Journal of Research in Biology Volume 3 Issue 8 by Journal of Research in Biology

Aim and Scope Journal of Research in Biology is an international scientific journal committed to the development and spread of research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make the most of your research by publishing articles in Journal of Research in Biology. Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of scientific research and education communities, particularly the biological sciences. The journal has been uniquely positioned to help members of the scientific community; become effective advocates for their science and to be better known for the public that relate to or impact the biological sciences. Call for Papers

Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept and review submissions in English from any author, in any global locality. A body of international peers will review all submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that: Relate to the field of Biology Represent new, previously unpublished work Advance the state of knowledge of the field Conform to a high standard of presentation.

Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflict s in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher i nvites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.

List of Editors of Editors in the Journal of Research in Biology Managing and Executive Editor: Abiya Chelliah [Molecular Biology] Publisher, Journal of Research in Biology. Editorial Board Members: Ciccarese [Molecular Biology] Universita di Bari, Italy. Sathishkumar [Plant Biotechnologist] Bharathiar University. SUGANTHY [Entomologist] TNAU, Coimbatore. Elanchezhyan [Agriculture, Entomology] TNAU, Tirunelveli. Syed Mohsen Hosseini [Forestry & Ecology] Tarbiat Modares University (TMU), Iran. Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka. Kamal Prasad Acharya [Conservation Biology] Norwegian University of Science and Technology (NTNU), Norway. Dr. Ajay Singh [Zoology] Gorakhpur University, Gorakhpur Dr. T. P. Mall [Ethnobotany and Plant pathoilogy] Kisan PG College, BAHRAICH Ramesh Chandra [Hydrobiology, Zoology] S.S.(P.G.)College, Shahjahanpur, India. Adarsh Pandey [Mycology and Plant Pathology] SS P.G.College, Shahjahanpur, India Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology] Al-Azhar university, Egypt Ganga suresh [Microbiology] Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India. T.P. Mall [Ethnobotany, Plant pathology] Kisan PG College,BAHRAICH, India. Mirza Hasanuzzaman [Agronomy, Weeds, Plant] Sher-e-Bangla Agricultural University, Bangladesh Mukesh Kumar Chaubey [Immunology, Zoology] Mahatma Gandhi Post Graduate College, Gorakhpur, India. N.K. Patel [Plant physiology & Ethno Botany] Sheth M.N.Science College, Patan, India. Kumudben Babulal Patel [Bird, Ecology] Gujarat, India.

Dr. Afreenish Hassan [Microbiology] Department of Pathology, Army Medical College, Rawalpindi, Pakistan. Gurjit Singh [Soil Science] Krishi Vigyan Kendra, Amritsar, Punjab, India. Dr. Marcela Pagano [Mycology] Universidade Federal de São João del-Rei, Brazil. Dr.Amit Baran Sharangi [Horticulture] BCKV (Agri University), West Bengal, INDIA. Dr. Bhargava [Melittopalynology] School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA. Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology] Jawaharlal Technological University, Hyderabad. Dr. Mrs. Kaiser Jamil [Biotechnology] Bhagwan Mahavir Medical Research Centre, Hyderabad, India. Ahmed Mohammed El Naim [Agronomy] University of Kordofan, Elobeid-SUDAN. Dr. Zohair Rahemo [Parasitology] University of Mosul, Mosul,Iraq. Dr. Birendra Kumar [Breeding and Genetic improvement] Central Institute of Medicinal and Aromatic Plants, Lucknow, India. Dr. Sanjay M. Dave [Ornithology and Ecology] Hem. North Gujarat University, Patan. Dr. Nand Lal [Micropropagation Technology Development] C.S.J.M. University, India. Fábio M. da Costa [Biotechnology: Integrated pest control, genetics] Federal University of Rondônia, Brazil. Marcel Avramiuc [Biologist] Stefan cel Mare University of Suceava, Romania. Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner. P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science] School of Life Sciences, Bharathidasan University, India. Dr. Mrs Kavita Sharma [Botany] Arts and commerce girl’s college Raipur (C.G.), India. Suwattana Pruksasri [Enzyme technology, Biochemical Engineering] Silpakorn University, Thailand. Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries] Yogeshwari Mahavidyalaya, Ambajogai, India.

CHANDRAMOHAN [Biochemist] College of Applied Medical Sciences, King Saud University.

Dr. Pankaj Sah [Environmental Science, Plant Ecology] Higher College of Technology (HCT), Al-Khuwair.

B.C. Behera [Natural product and their Bioprospecting] Agharkar Research Institute, Pune, INDIA.

Dr. Erkan Kalipci [Environmental Engineering] Selcuk University, Turkey.

Kuvalekar Aniket Arun [Biotechnology] Lecturer, Pune.

Dr Gajendra Pandurang Jagtap [Plant Pathology] College of Agriculture, India.

Mohd. Kamil Usmani [Entomology, Insect taxonomy] Aligarh Muslim university, Aligarh, india.

Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry] Shree Shivaji Arts, Commerce & Science College, India.

Dr. Lachhman Das Singla [Veterinary Parasitology] Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.

Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy] Bio-Science Research Foundation, India.

Vaclav Vetvicka [Immunomodulators and Breast Cancer] University of Louisville, Kentucky.

Nasroallah Moradi Kor [Animal Science] Razi University of Agricultural Sciences and Natural Resources, Iran

José F. González-Maya [Conservation Biology] Laboratorio de ecología y conservación de fauna Silvestre, Instituto de Ecología, UNAM, México.

T. Badal Singh [plant tissue culture] Panjab University, India

Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture] AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia, West Bengal, India. Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous practices, Ethno botany] V. C., Vidyasagar University, Midnapore. M.Sugumaran [Phytochemistry] Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District. Prashanth N S [Public health, Medicine] Institute of Public Health, Bangalore. Tariq Aftab Department of Botany, Aligarh Muslim University, Aligarh, India. Manzoor Ahmad Shah Department of Botany, University of Kashmir, Srinagar, India. Syampungani Stephen School of Natural Resources, Copperbelt University, Kitwe, Zambia. Iheanyi Omezuruike OKONKO Department of Biochemistry & Microbiology, Lead City University, Ibadan, Nigeria. Sharangouda Patil Toxicology Laboratory, Bioenergetics & Environmental Sciences Division, National Institue of Animal Nutrition and Physiology (NIANP, ICAR), Adugodi, Bangalore. Jayapal Nandyal, Kurnool, Andrapradesh, India. T.S. Pathan [Aquatic toxicology and Fish biology] Department of Zoology, Kalikadevi Senior College, Shirur, India. Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA. Dr. Amit Bandyopadhyay [Sports & Exercise Physiology] Department of Physiology, University of Calcutta, Kolkata, INDIA . Maruthi [Plant Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India.

Dr. Satish Ambadas Bhalerao [Environmental Botany] Wilson College, Mumbai Rafael Gomez Kosky [Plant Biotechnology] Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas Eudriano Costa [Aquatic Bioecology] IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India Rajib Roychowdhury [Plant science] Centre for biotechnology visva-bharati, India. Dr. S.M.Gopinath [Environmental Biotechnology] Acharya Institute of Technology, Bangalore. Dr. U.S. Mahadeva Rao [Bio Chemistry] Universiti Sultan Zainal Abidin, Malaysia. Hérida Regina Nunes Salgado [Pharmacist] Unesp - Universidade Estadual Paulista, Brazil Mandava Venkata Basaveswara Rao [Chemistry] Krishna University, India. Dr. Mostafa Mohamed Rady [Agricultural Sciences] Fayoum University, Egypt. Dr. Hazim Jabbar Shah Ali [Poultry Science] College of Agriculture, University of Baghdad , Iraq. Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics] Agronomy and Plant Breeding Dept., Razi University, Iran Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution, Forest protection] College of Life Sciences, Nankai University, China. María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology] New University of Lisbon, Caparica, Portugal Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech] Visva-Bharati (a Central University), India

Veeranna [Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India.

Dr. Preetham Elumalai [Biochemistry and Immunology] Institute for Immunology Uniklinikum, Regensburg, Germany

RAVI [Biotechnology & Bioinformatics] Department of Botany, Government Arts College, Coimbatore, India.

Dr. Mrs. Sreeja Lakshmi PV [Biochemistry and Cell Biology] University of Regensburg, Germany

Sadanand Mallappa Yamakanamardi [Zoology] Department of Zoology, University of Mysore, Mysore, India.

Dr. Alma Rus [Experimental Biology] University of jaén, Spain.

Anoop Das [Ornithologist] Research Department of Zoology, MES Mampad College, Kerala, India.

Dr. Milan S. Stanković [Biology, Plant Science] University of Kragujevac, Serbia. Dr. Manoranjan chakraborty [Mycology and plant pathology] Bishnupur ramananda college, India.

Table of Contents (Volume 3 - Issue 8) Serial No

Accession No

RA0396

Title of the article

Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women

Page No

1111-1121

Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.

RA0397

Role of p73 polymorphism in Egyptian breast cancer patients as

1122-1131

molecular diagnostic markers. Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI.

RA0419

Efficient methods for fast, producible, C-Phycocyanin from

1132-1146

Thermosynechococcus elongates. El-Mohsnawy Eithar. 4

RA0406

Length-Weight relationship and condition factor of Channa

1147-1152

aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District, Assam, India. Banjit Bhatta and Mrigendra Mohan Goswami.

RA0412

Impact of ecological factors on genetic diversity in Nothapodytes nimmoniana Graham based on ISSR amplification. John De Britto A, Benjamin Jeya Rathna Kumar P and Herin Sheeba Gracelin D.

1153-1161

Journal of Research in Biology

An International Scientific Research Journal

Original Research

Journal of Research in Biology

Cyclin D1 gene polymorphism in Egyptian breast cancer women Authors: ABSTRACT: Ibrahim HAM1, Ebied SA1, Background: Abd El-Moneim NA2 and Cyclin D1, a key regulator of G1 to S phase progression of the cell cycle, is Hewala TI3. strongly established as an oncogene with an important pathogenetic role in many human tumors; therefore any genetic variations that disturb the normal function of this gene product is ultimately a target for association with cancer risk and survival. Cyclin D1 silent mutation (G870A) in the splicing region of exon-4 enhances alternative splicing, resulting two CCND1 mRNA transcripts variant [a] and [b], in which transcript b has a longer half-life. It has been deduced that G870A polymorphism of the CCND1 Institution: gene may play a role in tumorigenesis. The aim of our study was to investigate the 1. Department of Applied influence of CCND1 genotypes on the genetic susceptibility to breast cancer in Medical Chemistry, Medical Research Institute, Egyptian population. Patients and Methods: Alexandria University, Egypt. 80 newly diagnosed females representing Egyptian population confirmed breast cancer patients and 40 healthy controls were included in the study. Single 2. Department of Cancer nucleotide polymorphism (SNP) in CCND1 (G870A) was determined in these samples Management and Research, by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). Medical Research Institute, Results: Alexandria University, The frequencies of AG, AA genotypes between patients group and the Egypt. healthy control group have shown a significant difference at (p=0,009). Subjects less than 45 years of age with AA genotype were at decreased risk (Îżdds ratio 0.438, 95% 3. Department of Radiation confidence interval 0.251-0.763) and postmenopausal subjects with AA genotype Sciences, Medical Research were at increased risk of developing breast cancer (Îżdds ratio 5.056, 95% confidence Institute, Alexandria interval 1.239-20.626). We found that breast cancer females carrying A allele had University, Egypt. longer DFS than did patients with GG genotype (p=0,001). Conclusion: This study provides the first indication that CCND1 870A alleles (AA/AG genotypes) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of CCND1 G870A polymorphism may be useful for identifying females with higher risk to develop breast cancer. Corresponding author: Ibrahim HAM

Web Address:

http://jresearchbiology.com/ documents/RA0396.pdf.

Keywords: Breast Cancer, Cyclin D1, Polymorphism, Egypt

Article Citation: Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI. Cyclin D1 Gene Polymorphism in Egyptian Breast Cancer Women. Journal of Research in Biology (2014) 3(8): 1111-1121 Dates: Received: 09 Oct 2013

Accepted: 17 Dec 2013

Published: 06 Feb 2014

This article is governed by the Creative Commons Attribution License (http://creativecommons.org/ licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited. Journal of Research in Biology An International Scientific Research Journal

1111-1121| JRB | 2014 | Vol 3 | No 8

www.jresearchbiology.com

Ibrahim et al., 2014 cancer (Buckley et al.,1993). On the other hand it is also

INTRODUCTION: Breast cancer has become the leading cause of

demonstrated

by a

correlation

between

CCND1

cancer death for females in Egypt. It represents 31% of

overexpression and cellular metastasis (Drobnjak et al.,

all cancers diagnosed and 15% of all cancer death and

2000). Silent polymorphism (G870A, pro241pro) occurs

the incidence is increasing worldwide (Coral and Amy,

in cyclin D1 coding gene, this commonly available SNP,

2010). Molecular biological

studies have clearly

affects the exon 4/intron 4 splice donor site and leads to

indicated that genetic alteration play significant role in

two different variants of the cyclin D1 mRNA (Betticher

the development of breast carcinoma in some cases and

et al.,1995). Diverse studies demonstrated that variant

they addressed by better understanding of what genetic/

transcript (a) has carried all exons whereas variant (b)

epigenetic events are likely to be associated with the

lack exon 5 including a PEST domain, which was

earliest phases of the disease (Sadikovic et al., 2008).

hypothesized to acts as a degradation motif. It has been

Cyclin D1 protein (35-KDa) is established as an

shown that variant transcript b lead to a longer half- life

oncogene, gene considered as one of the human D-type

of cyclin D1 (Betticher et al.,1995; Sawa et al.,1998).

cyclin genes which encoded by the 5 exons and mapped

Furthermore, cyclin D1 transcript (b) was appear to be

to chromosome bands 11q13 (Haber and Harlow, 1997).

weakly catalyst of RB phosphorylation / inactivation and

Cyclin D1 proto oncogene acts as a growth sensor target

significantly enhanced cell transformation activity

of proliferative signals in G1, by regulating the cell cycle

compared to cyclin D1 transcript (a) (Solomon et al.,

progression from G1-to- S phase transition in different

2003). It has been proved that the cyclin D1 isoform

cell type from various tissues (Donnellan and Chetty,

(cyclin D1b) is an unclear oncogene which is generated

1998; Baldin et al.,1993). Cyclin D1 active complexes

via CCND1 mRNA alternative splicing and involved in

that phosphorylate and inactivate the retinoblastoma

tumorigenesis through promoting the transition between

tumor suppressor protein (RB), are formed by the

G1 and S phases (Sawa et al.,1998; Solomon et al.,

binding of cyclin D1 to its dependent kinases 4 and 6

2003; Lu et al., 2003). Numerous studies have been

(CDK4/6). Hyperphosphorylation of RB in early G1

examined on the correlation between cyclin D1

phase allows to bind active RB to E2F transcription

polymorphism and risk of breast cancer, but those studies

factors and stimulates the cell cycle entry into S phase

yielded conflicting results (Grieu et al., 2003; Ceschi

(Sherr, 1993; Alao et al.,2006). Several studies have

et al., 2005; Yu et al.,2008; Forsti et al., 2004; Krippl

demonstrated that cyclin D1 can also act as a

et al., 2003; Wang et al., 2002). The aim of our study

transcriptional co-factor for steroid hormone receptors

was to investigate the influence of CCND1 genotypes on

e.g., estrogen receptor (Neuman et al.,1997; Tashiro

the genetic susceptibility to breast cancer in the Egyptian

et al.,2007). CCND1 overexpression occurs in a number

population.

of cancers including breast cancer, conversely repression of CCND1 gene expression is a hallmark of cell

MATERIALS AND METHODS:

differentiation (Gillett et al.,1996; James et al., 2006).

All patients (n=80) who had experienced primary

Moreover, Robert and Elizabeth (Sutherland and

invasive breast carcinoma, with median age 52.0 (range

Musgrove, 2002) reported that the cyclin d1 gene is

32.0-77.0) years, at the Experimental and Clinical

amplified in up to 20% of breast cancer patients and

Surgery and

overexpression occurs in more than 50% of mammary

Departments, Medical Research Institute, Alexandria

tumors, and this appears to be an early event in the breast

University From 2008 to 2012, were enrolled in this

1112

Cancer

Management

and

Research

Journal of Research in Biology (2014) 3(8): 1111-1121

Ibrahim et al., 2014 study. The samples were collected before surgery or any

Each PCR started within the initial heat-

chemotherapeutic treatment. Blood samples were taken

activation program to activate Hot Star Tag DNA

from patients who had pathological diagnosis and had

polymerase (95°C for 15 min), followed by 35 cycles of

not

receiving

denaturation at 94°C for 30 sec, annealing at 55°C for 90

immunomodulatory agent. The non tumor control group

sec, and extension at 72°C for 90 sec, with a final

(n=40), with median age 49.50 (range 36.0-71.0) years,

extension step at 72°C for 10 minutes. For RFLP

was composed of healthy women volunteers clinically

analyses, each PCR product was subjected to ScrF1

free from any chronic disease. Questionnaires, medical

restriction enzyme (New England, BioLabs Inc, UK).

records, and pathological reports were used to confirm

According to the manufacture’s protocol, 1 unit of

the diagnosis and cancer status. This study protocol was

restriction enzyme digests 1 μg of substrate DNA in a 50

approved by the Local Ethical Committee at Alexandria

μl reaction in 60 minutes. Agarose gel electrophoresis

University.

was used as the appropriate detection system. This gave

CCND1 genotyping

a satisfactory signal with our PCR product. The DNA

undergone

blood

transfusion

5-mL blood samples were obtained from cases

fragments were separated using 2% agarose gel

and controls. The samples were collected in tubes

containing ethidium bromide and the bands on the gel

containing EDTA and genomic DNA was purified from

were visualized by using UV Transilluminator.

peripheral whole blood using a ready- for use DNA

The allele types were determined, GG genotype

extraction kit (QIA amp DNA Blood mini kit, Qiagen,

showed two fragments (145 and 22bp), AG genotype

Hilden, Germany). Genotyping was performed by

showed three fragments (167, 145, and 22 bp) and AA

polymerase chain reaction

genotype showed single fragment (167-bp).

(PCR) and restriction

fragment length polymorphism (RFLP) (Enayat, 2002; Onay

al.,

2008),

using

semi

Statistical Analysis

quantitatively

Predictive Analytics Software (PASW Statistics

conventional polymerase chain reaction (PCR) kits

18) for Windows (SPSS Inc, Chicago, USA) was used

(Qiagen, Germany) according to producer’s instructions.

for statistical analysis. Chi-square test and Firsher’s

For amplifying CCND1 gene we used the following

Exact test (When more than 20% of the cells have

primers, Forward primer:5´- GTTTTCCCAGTCACGAC

expected count less than five) were used for testing

-3´;Reverse primer: 5´ GGGACATCACCCTCACTTAC

Association between categorical variables. Quantitative

-3´_; The CCND1 G870A polymorphism specific

data were described using median, minimum and

primers were ordered from QIAGEN system (QIAGEN,

maximum as well as mean and standard deviation.

Germany) to amplify a 167-bp fragment of CCND1 gene

Parametric and non-parametric tests were applied for

at exon 4/intron 4. The PCR reactions were performed on

analyzed normal data and abnormally distributed data,

a thermal cycler (Biometra- TProfessional Thermocycler

respectively. Odd ratio (OR) and 95% Confidence

-Germany) and the cycling program was programmed

Interval (CI) were used. Significance test results are

according to the manufacturer’s protocol. Specifically,

quoted as two-tailed probabilities. Significance of the

these reactions were carried out in a total volume 50 μl

obtained results was judged at the 5% level.

of QIAGEN Multiplex PCR Master Mix 25 μl, primer mix (2 μl taken from each 20μM primer working solution) 4 μl and Template DNA 21 μl.

RESULTS The clinical profile of breast cancer patients included in the current study presented in table (1). The

Journal of Research in Biology (2014) 3(8): 1111-1121

1113

Ibrahim et al., 2014 Table 1: Characteristics of normal healthy controls and breast cancer patients Clinical characteristics

Normal subjects (n = 40)

Breast cancer patients n = 80)

< 45

37.5

13.8

≥ 45

62.5

86.3

Test of significance (P- value)

Age (years)

Range

36.00 –71.00

32.00 – 77.00

Mean ± SD

50.15 ± 9.43

52.62 ± 10.07

49.50

52.0

Median

X2 test (P = 0.454)

Student T test (P = 0.198)

Menopausal status Premenopausal

50.0

46.3

Postmenopausal

50.0

53.8

x2p: p value for Chi square test

X2test X P = 0.698 2

*: Statistically significant at p < 0.05

frequencies of GG, AG and AA genotypes were 37.5%,

increased risk for developing breast cancer compared

20% and 42.5% respectively, in healthy controls

with the GG genotype [OR= 2.986, 95%CI (1.178-

and16.3%, 28.8% 55.0% respectively, in patients group.

7.569); p= 0.019 and OR= 3.317, 95% CI (1.110-9.915);

The statistical analyses of these results revealed that, in

p= 0.029, respectively]. In addition AA also had a higher

comparison with that in control group CCND1 (G870A)

risk in postmenopausal women [OR=5.056, 95% CI

AG and AA genotypes frequencies in breast cancer

(1.239-20.626); p= 0.019] than premenopausal ones

patients were insignificantly higher, whereas CCND1

[OR= 1.870, 95% CI (0.530-6.603); p= 0.328], table

(G870A) GG genotype frequency was significantly

(3a), and had reduced risk in younger women [<45 y/o,

lower (p= 0.009).Our results revealed that, frequencies of

OR=0.438, 95% CI (0.251-0.763); p= 0.046] than elder

the three genotypes GG, AG and AA between patients

ones[≥ 45 y/o, OR= 2.423, 95% CI (0.804-7.300);

and controls were significantly different (p =0.034,

p= 0.111], table (3b). Association of different CCND1

table 2).

G870A polymorphic variants among breast cancer

Table 3 shows the results of the CCND1

patients with pathological features were shown in table

genotype effects on breast cancer risk. AA, AG were at

(4). There was no significant differences with (p=0.688)

Table 2: Frequencies of CCND1 G870A genotype in breast cancer patients and controls Normal healthy controls (n=40)

Breast cancer patients (n = 80 )

No.

37.5

16.33

0.009*

AG AA

8 17

20.0 42.5

23 44

28.80 55.00

0.302 0.197

Polymorphic variants

p p: p value for Chi-square test 1114

0.034* *: Statistically significant at p ≤ 0.05 Journal of Research in Biology (2014) 3(8): 1111-1121

Ibrahim et al., 2014 Table (3): Association of CCND1 G870A polymorphism with breast cancer risk Healthy control group (n=40)

Breast cancer patients (n=80)

OR ( 95% CI) (lower– upper)

Test of sig

GG®

37.5

16.33

20.0

28.80

P = 0.029*

3.317 (1.110-9.915)

55.00 83.80

2.986 (1.178-7.569) 3.092 (1.291-7.405)

All participants

AA AA+ AG

17 25

42.5 62.5

44 67

1.000 (reference)

P = 0.019 P = 0.009*

p: p value for Chi-square tes FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 in the CCND1 genotypes distribution between stage T3

metastasis [OR= 0.247, 95%CI (0.072-0.848); p= 0.020]

and T4 tumors. Breast cancer patients carrying the

when compared with those carrying GG genotype.

CCND1 A allele had a 1.04-fold increased risk for lymph

Kaplen Meir disease free survival (DFS) curve was

node metastasis but this was not statistically significant

constructed to study the prognostic value of CCND1

(p=1.000). The CCND1 genotypes were furthermore not

G870A genotypes. The median fallow up period 25

associated with vascular invasion in carrier A allele

months (range 18-48 months) in which 22(27.5%) out of

patients was higher when compared with G allele carriers

80 patients had metastasis. The incidence of metastasis

and this difference was statistically insignificant

was observed in 53.9% of patients with GG genotype

(p=0.717). In addition breast cancer patients carrying A

and 46.2% of patients carrying A allele (AA / AG

allele (AA/AG genotypes) were at reduced risk of

genotypes) (table 5). Survival curve of the different

Table (3a): Association of CCND1 G870A polymorphism with breast cancer risk Healthy control group (n=15)

Breast cancer patients (n=11)

OR ( 95% CI) (lower– upper)

Test of sig

GG®

40.0

00.0

13.3

18.2

FEp = 0.133

0.500 (0.188-1.332)

81.8 100.0

0.438 (0.251-0.763) 0.450 (0.277-0.731)

Women ages <45 years

AA AA+ AG

7 9

46.7 60.0

Healthy control group (n=25)

9 11

Breast cancer patients(n=69)

1.000 (reference)

FEp = 0.046 FEp= 0.024*

Test of sig

OR ( 95% CI) (lower– upper)

GG®

36.0

18.8

24.0

30.4

p = 0.158

2.423 (0.699-8.400)

10 16

40.0 64.0

25 56

50.7 81.2

p = 0.111 P = 0.083

2.423 (0.804-7.300) 2.423 (0.878-6.689)

Women ages ≥ 45 years

AA AA+ AG

1.000 (reference)

p: p value for Chi-square tes FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 Journal of Research in Biology (2014) 3(8): 1111-1121

1115

Ibrahim et al., 2014 Table (3b): Association of CCND1 G870A polymorphism with breast cancer risk Healthy control group (n=21) No % Premenopausal status GG® AG AA AA+ AG

Postmenopausal status GG® AG AA AA+ AG

Breast cancer patients(n=34) No

Test of sig

OR ( 95% CI) (lower– upper)

5.143 (0.819-32.302)

83.1

20.6

9.5

26.5

FEp = 0.109

18 27

52.9 79.4

p = 0.328 P = 0.157

11 52.4 13 61.9 Healthy control group (n=19) No %

1.000 (reference)

Breast cancer patients (n=46) No

1.870 (0.530-6.603) 2.374 (0.707-7.969)

Test of sig

OR ( 95% CI) (lower– upper)

36.8

13.0

31.6

30.4

p = 0.171

2.722 (0.638-11.610)

1.000 (reference)

6 12

31.6 63.2

26 40

56.5 87.0

p = 0.019* P = 0.029*

5.056 (1.239-20.626) 3.889 (1.095-13.806)

p: p value for Chi-square tes FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 genotypes are shown in Fig. 1. A significant association

Possible

between the genotypes and survival was found in the

polymorphism and breast cancer susceptibility were

patients (p < 0.001). Furthermore, patients with GG

studied in different population and produced inconsistent

genotype had a worse prognosis and short survival

results. In the present study, we noticed that CCND1

(24.0±1.13 months) than patients carrying A allele (AA /

AA, AG and AA/AG genotype frequencies were more

AG genotypes) (41.92±1.20 months).

frequently observed in cases, whereas GG genotype frequency

DISCUSSION:

correlations

was

between

significantly

CCND1

higher

gene

controls.

Furthermore, genotype distribution between patient

Cyclin D1 (CCND1) is considered as one of the

group and controls are markedly different, suggesting

proteins that acts within a regulatory circuit that

that CCND1 G870A polymorphism is associated to

dominate cell cycle G1 to S-phase transition (Diehl,

breast cancer susceptibility. These observations were in

2002). Moreover, it is proved that cyclin D1 acts as a

concordance with previous findings suggesting that

dual function in promoting cell proliferation and

CCND1 genotype is associated with the breast cancer

inhibiting drug- induced apoptosis; these finding are

risk (Yu et al., 2008; Forsti et al., 2004). Multiple and

attributed to the presence of a chemoresistance during

specialized studies were conducted to evaluate the

overexpression (Biliran et al., 2005). In a normal breast,

CCND1 polymorphic variants and breast cancer patients

cyclin D1 protein plays uncompensated roles in

from different ethnic groups. Yu et al., (2008) conducted

mammary gland development during different growth

a study in China and found that cyclin D1 G870A

cycles, whereas, enhanced oncogenic transformation and

polymorphism lead a potential contribution to breast

tumorigenesis, of the CCND1 gene may be a primary

cancer with superiority occurrence of breast cancer in

and early step in breast cancer formation (Fu et al.,

young women.

2004). It is found that 45-50% of human breast

In the present series, Lu et al., (2009) conducted

carcinoma types are over expressed by the oncogenic

a Meta analysis on the association between CCND1

CCND1 mRNA (Sutherland and Musgrove, 2002).

G870A polymorphism and breast cancer susceptibility,

1116

Journal of Research in Biology (2014) 3(8): 1111-1121

Ibrahim et al., 2014 Table (4): Association of CCND1 G870A polymorphism with clinicopathological features of breast cancer GG®

AA+AG No

83.6

92.3

16.4

7.7

52.2

46.2

47.8

53.8

< 5®

52.2

38.5

≥5

47.8

61.5

-ve®

22.4

23.1

+ve

77.6

76.9

4.5

7.7

+ve Progesterone receptor status -ve®

95.5

92.3

9.0

15.4

+ve Her2/neu expression -ve®

91.0

84.6

88.1

76.9

11.9

23.1

19.4

23.1

+ve

80.6

76.9

-ve®

77.6

46.2

+ve

22.4

53.8

OR ( 95% CI) (lower– upper)

Test of sig

Tumor pathological grade II ® III

FEp =0.679

2.357 (0.277-20.033)

Clinical stage II ® III

0.784 (0.238-2.579)

p = 0.688

Tumor size (cm) 0.571 (0.169-1.928)

p = 0.363

Lymph node involvements

Estrogen receptor status -ve®

+ve Vascular invasion -ve®

FEp= 1.000

1.040 (0.253-4.270)

FEp= 0.515

1.778 (0.170-18.560)

FEp=0.610

1.848 (0.330-10.367)

FEp= 0.374

FEp= 0.717

0.452 (0.102-1.999)

1.246 (0.300-5.182)

Metastasis

p: p value for Chi-square test

FEp : p value for Fisher Exact test

p = 0.020*

0.247 (0.072-0.848)

*: Statistically significant at p ≤ 0.05

he observed that the Caucasian population which

In the present study, We found that individuals

increased breast cancer susceptibility were carrying a

carrying A allele of CCND1 G870A polymorphism (AA,

variant 870 A allele, however, it is not observed in the

AG, AA/AG) had a 2.9, 3.3 and 3.1 fold increased risk

Asians.

and

for the development of breast cancer compared with

environmental factors might also contribute to the ethnic

those carrying GG genotype (P=0.019, P=0.029,

difference. In contrast, some studies reported that there

P=0.009)

was no association between CCND1 polymorphic

interpreted in view of Betticher et al., (1995) who

variants and susceptibility to breast cancer (Grieu et al.,

indicated that the alternative splicing and production of

2003; Krippl et al., 2003; Shu et al., 2005).

altered transcript b occurs in individuals those carrying

The

study

reviewed

that

genetic

Journal of Research in Biology (2014) 3(8): 1111-1121

respectively.

These

finding

could

1117

Ibrahim et al., 2014 Table (5): Association of CCND1 G870A genotypes with breast cancer disease free survival (DFS)

GG (N= 13)

Metastasis N =22 7 (53.9%)

Non Metastasis N = 58 6 (46.2%)

Median (Mean ± SE) DFS (months) 24.0 (23.14 ± 1.30)

AG/AA (N=67)

15 (22.4%)

52 (77.6%)

44.0 (41.92 ± 1.20)

Log rank

26.617*

<0.001

*: Statistically significant at p<0.05

Figure 1: Kaplan-Meier disease free survival for CCND1 G870A genotypes the homozygosity for CCND1 A allele that may have

(2005) who stated that the A allele of the CCND1

longer half-life. Therefore cells will damaged DNA

G870A polymorphism was only weakly associated with

carrying A allele of CCND1 G870A polymorphism may

the risk of breast cancer among women ages < 45 years.

bypass G1/S check point easily compared to GG

These results lead us to predict that variant 870A allele

genotype. Also the study of Sawa et al., (1998) shown

may play a role in increasing estrogen metabolism and

that inhibition to the entry of the S phase in the cell cycle

inhibiting cell proliferation (Sutherland and Musgrove,

is occurred within high level of normal transcript a

2002). On the other hand postmenopausal females

occurrence. All these observations lead to proved that

carrying AA or combined variant (AA/AG genotypes)

different polymorphic CCND1 variants affect the

were at increased risk for breast cancer when compared

biological behavior of the cells, thus altering the risk of

with those carrying GG genotype. These findings agreed

developing breast cancer.

with the report of Grieu et al., (2003) who stated that A

Moreover, our results revealed that breast cancer

allele of CCND1 G870A polymorphism might play a

female patients < 45 years of age carrying AA or

more important role in the development of breast cancer

combined variant AA/AG genotypes were at decreased

among postmenopausal females.

risk of breast cancer than those with GG genotype. These

Furthermore, we evaluated the association of

finding are confirmed with the report of Shu et al.,

CCND1 G870A polymorphism with clinicopathological

1118

Journal of Research in Biology (2014) 3(8): 1111-1121

Ibrahim et al., 2014 features of breast cancer patients. We did not find any

cancer patients carrying the A allele of CCND1 G870A

significant association of carrying the A allele with

despite its positive association with increased risk of

tumor pathological grade III, clinical stage III, tumor size

breast cancer could be attributed to the induction of

â&#x2030;Ľ 5, axillary lymph node involvement, +ve hormone

cyclin D1 degradation by chemotherapy, causing cell

receptors status, +ve Her2/neu expression or vascular

death and apoptosis (Zhou et al., 2001).

invasion. These results may be attributed to the small

In conclusion, this study provides the first

sample size which limited our ability to detect a

indication that CCND1 870A allele (AA/AG genotypes)

significant difference.

is risk factors for breast cancer susceptibility in Egyptian

The correlation between CCND1 (A870G)

women. Thus analysis of CCND1 G870A polymorphism

polymorphism and cancer progression produced different

may be useful for identifying females with higher risk to

results. It is found that, carrying of 870A allele in

develop cancer. As compared with CCND1 870A allele

patients with advanced preinvasive neoplasia of the

and, CCND1 GG genotypes were significantly associated

larynx and/or oral cavity was positively correlated with

with shorter disease free survival in breast cancer

CCND1 expression and poor disease prognosis (Izzo

patients. Therefore analysis of these genes may also be

et al., 2003).

useful in identifying the breast cancer patients that have a

Also in non-small cell lung cancer the A allele of CCND1 (G870A) polymorphism had a more favorable

high risk of relapse and most likely to be benefit from the adjuvant chemotherapy.

disease free-survival and showed positive association with

increasing risk of local

relapse (Betticher

REFERENCES

et al.,1995). In contrast to results, a study on ovarian

Alao JP, Gamble SC, Stavropoulou AV, Pomeranz

cancer revealed that CCND1 polymorphic variants were

KM, Lam EW, Coombes RC, Vigushin DM. 2006.

not associated with the overall survival. On the other

The cyclin D1 proto-oncogene is sequestered in the

hand there was a positive correlation between 870A

cytoplasm of mammalian cancer cell lines. Mol Cancer

allele and early disease occurrence (Dhar et al., 1999).

5: 7.

Also the results of the study including 339 patients in CCND1 G870A polymorphism with breast cancer survival appear to be a null association with breast cancer prognosis (Grieu et al., 2003). These different

Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G. 1993. Cyclin D1 is a nuclear protein required for cell cycle progression in G1. Genes Dev. 7(5): 812-21.

results on CCND1 genotype and cancer prognosis may

Betticher DC, Thatcher N, Altermatt HJ, Hoban P,

be attributable to the cancer features in the study,

Ryder WD, Heighway J.1995. Alternate splicing

preparation design and treatment systems. Notably after

produces a novel cyclin D1 transcript. Oncogene 11:

a median 25 months of fallow up, only 27.5% of our

1005-11.

patients had metastasis of their breast cancer, suggesting that 72.5% of those patients are doing well in the short term with improvement in therapy. In the present study we found that carrying the A allele of CCND1 G870A polymorphism was related to a longer disease free survival for breast cancer than patients with GG genotype (p < 0.001). The favorable DFS for breast Journal of Research in Biology (2014) 3(8): 1111-1121

Biliran H Jr, Wang Y, Banerjee S, Xu H, Heng H, Thakur A, Bollig A, Sarkar FH, Liao JD. 2005. Overexpression of cyclin D1 promotes tumor cell growth and confers resistance to cisplatin-mediated apoptosis in an elastase-myc transgene-expressing pancreatic tumor cell line. Clin Cancer Res., 11(16):6075-86. 1119

Ibrahim et al., 2014 Buckley MF, Sweeney KJE, Hamilton JA, Sini RL,

Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. 2004.

Manning DL, Nicholson RI, deFazio A, Watts CKW,

Minireview: Cyclin D1: normal and abnormal functions.

Musgrove EA, Sutherland RL .1993. Expression and

Endocrinology 145(12):5439-47.

amplification of cyclin genes in human breast cancer. Oncogene 8:2127-2133.

Gillett C, Smith P, Gregory W, Richards M, Millis R, Peters G, Barnes D. 1996. Cyclin D1 and prognosis in

Ceschi M, Sun CL, Van Den Berg D, Koh WP, Yu MC, Probst-Hensch N. 2005. The effect of cyclin D1 (CCND1) G870A-polymorphism on breast cancer risk is modified by oxidative stress among Chinese women in Singapore. Carcinogenesis 26: 1457-64.

human breast cancer. Int J Cancer. 69(2):92-9. Grieu F, Malaney S, Ward R, Joseph D, Iacopetta B. 2003. Lack of association between CCND1 G870A polymorphism and the risk of breast and colorectal cancers. Anticancer Res 23: 4257-9.

Coral O and Amy T. 2010. The Differences between Male and Female Breast Cancer: In Principles of genderspecific medicine (2th ed.). Marianne J L (eds). Elsevier Inc (pub) 42(7): 459-69. Dhar KK, Branigan K, Howells REJ Musgrove C, Jones PW, Strange RC, Fryer AA, Redman CWE, Hoban PR. 1999. Prognostic significance of cyclin D1 gene (CCND1) polymorphism in epithelial ovarian cancer. Int J Gynecol Cancer. 9(4):342 –347.

Haber D, Harlow E. 1997. Tumour-suppressor genes: Evolving definitions in the genomic age. Nature Genetics 16: 320-322. Izzo JG, Papadimitrakopoulou VA, Liu DD, den Hollander PL, Babenko IM, Keck J, El-Naggar AK, Dong M. Shin, Jack Lee J, Waun K. Hong and Walter N. Hittelman. 2003. Cyclin D1 genotype, response to biochemoprevention, and progression rate to upper aerodigestive tract cancer. J Natl Cancer Inst 95

Diehl JA. 2002. Cycling to cancer with cyclin D1. Cancer Biol Ther., 1(3):226-31.

(3):198 – 205. James CG, Woods A, Underhill TM, Beier F. 2006.

Donnellan R and Chetty R. 1998. Cyclin D1 and

The transcription factor ATF3 is upregulated during

human neoplasia. Mol Pathol., 51: 1-7.

chondrocyte differentiation and represses cyclin D1 and

Drobnjak M, Osman I, Scher HI, Fazzari M, Cordon-

A gene transcription. 7:30.

Cardo C. 2000. Overexpression of cyclin D1 is

Krippl P, Langsenlehner U, Renner W, Yazdani-

associated with metastatic prostate cancer to bone. Clin

Biuki B, Wolf G, Wascher TC, Paulweber B, Weitzer

Cancer Res., 6:1891-5.

W, Leithner A, Samonigg H. 2003.

Enayat

MS.

2002.

Restriction

fragment

length

polymorphism. In: Methods of in molecular biology,

The 870G>A

polymorphism of the cyclin D1 gene is not associated with breast cancer. Breast Cancer Res Treat 82: 165-8.

PCR mutation detection protocols. Theophilus B D M,

Lu C, Dong J, Ma H, Jin G, Hu Z, Peng Y, Guo X,

Rapley R (eds). Human press Inc (pub), 5: 39-35.

Wang X, Shen H. 2009. CCND1 G870A polymorphism

Försti A, Angelini S, Festa F, Sanyal S, Zhang Z, Grzybowska E, Pamula J, Pekala W, Zientek H,

contributes to breast cancer susceptibility: a metaanalysis. Breast Cancer Res Treat 116: 571-5.

Hemminki K, Kumar R.2004. Single nucleotide polymorphisms in breast cancer. Oncol Rep., 1:917-22. 1120

Journal of Research in Biology (2014) 3(8): 1111-1121

Ibrahim et al., 2014 Lu F, Gladden AB, Diehl JA . 2003. An alternatively

mouse models. Breast Cancer Res 4(1):14-7. Epub 2001

spliced cyclin D1 isoform, cyclin D1b, is a nuclear

Nov 30.

oncogene. Cancer Res., 63: 7056-61.

Tashiro E, Tsuchiya A, Imoto. 2007. Functions of

Neuman E, Ladha MH, Lin N, Upton TM, Miller SJ,

cyclin D1 as an oncogene and regulation of cyclin D1

DiRenzo J, Pestell RG, Hinds PW, Dowdy SF, Brown

expression. Cancer Sci., 98:629-35.

M, Ewen ME. 1997. Cyclin D1 stimulation of estrogen receptor transcriptional activity independent of cdk4. Mol Cell Biol., 9: 5338-47.

Wang L, Habuchi T, Takahashi T, Mitsu K, Kamoto T, Kakehi Y, Kakinuma H, Sato K, Nakamura A, Ogawa O and Kato T. 2002. Cyclin D1 gene

Onay UV, Aaltonen K, Briollais L, Knight JA,

polymorphism is associated with an increased risk of

Pabalan N, Kilpivaara O, Andrulis IL, Blomqvist C,

urinary bladder cancer. Carcinogenesis 23(2): 257-264.

Nevanlinna H, Ozcelik H. 2008. Combined effect of CCND1 and COMT polymorphisms and increased breast cancer risk. BMC Cancer 8: 6. Sadikovic B, Al-Romaih K, Squire JA and Zielenska M. 2008. Cause and Consequences of Genetic and Epigenetic Alterations in Human Cancer. Current Genomics 9(6): 394 - 408. Sawa H, Ohshima TA, Ukita H, Murakami H, Chiba

Yu CP, Yu JC, Sun CA, Tzao C, Ho JY, Yen AM. 2008. Tumor susceptibility and prognosis of breast cancer associated with the G870A polymorphism of CCND1. Breast Cancer Res Treat. 107: 95-102. Zhou Q, Hopp T, Fuqua SA, Steeg PS. 2001. Cyclin D1 in breast premalignancy and early breast cancer: implications for prevention and treatment. Cancer Lett., 162(1):3 â&#x20AC;&#x201C; 17.

Y, Kamada H, Hara M, Saito I. 1998. Alternatively spliced forms of Cyclin D1 modulate entry into the cell cycle in an inverse manner. Oncogene 16: 1701-12. Sherr CJ. 1993. Mammalian G1 cyclins. Cell.73: 1059-1065. Shu XO, Moore DB, Cai Q, Cheng J, Wen W, Pierce L, Cai H, Gao YT, Zheng Wl. 2005. Association of cyclin D1 genotype with breast cancer risk and survival. Cancer Epidemiol Biomarkers Prev., 1(14): 91-7. Solomon DA, Wang Y, Fox SR, Lambeck TC,

Submit your articles online at www.jresearchbiology.com

Giesting S, Lan Z, Senderowicz AM, Conti CJ,

Advantages

Knudsen

ES.

2003. Cyclin D1 splice variants:

Differential effects on localization, RB phosphorylation, and cellular transformation. J Biol Chem., 278: 3033930347. Sutherland RL, Musgrove EA. 2002. Cyclin D1 and mammary carcinoma: new insights from transgenic

Journal of Research in Biology (2014) 3(8): 1111-1121

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

1121

Journal of Research in Biology

An International Scientific Research Journal

Original Research

Journal of Research in Biology

Role of p73 polymorphism in Egyptian breast cancer patients as molecular diagnostic markers Authors: Ibrahim HAM1, Ebied SA1, Abd El-Moneim NA2 and Hewala TI3.

ABSTRACT:

Corresponding author: Ibrahim HAM

Keywords: p73, Cyclin D1, polymorphism, diagnosis, Egypt.

Background: The incidence of breast cancer in Egyptian women is rising; to date, a few susceptibility genes have been identified. p73 protein (also known as p53-like transcription factor or p53-related protein) is one of the ancestors of the tumor suppressor p53 protein, whose gene is located within the chromosomal loci 1p36; a region most frequently deleted in human cancers. As a consequence of sharing same domain architecture with p53; p73 might regulate p53- response genes and induced cell cycle arrest/ apoptosis in response to DNA damage. A commonly studied non-coding polymorphism consisting of a double nucleotide substitutions (G→A) and (C→T) at position 4 and 14 exon 2, situated upstream of the initial AUG regions of p73. This functional consequence of p73 polymorphism may serve as a susceptibility marker for human cancer, but the results are inconsistent. Institution: Patients and Methods: 1. Department of Applied Eighty newly diagnosed females representing Egyptian population confirmed breast Medical Chemistry, Medical cancer patients and forty healthy controls, recruited from the departments of Experimental and Research Institute, Clinical Surgery and Cancer Management and Research, Medical Research Institute, Alexandria Alexandria University, University. Single Nucleotides Polymorphism (SNP) in p73 gene (G4C14-to-A4T14) was Egypt. determined in these samples by PCR-CTPP techniques. Results: 2. Department of Cancer Insignificant differences in the distributions of p73 genotypes between patients and Management and Research, controls were observed (p = 0.126). When p73 GC/GC genotype was used as the reference, the Medical Research Institute, combined variant genotypes (AT/AT)/(GC/AT) was significantly associated with the risk for Alexandria University, breast cancer [OR= 2.418, 95% CI (1.018-5.746); p= 0.042]. p73 [(GC/AT) /(AT/AT) genotypes] Egypt. was found to be associated with increased risk for breast cancer among women with pathological grade III, clinical stage III, tumor size ≥ 5 cm, axillary lymph node involvement and 3. Department of Radiation the +ve (Her2/neu) expression, but not significantly associated with +ve ER/PR status, vascular Sciences, Medical Research invasion and metastasis. Furthermore, patients carrying AT variant has a favorable prognosis (p Institute, Alexandria <0.001) and longer survival (41.33±1.45 months) than did patients carrying GC/GC genotype University, Egypt. (24.0±1.13 months). Conclusion: In conclusion, this study provides the first indication that p73 variants (AT/AT)/ (GC/ AT) are risk factors for breast cancer susceptibility in Egyptian women. Thus analysis of p73 G4C14- to- A4T14 polymorphism may be useful for identifying females with higher risk to develop cancer. Additional studies are needed to confirm these findings.

Web Address: http://jresearchbiology.com/ documents/RA0397.pdf.

Article Citation: Ibrahim HAM, Ebied SA, Abd El-Moneim NA and Hewala TI. Role of p73 polymorphism in Egyptian breast cancer patients as molecular diagnostic markers. Journal of Research in Biology (2014) 3(8): 1122-1131 Dates: Received: 09 Oct 2013

Accepted: 17 Dec 2013

Published: 06 Feb 2014

Journal of Research in Biology An International Scientific Research Journal

1122-1131 | JRB | 2014 | Vol 3 | No 8

www.jresearchbiology.com

Ibrahim et al., 2014 strengthen transcription activation (Kaghad et al.,1997).

INTRODUCTION: The global burden of breast cancer is growing

A part of p73 structure not present in p53 gene with an

larger in recent years .It is represent 31% of all cancers

expanded c-terminal region of p73 contains SAM (sterile

diagnosed and 15% of all cancer death in women (Coral

alpha motif) which acts as oligomerization domain and

and Amy, 2010). In Alexandria, Egypt, breast cancer

involved

accounts for 42.7% of malignancies among females

developmental regulation (Schultz et al., 1997; Ishimoto

(Alexandria Cancer Registry Annual Report, 2010).

et al., 2002).

protein-

protein

interactions

and

Molecular epidemiology is an emerging new field that

p73 gene is characterized by two promoters

for study not only the genetic and environmental causes

realizing different classes of proteins, the TAp73 protein

of carcinogenesis, but also interaction between the two

is generated by alternative splicing in the p1 promoter

(Perera and Weinstein, 2000). Therefore medicine is

region located upstream of exon 1, while the other

facing a new challenge, which is the identification of

alternative splicing located in intron 3 in the p2 promoter

determinations for genetic susceptibility to cancers

region is produceing the acidic NH2 terminally truncated

including breast cancer and the informations needed to

isoform (ΔNp73) which lack of all or most of the

accomplish this role require an understanding of human

transactivation domain (Ishimoto et al., 2002; Yang

genetic variation (Lyla and Dan, 2006).

et al., 2000; Stiewe et al., 2002).

Recent breast cancer epidemiologic studies

This ΔNp73 acts as a negative inhibitor towards

provide some genetic and epigenetic factors that play a

TAp73 and p53 (Grob et al., 2001). Observed that

role in the development of this disease, moreover, they

overexpression of p73 wild type is common alteration in

reported that individuals carrying breast carcinoma have

carcinogenesis particularly in patients with poor prognosis

a high probability to carry one of these factors(Coral and

(Stiewe and Putzer, 2002; Dominguez et al., 2001),

Amy, 2010).

rather,

∆TA-p73

isoform

significantly

detected

p73 (Jost et al., 1997), tumor suppressor gene

excessively in many types of cancers including breast

encoded protein that shares structural and functional

cancer (Alex et al., 2002; Uramoto et al., 2004; Douc-

homology with p53 but not identical. p73 gene located

Rasy et al., 2002; Casciano et al., 2002).

on chromosomal region 1p63, locus is deleted in a

Two silent single nucleotide polymorphisms

variety of tumorigenesis. Because of these similarities to

affect the five untranslated region in exon 2 at position

p53; p73 possiblely might activate p53 response genes

4/14 (G4C14-to-A4T14) produced different variants of

and induced cell cycle arrest or apoptosis in response to

p73 mRNAs (Kaghad et al.,1997). This p73 two linked

DNA damage (Kaghad et al.,1997). The wild -type

polymorphisms located upstream of the initiation AUG

isoform p73 α , contain 14 exons and gives rise to protein

codon of exon 2, causing stem-loop like structure during

containing 636 amino acids; it exhibits the same

transcription initiation thus, altering gene expression

structure of p53 and both have a transactivation domain

[(Kaghad et al.,1997; Melino et al., 2002). Many of the

(TA), a DNA binding domain (DBD), and an

studies have examined the correlation between p73 (GC/

oligomerization domain (OD) (Kaghad et al.,1997; Barry

AT) polymorphism and the risk of carcinogenesis (De

Trink et al., 1998; Thanos

Feo et al., 2009; Niwa et al., 2004; Li et al., 2004;

and Bowie, 1999). The

supreme similarity among all p53 family members present within the DNA binding domain indicated that p73 may bind the same DNA sequences like p53 and 1123

Pfeifer et al., 2005). Though, few studies have been conducted to investigate

the

impact

p73

dinucleotides

Journal of Research in Biology (2014) 3(8):1122-1131

Ibrahim et al., 2014 polymorphism on breast cancer susceptibility (Huang

CCACGGATGGGTCTGATCC-3´;

et al., 2003; Li et al., 2006). These studies producing a

(R1):

confused results. the aim of our study is to determined

Forward primer (F2): 5´-CCTTCCTTCCTGCAGAGCG

whether the p73 GC/AT dinucleotides polymorphism

3´;

are the risk factors for breast cancer susceptibility in

TTAGCCCAGCGAAGGTGG-3´; the p73 G4C14-to

Egyptian

there were any

A4T14 polymorphism specific primers were ordered

relationships of the p73 polymorphic variants with

from QIAGEN system (QIAGEN, Germany) to amplify

clinicopathological status.

a 260-bp fragment of p73 gene. The PCR reactions were

females, and

whether

Reverse

5´-GGCCTCCAAGGGCGACTT-3´

Reverse

primer

and (F2)

(R2):

5´

performed on a thermal cycler (Biometra- TProfessional METHODS:

Thermocycler-Germany) and the cycling program was

Patients:

programmed according to the manufacturer’s protocol.

All patients (n=80) who have experienced

Specifically, these reactions were carried out in a total

primary invasive breast carcinoma, with a median age

volume 50 µl of QIAGEN Multiplex PCR Master Mix 25

52.0 ( range 32.0-77.0) years, at the Experimental and

µl, primer mix (2 µl taken from each 20µM primer

Clinical Surgery and Cancer Management and Research

working solution) 8 µl , Template DNA 17 µl. Each PCR

Departments, Medical Research Institute, Alexandria

started within the initial heat- activation program to

University From 2008 to 2012, were enrolled in this

activate HotStar Tag DNA polymerase (95°C for 15

study. The samples were collected before starting any

min), followed by 35 cycles of denaturation at 94°C for

cancer treatments. Non tumor control group (n=40), with

30 sec, annealing at 62°C for 90 sec, and extension at 72

median age 49.50 (range 36.0-71.0) years, was composed

C° for 90 sec, with a final extension step at 72 °C for 10

of healthy women volunteers clinically free from any

minutes. Agarose gel electrophoresis was used as the

chronic disease. Other tools used to confirm our

appropriate detection system. This gave a satisfactory

information were questionnaires and medical reports.

signal with our PCR product. The DNA fragments were

This study protocol was approved by the Local Ethical

separated using 2% agarose gel containing ethidium

Committee at Alexandria University.

bromide and the bands on the gel were visualized by

p73 genotyping: 5-mL blood samples were

using UV Transilluminator. The allele types were

obtained from cases and controls. The samples were

determined as follows: two fragments of (270-, 428-bp)

collected in tubes containing EDTA and genomic DNA

for the AA genotype, three fragments of (193- , 270-,

was purified from peripheral whole blood using a ready-

428- bp) for the GA genotype and two fragments of (193

for use DNA extraction kit (QIA amp DNA Blood mini

-, 428- bp) for the GG genotype.

kit,

Statistical Analysis:

Qiagen,

Genotyping

was

Reaction

with

Data were analyzed using the Predictive Analysis

Confronting Two-Pair Primers (PCR-CTPP) [(Hamajima

Software (PASW statistics) for windows (SPSS Inc.

et al., 2000; Tamakoshi et al., 2003), using semi

Chicago,

quantitatively conventional Polymerase Chain Reaction

variables was tested using Chi – square test and Firsher’s

(PCR) kits (Qiagen, Germany) according to producer’s

exact test if more than 20% of the cell has expected

instructions.

account less than five. Range, mean, standard deviation

According to the published sequence of the human p73

and median were used with quantitative data. Parametric

gene, we designed four primers (Forward primer (F1):5´

tests were applied that reveals normal data distribution. If

performed

Hilden,

Germany).

Polymerase

Chain

Journal of Research in Biology (2014) 3(8):1122-1131

USA).

Association

between

categorical

1124

Ibrahim et al., 2014 data were abnormally distributed, the non parametric

G4C14/A4T14 polymorphism were analyzed among the

tests were used. Odd ratio (OR) and 95% confidence

controls and breast cancer patients. The frequencies of

interval were used and the P value was assumed to be

GC/GC, GC/AT and AT/AT genotypes were 31(77.5%),

significant at the 5% level.

8(20.0%) and 1(2.5%) for healthy controls and 47 (58.8%), 29(36.3%) and 4(5.0%) for breast cancer patients, respectively, table (2).

RESULTS:

The GC/AT genotypes of p73 G4C14/A4T14

The clinical profile of breast cancer patients included in the current study is presented in table (1).

were

not

correlated

with

age,

table

(3a)

and

Clinical characteristics of normal healthy female

Premenopausal status, table (3b). When p73 GC/GC

volunteers and patients with breast cancer were depicted

genotype was used as the reference, the combined variant

in table (1). Because the cases and control were

genotypes (AT/AT) / (GC/AT) was significantly

frequency- matched for age, there were no significant

associated with the risk for breast cancer [OR= 2.418,

differences in the distributions of age between cases and

95% CI (1.018-5.746); p= 0.042] table(3).

control (p=0.45). The genotype frequencies of P73 Table 1: Characteristics of normal healthy controls and breast cancer patients Clinical characteristics

Normal subjects (n = 40)

Breast cancer patients (n = 80)

< 45

37.5

13.8

≥ 45

62.5

86.3

Test of significance (P- value)

Age (years)

Range

36.00 –71.00

32.00 – 77.00

Mean ± SD

50.15 ± 9.43

52.62 ± 10.07

49.50

52.0

Median

X2 test (P = 0.454)

Student T test (P = 0.198)

Menopausal status Premenopausal

50.0

46.3

Postmenopausal

50.0

53.8

X2test X P = 0.698 2

x2p: p value for Chi square test *: Statistically significant at p < 0.05 Table 2: Frequencies of P73 (G4C14/A4T14) genotype in breast cancer patients and healthy controls Normal healthy controls (n=40)

Breast cancer patients (n = 80 ) p

No.

GC/GC

77.5

58.8

0.042*

GC/AT AT/AT

8 1

20.0 2.5

29 4

36.3 5.0

0.069 FEp =0.664

Polymorphic variants

p p: p value for Chi-square test 1125

0.126 FEp: p value for Fisher Exact test

*: Statistically significant at p ≤ 0.05

Journal of Research in Biology (2014) 3(8):1122-1131

Ibrahim et al., 2014 Table (3): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk

All participants GC/GC® GC/AT AT/AT AT/AT+GC/AT

Normal healthy controls

Breast cancer patients

31 8 1 9

77.5 20.0 2.5 22.5

47 29 4 33

58.8 36.3 5.0 41.3

Test of sig.

P = 0.055 FEp = 0.644 P = 0.042*

OR ( 95% CI) (lower– upper) 1.000 2.391 2.638 2.418

(reference) (0.968-5.908) (0.968-5.908) (1.018-5.746)

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 Table (3a): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk

Women age < 45years GC/GC® GC/AT AT/AT AT/AT+ GC/AT Women age ≥ 45 years GC/GC® GC/AT AT/AT AT/AT+ GC/AT

Normal healthy controls

Breast cancer patients

12 2 1 3

80.0 13.3 6.7 20.0

6 4 1 5

54.5 36.4 9.1 45.5

FEp = 0.192 FEp = 1.000 FEp = 0.218

1.00 (reference) 4.00 (0.563-28.396) 2.00 (0.106-37.830) 3.33 (0.588-18.891)

19 6 0 6

76.0 24.0 0.0 24.0

41 25 3 28

59.4 36.2 4.3 40.6

p = 0.322 FEp = 0.547 p = 0.139

1.00 (reference) 1.931 (0.680-5.484) 1.463 (1.232-1.738) 2.163 (0.767-6.094)

Test of sig.

OR ( 95% CI) (lower– upper)

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 Table (3b): Association of P73 (G4C14/A4T14) polymorphism with breast cancer risk Normal healthy controls Premenopausal status GC/GC® GC/AT AT/AT AT/AT+ GC/AT Postmenopausal status GC/GC® GC/AT AT/AT AT/AT+ GC/AT

Breast cancer patients

Test of sig.

OR ( 95% CI) (lower– upper)

16 4 1 5

76.2 19.0 4.8 23.8

22 10 2 12

64.7 29.4 5.9 35.3

FEp = 0.524 FEp = 1.000 p = 0.371

1.00 (reference) 1.181 (0.483-6.850) 1.455 (0.121-17.462) 1.745 (0.512-5.948)

15 4 0 4

78.9 21.1 0.0 21.1

25 19 2 21

54.3 41.3 4.3 45.7

FEp = 0.153 FEp = 0.530 FEp = 0.093

1.00 (reference) 2.850 (0.813-9.986) 1.600 (1.259-2.034) 3.150 (0.906-10.953)

p: p value for Chi-square test FEp : p value for Fisher Exact test *: Statistically significant at p ≤ 0.05 Association of different p73 (G4C14/A4T14)

associated with tumor pathological grade, clinical stage,

polymorphic variants among breast cancer patients with

tumor size, lymph node involvements and Her2/neu

clinicopathological features were shown in table (4).

expression. Patients with AT allele (GC/AT or AT/AT

Compared with GC/GC genotype, the combined variant

genotype) were potentially to be a positive lymph node

p73 GC/AT or AT/AT genotypes was significantly

status, advanced tumor stage or recurrence than patients

Journal of Research in Biology (2014) 3(8):1122-1131

1126

Ibrahim et al., 2014 Table (4): Association of p73 (G4C14/A4T14) polymorphism with clinicopathological features of breast cancer

GC/AT+AT/AT® No %

GC/GC® No %

Test of sig

OR ( 95% CI) (lower– upper)

Tumor pathological grade II ® III

72.7

93.6

27.3

6.4

FEp= 0.023*

5.500 (1.359-22.261)

Clinical stage II ®

18.2

74.5

III

81.8

25.5

Tumor size (cm) < 5®

12.1

76.6

87.9

23.4

3 30

9.1 90.9

15 32

31.9 68.1

FEp= 0.028*

6.1

4.2

FEp=1.000

≥5 Lymph node involvements -ve®+ve

p <0.001*

FEp <0.001*

13.125 (4.364-39.473)

23.727 (6.836-82.361)

4.688 (1.232-17.829)

Estrogen receptor status -ve® +ve

93.9

95.7

Progesterone receptor status -ve®

12.1

8.5

+ve

87.9

91.5

75.8

93.6

24.2

6.4

18.2

21.3

+ve

81.8

78.7

-ve® +ve

24 9

72.7 27.3

34 13

72.3 27.7

Her2/neu expression -ve® +ve Vascular invasion -ve®

0.689 (0.092-5.155) FEp=1.000 0.674 (0.156-2.915)

FEp= 0.044*

P= 0.733

4.693 (1.140-19.316)

1.216 (0.394-3.754)

Metastasis

p: p value for Chi-square test

p = 0.970

0.981 (0.362-2.660)

*: Statistically significant at p ≤ 0.05

FEp: p value for Fisher Exact test

with the GC/GC genotype. Kaplen Meir Disease Free

variant (AT/AT)/ (GC/AT) genotypes has a favorable

Survival (DFS) curve was constructed to study the

prognosis and longer survival (41.33±1.45 months) than

prognostic value of p73 (G4C14/A4T14) genotypes.

did patients carrying GC/GC genotype (24.0±1.13

After a median fallow up period of 25 months (range 18

months).

48 months), 22(27.5%) out of 80 patients had metastasis. The incidence of metastasis was observed in 27.7% of

DISCUSSION

patients with GC/GC genotype and 27.3% of patients

p73 protein was considered as one among the

carrying AT variant (AT/AT) / (GC/AT) genotypes

p53 family , the high level of similarity between p53 and

table (5). A significant association between the

p73 is appeared in the DBD domain which revealed that

genotypes and survival was found in the patients

p73 can bind and activate p53 target genes , thus induced

(p <0.001), figure (1). Furthermore, patients carrying AT

cell cycle arrest and apoptosis (Kaghad et al.,1997).

1127

Journal of Research in Biology (2014) 3(8):1122-1131

Ibrahim et al., 2014 Table (5): Association of p73 (G4C14/A4T14) genotypes with breast cancer disease free survival (DFS)

GC/GC (N=47) [(GC/AT)/(AT/AT)](N=33)

Metastasis N =22 13 (27.7) 9 (27.3%)

Non Metastasis N = 58 34 (72.3) 24 (72.7)

Median (Mean ± SE) DFS (months) 24.0 (24±1.13) 40.0 (41.33±1.45)

Log rank

20.557*

<0.001

*: Statistically significant at p<0.05

Figure (1): Kaplan-Meier disease free survival for p73 (G4C14/A4T14) genotypes Because of alternative N- and C- terminal splicing of

found in the p73 gene (designated as G4C14-to-A4T14).

transcription, p73 gives a variety of isoforms. Formation

This functional polymorphism lies upstream of the codon

of ∆N-isoform (shorter amino terminus lacking the TA

AUG of exon 2, region which might form a stem-loop

domain) requires activation of the alternative P2

like structure and affect translation efficiency (Kaghad

promoter in exon 3 / intron 3 � (Zaika et al., 2002). The

et al.,1997).

p73

amino-terminally truncated

(∆N)

isoform

The associations of p73

G4C14-to-A4T14

commonly called ∆TA-p73 and strongly established as

Polymorphism and cancer susceptibility have been

an oncogene. Therefore it is involved in the oncogenesis

investigated in different molecular epidemiological

by inhibiting tumor suppressive modulations of p53 and

studies, and produce conflicting results (Douc-Rasy

TA p73 (Zaika et al., 2002).

et al., 2002; Casciano et al., 2002; De Feo et al., 2009;

Numerous studies have proven that p73 protein is a classic tumor suppressor (Grob et al., 2001; Zaika

Niwa et al., 2004; Li et al., 2004; Pfeifer et al., 2005; Huang et al., 2003;Li et al., 2006).

et al., 2002; Benard et al., 2003). Surprise investigations

Therefore, this study was objective to examine

proved that the NH2-terminal truncated isoform of

the association of p73 G4C14→A4T14 polymorphism

human p73 (Np73) owning an opposite activities of

with breast cancer susceptibility and survival in 80 breast

TAp73 indicated that Np73 likely has an oncogenic

cancer Egyptian females with a median follow up of 25

function (Zaika et al., 2002). It is found that p73 is over-

months.

expressed in many cancer types including breast

In this study, we noticed that the two genotypes

carcinoma (Zaika et al., 1999; Cai et al., 2000; Kang

p73 (GC/AT) and (AT/AT) were more frequently

et al., 2000). Dinucleotides polymorphisms have been

observed in breast cancer patients whereas p73 GC/GC

Journal of Research in Biology (2014) 3(8):1122-1131

1128

Ibrahim et al., 2014 genotype was significantly higher in controls. However,

results suggest that AT variant allele has an important

insignificance difference in the genotypes distribution

role in breast cancer progression, and may provide the

between patients and controls was observed. Also found

clinician with additional information regarding patients

that the combined variant genotypes (GC/AT) / (AT/AT)

carrying AT variant with the risk of recurrence.

were more frequent in breast cancer patients [OR 2.418,

Results from the present study showed that

p=0.042] than those with GC/GC genotype. These results

patients with (AT/AT) / (GC/AT) genotypes had a more

indicated possible relationship between p73 G4C14–to–

favorable disease free survival than those with GC/GC

A4T14 polymorphism and breast cancer in Egyptian

genotype. Unexpectedly, our results taken together seem

population.

to show that there was a higher risk in developing breast

Moreover, we found that the combined variant

cancer of females carrying the AT/AT genotype, but

genotypes (GC/AT) / (AT/AT) were more frequent in

once affected, the patient has a better prognosis. Few

breast cancer patients [OR 2.418, p=0.042] than those

studies have shown that Tp73 polymorphism is a poor

with GC/GC genotype. These results indicated possible

prognostic factor in carcinogenesis (Grob et al., 2001;

relationship

Dominguez et al., 2001). Study in relationship between

between

p73

G4C14–to–A4

T14

ΔNp73 expression and prognosis in patient with lung

polymorphism and risk of breast cancer. that

cancer have concluded that positive expression of ΔNp73

individual carries AT allele is associated with increased

might be a possible marker in predicting poor prognosis

risk of developing breast cancers in Japanese population

(Uramoto et al., 2004; Casciano et al., 2002). These

(Li et al., 2004), gastric cancer in Caucasians population

funding might be due to the negative effect of p73

(De Feo et al., 2009), colorectal cancer in Korean

polymorphism in translation efficiency; further research

population (Pfeifer et al., 2005) and lung cancer in a non

with large number of samples are needed to confirm

-Hispanic white population (Huang et al., 2003). But few

these preliminary results.

Many

experimental

studies

showed

In summary, we found that p73 exon 2 G4C14-to

studies showed no correlations between p73 G4C14-to A4T14 Polymorphism and cancer risk (Choi et al., 2006;

-A4T14 polymorphism seem to have a major gene effect

Hu et al., 2005). Furthermore, very recently, Hu Y et al.,

on risk of breast cancer in Egyptian females. p73 GC/

(2012) conducted a Meta Analysis study and found that

GC genotype were significantly associated with shorter

Tp73 polymorphism (GC/AT) is probability associated

disease free survival in breast cancer patients . Larger

with cancer risk in most cancer types and ethnicities (Hu

prospective studies are needed to further confirm our

et al., 2012).

results.

Also we evaluated the association of p73 genotypes with pathological parameters of breast cancer patients. Compared with GC/GC genotype, the combined variant genotypes (GC/AT) / (AT/AT) were found to be associated with increased risk for breast cancer among women with pathological grade III [OR= 5.500, p= 0.023], clinical stage III [OR= 13.125, p < 0.001], tumor size ≥ 5 cm [OR= 23.727, p < 0.001], axillary lymph node involvement [OR= 4.688, p= 0.028] and the

REFERENCES: Alex I. Zaika, Neda Slade, Susan H. Erster, Christine Sansome, Troy W. Joseph, Michael Pearl , Eva Chalas, and Ute M. Moll. 2002. ΔNp73, A DominantNegative Inhibitor of Wild-type p53 and TAp73, Is Upregulated in Human Tumors. JEM. 196(6):765-780. Alexandria Cancer Registry Annual. Report 2010. Medical Research Institute, Alexandria University, Egypt.

+ve (Her2/neu) expression [OR= 4.693, p= 0.044]. These 1129

Journal of Research in Biology (2014) 3(8):1122-1131

Ibrahim et al., 2014 Barry Trink, Kenji Okami, Li Wu, Virote Sriuranpong, Jin Jen and David Sidransky. 1998. A new human p53 homologue. Nature Medicine. 4(7): 747 – 748. Benard J, Douc-Rasy S and Ahomadegbe JC 2003. TP53 family members and human cancers Hum Mutat. 21(3):182-191. Cai YC, Yang GY, Nie Y, Wang LD, Zhao X, Song YL, Seril DN, Liao J, Xing EP and Yang CS. 2000. Molecular alterations of p73 in human esophageal squamous cell carcinomas: loss of heterozygosity occurs frequently; loss of imprinting and elevation of p73 expression may be related to defective p53 Carcinogenesis. 21(4):683-689. Casciano I, Mazzocco K, Boni L, Pagnan G, Banelli B, Allemanni G, Ponzoni M, Tonini GP and Romani M. 2002. Expression of ΔNp73 is a molecular marker for adverse outcome in neuroblastoma patients. Cell Death Differ., 9(3):246-51. Choi JE, Kang HG, Chae MH, Kim EJ, Lee WK, Cha SI, Kim CH, Jung TH and Park JY. 2006. No associati on bet ween p73 G4C14-t o-A4T14 polymorphism and the risk of lung cancer in a Korean population. Biochemical genetics 4444(11-12): 533-540. Coral O and Amy T. 2010. The Differences between Male and Female Breast Cancer In Principles of genderspecific medicine (2th ed.). Marianne J L (eds). Elsevier Inc (pub), 42(7): 459-472. De Feo E, Persiani R, La Greca A, Amore R, Arzani D, Rausei S, D'Ugo D, Magistrelli P, van Duijn CM, Ricciardi G and Boccia S. 2009. A casecontrol study on the effect of p53 and p73 gene polymorphisms on gastric cancer risk and progression. Mutat Res., 675(1-2):60-5. Dominguez G, Silva JM, Silva J, Garcia JM, Sanchez A, Navarro A, Gallego I, Provencio M, España P and Bonilla F. 2001. Wild type p73 overexpression and highgrade malignancy in breast cancer. Breast Cancer Res Treat. 66 (3):183-90. Douc-Rasy S, Barrois M, Echeynne M, Kaghad M, Blanc E, Raguenez G, Goldschneider D, TerrierLacombe MJ, Hartmann O, Moll U, Caput D and Journal of Research in Biology (2014) 3(8):1122-1131

Bénard J. 2002. ΔN-p73 α accumulates in human neuroblastic tumors. Am J Pathol., 160(2):631-9. Grob TJ, Novak U, Maisse C, Barcaroli D, Luthi AU, Pirnia F, Hugli B, Graber HU, De Laurenzi V, Fey MF, Melino G and Tobler A. 2001. Human ΔNp73 regulates a dominant negative feedback loop for TAp73 and p53 Cell Death Differ., 8(12):1213-1223. Hamajima N, Saito T, Matsuo K, Kozaki K I, Takahashi T and Tajima K. 2000. Polymerase Chain Reaction with Confronting two-pair Primers for Polymorphism Genotyping. Jpn J Cancer Res., 91(9): 865–868. Hu Y, Jiang L, Zheng J, You Y, Zhou Y and Jiao S. 2012. Association between the p73 exon 2 G4C14-to A4T14 polymorphism and cancer risk: a meta-analysis. DNA Cell Biol., 31(2):230-7. Hu Z, Miao X, Ma H, Tan W, Wang X, Lu D, Wei Q, Lin D and Shen H. 2005. Dinucleotide polymorphism of p73 gene is associated with a reduced risk of lung cancer in a Chinese population. International journal of cancer. 114(3):455-460. Huang XE, Hamajima N, Katsuda N, Matsuo K, Hirose K, Mizutani M, Iwata H, Miura S, Xiang J, Tokudome S and Tajima K. 2003. Association of p53 codon Arg72Pro and p73 G4C14-to-A4T14 at exon 2 genetic polymorphisms with the risk of Japanese breast cancer. Breast Cancer. 10(4):307-311. Ishimoto O, Kawahara C, Enjo K, Obinata M, Nukiwa T and Ikawa S. 2002. Possible oncogenic potential of ΔNp73: a newly identified isoform of human p73 Cancer Res., 62(3):636-641. Jost CA, Marin MC and Kaelin WG Jr. 1997. p73 is a human p53-related protein that can induce apoptosis. Nature; 389(6647): 191-194. Kaghad M, Bonnet H, Yang A, Creancier L, Biscan JC, Valent A, Minty A, Chalon P, Lelias JM, Dumont X, Ferrara P, McKeon F and Caput D. 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell; 90(4): 809- 819. Kang MJ, Park BJ, Byun DS, Park JI, Kim HJ, Park JH and Chi SG. 2000. Loss of imprinting and elevated 1130

Ibrahim et al., 2014 expression of wild-type p73 in human gastric adenocarcinoma. Clin Cancer Res., 6(5):1767-71.

genotyping alcohol dehydrogenase β subunit (ADH2) and aldehyde dehydrogenase 2 (ALDH2). Alcohol 38 (5):407-10.

Li G, Wang LE, Chamberlain RM, Amos CI, Spitz MR and Wei Q. 2004. p73 G4C14-to-A4T14 polymorphism and risk of lung cancer. Cancer Res., 64 (19): 6863–6.

Thanos CD and Bowie JU. 1999. p53 Family members p63 and p73 are SAM domain-containing proteins. Protein Sci., 8(8):1708-10.

Li H, Yao L, Ouyang T, Li J, Wang T, Fan Z, Fan T, Dong B, Lin B, Li j and Yuntao Xie. 2006. Association of p73 G4C14-to-A4T14 (GC/AT) Polymorphism with Breast Cancer Survival, Carcinogenesis. 28(2):372 - 377.

Uramoto H, Sugio K, Oyama T, Nakata S, Ono K, Morita M, Funa K and Yasumoto K. 2004. Expression of ΔNp73 predicts poor prognosis in lung cancer. Clin Cancer Res., 10(20):6905-11.

Lyla MH and Dan GB. 2006. Genes, Behavior, and the Social Environment. National Academy of Sciences USA (pub) 44-8.

Yang A, Walker N, Bronson R, Kaghad M, Oosterwegel M, Bonnin J, Vagner C, Bonnet H, Dikkes P, Sharpe A, McKeon F and Caput D. 2000. p73- deficient mice have neurological, pheromonal and inflammatory defects but lack spontaneous tumours Nature. 404(6773): 99-103.

Melino G, De Laurenzi Vand Vousden KH. 2002. p73: friend or foe in tumorigenesis. Nat Rev Cancer. 2 (8):605 –615. Niwa Y, Hamajima N, Atsuta Y, Yamamoto K, Tamakoshi A, Saito T, Hirose K, Nakanishi T, Nawa A, Kuzuya K and Tajima K. 2004. Genetic polymorphisms of p73 G4C14-to-A4T14 at exon 2 and p53 Arg72Pro and the risk of cervical cancer in Japanese. Cancer Lett., 205(1):55-60. Perera FP and Weinstein IB. 2000. Molecular epidemiology: recent advances and future directions. Carcinogenesis. 21(3):517-24.

Zaika AI, Kovalev S, Marchenko ND and Moll UM.1999. Overexpression of the wild type p73 gene in breast cancer tissues and cell lines Cancer Res., 59 (13):3257-3263. Zaika AI, Slade N, Erster SH, Sansome C, Joseph TW, Pearl M, Chalas E and Moll UM. 2002. DeltaNp73, a dominant-negative inhibitor of wild-type p53 and TAp73, is up-regulated in human tumors. J Exp Med., 16; 196(6):765-80.

Pfeifer D, Arbman G and Sun XF. 2005. Polymorphism of the p73 gene in relation to colorectal cancer risk and survival. Carcinogenesis. 26 (1): 103–7. Schultz J, Ponting CP, Hofmann K and Bork P. 1997. SAM as a protein interaction domain involved in developmental regulation Protein Sci., 6 (1): 249-53. Stiewe T and Putzer BM. 2002. Role of p73 in malignancy: tumor suppressor or oncogene?. Cell death and differentiation. 9(3):237-45. Stiewe T, Zimmermann S, Frilling A, Esche H and Putzer BM. 2002. Transactivation-deficient ΔTA-p73 acts as an oncogene. Cancer Res., 62(13): 3598–3602. Tamakoshi A, Hamajima N, Kawase H, Wakai K, Katsuda N, Saito T, Ito H, Hirose K, Takezaki T and Tajima K. 2003. Duplex polymerase chain reaction with confronting two-pair primers (PCR-CTPP) for 1131

Submit your articles online at www.jresearchbiology.com Advantages

• • • • • •

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright

submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

Journal of Research in Biology (2014) 3(8):1122-1131

Journal of Research in Biology

An International Scientific Research Journal

Original Research

Efficient methods for fast, producible, C-Phycocyanin from

Journal of Research in Biology

Thermosynechococcus elongatus Authors: El-Mohsnawy Eithar.

Institution: Botany Department, Faculty of Science, Damanhour University, 22713, Egypt.

Corresponding author: El-Mohsnawy Eithar.

ABSTRACT:

This article describes different protocols that enhance the extraction, isolation and purification of phycocyanin from the cyanobacterium, Thermosynechococcus elongatus as well as absorbance and fluorescence spectral characterization. A combination of enzymatic degradation by Lysozyme followed by high pressure showed a mild cell wall destruction except for the composition of thylakoid membrane compared with glass beads. The use of ammonium sulfate precipitation as the first purification step exhibited high efficiency in removing most of the protein contamination. The best purified phycocyanin was obtained after using the second purification step that could be ion exchange chromatography or sucrose gradient. Unexpected results that were not used earlier were obtained by sucrose gradient, where a large amount of highly pure phycocyanin was assembled compared with published methods. An evaluation of C-phycocyanin throughout the series steps of isolation and purification was achieved by using absorbance and 77K fluorescence spectral analysis. Besides a spectroscopical evaluation, SDS-PAGE, productivity, and A620/A280 values pointed to the purity and structural preservation of a purified complex. Compared with published methods, the existing method not only reduces purification time but also enhances the productivity of phycocyanin in its native structure. The optimization of each purification step presented different purified phycocyanin levels; hence, it could be used not only by microbiologists but also by other researchers such as physicians and industrial applicants. In addition, this method could be used as a model for all cyanobacterial species and could be also used for Rhodophytes with some modifications. Keywords:

A620/A280 value, C-PC purification, C-Phycocyanin, Cyanobacteria, Fluorescence Spectra, IEC, Phycobilines, Sucrose Gradient, Thermosynechococcus elongatus. Abbreviations

A620/A280: Absorbance at 620 and 280 nm; Amm Sulf. ppt: Ammonium sulfate precipitate; APC: Allophycocyanin; MCF-7: Michigan Cancer Founda,on-7, referring to the ins;tute in Detroit where the cell line was established in 1973; OD: Op;cal density., PBP: Phycobilliprotein; PC (C-PC): Phycocyanin (phycocyanin from cyanobacteria); T. elongatus: Thermosynechococcus elongates; IEC: Ion exchange column.

Web Address: http://jresearchbiology.com/ documents/RA0419.pdf.

Article Citation:

El-Mohsnawy Eithar. Efficient methods for fast, producible, C-Phycocyanin from Thermosynechococcus elongates.

Journal of Research in Biology (2014) 3(8): 1132-1146 Dates: Received: 24 Jan 2014

Accepted: 05 Feb 2014

Published: 10 Feb 2014

1132-1146 | JRB | 2014 | Vol 3 | No 8

www.jresearchbiology.com

El-Mohsnawy Eithar, 2014 INTRODUCTION

One function of PC is energy absorbance which

Blue green are one of oldest prokaryotic fossils

is transferred by non-radiative transfer into APC and

(Schopf 2000) that have been known on the earth for

consequently into chlorophyll a, with an efficiency

more than 3.5 billion years. The traditional name ‘blue-

approaching 100%. In the absence or blocked the

green algae’ for Cyanophyceae is due to the presence of

photosynthetic reaction center (RC), the PBPs are

phycocyanin, allophycocyanin, and phycoerythrin, which

strongly fluorescent.

mask the chlorophyll pigmentation. Most cyanobacteria

C-phycocyanin is composed of two subunits: the

are found in fresh water, whereas others are found in

α-chain with one phycocyanobilin and the β-chain with

marines, in damp soil, or even in temporarily moistened

two phycocyanobilins (Troxler et al., 1981; Stec et al.,

rocks in deserts as well as in hot springs such as

1999; Adir et al., 2001; Contreras-Martel et al., 2007). In

Thermosynechococcus

elongatus.

elongatus

between,

there

are

large

amino-acid

sequence

considered a thermophilic obligate photoautotrophic

similarities. The αβ subunits aggregate into α3 β3 trimers

organism that contains chlorophyll a, carotenoids, and

and further into disc-shaped α6 β6 hexamers, the

phycobilins. For this reason, it has usually been used as a

functional unit of C-PC (Stec et al., 1999; Adir et al.,

model organism for the study of photosynthesis; such as,

2001; Contreras-Martel et al., 2007).

X-ray structure of PSI and PSII (Sonoike and Katoh

Nowadays, Phycocyanin receives a lot of

1989; Zouni et al., 2001; Jordan et al., 2001; and Katoh

attention

due

its

potential

medical

and

et al., 2001).

pharmaceutical treatments as well as in food industries.

In addition, Thermosynechococcus elongatus has

Its antioxidant protection of DNA has been demonstrated

been postulated as the model organism of choice for

by (Pleonsil and Suwanwong, 2013). It also promotes

structural studies. X-ray of photosystem I are studied by

PC12 cell survival, modulates immune and inflammatory

Jordan et al., 2001 and photosystem II are studied by

genes and oxidative stress markers in acute cerebral

Ferreira et al., 2004 and Loll et al., 2005. A crystal

hypoperfusion in rats (Marín-Prida et al., 2013), prevents

structure of the cytochrome b6f complex has been

hypertension and low serum adiponectin level in a rat

determined from another thermophilic cyanobacterium,

model of metabolic syndrome (Ichimura et al., 2013),

Mastigocladus laminosus (Kurisu et al., 2003).

exhibits an antioxidant and in vitro antiproliferative of

activity (Thangam et al., 2013), and involves an

Thermosynechococcus elongatus attached to external

apoptotic mechanism of MCF-7 breast cells either in vivo

light-harvesting structure known as the phycobilisome

or in vitro induced by photodynamic therapy with

(PBS; reviewed by Adir 2005), which acts as a light-

C-phycocyanin (Li et al., 2010).

The

th ylakoid

membrane

harvesting system for PSII and, to some extent, for PSI

For these reasons, a lot of attention is directed

(Rögner et al., 1996). The Synechococcus elongatus

toward improving the purification of phycocyanin from

phycobilisome consists of allophycocyanin (APC) and

several cyanobacterial organisms. The purification of

C-phycocyanin (C-PC), along with the linker proteins

C-phycocyanin from Spirulina platensis has been

(Adir, 2005). The bilin pigments are open-chained

reported by Bhaskar et al., (2005); from Anacystis

tetrapyrroles that are covalently bound to seven or more

nidulans (Gupta and. Sainis 2010); and in aqueous

proteins. These chromophores are composed of the

phytoplankton by Lawrenz et al., 2011.

cyclic iron (heme) tetrapyrrole (Frankenberg and Lagarias 2003; Frankenberg et al., 2003). 1133

Although all these represented evaluations were based on the ratio of A620/A280, which is suggested by Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 Bryant et al., (1979) and Boussiba and Richmond (1979),

Chloride and 0.2 % (w/v) Lysozyme). Stirring was

this ratio does not save an optimum image of the

applied at 37 °C for 30 minutes in the dark condition. In

presence of other impurities such as APC with

the first protocol, the cell wall was disrupted by applying

C-phycocyanin, where the existence of APC does not

2000 psi pressure using Parr bomb at at 4°C for 20

strongly disturb this ratio. Purity ratios varied among

minutes (El-Mohsnawy et al., 2010). However, in the

publications: 4.3 (Minkova et al., 2003), 3.64 (Niu et al.,

second protocol was done according to Kubota et al.,

2007), 4.05 (Patil and Raghavarao 2007), 4.72 (Gupta

2010, where T. elongatus cells were mixed with an equal

and Sainis 2010), and more than four (Pleonsil and

volume of glass beads (0.5 mm of Glass Beads, Soda

Suwanwong 2013).

Lime, BioSpec Products), and then, the cells were

This article displays the simple, fast, and

exposed to 18 disrupted cell cycles (10s ec glass beads

effective protocol by which large scales of PC were

break and 2min 50sec pause) on a vortex mixer (BSP

purified.

Bead-Beater 1107900, BioSpec Products). Phycocyanin crude extract was collected by

MATERIAL AND METHODS

suspending the thylakoid membrane with HEPES buffer

Culturing and assembly of T. elongatus

at pH 7.5 (20mM HEPES, 10mM MgCl2, 10 mMCaCl2, were

and 0.4 M mannitol) or with HEPES buffer at pH 7.5

cultivated in BG-11 medium at 50 °C with a stream of

containing 0.03% ß-DM and centrifugation at 3000 g at 4

5% (v/v) CO2 in air (according to Rippka et al., 1979).

°C for 10 min. The supernatant was collected, and pellets

Cells were grown in Polyamide flasks (2.5-L). 200-ml

were exposed to an additional extraction step using the

preculture cells were used for an inoculation of 2 L

same buffer and centrifugation conditions. By using

culture. The used white light was provided at about 100

glass bead disruption, an additional isolation step was not

µE*m-2*s-1. After incubation period, the cells were

required.

harvested in the exponential growth phase. The optical

Purification steps

density at 750 nm was 2.5 - 3.

First purification step:

Thermosynechococcus

elongatus

cells

Cells were sedimented by centrifugation at 2000

This step was preceded using two sequences of

g for 15 minutes (GSA-Rotor, Sorvall). The supernatant

ammonium sulfate precipitation steps. Ammonium

was removed. Cells in the pellet were washed once with

sulfate salts were added to the crude extract in HEPES

MES buffer (20mM MES, 10 mM Magnesium chloride,

buffer till it reached 20 %, was stirred at 4°C for 30

and 10 mM Calcium Chloride) and then re-centrifuged at

minutes followed by centrifugation of 6000 g at 4 °C for

the same speed and conditions.

15 min (Beckman -JA-14 Rotor). The pellets were

Extraction of phycocyanin

discarded. Additional ammonium sulfate salts were

The extraction of phycocyanin crude extract was

added to the supernatant till they reached 50 % saturation

performed in two steps. The first step was cell wall

and were stirred at 4°C for 60 minutes. Centrifugation of

destruction, and the second step was isolation of

12000 g at 4 °C for 30 min (Beckman -JA-14 Rotor) was

phycocyanin from the thylakoid membrane. Two

used

destruction techniques were applied. In both techniques,

(El-Mohsnawy, 2013).

collected T. elongatus cells were suspended in 100 ml of

Second purification step:

sediment

partial

purified

phycocyanin

MES containing Lysozyme buffer at pH 6.5 (20mM

Pellets were dissolved in HEPES buffer at pH 7.5

MES, 10 mM Magnesium chloride, and 10 mM Calcium

(20mM HEPES, 10mM MgCl2, 6mM CaCl2, and 0.4 M

Journal of Research in Biology (2014) 3(8): 1132-1146

1134

El-Mohsnawy Eithar, 2014 against HEPES buffer at pH 7.5 (20mM HEPES, 10mM

methanol and 10% acetic acid for 20 min. The gel was

MgCl2, 10mMCaCl2, and 0.4 M mannitol) for 6 hours

stained with Coomassie Brilliant Blue reagent (0.2% (w/

before loading to IEC (POROS HQ/M).

v), Coomassie Brilliant Blue R, 40% (v/v) methanol, and

Sucrose gradient

7 % (v/v) acetic acid) for an additional 20 min. The gel

Sucrose gradient was prepared by dissolving

was destained by immersing the gel in a mixture of 30 %

20 % (w/v) sucrose in HEPES buffer at pH 7.5 (20mM

(v/v) methanol and 10 % (v/v) acetic acid for 8–12 hours.

HEPES, 10mM MgCl2, and 10 mMCaCl2). 12 ml of

Absorption spectral analysis

sucrose solution was poured into each centrifuge tube

1 ml of crude or purified phycocyanin complexes

(SW40-Rotor ultracentrifuge, Beckman) followed by

was diluted in buffer (20 mM HEPES, pH 7.5, 10 mM

freezing and slowly thawing overnight at 10°C. 100 µl of

MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it

OD620 nm 6 suspensions were slowly dropped onto the

reached a maximum OD620 nm of 0.2–0.8 before

top of sucrose gradients. After centrifugation at 36000

measuring the absorption spectra from 250 to 750 nm.

rpm

4°C (SW40-Rotor

While thylakoid pellets were diluted to OD680 nm of 1.2-

ultracentrifuge, Beckman), two identical bands were

2. Two spectrophotometers are used according to the

detected. The lower band (phycocyanin) was collected

purpose of measurements. For fast evaluation of the

for further investigation.

efficiency of each purification step, 2 µl of sample was

Ion Exchange Chromatography (IEC)

used (NanoDrop ND-1000 Spectrophotometer). 500 µl

for

about

12 hours at

POROS HQ/M column was used as IEC for the

samples were used in case of Shimadzu UV-2450 or

second purification step. The column was equilibrated by

Beckman Du7400. Phycocyanin concentration was

8 CV of IEC equilibration buffer (20 mM MES, pH 6.5,

estimated according to an equation suggested by Bennett

10mM MgCl2, and 10 mMCaCl2) before loading the

and Bogorad 1973; Bryant et al. 1979: PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38

phycocyanin suspension. After loading the samples, washing occurred for 5 CV. The gradient from 0 to 200

Fluorescence emission spectra at 77 K

mM MgSO4 with a step at 35 mM that was carried out

Fluorescence emission spectra were performed in

for the elution of purified C-phycocyanin complex.

an SLM-AMINCO Bauman, Series 2 Luminescence

Purified phycocyanin was eluted at 23 mM MgSO4.

spectrometer (Schlodder et al., 2007). Phycocyanin

Purified phycocyanin was concentrated by centrifugation

complex was diluted to OD620 nm 0.05 buffer containing

at 3000 r/min for 40 min at 4°C using an Amicon 10,000

20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2,

Dalton weight cut-off.

and 60 % glycerol. The diluted sample was frozen to 77

SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

K by gradual immersion in liquid nitrogen. 580 nm of

actinic light was used for excitation. Fluorescence

Schägger and Von Jagow (1987). Briefly, 6 µl of

emission spectra were monitored in the range from 600

phycocyanin (OD620 nm 3) was mixed with sample

to 800 nm with a step size of 1 nm and a bandpass filter

buffer. Then, the mixture was injected into SDS-PAGE

of 4 nm.

SDS-PAGE

was

performed

according

(12% Acrylamide). The electrophoresis was carried out by applying a current of 100 mA for 30 min, and then,

RESULTS:

the current was reduced to 60 mA until the samples

The

purification

phycocyanin

from

reached the edge of the gel. After electrophoresis, SDS-

T. elongatus cells was achieved via several steps, so the

PAGE was fixed by incubation in a mixture of 50 %

optimization of each step was required to enhance the

1135

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 Table 1 a: Summary of purity of phycocyanin (expressed as A620/A280 ratio), productivity (expressed as percent to crude extracts), and required periods for each step. Step Crude HEPES

A620/A280 ratio 1.02909 ± 0.08229

Productivity % 100

Estimation Time 30.0 min.

Crude ß-DM

0.26732 ± 0.05131

100

30.0 min.

Crude Beads

1.09185 ± 0.07352

100

30.0 min.

After Amm Sulf. ppt

3.49497 ± 0.11303

2.0 hours

After IEC

4.51656 ± 0.03006

7.5 hours

Step After concentration

A620/A280 ratio 2.59960 ± 0.24710

Productivity % 93

After Sucrose gradient

4.40767 ± 0.03941

Table 1 b: Estimation Time 30.0 min. 8.0 hours

mannitol) till they reached six at OD620nm. The

occurred for 5 CV. The magnesium sulfate gradient (0 to

suspension was divided into two parts. The first part was

200 mM) with a step at 35 mM was used for the elution

fractionated using 20% sucrose gradient, and the second

part was dialysis against HEPES buffer at pH 7.5 (20mM

phycocyanin was eluted at 23 mM MgSO4. Amicon

HEPES, 10mM MgCl2, 10mMCaCl2, and 0.4 M

10,000 Dalton weight cut-off tube was used for

mannitol) for 6 hours before loading to IEC (POROS

concentrating the purified complex at 3000 r/min for 40

HQ/M).

min at 4°C.

Sucrose gradient

SDS-polyacrylamide gel electrophoresis (SDS-PAGE)

20 g of sucrose was dissolved in 100 ml HEPES

purified

C-phycocyanin

SDS-PAGE

was

complex.

performed

Purified

according

buffer at pH 7.5 (20mM HEPES, 10mM MgCl2, and 10

Schägger and Von Jagow (1987). Briefly, 6 µl of purified

mMCaCl2). 12 ml of sucrose solution was poured into

phycocyanin (OD620 nm 3) was mixed with sample buffer.

each centrifuge tube (SW40-Rotor

ultracentrifuge,

Then, the mixture was injected into SDS-PAGE (12%

Beckman) followed by freezing and slowly thawing

Acrylamide). Starting current was 100 mA for 30 min,

overnight at 10 °C. 100µl phycocyanin partially purified

and then, reduced to 60 mA until the samples reached the

extract of OD620 nm six was slowly dropped onto the top

edge of the gel. After electrophoresis, a mixture of 50 %

of sucrose gradients. Centrifugation took place at 36k

methanol and 10 % acetic acid was used to fix SDS-

rpm

4°C (SW40-Rotor

PAGE for 20 min. The gel was stained with Coomassie

ultracentrifuge, Beckman); two identical bands were

Brilliant Blue reagent (0.2 % (w/v), Coomassie Brilliant

observed. The lower band was found to be C-

Blue R, 40 % (v/v) methanol, and 7 % (v/v) acetic acid)

phycocyanin (El-Mohsnawy, 2013).

for an additional 20 min. The gel was destained by

Ion Exchange Chromatography (IEC)

immersing the gel in a mixture of 30 % (v/v) methanol

for

about

12 hours at

POROS HQ/M column was used as the second purification step. The column was equilibrated by 8 CV of IEC equilibration buffer (20 mM MES, pH 6.5, 10mM

and 10 % (v/v) acetic acid for 8–12 hours. Absorption spectra Crude or purified phycocyanin complex was

the

diluted in the buffer (20 mM HEPES, pH 7.5, 10 mM

phycocyanin partially purified extract. Samples were

MgCl2, 10 mM CaCl2, and 0.5 M mannitol) till it reaches

loaded in the flow rate of 1 ml/min and then washing was

a maximum OD620 nm of 0.2–0.8. Then, the absorption

MgCl2,

and

mMCaCl2)

before

Journal of Research in Biology (2014) 3(8): 1132-1146

1136

PC Purification

Cell Destruction

El-Mohsnawy Eithar, 2014

Figure 1: Scheme shows different isolation and purification steps for phycocyanin purification. During the first purification step, two series of ammonium sulfate precipitation were applied. spectra were measured in the range of 250 to 750 nm.

suggested by Bennett and Bogorad 1973; Bryant et al.,

While thylakoid pellets were diluted to OD680 nm of 1.2-2.

1979:

Two different spectrophotometer apparatus were used according to the purpose of measurements. For fast evaluation of the efficiency of each purification step, 2 µl

PC (mg.ml) = {A620 – (0.7*A650)}/ 7.38 77 K Fluorescence emission spectra Fluorescence emission spectra at 77K were

ND-1000

measured and investigated in an SLM-AMINCO

Spectrophotometer). 500 µl samples were used in case of

Bauman, Series 2 Luminescence spectrometer according

Shimadzu UV-2450 or Beckman Du7400. Phycocyanin

to Schlodder et al., 2007. Phycocyanin was diluted to

concentration was estimated according to an equation

0.05 at optical density of 620 nm using buffer containing

1137

sample

was

used

(NanoDrop

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 1.2

1.2 HEPES extraction

0.8 0.6 0.4

0.8

Amm Sulf sediment

0.6 0.4 0.2

0.2

ß-DM extraction Beads extraction

Abs orb anc e (R U)

Absorbance (RU)

HEPES extraction

ß-DM extraction Beads extraction Amm Sulf sediment

250

350

450

550

650

750

Wa ve le ng th (nm )

450

500

550

600

650

700

Wa veleng th (nm)

Figure 2 a: Absorption spectra of crude extracts by different conditions and after ammonium sulfate precipitation. 500 µl samples were measured by Shimadzu UV-2450 spectrophotometer. Absorption spectra 250-750 (A), absorbance 550-700 (B) 20 mM HEPES, pH 7.5, 10 mM MgCl2, 10 mM CaCl2

absorbance comparison between Lysozyme + HEPES,

and 60 % glycerol. Sample was frozen to 77 K by

Lysozyme + HEPES containing 0.03 % ß-DM, and

gradual immersion in liquid nitrogen. The used actinic

extraction by glass beads. It is obvious that the use of

light was 580 nm. Fluorescence emission spectra were

glass-bead destruction yielded a large amount of

observed in the range from 600 to 800 nm.

allophycocyanin which has a maximum absorbance at 650 nm, in addition to small peaks at 680 nm for PSI and

RESULTS:

673 nm for PSII that also have a maximum absorbance from

of nearly 440 nm. The absorption spectrum at 650 nm

T. elongatus cells was achieved via several steps, so the

proves the contamination of C-phycocyanin by a large

optimization of each step was required to enhance the

amount of allophycocyanin, whereas the absorbance at

productivity as well as the purity of phycocyanin. The

280 nm proves the presence of an additional large

scheme shown in Figure 1 illustrates the summary steps

amount of non-colored proteins. Extraction by HEPES

of extraction and purification of phycocyanin.

buffer showed a small shoulder at 650 nm, compared

Cell destruction and extraction of crude extract.

with the same buffer containing ß-DM. A remarkable

The

purification

phycocyanin

Two different techniques have been used for cell

peak at 440 nm and small shoulders were observed at

destruction: combination of 0.2 % Lysozyme with

650 nm and 680 nm in case of HEPES buffer containing

pressure (2000 psi) or combination of 0.2 % Lysozyme

ß-DM, which confirmed the contamination with PS (I

with glass-beads vortex. 0.2 % Lysozyme with pressure

and II) complexes. It should be pointed out that the high

(2000 psi) exhibited mild destruction of the cell wall

absorbance value of HEPES buffer containing ß-DM

while keeping the thylakoid membrane in its native

compared with other treatments may reflect the ability of

structure, even the attached phycobilisomes. After cell

ß-DM to dissolve large amounts of protein which do not

destruction, the crude extract was isolated using HEPES

have absorption spectra in visible regions. However, high

(pH 7.5) buffer or HEPES (pH 7.5) containing 0.03 % ß-

contamination of crude extract by allophycocyanin in

DM.

different

case of using glass beads did not exhibit a big difference

spectroscopical behavior. On the other hand, glass beads

in A620/A680 value (Table 1) compared with HEPES

destroyed the cell wall and thylakoid membrane, so

extraction.

Both

crude

extracts

exhibited

centrifugation led to sedimentation of the largest

This is regarding the close of absorption spectra

photosynthetic complexes. Figure 2a, b shows the

between allophycocyanin and phycocyanin (650 and 619

Journal of Research in Biology (2014) 3(8): 1132-1146

1138

El-Mohsnawy Eithar, 2014 3

T hylak oid m e m bra ne P e llets afte r ß-DM ex tra c tion P e llets w ithout ß-DM e x tra c tion

Absorbance RU

2.5

664 nm, 686 nm, and 733 nm for PSI. These spectra point to the presence of more allophycocyanin, PSII, and PSI in case of isolation by buffer containing ß-DM.

Purification

1.5

Ammonium sulfate precipitation

Phycocyanin crude extract containing other 0.5

impurities (allophycocyanin, photosystem complexes, 0 250

350

450

550

650

750

and other soluble proteins) was exposed to two series of

Wav e le ng th nm

Figure 3 a: Absorption spectra of pellets after different extraction conditions. Pellets were suspended in HEPES 7.5 buffer till they reached an OD680 of 1.5−2. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.

ammonium sulfate precipitation. In the first step (20% ammonium sulfate), large hydrophobic proteins were sedimented; whereas after the second step, phycocyanin was precipitated. A remarkable reduction in the absorbance at 650 nm, 440 nm, and 280 nm (Figure 2a b) was observed, which proves the high efficiency of these two steps to remove most of the dissolved and large hydrophobic contaminated proteins. These results were supported by A620/A280 value (3.494 ± 0.113) as shown in Table 1. This value is considered quite high, indicating the purity of phycocyanin.

Figure 3 b: 77K fluorescence emission spectra of different extraction conditions compared with ammonium sulfate precipitation. Samples were diluted with HEPES 7.5 buffer containing 60 % glycerol to OD620 = 0.05. The applied actinic light was 580 nm.

Although the absorption spectra and A620/A280 value pointed to pure phycocyanin, the emission fluorescence spectra showed the presence of some contamination (Figure 3b), where fluorescence emission spectra at 664 nm and 686 nm were detected apart from

nm, respectively). It could be concluded that the

647 nm, which indicates the presence of a few

extraction with HEPES buffer was the best kind of

contaminations of allophycocyanin in phycocyanin crude

extraction. Re-dissolving the thylakoid membrane in

extracts.

HEPES buffer not only enhanced the extraction of

Second purification steps.

phycocyanin

but

also

increased

the

amount

Since

purification

ammonium

sulfate

thylakoid

precipitation did not reach an optimum A620/A280 value,

membrane pellets exhibited no significant differences

C-phycocyanin extract needs an additional purification

between phycocyanin extracted by HEPES buffer and

step. A chromatographic step has been applied to reach

that extracted by HEPES buffer containing ß-DM,

an optimum value.

whereas a remarkable reduction was observed in the

Purification by IEC

allophycocyanin.

Absorption

spectra

absorbance at 440 nm and 680 nm in case of extraction

After 50% ammonium sulfate precipitation, the

by HEPES buffer only (Figure 3a). These results are

pellet was dissolved in HEPES buffer followed by

supported by 77K fluorescence spectra (Figure 3b),

dialysis against HEPES buffer for 8 hours. Changing of

where a high peak was observed at 647 nm for both

dialysis buffer was done after 2 hours. POROS HQ/M

isolation steps; whereas higher peaks were detected at

column was equilibrated with HEPES buffer before

1139

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 phycocyanin, sucrose gradient was found to be a fast and effective step for the same purpose. Sucrose gradient was prepared as described in the “Materials and Methods” section. A highly contaminated crude extract-derived glass-bead extraction step was concentrated using a 10,000 Amicon tube before being dropped directly onto the top surface of the sucrose gradient tube. After centrifugation, two distinct bands were observed. The Figure 4: Elution profile of purified phycocyanin using IEC (Poros HQ/M). The column was equilibrated by 8 CV of HEPES 7.5 buffer before loading. PC was eluted at 35 mM of MgSO4.

lower one was C-phycocyanin, and the upper one was allophycocyanin (Figure 5). The phycocyanin band was collected, washed by HEPES buffer, and concentrated to OD619 = 3 before storing it. Phycocyanin evaluation of both methods Evaluation of the purification of C-phycocyanin did not stop at the level of A620/A280 values and total yield,

whereas

extended

investigated

spectroscopically and by SDS-gel

PAGE. Room

temperature

C-phycocyanin

absorption

spectra

purified by IEC and sucrose gradient exhibited almost the same behavior, where only one peak was detected at a maximum absorbance of 619 nm; whereas a reduction in the absorbance at 355 nm and 280 nm was observed. Moreover, the small shoulder at 650 nm disappeared. 77K Figure 5: Sucrose density gradient of concentrated crude extract. 20% sucrose was frozen and slowly thawed at 10 °C. 100 µl of OD620 nm 6 suspensions were slowly dropped onto the top of sucrose gradients and centrifuged at 36000 rpm for about 12 hours at 4°C (SW40-Rotor ultracentrifuge, Beckman).

emi ssi on

fl uor escen ce

spectral

investigations of phycocyanin purified by IEC or fractionated by sucrose gradient exhibited only one peak at 647 nm; whereas shoulders at 664 nm and 686 nm disappeared (Figure 6b). These results supported absorbance results and indicated the purity of the

loading partial purified phycocyanin. Figure 4 shows the

complex. With regard to the A620/A280 value, purification

elution gradient of MgSO4 (0-150 mM) with a step at 35

by IEC and sucrose gradient produced 4.5 and 4.4 (Table

mM that was used to elute highly purified phycocyanin.

1a &b). These values pointed to high-quality C-

Pure phycocyanin was eluted at 35 mM of magnesium

phycocyanin. As shown in Figure 7, the SDS-gel

sulfate.

electrophoresis page, alpha, and beta phycocyanin

Phycocyanin

complex

was

desalted

and

concentrated to OD619 = 3. Quite a high A620/A280 value

subunits

are

visualized

without

any

additional

(4.516 ± 0.03) was obtained.

contamination. These results provided high evidence for

Purification by sucrose density gradient

the efficiency of the presented methods. purification

A summary evaluation of chromatographic and

presented a highly purified and large yield of C-

sucrose gradient methods are shown in Tables 1a and 1b.

Although

the

chromatographic

Journal of Research in Biology (2014) 3(8): 1132-1146

1140

El-Mohsnawy Eithar, 2014 protocols required longer time and more equipment. To reach an optimum PC complex (large amount, pure, and in a short time), the production of C-phycocyanin passed through 2 main steps. The first step was the isolation of PC, and the second one was purification. Each step was monitored spectroscopically in order to achieve high efficiency. Since the cyanobacterial cell wall is composed of Figure 6 a: Absorption spectra of purified phycocyanin after ammonium sulfate precipitation, IEC purification, and sucrose gradient. A partial purified phycocyanin was used to visualize the difference at 650 nm. 500-µl samples were measured by a Shimadzu UV-2450 spectrophotometer.

peptidoglycan with an external lipopolysaccharide layer such as gram-negative bacteria, the design of cell destruction is very important, by which the cell wall is destroyed while keeping the thylakoid membrane in its native structure. As shown in the “Results” section, a combination of Lysozyme with 2000 psi was effective and mild. These results were in agreement with Gan et al., (2004) for Spirulina sp., Santos et al., (2004) for Calothrix sp., and Gupta and Sainis (2010) for Anacystis nidulans. The use of a combination of Lysozyme and glass beads was very strong and caused the destruction of both the cell wall and the thylakoid membrane, resulting in

a huge amount

contamination,

especially

allophycocyanin. These contaminations extended to include photosystem complexes in case of using a buffer containing ß-DM. It should be pointed out that further Figure 6 b: 77K fluorescence emission spectra of phycocyanin purified by ammonium sulfate precipitation, IEC, and sucrose gradient, and these were precipitated by ammonium sulfate. Samples were diluted with HEPES 7.5 buffer containing 60 % glycerol to OD620 = 0.05. The applied actinic light was 580 nm.

extractions by HEPES buffer enhanced the isolation of the remaining C-phycocyanin, in addition to a large amount of allophycocyanin. There was an inverse relationship between the repetition of extraction and PC isolation, whereas a direct relationship has been recorded

There were no significant differences in A620/A280 values,

with regard to allophycocyanin (El-Mohsnawy, 2013). A

whereas the total productivity was high in case of the

model in Figure 8 illustrates a comparison between

sucrose gradient. In addition, a significant reduction in

different isolation conditions. It could be concluded that

purification time was observed in case of the sucrose

a combination between Lysozyme and high pressure

gradient.

(2000 psi) with HEPES buffer was ideal for phycocyanin isolation

DISCUSSION The

have

and been

the

purification

low

contamination.

Different

reported

for

investigated. A combination of two or more purification

different

steps were usually applied till they reach a high A620/A280

cyanobacterial species using several steps. These 1141

C-phycocyanin purification conditions have been widely

extraction

C-phycocyanin

with

ratio.

combination

ultrafiltration

charcoal

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 additional chromatographic steps were included to purify C-PC to A620/A280 of 3.91 with a yield of 9% (Herrera et al., 1989). This method was improved by Gupta and Sainis (2010) and reached 2.18 and 4.72, respectively. Com binat i on

am m oni um

sul fat e

with

chromatographic purification has been used for obtaining C-phycocyanin

different

purity

levels

and

recommended by Rito-Palomares et al., 2001 and Song et al., 2013. On the other hand, the use of two-phase aqueous

extraction

followed

chromatographic

purification was recently reported by Soni et al., 2008. Although it produced extremely pure C-phycocyanin with A620/A280=6.69, the total yield was affected. In the Figure 7: SDS-gel PAGE of purified phycocyanin. Lane 1 marker protein, lane 2 phycocyanin purified by sucrose gradient and lane 3 phycocyanin purified by IEC.

present work, two strategies have been applied. The first one was based on two steps: ammonium sulfate precipitation followed by chromatographic purification (IEC). The second strategy was based on

the

adsorption and spray drying was used to obtain C-PC

concentration of crude extract followed by sucrose

with A620/A280 of 0.74 and a yield of 34%, whereas

gradient fractionation. Through concentration of crude

Components of crude extract

Photosystem II Photosystem I

Cytochrome b6f

ATPase

Allophycocyanin C-Phycocyanin

B-DM Phospholipide

Glass-beads

Figure 8: Model illustrates the major protein isolated as a result of different extraction conditions. This model is based on the results of absorbance and 77k fluorescence spectral analysis. Journal of Research in Biology (2014) 3(8): 1132-1146

1142

El-Mohsnawy Eithar, 2014 for

his laboratory. I would like to thank Hisako Kubota for

concentration C-phycocyanin but also for the removal of

fruit discussions. I would like to thank Mrs Regina

the small-molecular-weight soluble protein.

Oworah-Nkruma for technical assistance rendered.

extract

was

considered

important

not

only

To evaluate this new purification step (sucrose gradient), a highly contaminated PC crude extract

REFERENCES

(Lysozyme with glass beads) was concentrated by an

Adir N, Dobrovetsky Y and Lerner N. 2001. Structure

Amicon 10,000 centrifugation tube and exposed to

of c-phycocyanin from the thermophilic cyanobacterium

sucrose density gradient fractionation. The astonishing

Synechococcus vulcanus at 2.5 Å: structural implications

results were recorded by the sucrose gradient that gave

for thermal stability in phycobilisome Assembly. J Mol

almost the same purity and a much better yield.

Biol. 313(1):71–81.

After several optimization sequences, it could be recommended that the digestion of T. elongatus cell wall by Lysozyme and the exposure to high pressure (2000 psi) followed by PC extraction by HEPES buffer once or

Adir N. 2005. Elucidation of the molecular structures of components of the phycobilisome: reconstructing a giant. Photosynth. Res., 85(1): 15–32.

twice was found to be the best condition for the isolation

Bennett A and Bogorad L. 1973. Complementary

of partial pure PC. This crude extract should be

chromatic adaptation in a filamentous blue-green alga.

concentrated through an Amicon 10,000 centrifugation

J Cell Biol., 58(2):419-35.

tube before fractionation by the sucrose gradient. Isolation and purification should be quick, reliable, and efficient; so, absorbance and fluorescence spectra facilitated the purity of C-phycocyanin, thus enabling the optimization of each step. Several advantages of the

Bhaskar SU, Gopalaswamy G and Raghu R. 2005. A simple method for efficient extraction and purification of C-phycocyanin from Spirulina platensis Geitler. Indian J Exp Biol., 43(3):277-279.

sucrose gradient method are that it reduces the amount of

Boussiba S and Richmond AE. 1979. Isolation and

lost PC complex during purification sequences, produces

characterization of phycocyanins from the blue-green

a highly purified complex (A620/A280 value), and reduces

alga Spirulina platensis. Arch Microbiol., 120(2):155–

time; thus, it could be considered a standard model that is

159.

applied in different cyanobacteria species and too simple not to be used by specialists.

Bryant DA, Guglielmi G, Tandeau de marsac N, Castets AM and Cohen-Bazire G. 1979. The structure of cyanobacterial phycobilisomes: a model. Arch

ACKNOWLEDGMENTS I would like to express my deep thanks for

Microbiol., 123(2):113–127.

Prof. Rögner Matthias (Ruhr University Bochum), who

Contreras-Martel C, Matamala A, Bruna C, Poo-

giving

some

Caamaño G, Almonacid D, Figueroa M, Martínez-

chromatographic and spectroscopical measurements.

Oyanedel J and Bunster M. 2007. The structure at 2 Å

Also, I acknowledge the German Research Council, DFG

resolution of phycocyanin from Gracilaria chilensis and

for the financial support. Prof. Kurisu, Genji (Protein

the energy transfer network in a PC–PC complex.

Center of Osaka University) is gratefully acknowledged

Biophys Chem., 125(2-3):388–396.

the

opportunity

measure

for permitting me to do a part of practical work in 1143

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 Schlodder

Yamaguchi N, Suruga K and Omagari K. 2013.

Warscheid

Phycocyanin prevents hypertension and low serum

Karapetyan NV and Rögner M. 2010. Structure and

adiponectin level in a rat model of metabolic syndrome.

function of intact photosystem 1 monomers from the

Nutr Res., 33(5): 397-405.

El-Mohsnawy Nowaczyk

Kopczak

Meyer

cyanobacterium

MJ,

HE,

Thermosynechococcus

elongatus.

Biochemistry. 15; 49(23):4740-4751.

Jordan P, Fromme P, Witt HT, Klukas O, Saenger W and Krauss N. 2001. Threedimensional structure of

El-Mohsnawy E. 2013. Purification, Characterization,

cyanobacterial photosystem I at 2.5 A resolution. Nature.

and Activity Evaluation of Allophycocyanin from

21 411(6840):909-917.

Thermosynechococcus elongatus. Life Science Journal. 10(4): 3754-3761. 503.

Katoh H, Hagino N, Grossmann AR and Ogawa T. 2001.

Genes essential to iron transport in the

Ferreira, KN, Iverson, TM, Maghlaoui, K, Barber, J

cyanobacterium Synechocystis sp. strain PCC 6803.

and Iwata S. 2004. Architecture of the photosynthetic

J Bacteriol., 183(9): 2779-2784.

oxygen-evolving center. Science. 303 (5665):1831-1838.

Kubota H, Sakurai I, Katayama K, Mizusawa N,

Frankenberg N, Moser J and Jahn D. 2003. Bacterial

Ohashi S, Kobayashi M, Zhang P, Aro EM and

heme biosynthesis and its biotechnological application.

Wada H. 2010. Purification and characterization of

Appl Microbiol Biotechnol., 63(2):115-127.

photosystem I complex from Synechocystis sp. PCC

Frankenberg

Phycocyanobilin:

and

Lagarias

Ferredoxin

JC.

2003.

Oxidoreductase

6803 by expressing histidine-tagged subunits. Biochim Biophys Acta. 1797(1):98-105.

Anabaena sp. PCC 7120: Biochemical and spectroscopic

Kurisu G, Zhang H, Smith JL and Cramer WA.

characterization. The Journal of Biological Chemistry.

2003. Structure of the cytochrome b6f complex of

278(11): 9219-9226. DOI 10.1074/jbc.M211643200.

oxygenic photosynthesis: Tuning the cavity. Science.

Gan X, Tang X, Shi C, Wang B, Cao Y and Zhao L.

302(5647):1009-1014.

2004. Preparation and regeneration of spheroplasts from

Lawrenz E, Fedewa EJ and Richardson TL. 2011.

Arthrospira platensis (Spirulina). J Appl Phycol., 16

Extraction protocols for the quantification of phycobilins

(6):513–517.

in aqueous phytoplankton extracts. J Appl Phycol., 23

Gupta

and

Sainis

JK.

2010.

Isolation

(5):865–871.

C-phycocyanin from Synechococcus sp., (Anacystis

Li B, Chu X, Gao M and Li W. 2010. Apoptotic

nidulans BD1). J Appl Phycol., 22(3):231–233.

mechanism of MCF-7 breast cells in vivo and in vitro

Herrera A, Boussiba S, Napoleone V and Hohlberg A. 1989.

Recovery

C-phycocyanin

from

the

cyanobacterium Spirulina maxima. J Appl Phycol., 1 (4):325–331. Ichimura M, Kato S, Tsuneyama K, Matsutake S, Kamogawa M, Hirao E, Miyata A, Mori S, Journal of Research in Biology (2014) 3(8): 1132-1146

induced by photodynamic therapy with C-phycocyanin. Acta Biochimica et Biophysica Sinica. Sin (Shanghai). 42 (1):80-89. Loll B, Kern J, Saenger W, Zouni A and Biesiadka J. 2005. Towards complete cofactor arrangement in the 3.0A resolution structure of photosystem II. Nature. 438 (7070):1040-4. 1144

El-Mohsnawy Eithar, 2014 Marín-Prida J, Pavón-Fuentes N, Llópiz-Arzuaga A,

Rögner M, Boekema EJ and Barber J. 1996. How

Fernández-Massó JR, Delgado-Roche L, Mendoza-

does photosystem 2 split water? The structural basis of

Marí Y, Santana SP, Cruz-Ramírez A, Valenzuela-

efficient energy conversion. Trends Biochem Sci., 21

Silva C, Nazábal-Gálvez M, Cintado-Benítez A,

(2):44-9.

Pardo-Andreu GL, Polentarutti N, Riva F, PentónArias E and Pentón-Rol G. 2013. Phycocyanobilin promotes PC12 cell survival and modulates immune and inflammatory genes and oxidative stress markers in acute cerebral

hypoperfusion

rats.

Toxicol

Appl

Pharmacol.,. 1; 272(1):49-60. Minkova KM, Tchernov AA, Tchorbadjieva MI, Fournadjieva ST, Antova RE and Busheva MCh. 2003. Purification of C-phycocyanin from Spirulina (Arthrospira) fusiformis. J Biotechnol., 102(1):55–59. Niu JF, Wang GC, Lin XZ and Zhou BC. 2007. Large -scale recovery of C-phycocyanin from Spirulina platensis

using

expanded

bed

adsorption

chromatography. J Chromatogr B. 850(1-2): 267–276. Patil G and Raghavarao KSMS. 2007. Aqueous two phase extraction for purification of C-phycocyanin. Biochem Eng J., 34(2):156–164.

Santiago-Santos Ramirez

MC,

Ponce-Noyola

Ortega-Lopez

and

Olvera-

Canizares-

Villanueva RO. 2004. Extraction and purification of phycocyanin from Calothrix sp. Process Biochemistry. 39(12): 2047-2052. Schägger, H and von Jagow, G. 1987. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Analyt Biochem., 166(2): 368-379. Schlodder E, Shubin VV, El-Mohsnawy E, Rögner M and Karapetyan NV. 2007. Steady-state and transient polarized absorption spectroscopy of photosystem I complexes from the cyanobacteria Arthrospira platensis and Thermosynechococcus elongatus. Biochim Biophys Acta. 2007 (6):732-741. Schopf JW. 2000. The fossil record: tracing the roots of the cyanobacterial lineage. In: Whitton BA, Potts M

Pleonsil P and Suwanwong Y. 2013. An in vitro study

(eds) The ecology of cyanobacteria: Their Diversity in

of c-phycocyanin activity on protection of DNA and

Time and Space. Kluwer, Dordrecht. p 13–35.

human erythrocyte membrane from oxidative damage. Journal of Chemical and Pharmaceutical Research. 5 (5):332-336 . Rippka R, Deruelles J, Waterbury JB, Herdman M and Stanier RY. 1979. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiology. 111(1):1–61.

Song W, Zhao C and Wang S. 2013. A Large-Scale Preparation Method of High Purity CPhycocyanin. International Journal of Bioscience, Biochemistry and Bioinformatics. 3(4):293-297. Soni B, Trivedi U and Madamwar D. 2008. A novel method

single

step

hydrophobic

interaction

chromatography for the purification of phycocyanin from

Rito-Palomares M, Nuñez L and Amador D. 2001.

Phormidium

Practical application of aqueous two phase systems for

antioxidant property. Bioresour Technol., 99(1):188–

the development of a prototype process for c-

194.

phycocyanin recovery from Spirulina maxima. J Chem Techn Biotechnol., 76(12):1273–1280.

1145

fragile

and

its

characterization

for

Sonoike K and Katoh S. 1989. Simple estimation of the differential absorption coefficient of P-700 in detergent-

Journal of Research in Biology (2014) 3(8): 1132-1146

El-Mohsnawy Eithar, 2014 treated preparations. Biochim Biophys Acta. 976(23):210–213. Stec B, Troxler RF and Teeter MM. 1999. Crystal structure of C-phycocyanin from Cyanidium caldarium provides a new perspective in on phycobilisome assembly. Biophys J., 76(6): 2912–2921. Thangam R, Suresh V, Asenath Princy W, Rajkumar M, Senthilkumar N, Gunasekaran P, Rengasamy R, Anbazhagan C, Kaveri K and Kannan S. 2013. C-Phycocyanin from Oscillatoria tenuis exhibited an antioxidant and in vitro antiproliferative activity through induction of apoptosis and G0/G1 cell cycle arrest. Food Chem., 140(1-2):262-72. Troxler RF, Ehrhardt MM, Brown-Mason AS and Offner GD. 1981. Primary structure of phycocyanin from the unicellular rhodophyte Cyanidium caldarium. II. Complete amino acid sequence of the beta subunit. J Biol Chem., 256(23):12176–12184. Zouni A, Witt HT, Kern J, Fromme P, Krauss N, Saenger W and Orth P. 2001. Crystal structure of photosystem II from Synechococcus elongatus at 3.8 A resolution. Nature. 409(6821):739-43.

Submit your articles online at www.jresearchbiology.com Advantages

• • • • • •

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright

submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

Journal of Research in Biology (2014) 3(8): 1132-1146

1146

Journal of Research in Biology

An International Scientific Research Journal

Original Research

Journal of Research in Biology

Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District, Assam, India Authors: Banjit Bhatta1 and Mrigendra Mohan Goswami2.

ABSTRACT: Present study reports the length-weight relationship, condition factor and relative condition factor of Channa aurantimaculata (Musikasinthorn, 2000), a hole dwelling snakehead endemic fish species (Goswami et al., 2006, Vishwanath and Geetakumari, 2009) of a riparian wetland habitat of Dhemaji district, Assam. Lengthweight relationship, condition factor and relative condition factor of the species was Institution: evaluated during the feeding cycle (December - March/April) in the year November 1. Department of Zoology, Dhemaji College, Dhemaji- 2008 to October 2009. The relative growth coefficient (b) values for male was found to 787057 (Assam). be 4.18 and for female was 2.65, the condition factor (K) value was 1.29 ± 0.27 for male and 1.66 ± 0.28 for female, relative condition factor (Kn) value 1.05 ± 0.42 in 2. Department of Zoology, male and 1.00 ± 0.40 in female were observed. The coefficient of correlation (r ) in Gauhati University, Guwahati- 781014 (Assam). both the sexes exhibit allometric growth (negative in female and highly positive in male). Corresponding author: Banjit Bhatta.

Web Address: http://jresearchbiology.com/ documents/RA0406.pdf.

Keywords: Channa aurantimaculata, L-W relationship, condition factor, Dhemaji district

Article Citation: Banjit Bhatta and Mrigendra Mohan Goswami. Length-Weight relationship and condition factor of Channa aurantimaculata (Musikasinthorn, 2000) studied in a riparian wetland of Dhemaji District, Assam, India. Journal of Research in Biology (2014) 3(8): 1147-1152 Dates: Received: 15 Dec 2013

Accepted: 15 Jan 2014

Published: 10 Feb 2014

1147-1152 | JRB | 2014 | Vol 3 | No 8

www.jresearchbiology.com

Bhatta and Goswami, 2014 factor of Channa aurantimaculata from the natural stock

INTRODUCTION: The growth performance and well-being of any

of Lachia beel, a riparian wetland (Longitude 94°57

fish species in relation to habitat diversity are determined

27// E and Latitude 27°38/ 33// N ) located in Dhemaji

through the measure of its length- weight relationship

District of Assam.

and condition factor. Such a knowledge on length and weight is useful in the assessment of fish stock and

MATERIALS AND METHODS

population to predict the potential yield of the species.

A total of 42 specimens with size ranges 21.4 -

The size variation in relation to growth in biomass of fish

39.6 in length and 150.25 – 769.82 in weight of both

is expressed in length-weight statistics. In the natural

sexes of Channa aurantimaculata were collected

population the growth dynamics of any fish species is

randomly from a riparian weltand namely Lachia beel

dependent on its habitat variability. The growth pattern

(Longitude 94°57 / 27// E and Latitude 27°38/ 33// N ) of

in fishes follow the cube law (Brody 1945; Lagler,

Dhemaji district of Assam, India during Nov, 2008 –

1952). As the fish grows isometrically exhibiting the

Oct, 2009. Since sex of the collected samples could not

exponential value exactly at 3.0, such relationship is

be distinguished by secondary sexual characters, all

considered valid. However, in reality, it may deviate

fishes were dissected and identified the sex based on

from this ideal value due to environmental condition or

gonadal structures following Mackie and Lewis, 2001.

condition of the fish (Le Cren, 1951). Therefore, as

The male specimens (15 number) and female specimens

suggested

relationship

(27number) were separated for their length and weight.

is expressed by an equation- W= aL or W= Log a + b

Total length (TL) were measured from tip of the snout to

Log L.

tip of the caudal fin nearest to 0.01 mm by digital vernier

by Le

Cren

(1951)

this b

Channa

(Musikasinthorn,

caliper and Body weight (BW) of the fish samples were

one of the burrowing members of the Asian

measured nearest to 0.01 gm by digital balance

snakehead exhibits its habitat range in the riparian

(Sartorius BA 610, Germany) individually. Length-

wetlands of upper Assam districts as distributed in

weight relationship were estimated by the equation

Tinsukia Dibrugarh Dhemaji districts. The dual life cycle

W=a Lb (Le Cren, 1951) which further expressed

of the fish (living in burrows and enjoying free

logarithmically as

2000),

aurantimaculata

swimming life) is a special behavioral character within

Log W=Log a +b Log L

the riparian range of the habitat. This species endemic to

Where, W= Weight of the fish, L=length of the

the upper Assam zone (Goswami et al., 2006;

fish and ‘a’ and ‘b’ are constant. Parameter ‘a’ and ‘b’

Vishwanath and Geetakumari, 2009) is of special interest

were calculated by the method of least square regression:

for its assessment of growth dynamics and natural population stock. The growth performance of the natural

Log a =

∑log W.∑(log L)2 - ∑log L. ∑(log L. log W) N. ∑(log L)2 – (∑log L)2

population of the species needs to be examined to ascertain its overall relationship of length and weight. The general well-being of the species in the present

Log b =

∑ Log W – N. Log a ∑ Log L

habitat characters is expressed in terms of its mathematical expression of condition factor. The present

The value of correlation ‘r’, standard deviation

study deals with computing the length- weight

(SD) between total length and body weight were

relationship, condition factor and relative condition

calculated with the help of SPSS software (version-16)

1148

Journal of Research in Biology (2014) 3(8): 1147-1152

Bhatta and Goswami, 2014 Table. 1: Mean ± standard deviation of Body weight (BW) and Total length (TL), value of ‘a’ and ‘b’ Sex Male N=15 Female N=27

Weight range (gm) 180.42 - 750.01

Size range (cm) 28.2 - 39.6

Mean±SD BW(gm) 443.12 ± 180.97

Mean±SD TL (cm) 32.42 ± 3.147

Value of ‘a’ -3.68

Value of ‘b’ 4.186

‘r’ value 0.898

150.25 - 769.82

21.4 -38.9

492.57 ± 193.85

30.47 ± 5.23

-1.26

2.651

0.959

⃰⃰ Significant level at 0.05 and Microsoft Office Excel. The Log transformed

are found high since the correlation coefficient ‘r’

regression was used to test the growth.

exhibits a high degree of positive allometric correlation in male and feebly

negative allometric correlation

between the L-W relationship (Table-1). Degree of

RESULTS AND DISCUSSION In the present study the body weight of male and

variation of exponential value of L-W relationship

female have been ranged between 180.42 and 750.01 gm

indicated by ‘ b’ value in male (4.186) is higher than the

and 150.25 and 769.82 gm respectively and the total

female (2.651). However, correlation coefficient ‘r’

length between 28.2 and 39.6 cm in male and 21.4 and

value in female is found to be more closer to 1.0 (0.959)

38.9 cm in female. The value of ‘a’, ’b’, ‘r’ and mean ±

than the ‘ r’ value in male (0.898). This indicates that the

of male and female are given in the Table 1. The

female has higher degree of relationship in growth

‘K’ and ‘Kn’ values are depicted in Table 2. The

performance than the male in spite of lower degree of

regression graphs of LWR and condition factor (K) are

exponential growth than the latter. Notwithstanding the

depicted in Fig.1 and Fig.2. Logarithmic form of Length-

value of exponent ‘b’ usually ranges between 2.5 and 4.0

weight relationship is expressed by the following

(Hile, 1936, Martin, 1949) and remains constant at 3.0

equations for male and females as

for an exactly ideal fish (Allen,1938), the present study

For Male, -Log W

= - 3.68 + 4.18 Log L

indicates

For Female, -Log W

= - 1.26 + 2.61Log L

Channa aurantimaculata is found to be deviated from

Channa aurantimaculata is a hole dwelling

that

the

value

‘b’

case

‘Cube law’ in both the cases of male and female.

snakehead species enjoying aestivation of life during the

Considerably

the

growth

coefficient

‘b’

dry season (December – March/April) and free living life

Channa aurantimaculata is positively allometric, but

during rest of the period (May- November). The growth

within the value (slightly higher in upper limit) as

performance of the fish during the free living period is an

suggested by Hile and Martin. Saikia et al., (2011) also

important part of its life cycle. In the present

observed the allometric growth in Channa punctatus

investigation the growth performance of both the sexes

from Assam. The higher ‘b’ value may be indicated by

Table. 2: Mean ± standard deviation of Condition factor (K) and Relative condition factor (Kn) Sex

Weight range (gm)

Size range (cm)

Range of K

Range of Kn

Mean ± SD K

Mean ± SD Kn

Male N=15

180.42 - 750.01

28.2 - 39.6

0.78 - 1.66

0.41 - 1.69

1.29± 0.27

1.05 ± 0.42

Female N=27

150.25 - 769.82

21.4 - 38.9

1.31- 2.33

1.00 - 1.56

1.66 ± 0.28

1.00 ± 0.40

Journal of Research in Biology (2014) 3(8): 1147-1152

1149

Bhatta and Goswami, 2014 y = 4.186x - 3.688 R² = 0.806

y = 2.651x - 1.268 R² = 0.919

Fig.1: Relationship between Log Total length (cm) and Log body weight (gm) of Channa aurantimaculata (A = Male and B= Female). the higher feeding proficiencies (Soni and Kathal, 1953; Kaur, 1981; Saikia et al., 2011), which is observed with the present study.

which is reflected in the Length-Weight relationship. ‘Condition’, ‘fatness’ or well being of fish

The free moving period of

expressed by K-factor is based on hypothesis that heavier

Channa aurantimaculata is marked as the best feeding

fish of a given length are in better condition (Bagenal

period, which reflects in correlation coefficient of L-W

and Tesch, 1978). For monitoring of feeding intensity

relationship (r) and high degree of exponential

and growth rate in fish in general K-factor is an essential

growth (b).

index (Oni et al.,1983). However, the condition factor

It is observed that Channa aurantimaculata lives

(K) and relative condition factor (Kn) in the free living

in burrows, which is followed by a free living life as

stage of Channa aurantimaculata (Table) clearly

soon as the riparian swamp habitats are inundated with

indicate that the general well being and the status of

flood water. The fish starts its feeding cycle overcoming

maturity and growth are favourably good. High K-value

the non-feeding life of aestivation. As the feed intensity

in both the species suggests that condition factor

increases during the feeding period the fish undergoes

increased with increasing length and weight of the fish

enhancement of growth. As a result, it follows favorably

(Yousuf and Khurshid, 2008). However in case of

a normal growth showing positive allometric relation

Channa aurantimaculata it exhibits highest peak in y = -0.000x + 1.788 R² = 0.032

y = 0.001x + 0.816 R² = 0.506

Fig.2: Condition factor (Kn) in relation to body weight (gm) of Channa aurantimaculata (C=Male and D=Female 1150

Journal of Research in Biology (2014) 3(8): 1147-1152

Bhatta and Goswami, 2014 K-factor in relation to BW within the weight range of

Brody S.

400-600 gm BW and thereafter steady decline is noticed

Publishing Corporation, New York. 1023.

(Figure 2). This may be due to completion of free swimming stage and initiation of burrowing /aestivation cycle.

1945. Bioenergetics and growth. Reichold

Goswami MM, Borthakur Arunav, and Pathak Janardan.

2006.

Comparative

biometry,

habitat

structure and distribution of four endemic snakehead (Teleostei : Channidae) species of Assam, India. J.

CONCLUSION Channa aurantimaculata is found to endemic in

Inland Fish. Soc. India. 38 (1): 1-8.

the upper Assam zone (Goswami et al., 2006,

Hile R. 1936.

Vishwanath and Geetakumari, 2009) and dwindling in

Leucichthys artedi (Le Sueur), in the Lakes of the North-

the natural wetland habitat. The feeding and breeding

eastern High Lands. Wisconsin. Bulletin U. S. Bur.

cycle of the fish is unidentical from the other common

Fishery. 48: 211 - 317.

snakeheads of the region. Due to rampant habitat destruction the fish is dwindling and struggling for survival in nature. For the conservation of the species the basic data for growth, breeding and feeding behavior are considered pre requisite. Steps related to conservation of the habitat for the species is highly recommended.

Age and Growth of the Cisco,

Kaur S. 1981. Studies on Some Aspects of the Ecology and Biology of Channa gachua (Ham.) and Channa stewartii (Playfair). Ph.D. Thesis. North Eastern Hill University, Shillong. Lagler KF. 1952. Freshwater Fishery Biology. Wim C Brown Co. Dubugue, Iowa. 360.

ACKNOWLEDGEMENTS The authors are very much grateful to the Head of the Department of Zoology, Gauhati University and Principal, Dhemaji College, Assam for extending their

Le-Cren ED. 1951. The Length-Weight Relationship and Seasonal Cycle in Gonad-Weight and Condition in the Perch (Perca fluviatilis). J. Anim. Ecol., 20:201-219.

help during the study period. The authors are also

Mackie M, Lewis P. 2001. Assessment of gonad staging

thankful to the UGC-SAP (DRS) Laboratory of zoology

system and other methods used in the study of the

department

reproductive

Gauhati

University

for

helping

biology

narrow-barred

Spanish

identification of the species. Appreciations are due to the

Mackeral, Scomberomorus commerson, in Western

skilled fishers and local youths for their immense help

Australia. Fish Res. Rep. West Aust. 136 :1-32.

and cooperation during the course of field study. REFERENCE Allen KR. 1938. Some Observation on the Biology of

Martin WR. 1949. The Mechanics of Enivironmental Control of Body Form in Fishes. Univ. Toronto Stud. Biol. 58 (Publ. Ont. Fish. Res. Lab.). 70: 1 -19.

the Trout (Salmo trutta) in Windermere. J. Anim. Ecol.,

Musikasinthorn P. 2000. Channa aurantimaculata, a

7(2): 333 - 349.

new channid fish from Assam (Brahmaputra River

Bagenal TB, Tesch AT. 1978. Conditions and Growth Patterns in Fresh Water Habitats. Blackwell Scientific Publications, Oxford. 75-89.

Journal of Research in Biology (2014) 3(8): 1147-1152

basin), India, with designation of a neotype for C.

amphibeus

(McClelland,1845),

Ichthyological

Research. 47: 27 -37.

1151

Bhatta and Goswami, 2014 Oni SK, Olayemi JY and Adegboye JD. 1983. Comparative physiology of three ecologically distinct fresh water fishes, Alestes nurse Ruppell, Synodontis schall Bloch and S. Schneider and Tilapia Zilli Gervais. J. Fish Biol., 22: 105- 109. Saikia AK, Singh ASK, Das DN and Biswas SP. 2011. Length-Weight relationship and condition factor of spotted snakehead, Channa punctatus ( Bloch), Bulletin of Life Science. XVII : 102-108. Soni

DD,

Kathal

1953. Length - Weight

Relationship in Cirrhina mrigala (Val.) and Cyprinus carpio (Ham.) Matsya. 5: 67 -72. Vishwanath

and

Geetakumari

KH.

2009.

Diagnosis and interrelationships of fishes of the genus Channa Scopoli (Teleostei : Channidae) of northeastern India. Journal of Threatened Taxa., 1(2) : 97-105. Yousuf F and Khurshid S. 2008. Length- weight relationship and relative conditions factor for the halfbeak Hamirampus far Forssk Ă&#x192;Ň°l,1775 from the Karachi coast. Univ. J. zool. Rajashahi Univ., 27:103104.

Submit your articles online at www.jresearchbiology.com Advantages

Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright submit@jresearchbiology.com www.jresearchbiology.com/Submit.php.

1152

Journal of Research in Biology (2014) 3(8): 1147-1152

Journal of Research in Biology

An International Scientific Research Journal

Impact of ecological factors on genetic diversity in Nothapodytes nimmoniana Graham based on ISSR amplification Authors: ABSTRACT: John De Britto A*, Benjamin Jeya Rathna, Nothapodytes nimmoniana Graham is one of the most important anti cancer Kumar P and Herin Sheeba phytochemical yielding plant belongs to the family of Icacinaceae. In order to evaluate Gracelin D. the genetic diversity of different N. nimmoniana land races based on molecular markers, five landraces were collected from different populations of the Western Ghats of South India. The ISSR method was utilized employed for evaluating the Institution: Plant Molecular Biology genetic diversity within the species, using 12 ISSR primers. A total of 108 bands were Research Unit, Post Graduate produced. The overall percentage of polymorphism was 87.10. Neiâ&#x20AC;&#x2122;s overall gene and Research Department of heterozygosity was found to be 0.3333. The genetic distance between the samples Plant Biology and Plant ranged from 0.2146 to 0.4099 and the genetic identity ranged from 0.6637 to 0.8068. Biotechnology, The Shannonâ&#x20AC;&#x2122;s information index was found to be 0.4924. The UPGMA dendrogram St.Xavier's College showed the relationship between five different populations in two major clusters. (Autonomous), Palayamkottai Genetic diversity is correlated with soil factors for ascertaining the validity of the - 627 002, Tamil Nadu, India. markers. Corresponding author: John De Britto A.

Keywords: Ecological factors, Genetic diversity, Nothapodytes nimmoniana, ISSR.

Guidelines for Authors

The article should be addressed to "The Editor". Submission of an article implies that it has never been published in any other journals and if accepted, it will not be publi shed elsewhere. All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review process. Journal Manuscript Format The manuscript should be typed in â&#x20AC;&#x153;Times new Romanâ&#x20AC;? font with font size 11 and 1.5 line spacing. The page size should be strictly A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address (including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to submit@jresearchbiology.com Title The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at scientific names, abbreviations etc., Center the authors' initials and last names directly below the title. Abstract The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion: The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations. Keywords A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list. Body of the Article The introductory section of the text should include a brief statement of why the research was conducted. It should also define the problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief survey of the relevant literature on the topic. Materials and Methods Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sou rces. Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment specifications are appropriate here. Results and Discussion This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on which your conclusions are based. Do not omit important negative results. In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation is encouraged, but it must be identified. Conclusion This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion. Acknowledgement Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences. References All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text. Accuracy of citation is the author's responsibility.

Reference Style References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows: Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109â&#x20AC;&#x201C; 124. Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999; 15-16. Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis, Dehradun: Forest Research Institute, 1998; 75-76. http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf. Appendix Use an appendix for material that is too long to include in the text of the article. Manuscript Charges Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text articles to interested readers from all around the world. The availability of the authorâ&#x20AC;&#x2122;s paper makes the scientific community to understand and develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be translated into more recognition of research. This journal also accelerates research and knowledge building worldwide. Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on the Internet to all interested researchers. For Indians The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250. For Foreign nationals The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD. Copyright Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use, distribution, and reproduction of an article in any medium, provided that the original work is properly cited. If you have any queries kindly contact us at contact@jresearchbiology.com