event is to get people to lace up their shoes, put on a t-shirt, and just get outside. The road race came together with the relentless support and guidance from not only my parents and cross-country coach, but also from community leaders from Huntsville Track Club and Fleet Feet, as well as key members of the Huntsville Hospital Foundation. With two Say No to Obesity 4K events behind me, I began to dig deeper into what obesity is and how to fight it. I realized that fighting obesity goes beyond just exercising, walking, or running. Obesity is linked to the consumption of highly processed foods. According to Harvard T.H. Chan's School of Public Health, what you put in your body matters. Buying fresh fruits and vegetables for the week, rather than going to fast food restaurants or stocking up on pre-made meals at the grocery store, can end up being less costly in the long run, fill you up more than processed foods, and is better and healthier for your body. I thought, wow! ...no wonder my mother tells me to

choose the grapes and cheese rather than the hidden stock of cookies in the pantry. Reminded of the healthy eating habits my mother strived to cultivate in my family, I began to venture into the food culture of obesity. In the summer of 2018, I interned with Ms. Steakley, a local dietician/nutritionist at Huntsville Hospital. While I meticulously learned about wholesome meals-proteins, carbohydrates, vegetables, monounsaturated fats-portion control, nutrition facts, reading labels, and recipe building, we looked at a study started by Dr. Amy Custack, professor at Michigan State University and nutrition director at the Michigan State University-Hurley Children’s Hospi-tal Pediatric Public Health Initiative: "Fruit and vegetable intake tracks from childhood to adulthood, making it important for health care professionals to guide children towards healthy eating early on." Similarly, Ms. Steakley had mentioned that her patients do not eat fresh vegetables, mainly because they do not buy them and because they do not know what to do with them. So, in a thirty min-ute interview with Dr. Custack, I was able to learn about how their fresh fruit and vegetable prescription program in Flint, Michigan could be emulated in our community of Huntsville. "We need to consider not only nutrition education but also barriers to access and affordability of fresh fruits and vegetables, particularly in underserved areas. The prescription program is a first step to introducing fresh, high-quality produce to children,” says Dr. Custack. Keeping in mind Dr. Custack’s study, I proposed using the funds raised from the Say No to Obesity 4K Run/Walk to start a fresh produce prescription program to promote the consumption of fresh produce in order to decrease reliance on processed food. The objective is to distribute “veggie vouchers” as prescriptions by our community of physicians to further raise awareness and fight obesity. This pilot program is unfolding as I write this article; my goal is for this prescription program to be fully implemented by next year. In the meantime, in an effort to further sustain this fresh produce prescription program in the long run, I created a GoFundMe: “A Recipe for Prescription.” Will you join our efforts? We live in America, in a democracy. Change starts with the people. Let us battle the politics, FDA subsidies on processed foods, medical bills, and increased weight. We make the choices, not them.

Cold-Pressed Juice

+Kombucha by Heather Mendez

Cold-pressed juice is all the rage. Kombucha is also becoming popular. But, what exactly are these? Cold-pressed juice uses a juicing process that crushes fruits and vegetables using a hydraulic press and 2000 pounds of pressure with no oxidation. The end result is healthier, longer lasting juice. Because the cold-pressed method uses no heat, the vitamins and live enzymes stay intact, and you get a better tasting and longer lasting juice compared to a centrifugal juicer. Cold-pressed juicing is the only way to maintain the integrity of the produce, ensuring your body absorbs the nutrients in their purest form. The vitamins and minerals in the juice get absorbed into your bloodstream immediately! Kombucha is a bubbly probiotic tea praised for its many health benefits. It starts with organic tea, sugar, and a kombucha culture. It is then fermented for an average of 7-21 days. The culture metabolizes the sugar and caffeine leaving the end result tangy, fizzy, and full of essential probiotics, B vitamins, organic acids, and live enzymes. What does cold-pressed juice and kombucha have in common? We believe they contain the purest, highest quality ingredients available. At The Juicery Press in Madison, AL, we craft our own kombucha and then flavor it with cold-pressed juice and then it is carefully fermented again. Every bottle of kombucha has all the benefits of the cold-pressed juice, but with 1/3 of the sugar compared to drinking pure juice. There are many reasons to drink our â&#x20AC;&#x153;cold-pressed kombuchaâ&#x20AC;?. First, it tastes amazing! Also, kombucha can help detox the body, protect and improve liver function, improve digestion, promote weightloss, alkaline the body, boost immunity, and increase energy levels.

Come purchase your own, locally brewed, Tribal Kombucha at The Juicery Press in Madison, AL.

A SELF AFFIRMING JOURNEY

A weight loss approach grounded in simplicity

.............................................. We understand the frustrations of being overweight and feeling that it’s a losing battle. At Arize Clinic many of our clients tell us that we are their last hope. They

BODY LEVERAGE

Let your body’s metabolism do the hard work by releasing fat and using that fat for your daily calorie needs. Then use your experience with us to manage your weight and health going forward.

EXPERT NUTRITIONAL SUPPORT

Benefit from weekly follow up sessions with our nutritional consultants, to provide you with support, nutritional guidance and tailoring the program based on what works for you.

JOURNEY SUPPORT

Once you achieve your weight goals you aren’t alone. While you will use your experience with us to manage your weight and health going forward, you can schedule weekly bi-weekly or monthly follow up to keep you on track.

have tried every diet imaginable and everything has

Our Food Supply

failed them. It’s understandable because the success

Our busy lives have us eating man-made “non-foods” that are processed, chemical filled, calorically dense and nutritional deficient. The foods we eat today have been purposefully engineered to taste good and get quickly converted into body fat so we eat more. We know our car would run poorly with the wrong type of gasoline or something other than gasoline. The same is true of our bodies. When we put the wrong type of food or nonfoods into our bodies, our weight and health suffers. Real food looks the same as when it came out of the ground, walked the earth or swam in the ocean. Fact: 120 years ago the average American consumed 1012lbs. of sugar per year. Today Americans consume more than 165lbs. of sugar per person each year.

rate with traditional diets, where you are eating less than what your body needs, is less than 5%! Traditional weight loss is a slow, painful and repetitive event.

The Arize Clinic Weight Loss program is NOT traditional! The Arize Clinic Program is a revolutionary way to lose weight quickly, safely and naturally. We do it through metabolism-boosting natural supplements, a nutritionally dense meal plan of whole foods and finally expert nutritional support and guidance. The Arize Clinic Program is not just about losing weight. It’s about maximizing weight loss, regaining your health and gaining the knowledge to keep it off. What starts as an event becomes an amazing, self-affirming journey! The Arize Clinic approach to health is grounded in simplicity: a solid nutritional based of whole foods, a balance of positive mental and physical activities and awareness and gratitude for your life journey. The Arize core program has four elements for rapid, healthy weight loss and on-going weight health management.

WHOLE AND NATURAL

Use our all natural FDA registered metabolism-boosting supplements and follow our scientifically designed whole foods meal plan, made up of nutrient dense fruits, vegetables and lean meats. 46

Inside Medicine | winter 2016

Traditional Diets Traditional diets are defined as any diet that has you eating fewer calories than what your body needs. When you go on one of these diets your body’s survival design will respond by slowing your metabolism so it can function on fewer calories and eventually the amount of calories you are eating. This makes you feel like you have no energy and slows your weight loss. As your body does not want to release fat, it will begin converting (eating) your lean tissue (muscle) into calories to provide additional calories. A traditional diet will always keep you hungry, because you aren’t getting enough calories, you will have no energy, and your metabolism and muscle mass will be reduced! With a decreased metabolism and less muscle mass you will gain weight easier after traditional diets and it will be harder to lose weight in the future. Fact: Sugar, Fat and Salt all trigger low grade addictions and chemical responses in the brain that make us eat more.

Seriously, why does the most important practice we know to be true have to be so difficult? Why does it take so much time and why aren’t there more private options?

home sweat home

In-home fitness training and private yoga instruction are in fact an option in Alabama!

We all know it. Physical activity is considered to be among the strongest tools to decrease the risk of death from heart disease, stroke, colon cancer, and diabetes. Sadly, approximately 45% of adults fail to exercise sufficiently enough to achieve health benefits, with 80% not even meeting the government’s national physical activity recommendations for aerobic and muscle strengthening. If you’re reading this then you’re clearly someone who stays abreast of the latest health news and works diligently to live a healthy lifestyle. Therefore you know for a fact that fitness and proper nutrition are among the most important items to maintain in your daily walk. But why don’t we do it? The CDC states that, “300,000 deaths each year in the U.S. likely are the results of physical inactivity and poor eating habits.” What really gets in our way of daily exercise? For professionals, it’s most commonly the lack of time. Do you really have 2.5 hours to lose by driving to the gym, completing a rushed workout, showering, and then getting back across town to your next appointment only to discover that your core temperature is still up and you are perspiring in front of your colleagues or patients? Maybe it’s the aggravation of having to exercise in public. The last thing you need during your day is to feel judged by the individuals that seem to live at the gym, or having to wipe off the residual sweat left behind by your treadmill predecessor. Seriously, why does the most important practice we know to be true have to be so difficult? Why does it take so much time and why aren’t there more private options? Plus, there is the constant battle of motivation to elevate your heart rate after a difficult and stressful day at work. You’re exhausted! Will working out not just make you more tired?

Thankfully, there is an alternative. In a world of saturated YouTube workout videos and diet plans, there remains a personalized touch that is tailored precisely to your goals and your body’s needs! A friendly face to knock on the door with equipment in-hand to guide and motivate you through your next workout. In-home fitness training and private yoga instruction are in fact an option in Alabama! Yes, you can roll out of bed, turn on the news, and sip through your first cup of coffee in time to hear the doorbell, “That must be my trainer.” You answer the door to your accountability partner, “Good morning!” and walk over to lace up your shoes while your personal trainer sets up the equipment for the session. A little banter about weekly news and upcoming family events while going through the warm-up and stretch routine. Now it’s time to focus. The trainer leads you through a 30-45 minute workout, inching you closer to your fitness goal. You notice your strength is much better, flexibility has improved, and getting up and down on the floor is a piece of cake. Before you know it several sets have already been knocked out and your “To Do List” for the day comes to mind as you go through the cool down portion of the workout. A handshake followed by a thank you and the trainer concludes with, “Great job! Have a wonderful day and I’ll see you on Thursday!” A quick glance at the clock on the way to the bedroom and you realize it’s just now 6:30am with plenty of time to get ready for work. That’s truly what many in-home training sessions look like. You have saved time, maintained privacy, and were held accountable to work hard toward your health and fitness goals. How great was it that you did not have to drive to the gym, especially now that winter is here. That is definitely concierge service at its finest. If this sounds like a great option for you, search for your local team of in-home personal trainers or yoga instructors and schedule a free workout to see if this is a perfect fit for you!

DOES DIET PLAY A ROLE IN A HEALTHY GUT MICROBIOME AND THE PREVENTION OF TYPE 2 DIABETES? by Julie Drzewiecki, MS, RD, CDE

The definition of the â&#x20AC;&#x153;gut microbiomeâ&#x20AC;? is all the microorganisms, like bacteria, protozoa, and fungi, found in the digestive tract. The gut microbiome affects our health through the fermentation of indigestible foods, immune system regulation, prevention of harmful bacteria growth, and stimulation of hunger and sati-ety hormones. Gut microbes are necessary. However, greater numbers of deleterious microbes, versus the beneficial ones, can promote an altered gut micro-biome. This, in turn, can lead to an increased risk of metabolic disorders, such as diabetes. This article will focus on the latest research about key microbes and associated metabolites that influence metabolic path-ways related to Type 2 Diabetes. Menu planning tips for a healthy gut microbiome will also be provided.

Lipopolysaccharides And Inflammation

Lipopolysaccharides (LPS) are large molecules that promote inflammation and are thought to be a possible “culprit” in the development of obesity and Type 2 Diabetes. LPS are located in the cell wall of gram negative bacteria. When one consumes a high fat diet, it can lead to the development of “metabolic endotoxemia.” Metabolic endotoxemia is when the gut becomes permeable to LPS. This leads to a sequence of changes leading to insulin resistance and associated hunger cravings, elevated blood sugars, and fat deposition that occur with Type 2 Diabetes. Although LPS does not exclusively cause the progression to diabetes, it is important to recognize its significance as a possible target for prevention.

Short Chain Fatty Acids and the Gut Microbiota

Fermentation of dietary fiber in the intestine by the gut microbiota is a major source of Short Chain Fatty Acids (SCFA). They are considered key messengers by which the gut microbes communicate with other organs and regulate metabolism. There is good evidence that inadequate intake of fiber decreases the production of SCFA. Another role of the SCFA is to maintain gut health and prevent the metabolic endotoxemia from the LPS, which can lead to an inflammatory response. Type 2 Diabetes and insulin resistance are characterized by a low-grade inflammation. This highlights the importance of the role of the gut microbiota and SCFA production for reducing the risk of Type 2 Diabetes.

The Role of the Gut Microbiota in Appetite Regulation

SCFA can modify the levels of gut peptides involved in glucose metabolism, gut barrier protection and energy balance. SCFA may improve blood glucose and suppress appetite by binding to G protein-coupled receptors (GPR) 43 and 41. This increases blood levels of Glucagon-Like Peptide -1 (GLP-1) and Glucagon-Like Peptide - 2 (GLP-2), and Peptide YY (PYY). GLP-1 enhances the secretion of insulin and improves the action of insulin throughout the body. GLP-2 works to provide a tighter mucosal barrier in the intestine, which may help to avert metabolic endotoxemia. PYY can slow emptying of the stomach, increase the efficiency of nutrient absorption of glucose after a meal and suppress appetite. The research on gut-derived SCFA and its role in appetite regulation and the metabolic changes associated with the development of Type 2 Diabetes and obesity is only beginning and more research is needed.

Diet and a Healthy Gut Microbiome

Recent research has studied the effect of probiotics and prebiotics on changes in the gut microbiome. Prebiotics can be defined as “non-digestible food ingredients that are

beneficial because of their selective stimulation of specific bacteria in the colon.” Probiotics can be described as live, beneficial bacteria, such as different strains of Lactobacilli. This strain of bacteria has been shown to improve the efficiency of insulin in the body and decrease the risk of Type 2 Diabetes in those individuals who have impaired glucose tolerance or who are “pre-diabetic.” Emerging research has shown another microbe, Akkermansia muciniphila (A. muciniphila), administered to mice with Type 2 Diabetes showed a reversal of metabolic endotoxemia, inflammation, and insulin resistance. However, human studies are needed to see if A. muciniphila and other species of bacteria can be used as a probiotic for those with Type 2 Diabetes. Scientists at Wake Forest Baptist Medical Center found that feeding non-human primates (Macaques) a Mediterranean-type diet improved the good bacteria living in the gut by up to 7% as compared to only 0.5% for those fed a more meat-centric Western diet. Before the study began, the animals were randomized to either Western or Mediterranean diet groups and studied for 30 months. The Western Diet consisted of lard, beef tallow, butter, eggs, cholesterol, high fructose corn syrup, and sucrose. The Mediterranean Diet consisted of fish oil, olive oil, fish meal, butter, eggs, black and garbanzo bean flour, wheat flour, fruit puree, and sucrose. Each diet plan had the same number of calories. At the end of 30 months, Harom Yadav, Ph.D. – the lead scientist, analyzed the good and bad bacteria that live in the digestive tract of both diet groups through fecal samples. Yadov noted, “Our study showed that the good bacteria, primarily Lactobacillus, most of which are probiotic, were significantly increased in the Mediterranean diet group.” More research on the gut microbiome and its relationship to Type 2 Diabetes is critically needed. In the meantime, Registered Dietitians will continue to promote a fiber-rich, plant-based diet. Congratulations, dear reader! You have just been introduced to the complex, yet exciting research on the relationship between diet and a healthy gut microbiome. The next portion of this article will focus on how you can plan a healthy Mediterranean Diet to possibly increase the beneficial bacteria in your gut. References: Alessandra Sarcona, EdD, RDN, “The Interrelationship of Diet, Gut Microbiome, and Type 2 Diabetes.” On The Cutting Edge newsletter. Volume 38: Number 6. February 2018. Pages 13-17. Harion Yadov et al. “Gut Microbiome Composition in Non-Human Primates Consuming a Western or Mediterranean Diet.” Frontiers in Nutrition. April 25, 2018 Further information on Nutrition and Diabetes can be found on the website of the Diabetes Care and Education Dietetic Practice Group of the Academy of Nutrition and Dietetics, www.dce.org.

The Mediterranean Diet is rich in legumes, fruits, vegetables (especially leafy greens), nuts, yogurt, kefir, fish, and olive oil. Here is a week’s work of Mediterranean Diet supper menus for your convenience: “Meatless Monday”: Hummus, Whole Wheat Crackers, Green Salad with Olive Oil and Vinegar Dressing “Taco Tuesday”: Bean Tacos with Fresh Mango Salsa (Recipe included with this article.) “Go Green Wednesday”: Maple Baked Salmon, Kale Citrus Salad with Olive Oil and Vinegar Dressing “Try New Food Thursday”: Black Bean Veggie Burgers, Whole Wheat Buns, Roasted Vegetables, Kefir Milkshake “Fish Friday”: Broiled Lemon Tilapia, Herb-Roasted Potatoes, Broccoli Salad with Raisins and Sunflower Seeds “Super Souper Saturday”: Cheese Sandwiches, Vegetable Barley Soup “Sunday Best Dinner”: Roast Herb Chicken, Greek Salad, Fruit/Nut Yogurt Parfaits (Menu Planning Tip: Some folks find menu planning easier when they have a meme like “Meatless Monday”. You don’t have to stick to the ones listed in the above menu. What about “Slow Cooker Saturday” or “Mexican Monday”? Have fun with your family coming up with your own memes!)

Bon Appetit!

Recipe Courtesy of the Diabetes Care and Education Dietetic Practice Group BEAN TACOS WITH FRESH MANGO SALSA Ingredients: 1 -15 oz. can beans (pinto, black, kidney, cannellini, almost anything will work). Drain and rinse beans well to reduce the sodium. ½ cup fresh cilantro, chopped 3 scallions, chopped Juice of 2 limes

½ teaspoon cumin

Dash of garlic powder

Dash of chili powder and/or paprika

Corn or Whole wheat tortillas cut into quarters (or cut in half if they are small) 1 pint grape tomatoes

½ mango, peeled and chopped into small cubes ¼ cup cilantro

Salt and pepper to taste

Hot sauce or jalapeno (optional) Directions: Bean Tacos 1. Combine beans, ¼ cup of the cilantro, 1 scallion, juice of 1 lime, cumin garlic powder, and chili powder in a medium-sized bowl. 2. Warm the tortillas in the oven or in a dry skillet on medium heat. 3. Fill the tortilla pieces with the bean mixture and serve with salsa found below. Optional, add Greek yogurt on top. Fresh Mango Salsa 1. Pulse the grape tomatoes in your blender about three times or until they are all finely chopped, but not yet liquid. 2. Add the tomatoes and the remaining ingredients in a bowl and stir to combine. Recipe by Marina Bedrossian, RDN, CDN, CLT Nutrition Facts: Servings: Approximately 4 Calories: 198 Protein: 10 g Carbohydrate: 38 g Sodium: 170 g

s i t Wha ULTRACELL? by, Kelly Reese

The population has been rising year after year and life expectancies have topped out at a higher average age than ever before. We are all hoping and preparing to live longer than our grandparents and parents. But, are we prepared for the financial burdens that are expected as medical costs increase with time and age? On top of just medical costs, insurance premiums can now be more than a car payment and in some cases, higher than a mortgage. Because of this, alternative medical treatments are hitting the market and flying off the shelves. If you have watched the news or read trending social media feeds, then you are well aware of the CBD oil that has grown in the past few years as a significant resource for the consumer. Not only is it great for consumers but stay at home moms and busy professionals have resorted to flexible hours by switching gears from corporate

America to financial freedom by becoming a distributor. The vast majority of people still skeptical of the actual benefits would like to understand the strategy behind an industry promising health, wealth, and life balance. Let's find out from entrepreneur Denise Moore about her company, Zilis and their product UltraCell. WHAT IS ULTRACELL? It is the main request of consumers. It is Cannabidiol (CBD)/Hemp oil, CBD UltraCell Topical, and the newest CBG oil. We are adding products that will help our Endocannabinoid System. Our UltraCell is pet-friendly and not all CBD products are. HOW CAN CBD IMPROVE YOUR OVERALL HEALTH? The human body creates its own endocan-

nabinoids, (the Endocannabinoid System), to maintain a healthy body by getting enough sleep, combating illness and disease, and regulating pain. When the system becomes unbalanced or deficient we do not sleep well, we feel pain, and we fall ill. Ultra cell is a full spectrum CBD/hemp oil, and with phytocannabinoids naturally found in hemp, our product helps balance the ECS. IS CBD LEGAL? Yes! With the passage of the 2018 Farm bill, all states are legal with no more than .3% THC. Ours is less than the .3% to allow everyone to use it without worrying about it showing up on a drug test. WHAT QUESTIONS DO YOU FACE DAILY WHEN ACTIVELY SELLING YOUR PRODUCT LINES? I get a lot of questions about how it can help and is it legal. DO YOU SEE A CONSIDERABLE RISE IN THE MARKET OVER THE NEXT TEN YEARS? Definitely! It is expected to be a trillion-dollar business by 2030. HOW WILL THE EVOLUTION OF THIS MARKET CHANGE THE WAY MEDICINE AND BIG PHARMA COMPANIES RESPOND? Full-Spectrum Science? Unlike other hemp oils that draw upon only isolated portions of the hemp plant, UltraCell is derived using full-spectrum hemp oil extract, known as cannabidiol, or CBD. While CBD has known health benefits, the reality is the other CBD-isolate products cannot benefit the body like our full-spectrum hemp oil, which utilizes all parts of the hemp plant and its phytocannabinoids. UltraCell contains over 400 biologically active compounds, including CBD and an entourage of other cannabinoids, flavonoids, terpenes, vitamins, fatty acids, and minerals. By utilizing all aspects of the hemp plant in its natural state, UltraCell creates an environment where the natural compounds work together to create a synergistic effect. WHAT DO YOU LOOK FOR WHEN FINDING A GOOD QUALITY CBD OIL? You want to find a CBD Oil that has a human study, CBD oil that is full spectrum, water soluble, has a 3rd Party Testing Certificate and is U.S. Hemp Authority Certified.

Ultracell is produced by Zilis, The Ultra Company. For more information visit their website www.zilis.com/dmoore. Thank you is expressed to Denise Moore.

Green

Should be Your New Favorite Color

When we begin a new healthy eating routine one of the meals we tend to automatically go for is salad. Now while this is not a bad idea it does need to be the right “kind” of salad for it to truly benefit our body. Salad can be a sneaky thing, especially if you are eating at a restaurant. Some salads can contain just as much if not more calories as a big hamburger and plate full of French fries. Salad in general can also be incredibly lacking in nutritional value and leave us feeling quite hungry very quickly. However, you can make a fabulous tasting salad that will have great benefit to your nutrition, it’s all about the greens you choose! Let’s just go ahead and say that a salad made up mostly of the pale green iceberg lettuce which is so common will NOT cut it!! Throw it out! We want to build our salad with rich deep greens that pack a huge nutritional punch! Spinach and kale are at the top of this list. These greens not only offer an amazing fiber punch, but spinach is packing a lot of iron your body needs to carry oxygen from your lungs to the rest of your body. Another major asset of eating spinach is the magnesium it provides. Magnesium is a mineral that helps keep things like headaches, muscle cramps, and chronic fatigue at bay. It also helps keep your blood sugar level and thyroid function normal. Finally, potassium is an unexpected component found here which aids in bone growth and may reduce high blood pressure.

by Nick Thomas

Now kale especially contains tons of immune-boosting vitamin A. It also offers vitamin C and RDI which provides a healthy immune system, not to mention a significant amount of vitamin K which your body needs in preventing blood clotting and supporting bone health. Both of these leafy greens have their own incredible benefits as you can see. You can now make an educated salad choice and pick the greens that best help your body. For example, if you are pregnant or have high blood pressure spinach will be your best choice. If you feel like you’re coming down with a cold reach for some kale or just grab a bit of both for good measure. Finally, remember not to destroy your healthy greens by piling them high with poor “toppings”. Keep it smart and tasty with some grilled chicken, olive oil & vinegar for dressing and a few of your favorite veggies! If you’re just not a salad person you might try making a smoothie and adding in a generous handful of these greens to trick yourself into getting the amazing health benefits without the taste. Remember that food should fuel our body. It’s not about how much you eat, it is COMPLETELY about WHAT you eat! For more information regarding a personalized general or sports nutrition plan contact me at Prime Performance 423-805-0870.

"THE TECHNIQUE STRENGTHENS YOUR BODY AND ALSO YOUR MIND"

RAISING THE BAR by Kari Kingsley, MSN, CRNP

Tired of your exercise routine? Try the Ultimate Workout!

IMFall'19.indd 24

8/28/19 2:38 PM

There is no question that exercise is good for just about every body system. When we work out, oxygenated blood showers our brain cells, stimulating the release of “feel good” endorphins which provides euphoria and calming effects while improving connections between neurons. Exercise allows our hearts to pump more forcefully and efficiently, increasing perfusion to vital tissue and organs. Perhaps the real reason Dorothy’s buddies, Tin Man and Scarecrow, received their respective heart and brain was the cross-country trek across Oz. Maybe the Wizard was a metaphor for exercise?? Probably best to not over analyze… Long term effects of exercise on our skeletal system includes increased bone density which helps to ward off osteoporosis while also making us more flexible and less susceptible to injury. To say I am not athletic is an understatement. In high school, I was the slowest person on the track team. The walk-on track team. I actually never finished a race. Full disclosure, I wanted my picture in the yearbook wearing a track shirt. Who knew you couldn’t show up to your first track meet without practicing and not go home with a gold medal?! Movies make it look so easy! My love-hate (mostly hate) relationship with exercise only deteriorated from there. I finished a 5K in 48 minutes once. I would begin a walking regimen each morning only to start slapping “snooze” on my alarm a few days in. I was your stereotypical New Year’s Resolutionist. Quit drinking soda. Check. Take my multi-vitamin. Check. Go to the Gym. Well… I would… but my neighbor’s friend’s cat might need a bath… so I better be available. My aversion to sweat and athletic pain would change in 2013 after a girlfriend dragged me (nearly kicking and screaming) to a new form of group exercise. Friendly agile instructors guided me through a 50-minute class utilizing the ballet barre to pinpoint specific muscle groups using small isometric movements to lift, tone, and burn not only my physique but my attitude about exercise as well. During the first class I felt like a baby walrus trying to dance her way through a pool of Jell-O. But with each class the movements became easier and I became stronger. The instructor’s gentle guiding voices coached not only my muscles and core but my mental health as well.

Owners of Pure Barre Huntsville, Angelica Lee and Susanna Chesser, share a passion and enthusiasm for helping their clients achieve total body workouts fueling both physical fitness and self-esteem. Angelica explains that “Pure Barre is a total body workout that uses the ballet barre to perform small isometric movements which burns fat, sculpt muscles, and creates long, lean physiques. It is the fastest, most effective, yet safest way to change your body in just a 50-minute workout.” But to Angelica, Pure Barre represents so much more. It is a sense of community, a sense of belonging, and a sense of self-awareness. Pure Barre provides a positive environment where her clients can come to class, work on their well-being and lift each other up mentally. “The technique strengthens your body and also your mind” Angelica emphasizes. “You can do anything you put your mind to. To me, the hardest part about Pure Barre is walking through the doors, showing up and allowing yourself to push through each class.” Angelica took her first Pure Barre class and was blown away with how difficult and challenging it was. She didn’t come back for six months. She remembers thinking, "who wants to do that?"... But months later after her regular work out had plateaued, she decided to give Pure Barre another chance. “I came back for my second class and was hooked. I attended 5-6 classes every week for 6 months and then became an instructor. I have been teaching Pure Barre since May 2012 and then pursued ownership of Pure Barre Huntsville with my best friend, Susanna Chesser, in October 2018.” She recommends her clients “show up ready to work and with the mindset that you will definitely see results...not just physically, but mentally. Don't ever give up on yourself!”

IMFall'19.indd 25

Susanna Chesser grew up as, what she would consider, a very athletic, healthy person. However, after college, the challenges of becoming an adult had turned her into the unhealthiest version of herself - both physically and mentally. “When I walked through the doors of Pure Barre Huntsville in 2013, I was greeted with a positive energy, welcoming faces, and a workout that totally and utterly kicked my tail. What an eye opener! It was this humbling experience along with the sense of community that brought me back for the next class. I was determined to find the strength that I had once known. Within just a few classes I began to feel like myself again. After 6 months I had lost 25 pounds and genuinely felt I had found my tribe.” Five years later, the same passion for Pure Barre that led her through the double doors, led her to purchase the franchise with her best friend Angelica. “For me, working out is not just about the physical benefits; it is about relieving stress, focusing on a goal, surrounding myself with a community of friends, and creating ALL those endorphins. We strive to create an environment where anyone can walk through the door and feel welcomed and walk out the door feeling like the very best version of themselves.” Many of us rely on taking a pill for any medical ailments that comes along. If ever there was a “magic pill” for youth and vitality, staying physically fit would be it. The phrase raising the bar encourages us to set tougher goals and increase standards. Pure Barre encourages us to raise the standards of quality and exceptionalism in our personal journey to physical and mental health.

8/28/19 2:38 PM

ALABAMADISC.COM

yoga ranger by, Kari Kingsley, MSN, CRNP

Most of us breathe an average of 12-18 times a minute. Thatâ&#x20AC;&#x2122;s close to a thousand breaths an hour. If we are lucky, we may reach 700,000,000 breaths in a lifetime. Breathing is so simple that the bodyâ&#x20AC;&#x2122;s autonomic nervous system takes over when we forget. Tiny nerve cells in the brainstem automatically send signals to our intercostal muscles and diaphragm to contract and relax in consistency and cooperation. Breathing is vital for aerobic creatures such as humans. The body uses oxygen delivered through breath to break down food for energy. But breath is so much more than the delicate bodily service keeping us alive. Michael Streeter is a yoga teacher and former army ranger. He currently teaches classes at Hot Yoga of Huntsville, Light on Yoga, and the YMCA. He also teaches private sessions. You can follow Michael Streeter on Instagram: YogaRanger275 I n s i d e M e d i c i n e | Fa l l I s s u e 2 0 1 9

Everyone in a delivery room waits with nervous anticipation until they hear a newborn infant take her first breath and then wail as she forces air out of her lungs for the first time. Sometimes a friend’s “humph” or “sigh” (perhaps with rolling eyes) can convey an entire paragraph. Breath can also signal great loss when it ceases. Think back to a difficult situation when you told yourself to “just breathe”. A stressful midterm. Mounting tensions with a coworker. The moments after a terrifying event when you are trying to right yourself. It’s simple, right? Just…. Breathe…… If only it were that easy. The simplicity of the command is outweighed by the looming shadow of anxieties driving the need to halt the racetrack of thoughts and emotions in our cerebral cortex. Breathing is more than drawing in oxygen-rich blood to nourish vital physiologic structures. Being able to breathe signifies our ability to calm the mind. So, what happens when the mind encounters a disconnect and loses the ability to tell our body to “just breathe”? In these intense moments, we may still be fulfilling the function of breathing, but trauma, stress, and anxiety can bombard the brain with a misfire of signals leading to activation of our “fight or flight” reflexes.

Breath:

Air taken into and exhaled out of the lungs. Something so effortless yet so multifaceted.

For Michael Streeter, years of mental and physical trauma began to manifest in the form of post-traumatic stress disorder. Streeter, as he prefers to be called, reached his lifelong dream of joining the special forces in the 1990s. He served with Alpha Company weapon’s platoon, 2nd Battalion, 75th Ranger regiment and deployed to many conflicts throughout the world. He has incredible memories of the time he served and literally lived the stuff Hollywood turns into blockbuster movies. But his heroic journey came at a price and left him with considerable mental and physical scars. While serving in Jordan, a parachuting accident turned disastrous. Streeter plummeted 100 feet to hard earth, resulting in broken vertebrae and a shattered left ankle. Even after the fall, Streeter tried to “Ranger Up” and continue performing his duties, not knowing the extent of his injuries. Eating Motrin like M&M’s, he continued to parachute and even went on an assault climber’s course in Alaska. Eventually, he was unable to perform his duties and parted ways with the Army in 1999. But Streeter faced a new battle. Acclimating to civilian life with chronic pain, an unhealthy lifestyle, and evolving depression would prove nearly insurmountable. Memories of the fall and vivid images of those suffering around the world would haunt his dreams and waking moments. Suffering from a traumatic brain injury, he began to feel very angry and paranoid with coworkers, friends, and family members. His anger would become so heightened, he would black out. He describes the paralyzing moments leading up to these episodes as if he were watching his life unfold with no control over his actions. “No one was in the driver seat. I couldn’t be reasoned with. And there was no switch to turn it off.” He lost several jobs and was on the brink of divorce. He lost his ability to breathe.

May the rulers of the earth keep to the path of virtue For protecting the welfare of all generations. May the religious, and all people be forever blessed, May all beings everywhere be happy and free. - Mangala mantra

After years of emotional turmoil and taking dozens of prescription medications to treat pain, depression, anxiety, and insomnia, Streeter found a lifeline. He entered into a holistic program at the Ralph H. Johnson VA Medical Center pain clinic under the care of an inspirational physician. Dr. Robert Freeman had practiced as a primary care provider for many years and was seeing little to no results with mainstay pharmacologic therapies. At 300 pounds and on numerous prescription medications, Streeter and his skilled team of providers had their work cut out for them. A combination of exercise, clean eating, meditation, and acupuncture had him on the right track. But Streeter’s life was forever changed after he began practicing yoga. Streeter had been breathing his entire life but he finally learned how to take a breath. Breath became a way of life. Inhale fully, exhale fully. He was able to change his breathing techniques and use the whole breath. As his core became stronger, his back pain subsided and the weight melted away. After a year of Vinyasa flow, he began to practice Astanga on a regular basis. The Astanga primary series spoke to Streeter’s comfort of routine and offered strong physical challenges. The practice helped him link mind and body through breath in a manner most accessible to his Ranger mentality. Streeter was so inspired and motivated by his journey to health that he enrolled at the Jiva Yoga Center in Hilton Head, South Carolina to become a yoga instructor. He is now member of the Yoga Alliance and active with several local and national organizations that address veterans, addiction, and PTSD. Streeter is affiliated with Bearded Warriors, Comfort Farms, and GallantFew. He has recently been invited to participate as the honorary guest speaker at the 2019 North Alabama Out of the Darkness Walk hosted by the American Foundation for Suicide Prevention. Streeter says “Yoga is a lifestyle. The definition of yoga is the union between two things: mind and body. And those two things are connected through breath. Yoga gives us the tools to manage life experiences.” Streeter said he was faced with a choice. He could let his injuries and mental health issues define him as a victim, or he could move forward through forgiveness and self-reflection. “Society forces habits on us.” He, like many others, had been taught to be a “Man’s Man”. Suck it up buttercup. Stand up and take it. Swallow the pill. Push through the pain. “Our society views mental health issues as weakness. Society also attaches mistrust to alternative therapies such as acupuncture, meditation, and yoga. Streeter advises his students to “trust the process”. Embrace the breath. Streeter’s favorite mantra is om gan ganapataye namo namah. Streeter explains that Ganesh (son of Shiva) is known as the remover of obstacles. This mantra encourages strength and wisdom to overcome what stands in your way.

At 300 pounds and on numerous prescription medications, Streeter and his skilled team of providers had cut out for them. A Optiontheir 4: Evenwork your options have options! Try a combination of the three. Many people elect to have a small combination of exercise, cleanAfrin, eating, nasal procedure combined with quitting or using short-term oral steroids and/or switching to non-addicmeditation, and acupuncture had tive medications like nasal steroid sprays as well as safer herbal on remedies Xylitol sprays. But Streeter’s him thelike right track. Be sure to discuss your treatment options as well as alternative your primary after care doctor life wasmedications foreverwithchanged heor ENT. Patient expectation is CRUCIAL. When using intranasal practicing steroid and antihistamine began yoga. sprays, a butter knife is not going to cut like a machete! But how do you eat an elephant? One bite at a time! “Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner with over 8 years of ENT experience who currently works at Huntsville ENT (256-882-0165). She is a medical writing consultant for Inside Medicine and enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.”

Be Still My

Beating Mind By Kari Kingsley, MSN, CRNP

he roots of my struggle with meditation run deep. Every time I attempted to meditate, the stillness and calm was bombarded by the never-ending adulting To-Do list on autorepeat in my mind. My type A, getit-right-the-first-time personality wanted not only to learn how to meditate, but to master it. I wanted to be the World Champion Meditator. (Because that’s a thing…) The funny thing about meditation is, the harder you try to do it perfectly, the harder it is. Meditation can especially be a white whale for control freaks like me. I developed a sort-of meditation stage-fright. Telling my mind to be still felt like trying to hush a room full of Kindergarteners hyped up on Mountain Dew. I have this major affliction that if I can’t do something well, I’d rather not do it. Each time I sat down to meditate, I failed. Thoughts screamed in my brain and the last thing I felt was inner peace. I stopped wanting to try. Meditation has been around for centuries. You can take classes on meditation, read books, listen to podcasts, and, yes, there’s an app for that. Oxford defines meditation as “the practice of focusing your mind in silence, especially for religious reasons

or in order to make your mind calm.” Simple enough, right? But how? You are what you think. Negative subconscious thoughts or paradigms give way to negative attitudes and those negative attitudes get married and have little baby negative attitudes. Meditation is a wonderful way to reset your daily intentions and turn that brain frown upside down. (Subtract 2 points from article quality for cheesiness). Meditation also has positive physiologic effects including anxiety reduction, lowered blood pressure, and improved sleep quality. Mental health providers encourage meditation to help treat PTSD, depression, anxiety, and bipolar disorder. Scientists suggest it improves brain plasticity. It literally rewires your brain circuits to improve your physical and mental health. Cool. It’s like a facelift for your gray matter. In my research, I kept coming across the term “mindfulness.” Mind-full-ness. I think they meant mind-empty-ness. My brain was anything but empty. Things changed when a friend suggested listening to a guided imagery meditation. For the first time I felt my brain relax and let go. As the soothing voice of the narrator guided my thoughts through

a forest and down a gentle stream, I could feel my brain emptying of the constant background noise. The peace I felt afterwards was indescribable. Days later, I tried again, only to fail (or so I thought). I then set out on a journey to learn how to meditate. I had to break down the failure. Who was judging this as a fail? I was. Who was I trying to impress with my outstanding meditation skills? Me. Who would be missing out if I never learned to meditate? I would. I put a gag on the internal judge and decided to be kinder to myself. Instead of saying that failure is not an option, I took failure off the table. Learning what I want and need from the practice led me to the biggest breakthrough in my meditation journey. The opposite of a cracked-out hamster doing an Iron Man on his tiny wheel after slamming a case of Red Bull. I began to realize the encouraging fact that I had been meditating all my life. One familiar example is the twilight between wakefulness and sleep. Those sacred few moments lying in bed when the brain begins to let go of the day’s events and becomes still. As meditation became less unknown, I recognized it all over the place. Each time I closed my eyes and opened my mind to my senses

“I began to realize the encouraging fact that I had been meditating all my life.” I encountered a brief meditation... walking outside on a warm spring day as the sun warmed my pale winter skin… the smell of knockout roses in the front yard filling my nostrils. I began to savor these moments. Life gives us gifts of moments like these throughout the day. These strong mind-body connections fuel the soul. Now it’s your turn. Close your eyes. (Ok, peak long enough to keep reading). Take a deep breath in. Now a lazy, fullrelease exhale. Don’t judge your breath. Don’t judge your thoughts. Acknowledge them. Accept them. For every negative attitude, replace it with a positive attitude. Or 2. Or 20. Ok, don’t be an over achiever. As your mind wanders, gently acknowledge the thought and re-center your focus on your breath. Deep breath in, and allow your exhale to fully release. The beauty of meditation is that you can’t fail. Meditation is your time. If your brain is flooded with thoughts and emotions, come back to the present moment and concentrate on your breath. When I meditate, I picture a blue sky. Each cloud that floats by is an individual thought. I acknowledge the cloud as it floats into view and then as it floats out the periphery. If you enjoy this short exercise, try a guided meditation that will teach you how to train your mind to let those negative thoughts and emotions pass through your mind without attaching to them or help you work through trauma or paralyzing fears and emotions. I still stumble and pick myself back up on my meditation journey. Life is hectic and somedays the thoughts in my head are really, really loud. The more I practice meditation and mindfulness, the easier it becomes to put the kindergarteners and hamsters down for a nap.

How to Live to Be 100: Lessons Learned from The Blue Zones

Do you want to know how to live to be 100? Honestly, living to be 100 doesn’t interest me that much. However, I am interested in knowing how I can live the highest quality life possible until God determines my time here on Earth is done.

If the book ended here, it would be a great read, and I’d highly recommend it. However, it gets even better.

Whether you want to live long or live well, I have just finished a book that you will find inspiring. The Blue Zones tells the story of five unique regions of the world that author, Dan Buettner, has visited during his travels with National Geographic. He calls these special areas “The Blue Zones.”

I’ll touch briefly on each one, but I highly encourage you to read the book to get all the details. Some of the lessons are things you probably expect, but I think a few will surprise you.

by Traci McCormick, MD

In these five pockets of the world, an extraordinary number of individuals live well into their 100s. But what he found most astonishing about these people wasn’t just their age, it was the quality of their lives. The vast majority of these people were living full, happy, relatively independent lives. They weren’t withering away in a nursing home unable to care for themselves. They were spending their time laughing with family and friends, drinking good wine, enjoying their hobbies, and living life with purpose. Buettner wanted to know what it was about these “Blue Zones” that allowed people to live so well for so long. Why were people here seldom sick? Why was heart disease, diabetes, or cancer almost unheard of in these communities? How were these people still thriving at an age that most people are already dead? The book follows Buettner’s travels to the five “Blue Zones”: Sardinia, Italy; Okinawa, Japan; Loma Linda, California; Hojancha, Costa Rica; and Ikaria, Greece. Each “Blue Zone” has its own chapter in which Buettner recounts his visits to each community and tells the stories of the people he met along the way. There are dozens of interviews with centenarians (people in their 100s) which will inspire you to take a good long look at how you are living your life.

How to Live to Be 100 Buettner was able to determine what these communities had in common that explained their excellent health and longevity. He talks about each in detail and breaks them down into nine lessons that he calls “Your Personal Blue Zone.”

Lesson 1: Move Naturally The first lesson is to be active without having to think about it. People in all five “Blue Zones” are active as part of daily routine. Most walk a lot, garden, or find another way to make exercise a natural part of their day. Lesson 2: Hara Hachi Bu The second lesson is this Confucian-inspired saying means “stop eating when you are 80% full.” Each “Blue Zone” has a philosophy similar to this that encourages them to eat in moderation. They enjoy and celebrate food, but they do not eat mindlessly, and they stop eating when they are no longer hungry. Lesson 3: Plant Slant The third lesson is to avoid meat and processed food. People in the “Blue Zones” eat simple diets consisting of grains, fruits, nuts, beans, and vegetables. They eat things that grow from the ground they tend. Meat is only for special occasions, and they never eat processed foods. Lesson 4: Grapes of Life Lesson number four is to drink alcohol regularly and in moderation. The people living in the “Blue Zones” relax with red wine, sake, or other local spirits each day. But, it is always just a glass or two.

Lesson 5: Purpose Now The fifth lesson is to take the time to see the big picture and wake each day with a sense of purpose. Centenarians in the “Blue Zones” still have daily goals and ways they still contribute to their communities. Lesson 6: Downshift Lesson number six is to take the time to relieve stress. Each of the “Blue Zone” communities has daily or weekly rituals which allow them to disconnect from being busy. They slow the mind. They relax with family and friends. Lesson 7: Belong Lesson seven is to participate in a spiritual community. All of the “Blue Zone” centenarians have deep faith and belong to active religious communities. The Sardinians and Nicoyans are Catholic. The Okinawans have a blended religion. Ikarians are Greek Orthodox, and most people in Loma Linda are Seventh-day Adventists. Lesson 8: Loved Ones First Lesson number eight is to make family a priority. In the “Blue Zone” communities, centenarians have a strong sense of duty when it comes to family. They live close together and have established family rituals or traditions. Shared meals and activities play an important part of their everyday lives. Lesson 9: Right Tribe The last lesson is to surround yourself with people that share “Blue Zone” values. These people are your tribe. “Blue Zone” communities have close social circles that they count on in difficult times and with whom they create strong bonds of friendship. Live Long and Live Well in Your Own “Blue Zone” If you have any interest in living long and living well, I encourage you to pick up a copy of this book. It’s full of valuable information and inspiring stories. After you read it, share your ideas of “Blue Zone” communities with others. For more information visit Traci’s blog at tracimccormickmd.com

100 years old

The hard knock life by Kari Kingsley, MSN, CRNP

Slowly peeling the label on my grande iced vanilla latte, sitting across the table at Starbucks from an attractive, 24-yearold financial advisor, I underestimated the emotional response I would have to the story he was willing to share. In a society where first impressions are everything, many times we are only able to appreciate the tip of the iceberg known as the “human spirit”. After meeting Will Steward, you would never guess that, just under a year ago, a skateboarding accident significantly affected this 23-year-old’s life and appearance. Will Steward comes across as an endearing and intelligent conversationalist with a zest for life that would rival most dare-devils. He currently works for Raymond James and Associates as a financial consultant, or “financial architect”, as he likes to tell his clients, helping them to design and build their futures. He loves chocolate milk, surfing, cutting grass, doubles sand volleyball, Taylor Swift, Donato’s pepperoni pizza, and cultivating relationships with people. He does not like shots or “pointy things that poke him” (luckily he didn’t realize I was a nurse practitioner until after our interview concluded), camel crickets, Instagram, and self-absorbed people. Will was quick to tell me he loves Mondays. I rolled my eyes and blurted out, “Who says that??” His motto is “attitude is everything” and he is grateful for the opportunities and possibilities that each week holds. He seems like a pretty regular guy, right? But there is so much more beneath the surface of the iceberg. June 16, 2016 everything changed for Will. During a downhill longboard run (longboards are similar to skateboards for those of us less athletically inclined), Will lost control of his board. He suffered a traumatic brain injury in which he struck the back of his head on the pavement causing multiple frontal, parietal and occipital fractures, as well as a left frontal subdural hematoma and bilateral frontal contusions. The injury caused extensive brain and neurologic damage. Will was bleeding from his nose, ears, and mouth as HEMSI carried him to our nearby level one trauma center. Upon arrival, he was diagnosed with a severe head injury, giving him the worst possible long-term prognosis. After 10 hours in Huntsville Hospital’s Neuro ICU, the pressure in his skull began to

rise uncontrollably. Will’s neurosurgeon, Dr. Jason T. Banks later said, “A life-saving operation was an option to try to save his life, but could also allow him to survive in a neurologically devastated state. The possibility that he may never wake up or have a meaningful recovery was imminent.” Dramatic television shows containing this heavy content can be gut-wrenching to watch. But this wasn’t a TV show. This was a 23-year-old son, brother, and friend whose loved ones were all too aware that if he were to somehow miraculously survive, he would likely be mentally impaired for the remainder of his life. Take a deep breath and slowly play back your most favorite memory. How old were you? What scents, sounds, and sights do you recall? My favorite, most peaceful memory is frozen in my brain, as if it were painted on an oil canvas. I am lying on the pier at our family lake house in Waterloo, Alabama, surrounded by the people I love the most. I can smell the sweet but pungent river water as the hot sun bounces off my skin. My younger brother is telling a snarky joke and my parents and I are laughing. I was 26. I might have missed this memory if I were in Will’s place. At 23 years old, Will had not yet even begun to live. And his life nearly ended. Until finally he woke up July 3, 2016. His first memory was his Dad saying, “See this on my face?” pointing to his smile. “You’ve been given a gift most people will never get.” This gift was in the form of a miracle, a blessing, a phenomenon. Whatever words you choose to call it, the merry-go-round of life had decided not to throw Will off. His accident left him in a coma for nearly 3 weeks at Huntsville Hospital’s Neuro ICU. He has a very vague account of the accident and the weeks following. When I asked him to describe his most terrifying moment in this horrendous ordeal, he smiled and said, “I don’t remember a lot of fear from this. I’m not trying to sound macho, but I only saw more life”. He recalls flirting with nurses and eating full meals early on, even though his doctors told him he wouldn’t have an appetite. His first day in recovery, Will didn’t realize he was a patient. He passed out business cards and even became slightly belligerent with a nurse who wouldn’t bring him his keys and phone so he could go home. To control the swelling in Will’s brain, Dr. Banks of Huntsville Hospital’s Spine and Neuro Center performed a

Forgive me, I had a brain injury.” You’d never know it to meet him. Because as I said, we so often only see the tip of the iceberg. Will is articulate and well-spoken. His zeal and passion for life are contagious. After spending 2 short hours with him, I walked away feeling better about life with more happiness and hope for the future in general. Will’s motto is “attitude is everything”. His other motto is to “recover quickly and recover with strength”. People like Will are examples of life winking at us, telling us to shoot for the stars and to be happy when you land on the moon. I asked him, as a motivational speaker what would you tell your audience? He responded, “Life’s biggest blessings come from our biggest challenges. Fly through life. But it’s probably better to do it with a helmet on.” craniectomy to control the massive intracranial pressure. Will had severely fractured his frontal bone which was removed and pieced back together, then placed in a storage freezer until it could be reattached after the swelling had subsided. During the reconstruction, the previously removed craniotomy flap was replaced with titanium screws. At this meeting with Will, my ever present foot-in-mouth personality joked, “Oh, so you have a few screws loose?” Will took my hand and pressed it to his right temple where I could feel a small but definite indentation. He politely said, “I assure you, my screws are fully tightened.” Where most of us might shrink into our obscure lives, merely grateful to be alive, Will awoke with a newly invigorated passion to live. Instead of wallowing in self-pity over facing reconstructive procedures, losing his sense of smell, and dropping nearly 40 pounds from his athletic frame, he considered his accident a blessing. Will’s near-death experience encouraged him to create Flatline Surf Company out of his vision for a fearless and persistent pursuit of life. His mission: “All of Flatline’s hand-crafted boards and products carry with them a reminder to use life’s difficulties as an opportunity to overcome adversity through a spirit of adventure.” All Flatline products are made in America. Will has also created the Flatline Foundation at Huntsville Hospital, dedicating 5% of his company’s profits, in addition to other donations and fundraiser proceeds, to traumatic brain injury research, as well as giving back to the Huntsville Hospital employees who were instrumental in saving his life. Although Will’s sheepskin degree comes in the form of a Bachelor’s in Finance from Mississippi State University, no one can argue he’s graduated summa cum laude from the school of hard knocks. Will struggled after the accident to rebuild his mental and physical deficits. He recalls that his muscles had not relearned the speed to which his brain was asking them to perform. He spent months in rehabilitation facilities and the gym to overcome his obstacles. He jokes, “It’s easier to have ‘will-power’ when Will is in your name”. Will would make a remarkable motivational speaker. For example, my first impression of him (which as I previously mentioned, in this world, can be everything) was that in our first encounter he was accidentally running 5 minutes late. He apologized, saying, “I went to the wrong Starbucks.

Writing this story provided many twists and turns for a novice journalist like myself. As my first human interest piece, it became crucial to me that I nail this article… knock it out of the park, so to speak. Will reminded me that the beauty in life is in the imperfections. No one really likes perfection. It’s boring. I’m reminded of the Japanese form of art known as kintsukukuroi that repairs broken pottery with lacquer resin mixed with powdered gold, silver, platinum, copper or bronze. Instead of concealing or hiding the cracks and damage, they accentuate it. This philosophical theory is similar to wabi-sabi and is a concept that discovers beauty in the imperfections and yet also accepts the natural cycle of life and death. Leonard Cohen tells us, “there is a crack in everything and that is how the light gets in.” Perhaps when Will cracked his skull, he was given a gift, allowing more light to shine through.

Will Steward “Kari Kingsley, MSN, CRNP is an otolaryngology nurse practitioner and medical writing consultant for Inside Medicine who enjoys writing articles on pertinent material to keep the residents of North Alabama up to date on the forefront of medicine.”

i am.

by Jill Windham

I’m sitting on my deck on this beautiful Monday morning, two dogs happily playing at my feet. Birds are singing, the air is cool enough for me to wear my cozy gray sweater, and I have THE most perfect cup of coffee next to me. I prayed for my husband. My kids. My friend. Myself. I opened my devotional for the day. The verse was 2 Corinthians 12:8-9. *screeching halt noise* Silence. Paul says he asked the Lord to remove his thorn in the flesh three times (SO wish he had told us what that struggle was, darn it...) and the Lord responded, “My grace is all you need. My power works best in weakness.” Then, Paul said, “So now, I am glad to boast about my weaknesses, so that the power of Christ can work in me... for when I am weak, then I am strong.” Get out of here. (insert all the eyeroll emojis) I boast about alot of things. My kids. My super strong husband. My ability to make THE perfect cup of coffee. My cutest puppy on Earth. But I have never, ever, EVER- not even ONE time boasted about a weakness. In fact, I am side-eyeing a weakness I possess right now. It’s ugly, it wants to rear its head in my heart every day, and it makes me furious that at 40 years old, I still struggle with it. Paul, my dear, you’re my hero and Father in the Faith. But I think you’ve lost your mind on this one, friend. Then, I remembered. A man named Moses once had a mandate from Heaven. God told him to speak to Pharaoh and immediately, Moses went into Jill-mode. Panicking. Excuse making. Groveling. When Moses finally had the nerve to say yes, he asked, “Who will I even say sent me? Pharoah is a tough nut to crack.”

God simply said, “I Am.” Moses: I’m not qualified. God: I Am. Moses: I’m not educated enough. God: I Am. Moses: I’m not a good speaker. God: I Am. Moses: I’m not even known. God: I Am. Oh. Now, it makes sense, Paul. I can delight in my weakness because where I am not, He IS. Where I leave a blank, “I’m not _________,” He fills it. Where my human strength fails, I have a golden opportunity for the superhuman part of me to wake up like springtime. Where I am deflated and defeated, I have paved a road for the Champion to enter the ring. Where I am tapped out, I tap Him in. So, once I realized this simple truth that I should have learned by now (aren’t pastors supposed to know this stuff?), the birds starting singing again. I have a new set of eyes on this weakness thing. I’m going to see it as clearing a path for the Holy Spirit to show up. I’ve got a pretty big spot in this weakness for His power to fill. If I could have fixed it on my own, I would have done it by now. I boast. Not because I HAVE a weakness, but because I have a wide open spot for the grace of God to do its miraculous thing. Switch your binoculars around, friend. Look at the wide open spaces instead of the microscopic places. God is much bigger, much more sufficient than your weakness today!!

by Sally Barton

It’s Saturday morning, February 25, 2017. I wake up at 6:15 a.m. anxious to get to this walk I’m involved in and scream “JAY?” Tears start flowing down my face and I’m having shortness of breath. Another dream, another reminder that I can’t kiss my son, smell my son, hug my son, tell him how much I love him, tell him how proud I am to be his Momma, tell him he has gorgeous blue eyes and Melissa is quite a lucky lady, watch him play with his precious niece Brinkley and little Finn man, watch him play softball, meet him for lunch, find out how his day was, or have him over for our routine Sunday night supper after a round of golf together with his Daddy! We get up, eat breakfast and hurry to the park to meet my friends from NOT ONE MORE ALABAMA and their families. I have a best friend with me from Huntsville, Shawn Bentley and three friends from Atlanta: Deborah, Diane, and Cindy. They are four parts of my rock star friends that are ALWAYS there for me! I see thousands and thousands of people! People with shirts on slamming heroin, signs with pictures of loved ones who are gone or who are in therapy, buttons on shirts with an addict’s picture; like the 13 buttons with Jay’s picture on them from all of the sports he played. TEARS start flowing again. I meet up with my group and love seeing the matching shirts with NOT ONE MORE ALABAMA on them. We get a group shot and here come the tears again. I personally know what all these people feel like. I hate it, but I can relate to the pain. I know what it’s like to feel that knot in your throat, that fear. The fear that death is coming, that you’ve done everything you can think of to help your loved one. You’re broke, you’re tired, you are absolutely longing for a day, just one day when you can feel like that loved one is safe, safe from the devil. To me, fear is this: Feeling Every Addicts Reality! Well, I felt it for over 12 years. The going in and out of recovery, praying that this time he could beat it, going to AL-Anon meetings because I thought I was crazy – are just some of the fears. Jay Barton, my precious son, my only son was born on May 19, 1984. He died on July 5, 2016 at 3:15 a.m. in the morning with a needle in his left arm and his chip in his right hand. That needle was NOT heroin. It was mixed. This Birmingham walk was a blessing to me. Knowing that there are thousands of people out there that you can turn to for help with recovery, addiction, love and support is a very heart-

warming feeling to me. It’s a feeling that I have longed for since July 5, 2016. I’m a Momma who cares, who is not ashamed, who feels a calling to help others get through this fear, this nightmare, this train wreck. Not One More Alabama is a way for us to fight! God set my son free! Free from the devil! God also set me free, Free from FEAR! I do not feel alone anymore. The only way to fight the devil is to LOVE! The Birmingham walk was a whole lot of Love! Not One More Alabama is a whole lot of LOVE! That walk was a day where God made the sky a gorgeous blue color just like my son Jay’s eyes. God is up there smiling at all of us because he knows we care together and together we can fight this evil heroin epidemic with LOVE. A quote from the Bible that always catches my attention is from Romans 5: 2-5: Suffering produces perseverance Perseverance brings character Character brings Hope And Hope does not put us to shame, because God’s love has poured into our hearts through the holy spirit who has been given to us. I will spend the rest of my life helping to fight this disease because I have God on my side. ALL MY LOVE,

Sally Barton