TWIK-1 Two-Pore Domain Potassium Channels Change Ion Selectivity

` TWIK-1 Two-Pore Domain Potassium Channels Change Ion Selectivity and Conduct Inward Leak Sodium Currents in Hypokalemia Liqun Ma, Xuexin Zhang and Haijun Chen (7 June 2011) Science Signaling 4 (176), ra37. [DOI: 10.1126/scisignal.2001726]

The following resources related to this article are available online at http://stke.sciencemag.org.

This information is current as of 3 August 2011.

Article Tools Supplemental Materials Related Content

"Supplementary Materials" http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37/DC1 The editors suggest related resources on Science's sites: http://stke.sciencemag.org/cgi/content/abstract/sigtrans;4/184/pe35 This article has been cited by 1 article(s) hosted by HighWire Press; see: http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37#BIBL This article cites 54 articles, 23 of which can be accessed for free: http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37#otherarticles

Glossary Permissions

Look up definitions for abbreviations and terms found in this article: http://stke.sciencemag.org/glossary/ Obtain information about reproducing this article: http://www.sciencemag.org/about/permissions.dtl

Science Signaling (ISSN 1937-9145) is published weekly, except the last week in December, by the American Association for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Copyright 2008 by the American Association for the Advancement of Science; all rights reserved.

Downloaded from stke.sciencemag.org on August 3, 2011

References

Visit the online version of this article to access the personalization and article tools: http://stke.sciencemag.org/cgi/content/full/sigtrans;4/176/ra37

RESEARCH ARTICLE CHANNELS

TWIK-1 Two-Pore Domain Potassium Channels Change Ion Selectivity and Conduct Inward Leak Sodium Currents in Hypokalemia Liqun Ma, Xuexin Zhang, Haijun Chen*

INTRODUCTION

Ion channels are characterized by such parameters as ion selectivity, conductance, voltage sensitivity, and sensitivity to pharmacological agents.

Of these fundamental characteristics, ion selectivity is generally considered to be an invariant property that does not change in response to physiological or pathophysiological stimuli (1). Indeed, evolutionary pressures exist to maintain channel ion selectivity constant (2). This dogma has been challenged by data showing that the ion selectivity of purinergic receptors and transient receptor potential cation channels can change during agonist stimulation (3–5). The ion selectivity of K+ channels is mainly determined by the selectivity filter, a functional unit within the pore (6–8), although the cytoplasmic N-terminal influences the ion selectivity of TREK-1 (TWIK–related K+ channel 1) (9) and electrostatic interactions influence that of GIRK (G protein–activated inwardly rectifying K+ channel) (10). None of more than 80 mammalian K+ channels has been reported to show dynamic changes in ion selectivity under physiological conditions, although several voltage-gated K+ channels conduct Na+ currents in the absence of intracellular K+ ions (11–14), implying that the selectivity filter of K+ channels can change its conformation and selectivity.

Hypokalemia refers to blood K+ concentrations lower than the normal values of 3.5 to 4.8 mM. Moderate hypokalemia, with 2.5 to 3 mM blood K+, can cause cardiac arrhythmias; more severe hypokalemia, with 1.7 to 2.5 mM blood K+, can result in cardiac arrest and sudden death (15–19).

Severe hypokalemia (<2.5 mM blood K+) is often observed in patients with periodic paralysis (18, 20, 21) or kidney disease (22, 23) and cancer patients undergoing chemotherapy (18, 24). Cardiac background K+ channels, which are open at the resting membrane potential, maintain

Department of Biological Sciences, University at Albany, State University of New York, Albany, NY 12222, USA. *To whom correspondence should be addressed. E-mail: hchen01@albany.edu

the cardiac resting membrane potential at around −80 mV, close to the K+ equilibrium potential (25). Under hypokalemic conditions, human cardiomyocytes can paradoxically depolarize to around −50 mV (26–28), whereas rat cardiomyocytes hyperpolarize in accord with the Nernst equation for K+ (29), suggesting that the function of human but not rat cardiac background K+ channels is impaired in lowered [K+]o. This paradoxical depolarization has also been observed in human, sheep, and canine cardiac Purkinje fibers (27, 30, 31), and is crucial to the etiology of hypokalemiainduced cardiac disorders (32). In cardiac cells, paradoxical depolarization is accompanied by a distinct phenomenon characterized by hysteresis of the recovery of a hyperpolarized resting membrane potential: When [K+]o is increased following paradoxical depolarization, the membrane potential does not immediately return to the same value observed at that [K+]o before the paradoxical depolarization. Instead it assumes a more depolarized value (26, 31). An inward leak Na+ current has been suggested to contribute to the paradoxical depolarization (30, 31). However, both the channel through which this inward leak Na+ current flows and the mechanism that gives rise to it remain unclear. The strong inward rectifier K+ channel (Kir2), which shows nonlinear conductance around normal resting potentials and is believed to play a role in setting the resting membrane potential, has been hypothesized to mediate hypokalemia-induced paradoxical depolarization (33, 34). However, Kir2 channels cannot account for the inward leak Na+ currents observed in paradoxically depolarized cardiac cells, because they do not show changes in ion selectivity in lowered [K+]o (34). Nor can Kir2 channels explain the hysteresis in restoring a hyperpolarized resting membrane potential from paradoxical depolarization (30, 31). This implies that Kir2 channels alone cannot fully account for hypokalemia-induced cardiac paradoxical depolarization and suggests that other background K+ channels may also contribute to this phenomenon.

The two-pore domain K+ channels (K2P), a subfamily of background K+ channels, are dimers with each subunit containing two asymmetric

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

1

Downloaded from stke.sciencemag.org on August 3, 2011

Background potassium (K+) channels, which are normally selectively permeable to K+, maintain the cardiac resting membrane potential at around −80 mV. In subphysiological extracellular K+ concentrations ([K+]o), which occur in pathological hypokalemia, the resting membrane potential of human cardiomyocytes can depolarize to around −50 mV, whereas rat and mouse cardiomyocytes become hyperpolarized, consistent with the Nernst equation for K+. This paradoxical depolarization of cardiomyocytes in subphysiological [K+]o, which may contribute to cardiac arrhythmias, is thought to involve an inward leak sodium (Na+) current. Here, we show that human cardiac TWIK-1 (also known as K2P1) two-pore domain K+ channels change ion selectivity, becoming permeable to external Na+, and conduct inward leak Na+ currents in subphysiological [K+]o. A specific threonine residue (Thr118) within the pore selectivity sequence TxGYG was required for this altered ion selectivity. Mouse cardiomyocyte–derived HL-1 cells exhibited paradoxical depolarization with ectopic expression of TWIK-1 channels, whereas TWIK-1 knockdown in human spherical primary cardiac myocytes eliminated paradoxical depolarization. These findings indicate that ion selectivity of TWIK-1 K+ channels changes during pathological hypokalemia, elucidate a molecular basis for inward leak Na+ currents that could trigger or contribute to cardiac paradoxical depolarization in lowered [K+]o, and identify a mechanism for regulating cardiac excitability.

RESEARCH ARTICLE RESULTS

TWIK-1 K+ channels show altered ion selectivity and conduct inward leak Na+ currents in subphysiological [K+]o

We expressed TWIK-1 channels in Chinese hamster ovary (CHO) cells to determine whether these K+ channels could become permeable to Na+ in lowered [K+]o. TWIK-1 wild-type (WT) channels produced a small detectable macroscopic current in only about 1 of 18 transfected cells (fig. S1); therefore, we used TWIK-1•K274E (Fig. 1A), which contains an intracellular point mutation that enables the detection of TWIK-1 currents (44), as a tool for this study. As previously reported (44), TWIK-1•K274E channels were highly K+-selective when exposed to physiological K+ gradients: the reversal potential shifted by 52.7 ± 1.3 mV in the depolarizing direction for every 10-fold increase in [K+]o (Fig. 1, B and D). Reversal potentials measured in Na+-based bath solutions with low [K+]o (0, 0.5, 1, and 2 mM), however, were far more depolarized than those predicted from the Goldman-Hodgkin-Katz (GHK) equation, whereas at 3 mM [K+]o, the reversal potential was close to the predicted value (Fig. 1, B to E). In contrast, reversal potentials measured in channel-impermeable N-methyl-Dglucamine (NMDG+)–based bath solutions with the same low [K+]o are consistent with the predicted values (Fig. 1, C to E). Thus, these results suggest that the permeability of the channels to Na+ is increased relative to the K+ permeability in subphysiological [K+]o. Indeed, at subphysiological [K+]o, the relative Na+ to K+ permeability of the channels increased with decreasing [K+]o (Fig. 1F), a finding consistent with the clinical observation that the degree of hypokalemia correlates with the severity of cardiac symptoms (15). Using this curve, we were able to predict the relative permeability of Na+ to K+ of TWIK-1 channels at any pathologically hypokalemic condition.

Unlike most mammalian K2P channels, which show outward rectification, TWIK-1 channels have a nearly linear current-voltage relationship in physiological K+ gradients (Fig. 1) (44). This allows TWIK-1 channels to conduct large inward Na+ currents with even the small increase in relative perFig. 1. TWIK-1 K+ channels undergo a change in ion selectivity and conduct inward leak Na+ currents in sub- meability of Na+ to K+ in subphysiological physiological [K+]o. (A) Topology of a TWIK-1•K274E subunit. (B) Whole-cell TWIK-1•K274E channel cur- [K+]o. At 2 mM [K+]o, subtracting the rents are shown from four different transfected CHO cells in Na+-based bath solutions with the indicated whole-cell currents recorded in Na+- and [K+]o. (C) Whole-cell current TWIK-1•K274E channel currents are shown from two different transfected CHO NMDG+-based bath solutions revealed the + + + + cells in Na - or NMDG -based bath solutions with 2 mM [K ]o. Dashed blue line represents net inward Na existence of inward Na+ currents through + currents calculated from comparison of currents in the presence or absence of Na . Quinine blockade TWIK-1•K274E channels (dashed blue confirmed that the currents recorded in Na+-based bath solutions were mediated by TWIK-1 (purple line). line, Fig. 1C). Thus, under hypokalemic (D) Reversal potentials (Erev) of TWIK-1•K274E channels were plotted as a function of [K+]o. Erev values were conditions, TWIK-1 channels conduct inmeasured in Na+-based (open and red filled circles, n = 10 to 53 cells) or NMDG+-based (blue filled circles, n = ward leak Na+ currents at membrane po10 to 13 cells) bath solutions with various [K+]o. The continuous curve is a fit for open circles with the GHK tentials comparable to the cardiac resting equation: Erev = RT/zF *ln[(P[Na+]o + [K+]o)/(P[Na+]i + [K+]i)], yielding a relative Na+ to K+ permeability (P) of membrane potential.

0.006. (E) Whole-cell currents are shown for TWIK-1•K274E channels before (black lines) and after (red lines) Inward Na+ currents through TWIK-1 + + + + removal of 5 mM [K ]o in Na -based bath solutions. (F) The relative Na to K permeability (PNa/PK) values channels can be measured directly in 0 mM were plotted as a function of [K+]o. PNa /PK values were calculated with the GHK equation using Erev values [K+]o. Replacing 5 mM [K+]o with 0 mM measured in (B) to (E). The superimposed single-exponential fit yielded a slope factor of [K+]o dependence at [K+]o shifted the reversal potential of TWIK0.78 mM per e-fold increase in PNa/PK. The [K+]o range consistent with hypokalemia is marked with an orange 1•K274E channels from −72.2 ± 0.7 to box. Whole-cell currents in 0 mM [K+]o represent those at equilibrium in all figures. −17.3 ± 0.8 mV (Fig. 1E, n = 12 cells). In

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

2

Downloaded from stke.sciencemag.org on August 3, 2011

pore regions (P loop) (Fig. 1A). They mediate simple electrochemical diffusion of K+ through the pore (35, 36) and contribute to maintenance of the cardiac resting membrane potentials (25, 37, 38). The KCNK1 (potassium channel, subfamily K, member 1) mRNA encoding TWIK-1 (also known as K2P1) has been detected in the human heart (39–41) but not in rat and mouse hearts (42, 43), in which paradoxical depolarization in response to low [K+]o does not occur, suggesting that TWIK-1 may account for the difference in response to low [K+]o between human and rat cardiomyocytes. Moreover, the KCNK1 mRNA is the most abundant of those encoding any of the cardiac K+ channels in the human atrium, the second most abundant in human cardiac Purkinje fibers, and is moderately abundant in the human ventricle (40, 41), consistent with the frequent observation of paradoxical depolarization in human cardiac Purkinje fibers and human cardiomyocytes (26–28). Consistent with the presence of its mRNA, TWIK-1 is also found in the human atrium and ventricle (40). This suggests that exploration of the functional properties of TWIK-1 channels in low [K+]o could provide insight into the mechanisms underlying paradoxical depolarization. Here, we report that in subphysiological [K+]o that occurs under hypokalemia, the ion selectivity of TWIK-1 K+ channels changes, so that they become permeable to Na+ and conduct inward leak Na+ currents that may trigger or contribute to cardiac paradoxical depolarization.

RESEARCH ARTICLE A specific threonine within the selectivity filter determines the dynamic change in ion selectivity of TWIK-1 K+ channels in subphysiological [K+]o

We investigated the molecular mechanism that gives rise to the altered ion selectivity of TWIK-1 channels at subphysiological [K+]o. The K+ channel signature sequence Thr-X-Gly-Tyr (or Phe or Leu)-Gly [TxGY(F/L)G, in which X stands for any amino acid], which constitutes the K+ selectivity filter, is conserved in the P loop of K+ channels (6–8, 46). Mutations in any position of this selectivity sequence could result in marked changes in ion selectivity (6). Crystal structures indicate that the K+ channel selectivity sequence consists of four ion binding sites (S1 to S4) in the selectivity filter of tetrameric K+ channels (7) (Fig. 2D). Alignment of the amino acid sequences of two asymmetric P loops of 10 human K2P channels identified a specific threonine (Thr118) within the TxGYG motif of the P1 loop of TWIK-1 K+ channels, rather than a conserved isoleucine found in the other nine K2P channels (Figs. 1A and 2A). A recent crystallographic study indicated that a corresponding threonine in the selectivity filter acts as a Na+binding site in NaK channels, which are nonselective cation channels (47).

To determine whether the Thr118 residue plays a key role in the altered ion selectivity of TWIK-1 channels, we substituted it with isoleucine to produce TWIK-1•K274E•T118I mutant channels.

These TWIK-1•K274E•T118I channels were K+-selective and did not change ion selectivity in lowered [K+]o (Fig. 2, B and C).

We introduced a threonine into the corresponding residue of TASK-3 (K2P9) channels and produced TASK-3•I94T mutant channels to determine whether TASK-3•I94T mutant channels show altered ion selectivity in lowered [K+]o. We examined the effects of removing 5 mM [K+]o on the reversal potential and ion selectivity of TASK-3•I94T mutant channels. Compared to the slow kinetics observed in TWIK-1•K274E K+ channels, the effects of removing 5 mM [K+]o in Na+based bath solutions on whole-cell currents mediated by TASK-3•I94T channels were rapid, taking only ~2 min to reach equilibrium. Because TASK-3 channels show outward rectification and conduct small inward K+ currents under physiological K+ gradients, it was not always easy to precisely measure the reversal potentials of TASK-3 and TASK-3•I94T channels in 5 and 0 mM [K+]o.

However, the trend of reversal potential movement in TASK-3•I94T channels was difFig. 2. The Thr118 residue in the TWIK-1 channel P1 loop determines the altered ion selectivity in ferent from that in TASK-3 channels. After lowered [K+]o. (A) Alignment of the amino acid sequences of the P1 and P2 loops of 10 human K2P removal of 5 mM [K+]o, the reversal potential + 118 channels. The K channel signature sequence TxGY(F/L)G is marked in red and TWIK-1 Thr in blue. of TASK-3•I94T channels shifted from (B) Whole-cell currents are shown for TWIK-1•K274E•T118I before (black line) and after (red line) re- −75.2 ± 0.6 to −56.1 ± 1.6 mV (n = 11 cells) moval of 5 mM [K+]o in Na+-based bath solutions; no inward Na+ current was detected in 0 mM [K+]o (n = (Fig. 3, B and C), and the relative permeabil20 cells). (C) Reversal potentials (Erev) of TWIK-1•K274E•T118I channels are plotted as a function of [K+]o. ity of Na+ to K+ increased from 0.005 to + + Erev values were measured in Na -based bath solutions with various [K ]o (n = 5 to 18 cells). The contin0.11 ± 0.01. Whole-cell currents at +60 mV uous curve is a fit with the GHK equation, yielding a PNa/PK value of 0.002 and a shift of reversal potential of TASK-3•I94T channels were reduced by 54.7 ± 1.3 mV per 10-fold change of [K+]o. Erev values measured at subphysiological [K+]o match the to ~15%, compared to ~87% for TASK-3 predicted values. (D) Conductive conformation of the selectivity filter in bacterial tetrameric KcsA K+ chan- channels (Fig. 3, A to C). The large reducnels is shown when the Val76 residue, corresponding to TWIK-1 Thr118, is replaced by a threonine (gray tion of outward K+ currents in TASK-3•I94T sticks) (7). Four purple balls represent bound ions in ion binding sites S1 to S4. Abbreviations for the amino channels was consistent with increased Na+ acid residues are as follows: A, Ala; C, Cys; D, Asp; F, Phe; G, Gly; H, His; I, Ile; L, Leu; M, Met; N, Asn; P, permeability and a decrease in the cation Pro; S, Ser; T, Thr; V, Val; and Y, Tyr. electrochemical driving force across the

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

3

Downloaded from stke.sciencemag.org on August 3, 2011

0 mM [K+]o, Na+ was the only extracellular monovalent cation; thus, under these conditions, the channels carried inward Na+ currents and outward K+ currents, and replacement of 140 mM extracellular Na+ with equimolar NMDG+ abolished the inward Na+ current (blue line, Fig. 1E, n = 6 cells). Whole-cell TWIK-1•K274E currents in 0 mM [K+]o at −140 and +80 mV were increased by 6.7 ± 0.5– and 3.1 ± 0.3–fold, respectively, relative to their amplitude in 5 mM [K+]o (Fig. 1E and table S1), indicating that the single-channel properties were altered. Quinine, a K+ channel blocker to which TWIK-1 is sensitive (45), reversibly inhibited these whole-cell currents (figs. S1E and S2A, n = 6 to 12). In contrast, these results were not observed with five other K2P channels (K2P2, K2P3, K2P9, K2P13, and K2P18; fig. S2).

Although whole-cell currents recorded from TWIK-1 WT channels in 5 mM [K+]o were small (table S1), all of the results obtained with TWIK-1•K274E mutant channels were confirmed in TWIK-1 WT channels (fig. S1). These findings support our hypothesis that TWIK-1 K+ channels become permeable to Na+ in subphysiological [K+]o and conduct inward leak Na+ currents, which have a depolarizing effect on the resting membrane potential, and that ~3 mM [K+]o is necessary to maintain the K+ selectivity of TWIK-1 channels.

RESEARCH ARTICLE cell membrane. It is also possible that lowering [K+]o regulates the unitary current or open probability of TASK-3•I94T channels. In addition, reversal potentials measured in Na+-based bath solutions with 0.5, 1, or 2 mM [K+]o were more depolarized than predicted (Fig. 3D), indicating that the relative permeability of Na+ to K+ was increased in these low [K+]o. Therefore, TASK-3•I94T mutant channels were K+-selective in physiological [K+]o, but became permeable to Na+ as well when [K+]o was <3 mM. The introduction of a threonine into the corresponding residue of THIK-1 (K2P13) channels, however, produced THIK-1•I112T mutant channels that were still highly K+-selective in 0 mM [K+]o (fig. S3), suggesting that this specific threonine residue is necessary but not always sufficient to produce the altered ion selectivity in K2P channels. These results indicate that the Thr118 residue is a major molecular determinant of the altered ion selectivity in TWIK-1 K+ channels in subphysiological [K+]o.

Because TWIK-1 channels are not found in mouse heart (43), we investigated the possibility that ectopic expression of TWIK-1 channels could cause paradoxical depolarization of mouse cardiac cells in subphysiological [K+]o. We used cultured mouse HL-1 cells, a transformed cell line of mouse atrial cardiomyocytes that resemble mouse primary atrial cardiomyocytes in genotype and phenotype (48, 49), for this analysis; coexpressed green fluorescent protein (GFP) was used to identify transfected HL-1 cells. As expected, decreasing [K+]o from 4 to 1 mM caused the membrane potential of mouse HL-1 cells to hyperpolarize, going from −77.7 ± 0.4 mV in 4 mM [K+]o (n = 33 cells) to −102.4 ± 0.6 mV in 1 mM [K+]o (n = 28 cells). However, mouse HL-1 cells in which TWIK-1 or TWIK1•K274E channels were ectopically expressed underwent a paradoxical depolarization to −62.9 ± 0.9 mV (n = 20 cells) or −63.2 ± 1.0 mV (n = 28 cells), respectively, in 1 mM [K+]o (Fig. 4A). In contrast, the same decrease in [K+]o elicited hyperpolarization in mouse HL-1 cells ectopically expressing either GFP alone (−100.5 ± 1.0 mV, n = 13 cells) or TWIK1•K274E•T118I K+ channels (−100.1 ± 0.7 mV, n = 24 cells), which do not show altered ion selectivity and do not conduct inward leak Na+ currents in subphysiological [K+]o (Fig. 2, B and C).

TWIK-1 K+ channels are highly abundant in the human heart; therefore, we determined whether their knockdown could eliminate paradoxical depolarization in human cardiac cells. Human primary cardiac myocytes, which are spherical and lack organized sarcomeres, can be isolated from adult ventricular tissues and proliferate in vitro. Although these cells do not show spontaneous contractile activity in vitro, they retain many of the characteristics of normal cardiomyocytes (50) and can thus be used for in vitro physiological and pharmacological studies. We found that cultured human spherical cardiac myocytes had a resting membrane potential of −78.0 ± 1.0 mV (n = 22 cells) in 4 mM [K+]o, similar to that of human rod-shaped ventricular cardiomyocytes (26). In 1 mM [K+]o, 45.3% of the cultured human spherical cardiac myocytes depolarized to a resting membrane potential of −44.4 ± 1.0 mV (n = 34), whereas 54.7% of them hyperpolarized to −93.8 ± 0.8 mV (n = 41) (open bars, Fig. 4D). This is consistent with previous observations that only a fraction of human rod-shaped ventricular cardiomyocytes shows paradoxical depolarization in lowered [K+]o (26, 27).

To determine the effects of TWIK-1 knockdown on cardiac paradoxical depolarization in low [K+]o, we screened a set of four human TWIK-1– specific small hairpin RNA (shRNA) plasmids. We coexpressed TWIK-1 with an N-terminal GFP Tag (GFP–TWIK-1) (44) and each TWIK-1 shRNA in CHO cells and then evaluated the effects of each shRNA by examining the intensity of green fluorescence in transfected CHO cells. TWIK-1 shRNA #1 and #3 were most effective and were chosen to knock down native TWIK-1 in human primary cardiac myocytes. Retroviral delivery of TWIK-1 shRNA #1 and #3 yielded ~70.3% and ~63.6% knockdown of TWIK-1 in human spherical cardiac myocytes (Fig. 4, B and C), respectively, validating the screened results in CHO cells transfected with GFP–TWIK-1.

When transduced into human spherical cardiac myocytes, neither of TWIK-1 shRNA #1 and #3 nor scrambled shRNA had any significant effect on resting membrane potential in 4 mM [K+]o (−78.2 ± 1.1 mV, n = 21 cells, 79.9 ± 1.3 mV, n = 9 cells, and −77.9 ± 1.4 mV, n = 20 cells, respectively). However, only 14.7% of human spherical cardiac myocytes transduced with TWIK-1 shRNA #1 showed paradoxical depolarization [to −48.2 ± 1.6 mV (n = 10)] in 1 mM [K+]o, whereas 85.3% of them hyperpolarized [to −92.3 ± 0.6 mV (n = 58)] (orange bars, Fig. 4D). In contrast, expression of scrambled noneffective shRNA did not significantly change the percentage of cells showing paradoxical depolarization (45.8%, n = 38; black bars, Fig. 4D). To rule out off-target effects of TWIK-1 shRNA #1, we repeated the knockdown experiments with

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

4

Downloaded from stke.sciencemag.org on August 3, 2011

Fig. 3. TASK-3•I94T mutant channels show altered ion selectivity in subphysiological [K+]o. (A and B) Whole-cell currents of human TASK-3 or TASK-3•I94T channels are shown before and after changes from 5 mM [K+]o (black lines) to 0 mM [K+]o (red lines) in Na+-based bath solutions.

Whole-cell currents in 0 mM [K+]o were obtained at equilibrium. Dashed red line in (B) represents a whole-cell current when the bath solution was changed back to 5 mM [K+]o for 2 min. Insets: Current traces are shown in shorter voltage ranges (−140 to −20 mV) and narrower current amplitudes (−200 to +400 pA) so that reversal potentials are clearly visible.

(C) Summary of reversal potentials (Erev, filled black and red bars) and current amplitudes at +60 mV (striped black and red bars) of TASK-3 and TASK-3•I94T channels in (A) and (B) (black bars for 5 mM [K+]o; red bars for 0 mM [K+]o; n = 11 cells). Current amplitudes at +60 mV were normalized by the values measured in 5 mM [K+]o. (D) Reversal potentials (Erev) of TASK-3 and TASK-3•I94T channels were plotted as a function of [K+]o. Erev values measured in Na+-based bath solutions for TASK-3 (open squares, n = 5 to 29 cells) and TASK-3•I94T (filled black and red circles, n = 11 to 18 cells) channels. Fits for open squares and filled black circles with the GHK equation provided the relative permeability of Na+ to K+ of 0.005 and 0.006 for TASK-3 and TASK-3•I94T channels, respectively. *P < 0.001 for data in 5 mM [K+]o versus data in 0 mM [K+]o.

TWIK-1 K+ channels contribute to cardiac resting membrane potentials in low [K+]o

RESEARCH ARTICLE

TWIK-1 shRNA #3 in human spherical cardiac myocytes. In 1 mM [K+]o, 23.6% of cells transduced with TWIK-1 shRNA #3 depolarized [to −46.5 ± 1.4 mV (n = 13)], whereas 76.4% of them hyperpolarized [to −91.9 ± 0.8 mV (n = 42)] (blue bars, Fig. 4D). Thus, knockdown of TWIK-1 significantly reduced the percentage of cells in which paradoxical depolarization occurred in 1 mM [K+]o in human spherical cardiac myocytes. These results indicate that TWIK-1 K+ channels play a more critical role in regulating cardiac resting membrane potentials in subphysiological [K+]o than in normal [K+]o, consistent with the observation that TWIK-1 K+ channels conduct only small ion currents in normal [K+]o (44, 51). These findings thus support the hypothesis that TWIK-1 K+ channels can trigger or contribute to cardiac paradoxical depolarization in subphysiological [K+]o.

Our analyses of TWIK-1 knockdown (Fig. 4) suggested that human spherical cardiac myocytes have abundant TWIK-1 K+ channels, suggesting that it might be possible to record TWIK-1–like currents from these cells. Isolation of whole-cell K+ currents through native TWIK-1 channels is difficult because of the lack of TWIK-1–specific blockers. However, the observation that TWIK-1 channels heterologously expressed in CHO cells conducted inward Na+ currents in Na+-based bath solution with 0 mM [K+]o (Fig. 1E and fig. S1, D and E) provided a strategy to identify TWIK-1– mediated Na+ currents in human primary cardiomyocytes with the K+ channel blocker quinine (which does not block Na+ channels). We recorded whole-cell quinine-sensitive inward leak Na+ currents in human spherical cardiac myocytes that underwent paradoxical depolarization (Fig. 5A); at −80 mV, the leak Na+ current amplitude was −850 ± 197 pA (n = 7 cells). In contrast, these currents were not observed in human spherical cardiac myocytes that showed hyperpolarization in lowered [K+]o (Fig. 5B).

These quinine-sensitive inward leak Na+ currents are likely mediated by native TWIK-1 K+ channels.

Kinetics of ion selectivity changes reveal a conformational change in TWIK-1 K+ channels We studied the kinetics of the conformational change between the K+selective and the Na+-permeable states of TWIK-1 channels by monitor-

human spherical cardiac myocytes. The TWIK-1 shRNAs #1 and #3 show 70.3 ± 5.1% (n = 5 experiments) and 63.6 ± 3.2% (n = 4 experiments) knockdown efficiency, respectively, whereas scrambled shRNA had no significant effect on TWIK-1 abundance. TWIK-1 signals were first standardized to the GAPDH signal in the parallel protein sample and then normalized to the similarly standardized value from nontransduced human spherical cardiac myocytes. *P < 0.001 relative to scrambled shRNA. (D) Percentage of cells with which paradoxical depolarization or hyperpolarization occurs in 1 mM [K+]o in these three groups of human spherical cardiac myocytes. *P < 0.001 relative to scrambled shRNA, n = 75 to 83 cells in eight experiments for each group.

Fig. 5. TWIK-1–like currents are identified by quinine-sensitive inward leak Na+ currents in human spherical cardiac myocytes in 0 mM [K+]o.

(A and B) Whole-cell currents are shown in Na+-based bath solutions with 0 mM [K+]o before (red lines) or after (purple lines) quinine block in human spherical cardiac myocytes that show paradoxical depolarization (A) or hyperpolarization (B) in lowered [K+]o, respectively. Dashed purple lines are quinine-sensitive currents. n = 4 to 7 cells.

ing the change in reversal potential while switching between 5 and 0 mM [K+]o in Na+-based bath solutions. Removing 5 mM [K+]o induced a twophase effect on TWIK-1•K274E channels. Within the first 60 s of changing the bath solution, the reversal potential followed the Nernst equation for K+ and shifted in the hyperpolarizing direction, indicating that the TWIK-1•K274E channels maintained their K+ selectivity. When the reversal potential reached −122.6 ± 1.8 mV (n = 12 cells), at about 60 s, however, it began to shift in the depolarizing direction until it reached an equilibrium at −17.3 mV (Fig. 6A), indicating that the channels altered their Na+ to K+ relative permeability during this period. The time constant of the change in the relative permeability of Na+ to K+ during the second phase was ~373 s (Fig. 6B), reflecting the process whereby the selectivity filter changes from a K+-selective to a Na+-permeable conformation.

We attempted to restore the K+ selectivity of TWIK-1•K274E channels by switching back to 5 mM [K+]o from 0 mM [K+]o. After 10 min, the

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

5

Downloaded from stke.sciencemag.org on August 3, 2011

Fig. 4. TWIK-1 K+ channels contribute to the resting membrane potential in lowered [K+]o. (A) Membrane potentials of mouse cardiomyocyte–derived HL-1 cells without (nontransfected cells, open diamonds; transfected cells with GFP alone, open squares) or with ectopic expression of TWIK-1 (black circles), TWIK-1•K274E (red circles, positive control), or TWIK-1•K274E•T118I (pink squares, negative control) channels were measured in Na+-based bath solutions with the indicated [K+]o (n = 12 to 33 cells for each experimental group). *P < 0.001 relative to other three negative controls. (B) TWIK-1–specific shRNA was validated in human spherical cardiac myocytes with retroviral delivery and Western blot analysis. Lanes 1 to 3 represent 15 mg of total protein from three groups of human spherical cardiac myocytes (lane 1, nontransduced cells; lane 2, cells transduced with scrambled shRNA; lane 3, cells transduced with TWIK-1 shRNA #1). Lane 4 is empty. Lane 5 represents total protein from CHO cells transfected with TWIK-1•K274E channels and functions as a protein marker. TWIK-1 and GAPDH signals were detected in parallel protein samples. GAPDH functions as a loading control. (C) Effects of scrambled shRNA (black bar) or the TWIK-1 shRNAs #1 (orange bar) or #3 (blue bar) on TWIK-1 abundance in

RESEARCH ARTICLE

(black line) to a 0 mM [K +]o NMDG+ -based bath solution (blue line) and then back to 5 mM [K+]o in a Na+-based bath solution for 5 min (pink line). Quinine blockade in Na+-based bath solutions with 5 mM [K+]o confirmed that currents in (C) and (E) (purple lines) were mediated by TWIK-1.

reversal potential had shifted to only −20.8 ± 0.8 mV from −17.3 ± 1.1 mV (Fig. 6C, n = 4 cells), indicating that recovery of K+ selectivity is extremely slow. To determine whether removing bound Na+ ions in the selectivity filter could speed the recovery of K+ selectivity, we first switched the bath solution to 140 mM [K+]o from 0 mM [K+]o while recording both inward and outward whole-cell K+ currents for 10 min. When we then switched bath solutions back to 5 mM [K+]o, it still took 40.3 ± 4.1 min (n = 3 cells) to restore the K+ selectivity (Fig. 6D). In addition, removing 5 mM [K+]o with NMDG+-based bath solutions that did not contain Na+ ions also affected the selectivity filter, because the reversal potential went to −26.3 ± 1.5 mV (n = 6 cells) within 2 min after restoration of 5 mM [K+]o in Na+-based bath solutions (Fig. 6E). Moreover, complete recovery of K+ selectivity then took 76.7 ± 4.7 min (n = 3 cells), which is consistent with the above results that removal of bound Na+ ions in the selectivity filter accelerates the recovery of the K+ selectivity. The slow recovery of K+ selectivity in TWIK-1 channels suggests that they may be temporarily locked in a nonselective conformation.

Ion selectivity of K+-selective and Na+-permeable TWIK-1 channels We next compared the ion selectivity of K+-selective and Na+-permeable TWIK-1•K274E channels. In <3 mM [K+]o, the Na+ permeability of the channels increased with decreasing [K+]o (Fig. 1F). We examined the relative permeability of the channels for monovalent cations in the absence of extracellular K+, the ionic condition in which the channels show the highest Na+ permeability, with a Na+ to K+ relative permeability of ~0.52.

The channels exhibited different monovalent cation selectivity in 0 mM [K+]o compared to that seen in 5 mM [K+]o (Fig. 7). The channels showed a permeability series of K+ > Rb+ > Na+ >> Li+ > NH4+ >> Cs+ in 0 mM [K+]o compared to a sequence of K+ > Rb+ >> NH4+ >> Cs+ ≈ Na+ ≈ Li+ in 5 mM [K+]o. Thus, they become significantly perme-

Fig. 7. Ion selectivity of TWIK-1•K274E channels for monovalent cations in 5 or 0 mM [K+]o. (A to D) Whole-cell currents are shown before (black lines) or after (red lines) removing 5 mM [K+]o in bath solutions on the basis of the indicated monovalent cations. Quinine blockade (purple lines) confirmed that currents were mediated by TWIK-1 (n = 5 to 10 cells). Wholecell currents are shown across a narrower voltage range in (C) and (D).

able to Na+ and Li+, but maintain a similarly high permeability to Rb+ and NH4+, and still show K+ selectivity over Cs+ (Fig. 7). The measured reversal potentials and calculated relative permeability in these two conditions

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

6

Downloaded from stke.sciencemag.org on August 3, 2011

Fig. 6. Kinetics of the change between the K+-selective and the Na+-permeable states of TWIK-1 channels. (A) Two phases of the effects of changing bath solutions from 5 to 0 mM [K+]o on whole-cell currents of TWIK-1•K274E channels. The left panel shows current traces obtained at 0, 30, and 60 s. Current traces obtained at 60-s intervals are shown in the right panel.

Shifts in reversal potential are indicated with “DErev” and arrows. (B) Kinetics of changes of the relative Na+ to K+ permeability (PNa/PK) in (A). The continuous curve is fit with a single-exponential function, yielding a time constant of 373.3 ± 43.5 s (n = 12 cells). (C) Whole-cell currents of TWIK-1•K274E channels are shown when a Na+-based bath solution was changed from 5 mM (black line) to 0 mM [K+]o (red line), and then back to 5 mM [K+]o for 10 min (pink line). (D) Whole-cell currents of TWIK-1•K274E channels are shown when a Na+-based bath solution with 5 mM [K+]o (black line) was successively replaced by a Na+-based bath solution with 0 mM [K+]o (red line), 140 mM [K+]o (orange line), or 5 mM [K+]o (pink line). (E) Whole-cell currents of TWIK-1•K274E channels are shown when a Na+-based bath solution was reversibly changed from 5 mM

RESEARCH ARTICLE are summarized in Table 1. Surprisingly, the channels conduct large inward Cs+ currents in 0 mM [K+]o, although the relative Cs+ to K+ permeability is only ~0.03. Systematic analysis of the Li+ permeability in TWIK-1 channels indicated that these channels also show altered ion selectivity to Li+ in lowered [K+]o and that decreasing [K+]o increases the relative Li+ to K+ permeability of the channels in a [K+]o-dependent manner (Fig. 8). Thus, TWIK-1 K+ channels undergo marked changes in ion selectivity in subphysiological [K+]o.

DISCUSSION

Physiological implications of hypokalemia-induced functional changes in TWIK-1 K+ channels

Table 1. Reversal potentials and monovalent cation selectivity of TWIK-1•K274E channels. PX/PK represents the relative permeability of a monovalent cation to K+. X represents the monovalent cations Rb, NH4, Cs, Li, and Na. The PX/PK values were calculated with the GHK equation as described in Fig. 1. N represents the number of measured cells.

Cation Rb NH4 Cs Li Na Rb NH4 Cs Li Na

Erev (mV)

PX/PK

5 mM extracellular K + −14.8 ± 0.6 0.56 −55.8 ± 0.9 0.08 −73.0 ± 0.7 0.005 −74.5 ± 0.6 0.003 −73.3 ± 0.4 0.005 0 mM extracellular K + −13.6 ± 0.6 0.57 −56.3 ± 1.0 0.10 * 0.03 −81.8 ± 1.5 −44.8 ± 1.1* 0.14 −17.5 ± 0.5* 0.52

N

± ± ± ± ±

0.005 0.003 0.001 0.001 0.001

14 19 6 12 53

± ± ± ± ±

0.004 0.005 0.005* 0.006* 0.002*

17 14 10 10 27

*P < 0.001 for data in 5 mM [K+]o versus data in 0 mM [K+]o.

Fig. 8. TWIK-1 K+ channels become permeable to Li+ in subphysiological [K+]o. (A and B) Whole-cell TWIK-1•K274E channel currents are shown from six different transfected CHO cells in Li+-based (black and red lines) or NMDG+-based (blue line) bath solutions with indicated [K+]o.

Quinine blockade confirmed that currents in Li+-based bath solutions were mediated by TWIK-1. (C) Reversal potentials (Erev) of TWIK-1•K274E channels were plotted as a function of [K+]o. Erev values were measured in Li+-based (open or red-filled squares, n = 6 to 12 cells) or NMDG+based (blue circles, n = 10 to 13 cells) bath solutions with various [K+]o.

The black continuous line is a fit for open squares with the GHK equation, yielding a Li+ to K+ relative permeability of 0.003. Reversal potentials measured in Li+-based bath solutions with <2 mM [K+]o were much more depolarized than predicted, suggesting that the relative permeability of Li+ to K+ is increased. (D) The relative permeability of Li+ to K+ (PLi /PK) was plotted as a function of [K+]o. The superimposed single-exponential fit yielded a slope factor of [K+]o dependence of 1.25 mM per e-fold increase in PLi /PK.

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

7

Downloaded from stke.sciencemag.org on August 3, 2011

Although TWIK-1–like K+ channels have not yet been identified in native cardiac cells, our data suggest that TWIK-1 K+ channels may play a physiological role in the heart. In heterologous expression systems, TWIK-1 K+ channels have a low open probability in physiological K+ gradients (44).

However, we found that decreasing [K+]o to <3 mM led to marked changes in the ion selectivity of TWIK-1 K+ channels and in inward and outward currents through TWIK-1 K+ channels. These functional changes in TWIK-1 K+ channels would be expected to influence the resting membrane potential or the action potential or both of cardiac cells in hypokalemic conditions. Thus, TWIK-1 channels provide a previously unappreciated mechanism to regulate cardiac excitability in subphysiological [K+]o.

Cardiac paradoxical depolarization in lowered [K+]o has been described for more than 3 decades (26–28, 30, 31), but its molecular mechanism is still not well understood. The resting membrane potential is determined by a balance of inward and outward ion currents. The background K+ conductances in the heart are counterbalanced by opposing cationic or chloride leak conductances and function mainly to maintain cardiac resting membrane potential (25). Previous studies have suggested that an inward leak Na+ current is responsible for hypokalemia-induced cardiac paradoxical depolarization (30, 31). Kir2 channels, which show a nonlinear conductance at around the normal resting membrane potential, may contribute to paradoxical depolarization in low [K+]o (33, 34). How-

ever, Kir2 channels, which do not mediate leak Na+ currents, are unlikely to trigger cardiac paradoxical depolarization. Voltage-gated Na+ channels, which are either closed or inactivated at membrane potentials between −90 and −40 mV, cannot conduct such depolarizing background Na+ currents.

We found that TWIK-1 K+ channels conduct inward leak Na+ currents in lowered [K+]o in transfected CHO cells (Fig. 1 and fig. S1) and recorded TWIK-1–like inward leak Na+ currents in human spherical cardiac myocytes in subphysiological [K+]o (Fig. 5A). If native TWIK-1 channels behave similarly in the heart, such an inward leak Na+ current could trigger paradoxical depolarization, if cardiac Na+,K+-ATPases (Na+- and K+dependent adenosine triphosphatases) and other transporters and channels failed to adequately compensate for it.

The slow recovery of K+ selectivity after restoration of physiological + [K ]o can theoretically provide a biophysical basis to explain the hysteresis of restoring hyperpolarization from paradoxical depolarization, because TWIK-1 K+ channels continue to conduct inward leak Na+ currents before complete recovery of K+ selectivity. Although background K+ channels generally contribute only to maintenance of the resting membrane potential and its restoration after depolarization (2), we found that ectopically expressed TWIK-1 K+ channels conferred the ability to undergo paradoxical depolarization in mouse cardiomyocyte–derived HL-1 cells in lowered

RESEARCH ARTICLE [K+]o. TWIK-1 knockdown decreased the percentage of cells in which paradoxical depolarization occurred in human spherical cardiac myocytes in subphysiological [K+]o. Thus, in aggregate, our findings support the hypothesis that TWIK-1 channels trigger or contribute to hypokalemiainduced paradoxical depolarization in the heart.

The Kir2 channel has been hypothesized to contribute to the low [K+]oinduced paradoxical depolarization because it shows a nonlinear decrease in conductance at potentials depolarized from the K+ equilibrium potential.

Decreases in [K+]o cause a progressive decline in the Kir2 conductance, so the decreased Kir2.1 conductance is insufficient to compensate for the influence of a depolarizing inward current (34). Our findings do not conflict with this previous hypothesis. Instead, our findings supplement it by describing a molecular mechanism for inward leak Na+ currents and providing a biophysical basis for the hysteresis of restoring hyperpolarization after paradoxical depolarization.

Regulation of ion selectivity of TWIK-1 K+ channels

MATERIALS AND METHODS

Molecular biology Mouse THIK-1 in pCMV-SPORT6 and mouse TRESK-2 in pCR-BluntIITOPO plasmids were purchased from Open Biosystems. Mouse TRESK-2 complementary DNA was subcloned into pMAX, a dual-purpose vector for Xenopus oocyte or mammalian cell expression (44). All K2P mutations were created by Pfu-based mutagenesis kits (Stratagene) and confirmed by automated DNA sequencing.

Cell culture, transfection, and retroviral delivery CHO cells were maintained in DMEM (Dulbecco’s modified Eagle’s medium) supplemented with 10% fetal calf serum in a 5% CO2 incubator.

CHO cells were seeded in 35-mm dishes 24 hours before transfection.

Cells showing at least 80% confluence were transfected by Lipofectamine 2000 (Invitrogen) with 3 mg of K2P plasmids and 1 mg of pEGFP plasmids and studied 24 hours later. GFP expression was used to identify effectively transfected CHO cells.

Mouse HL-1 cells were cultured in Claycomb Medium supplemented with 10% fetal bovine serum in a 5% CO2 incubator as previously described (48). HL-1 cells at 60 to 80% confluence were transfected with K2P or pEGFP plasmids or both by Lipofectamine 2000 for electrophysiological recordings.

Human spherical primary cardiac myocytes (PromoCell) were maintained in the PromoCell cell growth medium in a 5% CO2 incubator and subcultured at 70 to 90% confluence. Because human spherical primary cardiac myocytes have many of the characteristics of normal cardiomyocytes for at least 15 population doublings, we used these cardiac myocytes between 2 and 13 doublings for electrophysiological and biochemical experiments.

A set of five shRNA plasmids were purchased from Origene. The oligos encoding human TWIK-1–specific shRNA (TWIK-1 shRNA #1 sequence, GCACATCATAGAGCATGACCAACTGTCCT; TWIK-1 shRNA #3 sequence, GCCGCTGTCTTCTCAGTCCTGGAGGATGA) or scrambled noneffective shRNA (GCACTACCAGAGCTAACTCAGATAGTACT) were cloned into retroviral pRFP-C-RS vectors in which red fluorescence protein (RFP) functions as an expression reporter. We screened these TWIK-1 shRNA plasmids with fluorescence microscopy; we coexpressed each of these plasmids with GFP–TWIK-1 plasmids in CHO cells, which were cultured in 35-mm dishes, and examined the intensity of green fluorescence in transfected CHO cells under a confocal microscope (LSM 510, Carl Zeiss) after 60 hours.

The effective TWIK-1 shRNA #1 or #3 was used to knock down native TWIK-1 in human spherical primary cardiac myocytes. Packaging cells (RetroPack PT67 cell line, Clontech) were transfected with TWIK-1 shRNA #1 or #3 plasmids by Lipofectamine 2000. After 48 hours, virus was collected, filtered, and overlaid on human spherical cardiac myocytes, which were electrophysiologically recorded or prepared for Western blotting analysis 3 days later.

Western blot analysis Human spherical cardiac myocytes or transfected CHO cells were harvested by aspirating the medium and washing twice with phosphate-buffered saline (PBS). Cells were then suspended in 1 ml of PBS and centrifuged.

Isolated cell pellets were lysed for 20 min at 4°C in buffer containing 50 mM tris-HCl, 150 mM NaCl, 0.1% SDS, 1% Triton X-100, 1% sodium deoxycholate, 1 mM EGTA, and protease inhibitors. Extracts were centrifuged at 13,000g for 20 min at 4°C. Protein was quantified with the BCA

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

8

Downloaded from stke.sciencemag.org on August 3, 2011

Although previous studies have shown that the selectivity filter in several voltage-gated K+ channels can change its conformation and selectivity in the absence of intracellular K+ (11–14), we provide evidence showing that highly selective ion channels can exhibit the altered ion selectivity in response to physiological or pathopathological stimuli.

We found that the ion selectivity of TWIK-1 K+ channels changes when [K+]o decreases from physiological to pathophysiological levels.

About 3 mM [K+]o is required to stabilize the conformation of the selectivity filter and maintain TWIK-1 channel K+ selectivity. That is, decreasing [K+]o to that found in hypokalemia triggers functional changes in the TWIK-1 selectivity filter. To understand the molecular mechanism underlying the altered ion selectivity of TWIK-1 channels, we need to answer several basic questions. First, how does lowering [K+]o trigger conformational changes in the TWIK-1 selectivity filter? Bound Na+ ions are not necessary for these conformational changes, because they still occur when external K+ is removed in NMDG+-based bath solutions (Fig. 6E).

One possibility is that K+ binding sites or K+ sensors may exist near the outer mouth of the pore of TWIK-1 K+ channels. Lowering physiological [K+]o also decreases outward K+ currents of Kv1.4 and hERG voltage-gated K+ channels (52, 53), suggesting that extracellular K+ ions may regulate their pores as well.

Second, how do Na+ ions pass the TWIK-1 selectivity filter? The selectivity filter of tetrameric KcsA K+ channels has four ion binding sites (Fig. 2D). The KcsA selectivity filter is in a conductive conformation or open state when all ion binding sites are accessible to ions (7). Compared to tetrameric K+ channels, the selectivity filters of K2P channels are not well understood (36, 46). K2P channels are dimers (54, 55), and each subunit contains two asymmetric P loops with the GxGY(F/L)G selectivity sequences. Among the 15 mammalian K2P isoforms, we found that TWIK-1 has a specific threonine residue within the TxGYG motif in the P1 loop that determines the altered ion selectivity. This Thr118 residue, which may be located in the bottom of the selectivity filter, may constitute ion binding site 3 or 4 (Fig. 2D). Thr118 is necessary but not always sufficient to produce the altered ion selectivity in K2P channels, because introduction of a threonine into the corresponding residue of TASK-3 or THIK-1 channels had a much less potent or no effect on ion selectivity in lowered [K+]o (Fig. 3 and fig. S3).

Third, what happens in gating of TWIK-1 channels? Previous reports have indicated that Kv2.1 and Shaker K+ channels become permeable to Na+ during C-type inactivation (12, 56), a gating process that originates from transitions at the selectivity filter and develops with slow kinetics (57). However, both inward and outward whole-cell currents are increased after changes of ion selectivity in TWIK-1 channels (Fig. 1), suggesting

that C-type inactivation does not play a role in the dynamic change of ion selectivity of TWIK-1 channels.

RESEARCH ARTICLE (bicinchoninic acid) protein assay kit (Pierce). Total proteins (15 mg) were separated on 10% acrylamide gel with SDS–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride membranes. Membranes were blocked with 5% (w/v) nonfat milk in 50 mM tris, 500 mM NaCl, and 0.1% (w/v) Tween 20 (pH 7.6) for 1 hour. Membranes were then analyzed with primary antibodies directed against TWIK-1 (1:500) (Alomone) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000) (Santa Cruz Biotechnology). Blots were scanned and analyzed with the image software ChemiDoc XRS (Bio-Rad).

Electrophysiology

SUPPLEMENTARY MATERIALS www.sciencesignaling.org/cgi/content/full/4/176/ra37/DC1 Text Fig. S1. TWIK-1 WT K+ channels show altered ion selectivity and conduct inward leak Na+ currents in subphysiological [K+]o.

Fig. S2. Effects of removing 5 mM [K+]o on TWIK-1 WT K+ channels and five other types of K2P channels.

Fig. S3. Effects of removing 5 mM [K+]o on THIK-1 WT and THIK-1•I112T mutant channels.

Table S1. Reversal potentials and whole-cell currents of TWIK-1 WT and TWIK-1•K274E channels in 5 and 0 mM [K+]o.

References

REFERENCES AND NOTES 1. D. Bautista, D. Julius, Fire in the hole: Pore dilation of the capsaicin receptor TRPV1.

Nat. Neurosci. 11, 528–529 (2008).

2. B. Hille, Ion Channels of Excitable Membranes (Sinauer, Sunderland, MA, 2001), p. 469.

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

9

Downloaded from stke.sciencemag.org on August 3, 2011

Standard whole-cell patch-clamp recordings were performed with the EPC-10 USB amplifier and a Dell 745 computer with PatchMaster software (HEKA Elektronik). Patch pipettes with resistances of 2.0 to 3.5 megohms were used. The resistance was compensated at least 80% to minimize voltage errors. Whole-cell currents of K2P channels heterologously expressed in CHO cells were recorded each 15 s with a standard 2.2-s voltage ramp from −140 to +80 mV from a holding potential equivalent to the reversal potential. Currents were low-pass filtered at 5 kHz and sampled at a rate of 2 kHz. In nontransfected CHO cells or CHO cells transfected with GFP alone, maximum endogenous whole-cell currents induced by voltage ramp pulses were <250 pA, and average currents at +80 and −140 mV were around 40 and −20 pA, respectively (n = 20) (45). Maximum TWIK-1•K274E currents <500 pA were discarded. When measuring reversal potentials, quinine blockade was always used to confirm TWIK-1 currents. For measurement of resting membrane potentials in mouse HL-1 cells or human spherical primary cardiac myocytes, we built a Macro program in PatchMaster software so that the resting membrane potential could be measured with whole-cell current-clamp techniques within 1 to 2 s of establishing the whole-cell configuration. Data analysis was performed with Fitmaster (HEKA Elektronik), IGOR Pro (WaveMetrics), and Excel (Microsoft). All data are presented as means ± SEM. Two-tailed Student’s t tests were used to check for significant differences between two groups of data.

The pipette solution contained 140 mM KCl, 1 mM MgCl2, 10 mM EGTA, 1 mM K2-ATP (adenosine triphosphate), and 5 mM Hepes. The pH was adjusted to 7.4 with KOH. The bath solution contained 135 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 10 mM Hepes (pH 7.4). The total concentration of Na+ and K+ in bath solutions was 140 mM; bath solutions with various [K+]o were obtained by increasing or decreasing K+ and replacing it with equimolar Na+. Monovalent cation (Cs+, Li+, NH4+, and Rb+)– or NMDG+-based bath solutions with various [K+]o were obtained by replacing extracellular Na+ with equimolar monovalent cations or NMDG+.

3. B. S. Khakh, X. R. Bao, C. Labarca, H. A. Lester, Neuronal P2X transmitter-gated cation channels change their ion selectivity in seconds. Nat. Neurosci. 2, 322–330 (1999).

4. M. K. Chung, A. D. Guler, M. J. Caterina, TRPV1 shows dynamic ionic selectivity during agonist stimulation. Nat. Neurosci. 11, 555–564 (2008).

5. C. Virginio, A. MacKenzie, F. A. Rassendren, R. A. North, A. Surprenant, Pore dilation of neuronal P2X receptor channels. Nat. Neurosci. 2, 315–321 (1999).

6. L. Heginbotham, Z. Lu, T. Abramson, R. MacKinnon, Mutations in the K+ channel signature sequence. Biophys. J. 66, 1061–1067 (1994).

7. Y. Zhou, J. H. Morais-Cabral, A. Kaufman, R. MacKinnon, Chemistry of ion coordination and hydration revealed by a K+ channel-Fab complex at 2.0 Å resolution. Nature 414, 43–48 (2001).

8. D. A. Doyle, J. Morais Cabral, R. A. Pfuetzner, A. Kuo, J. M. Gulbis, S. L. Cohen, B. T. Chait, R. MacKinnon, The structure of the potassium channel: Molecular basis of K+ conduction and selectivity. Science 280, 69–77 (1998).

9. D. Thomas, L. D. Plant, C. M. Wilkens, Z. A. McCrossan, S. A. Goldstein, Alternative translation initiation in rat brain yields K2P2.1 potassium channels permeable to sodium.

Neuron 58, 859–870 (2008).

10. D. Bichet, M. Grabe, Y. N. Jan, L. Y. Jan, Electrostatic interactions in the channel cavity as an important determinant of potassium channel selectivity. Proc. Natl. Acad.

Sci. U.S.A. 103, 14355–14360 (2006).

11. S. J. Korn, S. R. Ikeda, Permeation selectivity by competition in a delayed rectifier potassium channel. Science 269, 410–412 (1995).

12. J. G. Starkus, L. Kuschel, M. D. Rayner, S. H. Heinemann, Macroscopic Na+ currents in the “Nonconducting” Shaker potassium channel mutant W434F. J. Gen. Physiol.

112, 85–93 (1998).

13. H. Gang, S. Zhang, Na+ permeation and block of hERG potassium channels. J. Gen. Physiol. 128, 55–71 (2006).

14. Z. Wang, X. Zhang, D. Fedida, Regulation of transient Na+ conductance by intra- and extracellular K+ in the human delayed rectifier K+ channel Kv1.5. J. Physiol. 523, 575–591 (2000).

15. D. Garth, Hypokalemia. eMedicine Emergency Medicine, http://emedicine.medscape. com/article/767448-overview (2010).

16. A. Rastegar, M. Soleimani, Hypokalaemia and hyperkalaemia. Postgrad. Med. J. 77, 759–764 (2001).

17. T. J. Schaefer, R. W. Wolford, Disorders of potassium. Emerg. Med. Clin. North Am. 23, 723–747 (2005).

18. C. J. Cheng, Y. H. Chen, T. Chau, S. H. Lin, A hidden cause of hypokalemic paralysis in a patient with prostate cancer. Support. Care Cancer 12, 810–812 (2004).

19. A. Shimony, S. Bereza, A. Shalev, H. Gilutz, R. Ilia, D. Zahger, Ventricular fibrillation as the presenting manifestation of adrenocortical carcinoma. Am. Heart Hosp. J. 7, 65–66 (2009).

20. F. S. Hsu, W. S. Tsai, T. Chau, H. H. Chen, Y. C. Chen, S. H. Lin, Thyrotropin-secreting pituitary adenoma presenting as hypokalemic periodic paralysis. Am. J. Med. Sci. 325, 48–50 (2003).

21. S. H. Lin, T. Chau, A puzzling cause of hypokalaemia. Lancet 360, 224 (2002).

22. S. H. Lin, J. S. Chiu, C. W. Hsu, T. Chau, A simple and rapid approach to hypokalemic paralysis. Am. J. Emerg. Med. 21, 487–491 (2003).

23. N. Jeck, C. Derst, E. Wischmeyer, H. Ott, S. Weber, C. Rudin, H. W. Seyberth, J. Daut, A. Karschin, M. Konrad, Functional heterogeneity of ROMK mutations linked to hyperprostaglandin E syndrome. Kidney Int. 59, 1803–1811 (2001).

24. M. Mohammadianpanah, S. Omidvari, A. Mosalaei, N. Ahmadloo, Cisplatin-induced hypokalemic paralysis. Clin. Ther. 26, 1320–1323 (2004).

25. A. Gurney, B. Manoury, Two-pore potassium channels in the cardiovascular system.

Eur. Biophys. J. 38, 305–318 (2009).

26. J. R. McCullough, W. T. Chua, H. H. Rasmussen, R. E. Ten Eick, D. H. Singer, Two stable levels of diastolic potential at physiological K+ concentrations in human ventricular myocardial cells. Circ. Res. 66, 191–201 (1990).

27. G. Christé, Effects of low [K+]o on the electrical activity of human cardiac ventricular and Purkinje cells. Cardiovasc. Res. 17, 243–250 (1983).

28. J. R. McCullough, C. M. Baumgarten, D. H. Singer, Intra- and extracellular potassium activities and the potassium equilibrium potential in partially depolarized human atrial cells. J. Mol. Cell. Cardiol. 19, 477–486 (1987).

29. R. Bouchard, R. B. Clark, A. E. Juhasz, W. R. Giles, Changes in extracellular K+ concentration modulate contractility of rat and rabbit cardiac myocytes via the inward rectifier K+ current IK1. J. Physiol. 556, 773–790 (2004).

30. S. S. Sheu, M. Korth, D. A. Lathrop, H. A. Fozzard, Intra- and extracellular K+ and Na+ activities and resting membrane potential in sheep cardiac purkinje strands. Circ. Res. 47, 692–700 (1980).

31. D. C. Gadsby, P. F. Cranefield, Two levels of resting potential in cardiac Purkinje fibers. J. Gen. Physiol. 70, 725–746 (1977).

32. A. Zaza, Serum potassium and arrhythmias. Europace 11, 421–422 (2009).

33. R. J. Geukes Foppen, H. G. van Mil, J. S. van Heukelom, Effects of chloride transport on bistable behaviour of the membrane potential in mouse skeletal muscle. J. Physiol.

542, 181–191 (2002).

RESEARCH ARTICLE 49. S. M. White, P. E. Constantin, W. C. Claycomb, Cardiac physiology at the cellular level: Use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure and function. Am. J. Physiol. Heart Circ. Physiol. 286, H823–H829 (2004).

50. M. Koller, B. O. Palsson, J. R. W. Masters, Eds., Human Cell Culture: Primary Mesenchymal Cells (Kluwer Academic Publishers, New York, 2001), vol. 5, pp. 103–124.

51. S. Feliciangeli, S. Bendahhou, G. Sandoz, P. Gounon, M. Reichold, R. Warth, M. Lazdunski, J. Barhanin, F. Lesage, Does sumoylation control K2P1/TWIK1 background K+ channels? Cell 130, 563–569 (2007).

52. L. A. Pardo, S. H. Heinemann, H. Terlau, U. Ludewig, C. Lorra, O. Pongs, W. Stühmer, Extracellular K+ specifically modulates a rat brain K+ channel. Proc. Natl. Acad. Sci. U.S.A. 89, 2466–2470 (1992).

53. M. C. Sanguinetti, C. Jiang, M. E. Curran, M. T. Keating, A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell 81, 299–307 (1995).

54. F. Lesage, R. Reyes, M. Fink, F. Duprat, E. Guillemare, M. Lazdunski, Dimerization of TWIK-1 K+ channel subunits via a disulfide bridge. EMBO J. 15, 6400–6407 (1996).

55. C. M. Lopes, N. Zilberberg, S. A. Goldstein, Block of Kcnk3 by protons. Evidence that 2-P-domain potassium channel subunits function as homodimers. J. Biol. Chem. 276, 24449–24452 (2001).

56. L. Kiss, J. LoTurco, S. J. Korn, Contribution of the selectivity filter to inactivation in potassium channels. Biophys. J. 76, 253–263 (1999).

57. L. G. Cuello, V. Jogini, D. M. Cortes, A. C. Pan, D. G. Gagnon, O. Dalmas, J. F. Cordero-Morales, S. Chakrapani, B. Roux, E. Perozo, Structural basis for the coupling between activation and inactivation gates in K+ channels. Nature 466, 272–275 (2010).

58. Acknowledgments: We thank L. K. Kaczmarek, S. A. Goldstein, F. Lesage, and D. Thomas for providing K2P plasmids; W. C. Claycomb for providing cultured HL-1 cells; and S. H. Heinemann, J. Schmidt, and G. Lnenicka for comments on the manuscript. Funding: This work is supported by an American Heart Association Scientist Development Grant, start-up funds, and a Faculty Research Award Program A award from State University of New York-Albany (to H.C.). Author contributions: H.C. designed the experiments, analyzed and interpreted the data in electrophysiology, and wrote the manuscript. L.M. performed experiments on molecular biology, Western blot analysis, and electrophysiology in CHO cells, mouse HL-1 cells, and human primary cardiac myocytes. X.Z. performed electrophysiological experiments in CHO cells and mouse HL-1 cells. Competing interests: The authors declare that they have no competing interests.

Submitted 30 November 2010 Accepted 18 May 2011 Final Publication 7 June 2011 10.1126/scisignal.2001726 Citation: L. Ma, X. Zhang, H. Chen, TWIK-1 two-pore domain potassium channels change ion selectivity and conduct inward leak sodium currents in hypokalemia. Sci. Signal. 4, ra37 (2011).

www.SCIENCESIGNALING.org

7 June 2011

Vol 4 Issue 176 ra37

10

Downloaded from stke.sciencemag.org on August 3, 2011

34. A. F. Struyk, S. C. Cannon, Paradoxical depolarization of BA2+-treated muscle exposed to low extracellular K+: Insights into resting potential abnormalities in hypokalemic paralysis.

Muscle Nerve 37, 326–337 (2008).

35. D. Kim, Physiology and pharmacology of two-pore domain potassium channels. Curr.

Pharm. Des. 11, 2717–2736 (2005).

36. S. A. Goldstein, D. A. Bayliss, D. Kim, F. Lesage, L. D. Plant, S. Rajan, International Union of Pharmacology. LV. Nomenclature and molecular relationships of two-P potassium channels. Pharmacol. Rev. 57, 527–540 (2005).

37. C. Putzke, K. Wemhöner, F. B. Sachse, S. Rinné, G. Schlichthörl, X. T. Li, L. Jaé, I. Eckhardt, E. Wischmeyer, H. Wulf, R. Preisig-Müller, J. Daut, N. Decher, The acidsensitive potassium channel TASK-1 in rat cardiac muscle. Cardiovasc. Res. 75, 59–68 (2007).

38. X. T. Li, V. Dyachenko, M. Zuzarte, C. Putzke, R. Preisig-Müller, G. Isenberg, J. Daut, The stretch-activated potassium channel TREK-1 in rat cardiac ventricular muscle.

Cardiovasc. Res. 69, 86–97 (2006).

39. F. Lesage, E. Guillemare, M. Fink, F. Duprat, M. Lazdunski, G. Romey, J. Barhanin, TWIK-1, a ubiquitous human weakly inward rectifying K+ channel with a novel structure. EMBO J. 15, 1004–1011 (1996).

40. N. Gaborit, S. Le Bouter, V. Szuts, A. Varro, D. Escande, S. Nattel, S. Demolombe, Regional and tissue specific transcript signatures of ion channel genes in the nondiseased human heart. J. Physiol. 582, 675–693 (2007).

41. B. Ordög, E. Brutyó, L. G. Puskás, J. G. Papp, A. Varro, J. Szabad, Z. Boldogkoi, Gene expression profiling of human cardiac potassium and sodium channels. Int. J. Cardiol.

111, 386–393 (2006).

42. W. Liu, D. A. Saint, Heterogeneous expression of tandem-pore K+ channel genes in adult and embryonic rat heart quantified by real-time polymerase chain reaction. Clin. Exp. Pharmacol. Physiol. 31, 174–178 (2004).

43. F. Lesage, I. Lauritzen, F. Duprat, R. Reyes, M. Fink, C. Heurteaux, M. Lazdunski, The structure, function and distribution of the mouse TWIK-1 K+ channel. FEBS Lett.

402, 28–32 (1997).

44. S. Rajan, L. D. Plant, M. L. Rabin, M. H. Butler, S. A. Goldstein, Sumoylation silences the plasma membrane leak K+ channel K2P1. Cell 121, 37–47 (2005).

45. M. Zhou, G. Xu, M. Xie, X. Zhang, G. P. Schools, L. Ma, H. K. Kimelberg, H. Chen, TWIK-1 and TREK-1 are potassium channels contributing significantly to astrocyte passive conductance in rat hippocampal slices. J. Neurosci. 29, 8551–8564 (2009).

46. K. H. Yuill, P. J. Stansfeld, I. Ashmole, M. J. Sutcliffe, P. R. Stanfield, The selectivity, voltage-dependence and acid sensitivity of the tandem pore potassium channel TASK-1: Contributions of the pore domains. Pflugers Arch. 455, 333–348 (2007).

47. A. Alam, Y. Jiang, Structural analysis of ion selectivity in the NaK channel. Nat. Struct.

Mol. Biol. 16, 35–41 (2009).

48. W. C. Claycomb, N. A. Lanson Jr., B. S. Stallworth, D. B. Egeland, J. B. Delcarpio, A. Bahinski, N. J. Izzo Jr., HL-1 cells: A cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc. Natl. Acad.

Sci. U.S.A. 95, 2979–2984 (1998).