Journal of Research in Biology Volume 4 Issue 2 by Journal of Research in Biology

Aim and Scope Journal of Research in Biology is an international scientific journal committed to the development and spread of research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make the most of your research by publishing articles in Journal of Research in Biology. Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of scientific research and education communities, particularly the biological sciences. The journal has been uniquely positioned to help members of the scientific community; become effective advocates for their science and to be better known for the public that relate to or impact the biological sciences. Call for Papers

Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept and review submissions in English from any author, in any global locality. A body of international peers will review all submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that: Relate to the field of Biology Represent new, previously unpublished work Advance the state of knowledge of the field Conform to a high standard of presentation.

Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflicts in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher invites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.

List of Editors of Editors in the Journal of Research in Biology Managing and Executive Editor: Abiya Chelliah [Molecular Biology] Publisher, Journal of Research in Biology. Editorial Board Members: Ciccarese [Molecular Biology] Universita di Bari, Italy. Sathishkumar [Plant Biotechnologist] Bharathiar University. SUGANTHY [Entomologist] TNAU, Coimbatore. Elanchezhyan [Agriculture, Entomology] TNAU, Tirunelveli. Syed Mohsen Hosseini [Forestry & Ecology] Tarbiat Modares University (TMU), Iran. Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka. Kamal Prasad Acharya [Conservation Biology] Norwegian University of Science and Technology (NTNU), Norway. Dr. Ajay Singh [Zoology] Gorakhpur University, Gorakhpur Dr. T. P. Mall [Ethnobotany and Plant pathoilogy] Kisan PG College, BAHRAICH Ramesh Chandra [Hydrobiology, Zoology] S.S.(P.G.)College, Shahjahanpur, India. Adarsh Pandey [Mycology and Plant Pathology] SS P.G.College, Shahjahanpur, India Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology] Al-Azhar university, Egypt Ganga suresh [Microbiology] Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India. T.P. Mall [Ethnobotany, Plant pathology] Kisan PG College,BAHRAICH, India. Mirza Hasanuzzaman [Agronomy, Weeds, Plant] Sher-e-Bangla Agricultural University, Bangladesh Mukesh Kumar Chaubey [Immunology, Zoology] Mahatma Gandhi Post Graduate College, Gorakhpur, India. N.K. Patel [Plant physiology & Ethno Botany] Sheth M.N.Science College, Patan, India. Kumudben Babulal Patel [Bird, Ecology] Gujarat, India.

Dr. Afreenish Hassan [Microbiology] Department of Pathology, Army Medical College, Rawalpindi, Pakistan. Gurjit Singh [Soil Science] Krishi Vigyan Kendra, Amritsar, Punjab, India. Dr. Marcela Pagano [Mycology] Universidade Federal de São João del-Rei, Brazil. Dr.Amit Baran Sharangi [Horticulture] BCKV (Agri University), West Bengal, INDIA. Dr. Bhargava [Melittopalynology] School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA. Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology] Jawaharlal Technological University, Hyderabad. Dr. Mrs. Kaiser Jamil [Biotechnology] Bhagwan Mahavir Medical Research Centre, Hyderabad, India. Ahmed Mohammed El Naim [Agronomy] University of Kordofan, Elobeid-SUDAN. Dr. Zohair Rahemo [Parasitology] University of Mosul, Mosul,Iraq. Dr. Birendra Kumar [Breeding and Genetic improvement] Central Institute of Medicinal and Aromatic Plants, Lucknow, India. Dr. Sanjay M. Dave [Ornithology and Ecology] Hem. North Gujarat University, Patan. Dr. Nand Lal [Micropropagation Technology Development] C.S.J.M. University, India. Fábio M. da Costa [Biotechnology: Integrated pest control, genetics] Federal University of Rondônia, Brazil. Marcel Avramiuc [Biologist] Stefan cel Mare University of Suceava, Romania. Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner. P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science] School of Life Sciences, Bharathidasan University, India. Dr. Mrs Kavita Sharma [Botany] Arts and commerce girl’s college Raipur (C.G.), India. Suwattana Pruksasri [Enzyme technology, Biochemical Engineering] Silpakorn University, Thailand. Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries] Yogeshwari Mahavidyalaya, Ambajogai, India.

CHANDRAMOHAN [Biochemist] College of Applied Medical Sciences, King Saud University.

Dr. Pankaj Sah [Environmental Science, Plant Ecology] Higher College of Technology (HCT), Al-Khuwair.

B.C. Behera [Natural product and their Bioprospecting] Agharkar Research Institute, Pune, INDIA.

Dr. Erkan Kalipci [Environmental Engineering] Selcuk University, Turkey.

Kuvalekar Aniket Arun [Biotechnology] Lecturer, Pune.

Dr Gajendra Pandurang Jagtap [Plant Pathology] College of Agriculture, India.

Mohd. Kamil Usmani [Entomology, Insect taxonomy] Aligarh Muslim university, Aligarh, india.

Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry] Shree Shivaji Arts, Commerce & Science College, India.

Dr. Lachhman Das Singla [Veterinary Parasitology] Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.

Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy] Bio-Science Research Foundation, India.

Vaclav Vetvicka [Immunomodulators and Breast Cancer] University of Louisville, Kentucky.

Nasroallah Moradi Kor [Animal Science] Razi University of Agricultural Sciences and Natural Resources, Iran

José F. González-Maya [Conservation Biology] Laboratorio de ecología y conservación de fauna Silvestre, Instituto de Ecología, UNAM, México.

T. Badal Singh [plant tissue culture] Panjab University, India

Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture] AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia, West Bengal, India. Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous practices, Ethno botany] V. C., Vidyasagar University, Midnapore. M.Sugumaran [Phytochemistry] Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District. Prashanth N S [Public health, Medicine] Institute of Public Health, Bangalore. Tariq Aftab Department of Botany, Aligarh Muslim University, Aligarh, India. Manzoor Ahmad Shah Department of Botany, University of Kashmir, Srinagar, India. Syampungani Stephen School of Natural Resources, Copperbelt University, Kitwe, Zambia. Iheanyi Omezuruike OKONKO Department of Biochemistry & Microbiology, Lead City University, Ibadan, Nigeria. Sharangouda Patil Toxicology Laboratory, Bioenergetics & Environmental Sciences Division, National Institue of Animal Nutrition and Physiology (NIANP, ICAR), Adugodi, Bangalore. Jayapal Nandyal, Kurnool, Andrapradesh, India. T.S. Pathan [Aquatic toxicology and Fish biology] Department of Zoology, Kalikadevi Senior College, Shirur, India. Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA. Dr. Amit Bandyopadhyay [Sports & Exercise Physiology] Department of Physiology, University of Calcutta, Kolkata, INDIA . Maruthi [Plant Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India. Veeranna [Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India. RAVI [Biotechnology & Bioinformatics] Department of Botany, Government Arts College, Coimbatore, India. Sadanand Mallappa Yamakanamardi [Zoology] Department of Zoology, University of Mysore, Mysore, India. Anoop Das [Ornithologist] Research Department of Zoology, MES Mampad College, Kerala, India.

Dr. Satish Ambadas Bhalerao [Environmental Botany] Wilson College, Mumbai Rafael Gomez Kosky [Plant Biotechnology] Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas Eudriano Costa [Aquatic Bioecology] IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India Rajib Roychowdhury [Plant science] Centre for biotechnology visva-bharati, India. Dr. S.M.Gopinath [Environmental Biotechnology] Acharya Institute of Technology, Bangalore. Dr. U.S. Mahadeva Rao [Bio Chemistry] Universiti Sultan Zainal Abidin, Malaysia. Hérida Regina Nunes Salgado [Pharmacist] Unesp - Universidade Estadual Paulista, Brazil Mandava Venkata Basaveswara Rao [Chemistry] Krishna University, India. Dr. Mostafa Mohamed Rady [Agricultural Sciences] Fayoum University, Egypt. Dr. Hazim Jabbar Shah Ali [Poultry Science] College of Agriculture, University of Baghdad , Iraq. Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics] Agronomy and Plant Breeding Dept., Razi University, Iran Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution, Forest protection] College of Life Sciences, Nankai University, China. María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology] New University of Lisbon, Caparica, Portugal Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech] Visva-Bharati (a Central University), India

Table of Contents (Volume 4 - Issue 2) Serial No

Accession No

RA0416

Title of the article

Associations of Arbuscular Mycorrhizal (AM) fungi in the

Page No

1247-1263

Phytoremediation of Trace Metal (TM) Contaminated Soils. Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.

RA0423

Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada

1264-1275

margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl culture industry. Jha S and Mohan PM.

RA0429

Genetics characterization, nutritional and phytochemicals potential of

1276-1286

gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a candidate of poultry feed. Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung. 4

RA0392

The growth performance of Clarias gariepinus fries raised in varying

1287-1292

coloured receptacles. Ekokotu Paterson Adogbaji and Nwachi Oster Francis.

RA0407

High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A possible reason for the vulnerability of this medicinal plant from the Indian Thar desert. Purushottam Lal, Sher Mohammed and Pawan K. Kasera.

1293-1300

Journal of Research in Biology An International Scientific Research Journal

ISSN No: Print: 2231 â&#x20AC;&#x201C; 6280; Online: 2231- 6299.

Original Research

Journal of Research in Biology

Associations of Arbuscular Mycorrhizal (AM) fungi in the Phytoremediation of Trace Metal (TM) Contaminated Soils. Authors: ABSTRACT: Dhritiman Chanda 1, Sharma GD2, Jha DK3 and Hijri M4. Arbuscular mycorrhizal fungi (AM) are integral, functioning parts of plant roots, widely recognized as plant growth enhancing beneficial mycobionts and Institution: tolerance to variety of stresses such as nutrient, drought, salinity and trace metals 1. Microbiology Laboratory, (TM). A study was undertaken to access the influence of paper mill effluents on Department of Life Science and Bioinformatics, Assam mycorrhizal colonization and mycorrhizal spore count. Plants grown in metal University, Silchar, Assam, contaminated site were found less mycotrophic than their counterparts on the nonpolluted one. Regression analyses revealed that the mycorrhizal colonization and India. mycorrhizal spore count are significantly and positively correlated with various soil 2. Bilaspur University, physio-chemical properties in the polluted and non-polluted site. Glomus was the Bilaspur, India. most frequently isolated mycorrhizal species from the polluted site. The isolated indigenous strains of AM can be used for inoculation of plant species that might be 3. Department of Botany, Gauhati University, Assam, used for rehabilitation of contaminated site. The study highlights the potential use of India. AM as bioremediation agent of polluted soils and as bioindicator of pollution for future research priorities. 4. Institut de Recherche en Biologie Vegetale, University de Montreal, Montreal, Canada. Corresponding author: Dhritiman Chanda.

Keywords: Arbuscular Mycorrhiza, Heavy metals, Phytoremediation, Glomus, Paper mill effluents.

Email Id:

Article Citation: Dhritiman Chanda, Sharma GD, Jha DK and Hijri M. Associations of Arbuscular Mycorrhizal (AM) fungi in the Phytoremediation of Trace Metal (TM) Contaminated Soils. Journal of Research in Biology (2014) 4(2): 1247-1263

Web Address:

http://jresearchbiology.com/ documents/RA0416.pdf.

Dates: Received: 17 Jan 2014 Accepted: 22 March 2014 Published: 23 April 2014 This article is governed by the Creative Commons Attribution License (http://creativecommons.org/ licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

Journal of Research in Biology An International Scientific Research Journal

1247-1263 | JRB | 2014 | Vol 4 | No 2

www.jresearchbiology.com

Chanda et al., 2014 AM

INTRODUCTION: Arbuscualr

mycorrhizal

(AM)

fungi

could

prove

beneficial

are

phytoremediation system as they can increase the rate of

ubiquitous obligate mycobionts forming symbiosis with

plant survival and establishment, reduce plant stress and

the terrstrial plant communities (Barea and Jeffries

increase plant nutrients acquisition, increase carbon and

1995). They are essential components of soil biota and

nitrogen deposition into soil, thereby contributing to

are found in almost all ecological situations particularly

bacterial growth and increase the volume of soil being

those supporting plant communities with high species

remediated

diversity. AM are known to enhance plant tolerance to a

concentration may decrease the number and vitality of

variety of stresses including nutrients, drought, metal

AM as a result of HM toxicity. Metal transporters and

toxicity, salinity and pathogens all of which may affect

plant-encoded transporters are involved in the tolerance

plants success in a contaminated or polluted soil (Olexa

and uptake of TM (Glassman and Casper 2012;

et al., 2000; Zarei et al., 2010). AM can help alleviate

Rahmanian et al., 2011).

(Almas

al.,

2004).Trace

metals

metal toxicity to plants by reducing metal translocation

In recent times, one of the challenges facing the

from root to shoot (Leyval et al., 1997). Therefore they

mankind is the degradation and pollution of soil by

may contribute to plant establishment and survival in

industrial effluents, sludge and solid waste. The pulp and

trace metals polluted sites and could be used as a

paper mill which has been categorized as one of the

complement to immobilization strategies. In the last few

twenty most polluting industries in India discharge huge

years, research interest has been focused on the diversity

quantities of coloured and waste water (effluent) into the

and tolerance of AM in trace metals contaminated soil.

environment and are responsible for soil pollution

To understand the basis underlying adaptation and

consequently the hazardous chemicals enter into surface

tolerance of AM to trace metals in soils,since this could

or ground water and poison the soil or crops. The decline

facilitate and manage these soil microoraganisms for

of plant diversity is due to the soil toxicity generated by

restoration and bioremediation programs (Khan et al.,

dumping of solid paper mill wastes in the area. Several

2000; Shah et al., 2010). AM constitute an important

researches have been carrying out to understand the role

functional component of the soil plant system that is

of AM fungi in plant interaction with toxic metal for

critical for sustainable productivity in stressed soils and

promoting plant growth and the bioavailibility in stressed

promote plant growth to reduce or eliminate the

soils. In order to develop the restoration protocol for

bioavilibility of plants as studied by Joner and Leyval

disturbed habitats, it is necesaary to study benificial

(2003). The variation in metal accumulation and inter-

rhizosphere fungi like AM fungi that are tolerant to

plant translocation depends on the different factors like

various stresses. This will help us develop a protocol by

host-plant, root density, soil characteristics, metals and

studying the association of arbuscular mycorrhizal fungi

their availibility. Metal tolerant AM isolates can decrease

in plants growing in soils polluted with paper mill

metal absorption capacity of these fungi, which could

effluents.

filter metal ions during uptake as described (Val et al., 1999; Andrew et al., 2013 and Martina and Vosatka

MATERIAL AND METHODS:

(2005)). AM increases its hostâ&#x20AC;&#x2122;s uptake of nutrients and

Location of the study area:

can improve the growth and resistance to environmental stresses (Biro et al., 2005; Smith and Read, 2008).

The study was conducted at two sites i.e. one polluted

with paper mill effluents and another non-

polluted site. The first site was effluent dumping site 1248

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014 inside the campus of Hindustan Paper Corporation

described by Phillips and Hayman (1970).

Limited, HPC, Assam, India. The two sites were

Isolation of Mycorrhizal spores:

approximately 2 Km apart. The study area was located at

Spore extraction from the soil was carried out

an altitude of 116mMSL between 24052`N and 92036`E

using the Wet Sieving and Decanting Technique by

longitides.

Gerdemann and Nicolson (1963). The isolated spores

Collection of soil Sample:

were mounted on glass slide using Polyvinyl Alcohol-

From the polluted and non-polluted site,10

Lactic acid Glycerol (PVLG) and observed under

dominant plant species were selected for the study of

compound

mycorrhizal association. The rhizosphere soil samples of

identified according to the manual of identification of

these individuals of a species were collected. The

VAM fungi by Schenck and Perez (1990). The INVAM

rhizospheric soil samples were randomly selected and

worksheet

then mixed together to obtain a composite representative

Additional spores not included in the manual were

sample. The soil samplings were done trimonthly from

identified as per the description given in the INVAM

April 2010 to January 2012. The soil samples were

website (http://invam.caf.wvu.edu/).

brought to the laboratory in sterile condition and stored

Soil Physico-chemical analysis:

in a refrigerator at 4째C until they were processed. Collection of root samples: Fine roots from ten dominant different plants of

microscope

(100-1000X).

was used for

Spores

were

diagnosing the spores.

The physical chracteristics of soil i.e., Moisture content, soil pH and soil temperature were recorded in both polluted and non-polluted sites.

the same species were randomly collected and mixed

The chemical chracteristic i.e., N, P, K, Ca, Mg

properly and a composite root sample was obtained for

etc of the soil samples were estimated using the

each plant species. Trypan blue method was followed for

technique in the polluted and non-polluted site

the determination of the intensity of root colonization as

(Jackson,1985). Concentration of trace metalss i.e., Zn,

Caesalpinia pulcherrima

Fig 1: Monthly variation in Mycorrhizal spore population 50gm-1soil of different plant species growing in the polluted site. Journal of Research in Biology (2014) 4(2): 1247-1263

1249

Chanda et al., 2014 Ni and Cu were determined by Atomic Absorption

malabathricum (54, 50 gm-1 soil) followed by Samanea

Spectrophotometer (VARIAN Spectra AA 220).

saman (52, 50 gm-1 soil) and Caesalpinia pulcherrima

Statistical analysis:

(49, 50 gm-1 soil) in the polluted site and in the non-

Statistical analysis was carried out by following

polluted site Melastoma malabathricum (123, 50 gm-1

the techniques of Gomez and Gomez (1984). Linear

soil) harboured maximum number of mycorrhizal spores

Regression analyses and correlation-coefficient values

followed by Samanea saman (109,50 gm-1 soil) ,Cassia

were calculated to find out the influence and association

sophera (109,50 gm-1 soil) and Caesalpinia pulcherrima

of various edaphic factors with mycorrhizal spore

(98, 50 gm-1 soil) (Figures-1 and 2).

population and mycorrhizal root colonization (%) in the both polluted and non-polluted site.

The maximum root colonization was obtained in July and found decreased gradually until January and again increased in April studied among the different

RESULTS AND DISCUSSION:

plant species studied in the both polluted and non-

The plants were more mycotrophic in the non-

polluted site. In the polluted site the maximum root

polluted site than those growing in the polluted site. The

colonization was estimated in Melastoma malabathricum

maximum root colonization was obtained in July both in

(44%) followed by Caesalpinia pulcherrima (43%) and

the polluted and non-polluted site. The mycorrhizal root

Mimosa pudica (41%) and the minimum percentage

colonization were estimated maximum in the month of

colonization was obtained in Colocasia esculenta (35%)

July and decreased gradually from October to January

and Axonopus compressus (32%). In the non-polluted

and again increased from April. The rhizosphere soil of

site the maximum root colonization was estimated in

the non-polluted site harboured more mycorrhizal spores

Melastoma

in all the selected plants than the non-polluted site.

Caesalpinia pulcherrima (64%), Samanea saman (62%)

Among the different plant species studied, maximum

and Axonopus compressus (61%) and the minimum root

malabathricum

(68%)

followed

mycorrhizal spore count was estimated in Melastoma

Caesalpinia pulcherrima

Fig 2: Monthly variation in mycorrhizal spore population 50gm-1soil of different plant species growing in the non-polluted site. 1250

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014 colonization was estimated in Eupatorium odoratum

content of polluted site was found less than the non-

(54%) and Mimosa pudica (52%) (Figures- 3 and 4).

polluted site. The soil calcium and magnesium content

Inter relationship of mycorrhizal association with soil

were also found more in the polluted site than the non-

Physio-chemical factors

polluted site. The various trace metals like Cu, Ni and Zn

The different soil parameters like N, P, K,

were also estimated and found gradually decreased from

Organic C (%), Ca and Mg were estimated in the

July to January and then slightly increased from the

polluted and non-polluted site. The polluted soil was less

month of April (Tables- 2 and 3).

moist than the non-polluted one. The rhizosphere soil

Liner regression analyses were calculated to find

from polluted site was more alkaline than the non-

out the influence of various edaphic factors on

polluted one. Likewise more temperature was recorded

mycorrhizal

in the polluted site and less temperature was recorded in

population. The results of regression analysis showed a

the non-polluted site. All physical parameters were

positive and significant correlation coefficient(R) values

recorded maximum in the month of July that gradually

between mycorrhizal spore population with soil moisture

decreased from October till April except soil pH

content (r = 0.95; P < 0.01; Fig. 5(a)), soil temperature

(Table- 1).

(r = 0.86; P < 0.01; Fig. 5(b)), Nitrogen (r = 0.81;

colonization

and

mycorrhizal

spore

The soil samples from polluted and non-polluted

P < 0.01;Fig. 5(d)), Organic carbon (r = 0.82; P < 0.01;

site showed marked monthly variation in their chemical

Fig. 5(g)), Calcium (r = 0.84; P < 0.01; Fig. 5(h)), Zinc

properties. Nitrogen, phosphorous and organic carbon

(r = 0.59; P < 0.01; Fig. 5(k)), Cu (r = 0.97;P < 0.01; Fig.

(%) content of the rhizosphere soil gradually decreased

5(i)) and Ni (r = 0.92; P < 0.01; Fig. 5(j)). The

from July to January and slightly increased in April.

correlation coefficient with soil pH (r = 0.75; P < 0.01;

A similar trend of monthly variation was also observed

Fig 5(c)) and soil phosphorus (r = 0.75; P < 0.01; Fig. 5

in the non-polluted site as well. The soil phosphorus

(e)) were however, negative and significant.

Caesalpinia pulcherrima

Fig 3: Monthly variation in mycorrhizal colonization (%) of different plant species growing in the polluted site. Journal of Research in Biology (2014) 4(2): 1247-1263

1251

Chanda et al., 2014

Caesalpinia pulcherrima

Fig 4: Monthly variation in mycorrhizal colonization (%) of different plant species growing in the non-polluted site. The coefficient

positive values

and were

significant between

correlation

0.39; P < 0.01; Fig. 7(k)) in the polluted site. The

mycorrhizal

correlation coefficient with soil Mg and soil pH was

colonization and soil moisture content (r = 0.86;

however found negative and significant.

P < 0.01; Fig. 7(a)), soil temperature (r = 0.70; P < 0.01;

In the non-polluted site, a significant correlation

Fig. 7(b)), Nitrogen (r = 0.85;P < 0.01; Fig. 7(d)),

coefficient values were estimated between mycorrhizal

phosphorus (r = 0.90;P < 0.01; Fig. 7(e)), soil organic

spore population soil pH (r = 0.67; P<0.01; Fig. 6(b)),

carbon (r = 0.64; P < 0.01; Fig. 7(f)), Calcium (r = 0.97;P

soil moisture content (r = 0.82;P < 0.01; Fig. 6(a)), soil

< 0.01; Fig. 7(g)), copper (r = 0.78; P < 0.01; Fig. 7(i))

organic carbon (r = 0.82; P < 0.01; Fig. 6(f)), soil

and Nickel (r = 0.82; P < 0.01; Fig. 7(j)) and Zinc (r =

nitrogen (r = 0.94; P<0.01; Fig. 6(d)), soil phosphorus

Table 1: Monthly Variation in the physical properties of polluted & non-polluted soils. Sampling Period

Physical parameters Moisture Content (%)

Soil Temperature (C0)

April,10

7.8 ± 0.08 (16.3 ± 0.05)

6.9 ± 0.08 (4.10 ± 0.05)

23.1 ± 0.08 (15.2 ± 0.03)

July,10

14.4 ± 0.12 (24.8 ± 0.05)

6.1 ± 0.05 (4.80 ± 0.06)

27.5 ± 0.03 (21.5 ± 0.05)

October,10

11.3 ± 0.05 (18.8 ± 0.03)

6.7 ± 0.03 (4.30 ± 0.03)

22.8 ± 0.03 (17.8 ± 0.08)

January,11

5.7 ± 0.03 ( 8.2 ± 0.08)

7.1 ± 0.03 (4.48 ± 0.13)

19.8 ± 0.06 (14.6 ± 0.03)

April,11

8.1 ± 0.03 (14.2 ± 0.06)

6.9 ± 0.05 (4.00 ± 0.05)

22.8 ± 0.03 (15.4 ± 0.08)

July,11

16.5 ± 0.05 (23.8 ± 0.05)

6.5 ± 0.03 (5.30 ± 0.03)

28.2 ± 0.06 (21.0 ± 0.03)

October,11

12.5 ± 0.03 (18.2 ± 0.03)

6.9 ± 0.03 (4.60 ± 0.03)

23.0 ± 0.05 (18.2 ± 0.08)

January,12

6.2 ± 0.03 ( 8.4 ± 0.05)

7.2 ± 0.03 (4.40 ± 0.05)

18.7 ± 0.06 (15.1 ± 0.05)

Months

Data are represented in mean ±SE; Value in parentheses represents the data from non-polluted site 1252

Journal of Research in Biology (2014) 4(2): 1247-1263

Journal of Research in Biology (2014) 4(2): 1247-1263 0.0062±0.06 (0.0034±0.05) 0.0021±0.03 (0.0071±0.05)

0.3290±0.070 (0.0260±0.030)

0.4510±0.050 (0.0870±0.030)

April,11

July,11

0.22±0.03 (0.022±0.06)

0.37±0.05 (0.037±0.06)

0.46±0.05 (0.057±0.03)

0.31±0.07 (0.080±0.04)

0.18±0.06 (0.017±0.05)

0.26±0.05 (0.032±0.03)

0.38±0.05 (0.046±0.06)

0.21±0.02 (0.050±0.03)

K (mg/g)

1.28±0.03 (0.447±0.02)

1.89±0.06 (0.580±0.05)

2.34±0.07 (0.648±0.03)

1.82±0.07 (0.424±0.03)

1.23±0.05 (0.439±0.06)

1.86±0.07 (0.578±0.03)

2.17±0.06 (0.615±0.05)

1.78±0.08 (0.413±0.03)

Organic C%

2.01±0.05 (0.129±0.06)

2.15±0.03 (0.120±0.04)

1.75±0.57 (0.105±0.38)

3.19±0.07 (0.141±0.05)

2.08±0.03 (0.127±0.06)

2.24±0.07 (0.118±0.05)

1.89±0.06 (0.081±0.08)

3.24±0.05 (0.132±0.03)

Mg (mg/g)

Chemical parameters

4.77±0.06 (0.082±0.02)

5.37±0.03 (0.07±0.05)

5.63±0.05 (0.11±0.06)

4.67±0.05 (0.17±0.03)

4.86±0.08 (0.079±0.07)

5.31±0.02 (0.068±0.06)

5.79±0.06 (0.07±0.03)

4.76±0.03 (0.12±0.05)

Ca (mg/g)

0.029±0.05 BDL

0.052±0.06 BDL

0.087±0.03 BDL

0.041±0.06 BDL

0.023±0.08 BDL

0.047±0.07 BDL

0.075±0.05 BDL

0.034±0.02 BDL

Cu (ppm)

Data are represented in mean ±SE; BDL=Below Detectable Limit; Value in parentheses represents the data from non-polluted site

January,12

.0049±0.07 (0.0051±0.03)

0.0047±0.05 (0.0020±0.03)

0.3630±0.060 (0.0240±0.050)

January,11

0.3200±0.030 (0.0280±0.028)

0.0035±0.07 (0.0047±0.03)

0.4100±0.050 (0.0380±0.030)

October,10

0.0031±0.06 (0.0039±0.03)

0.0016±0.05 (0.0062±0.06)

0.4270±0.060 (0.0740±0.030)

July,10

0.3800±0.057 (0.0420±0.060)

0.0057±0.06 (0.0027±0.03)

0.3125±0.080 (0.0217±0.050)

April,10

October,11

P (mg/g)

N (mg/g)

Sampling periods Months

Table 2: Monthly Variation in the chemical properties of polluted and non-polluted soil.

0.006±0.07 BDL

0.029±0.06 BDL

0.041±0.05 BDL

0.016±0.03 BDL

0.008±0.02 BDL

0.022±0.06 BDL

0.275±0.04 BDL

0.285±0.06 BDL

0.349±0.03 BDL

0.324±0.04 BDL

0.278±0.03 BDL

0.297±0.05 BDL

0.358±0.06 BDL

0.317±0.04 BDL

0.013± 0.05 BDL 0.034±0.03 BDL

Zn (ppm)

Ni (ppm)

Chanda et al., 2014

1253

Chanda et al., 2014 Table 3: Monthly Variation in the Mycorrhizal spore population and Mycorrhizal root colonization (%) in 50gm-1 soil of polluted and non-polluted sites

Sampling Periods

Endogonaceous Spore Population(50gm-1)

Mycorrhizal colonization (%)

24 ± 0.6 ( 52 ±0.8)

21 ± 0.8 (32 ± 0.6)

July,10

54 ± 0.5 (118 ±0.8)

44 ± 0.3 (68 ± 0.4)

October,10

39 ± 0.3 ( 75 ±0.8)

34 ± 0.5 (53 ± 0.3)

January,11

18 ± 0.5 ( 46 ±0.5)

21 ± 0.5 (26 ± 0.3)

April,11

26 ± 0.5 ( 49 ±0.8)

19 ± 0.5 (34 ± 0.6)

July,11

61 ± 0.5 (124 ±0.5)

39 ± 0.3 (61 ± 0.5)

October,11

35 ± 0.5 ( 68 ±0.8)

32 ± 0.3 (48 ± 0.8)

January,12

20 ± 0.5 ( 40 ±0.5)

18 ± 0.3 (28 ± 0.4)

Months April,10

Data are represented in mean ±SEM; Value in parentheses represents the data from non-polluted site (r = 0.85; P < 0.01; Fig. 6(e)) and soil magnesium (r =

the same decreased as the pH increased. The presence of

0.77; P < 0.01; Fig. 6(g)).

trace metals in the polluted soil may be responsible for

In the non-polluted site, the mycorrhizal

less percentage of root colonization in the polluted site.

colonization was found significantly and positively

AM spore population decreased with increased amount

correlated with soil moisture content (r = 0.80; P < 0.01;

of trace metals in the soil (Val et al., 1999; Hayes et al.,

Fig. 8(a)), soil temperature (r = 0.94; P < 0.01; Fig. 8(c)),

2003).The negative correlation with soil Phosphorous,

soil pH (r = 0.54; P < 0.01; Fig. 8(b)) soil Nitrogen (r =

Magnesium and pH is may be responsible for the less

0.79; P < 0.01; Fig. 8(d)), phosphorus (r = 0.92; P < 0.01;

percentage of root colonization in the plants. High

Fig. 8(e)), soil organic carbon (r = 0.90; P < 0.01; Fig. 8

alkalinity in the soil was also responsible for decrease in

(f)), Magnesium (r = 0.85; P < 0.01; Fig. 8(h)). The

the number of spores as well as root colonization in the

correlation coefficient with soil Calcium was however

polluted soil. The spore population and mycorrhizal root

found negative and significant.

colonization of AMF fungi were found decreased by the

The present experimental findings revealed the

higher levels of heavy metals in the soil. Our results also

relationship of mycorrhizal spore population and

supports the findings of (Shah et al., (2010); Biro et al.,

mycorrhizal colonization with various physio-chemical

(2005); Göhre and Paszkowski (2006); Mathur et al.,

properties of soil polluted with trace metals. The low

(2007)).

intensity of root colonization and low spore count in the

Among the isolated genera of AM fungi, Glomus

polluted site may be attributed to the sensitivity of

was the most dominant AM genus isolated during the

endomycorrhizal fungi to various soil pollutants. This

present investigation followed by Gigaspora and

may be due to the alkaline pH, higher soil temperature

Scutellospora sp. Dominance of Glomus sp in the

due to the deposition of more amounts of Calcium and

polluted soil may be due to its higher metal tolerance

trace metals that might have adversely affected the

capacity as reported earlier by various workers (Martina

sporulation and colonization ability of the mycorrhizal

and Vosatka 2005; Carrasco et al., 2011; Chen et al.,

fungi as reported by Schenck and Smith (1982). Rohyadi

2007; Zaefarian et al., 2010). The decline of AM fungal

et al., (2004) also observed that the relative growth

occurance (propagule density) and infectivity in trace

improvement by mycorrhizas was highest at pH 4.7 and

metal polluted site which can be used as bioindicators of

1254

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014 soil contamination (Citterio et al., 2005; Liao et al.,

efficiently to colonize plant roots in trace metal-stressed

2003).

environments by significantly correlated with various physic-chemical properties of the soil. It is therefore of

CONCLUSION: Our study suggests that the effluents and the

great importance that we combine selected plants with specific

fungal

isolates

adapted

high

solid wastes dumped by the paper mill have high

concentrations of trace metal in future research for

concentration of trace metals that changed the other

phytoremediation programes. Thus, the isolated strains

physical and chemical properties of the soil. The

of AM fungi can be of great interest since they can be

indigenous AM isolates existing naturally which are

used for inoculation of the plant species and the present

isolated from trace metal polluted soils are reported

study provides evidences for the potential use of the

(a)

(b)

(c)

(d)

(e)

(f)

Journal of Research in Biology (2014) 4(2): 1247-1263

1255

Chanda et al., 2014

(g)

(h)

(i)

(j)

(k) Figure 5: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical factors (Y) in the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC=Moisture Content; Soil temp(C0),soil pH,Nitrogen (N), Potassium (K), Phosphorus (K),Organic Carbon (%),Calcium (Ca),Copper (Cu), Nickel (Ni) and Zinc (Zn)).

1256

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014

(a)

(b)

(c)

(d)

(e)

(f)

(g) Figure 6: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical factors (Y) in the non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC=Moisture Content; Soil temp(C0),Soil pH, Nitrogen(N), Potassium(K),Phosphorus(P),Organic Carbon (%),Magnesium(Mg)).

Journal of Research in Biology (2014) 4(2): 1247-1263

1257

Chanda et al., 2014

(a)

(b)

(c)

(d)

(e)

(f)

1258

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014

(g)

(h)

(i)

(j)

(k) Figure 7: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). MC=Moisture Content; Soil temp(C0),Nitrogen (N), Phosphorous (P),Organic Carbon (%),Calcium (Ca),Magnesium (Mg),Copper (Cu),Nickel (Ni) and Zinc (Zn)).

Journal of Research in Biology (2014) 4(2): 1247-1263

1259

Chanda et al., 2014

(a)

(b)

(c)

(d)

(e)

(f)

(k)

(g)

1260

(h)

Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014

(i) Figure 8: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in the non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC = Moisture Content; Soil temp(C0),Soil pH, Nitrogen(N), Potassium (K),Phosphorus (P),Organic Carbon (%),Magnesium (Mg) and Calcium (Ca)).

plant species in combination with AM fungi in the paper

Function,

mill polluted with paper mill effluents contaminated with

Springer-Verlag, Heidelberg. 521-559.

various trace metals.

and

biotechnology.

2005. Mycorrhizal Functioning as part of the Survival

The authors are grateful to the Department of Science,

Biology

Biró B, Posta K, Füzy A, Kádár I and Németh T.

ACKNOWLEDGEMENT: Life

Molecular

Microbiology

Laboratory,

Assam

University (Silchar), India for providing the laboratory facilities.

Mechanisms of Barley (Hordeum vulgare L.) at Longterm Heavy Metal Stress, Acta Biol.Szegedien. 49 (1-2): 65-67. Carrasco L, Azcon R, Kohler J, Roldán A and Caravaca F. 2011. Comparative effects of native filamentous and arbuscular mycorrhizal fungi in the

REFERENCES: Jan Mulder. 2004.

establishment of an autochthonous, leguminous shrub

Changes in tolerance of soil microbial communities in

growing in a metal-contaminated soil. Sci Total

Zn and Cd contaminated soils. Soil Biol Biochem. 36(5):

Environ., 409(6): 1205-1209.

Almas AR, Bakken LR and

805–813.

Chen BD, Zhu Y.-G, Duan J, Xiao XY and Smith SE.

Andrew B, Brown MV, Steven DS and Peter HT.

2007.

2013.

fungus Glomus mosseae on growth and metal uptake by

change:

four plant species in copper mine tailings. Environ

Microbial

anthropogenically

community induced

responses

environmental

towards a systems approach. Ecol Lett. 16 (Supplement S1): 128-139. Barea JM and Jeffries P. 1995.

Effects

the

arbuscular

mycorrhizal

Pollut. 147(2): 374-380. Citterio S, Prato N, Fumagalli P. Aina R, Massa N,

Arbuscular

Santagostino A, Sgorbati S and Berta G. 2005. The

mycorrhizas in sustainable soil plant systems. In: B.

arbuscular mycorrhizal fungus Glomus mosseae induces

Hock and A. Varma (eds) Mycorrhiza, structure,

growth and metal accumulation changes in Cannabis

Journal of Research in Biology (2014) 4(2): 1247-1263

1261

Chanda et al., 2014 sativa L. Chemosphere. 59(1): 21-29.

colonization and function: physiological, ecological and

Glassman SI and Casper BB. 2012. Biotic contexts

applied aspects. Mycorrhiza. 7(3): 139-153.

alter metal sequestration and AMF effects on plant

Liao JP, Lin XG, Cao ZH, Shi YQ and Wong MH.

growth in soils polluted with heavy metals. Ecology.

2003. Interactions between arbuscular mycorrhizae and

93(7): 1550-1559.

heavy

Gerdemann JW and Nicolson TH. 1963. Spores of

metals

under

sand

culture

experiment.

Chemosphere. 50(6): 847-853.

mycorrhizal Endogone species extracted from soil by wet

Mathur N, Bohra JSS, Quaizi A and Vyas A. 2007.

sieving and decanting. Trans Br Mycol Soc., 46(2):

Arbuscular Mycorrhizal Fungi: A Potential Tool for

235-244.

Phytoremediation, J Plant Sci., 2(2): 127-140.

Gรถhre V and Paszkowski U. 2006. Contribution of the

Martina J and Vosatka M. 2005. Response to

Arbuscular Mycorrhizal Symbiosis to Heavy Metal

Cadmium of Daucus carota hairy roots dual cultures

Phytoremediation. Planta. 223(6): 1115-1122.

with Glomus intraradices or Gigaspora margarita.

Gomez

KA and Gomez

AA.

1984. Statistical

Mycorrhiza. 15(3): 217-224.

Procedures for Agricultural Research (2nd edn), An

Olexa TJ, Gentry TJ, Hartel PG. Wolfb DC,

International Rice Research Institute book, A Wiley-

Fuhrmannc

Interscience Publication, John Willey and Sons, New

Mycorrhizal Colonization and microbial community

York.

structure in the rhizosphere of annual ryegrass grown in

Hayes WJ, Chaudhry TM, Buckney RT and Khan

and

Reynoldsd

CM.

2000.

pyrene-amended soils. Int J Phytol., 2(3): 213-231.

AG. 2003. Phytoaccumulation of Trace Metals at the

Phillips JM and Hayman DS. 1970. Improved

Sunny Corner Mine, New South Wales with Suggestions

procedures for cleaning and staining parasitic and

for a Possible Remediation Strategy, Aust J Toxicol.,

vesicular-arbuscular

9(1):69-82.

assessment of infection. Trans Br Mycol Soc., 55(1):

Jackson ML. 1985. Soil chemical analysis, 2nd edition, Madison, WI, USA.

organic pollutants using mycorrhizal plants: a new aspect rhizosphere

interactions.

Agronomie.

23(5-6):

495-502. Khan AG, Kuek C, Chaudhry TM, Khoo CS and Hayes WJ. 2000. Role of plants,mycorrhizae and phytochelators in heavy metal contaminated land remediation. Chemosphere. 41(1-2):197-207. Leyval C, Turnau K and Haselwandter K. 1997. Effect of heavy metal pollution on mycorrhizal 1262

fungi

for

rapid

158-161. Rahmanian M, Khodaverdiloo H, Rezaee DY and

Joner EJ and Leyval C. 2003. Phytoremediation of of

mycorrhizal

Rasouli SMH. 2011. Effects of Heavy Metal Resistant Soil Microbes Inoculation and Soil Cd Concentration on Growth and Metal Uptake of Millet, Couch Grass and Alfalfa. Afr J Microbiol Res., 5(4): 403-410. Rohyadi A, Smith FA, Murray RS and Smith SE. 2004. Effects of pH on mycorrhizal colonisation and nutrient uptake in cowpea under conditions that minimise confounding effects of elevated available aluminium. Plant Soil. 260(1-2): 283-290. Shah FR, Ahmad N, Masood KR. Peralta-Videa JR and Ahmad FuD. 2010. Heavy Metal Toxicity in Plants. Journal of Research in Biology (2014) 4(2): 1247-1263

Chanda et al., 2014 In: Ashraf, M. Ozturk M. and S.A. Ahmad (eds) Plant Adaptation and Phytoremediation, Springer Dordrecht Heidelberg London, New York.71-98. Schenck NC and Smith GS. 1982. Responses of six species of vesicular arbuscular mycorrhizal fungi and their effects on soybean at four-soil temperatures. New Phytol., 92(2):193-201. Schenck, NC and Perez Y. 1990. Manual for the Identification of VA Mycorrhizal Fungi. (3rd edn). Gainesville, Florida, Synergistic Publications. Smith SE and Read DJ. 2008. Mycorrhizal Symbiosis Academic press London. Val CD, Barea, JM and Azcon-Aguilar C. 1999. Diversity of arbuscular mycorrhizal fungus populations in heavy- metal- contaminated soils. Appl Environ. Microbiol., 65(2): 718-723. Zaefarian F, Rezvani M, Rejali F, Ardakani MR and Noormohammadi G. 2010 Ability of Glomus mosseaeAlfalfa (Medicago sativa L.) Association for Heavy Metal Phytoextraction from Soil.

Environ Sci., 7(3):

77-90. Zarei M, Hempel S, Wubet T, Sch채fer SH, Savaghebi G, Jouzani GS, Nekouei MK and Buscot F. 2010. Molecular diversity of arbuscular mycorrhizal fungi in relation to soil chemical properties and heavy metal contamination. Environ. Pollu., 158(8): 27572765. Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

Journal of Research in Biology (2014) 4(2): 1247-1263

1263

Journal of Research in Biology

ISSN No: Print: 2231 – 6280; Online: 2231 - 6299.

An International Scientific Research Journal

Original Research

Journal of Research in Biology

Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl culture industry Authors: Jha S and Mohan PM.

ABSTRACT: The present study on the biometry and fouling load of black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758), was conducted to understand the eco-biology of these intertidal oysters so that their eligibility in the pearl culture industry could be determined. Biometric parameters viz., Anteroposterior measurement (APM), hinge length (HL), thickness (THK) and total weight (TWT) of each oyster were checked for their correlation with dorsoventral measurement (DVM) and fouling load (ΔF) separately by regression analysis. Shell length of collected Institution: specimens ranged between 16 ± 3.7- 88.2 ± 6.5 mm. Most of the P. margaritifera from Department of Ocean Studies and Marine Biology, intertidal regions of Andaman were confined to 61-80 mm size group. The average size of all the shell dimensions and TWT increased with increase in the shell length. Pondicherry University The rate of increase of all the biometric parameters except TWT, declined in size range (Brookshabad Campus), >41-60 mm. Maximum and minimum fouling load was observed during September Chakkargaon Post, Port 2011 (27.8 ± 5.1 g) and July 2012 (3.2 ± 3.7 g), respectively. Lower size groups showed Blair, 744112, maximum correlation indicating isometric growth but in higher size range, allometry Andaman and Nicobar Islands, India. was observed as the rate of increase of biometric parameters varied with increasing size range. On the basis of this study it could be concluded that if transferred to suspended culture at an early stage, these intertidal oysters, adapted to survive in harsh environmental conditions, would acclimatize more easily to the new environment and would cross the 61-80 mm size range becoming larger and thicker, a parameter favourable for pearl production. Corresponding author: Jha S.

Keywords: Black-lip pearl oyster, Allometry, Biofouling, Intertidal Limiting factors, Reproductive maturity, Pearl culture.

Email Id:

Article Citation: Jha S and Mohan PM. Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl culture industry. Journal of Research in Biology (2014) 4(2): 1264-1275

Web Address:

Dates: Received: 19 Feb 2014

http://jresearchbiology.com/ documents/RA0423.pdf.

Journal of Research in Biology An International Scientific Research Journal

Accepted: 01 Apr 2014

Published: 14 May 2014

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/ licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.

1264-1275| JRB | 2014 | Vol 4 | No 2

www.jresearchbiology.com

Jha and Mohan, 2014 the correlation of biometric parameter of all the oysters

INTRODUCTION Pearl oyster Pinctada margaritifera (Linnaeus,

without dividing them into any size group. None of these

1758) is commonly known as the black-lip pearl oyster

authors studied the correlation between DVM and the

due to dark colouration of the nacre of its inner shell

fouling load (ΔF).

towards the distal rim (Saville-Kent, 1893). This

In the natural habitat, several environmental

exclusively marine, sedentary bivalve is distributed along

factors such as availability of food and space, nature of

the tropic belt within the Indo-Pacific Ocean (Pouvreau

substratum, fouling, competition, predation etc., affect

and Prasil, 2001; El-Sayed et al., 2011).

the

biometric

growth

black

pearl

oysters

P. margaritifera are cultured around the world

(Alagarswami, 1991; Gervis and Sims, 1992; Mohamed

for the production of black pearls, designer mabe (Kripa

et al., 2006). Fouling on the sedentary organism plays a

et al., 2008), and for their lustrous inner shell known as

major role in adversely affecting their growth and

mother of pearl which is used in the ornamental and

development as more the fouling more is the energy

button industry (Kimani and Mavuti, 2002; Fletcher

required for oysters to open its valve for food filtration

et al., 2006). A thorough knowledge of the biometry of

and respiration (Alagarswami and Chellam, 1976;

pearl oyster is of prime importance in the pearl culture

Mohammad, 1976; Alagarswami, 1987; Taylor et al.,

industry. Thickness and wet weight of the pearl oyster

1997; Mohammed, 1998; Pit and Southgate, 2003).

helps in predicting the nuclei size (Mohamed et al.,

The main objective of the present study was to

2006; Abraham et al., 2007). Kripa et al., (2008)

determine the eligibility of intertidal P. margaritifera in

considered shell size to be an important criteria for mabe

the pearl culture industry by understanding their

production.

biometry as well as month-wise variation in the fouling

In different parts of the world, research is being

load at natural habitat. A novel aspect of pearl oyster

carried out to understand the biometric relationship of

ecology explored in this study was the correlation

black pearl oysters in natural and cultured conditions.

between DVM-ΔF, which shall be the first known

Friedman and Southgate (1999) studied the biometric

reference available from Andaman and elsewhere.

relationship of these oysters in Solomon Islands. Pouvreau et al., (2000a) reported the isometric relation

MATERIALS AND METHODS

between their length and thickness in French Polynesia.

Study Area

El-Sayed (2011) studied the concept of allometric growth in P. margaritifera from the Egyptian coastal waters.

Preliminary surveys were conducted in 10 intertidal regions of South Andaman, out of which only

In India P. margaritifera is the most abundant in

three regions viz. Burmanallah (11°34’19” N; 92°44’39”

Andaman and Nicobar Islands (Alagarswami, 1983).

E), Carbyn (11°38’49” N; 92°44’81” E) and Marina Jetty

Alagarswami (1983) and Abraham et al., (2007) studied

area (11°40’16” N; 92°44’53” E) showed natural

the

shell

availability of P. margaritifera and hence were selected

dimensions viz., hinge length (HL), thickness (THK) and

as the study area for the present study conducted during

total weight (TWT) with the dorsoventral measurement

July 2011 to July 2012.

(DVM) or the shell length of the black-lip pearl oyster in

Sampling Method

biometric

relationship

between

various

Andaman and Nicobar Islands. But the size range and

For studying the relationship between various

total number of specimens studied by them were

shell dimensions during different growth size of the

different from the present study. Alagarswami studied

oysters, 151 specimens of P. margaritifera were

1265

Journal of Research in Biology (2014) 4(2): 1264-1275

Jha and Mohan, 2014 collected and brought to the laboratory in a bucket filled with raw sea water.

Statistical Analysis The average value of biometric dimensions,

The individual morphometric parameters viz.

fouling load and their rate of increment for five different

shell length or the dorsoventral measurement (DVM),

size groups were obtained by calculating the mean and

anteroposterior measurement (APM), hinge length (HL)

standard deviation. Month-wise average fouling load was

and shell thickness (THK) were measured with the help

also calculated using the same method. Pearson’s

of a digital vernier calliper (Aerospace, accuracy = 0.01

Correlation Coefficient between biometric relationships

mm) using the method of Hynd (1955) and then grouped

viz., DVM-APM, DVM-HL, DVM-THK and the

into five length classes with a class interval of 20 mm

correlation between ΔF with biometric parameters

viz., 1-20, 21-40, 41-60, 61-80 and 81-100 mm. DVM

(DVM, APM, HL, THK and TWT) were calculated by

and APM were measured excluding the growth process.

fitting the least square method equation, y = a+bx, of

To minimize any error during the measurement

linear regression.

of total weight (TWT), oysters were taken out from the

The length-weight relationship was determined

bucket and kept outside in a tray covered with wet cloth

by following the method of Abraham et al., (2007) where

for 15 minutes to remove the water trapped inside the

the length measurements were expressed in centimeters

oyster as described in Moullac et al., (2012). Once most

and the weight was expressed in grams. Exponential

of the in-held water had seeped out, weight of the fouled

curvi-linear regression models were prepared for the

oysters were measured by using digital balance

estimation of correlation between DVM-TWT, as their

(Professional Digital Scale, accuracy = 0.01 g).

relationship was non-linear. The correlation values were

The attached foulers on the shells of the oysters were then scrapped off and oysters were washed with

tested for significance with one-way ANOVA adopting Hynd (1955).

filtered sea water to clean all the epiphytic growth. The cleaned oysters were weighed again to determine their

RESULTS

actual total weight (foul free weight). The fouling load

Trend of biometric growth and fouling

(ΔF) was calculated by comparing the individual weight

The DVM of the 151 collected specimens ranged

of each fouled oyster with their respective weight after

between 16 ± 3.7- 88.2 ± 6.5 mm. The average values of

cleaning.

biometric dimensions of all the size groups and their fouling load have been graphically represented in Fig.1,

Fig. 1 Average biometric dimensions (±SE) of 5 size groups of Pinctada margaritifera.

Journal of Research in Biology (2014) 4(2): 1264-1275

1266

Jha and Mohan, 2014 DVM-HL (r2 = 0.550, P > 0.05, n = 18) were moderate to

along with their standard deviation values. From the observation it was found that as the

low.

DVM increased the average size of all other shell dimensions also increased, though not at a constant rate

In the size group of 21-40 mm, higher degree of correlation

was

observed

between

DVM-APM

(Fig. 2). ΔF also increased with the DVM except for the

(r = 0.802, P > 0.05, n = 24) and DVM-HL (r2 = 0.808,

largest size group (81-100 mm) where ΔF was lesser

P < 0.001, n = 24). DVM-THK (r2 = 0.673, P < 0.001,

than 61-80 mm group. The size group, 61-80 mm was

n = 24) and DVM-TWT (r2 = 0.304, P > 0.05, n = 24)

the most heavily fouled of all the other size ranges. The

showed moderate and poor correlation, respectively.

monthly average fouling load on an individual specimen

The value of correlation between DVM-TWT 2

of P. margaritifera has been graphically shown in Fig.3.

(r = 0.725, P < 0.001, n = 33) was highest for the 41-60

It can be inferred that ΔF showed a changing trend over a

mm size group. However, it showed moderate correlation

span of one year. Maximum fouling load was observed

between DVM-APM (r2 = 0.577, P = 0.002, n = 33) and

during the month of September 2011 (27.8 ± 5.1 g)

DVM-HL (r2 = 0.523, P < 0.001, n = 33).

followed by February 2012 (19.5 ± 13.5 g) and June 2012 (15.0 ± 3.6 g).

Maximum number of individuals collected during the study belonged to the size group 61-80 mm.

Fouling load was minimal during July 2012 (3.2

The regression analysis of this size group showed

± 3.7 g) followed by November 2011 (4.6 ± 6.9 g) and

moderate to low correlation between DVM and all the

December 2011 (4.7 ± 14.1 g).

other parameters, with the exception of DVM-APM

Correlation of DVM with other biometric parameters

(r2 = 0.721, P < 0.001, n = 52).

The

size-wise

correlation

biometric

In the largest size group of 81-100 mm (n = 24),

dimensions with the DVM (at 99.5% significance level)

all the parameters showed poor correlation with the

has been presented in Table 1.

DVM.

The

regression

coefficient

for

most

In the lower size group of 1-20 mm, the

the parameters of the above mentioned size ranges

maximum correlation was observed between DVM-APM

when tested against DVM with one-way ANOVA,

(r = 0.876, P > 0.05, n = 18). Correlation coefficient 2

values of DVM-THK (r = 0.673, P < 0.001, n = 18) and

showed significant value except for a few as mentioned in Table 1.

Fig. 2 Average increment (±SE) in the biometric dimensions of 5 size groups of Pinctada margaritifera. 1267

Journal of Research in Biology (2014) 4(2): 1264-1275

Jha and Mohan, 2014 Correlation of ΔF with biometric parameters

investment of body energy in reproduction rather than

The regression analysis of biometric parameters

shell growth (Pouvreau et al., 2000b), etc., might have

with ΔF showed poor correlation in all the size groups

consequently resulted in the slow allometric growth rate

except for a moderate correlation between TWT-ΔF

(Gimin et al., 2004; El-Sayed et al., 2011) and hence

(r = 0.619, P < 0.001, n = 33) for the 41-60 mm size

poor correlation between DVM and other shell

group (Table 2).

dimensions in the higher size groups of black-lip pearl oyster of intertidal region of South Andaman.

DISCUSSION

Shell Dimensional Relationship

Maximum value of correlation coefficient for

The smaller oysters showed more increment in

most of the shell dimensions was seen in small size

shell dimension than in total weight. It might be due to

oysters hinting towards isometric growth of the oyster at

the fact that in the initial stages of the oyster’s

this stage. The site of attachment selected by settling

development, the body energy is mainly utilized towards

larval stage plays a pivotal role in the biometric growth

the shell growth when compared to the tissue growth or

of these sessile organisms, as the Pediveliger larvae settle

reproductive development (Chellam, 1987; Dharmaraj

in the crevices of rocks during the juvenile stage and it

et al., 1987b; Gimin et al., 2004).

has enough space available for growth in all the

A good correlation between DVM-APM was

dimensions. Optimum space availability and lesser food

observed between smaller size groups, 1-20 mm

requirement could be a possible reason for such type of

(r2 = 0.876, P > 0.05, n = 18) and 21-40 mm, (r2 = 0.802,

growth.

P > 0.05, n = 24) indicating comparable increase in the Harsh environmental conditions viz. atmospheric

growth rate of the two variables. Low regression value

and respiratory stress due to exposure during low tide,

for higher size groups could have been due to the

limited food availability (Bartol et al., 1999), water

investment of energy for tissue development or

temperature and turbidity (Pouvreau and Prasil, 2001),

reproductive maturity.

competition between foulers with oyster (Zhenxia et al., 2007), limited space for growth (Abraham et al., 2007), decrease in growth rate with age due to progressive

The the

present

correlation study

values

were

for

slightly

DVM-HL better

(highest

being r = 0.808, P = 0.001, n = 24, 21-40 mm) than that

Fig. 3 Month-wise average fouling load (±SE) on Pinctada margaritifera. Journal of Research in Biology (2014) 4(2): 1264-1275

1268

Jha and Mohan, 2014 Table 1. Estimates of biometric relationship between DVM and other shell parameters in different size groups of Pinctada margaritifera, along with the results of one-way ANOVA. Size Group (mm)

1-20

21-40

41-60

61-80

81-100

‘a’ Value

‘b’ value

r2 value

P value- S/NS

DVM- APM

0.848

0.878

0.876*

0.370 - NS

DVM-HL

1.547

0.793

0.550

0.180 - NS

DVM-THK

2.402

0.430

0.673*

< 0.001 - S

DVM-TWT

0.275

1.218

0.218

< 0.001 - S

DVM-APM

1.113

0.955

0.802*

0.120 - NS

DVM-HL

3.006

0.926

0.808*

0.001 - S

DVM-THK

3.113

0.402

0.673*

< 0.001 - S

DVM-TWT

0.304

2.236

0.304

0.110 - NS

DVM-APM

1.525

0.936

0.577*

0.002 - S

DVM-HL

3.664

0.666

0.523*

< 0.001 - S

DVM-THK

2.076

0.380

0.372

< 0.001 - S

DVM-TWT

0.144

3.015

0.725*

< 0.001 - S

DVM-APM

20.16

1.182

0.721*

< 0.001 - S

DVM-HL

1.911

0.554

0.378*

< 0.001 - S

DVM-THK

2.158

0.355

0.343*

< 0.001 - S

DVM-TWT

0.127

3.026

0.412*

< 0.001 - S

DVM-APM

48.46

0.351

0.210

0.001 - S

DVM-HL

30.68

0.191

0.101

< 0.001 - S

DVM-THK

12.82

0.148

0.106

< 0.001 - S

DVM-TWT

1.878

1.786

0.180

< 0.001 - S

Variables

N= Number of individuals, a= Slope, b= Intercept, r 2= Correlation coefficient, *Pearson’s correlation coefficient significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.

1269

Journal of Research in Biology (2014) 4(2): 1264-1275

Jha and Mohan, 2014 Table 2. Estimates of biometric relationship between ΔF and other shell parameters in different size groups of Pinctada margaritifera, along with the results of one-way ANOVA. Size Group (mm)

1-20

21-40

41-60

61-80

81-100

Variables

‘a’ Value

‘b’ value

r2 value

P value- S/NS

DVM - ΔF

0.019

2.032

0.293

<0.001- S

APM - ΔF

0.020

2.232

0.325

<0.001- S

HL - ΔF

0.029

1.592

0.292

<0.001- S

THK - ΔF

0.076

0.429

0.236

<0.001- S

TWT - ΔF

0.167

0.018

0.293

<0.001- S

DVM - ΔF

0.005

4.402

0.243

<0.001- S

APM - ΔF

0.030

2.938

0.142

<0.001- S

HL - ΔF

0.056

2.569

0.120

<0.001- S

THK - ΔF

0.786

2.196

0.190

<0.001- S

TWT - ΔF

0.235

0.111

0.331

<0.001- S

DVM - ΔF

0.012

3.649

0.300

<0.001- S

APM - ΔF

0.034

3.248

0.412

<0.001- S

HL - ΔF

0.646

1.890

0.211

<0.001- S

THK - ΔF

1.790

1.981

0.341

<0.001- S

TWT - ΔF

0.495

4.893

0.619*

<0.001- S

DVM - ΔF

0.031

3.035

0.088

<0.001- S

APM - ΔF

0.286

2.017

0.091

<0.001- S

HL - ΔF

1.214

1.61

0.063

0.002- S

THK - ΔF

5.468

0.924

0.029

<0.001- S

TWT - ΔF

0.150

7.487

0.066

<0.001- S

DVM - ΔF

7.363

1.940

0.046

<0.001- S

APM - ΔF

1.717

2.450

0.057

<0.001- S

HL - ΔF

10.81

0.134

0.038

<0.001- S

THK - ΔF

1.949

1.802

0.096

<0.001- S

TWT - ΔF

0.015

11.300

0.004

<0.001- S

N= Number of individuals, a= Slope, b= Intercept, r 2= Correlation coefficient, * Pearson’s correlation coefficient significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.

Journal of Research in Biology (2014) 4(2): 1264-1275

1270

Jha and Mohan, 2014 obtained by Abraham et al., 2007 (highest being 2

rate of increase in the individual TWT with respect to the

r = 0.31, n = 22, 36-55 mm) and the value (r = 0.79,

increase in individual DVM is not uniform amongst the

n = 106, 34.0-109.5 mm) obtained by Alagarswami

specimen belonging to the same size class.

(1983). The site of collection of specimen may also have

In the size group of 1-20 mm (r2 = 0.218,

an impact on this observation because oysters in the

P < 0.001, n = 18) and 21-40 mm (r2 = 0.304, P > 0.05,

present study were collected exclusively from intertidal

n = 24) the correlation between DVM-TWT was poor

area where they are attached to the crevices of rocks

indicating gonadal development might still be in the

having limited space for growth whereas in case of other

nascent stages accounting for slower rate of increase in

authors sub tidal and deep water specimens were also

their tissue weight (Chellam, 1987). However, good and

studied.

moderate correlation was observed in the size group The values obtained for coefficient of correlation

41-60 mm (r2 = 0.725, P < 0.001, n = 33) and 61-80 mm

between DVM-THK in the present study was moderate

(r2 = 0.412, P < 0.001, n = 52), respectively, indicating

for size range 1-20 mm (r2 = 0.673, P < 0.001, n = 18)

that the concentration of body energy was beginning to

and 21-40 mm (r = 0.673, P < 0.001, n = 24). But was 2

direct more towards tissue growth rather than shell

slightly lower (r = 0.372, P < 0.001, n = 33) for size

growth which finally concluded with low correlation

range 41-60mm) than those obtained by Abraham,

values in the 81-100 mm group (r2 = 0.180, P < 0.001,

(2007) (r2 = 0.82 for size range 36-55 mm). In larger

n = 24), where most of the body energy was directed

oysters, a poor correlation existed between DVM-THK

towards tissue growth indicated by a higher rate of

(r = 0.343, P < 0.001, n = 52 and r = 0.106, P < 0.001,

increase in TWT when the rate of increase of all the

n = 24 for 61-80 mm and 81-100 mm size group

other biometric parameters declined.

respectively). This could be explained by the report of

In the present study, the lower degree of

Sims (1993) which stated that, in the larger oysters the

correlation

between

DVM-TWT

compared

rate of increase of DVM becomes very slow and the

Alagarswami (1983), Friedman and Southgate (1999)

subsequent growth consists mainly of increase in shell

and Pouvreau (2000) who obtained very good correlation

thickness with continuous secretion of nacre throughout

between these two variables (r2 = 0.96, 0.86 and 0.97

its life.

respectively) could be due to the fact that in the other As the size range and total number of specimen

studies specimen were either cultured in farm (Friedman

in biometry study by other authors (34-109.5 mm,

and Southgate, 1999; Pouvreau, 2000a) or collected

n = 106, Alagarswami, 1983; 40.18-132.72 mm, n = 458,

mostly from sub tidal or deep waters (Alagarswami,

Abraham et al., 2007) were different from the present

1983; Abraham et al., 2007).

study (7.06-99.01 mm, n = 151) the correlation value

In those habitats isometric growth can take place

between shell dimensions also differed and only few size

due to less stress per unit area in terms of availability of

ranges could be compared.

food and space, protection from direct sunlight and

Length â&#x20AC;&#x201C;Weight Relationship

desiccation, predators, low turbidity and continuous

Similar to the observation of Abraham et al.,

oxygen supplies as opposed to the harsh intertidal

(2007), there was an increase in the average total weight

condition in this study.

with respect to increase in the average shell length

Shell Dimensions and Fouling Load

(Fig. 1). Hence, the low value of correlation between

Biofouling caused by the settlement of fouling

these two variables in the present study suggests that the

organisms on the shell surface adversely affects the

1271

Journal of Research in Biology (2014) 4(2): 1264-1275

Jha and Mohan, 2014 wellbeing of pearl oysters. It leads to retarded growth (Southgate

and

Beer,

2000),

deformation

9.9 g, n = 52) expressed in Fig. 1.

and

Occurrence of lesser ΔF in 81-100 mm size

deterioration of the shell (Taylor et al., 1997b; Doroudi,

group (12.8 ± 7.1 g, n = 24) as compared to its preceding

1996) and even mortality of the oyster in extreme cases

length group could be attributed to the attachment of

(Alagarswami and Chellam, 1976; Mohammad, 1976).

these specimens in area having oligotrophic waters with

Maximum fouling load observed during the

less fouling activity, lesser competition for available

month of September 2011 (27.8 ± 5.1 g) followed by

resources and lower risk of predators which could be the

February 2012 (19.5 ± 13.5 g) and June 2012 (15.0 ± 3.6

reason for their large size in the first place.

g) could be attributed to the settlement of heavy foulers

A poor correlation in general was observed

(weight-wise) such as predatory mussel, tube forming

between ΔF and other shell dimensions for all the size

polychaetes, barnacles, sponges and ascidians found to

groups except 41-60 mm (r2 = 0.619, P < 0.001, n = 33)

be dominant during these months. Such settlement may

in Table 2. The variation in the growth rate of shell and

have caused the increase in the fouling load (Dharmaraj

rate of fouling in different size groups could be the

1987a) and in turn might have influenced the recruitment

reason for their poor correlation.

of other foulers.

The Critical Size Group, 41-60 mm

Minimal

fouling

load

during

July

2012

Contrary to all the other size groups, 41-60 mm

(3.2 ± 3.7 g), November 2011 (4.6 ± 6.9 g) and

size group showed the best correlation between DVM-

December 2011 (4.7 ± 14.1 g) could be due to the fact

TWT with r2 corresponding to 0.725. However, the

that these months are peak period of spawning of the

correlation between other biometric dimensions was

above foulers, no attachment of heavy foulers occurred

moderate to low (Table 1). Amongst all the size classes,

during this period. Similar results were reported by

ΔF showed better correlation with other shell dimensions

Alagarswami and Chellam (1976), Dev and Muthuraman

in this size class (Table 2). The above observations

(1987) and Velayudhan (1988) in their studies on

suggest that the P. margaritifera of the intertidal regions

biofouling of Akoya pearl oyster Pinctada fucata.

of Andaman, attains initial sexual maturity in this size

Scardino et al., (2003) and Aji (2011) in their

group with the beginning of their gonad development

respective studies on pearl oysters reported that the rate

and complete reproductive development takes place as

of fouling is lower in the smaller oysters due to the

the oyster reaches 61-80 mm size group and becomes

presence of periostracum layer (a physical defence

fully mature. This justifies their increased tissue weight

against fouling) which wears off with aging in larger

and retarded growth of other shell dimensions with

oysters. An increase in the shell surface area also

respect to DVM (Fig. 2). The body energy at this stage

facilitates higher settlement of biofoulers (Mohammed,

gets distributed more towards tissue growth than shell

1998).

growth (Bayne and Newell, 1983; Dharmaraj, 1987b). This explains the lower values of fouling load in

Gervis and Sims (1992) also stated that full

size groups 1-20 mm (0.1 ± 0.1 g, n = 18) and 21-40 mm

maturity occurs in P. margaritifera in 2nd year at size

(1.0 ± 1.0 g, n = 24). Availability of more surface area

>70 mm. Pouvreau et al., (2000b) and Kimani and

for settlement of foulers and wearing off of the

Mavuti (2002) in their respective studies on black-lip

periostracum layer could be responsible for multifold

pearl oyster of French Polynesia and Kenya reported that

time increment in the fouling load in the size groups

the initial sexual maturity, corresponding to the smallest

41-60 mm (7.3 ± 5.3 g, n = 33) and 61-80 mm (14.9 ±

individual with mature gonads occur at the end of 1 st

Journal of Research in Biology (2014) 4(2): 1264-1275

1272

Jha and Mohan, 2014 year at size <40 mm. Chellam (1987) in his study on

its effect on their biometry. 3) It shall also throw some

Indian Pinctada fucata also reported that cultured oysters

light on the importance of these intertidal oysters in the

became sexually mature in 9 months (size <47 mm). This

pearl culture industry.

difference in size at sexual maturity of both the species in India is possible as P. margaritifera in comparison to P. fucata is a larger and late maturing species (Pouvreau et al., 2000b).

ACKNOWLEDGEMENT The authors are thankful to the Vice Chancellor, Pondicherry University for providing infrastructural

From the present study it can be concluded that,

support for this study at the Department of Ocean Studies

1) Smaller oysters show isometric growth pattern but in

and Marine Biology, Pondicherry University, Port Blair

larger oysters, allometry is observed as the rate of

campus. The first author is also obliged to the University

increase of biometric parameters vary with increasing

Grants Commission (UGC), New Delhi for providing

size range. 2) September, February and June months

financial aid in the form of Research Fellowship in

witness settlement of heavy foulers whereas fouling load

Science for Meritorious Student (RFSMS).

is minimal during the month of July, November and December, 3) Even though ﾎ認 did not show any significant correlation with the DVM, biofouling could also be a possible factor responsible for restricting the maximum size attained by these oysters or in extreme cases even mortality of the oyster by competing for resources required for their growth, 4) 41-60 mm size group is a critical stage in the life cycle of these specimen when sexual maturity initiates, 5) Harsh intertidal

environment

could

responsible

for

difference in growth pattern and also for confining most of the P. margaritifera from intertidal regions of Andaman, to the size group of 61-80 mm, 6) The intertidal P. margaritifera which are adapted to survive in tough environmental conditions would more easily acclimatize to a new environment such as in the case of suspended or raft culture, if transferred at an early stage, they could cross the 61-80 mm size range and become larger and thicker, a parameter favourable for pearl production. The present biometric study of P. margaritifera will be helpful in 1) Understanding the correlation existing between length and other shell dimensions of different size groups in intertidal rocky habitat and the factors responsible for it, 2) Observing the trend of biofouling on various size ranges of P. margaritifera and 1273

REFERENCES Abraham KJ, Libini CL, Basak R, Madhupal P, Kripa V, Velayudhan TS, Mohamed KS and Modayil MJ. 2007. Biometric relationships of the black-lip pearl oyster Pinctada margaritifera (Linnaeus, 1758) from the Andaman and Nicobar waters. Indian J Fish. 54(4):409415. Aji L. 2011. An overview of the method, management, problem and their solution in the pearl oyster (Pinctada margaritifera) culture. J Coast Develop., 14(3):181-190. Alagarswami K. 1991. Production of cultured pearls. ICAR, New Delhi.15-21. Alagarswami K. 1983. The black-lip pear oyster resource and pearl culture potential. In: Mariculture potential of Andaman and Nicobar Islands-An indicative survey (K. Alagarswami, Ed.). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 34:72-78. Alagarswami K. 1987. Pearl culture. Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 39:136 p. Alagarswami K and Chellam A. 1976. On fouling and boring organisms and mortality of pearl oysters in the farm at Veppalodai, Gulf of Mannar. Indian J Fish. 23 (1-2):10-22. Bartol IK, Mann R and Luckenbach M. 1999. Growth and mortality of oysters (Crassostrea virginica) on Journal of Research in Biology (2014) 4(2): 1264-1275

Jha and Mohan, 2014 constructed intertidal reefs: effects of tidal height and substrate level. J Expt Mar Boil Ecol., 237(2):157-184. Bayne BL and Newell RCA. 1983. Physiological energetics of marine molluscs. In: The Mollusca, Volume 4, Physiology, part 1 (eds: S. M. Saleuddin, Karl Milton Wilbur), Academic Press, London. p.407-515. Chellam A. 1987. Biology of pearl oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 39:13-20. Dev DS and Muthuraman AI. 1987. Observation on the biofouling in pearl oyster farm at Krusadai Island, Gulf of Mannar. In: National seminar on shellfish resources and farming sessions-II-IV (eds: Mahadevan S, Narasimham KA, Satya Narayana Rao K, Ameer Hamsa KMS and Muthiah P). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 42(2): 306 -310. Dharmaraj S, Chellam A and Velayudhan TS. 1987a. Biofouling, boring and predation of pearl oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin, p. 39: 92-97. Dharmaraj S, Kandasami D and Alagarswami K. 1987b. Some aspects of physiology of Indian pearl oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 39: 21-28. Doroudi MS. 1996. Infestation of pearl oysters by boring and fouling organisms in the northern Persian Gulf. Indian J. Mar. Sci., 25(2):168â&#x20AC;&#x201C;169. El-Sayed AEH, Razek FAA, Abou-Zaid MM and Taha SM. 2011. Measures of allometric growth of black -lip pearl oyster Pinctada margaritifera (Linnaeus, 1758) Red Sea, Egypt. Int J Zool Res., 7(2):201-211.

Islands. J Shellfish Res., 18:451-458. Gervis MH and Sims NA. 1992. The biology and culture of pearl oysters (Bivalvia: Pteriidae). Manila (Philippines). ICLARM Stud. Rev., 21:1-49. Gimin R, Mohan R, Thinh LV and Griffiths AD. 2004. The relationship of shell dimensions and shell volume to live weight and soft tissue weight in the mangrove clam, Polymesoda erosa (Solander, 1786) from Northern Australia. NAGA, World Fish Center Quarterly. 27(3 and 4): 32-35. Hynd JS. 1955. A revision of Australian pearl- shells, genus Pinctada (Lamelli-branchia). Aust J Mar Freshwater Res., 6(1):98-138. Kimani EN and Mavuti KM. 2002. Abundance and population structure of the black-lip pearl oyster, Pinctada margaritifera L. 1758 (Bivalvia: Pteriidae), in coastal Kenya. Western Indian Ocean J Mar Sci., 1(2):169-179. Kripa V, Abraham KJ, Libini CL, Velayudhan TS, Radhakrishnan P, Mohamed KS and Modayil MJ. 2008. Production of designer Mabe Pearls in the blacklipped pearl oyster, Pinctada margaritifera, and the winged pearl oyster, Pteria penguin, from Andaman and Nicobar Islands, India. J World Aquacult Soc., 39(1):131 -137. Mohamed KS, Kripa V, Velayudhan TS and Appukuttan KK. 2006. Growth and biometric relationships of the pearl oyster Pinctada fucata (Gould) on transplanting from the Gulf of Mannar to the Arabian sea. Aquaculture Research. 37(7):725-741. Mohammad MBM. 1976. Relationship between biofouling and growth of the pearl oyster Pinctada fucata (Gould) in Kuwait, Arabian Gulf. Hydrobiologia. 51(2):129-138.

Fletcher W, Friedman K, Weir V, McCrea J and Clark R. 2006. Pearl oyster fishery. Department of Fisheries, Western Australia.

Mohammed SZ. 1998. On the epifouling of pearl oyster (Pinctada radiata) in Qatari water Arabian Gulf and its influence on the flesh growth. Egyptain J Aquat Biol and Fish. 2(2):73-85.

Friedman KJ and Southgate PC. 1999. Grow-out of black-lip pearl oysters, Pinctada margaritifera (Linnaeus 1758) on chaplets in suspended culture in Solomon

Moullac GL, Tiapari J, Teissier H, Martinez E and Cochard JC. 2012. Growth and gonad development of the tropical black-lip pearl oyster, Pinctada

Journal of Research in Biology (2014) 4(2): 1264-1275

1274

Jha and Mohan, 2014 margaritifera (L.), in the Gambier archipelago (French Polynesia). Aquac Internat. 20(2): 305-315.

maxima (Jameson), held in suspended nursery culture. Aquaculture. 153(1-2): 41-49.

Pit JH and Southgate PC. 2003. Fouling and predation; how do they affect growth and survival of the black-lip pearl oyster, Pinctada margaritifera, during nursery culture? Aquac Internat. 11(6): 545 555.

Velayudhan TS. 1988. Studies on the settlement of barnacles at different depths in the pearl oyster farm at Tuticorin. In: National seminar on shellfish resources and farming sessions-II-IV (eds: Mahadevan S, Narasimham KA, Satya Narayana Rao K, Ameer Hamsa KMS and Muthiah P). Bulletin of Central Marine Fisheries Research Institute, CMFRI, Cochin. 42(2): 301-305.

Pouvreau S, Gangnery A, Tiapari J, Lagarde F, Garnier M and Bodoy A. 2000b. Gametogenic cycle and reproductive effort of the tropical black- lip pearl oyster, Pinctada margaritifera (Bivalvia: Pteriidae), cultivated in Takapoto atoll (French Polynesia). Aquat Living Resour., 13(1): 37-48. Pouvreau S and Prasil V. 2001. Growth of the black-lip pearl oyster, Pinctada margaritifera, at nine culture sites of French Polynesia: synthesis of several sampling designs conducted between 1994 and 1999. Aquat Living Resour., 14(3): 155-163.

Zhenxia SU, Yan Y and Liangmin H. 2007. Effect of Fouling on Feeding, Oxygen Consumption and Waste Excretion of Pearl Oyster Pinctada martensii in Daya Bay Cultivation. Mar Sci Bull., 9(2): 34-42.

Pouvreau S, Tiapari J, Gangnery A, Lagarde F, Garnier M, Teissier H, Haumani G, Buestel D and Bodoy A. 2000a. Growth of the black-lip pearl oyster, Pinctada margaritifera, in suspended culture under hydrobiological conditions of Takapoto lagoon (French Polynesia). Aquaculture. 184(1-2):133-154. Saville-Kent W. 1893. The great barrier reef of Australia: its products and potentialities, W.H. Allen and Co., London, p. 204-224. Scardino A, Nys RD, Ison O, Connor WO and Steinberg P. 2003. Microtopography and antifouling properties of the shell surface of the bivalve molluscs Mytilus galloprovincialis and Pinctada imbricata. Biofouling. 19(Supplement 1): 221-230. Sims NA. 1993. Size, age and growth of the black-lip pearl oyster, Pinctada margaritifera (L.) (Bivalvia: Pteriidae). J Shellfish Res., 12:223-228. Southgate PC and Beer A. 2000. Growth of black-lip pearl oyster (Pinctada margaritifera) juveniles using different nursery culture techniques. Aquaculture. 187 (1-2): 97-104. Taylor JJ, Rose RA, Southgate PC and Taylor CE. 1997. Effects of stocking density on growth and survival of early juvenile silver-lip pearl oysters, Pinctada 1275

Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

Journal of Research in Biology (2014) 4(2): 1264-1275

Journal of Research in Biology

ISSN No: Print: 2231 â&#x20AC;&#x201C; 6280; Online: 2231 - 6299.

An International Scientific Research Journal

Original Research

Journal of Research in Biology

Genetics characterization, nutritional and phytochemicals potential of gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a candidate of poultry feed Authors: Jet S Mandey1*, Hendrawan Soetanto2, Osfar Sjofjan2 and Bernat Tulung1.

Institution: 1. Animal Husbandry Faculty, Sam Ratulangi University, Manado, The North Sulawesi, Indonesia . 2. Animal Nutrition Department, Animal Husbandry Faculty, Brawijaya University, Malang, The East Java, Indonesia.

Corresponding author: Jet S Mandey.

Email Id:

Web Address: http://jresearchbiology.com/ documents/RA0429.pdf.

ABSTRACT: Gedi, local name of Abelmoschus manihot (L.) Medik was used by local people in Northern Sulawesi-Indonesia as vegetable, because of its medicinal properties. The potency of gedi leaves in broiler diet has not been reported in literatures. The objective of this research was to investigate a genetic diversity of gedi commonly consumed as a gourmet cuisine in the North Sulawesi of Indonesia, and exploring the potential of this plant as a herb plant for a candidate of poultry feedstuff. Eight morphologically different gedi leaves (GH1, GH2, GH3, GH4, GH5, GH6, GM1 and GM2) that grow in Manado area, North Sulawesi of Indonesia were collected and identified. The leaves were extracted for DNA isolation followed by PCR and DNA sequencing analysis. During DNA isolation, 3 of 6 GH (GH4, GH5, GH6) were discontinued because of difficulty in separating the mucilage properties. Following PCR analysis, GH2 and GH3 did not produce bands and consequently were excluded from further analysis. In addition to that, chemical analysis was also performed to determine the phytochemical and nutritional contents .The results indicated that all gedi leaf samples showed similarity (99%) to species member of Abelmoschus manihot, and tribe of Malvaceae. In terms of proximate analysis, gedi leaves showed high crude protein (18.76 - 24.16%) and calcium (2.92-3.70%) content. Also, showed high crude fibre (13.06-17.53%). Together with the presence of alkaloid and steroidal saponin gedi leaves may offer beneficial effects as poultry feedstuff to a special production trait such as cholesterol-less meat. Keywords: Abelmoschus manihot, phytochemical constituents.

genetic

characterization,

nutritional

analysis,

Article Citation: Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung. Genetics characterization, nutritional and phytochemicals potential of gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a candidate of poultry feed. Journal of Research in Biology (2014) 4(2): 1276-1286 Dates: Received: 06 Mar 2014

Accepted: 22 Mar 2014

Published: 19 May 2014

1276-1286 | JRB | 2014 | Vol 4 | No 2

www.jresearchbiology.com

Mandey et al., 2014 information of Abelmoschus manihot derived from the

INTRODUCTION Abelmoschus manihot (L.) Medik is

a native

plant which is 1.2 – 1.8 m height and is widely

studies carried out in the polynesian pacific regions (Preston, 1998).

distributed in the tropical regions. This plant has various

Gedi as a culinary herb and medicinal herb may

local names such as aibika. It was hypothesized that the

have beneficial effects in animals. The phytochemical

origin of this plant from the survey of literature the local

and nutritional compounds of leaf material may affect to

names of Abelmoschus manihot (L.) Medik varies and

poultry health and productivity. Cross

the data available were largely derived from studies

reported that culinary herbs in diets affect chick

carried out in the polynesian-pacific regions (Preston,

performance, gut health and endogenous secretions.

1998). In North Sulawesi of Indonesia this plant is called

Al-Sultan and Gameel (2004) suggests that feeding

“gedi” and its leaves provide essential ingredient for

Curcuma longa (turmeric) to chicken through diet can

cooking porridge as a special gourmet food among the

induce hepatic changes and that these changes are not

North Sulawesi cuisine. According

to Jain and Bari

dose or time dependent. Windisch et al., (2008) cited

(2010), gedi leaves contain polysaccharides and protein

several research, i.e. that phytogenic product also

containing mucilage (gum) that enables the porridge to

reduced activities of intestinal and fecal urease enzyme

have a special viscosity. Morphologically, gedi plants

in broilers.

vary in shape, color and other properties regardless of geographical

differences

suggesting

some

genetic

variation may occur after a long period of adaptation.

et al., (2007)

Ashayerizadeh et al., (2009) reported that garlic powder and turmeric powder in diet significantly reduced abdominal fat percent, LDL and VLDL concentration in

Gedi plants have been reported to posses

serum of broiler. Moreover, Yang et al., (2003) reported

medicinal properties that may benefit to human health.

that green tea by product affect the reduction of body

Puel et al., (2005) reported that the female wistar rat

weight gain and meat cholesterol in broilers. Khatun

which feeding 15 % of gedi leaves prevent osteopenia

et al., (2010) observed using in vitro model that viscous

that was attributable to the calcium content of gedi

water-soluble portion of the fruit of Abelmoschus

leaves. Other authors, Jain et al., (2009) reported that

esculentus (L.) Moench has significant capacity to

woody stem of gedi plant contain stigmasterol and

reduce the glucose diffusion form the dietary fiber-

γ-sitosterol, and also contain isoquercitrin, hyperoside,

glucose systems.

hibifolin, quercetin and isohamnetin that have anti

The study was undertaken to investigate the

consulvant and anti depressant-like activity (Guo et al.,

compositional characterization of gedi. The samples

2011; Wang et al., 1981; Wang et al., 2004). Gedi leaves

were an alysed for the molecular characterization and

have active pharmacological properties against analgesic

identification, the proximate composition of the leaf part,

effect (Jain et al., 2011). Sarwar et al., (2011) stated that

energy content and the phytochemical composition, in

Abelmoschus manihot has a profound anti-inflammatory

order to get some useful information to be used in the

and anti-diabetic effect. From these reports it can be

preparation of poultry feed. Because there are no major

concluded that gedi plants posses

reports in the literature, this would be an information for

herbal medicine

properties that can be used to manipulate the human and

the detailed utilization of gedi to poultry feed.

animal health. In spite of its phytopharmaceutical benefits there is paucity in information dealing with genetic diversity of gedi plant in Indonesia. Most 1277

Journal of Research in Biology (2014) 4(2): 1276-1286

Mandey et al., 2014 MATERIAL AND METHODS

were initially screened for amplification in PCR, they are

Plant Identification

Primer ndhF-F1 with product description 5’-GAA-TAT-

Eight accessions of gedi (Abelmoschus manihot)

GCA-TGG-ATC-ATA-CC-3’ (length 20) dan primer

collected from Manado, the North Sulawesi, Indonesia

ndhF-R1318 with product description 5’-CGA-AAC-

were used for this study. Herbarium specimens were

ATA-TAA-AAT-GCR-GTT-AAT-CC-3’ (length 26).

identified for plant species at the Research Center for

PCR conditions were pre-hot 94°C (5 minutes),

Biology, Indonesian Institute of Sciences, Bogor,

denaturation 94°C (45 seconds), annealing 54°C (45

Indonesia.

seconds), primerization 72°C (1 minute 30 seconds) in

DNA extraction, quantification, and sequencing

35 cycles and hold at 72°C (5 minutes). All PCR

DNA was extracted from 80-100 mg of fresh leaf

products were separated by electrophoresis in 1%

tissue from each of the 5 randomly selected samples

agarose gel in 1 x TBE ran for 2 hours followed by

using a protocol of AxyPrep Multisource Genomic DNA

ethidium bromide staining (5 µg ethidium bromide/ml).

Miniprep

Biosciences,

The gel was then stained and rinsed in water for about 10

www.axygenbio.com). Three samples were scored as

minutes, and after that visualized under UV-light in trans

missing because of unable to isolate the mucilage. The

-illuminator.

final

DNA

Kit

(Axygen

supernatant

were

diluted

for

DNA

All PCR products were sequenced. Sequence

quantifications with PCR technique. PCR analysis were

data were identified at First Base Laboratories Sdn, Bhd

performed using a Thermocycler machine, and in 50 µl

(1st base), Taman Serdang Perdana, Selangor, Malaysia.

reaction mixture containing 2 µl template of DNA, 2 x

Sequences were aligned using BLAST programme, and

master Mix Vivantis 25 µl (Vi Buffer A 1 x; Taq

the building of a phylogenetic tree was established by

Polimerase 1,25 unit), Primer F1 (10 pmol/µl) 1 µl (0,2

Bioedit

mM), Primer R1318 (10 pmol/µl) 1 µl (0,2 mM), MgCl 2

megasoftware.net).

(50 mM) 1,5 µl (3 mM dNTPs 0,4 mM), H2O 20,5 µl,

Phytochemical Screening

sample 1 µl.Initial trial was run on 5 samples and Taq quantity was Taq Polimerase 1,25 unit. Two primers

7.19

and

Mega

programme

(http://

Chemical tests were carried out to evaluate the presence of the phytochemicals

such as alkaloids,

Table 1: Identification/Determination of Gedi Leaves from Manado, North Sulawesi No

Place of Collection

Species

Tribe

(1) (GH4)

Abelmoschus manihot (L.) Medik

Malvaceae

(2) (GH5)

Abelmoschus manihot (L.) Medik

Malvaceae

(3) (GH2)

Abelmoschus manihot (L.) Medik

Malvaceae

(4) (GM2)

Abelmoschus manihot (L.) Medik

Malvaceae

(6) (GH3)

Abelmoschus manihot (L.) Medik

Malvaceae

(8) (GM1)

Abelmoschus manihot (L.) Medik

Malvaceae

(9) (GH1)

Abelmoschus manihot (L.) Medik

Malvaceae

(11) (GH6)

Abelmoschus manihot (L.) Medik

Malvaceae

Notes: GH = green leaf; GM = reddish green leaf; GH1= Bumi Nyiur; GH2 = Wanea; GH3 = Bumi Beringin; GH4 = Teling; GH5 = Bahu; GH6 = Kleak; GM1 = Tingkulu; GM2 = Wanea. Journal of Research in Biology (2014) 4(2): 1276-1286

1278

Mandey et al., 2014 flavonoids, saponins, tannins, triterpenoids/steroids, and

Test for phenolic

hydroquinone in five selected samples; using standard

Approximately 5 g powder was shaken and then

procedures described by Harborne (1987), and one of the

heated to boil and filtered. For testing the presence of

five samples was performed for total flavonoid analysis.

flavonoids, filtrate was added with Mg powder,

Test for alkaloids

HCl:EtOH (1:1) and amyl alcohol. A yellow solution that

One gram of sample was homogenized, added

turned colorless within few minutes indicated the

with chloroform and then with 3 ml of ammonia.

presence flavonoids. For the evaluation of saponins,

Chloroform fraction was separated and acidified using

filtrate was shaken with distilled water. The presence of

H2SO4 2M for two minutes. The filtrate was separated

saponins was indicated by the appearance of bubbles. For

and added with few drops of Mayer, Wagner, and

the evaluation of tannins availability, filtrate was added

Dragendorffâ&#x20AC;&#x2122;s reagent. The sample was contained

with three drops of FeCl3 10%. The dark green solution

alkaloid if produced white sediment using Mayer

indicated the presence of tannins.

reagent, orange sediment using Dragendorff reagent, and

Test for steroids/triterpenoids

brown sediment using Wagner reagent.

Four grams of sample were added with 2 ml hot ethanol. Filtered and heated, and homogenized with 1 ml

Table 2: Nutrients composition and energy values of gedi leaf (dry weight basis) Types of Gedi Nutrients GH1

GH2

GH3

GM1

GM2

Dry Matter (%)

81.72

87.33

87.14

86.70

84.76

Ash (%)

11.78

13.22

11.45

12.29

14.27

Crude Protein (%)

20.18

18.76

19.89

22.62

24.16

Crude Fiber (%)

17.53

14.37

15.68

14.37

13.06

1.06

3.80

2.96

1.63

4.51

31.17

37.18

37.16

35.79

28.76

Ca (%)

3.29

3.70

2.92

3.33

3.36

P (%)

0.39

0.50

0.55

0.48

0.85

GE (Kkal/kg)

3419

3859

3850

3654

3699

NDF

20.78

21.72

25.02

34.09

23.51

ADF

18.44

19.11

16.23

20.10

17.30

2.34

2.61

8.79

13.99

6.21

11.39

15.25

11.02

5.50

10.62

Lignin

5.88

3.02

4.54

13.17

6.50

Silica

1.15

0.84

0.66

1.18

0.16

Crude Fat (%) N-free extract (%)

Component of Fiber (%):

Hemicellulose Cellulose

Notes: GH = green leaf; GM = reddish green leaf 1279

Journal of Research in Biology (2014) 4(2): 1276-1286

Mandey et al., 2014

GH1

GH2

GH3

GH4

GH5

GH6

GM1

GM2

Figure 1: Eight accessions of gedi leaf collected from Manado, North Sulawesi. GH1= Bumi Nyiur area, GH2 = Wanea area, GH3 = Bumi Beringin area, GH4 = Teling area, GH5 = Bahu area, GH6 = Kleak area, GM1 = Tingkulu area, GM2 = Wanea area

Journal of Research in Biology (2014) 4(2): 1276-1286

1280

Mandey et al., 2014 diethyl ether. It is added with one drop of H 2SO4 and one

plant identification of eight accessions of gedi leaf were

drop of CH3COOH anhydrate. The presence of steroids

summarized in Table 1. Those have been recognized that

was indicated by the alteration of violet to blue or green

all of eight accessions of gedi leaf in this research were

color. The formation of reddish violet color to the

species of Abelmoschus manihot (L.) Medik, tribe

interface was formed that indicating positive sign for

Malvaceae. Breen (2012) reported that leaves are often

triterpenoids.

the basis for identifying plants since they are so easily

Test for hydroquinons

observed.

One gram sample was boiled with methanol for

The boundaries of the eight accessions of gedi

few minutes. The filtrate was allowed to cool and then

from the different locations of Manado area were based

added with 3 drops of NaOH 10%. The appearance of

red color indicated the presence of hydroquinone.

phylogenetic hypotheses were tested using chloroplast

Nutritional Analysis

DNA sequence of ndhF. Total genomic DNA were

The proximate analysis were carried out in duplicates and the results obtained were the average

morphological

features

the

species.

The

extracted from eight accessions of fresh leaf material, and the ndhF gene was amplified in PCR using primer.

values. The proximate analysis (protein, crude fiber,

In this research, DNA fragments of the expected

crude fat, carbohydrate and ash) of five types of gedi leaf

size were amplified from five samples to obtain the

were determined by using the Association of Official of

isolation

Analytical Chemists (AOAC) methods (1980). Nutrient

at Figure 2. Based on DNA fragments, according to their

contents were valued in percentage. The energy value

molecular weights those products indicated that there

was determined by bomb calorie meter.

were no different chloroplast type of gedi leaf color

product

electrophoresis,

shown

characteristics between green leaf (GH) and reddish RESULTS AND DISCUSSION

green leaf (GM) with bands of 1.3 kb (Figure 2).

Plant Identification

Moreover, profile (external shape) of gedi leaf from the

Two typical colors of gedi leaves (green and

two color types were analysed as shown in Figure 2. Two

reddish green leaves) growing at eight locations in

samples of reddish green leaf (GM) and one sample of

Manado area were presented in Figure 1. All leaves of

green leaf (GH) were used in the analysis of gedi leaf

this plant do not have the same size or even appearance.

profile (Figure 3).

They vary in size, color, and even shape. The results of

Figure 2: Electrophoresis of 5 samples of gedi leaf isolation product 1281

Figure 3: PCR amplification and electrophoresis product for profiles of gedi leaf obtained from 3 samples

Journal of Research in Biology (2014) 4(2): 1276-1286

Mandey et al., 2014 > gb|AF384639.1| Abelmoschus manihot NADH dehydrogenase component NdhF (ndhF)gene, partial cds; chloroplast gene for chloroplast product Length=1257 Score = 2242 bits (1214), Expect = 0.0 Identities = 1223/1229 (99%), Gaps = 2/1229 (0%) Strand=Plus/Plus Query 29 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 88 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 60 Query 89 TTGTTAAGTATAGTTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 148 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TTGTTAAGTATAGNTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 120 Query 149 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGTTTGGC 208 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 121 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGNTTGGC 180 Query 209 TACTTTATTGATTCACTTACCTCTATTATGTCAATATTAATCACTACTGTTGGAATTTTT 268 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 181 TACTTTATTGATTCACTTACCTCTATTATGNCAATATTAATCACTACTGTTGGAATTTTT 240 Query 269 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 328 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 300 Query 329 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 388 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 360 Query 389 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 448 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 420 Query 449 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 508 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 480 Query 509 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 568 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 540 Query 569 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 628 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 541 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 600 Query 629 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 688 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 601 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 660 Query 689 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 748 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 661 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 720 Query 749 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 808 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Journal of Research in Biology (2014) 4(2): 1276-1286

1282

Mandey et al., 2014 Sbjct 721 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 780 Query 809 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 868 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 781 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 840 Query 869 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 928 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 841 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 900 Query 929 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 988 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 901 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 960 Query 989 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1048 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 961 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1020 Query 1049 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1108 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1021 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1080 Query 1109 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1168 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1081 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1140 Query 1169 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGTTGGCTG 1228 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1141 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGNTGGCTG 1200 Query 1229 TATTCACCGATTT--GCAATAATAGCTTG 1255 ||||||||||||| |||||||||||||| Sbjct 1201 TATTCACCGATTTTTGCAATAATAGCTTG 1229

Figure 4: DNA Sequence Alignment with BLAST Method Based on DNA bands, the gedi leaf color type of

Abelmoschus manihot (L.) Medik, tribe Malvaceae, and

GH and GM had the same positions of bands of 1.3 bp

the sample GH1 was 96% similar to Abelmoschus

indicating the similar profiles. By sequencing the PCR

manihot.(L.) Medik.

product, additional useful taxonomic and genome

Nutritional Analysis

information were successfully obtained from three

The proximate concentration of five samples of

samples. The ndhF data sets have aligned lengths

gedi were expressed on dry basis listed in Table 2. The

of 1257 bases, and the sequence data were shown in

proximate analysis showed that the gedi leaves contained

Figure 4.

ash (11.45-14.27%), crude protein (18.76-24.16%), crude

Comparisons were done with a few selected

fibre (13.06-17.53%), crude fat (1.06-4.51), N-free

DNA sequences, using closest relationship in a BLAST

extract (28.76-37.18%) and gross energy (3419-3859

search. Analysis showed that this sequence was very

Kkal/kg), and minerals were calcium (2.92-3.70%) and

similar to Abelmoschus manihot (L.) Medik (99%), as

phosphorous (0.39-0.85%). In terms of proximate

shown in Figure 4. The phylogenetic analysis was done

analysis, gedi leaves showed high crude protein (18.76 -

based on ndhF sequences from each of the available

24.16 %) and calcium (2.92-3.70%) content. Also, it

three sample accessions of gedi (Figure 5). The three

showed high crude fiber (13.06-17.53%). In addition, the

samples were clearly obtained asa member of the species

component of fiber were NDF (20.78-34.09), ADF

1283

Journal of Research in Biology (2014) 4(2): 1276-1286

Mandey et al., 2014 Table 3: Phytochemical screening of gedi leaf Qualitative Phytochemicals

Quantitative (%) (w/w) (n=3)

Reddish green

Green GH1

GH2

GH3

GM1

GM2

Wagner

Meyer

Dragendorf

Hidroquinon

Tannin

Flavonoid

Saponin

Steroid

+++

Alkaloid

Triterpenoid

GH1

0.48

Notes: - = nothing; + = weak positive; ++ = positive; +++ = strong positive (16.23-20.10%), hemicellulose (2.34-13.99%), cellulose

depicted that all samples had rich steroid but had no

(5.50-15.25%), lignin (3.02-13.17%), and silica (0.16-

tannin. Four samples contained saponin and flavonoid,

1.18%). Prasad, et al., (2010) reported that

the

while three samples contained alkaloid. The result of this

biological effects of estimated proximate components

study indicated that Abelmoschus manihot (L.) Medik

(moisture, protein, fiber, fat, ash, and energy) in living

from Manado

system

phychemical steroid, flavonoid and saponin.

strongly

depend

their

concentration.

good

alternative

source

Therefore, it should be carefully controlled when herbs

The phytochemical steroid was detected in all

are used as food component. Energy and nutrient values

types of gedi leaf, and this phytochemical was found in

of herb plant samples are mainly used to translate herb

maximum content. Alkaloids were detected with Wagner

samples intakes as intakes of food components.The result

reagent only in green leaves GH1, GH2, and GH3.

of this study indicated that Abelmoschus manihot (L.)

Flavonoids were found at the adequate amount in green

Medik from The North Sulawesi

might be the best

leaf GH1 and GH2 while flavonoids in reddish green leaf

alternative source of nutrient. High protein and fiber

were at the minimum amount. Quantification of total

obtained in this study confirms that Abelmoschus

phenolic content from sample GH1 showed its phenolic

manihot can be used as good alternative source of protein

content as 0.48% (w/w). The results suggested that all

and crude fiber.

samples of gedi had the potential in steroid, flavonoid

These results recommended high rank for the

and saponin, and free of anti nutritional tannin.

leaves of Abelmoschus manihot as the best in terms of

Flavonoids had been reported in rat brain, and might

essential nutrients composition if compared with those of

represent

other edible leaves in the literature.

A. manihot and contributed to its anticonsulvant and anti

the

potential

bioactive

component

The results of phytochemical screening of five

depressant-like activity in vivo (Guo et al., 2011). Jain

types of gedi leaf were summarized in Table 3. Result

et al., (2011) reported that the phytochemical analysis

Journal of Research in Biology (2014) 4(2): 1276-1286

1284

Mandey et al., 2014 who rely upon them as poultry feed or supplements to poultry diet. The next step is to assess the bioavailability of the essential nutrients and phytochemicals in these plants. Further study have to focus on the digestibility of protein, fibre, and lipid, and phytochemicals. REFERENCES Association of Official of Analytical Chemist (AOAC). 1980. Official methods of analysis of the Association of Official Analytical Chemists. 13th Ed. Washington DC., USA. Al-Sultan SI and Gameel AA. 2004. Histopathological changes in the livers of broiler chicken supplemented with Turmeric (Curcuma longa).Intern. J. of Poult. Sci., 3(5):333-336. Ashayerizadeh O, Dastar B, Shams Shargh M, Rahmatnejad E and Ashayerizadeh A. 2009. Influence of prebiotic and two herbal additives on interior organs and hematological indices of broilers. J. of Animal and Veterinary Advances. 8(9):1851-1855.

Figure 5: The phylogenetic tree of gedi leaves based on ndhF-gen with Kimura-2 model parameter. Data on the branch are bootstrap maximum likelihood values showed the presence of steroids, triterpenoids and flavonoids in petroleum ether and methanol extract, respectively which possesses analgesic, antioxidant and anti-inflammatory activity. Saponins that were steroid or triterpenoid glycosides are important in animal nutrition. Some saponins increase the permeability of intestinal mucosal cells in vitro, inhibit active mucosal transport and facilitate uptake of substances that are normally not absorbed (Francis et al., 2002). CONCLUSION The characterization, nutritional analysis and phytochemical analysis of Abelmoschus manihot leaf by genetical and chemical analysis recommended

the

Breen P. 2012. Plant Identification: Examining Leaves. Orego n Sta te Un iver sit y Dep art men t o f Horticulture.http://oregonstate.edu/dept/Idplants/PlantID -leaves.htm. Cross DE, McDevitt RM, Hillman K and Acamovic T. 2007. The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. British Poult. Sci., 48(4):496-506.URL:http:// mc.manuscriptcentral.co./cbps. Francis G, Kerem Z, Makkar HPS, Becker K. 2002. The biological action of saponins in animal systems: a review. British J. of Nutrition. 88(6):587-605. DOI: 10.1079/BJN2002725. Guo J, Xue C, Duan Jin-ao, Qian D, Tang Y and You Y. 2011. Anticonvulsant, antidepressant-like activity of Abelmoschus manihot ethanol extract and its potential active components in vivo. Phytomedicine: Intern. J. of Phytotherapy & Phytopharmacology. 18(14):1250-1254.DOI: 10.1016/ j. phymed. 2011.06.012.

potential value of these feedstuff to those populations 1285

Journal of Research in Biology (2014) 4(2): 1276-1286

Mandey et al., 2014 Harborne JB. 1987. Metode Fitokimia, Penuntun Cara Modern Menganalisis Tumbuhan.Translater: Padmawinata K dan I. Sudiro I. Institut Teknologi Bandung, Bandung. Jain PS, Bari SB and Surana SJ. 2009. Isolation of stigmasterol and Ă˝-sitosterol from petroleum ether extract of woody stem of Abelmoschus manihot.Asian J. of Biological Sci. 2(4):112-117, from http:// www.scialert.net/qdirect.php?/ doi=ajbs.2009.112.117&linkid=pdf. Jain PS and Bari SB. 2010. Anti-inflammatory activity of Abelmoschus manihot extracts. Intern. J. ofPharmacology. 6 (4):505-509. http://www.scialert.net/ qdirect.php?.doi=ijp. 2010.505.509&linkid=pdf. Jain PS, Todarwal AA.Bari SB, Sanjay JS. 2011.. Analgesic activity of Abelmoschus manihot extracts. Intern. J. of Pharmacology. 7(6):716-720.http:// w w w . s c i a l e r t . n e t / f u l l t e x t / ? doi=ijp.2011.716.720&org=11.

Wang XR, Wang ZQ, Li Y. 1981. Studies on the chemical constituents of Abelmoschus manihot L. Medic. Acta Bot. Sin., 23(3):222-227. Wang XR, Zhou ZH, Du AQ, Huang ZM. 2004. Studies on the flavonol constituents of Abelmoschusmanihot L. Medic. Chin. J. Nat. Med., 2(2):91-93. Windisch W, Schedle K, Plitzner C, Kroismayr A. 2008. Use of phytogenic products as feed additives for swine and poultry. J. of Animal Sci.86(14Suppl.):E140E 1 4 8 . h t t p : / / w w w. j o u r n a l o f a n i m a l s c i e n c e . o r g / content/86/14Suppl/E140. Yang CJ, Yang IY, Oh DH, Bae IH, Cho SG, Kong IG, Uuganbayar D , Nou IS, Choi KS. 2003. Effect of green tea by-product on performance and body composition in broiler chicks. Asian-Australian J. of Anim. Sci., 16(6):867-872. From http://www.ajas.info/ Editor/manuscript/upload/16_128.pdf.

Khatun MH, Rahman MA, Biswas M, Ul Islam MA. 2010. In vitro study of the effects of viscous soluble dietary fibers of Abelmoschus esculentus L in lowering intestinal glucose absorption. Bangladesh Pharmaceutical J., 13(2):35-40. Prasad K, Janve B, Sharma RK, Prasad KK. 2010. Compositional characterization of traditional medicinal plants: Chemo-metric approach. Archives of Applied Sci. Research. 2(5):1-10. Preston SR. 1998. Aibika/Bele. Abelmoschus manihot (L.) Medik. International Plant Genetic Resources Institute. Rome, Italy.97 pages. Puel C, Mathey J, Kati-Coulibaly S, Davicco MJ, Lebecque P, Chanteranne B, Horcajada MN, Coxam V. 2005. Preventive effect of Abelmoschus manihot (L.) Medik. on bone loss in the ovariectomised rats. J. Ethnobotanical. 99(1):55-60. Sarwar M, Attitallia IH, Abdollahi M. 2011. A review on the recent advances in pharmacological studies on medicinal plants; animal studies are done but clinical studies needs completing. Asian J. of Animal and Veterinary Advances. 6(8):867-883.

Journal of Research in Biology (2014) 4(2): 1276-1286

Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

1286

Journal of Research in Biology

ISSN No: Print: 2231 â&#x20AC;&#x201C; 6280; Online: 2231 - 6299

An International Scientific Research Journal

Original Research

Journal of Research in Biology

The growth performance of Clarias gariepinus fries raised in varying coloured receptacles. Authors: Ekokotu Paterson1 Adogbaji and Nwachi Oster Francis2.

Institution: Department of Fisheries, Delta State University, Asaba Campus, Nigeria.

ABSTRACT: This study was conducted to access the effect of various background colors of cultured vessel on growth performance and response in the production of Clarias gariepinus fry. A total of two female (800 g) and one male (1 kg) of test fish was used. During the eight weeks of the experimental period, the C. gariepinus fry were reared in three tanks in duplicates with different background colors (green, blue and white). Body weight and total length of C. gariepinus were recorded for the eight weeks and mean variance of the collected data were analyzed for significant difference. Mean weight and Mean length values were separated using Duncan multiple range test (DMRTS). Background color did not significantly affect the growth performance of C. gariepinus fry. The length and weight of the sample were measured weekly. Data collected were used to determine the specific growth rate. at week one green tank was 0.19 g with a length of 1.02 cm with a survival rate, mean weight and length of 86%, 0.56 g and 4.26 cm, blue tank was 0.14 g with a length of 1.02 cm with a survival rate, mean weight and length of 84%, 0.64 g and 4.38 cm and white tank 0.16 g with a length of 1.02 with a survival rate, mean weight and length of 82%, 0.53 g and 3.38 cm and general hatchability rate 82% respectively. At the final week (8) of the experiment blue tank had the highest weight and length 0.78 g and 5.9 cm respectively while green tank has 0.74 g and 5.2 cm, white tank has the least 0.69 g and 4.4 cm at a significant difference of 0.05.

Corresponding author: Nwachi Oster Francis.

Keywords: Receptacle, growth coloured, cultured, vessel and Clarias gariepinus.

Email Id: fish2rod@yahoo.com

Article Citation: Ekokotu Paterson Adogbaji and Nwachi Oster Francis. The growth performance of Clarias gariepinus fries raised in varying coloured receptacles. Journal of Research in Biology (2014) 4(2): 1287-1292

Web Address: http://jresearchbiology.com/ documents/RA0392.pdf.

Dates: Received: 29 Nov 2013

Accepted: 17 Dec 2013

Published: 20 May 2014

Journal of Research in Biology An International Scientific Research Journal

1287-1292 | JRB | 2014 | Vol 4 | No 2

www.jresearchbiology.com

Ekokotu and Nwachi, 2014 INTRODUCTION

vegetation which again diminishes light intensity.

Fresh water fishes have the ability to vary their

Lam and Soh (1995) carried out experiment on

growth rate in the present of changing environmental

the effect of photoperiod on gonadal maturation in the

conditions (Dahle et al., 2000). This suggests that

rabbit fish Siganus canaliculates and discovered that a

characteristics pattern of growth exist whose analysis

long photoperiod of 18 hours light alternation with

may provide a better understanding of their adaptation to

the environment. An analysis of this kind must be

development in contrast with the normal photoperiod of

accompanied by an appreciation of the fact that growth

12 hours light and 12 hours darkness (12L, 12D). Thus a

pattern may change throughout the life history of the fish

long photoperiod may be used to delay the breeding

Light acting through photoperiodicity is becoming

season of this fish. Histophysiological studies linking

accepted as playing a major role in influencing the

external factor with gonadal development have been

timing of seasonal reproductive activating, feeding body

reported by Hyder (1990) that light intensity are

coloration, survival and specific growth rate rather than

probably the primary cause of the great intensity of

other factors such as temperature, pH etc. The African

reproductive activity. According to Lofts (1970) light

catfish, Clarias gariepinus is one of the most important

can affect the reproductive organs of fishes in terms of

species of the family Clariidae which is commonly

ability to reproduce and the size of the organ it can

farmed in Nigeria. Clarias gariepinus is a native of

course degeneration of the organ on continuous exposure

tropical and sub-tropical waters outside its natural range

of gonads. The main purpose of every culturist is to

(Hecht and Appelbaum, 1988). Clarias gariepinus is a

produce

well sort fish for the people of tropical and subtropical

experience has shown that farmers sometimes based the

region it has the ability to live and thrive in fresh water

choice of fish seed to be purchased on the colour of the

lakes and tropical swamp, it has the ability to take in air

seed which is mainly influenced by the colour of the

from the atmosphere with a remarkable ability to resist

receptacle used in raising the fish. This work is aimed at

endemic disease prevailing in the region, its ability to

examining the effect of different type of colour on the

reproduce in confine water with the aid of insemination

fries cum fingerlings of Clarias gariepinus.

hours

darkness

fingerlings

(18L,

that

6D),

would

retarded

attract

gonadal

farmers;

increases the ease in which the fingerlings can be made available (Van de Nieuwegiessen et al., 2009). Catfishes

MATERIAL AND METHODS

also have the unique characteristics of consuming both

This research work was conducted at the wet

plant and animal matter. They can feed on insects

laboratory of the Teaching and Research farm of Delta

plankton and even snail found in the water, they can also

State University Abraka Asaba campus, between the

cannibalize on smaller fishes depending on its ability

months of October and January, 2013. Data was

hence is known to feed on any available palatable feed.

collected for a period of eight weeks.

The reproductive activity of Clarias gariepinus

Spawning of fish

in its natural environment increases during the period of

Spawning refers to the natural procedure the

heavy rains in West Africa (June and July) again in

fishes go through in order to give birth to their fry. The

October and November produces deeper and more turbid

broodstock used for the spawning was procured from a

water which has the effect of reducing illumination

well-established farm. After the procurement, the

breeding activity. Also due to flooding of the lowland

broodstock was disinfected using saline solution (30 g of

coastal areas, the fish spread into waters with dense

Nacl per 10 liters of water). The sexes were kept

1288

Journal of Research in Biology (2014) 4(2): 1287-1292

Ekokotu and Nwachi, 2014 separately to avoid indiscriminate spawning, and were

taken while stripping to guard the egg and the milt that

allowed to acclimatize for 24 hours

not to get contact with water.

Broodstock Selection

Fertilization

The male broodstock selected weigh 1.5-2 kg at

Milt solution was prepared by macerating milt

the age of 13-15 months, the reproductive organ of the

with mortar and pestle, and mixing the extract with

male extend to the anterior papilla and the fish shows

saline solution (0.09% salt). The milt solution was mixed

element of aggressiveness. The female fish selected

with the eggs and mechanically shaken for a minute. The

weigh 2-2.5 kg at the age of 13-15 months of age, the

eggs were then spread on the hatching mat

female fish has swollen soft stomach, reddish to pinkish

Hatching

reproductive organ with the ability to release egg on

Hatching involve breaking the eggs shell and the

slight touch.

releasing of the larvae. Hatchings of the eggs occurred

Administration of Hormone

after a fertilization process of about 26 hours after

Reproductive hormone (ovaprim) was injected

incubation. The hatchling has the yolk sac attached to it

intramuscularly above the lateral line just below the

for a period of 4 days when they became swim up fry.

dorsal fin at the rate of 0.5 ml to 1 kg of body weight of

They were kept for 10 days in the nursery and fed with

test fish. All the broodstock were returned to solitary

artemia

confinement for a latency period of 9 hrs at a room

Experimental design

temperature (25°)

The already acclimatized fish were counted (200) and stocked in duplicates in colored receptacles of 100 litres

Stripping The male fish was sacrificed and dissected to get

capacity of color blue, white and green (B1, B2, W1,

the milt. After a latency period of nine hours and at a

W2, G1 and G2). The fishes were fed with artemia for

time egg were freely oozing out on slight touch. The

7 days.

eggs were stripped into a clean receptacle and care was Table 1: Mean variation of weekly Body Weight of (twenty) Clarias gariepinus species per tank reared under different colour.

Table 2: Mean variation of weekly Total Length of twenty Clarias gariepinus species per tank under different tank colour

Week

Green

Blue a

0.14±0.00

White a

0.16±0.00

Green Tank

Week 1

1.02±0.00

Blue Tank

White Tank

1.02±0.01a

Week 1

0.19±0.00

Week 2

0.05±0.01a

0.07±0.01a

0.06±0.01a

Week 2

2.00±0.00a

1.82±0.00a

2.44±0.00b

Week 3

0.06±0.01a

0.07±0.01a

0.11±0.00a

Week 3

1.96±0.00a

1.99±0.01a

1.91±0.01a

Week 4

1.90±0.00a

1.98±0.00a

2.01±0.01a

Week 4

1.91±0.00a

1.98±0.00a

2.01±0.01a

Week 5

0.68±0.01b

0.12±0.01a

0.72±0.00a

Week 5

4.50±0.01b

2.40±0.00a

2.57±0.00a

Week 6

0.68±0.00a

0.67±0.00a

0.50±0.00a

Week 6

5.12±0.00b

4.66±0.00ab

4.30±0.00a

Week 7

0.65±0.00a

0.89±0.01a

0.66±0.00a

Week 7

5.01±0.00ab

5.14±0.00b

4.55±0.01ab

Week 8

0.74±0.00a

0.78±0.01a

0.69±0.01a

Week 8

5.280.00b

5.90±0.01b

4.40±0.01a

Mean: Mean ± SE (standard Error of mean) X = 0.05 (95% level of significant) Journal of Research in Biology (2014) 4(2): 1287-1292

1.02±0.00

Mean: Mean ± SE (standard Error of mean) X = 0.05 (95% level of significant) 1289

Ekokotu and Nwachi, 2014 T1 = Initial time

Fish sampling The initial mean weight and total length of the

Survival rate

fry were taken using a sensitive analytical balance and meter

rule

before

commencement

feeding.

Subsequently, weight and total length of experimental

At the end of each trial (14 days), all the survived fish were harvested totally, counted and divided by the total number stocked.

fishes were observed at weekly basis throughout the

No of fish harvested Percentage survival =

culture period of two weeks.

No of fish stocked. 100

Weight determination Samples to be weighed were randomly removed

Determination of water quality parameters.

from each experimental bowls and kept alive in a small

Water quality data collected during the study

plastic bowl and weighed collectively on weighing days,

include temperature, dissolved oxygen (DO) hydrogen

fish were not fed until the whole exercise was completed.

concentration

After measurements, the fish were put in fresh water and

requirement were monitored and stabilized. These were

then returned to the rearing bowls while subsequent

observed routinely, Water temperature was maintained at

weighing were done individually and mean weight gain

28 – 30°C, pH at 7.5 – 7.8 and dissolved oxygen (DO) at

were determined.

7.5 – 8.8 mg\l.

Weight gain (WG) =

(pH)

and

other

physiochemical

Statistical Analysis

W1—Wf

One-way

ANOVA

was

used

compute

collected data while Duncan Multiple Range Test

Where:

(DMRT) was used to separate the mean the at 5% level

Wf = final mean weight gain (mg)

of significance.

W1 = initial mean weight gain (mg)

A total of twenty fish was sample from the

d = nursing period in days.

culture tank on a weekly basis. The effect of fish environment is important in

Specific Growth Rate. The logarithm of difference in final and initial mean weights test fish was determined by: SGR =

fish culture fish react positively or negatively to its the natural habitats of fish may negatively affect fish also on

LogW2/T2 - Log W1

fish response under the effect of acute or feeding activity, health, welfare and growth. (Papoutsoglou et al.,

T1.100

2000, and Green and Baker et al., 1991) The effect of Where;

this stressors may affect the performance of the fish.

W2 = Final weight of fry

According Strand et al., (2007). Fishes maintained in the

W1 = Initial weight of fry

blue tanks shows a positive increase in both size and

T2 = Final time

weight this opinion was expressed by Sumner and Table 3: Mean Weight

Treatment

1290

Initial weight (g)

Final weight (g)

Survival rate (%)

Mean weight (g)

Green (T1)

0.19

0.74

0.56

Blue (T2)

0.14

0.78

0.64

White (T3)

0.16

0.69

0.53

Journal of Research in Biology (2014) 4(2): 1287-1292

Ekokotu and Nwachi, 2014 Table 4: Mean Length Treatment

Initial length (g)

Final length (g)

Hatchability (%)

Mean lenght (g)

Green (T1)

1.02

5.3

4.26

Blue (T2)

1.02

5.4

4.38

White (T3)

1.02

4.4

3.38

Doudoroff (1938). In the present study, no contrast was

Institute of Marine Research and University of Bergen.

observed as there was no specific significant disparities

Norway, July 4-9 1999. P 336.

the

growth

reaction

background

colour.

Performance was observed for three colors and the mean growth rate of fish in the three treatment was obtained as 0.78 ± 0.01 (g) for blue tank, 0.74 (g) ± 0.0 for Green tank and 0.69 ± 0.01 for white tank. (Table-1). This finding was similar to the study of Martinez

Green JA and Baker BI. 1991. The influence of repeated stress on the release of melanin-concentrating hormone in the rainbow trout. J Endocrinol., 128(2): 261-266. Hecht T and Appelbaum S. 1988.

Observations on

and Purser, (2007). In clear, white, green tanks expressed

intra-specific aggression and coeval sibling cannibalism

no Support for the latter metabolic effect of background

by larval and juvenile Clarias gariepinus (Clariidae

color differences in growth performance of fry Clarias

pisces) under controlled conditions. Journal of zoology.

gariepinus, as the length of fish ranges from 4.00 to

214(1): 21-44.

7.50 cm for blue tank, 4.00 to 6.50 cm for Green tank and 2.80 to 6.50 cm for White tank. (Table-2). The hatchability rate was uniform for the three

Hyder M. 1990. Endocrine regulation of reproduction in Tilapia. Gen comp: Endocine 3(Supplement):729-740.

colure tanks due to the fact that the incubator was in one

Lam TJ and Soh CL. 1995. Effect of photoperiod on

receptacle the hatching rate of 82% (Table-4) was

gonadal maturation in the rabbit fish. Signanus

observed for the three tanks but there was significance

canaliculatus, park 1797. aquaculture. 5 (4): 407-4 10.

difference in the survival rate of fish across the three tank as 86% was observed in green tank and 84% rate was observed in Blue tank and 82% rate in white Tank.

Lofts B. 1970. Animal photoperiodism; Edward Arnold publishers limited p. 62

(Table-3). The high survival rate of Clarias gariepinus

Martinez-Cardenas L and Purser GJ. 2007. Effect of

fry could be due to proper water management during the

tank colour on Artemia ingestion, growth and survival in

period of study.

cultured

early

juvenile

pot-bellied

seahorses

(Hippocampus abdominalis). Aquaculture. 264(1-4): REFERENCES Dahle R, Taranger GL and Norberg B. 2000. Sexual maturation and Growth of Atlantic cod (Gadus morhua L) reared at different light intensities. In Norberg B; Kjesbu OS; Taranger GL; Anderson E; Stefansson SO. (Eds)(2000) proceeding of the sixth International Symposium on the Reproductive Physiology of Fish. Journal of Research in Biology (2014) 4(2): 1287-1292

92-100. Papoutsoglou

SE,

Mylonakis

Miliou

KaraKatsouli NP and Chadio S. 2000. Effects of background

color

growth

performances

and

physiological responses of scaled carp (Cyprinus carpio L.) reared in a closed circulated system. Aquacult. Eng. 1291

Ekokotu and Nwachi, 2014 22(4): 309-318. Strand A, Alanara A, Staffan F and Magnhagen C. 2007. Effects of tank colour and light intensity on feed intake, growth rate and energy expenditure of juvenile Eurasian perch, Perca fluviatilis L. Aquaculture. 272(1-4): 312-318. Sumner FB and Doudoroff P. 1938. The effects of light and dark backgrounds upon the incidence of a seemingly infectious disease in fishes. Proceedings of National Academy of Science of the United States of America. 24 (10): 463-466. Van de Nieuwegiessen PG, Olwo J, Khong S, Verreth JAJ and Schrama JW. 2009. Effects of age and stocking density on the welfare of African catfish Clarias gariepinus. Burchell aquaculture. 288(1-2):6975.

Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

1292

Journal of Research in Biology (2014) 4(2): 1287-1292

Journal of Research in Biology

ISSN No: Print: 2231 â&#x20AC;&#x201C; 6280; Online: 2231 - 6299.

An International Scientific Research Journal

Original Research

Journal of Research in Biology

High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A possible reason for the vulnerability of this medicinal plant from the Indian Thar desert Authors: Purushottam Lal1, Sher Mohammed2* and Pawan K. Kasera3.

Institution: 1,2. Department of Botany, Government Lohia PG College, Churu-331001, Rajasthan, India. 3. Department of Botany, J.N.V. University, Jodhpur342 033, Rajasthan, India.

ABSTRACT: The seeds of Blepharis sindica T. Anders (Acanthaceae) are the official part of the plant for its medicinal values and also as the promise of its future. Dunes of the Thar desert with high percolation capabilities are the most preferred habitat of this vulnerable medicinal plant. It produces 1337.26 seeds/plant as an average and shows high viability and germination percentage under in-vitro conditions, but efficiency of seedling establishment was observed poor at natural sites. Occurrence of seed coat layers as sheath of hygroscopic hairs is a sign of its extreme capabilities to initiate life under lesser soil moisture availabilities in desert. Seeds with 0.5 to 1.0 ml distilled water were observed most suitable for the production of maximum shoot and root lengths under controlled conditions. Maximum biomass of shoot and root modules were observed in 0.5 ml distilled water. Maximum amount of non-soluble sugar was found in intact seeds devoid of any imbibition. Seeds with 0.5 ml distilled water produced maximum amount of shoot biomass and soluble sugar, while seedlings with 1.0 ml had maximum root biomass. Seedlings treated with >1.5 ml of distilled water showed a decreasing trend in all parameters. Excessive water always found to cause seedling collapse and failure of its establishment.

Corresponding author: Sher Mohammed.

Keywords: Thar desert, medicinal plant, vulnerable, hygroscopic hairs, moisture, seedling collapse.

Email Id:

Article Citation: Purushottam Lal, Sher Mohammed and Pawan K. Kasera. High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A possible reason for the vulnerability of this medicinal plant from the Indian Thar desert Journal of Research in Biology (2014) 4(2): 1293-1300

Web Address: http://jresearchbiology.com/ documents/RA0407.pdf.

Dates: Received: 02 Jan 2014

Accepted: 04 Feb 2014

Published: 22 May 2014

1293-1300 | JRB | 2014 | Vol 4 | No 2

www.jresearchbiology.com

Lal et al., 2014 B. sindica is a lignified annual plant with

INTRODUCTION: Indian Thar desert is characterised by scanty

characteristically dichotomously branching habit. It is

rainfall and long dry periods throughout the year, which

locally known as Billi khojio, Bhangara and Unt-katalo

pushes the typical scrub vegetation to firm adopt specific

(Bhandari, 1990). It grows on loose soils, along the crop

life sustaining adaptabilities (Sen, 1982). In desert

fencings and much especially on dune slopes. Sandy soil

ecosystems, long dry periods and scanty rainfall impose

with heavy percolation is much preferred by this plant.

severe water deficit in natural vegetation (Sen, 1982;

After a successful completion of life cycle (July to

Raghav and Kasera, 2012). Biodiversity of desert areas is

December), capsules loaded spikes remain attached to

a better reflection of highly synchronised life patterns of

the dried plant and provide a special distinguishable

living beings against the environmental entities which

appearance to the species. Seeds within capsules remain

always restrict the life to express beyond their biotic

open to face the extreme of winter and summer

potentials. The Indian Thar desert has a unique

temperatures till their first imbibition. Habitat limitation

vegetation cover as compared to other deserts around the

plays an excellent role for this species as sand shifting

world. Besides harsh climatic conditions and much

and eolian deposition cause to bury the spikes which

constrains on growth potentials, the plant species of arid

trigger microbial decomposition of lignified bracts. The

zone synthesise and accumulate a variety of bioactive

plant emerge through seeds after first rain as soon as fruit

compounds which have different values to serve

wall split explosively from distal tapered end and release

mankind. Due to their medicinal as well as economic

seeds to imbibe (Fig. 1).

importance, the medicinal plants and their different parts

Compressed

seeds

with

densely

clothed

are being exploited largely from natural habitats. Habitat

hygroscopic hairs are used in the preparation of herbal

destruction,

ecological

medicines and it is used as aphrodisiac (Shekhawat,

limitations, etc. are crucial factors to push valuable

1986; Singh et al., 1996; Mathur, 2012). Its roots are

medicinal plants under verge of extinction. UNDP

used

(2010) have published Red List Categories for 39

Powdered plant is applied locally on the infections of

medicinal plants of Rajasthan State, of which Blepharis

genitals and on the burns (Khare, 2007). Seeds contain

sindica is considered as “Vulnerable”. Thus, it is quite

flavonoides

important to know its adaptability to conserve in natural

coumarate, and terniflorin), steroid (β-sitosterol) and

habitat.

triterpinoide-oleanolic acid (Ahmad et al., 1984).

unscientific

collection,

for

urinary

discharge

(apigenin,

and

blepharin,

dysmenorrhoea.

prunine-6″-O-

Fig. 1: Blepharis sindica: One-year-old plant after first rains, showing spreading of seeds to initiate germination (a), freshly fallen seed after moisture uptake by hygroscopic hairs at sandy surface of dune (b), single young seedling (c), and seedlings in association (d). 1294

Journal of Research in Biology (2014) 4(2): 1293-1300

Lal et al., 2014 Hence in the present study, an attempt has been

of a graph paper. Shoot and root biomass values of

made to identify a correlation between availed moisture

seedlings against different moisture regimes were

and seedling establishment in B. sindica germplasm

estimated by oven-dried weight basis. Amount of sugars

collected from different localities of the Churu district, a

in seedlings after varied doses of distilled water was

part of Indian Thar desert.

estimated by using anthrone reagent method (Plummer, 1971). Differences in biomass & sugar contents of seedlings from various moisture regimes were compared

MATERIALS AND METHODS: The germplasm of this species was collected

with the values for intact seeds and measured in

during 2011-2012 from two different sites, viz.,

percentage basis. The relation between total biomass %

Shyampura village (Site-I; 12 km away towards west-

and total sugars % in comparison to intact seeds were

south direction from the College Campus) and Buntia

expressed as metabolic efficiencies of seedlings at

village (Site-II; 10 km towards north-east), a part of the

particular moisture regime. The pooled data of entire

Indian Thar desert. The seed size was measured with the

season were analyzed statistically as per the methods of

help of vernier caliper and graph paper. Seed volume and

Gomez and Gomez (1984), presented in tabular and

density estimations were based on water displacement

figure forms.

method (Misra, 1968). Values were calculated for 100 seeds in triplicate and confirmed twice. Arithmetic mean

RESULTS:

and standard deviation were computed for each

The data on various morphological parameters,

parameter. Seed viability was tested by T.T.C. method

viz. weight, size, volume, density and viability of seeds

(Porter et al., 1947). The seed germination experiments

collected from different sites are given in Table 1.

were performed in seed germinator at 28°C. Seeds were

Morphological variations provide understanding about

placed in the sterilized petri dishes lined with single layer

germplasm variability, which is an important adaptation

of filter paper to evaluate germination behaviour. To

skill of desert plants. Seed length and density values

evaluate moisture response, the filter paper in each

were observed higher at site-I, whereas other parameters

experiment was moistened with 0.5, 1.0, 1.5, 2.0, 5.0 and

at site-II.

10.0 ml volume of distilled water separately. Each petri

Morphological parameters revealed that higher

dish containing 10 seeds in triplicate was used and

(5.73 x 4.13 x 0.10 mm) values of seed size were

experiment was repeated for two times for the

observed at site-II, while lower (5.75 x 4.11 x 0.07 mm)

confirmation of results. After one week of setting the

at site-I. Weight of 100 seeds was greater (1.33 g) at site-

experiments, germination percentage (%) and root &

II than site-I (1.16 g). Volume of 100 seeds was more

shoot lengths of seedlings were measured with the help

(1.57 ml) at site-II, whereas less (1.13 ml) at site-I.

Table 1. Variation in morphological parameters of B. sindica seeds collected from sites- I & II. Parameters Sites

Weight of 100 seeds (g)

I II

Seed size (mm)

Volume of 100 seeds (ml)

Density (g ml-1)

Viability (%)

Length

Breadth

Thickness

1.16±0.015

5.75±0.010

4.11±0.006

0.07±0.0004

1.13±0.028

1.02±0.057

100.00±0.00

1.33±0.022

5.73±0.010

4.13±0.006

0.10±0.0004

1.57±0.028

0.85±0.021

100.00±0.00

± = Standard deviation Journal of Research in Biology (2014) 4(2): 1293-1300

1295

Lal et al., 2014 Freshly collected seeds from both sites exhibited cent

(Fig. 2). The expression of comparative relation between

percent viability.

shoot and root lengths as R/S ratio was found significant

To evaluate the significance of moisture regimes

at 1.0, 1.5 & 2.0 ml regimes. It was observed maximum

on germination process, 0.5 ml to 10.0 ml range of

(45.23) at 1.0 ml moisture for both sites, while minimum

distilled water was provided to seeds. Under controlled

(0.82) at 10.0 ml for site-I. Seedlings from site-I showed

laboratory conditions, cent percent germination was

a rapid decline in R/S ratio along with

observed in 0.5, 1.0, 1.5 and 2.0 ml moisture regimes for

moisture levels as compared to site-II.

both sites. 5.0 and 10.0 ml moisture regimes caused deterioration for seed germination.

increasing

Anabolic efficacy of germinating seeds was measured in the form of over-dried biomass of seedlings.

Shoot length parameter was found to have

Shoot biomass was found more as compared to root

increasing trend from 0.5 ml to 2.0 ml range, afterwards

ones. Maximum (0.28 g d. wt.) shoot biomass was

it gets decreased (Table 2). Maximum

shoot length

estimated at 0.5 ml moisture for site-II, while minimum

(10.47 mm) was observed at 2.0 ml moisture for site-II,

(0.09 g d. wt.) at 10.0 ml for site-II. Maximum extension

while at 0.5 ml moisture slight expansion in cotyledons

of root axis was observed at 1.0 ml levels, while

was occured without shoot development for both sites.

maximum (0.05 g d. wt.) root biomass were found at 1.0,

Higher values of root length were observed at 1.0 ml

1.5 & 2.0 ml levels for site-II. Total biomass was

moisture for both sites, being maximum (61.97 mm) for

increased after seeds were permitted to imbibing and

site-I.

found maximum (0.31 g d. wt.) with 0.5 ml and 1.0 ml At 0.5 ml level, only radicle emerged out

moisture for site-II. Total biomass values exhibited

without any shoot elongation; whereas at 5.0 & 10.0 ml

declining trend along with increasing moisture regimes

levels shoot and root axies collapsed after a short growth

(Fig. 3).

Table 2. Effect of different amount of distilled water on seed germination (%), seedling growth (mm), seedling biomass (g) and sugar contents (mg g-1 d. wt.) during seedling establishment in B. sindica seeds under laboratory conditions at sites- I & II (Observations taken after 7 days).

Site-I Germination Shoot length Root length R/S ratio Shoot biomass Root biomass Total biomass Soluble sugar Non-soluble sugar Site-II Germination Shoot length Root length R/S ratio Shoot biomass Root biomass Total biomass Soluble sugar Non-soluble sugar

Seed 0.12 28.87 2.34 0.13 29.12 2.41

Amount of distilled water provided (moisture regime) 0.5 ml 1.0 ml 1.5 ml 2.0 ml 5.0 ml 10.0 ml 100.00 100.00 100.00 100.00 36.67 6.67 0.00 1.37 4.60 8.20 2.53 1.67 8.73 61.97 44.53 50.73 5.90 1.37 # 45.23 9.68 6.19 2.33 0.82 0.26 0.23 0.23 0.22 0.13 0.11 0.02 0.04 0.04 0.04 0.01 0.01 0.28 0.27 0.27 0.26 0.14 0.12 29.12 28.87 28.25 27.08 18.61 5.62 1.91 1.92 1.78 1.91 1.59 1.21 100.00 0.00 13.77 # 0.28 0.03 0.31 29.75 2.03

100.00 1.50 51.03 34.02 0.26 0.05 0.31 29.27 2.02

100.00 8.77 50.93 5.81 0.25 0.05 0.30 28.42 1.81

100.00 10.47 46.60 4.45 0.25 0.05 0.30 26.42 2.06

50.00 7.53 11.63 1.54 0.17 0.02 0.19 17.87 1.81

50.00 6.27 8.60 1.37 0.09 0.01 0.10 7.87 1.38

CD 1.4684 ns 0.1457ns 0.7204* 1.3604ns 0.0071ns 0.0021ns 0.0047ns 0.6669* 0.1132* 1.5604ns 0.0092ns 0.4439 ns 1.2667ns 0.0054ns 0.0026ns 0.0065ns 0.1553ns 0.1307ns

- = Values are not applicable, # = Values are infinitive, *= Significant at (P < 0.05) level, and ns = non-significant 1296

Journal of Research in Biology (2014) 4(2): 1293-1300

Lal et al., 2014

Fig.2: In-vitro seedlings of B. sindica after 07 days response against varied amount of moisture regimes (0.5 to 10.0 ml distilled water per petridish) from site-I (a) and site-II (b). Fully expand hygroscopic hairs at 0.5 & 1.0 ml and collapsed seedlings at 5.0 & 10.0 ml. Amounts of soluble and non-soluble sugars were

moisture regimes during seed germination. Metabolic

estimated in oven-dried seedlings obtained after response

fluctuations (percentage sugar loss & percentage biomass

of varied moisture regimes. Soluble sugar was maximum

growth in comparison to intact seeds) and metabolic

-1

(29.75 mg g d. wt.) at 0.5 ml moisture level for site-II, -1

while minimum (5.62 mg g d. wt.) at 10.0 ml for site-I.

efficiency values against various moisture regimes were found non-significant (P > 0.05) for both sites.

Amount of non-soluble sugar was more in intact seeds as compared to seedlings. Its maximum (2.41 mg g-1 d. wt.)

DISCUSSION:

value was estimated in seeds from site-II. Seedlings with

Seed germination is a crucial step of life cycle in

10.0 ml moisture exhibited minimum values for site-I. In

higher plants as it determines the future of the species as

this species, intact seeds were found to have maximum

well as it offers the availability of plant resources for all

amount of total sugars (soluble & non-soluble) and

living beings. Most of arid plants produce seeds with

showed a decreasing trend with increasing moisture

hard seed coats that enable the species to cope drought

regime. On using intact seeds as reference, the total

constrains (Sen et al., 1988). In this species, seeds

sugars loss occurred on different moisture regimes are

completely lacking of hard coverings and embryos found

expressed on percentage basis (Fig. 3). As compared to

directly encapsulated within hygroscopic membrane

site-I, seedlings from site-II exhibited more sugar loss

which further extends in hygroscopic hairs. The seeds

percentage at all moisture regimes, except in 10.0 ml.

collected

Maximum (78.12 %) sugar loss was occurred at 0.5 ml

variability, which influenced the response of seeds

moisture for site-II, whereas minimum (0.58 %) at 10.0

against different moisture regimes during in-vitro

ml for site-I. Production of total biomass (g d. wt.) in

germination. Freshly collected seeds exhibited cent

-1

relation to total sugars loss (% mg g d. wt.) can be used

from both

sites

showed

morphological

percent viability without any dormancy barrier.

-1

Germplasm tolerance against extreme aridity of

d. wt.) of seedling establishment (Fig. 4). Highest (229)

the area is solely paid by its hard capsule (fruit)

value for metabolic efficiency of germinating seeds were

coverings whereas the hygroscopic sheath (seed coat

observed at 0.5 ml moisture level for site-I, whereas

layer) has the most prominent contribution for rapid

minimum (-0.32) at 10.0 ml for site-II. A decline in

uptake of soil moisture and subsequent imbibitions. The

metabolic efficiency was observed on increasing

present

to express the metabolic efficiency (% d. wt. / % mg g

Journal of Research in Biology (2014) 4(2): 1293-1300

investigation

reveals

that

this

part, 1297

Lal et al., 2014

a Fig. 4: Metabolic efficiency of germinating seeds under varied amount of availed moisture levels (% d. wt. total biomass / % total sugar loss) from sites- I & II (Data are average of three replicates). moisture amount in seed germination process; this unique experiment was designed and the results illustrate the comparative effect of different levels of moisture in

sense

seedling rate

growth, of

reserve

biomass food

production,

Fig. 3: Total sugar loss (a) and total biomass growth (b) in seedlings against varied amount of moisture regimes as compared to intact seeds for sites- I & II.

consumption

contents

and

i.e. hygroscopic sheath has some short of limitations in

production (shoot & root modules) were observed in 0.5

sense of its carrying capacity of soil moisture contents.

to 2.0 ml moisture regimes. Seed germination percentage

comparative efficiency of seedling establishment. Higher values of seedling length and biomass

Field study of the area revealed that in spite of

as well as seedling vigour (length & biomass) values

having cent percent viability and germination percentage,

showed a clear decline on excessive moisture contents

a limited number of seedlings develop in-vivo at its

(5.0 & 10.0 ml). The values for biomass growth (%) in

preferred sand dune surfaces during early monsoon

comparison to dry weight of intact seeds were found

period. Observations are in the record that mucilaginous

highest at minimum moisture level, i.e. 0.5 ml. Amount

sheathing on seeds and its other parts which provide

of soluble sugars, a part of nourishment ready to

adequate water, leds to improved germination in Cactus

consume during germinating seedlings; also estimated

(Bregman and Graven, 1997; Gorai et al., 2014).

maximum at 0.5 ml moisture level. Metabolic efficiency

Excessive

seed

of germinating seeds (dry weight increase per unit

germination in B. sindica, as observed by Mathur (2012)

reserve food loss) was also estimated highest at

but the present investigations point out that at particular

minimum moisture regimes, while its negative value was

stage of early seed germination physiology, water

estimated

amount works as a master factor but interestingly it is

experiment.

moisture

was

found

inhibit

highest

regimes

the

performed

positive for a very short range, i.e. 0.5 to 1.0 ml. The amount of first rain fall over detached seeds and the rate

CONCLUSIONS:

by which rain water get percolated through inter-particle

Seeds of B. sindica are highly adjusted structures

spaces, which determine the value of availed moisture

toward moisture limitations in arid habitat. The seeds

for seeds to imbibe. For better understanding the role of

exhibited absolute requirement of 0.5 ml moisture level

1298

Journal of Research in Biology (2014) 4(2): 1293-1300

Lal et al., 2014 for the better establishment of in-vitro seedlings. Primarily, the species has high biotic potential (1337.26 seeds / plant with 100 percent viability and germination efficiencies) and secondly the species has absolutely free

Chem. Soc. Pak., 6(4): 217-223. Bhandari MM. 1990. Flora of the Indian Desert. MPS REPROS, Jodhpur, p. 435.

from any type of grazing & fruit collection pressures. In

Bregman R and Graven P. 1997. Subcuticular secretion

spite of this, the number of well established seedlings

by cactus seeds improves germination by means of rapid

and consequent mature plants were found restricted at

uptake and distribution of water. Annals of Botany. 80

both sites. This condition marks a clear threat at the point

(4): 525-531.

when its life moulds from seed to seedling phase. Metabolic diagnosis of germinating seeds, i.e. total sugar loss (%), total biomass growth (%) and the rate of metabolic efficiency (% d. wt. total biomass /% total

Gomez

and

Gomez

AA.

1984. Statistical

Procedures for Agricultural Research, 2 nd ed. John Wiley & Sons, New York, p. 294.

sugars loss) provides ample insight into compensation

Gorai M, El Aloui W, Yang X and Neffati M. 2014.

efficacy of germinating seeds against a particular

Toward understanding the ecological role of mucilage in

moisture level. Seedling collapsing at 5.0 & 10.0 ml

seed germination of desert shrub Henophyton deserti:

regimes indicates the seed tissue incompatibility at

interactive effects of temperature, salinity and osmotic

excessive moisture regimes. Our results could make an

stress. Plant Soil 374 (1-2): 727-738.

excellent way to define this natural problem with this species and assessment of threat in the arid habitats of Indian desert. The entire cascade of this pioneer work justifies the esteem love of B. sindica seeds with that of

Khare CP. 2007. Indian Medicinal Plants - An Illustrated Dictionary. Springer-Verlag, Berlin, New York, USA, p. 812.

Thar desert aridity. Such type of findings may also be

Mathur M. 2012. Phytosterol composition in seeds of

helpful for conservation strategies related to different

Blepharis sindica and its relation with bottom up, top

plant species of the area.

down and plant metabolites factors. Medicinal plants International Journal of Phytomedicines and Related Industries 4(3): 126-132.

ACKNOWLEDGEMENTS: Financial assistance received from CSIR, New Delhi in the form of SRF-NET (File No.: 08/544 (0001)/2009-EMR-I, 27.06.2009) to first author is gratefully acknowledged. Thanks are due to the

Mathur M and Sundaramoorthy S. 2012. Studies on distribution patterns for an endangered semi-arid plantBlepharis sindica. Vegetos 25(2): 66-75.

Principal, Govt. Lohia PG College, Churu for providing

Misra R. 1968. Ecology Work Book. IBH Publishing

necessary facilities. The authors are also thankful to Dr.

Company, Oxford, New Delhi, p. 242.

David N. Sen (Retd. Professor & Head), Department of Botany,

J.N.V.

University,

Jodhpur

for

valuable

suggestions in improvement of this paper.

Plummer DT. 1971. An Introduction to Practical Biochemistry. Tata McGraw Hill Publishing Co Ltd, New Delhi, p. 369.

REFERENCES:

Porter RH, Durrell M and Romm HJ. 1947. The use

Ahmad VU, Burki AM, Mahmood I and Smith DL.

of 2, 3, 5-triphenyl tetrazolium chloride as a measure of

1984. Chemical constituents of Blepharis sindica seeds.

seed germinability. Plant Physiol., 22(2): 149-159.

Journal of Research in Biology (2014) 4(2): 1293-1300

1299

Lal et al., 2014 Raghav A and Kasera PK. 2012. Seed germination behaviour of Asparagus racemosus (Shatavari) under invivo and in-vitro conditions. Asian Journal of Plant Science & Research. 2 (4): 409-413. Sen DN. 1982. Environment and Plant Life in Indian Desert. Geobios International, Jodhpur, p. 249. Sen DN, Mohammed S and Kasera PK. 1988. Report on weed seed longevity in arid zone-Test of seed bank. Geobios new Reports. 7: 98-100. Shekhawat GS. 1986. Ethnobotanical survey of desert area of Rajasthan. Ph D Thesis, University of Jodhpur, Jodhpur, India. Singh U, Wadhwani AM and Johri BM. 1996. Dictionary of Economic Plants in India. ICAR, New Delhi, p. 288. UNDP 2010. Rajasthan Red Listed Medicinal Plants, http://envis.frlht.org/documents/rajasthan-medicinalplants-conservation.pdf

Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

1300

Journal of Research in Biology (2014) 4(2): 1293-1300

Guidelines for Authors

The article should be addressed to "The Editor". Submission of an article implies that it has never been published in any other journals and if accepted, it will not be published elsewhere. All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review process. Journal Manuscript Format The manuscript should be typed in â&#x20AC;&#x153;Times new Romanâ&#x20AC;? font with font size 11 and 1.5 line spacing. The page size should be strictly A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address (including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to submit@jresearchbiology.com Title The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at scientific names, abbreviations etc., Center the authors' initials and last names directly below the title. Abstract The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion: The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations. Keywords A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list. Body of the Article The introductory section of the text should include a brief statement of why the research was conducted. It should also define the problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief survey of the relevant literature on the topic. Materials and Methods Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sources. Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment specifications are appropriate here. Results and Discussion This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on which your conclusions are based. Do not omit important negative results. In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation is encouraged, but it must be identified. Conclusion This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion. Acknowledgement Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences. References All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text. Accuracy of citation is the author's responsibility.

Reference Style References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows: Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109â&#x20AC;&#x201C; 124. Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999; 15-16. Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis, Dehradun: Forest Research Institute, 1998; 75-76. http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf. Appendix Use an appendix for material that is too long to include in the text of the article. Manuscript Charges Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text articles to interested readers from all around the world. The availability of the authorâ&#x20AC;&#x2122;s paper makes the scientific community to understand and develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be translated into more recognition of research. This journal also accelerates research and knowledge building worldwide. Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on the Internet to all interested researchers. For Indians The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250. For Foreign nationals The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD. Copyright Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use, distribution, and reproduction of an article in any medium, provided that the original work is properly cited. If you have any queries kindly contact us at contact@jresearchbiology.com