TargetMD 2 of 4 2012

magazine

Target MD Issue 2 of 4 2012

Adapted housing and all you need to know

must read

Meet Ethan

Feature

A lively boy with a rare condition

All inside

Moving forward The NeuroMuscular Centre in Cheshire becomes independent

Latest news • Sports update • A Life worth Living film • Research news • Make today count • Trailblazers news

The new Avantgarde3 Living ahead!

31 year old Nina is a model, mother, wife and rugby player. She lives her dreams and enjoys life to the full. When posing before the camera Nina emits passion, beauty and radiance that even her wheelchair cannot distract – quite the reverse!

© Ottobock UK/ADV/MOB/0378

‘I would like to make a difference and hope my actions inspire others with a similar disability, to have the courage to live their dreams’. Following a car accident that changed her life leaving her a quadriplegic, with the assistance and support of family and friends Nina energetically fought her way to regain her old (new) life back. ‘Most important is a healthy self being and feeling of value, whether disabled or not. I have learned to live with change and have become extremely disciplined’ states Nina.

‘Obviously my family and modeling career keep me extremely busy, however, during 2008 I commenced a new hobby and actively and enthusiastically play wheelchair rugby defense for the Maple Panthers. Rugby is like playing chess, only more complicated since the figures move considerably faster!’

Ottobock

0845 600 7664 · www.ottobock.co.uk

1155_OB_Avantgarde_A4_27Feb_12_F.indd 1

27/02/2012 11:37

www.muscular-dystrophy.org

A word from the CEO At last we are looking towards the summer and the prospect of warmer weather; perhaps a holiday break and certainly several weeks of sporting achievement with the Paralympics being the focus of much attention.

My thoughts are centred right now on research progress and the need for additional funds to maintain our present momentum. The latest research news continues to be very encouraging, although it must be balanced with an appreciation of the number of steps required for potential treatments to move from laboratory to patient. For people living with muscular dystrophy and related conditions, each day is vital; we are determined to progress this work as quickly as possible.

We are working hard to raise additional funds as our role is so vital in leading research and enabling new approaches to be developed. Our funding of pioneering techniques, such as exon skipping and improvements in our understanding of mitochondrial conditions, has led to major progress and has also unlocked additional research funds from external funders.

Further, major improvements in healthcare and support have been secured by our supporters and volunteers campaigning together in our Muscle Groups across the country. While improved healthcare is so important for people with muscular dystrophy and related conditions, these developments also help to build up the specialist research and clinical centres needed for clinical trials. Further, we recognise the need for steps to harmonise healthcare standards in the UK with those in Europe (one of the recommendations in the Walton Report in 2009) to provide the ‘level playing field’ for clinical trials in this country.

As you will appreciate, these are not the easiest of times to raise funds, given the economic pressures and the government’s actions to reduce debt levels. We continue to take steps to reduce our costs and improve efficiency and we are very grateful to all our supporters who give freely of their time and energy to raise vital funds.

As a compassionate, innovative and indeed award-winning charity, we always welcome new members and supporters to join in and help us speed up the progress we’re making. We are determined to win the fight to beat muscular dystrophy and related conditions.

With all best wishes,

Robert Meadowcroft Chief Executive

page 3

page 4

www.muscular-dystrophy.org

28

Making today count

Sky high fundraising success

Contents 08

24

14

Housing: turning your house into a home

14

Jon Hastie: an indomitable will

20

Ethan without equal

24

The Centre in the heart of Cheshire

16

News

Northern Ireland inquiry

17

Trailblazers tackle hate crime

20

IVF technique to prevent mitochondrial myopathy

26

An award-winning sling

06 20

Features

Regular

Letters - write and tell us what you think

29

The best of the web

33

Fundraising news

www.muscular-dystrophy.org

Hello, The Target MD team and I would like to welcome you, this spring, to the second 2012 edition of the magazine.

With the theme of housing, we bring you useful information and outline the challenges and hurdles many people face in adapting their homes to cater for changing needs. The Bosanquet family share their adaptations process with us and offer some helpful insights along the way. The time, patience and effort certainly paid off, and the family now enjoys a home that meets their needs fully.

We also visit Dr Jon Hastie, a Trailblazer and infectiously inspiring man who has recently moved into his own home in Shoreham-by-Sea. As we sat in his lovely new home, he told us not only about his big decision to live independently, but also about his forthcoming documentary film, A Life Worth Living: Pushing the boundaries of Duchenne, due for release in the summer.

By the time you read this, the NeuroMuscular Centre in Cheshire will have become a fully independent charity. Read all about the excellent work of the Centre, how far it has come in its 21 year history and how it will continue to work closely with the Muscular Dystrophy Campaign in the future.

And, as always, we bring you our latest campaigning, research and fundraising news.

See how fantastically well all our supporters did to ‘Make today count’ on 29 February.

We had 100 people skydiving for us and bucket collections going on all around the country too. Thank you to everyone who got involved and supported our work in this outstanding way.

Please let me know if you have any thoughts or comments on the magazine, or ideas for future editions. We do always want to bring you the news and stories you want to read.

The magazine for supporters of the Muscular Dystrophy Campaign , written and produced entirely in-house.

I’d love to hear from you.

Editor Ruth Martin Art director Deborah Waters targetmd@muscular-dystrophy.org Muscular Dystrophy Campaign 61 Southwark Street London SE1 0HL t: 020 7803 4800 e: hello@muscular-dystrophy.org w: www.muscular-dystrophy.org Disclaimer While every effort has been made to ensure the information contained within TargetMD is accurate, Muscular Dystrophy Campaign accepts no responsibility or liability where errors or omissions are made. The Muscular Dystrophy Campaign does not necessarily endorse the products advertised and no responsibility can be accepted for claims made by the advertisers. The views expressed in this magazine are not necessarily those of the charity. ISSN 1663-4538

Registered Charity No. 205395 and Registered Scottish Charity No. SC039445 Printed on PEFC paper, produced at a mill that is certified with the ISO14001 environmental management standard Enclosed into a bio-degradeable polybag

Ruth Martin

Editor

t: 020 7803 4836 e: r.martin@muscular-dystrophy.org tw: @RuthWriter

Interact with us and more than 7,800 fans on our Facebook page at: www.facebook.com/musculardystrophycampaign For up-to-the-minute updates on all areas of our work, follow us on Twitter @TargetMD

About the Muscular Dystrophy Campaign

The Muscular Dystrophy Campaign is the leading UK charity focusing on muscular dystrophy and related conditions. We are dedicated to finding treatments and cures and improving the lives of the 70,000 adults and children affected by the conditions.

We focus on funding world-class research, providing practical information, advice and support, campaigning to bring about change and raise awareness, awarding grants towards the cost of specialist equipment and providing specialist education and development for health professionals.

page 5

page 6

www.muscular-dystrophy.org

Letters What do you think? Write to us...

Hi Editor I have limb girdle muscular dystrophy type 2, and I am 64 years of age. I started a new career as an entrepreneur of the age of 60 and six weeks ago, became the first person with muscular dystrophy to win the 2011 Stelios Disabled Entrepreneur of the Year. I have designed and now market a sling for picking somebody up from a wheelchair when there is no hoist available; although intended for my own use, I realised it would have wider applications. A lot of people with muscular dystrophy have already purchased the sling, and I think it would be of interest to many others.

Kind regards Huw Thomas (See article on p26 where Huw describes how he went from retirement to award-winning entrepreneurship.)

Dear Editor sisters, p9I was interested to read your article about Jane and Tracy (Two in a million r muscula ne Duchen of carriers ting 11, Target MD November 2011), who are manifes r muscula ne Duchen have sons three dystrophy. I had never heard of that before (my asked and article e magazin the her dystrophy) and so I went to see my GP, I showed appointment. for a check-up. She was concerned enough to send me for a cardiology carriers, ting manifes about known Without reading that article, I would never have ge any encoura also would I nt. importa so thank you for alerting me to something so GP. their see and carrier of Duchenne muscular dystrophy to go Kind regards Helen Lloyd

Dear Editors I would like to congratulate the team for the fantastic new format of the Target magazines. I especially like reading Target Research as it documents such a wide range of conditions and gives hope to many families living with muscle disease that one day a cure will be found. It is fascinating to find out what actually happens with regard to research and without this information in its clear and concise form, I would not know where to begin. Our son has a rare congenital myopathy, and we like to keep up to date with any new trials that are happening, so thank you all and I look forward to reading the next issue.

Regards Mel Lane (See feature on Ethan’s rare condition, on p20.)

Looking ahead In the next edition of Target MD, due out in July 2012, we’ll focus on volunteering.

With many people involved with the Olympics and Paralympics, we’ll bring you stories of torchbearers, ambassadors and athletes. Of course, we’ll also feature our own volunteers who make such a wonderful difference to our vital work. We’ll also bring you our usual news, features and updates and again with you, our supporters, in the spotlight. As you know, people with muscular dystrophy and related conditions, together with their families and carers, are at the heart of everything we do.

Adjustments in the workplace If you’ve had a positive experience of an employer making adjustments in the workplace, either in a new job or to help you continue in your current job, Sheila Hawkins would love to hear from you. The British Society of Rehabilitation Medicine is developing guidelines for people with neuromuscular conditions, such as muscular dystrophy, as a resource for healthcare professionals and other people involved in delivering services. To put the guidelines together, they are looking for good examples of workplaces which have made reasonable adjustments for people with neuromuscular conditions. If you have such an example, please do get in touch with Sheila at hawkinssheila@hotmail. com by 31 May 2012. Thank you.

Dear Editor That’s a lovely article about Mark Chapman, (A full and independent life, p26-27, Target MD Issue 1 of 2012). It will be nice for the patients at clinic to read about someone local.

Regards Gillian Paton, Muscular Dystrophy Campaign Care Advisor Western General Hospital, Edinburgh (via email) Feature

phy.org

www.muscular-dystro

mixing with children week, but enjoyed in extra and taking part similar to himself Scouts. It as joining the activities, such , where d him to Edinburgh also introduce he lives today.

time set me “I believe thatfor the future,” up very well said.

Mark

difficult for things got very After school, to study art/design Mark. He wished , but needed at college in Edinburghlive that would e to to find somewher he needed. Unable provide the support funding, Mark to access the necessary with nothing at home ended up back ght to helped him fi to do. His parents dation and to find suitable accommo appropriate Local and access the support moved and he finally Authority funding, supported, flat in brand new in into a shared accommodation of being independent-living horrendous time’ Freespace Housing.

Muscle paranoid, Mark’s Edinburgh, called at college hair of the Scottish like she was being extra support for Mark to see with member there, referral a active , he Living Group and an mum was given ity Service Volunteer in Group from a Commun Diploma of the Cross Party Professor Emery. a Higher National Dystrophy completed Like most for Muscular Media Design. leads received the shattering Illustration and Parliament, Mark active social life “My parents then muscular in the Scottish Mark had an nt life. He I had Duchenne students, that parties. independe and and diagnosis probably pubs, clubs a full, active nce were told I would involving many ” for the independe dystrophy and . I was only six, has fought hard today, and this beyond adulthood care enjoys live his he not found Mark and support up for After college, him to speak Mark said. . Recurring chest experience drives . needs were increasing low energy and in similar situations , tested other people my brothers both infections, headaches led to many “Fortunately, changes idyllic severe mood that his at Paxton in the negative.” the discovery Mark grew up the Scottish GP visits, and r countryside in seriously affecting Berwickshire using a wheelchai condition was son of Donald to At 10, Mark started He was told Borders, the middle to Graeme and school, he went respiratory function. done. However, brother and, after primary – a school could be and Janet and in Edinburgh nothing more he went to primary had a Graysmill School friend with the Stephen. When disabilities, which knew of a school he kept falling, with Mark an noticed his children for who – following school, his mum and was – where he completed same condition up with his peers residential unit admission – was it difficult wasn’t keeping off the floor. emergency hospital in 1988. He found now using get himself up was the schooling to and y struggling g slowly the family during given a tracheotom the he was developin being away from friend told him Doctors said After ‘a a ventilator. His not to worry. . ‘saved his life’ and told his mum procedure had

w in a cosy bungalo man who lives and recently art, is a 41-year old Mark ChapmanHe enjoys photography and – for the first time where has in Edinburgh. ek holiday in Spain ing pool. Mark enjoyed a two-we– he went into the swimm in about 20 years ar dystrophy. made to feel Duchenne muscul

C

friends his options with Mark discussed his lifelong friend and family (especially who he’d been and partner, Corinna, being two years), before living with for consultant, same specialist referred to the Mark’s who became Dr Ian Grant, a number of years. consultant for

was to go his best choice Mark decided and use a tracheotomy ahead with a be risks knew there would ventilator. He also knew the surgery, but involved with support need increased that he would another home. It took when he went won – to he fought and battle – which

phy.org

www.muscular-dystro

page 27

the to put in place access the funding support one-on-one, 24/7 vital fulltime, he needed.

– nearly at the age of 26 So it was, then, a successful that Mark had 16 years ago – the housing and moved into tracheotomy He he lives in today. association flat ted Support funding has a Self-Direc his team of five package to employ all specially trained personal assistants, receives He . his ventilation in managing nurses from specialist up at additional support Dr Grant set Unit n at the Ventilatio General Hospital.

Edinburgh’s Western

support “This whole of main one the and package is my health ed reasons remain wellbeing have Mark. so good,” said d for two disabilityMark has volunteere Lothian Centre for ons: the led organisati Personal and the Scottish is Inclusive Living s’ Network, and Assistant Employer campaigning and in currently involved Dystrophy the Muscular media work for he rough social media, Campaign. Th with many other men keeps up with dystrophy, a few Duchenne muscular is, and he even older than go of whom are many of them learns of the struggles

for people with “Time is so precious Dystrophy. Your Duchenne Muscular short so much in a health can change you that family will tell , time and every The correct assistance every day counts. equipment and support, advice, difference can make a huge physiotherapy of people’s lives. quality and to the length care advisor posts afford This is why increasing . We simply cannot important so is to happen,” for these things to wait around

through.

people how much other to “When I realised and not getting were really struggling to, I started I had managed the point that Mark wasn’t right,” thinking something said.

he said.

to wait not been one Mark has certainly worked to happen. He’s around for things he needs sure he has what hard to make life. Not independent to live a full and managing his have the job of only does he art, visiting he still enjoys own care, but he can, and being exhibitions whenever artwork and designs producing creative, He is also a keen on his computer. acquired and has recently photographer, take enables him to technology that a blow-type with the use of photographs

the get involved with “I decided to Campaign because Muscular Dystrophy out for can really speak people like me happy to situations. I am others in similar what is t and talk about go to Parliamen people aren’t question why going on and ties and services getting the opportuni getting.” be they should recent weight to the Mark added his Invest to charity’s report: launch of the services and reducing Save: improving The report was costs in Scotland. an investigation launched following t of improving in into the cost benefi services in Scotland, s neuromuscular y admission emergenc order to prevent people with muscular to to hospital for said things needed dystrophy. Mark change.

switch.

d for Jon was interviewe Last spring, Mark A life e-released film, Hastie’s soon-to-b journey the story of Jon’s worth living; adults with Duchenne to meet other who are living muscular dystrophy lives. and fulfilling productive, creative flew for summer, Mark And then in the and went in many years the first time Piedras, a holiday to Las on a two-week (pictured near Malaga Spanish resort perfectly was fully and s and right). The resort people with disabilitie g equipped for sightseein walks, drives, of Mark enjoyed and finding plenty swim a hy. trips, having landscape photograp opportunity for word, Mark certainly A man of his every day count

Keep in touch with us...

We’d love to hear from you and to fill this page with your letters. Send us your good news, your frustrations, your story ideas, as well as any news you’d like to share with our readers.

Here’s how you can get in touch with us: via Twitter @TargetMD or @RuthWriter, write to us on our Facebook page or at TalkMD, or write to the Editor of TargetMD at 61 Southwark Street, London SE1 0HL or at targetmd@muscular-dystrophy.org

makes

On the web LCIL: k www.lothiancil.org.u SPAEN: www.spaen.co.uk Las Piedras: www.laspiedras.co.uk A life worth living: om www.alifeworthliving.c

NEW Volkswagen Sharan conversion by BROTHERWOOD

Super 5 for the wheelchair passenger and family No Lifting with the new optional quick fold seat No Pushing - PAWRS (powered assisted wheelchair restraint system) For details of the complete range of vehicles transformed by Brotherwoods ring 01935 872603 or visit www.brotherwood.com

Brotherwoods KIA Sedona Gold Label “a winning front runner”

BROTHERWOOD

Automobility Limited TELEPHONE: 01935 872603 BROTHERWOOD AUTOMOBILITY LIMITED, BEER HACKETT, SHERBORNE, DORSET DT9 6QP

Feature

www.muscular-dystrophy.org

Turning a house into a home Learning that you or a family member has been diagnosed with muscular dystrophy or a related neuromuscular condition can be devastating.

Everyone involved needs support and access to the right information about how to manage the long-term impact of the diagnosis.

And then there are the practical issues to consider, such as ensuring your home is accessible to cater for your family’s changing needs. Claire and Ian Bosanquet went through that process in 2004, a year after both of their sons – Jack and Tom (now 12 and 9 respectively) – were diagnosed with Duchenne muscular dystrophy, and they began the long and arduous process of home adaptations that only ended last year. This is their story, in Claire’s words: We live in Keyworth in Nottinghamshire, with our two sons, Jack and Tom (pictured left to right, opposite). Jack is at mainstream senior school and he is academically bright. Tom goes to mainstream junior school and has mild to moderate learning difficulties with some autistic features. I am a genetic carrier of Duchenne muscular dystrophy and the boys have a *deletion between exon 45 and 50. They were involved with the recent **AVI drug trial. *Deletion: the loss of genetic material from a chromosome or gene. **Muscular Dystrophy Campaign website article: AVI Biopharma releases promising results from the exon skipping clinical trial: www.bit.ly/wJBvNF

At the time of Jack and Tom’s diagnoses, we lived in a 1930s owner-occupied three-bed detached house. We wanted to adapt the property but it became

increasingly obvious that the only solution was to move to a bungalow. We tried to get the local authority to state the latter in writing and also met with our MP regarding exemption from stamp duty but all to no avail.

We contacted the Muscular Dystrophy Campaign and got a copy of the charity’s Adaptations Manual and in there found a list of architects who had attended some training on muscular dystrophy. We made contact with those listed locally and looked at preliminary drawings and planning with them before we agreed to purchase a two-bed bungalow, which we moved into in December 2004.

Work that needed to be done:

• both bedrooms needed a shared ensuite bathroom, with room for a level access shower, changing table, basin and toilet • internal access for a wheelchair and external access, which included front door and ramp • extension of the living area of the

property • accommodation for a live-in carer if/ when required.

The project was phased. The bedrooms and bathroom were completed first alongside some preliminary work on the loft and a temporary staircase, which was blocked in until phase two. The second phase involved widening the lounge door,

www.muscular-dystrophy.org

chopping the corner off the existing main bedroom and creating a new front door for wheelchair access; the living area and kitchen were extended; a ramped access was built at the front of the property and driveway and the loft was converted into a bedroom/living room and toilet for a carer.

We were extremely thorough and practical in the way we approached the adaptations’ process: we used the Adaptations Manual, we talked to other families – in particular another family with two sons with Duchenne muscular dystrophy, and we sought advice from the professional architect as well as the Social Services occupational therapist and health occupational therapist. I also gave up work to concentrate on the care of our sons, including the management of the adaptations’ process.

It was quite a tricky time to apply for a Disabled Facilities Grant (DFG) because at the time it was means-tested. During the course of our move to the bungalow, this requirement was abolished. The DFG is, however, discretionary, and as a result the authority had to seek advice elsewhere as to whether the boys were entitled to a grant each. There were discussions around same condition, and same need, although Tom has additional ones with learning and also because of their ages, they would require different levels of care and disturbance during the night.

Fortunately, the authority awarded a full DFG for each of our sons. The figure for phase one was £25,000 and had been increased to £30,000 by phase two.

No work could be initiated until the DFG had been granted. Not all the work to the property was covered by the DFG and any fixtures and fittings had to be at standard or minimal cost so if for example we wanted an alternative (i.e. not white tiles), then we had to meet the additional costs ourselves.

There was also work on the property which was not covered by the DFG, such as extending the kitchen area adjacent to the living area and conversion of the loft for potential use by a carer. We had to pay for that ourselves.

Once the initial DFG approval was made, we had to get three quotes for the building works and then nominate

a preferred contractor. We then had to come to an agreement with the authority if the preferred contractor was not the lowest quoted, as the DFG covers what is ‘reasonable and practical’.

We moved into the bungalow in December 2004 and we finally completed the work in March 2011. At one stage in the second phase, we had a couple of tons of concrete in the house so the builders could do the floor as the very cold weather meant we were losing time!

Along the way, there were also plenty of hurdles, including having to get plans and planning permission for a ramp. Fortunately a family friend with experience in this area did the drawings for us. We also seemed to have more than our fair share of plumbing problems.

We also found we had to share our private lives with neighbours, so we could communicate what was happening onsite and discuss any issues raised by them. Unfortunately I can’t think of any pleasant surprises along the way...

The difference the building work has made to our family is immeasurable, particularly as our boys become less mobile. We now have a house, no, we have a home that is fit for purpose and does not look like a clinical setting. It may need the occasional tweak later on and it shouldn’t interrupt our family life too much.

We can now focus more quality time with our sons and family. It has taken a considerable pressure and stress off us as parents, in trying to provide what the boys deserve: a home that is safe, secure and happy. We can now really focus on the happy.

On the web How to obtain a copy of the Muscular Dystrophy Campaign’s Adaptations Manual: www.bit.ly/yjg7tq or call 0800 652 6352

Hints and tips

Be well prepared and plan in seeking advice. Use all the resources available to you and listen to other local families who have been through the same experience.

Be thorough. Keep records of building works and a spreadsheet of costs in what comes under the DFG, what is VAT exempt and what isn’t. A builder with this experience may be useful. · Communication is crucial, particularly in following up on what should be done.

Request a grant officer at stages in the build to site-check and release some of the DFG money to the contractor. Keep your neighbours informed; you will have to live next to them when the builders have gone.

Research and look into fixtures and fittings. In the bathroom for the boys we have sourced non-disability equipment, such as a wall-mounted accessible sink with lever style taps, but we have installed the electrics in case we need a height adjustable one at a later date. I have been slightly ribbed about the amount of forward planning that has gone into some of the fittings, but it is hoped that that will alleviate any difficulties later on. It may even mean there are none.

You also may need some time out, so in our case we did have a break between phase one and phase two, not only from a financial perspective but an emotional one.

Use only recommended professionals and tradesmen and, if you have your own contacts, use them too.

We installed wooden flooring in the majority of the property as it is more hard-wearing and easier to clean, now that Jack is in his powered wheelchair. An outside cleaning area is useful too. We have underfloor heating in the boys’ area bedrooms/ensuite, thus maximising the space and isolating that area for heat, as required. Note: the DFG does not cover space for a carer or for accommodating storage/charging of equipment but will cover space for the equipment itself.

The building firm we used regularly does authority work and they were very good.

I do appreciate that not all people’s living arrangements are like ours. Everything comes at some degree of cost financially and emotionally, but as long as you are prepared to face some of the hurdles, the end results are worth it: a quality home life for our sons.

Stay focused. There is light at the end of the building work tunnel!

page 9

Feature

www.muscular-dystrophy.org

Housing market needs to adapt Finding accessible housing is a challenge that many of our Trailblazers have experienced. Just where do you go to find information about accessible accommodation? Is there a property website that lists accessible accommodation? Or an estate agent’s office that is actually accessible?

Towards the end of last year, Trailblazers launched a nationwide investigation into housing that they hope will answer some of these questions. When the investigation closes and the report is published in the summer, our young campaigners’ network will call on estate agents and other representatives from the housing industry to give evidence at an All Party Parliamentary Group for

Young Disabled People about how they handle disabled customers and advertise accessible properties.

The investigation was sparked by an ongoing flood of reports of Trailblazers waiting years to find wheelchairaccessible homes to rent or buy, despite local authorities funding adaptations to thousands of UK homes each year. Young disabled people who had relocated for work reported they had to stay in hotels or bed and breakfast accommodation for up to a year before they could find wheelchair-accessible rental accommodation. Others had been forced to buy property and take on mortgages in order to secure grants to adapt a home, despite not feeling financially secure enough to do so.

Trailblazer Hannah-Lou Blackall decided to get involved with the project after struggling to find accessible rental accommodation when she moved from Norfolk to Hull for employment. She had to live in a conference centre for a year – at a cost of £1,000 a month – before she found a suitable home.

On the web Read about our housing investigation: www.bit.ly/y6ISm3 Join in our housing investigation at www.svy.mk/xEdiQK Listen to Hannah-Lou and Bobby on BBC Radio 4’s You & Yours: www.bbc.in/wq6HyG

“It was very frustrating trying to track down a property near Hull that would actually work for me. I was signed up to every single estate agent, but none of them really seemed to understand what an accessible property was. The rental market doesn’t seem to realise that young disabled people now live and work independently; there is a big potential market out there if they take the right approach to catering for disabled customers,” Hannah-Lou said.

Hannah-Lou told her story to BBC Radio 4’s You & Yours in October, and was joined by Trailblazers Project Manager, Bobby Ancil, who talked about the housing investigation.

There is still time to share your experiences by taking part in the housing investigation and help the Trailblazers to call for this situation urgently to change.

Visit our website or contact Bobby Ancil on 020 7803 4807 or b.ancil@muscular-dystrophy.org Our network of occupational therapists sent us many contacts for builders and contractors all around the UK. Please call our information team on 0800 652 6352 (freephone) and we can put you in touch with your local occupational therapist for a list of contacts.

www.muscular-dystrophy.org

at home and cost under £1,000 should be provided free of charge in England by your local authority.

the

Adaptations, improvements and repairs are all important aspects of making life easier for a disabled person. Local authorities have funds to help cover the costs of such improvements.

A Disabled Facilities Grant (DFG) is a local council grant to help towards the cost of adapting your home to enable you to continue to live there.

A grant is paid where the council considers the changes necessary to meet your needs and is happy that the work is reasonable and practical.

Adaptations, improvements and repairs to the home Adaptations, improvements or repairs to the home are a key part of making your home more accessible and safer. Often getting the right adaptations means that someone can remain in their own home for longer.

Local authorities have funds available to help out with the cost of adaptations, with social services taking care of minor adaptations, such as handrails. In most cases community equipment, aids and minor adaptations that help with living

In order to see what adaptations, if any, are required in your home, social services will arrange for an occupational therapist (OT) to visit your home and assess the situation. They can then advise on whether or not a particular adaptation may be helpful and decide whether you qualify for grants towards the cost of any major adaptations.

Disabled Facilities Grant A DFG is provided by local authorities to help meet the cost of adapting a property to meet the needs of a disabled person. To apply for a DFG, you need to complete a form which you can get from your local housing authority.

What are the criteria you need to meet?

An OT will look at your circumstances and can recommend the type of adaptations needed.

You can only get a DFG if the work you need done on your home is deemed to be: • necessary and appropriate to meet your needs. Your local authority will normally ask an OT for their opinion on whether or not you need the work done; • reasonable and practical, given the age of your home and the condition it is in. For example, if your home is in a serious state of disrepair, it might not be practical to do the work you need.

The amount you contribute to DFG is determined by a means test of the applicant (so the home-owner, private tenant, landlord). However, there is no means-testing if the adaptations are for a disabled child under the age of 19.

Depending on the outcome of this assessment, the amount of financial assistance offered can vary from nought to 100 percent of the cost of improvements. The maximum amount of DFG that local authorities are required to pay in England is £30,000. If the cost of the eligible works is higher, the council can use discretionary powers to increase the grant.

What to expect Your local council must notify you of the result of your application in writing within six months of the date of completed application.

The grant must be approved before work starts, and is paid in instalments or in full on completion of the work. Make sure you have agreed this in writing with the council before work starts.

Alternative housing Rather than adapting their existing home, some people might be able to move to a home which has been designed specifically to be accessible for a disabled person.

If you seek this type of social housing, you need to contact your local authority in order to be placed on to the housing register.

Remember to stress your housing requirements – for example if you need a specially adapted bathroom or kitchen – so that suitable housing can be found.

Do email info@muscular-dystrophy.org or call us on 0800 652 6352 (freephone) for the full version of our Housing Adaptations factsheet.

On the web Muscular Dystrophy Campaign website where you can download a factsheet: www.bit.ly/zTrFC8 Direct.gov is a useful website with more information about applying for grants: www.bit.ly/xWSoKg Citizens’ Advice Bureau has expertise in dealing with benefits claims. You can find your local one here: www.bit.ly/y0Mfy2 Local Home Improvement Agency’s (HIA) can provide advice and practical help on improvements and adaptations: www.bit.ly/zM2tPM or http://bit.ly/Ajbmc3

page 11

Email: jennyf@crelling.com Website: www.crelling.com

www.muscular-dystrophy.org

So happy, I could .... skydive

Robyn Gunner is 25 years old and has limb girdle muscular dystrophy type 2b.

Our advocacy team recently assisted her to find an accessible house close to her parents’ home. Robyn was so thrilled with the result, she decided that once she’d moved house and settled in, she’d join in our Make today count campaign and skydive for us in May. Her friend, Darren, is going to join her.

Robyn wanted to do something to grab the attention of people to support her and help her raise as much money as possible.

And what better way to that, than to throw herself out of a plane? She is doing it not only to raise funds for all those affected by muscular dystrophy, but also to try and raise awareness of muscular dystrophy in the area she lives in, as she feels it’s a hidden illness that she hadn’t heard of until diagnosis.

Around the houses

This is Robyn’s housing story in her own words:

I was diagnosed with limb girdle muscular dystrophy (LGMD) type 2b two weeks before I turned 18. After numerous visits to the doctors and being told I had ‘anterior knee pain’ and that I needed to go to the gym, my physiotherapist sent me to private care as she was concerned that at 17, I should be able to stand on my tiptoes.

After MRI scans, ECGs, blood tests and a biopsy, my neurologist gave me the diagnosis of LGMD. For a few weeks, I spun into an emotional brick wall. I spent a lot of time on the Muscular Dystrophy Campaign website, researching my type of muscular dystrophy, speaking to people in the same boat as me, seeing what the organisation does for people and, in my hour of despair, I was eventually able to see some light.

In July 2009, my daughter, Chloë, was born. As my condition worsened, stairs became a complete no-go for me; I

couldn’t get into a bath; in the winter I found it difficult to go out, and I was using a wheelchair a lot more.

In thinking about the future and my daughter, I contacted social services to see what help I could get. I was told I wasn’t eligible for help.

A month or so later I rang social services and asked for an assessment. The team came a few weeks later and were surprised that I had no help – financially or medically – and, after seeing my daughter escape out of my back door without me being able to get her back, they then got me the help I had wanted and needed right from the start.

Then I began my battle with the housing association. My bungalow wasn’t wheelchair adaptable, as it would need major structural work, and I also wanted to be in the local town where my parents live as they help me a lot. The housing association told me to look for an already adapted bungalow in a surrounding village, as one in a town may not become available for a long time.

Not taking ‘no’ for an answer, I asked the relevant medical people to write supporting letters to the housing association for me about my condition and I contacted the Muscular Dystrophy Campaign, who also wrote to the housing association stating why I needed help with re-housing. A friend of mine wrote to my local MP Elizabeth Truss who wrote several letters to them. As a result, I got a very different response saying I could look for a house which could be adapted.

A few weeks ago, a house came up opposite my parents’ home, which my occupational therapist found to be suitable for adapting. The housing association agreed to let me have the property. The house was measured to make it wheelchair friendly, have ramps installed and doors widened. I now have a home that I can live in independently, which is close to my parents and in a town that has all the amenities I need.

Many disabled people out there struggle with housing problems and getting the help they need. If you’re not happy with a decision you’re given, get another one and if you still don’t think that one’s fair, get another one. If someone doesn’t

understand your condition, make them understand. Do what I did and get on to the Muscular Dystrophy Campaign’s website, print off the factsheet of your condition and give it the person who needs telling.

The Muscular Dystrophy Campaign is an organisation that has so many resources to help us: fundraising, grants, help, information on groups around you and teams who will help you fight for your rights.

If you, like Robyn, are struggling to get the help you need, please get in touch with our advocacy service on 0800 652 6352 (freephone) or campaigns@musculardystrophy.org

All the facts in one pack Since our advocacy team launched last April, it has been inundated with requests for help. It seems that in the current economic climate, and with all the proposed budget cuts, it is becoming more and more difficult to get and keep the services and benefits to which you are entitled.

With this in mind, the advocacy team has put together an information pack to help you fight directly for your rights.

The advocacy fact pack outlines the services and benefits to which you may be entitled, and includes resources such as template letters, to make sure you have what you require to lead as full and independent a life as possible.

If you have questions around housing, disability living allowance (or the new personal independence payment that comes into effect in 2013), employment support allowance, workplace adjustments, care packages or the Blue Badge, the advocacy fact pack has all the answers and information you need.

Our advocacy service is still available to help you if you feel you are not getting the results you seek. The advocacy fact pack will help you take those first important steps towards the outcome you are looking for.

If you would like a copy of our advocacy fact pack, do get in touch with David Moore-Crouch in our advocacy service on 020 7803 4808 or info@muscular-dystrophy.org

page 13

Feature

www.muscular-dystrophy.org

“Strength does not come from physical capacity. It comes from an indomitable will.”

Mahatma Gandhi

Jon outlined what kind of film he wanted to create, and posted this on an independent filmmakers’ website called Shooting People. With the pick of the 13 Dr Jon Hastie (31) lives in Shoreham-by-Sea. He’s just finished making a fulllength film about his life, he is about to launch a research report into disability people who responded, he put together access in Brighton and Hove and he’s recently moved into his own flat. Jon won’t a professional, compassionate, dedicated and fun film-crew who understood let anything, not even his Duchenne muscular dystrophy, stand in his way.

Jon’s desire to send ‘a message of hope and inspiration for the next generation’. orn in Eastbourne and raised Jon wanted to meet lots of like-minded Together they crafted just that: an in Worthing, Jon studied at people with Duchenne muscular outstanding 90-minute documentary. the University of Essex in dystrophy. He set up a Facebook page and Colchester, where he completed soon became connected with a ‘massive A Life Worth Living: Pushing the a BA in politics and international community’ of men with Duchenne boundaries of Duchenne is a full-length relations, an MA in environmental muscular dystrophy. documentary film about Jon’s journey studies and a PhD in government. After to meet men with Duchenne muscular living independently in university halls “I met one guy from the USA, who was dystrophy. It took Jon and his film for eight years, Jon moved back into his 50. I had no idea that was possible. I had crew around the UK and into Europe family home in Worthing in 2008. expected I’d have four or five more years last summer, to meet six inspiring myself, but suddenly I realised I could be ‘Duchenners’, as Jon calls them. The “At that stage, I didn’t really know anyone around for a while. It took me completely film, which the Muscular Dystrophy older than me living with Duchenne out of the fatalism that I had been living Campaign part-funded, is due for release muscular dystrophy. I thought I was my life by,” he said. in late 2012/early 2013. going home to live out my final years with my family,” Jon said.

“Also, I wouldn’t have had the idea for “I don’t think I knew what to expect from making a film if it weren’t for Facebook!” making the film. I chose all the men I “I didn’t know what the future would hold wanted to interview because I found or what it would mean in terms of my So as he approached his 30th birthday, them to be inspirational. I met them all health. I thought it might be best to be at armed with this new perspective, Jon for the first time when we went on our home and to be looked after by my family. decided to make a film. By the time his filming road-trip. birthday came around, he had a firm plan “It felt like I was going home to die,” Jon of what he wanted to do, and he made the “It was interesting to see people at said. announcement to his friends and family, different stages in their lives, not so much who were all positive and supportive.

B

www.muscular-dystrophy.org

The Lifetime Homes Standard regulations

The Lifetime Homes Standard was established in the mid-1990s to incorporate a set of principles that should be implicit in good housing design. Good design, in this context, is considered to be design that maximizes utility, independence and quality of life, while not compromising other design issues such as aesthetics or cost effectiveness.

Housing that is designed to the Lifetime Homes Standard will be convenient for most occupants, including some (but not all) wheelchair users and disabled visitors, without the necessity for substantial alterations. in terms of their health but in terms of the support they receive. We talked about some of the difficulties they have in their lives and continue to have; some are socially isolated, some are angry; all have the unwavering spirit of men determined to beat the odds.

“It gave me a deeper understanding of how people cope with the condition, the support available and the impact that can have on people’s lives. I had already been inspired by them, but meeting them just added to the depth,” said Jon.

“I was also reminded about how important it is to have fun. We really had fun making the film. It was physically and mentally exhausting, but when we’d finished filming, it was like coming back from a really nice holiday,” Jon said.

Among the inspiring ‘Duchenners’ Jon met on his filming road-trip last year was 41-year-old Mark Chapman, from Edinburgh. (Mark featured in Target MD Issue 1 of 4 2012: A full and independent life – p26-27).

Jon was especially interested to find out from Mark what he thought about moving out of his family home. Mark has lived independently, with 24/7 care, for the past 16 years.

“Mark is such a positive role model.

When we talked about my moving out, he challenged me a bit and made me think about why I wanted to move out.

Talking to him and understanding how he manages his life and his full-time care really helped me when I got home, to make my decision to move out,” Jon said.

Jon has very little mobility throughout his body, requires non-invasive ventilation at night and increasingly during the day.

He can eat only soft or puréed foods.

Jon employs a team of seven carers to provide his complex care needs 24/7. Last year, the Muscular Dystrophy Campaign helped him take on his local authority and Continuing Health Care Team to get the full-time care he required to live independently. His local authority believed that Jon needed to move into a residential care home, so with our help he managed to challenge his Continuous Health Care assessment and get the decision reversed.

Armed with this care package, Jon began the process last autumn of making contact with most of the estate agents in his area. They had no suggestions of adapted or suitably accessible houses for him. Jon ploughed through the online listings of flats for sale and for rent, and eventually got into the rhythm of picking out potentially suitable properties: bungalows and ground floor flats being the starting point.

“I knew that if I was going to buy a property, I’d have to find something to adapt. I arranged a few preliminary visits, with my parents or my PA. A few bungalows were unsuitable; older properties were more difficult to adapt; some flats were OK but their communal entrances were inaccessible,” Jon said.

After viewing hundreds of properties online, and visiting about a dozen, Jon found a ground floor flat in a new build, where only the bathroom needed to be adapted. Jon also needed to install a ceiling hoist track in his bedroom, and this proved to be a challenge because of the thickness of the ceiling board and insulation. Eventually, after consulting an occupational therapist for an assessment, a ceiling hoist track was installed.

Jon’s advice to anyone wishing to live independently starts with research: “Find out as much as you can, do as much research as possible about how other people manage. You need to be strong

and pushy about what you want and need; some independent organisations run care management services and help people to live independently, so make contact with them.

“Start the process early and give yourself plenty of time; if you have to go on a council housing list, do that as soon as you can. If you are able to buy a property, that’s ideal, but not many people are in that position. The private rental market isn’t suitable or secure, but keep pushing.

“Call on all your friends and contacts to help you in your search for the right property, and to help you once you’ve moved in. It’s so helpful to have friends lend a hand by hanging pictures and fixing boiler problems!

“Probably the most important piece of advice I could give, though, is to think about what you want to do with your life once you are out there living independently,” Jon said.

Although Jon’s parents miss having him living with them at home, they were surprised at how smoothly things went for Jon and were quite supportive once they realised Jon had his mind set on moving out.

Through his film, Jon wants to tell the world – especially the Duchenne world – not to give up hope and to live life to the full. He certainly leads by shining example.

If you are facing a similar fight regarding your Continuous Health Care needs, do get in touch with David Moore-Crouch in the Muscular Dystrophy Campaign’s advocacy service on 020 7803 4808.

The advocacy team’s help and expertise have proven invaluable in many cases, so if you’d like to help us support people, like Jon, to fight for their right to live independently, do get in touch with our fundraising team on 0845 872 9058.

On the web A Life Worth Living film website: www.bit.ly/z9T8TB Shooting People: www.shootingpeople.org Mark Chapman feature in Target MD: www.bit.ly/ygUT6Q Lifetime Homes Standard: www.bit.ly/zKNNu5

page 15

News

www.muscular-dystrophy.org

Mentoring inspiration

News Here we bring you news, from all around the UK, of our work in leading the fight against muscular dystrophy and related conditions.

Walking on wheels An independent review Last year, one of our long-time supporters – Jill Brown – published her first book, Walking on Wheels. In it, Jill shares the story of her life, including her early career as a physiotherapist and her diagnosis of proximal and distal spinal muscular atrophy in the 1970s.

Jill writes in a personal and engaging way that really draws you into her life. It is particularly interesting to read about her career as a physiotherapist and the changes Jill had to make in both her work and personal life during her long wait for a diagnosis.

As her condition progressed, Jill has been greatly helped by her assistance dogs – first Astrid and now Yates. It’s fascinating to read about the creative and sometimes surprising things they do to help Jill in her day-to-day life. Jill’s next project is a book written from Yates’ perspective, which I’m sure will provide even more insights into their lives together!

If you’d like to buy a copy of Walking on Wheels, please email campaigns@muscular-dystrophy.org.

Alternatively, you can buy the book online from Waterstones, or if you live in the South West of England you can buy a copy in their Salisbury branch.

Walking on Wheels was reviewed by Lisa James, Senior Policy and Campaigns Officer at the Muscular Dystrophy Campaign

Northern Ireland inquiry

Patients and families, backed by the Muscular Dystrophy Campaign, gave evidence in a major inquiry into specialist care by the All Party Group on Muscular Dystrophy in the Northern Ireland Assembly.

Michaela Hollywood, from Downpatrick, who has spinal muscular atrophy told Members of the Legislative Assembly that patients need to be able to access all their services in one hospital, as they can in other parts of the UK. “Neuromuscular conditions don’t just affect the limbs. They cause all kinds of chest, heart and digestion problems too.

“On consecutive days, I might have an appointment at Downpatrick Hospital and then at Belfast City Hospital over 20 miles away, with physiotherapy and wheelchair assessments somewhere else again. It’s a real waste of money for the NHS, and makes it very difficult for families to access the dizzying array of services they may need,” Michaela said.

Nic Bungay, our Director of Campaigns, Care and Support, said it was vital to see investment in specialist teams, working in a managed clinical neuromuscular network, in Northern Ireland. ”This kind of network would allow specialist teams to hold clinics closer to people’s homes, which would be of huge benefit to our families in Northern Ireland,” Nic said.

For young people with muscular dystrophy or related conditions, who are facing transition into adulthood and all that that entails, it can be really useful to discuss things with someone older who might have been through the same experience him/herself.

In response to this expressed need among our supporters, the Muscular Dystrophy Campaign is developing an exciting new mentoring project – the Inspire project.

We connect young people with muscular dystrophy and related conditions with a relevant mentor who can offer advice and guidance on a variety of transition issues such as higher education, employment, moving house, or independent living.

If you’d like to find out more about the Inspire project, or would like to contribute to it as a mentor or a donor, do get in touch with our information team on 0800 652 6352 (freephone) or email info@muscular-dystrophy.org

Mum steps up battle for VAT exemptions Campaigning mum, Linda Ball, is stepping up her campaign for VAT exemptions on housing adaptations.

Currently, only certain types of housing adaptations are exempt from VAT. The construction of ramps, doorways, passages, bathrooms and lifts are usually exempt from the tax. However, adaptations of bedrooms and kitchens are currently not exempt.

These rules have a huge financial impact on families who need to make essential adaptations to bedrooms or kitchens in order to make a house suitable to live in.

To this end, Linda has started a petition to campaign for these adaptations also to be exempt from VAT. Linda has been raising awareness of her campaign in the media and in March she spoke on BBC Radio Northampton as well as BBC Look East to talk about the issue.

Linda’s local MP, Chris Heaton-Harris, has also thrown his weight behind the campaign and has written to the Treasury on her behalf.

On the web If you’d like to sign Linda’s petition online, visit our website at www.bit.ly/y4tnLn

www.muscular-dystrophy.org Trailblazers Part of the Young Campaigners’ Network

“I think taunti disabled pe ng an d abus ople have pu think e for so tha t as part t it should long thaup with be disab of their lives. something t they ilit just so y hate incide I now unde they accep rstand t me of your thing tha nts are rea l thing that t you life as shou s - no a disab led pe ld accept as t Rebecca rson.” part Oughton , Lancas ter

Under investigation

Trailblazers tackle hate crime

Our young campaigners, the Trailblazers, hit the headlines in February when they launched a new report, Under Investigation, showing that up to 80 per cent of young disabled people believe that the police do not take disability harassment and hate crime seriously.

THE Trailblazers Hate Crime report Report 7 of the Inclusion Now series February 2012

Trailblazers are now urging police authorities to review their handling of disability-motivated hate crime. The survey revealed that: • two out of three young disabled people have been taunted or verbally abused because they are disabled • 62 percent of young disabled people say they have been or may have been the victim of disability hate crime • only four out of ten young disabled people who have been harassed or abused, have reported the incident to a person in authority • eight out of ten young disabled

people think the police do not take disability hate crime seriously enough.

Trailblazers told of reluctance to report incidents of verbal abuse, spitting and confrontational behaviour, owing to the belief that their local police force would not take action or that the incident was not ‘significant enough’ to warrant police time.

Trailblazers are now calling for a nationwide initiative between police forces to crack down on disabilitymotivated crime by building links with local disabled groups, providing alternative ways for reporting abuse, and reviewing approaches to recording and tackling incidents.

Marc Pyle from Swindon said he’d been faced with repeated incidents of verbal abuse from strangers, but only felt able to inform the police following a physical attack.

“People regularly taunt me for the way I walk, which has changed due to the muscles in my legs weakening. The

perpetrators are usually big groups of men, who like to shout comments or mimic my walk. I’ve been attacked physically once, while at university in Newport. I was on the way to the pub with a group of friends, when a gang of young lads surrounded us on the pavement. My friends were able to run from the scene, but I couldn’t and was kicked on to the floor.

”Many of those who tell us about incidents of unprovoked abuse and threatening behaviour have no idea that they have been victims of a ‘hate crime’ in the eyes of the law. People feel that attacks have to be sustained and physical for the police to take them seriously, and that sadly, day-to-day intimidation and verbal abuse must just be tolerated.

The Minister for Disabled People, Maria Miller MP, commented on the report in the House of Commons, calling it an ‘excellent piece of research’. The campaign also featured on ITV’s Daybreak, was covered by the Independent newspaper, and appeared in print and broadcast media across the UK. ”Having been beaten up for being disabled it seemed fair enough to report this to the police. However, they didn’t really seem to care. It took three hours for them to get to the scene and as no-one was prepared to act as a witness they said there was nothing they could do.”

Bobby Ancil, Trailblazers Project Manager, said it was disturbing that in 2012 young disabled people were still facing these kinds of offences.

I hope this report inspires the victims of hate crime to report the abuse they face and that the police start working effectively with disabled people’s groups like Trailblazers to put an end to this shameful situation. ”If police forces are to regain the trust of young disabled people and tackle the underreporting of intimidation and abuse, we need to see both willingness and ability to do so across each and every police authority. We need a joined up approach,” Bobby said.

The sex factor: season two In the Spring 2010 edition of Target MD, you may remember we featured an article entitled The Sex Factor, about young disabled people, sex and relationships. In this article, we reported on research being carried out in this area by doctoral researcher and sociologist Kirsty Liddiard, from the University of Warwick. Kirsty herself has a form of congenital muscular dystrophy.

The research explored disability and sexuality and took place over three years. Kirsty was concerned about the ways in which disabled people can often be subject to sexual stereotypes, such as the common assumption that they’re asexual (that they lack any sexual feeling or desire) or that they are sexually inadequate or incapable.

Kirsty’s research aimed to understand not only how disabled people felt about these stereotypes, but also the ways in which disabled people experienced sexual and intimate life more generally.

Within the research, Kirsty spoke to a wide variety of disabled people, many with neuromuscular conditions, who told their individual stories. Kirsty’s research is now complete, and in the next edition of Target MD, we’ll bring you her key findings which centred on care and caring, intimate relationships, body image, sexual pleasure, desire and practices, gender differences, sex work, and PA or carer support.

page 17

Take an accessible break in 2012

Vitalise, not just a break . .. an experience Breaks for adults with physical disabilities and carers 24-hour care on-call and personal support

Call for latest offers and discounts Help with funding is available

New for 2012 Visit the Olympics More live music weeks New excursions

New entertainment Hair & Therapy Salons* Superb new menus

* Available at Sandpipers & Jubilee Lodge.

Coming soon at Netley Waterside House.

www.vitalise.org.uk

Registered charity no. 295072

Call for our 2012 brochure on 0303 303 0145

www.muscular-dystrophy.org

Inquiry into IVF technique to prevent mitochondrial myopathy Research funded by the Muscular Dystrophy Campaign and led by Professor Doug Turnbull in Newcastle has led to the development of a technique which involves in vitro fertilisation (IVF) to prevent mitochondrial diseases being passed from mother to child.

An estimated 6,000 people in the UK have a mitochondrial disease, 3,500 of which have mitochondrial myopathy.

These conditions, in the most severe cases, can cause debilitating and lifethreatening muscle weakness.

This emerging IVF technique, if developed for clinical use, has the potential to help thousands of couples in the UK. There is currently no treatment available and, because of the way these conditions are inherited, clinicians cannot give parents an idea of how severely their child will be affected.

This IVF technique is controversial because it involves transferring the genetic material of a fertilised egg (from a couple affected by mitochondrial myopathy) to a donor egg that has healthy mitochondria, and its own chromosomes removed. Mitochondria (the batteries of the cell) carry their own small piece of DNA and therefore the child inherits a very tiny proportion of its DNA from the donor as well as the chromosomes from their parents.

More research is required before these techniques are considered for introduction into clinical practice, and it was recently announced that a £5.8m research centre is to be set up in Newcastle to continue this research.

However, the law currently does not allow the technique to be tested in a clinical trial. The reason is that no egg modified in this way is allowed to be implanted into a woman’s womb. The health secretary will need to introduce further regulations, which will have to be agreed by parliament.

The Human Fertilisation & Embryology Authority (HFEA) has announced that it will launch a public consultation to

find out what the public thinks about this type of IVF technique becoming available as a treatment. The Muscular Dystrophy Campaign and the Association of Medical Research Charities (AMRC) recently submitted a joint response to a call for evidence from the Nuffield Council on Bioethics, who are conducting an inquiry into the ethical implications of this technique. The information gathered by the Council will also feed into the consultation.

The Muscular Dystrophy Campaign has invested in research into this area for more than 10 years and, together with our families, we will campaign for regulatory approval that will allow researchers to explore the full potential of this promising technique.

School drive gets top marks

Over the last six months the charity’s information team has been working on improving our service to schools and parents. We want to offer the best possible support for children with muscular dystrophy or a related condition, so they receive a fulfilling education.

Our Parents Education Network (PEN) has proven a big hit so far. The online community, aimed at getting parents talking to other parents about education, has seen a total of 3,796 views of posts covering issues such as Special Education Needs statements, discrimination and choosing the right school.

Annette Rush, whose son Joe has Duchenne muscular dystrophy said, “PEN is fabulous. Education is the biggest worry in my son’s life at the moment. It’s great to have a space to speak to other parents about what Joe is facing at school.”

If you’d like to get involved with PEN, please visit the TalkMD forum at http://bit.ly/penmdc To find out more about our schools work or to make a donation to this area of our work, please contact the information team on 0800 652 6352 (freephone) or info@ muscular-dystrophy.org

Gold standard of care outlined by NHS

The NHS is moving closer to developing a ‘gold standard’ service for patients with a neuromuscular condition through their draft service specification.

The service specification document sets out the standards of care all patients with a neuromuscular condition should expect to receive and is a welcome step towards ending the ‘postcode lottery’ in service provision across England.

It also emphasises the importance of all patients being able to access specialist care and recognises the vital role that a neuromuscular care advisor plays in delivering this. Of course, this is encouraging news to all our excellent supporters who have been campaigning for improvements to the NHS over the years.

Once the document is finalised, we will campaign to make sure that the gold standard service is put in place as soon as possible and that everyone with a neuromuscular condition can access the specialist services they need.

As the structure of the NHS undergoes significant change as a result of the Health and Social Care Bill, the Muscular Dystrophy Campaign is delighted that a campaigning mum is at the heart of NHS reform. Kate Parkin is the mother of a son with Duchenne muscular dystrophy and is a former trustee of the charity.

Kate will be the patient representative on two key groups: on services for people with neuromuscular conditions, and on specialist equipment (including wheelchairs).

Kate will be championing the needs of all people with neuromuscular conditions with these groups and will be able to use her own personal experience to influence decision-makers as they work to make sure that the NHS can fully meet the needs of patients once the new structures are in place.

We will be discussing the draft NHS service specification at regional Muscle Group meetings, so do come along and get your voice heard. Look on our website or get in touch with us on 0800 652 6352 for dates of forthcoming meetings.

page 19

Feature

www.muscular-dystrophy.org

Ethan without equal When Ethan Lane was born, his little body was completely floppy.

Specialists told his mum and dad, Mel and Chris, to expect the worst.

W

e met Ethan at his home in Torquay, in early February.

Pictured here showing us his muscles, Ethan is a lively, smiley, witty little three-year-old who is the class clown at nursery school, who annoys his older sister, Jasmine, and who absolutely loves cars. He also makes jokes, like when he told his teacher that his dog, Nemo, had died. Ethan has never had a dog. His dad laughs at Ethan’s mischievous ways but draws the line when Ethan’s eyes twinkle and he tells us he supports Manchester United.

“Enough is enough,” says the Derby County supporter, “not Manchester United!”

Thank you to Dr Nigel Clarke, MB ChB, FRACP, PhD, Clinical Geneticist (HGSA) and Senior Lecturer at the University of Sydney’s Institute for Neuroscience and Muscle Research, for providing the information about CFTD and ACTA1.

www.muscular-dystrophy.org

Ethan has congenital fibre type disproportion with the faulty gene being ACTA1. While he is a typical little brother, he is also a unique little boy. Doctors call him ‘child 3’, as he is only the third child in Europe that they know of with this specific diagnosis.

Born in Torbay Hospital in 2008, Ethan’s floppy little body sent the medical specialists into a flurry. After initially ruling out strep B, the consultant called for more tests.

“When Ethan was two weeks old, he was transferred to Bristol Hospital and the consultant asked to speak to us. He told us he thought Ethan had spinal muscular atrophy (SMA) type 1. He told us that would give Ethan two years, tops,” said Mel.

Mel and Chris spent the next 24 hours in a blur of devastation. Their new-born boy had been given a short life expectancy and they didn’t know where to turn. Or how would they tell their daughter or their families. The consultant called them later the next day to tell them Ethan did not, in fact, have SMA; the tests had come back negative.

And so it continued for the first year of Ethan’s life. Mel said they went through a rollercoaster of potential diagnoses followed by temporary relief as Ethan had tests that then returned negative. Chris and Mel considered the possibility they might never get a diagnosis and then, when Ethan was just over a year old their paediatrician suggested he should have a muscle biopsy and further blood tests.

Around three months later, they learnt that Ethan had congenital fibre type disproportion. Not only that, but the genetic consultant had located the faulty gene – ACTA1 – making Ethan’s diagnosis almost one in a million. Both Chris and Mel were subsequently tested, and neither had any trace of the faulty gene; Ethan’s faulty gene had appeared spontaneously.

“It was actually quite a relief to get a diagnosis and, although so little is known about the condition, at least we had something to work with,” said Chris.

Congenital fibre type disproportion (CFTD) is diagnosed when a particular pattern is seen on the muscle biopsy. In CFTD, slow twitch fibres, which look after movements that require muscle stamina like holding the posture, have failed to grow normally and they are often only half the size of fast twitch muscles that look after rapid movements.

Usually these two fibres are the same size and doctors don’t yet understand why slow twitch fibres should be so small.

Recent breakthroughs have meant that around half of families with CFTD can now get a genetic diagnosis, and the fault can be in one of five different genes. Ethan has an uncommon form of CFTD. The gene causing his weakness is responsible for only five percent of patients and fewer than 10 children in the world have been diagnosed with this.

Mutations in ACTA1 are much more likely to cause nemaline myopathy, a closely related muscle condition in which protein ‘rods’ are found in muscle fibres.

A team of international scientists from England, Australia and the Netherlands is now studying why CFTD gene mutations cause such dramatic changes to muscle fibre growth and why muscles don’t generate normal strength. The hope is that this will lead researchers to the heart of the problem so they can plan drug or gene-based treatments that counteract the effects of the gene mutations and get children back to running and breathing normally. Even though CFTD is one of the rarest muscle conditions known, any advances in understanding the condition and developing treatments should help children and adults with a wide range of muscle disorders since the muscle processes that are affected in CFTD are also found in many other conditions.

The prognosis for Ethan is very much unknown. Chris and Mel said they really just manage the symptoms. The breathing muscles are often affected in CFTD and this has happened in Ethan. Tests showed

he was not breathing fully overnight and Ethan is now on overnight ventilation, which has made a huge difference.

“It has given Ethan the energy to learn and develop, and without this, he would be very lethargic,” said Mel. He has waking carers with him six nights a week, to ensure he is connected to his BiPAP (bi-level positive airway pressure) ventilation system. The carers are funded partly by Social Services and the NHS. He also has regular hydrotherapy at Mayfields School in Torquay, which has helped him to develop his strength and mobility. He has a powered wheelchair – funded by the NHS – which he uses when he goes to nursery two and a half days a week, when he goes to the respite centre and when he goes on outings.

“We have had many highs and lows with Ethan, but he is a very cheeky young man with a great sense of humour,” said Mel. While Mel and Chris do all they can to arm themselves with the knowledge and information about Ethan’s rare condition, they are also happy to support other families facing similar situations.

Mel is quite a regular on the Muscular Dystrophy Campaign’s online forum, TalkMD, where she has both encouraged – and been encouraged by – other mums with children with rare conditions.

While we chatted to his mum and dad, Ethan sat on the floor and played with his toy trains. He pulled himself up to standing next to a chair; he showed us his muscles. We met his favourite toys, including Peter the doll, and many others, whose names he couldn’t remember.

With such a loving family around him, all the care and support he needs, specialist equipment, a cupboard filled with toys and a big sister who keeps him in line, Ethan is doing just fine

On the web Congenital fibre type disproportion: www.bit.ly/yIWxRr BiPAP info: www.bit.ly/znSadA

page 21

page 22

www.muscular-dystrophy.org

Sports news

A Trailblazer at Trafalgar Square In the last edition of Target MD, we invited readers to tell us if they are involved in the Olympics or the Paralympics in London.

Taz Virdee, 25, is a Trailblazer who has been selected as a London Ambassador for the Paralympics.

Taz applied last May, on the London Ambassador website. He was invited to an interview in Ealing, West London, where applicants were put into small groups of three to work as a team in order to test their knowledge of London.

“At first I thought I knew a lot about London, since I live here, but I soon discovered there was plenty of London I wasn’t aware of, which got me thinking: how much do I really know?” Taz said.

After the team games and tests, the applicants each had a one-to-one interview and were asked why they wanted to be London Ambassadors.

“For me, it was simple: this is once-ina-lifetime opportunity and with my experience and passion for disability sports, I just had to get involved with the Paralympics. This was the perfect role for me,” Taz said.

A few months later, Taz found out he’d been successful.

“I was really happy to be selected as one of 80,000 London Ambassadors,” Taz said.

“I will be based in Trafalgar Square during the first week of the Paralympics games. My duty is to answer any questions that tourists may have, such as: where the nearest tube station is; hotels, best restaurants, directions to the stadiums, etc. Our main objective is to help people who visit the games to have an overall enjoyable experience while in London,” Taz said.

Taz is a perfect candidate for this role; he tells us about a number of sports and other projects he’s involved with at DASH.

‘DASH (Disablement Association of Hillingdon) is a charity that offers support, information and advice to people with disabilities in the London Borough of Hillingdon.

We have a cricket team and a football team for people with disabilities. In the last year our cricket team won two trophies in competitions organised by a charity called Cricket4Change, and our football team won the Middlesex FA PAN Disability League in the 2010-11 campaign.

We have also recently developed some educational projects to improve reading and writing skills, actively working with disabled adults. We have been working with local day centres to offer interactive storytelling sessions for their service users.

The new reading and writing project, which we run at Uxbridge Library, and the opportunity to work with day centres in Hillingdon, have opened new avenues for DASH; we have opportunities for our service users, some of whom are now volunteering at our sports sessions at day centres and we hope our volunteers will get involved with the interactive storytelling sessions to improve their communication, confidence and public speaking skills.

In the last 18 months, DASH has also been delivering disability awareness talks at local primary schools. These are designed to raise awareness of disability, anti-bullying and the understanding of different disabilities. We have Q&A sessions with special guests about issues disabled people face on a daily basis and this has been eye-opening for many children.

For more information about DASH and their projects please visit: www.dash.org.uk

England’s most successful football team of 2011

As the 2011/12 Wheelchair Football Association (WFA) season enters the closing stages, it has been another great year for powerchair football. It’s seen the 2011 FIPFA World Cup take place, the launch of the WFA Cup and the WFA’s biggest National League to date.

The WFA England team finished as runners up in the World Cup in Paris, and became the most successful England team of the year. To celebrate this, the team (pictured above) was invited to Wembley and were presented on the pitch at half-time during the recent England game against Holland.

The new format National League has proved highly successful and is all still to play for. Aspire PFC lead the way in the Premiership as they look to defend their title, but are being chased by Northern

Thunder PFC and Sporting Club Albion.

After a great season for Norwich City PFC and Bolton Bullets in the Championship, they have secured promotion to next year’s Premiership division.

We now have more than 30 clubs across the country and have new teams starting to train in Northampton, Middlesbrough and Manchester.

If you would like more information about powerchair football, or would like to visit a club in your area, do visit www.thewfa. org.uk, follow @wfaenglandteam on Twitter or search ‘Wheelchair Football Association’ on Facebook.

They’re carrying the torch!

Congratulations to supporters Carl Tilson of Manchester, Laura Bizzey of Saxmundham, Jack Franklin of Brough, Michaela Hollywood of Downpatrick, Paul McIntyre of Stirling, Zakia Begum of Walsall, Alexander Jordan of Worcester, Cam Edmonds of Broadstairs and Pamela Moffatt of London, who have all been selected as Olympic torchbearers for the London 2012 Olympics. Each of them will carry the flame for 300m through their local areas during its 8,000 mile journey.

Also, watch out for Ollie Hynde, 17-year-old European swimming champion from Nottingham who will be participating in the ParalympicsGB. And of course the fab four: Jacob Thomas of Narberth, Scott McCowan of Ayrshire, and Stephen and Pete McGuire of Lanarkshire, in the national Boccia team.

Feature

www.muscular-dystrophy.org

Dan Cundall, head of design

Since its formation in 1990, the NMC has grown from offering just physiotherapy, to offering employment, training, support and respite for carers. Everything the NMC does, has the sole aim of improving the quality of life for adults and young people with muscular dystrophy. The Muscular Dystrophy Campaign became involved with the NMC in the mid-1990s, at which point it became sole trustee.

The Centre in the heart of Cheshire M atthew Lanham, Chief Executive of the NMC, welcomed us on arrival at the Centre and then encouraged us to walk around the NMC, to meet the people who work or visit there, and to see and experience for ourselves what the NMC was all about.

Steve Bebe, fundraising/administrative assistant was our tour guide. Steve’s been coming to the NMC for about ten years; firstly for physiotherapy and hydrotherapy and then for training in graphic design. He’s been working in the office for the past six years.

We met Gill Storey, head of physiotherapy, in the communal treatment area. This is a busy, busy area. It’s a place of not only innovative treatments and therapies, but also of informal chat and support among clients. People come to the NMC from all over the UK – and abroad – for physiotherapy, referred either by their GP or consultant. With the additional use of a hydrotherapy pool at the neighbouring school four times a week, the NMC offers people with muscular dystrophy a range of relevant and regular treatments.

“We encourage as much active, assisted exercise as people can manage. There has been a huge increase in the kind of active things clients are doing at the NMC and at home, and we are now seeing more people improve,” Gill said.

One of the first things you hear about the NeuroMuscular Centre (NMC) in Winsford in Cheshire is that ‘people with muscular dystrophy are at the heart of running the place’. Visiting the NMC in early March, it was evident that this truly is the case.

With 600 clients on the NMC’s books, around 200 men and women visit regularly. Clients from as far afield as Gibraltar and the Isle of Man might visit monthly or even annually. It’s the only place in the entire UK where adults can go for ongoing, specialist physiotherapy.

“Often when clients come to the NMC, they won’t ever have seen anyone else with the same condition as theirs. The peer support and interaction that happens here is invaluable and we find that we learn as much from the clients as they do from us and from each other,” Gill said.

Gill told us of the Muscle Challenge Week that was currently taking place in the physiotherapy centre. Styled on the ‘Sponsored NMC Coast to Coast cycle challenge of 2010’, 35 people cycled the equivalent of 225km, using four pieces of static cycling equipment, with either arm or leg pedals. The challenge was not only about getting clients doing more active exercise, but also about involving them in fundraising. At the latest count, £1,200 in sponsorship money had come in.

Next to the communal treatment area is the carers’ lounge, where carers can relax, chat together and have a break as they wait. Caring for carers is a growing area of focus for the NMC, which had funding to support 12,000 breaks for carers at the NMC during the past twelve months.

Steve took us through to the design studio. Silent, apart from the humming of shiny Macs and PCs, the studio has a staff of nine designers who produce not only internal marketing materials for the NMC, but also a variety of materials for external clients. Dan Cundall, head of design, has worked at the NMC for 15 years and has seen the studio’s portfolio develop from event leaflets through to cookie cutters, newsletters, exhibition stands, annual reports and NHS directories. Customers come from mulitinational commerce through to public sector, charities and social enterprises as well as individual customers needing wedding stationery.

“Our sales manager goes out to meet with clients on our behalf. We can take on pretty much any design projects. If it can be done on the screen, we can do anything. And, with the enabling staff here to assist with physical work, we are

www.muscular-dystrophy.org

able to produce an impressive portfolio of work,” Dan said.

“We appreciate any opportunities to quote for work – we are usually very competitive!” he added.

This is not only a working studio, but also a training centre for digital graphic design, IT skills and, most recently, website design. Around 30 students – who train at the NMC or via Skype from home – can complete a variety of formal qualifications: NCFE Level 1 or 2 in Graphic Design, BTec Level 2 in Creative Media Production or BTec Level 3 in Graphic Design.

Jason Smyth, the NMC’s web designer, has been at the NMC for a year and a half and is currently finalising the training course in web design, which will be available for prospective students during the coming year. As with all of the training courses on offer, students can begin their courses at any time and finish within whatever timeframe is practical and workable for the student. Dee Valkering, Training Co-ordinator, and Hayley Miles, Trainer, organise and run the training courses.

Ben Dale, Operations Manager at the NMC, has been working at the NMC for 12 years and has seen its annual turnover grow from £250k to £800k. Alongside this growth has been the increase in clients from 70 to around 600. The NMC values an enabling environment for all staff. Along with the NMC’s finances and commercial relationship with the NHS, Ben manages a fleet of four minibuses that bring staff to work every day. Matt Cundall, Finance Manager, has worked at the NMC for 13 years, looking after costings and quotations for the growing and successful social enterprise.

Matthew Lanham and Support Manager, Sue Walker, speak of the work of the NMC with passion and dedication. The two areas they have identified as current focus areas are transition and carer support.

“We want to help families through the tough times of transition and provide some inspiring, practical options for young people,” said Matthew.

Sue said the NMC actively offers support to families dealing with transition into adulthood and the shift from children’s services into work, further education and career options; health and adult services and practical support in terms of housing adaptations, physiotherapy and exercise, as well as bereavement support.

The busy design studio (above) Steve Bebe (left) Jason Smyth (below)

“For people with neuromuscular conditions, they are dealing with transition in condition at all times. We want to provide appropriate and helpful support for them as they go through these changes, at all times. Sometimes this will involve advocacy,” Sue said.

The NMC offers much-needed support to carers and has secured funding from the local council to offer carers advice, guidance, support and respite.

Alongside growth, and the development into a fully-functioning social enterprise, the NMC has now also come of age. In April 2012, it will officially break away from the trusteeship of the Muscular Dystrophy Campaign, and become fully independent.

“The time was right for us to go our separate ways and both sides are genuinely committed to working together going forward,” said Matthew.

Robert Meadowcroft, Chief Executive of the Muscular Dystrophy Campaign, said the charity supported the NMC’s launch as an independent charity.

“The NMC offers a vital service to people affected by muscular dystrophy. As with our charity, people with muscular dystrophy and related neuromuscular conditions are at the heart of everything the NMC does. We look forward to continuing our close working relationship with the charity and, on behalf of everyone at the Muscular Dystrophy Campaign, I wish the NMC every success in the future,” Robert said

page 25

page 26

www.muscular-dystrophy.org

A winning sling Dr Huw Thomas, 64, has limb girdle muscular dystrophy type 2 and lives in Aberystwyth. Huw came joint first in the 2011 Stelios Award for Disabled Entrepreneurs in the UK, for the manual sling that he designed. The Award is a competition run by Sir Stelios Haji-Ioannou, the Stelios Philanthropic Foundation and the charity Leonard Cheshire Disability.

I started the design, in 2006, of a very simple sling for manual handling. In August 2007, I established a limited company in partnership with a young friend and we launched the product on the market in November of that year. We sold nothing until the spring of 2008 and showed a profit for the first time at the end of our business year in August 2011.

The Stelios competition was started five years ago and recognises the achievements and unique challenges faced by disabled entrepreneurs.

According to the official press release, ‘To win this award you have to prove that you are dynamic, driven and that your business, which is meeting a need in the market, is destined to be a huge success.’ Winners also benefit from specialist support courtesy of the Stelios Scholar Reach-out Programme.

Based on feedback from customers, we now have slings that range in size to suit a three-year-old child right up to possibly the largest person in the UK – maximum safe working load of 63 stone, which we sell to the ambulance service and fire brigade.

Here is Huw’s story, in his own words, of how he moved from retirement into award-winning entrepreneurship:

Just over a year ago, we took on two new business partners to help advise us on how to grow the business. We have sold slings not only to disabled individuals and their families, but also to the fire and rescue service, ambulance service, schools and colleges, airports, Outward Bound, some PCTs and a few others, for example to a North Sea oil exploration company. We also have some modest exports to Sweden, France, USA, Ireland, Qatar and New Zealand.

I

worked for 34 years as a research scientist, starting at the lowest scale and retiring at the age of 56 as a project leader. I have a PhD in plant genetics.

Huw Thomas, and his awardwinning sling in action

After two years of retirement, I realised this was not for me and started looking at alternatives. I had several ideas that could possibly be turned into business ideas and I chose the one that I thought was going to be the easiest to implement: to design and manufacture a sling for moving me from my wheelchair in an emergency or when travelling.

I was once in the art centre on the first floor, when the lift broke down and the management called the fire brigade to get me out! My embarrassment and humiliation were off the scale! They came along in their full kit, including helmets; everything except the hoses and hatchets.

There is also the difficulty when travelling and boarding aircraft; the regular procedure is to pick someone up under the arms and knees to move them from wheelchair to aisle chair and then from my wheelchair into the aircraft seat. With muscular dystrophy, I am susceptible to dislocations and with osteoporosis, am susceptible to fractures. Therefore, being picked up manually is not only uncomfortable (even painful) but very hazardous.

So, I had a business idea but no business experience – I can’t even make sense of my bank statement! It was a very steep learning curve.

“I find the Promove sling invaluable when flying.

Without it I would have great difficulty transferring from wheelchair to aircraft seating. It is straightforward to use, putting it on like a normal sling, and then having two or three persons to lift you.”

Jacob Thomas I’d been keeping an eye on the Stelios competition for a while. I put in an application in 2010 as a dry run, with little thought of winning because the business was still making a loss. It did prove useful as I got to the final three in December 2011.

Stelios decided to share the award between two of us, but during the reception following the announcement, they had a change of heart. Instead of sharing the prize of £50,000 between two of us, he decided to award each of us £50,000. I have started putting that money to good use with a new marketing strategy

On the web Promove: the moving & handling solution www.promove.uk.com

page 28

www.muscular-dystrophy.org

Make today count Families from across the UK came together to make the leap year day count and raise much-needed funds for Muscular Dystrophy Campaign research. A team of 100 brave skydivers, 25 teams of bucket collectors and a number of businesses across the country joined together on the day and raised a staggering £60,000.

Our thanks to everyone who helped us to make today count for muscular dystrophy research.

www.muscular-dystrophy.org

The best of the web Y

ou may remember from the last Target MD that I focused on the importance of storytelling, collaboration and sharing to illustrate how we are using the web to reach people and raise awareness of the charity’s work. We are focusing on those areas again, but this time they are all about the one event.

Make today count was a fundraising event to support our research. People around the UK held collections, arranged raffles and 100 brave fundraisers skydived on that extra day: 29 February.

Our Twitter and Facebook pages were buzzing with people sharing their stories, pictures, fundraising pages and updates from their skydives. We used the storytelling tool, Storify, to share all these stories with the world and also launched a new social media presence, Pinterest (a digital pinboard for photos), to mark the occasion. www.bit.ly/FPPz8g

David Pearce Direct Marketing and Digital Manager t: 020 7803 4837 e: d.pearce@muscular-dystrophy.org tw: @TargetMD

The story of Mr 100 Team 100 is what we called our 100 fundraising skydivers, but it wouldn’t have worked with only 99!

With just one day to go before 29 February, we signed our 100th volunteer skydiver via Twitter and we called him Mr 100 (and Alex).

Alex Gray really threw himself into the challenge, talking to the local newspaper, speaking on local radio (twice), editing his jump video for YouTube and all the while sharing his story with us on Twitter.

This is just one great fundraising story told online; there are at least 99 others and they are all just about this event. www.bit.ly/yogsxn

Make today count web stats The most re-tweeted tweet reached more than 6,000 people Our email from skydiver Becky Littler, a supporter who had a special reason for doing the skydive, was sent to 19,435 people Our most popular (of five) Facebook posts reached 2,042 people Mr 100: www.bit.ly/yrMON2 Playlist of all the video I have seen: www.bit.ly/xg1SDd The email: www.bit.ly/FR6Uy4

page 29

Target MD and Target Research

who really want to read them, and they’re both now produced fully in-house, the Muscular Dystrophy Campaign can free up more funds to spend on further research, campaigning, support and equipment grants.

In these harsh economic times, we’re working hard to save money.

Now more than ever, we rely on every penny of your donations to fund vital research and provide support and care for people with muscular dystrophy and related conditions. With this in mind, we‘ve launched our new-look Target MD and Target Research – both to be delivered to you four times a year.

If you’d like to subscribe to the magazines, please post your details, together with a cheque for £18 made payable to ‘Muscular Dystrophy Campaign’ to Target MD Subscriptions at 61 Southwark Street, London SE1 0HL:

That’s right! You will receive Target MD four times a year instead of three, plus you will receive the new ‘slimline’ Target Research at the same time, rather than once a year as you did previously.

And all for an annual subscription gift of just £18. This will help us cover our costs - even reduce them - while ensuring the same editorial quality you’d expect from every issue of Target MD and Target Research. And because they now only go to people like you

I wish to subscribe to Target MD and Target Research for one year, at a cost of £18.

I wish to make a donation of £___________

Using Gift Aid means that for every pound you give, we are able to reclaim back from the Inland Revenue the tax paid on it – helping your donation to go further. Please tick the box below:

Target MD

magazine

Gift Aid Declaration

Issue 1 of 4 2012

Yes I would like Muscular Dystrophy Campaign to treat all gifts that I have made in the last four years and all future donations that I make from the date of this declaration as Gift Aid donations.

I will notify the charity if my gifts are no longer eligible.

School days

No, please do not claim Gift Aid on my donations.

MUST READ

Choices and challenges in finding the best school for your child

To be eligible for Gift Aid you must pay an amount of Income Tax and/or Capital Gains Tax for each tax year (6 April one year to 5 April the next) that is at least equal to the amount of tax that the charity will reclaim on your gifts for that tax year.

Come and play Boccia JOIN IN

Date____________________________________________ Please include a date here, as without a date this form is invalid. Thank you.

Would you like to receive updates from us?

Meet the ParalympicsGB hopefuls

Yes

Trailblazers news

No

Education, advocacy, fundraising and life stories ALL INSIDE

Title_______________ First name_____________________Surname_______________________

Research news • Information Standard Award • The President’s Awards • Get fit in 2012 • Campaigning news

Address________________________________________________________________________ ______________________________________________________________________________ Postcode_______________________________________________________________________ Phone_________________________________________________________________________ Email__________________________________________________________________________ Payment information: Method: Credit card Direct debit cheque to pay by credit card/debit card (details below) Name of cardholder: Title_______________ First name_____________________Family name____________________ Card type:

Visa

Mastercard

Debit

Access

Target Research Issue 1 of 4 2012

Time to register A MUST READ

How patient registries are opening up opportunities for both patients and researchers

Improving care standards Clinical trial opportunities

Speeding up recruitment to clinical trials

Access to information

atgctttggtgggaagaagtagaggactgttatgaaagagaagatgttcaaaagaaaacattcacaaaatgggtaaatgcacaattttctaagtttgggaagcagcatattgagaa Patient’s link to the research community

Crucial for clinical trial planning

Myotonic dystrophy CUTTING-EDGE

Card No:

Expiry Date: /

Start Date(if applicable) /

Issue No.(if applicable)

(maestro only)

Security code (if applicable)

Signature______________________________________ Date____________________________ Alternatively, call us on 020 7803 4836 or visit our website and subscribe online at www.muscular-dystrophy.org/targetmdsubscribe Registered Charity No. 205395 and Registered Scottish Charity No. SC039445

Our researchers are improving diagnosis and moving towards possible therapies

Point of View What’s it like to join a patient registry?

Also inside…experts answer your questions and read about all the latest research and clinical trial news

www.muscular-dystrophy.org

Thinning bones, menopausal women and muscular dystrophy Val Wintle, 51, is from Corfe Mullen, Dorset

I was diagnosed with mitochondrial myopathy in 1996. My daughter, who is 30, will be a carrier of the defective gene. It has been a steady decline over the years and now I am housebound, losing all my independence. My lovely husband, Mark, is my rock and does all the housework! Luckily we have travelled in the past as it would be impossible now. All my hobbies have fallen away due to mobility problems and fatigue. Even reading and watching TV is a chore due to eyesight problems. I’m into spirituality and I try to stay positive but sometimes fail miserably.

T

hinning bones are a commonplace problem for menopausal and older women.

Add instability and difficulty in doing enough load-bearing exercise to strengthen weakening bones, and you have a recipe for disaster.

With the right care, there is a good chance of preventing fractures.

Preventative measures ought to save money, whereas reacting when the damage is already done is costly, as well as increasing the suffering of muscular dystrophy patients. Yet this kind of care seems to be a postcode lottery. My experience highlights this.

My mitochondrial myopathy restricts my mobility and limits the exercise I can do. I am also prone to falls. Furthermore, I am peri-menopausal (stage before menopause); a critical time for women when the risk of thinning bones increases dramatically.

Last September, I broke my ankle trying to sit in a chair! After an x-ray, I had a temporary plaster until I could attend the fracture clinic. It was a difficult experience at the best of times, never mind with muscular dystrophy.

Several days later, the fracture clinic put me in plaster for four weeks. At least I could hobble on this, but it was a long four weeks. Ironically, I felt more stable

with the plaster on, and more “legitimate” when out in my wheelchair.

No-one in the medical profession that I met took account of my muscular dystrophy and tendency to fall, or of my age and being menopausal, when considering aftercare. I had already decided that I needed a bone density test and that I should increase my calcium intake, so I went to the GP to arrange this.

After some debate, she agreed. The test showed I had Osteopenia, or thin bones (a condition where bone mineral density is lower than normal).

Now I am on high dosage calcium and vitamin D tablets daily, and alendronic acid tablets (to build up bone) once a week, all for the foreseeable future.

In complete contrast, I discovered that in Newcastle your consultant would advise a bone density test for a menopausal woman to see if there is an increased likelihood of fractures. If there is, this can then be treated.

Prevention must be better than cure.

Those in Newcastle can do it, so why not elsewhere? This simple test could have prevented a fracture and all the physical and mental stress for me and my family, not to mention the huge cost to the NHS.

Mitochondrial myopathy:

My advice for menopausal women with muscular dystrophy who are still mobile is to badger your GP for a bone density test. It could save you much pain and the NHS a lot of money!

is a collective term for a group of diseases that particularly affect muscle, but which may also affect every other part of the body including the brain and the eye.

(Please see our website for more details www.muscular-dystrophy.org)

It is good to know that the Muscular Dystrophy Campaign is campaigning nationally for better preventative services from the NHS, which might prevent such situations in the future.

Val’s condition

Fractures risk and muscular dystrophy

Terry Aspray, Consultant in Metabolic Bone Disease, Freeman Hospital, Newcastle upon Tyne Osteoporosis is a condition in which bone tissue is structurally altered, bone mass is low and there is an increased risk of breaking bones without significant injury, such as falling from standing height (so-called fragility fracture), for which increasing age and female gender are the most important risks. However, there are a number of important determinants of fracture risk, including family history, rheumatoid arthritis, glucocorticoid (steroids) treatment, smoking cigarettes and drinking alcohol.

Fragility fractures significantly increase the risk of further fracture. From April 2012, the government has directed GPs to assess patients who fracture for appropriate treatment to protect their bones. This may include a Dual Energy X-ray Absorptiometry (DXA) scan.

Identifying patients at risk of fracture (but who have not yet broken a bone) is more challenging. The National Institute for Health and Clinical Excellence (NICE) guideline on assessing fragility fracture risk has been presented in draft form to stakeholders for consultation.

Immobility and increased risk of falling are both important factors which should prompt a clinician to assess fracture risk.

However, this may not need a DXA scan.

Assessment tools such as FRAX and QFracture are both readily available online and can estimate 10-year risk of fracture, based on a number of characteristics such as family history of hip fracture and personal history of smoking, alcohol consumption or fracture.

Patients should discuss fracture risk and agree on lifestyle changes and treatment based on their estimated risk. Online and easy-to-use fracture risk tools empower patients to understand this condition and will help with communication between patients and clinicians.

On the web NICE guideline: www.guidance.nice.org.uk/CG/Wave25/2 FRAX: www.shef.ac.uk/FRAX/ QFracture: www.qfracture.org/

page 31

The Mobility Roadshow Open 10am daily Free admission & parking

...driving mobility forward

21st, 22nd & 23rd June 2012

Peterborough Arena (East of England Showground)

The UK’s original hands-on consumer event, showcasing mobility innovation for almost 30 years INSPIRATIONAL - be amazed at life-changing products and new ideas for YOUR independent lifestyle

INTERACTIVE - test drive vehicles, wheelchairs, powerchairs, scooters, cycles; join in sport, watch demonstrations, activities for all the family

INFORMATIVE - gain a wealth of expert help, information and advice

Register online for your FREE tickets at www.mobilityroadshow.co.uk or call 0845 241 0390

Hello from Target Research Our latest edition of Target Research tackles some hot, thought-provoking topics and I hope you’ll enjoy reading about them.

The main feature is about newborn screening for neuromuscular conditions. This has been in the spotlight recently, especially for Duchenne muscular dystrophy. We also feature research we are funding at King’s College London into how the quality of life of people with muscle disease is affected by factors such as the way they cope with stressful situations and their beliefs about their condition.

In the news, we highlight progress towards preventing mitochondrial myopathy being passed on to future generations using a new type of IVF. We also report on new advances that are improving the diagnosis of neuromuscular conditions and announce exciting news of clinical trials starting and being planned.

Sadly this is my last issue of Target Research. I’m off on maternity leave and will be moving back home to Australia to have the baby. I will be keeping a watchful eye from afar and cheering on the charity and researchers to keep making big strides forward.

Kristina Elvidge Editor, Target Research

Town and Gown 10k – new addition, new target Christmas is on the cards Unless you come from the southern hemisphere, Christmas and warm weather just don’t go together. But here at the Muscular Dystrophy Campaign, there’s a reason why we have Christmas cards – and you – on our minds right now.

Our well-established Muscular Dystrophy Campaign Oxford Town and Gown 10k now has a competitive historic rival in 2012. This April will see the inaugural Cambridge Town and Gown 10k running race launched through the heart of the city.

We’ve just launched our 2012 Christmas card design competition.

The charity has hosted a Town and Gown 10k race in Oxford since 1982 and it has, to date, raised a staggering £1million. Now the charity is bringing the challenge to Cambridge in the hope of uniting university students and townsfolk to join in and raise money for the Muscular Dystrophy Campaign.

Our 2011 competition was so successful, that we’d like you to be part of an even bigger and better one this year. Enter our competition and, if your design is selected, we will make it into a card and sell it through our ever-popular Christmas catalogue and our online shop. Runners-up will have their designs made into eCards, and these will be sold on our website.

Event organiser Alun Mainwaring said, “With two fantastic runs in the calendar, we’ve got our sights set on reaching the second million in the next six years.”

The races will be held two weeks apart, giving ambitious runners the option of taking on both. The Cambridge Town and Gown 10k will be held on Sunday 29 April and the Oxford Town and Gown 10k on Sunday 13 May.

Last year’s winners Liz Morgan and Alison Walker both really enjoyed taking part in the competition. Their winning designs are pictured above.

Registrations are filling up quickly, so you won’t want to miss out. Sign up today at www.muscular-dystrophy.org/ townandgown10k, or contact Alun at events@muscular-dystrophy.org or 0207 803 4820.

“It was great to see my [sheep] design made into a card, and to know that so many people bought it to raise money for the Muscular Dystrophy Campaign. I would definitely recommend entering the competition to anyone,” said Alison.

The competition is open to all Muscular Dystrophy Campaign supporters. If you fancy designing a card with a Christmas or wintry theme, do send in your painting, drawing or digital design. If you are under 16, we’ll need signed permission from your parent or guardian too.

What to do: 1. design a Christmas card 2. write a paragraph or two about yourself (no more than 200 words) 3. submit the design and completed entry form and a photo of yourself, before 15 June 2012. (Incomplete entry forms will not be considered.)

See entry form for details.

Visit our website or contact Sarah Greenwood on 020 7803 4834 or s.greenwood@muscular-dystrophy.org for an entry form.

Three Peaks in two days Join the Muscular Dystrophy Campaign in an attempt to climb the highest three peaks in Scotland, England and Wales in 24 hours, from 17 to19 August. We will travel to Fort William on Friday 17 August to take on Ben Nevis on the Saturday morning, climb Scafell Pike that night and finish Snowdon on Sunday 19 August in Wales. Are you up for the challenge?

It will be tough, exciting and very rewarding. You should have the necessary fitness for the physically demanding two days, and also be prepared to go without sleep.

Can we encourage you to do something incredible this year? Push your body to the limit, join us in the fight against muscular dystrophy and related neuromuscular conditions, and take in some spectacular views along the way.

To join us in this great trek, you will need to pay a registration fee of £99 and commit to raising a minimum of £600 in sponsorship for us. For more information please contact Julia on 020 7803 4828 or j.selby@muscular-dystrophy.org

The big pedal

Check out this amazing Muscular Dystrophy Campaign-themed cake our long-time supporter, Jim Martin, had for his 40th birthday in March. Along with his brother Scott, and son Dale, he is going to cycle from Lands End to John O’Groats this summer and hopes to raise £10,000. They will cycle through Scotland, Wales and England and all for a special cause: Jim’s son, Robbie, has Duchenne muscular dystrophy.

You can sponsor them here: www.justgiving.com/Barbara-Martin2

page 34

www.muscular-dystrophy.org A peak experi

Come and climb Kilimanja with us ro ence

The kite man runneth Virgin London Marathon 2012 22 April 2012 We’d like to wish all 110 of our runners a fabulous Virgin London Marathon 2012.

Thank you for your support and for your hard work in fundraising towards our amazing target of £240,000.

Among our runners who will be dressed in orange and pounding 26 miles of London pavement for us is our very own ‘kite runner’. Meet Tim Moss (pictured left): “I’m 48 years old, married to Sara. I work as the Systems Development Manager for Sparsholt College Hampshire, just outside Winchester. We live in the village of Eversley and we have some land a few miles away, where we keep our horses, chickens and ducks.

I have a personal reason for running the marathon on behalf of the Muscular Dystrophy Campaign, as my younger brother Chris has Becker muscular dystrophy. He is planning to be at the Muscular Dystrophy Campaign race headquarters on Marathon day – I hope he’ll be there to buy me a drink!

This is in fact my seventh marathon, third time round London, second time running for the Muscular Dystrophy Campaign and the first time in fancy dress. I came up with the idea of the kite after seeing the Muscular Dystrophy Campaign logo. The challenge then was on coming up with a design that would make it possible to run without the risk of becoming a hazard to aircraft.

I am hoping that as the kite will have the logo and the Muscular Dystrophy Campaign’s details, my text message donation details on the kite will elicit a few more donations.”

Tim, and the rest of our team of 110 runners, can be sure of our support every step of the way, and in particular on our two cheering points at Bridge House on Tower Bridge and along the Embankment where orange-clad supporters will be shouting out their encouragement to runners.

A peak experience

20 – 30 Octob

er 2012

20 – 30 October 2012 Come and climb Kilimanjaro with us in October 2012. Conquer the highest free-standing mountain in the world and while doing so, you’ll be helping us in our fight to conquer muscular dystrophy and other related conditions.

Bharti Shah (pictured left) was one of the first to sign up for the challenge. Her epic fundraising feats for the Muscular Dystrophy Campaign began in 2007, when she took on a gruelling 100km trek through the Sahara Desert to support the charity. Her 22-year-old son Rikin has congenital muscular dystrophy, and Bharti was determined not only to raise awareness of the condition but also to help generate funds for pioneering research into treatments.

Conquering the Sahara was just the start for Bharti, who also went on to raise thousands of pounds for us, navigating the length of the Great Wall of China in 2010.

“Trekking through the Sahara was one of the most amazing things I have

done in my life. The trek was really tough, trudging miles across the desert with our feet sinking into the sand. We all endured severe aches and pains – sometimes it really was agony, but I wouldn’t have even considered giving up for a moment. All of us had a connection to muscular dystrophy and a reason to keep going.

“My only fear was falling ill and being unable to complete the journey. The last day was very emotional, when we reached the end of the trek. It was a pretty powerful feeling finishing a challenge like this. Together our blood, sweat and tears raised tens of thousands of pounds for the Muscular Dystrophy Campaign. I would definitely encourage anyone considering the 2012 Kilimanjaro challenge to get involved. I, for one, will be back this year for round three!”

If you’d like to join Bharti and sign up for this challenge to climb Kilimanjaro and raise funds for us, do get in touch with Julia in our events team on 020 7803 4828 or j.selby@muscular-dystrophy.org

Sporting people

For a second year in a row, our Celebrity Sports Quiz in the world-famous Long Room at Lord’s Cricket Ground was a resounding success. More than 170 guests enjoyed the black-tie evening that brought with it sports memorabilia, much banter and a serious sports quiz, not to mention a great dinner and a chance to meet UK’s sporting elite.

With Jonathan ‘Aggers’ Agnew as host, Matt Dawson as quizmaster and Willie Thorne as auctioneer, teams battled it out over six quiz rounds. They were helped – or were they? – by celebrity hosts Sam Torrance, Barry McGuigan, Alec Stewart and Robin Cousins, among others.

Alex Manby and his team emerged victorious as the 2012 Sports Quiz champions. But the true winner on the night was the Muscular Dystrophy Campaign as more than £70,000 was raised for our vital research into muscular dystrophy and other related conditions. Thanks to everyone for their generous support.

“Wonderful evening – please send me an invite for next year.”

Justin Marking, Director, Head of UK Residential, Savills “Thank you for allowing me to be a part of such a great evening! I had a really enjoyable time and it’s brilliant news that such a good amount of money was raised. I would certainly love to be involved again next year.”

Rob Moore, England hockey player Mark Ramprakash, Robin Cousins, Jonathan Agnew, Rob Moore, Steve Collins and (in front) Stevie Pearson

Muscular Dystrophy

Campaign

2012 Celebrity Sport Thursday 1 March 2012 The Long Room Lord’s Cricket Ground, London

s Quiz

Muscular Dystrophy Campaign

Four Course Classic Friday 22 June 2012

Chip in and change lives

Come and play golf for us on one of the longest days of the year. Tee off at dawn at a golf course near you, play 72 holes at four different courses, and relax at the fourth clubhouse as the light begins to fade on a great day of golf. It’s the ultimate golf challenge.

Get a four-ball together to join in the biggest golfing day – the Muscular Dystrophy Campaign’s Four Course Classic 2012. Not only will you get to play golf from sunrise to sunset, but you’ll also be making a real difference to the lives of the 70,000 people we support in the UK who are affected by muscular dystrophy and related conditions.

To enter a team or to find out more: t: 0845 872 9058 e: golf@muscular-dystrophy.org w: www.fourcourseclassic.co.uk Registered Charity No. 205395 and Registered Scottish Charity No. SC039445

In memoriam

A special way to remember friends and loved ones A donation to the Muscular Dystrophy Campaign is a very special way to remember and honour the life of a relative or friend. Your donation will be used to give hope and support to all those families living with muscular dystrophy and related conditions.

If you’d like to talk to someone about In Memoriam giving, please do get in touch with Sarah Greenwood: t: 020 7803 4834 e: s.greenwood@muscular-dystrophy.org w: www.muscular-dystrophy.org Registered Charity No. 205395 and Registered Scottish Charity No. SC039445