TargetMD 2012 (3 of 4 )

magazine

Target MD Issue 3 of 4 2012

must read

A dedicated supporter – a fund in his name

Volunteering Read of some ways our valued volunteers support our work

Feature

Paralympic sport All inside

Meet some team members

Campaigning news – Research updates – Sports latest – Housing report – Fundraising events – Trailblazers news

Email: jennyf@crelling.com Website: www.crelling.com

www.muscular-dystrophy.org

A word from the CEO Despite the poor weather at the start to the summer, this has been a very busy time with all of the Diamond Jubilee celebrations, and now the Olympics and Paralympics getting underway. Volunteering has been placed very much in the national spotlight thanks to these events, so the theme of volunteering for this edition of Target MD is certainly timely.

The Muscular Dystrophy Campaign receives no funds from the government – we rely almost entirely on the hard work and dedication of our volunteers across the country whose support enables us to carry out the charity’s vital work. I am always struck by the level of their commitment and determination – be it running marathons, supporting their branch or group, or braving the cold weather in their area with a collecting tin in their hand. However, volunteering isn’t only about raising much-needed money. It can also be about campaigning for change, fighting for better healthcare and raising awareness of the devastating neuromuscular conditions that we support.

I have been lucky enough to meet countless individuals and families over the years, who, despite the difficulty of living with one of these muscle-wasting conditions, have ploughed on tirelessly in the fight to help others. Thank you to all of our wonderful volunteers for everything you do for the charity and the individuals and families we support.

In this edition of Target MD, we feature two unique and very special volunteers, who have carried out an impressive number of volunteering roles both consistently and successfully over the more than 100 years between them. Lord Richard Attenborough and Lord John Walton: the Muscular Dystrophy Campaign would not be here today if it were not for these two remarkable individuals. We have them both to thank for much of the progress we have seen in research, as well as the improvements to people’s quality of life and independence.

I hope that by reading all of these personal stories about volunteering, you might be able to encourage others to get involved. The more volunteers we work with, the greater impact we can have – impact in terms of the vital research we fund, the information and support we provide and the essential services we campaign to improve.

Enjoy the rest of the summer!

Robert Meadowcroft Chief Executive

page 3

page 4

www.muscular-dystrophy.org

08

Volunteering

Together we make a difference

Contents 16

18

Abbi’s campaign: one in a million

18

Eminent supporters: Lord Attenborough and Lord Walton

25

WFA round-up - an epic cup final

27

Ollie Hynd’s in the gold lane

20

News

Phase 1 clinical trial of utrophin drug announced

21

Northern Ireland fills the gap in care advisor support

22

New myotonic dystrophy registry launched

24

Sex and disability

06 27

Features

16

Regular

Letters - write and tell us what you think

30

The best of the web

34

Fundraising news

www.muscular-dystrophy.org

Hello, Welcome to the third edition of Target MD for 2012. This edition is devoted to volunteering. As a charity, we rely on the support of our valued volunteers in so many areas of our work. In the main feature, from p8 to p19, you’ll read about how volunteers help us to continue leading the fight against muscular dystrophy and related neuromuscular conditions, on all fronts.

Within the volunteering feature, we also pay tribute to two long-term and highly influential supporters of the charity, whose exceptional efforts have helped the charity to lead the way in research into effective treatments and cures for these neuromuscular conditions. Lord Walton of Detchant and Lord Attenborough need little introduction; read about their work with our charity, on p18 and p19.

By the time you read this, London 2012 will be almost upon us: whether you’re a torchbearer, ambassador, Paralympian, spectator or armchair commentator, you’ll be looking forward to the feast of international sport that awaits.

On p26 we bring you news of the Paralympic taster events that gave GB Boccia a taste of gold medal action ahead of London 2012. And then on p27, you’ll meet Ollie Hynd, the 17-year-old Paralympic world-champion swimmer who also has his sights set on gold.

We also bring you an end-of-season round-up of powerchair football events. on p25.

Don’t forget to get in touch with the WFA (Wheelchair Football Association) if you’re interested in playing, supporting or starting up a powerchair football club in the UK. And, of course, there’s our latest campaigning, research and fundraising news, with wonderful photo spreads of our running events in London, Cambridge and Oxford.

Do let me know if you have any thoughts about the magazine, or any ideas for future editions. We do always want to bring you the news and stories you want to read.

The magazine for supporters of the Muscular Dystrophy Campaign , written and produced entirely in-house.

I’d love to hear from you.

Editor Ruth Martin Art director Deborah Waters targetmd@muscular-dystrophy.org Muscular Dystrophy Campaign 61 Southwark Street London SE1 0HL t: 020 7803 4800 e: hello@muscular-dystrophy.org w: www.muscular-dystrophy.org Disclaimer While every effort has been made to ensure the information contained within TargetMD is accurate, Muscular Dystrophy Campaign accepts no responsibility or liability where errors or omissions are made. The Muscular Dystrophy Campaign does not necessarily endorse the products advertised and no responsibility can be accepted for claims made by the advertisers. The views expressed in this magazine are not necessarily those of the charity. ISSN 1663-4538

Registered Charity No. 205395 and Registered Scottish Charity No. SC039445 Printed on PEFC paper, produced at a mill that is certified with the ISO14001 environmental management standard Enclosed into a bio-degradeable polybag

Ruth Martin

Editor

t: 020 7803 4836 e: r.martin@muscular-dystrophy.org tw: @RuthWriter

Interact with us and more than 8,200 fans on our Facebook page at: www.facebook.com/musculardystrophycampaign Join 3,600 others and follow us for regular updates on all areas of our work @TargetMD

About the Muscular Dystrophy Campaign

The Muscular Dystrophy Campaign is the leading UK charity focusing on muscular dystrophy and related neuromuscular conditions. We are dedicated to finding treatments and cures and improving the lives of the 70,000 adults and children affected by the conditions. We focus on funding world-class research, providing practical information, advice and support, campaigning to bring about change and raise awareness, awarding grants towards the cost of specialist equipment and providing specialist education and development for health professionals.

page 5

page 6

www.muscular-dystrophy.org

phy.org

www.muscular-dystro

What do you think? Write to us...

Dear Sir Feature

Just a few lines to thank you for sending me copies of the Boccia edition of Target MD [Edition 1 of 2012], which I requested.

ch Target Resear

now produced and they’re both can free up to read them, who really want Dystrophy Campaign ing, support money. the Muscular hard to save fully in-house, research, campaign we’re working s spend on further economic times, of your donation more funds to In these harsh on every penny ever, we rely and care for people equipment grants.

Now more than mind, and provide support your s. With this in research and s, please post to fund vital the magazine related condition – subscribe to payable to dystrophy and Target Research If you’d like to for £18 made with muscular at 61 Target MD and with a cheque Subscriptions our new-look a year. to Target MD details, together n’ we‘ve launched times four Campaig y to you ‘Muscular Dystroph both to be delivered of London SE1 0HL: a year instead Southwark Street, MD four times at the for one will receive Target Target Research and Target Research That’s right! You new ‘slimline’ to Target MD y. will receive the I wish to subscribe you did previousl three, plus you once a year as of £18. than cost a __ at rather year, £ ________ same time, help a donation of £18. This will I wish to make ion gift of just the same annual subscript ensuring an for while all And them and costs - even reduce every issue of Target MD us cover our from like you you’d expect go to people editorial quality they now only And because Target Research.

Dear Editor reclaim back

Issue 1 of 4 2012

from the Inland

to on give, we are able Please tick the box below: Gift Aid Declarati that for every pound you to go further.

School days

means donation in the last four Using Gift Aid – helping your that I have made Aid donations. tax paid on it treat all gifts Revenue the as Gift Campaign to this declaration Muscular DystrophyI make from the date of that Yes I would like future donations are no longer eligible. years and all gifts charity if my I will notify the each Gains Tax for Aid on my donations. not claim Gift Tax and/or Capital of tax that the No, please do amount of Income amount must pay an equal to the that is at least for Gift Aid you To be eligible April the next) one year to 5 tax year. that for tax year (6 April on your gifts charity will reclaim ________________ Thank you. __________________ a date this form is invalid.

Date_________ without a date here, as Please include

Terry Aspray, Disease, Metabolic Bone Tyne Consultant in Newcastle upon Freeman Hospital, Mullen, Dorset in which is a condition is from Corfe myopathy in 1996. My Osteoporosis bone ndrial Val Wintle, 51, It has structurally altered, d with mitocho defective gene. risk bone tissue is I was diagnose a carrier of the I am housebound, there is an increased is 30, will be now mass is low and significant daughter, who my the years and is without over Mark, bones , decline of breaking been a steady My lovely husband travelled falling from standing independence. we have for injury, such as losing all my fragility fracture), housework! Luckily All my hobbies the all (so-called does height gender le now. rock and age and female fatigue. Even it would be impossib which increasing problems and in the past as risks. However, into due to mobility problems. I’m are the most importantimportant have fallen away of due to eyesight y.

TV is a chore there are a number es fail miserabl risk, including reading and watchingto stay positive but sometim nts of fracture determina try I e” arthritis, and id “legitimat rheumato spirituality on, and more , family history, with the plaster (steroids) treatment wheelchair. are a glucocorticoid alcohol. when out in my hinning bones and drinking problem for smoking cigarettes that commonplace older women. medical profession No-one in the menopausal and significantly increase in of my muscular and difficulty Fragility fractures April I met took account Add instability or of fracture. From exercise to tendency to fall, the risk of further load-bearing dystrophy and when nt has directed doing enough you menopausal, 2012, the governme who fracture for g bones, and my age and being patients strengthen weakenin ercare. I had already test GPs to assess for disaster. protect their considering aft density have a recipe te treatment to needed a bone I appropria Energy that decided include a Dual increase my calcium a good bones. This may scan. care, there is this. and that I should metry (DXA) With the right to the GP to arrange X-ray Absorptio g fractures. intake, so I went e test chance of preventin ought to save she agreed. Th After some debate, at risk of fracture thin bones Preventative measures when the Osteopenia, or Identifying patients broken a bone) is reacting showed I had density not yet money, whereas as well bone mineral (but who have Institute done is costly, (a condition where g. The National damage is already of muscular normal). more challengin the suffering is lower than Clinical Excellence as increasing of for Health and Yet this kind and on assessing fragility dystrophy patients. lottery. My high dosage calcium (NICE) guideline in draft be a postcode Now I am on been presented alendronic has and care seems to risk daily, fracture on. this. vitamin D tablets once a ers for consultati experience highlights build up bone) form to stakehold of falling acid tablets (to increased risk restricts foreseeable future.

Immobility and should drial myopathy week, all for the factors which I can My mitochon risk. are both important limits the exercise in assess fracture ore, my mobility and I discovered that a clinician to contrast, prompt falls. Furtherm to DXA scan. a complete prone In advise may not need do. I am also before consultant would However, this pausal (stage Newcastle your I am peri-meno a menopausal for women and density test for a critical time bone FRAX a e); as such menopaus increases if there is an increased can Assessment tools of thinning bones woman to see is, this both readily available when the risk fractures. If there QFracture are 10-year risk likelihood of estimate dramatically. can online and of then be treated. on a number ankle trying of fracture, based r, I broke my cure. as family history than such a Last Septembe stics had better I be characteri After an x-ray, history of not Prevention must and personal to sit in a chair! can do it, so why of hip fracture or fracture. until I could attend Those in Newcastle consumption could have temporary plaster is simple test smoking, alcohol risk and It was a difficult elsewhere? Th discuss fracture the fracture clinic. and all the physical never Patients should the best of times, prevented a fracture family, changes and treatment experience at for me and my agree on lifestyle dystrophy.

Online and and mental stress to the NHS. estimated risk. mind with muscular the huge cost based on their not to mention risk tools empower put easy-to-use fracture this condition and the fracture clinic with d Several days later, At least I menopausal women patients to understan cation between for four weeks.

My advice for communi are still mobile me in plaster was a long will help with dystrophy who on this, but it muscular density bone a clinicians. could hobble GP for patients and I felt more stable is to badger your and the four weeks. Ironically, you much pain test. It could save tion On the web Val’s condi NHS a lot of money!

MUST READ

finding challenges in Choices and for your child the best school

Thank you for printing my article about muscular dystrophy and the menopause. It was interesting to read what consultant Terry Asprey said and the websites he mentioned could be very helpful to someone. I wish I’d known about them. However if this article helps just one person it will have been worth it!

Would you like

to receive updates

Yes

from us?

Come and play Boccia JOIN IN

Meet the ParalympicsGB

Education, advocacy, life stories fundraising and

No

ALL INSIDE

• Information Research news

Security code

(if applicable)

Issue No.(if applicable) Start Date(if applicable) / ___ ________________ Date ________ at _____________ subscribe online ________________ website and Signature ________ 020 7803 4836 or visit our call us on mdsubscribe Alternatively, strophy.org/target www.muscular-dy

Expiry Date: /

No. 205395 and

Registered Scottish

• The President’s Standard Award

• Campaigning fit in 2012 Awards • Get

news

______

Card No:

Registered Charity

hopefuls

Trailblazers news

________ ame ________ ____________Surn _______________ name ________ ________________ ______ First Title ________ ________________ ______________ ________________ ________________ Address ________ ________________ ______________ ________________ ________________ ________________ ________________ ________________ ________________ ________________ _ Postcode ________ ________________ ________________ ________________ ________________ Phone ________ ________________ ________ ________ cheque Email ________ ion: Direct debit Payment informat Credit card Method: (details below) card/debit card ___________ to pay by credit name ________ ly r: ____Fami ________ Name of cardholde Access name ________ Debit ______ First Title ________ Mastercard (maestro only) Visa Card type:

Time to register

Target Research

A MUST READ

Issue 1 of 4 2012

registries are How patient for opening up opportunities and researchers both patients

up recruitment Speeding trials to clinical

Improving standards

care

information Access to

attgagaa

caattttctaagtttgggaagcagcat

trial Clinical opportunities

aaaacattcacaaaatgggtaaatgca clinical Crucial for trial planning

tgttatgaaagagaagatgttcaaaag

atgctttggtgggaagaagtagaggac

link to the Patient’s community research

Myotonic dystrophy CUTTING-EDGE

are Our researchers improving diagnosis towards and moving possible therapies

Point of View

to join a What’s it like patient registry?

Also inside…experts

answer your

questions and

read about all

the latest research

and clinical trial

news

myopathy: Mitochondrial for a group of diseases term is a collective but which ly affect muscle, that particular of the every other part may also affect the eye. the brain and body including details website for more (Please see our rophy.org) www.muscular-dyst

that the Muscular It is good to know is campaigning Dystrophy Campaign ve services better preventati nationally for prevent such which might from the NHS, future. situations in the

NICE guideline: rg.uk/CG/Wave25/2 www.guidance.nice.o FRAX: / www.shef.ac.uk/FRAX QFracture: www.qfracture.org/

Charity No. SC039445

www.muscular-dystrophy.org

week, but enjoyed mixing with children similar to himself and taking part in extra activities, such as joining the Scouts. It also introduced him to Edinburgh, where he lives today.

“I believe that time me up very well for the set future,” Mark said.

Mark Chapman is a 41-year old man who lives in Edinburgh. He enjoys photography and art, in a cosy bungalow enjoyed a two-week and recently in about 20 years – heholiday in Spain where – for the first time Duchenne muscular went into the swimming pool. Mark has dystrophy.

C

hair of the Scottish Muscle Group and an active member of the Cross Party Group for Muscular Dystrophy in the Scottish Parliament, Mark leads a full, active and independent life. He has fought hard for the independence and support he enjoys today, and this experience drives him to speak up for other people in similar situations.

Mark grew up at Paxton in the idyllic Berwickshire countryside in the Scottish Borders, the middle son of Donald and Janet and brother to Graeme and Stephen. When he went to primary school, his mum noticed he kept falling, wasn’t keeping up with his peers and was struggling to get himself up off the floor.

Doctors said he was developing slowly and told his mum not to worry. After ‘a

Since I spoke to you on the phone, my oldest grandson, Scott McCowan, has been picked for the Paralympics GB team which makes the magazine more precious. Sadly his younger brother [Jamie] just missed out.

horrendous time’ of being made to feel like she was being paranoid, Mark’s mum was given a referral for Mark to see Professor Emery.

“My parents then received the shattering diagnosis that I had Duchenne muscular dystrophy and were told I would probably not live beyond adulthood.

I was only six,” Mark said.

“Fortunately, my brothers both tested negative.”

At 10, Mark started using a wheelchair and, after primary school, he went to Graysmill School in Edinburgh – a school for children with disabilities, which had a residential unit – where he completed his schooling in 1988. He found it difficult being away from the family during the

After school, things got very difficult for Mark. He wished to study art/design at college in Edinburgh, but needed to find somewhere to live that would provide the support he needed. Unable to access the necessary funding, Mark ended up back at home with nothing to do. His parents helped him fight to find suitable accommodation and to access the support and appropriate Local Authority funding, and he finally moved into a shared flat in brand new supported, independent-living accommodation in Edinburgh, called Freespace Housing.

Living there, with extra support at college from a Community Service Volunteer, he completed a Higher National Diploma in Illustration and Media Design. Like most students, Mark had an active social life involving many pubs, clubs and parties.

After college, Mark found his care needs were increasing.

Recurring chest infections, headaches, low energy and severe mood changes led to many GP visits, and the discovery that his condition was seriously affecting respiratory function.

He was told nothing more could be done. However, Mark knew of a school friend with the same condition who – following an emergency hospital admission – was given a tracheotomy and was now using a ventilator. His friend told him the procedure had ‘saved his life’.

Mark discussed his options with friends and family (especially his lifelong friend and partner, Corinna, who he’d been living with for two years), before being referred to the same specialist consultant, Dr Ian Grant, who became Mark’s consultant for a number of years.

Mark decided his best choice was to go ahead with a tracheotomy and use a ventilator. He knew there would be risks involved with the surgery, but also knew that he would need increased support when he went home.

It took another battle – which he fought and won – to

www.muscular-dystrophy.org

page 27

access the funding to put in place the vital fulltime, one-on-one, 24/7 support he needed.

So it was, then, at the age of 26 – nearly 16 years ago – that Mark had a successful tracheotomy and moved into the housing association flat he lives in today. He has a Self-Directed Support funding package to employ his team of five personal assistants, all specially trained in managing his ventilation.

He receives additional support from specialist nurses at the Ventilation Unit Dr Grant set up at Edinburgh’s Western General Hospital.

“This whole support package is one of the main reasons my health and wellbeing have remained so good,” said Mark.

Mark has volunteered for two disabilityled organisations: the Lothian Centre for Inclusive Living and the Scottish Personal Assistant Employers’ Network, and is currently involved in campaigning and media work for the Muscular Dystrophy Campaign. Through social media, he keeps up with many other men with Duchenne muscular dystrophy, a few of whom are even older than he is, and learns of the struggles many of them go through.

“When I realised how much other people were really struggling and not getting to the point that I had managed to, I started thinking something wasn’t right,” Mark said.

“I decided to get involved with the Muscular Dystrophy Campaign because people like me can really speak out for others in similar situations.

I am happy to go to Parliament and talk about what is going on and question why people aren’t getting the opportunities and services they should be getting. ” Mark added his weight to the recent launch of the charity’s report: Invest to Save: improving services and reducing costs in Scotland. Th e report was launched following an investigation into the cost benefit of improving neuromuscular services in Scotland, in order to prevent emergency admissions to hospital for people with muscular dystrophy. Mark said things needed to change.

Best wishes Val Wintle [page 31 Target MD Issue 2 of 2012]

“Time is so precious for people with Duchenne Muscular Dystrophy. Your health can change so much in a short time and every family will tell you that every day counts. Th e correct assistance, support, advice, equipment and physiotherapy can make a huge difference to the length and quality of people’s lives.

This is why increasing care advisor posts is so important. We simply cannot afford to wait around for these things to happen,” he said.

Mark has certainly not been one to wait around for things to happen. He’s worked hard to make sure he has what he needs to live a full and independent life. Not only does he have the job of managing his own care, but he still enjoys art, visiting exhibitions whenever he can, and being creative, producing artwork and designs on his computer. He is also a keen photographer, and has recently acquired technology that enables him to take photographs with the use of a blow-type switch.

Last spring, Mark was interviewed for Jon Hastie’s soon-to-be-rele ased film, A life worth living; the story of Jon’s journey to meet other adults with Duchenne muscular dystrophy who are living productive, creative and fulfilling lives.

And then in the summer, Mark flew for the first time in many years and went on a two-week holiday to Las Piedras, a Spanish resort near Malaga (pictured right). The resort was fully and perfectly On the web equipped for people with disabilities and Mark enjoyed walks, LCIL: drives, sightseeing trips, having a swim www.lothiancil.org.uk and finding plenty of SPAEN: opportunity for landscape photography. www.spaen.co.u A man of his word, Mark certainly makes every day count

Las Piedras:

k

www.laspiedras.co.uk A life worth living: www.alifeworthliving.com

So thank you again. Have enclosed a cheque for £50 as a donation.

Yours truly A McCowan

Dear Ruth

to be gazine. We are pleased ter and the Target MD ma let ent rec r you for you Thank losed. a cheque for £100 is enc able to help you again and been scular dystrophy. She has zey, is a sufferer from mu Biz ra Lau July. ce, 5 nie on ’ at ‘bit gre My will be doing her chbearer in Suffolk and tor ic mp Oly an as sen cho With best wishes

Dear Editor Would you print our story? We fought for changes by ourselves at Great Ormond Street Hospital because of what happened with our brother Arvind, who had Duchenne muscular dystrophy. The result was the Arvind Jain Pathway; the engagement of another neuromuscular nurse and many other changes. Most families know what happened as it was in the press but it would nice for them to know the outcome. Most people at the Muscular Dystrophy Campaign know about our story too.

Kind regards Shushma [Read Shushma’s story on p 22.]

Yours sincerely Geoffrey Boston le Trust Trustee Ludford Charitab

Looking ahead In the next edition of Target MD, due out in October 2012, we’ll focus on technology.

There are so many apps, devices, gadgets and widgets on the market to make life easier and keep people connected, so we thought we’d gather as much information as we can about these new technologies to share with you. If you’d like to write in and tell us about your best and favourite pieces of technology, please do so – triedand-tested stories are always the best! As always, you’ll also be able to read our latest news, features and updates that keep you, our valued supporters, in the spotlight.

People with muscular dystrophy and related neuromuscular conditions, together with their families and carers, are at the heart of everything we do.

page 31

and Fractures risk phy muscular dystro

T

Target MD

magazine

Letters

Target MD and

es, menopausal hy Thinning bon cular dystrop women and mus

Keep in touch with us...

We’d love to hear from you and to fill this page with your letters. Send us your good news, your frustrations, your story ideas, as well as any news you’d like to share with our readers.

Here’s how you can get in touch with us: via Twitter @TargetMD or @RuthWriter, write to us on our Facebook page or at TalkMD, or write to the Editor of TargetMD at 61 Southwark Street, London SE1 0HL or at targetmd@muscular-dystrophy.org

www.muscular-dystrophy.org

page 7

The magazine is excellent and up to its usual high standard.

Excellent and moving article on “turning a house into a home”, good coverage of Jon Hastie and his magnificent new film, and details of Trailblazers campaign against disability hate crime. The first article included an in-depth guide to adapting your home to deal with progressive disability.

Even managed to read the thing on a mobile device. Technology is getting so good for MD people!

The title of Jon Hastie’s article is “An Indomitable Will”. He gives us inspiration with Mahatma Gandhi’s quote :“Strength does not come from physical capacity. It comes from an indomitable will.”

Taungfox from North Somerset (via online forum, TalkMD)

page 22

www.muscular-dystro

phy.org

Sports news

A Trailblazer at Trafalgar Square In the last edition they are involved of Target MD, we invited readers to tell in the Olympi Taz Virdee, 25, is a Trailblazer cs or the Paralympics in us if Ambassador for who London. the Paralympics. has been selected as a London Taz applied last May, on the London Ambassad or website. He was invited to an interview in Ealing, West London, where applicants were put into small

groups of three to work as a team in order to test their knowledg e of London.

‘DASH (Disablem ent Associatio n of Hillingdon) is a charity that offers support, informati on people with disabilitieand advice to Borough of Hillingdo s in the London n.

Dear Ruth, England’s mo st Isuhave read ccessfulfully football team of 2011

and enjoyed the latest Target MD magazine, it was packed with brilliant content and interesting stories. Thank you for including me in this issue as well, it looks really good and I am pleased with the outcome.

“At first I thought I knew a lot about London, since I live here, but I soon discovered there was plenty of London I wasn’t aware of, which got me thinking: how much do I really know?”

Taz said.

After the team games and tests, the applicants each had a one-to-on e interview and were asked why they wanted to be London Ambassad ors.

“For me, it was simple: a-lifetime opportun this is once-inity and with my experience and passion for disability sports, I just had to get involved with the Paralymp ics. This was the perfect role for me,” Taz said.

A few months later, Taz found out he’d been successfu l.

“I was really happy to be selected as one London Ambaof 80,000 ssadors,” Taz said.

“I will be based in Trafalgar Square during the first week of the Paralymp games. My duty ics is to answer any questions that tourists may have, such as: where the nearest hotels, best restauran tube station is; ts, directions the stadiums, to etc. Our main objective is to help people who visit the games to have an overall enjoyable experienc while in London,” e Taz said.

Taz is a perfect candidate for this role; he tells us about a number of sports and other projects he’s involved with at DASH.

We have a cricket team and a football team for people with disabilitie s. In the last year our cricket trophies in competiti team won two ons organised a charity called by Cricket4Change, and our football team won the Middlese FA PAN Disability x League in the 2010-11 campaign.

We have also recently educational projects developed some to improve reading and writing skills, actively working with disabled adults. We have been working with local day interactive storytellin centres to offer g sessions for service users. their

The new reading and writing project, which we run at Uxbridge Library, the opportun and ity to work with day centres in Hillingdo n, have opened new avenues for DASH; we have opportunities for our service users, some of whom are now volunteer at our sports ing sessions at day centres and we hope our volunteer s will get involved with the interactiv e storytelling sessions to improve their communication, confidence and public speaking skills.

In the last 18 months, DASH has also been delivering disability awarenes talks at local s primary schools.

These are designed to raise awareness of disability, anti-bullying and the of different disabilitie understanding s. We have Q&A sessions with special guests about issues disabled people face on a daily basis and this has been eye-open ing for many children.

For more informatio n about DASH and their projects please visit: www.dash.org.uk

As the 2011/12 Wheelchair Football Association (WFA) Thunder PFC and Sporting the closing stages, season enters Club Albion.

After a great season it has been If you would for Norwich City another great like more and Bolton Bullets PFC year powerchair football, information about in the Champion football. It’s seen for powerchair or would like they have secured ship, to visit a club in your promotion to World Cup take the 2011 FIPFA area, do visit next year’s Premiersh www.thewfa. place, the launch org.uk, follow ip division. the WFA Cup @wfaenglandteam of and on Twitter or search National League the WFA’s biggest We now ‘Wheelchair Football have more than to date.

Association’ on 30 clubs across Facebook. the

The WFA England team finished as runners up in the World Cup in Paris, and became the most successful England team of the year.

To celebrate this, the team (pictured above) was invited to Wembley and were presented on the pitch at half-time during the recent England game against Holland.

The new format National League has proved highly successful and is all still to play for. Aspire PFC lead the way in the Premiership as they look to defend title, but are being their chased by Northern

country and have to train in Northamp new teams starting ton, Middlesbr and Manchest ough er.

They’re carrying

the torch!

Congratulations to supporters Carl Tilson of Saxmundham, Manchester, Jack Franklin Laura Bizzey of Brough, Michaela McIntyre of Stirling, of Hollywood of Zakia Begum Downpatrick, Edmonds of Broadstai of Walsall, Alexande r Jordan of Worceste Paul as Olympic torchbear rs and Pamela Moffatt of r, Cam London, who ers for the London have all been flame for 300m 2012 Olympics selected through their . Each of them local areas during will carry the its 8,000 mile journey.

Also, watch out for Ollie Hynde, 17-year-old European Nottingham who will swimming champion four: Jacob Thomas be participating in the Paralymp from of Narberth, icsGB. And of course Scott McCowan McGuire of Lanarkshi the fab of Ayrshire, and re, in the national Stephen and Boccia team.

Pete

In the future I hope to contribute some more articles about the project I am involved with for my charity and as a Trailblazer.

Once again thank you and I look forward to catch up soon, Best wishes Taz [Virdee] [page 22: Target MD Issue 2 of 2012]

Paralympics tickets

Boccia bonus We have three pairs of tickets (for a wheelchair user plus a companion) to the Paralympics Boccia event at the ExCel Centre in London in September to give away. Tickets are for the afternoon event on 6 September, which will feature the men/women individual quarterfinals for all four categories. If you’d like to nominate yourself – or someone else – to win a pair of tickets to this exciting event, please send us a 100-word nomination and a photograph. The three winners will not only get the pair of Paralympics tickets, but will also be featured on our website. Please email us at targetmd@muscular-dystrophy.org with ‘Boccia tickets’ in the subject line, before 17 August 2012.

Feature

www.muscular-dystrophy.org

At home with volunteering “The most important reason I love volunteering is being able to raise awareness about the charity”

S

ome volunteers work from their homes and provide support to their local volunteer fundraising managers. Some already have a connection with the charity, and some know nothing about us at all.

Like Judy Field from Harrogate in North Yorkshire.

Judy, 44, an experienced volunteer co-ordinator, recruiter and manager, contacted her local Volunteer Centre, who put her in contact with Sara Wilcox (Volunteer Fundraising Manager for the North East and Yorkshire) at the Muscular Dystrophy Campaign.

“I love being able to make a difference and also to play a part in increasing volunteer activity for the charity,” Judy said.

As a home-based volunteer, Judy assists Sara by working with regional volunteer centres and other agencies to promote volunteering opportunities and increase volunteer activity for the charity.

“Volunteering enables me to maintain my confidence and self-esteem and feel that what I am doing is worthwhile,” Judy said.

There are many ways to volunteer for the Muscular Dystrophy Campaign. As a charity, we cannot achieve anything that we do without the valued support of our volunteers. We’d like to thank you all most sincerely for helping us to improve the lives of all the individuals and families in the UK who are affected by muscular dystrophy and related neuromuscular conditions.

Everything that our volunteers do on behalf of the charity serves to support our overall vision: to beat these conditions on all fronts throughout the UK. Read here about just some of the wonderful volunteers we have working for us right around the country. Whether you help by sending out event mailings, cheering participants on at events, serving on our board of trustees, campaigning for the charity, attending Muscle Groups, as an MP/clinician/researcher - offering your endorsement to a charity campaign, serving on an event committee, taking part and fundraising for us in an event, or telling your friends about any of our events or activities, you’re helping us to win this fight. Thank you.

“I would recommend volunteering with the Muscular Dystrophy Campaign to everyone. There is such a wide range of activities that people can get involved in and can also be very enjoyable. Everyone has skills, experience and abilities to give that may potentially make a difference to the lives of others.

“The charity is warm and friendly and values its volunteers. The support I have received from Sara and the trust she has placed in me to get on with the task in hand, has helped me get the most out of volunteering,” Judy said.

If you, like Judy, would like to make a difference and get involved with the Muscular Dystrophy Campaign as a homebased volunteer, do get in touch with our fundraising team on 0845 872 9058.

www.muscular-dystrophy.org

For Peter Duffy, Operations Executive at the Muscular Dystrophy Campaign, the personal development he gained from his time of volunteering at the charity was not the only benefit he received.

“The Muscular Dystrophy Campaign has been a part of my life since my brother, Andrew, was diagnosed with Duchenne muscular dystrophy in 1996.

It was gratifying to know that I was giving back to an organisation which has not only given to my own family, but is constantly enhancing the lives of thousands more across the UK. “After a few months of volunteering, I successfully obtained a full-time role – just the type of role I had been looking for and in the warmest of organisations!

Had I not had the opportunity to gain full-time employment internally, I believe that my experience gained as a volunteer had added a necessary edge to my CV that had previously been missing. I would recommend volunteering at the Muscular Dystrophy Campaign to anyone and everyone; whether you’re looking to gain experience in the charity sector, or just have a desire to make a change!”

Covering 500 kilometres for us

A

dedicated volunteer from the North East has been putting in the metres to raise funds for the Muscular Dystrophy Campaign.

We’re talking plenty of metres, here.

Make sure you warm up before you read this … Graham Stobbs is going to take us all along with him, on foot, on mountain bike and into the water.

“When my training gets tough, or an event gets tough, I motivate myself by telling myself that my Dad (Brian) and Ray would love to be able to run and they can’t. I keep going for them,” Graham said.

For 2012, Graham decided to continue with the duathlons, but he also got motivated to find other similar events.

Graham’s JustGiving page for the Muscular Dystrophy Campaign www.justgiving.com/grahamstobbs2012

Graham has enrolled quite a circle of supporters around him. Most of his supporters are family and friends and without them, Graham says, he wouldn’t achieve as much.

Graham, 38, lives in Whitley Bay in Tyne and Wear with his wife and two children.

Having done hardly any exercise since he left school, Graham has set himself a fantastic fundraising challenge for the charity for 2012: to cover 500km by taking part in running, swimming and cycling events throughout the year. His motivation? His dad and uncle both have limb girdle muscular dystrophy.

“I did the Great North Run last year and after all of the training leading up to the event, and then recovering from the race, I felt a bit empty with nothing to train for. I searched the web and found a duathlon series based in the north of England. I entered the first one in November last year but with only four weeks to train, I completely underestimated the challenge. However, the style of event (run, mountain bike, run) got me totally hooked,” said Graham.

On the web

“It just sort of spiralled from there with mountain bike races, 10k races, two half marathons, the Great North Swim,” said Graham.

“By doing lots of events during the year, I hope to get a bit more sponsorship money than just asking for one large donation. I am using my Facebook status updates to inform everyone how my training is going, which event is next and how each event goes. I always receive such positive comments, that it keeps me motivated for the next challenge,” he said.

His challenge involves ongoing training and includes one or two events for every month of the year – three duathlons, three mountain bike challenges, three 10k runs, a 92km cycle, a 1.6km swim, one half marathon, a run/bike/run in Kielder and three further runs. He’ll cover 500km across the 16 events, and raise awareness of the charity every step of the way.

page 9

Feature

www.muscular-dystrophy.org

L

iam Ashton is after David Cameron’s job. He wants to become the British Prime Minister and when he does, he wants to ban toy guns. Liam is eight years old. No need to move out of number 10 quite yet, Mr Cameron.

Liam (pictured left with Sir Alex Ferguson) gets his fabulous fighting spirit from his mum, Jo, who is an outstanding volunteer for the Muscular Dystrophy Campaign. A strong and determined campaigner and media volunteer, Jo will ‘do anything and speak to anyone’ to make sure that families, like hers, have access to the services they need.

Since he was diagnosed with Duchenne muscular dystrophy at the age of two and a half, Liam has had the care and support of an outstanding clinical team at Alder Hey Children’s Hospital in their home city of Liverpool. Dr Stefan Spinty leads the team who offers groundbreaking support and treatment for Liam: at his last clinical appointment, he had 11 people in the room with him, all there to discuss his care and treatment.

When Jo (pictured left) heard that not every family in the North West, affected by muscular dystrophy or other related neuromuscular conditions, had access to such specialist healthcare, she got on the

put forward by the North West NHS Specialised Commissioning Group.

This followed a year-long review into neuromuscular services, where ‘critical gaps’ in care were identified by the NHS. The recommendations included additional investment in services and the recruitment of key healthcare specialists, such as care advisors, physiotherapists and consultants. Some PCTs had indeed taken this on board; some had not heard about it all but said they would find out; some, like her own local authority, have yet to get back to Jo. She won’t stop until she’s heard from each one of them.

Not just a campaigner, Jo is also an effective media volunteer. Jo’s first-ever interview took place over the phone and so brilliant was it – she talked about finances and the difficulties and worries that parents of boys with Duchenne muscular dystrophy face regarding their transition from children’s services to adult services – that it was played to supporters at the media workshop at the Scottish Conference last year as

“Because Liam has so much support and others have so little, I am happy to be vocal to make sure things change.

We need to champion people who haven’t got that support in other parts of the country. It’s important for us to be campaigning for consistency and the same level of support countrywide,” Jo said. phone immediately. Armed with a list of every primary care trust (PCT) in the North West, Jo sat next to her phone last year and called every single one of them.

She followed up each call with an email.

Her priority was to ask them what exactly was being done in the North West to improve essential neuromuscular services.

Joanne was campaigning not only for her young son, but also for thousands of other families like hers.

Joanne asked each of the PCTs in the region to sign up to the recommendations

an example of how to give a fantastic interview. Jo’s second interview, which took place in the studio of Radio Merseyside and was about the Specialist Commissioning Group and her telephone campaign, was equally brilliant.

Jo has also done some fundraising for the charity. After taking part in some 5k runs, she decided to take on the world’s most prestigious half-marathon – the Great North Run – in Newcastle in 2010. Not a keen runner, Jo describes her experience of the day as equally ‘fantastic’ and ‘mad’.

www.muscular-dystrophy.org

Involving friends and colleagues in her campaigns, Jo has found an equally vocal supporter in Amy, the 13-year-old daughter of her partner, Brian Hayes.

Amy lives in Ballymena in Northern Ireland and has been fundraising and raising awareness for the Muscular Dystrophy Campaign at her school and in her community. She’s done ‘show and tell’ events at school where she talks about Liam’s condition and how to support our charity. Everyone at her school now knows about Liam, and about muscular dystrophy and related neuromuscular conditions.

Jo, Liam and Brian also went along last year to support the charity’s bid to develop a partnership with national retailer, Matalan. Not only did they get to meet the Matalan team, but they also met charity Vice President Sir Alex Ferguson.

It was, however, Jo’s sharing of Liam’s story, her determination as a mother to access the best possible support for her son, and Liam’s dream to become prime minister, that won the retail giant over.

“When the team from Matalan heard what Liam does every day, how he gets up and goes to school and gets on with his life, they said that they could raise some money for the charity,” Jo said.

And raise money they certainly have.

Matalan’s first three-month campaign brought in more than £10k for the charity.

They have identified several opportunities to raise funds and awareness for the charity, in a partnership that is valuable and far-reaching.

“I like to be vocal. If I can do anything I will do it; I will ask anyone anything. In my campaigning, I don’t mind putting people on the spot if it means consistency of service for boys like Liam,” Jo said.

It seems there’s just no stopping Jo. Or maybe there is…

“Just don’t ask me to do the Great North Run again!”

If you, like Jo, would like to volunteer as a media spokesperson or a campaigner for the charity, do get in touch with our Care, Campaigns and Information team on 020 7803 4800.

David’s having a ball

David Hanrahan likes a good party so it’s perhaps not surprising that for many years he’s been involved in organising one of the best nights out in the property industry calendar: the Microscope Ball. The event has now raised more than £2m for the Muscular Dystrophy Campaign but had very modest beginnings, as a breakfast.

According to the co-founder of property consulting firm, H2SO, the event started 28 years ago as a breakfast fundraiser.

“One of the guys involved had a son who had been diagnosed with muscular dystrophy and the intention was to raise money for research into the condition.

Around 30 people attended those first events but eventually demand transformed the breakfasts into a Ball, which today attracts more than 800 of the most influential people from the most prestigious commercial property companies in the country.

“It’s a perfect example of how a modest fundraising initiative can grow over time into something major,” David said.

The Muscular Dystrophy Campaign’s special events team has now taken over the running of the event.

“The team gives the committee excellent support. They take care of the planning, logistics and practical aspects such as recruiting volunteers to help out on the night. Each year, with a different theme and new, fresh ideas, the event formula is continually fine-tuned,” said David.

The charity’s events team also helps to keep the committee members informed and connected to the cause by taking them out to meet researchers and families affected by muscular dystrophy

and related neuromuscular conditions.

That information is always shared with guests at the ball as a reminder of the huge difference their support makes to the charity.

“Without the Muscular Dystrophy Campaign’s support, the event simply would not happen,” said David, who has served on the committee for 15 years, five of which have been as Chairman.

He says his continued involvement is inspired by the help that the money raised by the Ball can give to families who are affected by muscular dystrophy and related neuromuscular conditions.

The Microscope Ball is now one of the main – and most popular - events in the property industry’s calendar.

“People come to the Ball every year because it’s a great cause, they have a great time and it’s a great opportunity to catch up with friends and contacts across the business. In the property industry you can never underestimate the importance of networking! And if that can benefit a cause as important as the Muscular Dystrophy Campaign, then so much the better,” said David.

If you’d like our special events team to help you put on a great networking event for your industry and raise funds for the work of the Muscular Dystrophy Campaign at the same time, do get in touch with them on 020 7803 2856 or email events@muscular-dystrophy.org

page 11

Feature

www.muscular-dystrophy.org

many mountains. It wasn’t exactly my idea of sunny Spain, but it was very spectacular!” Martyn said.

The organisation Martyn volunteered for was contracted by the city council to run a structured programme of projects for the local community, particularly for disadvantaged young people. Martyn’s main job was to teach English and, to equip himself for this, he took Spanish lessons twice a week.

Sunnier days in Spain

M

artyn Sibley believes he’s solar powered.

This man, who describes himself as an ‘all round cheeky chap’, runs his own company, writes a blog, travels the world, runs webinars, meets with government ministers, soaks in the sun when he can and uses traditional and social media to lead the discussion on disability issues.

Powered by the sun? Perhaps it’s the other way round.

Martyn (pictured above left) has spinal muscular atrophy (SMA). He has never walked. He describes his childhood in St Ives in Cambridgeshire as ‘fortunate’ and his parents as ‘very forthright’ about his going to the local mainstream school. His mum and dad were always getting him ‘out there’, making sure he was always integrated and doing well. This gave him a good platform for acquiring not only good academic results, but also good social skills.

Going to university in Coventry was a new experience for him; he had to rely on people other than his parents to provide his care. He worked through the Community Service Volunteers (CSV) to recruit carers and he found this to be a good transitional step for him.

Armed with a degree in economics and a master’s degree in marketing, Martyn returned to his home town and entered the world of work through a local job at the charity, Scope. He worked in human resources and training for a year, and gained some valuable experience before

getting a transfer to the London office. He worked there for four years before taking the leap into self-employment.

Independently of this career move, Martyn had also been working on another dream of his: to travel abroad for a longer period of time than a holiday; to volunteer and do something meaningful, to meet people from other cultures and to learn a new language.

Through the Leonard Cheshire charity, Martyn applied to the European Voluntary Service (EVS) to explore the opportunity to volunteer abroad; more specifically, to go to Spain for the sunshine! He started looking at a database in a Youth in Action programme and a lot of the opportunities were not suitable for disabled people; Martyn was turned down because they could not support his care and accommodation needs. In September, while on holiday in New York, Martyn heard from the EVS that they had an opportunity for him.

After spending seven months working on budgets for equipment and personal assistants and getting everything in place, Martyn flew off in March to the north west of Spain to start his volunteer job in Avilés, a small town in Asturias with a population of 80,000. He describes the town as full of children and older people; much of the younger work force is at university or at work in the bigger cities.

“Everyone seems to know everyone and, coming from a small town myself, I enjoyed the familiarity. The whole region of Asturias is industrial, but it also has

“The more I learned Spanish, the better I could teach English. I learned a lot about the English language too, with all the questions around grammar and tenses – those really got me thinking hard before I could answer them!

“I have never felt so British. I lived in a hostel with people from all over Europe, and they always commented that I was so British – and not necessarily in a good way! It was very amusing,” Martyn said.

On top of his language classes, Martyn also presented an online radio show every Friday afternoon. He’d never presented a show before but not one to shy away from a new learning experience, he grabbed the opportunity to think up topics for discussion and to choose music to play. He really enjoyed the process.

If that wasn’t enough, Martyn also developed his own workshops on CVs and employability, and social media, and about 15 young people joined in.

“Volunteering abroad is a great experience, although you do go through ups and downs. In the training you get before you leave, they prepare you for this: when you arrive there is an amazing buzz that you are actually there, in another country. It feels like you’re on holiday, there is a great novelty value.

www.muscular-dystrophy.org

“Then after a week or two, it hits you that you are there for a while, you notice the cultural differences, language differences, and you get a bit homesick. I did feel a bit unhinged for a while and I really missed home. What helped me was speaking to people from home and making the most of going out and about. Eventually I found a plateau,” Martyn said.

“The best part for me was realising I was comfortable there; I was making friends and my Spanish was coming along. It was a good feeling,” he said.

“When you have a disability, volunteering is a good way of testing your own needs and strengths, to see if fulltime work would be possible for you. It gives you the chance to overcome barriers without being in paid employment. It also gives you work experience on your CV, which will make it easier to find paid work,” Martyn said.

“If any disabled people would like to volunteer abroad like I did, it’s important to acknowledge there will always be worries and doubts. But don’t let your disability stop you. It will take a little bit longer to arrange, it will also take patience and thinking outside of the box.

“I have proved it is possible, though, and it’s definitely worthwhile and worth pursuing,” Martyn said.

Constantly motivated to do new things, to challenge the status quo, to make a difference and to lead the way for what is possible for disabled people, Martyn lives what he believes. And if he can do that in the sunshine, he’s a very happy man.

On the web A day in the life of Martyn Sibley (Muscular Dystrophy Campaign website) www.bit.ly/L0BeWH Martyn’s blog: Martyn Sibley www.martynsibley.com Disability Horizons: A 21st Century view of disability Martyn co-founded and co-writes this blog, intended to create a positive, interesting and useful disability related magazine with articles and resources to help disabled people achieve whatever they wish. www.disabilityhorizons.com Follow Martyn on: Twitter @martynsibley

Volunteering from home Peter Durgan, 59, lives in Huyton in Liverpool at home with his mum. He retired last year after 20 years with builders’ merchants where he was a goods inward manager. After he retired, he visited the Muscular Dystrophy Campaign website to look for volunteer work he could do from home.

Armed with a European Computer Driving Licence (ECDL), he began volunteering as a researcher for the charity. Working closely with Charles Horton, Volunteer Fundraising Manager for the North West and North Wales, Peter researches target audiences, such as service and sports clubs, as a basis for potential new fundraising events, and creates databases for the fundraising team.

“The thing I enjoy about volunteering is the sense of being part of something, as I did when I worked full-time,” said Peter.

“I’d have no hesitation in recommending anyone to volunteer for the charity. My only advice would be not to bite off more than you can chew. I have said to Charles on occasion I would hate to start something I couldn’t finish,” said Peter.

Volunteers’ Week 2012 Every year, the first week of June is devoted to a national celebration of volunteers. We rely on the support of volunteers and our appreciation of their contribution is constant.

We paid tribute to the huge efforts that so many people across the UK put into the work of our charity by volunteering.

These individuals and families, friends, scientists and health professionals, all offer a wide range of support; no matter how they support our work, their commitment is invaluable to us.

We are constantly amazed at the lengths to which many of our volunteers go to support our work, many getting up early in the morning, travelling fair distances to represent us in some way or another. This valued support never goes unnoticed.

Meet some of our excellent volunteers across the country at bit.ly/JVSqk3

Volunteering from university

Another way to get involved in volunteering for the Muscular Dystrophy Campaign is through the Volunteer Events management programme that we run in conjunction with Glasgow Caledonian University. The programme was created in 2009 for second year Event Management students, to help students gain responsibility and recruit people to fundraise for the charity. The students create their own marketing and promotional strategies using the skills they have been taught, using their own initiative and following through their ideas from concept to seeing the success of the programme.

Andrea Hardy jumped at the opportunity to get involved in the programme, and this is what she had to say: “Volunteering is a huge part of my life. I currently volunteer at two youth drama groups, to help the young people develop their skills and communication with others.

“Volunteering for the Muscular Dystrophy Campaign, for me, is the exact same: at collections, events and just speaking to people making the name known gives me a great sense of pride.

“When I found out about the post through university, I was instantly interested. The voluntary work I do with the charity has enhanced my communication skills and research abilities, and these transferable skills will help with all jobs I take on in the future. It might not be for everyone, but volunteering, for me, is a confidence builder and a great use of extra time to help people less fortunate than I am.”

“I started off as a volunteer for the charity, fresh out of university and not quite knowing what I wanted to do with my degree. The Muscular Dystrophy Campaign gave me the skills and confidence to enter the ‘working world’ and without volunteering here I wouldn’t have found my passion for fundraising events. Everybody was always really friendly during my volunteering time, and they cared about what I wanted out of the experience as well.”

Julia Selby, Challenge Events Co-ordinator

page 13

Feature

www.muscular-dystrophy.org

It’s all voluntary on the online forum Some members of our online forum, TalkMD, give us their views on volunteering: Sybylla: “I spent quite a long time

researching my family history [entirely online] and wanted to help others do the same as it has proved a valuable experience for me and my family. I used a website called freeBMD to trace lots of my ancestors, and the reason I used it was because it is free. So I volunteered to transcribe for them seven years ago and have been doing transcribing ever since.

It is all done on the computer at home, so I have no worries about travel, toilets, making sure I am available at certain times and so on. I just do as much as I want to whenever I want. During the times when I’ve been out of action it’s not a problem if I don’t do any transcribing for a few weeks.

For me, volunteering helps me to contribute to a valuable resource [albeit in a very small way] at the same time as belonging to a very large “workforce” of volunteers all around the world. I enjoy what I do and ultimately hope that some of my work is helpful to others researching their family trees.

Transcribing also keeps my typing skills up to scratch as I have to be accurate and check everything I do.”

Louise: “I was a British

Red Cross Volunteer for eight years until about 2002, working with all sorts of people from Albanian refugees to training ambulance staff and running communications for large events (first aid/ambulance dispatch etc). I also attended events like helping with royal funerals and emergency response things.

Loved human rights/humanitarian type information work as so few people know what the Red Cross is about locally and internationally. I also did casualty simulation where you train to act, do

make up and set up scenes to simulate things like a car crash or having a medical condition. I think all the screaming probably gave my lungs some exercise so it kept me healthy!

“Got up to all sorts socially, including audio describing a cabaret ‘strip’ show for our blind guests on Red Cross Holidays for disabled people - loved it! I was pretty much included in everything - there was no such thing as ‘can’t’ because of health and safety etc, we just got on and did it and lifted and carried me into places if necessary.

In a way I still do voluntary work, like I’m writing a book chapter for the Open University around social care and a lot of ‘consultation’ events where disabled folks don’t get paid for our expertise or do things online - it’s still voluntary giving?

I think, if we can, we owe it to others to do our bit and apply our skills to helping people/communities if we can and fill our time doing something useful and pleasurable. I think it’s hugely important to challenge people’s misconceptions that disabled people are just on the receiving end of voluntary support and show people we are as much givers and helpers as anyone else. Especially if you have a severe impairment and appear very ‘limited’.”

Ailsa: “I’ve done bits

and pieces over the years - I help out in a shop (not exactly a charity shop but kind of along those lines) once a fortnight and I’ve helped out with young people and international students through church. I am in the fortunate position of being able to work almost full time so my volunteering has always been a weekend and evening ‘extra’. Through volunteering I’ve met some great people and I’ve had the privilege of being a little part of something that makes a real difference to people’s lives - I think it’s a general rule of these things that you get out more than you put in - it’s what we were designed for if you will.”

Sarah (who is also a volunteer

moderator for the TalkMD forum): “I have done a few different voluntary jobs and the nature of them has changed according to my physical abilities. My first voluntary job was editing magazine articles for a Talking Newspaper distributor and I answered the advert because I wanted

to experience the world of work and ultimately feel useful. I then volunteered for the Stroke Association, doing home visits to help with speech therapy and then volunteered at my local school to help with research for the course I was taking with the Open University - this led to a paid position that I could do for seven years until it physically became too demanding. I was finding it a struggle and it was around that time that I saw the TalkMD advert.

I also volunteer for my local Citizens’ Advice Bureau and have the flexibility of going in when I can or work from home as it is reach-based work but it allows me to work as a team as well. The Internet/ email is a brilliant thing and I find I can do so much from home. I would say however, that I have got a lot out of meeting and working alongside some brilliant people and the social contact is a big part of volunteering for me whether it is virtual contact or in person.

Some weeks I find I can’t do much, appointments crop up all over the place, going out can wear me out or just lack of sleep can have a big effect on what I do so volunteering is a good way for me to balance being occupied and mentally stimulated with doing what is best for my physical health.”

AMG (also a volunteer

moderator on the TalkMD forum): “I was watching “War Hero In My Family” the other night and Paddy Ashdown remarked on something he experienced; you volunteer yourself but when someone else volunteers you they called it ‘voluntold’. Haha – that’s a keeper!

Volunteering: I am one, as a mod (moderator). The decisive factor for my expressing interest was because I could do it at home, it did not require any transport considerations, or the assistance of a carer, and the loo is near.

If I was more able, I would consider volunteering for such things as helping at the local library or in a local charity shop.

But access and my capabilities scupper many plans.”

A big thank you to all the volunteer moderators on the forum. They are always welcoming and supportive.

www.muscular-dystrophy.org

than walking around in a sports club car park! Mum will always support me at the London Marathon – she thinks that there will be a Harrod’s Bear in it for her! Work colleagues and clients have always been very supportive financially too. I can’t thank any of them enough.

In October last year, Gavin Reeves pipped the other contenders to the post to win the Muscular Dystrophy Campaign’s Fundraiser of the Year award at the charity’s National Conference in Nottingham.

The award came in recognition of the 38-year-old’s marathon fundraising achievements for us. Gavin, who lives in Buckley in the North Wales county of Clwyd, and works as the Senior Family Clerk at Linenhall [Barristers] Chambers in Chester, ran the London Marathon for us for 15 years in a row.

This year, he’s set the bar slightly higher and is going to do five marathons for us. Oh, and he also skydived for us in March for Make today count, just for good measure.

Why the Muscular Dystrophy Campaign?

I was really impressed with the friendly nature and welcome I received when I asked the Muscular Dystrophy Campaign for a Golden Bond place for the 1997 London Marathon. I was really made to feel part of the team, and it helped to know that every pound raised would really make a difference. The Muscular Dystrophy Campaign is a small charity in comparison to the major, better-known charities and I enjoy helping to increase the awareness of the charity and the work it does.

“While racing wearing the bright orange vest, it’s hard to describe the buzz that I feel when you are spotted by the large groups of orange-wearing supporters who literally go crazy when they see you approaching and running past them!”

Fifteen marathons in 15 years, followed by five marathons and a skydive in 2012. What keeps you going (apart from your feet)?

I keep motivated with the challenge of taking myself out of my comfort zone. I’m fortunate enough to be able to do many things and the support from the Muscular Dystrophy Campaign’s team is incredible.

Having been lucky enough to meet so many wonderful people who live their lives with muscular dystrophy, it’s nice to feel that I can try to give something back by raising funds. The next challenge is always what keeps me going.

What has the charity’s support of your fundraising activities been like over the years?

The charity’s support has been nothing short of amazing. I’ve really been made to feel a part of the charity and to receive the President’s Award in 2012 was an incredibly humbling moment for me.

I run to raise money, that’s all. There were so many people at the National Conference who devote their lives to care for people who are far more deserving than I am, but the support and thanks that everyone gave me made me feel so proud. I hope I can support the charity just as much as they have supported me.

You seem to have enrolled quite a circle of supporters around you. Who are your main supporters? How did you get them – and keep them – engaged?

My parents, Eddie and Shirley, have always been very supportive of the runs I have done and, more recently, my girlfriend, Natasha Al-Egaily, has been roped into standing around for hours on end while I disappear off for a race! I think they like the bigger city races rather

You’re also raising fabulous awareness of muscular dystrophy and related neuromuscular conditions through all of your fundraising.

In recent years, the Muscular Dystrophy Campaign’s website has been a great source of information for me, and it really helps to raise awareness. It’s also great to be able to send people a link to the website to show them how their money is being used and the difference it’s making to so many people’s lives. The advent of Twitter and Facebook also help to spread the word enormously.

What is 2013’s challenge?

Watch this space! Charles Horton (Volunteer Fundraising Manager for the North West and North Wales) has kindly sent me a list of events that have really caught my eye. Certainly 2013 will involve an ultra-marathon and then who knows what else?

page 15

Feature

www.muscular-dystrophy.org

Abbi’s campaign –

one in a million G

ary and Sarah Bennett started their own fundraising committee: Abbi’s campaign – one in a million. According to their Facebook page, their mission is ‘to raise awareness of the range of muscular dystrophies (of which there are 60) and to work alongside the Muscular Dystrophy Campaign to raise funds which are so vital for the research and development of potential treatments for the future. Without the Muscular Dystrophy Campaign, the recent breakthrough of exon skipping for boys with Duchenne muscular dystrophy would not have been possible.’

Sarah and Gary Bennett live in Birmingham with their family of four daughters: Ashleigh (12), Amber (6), Abbi (4) and Ava (2). Sarah is studying psychology and Gary works as a teaching assistant in a special needs school.

Their first child together, Abbi, was born in February 2008. Everything seemed fine at first and Gary was overjoyed in becoming a dad for the first time.

However, when Abbi was a few months old she wasn’t gaining weight as she should and by six months she wasn’t

crawling or pulling herself up as other babies do. Doctors were unable to tell them what was wrong and she was referred to the Birmingham Children’s Hospital. After various tests and a biopsy, Abbi was diagnosed in April 2011 with Ullrich congenital muscular dystrophy.

“We were in total shock, mainly because nobody could really tell us about the condition or what we could expect for the future. Over the last two years, more information has become available and we know more about what we are dealing with, which makes it a little easier for us and for Abbi to accept and understand,” said Gary.

“Abbi is a beautiful, happy, intelligent young lady who loves to sing. She continues to inspire us everyday.”

Because so many people were fundraising in support of Abbi, Gary and Sarah decided to start their own fundraising committee to support the charity. Abbi’s

campaign got its name from the odds of being born with Ullrich congenital muscular dystrophy.

“Our goals are simple: to raise as much awareness – and money – as we can of muscular dystrophy and the impact it has on families in the UK and indeed the rest of the world,” said Sarah.

Gary recently skydived, along with friend Lauren Ainge, for Team 100 in the Make today count fundraising initiative in February 2012, and in November 2011 he and Daniel Bacon dived with sharks at the Blue Planet Aquarium in Chester.

One of their major fundraisers, Liam Barnes, is doing four runs for them and another, John Darby, has organised a quiz night.

With the help of Sarah’s mum, who has a photography business, the committee also produced their own version of a Calendar Girls’ calendar for 2012. The committee is also organising a race night to thank all their supporters and are looking for the next exciting challenge to take on.

The committee is supported by Charlotte Allen their local Muscular Dystrophy Campaign Volunteer Fundraising

Abbi’s condition

Ullrich congenital muscular dystrophy: The congenital muscular dystrophies are a group of conditions which share early presentation and a similar appearance of the muscle. Congenital means ‘from birth’ and in congenital muscular dystrophy the initial symptoms are present at birth or in the first few months. Congenital muscular dystrophies are a very heterogeneous group of conditions and in the last few years a lot of effort has gone into identifying the separate entities and in locating the genes responsible for a number of these forms.

On the web Abbi’s Facebook page: www.facebook.com/AbbiFaithBennett/info Follow Gary and Sarah on Twitter: @MrGB2909 and @mrssb1002

Ullrich congenital muscular dystrophy is a form of congenital muscular dystrophy with specific features: • children are often double-jointed in their hands and feet but have some tightness in other joints such as elbows or hips • they have rigidity (stiffness) of the spine • children tend to develop respiratory problems, which result in frequent chest infections and might require ventilatory support at night.

www.muscular-dystrophy.org

Manager, who helps them with ideas, resources, and plenty of encouragement to keep up the good work.

“In fact, without meeting Charlotte, we probably wouldn’t have done half the things we have. A big thank you to her,” said Sarah.

“Our main supporters at the moment are family, friends and work colleagues, all of whom have shown us a kind of generosity that we could only dream of. We keep them engaged through Facebook and Twitter with regular updates of what we are doing, where their money is going and what Abbi has been up to,” said Gary.

Committees All across the country, supporters of the Muscular Dystrophy Campaign are coming together to form local fundraising teams and committees.

Over the last two years about 50 new groups have been established raising about £200,000 by organising balls, walks, coffee mornings and collections, to name just a few.

Those involved say they have enjoyed meeting new people, developing new skills and having a lot of fun along the way. If you’d like to help us in the fight against muscular dystrophy and related neuromuscular conditions, why not join your local fundraising committee or get together friends and family to establish your own group? Your local Volunteer Fundraising Manager is on hand to support you every step of the way. Call our fundraising hotline on 0845 872 9058

How we support our volunteers Our relationships with volunteers, their local community, the

families we support are paramount. As a volunteer, you have access to a dedicated team at our head office, as well as a Volunteer Fundraising Manager (VFM) in your region, who will support you in everything you do.

Charles Horton is our VFM for the North West and North Wales. He is one of a team of eight such managers who work all across the UK. Here’s what a week in the life of a VFM might look like:

Monday 8.30am: check through emails and telephone messages.

10am: weekly team conference call.

The rest of the day: mapping out target areas for prospective new fundraising committees, looking into the profile of the area and opportunities for events.

Tuesday 9am: off to meet a new volunteer in Lancashire, including induction training. Lunch on the move.

Visit the Imperial War Museum North in Salford to do a risk assessment for our Zipwire day in October. Emails; put info on to our database. 7.30pm: Branch meeting in Warrington; “It’s wonderful to have volunteers who support our work in so many ways.”

Wednesday Working on our national fundraising initiative, ‘Make every birthday count’. 2.30pm: meeting at a Liverpool hotel venue about a Question of Support. Check post, reply to emails.

Thursday 7.30am: leave for a meeting with my line manager in Penrith at 10am.12pm: catch-up meeting in Rochdale with the Lead Volunteer of the North Manchester fundraising committee.

Massive milestone in Winchester The Winchester Branch of the Muscular Dystrophy Campaign will celebrate an important milestone this year: after 42 years of dedicated fundraising, they are close to having raised a whopping £250,000 for the Muscular Dystrophy Campaign.

A group of volunteers who came together to fundraise after being approached by their local Volunteer Fundraising Manager, the Branch holds a number of successful fundraising events throughout the year, such as a

tennis tournament, a murder mystery evening, and collections at the local Tesco. They also boost their income by selling the charity’s Christmas cards and collecting goods for car-boot sales.

Janette Hull, Chair of the Winchester Branch, said they were really excited to have raised close to a quarter of a million pounds.

“It has been a real team effort. We’d like to thank everyone who’s taken part in an event, put money in our collecting

Friday Phone calls, emails, thank you letters; updating the website. Afternoon: prepare for meetings next week, including two days in London at a VFM national team meeting.

Saturday Diving with sharks event at the Blue Planet Aquarium in Cheshire.

Sunday - no events today.

“Sometimes a well-planned diary changes completely to react to a new opportunity. Sometimes it can feel like a lot of things are being juggled at once, but I enjoy never quite knowing what tomorrow might bring.”

“It’s good to be part of a hard-working and conscientious team who are all aware that what they do makes a difference to the lives of people affected by muscular dystrophy and related conditions. We all work towards raising enough funds to fight these conditions on all fronts, and it is very satisfying to know that many people want to volunteer or fundraise for us to help us achieve our goals.”

If you’d like to volunteer for the Muscular Dystrophy Campaign, do get in touch with us on 0845 872 9058 or volunteer@muscular-dystrophy.org

tins or bought a Christmas card! It’s wonderful to have been able to make such a difference to people living with neuromuscular conditions.”

Thank you to all our branches and fundraising committees who support the work of the Muscular Dystrophy Campaign. If you feel inspired to join your local branch or set up your own fundraising group, do get in touch with our fundraising team on 0845 872 9058.

page 17

Feature

www.muscular-dystrophy.org

An eminent Fellowship Much-loved and distinguished British actor, director and producer, Lord Richard Attenborough (pictured below) counts among his most proud achievements the impact he’s had on the work of the Muscular Dystrophy Campaign and on people affected by muscular dystrophy and related neuromuscular conditions.

L

ord Attenborough first took note of the work of the Muscular Dystrophy Group (as it was then known) in 1962.

He went to a local hospital fete where he met some young boys with Duchenne muscular dystrophy. He’d never heard of the condition and he did what he could to find out as much as he could about it. He also made a promise to himself to do what he could to support the work of the charity.

That was 50 years ago. Since then, he has received a CBE (1967), was knighted (1976) and then created a life peer (1993).

Alongside his significant career in film, Lord Attenborough has also contributed considerably to raising the profile of the charity; not only has he generated hundreds of thousands of pounds for us, but he’s also served as President of the charity for 30 years. Now an Honorary Life President (since 2004), Lord Attenborough remains an inspirational supporter of the charity.

Driven to do what he could to change this, Lord Attenborough set up an

Lord Attenborough is most proud of the fact that the charity spearheaded the development of exon skipping in the early 1990s which now, after twenty years of work, is potentially a viable treatment that can one day improve the quality of life of many boys affected by Duchenne muscular dystrophy. What was once just a hope 50 years ago now shows real potential for a treatment.

Lord Attenborough’s determination has always inspired people, leading many of his friends and indeed the general public to support our work and, as a result, we have been able to make a growing investment in scientific research. We are closer now than we have ever been to the first treatments, and we need to build on these significant achievements.

In honouring Lord Attenborough’s tireless work and commitment to research, we are launching the Richard Attenborough Fellowship fund to enable the charity to drive forward his initial work, ensuring the research momentum is maintained, with treatments developed and progressed to clinical trial.

One of the limiting factors in developing research and conducting trials is the shortage of neuromuscular researchers and clinical specialists. Thanks to this

“As you will know the Muscular Dystrophy Campaign has been extremely close to my heart since I first joined the Group as a Vice President in 1962. I have never forgotten learning at first hand of the impact of Duchenne muscular dystrophy on boys and being so moved and indeed distressed to find that there were really no effective treatments and indeed no sign of a cure even on the far horizon in those days,” Lord Attenborough said. appeals committee in the 1980s that raised millions of pounds for research into muscular dystrophy and related neuromuscular conditions. He also introduced his friends to the cause and travelled the country raising funds for the appeal. As a result, the charity was able to invest in groundbreaking scientific research for effective treatments and cures. The Muscular Dystrophy Campaign has been one of the few funders to identify and invest in the early stages of neuromuscular research, laying the foundations for the most promising projects currently in clinical trials.

fund, the Muscular Dystrophy Campaign will be able to offer Richard Attenborough Fellowships to ensure clinical research and training continues at the leading UK centres such as Newcastle, Oxford and London.

Lord Attenborough was extremely passionate about raising funds for research. To recognise his valuable support, please join us in making a financial contribution to establish a fellowship programme in his name. Do get in touch with Anna Porcherot on 020 7803 2862 or a.porcherot@muscular-dystrophy.org

www.muscular-dystrophy.org

A lifetime of achievement – Lord Walton retires Lord Walton of Detchant (pictured below right), a founding member of the Muscular Dystrophy Campaign, was recently presented with a Lifetime Achievement Award by the charity.

T

he Award, presented to him by the charity’s Patron, His Royal Highness The Duke of Edinburgh, K.G., K.T., had the following citation:

“As a founder of the Muscular Dystrophy Campaign, Lord Walton has offered his tireless support and made a remarkable contribution to the work of the charity for more than 50 years. As a long-term Chairman [1970 to 1994] and Honorary Life President of the charity, as well as a leading international figure in medical research, he has been a loyal and positive guiding influence and continues to be an inspiration.”

Lord Walton originally planned to become a paediatrician but while he was completing his medical training in Newcastle he met the influential Professor Fred Nattrass and decided to specialise in neurology. In 1964, the two doctors published a paper on the classification of muscle disease. The international success of this work led to a major grant from the Muscular Dystrophy Association in America, which enabled Lord Walton to develop a research programme in Newcastle, which is still thriving today.

Lord Walton of Detchant was awarded a life peerage in 1989. He has been a regular advocate in the House of Lords of the need for improvements in specialist care for people with muscular dystrophy and related neuromuscular conditions.

He has also forensically scrutinised the details of the Health and Social Care Bill during its passage through the House of Lords in 2011 and 2012.

He has a well-earned reputation as an effective, skilled and influential member of the House of Lords who commands the utmost respect when he contributes to debates in Parliament.

The All Party Parliamentary Group (APPG) for Muscular Dystrophy, for which the Muscular Dystrophy

Campaign provides the organisational support, conducted a nine-month inquiry (December 2008 to August 2009), with Lord Walton’s expert knowledge and insight proving invaluable to its success.

Indeed, many of the country’s leading clinicians providing evidence during the inquiry had at some time been trained by Lord Walton.

During an APPG meeting at which Lord Walton was not present, MPs and Peers unanimously decided that it would fitting for the inquiry’s report on access to specialist neuromuscular care to be named The Walton Report.

The report was launched in August 2009, and in a House of Lords debate in November 2009, the then Health Minister, Baroness Thornton, commented: “I have to say – I am sure that the House will join me in this – that I am not surprised that the report was named after the noble Lord, given his record and work in this area.”

Within the NHS, commissioners use the phrase ‘Walton-compliant’ to assess whether they are fulfilling the recommendations of this landmark report.

page 19

News

www.muscular-dystrophy.org

Phase 1 clinical trial of utrophin drug for Duchenne announced

News Here we bring you news, from all around the UK, of our work in leading the fight against muscular dystrophy and related neuromuscular conditions.

The 2012 patient survey We campaign to call for the services that our supporters tell us they need.

Our 2012 Patient Survey is designed to do just that, and we’d like to encourage those of you who’ve not yet filled out the survey to do so before the end of August.

The Patient Survey will help us to understand the care and support needs of our supporters, so it is important that you tell us what you think of the services you receive. To date, the survey has highlighted the following issues: · access to health services such as physiotherapy, expert consultants and specialist teams · the understanding that GPs have of these conditions (important as they will be the ones taking charge of more local services, such as physiotherapy) · the problems with wheelchairs and other equipment such as cough assists (long waits/costly equipment) · advocacy issues such as local authority grants/adaptations/care packages.

Nic Bungay, Director of Care, Campaigns and Information, said it was important for these specialist services not to get lost in the proposed reforms of the NHS. “We want the new National Commissioning Board, rather than the GP-led local groups, to plan and deliver these specialist services. I’d encourage

as many people as possible to take part in the patient survey so that we can update the picture of how well the NHS and local authorities support people with muscular dystrophy and related neuromuscular conditions. People’s direct experiences help to create the most current and comprehensive picture of the state of services in 2012,” Nic said.

Information gathered from this survey will be used in updating our State of the Nation reports published in 2008 and 2010. We will also use the results of the survey to help shape our campaigning over the coming months as we continue to call for services that better meet the needs of people with muscular dystrophy and related neuromuscular conditions. And by completing this survey you will be helping us to fight for additional investment.

If you’ve not yet done so, please take 15 minutes to fill out our survey and tel us about your recent experience of NHS services, social care support and wheelchair services.

For more information about the survey, please get in touch on 020 7803 4839 or campaigns@muscular-dystrophy.org

On the web To fill out the patient survey, go to: www.bit.ly/L9Akav

A new clinical trial of the utrophin drug for Duchenne muscular dystrophy has been announced. Unlike other approaches such as exon skipping, this drug has the potential to treat all boys with Duchenne muscular dystrophy, regardless of what genetic mutation they have.

The start of this phase 1 safety trial of the drug was announced by Oxfordbased drug discovery company, Summit Corporation plc, in May. The drug, currently being tested in healthy volunteers to assess how safe and welltolerated it is at various doses, is designed to increase levels of utrophin in the body, which may be able to compensate for the lack of dystrophin in boys with Duchenne muscular dystrophy.

SMT C1100 was previously tested in a phase 1 clinical trial by US pharmaceutical company, BioMarin, but unfortunately even at high doses only small amounts entered the bloodstream.

Summit plc has since reformulated SMT C1100 into a form that should be better absorbed and reach the muscles at the levels thought to be required to improve muscle function. In addition to testing the safety of the drug, this phase 1 trial will also evaluate how well this new formulation of the drug is absorbed.

It is anticipated that initial results from the trial will be available before the end of this year. A successful outcome from the phase 1 trial is expected to lead to a phase 2 study in Duchenne muscular dystrophy patients. This drug may also be applicable to individuals with Becker muscular dystrophy who have reduced levels of dystrophin in their muscles, but this has not been studied in detail as yet.

The Muscular Dystrophy Campaign has funded Professor Dame Kay Davies’ research into utrophin for more than 25 years and in collaboration with Summit they discovered and developed SMT C1100. Research has shown that treating a mouse model of Duchenne muscular dystrophy with SMT C1100 resulted in increased muscle strength and muscles that didn’t tire as easily.

www.muscular-dystrophy.org

Foundational research: an update

The Muscular Dystrophy Campaign was established in 1959 to raise money for research into causes of and cures for muscular dystrophy. Since then, diagnosis into the various conditions has improved tremendously and we now provide support for more than 60 forms of muscular dystrophy and related neuromuscular conditions.

Research into effective treatments and, indeed, a cure, remains our priority.

We fund high-quality science and groundbreaking research. We held two research receptions earlier this year – in London and in Edinburgh – to showcase this research and to thank supporters for making this pioneering work possible.

We gathered at the Wellcome Collection for the London event, where we heard updates from Professor Doug Turnbull, whose groundbreaking research has been shown in mice to prevent the transmission of mitochondrial disease.

This provides real hope for families, for the first time, to have a child unaffected by mitochondrial myopathy.

Professor Jane Hewitt spoke about her work understanding the complex underlying mechanisms behind facioscapulohumeral muscular dystrophy (FSH), which is essential

for the development of potential therapeutic approaches. And then Professor Matthew Wood presented his current project that is further developing exon skipping technology, which is being developed for boys with Duchenne muscular dystrophy. He detailed how his lab has improved the delivery of the molecular patches to the heart of mouse models, an area of muscle that previously delivered poor results.

At our first Scottish research reception in Edinburgh, guests heard from our Research Director, Dr Marita Pohschmidt, about our investment into foundational research that consistently paves the way for potential treatments.

Professor Darren Monckton presented his lab’s investigation into the basis of genetic instability in disorders such as myotonic dystrophy. His work aims to provide more accurate prognostic information to help progress towards treatments and cures.

Finally Professor Thomas Gillingwater presented some findings relating to spinal muscular atrophy (SMA) and its underlying causes. His lab has made several major breakthroughs in SMA research recently, including the identification of a drug that has the potential to reverse muscle pathology.

Commitment on care advisor post in Northern Ireland

The Northern Ireland Assembly’s All Party Group on Muscular Dystrophy has received a commitment on the imminent recruitment of the vital care advisor post at the group’s latest inquiry session.

Karin Jackson, representing the Belfast Health and Social Care Trust, informed the All Party Group, chaired by Conall McDevitt MLA, that the care advisor post, which has been vacant since November 2011, would be advertised before the end of May and an appointment made by the start of July.

While there is significant disappointment and frustration that people living with muscular dystrophy and related neuromuscular conditions in Northern Ireland have been left without this vital role since November, this is a welcome development in the fight to improve access to specialist neuromuscular care.

The All Party Group’s inquiry report - The McCollum Report - was launched on 3 July at the Northern Ireland Assembly. The Muscular Dystrophy Campaign provides all the organisational support for this All Party Group on Muscular Dystrophy. Read more about the lobby and the report in the next edition of Target MD. For more information about the campaign to improve services in Northern Ireland, please get in touch with Jonathan Kingsley on 020 7803 4839 or j.kingsley@muscular-dystrophy.org

Muscular dystrophy care in Wales

The Welsh Health Minister, Lesley Griffiths AM, was recently challenged on specialist care improvements in Wales, at Health Questions in the Welsh Assembly.

Bethan Jenkins AM, Chair of the Cross Party Group on Muscular Dystrophy in the Welsh Assembly, quizzed the Health Minister on mapping neuromuscular services and identifying gaps, such as specialist physiotherapy for adults.

The Health Minister responded that the Welsh government was working with the Muscular Dystrophy Campaign and the health boards to improve services and support for individuals and their families living with these conditions.

“We have met, and I realise there were calls for additional investment in specialist adult physiotherapy. However, clinical staff felt that if there was further investment, it should be used for specialist occupational therapists and psychology staff. I am committed to ensuring that all patients with conditions such as muscular dystrophy have personal care plans,” Mr Griffiths said.

For more information about our campaigning in Wales, please get in touch with us on 020 7803 4839 or campaigns@muscular-dystrophy.org DIY advocacy – all the tools in one pack A new addition to the charity’s advocacy service, which will help you fight for your rights and get the essential support and equipment you need, was launched by the Muscular Dystrophy Campaign at the end of May. The Advocacy Pack provides information and support for people with muscular dystrophy and related neuromuscular conditions. It complements the range of advocacy support the charity currently provides, including a telephone helpline, email support and legal advice from our pro bono partner law firm, Hogan Lovells.

If you struggle to access the necessary care, support and adaptations you need to live a full and independent life, do contact our advocacy team who can advise you, and send you a copy of the new Advocacy Pack. Call our toll-free helpline on 0800 652 6352 or email info@muscular-dystrophy.org

page 21

News

www.muscular-dystrophy.org

The pathway of change “My brother Arvind Jain had Duchenne muscular dystrophy, a musclewasting illness. He had never been admitted to hospital during his 13 years.

He was under the neuromuscular team in Hammersmith since he was diagnosed at the age of three.

Just before his 13th birthday at Christmas, he become unwell and his swallowing muscles had become weak, making it difficult for him to swallow. He was admitted to our local hospital where a naso-gastric tube was put in via his nose into his stomach to feed him. This is a temporary measure, which is usually in for a maximum of two months until a person has a feeding operation, called a PEG*. The reason the tube is in temporarily is because it can move out of position and it also needs changing regularly. As you can imagine, it’s not nice to keep putting a tube down someone’s nose, through his throat and then having an X-ray to make sure it is in the right place. * Percutaneous endoscopic gastrostomy is an endoscopic medical procedure in which a tube (PEG tube) is passed into a patient’s stomach through the abdominal wall, most commonly to provide a means of feeding when oral intake is not adequate.

Arvind was moved to Great Ormond Street Hospital and in January, when the consultant saw Arvind, he asked him whether he wanted this operation and he said yes.

The consultant then wrote a letter, explaining the urgency, to the surgeons in the same hospital. Months went by and nothing happened. In the meantime, Arvind got weaker and was losing weight.

The consultant wrote various letters and emails, and did a pre-assessment on Arvind; we too complained to PALS (the NHS’ Patient Advice and Liaison Service).

Nothing happened and on 9 August 2009, we lost Arvind to malnutrition. We resolved to continue our fight against the hospital.

Somebody emailed the local paper from the hospital with the investigation papers.

The journalist printed only a story about confidentiality. I requested Arvind’s files from the hospital and went through everything with a fine tooth comb and found out things that we never knew,

for example dates for the operation, but Arvind was never booked in.

I then built my own case against the Hospital, using evidence from the file and letters to prove Arvind’s life had been shortened by these oversights. I wrote to the General Medical Council, the Health and Parliamentary Service Ombudsman (HPSO); in fact I got in touch with anyone who could help but my case was rejected.

In March 2010, I got in touch with the journalist and said we were ready to go public. He printed our story and a freelance journalist saw it and got in contact with us. He wanted to get our story in the press. We decided to go ahead and our story ended up in newspapers and on the television.

Because of this, Great Ormond Street Hospital got in touch with us the same day as we wanted a meeting with that doctor. We had the meeting, with the Church of England involved. We had all the evidence, so they couldn’t do anything.

We were not happy, so we wrote back to HPSO, who said they would review our case and let us know again about taking the case. The journalist advised us to write to our local MP. Instead of writing, I decided to make an appointment with the MP. He listened and said he would go through the case we made. After a week, he wrote back saying he was appalled and disgusted and he wrote to HPSO to take the case. They did take the case and found GOSH guilty of maladministration, and found their service of care to be way below where it should be and that had Arvind had the operation, he may still be here.

We were offered compensation but turned it down. We wanted changes instead. We made sure changes happened and the result of this was the Arvind Jain Pathway; this is used for any child needing a feeding operation. We have

made sure there are specialist nurses and doctors and the way they communicate is different – all were given mobile phones on which they could access emails etc.

These are just some of the changes. This Pathway has completely changed the whole process in the hospital. Each point has a step-by-step process, which means that what happened to Arvind can never ever happen again.

The Arvind Jain Pathway is now being used for all patients in the hospital for all illnesses. The hospital may not amend or make any changes unless they speak to us and we have the final say in all amendments to this Pathway.

Arvind isn’t here anymore, but we have made sure that his legacy will be here forever; long after we have left this earth.”

Shushma Jain, on behalf of the Jain family

Scotland Cross Party Group vows to tackle social injustices

The Cross Party Group on Muscular Dystrophy in the Scottish Parliament, chaired by Jackie Baillie MSP, met at the end of May to discuss the social injustices highlighted in the Inclusion Now report

by Scotland’s Trailblazers.

The Cross Party Group, after hearing many shocking experiences of accessibility problems, resolved to conduct an inquiry, which will begin in the autumn, into the difficulties faced by young disabled people in Scotland.

The discussions with supporters at the session, including Trailblazers, covered transport, leisure facilities, employment, higher education and tourism.

The meeting was also an opportunity to highlight the urgent need for the commitments made by the NHS in February to be fulfilled: to increase neuromuscular care advisor support to three full-time posts in Scotland.

The Muscular Dystrophy Campaign provides organisational support for the Cross Party/All Party Parliamentary Groups on Muscular Dystrophy in the Scottish, Welsh, English and Northern Irish parliaments. For more information about these groups’ activity, please get in touch with Jonathan Kingsley on 020 7803 4839 or j.kingsley@muscular-dystrophy.org

www.muscular-dystrophy.org

New registry brings hope for families with myotonic dystrophy

The Muscular Dystrophy Campaign and the Myotonic Dystrophy Support Group are calling on everybody in the UK with myotonic dystrophy type 1 to join the new patient registry, launched in May. The new registry will allow clinicians and researchers to speed up the transition of treatments from the laboratory to the clinic by speeding up the recruitment process of people to take part in clinical trials and ultimately to improve understanding of the condition.

Researchers have made considerable progress in recent years with the development of promising technologies that could provide the basis for potential treatments for myotonic dystrophy.

To find out whether any of these new technologies can be used to treat the symptoms of the condition, they have to be tested in a clinical trial. Myotonic dystrophy, however, is a rare disease and one of the problems clinicians face is in finding enough patients for clinical trials to start without delay.

The registry, established under the lead of Professor Hanns Lochmüller at Newcastle University, is a centralised database that contains the crucial information needed to find people suitable for clinical trials.

The information will also be used to develop standards of care and give people a link to the research community, as well as the opportunity to get information directly relevant to their condition.

When you register, you will be asked to fill in a short online questionnaire about your symptoms and family history. If you prefer, you can call the registry curator, Karen Rafferty (0191 241 8640) to request a paper copy of the form. All the data is stored in a secure server and is only accessible to appointed registry staff.

The Muscular Dystrophy Campaign is currently funding the setting up of a new registry in the UK, and we plan to support more registries in the future. It is only through your contributions that we can fund these vital registries. To find out more about patient registries, or to make a donation towards this vital work, do call 0800 652 6352 (freephone) or email info@ muscular-dystrophy.org

How can we help?

A round-up of advocacy services over the past few months Demand for our advocacy service is increasing all the time. Here is an update of recent work we’ve taken on ourselves and with the support of our pro bono partner law firm, Hogan Lovells.

• In April we received seven new cases, closed five and carried 18 over. The new cases relate to adaptations and care packages. We secured £19,000 worth of support for people with muscular dystrophy and related neuromuscular conditions.

• In May we received nine new cases, closed six and carried 22 cases over. The new cases relate to wheelchairs, care packages, housing, benefits and education.

• In June we received nine new cases, closed six and carried 25 over.

• Our current case load is 24.

• Two cases are currently being dealt with by our partner law firm, Hogan Lovells.

• Since the beginning of April, we have secured an amazing £178,378 worth of support for people with muscular dystrophy and related neuromuscular conditions. This includes 87,078 worth of support that we secured in May, our most successful month to date, and puts our total for 2012 at a staggering £319,805.

Trailblazer Carrie-Ann Lightley of Cumbria, was having difficulty accessing a local nightclub, as the lift was constantly breaking down. The nightclub told Carrie-Ann they had no legal requirement to have a lift. We handed the case to Hogan Lovells, and this has resulted in representatives of the nightclub confirming that the lift is now in full working order, and then sending Carrie-Ann a full written apology.

Catriona Jack, from Scotland, contacted us regarding the difficulties she was having trying to access the bathroom facilities at Strathclyde University. The university refused to put locks on the adapted bathrooms designed for Catriona. This was leading to misuse and often led to situations that put Catriona’s health at risk with students leaving the facilities messy and unsafe. The university also refused to give her a card to allow her easy access to parts of the university. We wrote a letter to the university requesting them to adopt the RADAR key system. They have since installed this system, provided more signage stating that those bathroom facilities are for the sole use of disabled people and also provided Catriona with a card that will allow her access to all areas of the university.

If you’re experiencing similar difficulties to any of these described here, do get in touch with our advocacy service and we can speak up on your behalf, or give you the information to do so yourself. Do get in touch with David Moore-Crouch on 020 7803 4800 or info@muscular-dystrophy.org

On the web Read Carrie-Ann’s story here: www.mdctrailblazers.org/news/1018

On the web Read more about the UK Myotonic Dystrophy Patient Registry www.bit.ly/Kwwj50 Register now: www.dm-registry.org/uk Read about research we fund that could benefit people with myotonic dystrophy: www.bit.ly/KOmA8 Visit the Myotonic Dystrophy Support Group website: www.myotonicdystrophysupportgroup.org

page 23

page 24

www.muscular-dystrophy.org

Sex and disability – the research Dr Kirsty Liddiard

Sex and disability can evoke a range of problematic reactions (or worse, just silence). It’s these reactions which ensure that sex and disability remain ‘the last taboo’. To add context, I have recently completed my doctoral research at the University of Warwick, the aim of which was to collect disabled people’s sexual stories in order to explore their experiences of sexual and intimate life.

Many of the people who took part in my research had muscular dystrophy or other neuromuscular conditions, and so in this article I’d like to share some of my research findings.

A key finding which will resonate strongly with people living with muscular dystrophy is the way in which our bodies – which can be weak, immobile, painful, incontinent, as well as the site of pain, contractures and spasms – may conflict with conventional markers of what we perceive as ‘successful’ sex: as penetrative, spontaneous, genitallyfocused and incredibly physical. The majority of participants said that not meeting these markers made them feel sexually inadequate – a sexual failure.

Many also felt additionally pressured by the stereotypical gender roles that we often associate with (heterosexual) sex.

For example, some men felt ‘unmanly’ because they found it hard to take the conventional ‘dominant’ role, and most women felt ashamed at their body’s departure from the ‘ideal’ sexy feminine body which is reproduced through our media and wider culture.

Helen*, who has limb girdle muscular dystrophy, said she hid her body during sex with her long-term partner, a common practice among the women who took part in my research. However, some others could redefine sex according to their own bodily capabilities which often meant being creative and exploratory to see what sexual pleasures and practices worked best for them.

*Not their real names.

For example, Terry*, who has spinal muscular atrophy, couldn’t move independently during sex which meant that he had to find unique ways around his restricted movement. I suggest, then, that while we may assume that our bodies are the biggest hindrance to sexual expression, actually it’s probably far more likely to do with the very limited ways in which we, as a society, define sex.

Interestingly, participants’ stories also revealed the considerable ‘work’ which could be part of their sexual and intimate lives. This may sound like a strange concept, but I found that many routinely took on the roles of teacher, negotiator, manager, mediator, performer, educator, and resistor. Types of work included anything from having to navigate nondisabled people’s curiosity about sexual ‘capabilities’ (“Can you have sex?” was a common one) to mediating suitable sexual health and pregnancy care. For

most people, negotiating privacy was a central form of work. For example, Harjit*, who has congenital muscular dystrophy, and Abram*, who has spinal muscular atrophy, devised ingenious strategies to keep their sexual expression private from their parents – who were their primary carers – during adolescence.

It is important to identify and label such work because it shows that disabled people are often skilful managers of their private and intimate lives.

In this article I’ve provided just a tiny snapshot of my participants’ experiences of sexual and intimate life; please read my Research Summary to find out more (details below). I hope that we keep talking openly about the potential conflicts, complexities, and pleasures of disability and sex. Talking openly and honestly is a way to foster more positive sexual cultures for disabled people, and the only way to rid us of ‘the last taboo’.

If you’d like any further information about any of the contents of this article, please don’t hesitate to get in touch: Kirsty.liddiard@ryerson.ca If you’d like to know more, please read my Research Summary, which can be found here: www2.warwick.ac.uk/fac/ soc/sociology/pg/current/phdstudents/ current/sypgbj/

www.muscular-dystrophy.org

Epic WFA Cup final We have just ended a historic season and one that will be talked about for years to come. The sport of powerchair football in England continues its amazing story.

The final

On Saturday 2 June 2012, Northern Thunder PFC faced Sporting Club Albion in the final of the 2011/12 WFA Cup. With a large crowd in attendance, the last event of the season turned out to be a fantastic match.

After a cagey start, both sides started to look to create chances. Both teams defended well and goal scoring opportunities were difficult to find. It was goalless at half-time, but a good set piece and then a counter attack gave both sides early chances in the second half. As the first goal remained elusive, both teams seemed to settle for extra time. Extra time was a nervy affair with neither side wanting to make a mistake. Following 60 minutes of action the scores were still level and the Cup final would be decided on penalties.

Sporting Club Albion was up first and scored what would turn out to be the first of many penalty kicks. The pressure started to build on the players, and it was Sporting Club Albion who cracked first, with their third penalty going just

wide of the post. Northern Thunder had a great chance to win it, but then agonisingly struck the post for the score to be 3-3 after the first four kicks. This meant it would be decided on sudden death. Amazingly, the next 30 penalties were scored and with the scores at 1818, Sporting Club Albion hit the post to give Northern Thunder another chance to win it. Ed Common remained calm to strike the ball into the corner and give Northern Thunder a fantastic victory and claim their first ever piece of silverware.

The season

The 2011/12 season kicked off in September 2011 and saw the National League based at a new venue, with a new format and 22 teams taking part. This would be the largest WFA competition ever and would see over 180 players take part in 264 matches played over 11 event weekends. The WFA Cup also took a new format with matches being played throughout England as it went ‘on the road’.

After the fantastic effort by England at the FIPFA 2011 World Cup where

they finished second – and as the most successful England football team of the year – the focus returned to the domestic season. Aspire PFC claimed their sixth Premiership title, but didn’t have it all their own way as they were pushed until the last game of their season to confirm the title.

At the other end of the table, Sevenoaks Vikings and Evergreen PFC will play in the Championship division following hard campaigns. Norwich City PFC were crowned Championship winners and will be promoted along with Bolton Bullets PFC. The final Premiership place was decided with a play-off match between Aspire 2 and Swindon Rockets, and a tight 1-0 victory ensured Aspire 2 survived for another season in the top division.

On the web If you would like to find out more about Powerchair Football, please visit the Wheelchair Football Association’s website www.thewfa.org.uk

page 25

page 26

www.muscular-dystrophy.org

A

s the country gears up for London 2012, elite athletes all around the country are working hard to prepare for the biggest sporting event on the planet. To play in a home Paralympics, for many, is a dream come true.

Aside from the athletes, however, ticket sellers, broadcasters and innovators are also getting things in line to make the London 2012 Paralympics the most successful to date. Paralympics officials have expressed confidence the London Games could become the first to sell out completely in the event’s 52-year history, while Channel 4’s broadcast schedule will be dominated by Paralympics action, with more than 150 hours of coverage during the event’s 12 days (29 August to 9 September 2012). The daily broadcasts will be presented by an on-screen roster of sports commentators, including disabled presenters and reporters and Australian comic, Adam Hill.

And if 150 hours of coverage weren’t enough, Channel 4 has also unveiled a ‘revolutionary’ graphics system called ‘Lexi’ to help viewers understand the Paralympics classification systems, which have been identified as the single biggest barrier to viewer understanding.

Paralympic swimmer and gold medallist Giles Long developed ‘Lexi’, a graphics system which seeks to demonstrate – onscreen and in quick and simple form – why athletes with different disabilities are grouped together in competition.

Long said he had been working on the system, for which he has already developed 122 on-screen symbols using a traffic light rating to indicate the extent to which athletes are affected by their disability, since the Sydney Games in 2000.

In addition, a number of the Muscular Dystrophy Campaign’s supporters have been selected as torchbearers, volunteers and ambassadors for the Olympics and Paralympics, and many have already carried the torch on their particular leg of its 3,000 mile journey across the country.

On the web: http://storify.com/TargetMD/london2012-paralympic-games

Gold for GB? Watch the Boccia

Early in May, GB Boccia was hard at work at a Paralympic Test Event – the London Boccia Invitational at the Olympic Basketball Arena – at which Great Britain topped the medal table, reaching the podium in all five events.

In the individual BC3 event, Jacob Thomas bounced back from a semi-final defeat to snatch the bronze. In the pairs, he and Jess Hunter took gold.

GB Boccia contributed to another national win at the BT Paralympic World Cup event in Manchester towards the end of May. Early in the week, Great Britain beat the Czech Republic in a friendly international, with Scottish brothers Stephen and Peter McGuire – and super sub, Jamie McCowan – representing the host nation.

Over the five days of competition more than 200 athletes from 30 countries competed in front of more than 11,000 spectators. A great taste of things to come in London 2012.

Stephen, Peter and Jacob were featured in Target MD Issue 1 of 2012 p29 – 32, along with fellow ParalympicsGB Boccia player, Scott McCowan. (l to r) Pete and Stephen McGuire; Jamie McCowan; Channel 4’s Jon Snow watches the Boccia while the TV crew films it all.

www.muscular-dystrophy.org

Ollie’s in the fast lane to the Paralympics

Ollie Hynd is a regular 17-year-old. He’s never without his iPod, he eats mountains of food, he likes playing computer games and enjoys spending time with his friends. Two things set him apart from his peers, however: he’s a Paralympic swimmer and for both of his London 2012 events he’s ranked world number one.

Ollie describes himself as ‘tough, focused and driven’. You’d have to be to spend four hours a day, six days a week, training towards the dream of getting on to the podium at London 2012. Ollie trains at the Nova Centurion Club in Mansfield under the direction of coach, Glenn Smith, and with the support of strength and conditioning coach, Tim Stevenson.

He specialises in the 400m freestyle and the 200m individual medley (IM) and for all the other S8 competitors at London 2012 – including older brother Sam – Ollie will be the one to beat.

While we sat and watched Ollie training, so did his six-year-old cousin, Jack, whose dad said, “Ollie is an amazing rolemodel for able-bodied swimmers as well as disabled swimmers. Jack dreams of one day being a champion swimmer like his cousin.”

“Ollie is an amazing rolemodel for able-bodied swimmers as well as disabled swimmers.”

Ollie’s inspiration comes from Michael Phelps, the American swimmer who, with 16 medals from Athens (2004) and Beijing (2008), is the most successful athlete at both of these Olympic Games.

“Michael is a constant source of inspiration for me,” Ollie said.

On the other side of the pool, a poster of Ollie’s brother, Sam, watched over the training session too. Also a role-model for the swimming club and a medal contender for this year’s Paralympics, Sam (20) trains and studies in Swansea.

He won gold in the S8 400m freestyle at the Beijing Paralympics in 2008.

That was the year things changed for Ollie too. A strong swimmer from a young age, it was only when he was 12 that Ollie noticed his left leg was growing abnormally. After an operation in May 2008, Ollie was referred to the neurology unit in Nottingham and then on to Great Ormond Street Hospital where he was diagnosed with mitochondrial myopathy.

Sam has the same condition.

It was, undoubtedly, a double blow for the family to have both sons diagnosed with a muscle-wasting condition. Mum, Helen (who, herself, has been selected as a torchbearer for the Paralympic torch relay), said that Sam and Ollie had always been keen swimmers, but swimming had taken on a new significance following their diagnoses; the sport keeps their muscles stretched, prevents stiffness and aches and reduces fatigue.

Ollie’s condition

Mitochondrial myopathy This is a collective term for a group of diseases that particularly affect muscle, but may also affect every other part of the body including the brain and the eye.

Our bodies are made up of many different tissues, which are composed of small ‘building blocks’, called cells, and within each cell are mitochondria. The job of these mitochondria is to produce energy, like a power generator, taking in fuel (the food we eat) and burning it up to generate energy. If this process fails, the cell cannot function adequately and this can lead to disease. Muscle and brain require a lot of energy, and are often the most severely affected.

The part of mitochondria concerned with energy production is called the respiratory chain and components of this chain pathway are produced from a genetic blueprint (the DNA) found either within the mitochondria (mtDNA), or on the chromosomes in the nucleus of the cell. Many mitochondrial diseases are sporadic. This means that only one individual in a family is affected – the parents and any children of that person are unaffected. Other mitochondrial diseases are only inherited from the mother. Diseases that arise because of defects within the genes found on chromosomes within the nucleus may be inherited from either parent.

Ollie’s fortnightly physiotherapy and sports massage, as well as regular sessions with his strength and conditioning coach, help both his sport and his health.

“Anything is possible, with hard work, dedication and belief,” said Ollie, whose Paralympic hopes are to do the best he can and swim some personal bests.

With the official launch of ParalympicsGB in London in July, followed by the national swimming championships in Sheffield and a holding camp until the Games begin, 2012 is turning out to be a very big year for Ollie: an extraordinary, regular, 17-year-old.

On the web Follow our Twitter list to keep up with London 2012: twitter.com/#!/TargetMD/london-2012 Paralympic coverage on Channel 4 www.mirror.co.uk/sport/other-sports/learnas-you-watch-channel-4-852141 Follow Lexi; he’ll explain the Paralympic classifications: twitter.com/#!/LexiDecoder www.guardian.co.uk/sport/2012/may/29/ london-2012-paralympic-games-tickets Find out about Boccia: www.gb-boccia.org Read more about Ollie Hynd: www.oliverhynd.co.uk/

page 27

page 28

www.muscular-dystrophy.org

M

any young disabled people feel locked out of the housing market in the UK. Trailblazers, a network of young campaigners, have called on the government to turn the situation around.

The young campaigners presented their housing report, Locked out, to the All Party Parliamentary Group for Young Disabled People in Parliament in early July. The report, which followed their investigation into accessible housing and the services of the UK’s housing providers, calls on the government to hold a comprehensive housing and disability review to ensure that all young disabled people throughout the UK have equal access to adapted housing, or housing adaptations, wherever they choose to live.

According to statistics provided by Lifetime Homes, more than 40 percent of young disabled people live in accommodation that doesn’t meet their needs. After university, many young people want to move away from home and begin a new chapter of their lives. For young disabled people it means obtaining barrier-free, accessible accommodation so they can live independently.

Locked out – a housing investigation

The report was taken from a survey and focus group meetings across the UK. It reveals that many young disabled people believe that the property sector and independent living services regularly fail to deliver an efficient service for them.

The barriers to living independently can range from an estate agent’s lack of knowledge of the accessibility of housing stock to the quality of personal care in different areas of the country.

The Trailblazers hope this report will help to create a situation where young disabled people in the UK feel confident that estate agents, local authorities, property developers and architects will deliver a service that means they can live independently, where they want to. The launch of the report featured in the Guardian online, the Independent and Channel 4 News, with a Twitter discussion thread at #nogobritain

On the web Read Locked out here: bit.ly/lockedoutreport

NEW Volkswagen Sharan conversion by BROTHERWOOD

Super 5 for the wheelchair passenger and family No Lifting with the new optional quick fold seat No Pushing - PAWRS (powered assisted wheelchair restraint system) For details of the complete range of vehicles transformed by Brotherwoods ring 01935 872603 or visit www.brotherwood.com

Brotherwoods KIA Sedona Gold Label “a winning front runner”

BROTHERWOOD

Automobility Limited TELEPHONE: 01935 872603 BROTHERWOOD AUTOMOBILITY LIMITED, BEER HACKETT, SHERBORNE, DORSET DT9 6QP

page 30

www.muscular-dystrophy.org

www.muscular-dystrophy.org

The best of the web

Each of these events had its own unique vibe but they did have a few things in common – iconic cities, committed fundraisers and dedicated friends and family cheering them all on.

nners t happy ru Soggy bu g their brandishin medals e Cambridg

Massive support from “team oran ge� at the London M arathon

A

focus on volunteering; we have so many volunteers, doing so many great things on behalf of the Muscular Dystrophy Campaign, who are in touch with us online. What to choose, what to choose!

I eventually decided to focus on our Town and Gown 10k race series and our 2012 London Marathon. We got so many messages of thanks from runners praising the volunteer marshals, who braved some pretty horrendous weather to make the inaugural Cambridge 10k event a success.

We had even more volunteers out in force for the Oxford event. The Oxford race has over 3,000 runners, so we rely on volunteers to make such a great event happen. The London Marathon was even bigger.

Here are a few highlights from the web from the days of the races:

David Pearce Direct Marketing and Digital Manager t: 020 7803 4837 e: d.pearce@muscular-dystrophy.org tw: @TargetMD

Smiles all round at the finish line In Oxford

page 31

page 32

www.muscular-dystrophy.org

Watford made our day count

We love it, at the charity, when stories of our supporters spark the interest of other supporters and a chain of events takes place. The end result is not only increased fundraising, but also new communities made aware of muscular dystrophy and related neuromuscular conditions. That’s what it’s all about.

When our leap year fundraising campaign – Make today count – was launched in January this year, the Watford Observer ran a story about local powerchair footballer, Stevie Pearson (19). An England powerchair footballer, Stevie has Duchenne muscular dystrophy and the article about him was an appeal to his local community to skydive in support of the charity’s fundraising campaign.

“Funds raised could help to change the lives of the next generation born with muscular dystrophy,” Stevie said.

Make today count 2013

In 2012, families from across the UK came together to make the leap year day count and raised more than £84,000 for Muscular Dystrophy Campaign research.

In 2013, we will be making Friday 1 March count for muscular dystrophy and related neuromuscular conditions. Put the date in your diary, and watch this space for more information about how you can get involved. Registration opens in August.

Stevie’s nan, Linda Harman (61), read the article and was so impressed to read about her inspiring grandson that she decided there and then to skydive. When she made the announcement to her family, her son-in-law, Marco Hatfield, decided to join her.

“I’m so pleased I can now say ‘I did it’ and it was the most fantastic thing ever! Such a buzz, plus knowing I have raised well over £500 is even better,” said Linda.

Two other local residents who noted the Watford Observer article were cricket coaches, Ian Sampson and Gulfraz Riaz, both 40. Inspired by Stevie’s story in the paper, Ian and Gulfraz decided to walk from Watford Town Cricket Club to Lord’s Cricket Ground in London, in full batting gear.

Not only that, but Stevie’s family decided they wanted to raise some money themselves too. During the February half-term, Stevie and his family group all donned the charity’s orange T-shirts and for three hours collected outside their local Sainsbury’s in Watford.

One local newspaper article led directly to a number of people doing fundraising challenges for us, around £2,500 being raised and a community newly engaged in a charity that supports – among the 70,000 adults and children affected by muscular dystrophy and related neuromuscular conditions – a lovely Watford family.

www.muscular-dystrophy.org

The kite walk and wheel

Not just a walk in the park Our first fully accessible fundraising walk, The kite walk and wheel, will take place around the beautiful Virginia Water Lake and through the grounds of Windsor Great Park on Saturday 29 September. Participants can choose a circular distance of fourteen, ten or four miles and will finish at a Muscular Dystrophy Campaign post-walk reception. All families and supporters are invited to join us there and help us launch this exciting, new event.

If you’d like to find out more, please contact Danielle on d.bidos@muscular-dystrophy.org or 020 7803 4816

An evening with Sir Alex

Join us on Thursday 13 September in Manchester for our new fundraising dinner event: ‘An evening with Sir Alex in 2012’. Not only is Sir Alex one of the most admired and respected managers in the history of football, but he is also one of the charity’s most dedicated supporters.

Involved with the charity – which is ‘very close’ to his heart – for most of his adult life, Sir Alex said, “I am delighted to help all those affected by muscular dystrophy and related neuromuscular conditions and am looking forward to hosting this event in September.”

page 33

Friends of Muscular Dyst invite you to an even ing w

Sir Alex Ferg

To book a table of 10 for £500, or £750 for preferential seating, do get in touch with Danielle Bidos on d.bidos@muscular-dystrophy.org or 020 7803 4816

Hello from Target Research I’m Julia, and I’m the Head of Grants at the Muscular Dystrophy Campaign. Now that Kristina is in back in Australia and enjoying being a new mum, I have been temporarily covering for her until Neil Bennett, our new editor, takes over. I hope you enjoy our latest issue of Target Research!

The main feature in this issue is a report on the fifth UK Neuromuscular Translational Research Conference held at the end of March. Our volunteer science writer, Dr Alexandra Dedman, brings us an update from the meeting, which was attended by around 200 scientists and clinicians from all over the UK and further afield. We are also featuring a clinical trials update to give you an overview of what is happening right now.

In the news this time, we update you on the progress being made towards the consultation on whether to change the law to allow the use of an IVF technique to prevent the transmission of mitochondrial myopathy from mother to child.

We also highlight some exciting new research on Duchenne muscular dystrophy that may lead to a therapy in the future.

Julia Ambler (Stand-in) Editor, Target Research

uso

Thursday 13 September Mercure Man 2012 chester Picc Manchester adill

page 34

www.muscular-dystrophy.org

Hannah’s climbing for Greg Hannah Flynn is one of seven intrepid trekkers who will be climbing Kilimanjaro for the Muscular Dystrophy Campaign in October. Hannah decided to take on this peak experience for us in memory of her late brother, Greg, who had Duchenne muscular dystrophy.

“The Muscular Dystrophy Campaign is particularly special to me as it was supportive of my family after Greg’s initial diagnosis. The charity gave my parents the information and direction they really needed at that time,” Hannah said.

Why not support Hannah and the rest of the Muscular Dystrophy Campaign team on the trek to the top of the world’s highest free-standing mountain, in the beautiful heart of Africa? Not only are they climbing to the summit at 5,895m but as they do so they’ll be helping us to beat muscular dystrophy and related neuromuscular conditions and to improve the lives of everyone affected by them.

Marathon effort for the charity On Sunday 22 April, 112 fabulous runners completed a gruelling 26 miles in the London Marathon and are on their way to raising an amazing £240,000 for the Muscular Dystrophy Campaign.

We would like to extend a great big thank you to all of our dedicated and enthusiastic runners who participated in the London Marathon. Experienced athletes and first-time fun runners took part in the nation’s favourite road race, and each had their own personal story to tell as to why they wanted to run for the charity.

Our most successful fundraiser is Tim Northam, who raised an astonishing £9,700 for us. He ran to support his seven-year-old daughter and wife who both have facioschapulohumeral muscular dystrophy (FSH).

You may have read in the last issue of Target MD (Issue 2 of 2012) about Tim Moss, our very own ‘kite man’ runner. We are pleased to say that Tim and his kite completed the route in a very respectable 4hrs 46mins. Really well done, Tim, and the rest of our outstanding team.

If you were inspired by this year’s team and would like to join our team in 2013, then please email Julia on events@muscular-dystrophy.org or call her on 020 7803 4828.

Town and Gown 10k double This year, the Muscular Dystrophy Campaign introduced a new event to complement the 31-year-old Oxford Town and Gown 10k: the Cambridge Town and Gown 10k.

The inaugural event took place on Sunday 29 April and, despite torrential rain, 500 runners took on the challenge and took in the sights as they ran through the heart of this beautiful university city. The charity would like to say well done and thank you to everyone who took part.

From all of us at the charity, we’d like to say good luck and thank you to each one for taking on this Kilimanjaro trek for us.

Read the next edition of Target MD to find out how the team got on.

On the web Full details of the Kilimanjaro trek team are here: www.facebook.com/ musculardystrophycampaign Sponsor some of the team members here: Hannah Flynn: www.justgiving.com/Hannah-Flynn Hannah Weston: www.justgiving.com/HannahGWeston Dean Robinson: www.justgiving.com/summitforsean

Two weeks after the rainy start to the Town and Gown 10k series, more than 3,000 runners registered to take part in the Muscular Dystrophy Campaign’s Oxford Town and Gown 10k. We had everyone from elite club runners to those in fancy dress, marking the 31st consecutive year that we’ve hosted the popular Oxford event.

The Muscular Dystrophy Campaign relies on fundraising to provide support to people affected by muscular dystrophy and related neuromuscular conditions, so we are extremely grateful for the money the runners have raised. The events couldn’t take place without the support of a number of sponsors, as well as our dedicated race committee who generously give up their time to ensure the race is a success.

The Oxford Town and Gown was started by TV personality and dedicated supporter of our charity, Christine Hamilton.

page 35

www.muscular-dystrophy.org

Target MD and Target Research

who really want to read them, and they’re both now produced fully in-house, the Muscular Dystrophy Campaign can free up more funds to spend on further research, campaigning, support and equipment grants.

In these harsh economic times, we’re working hard to save money.

Now more than ever, we rely on every penny of your donations to fund vital research and provide support and care for people with muscular dystrophy and related conditions. With this in mind, we‘ve launched our new-look Target MD and Target Research – both to be delivered to you four times a year.

If you’d like to subscribe to the magazines, please post your details, together with a cheque for £18 made payable to ‘Muscular Dystrophy Campaign’ to Target MD Subscriptions at 61 Southwark Street, London SE1 0HL:

That’s right! You will receive Target MD four times a year instead of three, plus you will receive the new ‘slimline’ Target Research at the same time, rather than once a year as you did previously.

And all for an annual subscription gift of just £18. This will help us cover our costs - even reduce them - while ensuring the same editorial quality you’d expect from every issue of Target MD and Target Research. And because they now only go to people like you

I wish to subscribe to Target MD and Target Research for one year, at a cost of £18.

I wish to make a donation of £___________

Using Gift Aid means that for every pound you give, we are able to reclaim back from the Inland Revenue the tax paid on it – helping your donation to go further. Please tick the box below:

Target MD

magazine

Gift Aid Declaration

Issue 2 of 4 2012

Yes I would like Muscular Dystrophy Campaign to treat all gifts that I have made in the last four years and all future donations that I make from the date of this declaration as Gift Aid donations.

I will notify the charity if my gifts are no longer eligible.

Adapted housing and all you need to know

MUST READ

Meet Ethan

No, please do not claim Gift Aid on my donations.

FEATURE

To be eligible for Gift Aid you must pay an amount of Income Tax and/or Capital Gains Tax for each tax year (6 April one year to 5 April the next) that is at least equal to the amount of tax that the charity will reclaim on your gifts for that tax year.

A lively boy with a rare condition

Date____________________________________________ Please include a date here, as without a date this form is invalid. Thank you.

ALL INSIDE

Moving forward

Would you like to receive updates from us?

Yes

The NeuroMuscular Centre in Cheshire becomes independent

No

Title_______________ First name_____________________Surname_______________________

Latest news • Sports update • A Life worth Living film • Research news • Make today count • Trailblazers news

Address________________________________________________________________________ ______________________________________________________________________________ Postcode_______________________________________________________________________ Phone_________________________________________________________________________ Email__________________________________________________________________________ Payment information: Method: Credit card Direct debit cheque to pay by credit card/debit card (details below) Name of cardholder:

Target Research Issue 2 of 4 2012

Newborn

screening THOUGHT PROVOKING

Is getting an early diagnosis by testing all babies at birth a good idea?

A MUST READ

Psychology and muscle disease Research we’re funding to help people deal with daily challenges and get the most out of their lives

Title_______________ First name_____________________Family name____________________ Card type: Card No:

Visa

Expiry Date: /

Mastercard

Start Date(if applicable) /

Debit

Issue No.(if applicable)

Access

(maestro only)

Experts answer this and other questions asked by you

Security code (if applicable)

Signature______________________________________ Date____________________________ Alternatively, call us on 020 7803 2867 or visit our website and subscribe online via Direct Debit or credit/debit card at www.muscular-dystrophy.org/targetmdsubscribe Registered Charity No. 205395 and Registered Scottish Charity No. SC039445

Can I take statins for my high cholesterol?

Also inside… read about all the latest research and clinical trial news from the UK and around the world.

The new Avantgarde3 Living ahead!

31 year old Nina is a model, mother, wife and rugby player. She lives her dreams and enjoys life to the full. When posing before the camera Nina emits passion, beauty and radiance that even her wheelchair cannot distract – quite the reverse!

© Ottobock UK/ADV/MOB/0378

‘I would like to make a difference and hope my actions inspire others with a similar disability, to have the courage to live their dreams’. Following a car accident that changed her life leaving her a quadriplegic, with the assistance and support of family and friends Nina energetically fought her way to regain her old (new) life back. ‘Most important is a healthy self being and feeling of value, whether disabled or not. I have learned to live with change and have become extremely disciplined’ states Nina.

‘Obviously my family and modeling career keep me extremely busy, however, during 2008 I commenced a new hobby and actively and enthusiastically play wheelchair rugby defense for the Maple Panthers. Rugby is like playing chess, only more complicated since the figures move considerably faster!’

Ottobock

0845 600 7664 · www.ottobock.co.uk