JOB Vol.1 - N.1 - 2010 by Paolo Trisi

ISSN: 2036-6795

Journal Journal of of Osteology Osteology and Biomaterials Biomaterials and The official Journal of Biomaterial Clinical and histological Research Association

Volume 1 Number 1 2 0 1 0

The

Laser Microfused Titanium Surface by LEADER

Tixos is a porous surface characterized by

IMPLANTS

Perfect adherence between

interconnected cavities,

the

with predetermined geometry, that enhance fast bone formation*.

MUCOSAL

implant neck and soft tissues

C O N N E C T I V E F I B E R S A D H E R E A N D P E N E T R AT E D E E P I N S I D E T H E S U R FA C E O F

T I XO S

IMPLANT

( B LU E )

* References available upon request.

L E AD E R I

LEADER ITALIA s.r.l. Via Aquileja, 49 - 20092 Cinisello Balsamo (MI) ITALY ph. +39 02 618651 - fax +39 02 61290676 - www.leaderitalia.it - export@leaderitalia.it

The

Laser Microfused Titanium Surface by LEADER

Tixos is a porous surface characterized by interconnected cavities, with predetermined geometry, that enhance

IMPLANTS

Faster Bone Growth inside the cavities of the microfused titanium surface

fast bone formation*.

N E W B O N E F O R M AT I O N

INSIDE THE

IN HUMAN AFTER

I M P L A N T C AV I T I E S 8 WEEKS.

AND PORES

* References available upon request.

L E AD E R I

LEADER ITALIA s.r.l. Via Aquileja, 49 - 20092 Cinisello Balsamo (MI) ITALY ph. +39 02 618651 - fax +39 02 61290676 - www.leaderitalia.it - export@leaderitalia.it

Journal of Osteology and Biomaterials The official journal of Biomaterial Clinical and histological Research Association President Giampiero Massei Deputy-president Alberto Rebaudi Editor in-chief Paolo Trisi, DDS PhD Scientfic director BioCRA, Pescara, Italy Associate Editor Gilberto Sammartino, MD DDS University of Naples Federico II, Naples, Italy Assistant Editor Teocrito Carlesi, DDS Secretary BioCRA, Chieti, Italy Managing Editor Renato C. Barbacane, MD University G. d’Annunzio, Chieti, Italy

www.osteobiom.com Manuscript submission: information can be found on the “Instructions to Authors” www.osteobiom.com. Manuscripts should be written in PC Word (doc) file format with tables preferably embedded at the end of the document; figures in pdf, tif or jpg, and should be sent to via email to: info@osteobiom.com

Scientific Director Paolo Trisi Secretary Teocrito Carlesi

Editorial Board Roberto Abundo, Turin, Italy Mario Aimetti, Turin, Italy Luigi Ambrosio, Naples, Italy Massimo Balsamo, Thiene, Italy Ermanno Bonucci, Roma, Italy Mauro Bovi, Rome, Italy Maria Luisa Brandi, Firenze, Italy Saverio Capodiferro, Bari, Italy Sergio Caputi, Chieti, Italy Francesco Carinci, Ferrara, Italy Chih-Hwa Chen, Keelung, Taiwan Joseph Choukroun, Nice, France Gabriela Ciapetti, Bologna, Italy Giuseppe Corrente, Turin, Italy Marco Esposito, Manchester, UK Antonello Falco, Pescara, Italy Paolo Filipponi, Umbertide, Italy Bruno Frediani, Siena, Italy Sergio Gandolfo, Turin, Italy Zhimon Jacobson, Boston, USA Lorenzo Lo Muzio, Foggia, Italy Christian T. Makary, Beirut, Lebanon Ivan Martin, Basel, Switzerland Milena Mastrogiacomo, Genoa, Italy Sandro Palla, Zurich, Switzerland Giorgio Perfetti, Chieti, Italy Adriano Piattelli, Chieti, Italy Domenique P. Pioletti, Lausanne, Switzerland Sergio Rosini, Pisa, Italy Ugo Ripamonti, Johannesburg, South Africa, Lucia Savarino, Bologna, Italy Arnaud Scherberich, Basel, Switzerland Tiziano Testori, Milan, Italy Anna Teti, L’Aquila, Italy Alexander Veis, Thessaloniki, Greece Raffaele Volpi, Rome, Italy Giovanni Vozzi, Pisa, Italy Hom-Lay Wang, Michigan, USA

Journal of Osteology and Biomaterials (ISSN: 20366795; On-line version ISSN 2036-6809) is is the official journal of the Biomaterial Clinical and histological Research Association (BioCRA). The Journal is published quaterly, one volume per year, by Biocra, Via Silvio Pellico 68, 65132 Pescara, Italy. Copyright ©2010 by Biocra. All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information and retrieval system, without permission in writing from the publisher. The views expressed herein are those of the publisher or the Biomaterial Clinical and histological Research Association (BioCRA). Information included herein is not professional advice and is not intended to replace the judgment of a practitioner with respect to particular patients, procedures, or practices. To the extent permissible under applicable laws, the publisher and BioCRA disclaim responsibility for any injury and/ or damage to person or property as result of any actual or alleged libellous statements, infringement of intellectual property or other proprietary or privacy rights, or from the use or operation of any ideas, instructions, procedure, products, or methods contained in the material therein. The publisher assumes no responsibility for unsolicited manuscript.

For advertising, subscription information, back numbers and sponsorship contact: BioCRA, Via Silvio Pellico 68, 65123 Pescara, Italy E-mail: info@osteobiom.com Web site: www.osteobiom.com www.biocra.com Printed by Grafiche Gercap - Foggia - Italy Graphic by ArtWork sas - Vasto - Italy Direttore responsabile: Giuseppe Tagliente in attesa di autorizzazione The Journal is printed on acid-free paper that meets the minimum requirements of ANSI Standard Z39.48-1984 (Permanence of Paper).

Volume 1 - Number 1 - 2010

Journal of Osteology and Biomaterials The official journal of Biomaterial Clinical and histological Research Association

contents

PREFACE

Paolo Trisi, DDS, PhD. Editor-in-Chief

Review articles

05 Bone regeneration and biomaterials 11 Dental pulp stem cells curriculum vitae 23

Innovative cell-based approaches for bone regeneration

Franziska Saxer MD, Arnaud Scherberich PhD, Ivan Martin PhD

Gabriela Ciapetti, MSC, Lucia Savarino, MSC

Andrea Ballini, Saverio Capodiferro, Stefania Cantore, Vito Crincoli, Carlo Lajolo, Gianluca De Frenza, Gianfranco Favia, Felice Roberto Grassi

Original articles

Implant placement and simultaneous localized ridge augmentation using micro titanium mesh fixed by cover screws: a clinical study in humans.

Giampiero Massei MD DDS, Teocrito Carlesi DDS, Duccio Massei DDS, Paolo Trisi DDS PhD

Morphoscopical analysis of non-metric traits of human clavicle and their association with gender and age of northwest Indian subjects of Chandigarh region: a preliminary forensic osteological study

Jagmahender Singh, M.Sc (Hons.), PhD.

55 Calcium sulfate acts on stem cells derived from peripheral blood 63

Vincenzo Sollazzo, Annalisa Palmieri, Luca Scapoli, Marcella Martinelli, Ambra Girardi, Furio Pezzetti, Francesca Farinella, Francesco Carinci

Appointments

Journal of Osteology and Biomaterials

Journal of Osteology and Biomaterials The official journal of Biomaterial Clinical and histological Research Association

PREFACE Paolo Trisi, DDS, Ph.D. Editor-in-Chief

The launching of a new journal is customarily accompanied by a send-off note of boost and cheer, and needs a word from the Editor to justify its coming into existence. It is becoming common practice that the first issue of a new scientific journal begins with an excuse: â&#x20AC;&#x153;why another new journal? Why increase the number of pages scientists should read, when they are already unable to cope with those published earlier?â&#x20AC;? Journal of Osteology and Biomaterials (JOB) is not just another journal in an already established field. It is a new medium for the publication of recent results in many fields bone research, including, biomaterials and tissue engineering, biomechanics, bone biology, bone pharmacology, dentistry, oral maxillofacial surgery and orthopaedics, which until now each topic has been exclusively covered by many authoritative journals. JOB explores the knowledge that, in the past, was specific competence of the orthopaedics journals: the biology of bone, the healing of bone and the use of biomaterials. In the international scientific panorama there are no journals that combine these different fields extensively. We feel that scientists who work in these fast, expanding fields will find the information they need far more easily if special journals concentrate on all these areas of progress. In founding this new journal, the Editor wishes to further its aim of promoting the highest standards of experimental and clinical research. I am convinced that the Journal of Osteology and Biomaterials is needed. The plan to establish the Journal of Osteology and Biomaterials was originated by myself and the members of the non-profit organization BioC.R.A, who received such an enthusiastic response from researchers and clinicians engaged in the various fields in which bone biology has developed. Enthusiastic reports were received from many European countries and further support came from Canada, Great Britain, the USA and Japan. The journal will be in a position to serve scientists of various disciplines who are interested in the development of scientific research in the field of biomaterials, particularly in biomaterials involved in bone regeneration and osteology in its broadest sense. Welcome to the Journal of Osteology and Biomaterials.

Volume 1 - Number 1 - 2010

BioCRA

Review

Innovative cell-based approaches for bone regeneration Franziska Saxer MD, Arnaud Scherberich PhD, Ivan Martin PhD*

Despite the excellent intrinsic capacity of bone tissue to heal spontaneously, defects in critically sized dimensions or associated with a compromised microenvironment often do not achieve a functional regeneration. The use of autologous or allogeneic bone grafts or of osteoconductive bone substitute materials still suffers from several limitations. The combination of osteoconductive substrates with osteoinductive factors capable to recruit local osteoprogenitor cells holds a great promise, though optimal combinations, doses and release kinetics for such factors are still far from being identified and implemented in safe and clinically effective products. In this paper, we describe strategies to manufacture grafts with intrinsic osteogenic capacity by the association of porous scaffolds with osteoprogenitor cells. In particular, we introduce the possibility to use bone marrow- or adipose tissue-derived mesenchymal stromal cells and briefly discuss some of the challenges related to their engraftment and vascularization upon implantation. We propose that a routine clinical implementation of autologous cell-based osteogenic grafts could be facilitated by (i) the use of advanced 3D culture conditions within controlled bioreactor systems, or (ii) the development of â&#x20AC;&#x2DC;one stepâ&#x20AC;&#x2122; strategies, where grafts are manufactured within the time of a single surgical procedure. (J Osteol Biomat 2010; 1:5-9)

Keywords Tissue engineering, regenerative medicine, mesenchymal stem cells, bioreactor, osteoconduction, osteoinductivity, osteogenicity

Departments of Surgery and of Biomedicine, University Hospital Basel Corresponding author: * Ivan Martin PhD, Departments of Surgery and of Biomedicine, University Hospital Basel, Hebelstrasse 20, 4031 Basel, ph: +41 61 265 23 84, fax: +41 61 265 39 90, email: imartin@uhbs.ch

Introduction Despite substantial advances in surgical techniques, additional measures to efficiently support bone formation and structure are often required. Nonstructural materials are used to fill posttraumatic or congenital defects and cysts or to reinforce the bone structure in osteoporotic patients. Structural grafts, namely those with a defined size and shape, are necessary for more complex bone defects, mostly in reconstructive surgery. Bone grafts can also be classified according to the mode of action. In this regard, osteoconductive materials actively integrate with preexisting bone tissue by supporting the immigration of resident osteoblasts, while osteoinductive substitutes can form bone in non-osseous sites by recruiting and instructing resident mesenchymal stem/stromal cells (MSC). Osteogenic constructs, instead, carry genuinely osteogenic cells and can thus form bone even in a compromised environment, lacking a competent, local osteoprogenitor cellular pool. Autografts (i.e., bones obtained from another anatomic site in the same individual) and allografts (i.e., bone from another individual, such as processed cadaver bone) are considered as being respectively osteogenic and osteoinductive. However, they suffer from

Volume 1 - Number 1 - 2010

Figure 1 Schematic representation of different approaches to generate bone tissue for therapeutic purposes. Filled arrows (track 1) show the original, typical paradigm of bone tissue engineering, involving cell isolation, extensive in vitro expansion in Petri dishes to generate enough cells, cell seeding onto porous scaffolds and possibly further in vitro maturation of the generated construct prior to grafting back to the patient. Empty arrows (track 2) indicate the alternative perfusion bioreactor-based paradigm, where cell expansion, seeding and culture are performed directly in a 3D scaffold within a perfusion bioreactor system. This approach allows to streamline the manufacturing process and to introduce features of automation and control, in turn required to increase standardisation of the procedure. Line arrows (track 3) outline a one-step approach, where cells are mixed with a hydrogel and a scaffold immediately after isolation and implanted in the same patient within few hours, compatible with an intraoperative procedure. The paradigm is attractive from a surgical and economic standpoint, but requires the definition of appropriate quality controls and potency markers for the implanted cells, in order to guarantee reproducibility and predictability of the outcome.

several disadvantages1, including the possibility of donor site morbidity2 and limited availability (for autografts), or the potential viral transmission and immunogenicity (for allografts). Bone substitutes based on calcium phosphates, polymers or combinations thereof are virtually safe and infinitely available, but – beyond few examples of osteoinductive bioceramics – only convey osteoconductive properties3. Osteoinductivity may be engineered by addition of growth and differentiation factors, like the bone morphogenic proteins (BMPs). However, the optimum

Journal of Osteology and Biomaterials

combination, dose and release kinetics of such factors is not yet established, and currently there is Level-I evidence of enhancement of bone formation only for the use of BMP-2 and -7 4, 5, which – due to the highly supra-physiologic concentrations required – may be associated with severe side effects.

Engineered osteogenic grafts Osteogenic grafts may be engineered by the combination of suitable scaffolds with viable osteogenic cells. Culture-expanded, bone marrow-derived MSC (BMSC) have been demonstrated to support formation of de novo bone tissue in ectopic and orthotopic animal models, and have been tested in pilot clinical studies for bone repair 6 (see Figure 1, track 1). However, their use in the routine clinical praxis is hampered on the one hand by the complex and costly manufacturing, and on the other hand by a limited reproducibility in

the performance, resulting in a still not convincing general benefit. The in vivo bone formation capacity of BMSC was reported to be more efficient and more reproducible if cells were expanded directly within the pores of 3D ceramic scaffolds under perfusion flow, as opposed to the static and artificial environment of 2D plastic dishes 7 (see Figure 1, track 2). In order to translate these experimental findings into a facilitated clinical use, efforts are being made to develop closed and controlled bioreactor systems implementing the culture regime of 3D perfusion flow, towards a safe, automated and possibly cost-effective manufacture of BMSCbased osteogenic grafts 8. If osteogenic grafts need to be upscaled in size, as would be required for structural ones, cell survival and function after implantation â&#x20AC;&#x201C; especially in the inner core â&#x20AC;&#x201C; could become a limiting factor for the bone repair efficiency. The issue of engraftment can be addressed by accelerating and improving construct vascularization, which could be achieved by co-implantation of vascular progenitors together with osteoprogenitor cells 9. In this regard, adipose tissue represents an attractive cell source since (i) it is easily collected and available in rather large quantities, (ii) it contains a higher density of osteoprogenitor cells than bone marrow, and (iii) it contains not only osteoprogenitor cells, but also cells from the endothelial and pericytic lineages. By employing the principle described above of 3D perfusion culture for human adipose tissue-derived cells, we could recently demonstrate the possibility to manufacture, within only 5 days, constructs, which were both

osteogenic and vasculogenic upon ectopic implantation 10 (Figure 2). Studies are ongoing to test if the intrinsic capacity to support blood vessel formation can effectively improve the efficiency of vascularization and thereby support the engraftment of scaled up engineered osteogenic tissues. In order to further facilitate the transfer of these findings into a clinical scenario, we also addressed whether osteogenic and vasculogenic constructs based on human adipose tissue-derived cells could be generated in an intraoperative-compatible timing, whereby the abundance of osteoprogenitor cells could bypass the need for cell expansion and ex vivo culture (see Figure 1, track 3). First proof-of-principle studies indicated the feasibility of the concept, although further tests including delivery of low doses of osteoinductive growth factors or application of targeted mechanical stimuli upon implantation are required to demonstrate osteogenicity of the constructs generated within a couple of hours from cell isolation 11.

Volume 1 - Number 1 - 2010

Figure 2 Histological analysis of human adipose derived cell-porous ceramic constructs after subcutaneous implantion in nude mice for 8 weeks. The top panel displays the newly formed bone tissue (b) observed under trasmitted light (left) and fluorescent light (right) in the same histological slide after hematoxylin and eosin staining. Both differentiated osteocytes (black arrow) and lining osteoblasts (open arrow) depositing compact collagenous matrix (dark pink staining colocalized with strong fluorescence) are visible at the surface of the materials (mat). The bottom left image shows a Masson tri-

Journal of Osteology and Biomaterials

chrome staining confirming the collagenous nature of the matrix deposited. The bottom right image shows an immunostaining for the human isoform of CD34, a marker of endothelial cells. Stained vascular structures of human (donor) origin are visible (pink arrow) together with unstained blood vessels of mouse (host) origin (grey arrow). Stained vascular-like structures of human origin are functional blood vessels, as documented by their morphology and the presence of erythrocytes in their lumen (black arrow). Bars = 100Îźm.

Conclusions In the past decade, cell-based autologous, osteogenic grafts have been introduced as an alternative to currently used bone substitute materials. Here we propose that a routine clinical implementation of this attractive approach could be facilitated by (i) the use of advanced 3D culture conditions within automated and controlled bioreactor systems, or (ii) the development of ‘one step’ strategies, which support the manufacture of the grafts within times compatible with those of a single surgical procedure. These concepts should be soon tested in pilot clinical studies.

References 1. De Long WG Jr, Einhorn TA, Koval K, McKee M, Smith W, Sanders R, Watson T. Bone grafts and bone graft substitutes in orthopaedic trauma surgery. A critical analysis. J Bone Joint Surg Am 2007; 89:649-58. 2. Schwartz CE, Martha JF, Kowalski P, Wang DA, Bode R, Li L, Kim DH. Prospective evaluation of chronic pain associated with posterior autologous iliac crest bone graft harvest and its effect on postoperative outcome. Health Qual Life Outcomes 2009; 7:49.

5. De Biase P, Capanna R. Clinical applications of BMPs. Injury 2005; 36 Suppl 3:S43-6. 6.. Meijer GJ, de Bruijn JD, Koole R, van Blitterswijk CA. Cell-based bone tissue engineering. PLoS Med 2007; 4:e9 7. Braccini A, Wendt D, Jaquiery C, Jakob M, Heberer M, Kenins L, Wodnar-Filipowicz A, Quarto R, Martin I. Three-dimensional perfusion culture of human bone marrow cells and generation of osteoinductive grafts. Stem Cells 2005; 23:1066-72. 8. Martin I, Smith T, Wendt D. Bioreactorbased roadmap for the translation of tissue engineering strategies into clinical products. Trends Biotechnol 2009 Sep;27(9):495-502. 9. Levenberg S, Rouwkema J, Macdonald M, Garfein ES, Kohane DS, Darland DC, Marini R, van Blitterswijk CA, Mulligan RC, D’Amore PA, Langer R. Engineering vascularized skeletal muscle tissue. Nat Biotechnol 2005; 23:879-84. 10. Scherberich A, Galli R, Jaquiery C, Farhadi J, Martin I. Three-dimensional perfusion culture of human adipose tissue-derived endothelial and osteoblastic progenitors generates osteogenic constructs with intrinsic vascularization capacity. Stem Cells 2007; 25:1823-9. 11. Müller AM, Mehrkens A, Schäfer DJ, Jacquiery C, Güven S, Lehmicke M, Martinetti R, Farhadi I, Jakob M, Scherberich A, Martin I. Towards an intraoperative engineering of osteogenic and vasculogenic grafts from the stromal vascular fraction of human adipose tissue. Eur Cell Mater (In Press).

3. LeGeros RZ. Calcium phosphate-based osteoinductive materials. Chem Rev 2008; 108:4742-53. 4. Govender S, Csimma C, Genant HK, Valentin-Opran A, Amit Y, Arbel R et al. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J Bone Joint Surg Am 2002; 84-A2123-34.

Volume 1 - Number 1 - 2010

BioCRA

Review

Bone regeneration and biomaterials Gabriela Ciapetti MSC* Lucia Savarino MSC

The recent improvement in our understanding of biology and nanotechnologies has led to a substantial change in tissue and organ substitution. From tissue repair using prosthetic materials we are applying tissue engineering strategies, i.e. ‘a multidisciplinary area of research seeking tissue regeneration and functional retrieval using cells or tissues expanded outside the body, or stimulating cells to proliferate inside an implanted matrix [Vacanti CA, Mikos AG, 1995], to arrive at regenerative medicine, based on: the innate self-regenerative capacity of tissues; the ability of mesenchymal stem cells to promote such regeneration through trophic factors and immunomodulatory properties; and the biomimetic and multi-functional features of advanced materials. Today the mechanisms of bone regeneration following injury, including cell activities, biochemical factors and molecular pathways, are better understood. It is well known that mesenchymal stem cells isolated from adults are able to undergo osteogenic differentiation under biochemical and chemico-physical signals, and this property is used to induce bone formation. New materials are bioinspired, i.e. multiscale and multifunctional, to support various cell types cooperating in bone regeneration. Following a general description of such aspects, we describe studies performed in our lab on orthopaedic and dental materials. Fluoride-releasing compounds and microhybrid composites, to be employed to restore caries, have been tested for their ability to prevent demineralization in hard tissues such as bone and dentin. Dentin was demineralized in vitro, and the efficacy of the protective agent was measured using microhardness, microradiography and image analysis. The release of fluoride and aluminium ions from compomers or glass-ionomeric cements were measured because of their toxic potential, as well as their ability to induce or prevent demineralization. The efficacy of biomimetic hydroxyapatite and nanostructured apatite to reduce the resorption of alveolar bone after tooth extraction, has been compared to commercial materials. Thanks to the deep understanding of tissue repair phenomena and the advancement in biomimetic design of materials, the translation of in vitro-assayed bone regeneration systems to the clinical setting is more reliable. (J Osteol Biomat 2010; 1:11-21)

Keywords Tissue engineering, regenerative medicine, mesenchymal stem cells, osteogenicity Laboratory for Orthopaedic Pathophysiology and Regenerative Medicine, Rizzoli Orthopaedic Institute, via di Barbiano 1/10, 40136, Bologna, Italy. Corresponding author: *dr. Gabriela Ciapetti, MSc Laboratory for Orthopaedic Pathophysiology and Regenerative Medicine, Rizzoli Orthopaedic Institute, via di Barbiano 1/10, 40136 Bologna, Italy ph: +39 051 6366897 - fax: +39 051 6366748 email:gabriela.ciapetti@ior.it

INTRODUCTION Postnatal bone retains an inherent capacity for controlled growth, remodelling in response to mechanical stimuli and regeneration upon damage providing a natural paradigm informing tissue engineering strategies. Repair involves both intramembranous ossification occurring in early days after fracture, and endochondral ossification adjacent to the fracture site over a period of up to 28 days, to be followed by remodelling. Tissue engineering has been defined as ‘‘an interdisciplinary field that applies the principles of engineering and the life sciences toward the development of biological substitutes that restore, maintain, or improve tissue function’’.1 These substitute tissues can be fabricated in situ from precursor materials by harnessing the patient’s own repair mechanisms or ex vivo for use as implants, in research, and as extracorporeal devices. 2 The term ‘Regenerative Medicine’ was found in a 1992 article on hospital administration by L. Kaiser about future technologies that will impact hospitals: it was defined as ‘‘A new branch of medicine will develop that attempts to change the course of chronic disease and in many instances will regenerate tired and failing organ systems”. 3 Regenerative medicine was initially used as a synonym for ‘‘tissue engi-

Volume 1 - Number 1 - 2010

neering”, but actually it embodies the benefit to the patient rather than the art of the practitioner. The term as known today first appears in peer-reviewed citations found on PubMed in 2000 and was in widespread use by the following year. Differences between Tissue Engineering (TE) and Regenerative Medicine (RM) may be outlined as follows: TE lies on - MSC ability to differentiate (if true) to a specific cell phenotype - Scaffold ability to hosts cells and to supply mechanical support along the healing time - Addition of growth factors for angiogenesis and osteogenesis RM lies on - MSC ability to provide growth factors and cytokines for repair (trophic activity) and to ‘instruct’ host cells - Scaffold ability to reproduce as close as possible the physiological extracellular matrix, that is to provide the right signals for differentiation As remarked above, the goal of regenerative medicine is to enhance bone’s regenerative capacity by stimulating patient’own resources and healing mechanisms. 4 The strategy typically involves the ex vivo expansion of stem cell populations followed by their delivery to the site of damage on a biocompatible scaffold. When attempting to rebuild an injured tissue, where resident cells are few or damaged, and, if the patient is old, show a low replication rate, mesenchymal stem cells offer a potentially large source of self renewing cells. Why MSC and not embryonal stem cells (ESC) is

Journal of Osteology and Biomaterials

due to ethical and legal issues, as well as to transformation risk. When using progenitor cells, the assumption is that the pathway to mature tissue during regeneration is the same as that taken by cells during organogenesis; therefore, the understanding of developmental biology has become essential. ‘Adult’ stem cells derived from the bone marrow have been used for more than 40 years for the treatment of haematological disorders. Throughout the 1950s and 1960s, it was shown that transplantations of ‘haematopoietic stem cells’ (HSCs), isolated from the bone marrow, could reconstitute the depleted bone marrow following irradiation. Following this success, Friedenstein et al. 5 noticed another cell type in bone marrow explants, initially called the fibroblast colony-forming cell because it stuck down on cell culture plastic, that was later shown to be a stem cell. They are now referred to as marrow stromal cells or MSC. These cells resemble cells of the connective tissue (fibroblasts) and, in contrast to HSC, can be grown

easily in cell culture dishes. 6(Fig.1) Fundamental discoveries that elucidate the molecular mechanism of stem cell self-renewal and differentiation aided the tissue engineer in harvesting stem cells, retaining their regenerative capacity, and directing their fate. The rarity of adult stem cells (one connective tissue progenitor (CTP) per 20,000 cells in bone marrow; one per 4,000 cells in fat tissue) necessitates the identification of easily recognized characteristics, like surface markers or dye efflux rate, that clearly distinguish stem cells and progenitors from mature cells in tissue. The loss of the regenerative capacity of stem cells during ex vivo amplification is another obstacle to overcome. Culture conditions that more closely mimic cell–cell and cell–matrix interactions in the stem cell niche will likely retain the proliferative and differentiation capacity of stem cells for longer periods of time.

Figure 1. Human marrow-derived stromal cells.

msc PROPERTIES Different sources. In addition to bone marrow, MSC have been isolated from nearly all human adult tissues, including adipose tissue, cartilage, dental pulp, perichondrium, periostium, skeletal muscle, spleen, synovium, tendon, etc. 7 The multiplicity of tissues as sources of MSC strenghtens the hypothesis that pericytes, the cells located on the abluminal side of blood vessels, in close contact with endothelial cells, are stem cells in the tissues from which they originate and correspond to MSC in connective tissues. This proposition does not imply that pericytes from all organs are equivalent. 8,9 Indeed, MSC obtained from different tissue sources show some differences regarding differentiation potential and gene expression profiles: for example, marrow-derived stromal cells differentiate to osteogenic, chondrogenic and adipocytic phenotypes, whereas adipose tissue do not easily become chondrocytes. Secretory or paracrine activity. MSCs secrete a large spectrum of bioactive molecules which actively participate to tissue regeneration. These molecules are: - trophic, subdivided in anti-apoptotic, supportive and angiogenic - immunomodulatory - anti-scarring through secretion of HGF - chemoattractant through several chemokines In this context, the secreted bioactive molecules provide a regenerative microenvironment for a variety of injured adult tissues to limit the area of damage and to mount a self-regulated re-

generative response. Indeed, human clinical trials are now under way to use allogeneic MSCs for treatment of myocardial infarcts, graft-versus-host disease, Crohn’s Disease, cartilage and meniscus repair, stroke, and spinal cord injury. Immunomodulatory activity. MSC have been shown to be immunosuppressive, especially for T-cells, and have been found to escape cytotoxic T-cell mediated lysis: thus, allogeneic MSCs can be considered for therapeutic use. They also can inhibit or promote B cell proliferation, suppress NK cell activation and modulate the cytokine secretion profile of dendritic cells and macrophages. These properties pave the way to the use of allogenic MSC in patients suffering from self- MSC paucity. Aging. It has been reported that the number of MSC did not change with aging or in osteoporosis; however, MSC in vitro exhibit an senescence phenotype, and an age-related decline in the maximal life-span of hMSC from 41 ± 10 population doublings (PD) in young donors to 24 ± 11 PD in old donors has been observed. In addition to impairment of cell proliferation of MSC with aging, the senescent microenvironment affects MSC functions: aged-sera, used as a surrogate condition for senescent microenvironment, inhibited osteoblast differentiation and functions of MSC. 10 Thus, intrinsic aging of MSC and the negative effects of the senescent microenvironment are possible mechanisms for the observed agerelated defective osteoblast function and bone formation in vivo in humans.

BONE REGENERATION KINETICS In either cortical or endosteal bone remodeling, this will involve the migration, through primitive connective tissue matrix, of peri-vascular cells to the resorbed bone surface. Similarly, in fracture and peri-implant healing, the potentially osteogenic population will migrate through the resolving blood clot and, assuming clot retention, will reach the surface of bone fragments, or the implant, within the wound site. In each of these cases, cells that reach the solid surface, provided by either the old bone or implant, will initiate matrix synthesis at the solid, or ‘‘target’’, surface. Those cells that differentiate before reaching the target surface will secrete matrix. As a result, they will stop migrating and will not reach the target surface. Thus, osteoconduction will result in a bony spicule advancing toward the target surface. Osteogenic cells that migrate onto the implant surface will differentiate and form de novo bone by secreting first a proteinaceous matrix directly on the implant surface. This second healing phase, de novo bone formation, results in a mineralized interfacial matrix equivalent to that seen in the cement line in natural bone tissue. These two healing phases, osteoconduction and new bone formation, result in contact osteogenesis and, given an appropriate implant surface, bone bonding. The third healing phase, bone remodeling, relies on slower processes. During several remodeling cycles, the bone surrounding the implant achieves its highest degree of organization and mechanical properties. 11

Volume 1 - Number 1 - 2010

Bulk Materials Current clinical scaffolds are made from a broad range of bulk materials, including: - tissue-derived materials (e.g., allograft bone matrix), - biological polymers (e.g., collagen, hyaluronan, fibrin, and alginate), - ceramics or mineral-based matrices (e.g., tricalcium phosphate, hydroxyapatite, and calcium sulfate), - metals (e.g., titanium, tantalum, and other alloys), - composites of two or more materials, - synthetic polymers (e.g., poly[lactide], polytyrosine carbonates, poly[caprolactone], varying copolymers, and synthetic gel-like polymers). 3D SCAFFOLD PROPERTIES Surface Chemistry. Interactions between cells and scaffolds occur at the surface and are the direct result of the unique chemical environment that is created. The surface chemistry depends on the properties of the bulk material but is not defined by the bulk material, due to the fact that almost all implanted materials rapidly become coated with proteins and lipids, and these adsorbed biomolecules mediate the cellular response to materials. The net effect involves an interaction between a given surface and available biomolecules that adsorb to the surface. Furthermore, when a protein adsorbs, it usually undergoes a change in conformation, which may include denaturation or unfolding. This, in turn, may either hide or expose sites within the protein that interact with cell surface receptors. For example, fibronectin is a more active adhesion molecule on hydrophilic surfaces (e.g., glass) than on

Journal of Osteology and Biomaterials

hydrophobic surfaces (e.g., Teflon or polyethylene). Biological fluids contain a vast diversity of proteins, and cells have hundreds of different types of cell surface receptors. There are twenty-four distinct cellmatrix receptors in the integrin family alone. As a result, it is not surprising that scaffold materials have been discovered and selected empirically. Three-Dimensional Architecture and Porosity. Matrix architecture refers to the way in which a bulk material is distributed in space, at the nanoscale, microscale, and macroscale (i.e., molecular, cellular, and tissue-length scales, respectively). Matrix architecture defines the mechanical structure of the scaffold, but it also defines the initial void space available for connective tissue progenitors to form new tissue, including new blood vessels, as well as the pathways for mass transport (convection and diffusion). The pore size used for most bone ingrowth settings is between 150 and 500 Âľm, which is just large enough to support ingrowth of vascular tissues, depending on the depth of penetration required. Nanostructural features (<100 nm) may also play an important role in scaffold function. Nanopores are too small to influence where cells can or cannot migrate, but they may still have important effects on cell behavior by changing surface texture or diffusion of soluble materials. Mechanical properties. In some settings, the scaffold must bear or share substantial load immediately, and then high-strength materials and structures

such as cortical bone, metals, ceramics, or carbon-fiber-based polymers are required. Scaffoldâ&#x20AC;&#x2122;s mechanical properties (strength, modulus, toughness, and ductility) are determined both by the material properties of the bulk material and by its structure macrostructure, microstructure, and nanostructure). It has been recently shown that mechanical signals are important mediators of the differentiation of connective tissue progenitors. Therefore, a scaffold must possess the proper stiffness to induce cell differentiation, and create an appropriate stress environment throughout the site where new tissue is desired. 12 One of the greatest challenges in scaffold design is the control of the mechanical properties of the scaffold over time. Scaffolds that do not degrade (metals and ceramics) simplify this problem and can provide excellent and durable function in some applications. However, these materials can also compromise tissue repair and function. It is obvious that persistence of a scaffold or implant precludes the formation of new tissue in the space that it occupies. In addition, following integration of a rigid nondegradable implant, adjacent tissue is often mechanically protected (stress-shielded), changing local mechanical signals and resulting in loss of desired local tissue. Problems arising from retained implants have increased the desire to use resorbable scaffolds whenever feasible. One example of that strategy is the recent shift from the use of very slowly degradable ceramics (e.g., hydroxyapatite) for bone-void fillers to the use of more rapidly resorbed materials (e.g., tricalcium phosphate). 13

Innovative materials A wide variety of materials with a range of properties have been designed and utilized for interactions with stem cells. 14 These materials have been fabricated into porous, fibrous, and hydrogel scaffolds. Porous scaffolds provide macroscopic voids for the migration and infiltration of cells, whereas fibrous scaffolds may be fabricated on a size-scale that mimics the native ECM and may be aligned to control cellular alignment. Alternatively, hydrogels are waterswollen polymers that may be fabricated from natural ECM components or synthetic materials and can be engineered to include capabilities of native tissues (e.g., those present during early development). Both natural and synthetic materials have been investigated for interactions with stem cells and to control their behavior. The benefits of natural materials include their ability to provide signaling to the encapsulated cells by several different mechanisms: through surface receptor interactions, by uptake in soluble form, and via degradation by cell-instructive enzymes. The limitations to such materials are that they may be difficult to process without disrupting a potentially important hierarchical structure, and that gels formed from natural materials generally have poor mechanical properties and the potential for an immune response depending on the source of the material. Examples of natural materials that have been used to culture stem cells include Matrigel, collagen, alginate, fibrin, and hyaluronic acid (HA). Alternatively, synthetic biomaterials have wide diversity in properties that may be obtained and tailored with

respect to mechanics, chemistry, and degradation. Hydrogels have been engineered to exhibit a wide range of mechanical properties that correlate to the mechanical properties of native tissues. Additionally, the processing of synthetic materials into desired structures may be much simpler than with natural materials. However, potential limitations to the use of synthetic materials include toxicity and a limited repertoire of cellular interactions, unless they are modified with adhesion peptides or designed to release biological molecules. Both nondegradable and materials that degrade through either hydrolytic or enzymatic mechanisms have been synthesized, and one advantage is the tunability and versatility of these physical properties. Poly(a-hydroxy esters) have been extensively used in the field of tissue engineering, primarily due to their history of biocompatibility and use in medicine. Poly(ethylene glycol) (PEG) hydrogels are one example of a synthetic material that has been investigated for the encapsulation and culture of stem cells. ADVANCES IN DENTAL IMPLANTS One of the main purposes for modifying dental implant surfaces is to decrease the healing period time for osseointegration: this is desirable for both the implant dentistry clinicians and patients. Along with implant macrodesign evolution, surface treatment appears to be another step towards minimizing healing period times before implant restoration. Because the surface is the first part of the implant to encounter the host, it is natural that surface engineering

has become an extensively investigated area. In early implant dentistry, machining (turning) of the implant bulk, an implant surface with periodic grooves was generated. This procedure typically results in the implantation of a clean, minimally rough surface (Ra typically ranging from 0.4 to 0.8 μm), which according to classic protocols requires several months for osseointegration. Several studies (2003-2005) have demonstrated that increasing Ra values range from 0.5 to 2 μm tends to not only increase the bone-implant contact but also the biomechanical interaction of the interface between them at early implantation times. It should be noted that the majority of current commercial implant systems present Ra ranging from 1 μm to 2 μm, and that the effects of such characteristics on the osseoconductivity and bone apposition on the implant surface are still under investigation. As a consequence, implant surface texture has been increased through a variety of methods in an attempt to increase surface area, cleanliness, and chemistry. One of the earliest methods that was commercially available was surface acid-etching and grit-blasting/acidetching. The majority of commercially available grit-blasted implant surfaces are subsequently acid-etched. Titanium plasma spraying (TPS) processing is one of the techniques: it increases the surface area of dental implants up to approximately six times the initial surface area. In an attempt to improve on the widely used Plasma Sprayed HydroxyApatite coating process limitations, thinfilm nanostructured bioceramic coatings have been developed for implant surfaces through processes such as sol-

Volume 1 - Number 1 - 2010

gel deposition, pulsed laser deposition (PLD), sputtering coating techniques, ion beam assisted deposition (IBAD), and electrophoretic deposition. Another engineering-based approach to incorporate Ca- and P-based components onto implant surfaces is the discrete crystalline deposition (DCD) method. This process incorporates nanometer-size crystals of CaP onto a previously treated surface (dual acidetch). The coating of the implant surface with growth factors is a recent strategy. 15 As BMP-2 possesses high osteoinductive potential, it was considered to be an interesting candidate growth factor to coat titanium implants. While BMP2 is used more commonly, BMP-4 is also considered as a candidate growth factor that might improve the remodeling process at the boneâ&#x20AC;&#x201C;implant interface. Besides BMPs, other growth factors loaded onto titanium Besides BMPs, other growth factors loaded onto titanium implant surfaces were tested in animals as potential agents to enhance osseointegration. Examples are: growth hormone (GH), platelet-derived growth factor (PDGF), combined with insulin-like growth factor- 1 (IGF1), platelet released growth factors (PRGFs), TGF-b2, plasma-rich growth factors (PRGFs) and fibroblast growth factor-human fibronectin fragment fusion protein (FGF-hFNIII). In summary, the various available studies show that the applied implant surface roughening procedures not only create surface surface roughness but also result in modification of the surface chemistry. Studies dealing with various thin-film CaP coating technologies show that there is no defini-

Journal of Osteology and Biomaterials

tive proof of an advantageous effect on boneâ&#x20AC;&#x201C;implant healing. For example, there is a lack of human studies in which the success rate of thin CaP coated implants is compared with just surface- roughened implants. A similar remark can be made about the use of extracellular matrix (ECM) peptide sequences or proteins or growth factors coated onto titanium implant surfaces. No unequivocal evidence is present, but there is a tendency to suggest a positive effect of such coatings on the bone-to-implant response. On the other hand, it has to be emphasized that the results as obtained with BMP-2 coatings are confusing. The current findings indicate that BMP-2 and BMP-4 might impede the magnitude of implant-to bone response and are not favorable at all for final implant fixation. Evidently, the currently available methods to modify implant surface composition show potential to control the biological activity of the implant surface. Still additional animal as well as human studies are needed to provide more insight into the bone response as evoked and to generate a predicted bone response. CONCLUSION The goal of regenerative medicine is regeneration as opposed to repair, where the latter represents the rapid but curtailed restoration of function by scar tissue, favoured over the course of the evolution of higher vertebrates, whereas the former looks to the full functionality yielded by developmental processes. The basic strategy combines conductive scaffolds (or three-dimensional matrices) and a developmen-

tally informed selection and supply of inductive growth factors to facilitate and control the spatial and temporal organisation of progenitor cell growth, differentiation and function. If the key to regenerative medicine is to place the right scaffold in the right place at the right time, further studies are needed to approach this goal and to translate such concept to clinics.

TESTING OF DENTAL MATERIALS In the second part of this review, research work on dental biomaterials is described, and two main aspects are considered: bone regeneration in the presence of dental implants, and dentin/enamel mineralization/demineralization process, which is a concern in restorative dentistry. Dental Grafts Trauma, severe periodontitis and endodontic lesions are the most significant reasons for tooth extraction and dental implants are established alternatives for replacing missing teeth after socket extraction healing. The normal sequence of events of socket healing takes place over a period of approximately 40 days, beginning with clot formation and culminating in a bonefilled socket with a connective tissue and epithelial tissue covering. The ideal situation is for an extraction site to heal with bone formation completely preserving and recreating the original dimensions of the bone when the tooth was present. On the contrary, bone resorption is common, and a variety of techniques and materials have been suggested to promote bone regeneration in such bone tissue defects.16 The materials chosen to graft the extraction socket should maintain space for bone to repopulate the graft and thus recreate the bone volume to close to original; moreover, the new bone density should allow a stabile placement of the implant; thus, the graft should be osteoconductive to provide a scaffold to allow bone growth. Eventually, the material should be relatively

inexpensive and readily available, without transferring any morbidity. Autologous bone graft is still regarded as the â&#x20AC;&#x153;gold standardâ&#x20AC;? in alveolar reconstruction, but other bone substitutes are frequently used.17 Among these, resorptive tricalcium phosphate and nonresorptive hydroxyapatite, deproteinized bovine bone matrix and synthetic bioactive glasses have been largely tested. Each of these materials has advantages and disadvantages. Resorptive materials usually have high osteoinductive ability, although the period of their biodegradation is much faster than the possibility of bone apposition in the lumen of the defect. On the other hand, non-resorptive materials have very low osteoinductive ability, although they remain permanently in the lumen of the defect and create the basis for the formation of new bone.18,19 Nevertheless, compared with natural healing sites, particles of graft materials into the extraction sites, which can interfere with the new bone formation that occurs into the wound sites, were often shown.20,21 In addition, growing connective tissue frequently occurs around the nonresorptive granules instead of the formation of new bone.22 For this reason, new materials have been proposed, such as nanocrystalline hydroxyapatite and biomimetic hydroxyapatite; this one is drugged with magnesium ions that let the material mimic human bone and enhance its degradation.22 These nanosized ceramics should be characterized by a quick resorption and improved osseointegrative properties.24 However, controversial results have been reported, and various amount of non resorbed par-

ticles surrounded by soft tissues have been still demonstrated by some authors.25,26 On the contrary, Thorwarth et al. 27 have showed suitable osseointegration and osteoconduction of the used material, as well as nanoparticle complete resorption. The role of nonresorbed hydroxyapatite remnants for implant placement is still unclear and requires further investigation. In vitro testing of restorative materials As a second topic, we shortly review the literature about dentin/enamel mineralization/demineralization process, which is a concern in restorative dentistry. The ideal restorative material would be identical to natural tooth structure, in strength adherence and appearance, and biocompatible. Morever, it would protect from enamel and dentin demineralization and, consequently, from secondary caries formation. Composite resins, Compomers, Glass Ionomer Cements and Resin Modified Glass-Ionomer Cement have been proposed as restorative materials and are currently used in dental practice. The adoption of standard test procedures for the biological evaluation of such materials is recommended by the International Standards Organization (ISO-10993). These standards include guidelines for sample preparation, tests for cytotoxicity, genotoxicity, carcinogenicity, and reproductive toxicity, as well as tests to evaluate local reactions after implantation, irritation, sensitization, and systemic toxicity. Genotoxicity tests, such as Ames test, chromosomal aberration test and the sister chromatid exchange, demonstrated doubtful behaviour of some materi-

Volume 1 - Number 1 - 2010

als, probably due to unreacted components or setting reaction by-products released in the surrounding tissues, as well as some effects on the mineralization process.28-30 Therefore, careful handling of such materials is critical in order to minimize adverse effects, e.g., optimum polymerization, cavity lining in areas with deep dentin, and no direct skin contact. Safety assessment should include aluminum and fluoride release measurement. Fluoride-releasing materials are preferred, due to fluoride antiocariogenic effect, even if the amount necessary for ‘curing’ carious lesions is not well documented.31 Fluoride is known to have positive biological effects on bone cells, as well as physicochemical effects on bone crystals.32 Nevertheless,it has been hypothesized that excessive release could induce undesired toxic effects on dentin and enamel, such as skeletal fluorosis.33 Aluminium ions are released from cements as well, but, as in fluoride, the levels in the surrounding tissues that could induce undesirable or toxic effects are not reported in the literature: indeed, both toxic34 and growth-stimulating effects have been reported.35 In vitro experiments have demonstrated that aluminium retards the formation and the growth of hydroxyapatite crystals and may disturb the mineralization process in a similar manner to the effect of aluminium on bone mineralization.36,37 Consequently, each fluoridereleasing material should be carefully evaluated in order to establish the real effect on tooth mineralized tissues, because ion release could contribute to the secondary or recurrent caries occurring along the restoration margins

Journal of Osteology and Biomaterials

over time.38 Other factors can contribute to the restoration failure: enamel and dentin margins can be considered critical areas due to the possible presence of gaps, porosities and fractures produced by the polymerisation contraction that occurs during the setting of the restorative materials. The lack of integrity of these areas may severely alter the tooth tissue morphology and increase the risk of secondary caries. Gaps can be determined also by the inability of the enamel/dentin bonding system to maintain a complete sealing over time.39 It has been shown that the micromechanical attachment of adhesives to dentin with the formation of the so-called hybrid layer is the most important mechanism for stability and durability of bonding. Voids, porosities, marginal gaps and open dentinal tubules may be found in marginal dentin and hybrid layer,40 and all these conditions may increase the risk of high permeability of marginal dentin: acidic solutions, such as lactic acid, may attack the weakened dentin, creating marginal demineralization zones, and caries may be rapidly promoted by such marginal degradation. Actually these areas represent a protected biological environment, where bacteria can actively produce acids and further demineralize the dentin structure.41 After dentin demineralization induced by acid biofilm of dental plaque, bacterial proteolytic enzymes can attack the residual dentin matrix (collagen), thus leading to deeper secondary caries. Therefore, in order to establish the effects of materials in the prevention or induction of secondary caries formation, the study of the deminer-

alization process of dentin surface is a major concern.42 Accordingly, it has been proposed that innovation of restorative materials could be directed toward the development of materials with “bio-active functions” to provide therapeutic effects. As one bio-active function for the restorative treatment of caries, anti-demineralization activity can be highlighted.43 To test the ability of innovative materials and filling techniques in preventing enamel and dentin demineralization, in vitro restoration models are used, usually by simulating cariogenic conditions. After demineralizing treatments, lesion morphology, microhardness, microradiography of enamel and dentin around the restorations can be studied. It has been reported that enamel is significantly demineralized by acid solutions (as demonstrated by a lower microhardness) in the first superficial 20-40 microns44 and that, close to the margins of the restoration the mineralization is significantly lower than fat from it. The explanation may be related to the presence of gaps along the margins that allow the penetration of the acid solution (the so-called marginal microleakage) between restoration and enamel walls and increase the rate of demineralization.44 In these studies, fluoride-releasing materials have not been shown able to prevent enamel demineralization, suggesting that marginal enamel is the weakest point of the restoration complex, even if in the presence of fluoride. Also, microradiography has been demonstrated an effective technique to early reveal the mineral content decrease, which is an initial sign of caries, along the margins of restorations, after

exposure to cariogenic solutions;46,47 these in vitro studies indicated that the dentin marginal mineralization of restorations is really affected by different restorative materials. Interestingly, compomers, due to their lower rate of polymerization shrinkage compared to composite resins, were shown able to ensure a marginal seal along the dentin walls and to prevent marginal alteration. Alternatively, they could rapidly expand hygroscopically, thus reducing the gap between dentin walls. Both these conditions could decrease the penetration of the cariogenic solution around the margin of restorations and prevent a deeper demineralization. On the contrary, the marginal gaps observed adjacent to the composite restorations, as well as the polymerisation shrinkage of filling materials and the alterations of the marginal hybrid layer, allowed the acid deep penetration along the dentin-restoration gap, and caused a perimarginal high rate of demineralization. Conclusion Periodontal and restorative dentistry are mutually important aspects of clinical dentistry. Clinicians have many treatment options at their disposal, including biocompatible restorative materials and implants. Contemporary tissue-saving treatments, such as ultraconservative caries removal, and atraumatic restorative techniques, assume that caries can be halted and affected tissue can be remineralized. Healing of remaining affected dentin may be encouraged by the use of bioactive materials.

REFERENCES 1. Langer R, Vacanti JP. Tissue engineering. Science 1993; 260: 920-6. 2. Barilleaux B, Phinney DG, Prockop DJ, O’Connor KC. Review: Ex Vivo Engineering of Living Tissues with Adult Stem Cells. Tissue Eng 2006; 12: 3007-19. 3. Lysaght MJ, Crager J. Origins. Tissue Eng Part A. 2009; 15(7):1449-50. 4. Bajada S, Mazakova I, Richardson JB, Ashammakhi N. Updates on stem cells and their applications in regenerative medicine. J Tissue Eng Regen Med 2008; 2: 169–83. 5. Friedenstein AJ, Chailakhjan RK, Lalykina KS. The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Tissue Kinet 1970; 3:393–403. 6. Ciapetti G, Ambrosio L, Marletta G, Baldini N, Giunti A. Human bone marrow stromal cells: In vitro expansion and differentiation for bone engineering. Biomaterials 2006; 27: 6150-60. 7. Gimble JM, Guilak F, Nuttall ME, Sathishkumar S, Vidal M, Bunnell BA. In vitro Differentiation Potential of Mesenchymal Stem Cells. Transfus Med Hemother 2008; 35:228–38. 8. Da Silva Meirelles L, Fontes MA, Covas DT, Caplan AI. Mechanisms involved in the therapeutic properties of mesenchymal stem cells. Cytok Growth Factors Rev 2009; 20:419-27. 9. Crisan M, Yap S, Casteilla L, Chen CW, Corselli M, Soon Park T, Andriolo G, Sun B, Zheng B, Zhang L, Norotte C, Teng PN, Traas J, Schugar R, Deasy BM, Badylak S, Buhring HJ, Giacobino JP, Lazzari L, Huard J, Pèault B. A Perivascular Origin for Mesenchymal Stem Cells in Multiple Human Organs. Cell Stem Cell 2008; 3:301–13. 10. Kassem M, Abdallah BM, Saeed H. Osteoblastic cells: Differentiation and trans-differentiation. Archiv Biochem Biophys 2008; 473:183–7.

Volume 1 - Number 1 - 2010

11. Davies JE. Bone nbonding at natural and biomaterial surfaces. Biomaterials 2007; 28:5058-67. 12. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell 2006; 126:677-89. 13. Muschler GF, Nakamoto C, Griffith LG. Engineering Principles of Clinical Cell-Based Tissue Engineering. J Bone Joint Surg Am 2004; 86:1541-58. 14. Burdick JA, Vunjak-Novakovic G. Review. Engineered Microenvironments for Controlled Stem Cell Differentiation. Tissue Engineering: Part A. 2009; 15 (2):205-19. 15. Junker R, Dimakis A, Thoneick M, Jansen JA. Effects of implant surface coatings and composition on bone integration: a systematic review. Clin. Oral Impl. Res 2009; 20 (S4): 185–206. 16. Block MS, Jackson WC. Techniques for grafting the extraction site in preparation for dental implant placement. Atlas Oral Maxillofac Surg Clin North Am 2006; 14:125. 17. Eppley BL, Pietrzak WS, Blanton MW. Allograft and alloplastic bone substitutes: a review of science and technology for the craniomaxillofacial surgeon. J Craniofac Surg 2005; 16:981–9. 18. Froum S, Cho SC, Rosenberg E, Roher M, Tarnow D. Histological comparison of healing extraction socket implanted with bioactive glass or demineralized freeze-dried bone allograft: a pilot study. J Periodontol 2002; 73:94-102. 19. Norton MR, Wilson J. Dental implants placed in extraction sites implanted with bioactive glass: human histology and clinical outcome. Int Oral Maxillofac Impl 2002; 17:249-57. 20. Carmagnola D, Abati S, Celestino S, Chiapasco M, Bosshardt D, Lang NP. Oral implants placed in bone defects treated with Bio-Oss, Ostim-Paste or PerioGlass: an experimental study in the rabbit tibiae. Clin Oral Implants Res 2008; 19:1246-53.

Journal of Osteology and Biomaterials

21. Molly L, Vandromme H, Quirynen M, Schepers E, Adams JL, van Steenberghe D. Bone formation following implantation of bone biomaterials into extraction sites. J Periodontol 2008; 79:1108-15. 22. Thorwarth M, Schlegel KA, Wehrhan F, Srour S, Schultze-Mosgau S. Acceleration of de novo bone formation following application of autogenous bone to particulated anorganic bovine material in vivo. Oral Surg Oral Med Oral Pathol Oral Radiol Endo 2006; 101:309–16. 23. Landi E, Logroscino G, Proietti L, Tampieri A, Sandri M, Sprio S. Biomimetic Mgsubstituted hydroxyapatite: from synthesis to in vivo behaviour. J Mater Sci Mater Med 2008; 19:239-47.Webster TJ, Ergun C, Doremus RH, Siegel RW, Bizios R. Enhanced functions of osteoblast on nanophase ceramics. Biomaterials 2000; 21:1803-10. 24. Rothamel D, Schwarz F, Herten M, Engelhardt E, Donath K, Kuehn P, Becker J. Dimensional ridge alterations following socket preservation using a nanocrystalline hydroxyapatite paste. A histomorphometrical study in dogs. Int J Oral Maxillofac Surg 2008; 37:741-7. 25. Chris Arts JJ, Verdonschot N, Schreurs BW, Buma P. The use of a bioresorbable nano-crystalline hydroxyapatite paste in acetabular bone impaction grafting. Biomaterials 2006; 27:1110-8. 26. Thorwarth M, Schultze-Mosgau S, Kessler P, Wiltfang J, Schlegel KA. Bone regeneration in osseous defects using a resorbable nanoparticular hydroxyapatite. J Oral Maxillofac Surg 2005; 63:1626-33. 27. Geurtsen W, Spahl W, Leyhausen G. Residual monomer/additive release and variability in cytotoxicity of light-curing glassionomer cements and compomers. J Dent Res 1998; 77:2012-9. 28. Stea S, Cervellati M, Cavedagna D, Savarino L, Cenni E, Pizzoferrato A, Stea S. Detection of mutagenic potential of some glass-ionomer cements through Ames testing. J Mater Sci Mater Med 1998; 9:141-6.

29. Stea S, Visentin M, Cervellati M, Verri E, Cenni E, Savarino L, Stea S, Pizzoferrato A. In vitro sister chromatid exchange induced by glass ionomer cements. J Biomed Mater Res 1998; 15;:0:545-50.

39. Dietschi D, Monasevic M, Krejci I, Davidson CL. Marginal and internal adaptation of class II restorations after immediate or delayed composite placement. J Dent 2002; 30:259-69.

30. Savarino L, Cervellati M, Stea S, Cavedagna D, Donati ME, Pizzoferrato A, Visentin M.In vitro investigation of aluminum and fluoride release from compomers, conventional and resin-modified glass-ionomer cements: a standardized approach.J Biomater Sci Polym Ed 2000; 11:289-300.

40. Prati C, Pashley DH, Chersoni S, Mongiorgi R. Marginal hybrid layer in Class V restorations. Oper Dent 2000; 25:228-33.

31. Grynpas MD. Fluoride effects on bone crystals. J Bone Miner Res 1990; 5:S169-75. 32. Morgan L, Allred E, Tavares M, Bellinger D, Needleman H. Investigation of the possible associations between fluorosis, fluoride exposure, and childhood behavior problems. Pediatr Dent 1998; 20:244-52. 33. Whitford GM. Determinants and mechanisms of enamel fluorosis. Ciba Found Symp 1997;205:26-41; discussion 241-5. 34. Rodriguez M, Felsenfeld AJ, Llach F. Aluminum administration in the rat separately affects the osteoblast and bone mineralization. J Bone Miner Res 1990; 5:59-67. 35. Oliva A, Della Ragione F, Salerno A, Riccio V, Tartaro G, Cozzolino A, Dâ&#x20AC;&#x2122;Amato S, Pontoni G, Zappia V. Biocompatibility studies on glass ionomer cements by primary cultures of human osteoblasts. Biomaterials 1996; 17:1351-6. 36. Savarino L, Cenni E, Stea S, Donati ME, Paganetto G, Moroni A, Toni A, Pizzoferrato A. X-ray diffraction of newly formed bone close to alumina- or hydroxyapatite-coated femoral stem. Biomaterials 1993; 14:900-5.

41. Gonzalez-Cabezas C, Li Y, Gregory RL, Stookey GK. Distribution of cariogenic bacteria in carious lesions around tooth-colored restorations. Am J Dent 2002; 15:248-51. 42. Arends J, Ruben J, Jongebload WL. Dentine caries in vivo. Caries Res 1989; 23:3641. 43. Imazato S. Bio-active restorative materials with antibacterial effects: new dimension of innovation in restorative dentistry. Dent Mater J 2009; 28:11-9. 44. Savarino L, Saponara Teutonico A, Tarabusi C, Breschi L, Prati C. Enamel microhardness after in vitro demineralization and role of different restorative materials. J Biomater Sci Polym Ed 2002; 13:349-57. 45. Prati C, Chersoni S, Cretti L, Mongiorgi R. Marginal morphology of Class V composite restorations. Am J Dent 1997; 10:231-6. 46. Savarino L, Breschi L, Tedaldi M, Ciapetti G, Tarabusi C, Greco M, Giunti A, Prati C. Ability of restorative and fluoride releasing materials to prevent marginal dentin demineralization. Biomaterials 2004; 25:1011-7. 47. Savarino L, Greco M, Baldini N, Giunti A, Pistone M, Marchionni S, Breschi L, Prati C. Evaluation of restorative materials using a new perfusion system. J Adhes Dent 2008; 10:269-75.

37. Stea S, Savarino L, Toni A, Sudanese A, Giunti A, Pizzoferrato A. Microradiographic and histochemical evaluation of mineralization inhibition at the bone-alumina interface. Biomaterials 1992; 13:664-7. 38. Fontana M, Gonzalez-Cabezas C. Secondary caries and restoration replacement: an unresolved problem. Compend Contin Educ Dent 2000; 21:15-8, 21-4, 26.

Volume 1 - Number 1 - 2010

BioCRA

Review

Dental pulp stem cells curriculum vitae Andrea Ballini*, Saverio Capodiferro, Stefania Cantore, Vito Crincoli, Carlo Lajolo, Gianluca De Frenza, Gianfranco Favia, Felice Roberto Grassi

Dental pulp has been identified as a promising source of mesenchymal stem cells (MSCs) for tissue engineering. The discovery that human pulp tissue contains a population of dental pulp stem cells (DPSCs) with high proliferative potential for self-renewal and the ability to differentiate into functional odontoblasts has revolutionized dental research and opened new perspectives in particular for reparative and reconstructive dentistry and tissue engineering in general. There is an increasing demand for innovative, novel approaches to solve the complex issues associated with restoring, replacing and regenerating dental and craniofacial tissues lost due to trauma or disease. DPSCs could represent a potential source of osteoblasts to be used for bone regeneration. (J Osteol Biomat 2010; 1:23-27)

Key words: dental pulp, stem cells, bone phenotype, osteoblast.

Department of Dentistry and Surgery, University of Bari “Aldo Moro”, Bari, Italy Corresponding author: *Andrea Ballini Department of Dentistry and Surgery, University of Bari “Aldo Moro” P.zza G. Cesare n. 11 - 70124 Bari, Italy tel.: +39 (080) 5594242 fax.: +39 (080) 5478043 E-mail: andrea.ballini@medgene@uniba.it

Introduction Experimental evidence suggests that MSCs are self renewing and multipotential and therefore have become an important source of different cell types for autologous reparative and reconstructive cell therapy 1. The multipotentiality is believed to define a stem cell position in the hierarchal organization of stem cells in tissues (FIG. 1). Human dental pulp stem cells (DPSCs) is a term used for the remaining mesenchymal stem cell population in adult teeth. DPSCs with the self renewal and odontoblastic differentiation capacities were first described by Gronthos et al. 2. DPSCs are considered to be a potential source of MSCs because dental pulp is a vascular connective tissue similar to the mesenchymal tissues found in bone marrow, placenta, muscle, and adipocytes 3,4. Our knowledge about hierarchal organization of DPSCs is still incomplete. It is known however, that their differentiation potential is close to that of bone marrow mesenchymal stem cells 1,5. However, several subsets of cells expressing markers of bone (alkaline phosphatase, osteopontin, and bone sialoprotein), smooth muscle (α-smooth muscle actin), and endothelial cells (MUC-18) were represented in both DPSCs and BMSCs 1-3,5.

Volume 1 - Number 1 - 2010

Moreover, DPSCs and BMSCs also have similar biofunctions, such as suppressing T-cell functions in the modulation of immune responses 4. Compared to bone marrow, dental pulp is easy to access 1-5, and proliferates at a higher rate. Since the initial description of DPSCs, several laboratories have reported the successful isolation of stem cells from human 3 and non human 6-9 teeth using variable approaches. Their ability to differentiate into a wide variety of cell types, together with their reproducibility of isolation, high expansion potential and capacity for useful modification using molecular biological engineering techniques, make them good candidates for the repair and regeneration of a large variety of tissues. In vitro differentiation of DPSCs to a designated lineage or cell type has been difficult because of the lack of knowledge in the area of differentiation control. Extensive culturing, however, resulted in loss of reproductive cells, proving that the in vitro growth conditions were suboptimal for their self renewal. Spontaneous and guided differentiation has enabled differentiation of DPSCs to various cell types, including adipocytes 1-2,10, osteoblasts 1-2,10 , chondrocytes 1-2,10 and neurons 7. Some studies have shown that MSCs expressed OPN and OCN genes during mineralization, followed by the differentiation into osteoblasts and odontoblasts 11. Interestingly, DPSCs exhibited a higher proliferation rate compared with BMSCs in vitro 2. This may be attributed to the developmental state of the respective tissues, because the third molars are the last permanent teeth to fully

Journal of Osteology and Biomaterials

Figure 1. Hierarchal organization and multilineage differentiation potential of mesenchymal stem cells (MSCs): totipotent, pluripotent, multipotent, unipotent.

develop and erupt and are therefore at an earlier state of development compared with adult bone marrow. Current studies indicate that they maintain their high rate of proliferation even after extensive subculturing 12. BMSCs and DPSCs have similar gene expression patterns and cell surface antigen profiles even though they are two distinct populations of precursor cells 13, 14 . To date, however, the universal markers identifying these cells are lacking despite many attempts to define their molecular signature. Futhermore, these cells express strongly RUNX-2 gene that correlates a transcription factor essential for osteoblast differentiation and ossification regulation, while osteoblasts in knock-out mice for the gene RUNX-2 did not share to formation of fibrous bone 15-16. However, there is still a lack of specific markers to identify this cell type. Tooth development and regeneration Tooth formation results from sequential and reciprocal interactions between ectodermal and ectomesenchy-

mal cells of the oral mucosa. The dental pulp is a well vascularized and innervated connective tissue that shows some potential for healing in response to various stimuli and injury 17. The high alkaline pH that calcium hydroxide promotes at the surface of the exposed pulp causes a controlled burn and subsequent scar, below which reparative cells are recruited in the central part of the pulp 18. Given the replication potential of such reparative cells, it is unlikely that these cells are mature odontoblasts, since these typically are terminally differentiated. Consequently, there is the possibility for the existence of DPSCs, which have high proliferation and differentiation potential. These cells aggregate and proliferate adjacent to the wounded area and initiate repair forming osteodentin 18. Further characterization of pulp stem cells indicate some similarities to bone marrow derived progenitor cells, such as extended self renewal capabilities as well as multiple lineage differentiation 2,5,10,14,17,19. Previous studies have demonstrated

the differentiation potential of pulp derived cells into many lineage specific cells including dentin and cementum producing cells such as odontoblasts and cementoblasts 3,20-21. TGFβs such as BMPs induce differentiation of pulp cells into odontoblasts 22. DPSCs may be cultured in various surfaces in order to regulate their differentiation 4. For instance, DPSCs cultured on dentin surfaces assume odontoblast-like morphologies with cytoplasmic processes that extend the dentinal tubule 20. The high expandability potential of DPSCs was demonstrated in comparable levels to immortal cell lines (NIH 3T3). Additionally, DPSCs may be differentiated into mineral nodule forming cells with exposure to dexamethasone and 1,25-dihydroxyvitamin D3 16.(FIG.2). Morover, is possible to detect the Alkaline Phosphatase (ALP) activity and mineralization in DPSCs by Von Kossa Staining 16.

Molecular fingerprints Different studies have shown that cells isolated using different methodologies are, in fact, highly similar and appear to have the same differentiation potential 20,23 . Most of the signaling molecules regulating ectoderm and mesenchymal interactions during tooth development belong to the transforming growth factor-β (TGF-β), fibroblast growth factor (FGF), Hedgehog, and Wnt families 13,24,25 . The sequential morphogenesis steps are characterized by the formation of signaling centers in the epithelium. Initially, the dental placodes are found during budding, and are characterized by the expression of activin, FGF and BMP-4 (bone morphogenetic protein-4) 17,25. Placode development is further regulated by Wnts and ectodysplasin. Budding begins along with condensation of mesenchymal stem cells 25 . At this point, the transcription factors Runx2 and Fgf3 regulate epithelial morphogenesis during the bud to cap transition 16-17,25. BMP-4 is also involved in enamel knot formation at the tip

of the bud, by inducing expression of p21, resulting in knot cells leaving the cell cycle 25. The enamel knot expresses many other signaling molecules such as Shh, Bmp-2, Bmp-4, and Bmp-7, Fgf3, Fgf- 4, Fgf-9 and Fgf-20, and Wnt-3, Wnt 10a, and Wnt-10b 3,13,16,22-25. SHH signaling is also crucial for the development of epithelial cervical loops flanking the enamel knots 17. Patterning of the tooth crown is regulated by the secondary enamel knots, which conserve the molecular expression signature and determine the sites for epithelial sheet folds and cusp development. The exact recapitulation of the molecular fingerprints during tooth formation may not be necessary in the process of engineering tooth structures. It is prudent however, to consider the spatial and temporal activity of cytokines and morphogens in order to establish optimal signaling cascades using drug delivery technologies. The delivery of commonly used growth factors such as FGF, BMP and TGF-β are discussed below in the context of regeneration

Figures 2. 2A: DPSCs differentiated into mineral nodule forming cells. 2B: Alkaline Phosphatase (ALP) in DPSCs by Von Kossa Staining.

Volume 1 - Number 1 - 2010

of the dental pulp, as well as dentin and periodontal structures 2,3,11,12,22-25. Microarray-based gene expression profiling is being used to identify the key regulatory genes in the transdifferentiation/dedifferentiation process 26.

Future Directions DPSCs an exciting cell source for applications in the regeneration of tissues in Dentistry. Future therapeutic modalities using DPSCs may include direct implantation and/or in vitro/ex vivo tissue engineering, in combination with biomimetic/biocompatible biomaterials and/or natural or recombinantly derived biologics. These cells may also be considered clinically for their ability to deliver genes or gene products. Immediate challenges that need to be overcome include understanding the biology of DPSCs, in particular the mechanisms that direct and maintain lineage-specific differentiation, and determining the optimal combinations of cell-delivery scaffold and bioactive factor, for the future clinical applications in regenerative medicine.

References 1. Mimeault M, Hauke R, Batra SK. Stem cells: a revolution in therapeutics-recent advances in stem cell biology and their therapeutic applications in regenerative medicine and cancer therapies. Clin Pharmacol Ther 2007; 82:252–264. 2. Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci USA 2000; 97:13625–13630. 3. Huang GT, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res. 2009; 88:792-806. 4. Pierdomenico L, Bonsi L, Calvitti M, Rondelli D, Arpinati M, Chirumbolo G, Becchetti E, Marchionni C, Alviano F, Fossati V, Staffolani N,Franchina M, Grossi A, Bagnara GP. Multipotent mesenchymal stem cells with immunosuppressive activity can be easily isolated from dental pulp. Transplantation 2005; 80:836-842. 5. Shi S, PM Bartold, M Miura, BM Seo, PG Robey and S Gronthos. The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res 2005; 8:191–199. 6. Cheng PH, Snyder B, Fillos D, Ibegbu CC, Huang AH, Chan AW. Postnatal stem/progenitor cells derived from the dental pulp of adult chimpanzee. BMC Cell Biol. 2008; 22;9:20. 7. Iohara K, Zheng L, Ito M, Tomokiyo A, Matsushita K, Nakashima M.. Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. Stem Cells 2006; 24:2493–2503. 8. Luan X, Ito Y, Dangaria S, Diekwisch TG. Dental follicle progenitor cell heterogeneity in the developing mouse periodontium. Stem Cells Dev 2006; 15:595–608.

Journal of Osteology and Biomaterials

9. Yang X, J van den Dolder, XF Walboomers, W Zhang, Z Bian, M Fan and JA Jansen. The odontogenic potential of STRO-1 sorted rat dental pulp stem cells in vitro. J Tissue Eng Regen Med 2007; 1:66–73. 10. Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, DenBesten P, Robey PG, Shi S: Stem cell properties of human dental pulp stem cells. J Dent Res 2002; 81:531-535. 11. Mimeault M, Hauke R, Batra SK. Stem cells: a revolution in therapeutics-recent advances in stem cell biology and their therapeutic applications in regenerative medicine and cancer therapies. Clin Pharmacol Ther 2007; 82:252–264. 12. Vaananen HK: Mesenchymal stem cells. Annals of medicine 2005; 37:469-479. 13. Ballini A, De Frenza G, Cantore S, Papa F, Grano M, Mastrangelo F, Tetè S, Grassi FR. In vitro stem cell cultures from human dental pulp and periodontal ligament: new prospects in dentistry. Int J Immunopathol Pharmacol 2007; 20:9-16. 14. Shi S, Robey PG, Gronthos S: Comparison of human dental pulp and bone marrow stromal stem cells by cDNA microarray analysis. Bone 2001; 29:532-539. 15. Baek WY, Lee MA, Jung JW, Kim SY, Akiyama H, de Crombrugghe B, Kim JE. Positive regulation of adult bone formation by osteoblast-specific transcription factor osterix. J Bone Miner Res 2009; 24:1055-65. 16. Takeyasu M, Nozaki T, Watanabe M, Shinohara M, Morita J, Hidaka A, Iawamoto K, Takahashi T, Nagata S, Daito M, Ohura K. In vitro osteogenic differentiation potential of dental pulp stem cells. J Oral Tissue Engin. 2004; 2:25-30.

dentistry, Dent Clin North Am 2006; 50: 277–298. 19. Shi S, Gronthos S, Chen S, Reddi A, Counter CM, Robey PG, Wang CY. Bone formation by human postnatal bone marrow stromal stem cells is enhanced by telomerase expression, Nat Biotechnol 2002; 20:587–591. 20. Huang GT, Sonoyama W, Chen J, Park SH. In vitro characterization of human dental pulp cells: various isolation methods and culturing environments. Cell Tissue Res 2006; 324: 225–236. 21. Zhang W, Frank W, van Kuppevelt XTH, Daamen WF, Bian Z, Jansen JA, The performance of human dental pulp stem cells on different three-dimensional scaffold materials. Biomaterials 2006; 27: 5658–5668. 22. Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A, Akamine A. Dentin regeneration by dental pulp stem cell therapy with recombinant human bone morphogenetic protein 2, J Dent Res 2004; 83:590–595. 23. Tuan RS, Boland G, Tuli R: Adult mesenchymal stem cells and cell-based tissue engineering. Arthritis Res Ther 2003;5: 32. 24. I. Thesleff, Developmental biology and building a tooth, Quintessence Int. 2003; 34:613–620. 25. Luo Q, Kang Q, Si W, et al: Connective tissue growth factor (CTGF) is regulated by Wnt and bone morphogenetic proteins signaling in osteoblast differentiation of mesenchymal stem cells. J Biol Chem 2004; 279:55958. 26. Baksh D, Song L, Tuan RS: Adult mesenchymal stem cells:Characterization, differentiation, and application in cell and gene therapy. J Cell Mol Med 2004; 8:301.

17. Liu H, Gronthos S, Shi S. Dental pulp stem cells, Methods Enzymol. 2006; 419: 99–113. 18. Goldberg M, Lacerda-Pinheiro S, Jegat N, Six N, Septier D, et al. The impact of bioactive molecules to stimulate tooth repair andregeneration as part of restorative

Volume 1 - Number 1 - 2010

Journal of Osteology and Biomaterials

BioCRA

Original article

Implant placement and simultaneous localized ridge augmentation using micro titanium mesh fixed by cover screws: a clinical study in humans. Giampiero Massei MD DDS1 Teocrito Carlesi DDS2 Duccio Massei DDS3 Paolo Trisi DDS PhD4* The present study evaluates the efficacy of a mixture of deproteinized bovine bone mineral (DBBM) and autogenous bone chips graft associated with a micro titanium mesh fixed by implant cover screws, for localized ridge augmentation simultaneous to implant placement. In 260 partially edentulous patients, 296 titanium meshes were placed and 514 implants (350 Pitt Easy and 164 3i Osseotite NT) were inserted. To evaluate the amount of bone regeneration, intrasurgical measurements were taken at first surgery and at titanium mesh removal. The healing period was uneventful in 258 surgical sites (87.2% of total meshes). In 38 surgical sites the titanium grid was exposed and 23 implants (4.45% of total implants) had to be removed at re-entry. A mean bone gain of 4.45mm (SDÂą2.11; range 2-11 mm) was found, which represents 94.68% filling of the defect. The results of the present study demonstrate that this technique can be used for GBR procedures in localized ridge augmentation with predictable results and without a large occurrence of complications. (J Osteol Biomat 2010; 1:29-37)

Keywords: Titanium mesh, grid, guided bone regeneration, dental implant, bone augmentation, DBBM, autologous bone.

1 President, Biomaterial Clinical and histological Research Association (BioCRA), Torino, Italy; Private Practice, Torino, Italy. 2 Secretary, BioCRA, Pescara, Italy; Department of Oral Surgery, University of Chieti-Pescara, Italy; Private Practice, Pescara, Italy. 3 Treasurer, BioCRA, Torino, Italy; Private Practice, Torino, Italy. 4 Scientific Director, , Pescara, Italy; Director Laboratory of Biomaterials and Biomechanics, Galeazzi Orthopaedic Institute, University of Milano, Italy; Private Practice, Pescara, Italy.

Corresponding author: * Dr. Paolo Trisi DDS, PhD Biomaterials Clinical and histological Research Association, Via Silvio Pellico 68, 65132 Pescara, Italy. Tel:+39 085 28432; Fax: +39 085 28427; E-mail: paulbioc@tin.it

Introduction Placement of dental titanium implants is a well-established treatment modality in edentulous areas of the jaws1. However, in areas with limited alveolar bone height and thickness, installation of implants may not be possible. An adequate bone volume for complete circumferential coverage of the implants is very important in obtaining long-term success of oral implants.2 To ensure adequate bone support, many techniques are available for the treatment of bone augmentation: different surgical techniques (bone splitting osteotomy, inlay and onlay grafting, distraction osteogenesis), different materials (autogenous bone grafts, allografts, xenografts, alloplastic graft materials, bone promoting proteins and platelet rich plasma), and different barrier membranes for guided bone regeneration.3 Guided bone regeneration (GBR) techniques are based on the principle of compartmentalized wound healing. These techniques use special barrier membranes to protect defects from the ingrowth of soft tissue cells so that bone progenitor cells may develop bone uninhibitedly. Ingrowth of soft tissue may disturb or totally prevent osteogenesis in a defect or wound.4-6 This

Volume 1 - Number 1 - 2010

Figures 1a. Pre-panorex. Note the insufficient vertical height of the posterior mandible

Figures 1b. Pre-operative clinical image of the atrophic right side of the mandible

Figure 1c. Mucoperiostal elevated flap using a midcrestal incisions extending buccally and orally.

Figure 1d. The implant bed was prepared and implants were placed. Subsequently multiple perforations of the cortical bone were performed in order to expose the medullary spaces to achieve profuse marrow bleeding.

concept has been successfully utilized to treat periimplant bone defects at the time of implant placement, or to correct alveolar ridge defects before the placement of implants in animals and humans.7-10 For the last years a number of different techniques and materials, including both resorbable and nonresorbable membranes used alone or in combination with autografts, allografts, alloplastic grafts, titanium pins, have been used in GBR procedures with encouraging results.11-13 In the past Boyne14 proposed using titanium micro-mesh for restoring osseous maxillofacial defects. In recent years, titanium mesh has been used for the reconstruction of large or small osseous defects in oral and maxillofa-

Journal of Osteology and Biomaterials

cial surgery for the purpose of implant placement.15-20 In 1999 von Arx et al.21 utilized the similar surgical technique (micro titanium mesh and autogenous bone grafts without membrane barrier) for the regeneration of bone in conjunction with the placement of oral implants. Some authors have used the titanium mesh to perform simultaneous GBR to the implant placement, in humans and in animals.22-27 The present paper reports the clinical outcome of bone augmentation of periimplant defects using a titanium mesh and a mixture of autologous bone and deproteinized bovine bone (DBBM). In this new surgical technique the micro mesh was secured to implants by cover screws, without barrier membranes.

METHODS AND MATERIALS Subjects From 1997 up to 2007, 260 patients (110 females and 140 males) with a mean age of 46 years (range 24-70) participated in the present study. All patients required vertical ridge augmentation to allow implant placement and to improve the crown-implant ratio. The patients were in good general health, demonstrating no systemic or local contraindications to oral surgical procedures and implant placement. They underwent oral hygiene prophylaxis and comprehensive dental care. Clinical examinations revealed compromised bone volumes at future implant sites, both for the maxillae and for the mandible. No implants were placed im-

Figure 1e. Adaptation of the micro-titanium mesh to the morphology of the residual crest. A small window was created on its buccal aspect to allow for graft filling of the defect.

Figure 1f. After placing the graft underneath the grid, the window of the titanium mesh was repositioned in its original position to allow suturing the flap.

Figure 1g. Post-operative panorex following grid placement.

Figure 1h. 5 months after placement, no exposure of titanium mesh is visible.

mediately into extraction sockets. In some patients the titanium mesh was placed in two different fields of the maxillae and mandible. Prior to implant surgery, informed written consent was obtained from all patients. Implants and micro-titanium mesh Twohundredsixty (260) partially edentulous patients received a total of 296 micro titanium mesh “Bio-grid” [Cizeta Surgical S.R.L., San Lazzaro di Savena, Bologna, Italy] and 514 titanium implants (Table 1) (n=350 PITT-EASY® with a diameter of 3.25-4 mm and length of 10-16 mm [Sybron Implant Solutions GmbH, Bremen, Germany]; n=164 3iTM

Osseotite NT with a diameter of 3.25-4 mm and length of 8.5-15 mm [Implant Innovations Inc., Palm Beach Gardens, FL, USA]). The type of alloy of the “Biogrid” is titanium medical degree 2 ASTMF67 without surface treatment, the thickness is of 0.12 mm and the diameter of the holes is 1 mm and the distance between the holes is 1.5 mm. Clinical procedures (Figs. 1a-l). The pre-operative planning consisted of clinical and radiographic examinations. Peri-apical radiographs, orthopantomographs, in some cases CT scans were used to assess the morphol-

ogy of the alveolar ridge (Figs. 1a-b). Implant placement and ridge augmentation were carried out with local anesthesia, articaine 4% and epinephrine 1: 100,000 (Citocartin® 100, Molteni Dental, Milan, Italy). After a wide midcrest incision extending buccally and orally, a mucoperiostal flap was elevated. Preferably realising incisions were avoided, but in some cases we were forced to do it and they were executed away from the grid (about 10mm) (Fig. 1c). The implant site preparation was performed according to the manufacturer’s instructions; bone chips were

Table 1: Sample study

N° patients partially edentulous

N° Bio-grid and relative implants* 141 (1 implant)

Sites in maxillae and mandible

93 (2 implants) 61 (3 implants) 1 (4 implants)

Tot. 260

Tot. 296

N° implants

Time grid removal (months)

350 Pitt Easy: diameter 3.25-4 mm length 10-16 mm 164 3i Osseotite NT: diameter 3.25-4 mm length 8.5-15 mm Tot. 514

range 4-6

mean 4.5

* Number of implants placed underneath each grid.

Volume 1 - Number 1 - 2010

Figure 1i. Reopening of the augmented site for grid removal.

Figure 1k. The flap was repositioned and sutured with interrupted sutures, after placing healing cups.

Figure 1l. Final prosthetic restoration was placed two months after second stage surgery.

recovered from the bone drills during implant site preparation and subsequently placed in the implant sites. The exposed implant length (A) was assessed in an apical-coronal direction, measuring the longest distance from the most coronal part of the residual crest and the implant neck, using a periodontal probe. Implants were left to protrude 0–12 mm from the top of the bone surface. Multiple perforations of the cortical bone were made in order to expose the bone marrow achieving profuse bleeding in order to activate the bone. (Fig. 1d). After adapting the micro-titanium mesh “Bio-grid” to the morphology of the residual crest, one or more holes were prepared into the

Journal of Osteology and Biomaterials

Figure 1j. The micro titanium mesh and the cover screws were removed and the regenerated tissue, clinically similar to bone, extended over the top of the implant neck.

grid in correspondence of the placed implants. Before placing the mesh in situ, a small window was created on its buccal surface to allow for graft filling of the defect. (Fig. 1e) Consequently the “Bio-grid” was adapted and tightly fixed over the augmented site through tightening of the implant cover screws. After grid positioning and tightening, the window was elevated and the graft was placed underneath the grid and condensed for a complete filling of the

regenerating space. The grafting material consisted of a mixture of spongiosa granules 0.25-1 mm of DBBM (Bio-Oss, Geistlich, Wolhusen, Switzerland) and an autogenous bone harvested from bone drills. Thereafter, the window of the titanium mesh was repositioned in its original position to allow for suturing of the flap. (Fig. 1f). The periosteum was released to achieve a tension-free wound closure. A liquid antibiotic solution (Lincomicina cloridrate 2ml 600mg

Table 2: Bio-grids healing

Number (%)

Exposed

Total grids (296)* Exposed with infection

TOT

19 (6.4%)

38 (12.8%)

Mean time after placement (months)

3.5 (range 2.5-4.5)

* Number tot. 296 bio-grids of the study group. Table 3: Implants underneath exposed grids

Number (%)*

Implants without problems

Implants with thread exposure¤

Implants failed

TOT

26 (5%)

10 (1.9%)

23 (4.5%)

* number tot. 514 implants of the study group ¤ These implants appeared clinically stable and were maintained for provisional and final prostheses.

Vertical initial defect

Vertical residual defect

Bone gain (mm)

Bone gain (%)

Mean A = implant Mean B = residual defect Mean ∆ = A - B exposed (remaining implant exposed) 4.7 mm SD±2.15 (range 0-12mm)

0.25 mm SD±0.73 (range 0-2mm)

Figures 2. Intraoperative measure of the defect. Implant exposure (A) was assessed in an apico-coronal direction by measuring the longest distance between the most apical part of the residual crest and the implant neck, using a periodontal probe.

Table 4: Intrasurgical measurements to evaluate bone gain

[PHARMACIA & UPJOHN S.p.A, Milano, Italy]) was used to wash the site. Finally the flaps were repositioned and approximated with mattress and interrupted sutures. All patients underwent antibiotic prophylactic treatment starting 1 day before surgery and then twice a day for 1 week (amoxicillin/clavulanic acid, Augmentin, GlaxoSmithKline, Brentford, UK). After surgery, an anti-inflammatory agent (Ketoprofen, Orudis, Aventis Pharma, Origgio, Varese, Italy) was prescribed to all patients for 1 week. Patients were also instructed to rinse twice a day using a 0.2% chlorhexidine solution and to refrain from mechanical plaque removal in the surgical area for 1 week. Sutures were removed 10 days after surgery and a provisional prosthesis was not used. After a mean interval of 4.5 months (range of 4-6 months) the augmented site was reopened for grid removal. If the bone defect was greater (8-12mm) the healing time was extended to six months. The micro titanium mesh and the cover screws were identified and removed. A “pseudoperiosteum” was always found and removed, showing

a highly vascularized regenerated periimplant bone. (Fig. 1h-j) The height of the regenerated bone was assessed by measuring the residual defect (B, remaining implant exposed). For peri-implant soft tissue healing, a healing cap of appropriate length (2 to 4 mm) was inserted and the flap was repositioned and approximated with interrupted sutures (Fig. 1k). Thereafter, the patient was referred for the prosthetic treatment. (Fig. 1l) After the final prosthetic restoration, the patients were included in a maintenance program consisting of recalls for oral hygiene and clinical evaluation every 6 months and peri-apical X-rays once a year. Bone gain evaluation Intrasurgical measurements were taken on first surgical procedure (A = exposed implant) and at titanium mesh removal (B = residual defect) to evaluate the bone gain (∆ = A – B). The distance between the top of the implant neck and the most coronal part of the regenerated bone was measured for each implant with a periodontal probe. (Fig. 2)

4.45 SD±2.11 (range 2-11 mm)

94.68%

RESULTS Clinical results The healing was uneventful in 258 Biogrid (87.2%) and 455 implants (95.55%), in which the grid was unexposed for an average 5 month period (range 4-6 months), according to the dimension of the peri-implant bone defect. In these sites, after bio-grid removal and abutment connection, a regenerated tissue – clinically similar to bone – was found and extended over the top of the implant neck and the cover-screw (Figs 1l). In most of the sites, a thin bone-like tissue layer was present between the grid’s holes and above this, producing difficulty in the grid removal (Fig.3 a-b). All implants appeared clinically stable and were subsequently prosthetically loaded. Of the 38 exposed Bio-grids (12.8%) (Table 2-3), 19 showed infection (14 within 1° month and 5 among 2° - 3° months), dehiscence and redness of the soft tissue, without swelling, pain, abscess and fistula. The 19 exposed Bio-grid remaining showed exposure without infection. In the exposed and exposed-infected grids, the site was washed using 10 ml solution of 0.2 %

Volume 1 - Number 1 - 2010

exposed meshes the premature mesh removal resulted in a partial loss of the regenerated bone graft and a partial bone regeneration. In a total of 296 grids and 514 implants a mean crestal bone regeneration of 4.45 mm (SDÂą2.11; range 2-11 mm) was found. The mean overall bone fill of the original peri-implant defects was 94.68%. (Table 4).

Figures 3a. After implant placement in the sites 4.6 and 4.5, a vertical 4-5 mm defect was found.

Figures 3b. On surgical reentry, the regenerated tissue completely filled the initial bone defect, and a bone-like tissue was present between and above the gridâ&#x20AC;&#x2122;s holes.

chlorhexidine and/or H2O2 10 vol. diluted 50%, local application of chlorhexidine gel and oral tetracycline (Bassado, Doxycycline Hyclate mg 100, Pharmacia Italia S.p.A., Milano, Italy) was administered to the patients. The time of treatment was 15-20 day, and if it improved the grid removal was delayed to 3.5 months. In the exposed grids that did not showed infection daily topical applications of chlorhexidine gel was prescribed up to the time of the re-entry (at least 4 month). The mean

Journal of Osteology and Biomaterials

time before removal of the 38 exposed grids was 3.5 month (range 2.5-4.5). In a total of 38 exposed grids and 59 relative implants, 23 implants (15 Pitt Easy - 8 Osseotite) were removed at the re-entry, 10 implants (7 Pitt Easy â&#x20AC;&#x201C; 3 Osseotite) showed 2 exposed threads but appeared clinically stable and were used for the provisional and definitive prosthetic rehabilitation. The remaining 26 implants (18 Pitt Easy - 8 Osseotite) were stable and did not show any thread exposure. In the site of the

DISCUSSION The results of this study demonstrates that a mixture of autogenous bone chips and deproteinized bovine bone, associated with titanium-grid, tightly fixed by the tightening of the implant cover screws, can be used for localized vertical ridge augmentation of severely atrophic ridges. In 258 uneventfully healed sites (87.2% of total grids) at Bio-grid removal, all implants appeared stable and submerged into a hard regenerated tissue clinically similar to bone. Only 38 surgical sites showed exposure and infection (12.8% of total grids). In a total of 514 implants, 491 (10 with 2 threads exposed) clinically stable implants were used for provisional and final prosthetic rehabilitation and only 23 implants (4.45% of total implants) failed. In the present study the mean bone was 4.45mm with mean bone gain of 94.68%. At the time of grid removal in non-exposed sites, the defect was completely restored, and the shape of the regenerated tissue matched perfectly the shape of the grid. (Figs. 3a-b) In some surgical sites the vertical bone gain was up to 10-12 mm, but it is important to underline that such defects were almost always buccal dehesions with the presence of

the oral cortical wall and/or the mesial and distal bone peaks at the level of the implant shoulder. The percentage of bone fill reported in different studies28-30 using the membrane/GBR technique without a grafting material to simultaneous implant placement, ranged from 74% to 83%. Two studies25,26 report on a canine model using GBR for supracrestal perimplant defect regeneration by titanium mesh and ePTFE membrane without filling material but only peripheral venous blood25 and bone morphogenetic protein (BMP) with an insoluble bone martrix carrier or with the carrier alone26; failed to obtain bone regeneration. Contrarily, Leghissa et al.24 reported about 85% bone gain in humans of the perimplant defects using blood clot protected with titanium grids and non-resorbable membranes, without any filling materials. Simion et al. 12 reported a mean bone fill of 93.4% for the membrane technique in conjunction with autogenous bone grafts for the treatment of implant dehiscence or fenestrations; an identical percentage of bone regeneration (93.5%) for the treatment of implant dehiscence or fenestrations, using titanium mesh and autogenous bone, was found in the von Arx et al. study 21. A slightly greater percentage of bone regeneration (94.68 %) was found in the present study though the site augmented with autogenous bone and DBBM grafts was not covered with a barrier membrane. The titanium grid seems to protect the applied bone grafts from resorption during healing.15,21 The present new surgical technique of simultaneous ridge augmentation and implant placement differs from that of von Arx et al.21

, Leghissa et al.24 and Degidi et al.22 , because the grid was fixed by tightening the implant cover screws, while in the other studies the mesh was secured with small bone screws to the residual jaw bone. Only in the Assenza study23 the clinical images show that the mesh was secured through the tightening of the implant cover screws, but the grid was covered by an e-PTFE membrane. Good vascular supply and mechanical stability are prerequisites for graft integration and bone regeneration.31 In the present study, numerous perforations were drilled in the cortical layer of the host site to open the marrow cavity. This technique â&#x20AC;&#x153;also called intramarrow penetrationâ&#x20AC;? activates bone formation by releasing local growth factors and other bone inducing factors31 and ensured bleeding to achieve a blood clot around the grafts. This technique was obviously sufficient to establish a vascular supply in the grid-protected defect by ingrowing angiogenic cells. This is very important, because the newly formed tissue also relies on marrow-derived blood vessels for its vascular supply. In the present study the grids, which were fixed through the tightening of the implant cover screws guaranteed graft stability. In respect to mechanical stability, the titanium grid has mechanical properties superior to any other membrane currently available.21 On the other hand, the rigidity of the titanium grid borders might increase the risk of dehiscence of the overlaying soft tissue. In the present study only 38 surgical sites showed exposure and infection, about 12.8% of the total grids. Nevertheless, in the exposed grid

group the Bio-grid was removed about 3.5 month after placement, and only 23 out of 59 implants were removed. Emphasis was placed on not using releasing incisions of the mucosa while preparing large mucoperiosteal flaps with wide midcrest incisions for optimal maintenance of the vascular supply; accurate modelling of the grid to the residual bone defect; a tension-free wound closure, with an overlapping of the wound margins; and a strict postsurgical protocol to reduce the amount of swelling in the surgical site and absolute non use of provisional prosthesis. All of these efforts, combined with increasing surgical experience of the surgeon, helped to significantly decrease the incidence of soft tissue dehiscence from 1997 in the early development period of this surgical technique to recent years. The % of grid exposure in the present study is better than that reported by von Arx et al.15 (50%). Contrarily, in the study of von Arx et al. 1999 21 (grid and implant placement) reported that the exposure meshes were only 5% of total implant sites (1 implant site of a total of 20). Celletti et al.27 in an experimental study in dogs using titanium mesh, found that, at 3 weeks, all these membranes were exposed. These different results could be due to the fact that the grid used in the present study and in the von Arx et al. studies 21,15 was a micromesh with holes, while Celletti et al.27 used a grid with no holes. The Bio-grid used in the present study had a thickness 0.12 mm and the diameter of the holes is 1 mm and the distance between the holes is 1.5 mm. In the authorâ&#x20AC;&#x2122;s opinion, the holes of the grid

Volume 1 - Number 1 - 2010

are important to allow the flow of the extracellular fluids from the underlying tissue to the soft tissue above of the mesh. In this way the soft tissue could benefit from better healing. The importance of bone quality in vertically and horizontally augmented sites is particularly important because of the limited amount of residual native bone available for implant osseointegration.32 Corinaldesi et al.19 show that autogenous bone alone and a combination of autogenous bone (70%) and bovine porous bone mineral BPBM (30%) could be used successfully for ridge augmentation with titanium mesh secured to the residual jaw bone in reconstructive pre-implant surgery. In the 2-year prospective study, the same group 33, demonstrated that implants placed into augmented bone using this technique exhibited peri-implant stability with high survival (100%) and success (93.1%) rates. The present surgical technique using a simultaneous approach, has the advantage to reduce the treatment times, since the correct morphology of the residual alveolar crest is simultaneously restored to the positioning of the implants. On the other hand to perform this technique at least 3-4mm of residual bone crest is essential to achieve a good implant primary stability, since the grid is directly fixed to the cover screws of the implant. It is very important to appraise the height of the residual bones peaks of the defective bone. Also dehiscences of 12mm could be filled, but excessive vertical ridge augmentation with limited residual bones peaks were difficult to be regenerated.

Journal of Osteology and Biomaterials

CONCLUSION In this clinical human study, the results show excellent bone regeneration of peri-implant bone defects using autogenous bone chips and DBBM grafts in conjunction with a titanium grid, without membrane barrier. The mechanical properties, the design and the procedure to secure this specific titanium grid ensured optimal graft integration by firm immobilization and contour stability. In addition, complications included the exposure of the grid, but to a very low percentage. Only 4.45% of total implants were removed and in the other surgical sites with exposure the per-implant bone exhibited a partial loss of the bone graft. In the 258 surgical sites (87%) healings were uneventful, all implants appeared stable and submerged into a hard regenerated tissue clinically similar to bone.

REFERENCES 1. Albrektsson T, Dahl E, Enbom L, Engevall S, Engquist B, et al. Osseointegrated oral implants. A Swedish multicenter study of 8139 consecutively inserted Nobelpharma implants. J Periodontol 1988;59:287–296. 2. Simion M, Trisi P, Piattelli A. Vertical ridge augmentation using a membrane technique associated with osseointegrated implants. Int J Periodontics Restorative Dent 1994;14:496– 511. 3. Esposito M, Grusovin MG, Kwan S, Worthington HV, Coulthard P. Interventions for replacing missing teeth:bone augmentation techniques for dental implant treatment. Cochrane Database Syst Rev. 2008 Jul 16;(3):CD003607. 4. Gottlow J, Nyman S, Karring T, Lindhe J. New attachment formation as the result of controlled tissue regeneration. J Clin Periodontol 1984;11:494–503. 5. Nyman S. Bone regeneration using the principle of guided tissue regeneration. J Clin Periodontol 1991;18:494–498. 6. Dahlin C, Linde A, Gottlow J, Nyman S. Healing of bone defects by guided tissue regeneration. Plast Reconstr Surg 1988;81:672-676. 7. Dahlin C, Sennerby L, Lekholm U, Linde A, Nyman S. Generation of new bone around titanium implants using a membrane technique: an experimental study in rabbits. Int J Oral Maxillofac Implants 1989;4:19–25. 8. Becker W, Becker BE. Guided tissue regeneration for implants placed into extraction sockets and for implant dehiscences: surgical techniques and case report. Int J Periodontics Restorative Dent 1990;10:376–391. 9. Nyman S, Lang NP, Buser D, Bragger U. Bone regeneration adjacent to titanium dental implants using guided tissue regeneration: a report of two cases. Int J Oral Maxillofac Implants 1990;5:9–14. 10. Buser D, Bragger U, Lang NP, Nyman S. Regeneration and enlargement of jaw bone using guided tissue regeneration. Clin Oral Implants Res 1990;1:22-3. 11. Mellonig JT, Nevins M. Guided bone regeneration of bone defects associated with implants: an evidence-based outcome assessment. Int J Periodontics Restorative Dent 1995;15:168–185.

12. Simion M, Misitano U, Gionso L, Salvato A. (1997) Treatment of dehiscences and fenestrations around dental implants using resorbable and nonresorbable membranes associated with bone autografts: a comparative clinical study. Int J Oral Maxillofac Implants 1997;12:159–167. 13. Simion M, Fontana F, Raperini G, Maiorana C. Vertical ridge augmentation by expanded-polytetrafluoroethylene membrane and a combination of intraoral autogenous graft and deproteinized anorganic bovine bone (Bio Oss). Clin Oral Implants Res 2007;18: 620–629. 14. Boyne PJ. Restoration of osseous defects in maxillofacial casualties. J Am Dent Assoc 1969;78:767-776. 15. von Arx T, Hardt N, Wallkamm B. The TIME technique: A new method for localized alveolar ridge augmentation prior to placement of dental implants. Int J Oral Maxillofac Implants 1996;11:387-394. 16. Louis PJ, Gutta R, Said-Al-Naief N, Bartolucci AA. Reconstruction of the maxilla and mandible with particulate bone graft and titanium mesh for implant placement. J Oral Maxillofac Surg 2008;66:235-245. 17. Roccuzzo M, Ramieri G, Spada MC, Bianchi SD, Berrone S. Vertical alveolar ridge augmentation by means of a titanium mesh and autogenous bone grafts. Clin Oral Implants Res 2004;15:73–81. 18. Roccuzzo M, Ramieri G, Bunino M, Berrone S. Autogenous bone graft alone or associated with titanium mesh for vertical alveolar ridge augmentation: a controlled clinical trial. Clin Oral Implants Res 2007;18:286–294. 19. Corinaldesi G, Pieri F, Marchetti C, Fini M, Aldini NN, Giardino R. Histologic and histomorphometric evaluation of alveolar ridge augmentation using bone grafts and titanium micromesh in humans. J Periodontol 2007;78:1477-84. 20. Matsui Y, Ohta M, Ohno K, Nagumo M. Alveolar bone graft for patients with cleft lip/palate using bone particles and titanium mesh: a quantitative study. J Oral Maxillofac Surg 2006;64:1540-1545. 21. von Arx T, Kurt B. Implant placement and simultaneous ridge augmentation using autogenous bone and a micro titanium mesh:

a prospective clinical study with 20 implants. Clin Oral Implants Res 1999 ;10:24-33. 22. Degidi M, Scarano A, Piattelli A. Regeneration of the alveolar crest using titanium micromesh with autologous bone and a resorbable membrane. J Oral Implantol 2003;29:86-90. 23. Assenza B, Piattelli M, Scarano A, Lezzi G, Petrone G, Piattelli A. Localized ridge augmentation using titanium micromesh. J Oral Implantol 2001;27:287-92. 24. Leghissa GC, Zaffe D, Assenza B, Botticelli AR. Guided bone regeneration using titanium grids: report of 10 cases. Clin Oral Implants Res 1999;10:62-8.

31. Schenk RK. Bone regeneration: biologic basis. In: Buser D, Dahlin C, Schenk RK (ed). Guided Bone Regeneration in Implant Dentistry. Chicago: Quintessence,1994:49-100. 32. Ersanli S, Olgac V, Leblebicioglu B. Histologic analysis of alveolar bone following guided bone regeneration. J Periodontol 2004;75:750-756. 33. Pieri F, Corinaldesi G, Fini M, Aldini NN, Giardino R, Marchetti C. Alveolar ridge augmentation with titanium mesh and a combination of autogenous bone and anorganic bovine bone: a 2-year prospective study. J Periodontol 2008;79:2093-103.

25. Roos-Jansaker AM, Franke-Stenport V, Renvert S, Albrektsson T, Claffey, N. Dog model for study of supracrestal bone apposition around partially inserted implants. Clin Oral Implants Res 2002;13:455–459. 26. Stenport VF, Roos-Jansaker AM, Renvert S, Kuboki Y, Irwin C, Albrektsson T, Claffey N. Failure to induce supracrestal bonegrowth between and around partially inserted titanium implants using bone morphogenetic protein (BMP): an experimental study in dogs. Clin Oral Implants Res 2003;14: 219–225. 27. Celletti R, Davarpanah M, Etienne D, Pecora G, Tecucianu JF, Djukanovic D, Donath K. Guided tissue regeneration around dental implants in immediate extraction sockets:comparison of e-PTFE and a new titanium membrane. Int J Periodontics Restorative Dent 1994;14:243-253. 28. Becker W, Dahlin C, Becker BE, Lekolm U, van Steenberhe D, Higuchi K, Kultje C. The use of ePTFE barrier membranes for bone promotion around titanium implants placed into extraction sockets:a prospective multicenter study. Int J Oral Maxillofac Implants 1994;9 :31-40. 29. Dahlin C, Andersson L, Lindhe A. Bone augmentation at fenestrated implants by an osteopromotive membrane technique. A controlled clinical study. Clin Oral Implants Res 1991;2:159-165. 30. Dhalin C, Lekholm U, Becker W, Becker BE, Higuchi K, Callens A, van Steenberhe D. Treatment of fenestration and dehiscence bone defects around oral implants using guided tissue regeneration technique: a prospective multicenter study. Int J Oral Maxillofac Implants 1995;10 :312-318.

Volume 1 - Number 1 - 2010

BioCRA

Original article

Morphoscopical analysis of non-metric traits of human clavicle and their association with gender and age of northwest Indian subjects of Chandigarh region: a preliminary forensic osteological study Jagmahender Singh, M.Sc (Hons.) PhD Bones form the basic framework of human body and thus, contain much information and evidence about the biological identity of an individual even after death, as they often survive the morphological alterations, decay, mutilation, decomposition etc. Both discrete and non-discrete skeletal traits can be used in identification of an individual and estimating biological affinities amongst different populations. In the present study, 343 pairs of adult clavicles collected from fresh cadavers of both the genders were assessed for 10 nonmetric traits to find their frequency distribution, their relationship with sex and age of the deceased. Almost all the clavicles with prominent rhomboid fossa and coraco-clavicular facet belonged to laborers or farmers. Male clavicles, which were ‘long and robust’ in majority of subjects, more prominently differentiated/reflected the incidence of non-metric traits than the female bones which were mostly ‘short and smooth.’ Medial clavicular epiphysis can significantly contribute in age estimation of the deceased, but gender can be determined from the ‘type of clavicle’. Most clavicles of both the sexes showed complete fusion, but earliest and latest complete fusion was seen one year earlier in females than the males. Gender was found to affect the frequency distribution of non-metric traits in clavicle, though age was also a factor in some cases. Non-metric traits can be of very helpful in forensic identification, if antemortem radiographs of the deceased are available for comparisons. Further forensic osteological studies in other populations are required to augment or reject the findings of the present study. (J Osteol Biomat 2010; 1:39-53)

Keywords: Forensic osteology, clavicle, non-metric traits, identification, population affinities, gender and age estimation. Forensic Anthropologist, Department of Forensic Medicine and Toxicology, Govt. Medical College and Hospital, Sector-32, Chandigarh-160030, India Corresponding author: *Jagmahender Singh, M.Sc (Hons.) PhD Forensic Anthropologist, Department of Forensic Medicine and Toxicology, Govt. Medical College and Hospital, Sector-32, Chandigarh-160030, India Telephone: +911722665253-60 (Office).Ext:1064; +919417048690 (M) Fax: +911722606948 - E-mail:jagmindera@hotmail.com

Introduction Non metric traits are discrete nonpathological variations of human skeleton that may be present in cranial (as supernumerary ossicles occurring on suture lines, inca bones, metopic suture retention, variations in the number and location of foramina, and bony tori occurring on the palatine suture or lingual aspects of the mandible) post-cranial (as supernumerary vertebrae, ribs, and bones in the hand and wrist, perforation of the olecranon fossa, accessory foramina in cervical vertebra, posterior bridging of the atlas, third femoral trochanters, sternal foramina, and variations of the surface of facets) or dental (as supernumerary teeth, missing teeth, variable numbers of cusps, shovel shaped incisors, and variations in the number of roots on molars) parts of skeleton1-4.The biological profile of unknown human skeletal remains can be constructed from the interpretation and analysis of both the visual morphoscopical variants as well as morphometric features of human skeleton. The usefulness of non-metric traits for gender and age estimation of skeletal remains is not straightforward and has some limitations due to the inherent subjectivity and inter-observer errors in their observation and also

Volume 1 - Number 1 - 2010

due to lack of some standards for their description and illustration5. So a focused and through knowledge of various subtle discrete variations in human skeleton is required in order to have a knowledge of their frequency distribution in different populations as well as their relation to gender and age of the individual/s in question. The clavicle is one of the long bones of appendicular skeleton that have been least studied finds a very least place in anatomical, osteological and anthropological records in comparison to other bones of human appendicular skeleton. The frequency distribution of a number of

Age-range (years) 17-25 26-35 36-45 46-55 56-65 66-75 Above 75 Total

Punjab M 19 24 21 12 10 5 2 93

F 19 9 2 8 4 2 0 44

137 39.94%

non-metric traits of clavicle like rhomboid fossa6-10, nutrient foramina11-12, coraco-clavicular joint13-16, epiphyseal union degrees17-28, shapes of inner and outer ends, conoid and deltoid tubercles11, etc., of clavicle have been studied in two genders but a few of them have been recorded for the first time in the present study as per the available literature. Aim of present study: The main aim of the present study was to assess and compare the frequency distribution of various non-metric traits of clavicle in the target population, to further broaden our knowledge

Haryana M 28 30 13 6 2 3 3 85

F 9 10 0 4 3 1 0 27

Himachal Pradesh M 14 11 8 4 4 1 0 42

112 32.65%

F 4 3 1 2 1 1 0 12

54 15.74%

of their importance in forensic identification of an individual/individuals and as indicators of the biological distance amongst populations; and also to find their relationship to gender and age of the subjects, if any, from whom these bones were collected. Material and methods The material for the present study consisted of 343 pairs of clavicles of both sexes (Male, 252; Female, 91) collected from adult cadavers (18-94 years) brought for medico-legal autopsy to the Department of Forensic Medicine, Postgraduate Institute of Medical Edu-

Western Uttar Pradesh M F 6 1 4 0 4 0 1 0 0 1 0 0 0 0 15 2 17 4.96%

Chandigarh M 6 6 3 1 1 0 0 17

F 4 1 0 0 0 1 0 6 23 6.70%

Total 110 (32.07%) 98 (28.57%) 52 (15.16%) 38 (11.08%) 26 (7.58%) 14 (4.08%) 5 (1.46%) 343

Table 1. State-wise distribution of study population. [Males (n=252 pairs), Females (n=91 pairs)]

Occupation Student Pvt work Gvt service Farmer Household Business Driver Labourer Housewife

Male (N=252) Frequency Percentage 17 6.7 46 18.3 28 11.1 52 20.6 2 0.8 5 2.0 18 7.1 84 33.3 -

Table 2. Occupation-wise distribution of studied population

Journal of Osteology and Biomaterials

Female (N=91) Frequency Percentage 8 8.8 5 5.5 3 3.3 1 1.1 1 1.1 73 80.2

Total (N=343) Frequency Percentage 25 7.3 51 14.9 31 9.0 52 15.2 3 0.9 5 1.5 18 5.2 85 24.8 73 21.3

cation and Research, Chandigarh. The bones were collected after obtaining a written informed consent from the next of kin of the deceased and ethical clearance from the concerned institutional committee for the study. Both side clavicles were removed from the deceased persons ethnically belonging to the states of Punjab, Haryana and Himachal Pradesh, the Union Territory of Chandigarh and western part Uttar Pradesh (Table 1). The cases of other regions/states were not considered in the present study in order to avoid any distortion in the observations as this population (Northwest Indian population of Chandigarh) is thought to be homogeneous from geographical, morphological, nutritional, and anthropological point of view29 as some previous studies have reported marked differences in their metric observations in subjects of different zones of India29-35. The majority of subjects of the present study were labourers or farmers doing manual laborious work, while only a few were government servants, petty businessmen, students, housewives, etc (Table 2). After removal, both the bones were put in a boiling solution containing caustic

soda, sodium chloride, Henko速 washing powder (Henkel Detergents Ltd., Gurgaon, Haryana, India) and liquid ammonia as per the procedure prescribed by Fenton et al.,36. The bones showing grossly visible pathology, fracture or any deformity were excluded from the study sample. Careful boiling was done for 10-15 minutes or until the muscular coverings of the bones were separated. While boiling, repeated careful inspection of the bones was done to retain their medial epiphyses. Muscular attachments, if any, remaining after boiling, were removed manually by scraping carefully with a blunt scalpel. The wet bones were wiped clean with a piece of gauze and dried using a hairdryer to remove any apparent moisture on their surface. The bones were examined for occurrence of the following non-metric traits as shown in Figure 1 and as per Ray 11, Mc Kern and Stewart17 and Rogers et al.,10, without employing any prolonged defatting or drying processes as the bones were to be replaced into the body after conduction of the postmortem as accepted by the Ethics Committee: The chi-square test was applied to assess the significance level of the differences between frequencies

Figure 1.

of various non-metric traits as well as the different sizes of some traits in two sexes or two age-groups considered. A bone is supposed to attain its skeletal maturity in its all usual dimensions and features when the epiphyseal plate has completely ossified37 and a clavicle is thought to have completed its growth around 30 years of age when its medial epiphysis has completely fused17-28, so in the present study the data was subdivided into two age-groups of 17-30 years and more than 30 years.

Table 3. Gender-wise frequency distribution of rhomboid fossa in both side clavicles.

Side

Right

Left

Sex Male (N=252) Female (N=91) Male (N=252) Female (N=91)

n % n % n % n %

Absent

Present

6 2.4 12 13.2 20 7.9 12 13.2

246 97.6 79 86.8 232 92.1 79 86.8

Chi-Square value

17.505**

4.721*

Small

Medium

Large

60 23.4 39 49.4 77 33.2 25 31.6

80 32.5 31 39.2 52 22.4 27 34.2

106 43.1 9 11.4 103 44.4 27 34.2

Chi-Square value

15.700**

2.179

** Significant at 0.01 level.

Volume 1 - Number 1 - 2010

Rhomboid fossa (RF): It is a costal impression, depressed or pitted, 2-3 cm away from the sternal end, at the inferior aspect of clavicle where costo-clavicular ligament or the rhomboid ligament connects it to the superior portion of the first rib. It is a normal variant of the clavicle. If present, it may be large, medium or small sized based on visual observations. For size of rhomboid fossa, arbitrarily, the size of approximately more than 25 mm in its long axis was considered as large, 15 – 25 mm as medium and less than 15 mm as small. Perforations (PF): These are (probably) vascular in origin and, if present, are situated in a superficial position on the postero-superior edge of the bone at about mid-point or in the lateral third portion. Subclavian groove (SCG): It is a sharply defined obvious structure on the inferior surface of medial end of the clavicle gradually deepening and becoming well formed medial to the conoid tubercle. If present, it may be large, medium or small, based on visual observation. If the groove is wider and is present approximately all along the length of the bone, it is considered to be ‘large’, taken as ‘medium’ if it covers more half or more than half of the length of the bone and was marked as ‘small’ if it is narrow and has just started canalizing but remains less than half of the length of the clavicle. Nutrient foramen (NF): It is a foramen found in the lateral end of the subclavian groove or is located in the central 50% of the length of the bone. If present, the nutrient foramina were sub-classified into small, medium and

Journal of Osteology and Biomaterials

large sizes, depending upon the size of the opening (wider or narrower) of the foramen. All the nutrient foramina were recorded only if they had entrant channels measuring at least 0.2 mm in diameter at the point at which they entered the compact bone. For size, the criteria adopted by Carroll38 was followed and the wire probes of different sizes were inserted in the foramina and was marked as ‘large’ if they accepted a wire probe of 0.8 mm, as ‘medium’ if they accepted no wire probe of diameter more than 0.5 mm and as ‘small’ if they accepted no wire probe of diameter greater than 0.2 mm12. The presence, number and size of these foramina were noted. Type of clavicle (TC): The clavicle may be short and smooth or short and robust, long and smooth or long and robust. The clavicles with length of 140 mm or more were taken as long and lesser than it were considered as small, whereas the clavicles having robustness index 25 or more were assumed to be robust and less than this were assigned to be smooth. So, four different combinations of shape and size of the bones, as stated earlier, were obtained using this arbitrarily formed criterion. Conoid tubercle (CT): The conoid tubercle represents the site of attachment of conoid ligament of the acromio-clavicular joint. Its presence or absence was recorded. Deltoid tubercle (DT): Deltoid tubercle represents the site of attachment of deltoid process or deltoid muscle of scapula on lateral anterior margin of the clavicle. Their presence or absence was noted.

Shape of inner/sternal end (SIE): The sternal end surface of the clavicles may be oval, round, triangular, quadrangular or irregular in shape. The respective shapes were noted. It may be cleared here that such a classification of shape of inner end was purely arbitrary. Coracoclavicular facet/joint (CCJ): The coraco-clavicular joint is an articular facet on the inferior surface of conoid tubercle of the clavicle and the superior surface of horizontal part of coracoid process of scapula. It may be present unilaterally or bilaterally, and may be of different sizes. The absence/presence and size of this facet was noted. Stage of epiphyseal union of medial clavicle (SEU): The following stages were noted as per the criterion used by different workers like McKern and Stewart17, Ji et al.23, Schaeufer39 etc.: Stage 0 = no fusion Stage 1 = Fusion is commencing, but less than one-third of the epiphyses shows the union. Stage 2 = Active fusion, as approximately half of the epiphysis shows union. Stage 3 = Recent fusion, or more than three fourth of the epiphysis shows union. Stage 4 = Complete union. Results Table 2 shows that a majority of male subjects were either labourers or farmers or were engaged in some private work and almost all the females were housewives. All the subjects above 70 years were found to engage in the routine household works. A greater percentage of men were government servants than the women. A slightly greater

Side

Sex

Age-group (years) Absent

Male (N=252) Right

Female (N=91) Male (N=252)

Left

Female (N=91)

17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41) 17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41)

n % n % n % n % n % n % n % n %

5 4.2 1 0.70% 8 16 4 9.80% 18 15.3 2 1.5 12 24 -

Present 113 95.8 133 99.30% 42 84 37 90.20% 100 84.7 132 98.5 38 76.6 41 100

Chi-Square 3.29

0.767

18.263**

11.335**

Small

Medium

Large

27 23.9 33 24.8 34 81 5 13.5 35 35 42 31.8 23 60.5 2 4.9

44 38.9 36 27.1 6 14.3 25 67.6 18 18 34 25.8 8 21.1 19 46.3

42 37.2 64 48.1 2 4.76 4 10.8 47 47 56 42.4 7 18.4 20 48.8

Chi-Square 4.367 35.81**

1.185

28.30**

Table 4. Comparative frequency distribution of rhomboid fossa between two age-groups of same gender in left and right clavicles Â

Side

Age-group (years) 17-30

Right 30+

17-30 Left 30+

Sex Male (N=118) Female (N=50) Male (N=134) Female (N=41) Male (N=118) Female (N=50) Male (N=134) Female (N=41)

n % n % n % n % n % n % n % n %

Absent

Present

5 4.2 8 16 1 0.70% 4 9.80% 18 15.3 12 24 2 1.5 -

113 95.8 42 84 133 99.30% 37 90.20% 100 84.7 38 76.6 132 98.5 41 100

Chi-Square 6.806**

9.182**

1.831

0.619

Small

Medium

Large

27 23.9 34 81 33 24.8 5 13.5 35 35 23 60.5 42 31.8 2 4.9

44 38.9 6 14.3 36 27.1 25 67.6 18 18 8 21.1 34 25.8 19 46.3

42 37.2 2 4.76 64 48.1 4 10.8 47 47 7 18.4 56 42.4 20 48.8

Chi-Square 41.613**

13.225**

10.152**

13.208**

Table 5. Comparative frequency distribution of rhomboid fossa between two genders of same age-group in right and left clavicles

Side Right

Left

Sex Male (N=252) Female (N=91) Male (N=252) Female (N=91)

n % n % n % n %

Absent

Present

112 44.4 58 63.7 114 45.2 59 64.8

140 55.6 33 36.3 138 54.8 32 35.2

Chi-Square value 9.954**

10.271**

Table 6. Gender-wise frequency distribution of perforations in both side clavicles ** Significant at 0.01 level

Volume 1 - Number 1 - 2010

Side

Age-group (years)

Sex

Right 30+

17-30 Left 30+

Present

62 52.5 29 58 50 37.3 29 70.7 61 51.7. 33 66 53 39.6 26 63.4

56 47.5 21 42 84 62.7 12 29.3 57 48.3 17 34 81 60.4 15 36.6

n % n % n % n % n % n % n % n %

Male (N=118) Female (N=50) Male (N=134) Female (N=41) Male (N=118) Female (N=50) Male (N=134) Female (N=41)

17-30

Absent

Chi-square value 0.421

14.158**

2.916

7.219**

Table 7. Comparative frequency distribution of perforations between two genders of same age-group in right and left clavicles

Side Right

Left

Sex Male (N=252) Female (N=91) Male (N=252) Female (N=91)

n % n % n % n %

Absent

Present

107 42.5 65 71.4 100 39.7 47 51.6

145 57.5 26 28.6 152 60.3 44 48.4

Chi-Square value 22.442**

3.909*

Small

Medium

Large

43 17.1 15 16.5 65 25.8 18 19.8

49 19.4 1 1.1 40 15.9 17 18.7

53 21 10 11 47 18.7 9 9.9

Chi-Square value 11.89

3.111

Table 8. Gender-wise frequency distribution of nutrient foramen in both side clavicles

Side

Sex Male (N=252)

Right Female (N=91)

Male (N=252) Left Female (N=91)

Age-group (years) n 17-30 (N=118) % n 30+ (N=134) % n 17-30 (N=50) % n 30+ (N=41) % n 17-30 (N=118) % n 30+ (N=134) % n 17-30 (N=50) % n 30+ (N=41) %

Absent

Present

59 50 48 35.8 34 68 31 75.6 61 51.7 39 29.1 27 54 20 48.8

59 50 86 64.2 16 32 10 24.4 57 48.3 95 70.9 23 46 21 51.2

Chi-Square 5.163

0.639

13.378**

0.246

Small

Medium

Large

27 22.9 16 11.9 7 14.00% 8 19.50% 32 27.1 33 24.6 12 24 6 14.6

18 15.3 31 23.1 1 2.40% 11 9.3 29 21.6 11 22 6 14.60%

14 11.9 39 29.1 9 18.00% 1 2.40% 14 11.9 33 24.6 9 22

Chi-Square value 13.494**

6.463*

6.715*

8.142*

Table 9. Comparative frequency distribution of nutrient foramen between two age-groups of same gender in left and right clavicles ** Significant at 0.01 level. * Significant at 0.05 level

Journal of Osteology and Biomaterials

percentage of girl students died due to accidents or poisoning. The male clavicles showed greater incidence of rhomboid fossa (mainly large-sized) than the females (small or medium sized) but these differences were not found to be significant (Table 3). No significant difference was noted between two sides as regards to frequency of occurrence of this fossa as it was found to occur bilaterally in almost all the cases, if present. The older clavicles had a greater frequency than the younger one. The younger female bones had a significantly greater incidence of small-sized rhomboid fossa. Within same age-group, frequency differences between two sexes were found significant only for right clavicles and size differences were significant for both side clavicles (Table 4, 5). The reason for such right side predominance was not ascertained in the present study and no inference could be drawn from the results. No significant association was noticed between occupation and occurrence of this fossa in either side clavicles though a significant correlation was found between ethnicity and its occurrence only in right clavicles (Pearson chi-square=0.053). Perforations were significantly more in male clavicles than the females (Table 6). Two male subjects of 37.5 and 38 years of age were found to have large perforations piercing the antero-posterior surfaces of the bone. Both the subjects were heavily built belonging to farmer community of Punjab, an agrarian state. Male right clavicles showed significant age differences in the frequency of occurrence of perforations. Significant sex differences were noticed

in the 30+ yearsâ&#x20AC;&#x2122; age-group of clavicles of both sides (Table 7). The sub-clavian groove was found to be present in majority of clavicles of both sexes. Most of male clavicles had large sized groove, whereas the females had medium sized groove and such a difference in size between two genders was found to be statistically significant for both side clavicles. Only a few cases in younger age-group, particularly in females, were found to have no demarcation of this groove, however, cent percent clavicles of the older agegroup showed groove. Statistically significant sex differences were noted for occurrence of nutrient foramen in the studied population, with more than 50% clavicles showing presence of this trait in males and absence in females (Table 8). Majority of clavicles were found to possess a single foramen. The size of nutrient foramen was found to be highly significant for discriminating sex in right clavicles only. Significant age-differences for presence/absence of nutrient foramen were noted for the male clavicles only. Age-dependent differences in size of nutrient foramen were statistically significant in both side clavicles of both the sexes (Table 9). Male clavicles showed significantly greater incidence of deltoid tubercle than the female clavicles. Female clavicles showed the presence of conoid tubercle in cent percent cases, whereas a few male clavicles showed the absence of this trait. A majority of male clavicles were either long and robust (right side) or long and smooth (left side) but majority of female clavicles were of short and smooth type. These differences in

the clavicular shape and size between the two sexes were found to be statistically highly significant for both side clavicles (Table 11). A statistically significant difference was noticed in the shape and size of clavicles between younger and older subjects as well as between males and females of either younger or the older subjects (Table 12, 13). A small to medium and large sized coraco-clavicular facet was observed only in about 12 to 14% of clavicles of both sexes but no significant difference was noticed between two genders (Table 14), on the superior margin of conoid tubercle. No significant difference was found in the size of this facet between two sexes for either side of clavicle or between side clavicles of either sex Among males, 1.98% cases showed this facet unilaterally (mainly on right side) whereas the remaining 11.90% subjects were having the facet on both side clavicles. All the female clavicles were found to have this facet bilaterally and no case was noticed having this facet (for coracoclavicular joint) unilaterally. Secondly, most of the cases showing this facet were in the age group of 4555 years, though the youngest age of its appearance was found to be at 35 years in both the sexes. Almost all the subjects, in whom this facet appeared, were either labourers or farmers who, in turn, do laborious, strenuous and manual work, though few other occupational subjects also had such a facet. The relation between occupation and presence of this facet was found to be statistically highly significant with a chisquare value of 57.09 for right clavicles and 56.02 for left clavicles, both having

Volume 1 - Number 1 - 2010

p-value <0.0001.. No coraco-clavicular facet was found to be present in clavicles of age group 17-30 years of either sex, and such a difference in two agegroups in each sex was statistically highly significant for both right and left clavicles. No significant sex differences were noticed in relation to occurrence of this facet when two age-groups of same sex were compared (Table 15). Majority of right clavicles had round ends and the left clavicles had oval ends in both sexes. A good number of male and female clavicles also had triangular or quadrangular sternal ends. About 70% male and 60% female clavicles showed complete fusion of their epiphyses Commencement of fusion was seen as early as 18 years of age in clavicles of both the genders and no clavicle showed complete fusion until the age of 22 years. The earliest age at which complete fusion was seen was 22 years in male clavicles and 21 years in female clavicles Complete fusion of the medial end of the clavicle was seen latest at 32 years in the male clavicles (about 39%) while the same was observed at 31 years in the female bones (about 29%), i.e., the medial epiphysis of female clavicles fused one year earlier than their male counterparts. Advanced stages of clavicular epiphyseal union were seen in most of the clavicles after 24 years of age in females and 23 years of age in males. The left bones showed complete union one year earlier than the right clavicles.. Thus, male or female clavicle showing complete fusion or no fusion can probably be more than 22 years and less than 21 years, respectively. No significant difference was noticed in both sexes for

Journal of Osteology and Biomaterials

the right and left clavicles as regards to the occurrence of various stages of epiphyseal union. Discussions: Â Â Nonmetric trait analysis is done to examine biological affinities between different groups of people by studying their frequency distribution as populations displaying the most similarity are the most closely related ones and vice-versa4. The differential distribution of various non-metric traits and morphologic alterations in human skeleton of different populations has still not been completely elucidated but some comparative studies demonstrate that the differences in the shape and size of some human bones are determined basically by environmental factors and genetic influence or habitual activity patterns, besides the pattern and rate of growth and development and the type of bone remodeling40-41. Table-16 lists the comparative genderwise frequency distribution of various non-metric traits of clavicle studied by various workers. Clavicles of both the genders have almost similar incidence of rhomboid fossa in the present study as against that reported by Prado et al.42 who reported that females have significantly lesser percentage of this anatomic manifestation. The incidence of rhomboid fossa was greater on the right than the left side clavicle in both the sexes9,12, and present study]. However, Rogers et al.10 reported higher frequency of occurrence on the left male clavicles. While comparing the bilateral/ unilateral frequencies of rhomboid fossa, significant differences are observed between present study and that of Jit and Kaur9 for both sexes and Rogers

et al.10 for males only. Rogers et al.10 found that rhomboid fossa (large sized) was comparatively more common in younger subjects of age between 2030 years, but cautioned that rhomboid fossa is not a reliable indicator of age, if otherwise, more findings donâ&#x20AC;&#x2122;t support this. In the present study, occurrence of rhomboid fossa does not reveal significant difference in the two age-groups considered. As far as overall incidence of occurrence of rhomboid fossa is concerned, the results of present study correspond to that reported by some earlier workers8,43, but, this frequency is higher than that reported by Jit and Kaur9 and Prado et al.42 Significant difference was found between Americans and the present study subjects for incidence of rhomboid fossa10. Present study supports the earlier Indian studies6,8 that rhomboid fossa is present with greater frequency in Indian populations (particularly in males) than in western populations44-45, probably, because of the reason that Indian people are accustomed to do relatively more strenuous and muscular work10. The same might be true for the present population as the majority of deceased belonged to labourer or farming community who do strenuous manual/mechanical work. Significant sex and age differences in expression of this fossa were observed by Rogers et al.10, suggesting that if a rhomboid fossa is found particularly on left side, then it is more likely a male clavicle, but no such relation was found in the present study for this trait. The fossa is present with greater frequency in males than females9, 45 and the same has been observed in the present

Side

Right

Left

Sex Male (N=252) Female (N=91) Male (N=252) Female (N=91)

n % n % n % n %

Absent

Present

123 48.8 60 65.9 115 45.6 55 60.4

129 51.2 31 34.1 137 54.4 36 39.6

Chi-square value

7.878*

5.862*

Table 10. Gender-wise frequency distribution of deltoid tubercle in both side clavicles

Side

Right

Left

Sex Male (N=252) Female (N=91) Male (N=252) Female (N=91)

n % n % n % n %

Short & Smooth 3 1.2 44 48.4 11 4.4 42 46.2

Short & Robust 35 13.9 23 25.3 19 7.5 11 12.1

Long & Smooth 79 31.3 20 22 142 56.3 37 40.7

Long & Robust 135 53.6 4 4.4 80 31.7 1 1.1

Chi-square value

155.577**

106.885**

Table 11. Gender-wise distribution of type of clavicle in both side clavicles

Side

Sex Male (N=252)

Right Female (N=91)

Male (N=252) Left Female (N=91)

Age-group (years) 17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41) 17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41)

n % n % n % n % n % n % n % n %

Short & Smooth 3 2.5 30 60 14 34.1 8 6 3 2.2 29 58 13 31.7

Short & Robust 23 19.5 12 9 13 26 10 24.4 13 11 6 4.5 7 14 4 9.8

Long & Smooth 37 31.4 42 31.3 7 14 13 31.7 62 52.5 80 59.7 13 26 24 58.5

Long & Robust 55 46.6 80 59.7 4 9.8 35 29.7 45 33.6 1 2 -

Chi-Square values

10.429*

11.229*

7.397

10.395*

Table 12. Comparative frequency distribution of type of clavicle in both side clavicles of two age-groups of same gender ** Significant at 0.01 level. * Significant at 0.05 level

Volume 1 - Number 1 - 2010

study, particularly in right clavicle. The occurrence of perforations (on the postero-superior edge) in the present study is observed to be significantly more than that observed among Australian aborigines. Earlier studies did Side

Age-group (years)

Sex Male (N=118) Female (N=50) Male (N=134) Female (N=41) Male (N=118) Female (N=50) Male (N=134) Female (N=41)

17-30 Right 30+

17-30 Left 30+

not mention gender-wise frequency distribution of occurrence of perforations. In the present study, as also in Australian aborigines, the perforations were present significantly more in male than the female clavicles of both sides.

n % n % n % n % n % n % n % n %

Short & Smooth 3 2.5 30 60 14 34.1 8 6 29 58 3 2.2 13 31.7

Short & Robust 23 19.5 13 26 12 9 10 24.4 13 11 7 14 6 4.5 4 9.8

The comparative results reveal similar frequency of occurrence of sub-clavian groove in both the sexes. In the Australian aborigines as well as present study, the male clavicles had a greater tendency of having large-sized or well

Long & Smooth 37 31.4 7 14 42 31.3 13 31.7 62 52.5 13 26 80 59.7 24 58.5

Long & Robust 55 46.6 80 59.7 4 9.8 35 29.7 1 2 45 33.6 -

Chi-Square values 87.063**

68.022**

60.179**

45.125**

Table 13. Comparative frequency distribution of different types of clavicles between two age-groups of same gender in right and left clavicles

Side

Age-group (years)

Sex Male (N=252)

Right Female (N=91)

Male (N=252) Left Female (N=91)

17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41) 17-30 (N=118) 30+ (N=134) 17-30 (N=50) 30+ (N=41)

n % n % n % n % n % n % n % n %

No Fusion

Fusion commencing

Active Fusion

Recent Fusion

Complete Fusion

11 9.3 -

12 10.2 -

16 13.6 -

7 14 8 6.8 4 8 -

7 14 15 12.7 9 18 -

8 16 17 14.4 8 16 -

41 34.7 1 0.7 17 34 33 28 1 0.70% 15 30 -

38 32.2 133 99.3 11 22 41 100 45 38.1 133 99.30% 14 28 41 100

Chi-Square

129.379**

55.965**

113.063**

48.842**

Table 14. Comparative frequency distribution of different stages of epiphyseal union between two age-groups of same gender in left and right clavicles ** Significant at 0.01 level.

Journal of Osteology and Biomaterials

Side

Sex Male (N=252)

Right Female (N=91)

Male (N=252) Left Female (N=91)

Age-group (years) 17-30 n (N=118) % 30+ n (N=134) % 17-30 n (N=50) % 30+ n (N=41) % 17-30 n (N=118) % 30+ n (N=134) % 17-30 n (N=50) % 30+ n (N=41) %

Absent 118 100 99 73.9 50 100 29 70.7 118 100 104 77.6 50 100 29 70.7

Present 35 26.1 12 29.3 30 22.4 12 29.3

Small 10 7.5 4 9.8 7 5.2 4 9.8

Medium 9 6.7 2 4.9 10 7.5 2 4.9

Large 16 11.9 6 14.6 13 9.7 6 14.6

Chi-Square 35.792**

16.857**

29.988**

16.857**

Table 15. Comparative frequency distribution of coraco-clavicular facet between two age-groups of same gender in left and right clavicles

Variable

Rhomboid Fossa

Perforations Sub-clavian groove Nutrient foramen Deltoid tubercle Conoid tubercle

Coraco-clavicular facet

Author

Ethnicity/ Region

Male

Female

Chi-square value

Ray [11] Jit and Kaur [9] Rogers et al [10] Prado et al[42] Present study (2009) Ray[11] Present study (2009) Ray([11] Present study (2009) Ray[11] Present study (2009) Ray[11] Present study (2009) Ray[11] Present study (2009) Kaur and Jit [13] Nalla and Asvat [14] Nalla and Asvat [14] Cho and Kang [15] Present study (2009)

Australian aborigines Chandigarh (Indian) Americans Brazilian Chandigarh (Indian) Australian aborigines Chandigarh (Indian) Australian aborigines Chandigarh (Indian) Australian aborigines Chandigarh (Indian) Australian aborigines Chandigarh (Indian) Australian aborigines Chandigarh (Indian) Chandigarh (Indian) South African (Whites) South African (Blacks) Koreans Chandigarh (Indian)

100.0 72.0 33.5 63.6 94.8 3.1 55.1 98.0 99.2 100.0 58.9 100 52.8 99.0 97.4 10.1 10.0 11.7 9.8 13.5

97.0 70.70 5.5 2.9 86.8 0.8 35.7 90.0 97.3 100.0 38.46 99.0 36.8 100.0 100.0 8..3 10.0 7.8 9.8 13.2

0.077 0.233 24.958**

**Significant at 0.01 level. * Significant at 0.05.

13.698** 0.102 2.895 1.864 0.004 0.081 0.004 0.306 0.000 -

† ‘Chi-square’ values for comparison with present study

Table 16. Comparative gender-wise percentage frequency distribution of various non-metric traits of clavicle studied by various workers

Volume 1 - Number 1 - 2010

Author

Ethnicity & method

Sample size & sex

Todd and D’Errico [54]

American (Dry bones)

McKern and Stewart [17]

American (Dry bones)

Webb and Suchey [20]

American (Dry bones)

166 M-130 F-36 374 (males) 859 M-605 F-254

Schaefer and black [55] Schaefer and black [56] Schaefer [39] Flecker ([50]

Bosnian Muslims (Dry bones) Bosnian Muslims (Dry bones) Bosnian (dry bones) Australian Radiographs)

Galstaun [49]

Bengali ( Radiographs)

Jit and Kulkarni [18]

North Indian (Radiographs)

Kreitner et al. [24]

German (CT scan)

Present study (2009)

North Indian (Fresh bones)

M= Male F= Female

Partial fusion range

Latest no fusion

Youngest complete fusion

Latest incomplete fusion

Complete fusion in 100% cases

19-27

28*, 29†

18-30+

30+

17-30M 16-33F

24M 23F

21 (both sexes)

30M 33M

31M 34M

114 (males)

?-28

258 (males) 233 (males)

17-29

437

?-25

18-24

19M 20F

24M 23F

25M 24F

18-24

21 (both sexes)

22M 23F

24M 23F

25M 24F

16-26

31M 30F

32M 31F

654 M-445 F-209 684 M-391 F-293 380 M-229 F-151 686 M-504 F-182 †= Blacks

18-31

21 22 (both sexes) (Both sexes)

*= Whites

Table 17. Comparative analysis of epiphyseal fusion timings of medial clavicle studied by various workers

demarcated groove, however, in case of female clavicles, both studies have almost equal incidence of having smallsized and medium-sized sub-clavian grooves. Parsons44 had reported that nutrient foramen was found in about 95% English clavicles, though no differentiation was made between male and female clavicles as regards to occurrence of this foramen. A single nutrient foramen was found with greatest frequency than the multiple foramina11,44. Nutrient foramen (single or multiple) were

Journal of Osteology and Biomaterials

reported in 100% of Australian aborigine data, whereas, present study found its presence in about 59% male and 38% female clavicles studied. In the present study, majority of female clavicles had either small sized or medium sized nutrient foramen but, frequency of large or medium sized foramen was noticed in males and these size differences were found to be highly significant for discriminating sex in right clavicles only. Ray44 found deltoid tubercle in almost cent percent clavicles of both the sexes,

while in the present study this tubercle was present in about 53 and 37% male and females, respectively. Thus, in the present study, male clavicles showed significantly greater incidence of deltoid tubercle than the female clavicles. The occurrence of conoid tubercle was found to be similar in both sexes clavicles in present study as also among Australian aborigines. Further, the two studies do not differ in the frequency of occurrence of this tubercle. Ray44 had classified the types of clavicles (Australian aborigines) in two cat-

egories; ‘long and smooth’, ‘short and robust’. On the basis of this classification, greater percentages of male and female clavicles were found to be long and smooth, than the short and robust type. On the other hand, in the present study clavicles were classified into four categories, and it was found that significantly greater percentage of male clavicles were either ‘long and robust’ or ‘long and smooth’, however, a majority of female clavicles were ‘short and smooth’. In majority of males, the inner end was either oblong or irregular in shape, but in the females, no particular shape could be assigned as all shapes were equally distributed in the studied sample (triangular shape was not sub-categorized by Ray44). In the present study, a majority of male as well as female clavicles had round or oval shaped inner ends and these differences were statistically highly significant. Coraco-clavicular facet was found to be present more in males than females44,46, but some other earlier studies13,14 as well as present study detected no statistically significant difference in occurrence of this facet in the two sexes.. Indians (present study) have a greater manifestation of coracoclavicular facet on their clavicles than the Japanese44, South Africans14 Australians aborigines44, Italians16 and the previous Indian study13. So the present study supports the earlier findings that this facet is more common in Asians than Europeans or Africans16, 47,48 ,but, Nalla and Asvat[14 denied any such generalization. If present, this facet is large in Indians, whereas, in Australian aborigines the facet is mostly small sized.

Almost all the subjects, in whom this facet appeared, were labourers. All the earlier studies conducted on clavicular epiphyseal union were done on either dry bones or using radiographs or computerized tomographic scans (Table 17). The present study was conducted on fresh bones obtained from the bodies of cadavers brought for autopsy and hence some difference in observations between the previous studies and the current study is expected. The large sample size of the present study ensures that there is no error in the interpretation of the findings of the study. In the present study, the earliest age at which the process of union was observed was 18 years which is in agreement with the observations of most of the previous studies except for the observation of Kreitner et al.24, where the age was found to be 16 years. The difference could be probably due to the difficulty in reading the CT scans which were used for the study conducted by Kreitner et al.24 There is however, some disagreement on the latest age when partial union was observed. The current study shows the latest age when partial union is observed as 31 years which is higher than the latest age observed in almost all the earlier studies except the observation of Webb and Suchey20 on female clavicles, where the latest age at which partial fusion was observed was seen to be 33 years. The lowest observation of 24 years was reported by Galstaun49 and Jit and Kulkarni18, both the later studies having been conducted using radiographs on different Indian populations. The other study by Flecker50 using radiographs was conducted on Australian popula-

tion and also gives almost a similar observation i.e., 25 years as latest age of partial fusion. As observed by other workers, conventional radiographs of medial clavicular epiphyses used for the purpose of aging the living individuals are often suboptimal because of overlapping ribs, vertebrae and mediastinal shadows51,52 as these structures may prevent the exact determination of stage of medial epiphyseal development49,53. Hence, probably the difference was observed. Similarly, complete union in all cases was seen at 32 years of age, which is later than the observations of all the previous studies. Again, the observations made in other studies using radiographs returned the lowest age for complete union in 100 percent cases. Wherever, the gender difference in fusion has been studied, it has been observed that complete union occurs earlier in the females as compared to males by around one year. The present study findings in this aspect are in agreement with those of other studies, but the age of complete fusion has been observed to be higher than other studies. Only one other study20 gives the latest age of complete union to be earlier in males than in females. The studied population however, was an American population. Recent studies on American populations have yielded different results. The differences in age for different stages of epiphyseal union of the clavicle as given by different authors including the present study could, perhaps, be attributed to different methodologies of data collection and/or scoring techniques.

Volume 1 - Number 1 - 2010

Conclusions The differential distribution of nonmetric traits in different populations and also in different genders may be basically due to some environmental factors, genetic variations or habitual activity patterns. In the present study, from the descriptive statistics for the frequencies of occurrence in two age-groups of both the sexes of 10 non-metric traits of the clavicle, it was found that rhomboid fossa and perforations were present with greater frequency in males and particularly the right clavicles. No relationship was noticed between age of the subjects and incidence of rhomboid fossa. The Indian populations were found to have greater incidence of rhomboid fossa and coraco-clavicular facet than other western populations as, probably, the former do more strenuous manual work. The males had prominently demarcated and large-sized sub-clavian groove. A single nutrient foramen was present, but with a lower percentage than the Australian aborigines. Nonmetric traits such as perforations, nutrient foramen and deltoid tubercle were observed to be present in more than 50% male cases but absent in females, but no significant difference was noticed in case of conoid tubercle.. A majority of male clavicles were long and robust or long and smooth, while those of females were short and smooth. Majority of collar bones of two genders were having round or oval shaped inner ends. No sexual dimorphism was found in incidence of coraco-clavicular facet and almost all the clavicles with this facet belonged to laborers or farmers. Most clavicles

Journal of Osteology and Biomaterials

of both sexes showed complete fusion but earliest complete fusion was seen one year earlier in females than the males. Complete fusion in cent percent cases was later in the males of present study than the observations of all the previous studies, though it was just similar in females.. All the non-metric traits, except conoid tubercle, coracoclavicular facet and stage of epiphyseal union reveal, significant sex differences for one side (rhomboid fossa, sub-clavian groove, shape of sternal end) or both sides (perforations, nutrient foramen, deltoid tubercle, type of clavicle) of clavicle. Significant age differences were observed for different stages of epiphyseal union and coracoclavicular facet in both side clavicles of two sexes but only for male bones both sides and female left bones for the â&#x20AC;&#x2DC;type of clavicleâ&#x20AC;&#x2122;. Other traits showed age differences either for left or for right side of male or female clavicles. Conflict of interests: There is no conflict of interests

4. White TD. Human osteology. 2nd edition. 2000. San Diego: Academic Press 5. Berry AC. Factor affecting the incidence of non-metric skeletal variants. J Anat 1975;120: 519-535. 6. Chawla S, Mukerjee P. Unilateral rhomboid fossa: a case report. Ind J Radiol 1970;24:51-51. 7. Goldenberg DB, Brogdon BG. Congenital anomalies of the pectoral girdle, demonstrated by chest radiography. J Can Assoc Radiol 1970;18:472-477. 8. Srivastava U, Bahl I, Kaul M, Garg K, Barry K.. Rhomboid fossa-an anatomical study. Ind J Radiol 1977;31:209-10. 9. Jit I, Kaur H. Rhomboid fossa in the clavicles of North Indians. Am J Phys Anthropol 1986;70:97-103. 10. Rogers NL, Flournoy LE, McCormick. The rhomboid fossa of the clavicle as a sex and age estimator. J Forensic Sci 2000; 45(1):61-67. 11. Ray LJ. Metrical and non-metrical features of the clavicle of the Australian aboriginal. Am J Phys Anthropol 1959; 17:217-226. 12. Mays S, Steel J, Ford M. Directional asymmetry in the human clavicle. Int J Osteoarchaeol 1999; 9:18-28. 13. Kaur H, Jit I. Brief communication: coracoclavicular joint in northwest Indians. Am J Phys Anthropol. 1991; 85: 457-460. 14. Nalla S, Asvat R. Incidence of coracoclavicular joint in South African populations. J Anat. 1995; 186:645-649. 15. Cho BP, Kang HS. Articular facets of the coraco-clavicular joint in Koreans. Acta Anat. 1998;163:56-62.

References 1. El-Najjar M, Mc Williams RK. Forensic anthropology: The structure, morphology, and variation of human bone and dentition. Springfield: Charles C. Tomas; 1978. 2. Haas J. Standards: For data collection from human skeletal remains, proceedings of a seminar at the Field Museum of Natural History. In Buikstra JE and Ubelaker DH, (eds). Arkansas Archaeological Survey Research Series No. 44. 1994; Fayetteville Ark: Arkansas Archaeological Survey. 3. Mays S. The archaeology of human bones. London: Routledge, 1998.

16. Gumina S, Salvatore M, Santis PD, Orsina L, Postacchini F. Coracoclavicular joint: osteologic study of 1020 human clavicles. J Anat 2002;201:513-19. 17. Mc Kern TW, Stewart TD. Skeletal age changes in young American Males: analyzed from the standpoint of age identification Headquarters Quartermaster Research and Development Command Technical report EP 1957:45. 18. Jit I, Kulkarni M. Times of appearance and fusion of epiphysis at the medial end of the clavicle. Ind J Med Res 1976;64 (5):773782.

19. Szilvassy J. Age determinations on the sternal auricular faces of the clavicula. J Hum Evol 1980;9: 609-610. 20. Webb PO, Suchey JM. Epiphyseal union of anterior iliac crest and medial clavicle in a modern multiracial sample of American males and females. Am J Phys Anthropol 1985; 68: 457-66. 21. Mc Laughlin SM. Epiphyseal fusion at the sternal end of clavicle in a modern Portuguese skeletal sample. Antropol Port 1990;8:59-68. 22. Black S, Scheuer B. Age changes in the clavicle: from the early neonatal period to skeletal maturity. Int J Osteoarchaeol 1996;6:425-434. 23. Ji L, Terazawa K, Tsukamoto T, Haga K. Estimation of age from epiphyseal union degrees of the sternal end of the clavicle. Hokkaido Igaku Zasshi 1994;69(1):104-111. 24. Kreitner KF, Schweden FJ, Riepert T, Nafe B, Thelen M. Bone age determination based on the study of the medial extremity of the clavicle. Eur Radiol 1998;8:1116-1122. 25. Schulz R, Miihler M, Mutze S, Schmidt S, Reisinger W, Schmeling A Studies on the time frame for ossification of the medial epiphyses of the clavicle as revealed by CT scans. Int J Legal Med 2005;119(3):142-145. 26. Schulze D, Rother U; Fuhrmann A, Richel S, Faulmann G, Heiland M. Correlation of age and ossification of the medial clavicular epiphysis using computed tomography. Forensic Sci Int 2006;158:184-189. 27. Mühler M, Schulz R, Schmidt S, Schmeling A, Reisinger W. The influence of slice thickness on assessment of clavicle ossification in forensic age diagnostics. Int J Legal Med 2006;120:15-17. 28. Kellinghaus M, Schulz R, Vieth V, Schmidt S, Schmeling A. Forensic age estimation in living subjects based on the ossification status of the medial clavicular epiphysis as revealed by thin-slice multi-detector computed tomography. Int J Legal Med 2009; DOI 10.1007/s00414-009-0398-8.

nasi zone. J Anat Soc India 1968;17: 89-100. 31. Singh D, Jit I. Identification of sex from the volume of the clavicle. J Anat Soc Ind 1996;45(2):119-124. 32. Singh D, Jit I. Sexing the adult clavicle of Chandigarh zone. J Ind Acad Forensic Med. 1999; 21(1):3-14. 33. Sayee R, Janakiram S, Rajangam RK, Thomas IM. Clavicle: a metrical study. J Ind Acad Forensic Sci. 1992;31(2):24-29. 34. Kaur K, Sidhu SS, Kaushal S, Kaur B. Sexing the northwest Indian adult clavicles of Patiala zone. J Anat Soc India 1997;46(2):121-130. 35. Patel J, Shah GV. Sexing of known human adult clavicles in Gujarat zone. 51st proceedings of Anatomical Society of India, at NHLM Medical College, Ahamdabad; 2004;53(1):31-66 36. Fenton TW, Birkby WH, Cornelison J. A fast and safe non-bleaching method for forensic skeletal preparations. J Forensic Sci 2003;48(2): 274-276. 37. Williams PL, Warwick R, Dyson M, Bannister LN. Gray’s Anatomy. 37th edition Churchill Livingstone, 1989. 38. Carroll SE. A study of the nutrient foramina of the humeral diaphysis. J Bone Joint Surg 1963;45-B:176-181. 39. Schaefer MC. A summary of epiphyseal union timings in Bosnian males. Int J Osteoarchaeol. 2008; 18(5):536-545. 40. Humphrey LT, Dean MC, Stringer CB. Morphological variation in great ape and modern human mandibles. J Anat 1999;195:491–513. 41. Wood BA, Willoughby C. Intra-specific variation and sexual dimorphism in cranial and dental variables among higher primates and their bearing on the hominid fossil record. J Anat 1991;174:185-205

29. Jit I, Singh S. The sexing of the adult clavicles. Ind J Med Research 1966;54(6):551571.

42. Prado FB, Santos LSM, Caria PFH, Kawaguchi JT, Preza AOG, Jnr ED, Silva RI, Daruge E. Incidence of clavicular rhomboid fossa (impression for costoclavicular ligament) in a Brazilian population:Forensic application. Jr Forensic Odontostomatol 2009;27(1):12-16.

30. Singh S, Gangrade KC. The sexing of adult clavicles demarking points for Vara-

43. Longia GS, Agarwal AK, Thomas RJ, Jain PN, Saxena SK. Metrical study of

rhomboid fossa of clavicle. Anthropol Anz 1982;40:111-115. 44. Parsons FG. On the proportions and characteristics of the modern English clavicle. J Anat 1916;51:71-93. 1. Shauffer IA, Collins WV. The deep clavicular rhomboid fossa. J Am Med Assoc 1966;195:158-159. 46. Lewis OJ. The coracoclavicular joint. J Anat 1959;93:296-303 47. Abe K. On the coraco-clavicular joint and its incidence. Acta Anat Nippon 1964;39:227-231. 48. Cockshott WP. The coraco-clavicular joint. Diagn Radiol 1979;131:313-316. 49. Galstaun G. A study of ossification as observed in Indian subjects. Indian J Med Research 1937;25:267-324. 50. Flecker H. Roentgenographic observations of the times of appearance of epiphyses and their fusion with the diaphyses. J Anat 1933;67:118-164. 51. Destouet JM, Gilula LA, Morphy WA, Sagel SS. Computed tomography of the sterno-clavicular joint and sternum. Radiology 1981;138:123-128. 52. Lucet L, LeLoet X, Ménard JF, Mejjad O, Louvel JP, Janvresse A, Dragon A. 1996. Computed tomography of the normal sterno-clavicular joint. Skeletal Radiol 25:237241 53. Flecker H. Time of appearance and fusion of ossification centers as observed by roentgenographic methods. Am J Radiol 1942;47:97-159 54. Todd TW, D’Errico J. The clavicular epiphyses. Am J Anat 1928; 41:25-50. 55. Schaefer MC, Black SM. Comparison of ages of epiphyseal union in North American and Bosnian skeletal material. J Forensic Sci 2005;50(4):777-784. 56. Schaefer MC, Black SM. Epiphyseal union sequencing: aiding in the recognition and sorting of commingled remains. J Forensic Sci 2007;52(2):277-285.

Volume 1 - Number 1 - 2010

BioCRA

Original article

Calcium sulfate acts on stem cells derived from peripheral blood Vincenzo Sollazzo,1 Annalisa Palmieri,2 Luca Scapoli,3 Marcella Martinelli,3 Ambra Girardi,3 Furio Pezzetti,3 Francesca Farinella,2 Francesco Carinci2*

Calcium sulfate (CaS) is a highly biocompatible material and enhances bone formation in vivo. However, how CaS alters osteoblast activity to promote bone formation is incompletely understood. To study how CaS can induce osteoblast differentiation in mesenchymal stem cells, the expression levels of bone related genes and mesenchymal stem cell markers were analyzed, using real time Reverse Transcription-Polymerase Chain Reaction. CaS causes a significant induction of the bone related genes osteopontin (SPP1), osteocalcin (BGLAP) and collagen, type III, alpha 1 (COL3A1). The expression of ENG and FOSL1 were not significantly changed in stem cells treated with CaS respect to untreated cells, while RUNX1, COL1A1 and ALPL were significantly down expressed. The results obtained lend to a better understand of the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects. (J Osteol Biomat 2010; 1:55-60)

Key words: calcium sulfate, gene expression, stem cells, bone regeneration. Orthopedic Clinic, University of Ferrara, Ferrara, Italy; Department of Maxillofacial Surgery, University of Ferrara, Ferrara, Italy; 3 Department of Histology, Embryology and Applied Biology, University of Bologna, Bologna, Italy;â&#x20AC;? 1 2

Corresponding author: *Prof. Francesco Carinci, MD Department of D.M.C.C.C. University of Ferrara Corso Giovecca, 203 - 44100 Ferrara (Italy) Phone/Fax : 0039-0532-455582 E-mail: crc@unife.it - Web: www.carinci.org

Introduction Several graft materials have been proposed in implants dentistry. Autogenous bone is the gold standard but usually donor oral sites have a limited amount of graft material. Consequently, surgeons harvest bone from extraoral sites with increased morbidity and the need for general anesthesia1,2. An alloplastic material avoids the need for a second surgical field but it should be safe, resorbable, able to maintain space, and cheap3,4. Calcium sulfate (CaS) is highly biocompatible and it is one of the synthetic grafts with the longest clinical history (more than 100 years)5-12. It has been utilized in treating periodontal disease, endodontic lesions, alveolar bone loss, and maxillary sinus augmentation3,4,13-18. CaS has been used as a membrane to facilitate healing and to prevent the loss of other grafting materials19. When associated with other bone grafts it seems to have a favorable effect on osteogenesis2,20. CaS rapidly resorbs and leaves a calcium phosphate lattice which promotes osteogenic activity21,22. Ricci et al.23 demonstrated that CaS induces new bone formation in dogs after 2 weeks and that it is almost completely resorbed after 1 month. In previous studies we carried out a

Volume 1 - Number 1 - 2010

genome wide screen of osteoblast-like cell line (MG-63) following treatment with CaS, using cDNA microarray. Several genes covering a broad range of functional activities, like signal transduction, differentiation, cell-cycle regulation, were significantly up-regulated24. Then the genetic effect of CaS was studied in the same cell system at posttranscriptional level, with microRNA microarray25. We identified miRNA that regulates the transduction of genes related to bone formation (TFIP11), skeletal development (MSX1, ADAMTS4, DLX5 FGFR1 COMP EN1 SHOX), cartilage remodeling (MATN1) and ossification (BMP1, BMP7, ALPL, PTH). Because few reports analyze the genetic effects of CaS on stem cells26, the expression of genes related to osteoblast differentiation were analyzed using cultures of mesenchymal stem cells derived from peripheral blood (PBhMSCs) treated with CaS. To investigate the osteogenic differentiation of PB-hMSCs, the quantitative expression of the mRNA of specific genes, like transcriptional factor (RUNX2), bone related genes (SPP1, COL1A1, COL3A1, BGLAP, ALPL, and FOSL1) and mesenchymal stem cells marker (ENG) were examined by means of real time Reverse Transcription-Polymerase Chain Reaction (real time RT-PCR).

Journal of Osteology and Biomaterials

Materials and Methods a) Stem preparation PB-hMSCs were obtained for gradient centrifugation from peripheral blood of healthy anonymous volunteers, using the Acuspin System-Histopaque 1077 (Sigma Aldrich, Inc., St Louis, Mo, USA). Firstly, 30 ml of heparinizated peripheral blood were added to the Acuspin System-Histopaque 1077 tube and centrifugated at 1000 x g for 10 minutes. After centrifugation the interface containing mononuclear cells was transferred in another tube, washed with PBS and centrifuged at 250 x g per 10 minutes. The enriched mononuclear pellets was resuspended in 10 ml of Alphamem medium (Sigma Aldrich, Inc., St Louis, Mo, USA) supplemented with antibiotics (Penicillin 100 U/ml and Streptomycin 100 micrograms/ml Sigma, Chemical Co., St Louis, Mo, USA) and amminoacids (L-Glutamine - Sigma, Chemical Co., St Louis, Mo, USA). The cells were incubated at 37°C in a humidified atmosphere with 5% CO2 Medium was changed after 24 hours. PB-hMSC were selected for adhesiveness and characterized as stem cells by immunoflorescence. b) Immunofluorescence Cells were washed with PBS for three times and fixed with cold methanol for 5 min at room temperature. After washing with PBS, cells were blocked with bovine albumin 3% (Sigma Aldrich, Inc., St Louis, Mo, USA) for 30 min at room temperature. The cells were incubated overnight sequentially at 4 °C with primary antibodies raised against CD105 1:200, mouse (BD Biosciences,

San Jose, CA, USA), CD73 1:200, mouse (Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA), CD90 1:200, mouse (Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA), CD34 1:200, mouse (Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA). They were washed with PBS and incubated for 1 h at room temperature with secondary antibody conjugated-Rodamine goat anti-mouse 1:200 (Santa Cruz Biotecnology, Inc., Santa Cruz, CA, USA). Subsequently, cells were mounted with the Vectashield Mounting Medium with DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) and observed under a fluorescence microscope (Eclipse TE 2000-E, Nikon Instruments S.p.a., Florence, Italy). c) Cell culture PB-hMSCs at second passage were cultured in Alphamem medium (Sigma Aldrich, Inc., St Louis, Mo, USA) supplemented with 10% fetal calf serum, antibiotics (Penicillin 100 U/ml and Streptomycin 100 micrograms/ml Sigma Aldrich, Inc., St Louis, Mo, USA) and amminoacids (L-Glutamine - Sigma Aldrich, Inc., St Louis, Mo, USA). The cells were incubated at 37°C in a humidified atmosphere with 5% CO2. For the assay, cells were collected and seeded at a density of 1x105 cells/ml into 9 cm2 (3ml) wells by using 0.1% trypsin, 0.02% EDTA in Ca++ - and Mg – free Eagle’s buffer for cell release. One set of wells were added with CaS (Surgiplaster, Classimplant, Rome, Italy) at the concentration of 0.001 mg/ ml. Another set of wells containing untreated cells were used as control. The medium was changed every 3 days.

After seven days, when cultures were sub-confluent, cells were processed for RNA extraction. d) RNA processing Reverse transcription to cDNA was performed directly from cultured cell lysate using the TaqMAn Gene Expression Cells-to-Ct Kit (Ambion Inc., Austin, TX, USA), following manufacturer’s instructions. Briefly, cultured cells were lysed with lysis buffer and RNA released in this solution. Cell lysate were reverse transcribed to cDNA using the RT Enzyme Mix and appropriate RT buffer (Ambion Inc., Austin, TX, USA). Finally the cDNA was amplified by realtime PCR using the included TaqMan Gene Expression Master Mix and the

specific assay designed for the investigated genes. e) Real time PCR Expression was quantified using real time RT-PCR. The gene expression levels were normalized to the expression of the housekeeping gene RPL13A and were expressed as fold changes relative to the expression of the untreated PB-hMSCs. Quantification was done with the delta/ delta calculation method27. Forward and reverse primers and probes for the selected genes were designed using primer express software (Applied Biosystems, Foster City, CA, USA) and are listed in Table 1. All PCR reactions were performed in a 20 µl volume using the ABI PRISM 7500

(Applied Biosystems, Foster City, CA, USA). Each reaction contained 10 µl 2X TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA, USA), 400 nM concentration of each primer and 200 nM of the probe, and cDNA. The amplification profile was initiated by 10-minute incubation at 95°C, followed by two-step amplification of 15 seconds at 95°C and 60 seconds at 60°C for 40 cycles. All experiments were performed including non-template controls to exclude reagents contamination. PCRs were performed with two biological replicates.

Gene symbol

Gene name

Primer sequence (5’>3’)

Probe sequence (5’>3’)

SPP1

osteopontin

F-GCCAGTTGCAGCCTTCTCA R-AAAAGCAAATCACTGCAATTCTCA

CCAAACGCCGACCAAGGAAAACTCAC

COL1A1

collagen type I alpha1

F-TAGGGTCTAGACATGTTCAGCTTTGT R-GTGATTGGTGGGATGTCTTCGT

CCTCTTAGCGGCCACCGCCCT

RUNX2

runt-related transcription factor 2

F-TCTACCACCCCGCTGTCTTC R-TGGCAGTGTCATCATCTGAAATG

ACTGGGCTTCCTGCCATCACCGA

ALPL

alkaline phospatasi

F-CCGTGGCAACTCTATCTTTGG R-CAGGCCCATTGCCATACAG

CCATGCTGAGTGACACAGACAAGAAGCC

COL3A1

collagen, type III, alpha 1

F-CCCACTATTATTTTGGCACAACAG R-AACGGATCCTGAGTCACAGACA

ATGTTCCCATCTTGGTCAGTCCTATGCG

BGLAP

osteocalcin

F-CCCTCCTGCTTGGACACAAA R-CACACTCCTCGCCCTATTGG

CCTTTGCTGGACTCTGCACCGCTG

CD105

endoglin

F-TCATCACCACAGCGGAAAAA R-GGTAGAGGCCCAGCTGGAA

TGCACTGCCTCAACATGGACAGCCT

FOSL1

FOS-like antigen 1

F-CGCGAGCGGAACAAGCT R-GCAGCCCAGATTTCTCATCTTC

ACTTCCTGCAGGCGGAGACTGACAAAC

RPL13A

ribosomal protein L13

F-AAAGCGGATGGTGGTTCCT R-GCCCCAGATAGGCAAACTTTC

CTGCCCTCAAGGTCGTGCGTCTG

Table 1. Primer and probes used in real time PCR

Volume 1 - Number 1 - 2010

Results PB-hMSCs were characterized by immunofluorescence. The cell surfaces were positive for mesenchymal stem cell markers, CD105, CD90 and CD73 and negative for marker of hematopoietic origin, CD34 (Figure 1). Transcriptional expressions of several osteoblast-related genes (RUNX2, SPP1, COLIA1, COL3A1, BGLAP, ALPL and FOSL1) and mesenchymal stem cells marker (ENG) were examined after 7 days of supplement treatment with CaS (0.001 mg/ml). CaS enhanced the expression of bone related genes like COL3A1, BGLAP and SPP1. The treatment did not affect the mRNA expression of ENG and FOSL1 that were similarly in both treated and untreated PB-hMSCs. RUNX2, COL1A1 and ALPL were decreased in the presence of CaS at day 7.

Figure 1. PB-hMSCs by indirect immunofluorescence (Rodamine). Cultured cells were positive for the mesenchymal stem cell marker CD73 (b), CD90 (c), CD105 (d) and negative for the hematopoietic markers CD34 (a). Nucleuses were stained with DAPI. Original magnification x40.

Discussion CaS is a highly biocompatible material5-12. Solidified or crystallized CaS is very osteogenic in vivo. As the surface of CaS dissolves in body fluids, the calcium ions form calcium phosphate that re-precipitates on the surface forming an osteoblast “friendly” environment. How this “friendly” environment alters osteoblast activity to promote bone formation is incompletely understood. In order to get more inside how CaS acts on PB-hMSCs, changes in expression of bone related marker genes (RUNX2, SPP1, COLIA1, COL3A1, BGLAP, ALPL and FOSL1) and mesenchymal stem cells marker (ENG) were investigated by real-time RT–PCR. Mesenchymal stem cells (MSCs) are defined as self-renewable, multipotent progenitors cells with the ability

to differentiate, under adequate stimuli, into several mesenchymal lineages, including osteoblasts28. In our study, mesenchymal stem cells from human peripheral blood were isolated and characterized by morphology and immunophenotype. Isolated PB-hMSCs showed fibroblast-like morphology and were positive for MSCs surface molecules (CD90, CD105, CD73) and negative for markers of haematopoietic progenitors (CD34). After 7 day of treatment with CaS the expression levels of osseodifferentiation genes were measured by relative quantification methods using real-time RT–PCR. Two osteoblast-specific genes, SPP1 (an acid phosphoprotein involved in regulation of bone mineralization) and BGLAP (a bone specific protein in-

Journal of Osteology and Biomaterials

volved in mineralization and bone resorption), that are generally express by osteoblasts in the early stages of their differentiation29 were significantly upregulate in treated PB-hMSCs. Expression of ENG and FOSL1 didn’t have significant change in treated cells respect to control after 7 day of treatment with CaS. ENG (CD105) is a surface markers used to define a bone marrow stromal cell population capable of multilineage differentiation30. This gene is a receptor for TGF-β1 and -β331 and modulates TGF-β signaling by interacting with related molecules, such as TGF-β1, -β3, BMP-2, -7, and activin A. It is speculated that these members of the TFG-β superfamily are mediators of cell proliferation and differentiation and play regulatory roles in cartilage and bone formation32. The

Log10 (Reltive Quantification)

disappearance of the CD105 antigen during osteogenesis suggests that this protein, like others in the TFG-β superfamily, is involved in the regulation of osteogenesis33. FOSL1 that encodes for Fra-1, a component of the dimeric transcription factor activator protein-1 (Ap1), which is composed mainly of Fos (cFos, FosB, Fra-1 and Fra-2) and Jun proteins (c-Jun, JunB and JunD). AP-1 sites are present in the promoters of many developmentally regulated osteoblast genes, including alkaline phosphatase and collagen I. McCabe et al.34 demonstrated that differential expression of Fos and Jun family members could play a role in the developmental regulation of bone-specific gene expression and, as a result, may be functionally significant for osteoblast differentiation. Kim et al.35 studying the effect of a new anabolic agents that stimulate bone formation, find that this gene is activated in the late stage of differentiation, during the calcium deposition. In our study FOSL1 and ENG were weakly down- and up-regulated respectively, probably because cells were at early stage of differentiation. RUNX2 and ALPL were down regulated in treated cells respect to control after 7 day of treatment with CaS. RUNX2 is the most

Detectors

Figure 2. Gene expression analysis of PB-hMSCs after 7 days of treatment with CaS.

specific osteoblast transcription factor and is a prerequisite for osteoblast differentiation and consequently mineralization. This result is comparable with data reported by Kim et al.36 They showed that there was no BMP-2-mediated up-regulation of RUNX2 mRNA expression at days 3 or 736. Alkaline phosphatase regulates mineralization of bone matrix. Several studies demonstrated that the potency of individual substances to induce alkaline phosphatase varies in a species-dependent manner. Glucocorticoids such as dexamethasone are potent inducers in human and rat stromal cells, but they have no effect on alkaline phosphatase activity in mouse stromal cells37,38. On the contrary, bone morphogenetic proteins (BMPs) are potent inducers of osteogenesis in both mouse and rat bone marrow stromal cells39 but Diefenderfer et al showed that BMP-2 alone is a poor osteoblast inducer in human marrow derived stromal cells40. CaS also modulates the expression of genes encoding for collagenic extracellular matrix proteins like collagen type 1α1 (COL1A1). Collagen type1 is the most abundant in the human organism41. In our study COL1A1 is significantly down expressed as compared to the control when exposed to CaS probably because this gene is activated in the late stage of differentiation and are related to extracellular matrix synthesis. On the contrary, COL3A1 was up-regulated in treated cells respect to control. COL3A1 encodes the pro-alpha1 chains of type III collagen, a fibrillar collagen that is found in extensible connective tissues42.

Conclusions The present study shows the effect of CaS on PB-hMSCs in the early differentiation stages: CaS is an inducer of osteogenesis on human stem cells as demonstrated by the activation of bone related genes: osteopontin (SPP1), osteocalcin (BGLAP) and COL3A1. Moreover, we chose to perform the experiment after 7 days in order to get information on the early stages of stimulation. It is our understanding, therefore, that more investigations with different time points are needed in order to get a global comprehension of the molecular events related to CaS action. The reported model is useful to investigate the effects of different substances on stem cells. Acknowledgments This work was supported by FAR from the University of Ferrara (FC), Ferrara, Italy, and from Regione Emilia Romagna, Programma di Ricerca Regione Università, 2007–2009, Area 1B: Patologia osteoarticolare: ricerca pre-clinica e applicazioni cliniche della medicina rigenerativa, Unità Operativa n. 14.

References 1. Guarnieri R, Bovi M. Maxillary sinus augmentation using prehardened calcium sulfate: a case report. Int J Periodontics Restorative Dent 2002;22:503-8. 2. Macneill SR, Cobb C M, Rapley J W, Glaros a G, Spencer P. In vivo comparison of synthetic osseous graft materials. A preliminary study. J Clin Periodontol 1999;26:239-45. 3. Pecora G, De Leonardis D, Ibrahim N, Bovi M, Cornelini R. The use of calcium sulphate in the surgical treatment of a ‘through and through’ periradicular lesion. Int Endod J 2001;34:189-97. 4. Yoshikawa G, Murashima Y, Wadachi R, Sawada N, Suda H. Guided bone regeneration

Volume 1 - Number 1 - 2010

(GBR) using membranes and calcium sulphate after apicectomy: a comparative histomorphometrical study. Int Endod J 2002;35:255-63. 5. Alderman N. Sterile plaster of Paris as an implant in the infrabony environment: a preliminary study. J Periodontol 1969;40:11-13. 6. Alexander DI, Manson NA, Mitchell MJ. Efficacy of calcium sulfate plus decompression bone in lumbar and lumbosacral spinal fusion: preliminary results in 40 patients. Can J Surg 2001;44:262-6. 7. Gitelis S, Piasecki P, Turner T, Haggard W, Charters J, Urban R. Use of a calcium sulfatebased bone graft substitute for benign bone lesions. Orthopedics 2001;24:162-6. 8. Peltier LF. The use of plaster of Paris to fill large defects in bone. Am J Surg 1959;97:311. 9. Pietrzak WS, Ronk R. Calcium sulfate bone void filler: a review and a look ahead. J Craniofac Surg 2000;11:327-33; discussion 34. 10. Shaffer CD, App GR. The use of plaster of paris in treating infrabony periodontal defects in humans. J Periodontol 1971;42:685-90. 11. Sottosanti JS. Calcium sulfate-aided bone regeneration: a case report. Periodontal Clin Investig 1995;17:10-5. 12. Coetzee a S. Regeneration of bone in the presence of calcium sulfate. Arch Otolaryngol 1980;106:405-9. 13. Bier SJ, Sinensky MC. The versatility of calcium sulfate: resolving periodontal challenges. Compend Contin Educ Dent 1999;20:655-61; quiz 62. 14. Kim CK, Kim HY, Chai JK, Cho KS, Moon IS, Choi SH, Sottosanti JS, Wikesjo U M. Effect of a calcium sulfate implant with calcium sulfate barrier on periodontal healing in 3-wall intrabony defects in dogs. J Periodontol 1998;69:982-8. 15. Orsini M, Orsini G, Benlloch D, Aranda JJ, Lazaro P, Sanz M, De Luca M, Piattelli A. Comparison of calcium sulfate and autogenous bone graft to bioabsorbable membranes plus autogenous bone graft in the treatment of intrabony periodontal defects: a split-mouth study. J Periodontol 2001;72:296-302. 16. Pecora G, Baek SH, Rethnam S, Kim S. Barrier membrane techniques in endodontic microsurgery. Dent Clin North Am 1997;41:5817. 17. Pecora GE, De Leonardis D, Della Rocca C, Cornelini R, Cortesini C. Short-term healing following the use of calcium sulfate as a grafting material for sinus augmentation: a clinical report. Int J Oral Maxillofac Implants 1998;13:866-73. 18. Kelly CM, Wilkins RM, Gitelis S, Hartjen C, Watson JT, Kim P T. The use of a surgical grade calcium sulfate as a bone graft substitute: results of a multicenter trial. Clin Orthop Relat Res 2001;42-50.

Journal of Osteology and Biomaterials

19. Maragos P, Bissada NF, Wang R, Cole BP. Comparison of three methods using calcium sulfate as a graft/barrier material for the treatment of Class II mandibular molar furcation defects. Int J Periodontics Restorative Dent 2002;22:493-501. 20. Al Ruhaimi KA. Effect of adding resorbable calcium sulfate to grafting materials on early bone regeneration in osseous defects in rabbits. Int J Oral Maxillofac Implants 2000;15:859-64. 21. Damien CJ, Ricci JL, Christel P, Alexander H, Patat JL. Formation of a calcium phosphate-rich layer on absorbable calcium carbonate bone graft substitutes. Calcif Tissue Int 1994;55:151-8. 22. Tay BK, Patel VV, Bradford D S. Calcium sulfate- and calcium phosphate-based bone substitutes. Mimicry of the mineral phase of bone. Orthop Clin North Am 1999;30:615-23. 23. Ricci JL, Nadkarni P, Hawkins M, Turner J, Rosenblum S, Brezenoff L, De Leonardis D, Pecora G. Biological mechanisms of calcium sulfate replacement by bone ed. J.E. Davies. 2000, Toronto: Em Squared Incorporated. 332-44. 24. Carinci F, Piattelli A, Stabellini G, Palmieri A, Scapoli L, Laino G, Caputi S, Pezzetti F. Calcium sulfate: analysis of MG63 osteoblast-like cell response by means of a microarray technology. J Biomed Mater Res B Appl Biomater 2004;71:260-7. 25. Palmieri A, Pezzetti F, Brunelli G, Scapoli L, Lo Muzio L, Scarano A, Martinelli M, Carinci F. Calcium sulfate acts on the miRNA of MG63E osteoblast-like cells. J Biomed Mater Res B Appl Biomater 2008;84:369-74. 26. Lazary A, Balla B, Kosa JP, Bacsi K, Nagy Z, Takacs I, Varga PP, Speer G, Lakatos P. Effect of gypsum on proliferation and differentiation of MC3T3-E1 mouse osteoblastic cells. Biomaterials 2007;28:393-9. 27. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8. 28. Alhadlaq A, Mao JJ. Mesenchymal stem cells: isolation and therapeutics. Stem Cells Dev 2004;13:436-48. 29. Lian Jb a J. Bone formation: maturation and functional activities of osteoblast lineage cells, in Primer on the metabolic bone diseases and disorders on mineral metabolism, M.J. Favus, Editor. 2003, The American Society for Bone and Mineral Research: Washington p. 13-28. 30. Pittenger MF, Mackay aM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143-7. 31. Barry FP, Boynton RE, Haynesworth S, Murphy JM, Zaia J. The monoclonal antibody SH-2,

raised against human mesenchymal stem cells, recognizes an epitope on endoglin (CD105). Biochem Biophys Res Commun 1999;265:134-9. 32. Jakob M, Demarteau O, Schafer D, Hintermann B, Dick W, Heberer M, Martin I. Specific growth factors during the expansion and redifferentiation of adult human articular chondrocytes enhance chondrogenesis and cartilaginous tissue formation in vitro. J Cell Biochem 2001;81:368-77. 33. Haynesworth SE, Baber MA, Caplan a I. Cell surface antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 1992;13:69-80. 34. Mccabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR, Stein JL, Lian JB, Stein GS. Developmental expression and activities of specific fos and jun proteins are functionally related to osteoblast maturation: role of Fra-2 and Jun D during differentiation. Endocrinology 1996;137:4398-408. 35. Kim JM, Lee SU, Kim YS, Min YK, Kim SH. Baicalein stimulates osteoblast differentiation via coordinating activation of MAP kinases and transcription factors. J Cell Biochem 2008;104:1906-17. 36. Kim IS, Song YM, Cho TH, Park YD, Lee KB, Noh I, Weber F, Hwang SJ. In vitro response of primary human bone marrow stromal cells to recombinant human bone morphogenic protein-2 in the early and late stages of osteoblast differentiation. Dev Growth Differ 2008; 37. Leboy PS, Beresford JN, Devlin C, Owen ME. Dexamethasone induction of osteoblast mRNAs in rat marrow stromal cell cultures. J Cell Physiol 1991;146:370-8. 38. Beresford JN, Joyner CJ, Devlin C, Triffitt JT. The effects of dexamethasone and 1,25-dihydroxyvitamin D3 on osteogenic differentiation of human marrow stromal cells in vitro. Arch Oral Biol 1994;39:941-7. 39. Balk ML, Bray J, Day C, Epperly M, Greenberger J, Evans CH, Niyibizi C. Effect of rhBMP-2 on the osteogenic potential of bone marrow stromal cells from an osteogenesis imperfecta mouse (oim). Bone 1997;21:7-15. 40. Diefenderfer DL, Osyczka aM, Garino JP, Leboy PS. Regulation of BMP-induced transcription in cultured human bone marrow stromal cells. J Bone Joint Surg Am 2003;85-A Suppl 3:19-28. 41. Suuriniemi M, Kovanen V, Mahonen A, Alen M, Wang Q, Lyytikainen A, Cheng S. COL1A1 Sp1 polymorphism associates with bone density in early puberty. Bone 2006;39:591-7. 42. Chan TF, Poon A, Basu A, Addleman NR, Chen J, Phong A, Byers P H, Klein TE, Kwok PY. Natural variation in four human collagen genes across an ethnically diverse population. Genomics 2008;91:307-14.

Zimmer...non solo Impianti ! Puros 速 Blocco per Alloinnesto

Tapered Screw-Vent

Membrana Zimmer Socket Repair 速

Spline

Swiss Plus

CopiOs, Puros 速 Membrana Pericardica Particolato di Osso Corticale/Spongioso per Alloinnesto

One Piece

Collaborare con la natura per riempire un vuoto! Collaborare con la natura per riempire un vuoto!

Zimmer Dental Vittorio Veneto (TV) - Italy Zimmer Dental Italy Italysrl srl Via ViaMatteotti, Matteotti,9898- 31029 - 31029 Vittorio Veneto (TV) - Italy Zimmer 555573 Dental r.a. Italy srl0438 Tel.0438 Fax 553181 zimmerdental.italy@zimmer.com Via Matteotti, 98 - 31029 Vittorio Veneto (TV) - Italy Tel.0438 555573 r.a. Fax 0438 553181 zimmerdental.italy@zimmer.com

osteocom.net

2.0

The italian web network of the osteointegration community

osteoblog, the most effective system to

osteofriends, the new social forum for

receive updates on any new scientiďŹ c and technological breakthroughs by aggregating multi-user information.

central, interactive on-line sharing and management of patient treatment plans, shared by doctors, specialists, laboratories and companies.

osteovision, the added-value online

osteogate, a virtual display of goods to offer

multimedia channel for updates and interactive education for professional learning.

an online information and quick search tool to learn about the latest technology, saving time and offering a wider range of options.

NEW Highlights of the

Osteology and Biomaterials 2009 Bio.C.R.A. Meeting a r e ava i l a b l e o n DV D - R O M Bio.C.R.A.

Biomaterials Clinical and Histological R e s e a rch A s s o c i a t i o n

Speakers P r o f . I va n M a r t i n D r. S e r g i o R o s i n i P r o f . B r u n o Fr e d i a n i Prof. Claudio Ligresti D r Jo s e p h C o u k r o u n Runtime: 420 minutes I t a l i a n ve r s i o n

O n w w w. o s t e ov i s i o n . i t

Find out why we are the web leaders in Italy.

appointments April 9-10, 2010 National Osteology Symposium Cracow, Poland Information: www.osteologia.pl April 15-17, 2010 ITI World Symposium Geneva, Switzerland Information: www.iti.org/worldsymposium2010 April 21-24, 2010 2010 Annual meeting & exposition Society for Biomaterials Seattle, Washington Information: www.biomaterials.org April 30 - May 1, 2010 Annual Conference & Exhibition American Academy of Orofacial Pain Orlando, USA Information: www.aaop.org May 7, 2010 1° Congresso Nazionale Biomatariali in Chirurgia Orale BioMat-Ch Oral Roma, Italy Information: www.biomatchoral.it May 24-26, 2010 Congresso SIB 2010 Società Italiana Biomateriali Camogli (GE), Italy Information: www.biomateriali.org June 9-12, 2010 AOA’s 123rd Annual Meeting American Orthopaedic Association San Diego, California Information: www.aoassn.org June 10-13, 2010 American Academy of Periodontology Symposium on Periodontics & Restorative Dentistry Boston, Massachusetts Information: www.perio.org June 26-30, 2010 37th European Symposium on Calcified Tissues, European Calcified Tissue Society Glasgow, Scotland, Information: www.ectsoc.org June 28-30, 2010 eCM XI: Cartilage & Disc: Repair and Regeneration AO Research Institute Davos, Switzerland Information: www.ecmjournal.org June 30 - July 2, 2010 18th European Conference on Orthopaedics European Orthopaedic Research Society EORS Davos, Switzerland Information: www.eors2010.org

July 14-17, 2010 International Association for Dental Research 88th General Session & Exhibition of the IADR Barcelona, Spain Information: www.dentalresearch.org September 2-5, 2010 Annual World Dental Congress FDI World Dental Federation Salvador da Bahia, Brasil Information: www.fdiworldental.org September 9-11, 2010 ICOI World Congress International Congress of Oral Implantologists Hamburg, Germany Information: www.icoi.org September 11-15, 2010 23rd European Conference on Biomaterials ESB2010 The European Society for Biomaterials Tampere, Finland Information: www.esb2010.org September 14-18, 2010 14th International Biotechnology Symposium and Exhibition Biotechnology for the Sustainability of Human Society Rimini, Italy Information: www.ibs2010.org September 27 - October 2, 2010 92nd Annual Meeting; Scientific Sessions and Exhibition American Association of Oral & Maxillofacial Surgeons Chicago, Illinois Information: www.aaoms.org October 7-9, 2010 19th annual meeting European Association for Osseointegration Glasgow, UK Information: www.eao.org October 30 -November 2, 2010 American Academy of Periodontology 96th Annual Meeting in collaboration with the Japanese Society of Periodontology Honolulu, Hawaii Information: www.perio.org November 7-12, 2010 International Conference on the Chemistry and Biology of Mineralized Tissues Carefree, Arizona Information: www.iccbmt.org November 26-27, 2010 Bone Grafts BioCRA, Biomaterial Clinical and histological Research Association Turin, Italy Information: e-mail: info@biocra.com www.biocra.com

Volume 1 - Number 1 - 2010

Biomaterial Clinical and histological Research Association

The Meeting will have as participants eminent National and International researchers who will treat current, mainstream use and applications of bisphosphonates in dentistry and impart the SISBO guidelines for treatment of osteonecrosis of the jaw (ONJ).

With the support of the Italian Dental Association of Rome University of Rome “Tor Vergata”

www.geistlich-pharma.com

The Art of Perfection

The Art of Perfection 100 80 100 70 90 60

Cases in %

23.1 % 50.0 % 23.1 % 50.0 %

40 60 30 50 20 40 10

20 10Geistlich Bio-Gide® 0

Cross-linked collagen membrane

Complication-free healing Geistlich Bio-Gide®

Based on Tal et al. 2008.

Complication-free healing

Soft-tissue dehiscence

Cross-linked collagen membrane Soft-tissue dehiscence

Based on Tal et al. 2008.

The natural collagen structure of Geistlich Bio-Gide® The natural > provides highcollagen therapystructure safety of Geistlich Bio-Gide > provides therapy safety > leads to lesshigh dehiscence > leads tothe lessperfect dehiscence > underlies aesthetic outcome

> underlies the perfect aesthetic outcome

Covering the augmentation Covering the augmentation with Geistlich Bio-Gide®. ®

Excellent soft-tissue healing and Excellent soft-tissue healing and a perfect aesthetic outcome.

(PD Dr. R. Jung, University Zurich)

with Geistlich Bio-Gide .

(PD Dr. R. Jung, University Zurich)

(Prof. Dr. J.(Prof. Becker Dr. F./Schwarz, Dr./J.PD Becker PD Dr. F. Schwarz, University University Dusseldorf) Dusseldorf)

a perfect aesthetic outcome. (PD Dr. R. Jung, University Zurich)

LEADING LEADINGREGENERATION REGENERATION