Pulmonary Circulation Jan-Mar 2012 by Pulmonary Vascular Research Institute

COVER PHOTO: Confocal image of a remodelled small pulmonary artery in the lung of a patient with idiopathic pulmonary arterial hypertension immunostained for alpha-smooth muscle actin (green), the endothelial marker, CD31 (red) and counterstained with DAPI for cell nuclei (blue). Image courtesy of Dr. Mark Southwood, Papworth Hosital, Cambridge, UK

GENERAL INFORMATION The Journal Pulmonary Circulation (print ISSN 2045-8932, online ISSN 20458940) is a peer-reviewed journal published on behalf of the Pulmonary Vascular Research Institute (PVRI). Published quarterly in the months of March, June, September, and December the Journal publishes original research articles and review articles related to the pulmonary circulation, pulmonary vascular medicine, and pulmonary vascular disease.

Abstracting and indexing information

The Journal is indexed/listed with Caspur, DOAJ, EBSCO Publishing’s Electronic Databases, Expanded Academic ASAP, Genamics JournalSeek, Google Scholar, Hinari, Index Copernicus, OpenJGate, PrimoCentral, ProQuest, PubMed, Pubmed Central, SCOLOAR, SIIC databases, Summon by Serial Solutions and Ulrich’s International Periodical Directory.

Information for authors

There are no page charges for manuscript submissions. For details please check http://www.pulmonarycirculation.org/ contributors.asp. All manuscripts must be submitted online at www. journalonweb.com/pc.

Subscription information

Free print copies of the Journal are sent to all Fellows of the PVRI.

A year’s subscription to Pulmonary Circulation comprises 4 regular issues and one supplemental issue. Prices include postage. The annual subscription rate for nonmembers is: Institutional: USD 300.00 (or INR 3000.00) Personal: USD 50.00 (INR 1000.00)

For mode of payment and other details, please visit www.medknow. com/subscribe.asp.

Additional and special supplements may be published from time to time, and they carry additional charges. Claims for missing issues will be serviced if received within 60 days of the cover date for domestic subscribers, and within 3 months for subscribers outside India. Duplicate copies cannot be sent to replace issues not delivered because of failure to notify the Publisher, at the address shown below, of a change of address.

The Journal is published and distributed by Medknow Publications and Media Pvt. Ltd. Copies are sent to subscribers directly from the Publisher’s address. It is illegal to acquire copies from any other source. If a copy is received for personal use, one cannot resell the copy or give it away for commercial or library use.

The copies of Pulmonary Circulation to the members of the PVRI are sent by ordinary post. Neither the Publisher nor the PVRI nor the Journal’s Editorial Board will be responsible for any non-receipt of copies. If any member/subscriber wishes to receive his or her copies by registered post or courier, kindly contact the Publisher’s office. If a copy is returned due to an incomplete, incorrect, or changed address of a member/subscriber on 2 consecutive occasions, then the person’s name is deleted from the mailing list of the Journal. Providing a complete, correct and up-to-date address is the responsibility of the member/subscriber. Nonmembers: Please send change of address information to subscriptions@medknow.com.

Advertising

The Journal accepts both display and classified advertising. For prices and page positions, contact either Karen Gordon (gordonk@ uic.edu, or 312/996-5023) or Dr. Jason Yuan (jxyuan@uic.edu, or 312/355-5911). Frequency discounts and special positions are available. Inquiries about advertising may also be sent to Medknow Publications, media@medknow.com.

The Journal reserves the right to reject any advertisement considered unsuitable to the set policies of the Journal. The appearance of advertising or product information in the various sections in the Journal does not constitute an endorsement or approval by the Journal and/or the Publisher of the quality or value of the said product or of claims made for it by its manufacturer.

The entire contents of each issue of Pulmonary Circulation are protected under Indian and international copyright laws. The Journal, however, grants to all users a free, irrevocable, worldwide, perpetual right of access to, and a license to copy, use, distribute, perform and display the work publicly and to make and distribute derivative works in any digital medium for any reasonable noncommercial purpose, subject to proper attribution of authorship and ownership of the rights. The Journal also grants the right to make small numbers of printed copies for their personal noncommercial use. Individual authors retain ownership to the copyrights of their particular articles. As a mandatory part of the manuscript submission process, the author assigns First Serial Rights to the Publisher, Medknow Publications and Media Pvt. Ltd., and agrees that any subsequent publication of his or her article will end with this parenthetical statement: “(This article was first published in Pulmonary Circulation, Volume, Number [year], pages).”

Permissions

For information on how to request permissions to reproduce articles from this journal, please visit www.pulmonarycirculation.org.

Disclaimer

The information and opinions presented in the Journal reflect the views of the authors providing them and not of the Journal or its Editorial Board or the Publisher. Publication does not constitute endorsement by the Journal. Neither Pulmonary Circulation nor the Publisher nor anyone else involved in the creation, production, or delivery of Pulmonary Circulation or the materials contained therein, assumes any liability or responsibility for the accuracy, completeness, or usefulness of any information provided in Pulmonary Circulation, nor shall they be liable for any direct, indirect, special, consequential or punitive damages arising from the use of Pulmonary Circulation. Neither Pulmonary Circulation nor the Publisher nor any party in the preparation of material contained in Pulmonary Circulation represents or warrants that the information contained herein is in every respect accurate or complete, and they are not responsible for any errors or omissions or for the results obtained from the use of such material. Readers are encouraged to confirm the information contained herein with other sources.

Addresses

Editorial Office Chicago, USA Pulmonary Circulation Editorial Office University of Illinois at Chicago Ms. Christina N. Holt Email: chris88@uic.edu Website: www.pvri.info Journal website: www.pulmonarycirculation.org Published by Medknow Publications and Media Pvt. Ltd. B5-12, Kanara Business Centre, Off Link Road, Ghatkopar (East) Mumbai – 400075, India Phone: 91-22-66491818 Email: publishing@medknow.com Website: www.medknow.com Printed by Dhote Offset Technokrafts Pvt. Ltd. Jogeshwari, Mumbai, India.

Pulmonary Circulation

ISSN 2045-8932, E-ISSN 2045-8940

An official journal of the Pulmonary Vascular Research Institute Editors-in-Chief

Senior Editor

Jason X.-J. Yuan, MD, PhD (Chicago, USA) Nicholas W. Morrell, MD (Cambridge, UK) Harikrishnan S., MD (Trivandrum, India)

Ghazwan Butrous, MD (Canterbury, UK)

Kurt R. Stenmark, MD (Denver, USA) Kenneth D. Bloch, MD (Boston, USA) Stephen L. Archer, MD (Chicago, USA) Marlene Rabinovitch, MD (Stanford, USA) Joe G.N. Garcia, MD (Chicago, USA)

Editors

Stuart Rich, MD (Chicago, USA) Martin R. Wilkins, MD (London, UK) Hossein A. Ghofrani, MD (Giessen, Germany) Candice D. Fike, MD (Nashville, USA) Werner Seeger, MD (Giessen, Germany)

Scientific Advisory Board

Robert F. Grover, MD, PhD (Denver, USA) E. Kenneth Weir, MD (Mineapolis, USA) Charles A. Hales, MD (Boston, USA)

Executive Editor

Harikrishnan S., MD (Trivandrum, India) Sheila G. Haworth, MD (London, UK) Patricia A. Thistlethwaite, MD, PhD (San Diego, USA) Chen Wang, MD, PhD (Beijing, China) Antonio A. Lopes, MD, PhD (Sao Paulo, Brazil)

Joseph Loscalzo, MD (Boston, USA) John B. West, MD, PhD, DSc (San Diego, USA) Magdi H. Yacoub, MD, DSc, FRS (London, UK)

Editorial Board

Steven H. Abman, MD, USA Serge Adnot, MD, France Vera D. Aiello, MD, Brazil Almaz Aldashev, MD, PhD, Kyrgyz Republic Diego F. Alvarez, MD, PhD, USA Robyn J. Barst, MD, USA Evgeny Berdyshev, PhD, USA Michael A. Bettmann, MD, USA Jahar Bhattacharya, MD, PhD, USA Konstantin G. Birukov, MD, USA Murali Chakinala, MD, USA Navdeep S. Chandel, PhD, USA Richard N. Channick, MD, USA Hunter C. Champion, MD, USA Shampa Chatterjee, PhD, USA Xiansheng Cheng, MD, China Naomi C. Chesler, PhD, USA Augustine M.K. Choi, MD, USA Paul A. Corris, MD, UK David N. Cornfield, MD, USA Michael J. Cuttica, MD, USA Hiroshi Date, MD, PhD, Japan Regina M. Day, PhD, USA Steven M. Dudek, MD, USA Raed A. Dweik, MD, USA Yung E. Earm, MD, PhD, Korea Jeffrey D. Edelman, MD, USA Oliver Eickelberg, PhD, Germany C. Gregory Elliott, MD, USA Serpil Erzurum, MD, USA A. Mark Evans, PhD, UK Karen A. Fagan, MD, USA Barry L. Fanburg, MD, USA Harrison W. Farber, MD, USA Jeffrey A. Feinstein, MD, USA Jeffrey Fineman, MD, USA Patricia W. Finn, MD, USA Sonia C. Flores, PhD, USA Paul R. Forfia, MD, USA Robert Frantz, MD, USA M. Patricia George, MD, USA Mark W. Geraci, MD, USA Stefano Ghio, MD, Italy Mark N. Gillespie, PhD, USA

Reda Girgis, MD, USA Mark T. Gladwin, MD, USA Mardi Gomberg-Maitland, MD, USA Andy Grieve, PhD, Germany Alison M. Gurney, PhD, UK Elizabeth O. Harrington, PhD, USA C. Michael Hart, MD, USA Paul M. Hassoun, MD, USA Abraham G. Hartzema, USA Akiko Hata, PhD, USA Jianguo He, MD, China Jan Herget, MD, PhD, Czech Republic Nicholas S. Hill, MD, USA Marius M. Hoeper, MD, Germany Eric A. Hoffman, PhD, USA Yuji Imaizumi, PhD, Japan Dunbar Ivy, MD, USA Jeffrey R. Jacobson, MD, USA Roger Johns, MD, PhD, USA Peter L. Jones, PhD, USA Naftali Kaminski, MD, USA Chandrasekharan C. Kartha, MD, India Steven M. Kawut, MD, USA Ann M. Keogh, MD, Australia Nick H. Kim, MD, USA Sung Joon Kim, MD, PhD, Korea James R. Klinger, MD, USA Stella Kourembanas, MD, USA Michael J. Krowka, MD, USA Thomas J. Kulik, MD, USA R. Krishna Kumar, MD, DM, India Steven Kymes, PhD, USA David Langleben, MD, Canada Timothy D. Le Cras, PhD, USA Normand Leblanc, PhD, USA Fabiola Leon-Velarde, MD, Peru Irena Levitan, PhD, USA Jose Lopez-Barneo, MD, PhD, Spain Wenju Lu, MD, PhD, China Roberto Machado, MD, USA Margaret R. MacLean, PhD, UK Michael M. Madani, MD, USA Ayako Makino, PhD, USA Asrar B. Malik, PhD, USA

Jess Mandel, MD, USA Michael A. Matthay, MD, USA Marco Matucci-Cerinic, MD, PhD, Italy Paul McLoughlin, PhD, Ireland Ivan F. McMurtry, PhD, USA Dolly Mehta, PhD, USA Marilyn P. Merker, PhD, USA Barbara O. Meyrick, PhD, USA Evangelos Michelakis, MD, Canada Omar A. Minai, MD, USA Liliana Moreno, PhD, USA Timothy A. Morris, MD, USA Kamal K. Mubarak, MD, USA Srinivas Murali, MD, USA Fiona Murray, PhD, USA Kazufumi Nakamura, MD, PhD, Japan Norifumi Nakanishi, MD, PhD, Japan Robert Naeije, MD, Belgium Viswanathan Natarajan, PhD, USA John H. Newman, MD, USA Andrea Olschewski, MD, Austria Horst Olschewski, MD, Austria Stylianos E. Orfanos, MD, Greece Ronald J. Oudiz, MD, USA Harold Palevsky, MD, USA Lisa A. Palmer, PhD, USA Myung H. Park, MD, USA Qadar Pasha, PhD, India Andrew J. Peacock, MD, UK Joanna Pepke-Zaba, MD, UK Nicola Petrosillo, MD, Italy Bruce R. Pitt, PhD, USA Nanduri R. Prabhakar, PhD, USA Ioana R. Preston, MD, USA Tomas Pulido, MD, Mexico Soni S. Pullamsetti, PhD, Germany Goverdhan D. Puri, MD, India Rozenn Quarck, PhD, Belgium Deborah A. Quinn, MD, USA J. Usha Raj, MD, USA Amer Rana, PhD, USA Thomas C. Resta, PhD, USA Ivan M. Robbins, MD, USA Sharon I. Rounds, MD, USA

Editorial Staff

Nancy J. Rusch, PhD, USA Tarek Safwat, MD, Egypt Sami I. Said, MD, USA Julio Sandoval, MD, Mexico Maria V.T. Santana, MD, Brazil Bhagavathula K. Sastry, MD., India Anita Saxena, MD, India Marc J. Semigran, MD, USA Ralph T. Schermuly, MD, Germany Dean Schraufnagel, MD, USA Paul T. Schumacker, PhD, USA Pravin B. Sehgal, MD, PhD, USA James S.K. Sham, PhD, USA Steven D. Shapiro, MD, USA Larisa A. Shimoda, PhD, USA Robin H. Steinhorn, MD, USA Troy Stevens, PhD, USA Duncan J. Stuart, MD, Canada Yuchiro J. Suzuki, PhD, USA Victor F. Tapson, MD, USA Merryn H. Tawhai, PhD, New Zealand Dick Tibboel, MD, PhD, The Netherlands Christoph Thiemermann, MD, PhD, UK Mary I. Townsley, PhD, USA Richard C. Trembath, MD, UK Rubin M. Tuder, MD, USA Carmine D. Vizza, MD, Italy Norbert F. Voelkel, MD, USA Peter D. Wagner, MD, USA Wiltz W. Wagner, Jr., PhD, USA Jian Wang, MD, USA Jian-Ying Wang, MD, USA Jun Wang, MD, PhD, China Xingxiang Wang, MD, China Jeremy P.T. Ward, PhD, UK Aaron B. Waxman, MD, USA Norbert Weissmann, PhD, Germany James D. West, PhD, USA R. James White, MD, USA Sean W. Wilson, PhD, USA Michael S. Wolin, PhD, USA Tianyi Wu, MD, China Lan Zhao, MD PhD, UK Nanshan Zhong, MD, China Brian S. Zuckerbraun, MD, USA

Christina N. Holt (Chicago, USA), chris88@uic.edu Nikki Krol (London, UK), nkrol@imperial.ac.uk Karen Gordon (Chicago, USA), gordonk@uic.edu

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pulmonary Circulation

| January-March 2012 | Vol 2 | No 1 |

An official journal of the Pulmonary Vascular Research Institute

CONTENTS LEFT TO RIGHT: 10, 35, 88

inside front cover

General Information

Editors and Board Members Editorial

A one-year-old baby… into the Year of the Dragon

Jason X.-J. Yuan, Nicholas W. Morrell, S. Harikrishnan, and Ghazwan Butrous

Review Articles Targeting the adventitial microenvironment in pulmonary hypertension: A potential approach to therapy that considers epigenetic change Kurt R. Stenmark, Maria G. Frid, Michael Yeager, Min Li, Suzette Riddle, Timothy McKinsey, and Karim C. El Kasmi

Risk factors for persistent pulmonary hypertension of the newborn Cassidy Delaney, and David N. Cornfield

Research Articles Serum osteoprotegerin is increased and predicts survival in idiopathic pulmonary arterial hypertension Robin Condliffe, Josephine A. Pickworth, Kay Hopkinson, Sara J. Walker, Abdul G. Hameed, Jay Suntharaligam, Elaine Soon, Carmen Treacy, Joanna Pepke-Zaba, Sheila E. Francis, David C. Crossman, Christopher M. H. Newman, Charles A. Elliot, Allison C. Morton, Nicholas W. Morrell, David G. Kiely, and Allan Lawrie

Bosentan effects in hypoxic pulmonary vasoconstriction: Preliminary study in subjects with or without high altitude pulmonary edema-history Isabelle Pham, Grégoire Wuerzner, Jean-Paul Richalet, Séverine Peyrard, and Michel Azizi

Three-dimensional analysis of right ventricular shape and function in pulmonary hypertension

Depolarization-dependent contraction increase after birth and preservation following long-term hypoxia in sheep pulmonary arteries

Peter J. Leary, Christopher E. Kurtz, Catherine L. Hough, Mary-Pierre Waiss, David D. Ralph, and Florence H. Sheehan

Demosthenes G. Papamatheakis, Jay J. Patel, Quintin Blood, Travis T. Merritt, Lawrence D. Longo, and Sean M. Wilson

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

CONTENTS continued

Characterization of altered patterns of endothelial progenitor cells in sickle cell disease related pulmonary arterial hypertension Fatima Anjum, Jason Lazar, Joe Zein, Ghassan Jamaleddine, Spiro Demetis, and Raj Wadgaonkar

Inhaled epoprostenol therapy for pulmonary hypertension: Improves oxygenation index more consistently in neonates than in older children Anna T. Brown, Jennifer V. Gillespie, Franscesca Miquel-Verges, Kathryn Holmes, William Ravekes, Philip Spevak, Ken Brady, R. Blaine Easley, W. Christopher Golden, LeAnn McNamara, Michael A. Veltri, Christoph U. Lehmann, Kristen Nelson McMillan, Jamie M. Schwartz, and Lewis H. Romer

Estimation of endothelin-mediated vasoconstriction in acute pulmonary thromboembolism John Y. C. Tsang and Wayne J. E. Lamm

Pulmonary acceleration time to optimize the timing of lung transplant in cystic fibrosis Thibaud Damy, Pierre-Régis Burgel, Jean-Louis Pepin, Pierre-Yves Boelle, Claire Cracowski, Marlène Murris-Espin, Raphaele Nove-Josserand, Nathalie Stremler, Tabassome Simon, Serge Adnot, and Brigitte Fauroux

61 67

Methodological Approach for Research Identification of functional progenitor cells in the pulmonary vasculature Amy L. Firth and Jason X.-J. Yuan

Case Report

Severe pulmonary hypertension in idiopathic nonspecific interstitial pneumonia

101

The WHO classification of pulmonary hypertension: A case-based imaging compendium

107

Robert W. Hallowell, Robert M. Reed, Mostafa Fraig, Maureen R. Horton, and Reda E. Girgis

Images in Pulmonary Vascular Disease

John J. Ryan, Thenappan Thenappan, Nancy Luo, Thanh Ha, Amit R. Patel, Stuart Rich, and Stephen L. Archer

Letters to Editor

Regarding “Isolated large vessel pulmonary vasculitis and chronic obstruction of the pulmonary arteries” Beuy Joob, and Viroj Wiwanitkit

122

Author’s Reply

122

Abstracts

123

Instructions for Authors

126

Joanna Pepke-Zaba

LEFT TO RIGHT: 89, 111, 113

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

iii

Author Institution Mapping (AIM)

Please note that not all the institutions may get mapped due to non-availability of the requisite information in the Google Map. For AIM of other issues, please check the Archives/Back Issues page on the journalâ&#x20AC;&#x2122;s website. iv

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Edi t ori al

A one-year-old baby… into the Year of the Dragon A year has now passed since the launch of Pulmonary Circulation, a journal dedicated to the clinical and basic science of the pulmonary vasculature. The birth of any new journal is a fragile affair, and whether it truly succeeds is judged by a number of factors. It remains to be seen where the journal finds its place when judged by the hard indices of impact factor and citations. This may take another year and four further issues, though we are quietly confident that the quality of reviews and original articles we have published will be reflected in those figures. Another important measure of success of a specialist journal is the reception it receives from the clinical and scientific community that willed it into being. This reception has been loud and clear: The journal is fulfilling its mission of providing a high-quality forum for some of the best ideas, authoritative reviews, and original observations in the field of pulmonary vascular disease. This will serve to accelerate the generation and analysis of knowledge, ultimately leading to a greater understanding of disease mechanisms and better treatments for patients. But still the one-year-old journal is only an infant growing to the toddler stage. It demands constant attention and

Case Guideide report lines (2) (5) Review (20) Research (31) Articles Published in 2011

MD, PhD (8%) MD (60%)

PhD (32%)

nurturing. A major milestone over the past year was the indexing of our journal on PubMed after only two issues, an extraordinary achievement. This has projected us from relative obscurity to immediate visibility. This visibility leads to more citations and wider interest in individual articles. As an Open Access journal, readers can instantly access articles and download them from the journal website free of charge. The website statistics are testimony to the popularity of many of our best articles with many of them achieving several hundreds of downloads to date. To sustain the growth of our journal through this second year of life we continue to need your help. We need your contributions, your time for peer-reviewing the articles submitted, and your advocacy. Each of us must champion this journal to see it through the next stage of development. For example, handing round your print copy to researchers and clinicians who may not be familiar with the journal will definitely increase the exposure. Similarly, suggesting the journal to colleagues as an ideal outlet for their research will also spread the message. You can also download images for presentations from our comprehensive review articles and cite the journal during your talks. Promote our mission: “Increasing the awareness and knowledge of pulmonary vascular diseases.” All of these things will help the oneyear-old journal develop from crawling to walking. Within another year we will be running.

This infant journal is very fortunate to have a huge family around the globe to help guide it to success. There are 177 editorial board members from 24 countries. Sixty percent of the editorial board are MDs, 32% PhDs, and 8% MD/PhDs; 13% are from “developing” countries; 23% are women. By way of a school report, in the 4 issues of Volume 1, we published 20 review articles (35%), 31 original research articles (53%), 5 case reports (9%), and 2 guideline/consensus articles (3%) (Fig. 1). The majority of manuscripts received to date are from contributors Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94815

Editorial Board

Figure 1: Statistics on Pulmonary Circulation in 2011 – (on left) articles published by number and type; and (on right) percentage of editorial board members who have MDs, PhDs, and MD/PhDs. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

How to cite this article: Yuan JX, Morrell NW, Harikrishnan S, Butrous G. A one-yearold baby… into the Year of the Dragon. Pulm Circ 2012;2:1-2.

based in the USA (65%) and UK (13%). Other contributions have come from Germany, India, New Zealand, Canada, Denmark, France, China, Japan, the Netherlands, Pakistan, and Sweden.

Pulmonary Circulation was born in the Year of the Rabbit according to the Chinese zodiac calendar. The Rabbit symbolizes creativity, compassion, and sensitivity. In confrontational situations, Rabbits approach situations calmly and with consideration for the other party. But 2012 is the Year of the Dragon. Dragons symbolize dominance and ambition. Dragons are passionate, prefer to live by their own rules and are unafraid of challenges, and willing to take risks. In 2012 we intend to let our journal grow under the wing of the Dragon. Most importantly we want this fledgling journal to grow up healthy and strong, becoming an adult admired and respected by their peers, acting as a role model for others.

This year we start anew with the first issue of our second volume. This issue contains state-of-the-art reviews and the full spectrum of basic science and clinical research. We are also starting to publish a new type of article of great practical value from the second year onward: A methodological paper describing detailed protocols. In this issue we begin this series with the protocols for identification of adult progenitor cells in the pulmonary vasculature. We in the editorial board are looking forward for your continuing help and support to make Pulmonary Circulation “the preferred medium of communication” for researchers and clinicians working in the field of pulmonary vascular disease.

Jason X.-J. Yuan, Nicholas W. Morrell, S. Harikrishnan, and Ghazwan Butrous Email: jxyuan@uic.edu

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Review Ar ti cl e

Targeting the adventitial microenvironment in pulmonary hypertension: A potential approach to therapy that considers epigenetic change Kurt R. Stenmark1, Maria G. Frid1, Michael Yeager1, Min Li1, Suzette Riddle1, Timothy McKinsey2, and Karim C. El Kasmi1 1

Departments of Pediatric Gastroenterology, and 2Cardiology, Pediatric Critical Care-Developmental Lung Biology Laboratory, University of Colorado, Aurora, Colorado, USA

ABSTRACT Experimental data indicate that the adventitial compartment of blood vessels, in both the pulmonary and systemic circulations, like the connective tissue stroma in tissues throughout the body, is a critical regulator of vessel wall function in health and disease. It is clear that adventitial cells, and in particular the adventitial fibroblast, are activated early following vascular injury, and play essential roles in regulating vascular wall structure and function through production of chemokines, cytokines, growth factors, and reactive oxygen species (ROS). The recognition of the ability of these cells to generate and maintain inflammatory responses within the vessel wall provides insight into why vascular inflammatory responses, in certain situations, fail to resolve. It is also clear that the activated adventitial fibroblast plays an important role in regulating vasa vasorum growth, which can contribute to ongoing vascular remodeling by acting as a conduit for delivery of inflammatory and progenitor cells. These functions of the fibroblast clearly support the idea that targeting chemokine, cytokine, adhesion molecule, and growth factor production in activated fibroblasts could be helpful in abrogating vascular inflammatory responses and thus in ameliorating vascular disease. Further, the recent observations that fibroblasts in vascular and fibrotic diseases may maintain their activated state through epigenetic alterations in key inflammatory and pro-fibrotic genes suggests that current therapies used to treat pulmonary hypertension may not be sufficient to induce apoptosis or to inhibit key inflammatory signaling pathways in these fibroblasts. New therapies targeted at reversing changes in the acetylation or methylation status of key transcriptional networks may be needed. At present, therapies specifically targeting abnormalities of histone deacytelase (HDAC) activity in fibroblast-like cells appear to hold promise. Key Words: adventitial, fibroblasts, epigenetics, pulmonary hypertension

INTRODUCTION An increasing volume of experimental data indicate that the adventitial compartment of blood vessels, in both the pulmonary and systemic circulations, like the connective tissue stroma in tissues throughout the body, is a critical regulator of vessel wall function in health and disease.[1-4] A rapidly emerging concept is that the vascular adventitia acts as a biological processing center for the retrieval, integration, storage and release of key regulators of vessel wall function. Indeed, the adventitial compartment has been suggested to Address correspondence to:

Prof. Kurt R. Stenmark University of Colorado, Denver Pediatric Critical Care Medicine 12700 East 19th Avenue Research 2 Box B131 Aurora, CO 80045, USA Email: kurt.stenmark@ucdenver.edu Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

be the principal “injury-sensing tissue” of the vessel wall, and the adventitial fibroblast to be a “sentinel cell.”[5] In response to hormonal, inflammatory and environmental stresses such as hypoxia/ischemia, or vascular distention, resident adventitial fibroblasts are the first vascular wall cells to exhibit evidence of “activation.” Such activation is characterized by increases in cellular proliferation, the expression of contractile (a-SM-actin) and extracellular matrix proteins, as well as in the secretion of chemokines, cytokines, growth, and angiogenic factors capable of Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94817 How to cite this article: Stenmark KR, Frid MG, Yeager M, Li M, Riddle S, McKinsey T et al. Targeting the adventitial microenvironment in pulmonary hypertension: A potential approach to therapy that considers epigenetic change. Pulm Circ 2012;2:3-14.

Stenmark et al.: Targeting microenvironment in PH

directly affecting resident vascular wall cell growth and of initiating inflammation in a manner that influences overall vascular tone and wall structure. A particularly intriguing concept, given the fact that pulmonary hypertension in many cases is considered a chronic inflammatory disease, is that the fibroblast plays an active role in the persistence of inflammation. In fact, fibroblast-leukocyte interactions at sites of chronic inflammation appear to promote sustained leukocyte survival and retention resulting in failure to resolve the inflammatory lesion.[6-9] This has prompted some to consider fibroblasts and/or fibroblast-leukocyte interactions as a target for therapy in chronic inflammation and fibro-proliferative diseases. The purpose of this review is to provide evidence that pulmonary vascular adventitial fibroblasts (1) initiate and perpetuate chronic vascular inflammation through the production of soluble factors such as chemokines that facilitate recruitment of circulating leukocytes and progenitor cells to the vessel wall, and cytokines that subsequently promote retention and activation of the recruited cells; (2) synthesize and release angiogenic factors which support neovascular growth of the vasa vasorum, creating a conduit that serves to perpetuate

the inflammatory response; (3) undergo epigenetic alterations that drive the fibroblast towards a persistent pro-inflammatory activation state, thus preventing them from returning to a resting phenotype as would occur in physiological wound healing; and (4) may provide a promising therapeutic target to mitigate inflammation and fibrosis in the vessel wall.

ADVENTITIAL FIBROBLASTS: ROLE IN VASCULAR INFLAMMATION

Vascular inflammation (and remodeling in general) has traditionally been considered an “inside-out” response centered on leukocyte/monocyte recruitment to the intima of blood vessels. In this hypothesis, injured vascular cells on the intimal surface of blood vessels express surface adhesion molecules and inflammatory mediators that participate in monocyte homing to the endothelium and eventual transmigration into the media and/or intima.[10] In contrast, growing experimental evidence supports a new paradigm of an “outside-in” hypothesis in which vascular inflammation is initiated in the adventitia and progresses inward toward the intima (Fig. 1). For a long period of time, most immunologists

Figure 1: Contrasting hypotheses regarding origin and perpetuation of vascular remodeling and inflammation. (A) Traditionally, remodeling and inflammation have been considered an “Inside/Out” response centered on endothelial injury, leukocyte/monocyte recruitment to the intima of blood vessels, followed by activation of medial smooth muscle cells. In this hypothesis, remodeling is largely thought to be mediated by endothelial cell activation, injury or death, abnormalities in endothelial-smooth muscle communication and resultant hyper-proliferation of either/or both cell types and recruitment of inflammatory cells, which are directed from the lumen of the pulmonary artery. (B) The “Outside-In” hypothesis suggests that vascular inflammation because of resident professional (dendritic cells, macrophages and lymphocytes) and nonprofessional (fibroblasts) immune cells occurs early and persists in the adventitia. Fibroblast activation, leukocyte and progenitor cell accumulation and retention lead to remodeling not only of the adventitia, but cause subsequent changes in the media and ultimately even the intima. Thus, the adventitia, as opposed to its’ usual depiction (Panel A) of an unimportant simple support structure, is actually a highly cellular, metabolically active, regulatory compartment of the vessel wall, capable of controlling tone, structure, and inflammation from the outside-in. 4

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

regarded fibroblast activation as relatively insignificant in regulating immune responses and concentrated primarily on interactions between lymphocytes, macrophages, and dendritic cells. However, it is now becoming clear that local immune responses are initiated by a variety of exogenous and endogenous danger signals that engage pattern recognition receptors, and thus a more integrated concept focuses on an extended local immune response in which tissue stromal cells, including fibroblasts, play a key role in modulating both innate and adaptive immune responses. It is now established that fibroblasts indeed express pattern recognition receptors, such as the toll-like receptors (TLRs), NOD-like receptors (NLRs) and the receptor for advanced glycosylation end-products (RAGE).[11-13] Fibroblasts are thus equipped with the necessary machinery to recognize exogenous and endogenous danger signals and to function as an innate immune cell (Fig. 2). In addition, small peptides released during activation of the coagulation or complement cascades as well as during remodeling of the extracellular matrix can profoundly affect fibroblast immune responses. [5,8,14,15] Activated fibroblasts have been shown to regulate the functional phenotype of hematopoietic cells that have been recruited to damaged tissues through a number of mechanisms, including CD40/CD40-ligand interactions and the production of chemokines and cytokines, including MCP-1, RANTES, IL-6, and SDF-1.[5,16-21] Consequently, upon activation, fibroblasts are not only stimulated to proliferate and differentiate into myofibroblasts and to produce extracellular matrix proteins, but also to adapt innate immune functions characterized by generation of proinflammatory cytokines, chemokines, adhesion molecules, and mediators of tissue remodeling such as TIMPS and MMPs (Fig. 2).[12]

In many models of arterial injury in the systemic circulation, early adventitial inflammation and accumulation of activated monocytes/macrophages is consistently observed.[15,19,22-24] Additional experimental evidence supporting the postulated “outside-in” hypothesis regarding adventitial regulation of vascular is as follows: (1) Zhou et al. demonstration that inward remodeling in a mouse carotid flow reduction model required early adventitial accumulation of CXCR3positive macrophages,[25] both IP10 and Mig transcripts having rapidly increased following carotid flow reduction surgery and were required for subsequent accumulation of a unique subset of macrophages that are essential in promoting tissue remodeling; (2) Tang et al. demonstration that macrophage depletion prevented flow dependent inward remodeling in this mouse carotid artery model[24] and this inward remodeling was associated with adventitial macrophage activation and superoxide stimulated proinflammatory cytokine production (e.g., IL-1beta, IL-6, IP-10, and Mig); (3) the demonstration that inward remodeling was dependent on adventitial cell expression of MyD88, an essential TLR signaling pathway-associated adapter for activation of the transcription factor NFkb;[24] and (4) studies showing that angiotensin II-mediated hypertension was blunted in RAG1−/− mice that lack adaptive immunity (i.e., B and T lymphocytes), and in this model, adoptive transfer of T-cells but not B cells restored angiotensin II induced hypertensive responses.[21] These studies showed that low doses of angiotensin II stimulated the vessel wall cells to produce RANTES as well as other chemokines that recruit lymphocytes and leukocytes to the adventitia and adjacent peri-adventitial tissues. Infusion of angiotensin II also stimulated the production of IL-6 and MCP-1 by adventitial cells.[20] Increased expression of IL-6 and MCP-1 correlated

Figure 2: The activated adventitial fibroblast plays a pivotal role in the recruitment and retention of inflammatory cells in the vascular wall. In response to a variety of environmental stimuli, the adventitial fibroblast, potentially through a number of cell surface receptors, including Toll-like receptors (TLR), integrins, and receptors for advanced glycosolation end products (RAGE) is activated to produce extracellular matrix proteins, matricellular proteins, matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs). In addition, the fibroblast upregulates production of chemokines and cytokines, adhesion molecules, and angiogenic factors. This leads to the recruitment of leukocytes and ultimately to an increase in vasa vasorum density or adventitial neovascularization, which perpetuates the inflammatory process. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

with adventitial thickening, monocyte/macrophage recruitment and activation, as well as aortic wall remodeling. When monocytes and aortic adventitial fibroblasts were co-cultured in vitro, increased levels of IL-6 and MCP-1 were detected in the conditioned medium. Importantly, this conditioned medium promoted the differentiation of monocytes into macrophages and enhanced expression of MCP-1 and MMP-9 by adventitial fibroblasts.[20] Other studies have shown that in inflammatory vascular disease, increased macrophage and fibroblast p47phox (NADH oxidase) activity is increased in the adventitia, stimulating superoxide production that scavenges locally produced NO in the vessel wall leading to excessive vasoconstriction. Moreover, fibroblasts and macrophages can release TNFa and other cytokines that stimulate NADH oxidase activity in SMCs, further reducing NO levels and increasing vascular SM contractile tone.[2] Superoxide as well as other cytokines released by the activated stromal cells can also stimulate SMC proliferation and activation of

adventitial progenitor cells, which may play a role in intimal lesion formation.[26,27]

Collectively, these findings provide strong support for the postulated role of the arterial adventitia and specifically the adventitial fibroblast as an initiator and mediator of inflammatory processes that predispose vessel walls to excessive vasoconstriction as well as pathogenic remodeling in adventitial, medial, and even intimal layers of the systemic vasculature.

Though not investigated to the same extent, studies in the pulmonary circulation have also shown marked adventitial/ perivascular inflammation in animal models of pulmonary hypertension. In the two most commonly used models of pulmonary hypertension, hypoxia and monocrotaline, early appearance and subsequent persistence of inflammatory/ progenitor cells followed by prominent remodeling in the adventitia and media of both large and small pulmonary arteries are consistently observed (Fig. 3A).[28-33] In fact,

Figure 3: Animal models of pulmonary hypertension are consistently characterized by adventitial/peri-vascular accumulation of leukocytes, and in particular mononuclear cells. (A) Illustrates the accumulation of mononuclear cells/macrophages in the adventitial/ perivascular regions of chronically hypoxic rats, calves, and mice. (B) Perivascular accumulation of mononuclear cells (CD14+ cells) is observed in the human patient with iPAH. (C) Mouse models of pulmonary hypertension, including transgenic VIPâ&#x2C6;&#x2019;/â&#x2C6;&#x2019; mice, adiponectin (APN) deficient mice, IL-6 transgenic mice, and the BMPR2 mutated mouse model all exhibit perivascular accumulation of leukocytes.[28-38] 6

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

it appears that virtually all animal models of pulmonary hypertension, including those in genetically engineered mice including BMPR2 mutations, IL-6 overexpression, Neprilysin and VIP knockouts, S100A4 overexpression, and schistosomiasis as well as human PAH are characterized by adventitial/peri-vascular inflammation (Fig. 3B and C).[34-38] Recent studies have begun to elucidate the factors contributing to this inflammatory response. Using laser capture microdissection (LCM) in the hypoxic rat model of pulmonary hypertension, Burke et al. demonstrated a complex, time-dependent and pulmonary artery-specific upregulation of several cytokines, chemokines, their cognate receptors, as well as adhesion molecules, which appeared to be primarily produced/expressed by resident adventitial fibroblasts and macrophages and are likely involved in the initiation and perpetuation of the inflammatory response.[39] Chemotactic factors that were increased in the adventitia during the development of hypoxia-induced pulmonary hypertension included SDF-1, MCP-1, VEGF, ET-1, TGF-b, and osteopontin.[39,40] As mentioned above, all of these factors have also been shown to be upregulated in the adventitia in systemic vascular injury models. Similar findings using LCM of the pulmonary vessels in the monocrotaline models have been produced (personal communication, Scott Barman, David Fulton). Thus, there are likely numerous cytokines and chemokines that fibroblasts release in a stimulus-specific and temporal manner that create a microenvironment tailored to regulating the influx and persistence of specific leukocyte subtypes and subsequent fine-tuning of their functional phenotype. The newly recruited and activated leukocytes subsequently produce a variety of mediators such as ROS and cytokines, which in turn activate adventitial fibroblasts and/or the underlying SMC, thus augmenting and perpetuating the inflammatory response. This transition to a chronic nonresolving inflammatory tissue response requires changes in the expression repertoire of adhesion molecules, cytokines, chemokines, and cognate receptors on both fibroblasts and leukocytes. As such, fibroblasts do indeed express and upregulate adhesion molecules, including ICAM-1 and VCAM-1 that facilitate cell-adhesion of leukocytes in response to a variety of stimuli. [39,41] Moreover, secretion of cytokines, including TGF-b, by the activated fibroblast causes activation and upregulation of receptors such as CXCR4 on newlyrecruited hematopoetic cells.[42] Activated fibroblasts also secrete SDF-1, the cognate ligand for CXCR4. Thus, in chronically inflamed tissues, the fibroblast-generated stroma/ adventitial microenvironment appears to serve as a “foster home” for leukocytes leading to their prolonged retention, survival, and aberrant functional activation.[14,41] As in the systemic circulation, this bidirectional signaling between fibroblasts, macrophages, and T-cells likely promotes nonresolving inflammation and remodeling. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

ADVENTITIAL FIBROBLASTS AND THE VASA VASORUM Recently, there has been great interest in vascular diseases with prominent expansion of the vasa vasorum, which occurs in many vascular diseases, prompting the hypothesis that the vasa vasorum contributes to vascular remodeling and may do so specifically by acting as a conduit for delivery of leukocytes and progenitor cells.[3,43-45] It has been shown that hypertension not only induces medial and adventitial thickening, but also significantly increases adventitial vasa vasorum density. [3,44,46,47] Additional studies have emphasized the involvement of vasa vasorum in the inflammation and progression associated with atherosclerosis.[43,44,48] Moulton et al. showed that blocking neovascularization with angiostatin reduces progression of advanced atherosclerosis.[49] There are additional data indicating that the inflammatory reactions observed in vasculitis appear to begin in the adventitia where inflammatory cells are located close to the vasa vasorum.[50] Since chronic inflammation and fibrosis are known to be associated with angiogenic responses, the possibility exists that the vascular remodeling associated with at least some forms of pulmonary hypertension would involve angiogenic responses in or around the vessel wall. In the systemic circulation, the adventitial vasa vasorum undergoes marked neovascularization in a number of vasculopathies, including atherosclerosis, type II diabetes, metabolic syndrome, restenosis, and vasculitis.[44,49,51-54] This neovascularization is thought to play a direct role in the remodeling process. [44] In the setting of pulmonary hypertension, expansion of the vasa vasorum network in the adventitia and media has also been described.[40,55,56] In fact, expansion of the pulmonary artery vasa vasorum is commonly observed in the setting of pulmonary artery obstruction.[56] For instance, Kimura et al. reported that in patients with chronic thromboembolic obstruction of the pulmonary arteries, the volume of pulmonary adventitia vasa vasorum increases and the core of the nonresolving clots is recannulized by neovascular endothelialized structures that originate from the vasa vasorum. [57] Marked increases in the density of vasa vasorum have also been reported in idiopathic PAH (Fig. 4). [58] Increased density of capillaries in the adventitial and peri-adventitial regions of pulmonary arteries in patients with severe idiopathic pulmonary fibrosis and pulmonary hypertension has also been described.[59] In an animal model (i.e., the hypoxic neonatal calf) of severe hypoxiainduced pulmonary hypertension, marked expansion of the vasa vasorum network in the adventitia and within the outer aspects of the media of vessels all along the longitudinal axis of the pulmonary circulation has been described (Fig. 4).[40] 7

Stenmark et al.: Targeting microenvironment in PH

(A) (B) Figure 4: Vasa vasorum expansion in the hypoxic calf model of pulmonary hypertension and in iPAH. (A) In both large (panels A and C) and small pulmonary arteries (panels B and D) of the chronically hypoxic calf, marked expansion of the vasa vasorum is observed. Panels A and B demonstrate H and E staining. Panels C and D demonstrate von Willebrand Factor expression. (B) In pulmonary arterial lesions of patients with iPAH a large expansion of CD34+ vasa vasorum vessels around the remodeled pulmonary arteries is observed (panels B, C, and D). Rare CD 34+ vessels around pulmonary arteries of control subjects are observed (panel A).[40,58]

The mechanisms controlling expansion of the vasa vasorum network in the pulmonary and systemic circulations are not well understood. However, it is increasingly appreciated that activation of fibroblasts must play a critical role since stromal fibroblasts have been clearly implicated in the angiogenesis that accompanies tumor progression in cancers of epithelial origin and in chronic inflammatory diseases such as rheumatoid arthritis. [60-64] As noted, fibroblasts are capable of producing many factors involved in angiogenic responses, including VEGF, PDGF, ET-1, and TGF-b. Indeed, several angiogenic factors are observed in the hypoxic adventitia, including VEGF, fibronectin, thrombin, ET-1, and S100A4.[39,40] Davie et al. carried out experiments to determine if fibroblasts were involved in the expansion of the vasa vasorum seen in pulmonary hypertensive vessels. Using both co-culture and conditioned media approaches, they found that adventitial fibroblasts, especially those from pulmonary hypertensive animals, were capable of stimulating vasa vasorum endothelial cell (VVEC) proliferation.[55] Furthermore, conditioned media from adventitial fibroblasts was capable of augmenting both the self-assembly and the integrity of cord-like networks formed by VVEC in Matrigel. Exposure to hypoxia (3% O2) augmented all these responses. Interestingly, all these molecules have been found to be upregulated in the pulmonary arteries of human patients with various forms of PAH.[32,65] In addition, studies in the systemic circulation have also suggested that ET-1, a factor well known to be upregulated in pulmonary hypertension, plays a critical role in coronary vasa vasorum neovascularization in the setting of experimental hypercholesterolemia through local upregulation of VEGF.[66,67] These observations are in accordance with a number of previous studies in which hypoxic conditions have been shown to induce angiogenic 8

phenotypes in a number of stromal cell types. [68-70] Moreover, these observations are consistent with the wellestablished paradigm that hypoxia is a common feature of many pathological conditions associated with neovascular growth. Importantly, previous studies in our laboratory have established that adventitial fibroblasts exhibit the earliest and most dramatic activation responses among all cells in the vessel wall.[71] These data are consistent with the emerging concept that the endothelium of de novo forming microvessels receives and integrates pro-angiogenic signals from a number of nonendothelial cells, including fibroblasts.[52,72-75]

Fibroblasts, cultured on ECM proteins, have been shown to secrete cytokines and pro-angiogenic growth factors that regulate the formation of capillary-like networks by human umbilical vein endothelial cells and systemically derived microvascular endothelial cells. [52,73,76,77] Other studies have shown that stromal cells, including fibroblastlike cells, not only provide initial stimuli for the angiogenic cascade but also provide a stabilizin g force to newlyformed vessels. [52,72- 77] Tissue fibroblasts have also been described to exhibit pro-angiogenic capabilities at sites of wound healing and inflammation. These cells respond to chemotactic cytokines released in the tissue environment, and are frequently the first cell type to migrate to the wound site where they orchestrate reparative neovascularization. [72] Thus, activated adventitial fibroblasts may regulate angiogenic responses of the resident endothelial cells in the adventitia and stimulate a process of neovascular growth, be it normal or disordered. It is now appreciated that this vascular network can serve as a conduit for continued delivery of leukocytes and progenitor cells to the vessel wall. Thus, inhibiting or turning off fibroblast-produced Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

pro-angiogenic factors may be beneficial in certain inflammatory vascular diseases (Fig. 2).

EPIGENETIC CONTROL OF THE ACTIVATED FIBROBLAST PHENOTYPE: POTENTIAL FOR NEW THERAPY

As noted, there is good evidence that adventitial fibroblasts in the pulmonary hypertensive vessel wall exhibit a hyperproliferative, inflammatory, and invasive phenotype. Questions arise as to origins and mechanisms regulating this phenotype. Intriguingly, this phenotype resembles, in certain ways, the phenotypic characteristics of rheumatoid arthritis (RA) synovial fibroblasts (RASFs), cancerassociated fibroblasts and fibroblasts derived from the fibrotic lung, kidney and liver. It has been demonstrated that synovial fibroblasts (SF), perhaps more than other types of fibroblasts, acquire phenotypic characteristics commonly associated with transformed cells.[78,79]

RASFs show “spontaneous” or “constitutive” activities associated with aggressive behavior and they differ from SFs of patients with osteoarthritis or normal SFs. For example, RASFs upregulate proto-oncogenes, matrix-specific degrading enzymes (MMPs), adhesion molecules, and cytokines, thus exhibiting a distinct “imprinted” phenotype which is stable over many passages in culture.[8,79-82] Similarly, primary fibroblasts isolated from fibrotic kidneys maintain their “activated” pro-fibrotic state even when cultured in vitro.[83] Additionally, there are convincing data that demonstrate stable phenotypic differences in fibroblasts obtained from the lungs of patients with idiopathic pulmonary fibrosis (IPF). IPF fibroblasts are more resistant to apoptosis compared to fibroblasts isolated from nonfibrotic tissues.[84] Fibroblasts isolated from the lungs of IPF patients also have documented increases in the expression of IL-13 receptor subunits.[85] Another pathway in which phenotypic differences in receptor expression have been reported includes the CCL2:CCR2 pathway. Fibroblasts isolated from sites of scleroderma, including the lung, have increased CCR2 expression.[86] It has also been demonstrated that IPF derived fibroblasts are hyper-responsive to cytokines, including TGFb, IL-13 and CCL2.[87] Consistent with these observations is work from our laboratory, which demonstrates that hypoxia-induced pulmonary vascular remodeling is characterized by the emergence of a distinct adventitial fibroblast population that exhibits a constitutively activated, or “imprinted,” pro-inflammatory phenotype that is capable of inducing recruitment, retention and pro-inflammatory activation of monocytes/macrophages (Fig. 5).[41] Importantly, in the absence of any exogenous stimulation, these constitutivelyPulmonary Circulation | January-March 2012 | Vol 2 | No 1

activated pro-inflammatory fibroblasts are equipped to generate a microenvironment characterized by high expression levels of pro-inflammatory cytokines such as IL-1beta and IL-6; macrophage chemo-attractant cytokines such as (CCL2/MCP1), CXCL12, SDF1, and CCL5 (RANTES), macrophage growth and activation factor GM-CSF, cosimulatory molecules capable of activating macrophages such as CD40L, as well as the adhesion molecule VCAM-1. Smooth muscle cells isolated from the same arteries of hypertensive animals exhibited either no or a far lesser degree of activation of all the aforementioned molecules and mediators.[41]

The acquisition of stable, functional phenotypic changes in mesenchymal cells, such as the fibroblast described in the aforementioned conditions, probably requires epigenetic processes such as might occur in response to altered histone actelytation, DNA methylation and/or changes in microRNA expression profiles.[88,89] Histone-dependent packaging of genomic DNA into chromatin is a central mechanism for gene regulation. Expression of inflammatory genes, DNA repair genes and proliferation genes is controlled by the degree of acetylation of histone and nonhistone proteins produced by histoneacetyltransferase (HAT) and histone deacetylase (HDACs).[90-92] Several reports have documented such changes in HDAC activity in fibroblasts in rheumatoid arthritis (RA) and juvenile idiopathic arthritis, with recent reports demonstrating specific increases in HDAC-1 activity.[92,93] Additional reports have demonstrated anti-inflammatory effects of small molecule HDAC inhibitors in animal models of inflammatory diseases, fibrotic vascular disease and in cancer.[94,95] We recently reported that adventitial fibroblasts isolated from severely hypertensive, chronically hypoxic calves (described above) exhibited significantly elevated catalytic activity of HDACs, specifically Class 1 HDAC 1-3, which primarily localized to the nuclei and were linked to epigenetics through their ability to efficiently deacetylate nucleosomal histones.[41] Most importantly, we found that specific catalytic inhibition of Class 1 HDACs was sufficient to suppress production of the constitutivelyexpressed pro-inflammatory mediators expressed by activated fibroblasts.[41] These data suggest that transcriptional changes due to epigenetics, which are mitotically heritable and occur in the absence of underlying changes in DNA sequence, could mechanistically explain the stable pro-inflammatory phenotype of these adventitial fibroblasts. These findings are consistent with those of Kawabata et al. in RA with regard to specific increases in Class 1 HDAC activity and protein expression (Fig. 6).[92] HDAC inhibitors have been shown to exert antiinflammatory effects both in vitro and in vivo in various inflammatory diseases, including RA, systemic lupus erythematosus, asthma, inflammatory lung disease, atherosclerosis, hemorrhage shock, diabetes, inflammatory bowel disease, 9

Stenmark et al.: Targeting microenvironment in PH

Figure 5: Fibroblasts from the chronically hypoxic pulmonary artery express an “imprinted” pro-inflammatory phenotype. Fibroblasts derived from control and hypoxic pulmonary hypertensive calves were cultured and in the absence of any exogenous stimuli, the fibroblast from pulmonary hypertensive animals (PH-Fibs) exhibited a constitutively activated “imprinted” phenotype characterized by overexpression of cytokines, chemokines and adhesion molecules. This phenotype was confirmed at the mRNA level and at the protein level both in vivo and in vitro. At the protein level IL-1b, SDF-1, MCP-1, and VECAM are dramatically upregulated both in vivo and maintain this phenotype in vitro. Confirmation of MCP-1 and VECAM are shown in the bar graphs below.[41]

Figure 6: The constitutively activated “imprinted” phenotype of fibroblasts is due, at least in part, to increased HDAC activity.

osteoporosis, and macular degeneration.[96] In vascular disease models, recent publications have demonstrated that HDAC inhibition can decrease neointima formation and decrease inflammation.[94,97] Collectively, these results imply unforeseen potential for Class 1 HDAC-selective small 10

molecule inhibitors for the treatment of pathologic vascular remodeling in the setting of some forms of PH. In this regard, numerous HDAC inhibitors are in preclinical and clinical development, including compounds that selectively inhibit Class 1 HDACs (Fig. 7).[95] Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

Figure 7: HDAC inhibitors attenuate the pro-liferative and -inflammatory phenotype exhibited by the constitutively activated fibroblast from pulmonary hypertensive animals.

Another highly important mechanism through which cells become epigenetically altered is through DNA methylation changes. DNA methylation refers to the covalent attachment of a methyl group to the C5 position of cytosine residues in CpG dinucleotide sequences that are called CpG islands. DNA islands are often in the promoter or enhancer regions of genes and methylation of these sites can alter transcription. DNA methylation is involved in normal cellular control of gene expression and is dynamically regulated. However, changes in DNA methylation are also relevant to disease and may be of particular relevance to the changes in fibroblast phenotype that are observed in chronic fibrotic disorders. Five-methylcytosine DNA levels are reduced in RASF tissues and in cultured RASFs.[79,98] Specifically, the promoter of an L1 element was partially demethylated, confirming a global genomic hypomethylation in RASFs. It was proposed that the hyper-aggressive and pro-inflammatory phenotype of RASFs was the result of a progressive loss of methylation marks and tissue-specific transcription factors, which are not normally expressed, are upregulated and are responsible for activation of many genes involved in the pathogenesis of rheumatoid arthritis. This concept was confirmed in experiments where 5-azaC (a DNA-hypomethylator) treatment of normal SFs lead to a phenotype identical to RASFs. Over 186 genes were upregulated in 5-azaC treated cells by greater than 2-fold, including growth factors and growth factor receptors, extracellular matrix proteins, adhesion molecules and matrix degrading enzymes. Furthermore, hypomethylation of certain receptors, specifically the death receptor, could explain the relative resistance to apoptosis, which has been reported in RASFs in certain patients.[79,99] Additional data suggest that global genomic hypomethylation can be accompanied or followed by specific promoter hypermethylation.[100] There is growing evidence for abnormalities in DNA methylation in fibroblasts in other chronic fibrotic diseases, such as are observed in the lung and kidney. [101,102] A recent study demonstrated epigenetic silencing of Thy- 1 by DNA hypermethylation specifically within fibroblast foci in Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

patients with IPF, suggesting that this may be an important mechanism for pathogenetic fibroblast alterations since absence of Thy-1 correlates with a pro-fibrotic phenotype. [103] Importantly, treatment with DNA methyltransferase restored Thy-1 expression in Thy-1-negative fibroblasts. Interestingly, the adventitial fibroblasts from hypertensive calves described above are Thy-1-negative while adventitial fibroblasts from healthy control calves are Thy-1-positive. Furthermore, a recent study showed that hypermethylation of RASALI, encoding an inhibitor or the Ras oncoprotein, is associated with the perpetuation of fibroblast activation and fibrogenesis in the kidney,[83] and that kidney fibrosis is ameliorated in mice heterozygous for DNA (cytosine-5)methyltransferase 1 (Dnmt1). Very intriguing data came from a recent study using lung fibroblasts that convincingly indicated that alterations of histone modifications alter DNA methylation. [104] Sanders et al. showed that treatment with the HDAC inhibitor trichostatin (TSA) restored Thy-1 expression in Thy-1-negative cells in a time and concentration-dependent fashion and was associated with enrichment of histone acetylation. Bisulfite sequencing of the Thy-1 promoter region revealed demethylation of the previously hypermethylated CpG site in response to treatment with TSA.[104] TSA treatment also upregulated total methyltransferase activity in these cells. The experimental observation that treatment with an HDAC inhibitor can restore Thy-1 (a proposed “fibrosis-suppressor” gene) expression in fibroblasts in fibrotic disease and change the phenotype (it decreased a-SM-actin expression) suggests that HDACs could be used as a therapeutic target for the treatment of fibrotic diseases such as IPF with or without pulmonary hypertension.

Because of the well-documented antiproliferative and antiinflammatory properties of Class I HDACs in many cell types, including vascular wall and cardiac cells, we tested the effects of specific Class I HDAC inhibitors in a hypoxic model of PH. We found that two Class I HDAC inhibitors, MGCD0103 and MS-275, reduced hypoxia-mediated PH in rats in a manner 11

Stenmark et al.: Targeting microenvironment in PH

that correlated with suppression of medial thickening of pulmonary arteries and inhibition of SMC proliferation in these vessels.[105] Reduced SMC proliferation upon Class I HDAC inhibition was due, in part, to upregulation of the antiproliferative transcription factor, FoxO3a. Importantly, we also demonstrated that RV function was maintained in the face of Class I HDAC inhibition, and that indices of adverse ventricular remodeling (e.g., myocyte apoptosis and inflammation) were blunted by selective inhibition of Class I HDACs. This is in contrast to what was previously observed with the pan-HDAC inhibitor, trichostatin A (TSA) in a pulmonary artery banding model, and supports the hypothesis that isoform-selective HDAC inhibition will be safer than general HDAC inhibition in the setting of RV pressure overload. Both MGCD0103 (Mocetinostat) and MS-275 (Entinostat) are in clinical development for cancer and are well tolerated by humans, thus highlighting the translational potential of the present findings. Two other reports have addressed effects of HDAC inhibitors in models of PH and RV remodeling. Valproic acid was shown to block RV cardiac hypertrophy in response to pulmonary artery banding (PAB) as well as in the setting of pulmonary hypertension caused by monocrotaline-induced lung injury.[106] In contrast, TSA failed to block hypertrophy in response to PAB, and actually appeared to worsen RV function.[107]

TSA is a potent, pan-HDAC inhibitor.[108] The deleterious effects of this compound on the RV (e.g., decreased cardiac output, increased RV dilatation and apoptosis) could be a reflection of a protective role for HDAC(s) in this chamber of the heart. It is interesting to note that valproic acid, which exhibits selectivity for Class I HDACs, did not cause adverse effects in the PAB model.[107] Our findings suggested that, with regard to the PH and RV, isoform-selective HDAC inhibition was safer than nonselective suppression of HDAC activity. This was evidenced by the ability of MGCD0103 to block RV apoptosis and inflammation and maintain RV contractile function in chronically hypoxic rats.[105] Nonetheless, it should be noted that the model used for our studies (3 weeks of hypoxia in SD rats) was mild with regard to RV remodeling, and represented a model of PH caused by interstitial lung disease and/or hypoxemia (World Health Organization [WHO] Group III PH). It will be important to extend the current findings to more severe models of PH and RV dysfunction, such as the SUGEN plus hypoxia model, to determine whether the beneficial effects of Class I HDAC inhibitors are generalizable to other forms of PH, including WHO Group I iPAH.

SUMMARY

It is clear that adventitial cells, and in particular the 12

adventitial fibroblast, are activated early following vascular injury and play essential roles in regulating vascular wall structure and function through production of chemokines, cytokines, growth factors and ROS. The recognition of their ability to generate and maintain inflammatory responses within the vessel wall provides insight into why vascular inflammatory responses, in certain situations, fail to resolve. It is also clear that the activated adventitial fibroblast plays an important role in regulating vasa vasorum growth, which can contribute to ongoing vascular remodeling by acting as a conduit for delivery of inflammatory and progenitor cells. These functions of the fibroblast clearly support the idea that targeting chemokine, cytokine, adhesion molecule, and growth factor production in activated fibroblasts could be beneficial in abrogating vascular inflammatory responses and thus in ameliorating vascular disease. Further, recent observations that fibroblasts in vascular and fibrotic diseases may maintain their activated state through epigenetic alterations in key inflammatory and profibrotic genes suggests that current therapies used to treat pulmonary hypertension may not be sufficient to induce apoptosis or to inhibit inflammatory signaling pathways in these cells. New therapies targeted at reversing changes in the acetylation or methylation status of key transcriptional networks may be needed. At present, therapies specifically targeting abnormalities of HDAC activity in fibroblasts appear to hold promise.

REFERENCES 1.

7. 8. 9. 10. 11.

Di Wang H, Ratsep MT, Chapman A, Boyd R. Adventitial fibroblasts in vascular structure and function: The role of oxidative stress and beyond. Can J Physiol Pharmacol 2010;88:177-86. Haurani MJ, Pagano PJ. Adventitial fibroblast reactive oxygen species as autacrine and paracrine mediators of remodeling: Bellwether for vascular disease? Cardiovascular Res 2007;75:679-89. Majesky MW, Dong XR, Hoglund V, Mahoney WM Jr, Daum G. The adventitia: A dynamic interface containing resident progenitor cells. Arterioscler Thromb Vasc Biol 2011;31:1530-9. Stenmark K, Nozik-Grayck E, Gerasimovskaya E, Anwar A, Li M, Riddle S, et al. The Adventitia: Essential Role in Pulmonary Vascular Remodeling. Compr Physiol 2011;1:141-61. Smith RS, Smith TJ, Blieden TM, Phipps RP. Fibroblasts as sentinel cells. Synthesis of chemokines and regulation of inflammation. Am J Pathol 1997;151:317-22. Kitamura H, Cambier S, Somanath S, Barker T, Minagawa S, Markovics J, etâ&#x20AC;Żal. Mouse and human lung fibroblasts regulate dendritic cell trafficking, airway inflammation, and fibrosis through integrin alphavbeta8-mediated activation of TGF-beta. J Clin Invest. 2011;121:2863-75. Wei J, Bhattacharyya S, Tourtellotte WG, Varga J. Fibrosis in systemic sclerosis: Emerging concepts and implications for targeted therapy. Autoimmun Rev 2011;10:267-75. Flavell SJ, Hou TZ, Lax S, Filer AD, Salmon M, Buckley CD. Fibroblasts as novel therapeutic targets in chronic inflammation. Br J Pharmacol 2008;153 Suppl 1:S241-6. Buckley CD. Why does chronic inflammation persist: An unexpected role for fibroblasts. Immunol Lett 2011;138:12-4. Sakao S, Tatsumi K, Voelkel NF. Reversible or irreversible remodeling in pulmonary arterial hypertension. Am J Respir Cell Mol Biol 2010;43:629-34. Chizzolini C, Brembilla NC, Montanari E, Truchetet ME. Fibrosis and immune dysregulation in systemic sclerosis. Autoimmun Rev 2011;10: 276-81.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Stenmark et al.: Targeting microenvironment in PH

12.

13. 14. 15. 16. 17. 18. 19. 20.

21. 22. 23.

24. 25.

26. 27.

28. 29.

30.

31. 32. 33. 34. 35. 36.

Midwood K, Sacre S, Piccinini AM, Inglis J, Trebaul A, Chan E, et al. Tenascin-C is an endogenous activator of Toll-like receptor 4 that is essential for maintaining inflammation in arthritic joint disease. Nature Med 2009;15:774-80. Neumann E, Lefevre S, Zimmermann B, Gay S, Muller-Ladner U. Rheumatoid arthritis progression mediated by activated synovial fibroblasts. Trends Mol Med 2010;16:458-68. Buckley CD, Pilling D, Lord JM, Akbar AN, Scheel-Toellner D, Salmon M. Fibroblasts regulate the switch from acute resolving to chronic persistent inflammation. Trends Immunol 2001;22:199-204. Maiellaro K, Taylor WR. The role of the adventitia in vascular inflammation. Cardiovascular Res 2007;75:640-8. Capers QT, Alexander RW, Lou P, De Leon H, Wilcox JN, Ishizaka N, et al. Monocyte chemoattractant protein-1 expression in aortic tissues of hypertensive rats. Hypertension 1997;30:1397-402. Csanyi G, Taylor WR, Pagano PJ. NOX and inflammation in the vascular adventitia. Free Radical Biol Med 2009;47:1254-66. Jabs A, Okamoto E, Vinten-Johansen J, Bauriedel G, Wilcox JN. Sequential patterns of chemokine- and chemokine receptor-synthesis following vessel wall injury in porcine coronary arteries. Atherosclerosis 2007;192;75-84. Okamoto E, Couse T, De Leon H, Vinten-Johansen J, Goodman RB, Scott NA, et al. Perivascular inflammation after balloon angioplasty of porcine coronary arteries. Circulation 2001;104:2228-35. Tieu BC, Lee C, Sun H, Lejeune W, Recinos A 3rd, Ju X, et al. An adventitial IL-6/MCP1 amplification loop accelerates macrophage-mediated vascular inflammation leading to aortic dissection in mice. J Clin Invest 2009;119: 3637-51. Guzik TJ, Hoch NE, Brown KA, McCann LA, Rahman A, Dikalov S, et al. Role of the T cell in the genesis of angiotensin II induced hypertension and vascular dysfunction. J Exp Med 2007;204:2449-60. Best PJ, Hasdai D, Sangiorgi G, Schwartz RS, Holmes DR Jr, Simari RD, et al. Apoptosis. Basic concepts and implications in coronary artery disease. Arterioscler Thromb Vasc Biol 1999;19:14-22. Scott NA, Cipolla GD, Ross CE, Dunn B, Martin FH, Simonet L, et al. Identification of a potential role for the adventitia in vascular lesion formation after balloon overstretch injury of porcine coronary arteries. Circulation 1996;93:2178-87. Tang PC, Qin L, Zielonka J, Zhou J, Matte-Martone C, Bergaya S, et al. MyD88-dependent, superoxide-initiated inflammation is necessary for flowmediated inward remodeling of conduit arteries. J Exp Med 2008;205:3159-71. Zhou J, Tang PC, Qin L, Gayed PM, Li W, Skokos EA, et al. CXCR3dependent accumulation and activation of perivascular macrophages is necessary for homeostatic arterial remodeling to hemodynamic stresses. J Exp Med 2010;207:1951-66. Hoglund VJ, Dong XR, Majesky MW. Neointima formation: A local affair. Arterioscler Thromb Vasc Biol 2010;30:1877-9. Daniel JM, Bielenberg W, Stieger P, Weinert S, Tillmanns H, Sedding DG. Time-course analysis on the differentiation of bone marrow-derived progenitor cells into smooth muscle cells during neointima formation. Arterioscler Thromb Vasc Biol 2010;30:1890-6. Dorfmuller P, Perros F, Balabanian K, Humbert M. Inflammation in pulmonary arterial hypertension. Eur Respir J 2003;22:358-63. Frid MG, Brunetti JA, Burke DL, Carpenter TC, Davie NJ, Reeves JT, et al. Hypoxia-induced pulmonary vascular remodeling requires recruitment of circulating mesenchymal precursors of a monocyte/macrophage lineage. Am J Pathol 2006;168:659-69. Sahara M, Sata M, Morita T, Nakamura K, Hirata Y, Nagai R. Diverse contribution of bone marrow-derived cells to vascular remodeling associated with pulmonary arterial hypertension and arterial neointimal formation. Circulation 2007;115:509-17. Stenmark KR, Davie NJ, Reeves JT, Frid MG. Hypoxia, leukocytes, and the pulmonary circulation. J Appl Physiol 2005;98:715-21. Tuder RM, Marecki JC, Richter A, Fijalkowska I, Flores S. Pathology of pulmonary hypertension. Clin Chest Med 2007;28:23-42, vii. Hassoun PM, Mouthon L, Barbera JA, Eddahibi S, Flores SC, Grimminger F, et al. Inflammation, growth factors, and pulmonary vascular remodeling. J Am Coll Cardiol 2009;54:S10-9. West J, Harral J, Lane K, Deng Y, Ickes B, Crona D, et al. Mice expressing BMPR2R899X transgene in smooth muscle develop pulmonary vascular lesions. Am J Physiol Lung Cell Mol Physiol 2008;295:L744-55. Steiner MK, Syrkina OL, Kolliputi N, Mark EJ, Hales CA, Waxman AB. Interleukin-6 overexpression induces pulmonary hypertension. Circulation Res 2009;104:236-244, 228p following 244. Said SI, Hamidi SA, Dickman KG, Szema AM, Lyubsky S, Lin RZ, et al. Moderate pulmonary arterial hypertension in male mice lacking the

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

37. 38.

39.

40.

41.

42.

43. 44. 45. 46. 47.

48. 49.

50. 51. 52. 53. 54.

55.

56. 57.

58.

59. 60.

vasoactive intestinal peptide gene. Circulation 2007;115:1260-8. Dempsey EC, Wick MJ, Karoor V, Barr EJ, Tallman DW, Wehling CA, et al. Neprilysin null mice develop exaggerated pulmonary vascular remodeling in response to chronic hypoxia. Am J Pathol 2009;174:782-96. Greenway S, van Suylen RJ, Du Marchie Sarvaas G, Kwan E, Ambartsumian N, Lukanidin E, et al. S100A4/Mts1 produces murine pulmonary artery changes resembling plexogenic arteriopathy and is increased in human plexogenic arteriopathy. Am J Pathol 2004;164:253-62. Burke DL, Frid MG, Kunrath CL, Karoor V, Anwar A, Wagner BD, et al. Sustained hypoxia promotes the development of a pulmonary arteryspecific chronic inflammatory microenvironment. Am J Physiol Lung Cell Mol Physiol 2009;297:L238-50. Davie NJ, Crossno JT Jr, Frid MG, Hofmeister SE, Reeves JT, Hyde DM, et al. Hypoxia-induced pulmonary artery adventitial remodeling and neovascularization: Contribution of progenitor cells. Am J Physiol Lung Cell Mol Physiol 2004;286:L668-78. Li M, Riddle SR, Frid MG, El Kasmi KC, McKinsey TA, Sokol RJ, et al. Emergence of fibroblasts with a proinflammatory epigenetically altered phenotype in severe hypoxic pulmonary hypertension. J Immunol 2011;187:2711-22. Buckley CD, Amft N, Bradfield PF, Pilling D, Ross E, Arenzana-Seisdedos F, et al. Persistent induction of the chemokine receptor CXCR4 by TGF-beta 1 on synovial T cells contributes to their accumulation within the rheumatoid synovium. J Immunol 2000;165:3423-9. Langheinrich AC, Kampschulte M, Buch T, Bohle RM. Vasa vasorum and atherosclerosis - Quid novi? Thromb Haemost 2007;97:873-9. Ritman EL, Lerman A. The dynamic vasa vasorum. Cardiovascular Res 2007;75:649-58. Havelka GE, Kibbe MR. The vascular adventitia: Its role in the arterial injury response. Vasc Endovascular Surg 2011;45:381-90. Bayer IM, Caniggia I, Adamson SL, Langille BL. Experimental angiogenesis of arterial vasa vasorum. Cell Tissue Res 2002;307:303-13. Gossl M, Rosol M, Malyar NM, Fitzpatrick LA, Beighley PE, Zamir M, et al. Functional anatomy and hemodynamic characteristics of vasa vasorum in the walls of porcine coronary arteries. Anat Rec A Discov Mol Cell Evol Biol 2003;272:526-37. Moreno PR, Purushothaman KR, Zias E, Sanz J, Fuster V. Neovascularization in human atherosclerosis. Curr Mol Med 2006;6:457-77. Moulton KS, Vakili K, Zurakowski D, Soliman M, Butterfield C, Sylvin E, et al. Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis. Proc Natl Acad Sci U S A 2003;100:4736-41. Numano F. Vasa vasoritis, vasculitis and atherosclerosis. Int J Cardiol 2000;75 Suppl 1, S1-8; discussion S17-19. Barger AC, Beeuwkes R 3rd, Lainey LL,Silverman KJ. Hypothesis: Vasa vasorum and neovascularization of human coronary arteries. A possible role in the pathophysiology of atherosclerosis. N Engl J Med 1984;310:175-7. Hartlapp I, Abe R, Saeed RW, Peng T, Voelter W, Bucala R, et al. Fibrocytes induce an angiogenic phenotype in cultured endothelial cells and promote angiogenesis in vivo. Faseb J 2001;15:2215-24. Hayden MR, Tyagi SC. Vasa vasorum in plaque angiogenesis, metabolic syndrome, type 2 diabetes mellitus, and atheroscleropathy: A malignant transformation. Cardiovasc Diabetol. 2004;3:1. Herrmann J, Best PJ, Ritman EL, Holmes DR, Lerman LO, Lerman A. Chronic endothelin receptor antagonism prevents coronary vasa vasorum neovascularization in experimental hypercholesterolemia. J Am Coll Cardiol 2002;39:1555-61. Davie NJ, Gerasimovskaya EV, Hofmeister SE, Richman AP, Jones PL, Reeves JT, et al. Pulmonary artery adventitial fibroblasts cooperate with vasa vasorum endothelial cells to regulate vasa vasorum neovascularization: A process mediated by hypoxia and endothelin-1. Am J Pathol 2006;168:1793-807. Mitzner W, Wagner EM. Vascular remodeling in the circulations of the lung. J Appl Physiol 2004;97:1999-2004. Kimura H, Okada O, Tanabe N, Tanaka Y, Terai M, Takiguchi Y, et al. Plasma monocyte chemoattractant protein-1 and pulmonary vascular resistance in chronic thromboembolic pulmonary hypertension. Am J Respir Crit Care Med 2001;164:319-24. Montani D, Perros F, Gambaryan N, Girerd B, Dorfmuller P, Price LC, et al. C-kit-positive cells accumulate in remodeled vessels of idiopathic pulmonary arterial hypertension. Am J Respir Crit Care Med 2011;184: 116-23. Nathan S, Noble P, Tuder R. Idiopathic pulmonary fibrosis and pulmonary hypertension: Connecting the dots. Am J Respir Crit Care Med 2007;175:875-80. Bhowmick NA, Neilson EG, Moses HL. Stromal fibroblasts in cancer

Stenmark et al.: Targeting microenvironment in PH

61. 62. 63. 64. 65. 66.

67.

68.

69.

70.

71.

72. 73.

74.

75.

76.

77. 78.

79. 80. 81.

82. 83. 84.

85.

initiation and progression. Nature 2004;432:332-7. Egeblad M, Littlepage LE, Werb Z. The fibroblastic coconspirator in cancer progression. Cold Spring Harb Symp Quant Biol 2005;70:383-8. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nature Rev 2006;6:392-401. Mueller MM, Fusenig NE. Friends or foes - bipolar effects of the tumour stroma in cancer. Nature Rev 2004;4:839-49. Radisky E, Radisky D. Stromal induction of breast cancer: Inflammation and invasion. Rev Endocr Metab Disord 2007;8:279-87. Voelkel NF, Cool C. Pathology of pulmonary hypertension. Cardiol Clin 2004;22:343-51. Smith PJ, Teichert-Kuliszewska K, Monge JC, Stewart DJ. Regulation of endothelin-B receptor mRNA expression in human endothelial cells by cytokines and growth factors. J Cardiovasc Pharmacol 1998;31 Suppl 1:S158-60. Wilasrusmee C, Ondocin P, Bruch D, Shah G, Kittur S, Wilasrusmee S, et al. Amelioration of cyclosporin A effect on microvasculature by endothelin inhibitor. Surgery 2003;134:384-9. Hlatky L, Tsionou C, Hahnfeldt P, Coleman CN. Mammary fibroblasts may influence breast tumor angiogenesis via hypoxia-induced vascular endothelial growth factor up-regulation and protein expression. Cancer Res 1994;54:6083-6. Popovici RM, Irwin JC, Giaccia AJ, Giudice LC. Hypoxia and cAMP stimulate vascular endothelial growth factor (VEGF) in human endometrial stromal cells: Potential relevance to menstruation and endometrial regeneration. J Clin Endocrinol Metab 1999;84:2245-8. Sharkey AM, Day K, McPherson A, Malik S, Licence D, Smith SK, et al. Vascular endothelial growth factor expression in human endometrium is regulated by hypoxia. J Clin Endocrinol Metab 2000;85:402-9. Stenmark KR, Davie N, Frid M, Gerasimovskaya E, Das M. Role of the adventitia in pulmonary vascular remodeling. Physiology (Bethesda)2006;21:134-45. Martin TA, Harding K, Jiang WG. Matrix-bound fibroblasts regulate angiogenesis by modulation of VE-cadherin. Eur J Clin Invest 2001;31:931-8. Nakatsu MN, Sainson RC, Aoto JN, Taylor KL, Aitkenhead M, Perezdel-Pulgar S, et al. Angiogenic sprouting and capillary lumen formation modeled by human umbilical vein endothelial cells (HUVEC) in fibrin gels: The role of fibroblasts and Angiopoietin-1. Microvasc Res 2003;66:102-12. Velazquez OC, Snyder R, Liu ZJ, Fairman RM, Herlyn M. Fibroblastdependent differentiation of human microvascular endothelial cells into capillary-like 3-dimensional networks. Faseb J 2002;16:1316-8. Kroon ME, Koolwijk P, van der Vecht B,van Hinsbergh VW. Hypoxia in combination with FGF-2 induces tube formation by human microvascular endothelial cells in a fibrin matrix: Involvement of at least two signal transduction pathways. J Cell Sci 2001;114:825-33. Martin TA, Harding KG, Jiang WG. Regulation of angiogenesis and endothelial cell motility by matrix-bound fibroblasts. Angiogenesis 1999;3:69-76. Tille JC,Pepper MS. Mesenchymal cells potentiate vascular endothelial growth factor-induced angiogenesis in vitro. Exp Cell Res 2002;280:179-91. Lafyatis R, Remmers EF, Roberts AB, Yocum DE, Sporn MB, Wilder RL. Anchorage-independent growth of synoviocytes from arthritic and normal joints. Stimulation by exogenous platelet-derived growth factor and inhibition by transforming growth factor-beta and retinoids. J Clin Invest 1989;83:1267-76. Karouzakis E, Gay RE, Michel BA, Gay S, Neidhart M. DNA hypomethylation in rheumatoid arthritis synovial fibroblasts. Arthritis Rheum 2009;60:3613-22. Firestein GS, Alvaro-Gracia JM, Maki R. Quantitative analysis of cytokine gene expression in rheumatoid arthritis. J Immunol 1990;144:3347-53. Brouty-Boye D, Pottin-Clemenceau C, Doucet C, Jasmin C, Azzarone B. Chemokines and CD40 expression in human fibroblasts. Eur J Immunol 2000;30;914-9. Pap T, Muller-Ladner U, Gay RE, Gay S. Fibroblast biology. Role of synovial fibroblasts in the pathogenesis of rheumatoid arthritis. Arthritis Res 2000;2:361-7. Bechtel W, McGoohan S, Zeisberg EM, Muller GA, Kalbacher H, Salant DJ, et al. Methylation determines fibroblast activation and fibrogenesis in the kidney. Nature Med 2010;16:544-50. Moodley YP, Misso NL, Scaffidi AK, Fogel-Petrovic M, McAnulty RJ, Laurent GJ, et al. Inverse effects of interleukin-6 on apoptosis of fibroblasts from pulmonary fibrosis and normal lungs. Am J Respir Cell Mol Biol 2003;29:490-8. Jakubzick C, Choi ES, Carpenter KJ, Kunkel SL, Evanoff H, Martinez FJ, et al. Human pulmonary fibroblasts exhibit altered interleukin-4 and

86.

87. 88. 89. 90. 91. 92.

93. 94. 95. 96. 97.

98.

99.

100. 101. 102.

103.

104.

105.

106.

107.

108.

interleukin-13 receptor subunit expression in idiopathic interstitial pneumonia. Am J Pathol 2004;164:1989-2001. Carulli MT, Ong VH, Ponticos M, Shiwen X, Abraham DJ, Black CM, et al. Chemokine receptor CCR2 expression by systemic sclerosis fibroblasts: Evidence for autocrine regulation of myofibroblast differentiation. Arthritis Rheum 2005;52:3772-82. Murray LA, Argentieri RL, Farrell FX, Bracht M, Sheng H, Whitaker B, et al. Hyper-responsiveness of IPF/UIP fibroblasts: Interplay between TGFbeta1, IL-13 and CCL2. Int J Biochem Cell Biol 2008;40:2174-82. Kim GH, Ryan JJ, Marsboom G, Archer SL. Epigenetic mechanisms of pulmonary hypertension. Pulm Circ 2011;1:347-56. Karouzakis E, Gay RE, Gay S, Neidhart M. Epigenetic control in rheumatoid arthritis synovial fibroblasts. Nat Rev Rheumatol 2009;5:266-72. Adcock IM. HDAC inhibitors as anti-inflammatory agents. Br J Pharmacol 2007;150:829-31. Bush EW, McKinsey TA. Protein acetylation in the cardiorenal axis: The promise of histone deacetylase inhibitors. Circulation Res 2010;106: 272-84. Kawabata T, Nishida K, Takasugi K, Ogawa H, Sada K, Kadota Y, et al. Increased activity and expression of histone deacetylase 1 in relation to tumor necrosis factor-alpha in synovial tissue of rheumatoid arthritis. Arthritis Res Ther 2010;12:R133. Horiuchi M, Morinobu A, Chin T, Sakai Y, Kurosaka M, Kumagai S. Expression and function of histone deacetylases in rheumatoid arthritis synovial fibroblasts. J Rheumatol 2009;36:1580-9. Iyer A, Fenning A, Lim J, Le GT, Reid RC, Halili MA, et al. Antifibrotic activity of an inhibitor of histone deacetylases in DOCA-salt hypertensive rats. Br J Pharmacol 2010;159:1408-17. Tan J, Cang S, Ma Y, Petrillo RL, Liu D. Novel histone deacetylase inhibitors in clinical trials as anti-cancer agents. J Hematol Oncol 2010;3:5. Halili MA, Andrews MR, Sweet MJ,Fairlie DP. Histone deacetylase inhibitors in inflammatory disease. Curr Top Med Chem 2009;9:309-19. Findeisen HM, Gizard F, Zhao Y, Qing H, Heywood EB, Jones KL, et al. Epigenetic regulation of vascular smooth muscle cell proliferation and neointima formation by histone deacetylase inhibition. Arterioscler Thromb Vasc Biol 2011;31:851-60. Neidhart M, Rethage J, Kuchen S, Kunzler P, Crowl RM, Billingham ME, et al. Retrotransposable L1 elements expressed in rheumatoid arthritis synovial tissue: Association with genomic DNA hypomethylation and influence on gene expression. Arthritis Rheum 2000;43:2634-47. Takami N, Osawa K, Miura Y, Komai K, Taniguchi M, Shiraishi M, et al. Hypermethylated promoter region of DR3, the death receptor 3 gene, in rheumatoid arthritis synovial cells. Arthritis Rheum 2006;54:779-87. Esteller M. Epigenetics in cancer. N Engl J Med 2008;358:1148-59. Hardie WD, Glasser SW, Hagood JS. Emerging concepts in the pathogenesis of lung fibrosis. Am J Pathol 2009;175:3-16. Kottmann RM, Hogan CM, Phipps RP, Sime PJ. Determinants of initiation and progression of idiopathic pulmonary fibrosis. Respirology 2009;14: 917-33. Sanders YY, Pardo A, Selman M, Nuovo GJ, Tollefsbol TO, Siegal GP, et al. Thy-1 promoter hypermethylation: A novel epigenetic pathogenic mechanism in pulmonary fibrosis. Am J Respir Cell Mol Biol 2008; 39:610-8. Sanders YY, Tollefsbol TO, Varisco BM, Hagood JS. Epigenetic regulation of thy-1 by histone deacetylase inhibitor in rat lung fibroblasts. Am J Respir Cell Mol Biol 2011;45:16-23. Cavasin M, Demos-Davies K, Horn T, Walker L, Lemon D, Birdsey N, et al. Selective Class I HDAC Inhibition Suppresses Hypoxia-Induced Cardiopulmonary Remodeling Through an Anti-Proliferative Mehanism. Circulation Res 2012;110:739-48. Cho YK, Eom GH, Kee HJ, Kim HS, Choi WY, Nam KI, et al. Sodium valproate, a histone deacetylase inhibitor, but not captopril, prevents right ventricular hypertrophy in rats. Circ J 2010;74:760-70. Bogaard HJ, Mizuno S, Hussaini AA, Toldo S, Abbate A, Kraskauskas D, et al. Suppression of histone deacetylases worsens right ventricular dysfunction after pulmonary artery banding in rats. Am J Respir Crit Care Med 2011;183:1402-10. Bradner JE, West N, Grachan ML, Greenberg EF, Haggarty SJ, Warnow T, Chemical phylogenetics of histone deacetylases. Nat Chem Biol 2010;6:238-43.

Source of Support: Nil, Conflict of Interest: None declared.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Review Ar ti cl e

Risk factors for persistent pulmonary hypertension of the newborn Cassidy Delaney1 and David N. Cornfield2 1

Department of Pediatrics, University of Colorado School of Medicine, Aurora, Colorado, 2Department of Pediatrics, Divisions of Pulmonary, Asthma, and Critical Care Medicine, Stanford University School of Medicine, Stanford, California, USA

ABSTRACT In utero, pulmonary blood flow is closely circumscribed and oxygenation and ventilation occur via the placental circulation. Within the first few breaths of air-breathing life, the perinatal pulmonary circulation undergoes a dramatic transition as pulmonary blood flow increases 10-fold and the pulmonary arterial blood pressure decreases by 50% within 24 hours of birth. With the loss of the placental circulation, the increase in pulmonary flow enables oxygen to enter the bloodstream. The physiologic mechanisms that account for the remarkable transition of the pulmonary circulation include establishment of an air-liquid interface, rhythmic distention of the lung, an increase in shear stress and elaboration of nitric oxide from the pulmonary endothelium. If the perinatal pulmonary circulation does not dilate, blood is shunted away from the lungs at the level of the patent foramen ovale and the ductus arteriosus leading to the profound and unremitting hypoxemia that characterizes persistent pulmonary hypertension of the newborn (PPHN), a syndrome without either optimally effective preventative or treatment strategies. Despite significant advances in treatment, PPHN remains a major cause of morbidity and mortality in neonatal centers across the globe. While there is information surrounding factors that might increase the risk of PPHN, knowledge remains incomplete. Cesarean section delivery, high maternal body mass index, maternal use of aspirin, nonsteroidal anti-inflammatory agents and maternal diabetes mellitus are among the factors associated with an increased risk for PPHN. Recent data suggest that maternal use of serotonin reuptake inhibitors might represent another important risk factor for PPHN. Key Words: cesarean section, persistant pulmonary hypertension of the newborn, pulmonary circulation, serotonin reuptake inhibitors

INTRODUCTION Perinatal pulmonary vasodilation

In utero, oxygen tension is low and pulmonary vascular resistance is greater than systemic vascular resistance.â&#x20AC;&#x2030;[1] At birth, the pulmonary circulation undergoes an unprecedented and unparalleled transition, as pulmonary blood flow increases 8- to 10-fold and arterial pressure decreases by 50% within 24 hours concomitant with an increase in oxygen tension, establishment of an air-liquid interface and rhythmic distention of the lung.[2-4] In 1953, Dawes and coworkers performed a seminal study of the transitional pulmonary circulation. The study demonstrated that ventilation and establishment of an airliquid interface caused an immediate increase in pulmonary Address correspondence to:

Prof. David N. Cornfield Stanford University School of Medicine, Center for Excellence in Pulmonary Biology, 770 Welch Road, Suite 350 Stanford CA 94305-5162 USA Email: cornfield@stanford.edu Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

blood flow and a decrease in pulmonary arterial blood pressure.[4] Evidence for an integral role for oxygen in the postnatal adaptation of the pulmonary circulation came first with the finding that while ventilation with nitrogen caused pulmonary vasodilation, ventilation with O2 caused even greater pulmonary vasodilation.[5]

The demonstration that fetal blood flow increased more than 3-fold when pregnant ewes were placed in a hyperbaric chamber provided clear evidence that an increase in fetal oxygen tension alone, absent of any other stimulus, could cause fetal pulmonary vasodilation. [6] The discovery that during the transition of the pulmonary circulation Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94818 How to cite this article: Delaney C, Cornfield DN. Risk factors for persistent pulmonary hypertension of the newborn. Pulm Circ 2012;2:15-20.

Delaney and Cornfield: Risk factors for PPH of newborn

prostaglandin production from pulmonary endothelium increased[7] suggested that vasoactive mediators produced by the endothelium might modulate perinatal pulmonary vascular tone. While blockade of prostaglandin production prevented neither perinatal pulmonary vasodilation[8] nor oxygen-induced fetal pulmonary vasodilation,[9] the observation that pharmacologic blockade of endotheliumderived relaxing factor (EDRF), later identified as nitric oxide (NO),[10-12] prevented the postnatal adaptation of the pulmonary circulation[13] demonstrated the critical importance of the pulmonary endothelium in the postnatal adaptation of the pulmonary circulation. Pharmacologic inhibition of NO production also attenuated the decrease in pulmonary vascular resistance with both ventilation alone and ventilation with 100% O2, providing direct evidence that NO production played a key role in O2-induced fetal pulmonary vasodilation (Fig. 1).[14] Two separate studies found that O2-induced pulmonary vasodilation was either attenuated or prevented by blockade of NO in the chronically instrumented fetal lamb.â&#x20AC;&#x2030;[15,16] These findings, together with the observation that O2 tension is capable of modulating NO production in fetal PA endothelial cells,[17] implied that the increase in O2tension that occurs at birth may contribute to sustained and progressive pulmonary vasodilation by providing a stimulus for augmented NO production by the pulmonary endothelium.

Persistent pulmonary hypertension of the newborn In some newborn infants, pulmonary vascular resistance remains elevated after birth, resulting in shunting of blood away from the lungs and severe central hypoxemia.[18] Infants with the condition, termed persistent pulmonary hypertension of the newborn (PPHN), often respond only incompletely to administration of high concentrations of supplemental oxygen or inhaled nitric oxide.[19]

Although persistent pulmonary hypertension of the newborn (PPHN) may be the result of several divergent neonatal disorders, abnormal pulmonary vasoreactivity, marked pulmonary hypertension, incomplete response to vasodilator stimuli,[20] increase in circulating levels of endothelin and histologic changes in the pulmonary vasculature (in infants dying as a result of PPHN) are all consistent hallmarks of the syndrome. [18] Adverse intrauterine stimuli such as chronic hypoxia [21] or hypertension[22] can lead to pathophysiology that closely resembles PPHN. In fetal sheep, chronic intrauterine pulmonary hypertension leads to vascular smooth muscle cell proliferation, perivascular adventitial thickening[23-26] and a progressive decrease in the pulmonary vasodilator response to oxygen and acetylcholine.[27] Data derived from fetal lambs with chronic intrauterine pulmonary 16

Figure 1: Hemodynamic effects of pharmacologic inhibition of nitric oxide (L-NA) on left pulmonary arterial blood flow (LPA flow; top panel) and mean pulmonary arterial pressure (MPAP; bottom panel) during sequential ventilation with low and high concentrations of oxygen. In comparison with control animals (closed circles; n=6 animals), inhibition of nitric oxide (open circles; n=7 animals) markedly attenuated rise in LPA flow during ventilation with low and high fraction of inspired oxygen concentration as well as the decline in mean pulmonary artery pressure during ventilation with high fractional concentration of inspired oxygen.[14]

hypertension due to ligation of the ductus arteriosus indicate that decreases in endothelial nitric oxide synthase (eNOS) gene and protein expression[28,29] may limit perinatal NO production, thereby contributing to the pathophysiology of PPHN.[28-30] In addition, sensitivity to NO may be decreased by chronic intrauterine hypertension. [31] Evidence shows that intrauterine pulmonary hypertension causes pulmonary vascular smooth muscle hypertrophy[24] and decreases myosin light chain phosphatase levels.[25] Endothelin, a 21 amino acid polypeptide elaborated by the endothelium, has been shown to be a powerful vasoconstrictor and mitogen. Identified in 1987, endothelin has complex actions during cardiopulmonary development.â&#x20AC;&#x2030;[32,33] Endothelin is essential for normal cardiovascular development, as mice lacking the endothelin gene manifest lethal vascular abnormalities, including a hypoplastic aortic arch.[34,35] Circulating levels of endothelin levels are increased in human infants with PPHN,[32,33] concomitant with a decrease in cGMP concentration.[36] Endothelin receptor blockade in the ovine fetus results in substantial vasodilation,[37] suggesting that endothelin plays a role in the closely circumscribed pulmonary blood flow that characterizes fetal life. Despite the advent of Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Delaney and Cornfield: Risk factors for PPH of newborn

selective endothelin receptor antagonists for the treatment of pulmonary hypertension, none have been applied to PPHN. Enhanced understanding of the effects of endothelin on PA SMC from both normal and hypertensive fetuses will increase the likelihood that endothelin-based therapies might be applied to neonatal pulmonary hypertension.

Persistent pulmonary hypertension of the newborn risk factors

While an incomplete response to pulmonary vasodilator stimuli characterizes PPHN,[38] the factors that definitively increase the risk of PPHN remain uncertain. Perinatal risk factors for PPHN include pulmonary parenchymal disease, such as meconium aspiration or pneumonia, which clearly increases the likelihood that infants will develop PPHN. Infants with congenital diaphragmatic hernia (CDH) possess physiology that is consistent with PPHN as pulmonary vascular resistance remains elevated and blood is shunted away from the lungs.

Lung structural abnormalities

Children with congenital diaphragmatic hernia (CDH) are at risk for PPHN. The incidence of CDH is 1 in 2,000-3,000 live births.[39] Despite meaningful advances in neonatal intensive care, the mortality rate in infants with CDH is approximately 60%. Refractory pulmonary hypertension is the primary cause of mortality in infants with CDH. In 1951, Reid et al. demonstrated that airway number, and therefore the alveolar, acinar and arterial number is reduced in both lungs of patients with CDH.[40] The decrease is most pronounced in the lung that is ipsilateral to the defect. [40] In infants with CDH, endothelial nitric oxide synthase expression is decreased[41] and endothelin expression is increased.[42] The cause for pulmonary vascular remodeling in CDH remains unknown.

Mode of delivery

Increasing evidence suggests that mode of delivery is a significant determinant of the relative risk of PPHN. In a well-considered, case-control trial performed in the United States Army population, infants delivered via Cesarean section possessed an almost 5-fold increased risk of developing PPHN compared to a demographically well-matched control population. [43] While the study included almost 12,000 infants, only 20 developed PPHN. In this study, choramnionitis also conferred a significantly increased risk, more than 3-fold, of PPHN. The notion that Cesarean section delivery increases risk of PPHN is supported by data from an earlier study wherein mode of delivery, maternal race (Black, Asian) and high maternal body mass index each increased the likelihood of PPHN.[44]

Antenatal drug exposure

Among the most significant risk factors for PPHN is maternal medication usage. Compared to control infants, Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

in utero exposure to aspirin increases the risk of PPHN by 4.9-fold while NSAID exposure increases the likelihood of PPHN by more than 6-fold.[45] The mechanistic link between these medications and the risk of PPHN may relate to the importance of prostaglandins in maintaining patency of the ductus arteriosus. Aspirin and NSAID block prostaglandin and thromboxane synthesis and may cause premature ductus arteriosus closure, and elevate both blood pressure and shear stress in the pulmonary circulation.[22] Surgical ligation of the ductus arteriosus in sheep was initially described as a model for in utero pulmonary hypertension in 1972. [46] Further insight into the implications of ductal ligation derives from a report by Abman et al. demonstrating that libation of the ductus arteriosus resulted in increased pulmonary vascular reactivity, increased muscularization of the pulmonary circulation and physiology entirely consistent with PPHN.[47]

Recent epidemiologic studies have demonstrated an association between maternal use of selective serotonin reuptake inhibitors (SSRI) and PPHN, with SSRI use within the second half of pregnancy conferring a 6-fold increase in the risk of developing of PPHN.[48] Interpretation of these data is confounded by the prevalence of maternal depression among women in childbearing years. The study had a case-control design and reported that among the 20 infants with PPHN, 14 had been exposed to SSRI in utero after week 20 of gestation.[48] SSRI readily cross the placenta, as reflected by fetal cord blood levels corresponding to 30%-70% of maternal levels.[22,50] The mechanism whereby SSRI affect the fetal and neonatal pulmonary circulation remains unknown. However, data in adult mice indicate that overexpression of the 5-HT transporter gene potentiates hypoxic pulmonary hypertension by increasing vascular remodeling.[49] SSRI may increase fetal serotonin (5-HT) levels. Serotonin is a potent vasoconstrictor and stimulates smooth muscle cell growth and proliferation.[50-53] Recent studies have demonstrated that SSRI infusion into the fetal pulmonary circulation results in potent and sustained elevation of pulmonary vascular resistance (Fig. 2).[54] Moreover, maternal treatment with the SSRI fluoxetine leads to pulmonary hypertension in rat pups, as evidenced by pulmonary vascular remodeling, right ventricular hypertrophy, decreased oxygenation, and higher perinatal mortality.[55] Maternal smoking has also been linked to the development of PPHN. It is likely that maternal tobacco smoke exposure causes fetal hypoxia. In guinea pigs[56] and rhesus monkeys, fetal oxygen content was decreased after cigarette smoke exposure. [57] Hence, while cigarette smoking may indirectly increase the risk of PPHN in an infant, an epidemiologic link between cigarette smoking and PPHN remains elusive. 17

Delaney and Cornfield: Risk factors for PPH of newborn

Van Marter etâ&#x20AC;Żal. were unable to link maternal smoking to PPHN,[45] while a subsequent report demonstrated that among infants with PPHN, 64.5% had detectable levels of a nicotine metabolite in their cord blood compared to 28.2% of control infants.[58]

birth, [60] perhaps by increasing phosphodiesterase typeâ&#x20AC;ŻV activity.â&#x20AC;&#x2030;[61] Superoxide production is increased in experimental models of PPHN.[62] Superoxide anions rapidly combine with nitric oxide to reduce its bioavailability and

In the neonatal period, supplemental oxygen may increase pulmonary vascular resistance by increasing oxidative stress. High concentrations of inspired oxygen may potentiate endothelin-1 signaling and diminish eNOS expression.[59] Hyperoxia impairs pulmonary vasodilation caused by inhaled nitric oxide in normal lambs after

395 PP+J PO PLQ

While the perinatal issues that predispose to PPHN are well recognized (Table 1), how each increases the risk of PPHN remains incompletely understood. Among the most well-recognized risk factors for PPHN is meconium staining of the amniotic fluid. Whether PPHN is a direct consequence of meconium aspiration or is a surrogate marker for in utero stress remains unknown. Meconium inactivates surfactant, causes lung inflammation and alveolar hypoxia resulting in pulmonary vasoconstriction. Meconium in the airway leads to obstruction, gas trapping, and lung overdistention and elevation of pulmonary vascular resistance.

Perinatal

6HUWUDOLQH

7LPH PLQ

Figure 2: Hemodynamic response of the fetal pulmonary circulation to intrapulmonary infusion of the selective 5-hydroxytryptamine inhibitor, sertraline, P<0.05, versus baseline (n=16). Sertraline (10 mg) was infused over a 40-minute time period. Infusion of sertraline increased pulmonary vascular resistance. The pulmonary vasoconstrictor response to sertraline was sustained for at least 80â&#x20AC;Żminutes after the completion of the infusion.[54]

Decreased VEGF

Table 1: Risk factors for the development of PPHN Structural lung and heart disease Congenital diaphragmatic hernia Congenital cystic adenomatous malformation Alveolar capillary dysplasia Pulmonary hypoplasia Congenital heart defects In utero ductus arteriosus closure Perinatal clinical predictors Postmaturity Non-vertex presentation Fetal distress Cesarean section Asphyxia Twin-twin transfusion Placental abruption Intrauterine growth restriction Postnatal factors Sepsis Inflammation Oxidative stress Antenatal drug exposure ASA/NSAIDS SSRIs Cigarette Smoking Maternal health Body mass index Asthma Diabetes mellitus Urinary tract infection Preeclampsia Race and gender Black or Asian Male

Decreased NO/cGMP signaling

Increased endothelin PPHN Decreased prostanoids

â&#x20AC;˘ Altered vascular reactivity â&#x20AC;˘ Vascular remodeling â&#x20AC;˘ Abnormal cellular growth

Decreased thromboxane Oxidative stress

Rho kinase activation

Decreased expression of Calium-sesitive k+ channels

Figure 3: Schematic representation of persistent pulmonary hypertension of the newborn (PPHN). PPHN is characterized by abnormal vascular reactivity, cellular proliferation and vascular remodeling. Factors that contribute to the physiologic alterations that characterize PPHN include decreased production of vasodilator agents (nitric oxide, prostanoids) and an increase in endothelin production from the pulmonary endothelium, exposure to high concentrations of supplemental oxygen leading to increases in oxidative stress, activation of signaling pathways such Rho kinase and alterations in calcium-sensitive potassium channel expression. The overall effect is compromised pulmonary vasodilation, extra-pulmonary shunting of blood away from the lung and severe, central hypoxemia. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Delaney and Cornfield: Risk factors for PPH of newborn

forms peroxynitrite, a potent oxidant with the potential to produce vasoconstriction and cytotoxicity. Treatment with recombinant human superoxide dismutase (rhSOD) enhances vasodilation after birth.[60,62] SOD restores eNOS expression and function in pulmonary arteries of animals with PPHN,[61] providing still further evidence that increased oxidant stress increases perinatal pulmonary vascular tone.

CONCLUSIONS

PPHN remains a significant source of perinatal morbidity and mortality. The inability to either prevent or treat PPHN optimally confers great importance on early recognition of factors that increase the risk of PPHN. While there is information surrounding factors that might increase the risk of PPHN, knowledge remains incomplete. At present, delivery of infants via Cesarean section without the prior labor seems to pose the single greatest risk for a newborn infant to have PPHN. High maternal body mass index, maternal use of aspirin, nonsteroidal anti-inflammatory agents and maternal diabetes mellitus are additional factors that are associated with an increased risk for PPHN. Recent data suggest that maternal use of serotonin reuptake inhibitors might represent another important risk factor for PPHN. Infants with structural abnormalities of the lung, especially congenital diaphragmatic hernia, are also at increased risk for PPHN. Moreover, any in utero or perinatal insult that causes fetal or neonatal hypoxia will also increase the likelihood of PPHN (Fig. 3).

REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.

11.

12.

Rudolph A. Distribution and regulation of blood flow in the fetal and neonatal lamb. Circ Res 1985;57:811-21. Cassin S, Dawes GS, Mott JC, Ross BB, Strang LB. The vascular resistance of the fetal and newly ventilated lung of the lamb. J Physiol 1964;171:61-79. Teitel DF, Iwamoto HS, Rudolph AM. Changes in the pulmonary circulation during birth-related events. Pediatr Res 1990;27:372-8. Dawes GS, Mott JC, Widdicombe JG, Wyatt DG. Changes in the lungs of the newborn lamb. J Physiol Lond 1953;121:141-62. Cassin S, Dawes GS, Ross BB. Pulmonary blood flow and vascular resistance in immature fetal lambs. J Physiol 1964;171:80-9. Assali NS, Kirchbaum TH, Dilts PV. Effects of hyperbaric oxygen on utero placental and fetal circulation. Circ Res 1968;22:573-88. Leffler CW, Hessler JR, Green RS. The onset of breathing at birth stimulates pulmonary vascular prostacyclin synthesis. Pediatr Res 1984;18:938-42. Leffler CW, Tyler TL, Cassin S. Effect of indomethacin on pulmonary vascular response to ventilation of fetal goats. Am J Physiol 1978;235:H346-51. Morin F 3 rd, Egan EA, Ferguson W, Lundgren CE. Development of pulmonary vascular response to oxygen. Am J Physiol 1988;254:H542-6. Furchgott RF. Studies on relaxation of rabbit aorta by sodium nitrite: The basis for the proposal that the acid-activatable inhibitory factor from bovine retractor penis is inorganic nitrite and the endothelium-derived relaxing factor is nitric oxide. In: Vasodilatation, Vanhoutte PM, Editor. New York, N.Y. : Raven Press; 1988. p. 410-4. Ignarro LJ, Buga GM, Wood KS, Byrns RE, Chaudhuri G. Endotheliumderived relaxing factor produced and released from artery and vein is nitric oxide. Proc Natl Acad Sci U S A 1987;84:9265-9. Amezcua JL, Palmer RM, de Souza BM, Moncada S. Nitric oxide synthesized from L-arginine regulates vascular tone in the coronary circulation of the

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34.

35.

36.

37.

rabbit. Br J Pharmacol 1989;97:1019-24. Abman SH, Chatfield BA, Hall SL, McMurtry IF. Role of endotheliumderived relaxing factor during transition of pulmonary circulation at birth. Am J Physiol 1990;259:H1921-7. Cornfield DN, Chatfield BA, McQueston JA, McMurtry IF, Abman SH. Effects of birth-related stimuli on L-arginine-dependent pulmonary vasodilation in ovine fetus. Am J Physiol 1992;262:H1474-81. McQueston JA, Cornfield DN, McMurtry IF, Abman SH. Effects of oxygen and exogenous L-arginine on EDRF activity in fetal pulmonary circulation. Am J Physol 1993;264:H865-71. Tiktinsky MH,Morin FC. Increasing oxygen tension dilates fetal pulmonary circulation via endothelium-derived relaxing factor. Am J Physiol 1993;265:H376-80. Shaul PW, Wells LB. Oxygen modulates nitric oxide production selectively in fetal pulmonary endothelial cells. Am J Respir Cell Mol Biol 1994;11:432-8. Kinsella JP, Abman SH. Recent developments in the pathophysiology and treatment of persistent pulmonary hypertension of the newborn. J Pediatr 1995;126:853-64. Kinsella JP, Truog WE, Walsh WF, Goldberg RN, Bancalari E, Mayock DE, et al. Randomized, multicenter trial of inhaled nitric oxide in severe, persistent pumonary hypertension of the newborn. J Pediatr 1997;131:55-62. Kelly LK, Porta NF, Goodman DM, Carroll CL, Steinhorn RH. Inhaled prostacyclin for term infants with persistent pulmonary hypertension of refractory to inhaled nitric oxide. J Pediatr 2002;141:830-2. Goldberg SJ, Levy RA, Siassi B, Betten J. Effects of maternal hypoxia and hyperoxia upon the neonatal pulmonary vasculature. Pediatrics 1971;48:528-33. Levin DL, Levin DL, Hyman AI, Heymann MA, Rudolph AM. Fetal hypertension and the development of increased pulmonary vascular smooth muscle: A possible mechanism for the PPHN infant. J Pediatr 1976;92:265-9. Belik J. Myogenic response in large pulmonary arteries and its ontogenesis. Pediatr Res 1994;36(1 Part 1):34-40. Belik J, Keeley FW, Baldwin F, Rabinovitch M. Pulmonary hypertension and vascular remodeling in fetal sheep. Am J Physiol 1994;266:H2303-9. Belik J, Majumdar R, Fabris VE, Kerc E, Pato MD. Myosin light chain phosphatase and kinase abnormalities in fetal sheep pulmonary hypertension. Pediatr Res 1998;43:57-61. Belik J, Halayko AJ, Rao K, Stephens NL. Fetal ductus arteriosus ligation. Pulmonary vascular smooth muscle biochemical and mechanical changes. Circ Res 1993;72:588-96. McQueston JA, Kinsella JP, Ivy DD, McMurtry IF, Abman SH. Chronic pulmonary hypertension in utero impairs endothelium-dependent vasodilation. Am J Physiol 1995;37:H288-94. Villamor E, Le Cras TD, Horan MP, Halbower AC, Tuder RM, Abman SH. Chronic intrauterine pulmonary hypertension impairs endothelial nitric oxide synthase in the ovine fetus. Am J Physiol 1997;272:L1013-20. Shaul PW, Yuhanna IS, German Z, Chen Z, Steinhorn RH, Morin FC 3rd. Pulmonary endothelial NO synthase gene expression is decreased in fetal lambs with pulmonary hypertension. Am J Physiol 1997;272:L1005-12. Abman S,Accurso F. Acute effects of partial compression of ductus arteriosus on fetal pulmonary circulation. Am J Physiol 1989;260:H626-34. Steinhorn R, Russell J, Morin FR. Disruption of cGMP production in pulmonary arteries isolated from fetal lambs with pulmonary hypertension. Am J Physiol 1995;268:H1483-9. Kumar P, Kazzi NJ, Shankaran S. Plasma immunoreactive endothelin-1 concentrations in infants with persistent pulmonary hypertension of the newborn. Am J Perinatol 1996;13:335-41. RosenbergAA, Kennaugh J, Koppenhafer SL, Loomis M, Chatfield BA, Abman SH. Elevated immunoreactive endothelin-1 levels in newborn infants with persistent pulmonary hypertension. J Pediatr 1993;123:109-14. Yanagisawa H, Hammer RE, Richardson JA, Williams SC, Clouthier DE, Yanagisawa M. Role of Endothelin-1/Endothelin-A receptor-mediated signaling pathway in the aortic arch patterning in mice. J Clin Invest 1998;102:22-33. Yanagisawa H, Hammer RE, Richardson JA, Emoto N, Williams SC, Takeda S, et al. Disruption of ECE-1 and ECE-2 reveals a role for endothelinconverting enzyme-2 in murine cardiac development. J Clin Invest 2000;105:1373-82. Christou H, Adatia I, Van Marter LJ, Kane JW, Thompson JE, Stark AR, et al. Effect of inhaled nitric oxide on endothelin-1 and cyclic guanosine 5’-monophosphate plasma concentrations in newborn infants with persistent pulmonary hypertension. J Pediatr 1997;130:603-11. Ivy DD, Kinsella JP, Abman SH. Physiologic characterization of endothelin A and B receptor activity in the ovine fetal pulmonary circulation. J Clin

Delaney and Cornfield: Risk factors for PPH of newborn

38. 39. 40. 41.

42. 43.

44. 45.

46. 47. 48. 49.

50.

Invest 1994;93:2141-8. Goldman AP, Tasker RC, Haworth SG, Sigston PE, Macrae DJ. Four patterns of response to inhaled nitric oxide for persistent pulmonary hypertension of the newborn. Pediatrics 1996;98:706-13. Langham MR Jr, Kays DW, Ledbetter DJ, Frentzen B, Sanford LL, Richards DS. Congenital diaphragmatic hernia. Epidemiology and outcome. Clin Perinatol 1996;23:671-88. Reid LR. Diaphragmatic hernia of the liver with review of the literature. Miss Doct 1951;28:351-7. Shehata SM, Sharma HS, Mooi WJ, Tibboel D. Pulmonary hypertension in human newborns with congenital diaphragmatic hernia is associated with decreased vascular expression of nitric-oxide synthase. Cell Biochem Biophys 2006;44:147-55. Keller RL, Tacy TA, Hendricks-Munoz K, Xu J, Moon-Grady AJ, Neuhaus J, et al. Congenital diaphragmatic hernia: Endothelin-1, pulmonary hypertension, and disease severity. Am J Respir Crit Care Med 2010;182:555-61. Wilson KL, Zelig CM, Harvey JP, Cunningham BS, Dolinsky BM, Napolitano PG. Persistent pulmonary hypertension of the newborn is associated with mode of delivery and not with maternal use of selective serotonin reuptake inhibitors. Am J Perinatol 2011;28:19-24. Hernandez-Diaz S, Van Marter LJ, Werler MM, Louik C, Mitchell AA. Risk factors for persistent pulmonary hypertension of the newborn. Pediatrics 2007;120:e272-82. Van Marter LJ, Leviton A, Allred EN, Pagano M, Sullivan KF, Cohen A, et al. Persistent pulmonary hypertension of the newborn and smoking and aspirin and nonsteroidal antiinflammatory drug consumption during pregnancy. Pediatrics 1996;97:658-63. Ruiz U, Piasecki GJ, Balogh K, Polansky BJ, Jackson BT. An experimental model for fetal pulmonary hypertension. A preliminary report. Am J Surg 1972;123:468-71. Abman SH, Shanley PF, Accurso FJ. Failure of postnatal adaptation of the pulmonary circulation after chronic intrauterine pulmonary hypertension in fetal lambs. J Clin Invest 1989;83:1849-58. Chambers CD, Hernandez-Diaz S, Van Marter LJ, Werler MM, Louik C, Jones KL, et al. Selective serotonin-reuptake inhibitors and risk of persistent pulmonary hypertension of the newborn. New Eng J Med 2006;354:579-87. MacLean MR, Deuchar GA, Hicks MN, Morecroft I, Shen S, Sheward J, et al. Overexpression of the 5-hydroxytryptamine transporter gene: Effect on pulmonary hemodynamics and hypoxia-induced pulmonary hypertension. Circulation 2004;109:2150-5. Lawrie A, Spiekerkoetter E, Martinez EC, Ambartsumian N, Sheward WJ, MacLean MR, et al. Interdependent serotonin transporter and receptor

51. 52. 53.

54. 55. 56. 57. 58. 59. 60. 61. 62.

pathways regulate S100A4/Mts1, a gene associated with pulmonary vascular disease. Circ Res 2005;97:227-35. Long L, MacLean MR, Jeffery TK, Morecroft I, Yang X, Rudarakanchana N, et al. Serotonin increases susceptibility to pulmonary hypertension in BMPR2-deficient mice. Circ Res 2006;98:818-27. MacLean MR. Endothelin-1 and serotonin: Mediators of primary and secondary pulmonary hypertension? J Lab Clin Med 1999;134:105-14. Morecroft I, Loughlin L, Nilsen M, Colston J, Dempsie Y, Sheward J, et al. Functional interactions between 5-hydroxytryptamine receptors and the serotonin transporter in pulmonary arteries. J Pharmacol Exp Ther 2005;313:539-48. Delaney C, Gien J, Grover TR, Roe G, Abman SH. Pulmonary vascular effects of serotonin and selective serotonin reuptake inhibitors in the late-gestation ovine fetus. Am J Physiol Lung Cell Mol Physiol 2011;301:L937-44. Fornaro E, Li D, Pan J, Belik J. Prenatal exposure to fluoxetine induces fetal pulmonary hypertension in the rat. Am J Respir Crit Care Med 2007;176:1035-40. Johns JM, Louis TM, Becker RF, Means LW. Behavioral effects of prenatal exposure to nicotine in guinea pigs. Neurobehav Toxicol Teratol 1982;4: 365-9. Socol ML, Manning FA, Murata Y, Druzin ML. Maternal smoking causes fetal hypoxia: Experimental evidence. Am J Obstet Gynecol 1982;142: 214-8. Bearer C, Emerson RK, O’Riordan MA, Roitman E, Shackleton C. Maternal tobacco smoke exposure and persistent pulmonary hypertension of the newborn. Environ Health Perspect 1997;105:202-6. Förstermann U. Oxidative stress in vascular disease: Causes, defense mechanisms and potential therapies. Nat Clin Pract Cardiovasc Med 2008;5:338-49. Lakshminrusimha S, Russell JA, Steinhorn RH, Ryan RM, Gugino SF, Morin FC 3rd, et al. Pulmonary arterial contractility in neonatal lambs increases with 100% oxygen resuscitation. Pediatr Res 2006;59:137-41. Farrow KN, Groh BS, Schumacker PT, Lakshminrusimha S, Czech L, Gugino SF, et al. Hyperoxia increases phosphodiesterase 5 expression and activity in ovine fetal pulmonary artery smooth muscle cells. Circ Res 2008;102:226-33. Lakshminrusimha S, Russell JA, Wedgwood S, Gugino SF, Kazzaz JA, Davis JM, et al. Superoxide dismutase improves oxygenation and reduces oxidation in neonatal pulmonary hypertension. Am J Respir Crit Care Med 2006;174:1370-7.

Source of Support: Nil, Conflict of Interest: None declared.

“Quick Response Code” link for full text articles The journal issue has a unique new feature for reaching to the journal’s website without typing a single letter. Each article on its first page has a “Quick Response Code”. Using any mobile or other hand-held device with camera and GPRS/other internet source, one can reach to the full text of that particular article on the journal’s website. Start a QR-code reading software (see list of free applications from http://tinyurl.com/ yzlh2tc) and point the camera to the QR-code printed in the journal. It will automatically take you to the HTML full text of that article. One can also use a desktop or laptop with web camera for similar functionality. See http://tinyurl.com/2bw7fn3 or http://tinyurl.com/3ysr3me for the free applications. 20

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Serum osteoprotegerin is increased and predicts survival in idiopathic pulmonary arterial hypertension Robin Condliffe1, Josephine A. Pickworth2,3, Kay Hopkinson2, Sara J. Walker3, Abdul G. Hameed2, Jay Suntharaligam4, Elaine Soon5, Carmen Treacy5, Joanna Pepke-Zaba5, Sheila E. Francis2, David C. Crossman3, Christopher M. H. Newman2, Charles A. Elliot1, Allison C. Morton3, Nicholas W. Morrell5, David G. Kiely1, and Allan Lawrie2 3

1 Pulmonary Vascular Disease Unit, Royal Hallamshire Hospital, 2Department of Cardiovascular Science, University of Sheffield, National Institute for Health Research Cardiovascular Biomedical Research Unit, Sheffield, 4Department of Respiratory Medicine, Royal United Hospital, Bath, 5Medicine, University of Cambridge School of Clinical Medicine, Addenbrookeâ&#x20AC;&#x2122;s and Papworth Hospitals, Cambridge, UK

ABSTRACT We previously reported that osteoprotegerin (OPG) is regulated by pathways associated with pulmonary arterial hypertension (PAH), and is present at elevated levels within pulmonary vascular lesions and sera from patients with idiopathic PAH (IPAH). Since OPG is a naturally secreted protein, we investigated the relationship between serum OPG and disease severity and outcome in patients with IPAH and animal models. OPG mRNA expression was measured in pulmonary artery smooth muscle cells (PASMC) from pulmonary arteries of patients with and without IPAH. Serum concentrations of OPG were measured in a retrospective and prospective group of patients. OPG levels were compared with phenotypic data and other putative PAH biomarkers. Prognostic significance was assessed and levels compared with healthy controls. Correlation of OPG and pulmonary vascular remodeling was also performed in rodent models of PAH. OPG mRNA was significantly increased 2-fold in PASMC isolated from explanted PAH lungs compared with control. Serum OPG concentrations were markedly elevated in IPAH compared with controls. In Cohort 1 OPG levels significantly correlated with mean right atrial pressure and cardiac index, while in Cohort 2 significant correlations existed between age-adjusted OPG levels and gas transfer. In both cohorts an OPG concentration above a ROC-derived threshold of 4728 pg/ml predicted poorer survival. In two rodent models, OPG correlated with the degree of pulmonary vascular remodeling. OPG levels are significantly elevated in patients with idiopathic PAH and are of prognostic significance. The role of OPG as a potential biomarker and therapeutic target merits further investigation. Key Words: biomarker, osteoprotegerin, pulmonary arterial hypertension

INTRODUCTION Pulmonary arterial hypertension (PAH) is a rare, progressive condition characterized by abnormal intimal and medial proliferation within the pulmonary arterial bed[1] resulting in elevation of pulmonary vascular resistance and subsequent right heart failure.[2] Current biomarkers such as brain natriuretic peptide (BNP or NT-proBNP) reflect Address correspondence to: Dr. Allan Lawrie Department of Cardiovascular Science University of Sheffield The Medical School Beech Hill Road Sheffield S10 2RX UK Email: a.lawrie@sheffield.ac.uk

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

right ventricular load rather than pulmonary arterial remodeling. Subsequently, there has been increased interest in identifying biomarkers for PAH that reflects this vasculopathy. Osteoprotegerin (OPG) is a soluble member of the tumor necrosis factor (TNF) receptor family which acts as a decoy Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94819 How to cite this article: Condliffe R, Pickworth JA, Hopkinson K, Walker SJ, Hameed AG, Suntharaligam J et al. Serum osteoprotegerin is increased and predicts survival in idiopathic pulmonary arterial hypertension. Pulm Circ 2012;2:21-7.

Condliffe et al.: OPG as a biomarker for IPAH

receptor for receptor activator of nuclear factor-kB ligand (RANKL) in the regulation of osteoclast differentiation. [3] OPG can also block the binding of TNF-related apoptosisinducing ligand (TRAIL) with its membrane-associated death receptors thus preventing apoptosis. [4] We have previously demonstrated that several molecular pathways previously associated with PAH including reduced bone morphogenetic protein receptor type II (BMPR-2) expression stimulate OPG expression and secretion from pulmonary artery smooth muscle cells (PASMC).[5] Furthermore, we have shown increased protein expression of OPG within remodeled pulmonary vascular lesions and serum from patients with idiopathic PAH (IPAH) compared to controls. Interestingly, elevated levels of OPG have also been observed in PAH associated with congenital systemic to pulmonary shunts.[6] Altered levels and prognostic importance of OPG have been described in systemic cardiovascular disease,[7-10] diabetes[11-13] and connective tissue disease.[14,15] We therefore hypothesized that serum concentrations of OPG would provide meaningful prognostic information in patients with IPAH. We now report our findings utilizing both an initial retrospective and subsequent prospective collection of patients with IPAH from two separate UK centers. Critically, we demonstrated for the first time that OPG mRNA is upregulated in PASMCs isolated from patients with IPAH, suggesting that OPG is produced locally within remodeled vessels, and likely contributes significantly to serum levels. We also report significant relationships between serum OPG, pulmonary hemodynamics, and survival.

MATERIALS AND METHODS OPG gene expression in PASMC

RNA was isolated from PASMC grown from explanted pulmonary arteries of three patients with IPAH, and three controls (two emphysema, one lung cancer) as previously described.[16] The RNA was reverse transcribed using Superscript III (Invitrogen, Paisley, UK) and OPG gene expression measured using TaqMan quantitative PCR (Assay ID: Hs00171068_m1, Applied Biosystems, Warrington, UK). The relative quantity of OPG was assessed against 18S ribosomal RNA using the delta-delta comparative CT method.

Clinical subjects

Serum samples were obtained from two cohorts of patients with IPAH attending two large designated UK pulmonary vascular disease units. Cohort 1 consisted of 35 patients from Papworth Hospital, Cambridge (28 of whom were prevalent cases on targeted therapy), who were sampled between 2001 and 2006. Cohort 2 (validation cohort) consisted of 23 treatment-naïve incident cases at the 22

Royal Hallamshire Hospital, Sheffield, who were sampled during 2009 and 2011. A control group of 35 volunteers without PH or significant cardiorespiratory disease were age and gender matched for Cohort 2. PAH was defined as mean pulmonary arterial pressure (mPAP) ≥25 mmHg in association with a normal pulmonary capillary wedge pressure of ≤15 mmHg. Exclusion criteria included associated forms of PAH, FEV1 or FVC <60% predicted, or significant parenchymal lung disease on CT imaging. Serum was obtained peripherally in patients in Cohort 1 and at diagnostic right heart catheterization (RHC) in Cohort 2 unless the patient had undergone an isotope perfusion scan on the same day, in which case a peripheral sample was obtained the following day. All samples were obtained, stored, and analyzed in accordance with prior ethical approval from North Sheffield Research Ethics Committee via the Sheffield NIHR Cardiovascular Biomedical Research Unit Biobank, and Papworth Research Ethics Committee. OPG levels for patients from Cohort 1 have previously been reported but not interrogated for prognostic significance.[5]

Animals

PAH was induced in male Sprague Dawley rats (Charles River, UK) by subcutaneous injection of moncrotaline (Sigma, Poole, UK). Lung harvest was performed at days 2, 7, 14, 21, and 28 postinjection. Male ApoE–/– and ApoE–/– /IL-R1–/– mice 10-12 weeks of age (7 per group) were fed Paigen diet for 8 weeks as previously described. [17] Where stated disease progression was modified by administration of human IL-1Ra or placebo control (Amgen Inc., Thousand Oaks, Calif, USA. MTA 200517250-001) as previously described.[17] Lungs were harvested at 8 weeks and the pulmonary vascular remodeling was quantified as previously described.[17] All animal experiments were approved by the University of Sheffield Project Review Committee and conformed to UK Home Office ethical guidelines.

OPG measurement

OPG concentration in patient[18] and rodent[17] serum was measured using an enzyme-linked immunosorbent assay (ELISA) as previously described.

Statistical analysis

Baseline data was described using mean (standard deviation) or median (interquartile range). Comparison between groups was performed using the independent t-test and one-way ANOVA with Bonferonni post hoc analysis for parametric data and the Mann–Whitney or Kruskal–Wallis with Dunn’s post hoc analysis tests for nonparametric data. Categorical data were compared with the χ2 test. Correlations were assessed using Pearson’s test and multivariate linear regression. Optimal thresholds for survival analysis were identified using Receiver-Operated Characteristics (ROC) analysis. Event-free survival (death Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

or lung transplant) was assessed using the Kaplan–Meier method with a census date of July 1, 2009 in Cohort 1 and July 18, 2011 in Cohort 2. A P value of <0.05 was taken as significant throughout. Statistical analysis was performed using SPSS 19 (SPSS; Chicago, IL, USA) and GraphPad Prism 5.0d (San Diego, CA, USA) software.

RESULTS

OPG mRNA expression is increased in human PASMC

We previously showed that OPG protein expression is increased within both concentric and plexiform lesions from patients with IPAH compared to controls. [5] To determine whether de novo synthesis by resident PASMC could be the source of this OPG protein, we firstly examined OPG expression in human pulmonary artery smooth muscle cells isolated from patients with IPAH. We found a significant 2-fold (P<0.05, Fig. 1) increase in OPG mRNA in un-stimulated PA-SMC from patients with IPAH compared with control PA-SMC isolated from non-PAH explanted lungs. These data suggest that OPG within remodeled lesions can be produced locally, and likely contributes significantly to circulating levels. Serum levels of OPG may therefore reflect the degree or activity of the underlying pulmonary vascular remodeling.

Patient characteristics, OPG concentrations and prognostic strength in a retrospective cohort

Baseline demographics and serum OPG concentration for both cohorts and the control are shown in Table 1. The majority (79%) of patients in Cohort 1 were receiving targeted therapy: (24%) bosentan; 6 (17%) epoprostenol; 2 (6%) intravenous iloprost; 2 (6%) nebulized iloprost; 1 (3%) sildenafil; and 8 (23%) combination therapy at the time of sampling (Table 1). Median serum OPG concentrations in patients with IPAH from Cohort 1 were significantly higher than in control (4807 vs. 1352 pg/ml, P<0.001; Fig. 2A). Median time between RHC and serum sampling in Cohort 1 was 2.2 (0.72, 10.5) months. OPG levels correlated positively with mRAP (r=0.37, P=0.03) and inversely with CI (r=-0.36, P=0.04; Table 2). No correlations were observed with age, exercise capacity or WHO functional class nearest to date of sampling. Sixteen patients in Cohort 1 had RHC performed within 90 days of sampling; in these patients OPG concentration correlated positively with mean right atrial pressure (mRAP; r=0.57, P=0.03).

Median follow-up from date of sampling to census in Cohort 1 was 3.27 (1.81, 4.26) years. Fourteen patients died during follow-up while four patients underwent lung transplantation. The area under the curve in ROC analysis for the prediction of 4-year event-free survival Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Rel. quantity OPG/18S

Condliffe et al.: OPG as a biomarker for IPAH

Control

IPAH

Figure 1: OPG mRNA is elevated in PASMC from patients with IPAH. Bar graph shows TaqMan derived mRNA expression of OPG in explanted PASMC from patients with idiopathic pulmonary arterial hypertension (IPAH) and controls, normalised using ΔΔCT with 18S rRNA as the endogenous control gene. Bars represent mean±SEM, n=3. **P<0.01 compared to control cells.

Table 1: Patient demographics and serum concentrations Number Age (years)* Female (%)† WHO II/III/IV (%)‡ mRAP (mmHg) mPAP (mmHg) PCWP (mmHg)§ CI (l Min m2)¶ PVR (dyn s cm5)** OPG (pg/ml)†† FEV1 (%) FVC (%)

Cohort 1

Cohort 2

Control

35 43.9 (37, 58) 74 34/54/12 10.1 (6) 54.1 (13) 8.2 (3) 2.0 (0.6) 1163 (341) 4505 (2765, 6330) 80 (14) 91 (14)

23 63.6 (48, 71) 61 17/70/13 11 (4) 55.4 (9) 10.4 (3) 2.5 (0.8) 883 (417) 4807 (3518, 5866) 85 (13) 94 (15)

35 58 (51, 72) 56 n/a n/a n/a n/a n/a n/a 1352 (815, 2021) n/a n/a

mRAP: Mean right atrial pressure; mPAP: Mean pulmonary artery pressure; PCWP: Pulmonary capillary wedge pressure; CI: Cardiac index; PVR: Pulmonary vascular resistance; OPG: Osteoprotegerin; FEV1: Forced expiratory volume; FVC: Forced vital capacity. Significant pairwise comparisons are listed below: *P=0.004 (Cohort 1 vs. Cohort 2); P=0.001 (Cohort 1 vs. Control); †P=0.008 (Cohort 1 vs. Control); ‡P=0.02 (Cohort 1 vs. Cohort 2); § P=0.017 (Cohort 1 vs. Cohort 2); ¶P=0.006 (Cohort 1 vs. Cohort 2); **P=0.014 (Cohort 1 vs. Cohort 2); ††P<0.001 (Cohort 1 vs. Control, Cohort 2 vs. Control)

Table 2: Correlations between OPG, exercise capacity, TLCO and selected biomarkers Variable

Age 6MWD ISWT mRAP CI DLCO NT-proBNP eGFR hsCRP IL6 GDF-15

Cohort 1

Cohort 2

P value

-0.10 0.089 n/a 0.37 -0.36 n/a n/a n/a n/a n/a n/a

0.56 0.61

0.49 n/a -0.34 -0.068 -0.17 -0.69 0.085 -0.32 0.33 0.32 0.51

0.019*

0.031* 0.037*

0.12 0.76 0.44 0.002* 0.71 0.18 0.14 0.15 0.025*

6MWD: 6-minute walk distance; ISWT: Incremental shuttle walk test; mRAP: Mean right atrial pressure; CI: Cardiac index; DLCO: Diffusing capacity for Carbon monoxide; NT-proBNP: N-terminal fragment of B-type natriuretic peptide; eGFR: Estimated glomerular filtration rate; CRP: High sensitivity C reactive protein; IL-6: Interleukin-6; GDF-15: Growth differentiation factor-15. *Significant correlation with serum osteoprotegerin; OPG: Osteoprotegerin

Condliffe et al.: OPG as a biomarker for IPAH

1.0

12000

P=0.014 Cumulative survival (%)

OPG (pg/ml)

10000 8000 6000 4000 2000

0.6 0.4 0.2

<4728

>4728

0.0

0 (A)

0.8

Control

Cohort 1

(B)

0.00 2.00 4.00 6.00 8.00 10.00 Event-free survival from sample (years)

Figure 2: Retrospective analysis of serum OPG levels in patients with IPAH. (A) Scatter plot shows serum level of OPG in control and IPAH serum (Cohort 1) samples from retrospective analysis of prevalent cases. Dotted line represents the median, n=35. ***P<0.001 compared to control samples. (B) Assessment of serum OPG concentration against event-free survival. There was a significantly higher event-free survival in patients with serum OPG concentration below 4728 pg/ml (light gray line) having a 3-year survival of 84% compared with vs. 40% in patients with concentrations above 4728 pg/ ml (dark gray line).

by serum OPG concentration was 0.72 with an optimal threshold of 4728 pg/ml (true positive 73%, false positive 22%). A significant difference in event-free survival was demonstrated using this threshold (3-year survival 85% vs. 40%, P=0.014; Fig. 2B).

Patient characteristics, OPG concentrations and prognostic strength in a prospective, treatmentnaïve cohort Baseline demographics and serum OPG concentration for Cohort 2 and controls are shown in Table 1. Patients in Cohort 2 were older, had a higher mean cardiac index (CI) and lower pulmonary vascular resistance than in Cohort 1. All patients were treatment-naïve (Table 1) and all sampling was performed at or within 24 hours of RHC. Median OPG concentrations (4505 pg/ml) were significantly higher than in controls (1352 pg/ ml, P<0.001; Fig. 3A) while there was no significant difference compared with Cohort 1 (4807 pg/ml, P=ns). In Cohort 2, OPG concentrations correlated positively with age (r=0.49, P=0.019) and inversely with DLCO (r=–0.69, P=0.02; Table 2). When adjusted for age the correlation between OPG and DL CO persisted. No correlations between OPG and pulmonary hemodynamics, exercise capacity or WHO functional class were observed. Median follow-up from date of sampling to census in Cohort 2 was 0.62 (0.38, 1.5) years. Patients were treated with targeted therapies in keeping with current guidelines. [19] Six patients died during follow-up. The previously identified threshold of 4728 pg/ml predicted mortality in Cohort 2 (1 year survival 91% vs. 41%, P=0.046: Fig. 3B). Neither OPG nor traditional important prognostic factors such as pulmonary hemodynamics predicted survival in either Cohort 1 or 2 by univariate Cox regression analysis. 24

Comparison of OPG with previously recognized putative biomarkers Correlations of several previously described putative biomarkers were explored in the treatment-naïve Cohort 2. NT-Pro BNP correlated inversely with CI (r=–0.45, P=0.037) and incremental shuttle walking distance (r=–0.52, P=0.016) and positively with mRAP (r=0.53, P=0.011) but not with age, WHO functional class or OPG level. In this cohort no threshold of NT-Pro BNP could be identified which significantly predicted outcome. No correlations between creatinine, red cell distribution width, GDF-15, IL-1β, IL-6, IL-8, IL-10, and IL-12p70 and pulmonary hemodynamics were observed. OPG correlated positively with GDF-15 (r=0.53, P=0.025; Table 2).

Serum OPG correlates with disease progression and severity in pre-clinical models Utilizing serum and histomorphological data collected from our preclinical animal models, we examined whether there was any correlation between serum OPG and pulmonary vascular remodeling during disease progression and regression. In the monocrotaline rat model there was a significant correlation between pulmonary vascular remodeling as assessed by media/ cross sectional area (media/CSA) of small pulmonary arterioles (<50 µm) and serum OPG (R2=0.63, P<0.0001; Fig. 4A) over 28 days. We have recently described the beneficial effects of treatment with interleukin-1 receptor antagonist (IL-1Ra) in a mouse model of severe pulmonary hypertension that is associated with obliterative pulmonary vascular lesions. [17] To further examine whether OPG would also track with treatment of established disease, we subsequently examined the relationship between serum OPG and media/CSA in these mice and again found a significant correlation (R2=0.37, P<0.05: (Fig. 4B)). Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Condliffe et al.: OPG as a biomarker for IPAH

1.0

Cumulative survival (%)

12000

OPG (pg/ml)

10000 8000 6000 4000

<4728

0.8 0.6 0.4 >4728 0.2 P=0.46

2000 0.0

0 (A)

Cohort 1

Control

Cohort 2

(B)

0.00

1.00 1.50 2.00 0.50 Survival from sampling (yrs)

2.50

Figure 3: Prospective analysis of serum OPG levels in patients with IPAH. (A) Scatter plot shows serum level of OPG in control and retrospective prevalent cases of IPAH (Cohort 1) and prospectively collected samples of treatment naïve incident cases of IPAH (Cohort 2). Dotted line represents the median, n=35 of control and Cohort 1, and 23 for Cohort 2. ***P<0.001 compared to control samples. (B) Assessment of serum OPG concentration against event-free survival. There was a significantly higher event-free survival in patients with serum OPG concentration below 4728 pg/ml (light gray line) having a 1-year survival of 91% compared with vs. 41% in patients with concentrations above 4728 pg/ml (dark gray line).

Figure 4: Serum OPG levels correlate with pulmonary vascular remodeling in rodent models of PAH. Graphs show a significant correlation of serum OPG with media/cross-sectional area (Media/CSA) in (A) a time course of disease development in the monocrotaline rat model, and (B) the fat-fed ApoE–/– mouse model of PAH with disease regression following treatment with interleukin-1 receptor antagonist (IL-1Ra).

DISCUSSION We previously reported that levels of OPG protein are increased in pulmonary artery lesions and sera from patients with IPAH.[5] Critically, this is the first study to provide evidence that this increased protein expression is driven by resident PASMCs. We subsequently examined the prognostic utility of OPG as a biomarker in both a restrospective and subsequent prospective clinical study. We demonstrated in these two separate cohorts that IPAH is characterized by significantly higher serum OPG levels than control patients. We also showed that serum OPG correlates significantly with hemodynamic markers of severity such as mRAP and CI in a predominantly prevalent population (Cohort 1), while in an older incident population (Cohort 2) there was a significant correlation with DLCO Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

even when adjusted for age. Most importantly, we observed that OPG levels >4728 pg/ml predicted poorer survival in both cohorts. In addition we provide further evidence of the utility of OPG as a biomarker for pulmonary vascular remodeling by showing a significant correlation between serum levels and vascular remodeling in two animal models of pulmonary hypertension during disease progression but encouragingly, also during regression.

These findings are in keeping with a previous study in which OPG was found to be elevated in patients with PAH associated with congenital systemic to pulmonary shunts [6] and also with several studies which have found OPG to be an important prognostic factor in left ventricular disease. [7- 9] Interestingly, in a cohort of patients with acute coronary syndrome, OPG was shown to be of 25

Condliffe et al.: OPG as a biomarker for IPAH

strong prognostic value for mortality and heart failure hospitalization especially in patients with OPG >4540 pg/ml, a very similar level to the prognostic threshold observed in the present study.[20]

There is a major unmet need for a marker of pulmonary vascular remodeling. While we cannot rule out a contribution of other sources of OPG in serum, the evidence that PA-SMC express higher levels of OPG mRNA certainly suggests that the remodeling of the distal pulmonary arterial bed during disease progression contributes significantly to OPG concentrations in the bloodstream. Furthermore, we found significant correlations between serum OPG levels and pulmonary artery remodeling in 2 rodent models. The origin of OPG being in the pulmonary arteries is further supported by the lack of correlation of OPG levels with markers of right ventricular function such as mRAP, CI and NT pro-BNP in Cohort 2. Interestingly we also observed a significant correlation between DLCO and OPG. Pulmonary diffusing capacity of carbon monoxide is dependent on the alveolar membrane diffusing capacity and pulmonary capillary blood volume. Significantly abnormal lung function or a significant degree of parenchymal lung disease were exclusion criteria in the present study and it could therefore be hypothesized that this correlation was observed due to high levels of OPG reflecting a higher degree of pulmonary arterial vasculopathy and hence a lower pulmonary capillary blood volume. As has been noted above, however, that elevated OPG levels have been previously observed in left ventricular failure[9] and elsewhere this has been found to occur in both ischemic and non-ischemic forms of cardiomyopathy.[21] It is therefore also possible that a proportion of the serum OPG observed in the present may study arise from the right ventricle. This would be supported by the significant correlations observed with both mRAP and CI in Cohort 1.

It is interesting to note that there was a difference in observed correlations between OPG and other parameters in the two cohorts. There are several possible explanations for this difference. Firstly, patients in the more recent group (Cohort 2) were significantly older than in the earlier group, consistent with the increasing age of patients reported elsewhere.[22] Secondly, the majority of patients in Cohort 1 were already receiving disease-modifying therapies which may have affected OPG levels. A reduction in levels of another chemokine, monocyte chemoattractant protein-1, after treatment with prostacyclin, has previously been observed in patients with IPAH.[23] The effect of diseasemodifying therapy on OPG and other chemokines will be assessed in a larger cohort with a longer follow-up. Thirdly, median time between OPG sampling and RHC was significant in Cohort 1 while all patients in Cohort 2 had sampling performed either at or within 24 hours of RHC. 26

In the present study we also did find correlations between previously identified novel biomarkers and pulmonary hemodynamics but it is acknowledged that Cohort 2 is relatively small compared with previous studies.[24] In conclusion, OPG mRNA expression is increased in PASMC from patients with IPAH while serum levels are also significantly elevated when compared to controls. Levels of OPG >4728 pg/ml are associated with an increased chance of death or transplantation. These findings certainly warrant further investigation of OPG as both a biomarker and a potential therapeutic target.

ACKNOWLEDGMENTS

The authors would like to acknowledge funding from the Medical Research Council UK, the British Heart Foundation, the National Institute for Health Research Sheffield Cardiovascular Biomedical Research Unit, and Cambridge University Hospitals Biomedical Research Center. We are also grateful to all the patients, nurses and support staff who contributed to this study.

REFERENCES 1.

2. 3.

10.

11.

12.

Pietra GG, Capron F, Stewart S, Leone O, Humbert M, Robbins IM, et al. Pathologic assessment of vasculopathies in pulmonary hypertension. J Am Coll Cardiol 2004;43:25S-32S. Rubin L. Primary pulmonary hypertension. New Engl J Med 1997;336:111-7. Simonet W, Lacey D, Dunstan C, Kelley M, Chang M, Luthy R, et al. Osteoprotegerin: A novel secreted protein involved in the regulation of bone density. Cell 1997;89:309-19. Emery J, McDonnell P, Burke M, Deen K, Lyn S, Silverman C, et al. Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. J Biol Chem 1998;273:14363-7. Lawrie A, Waterman E, Southwood M, Evans D, Suntharalingam J, Francis S, et al. Evidence of a role for osteoprotegerin in the pathogenesis of pulmonary arterial hypertension. Am J Pathol 2008;172:256-64. Brun H, Holmstrøm H, Thaulow E, Damås JK, Yndestad A, Aukrust P, et al. Patients with pulmonary hypertension related to congenital systemic-topulmonary shunts are characterized by inflammation involving endothelial cell activation and platelet-mediated inflammation. Congenit Heart Dis 2009;4:153-9. Andersen GØ, Knudsen EC, Aukrust P, Yndestad A, Øie E, Müller C, et al. Elevated serum osteoprotegerin levels measured early after acute ST-elevation myocardial infarction predict final infarct size. Heart 2011;97: 460-5. Lieb W, Gona P, Larson M, Massaro J, Lipinska I, Keaney JF Jr, et al. Biomarkers of the Osteoprotegerin Pathway: Clinical Correlates, Subclinical Disease, Incident Cardiovascular Disease, and Mortality. Arterioscler Thromb Vasc Biol 2010;30:1849-54. Røysland R, Masson S, Omland T, Milani V, Bjerre M, Flyvbjerg A, et al. Prognostic value of osteoprotegerin in chronic heart failure: The GISSI-HF trial. Am Heart J 2010;160:286-93. Stępień E, Wypasek E, Stopyra K, Konieczyńska M, Przybyło M, Pasowicz M. Increased levels of bone remodeling biomarkers (osteoprotegerin and osteopontin) in hypertensive individuals. Clin Biochem 2011;44:826-31. Chang YH, Lin KD, He SR, Hsieh MC, Hsiao JY, Shin SJ. Serum osteoprotegerin and tumor necrosis factor related apoptosis inducingligand (TRAIL) are elevated in type 2 diabetic patients with albuminuria and serum osteoprotegerin is independently associated with the severity of diabetic nephropathy. Metabolism 2011;60:1064-9. Rasmussen L, Tarnow L, Hansen T, Parving H, Flyvbjerg A. Plasma osteoprotegerin levels are associated with glycaemic status, systolic blood pressure, kidney function and cardiovascular morbidity in type 1 diabetic

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Condliffe et al.: OPG as a biomarker for IPAH

13.

14.

15.

16.

17.

18. 19.

patients. Eur J Endocrinol 2006;154:75-81. Waluś-Miarka M, Katra B, Fedak D, Czarnecka D, Miarka P, Woźniakiewicz E, et al. Osteoprotegerin is associated with markers of atherosclerosis and body fat mass in type 2 diabetes patients. Int J Cardiol 2011;147:335-6. Chen CH, Chen HA, Liao HT, Liu CH, Tsai CY, Chou CT. Soluble receptor activator of nuclear factor-kappaB ligand (RANKL) and osteoprotegerin in ankylosing spondylitis: OPG is associated with poor physical mobility and reflects systemic inflammation. Clin Rheumatol 2010;29:1155-61. Castellino G, Corallini F, Bortoluzzi A, Corte RL, Monaco AL, Secchiero P, et al. The tumour necrosis factor-related apoptosis-inducing ligandosteoprotegerin system in limited systemic sclerosis: A new disease marker? Rheumatology (Oxford) 2010;49:1173-6. Yang X, Long L, Southwood M, Rudarakanchana N, Upton P, Jeffery T, et al. Dysfunctional Smad signaling contributes to abnormal smooth muscle cell proliferation in familial pulmonary arterial hypertension. Circ Res 2005;96:1053-63. Lawrie A, Hameed AG, Chamberlain J, Arnold N, Kennerley A, Hopkinson K, et al. Paigen Diet–Fed Apolipoprotein E Knockout Mice Develop Severe Pulmonary Hypertension in an Interleukin-1–Dependent Manner. Am J Pathol 2011;179:1693-705. Holen I, Croucher P, Hamdy F, Eaton C. Osteoprotegerin (OPG) is a survival factor for human prostate cancer cells. Cancer Res 2002;62:1619-23. Galie N, Hoeper MM, Humbert M, Torbicki A, Vachiery JL, Barbera JA, et al. Guidelines for the diagnosis and treatment of pulmonary hypertension: The Task Force for the Diagnosis and Treatment of Pulmonary Hypertension of the European Society of Cardiology (ESC) and the European Respiratory Society (ERS), endorsed by the International Society of Heart and Lung

20. 21.

22. 23.

24.

Transplantation (ISHLT). Eur Heart J 2009;30:2493-537. Omland T, Ueland T, Jansson AM, Persson A, Karlsson T, Smith C, et al. Circulating osteoprotegerin levels and long-term prognosis in patients with acute coronary syndromes. J Am Coll Cardiol 2008;51:627-33. Ueland T, Yndestad A, Øie E, Florholmen G, Halvorsen B, Frøland SS, et al. Dysregulated osteoprotegerin/RANK ligand/RANK axis in clinical and experimental heart failure. Circulation 2005;111:2461-8. Badesch DB, Raskob GE, Elliott CG, Krichman AM, Farber HW, Frost AE, et al. Pulmonary arterial hypertension: Baseline characteristics from the REVEAL Registry. Chest 2010;137:376-87. Katsushi H, Kazufumi N, Hideki F, Katsumasa M, Hiroshi M, Kengo K, et al. Epoprostenol therapy decreases elevated circulating levels of monocyte chemoattractant protein-1 in patients with primary pulmonary hypertension. Circ J 2004;68:227-31. Soon E, Holmes AM, Treacy CM, Doughty NJ, Southgate L, Machado RD, et al. Elevated levels of inflammatory cytokines predict survival in idiopathic and familial pulmonary arterial hypertension. Circulation 2010;122:920-7.

Source of Support: Medical Research Council Career Development Award (G0800318, AL); British Heart Foundation Clinical Research Training Fellowship (FS/08/061/25740, AGH), the National Institute for Health Research Sheffield Cardiovascular Biomedical Research Unit, and Cambridge University Hospitals Biomedical Research Center, Conflict of Interest: None declared.

Announcement

Android App A free application to browse and search the journal’s content is now available for Android based mobiles and devices. The application provides “Table of Contents” of the latest issues, which are stored on the device for future offline browsing. Internet connection is required to access the back issues and search facility. The application is compatible with all the versions of Android. The application can be downloaded from https://market.android.com/details?id=comm.app.medknow. For suggestions and comments do write back to us. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Bosentan effects in hypoxic pulmonary vasoconstriction: Preliminary study in subjects with or without high altitude pulmonary edema-history Isabelle Pham1,6, Grégoire Wuerzner2,3, Jean-Paul Richalet1,5, Séverine Peyrard2, and Michel Azizi2,3,4 Paris 13, University, laboratory: “Cellular and functional responses to hypoxia”, Bobigny, France, 2Georges Pompidou European Hospital, 3Paris-Descartes University, faculty of medicine, 4INSERM, Clinical Investigation Center 9201, Paris, 5AP-HP Avicenne Hospital, Physiology, Department of Functional explorations and Sports Medicine, Bobigny, France, 6AP-HP, Department of Functional explorations, Jean Verdier Hospital, Bondy, France 1

ABSTRACT Hypoxia-induced pulmonary vasoconstriction in patients with a medical history of high-altitude pulmonary edema (HAPE) may involve activation of the endothelin-1 (ET-1) pathway. We, therefore, compared the effect of the ETA/ETB receptor antagonist, bosentan, on pulmonary artery systolic pressure (PASP) in healthy subjects with (HS: HAPE subjects, n=5) or without a HAPEhistory (CS: Control subjects, n=10). A double-blind, placebo-controlled, randomized, crossover design was performed in order to study the effects on PASP of a single oral dose of bosentan (250 mg) after 90 min exposure to normobaric hypoxia (FiO2=0.12). In normoxia, PASP, evaluated by echocardiography, was 23.4±2.7 mmHg in CS and 28±5.8 mmHg in HS (NS). During the placebo period, hypoxia induced a significant decrease in SaO2, PaO2 and PCO2 and increase in pH in both CS and HS. Pulmonary arterial systolic pressure was also significantly increased (+8.5±5.0 mmHg in CS; +13.4±3.1 mmHg in HS) and reached significantly higher levels in HS than in CS (P=0.02). Bosentan significantly but similarly blunted the hypoxia-induced increase in PASP in both CS (Bosentan: 27.0±3.3 mmHg; placebo: 32.1±3.5 mmHg; P<0.01) and HS (Bosentan: 35.0±2.9 mmHg; placebo: 41.4±7.6 mmHg; P<0.05), (CS 5.2±5.3 vs. HS -6.4±5.2 mmHg, NS). Bosentan did not have a major effect on the hypoxia-induced changes in blood gas, or on cardiac output (CO) and systemic blood pressure (SBP), which were not modified by hypoxia. Plasma ET-1 in hypoxia during the bosentan period was 2.8 times higher than during for both CS and HS. A single oral dose of bosentan similarly blunted the hypoxia-induced increase in PASP both in healthy and HAPE-susceptible subjects, without altering CO or SBP. Key Words: endothelin-1, hypoxia, pulmonary hypertension

INTRODUCTION Endothelin, which is a potent pulmonary vasoconstrictor, has been involved in the pathophysiological pathway of high-altitude pulmonary edema (HAPE). Indeed, the main mechanism for edema constitution appears to be hypoxic pulmonary vasoconstriction that leads to a larger increase in pulmonary artery pressure (PAP) in subjects with HAPE susceptibility than in subjects without HAPE history. In mountaineers, the increase in plasma ET-1 concentration at high altitude is correlated with the increase in PAP, and is Address correspondence to:

Dr. Isabelle Pham AP-HP Jean Verdier Hospital Functionnal Explorations Department, Av 14-juillet 93143 Bondy, France Email: isabelle.pham@jvr.aphp.fr 28

larger in subjects susceptible to HAPE than in subjects with no HAPE history.[1,2] Nonselective ETA/ETB endothelin receptor blockade in animal models prevent hypoxic pulmonary vasoconstriction and reduces acute and chronic hypoxiainduced pulmonary hypertension.[3-5] Thus, we and other investigators have shown that pulmonary arterial systolic pressure (PASP) in healthy subjects exposed to high altitude was significantly lower after endothelin-1 (ET-1) receptor Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94824 How to cite this article: Pham I, Wuerzner G, Richalet J, Peyrard S, Azizi M. Bosentan effects in hypoxic pulmonary vasoconstriction: Preliminary study in subjects with or without high altitude pulmonary edema-history. Pulm Circ 2012;2:28-33.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pham et al.: Bosentan and pulmonary pressure during hypoxia

blockade by bosentan than after placebo.[6,7] However, at the present time no data are available for subjects with a previous history of HAPE.

The aim of this study was therefore to investigate, in healthy mountaineers with a past history of HAPE in comparison with control subjects, the effects of a single oral dose of bosentan on PASP and cardiac hemodynamics during an acute normobaric-hypoxia test at rest and during submaximal exercise.

MATERIALS AND METHODS

Fifteen men (age: 37±8 years) with experience in mountain hiking were recruited for the study. Five of them had previously experienced at least 2 HAPE episodes at high altitude, defined as acute dyspnea with cyanosis at an altitude >3,000 m. with a need to descend to an altitude <2,000 m (HAPE subjects group, HS). The 10 remaining healthy subjects had not previously experienced HAPE, despite regular mountain hiking at or above the same altitude (control subjects group, CS). The results for the latter group have been published in detail elsewhere.[7] None of the subjects was acclimatized to altitude or was on any medication. They were nonsmokers and free of disease at the time of the study. All subjects gave written informed consent to participate to the study. The study was approved by the “Comité des Personnes se Prêtant à la Recherche Biomédicale, Paris-Cochin” and was carried out in accordance with the Declaration of Helsinki principles.

Study design

Briefly, the two groups were compared in a two-period, randomized, double-blind, crossover study in order to investigate the hemodynamic and biochemical effects of a single oral 250 mg dose of bosentan (Actelion, Ltd, Basel, Switzerland) or placebo during hypoxia on 2 distinct days separated by at least 2 days washout interval. The dose of bosentan used is the recommended dose for patients with primary or secondary pulmonary hypertension. Subjects were instructed to avoid strenuous physical activity 1 week before the investigation. All investigations were performed at the Georges Pompidou Hospital Clinical Investigation Center in Paris (40-50 m. above sea level) at normal barometric pressure. On each study day at 8 a.m., after a light caffeine- and fat-free breakfast, baseline echocardiography (with PASP measurement) was carried out and blood samples for plasma ET-1 concentration and blood gas measurements were taken at rest in normoxia and during a submaximal exercise test at 8:30 a.m. At 9:30 a.m., 250 mg bosentan or a matching placebo was given orally with 250 ml tap water, according to the randomization procedure. At 11:30 Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

a.m., the subject was exposed to normobaric hypoxia for 90 minutes. During exposure to the normobaric hypoxic gas mixture, a second set of echocardiography and blood sample analyses were carried out, at rest at 12:30 p.m. (3 hours. after bosentan or placebo ingestion) and during a second submaximal exercise test at 1 p.m.

Oxygen saturation (SaO2) by ear oximetry (Oximax N-595, Nellcor, Boulder, Colo., USA), systolic and diastolic blood pressure (SBP and DBP, respectively) by a semiautomatic validated oscillometric device (Nippon Collins, Komaki City, Japan) and heart rate (HR) were continuously monitored.

Normobaric hypoxia

Normobaric hypoxia was achieved by inhalation of a gas mixture of O2 (FiO2=0.12) and N2 at normal barometric pressure through a tightly secure facial mask; this pressure was equivalent to the oxygen partial pressure found at an altitude of 4,300 m (Altitrainer, SM-TEC, Lausanne, Switzerland).

Submaximal exercise test

The submaximal exercise tests were performed in the semisupine position on a cycle ergometer. The test started with a workload of 40 W. This was then increased by 10 W every minute until reaching 30% of the maximal heart rate during exercise in normoxia, which was calculated as follows: Resting HR + (maximal predicted HR – resting HR) × 0.3. Maximal predicted heart rate was calculated as 220 – age (years). For each subject, the same target HR during exercise was used in normobaric hypoxic conditions.

Echocardiographic measurements

Echocardiography was performed with a 3.5 MHz probe (Vivid 7, GE Healthcare, Milwaukee, Wis., USA), and the recordings were analyzed off-line. Left heart disease and patent foramen ovale were excluded on the first study day in all subjects by left heart standard measurements and a contrast test.[8] The PASP, defined as equal to the RV systolic pressure, was calculated using the modified Bernoulli equation (PASP = 4VTR2 + RAP), where VTR is the tricuspid regurgitation peak velocity, measured by continuous-wave Doppler and RAP the right atrial pressure. The right atrial pressure was estimated as a function of the inferior vena cava diameter and its variation during breathing. Pulmonary flow was recorded by pulsed-wave Doppler and acceleration time was measured from onset to the peak velocity of pulmonary flow. Pulmonary vascular resistance (PVR) was determined using the formula PVR (Wood Unit, WU) = VTR/VTIRVOT + 0.16, where VTIRVOT is the velocity time-integral of the right ventricle outflow tract. [9] Cardiac output (CO) was calculated as the product of the velocity-time integral and the area of the LV outflow tract and HR. Early tricuspid inflow wave, E, and annular 29

Pham et al.: Bosentan and pulmonary pressure during hypoxia

Laboratory methods

Plasma ET-1 concentrations were determined with a luminescent immunoassay kit ‘’QET00’’ (R & D Systems Europe Ltd, Abingdon, UK). The quantification limit was 0.25 pg/ml PaO 2, PCO 2, and pHa were measured in arterialized blood samples taken from an ear lobe prewarmed with capsaicin cream.

Statistics

Baseline characteristics and echocardiographic measurements between subjects with or without HAPE history were compared using the Wilcoxon rank sum test.

Experimental and treatment effects were assessed using analysis of variance (ANOVA) for a cross-over design in the CS group.[7] Results were expressed as mean differences with their 95% confidence intervals (CI). P values less than 0.05 were considered significant.

Given the small sample size of the HS group (n=5), we used the Wilcoxon signed-rank test to analyze the differences between bosentan and placebo in the different experimental conditions as listed above. Results were expressed as mean differences with their range. Because of the small sample size of the HS group and the general lack of power of nonparametric tests (Wilcoxon test), the lowest two-tailed P value could not be lower than 0.063, whatever the difference between paired observations. However, P=0.063 suggests that all five paired differences were in the same direction and thus had the same sign. Statistical analyses were performed with SAS statistical software (version 9.1, Cary, NC, USA).

RESULTS

Differences between control and HAPEsubjects during the placebo period: Baseline measurements and effects of exercise or normobaric hypoxia At screening, clinical characteristics of CS and HS were similar, with the exception of SBP and DBP, which were significantly higher in HS than in CS (Table 1).

Baseline PASP in normoxia was not significantly different between CS and HS (Table 1 and Fig. 1). Three HS had a baseline PASP between 30 and 35 mmHg, whereas the greatest PASP measured in CS was 28 mmHg. Pulmonary acceleration time, PVR, Et/Ea ratio, and CO at rest did 30

Table 1: Control and HAPE subject characteristics at screening and baseline At screening

Control subjects

Age (y.o.) BMI (kg/m2) Blood pressure (mmHg)

HAPEsubjects

35.9±8.2 23.3±2.0 118.0±11.3/ 68.2±6.6

40.6±6.1 23.8±1.8 140.8±14.0/ 78.9±6.1**

118±11

143±17

63.7±7.3 23.4±2.7 5.2±1.2 141.7±20.6 1.4±0.2 4.2±1.2 97.7±0.6 90.1±9.5 39.6±1.9 7.41±0.02

62.6±6.5 28.0±5.8 5.8±1.0 162.3±21.9 1.27±0.2 4.2±1.1 98.1±0.2 97.7±7.3 40.8±3.9 7.41±0.01

At baseline Systolic blood pressure (mmHg) Heart rate PASP (mmHg) Cardiac output (l/min) PAT (ms) PVR (W.U.) E/Et SaO2 (%) PaO2 (mmHg) PCO2 (mmHg) pH

**P<0.001 HS versus CS. BMI: Body mass index; PASP: Pulmonary artery systolic pressure; PAT: Pulmonary acceleration time; PVR: Pulmonary vascular resistance; W.U.: Wood unit; E/Et: Tricuspid inflow early velocity/tissueDoppler-imaging systolic annular tricuspid early velocity

&RQWURO

&RQWURO ERVHQWDQ

+$3(

+$3( ERVHQWDQ

3$63 PP+J

tricuspid velocity, Et, were measured by Doppler imaging for the tricuspid ratio: E/Et calculation. During the exercise tests, only VTR, pulmonary flow, tricuspid flow, and tricuspid annular velocities were recorded.

1 5HVW

1 (;

+ 5HVW

+ ([

Figure 1: Systolic pulmonary arterial pressure (PASP) in HAPE subjects (HS, gray bars) and control subjects (CS, open bars) during normoxia at rest (N-Rest) and exercise (N-Ex), and during hypoxia exposure at rest (H-Rest) and exercise (H-Ex). *P=0.02 HS vs. CS).

not significantly differ between the two groups (Table 1). Baseline HR, SaO2, and blood gases were similar between HS and CS (Table 1).

During exercise in normoxia, the workload necessary to reach 30% of the maximal predicted HR was similar in HS (116±11 W achieved in 8.6±1.14 min. on Day 1) and in CS (106±22 W, 8.5±3.6 min. on Day 1). Pulmonary arterial systolic pressure increased similarly in both groups; it reached 38±9 mmHg on Day 1 and 40±7 mmHg on Day 2 in HS, and 39±11 mmHg on Day 1 and 39±9 mmHg on Day 2 in CS (NS between groups; Fig. 1). Five CS and 2 HS reached a PASP > 45 mmHg during exercise. As expected, SBP increased during exercise (CS 163±23 and HS 173±11 mmHg), with no significant Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pham et al.: Bosentan and pulmonary pressure during hypoxia

In both CS and HS, exposure to normobaric hypoxia induced, a large and similar decrease in SaO2 (CS: 82.6±7.8%, HS: 78.9±5.7%), PaO2 (CS: 42.1±6.8 mmHg, HS: 41.1±6.6 mmHg), and PaCO2 (CS: 33.4±4.4 mmHg, HS: 36.9±3.2 mmHg) and a similar increase in pH (CS: 7.48±0.03, HS: 7.46±0.01) at rest. Pulmonary arterial systolic pressure at rest increased significantly by +8.5±5.0 mmHg in CS and by +13.4±3.1 mmHg in HS after 60- to 90-minute exposure to normobaric hypoxia (P= 0.075 CS vs. HS). It reached significantly higher levels in HS (41.4±7.6 mmHg) than in CS (32.1±3.5 mmHg, P=0.02; Fig. 1). The hypoxia-induced increase in PASP was accompanied by a similar parallel increase in PVR in the CS: (1.7±0.2 WU, P<0.05) and the HS (1.8±0.4 WU, P=0.063) and a decrease in pulmonary acceleration time, which was significant only in HS (132.8±14.8 ms, P=0.063). Systemic blood pressure and CO did not significantly change with exposure to normobaric hypoxia, in either group (not shown). Plasma ET-1 concentrations at rest slightly increased with hypoxia in CS (+35%) but not in HS (Fig. 2). In both CS and HS, exercise in normobaric hypoxic conditions induced a further decrease in SaO2 (CS: 72.3±3.0%, HS 69.5±8.1 %), PaO2 (CS: 34.3±2.9 mmHg, HS 32.7±4.2 mmHg) and PaCO2 (CS: 29.7±4.3 mmHg, HS 31.4±3.8 mmHg) with no significant difference between the two groups. Maximal workload, and the time to reach the expected HR, decreased substantially during normobaric hypoxia in both CS and HS (workload: 69±14.5 W vs. 72±14.8 W, respectively, NS; HR: 4.20±1.75 min vs. 4.20±1.48 min, respectively, NS). A further increase in PASP, by +11±7.9 mmHg in CS and by +10.4±13 mmHg in HS, was observed (NS between groups; Fig. 1). The PASP reached at maximal workload in hypoxic conditions was higher in HS (51.8±12 mmHg) than in CS (43±8.5 mmHg) but the difference between groups was not significant (Fig. 1; P=0.21). Four HS patients had PAPS > 45 mmHg during exercise in normobaric hypoxia.

Differences between control and HAPE-subjects: Effects of bosentan at rest and exercise during normobaric hypoxia Bosentan was well tolerated in all subjects and induced significantly 3- to 4-fold higher plasma ET-1 concentrations in hypoxic conditions at rest compared to placebo (Fig. 2).

During normobaric hypoxia at rest, PASP after bosentan was not significantly different in CS and HS (CS: 27.0±3.3 mmHg and HS: 35.0±2.9 mmHg, P=NS), although bosentan significantly blunted the hypoxia-induced increase in PASP for both CS and HS compared to placebo (CS: 5.2 mmHg, 95% CI [2.4; 9.9], P=0.002 bosentan vs. placebo; HS: 6.4 mmHg, Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

8 Plasma ET-1 (pg/mL)

difference between HS and CS at the maximal workload. Heart rate, SaO2, and blood gases and echocardiographic measurements (pulmonary acceleration time, PVR, CO) were similar between HS and CS during exercise (not shown).

7 6

5 4 3 2 1 0

Normoxia

Hypoxia

Hypoxia-bosentan

Figure 2: Plasma endothelin-1 (ET-1) concentrations in control (CS, open bar) and HAPE (HS, gray bar) subjects. *P=0.04; **P<0.01.

95%CI [3.4; 13.1], P=0.063 bosentan vs. placebo Fig. 1). All HS had PASP <40 mmHg at rest during the bosentan period. The increase in PVR did not significantly change between bosentan and placebo periods for either group (CS: 1.5±0.2 WU, HS: 1.5±0.3 WU).

Bosentan had no significant effect on the magnitude of the exercise-induced increase in PASP during hypoxia (exercise–rest) in either CS (bosentan: +13.4±11.3 mmHg; placebo: +11.0±7.9 mmHg; P=0.68) or HS (bosentan: +11.9±11.9 mmHg; placebo: +10.4±13.0 mmHg; P=0.81). However, after bosentan intake, PASP during exercise in hypoxia remained higher for HS than for CS (not shown) and lower than after placebo, for both CS (39.6±12.6 mmHg) and HS (46.85±11.3 mmHg), although these differences were not statistically significant (Fig. 1). There was no significant difference between bosentan and placebo for either SBP or echocardiographic parameters in hypoxic conditions at rest or exercise (not shown). Bosentan had no significant effect on SaO2, PaCO2, PaO2, and pH at rest or during exercise in hypoxic conditions in either group (not shown).

DISCUSSION

High-altitude pulmonary edema occurs in <1% of otherwise healthy subjects during ascent to high altitude. Level of altitude, prior acclimatization, rate of ascent, exertion, cold, individual genetic susceptibility, and presence of patent foramen ovale are the main clinical determinants for HAPE.[10] However, searching for other potential pathophysiological pathways in order to detect the subjects susceptible to develop HAPE and to find new therapeutic strategies to prevent HAPE occurrence is still a topical subject. Our results show that, in subjects with or without medical history of HAPE, blockade of ETA and ETB receptors by a single oral dose of bosentan 250 mg similarly reduces the hypoxia-induced pulmonary hypertension at rest. Although bosentan did not significantly reduce 31

Pham et al.: Bosentan and pulmonary pressure during hypoxia

the magnitude of the increase in PASP due to exercise in hypoxic conditions, PASP remained 3-5 mmHg lower after bosentan intake than after placebo intake in both groups. The vasodilatory effect of bosentan was restricted to the pulmonary circulation and bosentan had no effect on right ventricular systolic or on systemic hemodynamics (SBP, CO and HR). Despite its favorable pulmonary hemodynamic effect, acute administration of bosentan had no significant effect on gas exchange in hypoxic conditions in control or HAPE subjects.

Differences between CS and HS during the placebo period

Several attempts have been made to identify HAPEsusceptible individuals and to apply preventive measures before an ascent to high altitude (reviewed in Reference 10). These subjects appear to have an increase pulmonary vasoreactivity which may be revealed by hypoxia and/or exercise. As previously reported, we first confirmed that HS had normal resting PASP at sea level in normoxia.[11] However, in our study, resting PASP was slightly higher, although nonsignificantly, in HS than in CS. Part of the difference in resting PASP between the two groups may be due to the higher SBP in HS than CS.[12] Second, we confirmed that for a similar hypoxia-induced decrease in SaO2 and PaO2 at rest, HS had more pronounced hypoxic pulmonary vasoconstriction (increase in PVR) than CS, thus achieving a significantly higher PASP. This was consistent with the results of previous studies.[11,13-15] However, there was an overlap of PASP values between HS and CS that did not allow HS to be distinguished from CS. Further, larger studies are needed in order to establish if the hypoxia test at rest could serve as a screening test to detect HAPE-susceptible subjects before altitude exposure. Third, in contrast to previous findings,[11] PASP values recorded during exercise at a similar workload in normoxic conditions (≈110 W for a HR ≈120 bpm in both groups) did not significantly differ between HS and CS. Indeed, Grunig et al.[11] suggested that a PASP > 45 mmHg during submaximal exercise in normoxia may be a useful screening test to identify HAPE susceptible subjects. We observed that PASP at exercise in normoxia was >45 mmHg only in 2 HS and that 2 CS reached PASP above this threshold during exercise. However, these data should be interpreted with caution because of the small sample size of the two studies. Finally, the workload achieved under normoxic (≈110 W, 8–9 minutes) and hypoxic (≈70 W, 4–5 minutes) conditions were similar between HS and CS. The larger increase in PASP in HS than in CS during hypoxia at rest and exercise suggests an increased intrinsic vasoreactivity of their pulmonary circulation in response to hypoxic stress, potentially involving ET-1 transduction pathways (reviews in [16] and [17]). We found that a 90-minute exposure to normobaric hypoxia induced a slight increase in plasma ET-1 concentrations in CS but not in HS, probably 32

because of its small sample size. Previous studies have found plasma ET-1 concentration to be higher in HAPE susceptible subjects than in nonsusceptible subjects, with the increase in plasma ET-1 concentration correlated to the increase in PASP after exposure to high altitude.[1,2] Berger et al. also found that at high altitude there is a transpulmonary gain in ET-1 plasma concentration while at sea level there is a transpulmonary loss.[18] This may be due to increased ET-1 release from endothelial cells and/or increased conversion of big ET-1.[19,20] However, measurement of endothelins in plasma is not a sensitive method for investigating the effects of endothelins within the vascular wall, whereas the magnitude of the response to a pharmacological of ETA/ETB receptors represents at best an integrated evaluation of the degree of the endothelin system involvement.

Bosentan effects at rest and during exercise during normobaric hypoxia in HS and CS The selected dose of bosentan (250 mg) effectively blocked ETA/ETB receptors in both CS and HS, with a similar 3-fold increase in plasma ET-1 concentrations.[21-23] It also blunted the hypoxia-induced increase in PASP at rest in both CS and HS subjects, with a similar decrease (15-20%) in PASP. This is consistent with the results of the ACME-1 study, in which PASP was 30% lower after 3-day bosentan treatment (62.5–125 mg o.d.) than after placebo in healthy subjects after an ascent to high altitude.[6] In our study, bosentan did not significantly reduce the magnitude of the exercise/ hypoxia-induced increase in PASP in both groups. However, PASP after bosentan treatment remained 3–5 mmHg lower than after placebo in both groups (NS). Although HS reached a higher PASP than CS during both rest and exercise under hypoxic conditions, the magnitude of the blunting effect of bosentan on PASP increase did not differ between HS and CS groups; however, PASP after bosentan treatment remained higher in HS than in CS.

The absence of a significant difference between bosentan and placebo during exercise can be explained by increased between-subject variability in PASP and difficulty in obtaining adequate Doppler signal during exercise. Furthermore, the small sample size of the study also contributes to the absence of significant response. The effect of bosentan on PASP was probably due to its selective pulmonary vasodilatory effect at the selected dose.[24] Indeed, the blunting effect of bosentan on the PASP increase was not associated with any change in CO, SBP or HR. Finally, a single oral dose of bosentan had no major effect on SaO2 or blood gases at rest or during exercise under hypoxic conditions, suggesting that in contrast with Faoro et al.[25] a single oral dose of bosentan does not have an acute effect on oxygen transfer capacity in these experimental conditions in normal or HAPE-subjects. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pham et al.: Bosentan and pulmonary pressure during hypoxia

CONCLUSION

Our preliminary findings demonstrate that (1) the ET1 system is indeed activated by hypoxia independently of individual susceptibility to HAPE, and (2) this activation can be effectively and partly reversed by an ETA/ETB receptor antagonist. However, the fact that the magnitude of the reduction in PASP after bosentan treatment was similar between HS and CS suggests that hypoxia-induced activation of the ET-1 system is not any greater in HS than in CS in our experimental conditions. Therefore, the PASP response during hypoxia to a single oral dose of 250 mg of bosentan cannot serve as a useful screening test to identify HAPE susceptible subjects. However, these results should be confirmed by further studies involving more subjects.

8. 9. 10. 11. 12. 13. 14. 15.

ACKNOWLEDGMENTS

The authors thank the nursing staff of the Clinical Investigation Centre at the Georges Pompidou Hospital who ran the protocol, Dr. Laure Marelle who recruited the subjects and Dr. Jean-Louis Paul who performed the ET1 dosages. They also thank Dr. Virgine Gressin (Actélion, France) and Dr. Martine Clozel (Actélion, Basle) to have kindly provided bosentan and its matching placebo.

REFERENCES 1. 2. 3. 4.

Sartori C, Vollenweider L, Loffler BM, Delabays A, Nicod P, Bärtsch P, et al. Exaggerated endothelin release in high-altitude pulmonary edema. Circulation 1999;99:2665-8. Goerre S, Wenk M, Bartsch P, Lüscher TF, Niroomand F, Hohenhaus E, et al. Endothelin-1 in pulmonary hypertension associated with high-altitude exposure. Circulation 1995;91:359-64. Eddahibi S, Raffestin B, Clozel M, Levame M, Adnot S. Protection from pulmonary hypertension with an orally active endothelin receptor antagonist in hypoxic rats. Am J Physiol 1995;268(2 Pt 2):H828-35. Willette RN, Ohlstein EH, Mitchell MP, Sauermelch CF, Beck GR, Luttmann MA, et al. Nonpeptide endothelin receptor antagonists. VIII: Attentuation of acute hypoxia-induced pulmonary hypertension in the dog. J Pharmacol Exp Ther 1997;280:695-701. Underwood DC, Bochnowicz S, Osborn RR, Luttmann MA, Hay DW. Nonpeptide endothelin receptor antagonists. X. Inhibition of endothelin-1and hypoxia-induced pulmonary pressor responses in the guinea pig by the endothelin receptor antagonist, SB 217242. J Pharmacol Exp Ther 1997;283:1130-7. Modesti PA, Vanni S, Morabito M, Modesti A, Marchetta M, Gamberi T, et al. Role of endothelin-1 in exposure to high altitude: Acute Mountain Sickness and Endothelin-1 (ACME-1) study. Circulation 2006;114:1410-6.

16. 17. 18. 19. 20. 21. 22. 23.

24. 25.

Pham I, Wuerzner G, Richalet JP, Peyrard S, Azizi M. Endothelin receptors blockade blunts hypoxia-induced increase in PAP in humans. Eur J Clin Invest 2010;40:195-202. Allemann Y, Hutter D, Lipp E, Sartori C, Duplain H, Egli M, et al. Patent foramen ovale and high-altitude pulmonary edema. JAMA 2006;296:2954-8. Abbas AE, Fortuin FD, Schiller NB, Appleton CP, Moreno CA, Lester SJ. A simple method for noninvasive estimation of pulmonary vascular resistance. J Am Coll Cardiol 2003;41:1021-7. Hackett PH, Roach RC. High-altitude illness. N Engl J Med 2001;345:107-14. Grunig E, Mereles D, Hildebrandt W, Swenson ER, Kübler W, Kuecherer H, et al. Stress Doppler echocardiography for identification of susceptibility to high altitude pulmonary edema. J Am Coll Cardiol 2000;35:980-7. Abergel E, Chatellier G, Toussaint P, Dib JC, Menard J, Diebold B. Dopplerderived pulmonary arterial systolic pressure in patients with known systemic arterial pressures. Am J Cardiol 1996;77:767-9. Hultgren HN, Grover RF, Hartley LH. Abnormal circulatory responses to high altitude in subjects with a previous history of high-altitude pulmonary edema. Circulation 1971;44:759-70. Kawashima A, Kubo K, Kobayashi T, Sekiguchi M. Hemodynamic responses to acute hypoxia, hypobaria, and exercise in subjects susceptible to highaltitude pulmonary edema. J Appl Physiol 1989;67:1982-9. Yagi H, Yamada H, Kobayashi T, Sekiguchi M. Doppler assessment of pulmonary hypertension induced by hypoxic breathing in subjects susceptible to high altitude pulmonary edema. Am Rev Respir Dis 1990;142:796-801. Weir EK, Lopez-Barneo J, Buckler KJ, Archer SL. Acute oxygen-sensing mechanisms. N Engl J Med 2005;353:2042-55. Bartsch P, Mairbaurl H, Maggiorini M, Swenson ER. Physiological aspects of high-altitude pulmonary edema. J Appl Physiol 2005;98:1101-10. Berger MM, Dehnert C, Bailey DM, Luks AM, Menold E, Castell C, et al. Transpulmonary plasma ET-1 and nitrite differences in high altitude pulmonary hypertension. High Alt Med Biol 2009;10:17-24. Takahashi H, Soma S, Muramatsu M, Oka M, Fukuchi Y. Upregulation of ET-1 and its receptors and remodeling in small pulmonary veins under hypoxic conditions. Am J Physiol Lung Cell Mol Physiol 2001;280:L1104-14. Takahashi H, Soma S, Muramatsu M, Oka M, Ienaga H, Fukuchi Y. Discrepant distribution of big endothelin (ET)-1 and ET receptors in the pulmonary artery. Eur Respir J 2001;18:5-14. Bohm F, Pernow J, Lindstrom J, Ahlborg G. ETA receptors mediate vasoconstriction, whereas ETB receptors clear endothelin-1 in the splanchnic and renal circulation of healthy men. Clin Sci (Lond) 2003;104:143-51. Fukuroda T, Fujikawa T, Ozaki S, Ishikawa K, Yano M, Nishikibe M. Clearance of circulating endothelin-1 by ETB receptors in rats. Biochem Biophys Res Commun 1994;199:1461-5. Weber C, Schmitt R, Birnboeck H, Hopfgartner G, van Marle SP, Peeters PA, et al. Pharmacokinetics and pharmacodynamics of the endothelin-receptor antagonist bosentan in healthy human subjects. Clin Pharmacol Ther 1996;60:124-37. Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, et al. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med 2002;346: 896-903. Faoro V, Boldingh S, Moreels M, Martinez S, Lamotte M, Unger P, et al. Bosentan Decreases Pulmonary Vascular Resistance and Improves Exercise Capacity in Acute Hypoxia. Chest 2009;135:1215-22.

Source of Support: This work was supported by a grant from Assistance Publique des Hôpitaux de Paris (Contrat d’Initiative à la Recherche Clinique: AOR05053). Clinical trial registration information: www.clinicaltrials.gov NCT00260819, Conflict of Interest: None declared.

Announcement

iPhone App A free application to browse and search the journal’s content is now available for iPhone/iPad. The application provides “Table of Contents” of the latest issues, which are stored on the device for future offline browsing. Internet connection is required to access the back issues and search facility. The application is Compatible with iPhone, iPod touch, and iPad and Requires iOS 3.1 or later. The application can be downloaded from http://itunes.apple.com/us/app/medknow-journals/ id458064375?ls=1&mt=8. For suggestions and comments do write back to us. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Three-dimensional analysis of right ventricular shape and function in pulmonary hypertension Peter J. Leary1, Christopher E. Kurtz2, Catherine L. Hough1, Mary-Pierre Waiss3, David D. Ralph1, and Florence H. Sheehan2 1

University of Washington, Division of Pulmonary and Critical Care, Seattle, Washington, 2University of Wisconsin, Division of Cardiology, Madison, Wisconsin, 3Ventripoint, Inc., USA

ABSTRACT Right ventricular (RV) failure is a key determinant of morbidity and mortality in pulmonary hypertension (PH). The present study aims to add to existing descriptions of RV structural and functional changes in PH through a comprehensive three-dimensional (3D) shape analysis. We performed 3D echocardiography on 53 subjects with PH and 19 normal subjects. Twenty short-axis slices from apex to tricuspid centroid were measured to characterize regional shape: apical angle, basal bulge, eccentricity, and area. Transverse shortening was assessed by fractional area change (FAC) in each short-axis slice, longitudinal contraction was assessed by tricuspid annular plane systolic excursion (TAPSE) and global function by RV ejection fraction. Multivariate logistic analysis was used to compare the association of RV parameters with New York Heart Association (NYHA) class. Compared to normal, RV function in PH is characterized by decreased stroke volume index (SVi), fractional area change and ejection fraction. Increased eccentricity, apical rounding and bulging at the base characterize the shape of the RV in PH. Increased SVi, ejection fraction and mid-ventricular FAC were associated with less severe NYHA class in adjusted analyses. The RV in idiopathic PH (iPAH) was observed to have a larger end-diastolic volume and decreased function compared with connective tissue disease associated PH (ctd-PH). This work describes increased eccentricity and decreased systolic function in subjects with PH. Functional parameters were associated with NYHA class and heterogeneity in the phenotype was noted between subjects with iPAH and ctd-PH. Key Words: pulmonary hypertension, right ventricle, 3D echocardiography

INTRODUCTION Pulmonary hypertension (PH) is defined by increased pulmonary vascular resistance and elevated pulmonary arterial pressure. Research focused on the vascular biology of PH has identified several therapeutic targets and progress has been made in treating the disease. Despite these significant advances, PH continues to have a high mortality and morbidity.[1]

Morbidity and mortality in PH are strongly related to right ventricular (RV) failure.[2] Characterization of the structure and function of the RV in a clinical population is limited by its complex shape, which poses an inherent challenge to traditional two-dimensional imaging modalities.[3] With the growing availability of three-dimensional (3D) techniques such Address correspondence to:

Dr. Peter J. Leary University of Washington Medical Center 1959 NE Pacific Street Campus Box 35622 Seattle, WA 98195-6522, USA Email: leary.peterj@gmail.com 34

as magnetic-resonance imaging and 3D echocardiography, assessment of structural and functional changes in the stressed RV is now becoming feasible.[4-8] Three-dimensional modalities offer superior accuracy and reproducibility in the assessment of RV shape and function.[3,9,10] With more accessible and reliable summary measures, including RV end-diastolic volume and ejection fraction, determinants of RV function are being investigated in large cohorts.[11-â&#x20AC;&#x2030;13] Comprehensive shape analyses are typically smaller in scale; however, they add granularity to the interpretation of summary measures in large cohort studies[14] and can suggest mechanistic paradigms.[15] To date, a comprehensive shape analysis of the RV in PH using 3D echocardiography has not Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94828 How to cite this article: Leary PJ, Kurtz CE, Hough CL, Waiss M, Ralph DD, Sheehan FH. Three-dimensional analysis of right ventricular shape and function in pulmonary hypertension. Pulm Circ 2012;2:34-40.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Leary et al.: 3D analysis of RV in PH

been performed, although individual shape parameters have been associated with prognosis.[6]

In this analysis we perform a comprehensive shape analysis. We hypothesize that the RV in PH has a unique phenotype compared to the RV in normal subjects; furthermore, we suspect that parameters of function instead of shape will associate with symptom severity. Secondarily, we hypothesize that heterogeneity in RV phenotype exists between iPAH and ctd-PH.

MATERIALS AND METHODS Patient population

This study includes 72 subjects: 58 with PH and 19 normal; 5 PH subjects were excluded for uninterpretable echocardiograms for a final study sample of 53 PH subjects. PH subjects were a convenience sample of volunteers at the 8th and 9th International Pulmonary Hypertension Conferences. PH subjects provided basic survey data with additional survey elements including NYHA class collected only during the second enrollment. Normal subjects were healthy volunteers with no history of heart or lung disease, abnormal electrocardiogram or echocardiogram. The Human Subjects Review Committee of the University of Washington (#27609) and Washington State Institutional Review Board (#20081178) approved the study and all subjects provided informed consent.

Image acquisition

Imaging was performed using standard echocardiography equipment (Terason 3000, Teratech, Burlington, MA, or Acuson Sequoia, Oceanside, Calif.). A magnetic field tracking system (Flock of Birds, Ascension Technology Corp., Burlington, Vt.) continuously registered the spatial position and orientation of the echo probe. Each subject was imaged in the left lateral decubitus position at held end expiration on a nonferrous bed with a deep apical cutout. The RV, LV, and all four cardiac valves were imaged from standard echocardiographic windows (left parasternal, apical, subcostal). Further images were taken from the suprasternal, high left parasternal, and right parasternal windows when necessary to obtain optimal visualization of the pulmonic valve, infundibulum, and RV free wall.

Using custom software, the borders of the ventricles, valve orifices, and other anatomic landmarks were manually traced. Endocardial borders were fit to spline curves and landmarks were converted to 3D coordinates using the magnetic tracking system. Papillary muscles and trabeculae were included in chamber volumes to obtain smooth endocardial contours suitable for shape analysis. The tricuspid and mitral annuli were reconstructed as Fourier series approximations to traced points. Circles fit to traced points approximated the semilunar valves. The RV and LV were reconstructed using the piecewise smooth subdivision surface method (Fig. 1). This provides anatomically accurate representations of the 3D contours of the ventricle.[16] RV volume was computed as the sum of signed tetrahedral volumes formed by connecting a point in space with each triangular surface face. RV volume measurements were normalized to the body surface area.

All tracing was performed blinded to patient characteristics. Clinical characteristics were only available during the analysis portion of the study at which point no changes were made to 3D cardiac reconstructions.

Interobserver variability

Using the methods described above, two observers traced the RV endocardial surface in 10 subjects (5 normal and 5 with PH) for measurement of volume and EF. Variability of assessment used the intraclass correlation coefficient (ICC).

Shape and regional function analysis

RV shape was analyzed at end-diastole to assess remodeling since end-systolic shape also reflects contractile function.â&#x20AC;&#x2030;[15,17] The LV long axis was drawn from the mitral centroid to the apex, defined as the most distant point on the LV. Twenty equidistant short-axis slices were constructed from the RV apex to the level

Image analysis for 3D RV reconstruction

Each two-dimensional echo cine loop was visually examined to assess end-diastole and end-systole. Enddiastole was identified as the onset of the QRS complex. If QRS onset was ambiguous, the frame with the larger ventricular area was identified as end-diastole. The endsystolic frame was identified as the frame with smallest RV area immediately prior to pulmonic valve or aortic valve closure for each clip. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 1: 3D reconstruction and regional shape analysis methods: Manual tracing of the endocardial borders and valve points on 2D echocardiogram (A), use of magnetic tracking to assign each trace a position in 3D space with mesh fit (B) and construction of 20 short axis slices from apex to base to analyze regional shape and function (C, D). 35

Leary et al.: 3D analysis of RV in PH

of the tricuspid annulus centroid. For each short-axis slice, we measured area and perimeter, and calculated eccentricity as 4parea/perimeter2, ranging from 1 (circle) to 0 (a line). Fractional area change was defined as the percentage decrease in area from end-diastole to endsystole. Short-axis area measurements were normalized by long-axis length. Basal bulge (bulging of the free wall lateral to the tricuspid valve) was calculated as the distance along the RV-long axis between the tricuspid centroid and the most basal point on the RV free wall in the four-chamber plane. The apical angle was measured with divergent lines along the septum and RV free wall on an apical four-chamber image and averaged on two images.[18] TAPSE was measured as distance in the four-chamber plane between the lateral aspect of the tricuspid annulus at end-diastole and endsystole.[19]

Statistical analysis

Studentâ&#x20AC;&#x2122;s t-test was used for comparisons of global parameters of RV size, shape, and function. RV regional parameters measured at multiple slices within a single subject (short-axis normalized area, fractional area change, and eccentricity) were compared individually with a Studentâ&#x20AC;&#x2122;s t-test and between groups, incorporating the trend in all slices, with analysis of variance for repeated measures (ANOVA). Multivariate logistic regression of the odds of NYHA class III/IV versus I/II by parameters of RV structure and function adjusted for available survey elements hypothesized to confound the relationship (age, gender, race, and time since diagnosis of PH) was performed.

RESULTS

Patient population

Subjects with PH were older, more likely to be female and had a lower LV ejection fraction than normal subjects (Table 1). PH etiology was predominantly iPAH and ctd-PH. In the 39 PH patients collected during the second enrollment, the majority was white with a self-reported NYHA class II. Functional class was similar in the two major etiologies of PH represented (iPAH class II: 65%, ctd-PH class II: 70%); however, time since diagnosis was qualitatively though not statistically different (iPAH, 96 months vs. ctd-PH, 68 months; P=0.4). Over half of the patients were on two vasodilators and nearly a quarter were on three vasodilators. Six patients were on a single vasodilator and three patients were on no therapy for PH.

RV shape and function in normal versus PH hearts In PH, the RV had diminished global and regional function compared to normal. The RV in PH was noted to have 36

decreased RVEF, TAPSE, stroke volume, and fractional area change in the basal and mid-ventricular segments (Table 2). The RV also had a unique shape in PH compared to normal characterized by increased eccentricity (roundness) in all ventricular segments and increased normalized area in the apex and mid-ventricular segments (Fig. 2). There was a significant basal bulge lateral to the tricuspid annulus and apical bulge (measured by apical angle) in PH hearts. Table 1: Clinical characteristics and diagnoses of the cohort Clinical characteristic

Normal PH subjects subjects n=19 n=53

Age, years (sd) BSA, m2 (sd) LV ejection fraction, %(sd) White, n (%)* NYHA class III, n (%)* NYHA class II, n (%)* NYHA class I, n (%)* Diagnoses, n (%) iPAH CTD-PH Chronic thromboembolic disease Anorexigen use HIV Familial-PAH LV dysfunction Sleep apnea Radiation injury Not specified Treatment, n (%)* Phosphodiesterase-5 inhibitor Prostacyclin analogue Endothelin receptor antagonist Dual agent therapy Triple therapy

31 (7) 1.8 (0.2) 54 (9)

48 (12) 1.9 (0.5) 39 (9) 32 (82) 11 (28) 24 (62) 4 (10) 26 15 3 2 1 1 1 1 1 2

(49) (28) (6) (4) (2) (2) (2) (2) (2) (4)

21 (54) 14 (36) 22 (56) 21(54) 9 (23)

sd: Standard deviation; PH: Pulmonary hypertension; BSA: Body surface area; NYHA: New York Heart Association; iPAH: Idiopathic pulmonary arterial hypertension; CTD-PAH: Connective tissue disease PAH; HIV: Human immunodeficiency virus; LV: Left ventricle. *Only includes the 39 patients in the second enrollment

Table 2: RV shape and function in normal and PH Normal (n=19)

PH (n=53)

Size RVEDV, ml 168 (38) 195 (65) RVEDVi, ml/m2 91 (16) 100 (32) Function RVEF, % 49 (8) 38 (10) TAPSE, mm 27 (5) 18 (5) Stroke volume, ml 82 (21) 70 (19) Stroke volume index, ml/m2 45 (10) 36 (9) Shape (end-diastole) Basal bulge, mm 0.07 (0.19) 1.65 (2.10) Endocardial SA, cm2 191 (29) 181 (36) Endocardial SA-index, cm2/m2 105 (12) 96 (21) Apical angle 56 (11) 65 (12)

P value

0.08 0.3 <0.0001 <0.0001 0.02 0.0004 0.002 0.3 0.03 0.004

PH: Pulmonary hypertension; iPAH: Idiopathic PH; ctd-PH: Connective tissue disease-PH; RVEDV: RV end-diastolic volume; RVEDVi: RVEDV indexed to body surface area; RVEF: RV ejection fraction; TAPSE: Tricuspid annular plane systolic excursion; SA: Surface area; RV: right ventricle. *All measurements presented as mean (SD) with P value from t-test

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Leary et al.: 3D analysis of RV in PH

(A)

Figure 3: Representative 3D reconstructions from a normal (A), iPAH (B) and ctd-PH (C) heart demonstrating apical rounding (*) and basal bulging (+), [LV: Left ventricle; RV: Right ventricle, pv: Pulmonary valve, av: Aortic valve; tv: Tricuspid valve; mv: Mitral valve].

(B)

of subjects stratified by TAPSE was performed. There were no significant differences between the RV in iPAH and ctdPH hearts in the “mild severity” group having TAPSE >18 mm. In hearts with TAPSE <18 mm, a distinct phenotype by etiology was observed that mirrored the observations seen in the “all iPAH vs. ctd-PH” comparison (Table 3).

Interobserver variability

(C) Figure 2: Fractional area change (A), eccentricity (B) and normalized area (C) in 20 short-axis slices from apex to base in normal and PH hearts. Significant differences by t-test for individual slices are noted on the figure (*, P<0.05).

RV shape and function in iPAH versus ctd-PH hearts

The RV shape in iPAH differed from ctd-PH (Fig. 3), particularly at the basal segments where there were greater normalized areas and a tendency toward greater eccentricity (rounding) (Fig. 4). The RVEDV was greater in iPAH (218 mL vs. 178 mL, P=0.05) and there was an increased height of the basal bulge (2.45 mm vs. 0.70 mm, P=0.02). RV function in iPAH was also distinct from ctd-PH with decreased global and regional function as measured by RVEF (34% vs. 42%, P=0.01) and fractional area shortening at the mid-ventricular segments (Fig. 4). Stroke volume index was similar in the two groups (35 mL/ m2 vs. 36 mL/ m2). There was concern that these results were confounded by discrepant severity of illness and an exploratory analysis Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

The ICCs were very good for volumes (0.83-0.95). The ICC for RVEF was good overall (0.80) though poor among normal subjects (0.37) (Table 4).

Correlation between echo metrics

There was modest correlation between TAPSE and RVEF in iPAH patients (r=0.53) and no correlation in normal patients or patients with ctd-PH (r=0.11 and 0.19). Index of TAPSE to RV long axis length improved correlation with RVEF in all groups but with a coefficient that remained <0.70. The relationship between RVEF and TAPSE in normal subjects was concordant despite the low correlation; all normal hearts had an RVEF >40% and TAPSE >20 mm (Table 5).

Odds ratio of worsened NYHA class by RV parameters of interest

None of the RV parameters of interest were associated with NYHA class in unadjusted analyses. After adjustment for age, race, gender and duration of PH, functional parameters including increased SVi and midventricular FAC were significantly associated with a reduced odds ratio of NYHA class III/IV. Increased RVEF trended toward association with improved NYHA class. Shape parameters, including RVEDVi, basal, and apical bulge were not suggestive of an association with NYHA class (Table 6). 37

Leary et al.: 3D analysis of RV in PH

Table 3: RV shape and function in iPAH compared to ctd-PH, stratified by TAPSE TAPSE<=18 mm

Size RVEDV, ml RVEDVi, ml/m2 Function RVEF, % TAPSE, mm Stroke volume, ml Stroke volume index, ml/m2 Shape (end-diastole) Basal bulge, mm Endocardial SA, cm2 Endocardial SA-index, cm2/m2 Apical angle

TAPSE>18 mm

iPAH (n=12)

ctd-PH (n=6)

P value

iPAH (n=13)

ctd-PH (n=9)

P value

254 (80) 131 (36)

173 (50) 81 (18)

0.04 0.007

188 (52) 93 (23)

181 (26) 90 (11)

0.69 0.71

28 (9) 14 (2) 68 (21) 35 (8)

39 (8) 15 (3) 66 (16) 31 (7)

0.02 0.66 0.85 0.39

39 (10) 21 (3) 70 (15) 35 (8)

44 (7) 23 (3) 80 (15) 40 (7)

0.16 0.21 0.14 0.15

3.2 (3.0) 209 (43) 109 (6) 73 (11)

0.8 (1.0) 166 (23) 79 (4) 67 (14)

0.08 0.04 0.002 0.34

1.8 (2.1) 179 (33) 89 (15) 62 (10)

0.7 (1.1) 177 (20) 88 (12) 63 (8)

0.14 0.87 0.86 0.74

RVEDV: RV end-diastolic volume; RVEDVi: RVEDV indexed to BSA; RVEF: RV ejection fraction; TAPSE: Tricuspid annular plane systolic excursion; SA: Surface area. *All measurements presented as mean (SD) with P value from t-test

Table 4: Inter-observer variability in RV volumes and EF Parameter

RVEDV (ml) Normal PH Combined RVEF (%) Normal PH Combined

(A)

Observer

Mean bias %

Mean abs error %

ICC

150±33 154±38 152±34

141±30 143±36 142±31

6 7 7

9 7 8

0.832 0.948 0.888

51±3 36±12 44±12

47±5 42±12 44±9

9 −16 −4

9 16 13

0.374 0.823 0.796

Abs: Absolute; R: Pearson’s correlation; ICC: Intra-class correlation coefficient; PH: Pulmonary hypertension; RVEDV: Right ventricular end-diastolic volume; RVEF: Right ventricular ejection fraction

Table 5: Correlation between echocardiographic measures of RV systolic function Group

Pearson’s correlation (r) TAPSETAPSE RVEF-Stroke TAPSE-Stroke RVEF index-RVEF volume index volume index

(B)

Normal, n=19 All PH, n=53 ctd-PH, n=15 iPAH, n=26

0.11 0.41 0.19 0.53

0.17 0.53 0.44 0.68

0.68 0.39 0.67 0.37

0.54 0.20 0.26 0.14

PH: Pulmonary hypertension; ctd-PH: Connective tissue disease PH; iPAH: Idiopathic PH; TAPSE: Tricuspid annular plane systolic excursion; RVEF: Right ventricular ejection fraction

DISCUSSION

(C) Figure 4: Fractional area change (A), eccentricity (B) and normalized area (C) in 20 short-axis slices from apex to base in the hearts of participants with iPAH or ctd-PH and TAPSE </= 18mm. Significant differences by t-test for individual slices are noted on the figure (*, P<0.05). 38

In this analysis, we identified an RV shape common to PH and characterized by increased eccentricity, basal, and apical bulging. Changes in shape did not appear to be associated with symptoms as assessed by NYHA class; however, changes in cardiac function were associated with subjects’ self-reported symptoms. While the RV shape was similar between ctd-PH and iPAH, we also demonstrated heterogeneity along etiologic lines. In PH, the RV is more spherical with increased cross Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Leary et al.: 3D analysis of RV in PH

Table 6: Logistic regression of the odds ratio of NYHA class III/IV versus I/II per unit change of selected RV parameters RV parameter

Function RVEF (per 10% change) TAPSE (per 1 mm change) SV index (per 5 mL/m2 change) Mid-ventricle FAC (per 5% change) Shape RVEDVi (per 5 mL/m2 change) Basal bulge (per 1 mm change) Apical angle (per 5° change)

Crude

Adjusted*

Odds ratio

P value

Odds ratio

P value

0.66 0.89 0.69 0.76

0.3 0.2 0.1 0.1

0.28 0.86 0.58 0.59

0.06 0.1 0.05 0.04

1.00 1.00 0.93

0.9 0.9 0.9

1.02 1.15 0.91

0.8 0.5 0.8

*Analyses adjusted for: Age, gender, race and time since diagnosis of pulmonary hypertension. NYHA: New York Heart Association; RV: Right ventricle; RVEF: RV ejection fraction; TAPSE: Tricuspid annular plane systolic excursion; SV: Stroke volume; FAC: Fractional area change; RVEDVi: RV end diastolic volume indexed to BSA

sectional area at the mid and basal ventricular segments, basal bulging adjacent to the tricuspid valve and blunting of the apex. This description reinforces previous observations including blunting of the apical angle[18] and changes in eccentricity.[20-22] We are not aware of previous investigations reporting basal bulging adjacent to the tricuspid valve in PH. While the RV in PH shared more similarities than differences between etiologies, we did observe variation in the phenotype between iPAH and ctd-PH. In iPAH, the RV had an increased volume and decreased RVEF. As has been previously reported, the greatest dilation was associated with the lowest RVEF.[6] Conversely in ctd-PH, the RV appeared to have a decreased surface area, unchanged volume and “normal” RVEF with little dilation occurring at low RVEF. These differences in RV shape and function between iPAH and ctd-PH contrasted with the similarity in clinical parameters suggested by equivalent stroke volume and functional class.

While stroke volume and NYHA class are accepted markers of severity in PH,[4,23] we questioned whether the observed differences were due to severity rather than etiology. We chose to stratify by TAPSE as a surrogate for severity. TAPSE is a validated marker of severity and prognosis in PH in both PH at large and scleroderma associated PH.[24,25] We used a “cut-off” value identified as most strongly predictive of mortality by Forfia et al. (18 mm).[24] In subjects with TAPSE >18 mm, there was little difference between the RV in ctd-PH and iPAH. In contrast, subjects with TAPSE <18 mm defined the subgroup phenotypes. Among these severely affected individuals, the RV in iPAH had increased volume, decreased function and a similar stroke volume index when compared to ctd-PH. Generalization of this finding of heterogeneity more broadly to iPAH and ctd-PH must be quite cautious due to the small population size, lack Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

of corroborative clinical data and qualitative differences in duration of PH by group; however, these findings do agree with Chung et al. who, using a PH registry, describe less systolic dysfunction and a tendency toward smaller RV volumes despite increased mortality in ctd-PH compared to iPAH.[26]

Taken together, we believe these finding should raise concern about the tendency homogenize findings in the right ventricle within World Health Organization (WHO) PH groups. WHO group I combines diseases with similar pulmonary vascular characteristics and it is not established that RV characteristics are likewise similar. Studies such as those done by Kawut et al, which demonstrate an association between RVEF and mortality, were performed in cohorts limited to familial and iPAH patients; therefore, further study of the RV in other etiologies of PH may be necessary to determine if analogous relationships exist and determine appropriate reference values. If validated in further study, the heterogeneity of RV function by etiology of PH may present a unique opportunity to look at a natural experiment of the necessary cofactors in the development of RV failure. The results of our study join others suggesting correlation between TAPSE and RVEF is limited.[29,30] We indexed TAPSE to RV long axis length to account for differences in RV size in longitudinal shortening, which improved the RVEF to TAPSE correlation in all groups. Standardly used TAPSE, however, is a validated prognostic tool[25] and may predict outcome independently of surrogacy for RVEF. Future validation against outcome data is therefore needed to establish any clinical value of TAPSE normalization. Finally, the current analysis suggests an association between parameters of RV function but not shape and severe NYHA class. The evidence supporting an association between functional parameters and symptoms is currently contradictory and this report adds to that understanding. [26,31] The association between shape and symptoms is unreported and similarly was not observed in our cohort.

Limitations

PH subjects were an ambulatory, cross-sectional sample at two national meetings. This could represent a unique group with mild disease and poor generalizability; however, inclusion of patients who were uncharacteristically healthy would be expected to bias the results toward the null and should not diminish the strength of observed associations. In addition, the present study is analytical and detailed clinical information including hemodynamic data was not collected a priori and is not available. This may limit the direct clinical applicability and generalizability of our findings. 39

Leary et al.: 3D analysis of RV in PH

In summary, this work describes increased eccentricity and decreased function in PH. Furthermore, parameters of function appear to be associated with NYHA class. Finally, heterogeneity in RV parameters between iPAH and ctd-PH was observed. These results further the description of the stressed RV through a comprehensive shape analysis in PH subjects and join other reports that suggest caution in the homogenization of RV findings even among diseases of the same World Health Organization PH group.

REFERENCES 1. 2. 3. 4. 5.

10. 11.

12. 13.

14.

Gomberg-Maitland M, Dufton C, Oudiz RJ, Benza RL. Compelling Evidence of Long-Term Outcomes in Pulmonary Arterial Hypertension? J Am Coll Cardiol 2011;57:1053-61. D’Alonzo GE, Barst RJ, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, et al. Survival in patients with primary pulmonary hypertension. Results from a national prospective registry. Ann Intern Med 1991;115:343-9. Sheehan F, Redington A. The right ventricle: Anatomy, physiology and clinical imaging. Heart 2008;94:1510-5. van Wolferen SA, van de Veerdonk MC, Mauritz GJ, Jacobs W, Marcus JT, Marques KMJ, et al. Clinically Significant Change in Stroke Volume in Pulmonary Hypertension. Chest 2011;139:1003-9. van Wolferen SA, Marcus JT, Boonstra A, Marques KM, Bronzwaer JG, Spreeuwenberg MD, et al. Prognostic value of right ventricular mass, volume, and function in idiopathic pulmonary arterial hypertension. Eur Heart J 2007;28:1250-7. Mauritz GJ, Kind T, Marcus JT, Bogaard HJ, van de Veerdonk M, Postmus PE, et al. Progressive Changes in Right Ventricular Geometric Shortening and Long-term Survival in Pulmonary Arterial Hypertension. Chest 2011 Sep. 29;[Epub ahead of print] Overbeek MJ, Lankhaar JW, Westerhof N, Voskuyl AE, Boonstra A, Bronzwaer JGF, et al. Right ventricular contractility in systemic sclerosisassociated and idiopathic pulmonary arterial hypertension. Eur Respir J 2008;31:1160-6. Ghio S, Pazzano AS, Klersy C, Scelsi L, Raineri C, Camporotondo R, et al. Clinical and Prognostic Relevance of Echocardiographic Evaluation of Right Ventricular Geometry in Patients With Idiopathic Pulmonary Arterial Hypertension. Am J Cardiol 2011;107:628-32. Amaki M, Nakatani S, Kanzaki H, Kyotani S, Nakanishi N, Shigemasa C, et al. Usefulness of three-dimensional echocardiography in assessing right ventricular function in patients with primary pulmonary hypertension. Hypertens Res 2009;32:419-22. Jenkins C, Leano R, Chan J, Marwick TH. Reconstructed versus real-time 3-dimensional echocardiography: Comparison with magnetic resonance imaging. J Am Soc Echocardiogr. 2007;20:862-8. Kawut SM, Lima JA, Barr RG, Chahal H, Jain A, Tandri H, et al. Sex and Race Differences in Right Ventricular Structure and Function: The MultiEthnic Study of Atherosclerosis-Right Ventricle Study. Circulation 2011;123: 2542-51. Kawut S, Barr R, Lima J, Johnson C, Kizer J, Tandri H, et al. Right Ventricular Morphology and Function and Long-Term Outcomes: The MESA-Right Ventricle Study. Am Thorac Soc Abstract 183; 2011:A4991 Kawut SM, Barr RG, Johnson WC, Chahal H, Tandri H, Jain A, et al. Matrix metalloproteinase-9 and plasminogen activator inhibitor-1 are associated with right ventricular structure and function: The MESA-RV Study. Biomarkers 2010;15:731-8. Salgo IS, Tsang W, Ackerman W, Ahmad H, Chandra S, Cardinale M, et al. Geometric Assessment of Regional Left Ventricular Remodeling by Three-Dimensional Echocardiographic Shape Analysis Correlates with Left

15. 16.

17.

18. 19.

20. 21. 22.

23. 24. 25.

26.

27. 28. 29. 30. 31.

Ventricular Function. J Am Soc Echocardiogr 2012;25:80-8. Sheehan FH, Ge S, Vick GW, Urnes K, Kerwin WS, Bolson EL, et al. Threedimensional shape analysis of right ventricular remodeling in repaired tetralogy of Fallot. Am J Cardiol 2008;101:107-13. Hubka M, Bolson EL, McDonald JA, Martin RW, Munt B, Sheehan FH. Three-dimensional echocardiographic measurement of left and right ventricular mass and volume: In vitro validation. Int J Cardiovasc Imaging 2002;18:111-8. Mancini GJ, DeBoe SF, Anselmo E, Simon SB, LeFree MT, Vogel RA. Quantitative regional curvature analysis: An application of shape determination for the assessment of segmental left ventricular function in man. Am Heart J 1987;113:326-34. López-Candales A, Dohi K, Iliescu A, Peterson RC, Edelman K, Bazaz R. An abnormal right ventricular apical angle is indicative of global right ventricular impairment. Echocardiography 2006;23:361-8. Morcos P, Vick GW III, Sahn DJ, Jerosch-Herold M, Shurman A, Sheehan FH. Correlation of right ventricular ejection fraction and tricuspid annular plane systolic excursion in tetralogy of Fallot by magnetic resonance imaging. Int J Cardiovasc Imaging 2008;25:263-70. López-Candales A, Bazaz R, Edelman K, Gulyasy B. Apical Systolic Eccentricity Index: A Better Marker of Right Ventricular Compromise in Pulmonary Hypertension. Echocardiography 2010;27:534-8. López-Candales A, Rajagopalan N, Kochar M, Gulyasy B, Edelman K. Systolic eccentricity index identifies right ventricular dysfunction in pulmonary hypertension. Int J Cardiol 2008;129:424-6. Ghio S, Klersy C, Magrini G, D’Armini AM, Scelsi L, Raineri C, et al. Prognostic relevance of the echocardiographic assessment of right ventricular function in patients with idiopathic pulmonary arterial hypertension. Int J Cardiol 2010;140:272-8. Sitbon O, Humbert M, Nunes H, Parent F, Garcia G, Hervé P, et al. Long-term intravenous epoprostenol infusion in primary pulmonary hypertension: Prognostic factors and survival. J Am Coll Cardiol 2002;40:780-8. Forfia PR, Fisher MR, Mathai SC, Housten-Harris T, Hemnes AR, Borlaug BA, et al. Tricuspid annular displacement predicts survival in pulmonary hypertension. Am J Respir Crit Care Med 2006;174:1034-41. Mathai SC, Sibley CT, Forfia PR, Mudd JO, Fisher MR, Tedford RJ, et al. Tricuspid Annular Plane Systolic Excursion Is a Robust Outcome Measure in Systemic Sclerosis-associated Pulmonary Arterial Hypertension. J Rheumatol 2011;38:2410-8. Chung L, Liu J, Parsons L, Hassoun PM, McGoon M, Badesch DB, et al. Characterization of Connective Tissue Disease-Associated Pulmonary Arterial Hypertension From REVEAL: Identifying Systemic Sclerosis as a Unique Phenotype. Chest 2010;138:1383-94. Simonneau G, Robbins IM, Beghetti M, Channick RN, Delcroix M, Denton CP, et al. Updated clinical classification of pulmonary hypertension. J Am Coll Cardiol 2009;54(1 Suppl):S43-54. Kawut SM, Horn EM, Berekashvili KK, Garofano RP, Goldsmith RL, Widlitz AC, et al. New predictors of outcome in idiopathic pulmonary arterial hypertension. Am J Cardiol 2005;95:199-203. Kjaergaard J, Petersen CL, Kjaer A, Schaadt BK, Oh JK, Hassager C. Evaluation of right ventricular volume and function by 2D and 3D echocardiography compared to MRI. Eur J Echocardiogr 2006;7:430-8. Kaul S, Tei C, Hopkins JM, Shah PM. Assessment of right ventricular function using two-dimensional echocardiography. Am Heart J 1984;107:526-31. Nath J, Demarco T, Hourigan L, Heidenreich PA, Foster E. Correlation between right ventricular indices and clinical improvement in epoprostenol treated pulmonary hypertension patients. Echocardiography 2005;22:374-9.

Source of Support: This work was supported by an NIH training grant [5T32HL007287-32]. Raw echocardiographic images were acquired by Ventripoint, Inc. and given as an unrestricted gift to Peter Leary for 3D reconstruction and analysis., Conflict of Interest: PJL, CEK, CLH and DDR report no conflicts of interest. FHS is a scientific and technical consultant for Ventripoint, Inc. (markets an alternative method of 3D echocardiographic reconstruction). MPW is an employee of Ventripoint, Inc.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Depolarization-dependent contraction increase after birth and preservation following long-term hypoxia in sheep pulmonary arteries Demosthenes G. Papamatheakis1, Jay J. Patel3, Quintin Blood3, Travis T. Merritt3, Lawrence D. Longo3, and Sean M. Wilson2,3 1

Division of Pulmonary and Critical Care, University of California San Diego Health System, La Jolla, California, 2 Division of Pulmonary and Critical Care, Loma Linda University Medical Center, 3 Center of Perinatal Biology, Loma Linda University, Loma Linda, California, USA

ABSTRACT Membrane depolarization is critical to pulmonary arterial (PA) contraction. Both L-type Ca2+ channels (CaL) and Rho-kinase are important signaling components of this process and mitochondrial and non-mitochondrial generated superoxides can be part of the signaling process. Maturation and long-term hypoxia (LTH) each can modify depolarization-dependent contraction and the role of superoxides. By the use of wire myography, we tested the hypothesis that maturation and LTH increase pulmonary arterial reactivity to high-K+-induced membrane depolarization through enhancements in the importance of CaL and Rho-kinase-dependent pathways. The data show that maturation, but not LTH, increases contraction to 125 mM KCl (high-K+) without altering the EC50. High-K+-dependent contraction was inhibited to a similar extent in fetal and adult PA by multiple CaL blockers, including 10 μM diltiazem, 10 μM verapamil, and 10 μM nifedipine. Postnatal maturation increased the role for 10 μM nifedipine-sensitive CaL, and decreased that for 10 μM Y-27632-sensitive Rho-kinase. In all groups, the combination of nifedipine and Y-27632 effectively inhibited high-K+ contraction. Tempol (3 mM) but not 100 μM apocynin slightly reduced contraction in arteries from fetal hypoxic and adult normoxic and hypoxic sheep, indicating a limited role for non-mitochondrial derived superoxide to high-K+-induced contraction. Western immunoblot for alpha smooth muscle actin indicated small increases in relative abundance in the adult. The data suggest that while CaL therapies more effectively vasodilate PA in adults and rho-kinase therapies are more effective in newborns, combination therapies would provide greater efficacy in both young and mature patients regardless of normoxic or hypoxic conditions. Key Words: K+-induced depolarization, L-type Ca2+ channel, myography, rho-kinase, superoxide

INTRODUCTION Depolarization of the vascular smooth muscle plasma membrane results in contraction through a combination of mechanisms, central to which is voltage-dependent Ca2+ influx.[1,2] This is exemplified by the inhibition of vessel contraction by L-type Ca2+ channel (CaL) blockers.[3-5] The depolarization-induced increase in cytosolic Ca2+ due to activation of CaL and other pathways, leads primarily to myosin light chain phosphorylation with resultant myocyte contraction. Such studies also demonstrate that membrane Address correspondence to:

Dr. Sean M. Wilson, Center for Perinatal Biology Loma Linda University School of Medicine 11234 Anderson Street Loma Linda, 92350 CA, USA Email: seanwilson@llu.edu Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

depolarization can cause arterial contraction through activation of the small GTPase Rho-kinase, which inhibits the myosin light chain phosphatase.[6,7] The consequential increase in Ca2+ sensitivity of the contractile filaments augments vasoconstriction when cytosolic Ca2+ increases following myocyte stimulation.[8,9] Long-term hypoxia (LTH) can augment potassiumdependent contraction of pulmonary arteries. In rats, this Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94832 How to cite this article: Papamatheakis DG, Patel JJ, Blood Q, Merritt TT, Longo LD, Wilson SM. Depolarization-dependent contraction increase after birth and preservation following long-term hypoxia in sheep pulmonary arteries. Pulm Circ 2012;2:41-53.

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

is mediated by changes in CaL and Rho-kinase activity. More specifically, LTH suppresses CaL activity,[10] while it enhances Rho-kinase activity in rat pulmonary vasculature. [8] This contrasts with the newborn pig where LTH increases Ca L activity. [11] These inter-species differences with regards to the effect of LTH on CaL activity may represent developmental age variability or simply species-specific differences. Although it is unknown whether age affects depolarization-dependent contraction in the pulmonary vasculature, previous studies illustrate that following birth potassium-dependent contraction in sheep middle cerebral arteries increases significantly.[12] Nonetheless, in the same vessels, CaL expression is more prominent in the fetus relative to that of the adult.[13]

These findings illustrate that both maturation and LTH alter membrane depolarization and arterial reactivity, and that Rho-kinase dependent responses are important to the resultant reactivity changes. Therefore, we designed a series of experiments to test the hypothesis that both maturation and LTH increase pulmonary arterial reactivity in response to potassium-induced membrane depolarization, through enhanced activities of CaL and Rho-kinase.

MATERIALS AND METHODS Experimental animals

All experimental procedures were performed within the regulations of the Animal Welfare Act, the National Institutes of Health Guide for the Care and Use of Laboratory Animals, “The Guiding Principles in the Care and Use of Animals,” approved by the Council of the American Physiological Society, and the Animal Care and Use Committee of the university. We conducted these studies on fourth- and fifth-order pulmonary arteries with internal diameters of about 500-700 μm, from fetuses or adult ewes that lived at Nebeker Ranch (Lancaster, Calif., USA; 720 m) and were brought to the university animal care facility (353 m; arterial PaO2=95±5 Torr) for experimental study, or were acclimatized to high altitude (3,801 m, PaO2=60±5 Torr) at the Barcroft Laboratory, White Mountain Research Station (Bishop, Calif., USA) for ~110 days.[14] Animals maintained at high altitude were transported to the university from the field station and shortly after arrival, a tracheal catheter was placed in the ewe, through which N2 flowed at a rate adjusted to maintain PaO2 at ~60 Torr, a value that is similar to that measured at the Barcroft laboratory.[15] This PaO2 was maintained until the time of the experimental study. Within 1 to 5 days after arriving at the university, sheep were euthanized with an overdose of the proprietary euthanasia solution, Euthasol (pentobarbital sodium 100 mg/kg and phenytoin sodium 10 mg/kg; Virbac, Ft. Worth, Tex., USA). Lungs with their vessels were removed and used immediately for contractility experiments. To avoid 42

complications from endothelium-mediated effects, the endothelium was removed by carefully inserting a small roughened hypodermic needle or rotating the artery on the mounting wire.[3-5]

Tissue preparation

Pulmonary arteries for contractility were dissected free of parenchyma and cut into 5 mm long rings in ice-cold phosphate-free balanced salt solution (BSS) of the following composition (mM): 126 NaCl; 5 KCl; 10 HEPES; 1 MgCl2; 2 CaCl2; 10 glucose; at a pH of 7.4 (adjusted with NaOH). All contraction studies were performed with a modified Krebs–Henseleit (K-H) solution containing (mM): 120 NaCl; 4.8 KCl; 1.2 K2HPO4; 25 NaHCO3; 1.2 MgCl2; 2.5 CaCl2; and 10 glucose.

Contraction studies

Pulmonary arterial rings were suspended in organ baths (Radnoti Glass Instruments, Inc. Monrovia, Calif., USA) that contained 5 or 10 ml of modified K-H solution maintained at 37°C and aerated with 95% O2–5% CO2 (pH=7.4) as performed previously.[3-5] Each ring was suspended between two tungsten wires passed through the lumen. One wire was anchored to the glass hook at the bottom of the organ chamber; the other was connected to a tissue hook attached to a low compliance force transducer (Radnoti Glass Instruments Inc.) for the measurement of isometric force.[3-5] The transducers were connected to an analogue to digital data interface (Powerlab 16/30 AD Instruments, Colorado Springs, Colo., USA; or MP100, Biopac Systems Inc., Goleta, Calif., USA) attached to a computer. The changes in tension were recorded using Chart 5.5 (AD Instruments), or AcqKnowledge 3.9 (Biopac Systems, Inc.), and the data were stored on magnetic media for later analysis. At the beginning of each experiment, vessels were equilibrated without tension for a minimum of thirty minutes. By stretching the vessels progressively, as previously described,[3-5] vessel rings were tensioned to 447±13 dynes in 108 vessels from 12 fetal normoxic sheep, to 429±21 dynes in 120 vessels from 12 adult normoxic sheep, to 418±14 dynes in 52 vessels from 6 fetal hypoxic sheep, and to 316±16 dynes in 76 vessels from 7 adult hypoxic sheep. Isolated pulmonary arterial rings were stimulated with 125 mM KCl (high-K+) to depolarize the plasma membrane and activate CaL.[1] In most experiments, the tension was normalized to a control response obtained with high-K+ (%TK (control)). To evaluate dose-response characteristics, arteries were stimulated by applying cumulatively 4 mM to 125 mM K+ without washing in-between each K+-concentration increase.

Western immunoblot assay

Pulmonary arteries from normoxic and hypoxic fetal and adult sheep were isolated, cleaned in BSS, and frozen rapidly in liquid nitrogen. SDS gel and Western blot analyses were Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

performed using protocols based on previous studies.[12,16] In particular, samples were homogenized and sonicated in RIPA buffer on ice containing 150 mM NaCl, 50 mM Tris, 1% Triton X-100, 0.5% deoxycholic acid, 1% SDS, 5 mM EDTA and Halt protease inhibitor (Thermo-Fisher Scientific, Rockford, Ill., USA). Nuclei and debris were pelleted by centrifugation at 1,000 g for 10 minutes at 4°C.

Protein concentrations were determined using a modification of the Bradford method. [12,17] A 8% polyacrylamide gel was loaded with 10 μg of protein mixed with an equal volume of electrophoresis sample buffer per lane and then electrophoresed at 90 V for 90 min. We used a Mini Trans-Blot Electrophoretic Transfer Cell system (Bio-Rad Laboratories, Hercules, Calif., USA) to transfer proteins from the gel to a nitrocellulose membrane at 100 V for 3 hours.

The membranes were blocked for nonspecific binding by incubating the membrane overnight in blotting solution (5% nonfat milk in tris-buffered saline with 0.1% Tween-20 – TTBS) at 4°C. Then membranes were incubated in a 1:1000 dilution of rabbit polyclonal anti-smooth muscle specific α-actin (ab5694, Abcam, Cambridge, Mass.) in blotting solution for 1 hour at room temperature (22°C), or were incubated overnight (16 hours) at 4°C. The differences in incubation conditions did not cause any systematic differences in the measured optical density. Membranes were then washed three times with TTBS, and incubated with goat antirabbit IgG horseradish perioxidase-conjugated secondary antibody (Cell Signaling Technology, Beverly, Mass., USA) for 45 minutes at a 1:2000 dilution at room temperature. Following the secondary antibody incubation, the membrane was washed three times in TTBS, for 5 minutes each time. The membrane was then incubated with a chemiluminescent reagent (Santa Cruz Biotechnology, Santa Cruz, Calif., USA) for 1 minute, and the protein band of a predicted weight of 42 KDa was detected using a chemiluminescent Imager (Alpha Innotech, San Leandro, Calif., USA). The densities of each band were determined using the gel analysis tools distributed with ImageJ.[18] The expression levels are expressed in optical density units and varied by ±9-11% (s.e.m.) in all four groups.

Chemicals and drugs

Most reagents and chemicals were purchased from SigmaAldrich (St. Louis, Mo., USA). Transfer, running, and wash buffers for Western Immunoblot were purchased from Bio-Rad Laboratories. Y-27632 was purchased from Tocris (Ellisville, Mo., USA). Sources for other specialized reagents are noted in the text.

Statistical methods

All time-series recordings were graphed with IGOR Pro 6.0 (Wavemetrics, Lake Oswego, Oreg., USA), and the data Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

presented as mean±S.E.M. Statistical analyses were made using GraphPad Prism 5.0 (La Jolla, Calif., USA). Data were evaluated for normality prior to any comparative statistical analysis using a D’Agostino-Pearson normality test. Between groups that were distributed normally, statistical differences were determined with a two-tailed unpaired Student’s t-test. A Mann-Whitney U test was used for comparisons of non-normal data. Dose-response curves were fitted in Prism 5.0 using a Hill equation.[3-5] The N values reported reflect the total number of arterial segments and total number of sheep tested. P<0.05 was accepted as statistically significant.

RESULTS

Stimulation of arterial segments with 125 mM KCl results in depolarization-dependent contraction, and is a common method to evaluate the amount of active smooth muscle.[1] Figure 1 shows the contraction induced with high-K + in arteries isolated from fetal and adult sheep under normoxic or LTH conditions. Figures 1A and B show representative isometric tension recordings from normoxic and LTH vessels, respectively, and illustrate the substantially greater contraction in vessels isolated from adults. This is emphasized in the summary data presented in Figure 1C, in which the high-K+-induced contraction was two- to threefold greater in adult vessels, regardless of the influence of hypoxia. The number of replicates and sheep used for these series of experiments are provided in the contraction studies methods section.

Next, we performed experiments to determine the importance of CaL to high-K+-induced contraction, and the influence of maturation and LTH on the role of this channel. This was achieved by stimulating arteries with 125 mM KCl in the absence and presence of three major classes of CaL blockers, including dihydropyridines (10 μM nifedipine), phenylalkylamines (10 μM verapamil), and benzothiazepines (10 μM diltiazem). Figures 2A and B show normalized isometric tension recordings from normoxic fetal vessels, while Figures 2D and E show recordings from normoxic adult vessels. In the fetus, vehicle (0.1% DMSO) did not reduce contraction, while 10 μM nifedipine, verapamil or nifedipine (Fig. 2A and B) suppressed contraction by approximately one-third. Moreover, in the adult, nifedipine, verapamil, or diltiazem reduced high-K+-dependent vascular contraction about twice as much as compared to the fetus (Fig. 2D and E). The summarized data in Figures 2C and F exemplify this and show that nifedipine (fetal N=18/6; adult N=12/4), verapamil (fetal N=12/4; adult N=16/6), or diltiazem (fetal N=13/5; adult N=13/5) each reduced high-K+-induced contraction by roughly 35% in the fetus and 70% in the adult, with respect to control (fetal N=20/6; adult N=25/8). 43

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(B)

(C) Figure 1: High-K+ elicits greater force in pulmonary arteries from adult relative to fetal sheep. Isometric tension recording of pulmonary arterial rings constricted with 125 mM KCl in fetus (gray) and adult (black) for animals housed in normoxic (A) or long-term hypoxic (B) conditions. (C) Bars (open: Fetus; solid: Adult) indicate mean±S.E.M. of the force generated by 125 mM KCl. **(P<0.01) denotes significant difference by two-way ANOVA relative to fetus.

We then performed parallel studies to assess the extent to which high-K+-induced contraction of pulmonary arteries from LTH sheep is dependent on CaL. This was done in the 44

setting of prior conflicting studies, reporting that LTHreduced CaL activity during ET-1 dependent Ca2+ responses in adult rats,[10] but increased CaL activity in newborn piglets.[11] Figures 3A and B show normalized isometric tension recordings from hypoxic fetal vessels while Figures 3D and E show those from hypoxic adult vessels. In the fetus, 10 μM nifedipine, verapamil or diltiazem mildly reduced high-K+-induced arterial contraction (Fig. 3A and B). The adult contrasts the fetus with 10 μM nifedipine, verapamil, or diltiazem reducing high-K +-dependent contraction to a greater extent (Fig. 3D and E). The summarized data in Figures 3C and F further illustrate the magnitude of these differences where nifedipine (fetal N=9/3; adult N=14/3), verapamil (fetal N=11/4; adult N=9/3), or diltiazem (fetal N=11/4; adult N=9/3) reduced high-K+-induced contraction to a greater extent in adult compared to fetus with respect to controls (fetal N=10/4; adult N=17/6). Interestingly, LTH did not substantially impact the influence of CaL blockers on high-K+-induced contraction per se (Figs. 2 and 3).

To delineate further the extent of the changes in high-K+mediated contraction by maturation and LTH, we applied cumulative doses of KCl to pulmonary arterial segments from normoxic and LTH animals. The dose-response data shown in Figure 4 for fetal normoxic (Fig. 4A; N=11/3), adult normoxic (Fig.4B; N=12/4), fetal hypoxic (Fig. 4C; N=18/6), and adult hypoxic (Fig. 4D; N=16/6) show that pulmonary arteries constrict to low concentrations of KCl, with a maximal response by 30 to 40 mM. The summarized data in Figure 4E show that the EC50 was approximately 25 mM in all four animal groups, and was unaffected by either maturation or LTH.

The next series of experiments examined the role of Rhokinase in high-K+-induced contraction, and determined the interaction between Rho-kinase and CaL. These studies were based on experiments performed on rodents in which Rho-kinase contributed to potassium-induced contraction, and LTH augmented the contribution of Rho-kinase.[8] In these experiments, Rho-kinase was inhibited with 10 μM Y-27632 while CaL was blocked with 10 μM nifedipine. Figures 5A and B show normalized isometric tension recordings from normoxic fetal vessels while Figures 5D and E show representative recordings from adult vessels. In the fetus, 10 μM Y-27632 and the combination of 10 μM nifedipine and 10 μM Y-27632 reduced high-K+-induced pulmonary artery contraction to a much greater extent than 10 μM nifedipine alone (Fig. 5A and B). The findings in pulmonary arteries from normoxic adult sheep were distinct from those of fetuses. Figure 5D shows that 10 μM Y-27632 decreased arterial contraction modestly while 10 μM nifedipine reduced contraction somewhat more. Figure 5E then shows the combination of 10 μM nifedipine and 10 μM Y-27632 reduced contraction more substantially Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(D)

(B)

(C)

as compared to either 10 μM nifedipine or 10 μM Y-27632 alone. The summary data shown in Figures 5C and F illustrate the differences in the actions of nifedipine and Y-27632 on high-K+ -induced contraction in pulmonary arteries from fetal as compared to adult. Even though the combination of 10 μM Y-27632 and 10 μM nifedipine (fetus N=9/3; adult N=16/3) reduced high-K+-induced contraction relative to control (fetus N=16/6; adult N=19/6) in both fetuses and adults, these summary data illustrate that 10 μM Y-27632 was more effective in arteries from fetus (fetus N=15/3; adult N=11/3) while 10 μM nifedipine was more effective in arteries from adult (fetus N=9/3; adult N=11/3) sheep. Parallel studies were performed in pulmonary arteries from hypoxic sheep with equivalent findings. Results Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

(E)

(F)

Figure 2: The L-type Ca 2+ channel is important for high-K+-elicited pulmonary arterial contractility in fetal and adult sheep housed in normoxic conditions. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 10 μM nifedipine (Nif; dashed), 10 μM verapamil (verap; dotted), or 10 μM diltiazem (dilt; dotted and dashed) from fetus (A and B) or adult (D and E). Tracings are plotted in relation to maximal contraction from initial high-K+ stimulation (% TK (control)). (C and F) Bars indicate mean±S.E.M. of high-K +induced contraction expressed as % TK (control) in the presence of vehicle control or L-type Ca2+ channel antagonists for pulmonary arteries from fetal (C; open) and adult (F; solid) sheep. *(P<0.05), ***(P<0.001) denotes significant difference by one-way ANOVA.

of these experiments are shown in Figure 6. Figures 6A and B show normalized isometric tension recordings from hypoxic fetal vessels, and Figures 6D and E show representative recordings from hypoxic adult vessels. In the fetus, the representative traces and summarized data (Fig. 6C) illustrate that 10 μM Y-27632 (N=12/4) alone as well as the combination of 10 μM Y-27632 and 10 μM nifedipine (N=9/4) reduced high-K +-induced arterial tension substantially, whereas 10 μM nifedipine alone (N=12/4) reduced contraction modestly with respect to control (N=9/4). In the adult, the representative and summary data (Fig. 6E) demonstrate that 10 μM Y-27632 (N=13/4) and 10 μM nifedipine (N=11/4) alone reduced high-K +-induced arterial tension by a similar, modest amount, while the combination of both antagonists 45

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(D)

(B)

(E) (E)

(C)

(N=10/4) decreased it extensively compared to control (N=10/4). In the next series of studies, we determined the extent to which high-K +-induced contraction is dependent on superoxide. These experiments were performed based on recent publications indicating that membrane depolarization can generate superoxides, which in turn activate Rho-kinase-dependent contraction. [8,19] The role of superoxides was addressed by using two inhibitors. NADPH-induced superoxide generation was inhibited with apocynin (100 μM), which has been used to examine the role of superoxides to newborn piglet pulmonary arterial reactivity. [20,21] Superoxide degradation to peroxide was increased by application of the superoxide dismutase mimetic tempol (3 mM), which has been used in contractility studies of pulmonary 46

(F)

Figure 3: The L-type Ca2+ channel is important for high-K + -elicited pulmonary arterial contractility in LTH fetal and adult sheep. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 10 μM nifedipine (Nif; dashed), 10 μM verapamil (verap; dotted), or 10 μM diltiazem (dilt; dotted and dashed) from fetus (A and B) or adult (D and E). Tracings are plotted in relation to maximal contraction from initial high-K+ stimulation (% TK (control)). (C and F) Bars indicate mean±S.E.M. of high-K+induced contraction expressed as % TK (control) in the presence of vehicle control or L-type Ca2+ channel antagonists for pulmonary arteries from fetus (C; open) and adult (F; solid) sheep. *(P<0.05), **(P<0.01), ***(P<0.001) denotes significant difference by one-way ANOVA.

arteries.[22] Figures 7A and C show normalized isometric tension recordings from normoxic fetal and adult vessels, respectively. For fetal arteries, the summary data in Figure 7B show that superoxide was not critical to high-K +-induced contraction, as neither apocynin (N=14/4), or tempol (N=14/4) altered contraction relative to control (N=12/4). However, Figure 7D shows that, in the adult, tempol (N=14/4) but not apocynin (N=15/4) reduced high-K+-induced pulmonary arterial contraction by approximately 20% with respect to the control (N=12/4). The results of similar experiments performed in hypoxic sheep are shown in Figure 8. Figures 8A and C show normalized isometric tension recordings from hypoxic fetal and adult arteries, respectively. The summary data of Figures 8B and D show that in both immature and mature Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(C)

(B)

(D)

(E)

arteries tempol (fetus N=16/4; adult N=16/4) reduced contraction relative to control (fetus N=16/4; adult N=12/4) while apocynin failed to do so (fetus N=17/4; adult N=15/4).

Because arterial tension is based on the contraction of myocytes in the arterial wall, we performed a series of studies to determine if there might be differences in the proportion of the active smooth muscle between fetal and adult tissues. We quantified the active smooth muscle by measuring the proportion of alpha smooth muscle actin relative to the total protein content. Figure 9 shows the results of these Western immunoblot studies. Figure 9A shows a representative immunoblot for alpha smooth muscle actin from individual arteries, where each lane was loaded with 10 Îźg of sample. The density of the fetal bands was not dramatically different as compared to the bands from adult arteries. Figure 9B summarizes results from experiments performed in 22 replicates from a total of 6 animals for each experimental group, where replicates were run on separate gels. The figure demonstrates that alpha smooth muscle actin expression was ~10-15% lower in the fetus but expression was not systematically influenced by LTH. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 4: The potency for high-K+ -induced contraction is unaffected by maturation or LTH. Dose response relationships based on isometric recordings of pulmonary arterial rings stimulated with 4 mM to 125 mM potassium in a cumulative manner for fetal and adult sheep exposed to normoxic (A and B) or long-term hypoxic conditions (C and D). Data were fitted with a Hill equation to the mean values normalized to %TKmax (percent contraction compared to the maximal high-K+ contraction). (E) Comparison of meanÂąS.E.M. for EC50 values between normoxic (open) and LTH (solid) in pulmonary arteries of fetal and adult sheep. No significant differences were observed between the EC50 based on a twoway ANOVA.

DISCUSSION The present study is the first comparison of depolarizationinduced contraction in pulmonary arteries from high-altitude acclimatized fetal and adult sheep, compared to normoxic controls. Key findings of these studies include these seven. (1) High-K+-induced pulmonary arterial contraction is considerably blunted in fetal, as compared to adult sheep. (2) Maturation-related increase in the expression of contractile proteins may account for a portion of this difference. (3) The role of CaL in high-K+-mediated contraction is blunted in fetal relative to adult sheep. (4) The role of Rho-kinase is significantly enhanced in fetal relative to adult sheep. (5) HighK+-dependent contraction and the role of CaL and Rho-kinase are preserved following LTH in both fetal and adult sheep. And (6) superoxide plays a minor role to high-K+-induced contraction of pulmonary arteries in sheep; however (7), its role is modestly increased after birth and by LTH in the fetus. The finding that pulmonary arterial contractility is highly sensitive to low-K+-concentrations with a maximal response at ~30 mM was somewhat surprising. Based on the extracellular and estimated intracellular potassium concentrations, the Nernst equation predicts that 30â&#x20AC;ŻmM 47

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(D)

(B)

(C)

K+ would depolarize the plasma membrane to ~−40 mV, which is below the predicted membrane potential that activates CaL in pulmonary arterial myocytes.[11,23] Secondarily, because the EC50 for K+-induced contraction was not altered by either maturation or LTH, the relevant process or processes are likely developed before birth and unaffected by LTH. One possible explanation for the substantial contraction at relatively negative membrane potentials is that membrane depolarization activates lowthreshold T-type Ca2+ channels, which could contribute to depolarization dependent contraction and activation of CaL.[24-26] Alternatively, other channels may be activated even at relatively negative membrane potentials. In particular, voltage-gated Na+ channels could be activated 48

(E)

(F)

Figure 5: Maturation increases the role for Rho-kinase during high-K + -elicited pulmonary arterial contractility in sheep housed in normoxic conditions. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 10 μM Y-27632 (dashed), 10 μM nifedipine (Nif; dotted), or 10 μM Y-27632 + 10 μM nifedipine (Y-27632 + Nif; dotted and dashed) from fetus (A and B) or adult (D and E). Tracings are plotted in relation to maximal contraction from initial high-K+ stimulation (% TK (control)). (C and F) Bars indicate mean±S.E.M. of high-K+-induced contraction expressed as % TK (control) in the presence of vehicle control or antagonists for pulmonary arteries from fetus (C; open) and adult (F; solid) sheep. ***(P<0.001) denotes significant difference by one-way ANOVA.

by depolarization, which then further depolarize the membrane leading to the opening of CaL.[27,28]

The pharmacological studies comparing different inhibitors of CaL expand on the details provided by the potassium dose-response studies. These studies also illustrate CaL and other signaling pathways, are important to high-K+induced pulmonary arterial contraction. Secondarily, given that dihydropyridines, benzothiazepines, and phenylalkylamines bind to different amino acid residues in the pore region of Ca L, our data indicate that the permeation pathway for these channels in fetuses and adults is structurally similar and unaffected by LTH.[29] In support of this supposition, there is evidence that in rat Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(D)

(B)

(E)

(C)

hearts the expression of CaL increases after birth although their structure appears similar.[30]

The finding that adult arteries are far more reactive to high-K+ than those of the fetus was not surprising. Recent work has shown a similar result in ovine middle cerebral arteries.[12] As a litmus test for the amount of active smooth muscle in the arterial wall, and in an attempt to resolve the source of developmental change in arterial reactivity, we compared the ratio of the total protein content to that of alpha-smooth muscle actin. These measurements are indicative of small, generalized increases in the expression of smooth muscle after birth, which may contribute to the Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

(F)

Figure 6: LTH does not greatly affect the role of Rho-kinase and the L-type Ca 2+ channel during high-K+-elicited pulmonary arterial contractility in sheep. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 10 μM Y-27632 (dashed), 10 μM nifedipine (NIF; dotted), or 10 μM Y-27632 + 10 μM NIF (Y-27632 + NIF; dotted and dashed) from fetus (A and B) or adult (D and E). Tracings are plotted in relation to maximal contraction from initial high-K+ stimulation (% TK (control)). (C and F) Bars indicate mean±S.E.M. of high-K+-induced contraction expressed as % TK (control) in the presence of vehicle control or antagonists for pulmonary arteries from fetus (C; open) and adult (F; solid) sheep. ***(P<0.001), **(P<0.01) denotes significant difference by one-way ANOVA.

increased arterial reactivity.[12] The mild increase of alpha smooth muscle actin may also reflect a potential increase in expression of other contractile machinery components. As indicated by the varied roles for CaL versus Rho-kinase, the majority of the increases in contraction due to maturation are likely mediated through more complex alterations in cellular signaling. The finding that Rho-kinase is important to K+-induced contraction was expected, as membrane depolarization and concomitant Ca2+ influx can activate Rho-kinase,[7,31] which subsequently causes pulmonary arterial contraction.[8,32-34] We did not anticipate, however, the substantial difference 49

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(B)

(D)

(A)

(C)

(B) 50

(C)

(D)

Figure 7: Maturation alters the role for superoxide during high-K+-elicited pulmonary arterial contractility in sheep housed in normoxic conditions. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 100 μM apocynin (dotted), 3 mM tempol (dashed) from fetus (A) or adult (C). Tracings are plotted in relation to maximal contraction from initial high-K stimulation (% T K (control) ). (B and D) Bars indicate mean±S.E.M. of high-K+-induced contraction expressed as % TK (control) in the presence of vehicle control or antagonists for pulmonary arteries from fetus (B; open) and adult (D; solid) sheep. **(P<0.01) denotes significant difference by one-way ANOVA.

Figure 8: LTH increases the role for mitochondrial-derived superoxide during high-K + -elicited pulmonary arterial contractility in fetal sheep. Isometric tension recordings of pulmonary arterial rings constricted in the presence of 0.1% DMSO (solid), 100 μM apocynin (dotted), or 3 mM tempol (dashed) from fetus (A) or adult (C). Tracings are plotted in relation to maximal contraction from initial high-K+ stimulation (% T K (control) ). (B and D) Bars indicate mean±S.E.M. of high-K+-induced contraction expressed as % TK (control) in the presence of vehicle control or antagonists for pulmonary arteries from fetus (B; open) and adult (D; solid) sheep. ***(P<0.001) denotes significant difference by one-way ANOVA. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

(A)

(B) Figure 9: Maturation modestly increases α smooth muscle (SM) actin expression. (A) Western blot result for α SM actin abundance in pulmonary artery homogenates. Equivalent masses of total protein (10 µg) were loaded on each lane (FN: Fetal normoxic; FH: Fetal LTH; AN: Adult normoxic; AH: Adult LTH). (B) Bars indicate mean±S.E.M. based on densitometric quantification of alpha smooth muscle actin abundance in pulmonary arterial preparations (ODactin: Optical density of alpha smooth muscle actin). *(P<0.05) denotes significant difference based on cumulative fetal versus adult densitometries based on a twoway ANOVA. No significant differences were noted based on level of oxygenation or between individual fetal and adult groups for each level of oxygenation.

in the role of Rho-kinase to high-K+-dependent contraction between fetal and adult pulmonary arteries. We were also surprised that Y-27632 did not suppress contraction to a greater extent in arteries from hypoxic fetal and adult sheep, as LTH increases Rho-kinase II expression, myosin light-chain phosphatase phosphorylation and role to Endothelin-1 (ET-1) dependent contraction in pulmonary arteries of fetal sheep.[35] LTH also increases the expression of RhoA and the role of Rho-kinase to KCl contraction in adult rats.[8] In our studies, Y-27632 inhibited contraction to a similar extent in both normoxic and hypoxic animals. One notable difference between our experiments and the previous work in pulmonary arteries of LTH fetal sheep[35] is that we contracted pulmonary arteries with high-K+ while the previous study contracted them with ET-1. Furthermore, another recent study by Gao and coworkers performed on fetal sheep pulmonary veins, shows LTH reduced Rhokinase II expression, cGMP-dependent relaxation via Rhokinase pathways, and arachidonic acid induced activity.[36] Possibly, the augmented importance of Rho-kinase in pulmonary arteries of LTH fetal sheep[35] versus the lack of an increase in the present experiments may, in part, reflect differential Ca2+-dependent activation of Rho-kinase.[37,38] In particular, Rho-kinase activation can be either reliant or independent of increases in cytosolic Ca2+, where G-protein receptor activation may couple to Rho-kinase activation Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

to a different extent as compared to K+-depolarization dependent elevations in cytosolic Ca2+. For example, Rhokinase activation can occur independently of changes in cytosolic Ca2+ in renal tubules as well as in renal and femoral arteries. [39,40] Recent evidence indicates that such Ca2+-independent activation mechanisms also exist in rat pulmonary arteries. [8,9] With respect to studies in adult rats that show LTH increases the importance of Rho-kinase to K+-dependent contraction, explaining the differences from our studies is less clear. Conceivably, sheep are more resilient to LTH than rats. Whereas pulmonary arteries from adult rats have an increased role for Rhokinase and enhanced contraction,[8,19] those of sheep are possibly maintained. Previous studies in sheep support this proposition, as long-term high-altitude hypoxia did not alter the maximum tension developed by ET-1 or serotonin in PA from sheep fetuses[3,35] or adults.[4]

The small role of superoxides to high-K + -induced contraction in the sheep, relative to the rat, also was unexpected. Published evidence shows that mitochondriagenerated superoxides are an important component to K+-elicited contraction in rat pulmonary arteries.[8] In fetal sheep, we found no role for apocynin-dependent NADPH-mitochondrial-generated superoxides in highK+-dependent contraction, while in the adult and fetal hypoxic arteries tempol-superoxide dismutase related non-NADPH-generated superoxide accounted for a small proportion of the contraction. This is indicative of species variability in terms of the acclimatization response to LTH.[3,4,8] As such, it will be of interest to determine the extent to which blunted superoxide responses in the sheep mitigate the deleterious influences of LTH on pulmonary vascular function.

There are several potential impacts of the increase in K+-dependent contraction after birth, and the shift from Rho-kinase to CaL-dependent contraction. In particular, the reduced pulmonary arterial contraction in the fetus may reflect the reduced pre-birth lung blood flow due to a patent and diverting ductus arteriosus. Moreover, the fetal pulmonary vasculature is characterized by a decreased ability for sustained vasodilation. [41,42] Nevertheless, Rho-kinase inhibitors achieved sustained vasodilation in late-gestation fetal lambs, suggesting that high Rhokinase activity contributes substantially to maintenance of increased pulmonary vascular resistance in the fetal lung. [33,43] Secondarily, the increased activity of Rhokinase in fetal arteries also may contribute to sustained contraction by preventing myosin dephosphorylation while Ca2+ influx is limited. This could conserve energy for other tasks, such as cell growth, as the rates of phosphorylation and dephosphorylation are potentially slowed in the fetal vessels relative to those of the adult. The end result would be a relatively stable and sustained 51

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

arterial contraction, albeit with potentially reduced force generation. Lastly, the data suggest that while Ca L therapies more effectively vasodilate pulmonary arteries in adults, and Rho-kinase therapies are more effective vasodilators in newborns, combination therapies would provide greater efficacy in both young and mature patients.

ACKNOWLEDGMENTS

We would like to acknowledge Srilakshmi Vemulakonda, Rachael Wilson, Nathan Matei, and Nina Chu for expert technical assistance.

16. 17. 18. 19. 20.

21.

22.

REFERENCES

23. 1.

Ward JP, Snetkov VA. Determination of signaling pathways responsible for hypoxic pulmonary vasoconstriction: Use of the small vessel myograph. Methods Enzymol 2004;381:71-87. 2. Sanderson MJ, Bai Y, Perez-Zoghbi J. Ca(2+) oscillations regulate contraction of intrapulmonary smooth muscle cells. Adv Exp Med Biol 2010;661: 77-96. 3. Goyal R, Papamatheakis DG, Loftin M, Vrancken K, Dawson AS, Osman NJ, et al. Long-term maternal hypoxia: The role of extracellular Ca2+ entry during serotonin-mediated contractility in fetal ovine pulmonary arteries. Reprod Sci 2011;18:948-62. 4. Papamatheakis DG, Vemulakonda S, Blood Q, Goyal R, Rubalcava M, Vrancken K, et al. Preservation of serotonin-mediated contractility in adult sheep pulmonary arteries following long-term high-altitude hypoxia. High Alt Med Biol 2011;12:253-64. 5. Wilson SM, Mason HS, Ng LC, Montague S, Johnston L, Nicholson N, et al. Role of basal extracellular Ca2+ entry during 5-HT-induced vasoconstriction of canine pulmonary arteries. Br J Pharmacol 2005;144:252-64. 6. Mita M, Yanagihara H, Hishinuma S, Saito M, Walsh MP. Membrane depolarization-induced contraction of rat caudal arterial smooth muscle involves Rho-associated kinase. Biochem J 2002;364:431-40. 7. Urban NH, Berg KM, Ratz PH. K+ depolarization induces RhoA kinase translocation to caveolae and Ca2+ sensitization of arterial muscle. Am J Physiol Cell Physiol 2003;285:C1377-85. 8. Broughton BR, Jernigan NL, Norton CE, Walker BR, Resta TC. Chronic hypoxia augments depolarization-induced Ca2+ sensitization in pulmonary vascular smooth muscle through superoxide-dependent stimulation of RhoA. Am J Physiol Lung Cell Mol Physiol 2010;298:L232-42. 9. Broughton BR, Walker BR, Resta TC. Chronic hypoxia induces Rho kinasedependent myogenic tone in small pulmonary arteries. Am J Physiol Lung Cell Mol Physiol 2008;294:L797-806. 10. Shimoda LA, Sham JS, Shimoda TH, Sylvester JT. L-type Ca(2+) channels, resting [Ca(2+)](i), and ET-1-induced responses in chronically hypoxic pulmonary myocytes. Am J Physiol Lung Cell Mol Physiol 2000;279:L884-94. 11. Hirenallur SD, Haworth ST, Leming JT, Chang J, Hernandez G, Gordon JB, et al. Upregulation of vascular calcium channels in neonatal piglets with hypoxia-induced pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2008;295:L915-24. 12. Goyal R, Henderson DA, Chu N, Longo LD. Ovine Middle Cerebral Artery Characterization and Quantification of Ultrastructure and Other Features: Changes with Development. Am J Physiol Regul Integr Comp Physiol 2011 Nov 23. [Epub ahead of print]. 13. Blood AB, Zhao Y, Long W, Zhang L, Longo LD. L-type Ca2+ channels in fetal and adult ovine cerebral arteries. Am J Physiol Regul Integr Comp Physiol 2002;282:R131-8. 14. Longo LD, Ueno N, Zhao Y, Zhang L, Pearce WJ. NE-induced contraction, alpha 1-adrenergic receptors, and Ins(1,4,5)P3 responses in cerebral arteries. Am J Physiol Renal Physiol 1996;270:H915-23. 15. Kamitomo M, Longo LD, Gilbert RD. Cardiac function in fetal sheep during two weeks of hypoxemia. Am J Physiol Renal Physiol 1994;266: R1778-85.

24. 25. 26. 27. 28. 29. 30. 31. 32.

33. 34.

35.

36.

37. 38. 39.

Zhao Y, Xiao H, Long W, Pearce WJ, Longo LD. Expression of several cytoskeletal proteins in ovine cerebral arteries: Developmental and functional considerations. J Physiol 2004;558:623-32. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-54. Rasband WS. ImageJ. In. Bethesda, Maryland, USA,: U. S. National Institutes of Health; 2011. Resta TC, Broughton BR, Jernigan NL. Reactive oxygen species and RhoA signaling in vascular smooth muscle: Role in chronic hypoxia-induced pulmonary hypertension. Adv Exp Med Biol 2010;661:355-73. Dennis KE, Aschner JL, Milatovic D, Schmidt JW, Aschner M, Kaplowitz MR, et al. NADPH oxidases and reactive oxygen species at different stages of chronic hypoxia-induced pulmonary hypertension in newborn piglets. Am J Physiol Lung Cell Mol Physiol 2009;297:L596-607. Fike CD, Slaughter JC, Kaplowitz MR, Zhang Y, Aschner JL. Reactive oxygen species from NADPH oxidase contribute to altered pulmonary vascular responses in piglets with chronic hypoxia-induced pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2008;295:L881-8. Knock GA, Snetkov VA, Shaifta Y, Connolly M, Drndarski S, Noah A, et al. Superoxide constricts rat pulmonary arteries via Rho-kinase-mediated Ca(2+) sensitization. Free Radic Biol Med 2009;46:633-42. Ostrovskaya O, Goyal R, Osman N, McAllister CE, Pessah IN, Hume JR, et al. Inhibition of ryanodine receptors by 4-(2-aminopropyl)-3,5-dichloroN,N-dimethylaniline (FLA 365) in canine pulmonary arterial smooth muscle cells. J Pharmacol Exp Ther 2007;323:381-90. Pluteanu F, Cribbs LL. Regulation and function of Cav3.1 T-type calcium channels in IGF-I-stimulated pulmonary artery smooth muscle cells. Am J Physiol Cell Physiol 2011;300:C517-25. Rodman DM, Reese K, Harral J, Fouty B, Wu S, West J, et al. Low-voltageactivated (T-type) calcium channels control proliferation of human pulmonary artery myocytes. Circ Res 2005;96:864-72. Firth AL, Remillard CV, Platoshyn O, Fantozzi I, Ko EA, Yuan JX. Functional ion channels in human pulmonary artery smooth muscle cells: Voltagedependent cation channels. Pulm Circ 2011;1:48-71. Saleh S, Yeung SY, Prestwich S, Pucovsky V, Greenwood I. Electrophysiological and molecular identification of voltage-gated sodium channels in murine vascular myocytes. J Physiol 2005;568:155-69. Platoshyn O, Remillard CV, Fantozzi I, Sison T, Yuan JX. Identification of functional voltage-gated Na(+) channels in cultured human pulmonary artery smooth muscle cells. Pflugers Arch 2005;451:380-7. Zamponi GW. Antagonist binding sites of voltage-dependent calcium channels. Drug Develop Res 1997;42:131-43. Liu L, O’Hara DS, Cala SE, Poornima I, Hines RN, Marsh JD. Developmental regulation of the L-type calcium channel alpha1C subunit expression in heart. Mol Cell Biochem 2000;205:101-9. Ratz PH, Berg KM, Urban NH, Miner AS. Regulation of smooth muscle calcium sensitivity: KCl as a calcium-sensitizing stimulus. Am J Physiol Cell Physiol 2005;288:C769-83. Fagan KA, Oka M, Bauer NR, Gebb SA, Ivy DD, Morris KG, et al. Attenuation of acute hypoxic pulmonary vasoconstriction and hypoxic pulmonary hypertension in mice by inhibition of Rho-kinase. Am J Physiol Lung Cell Mol Physiol 2004;287:L656-64. Parker TA, Roe G, Grover TR, Abman SH. Rho kinase activation maintains high pulmonary vascular resistance in the ovine fetal lung. Am J Physiol Lung Cell Mol Physiol 2006;291:L976-82. Homma N, Nagaoka T, Morio Y, Ota H, Gebb SA, Karoor V, et al. Endothelin-1 and serotonin are involved in activation of RhoA/Rho kinase signaling in the chronically hypoxic hypertensive rat pulmonary circulation. J Cardiovasc Pharmacol 2007;50:697-702. Gao Y, Portugal AD, Negash S, Zhou W, Longo LD, Usha Raj J. Role of Rho kinases in PKG-mediated relaxation of pulmonary arteries of fetal lambs exposed to chronic high altitude hypoxia. Am J Physiol Lung Cell Mol Physiol 2007;292:L678-84. Gao Y, Portugal AD, Liu J, Negash S, Zhou W, Tian J, et al. Preservation of cGMP-induced relaxation of pulmonary veins of fetal lambs exposed to chronic high altitude hypoxia: Role of PKG and Rho kinase. Am J Physiol Lung Cell Mol Physiol 2008;295:L889-96. Nagaoka T, Fagan KA, Gebb SA, Morris KG, Suzuki T, Shimokawa H, et al. Inhaled Rho kinase inhibitors are potent and selective vasodilators in rat pulmonary hypertension. Am J Respir Crit Care Med 2005;171:494-9. Nagaoka T, Gebb SA, Karoor V, Homma N, Morris KG, McMurtry IF, et al. Involvement of RhoA/Rho kinase signaling in pulmonary hypertension of the fawn-hooded rat. J Appl Physiol 2006;100:996-1002. Szaszi K, Sirokmany G, Di Ciano-Oliveira C, Rotstein OD, Kapus A.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Papamatheakis et al.: Maturation, LTH, and depolarization-dependent contraction

40. 41. 42.

Depolarization induces Rho-Rho kinase-mediated myosin light chain phosphorylation in kidney tubular cells. Am J Physiol Cell Physiol 2005;289:C673-85. Alvarez SM, Miner AS, Browne BM, Ratz PH. Failure of Bay K 8644 to induce RhoA kinase-dependent calcium sensitization in rabbit blood vessels. Br J Pharmacol 2010;160:1326-37. Abman SH, Shanley PF, Accurso FJ. Failure of postnatal adaptation of the pulmonary circulation after chronic intrauterine pulmonary hypertension in fetal lambs. J Clin Invest 1989;83:1849-58. Abman SH, Accurso FJ. Sustained fetal pulmonary vasodilation with prolonged atrial natriuretic factor and GMP infusions. Am J Physiol 1991;260:H183-92.

43.

Tourneux P, Chester M, Grover T, Abman SH. Fasudil inhibits the myogenic response in the fetal pulmonary circulation. Am J Physiol Heart Circ Physiol 2008;295:H1505-13.

Source of Support: This work was supported by National Institutes of Health Grants P01 HD-031226 and RO1 HD03807-38 (LD Longo) and supported by National Science Foundation Grant No. MRI-DBI 0923559 (SM Wilson). Jay J. Patel was an Apprentice Bridge to College Scholar in the Center for Molecular Medicine and Health Disparities funded by P20 MD001632 (Marino DeLeon), Conflict of Interest: None declared.

Author Help: Online submission of the manuscripts Articles can be submitted online from http://www.journalonweb.com. For online submission, the articles should be prepared in two files (first page file and article file). Images should be submitted separately. 1) First Page File: Prepare the title page, covering letter, acknowledgement etc. using a word processor program. All information related to your identity should be included here. Use text/rtf/doc/pdf files. Do not zip the files. 2) Article File: The main text of the article, beginning with the Abstract to References (including tables) should be in this file. Do not include any information (such as acknowledgement, your names in page headers etc.) in this file. Use text/rtf/doc/pdf files. Do not zip the files. Limit the file size to 1 MB. Do not incorporate images in the file. If file size is large, graphs can be submitted separately as images, without their being incorporated in the article file. This will reduce the size of the file. 3) Images: Submit good quality color images. Each image should be less than 4096 kb (4 MB) in size. The size of the image can be reduced by decreasing the actual height and width of the images (keep up to about 6 inches and up to about 1800 x 1200 pixels). JPEG is the most suitable file format. The image quality should be good enough to judge the scientific value of the image. For the purpose of printing, always retain a good quality, high resolution image. This high resolution image should be sent to the editorial office at the time of sending a revised article. 4) Legends: Legends for the figures/images should be included at the end of the article file. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

ABSTRACT Endothelial dysfunction plays an important role in the pathogenesis of pulmonary arterial hypertension (PAH) in sickle cell disease (SCD). A variety of evidence suggests that circulating endothelial progenitor cells (EPCs) play an integral role in vascular repair. We hypothesized that SCD patients with PAH are deficient in EPCs, potentially contributing to endothelial dysfunction and disease progression. The number of circulating CD34+/CD14−/CD106+ EPCs was significantly lower in SCD patients with PAH than without PAH (P=0.025). CD34+/CD14−/CD106+ numbers significantly correlated with tricuspid regurgitation velocity (TRV, r=−0.44, P=0.033) 6-minute walk distance (6MWD, r= 0.72, P=0.001), mean pulmonary artery pressure (mPAP, r= −0.43, P=0.05), and pulmonary vascular resistance (PVR, r=−0.45, P=0.05). Other EPC subsets including CD31+/CD133+/CD146+ were similar between both groups. Numbers of EPCs did not correlate with age, sex, hemoglobin, WBC count, reticulocyte count, lactate dehydrogenase (LDH), iron/ferritin levels, and serum creatinine. These data indicate that subsets of EPC are lower in SCD patients with PAH than in those without PAH. Fewer EPCs in PAH patients may contribute to the pulmonary vascular pathology. Reduced number of EPCs in SCD patients with PAH might not only give potential insight into the pathophysiological mechanisms but also might be useful for identifying suitable therapeutic targets in these patients. Key Words: associated pulmonary arterial hypertension, sickle cell disease, stem cell, pathogenic mechanism

INTRODUCTION PAH is a major complication of SCD with the prevalence ra n g i n g f ro m 2 0 % to 3 0 % b a s e d o n D o p p l e r echocardiographic studies.[1] Patients with SCD have a higher risk of death with even mild elevations in PAP compared to primary PH. Each 10 mmHg rise in mean PAP was found to be associated with a 1.7-fold increase in the rate of death.[2] Recent autopsy studies suggest that up to 75% of SCD patients have histological evidence of PAH at the time of death.[3]

Pathological changes seen in these patients are similar to those seen in other forms of PAH.[3] Specific mechanisms by which PAH develops in SCD remain poorly defined. Histological features of SCD-related PAH include intimal hyperplasia; smooth muscle proliferation; and formation of plexiform lesions causing vascular lumen obliteration.[4,5] These findings suggest abnormal endothelial

Address correspondence to: Dr. Raj Wadgaonkar SUNY Downstate and VA Medical Center Brooklyn NY 11209 USA Email: raj.wadgaonkar@downstate.edu 54

homeostasis caused by impairment of endothelial repair. Multiple lines of evidence suggest that endothelial progenitor cells (EPCs) play an important role in endothelial repair process. [6] EPCs are precursor cells that are typically considered to arise from mesodermal stem cells or hemangioblasts in the bone marrow. [7] Upon stimulation by various angiogenic factors including VEGF-A and SDF-1, these cells circulate to the site of ischemia or endothelial injury, where they proliferate and differentiate into mature endothelial cells and contribute to postnatal neovascularization and re-endothelialization.[6,8] EPCs lack mature endothelial markers, but coexpress markers of bone marrow origin such as CD34 or AC133 Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94834 How to cite this article: Anjum F, Lazar J, Zein J, Jamaleddine G, Demetis S, Wadgaonkar R. Characterization of altered patterns of endothelial progenitor cells in sickle cell disease related pulmonary arterial hypertension. Pulm Circ 2012;2:54-60.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Anjum, et al.: Endothelial progenitor cells in SCD

in addition to endothelial markers (VE-Cadherin or VEGFR-2).[7,9-11]

Since the discovery of EPCs by Asahara et al. in 1997,[12] numerous studies have shown that the number and function of progenitor cells correlate with cardiovascular risk factors, reflect endothelial impairment and are predictive of clinical outcome.[13-15] Numbers of circulating EPCs are also altered in pulmonary disease states.[16,17] These findings have fostered a growing interest in EPCs as a potential therapeutic target or predictive biomarker in PAH.[18,19] The exact role of progenitor cells in preventing pulmonary vascular alterations in patients with SCD remains undetermined. In this study we sought to compare numbers of various EPC subsets in patients with SCD with and without PAH.

MATERIALS AND METHODS Study population

Patients with known SCD were recruited from our hospital’s SCD clinic. Patients with PH related to left heart disease, pulmonary disease, chronic thromboembolic disease, autoimmune or collagen vascular disease, sleep-associated disorders, HIV infection or liver disease were excluded. Patients with chronic renal insufficiency (serum creatinine ≥ 1.5 mg/dl), pregnancy, smoking or substance abuse, active sickle crisis or acute chest syndrome at the time of their echo were also excluded (Table 1). All participants were free of wounds, ulcers, retinopathy, recent surgery, inflammatory or malignant disease as these conditions might influence EPC number. Venous blood was collected at the time of echo study from all participants and processed within 24 hours of collection for evaluation of progenitor cells. This study was approved by the Downstate-Kings County Review Board (Chairperson Eli Freidman: IRB # 050409-KCH-S0096) and written informed consent was obtained from all individuals.

Evaluation for PAH

Two-dimensional and Doppler echocardiographic studies (Phillips iE33 and 5500, Andover, Massachusetts) were performed by an experienced technician according to standard American Society of Echocardiography protocol. A 2.5 MHz ultrasound transducer (model S5-1 and S3) recorded continuous wave signals using multiple views to obtain peak TRV. Right ventricular systolic pressure (RVSP) was calculated using modified Bernoulli equation [4v2 + right atrial pressure (RAP), v=peak TRV meter/second] and was considered to be equal to the PASP in the absence of RV outflow obstruction. We defined TRV≥2.5 m/s as a marker of PAH in SCD. The presence of PAH was confirmed via right heart catheterization (RHC) defined as mPAP≥25 Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

mmHg. Hemodynamic measurements were performed in a recumbent position. Cardiac output was obtained, using triplicate measurements with the thermodilution method (Agilent, Boeblingen, Germany). Pulmonary vascular resistance (PVR) was calculated using the standard formula PVR=80 × (mean pulmonary artery pressure [mmHg] – pulmonary capillary wedge pressure [mmHg])/cardiac output [l/min]. Fourteen patients were found to have PAH while 22 patients were found to lack PAH. Exercise capacity was assessed by a 6-minute walk distance.

Flow cytometry

Flow cytometry was used to quantify EPCs in peripheral blood by identifying eight distinctive cell markers (CD34, CD14, CD106, CD105, CD31, CD133, KDR, CD146) in 20 different combinations in both groups of patients. One milliliter of venous blood (anticoagulant: EDTA) was prepared by lysing red cells with 10 ml of FACS lysing solution (10×, diluted 1:10) for 10 minutes. The white cells (WBC) were then blocked with 20 µl of specific Fcreceptor antibodies (Octagam; Octapharma) and 200 µl of mouse serum (Sigma) for a minimum of 20 minutes at room temperature. Next, the cells were incubated with monoclonal anti-human mouse antibodies, namely PECD146, and PE-Cy 5-CD34 (Becton Dickinson) CD31- FITC, CD106-PE, CD14-FITC (eBiosciences), CD105-PE, VEGFR2 antibody [KDR/EIC] (Abcam) and PE-CD133 (Miltenyi Biotec) for 20 minutes at room temperature, washed with cell buffer solution (PBS + 1% bovine serum albumin + 0.05% sodium azide), and centrifuged at 500 g to repellet the cells. The cells were then fixed with 200 µl of 2% paraformaldehyde for 20 minutes at 4°C and made up to a final volume of 1 ml with cell buffer solution ready for analysis. All samples were analyzed using a 3-color FAC scan flow cytometer (Becton Dickinson). At least 10,000 events were acquired and analyzed using Cell-Quest 3.3 software. Isotype-matched irrelevant antibodies were used as negative controls for nonspecific binding.

EPCs were predefined as cells expressing the following combinations of surface markers: CD34+/CD14−/CD106+ and CD31+/CD133+/CD146+ cells. In general, CD34+ is a marker of bone marrow origin while CD14− excludes monocytic origin and CD106+ denotes endothelial origin, labeling these cells as EPCs. Whereas in another subset, CD133+ indicates immaturity/bone marrow origin and CD31+ and CD146+ indicate endothelial origin, marking these cells as a different subpopulation of EPCs. Circulating endothelial cells (CECs) were defined as CD14−/KDR+ or CD31+/CD146+ cells.

Statistical analysis

A statistical software package (SAS, version 9.2; SAS institute Inc, Cary, N.C., USA) was applied for data management. Results were expressed as mean ± standard 55

Anjum, et al.: Endothelial progenitor cells in SCD

Table 1: Patient characteristics in sickle cell disease, PAH vs. No PAH Characteristics Age (years) Gender (M:F) Height (inch) Weight (Kg) BMI Ethnicity Genotypes SS SC Sickle cell trait + Sickle β Thalassemia Total hemoglobin Fetal hemoglobin Reticulocyte count Platelets MPV Blood urea nitrogen Serum creatinine CRP Lactate dehydrogenase Iron Ferritin Total bilirubin Direct bilirubin Ejection fraction (%) TRV, m/sec* 6-min walk distance, m* Right heart catheterization mPAP, mmHg PVR, dyns/ cm5 Cardiac output, L/min Medication Folic acid Pain medication Hydroxyurea Diuretics Calcium channel antagonists

PAH (n=14)

No PAH (n=22)

39.47±14.62 6:8 170.7±7.98 68.19±14.20 21.34±3.51 African American

37.97±13.27 9:13 177.6±51.92 64.93±13.26 20.79±4.17 African American

14 0 0 0 7.99±1.47 6.49±5.26 24.78±69.45 425.7±203.8 9.01±0.91 12.73±7.23 0.77±0.29 35.12±50.15 548.0±262.1 90.53±38.88 778.6±1398.7 2.96±2.07 1.04±1.43 57.24±4.54 3.49±0.35* 283±41*

22 0 0 0 8.83±1.62 5.91±4.03 11.6±5.53 410.5±189.4 9.23±0.95 5.94±1.05 0.65±0.21 27.09±36.22 436.8±179.6 85.71±43.22 1151.1±2140.9 2.95±1.86 0.61±0.29 57.90±4.23 2.10±0.23 577±68

56±7 932±213 3.5±0.7 14/14 14/14 2/14 2/14 1/14

22/22 22/22 4/22 3/22 2/22

*P≤0.05 compared with No pulmonary arterial hypertension (PAH) ; Values are expressed as mean±SD

deviation (SD). Statistical analyses were performed by a Wilcoxon t test and Spearman correlation. Multivariate regression analysis was applied to determine independent relations of all clinical variables with progenitor cells. A P value < 0.05 was considered statistically significant.

RESULTS

Numbers of circulating CD34+/CD14−/CD106+ (EPC Group-1) progenitor cells were found to be significantly lower in SCD patients with PAH than those in the nonPAH group (P=0.025) (Fig. 1). However, CD31+/CD133+/ CD146+ cells (EPC Group-2) did not show a significant difference in PAH versus non-PAH SCD patients (Fig. 1). In addition, the number of CD34+/CD14−/CD106+ cells (EPC Group-1) was also found to be significantly correlated with TRV on Doppler echo (r=−0.44, P=0.033), 6MWD (r=0.72, P=0.001), mPAP (r=−0.43, P=0.05), and PVR (r=−0.45, P=0.05) on RHC (Fig. 2). The EPC number did not correlate with age, sex, body mass index (BMI), hemoglobin, WBC 56

count, reticulocyte count, lactate dehydrogenase (LDH), iron/ferritin levels, BUN, and serum creatinine.

Percentage cell types of the total for various marker combinations are shown in (Table 2). Other than CD34+/ CD14−/CD106+ (EPC Group-1) we did not find significant differences in cells with other combinations of the endothelial markers including circulating endothelial cells (CECs) that are mature endothelial cells resulting partially from normal shedding of endothelial lining. Characterization of these cells by flow cytometry showed that CECs, namely CD14−/KDR+ and CD31+/CD146+ cells, were similar among PAH versus non-PAH SCD patients (Fig. 1). Patient demographics of SCD patients with PAH versus non-PAH are shown in (Table 1).

DISCUSSION

Endothelial dysfunction is a hallmark of PAH. Although EPCs have been largely implicated in endothelial Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Anjum, et al.: Endothelial progenitor cells in SCD

1.5 1 0.5

(N)

PAH

Y (R)

10 9 8 7 6 5 4 3 2 1 0

0.07 0.06 0.05 0.04 0.03 0.02 0.01 0 -0.01

PAH

(H)

PAH

(K)

PAH

(L) 0.04 0.03 0.02 0.01 0

N (O)

Y (S)

PAH

% cd14-/ cd105+ of total

% cd14-/ cd34+ of total

0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 -0.1

0.07 0.06 0.05 0.04 0.03 0.02 0.01 0 -0.01

3 2.5 2 1.5 1 0.5 0 -0.5

0.012 0.01 0.008 0.006 0.004 0.002 0 -0.002

PAH

N PAH

% cd14-/ cd34+/ KDR+/ cd106+

120 100 80 60 40 20 0 -20

% cd14-/ cd34+/ KDR+/ cd105+

1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

% cd146+ of total

(G)

0.5

1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

PAH

Y (P)

% cd31+/ 105-106+ of total

%cd14/ KDR+ of total

% cd133+ of total

(F)

PAH

% cd14-/ CD34+/ cd105+

**p=0.025

PAH

(J)

(D)

1.5

PAH

Y (T)

PAH

% cd31+/ cd133+/ cd146+/ cd105106+

106+

0.3 0.25 0.2 0.15 0.1 0.05 0 -0.05

PAH

% cd31+ of total

% cd14-/ cd34+/ cd106+ of total % cd14-/ cd34+/ KDR+/ cd105+/

0.012 0.01 0.008 0.006 0.004 0.002 0 -0.002

% cd31+/ cd133+/ cd105106+

0.1 0 -0.1

0.6 0.5 0.4 0.3 0.2 0.1 0 -0.1

% cd31+/ cd146+ of total

(Q)

PAH

0.6 0.5 0.4 0.3 0.2

(I)

(M)

(C)

% cd31+/ cd133+/ cd146+

% cd14/ cd106+ of total

(E)

(B) % cd14-of total

WBC (1000/ul)

16 15 14 13 12 11 10 9 8 7 6 5

% cd31+/ cd133+ of total

(A)

15 14 13 12 11 10 9 8 7 6 5 4

0.06 0.05 0.04 0.03 0.02 0.01 0 -0.01

PAH

Figure 1: Flow cytometric analysis and characterization of cell surface markers on EPC from peripheral blood. Using several[8] distinctive cell markers (CD34, CD14, CD106, CD105, CD31, CD133, KDR, CD146) in 20 different combinations in both groups of patients flow cytometric analysis was performed as described in the “Methods” section. EPCs with CD14−/CD34+/CD106+ markers showed a significant difference between SCD patients with PAH versus without PAH (P=0.025), while EPCs with CD31+/CD34+/CD146+ markers and CECs did not show any significant difference between the two groups of patients. Statistical analysis was performed as described in the methods section.

dysfunction in PAH, none of the studies have directly assessed their significance in setting of SCD-related PAH. We are unaware of a prior study that has characterized EPC subtypes in the setting of SCD-related PAH. Analysis of data from 20 different cell marker combinations Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

revealed two significant subpopulations of EPCs, CD34+/ CD14−/CD106+ cells (EPC Group-1) and CD31+/CD133+/ CD146+ cells (EPC Group-2). The number of circulating EPC Group-1 was significantly lower in SCD patients with PAH than that in the non-PAH group. In addition, these 57

0.7

0.6

% cd14-/ cd34+/ cd106+

Anjum, et al.: Endothelial progenitor cells in SCD

0.5 0.4 0.3 0.2 0.1 0

1.5

2.5

3.5

0.7

0.6

% cd14-/ cd34+/ cd106+

0.7

0.5 0.4 0.3 0.2 0.1 0 200

300

400

mPAP(mm Hg)

TRV( m/s)

500

600

0.5 0.4 0.3 0.2 0.1 0

300

6 min walk distance (m)

600

900

PVR (dyns/cm5)

Figure 2: Correlation of EPC’ with various PAH parameters. EPCs with CD34+/CD14−/ CD106+ markers (EPC Group-1) were found to be to be significantly correlated with TRV on Doppler echo (r=−0.44, P=0.033), 6MWD (r=0.72, P=0.001), mPAP (r=−0.43, P=0.05), and PVR (r=−0.45, P=0.05) on RHC. Multivariate regression analysis was applied to determine independent 1200 relations of all clinical variables with EPCs. A P value ≤0.05 was considered statistically significant.

Table 2: Numbers of different progenitor and circulating endothelial cells (percentage of total cells) in SCD patients with PAH vs. No PAH % Cell types of total

PAH (n=14)

No PAH (n=22)

P value

WBC(1000/ml) % CD14% CD14-/ CD34+ % CD14-/ CD105+ % CD14-/ CD106+ % CD14-/ KDR+ % CD14-/ CD34+/ CD105+ % CD14-/ CD34+/ CD106+* % CD14-/ CD34+/ KDR+/ CD105+ % CD14-/ CD34+/ KDR+/ CD106+ % CD31+/ CD133+/ CD105106+ % CD31+ % CD133+ % CD105-106+ % CD146+ % CD31+/CD133+ % CD31+/ CD105-106+ % CD31+/ CD146+ % CD31+/ CD133+/CD146+ % CD31+/ CD133+/ CD146+/ CD105106+ % CD14-/ CD34+/ KDR+/ CD105-106+

10.47±2.96 89.37±3.98 0.29±0.41 0.34±0.05 0.06±0.03 0.39±0.22 0.34±0.05 0.02±0.01* 0.006±0.002 0.0007±0.002 0.007±0.003 2.73±2.36 0.21±0.70 0.11±0.22 0.06±0.16 7.23±26.93 9.40±7.58 0.03±0.01 0.008±0.003 0.005±0.013 0.0007±0.002

10.46±3.01 89.32±5.32 0.28±0.37 0.23±0.04 0.09±0.01 0.47±0.39 0.23±0.04 0.12±0.09 0.004±0.002 0.0004±0.002 0.002±0.002 2.26±1.84 0.05±0.19 0.07±0.88 0.03±0.04 0.01±0.02 9.41±6.04 0.03±0.01 0.004±0.002 0.002±0.002 0.0004±0.002

0.988 0.798 0.932 0.109 0.294 0.489 0.109 0.025* 0.535 0.748 0.236 0.507 0.319 0.504 0.474 0.213 0.989 0.733 0.311 0.324 0.748

*P<0.05 compared with No pulmonary arterial hypertension (PAH), Values are expressed as mean±SD

cell numbers were found to be significantly correlated with TRV on 2D-echo, 6MWD, mPAP and PVR on RHC, indicating that SCD-related PAH is associated with lower number of EPCs. 58

These findings are consistent with prior studies that showed a decrease in the number of EPCs in other forms of PH. One such study found deficiency of bone marrow-derived progenitor cells (CD34+, CD133+/ Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Anjum, et al.: Endothelial progenitor cells in SCD

VEGFR2+, CD34+/CD133+/KDR+ cells) in patients with PH secondary to idiopathic pulmonary fibrosis.[20] Other studies have described a reduction in bone marrow-derived progenitor cells in idiopathic pulmonary hypertension (IPAH) patients versus healthy controls.[21,22] Depletion of circulating EPCs has also been found in patients with COPD, who are at risk of developing associated PH[16]. In contrast, some have shown an increase in number of circulating EPCs in IPAH patients versus healthy controls,[23,24] whereas others have found no difference.[25] The reason for this disparity is not fully clear, but may reflect differences in the markers used to identify and quantify EPCs.

The exact mechanism underlying the association between low numbers of EPCs and SCD-related PAH is not fully understood. One possibility is decreased mobilization of EPCs from the bone marrow. The fact that EPC mobilization is a protective compensatory mechanism during PH rather than a pathogenic event is supported by several observational studies.[15,22,26,27] One of the studies showed that the deletion of erythropoietin receptor in nonerythroid cells worsens histopathological features of hypoxia-induced PH compared to wild-type mice.[26] Indeed, more severe PH in EPOR-/- mice was associated with complete inhibition of CD133+KDR+ EPC mobilization. Similarly, chronic treatment of IPAH patients with sildenafil is associated with a dose-dependent increase in circulating EPC numbers.[22] Moreover, potential new therapies for PAH, such as statins and PPAR-γ agonists, also induce the mobilization and differentiation of EPCs.[15,27,28] These findings suggest that decreased mobilization of EPCs from bone marrow in PAH might contribute to the pulmonary vascular pathology.

Alternatively, fewer peripheral EPCs might be a consequence of greater homing of EPCs in pulmonary vasculature at the site of endothelial injury. The homing of CD34+KDR+EPCs to diseased pulmonary arteries has been demonstrated in a study of endarterectomised tissue from patients with chronic thromboembolic PH.[29] Davie et al. reported that hypoxia-induced PH in calves is characterized by increased development of perfused vasa vasorum that are c-kit positive (a marker of bone marrow-derived cells).[30] Using a GFP-positive bone marrow chimeric mouse model, Hayashida et al. confirmed that bone marrow cells are located at sites of remodeling pulmonary arteries in hypoxia-induced PH, but that they coexpress markers of smooth muscle cells rather than endothelial markers.[31] Interestingly, another study found that early EPCs isolated from mice with hypoxia-induced PH show defective proangiogenic activities in comparison to EPCs from control mice when transplanted into nude mouse ischemic hind limbs. [32] The in vitro functions of mononuclear cells (e.g., colony forming capacity, adherence, migration and sensitivity to apoptosis) isolated from the peripheral Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

blood of IPAH patients have also been found to vary when compared with cells from healthy controls.[21-23,33] Therefore, it appears that compensatory EPC mobilization and recruitment occurs in the setting of PAH, which in turn may cause a relative deficiency of EPCs in peripheral blood due to increased homing of cells to pulmonary vasculature. Whether the response is insufficient to prevent disease or detrimental because of EPC dysfunctionality is unknown.

In the current study, we did not find a significant difference among other subgroups of progenitor cells such as CD31+/ CD133+/CD146+ cells (EPC Group-2) in PAH versus nonPAH SCD patients. As shown by Diller et al.,[22] circulating EPC numbers (CD34+/KDR+, CD34+/CD133+/KDR+ cells) were significantly lower in patients with Eisenmenger’s syndrome or IPAH than healthy controls. However, numbers of CD34+/CD45−/low and CD34+/CD133+ progenitor cells were not significantly different from control in IPAH population versus Eisenmenger’s syndrome. These findings suggest that subpopulations of progenitor cells may be differentially affected in these two well-known forms of PH and support our observation of two significant subpopulations of EPCs in SCD. Although in this prior study by Diller et al. observations were based on subpopulations of progenitor cells in general rather than EPCs alone, it nonetheless appears that different subsets of EPCs might be involved in vascular repair and hence differentially affected in SCD-related PAH.

Circulating endothelial cells (CECs) are mature endothelial cells that can result either from conversion of circulating EPCs into mature endothelial cells or from normal shedding of endothelial lining into circulation.[7] Increased concentrations of CECs are thought to be a marker of vascular injury in patients with cardiovascular disease, neoplasia, vasculitis, shock, and sepsis.[34] In the current study, characterization of different types of CECs by flow cytometry revealed that CD14−/KDR+ and CD31+/CD146+ cell numbers were similar among PAH versus non-PAH SCD patients. These findings differ from those of a prior study showing higher numbers of CECs in 15 SCD patients than in healthy controls. Of note, CECs were significantly higher in patients with PAH.[35] This disparity in results may be due to the difference in patient characteristics. All participants in our study were free of wounds, ulcers, and retinopathy that may influence CECs kinetics. Our findings suggest that endothelial cell turn over might not be different among SCD patients with and without PAH. In conclusion, our study was limited, as we did right-heart catheterization in patients with TRV≥2.5 only to confirm PAH, but not in patients with normal TRV. Therefore, patients with PAH but normal TRV on echo may have been misclassified. Furthermore, the term EPC has been widely used and comprises a heterogeneous population 59

Anjum, et al.: Endothelial progenitor cells in SCD

of mononuclear cells. Further studies are needed to precisely identify their origins, different cell phenotypes, and the terminology to be used when describing them.[36] In summary, we show here for the first time that subpopulations of EPCs are differentially affected in patients with SCD-related PAH. Relative deficiency of these EPCs subgroups in PAH patients may contribute to the pulmonary vascular pathology. These findings will provide potential insight into the pathophysiological mechanisms and can be useful for identifying suitable therapeutic targets in these patients.

REFERENCES 1. 2. 3. 4. 5. 6.

7. 8. 9.

10. 11. 12. 13. 14. 15.

16. 17.

Sutton LL, Castro O, Cross DJ, Spencer JE, Lewis JF. Pulmonary hypertension in sickle cell disease. Am J Cardiol 1994;74:626-8. Castro O, Hoque M, Brown BD. Pulmonary hypertension in sickle cell disease: cardiac catheterization results and survival. Blood 2003;101: 1257-61. Haque AK, Gokhale S, Rampy BA, Adegboyega P, Duarte A, Saldana MJ. Pulmonary hypertension in sickle cell hemoglobinopathy: A clinicopathologic study of 20 cases. Hum Pathol 2002;33:1037-43. Budhiraja R, Tuder RM, Hassoun PM. Endothelial dysfunction in pulmonary hypertension. Circulation 2004;109:159-65. Dorfmüller P, Perros F, Balabanian K, Humbert M. Inflammation in pulmonary arterial hypertension. Eur Respir J 2003;22:358-63. Takahashi T, Kalka C, Masuda H, Chen D, Silver M, Kearney M, et al. Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization. Nat Med 1999;5: 434-8. Steurer M, Kern J, Zitt M, Amberger A, Bauer M, Gastl G, et al. Quantification of circulating endothelial and progenitor cells: comparison of quantitative PCR and four-channel flow cytometry. BMC Res Notes 2008;1:71. Petit I, Jin D, Rafii S. The SDF-1-CXCR4 signaling pathway: A molecular hub modulating neo-angiogenesis. Trends Immunol 2007;28:299-307. Hur J, Yoon CH, Kim HS, Choi JH, Kang HJ, Hwang KK, et al. Characterization of two types of endothelial progenitor cells and their different contributions to neovasculogenesis.. Arterioscler Thromb Vasc Biol 2004;24:288-93. Ingram DA, Mead LE, Tanaka H, Meade V, Fenoglio A, Mortell K, et al. Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood. Blood 2004;104:2752-60. Hristov M, Erl W, Weber PC. Endothelial progenitor cells: mobilization, differentiation, and homing. Arterioscler Thromb Vasc Biol 2003;23:1185-9. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997;275(5302):964-7. Hill JM, Zalos G, Halcox JP, Schenke WH, Waclawiw MA, Quyyumi AA, et al. Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. N Engl J Med 2003;348:593-600. Werner N, Nickenig G. Influence of cardiovascular risk factors on endothelial progenitor cells: limitations for therapy? Arterioscler Thromb Vasc Biol 2006;26:257-66. Vasa M, Fichtlscherer S, Aicher A, Adler K, Urbich C, Martin H, et al. Number and migratory activity of circulating endothelial progenitor cells inversely correlate with risk factors for coronary artery disease. Circ Res 2001;89:E1-7. Peinado VI, Ramírez J, Roca J, Rodriguez-Roisin R, Barberà JA. Identification of vascular progenitor cells in pulmonary arteries of patients with chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 2006;34:257-63. Weiss DJ. Stem cells and cell therapies for cystic fibrosis and other lung diseases. Pulm Pharmacol Ther 2008;21:588-94.

18. 19. 20. 21.

22.

23. 24. 25.

26.

27. 28.

29.

30.

31. 32.

33.

34. 35.

36.

Khakoo AY, Finkel T. Endothelial progenitor cells. Annu Rev Med 2005;56:79-101. Liew A, Barry F, O’Brien T. Endothelial progenitor cells: diagnostic and therapeutic considerations. Bioessays 2006;28:261-70. Fadini GP, Schiavon M, Rea F, Avogaro A, Agostini C. Depletion of endothelial progenitor cells may link pulmonary fibrosis and pulmonary hypertension. Am J Respir Crit Care Med 2007;176:724-5. Junhui Z, Xingxiang W, Guosheng F, Yunpeng S, Furong Z, Junzhu C. Reduced number and activity of circulating endothelial progenitor cells in patients with idiopathic pulmonary arterial hypertension. Respir Med 2008;102:1073-9. Diller GP, van Eijl S, Okonko DO, Howard LS, Ali O, Thum T, et al. Circulating endothelial progenitor cells in patients with Eisenmenger syndrome and idiopathic pulmonary arterial hypertension. Circulation 2008;117:3020-30. Asosingh K, Aldred MA, Vasanji A, Drazba J, Sharp J, Farver C, et al. Circulating angiogenic precursors in idiopathic pulmonary arterial hypertension. Am J Pathol 2008;172:615-27. Toshner M, Voswinckel R, Southwood M, Al-Lamki R, Howard LS, Marchesan D, et al. Evidence of dysfunction of endothelial progenitors in pulmonary arterial hypertension. Am J Respir Crit Care Med 2009;180:780-7. Smadja DM, Gaussem P, Mauge L, Israël-Biet D, Dignat-George F, Peyrard S, et al. Circulating endothelial cells: A new candidate biomarker of irreversible pulmonary hypertension secondary to congenital heart disease. Circulation 2009;119:374-81. Satoh K, Kagaya Y, Nakano M, Ito Y, Ohta J, Tada H, et al. Important role of endogenous erythropoietin system in recruitment of endothelial progenitor cells in hypoxia-induced pulmonary hypertension in mice. Circulation 2006;113:1442-50. Dimmeler S, Aicher A, Vasa M, Mildner-Rihm C, Adler K, Tiemann M, et al. HMG-CoA reductase inhibitors (statins) increase endothelial progenitor cells via the PI 3-kinase/Akt pathway. J Clin Invest 2001;108:391-7. Wang CH, Ciliberti N, Li SH, Szmitko PE, Weisel RD, Fedak PW, et al. Rosiglitazone facilitates angiogenic progenitor cell differentiation toward endothelial lineage: a new paradigm in glitazone pleiotropy. Circulation 2004;109:1392-400. Yao W, Firth AL, Sacks RS, Ogawa A, Auger WR, Fedullo PF, et al. Identification of putative endothelial progenitor cells (CD34+CD133+Flk-1+) in endarterectomized tissue of patients with chronic thromboembolic pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2009;296:L870-8. Davie NJ, Crossno JT Jr, Frid MG, Hofmeister SE, Reeves JT, Hyde DM, et al. Hypoxia-induced pulmonary artery adventitial remodeling and neovascularization: contribution of progenitor cells. Am J Physiol Lung Cell Mol Physiol 2004;286:L668-78. Hayashida K, Fujita J, Miyake Y, Kawada H, Ando K, Ogawa S, et al. Bone marrow-derived cells contribute to pulmonary vascular remodeling in hypoxia-induced pulmonary hypertension. Chest 2005;127:1793-8. Marsboom G, Pokreisz P, Gheysens O, Vermeersch P, Gillijns H, Pellens M, et al. Sustained endothelial progenitor cell dysfunction after chronic hypoxia-induced pulmonary hypertension. Stem Cells 2008;26: 1017-26. Teichert-Kuliszewska K, Kutryk MJ, Kuliszewski MA, Karoubi G, Courtman DW, Zucco L, et al. Bone morphogenetic protein receptor-2 signaling promotes pulmonary arterial endothelial cell survival: implications for loss-of-function mutations in the pathogenesis of pulmonary hypertension. Circ Res 2006;98:209-17. Wu H, Chen H, Hu PC. Circulating endothelial cells and endothelial progenitors as surrogate biomarkers in vascular dysfunction. Clin Lab 2007;53:285-95. Strijbos MH, Landburg PP, Nur E, Teerlink T, Leebeek FW, Rijneveld AW, et al. CURAMA study group. Circulating endothelial cells: A potential parameter of organ damage in sickle cell anemia? Blood Cells Mol Dis 2009;43:63-7. Zampetaki A, Kirton JP, Xu Q. Vascular repair by endothelial progenitor cells. Cardiovasc Res 2008;78:413-21.

Source of Support: Nil, Conflict of Interest: None declared.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Inhaled epoprostenol therapy for pulmonary hypertension: Improves oxygenation index more consistently in neonates than in older children Anna T. Brown1,2, Jennifer V. Gillespie3, Franscesca Miquel-Verges4, Kathryn Holmes2, William Ravekes2, Philip Spevak2, Ken Brady5,6, R. Blaine Easley5,6, W. Christopher Golden2, LeAnn McNamara3, Michael A. Veltri2,3, Christoph U. Lehmann2, Kristen Nelson McMillan1,2, Jamie M. Schwartz1,2, and Lewis H. Romer1,2 Departments of Anesthesiology and Critical Care Medicine, 2Pediatrics, and 3Pharmacy, Johns Hopkins University School of Medicine, Baltimore, Maryland, 4Pediatrics, University of Arkansas for Medical Sciences/Arkansas Children’s Hospital, Little Rock, Arkansas, 5Anesthesiology and 6Pediatrics, Baylor College of Medicine/Texas Children’s Hospital, Houston, Texas, USA 1

ABSTRACT The purpose of this study was to determine the efficacy of inhaled epoprostenol for treatment of acute pulmonary hypertension (PH) in pediatric patients and to formulate a plan for a prospective, randomized study of pulmonary vasodilator therapy in this population. Inhaled epoprostenol is an effective treatment for pediatric PH. A retrospective chart review was conducted of all pediatric patients who received inhaled epoprostenol at a tertiary care hospital between October 2005 and August 2007. The study population was restricted to all patients under 18 years of age who received inhaled epoprostenol for greater than 1 hour and had available data for oxygenation index (OI) calculation. Arterial blood gas values and ventilator settings were collected immediately prior to epoprostenol initiation, and during epoprostenol therapy (as close to 12 hours after initiation as possible). Echocardiograms were reviewed during two time frames: Within 48 hours prior to therapy initiation and within 96 hours after initiation. Of the 20 patients in the study population, 13 were neonates, and the mean OI for these patients improved during epoprostenol administration (mean OI before and during therapy was 25.6±16.3 and 14.5±13.6, respectively, P=0.02). Mean OI for the seven patients greater than 30 days of age was not significantly different during treatment (mean OI before and during therapy was 29.6±15.0 and 25.6±17.8, P=0.56). Improvement in echocardiographic findings (evidence of decreased right-sided pressures or improved right ventricular function) was demonstrated in 20% of all patients. Inhaled epoprostenol is an effective therapy for the treatment of selected pediatric patients with acute PH. Neonates may benefit more consistently from this therapy than older infants and children. A randomized controlled trial is needed to discern the optimal role for inhaled prostanoids in the treatment of acute PH in childhood. Key Words: child, epoprostenol, neonate, oxygenation index, pulmonary hypertension

INTRODUCTION Pulmonary hypertension (PH) is a complex disease with a heterogeneous group of etiologies in the neonatal and pediatric populations. The most common cause of acute pulmonary vascular crisis in children is persistent PH of the newborn (PPHN)—postpartum persistence of Address correspondence to:

Dr. Anna T. Brown Pediatric Anesthesiology and Critical Care Medicine 600 North Wolfe Street John Hopkins School of Medicine Baltimore, MD 21287-4904, USA Email: anna.brown@jhmi.edu Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

the high pulmonary vascular resistance of fetal life.[1] PPHN may be isolated but also occurs in association with meconium aspiration syndrome (MAS, 50%), pneumonia and/or sepsis (20%), as well as other disease states.[1-3] Congenital diaphragmatic hernia (CDH) is often associated Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94835 How to cite this article: Brown AT, Gillespie JV, Miquel-Verges F, Holmes K, Ravekes W, Spevak P et al. Inhaled epoprostenol therapy for pulmonary hypertension: Improves oxygenation index more consistently in neonates than in older children. Pulm Circ 2012;2:61-6.

Brown et al.: Inhaled epoprostenol

with newborn PH, and these cases are complicated by pulmonary vascular hypoplasia.[4] Etiologies of PH after the first month of life include acute respiratory distress syndrome (ARDS), restrictive lung disease, obstructive sleep apnea-hypopnea, acute and chronic thromboembolic disease and pulmonary venous obstruction. Nonpulmonary causes include left-to-right intracardiac shunts, left heart disease, idiopathic PH (both sporadic and familial) and portal hypertension. Early treatment of PH regardless of etiology is crucial because advanced disease may be less responsive to therapy.[5]

Prostacyclin (PGI2) is an arachidonic acid metabolite formed by prostacyclin synthase in the vascular endothelium. PGI2 acts as a potent systemic and pulmonary vasodilator through induction of adenyl cyclase and increased formation of cAMP. [6] Intravenous PGI 2 (epoprostenol sodium) is administered as a continuous infusion, both decreasing pulmonary artery pressures (PAP) and improving oxygenation in PPHN. [7] In addition, it has been used in pediatric patients with primary pulmonary arterial hypertension (PAH)[8] and PH acquired as a result of congenital heart disease.[9] Aerosolized or inhalational administration of epoprostenol offers the potential for more selective pulmonary vasodilatation with minimal impact on systemic systolic blood pressure (SBP).[10] In addition, ventilation/perfusion (V/Q) matching could be improved since lung units with the best ventilation will have more medication exposure. Use of inhaled epoprostenol for PPHN has been reported to improve oxygenation and decrease PAP by Doppler echocardiography without effects on SBP.[11,12] Improvements in oxygenation have also been demonstrated in a randomized trial of inhaled epoprostenol in children with acute lung injury (ALI).[13] In our study, we retrospectively reviewed the effects of inhaled epoprostenol on oxygenation index (OI) in neonates and children who received inhaled epoprostenol for PH due to various etiologies in the pediatric and neonatal intensive care units of a tertiary care hospital.

MATERIALS AND METHODS Study population

Following approval by the institutional review board, a retrospective chart review was conducted for all pediatric patients who received inhaled epoprostenol between October 2005 and August 2007. Potential study patients were identified as those having an order for epoprostenol in a computer-generated report from the pharmacy management system, GE Centricity. The study population was restricted to those patients under 18 years of age who received inhaled epoprostenol for at least 1 hour, and had data available for analysis of the OI before and 62

during treatment. Patient information was deidentified and subjects were assigned arbitrary sequential study-related numbers.

Delivery of inhaled epoprostenol

All patients received inhaled epoprostenol via a MiniHeart Lo-Flo nebulizer (model number 100611, Westmed, Tucson, Ariz.). The nebulizer was connected to either the inspiratory limb of the ventilator circuit or to the BiPAP circuit for noninvasive ventilation, at a point as close as possible to the endotracheal tube or mask. The intravenous formulation of epoprostenol (Flolan) was reconstituted with sterile diluent supplied by the manufacturer, GlaxoSmithKline, and nebulized. The reconstituted solution of epoprostenol has a pH of 10.2–10.8 as the diluent contains glycine, sodium chloride, sodium hydroxide and water for injection. The epoprostenol was diluted for continuous nebulization at a rate of 8 ml/hr, and a dose of 50 ng/kg/min, or intermittently as 50 ng/kg diluted in 3 ml of diluent.

Outcome measures

There were two primary outcome measures: (1) proportion of patients with improved OI (defined as a 10-point or 20% decrease from baseline); and (2) proportion of patients whose echocardiographic data depicted improved PAP and/or right heart mechanics. There were six secondary outcome variables: (1) need for extracorporeal membrane oxygenation (ECMO); (2) deterioration of renal function; (3) deterioration of liver function; (4) sustained and significant drop in SBP; (5) worsening respiratory failure; and (6) death. For subgroup analyses of outcome measures, patients were subdivided a priori by age group (≤30 days vs. >30 days) and primary diagnosis.

Data collection

For each patient identified, the following data were collected manually from the electronic medical records (Eclipsys Sunrise Critical Care and the institutional Electronic Patient Record): Age and weight; admitting diagnosis; dose and duration of epoprostenol; and concurrent administration of other therapies for PH. Arterial blood gas values and ventilator settings were collected at two time points: The time prior and closest to epoprostenol initiation; and the latest available time point during the continued administration of epoprostenol up to 12 hours after initiation. Laboratory data including blood urea nitrogen, creatinine, AST, ALT, and bilirubin were collected during these time windows and following epoprostenol discontinuation. Echocardiograms were reviewed during two separate time frames for each patient. The first window was within 48 hours prior to therapy initiation; the second window was within 96 hours after initiation. All echocardiograms were deidentified and reviewed by three blinded pediatric Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Brown et al.: Inhaled epoprostenol

cardiologists. Echocardiographic data collected included the presence or absence of structural abnormalities and estimation of PAP and right ventricular (RV) function. Ten percent of echocardiograms were randomly selected for independent review by all three blinded cardiologists. Inter-rater reliability was analyzed for categorization of the parameters of RV function, RV dilation, and septal position.

Statistical analysis

Proportions were calculated for all outcome measures. Student’s t-test for paired, parametric data (or Wilcoxon’s nonparametric test) was used to compare pre- and postOI continuous data. Chi-square or Fisher’s exact was used to evaluate categorical variables. The null hypothesis was rejected with a=0.05, and P<0.05 was considered significant. Inter-rater reliability data were calculated for echocardiogram analysis. Data were presented as mean±SD for normally distributed data and median±interquartile range for non-normally distributed data.

RESULTS

Patient population

Twenty patients under the age of 18 years were identified that had received inhaled epoprostenol for greater than 1 hour and had OI data available for analysis, between October 2005 to August 2007.

Patient demographics, diagnoses, and outcomes are shown in (Table 1). The majority of patients (65%) were 30 days of age or less, and the most common admission diagnosis for this age group was MAS and/or PPHN (85%). The median age for all patients was 12 days (range 0 days to 15 years). All patients were treated with other pulmonary vasodilators concomitantly with the inhaled epoprostenol. All 20 patients received inhaled nitric oxide and intravenous Table 1: Baseline patient characteristics

Number of subjects (%) Median age (IQR, days) Mean age (days) Male gender (%) Median weight (IQR, kg) Mean weight (kg) Admission diagnosis (%) MAS and/or PPHN Cardiac CDH ARDS Mean OI

All subjects

≤30 days of age

>30 days of age

20 (100)

13 (65)

7 (35)

12.5 (4 to 165) 12 (60) 3.7 (3.2 to 4.4)

11(55) 5 (25) 1 (5) 3 (15) 26.4±15.7

milrinone, and 16 of the 20 patients received enteral sildenafil.

The first patient to receive inhaled epoprostenol received intermittent nebulizations every 2 hours of 50 ng/kg. All subsequent patients in this series received continuous nebulization at a dose of 50 ng/kg/min. Patients received inhaled epoprostenol for an average of 7 hours and 14 minutes (range 3 hours to 630 hours.).

Oxygenation index

The mean OI prior to treatment for all 20 patients was 26.4±15.8 and the mean OI during treatment was significantly decreased to 18.6±16.1 (P=0.04). Of the patients, 13 were neonates and 7 were not. The mean OI prior to initiation of epoprostenol for patients less than 30 days of age was 25.6±16.3 and the mean OI during epoprostenol was 14.5±13.6, which represents a statistically significant decrease (P=0.02). The mean OI prior to treatment for patients greater than 30 days of age was not significantly different during and before epoprostenol administration (29.6±15.0 vs. 25.6±17.8, P=0.56 ; Fig. 1).

Echocardiographic data

Twelve patients had interpretable echocardiography data before and during therapy with epoprostenol. Four had improvement in either estimations of RV function or PAP on echocardiogram while on epoprostenol. Two had insufficient data for analysis, and 7 had no change. One patient had worsening RV function on echocardiography after epoprostenol initiation. Six patients were excluded from echocardiographic data review as they were on ECMO during echocardiography and outcome measures specific to epoprostenol could not be accurately evaluated. Twenty percent (4 of 20) had echocardiographic signs of improvement in RV function or decreases in PAP. Inter-

459 (205 to 968) 7.2±6.5 9 (69)

3 (43)

3.5±0.6

14.3±21.3

11 (85) 1 (8) 1 (8)

4 (57)

25.6±16.3

3 (43) 29.6±15.0

Values are mean±S.D. except where indicated otherwise. IQR: Interquartile range; Oxygenation Index (OI) = (FiO2 *Mean Airway Pressure *100)/PaO2

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 1: Response to inhaled epoprostenol therapy for patients by age group (less than 30 days of age vs. greater than 30 days of age). Mean oxygenation indices with standard error prior to therapy and during therapy are shown. 63

Brown et al.: Inhaled epoprostenol

rater reliability for individual indices was as follows: RV function, 97% agreement (90% CI: 0.890-0.995); RV dilation, 90% agreement (90% CI: 0.627-0.984); and septal position, 94% agreement (90% CI: 0.764-0.990). There was 95% agreement (90% CI: 0.905, 0.980) for analysis of echocardiographic data for all examined indices.

Subgroup analysis by diagnosis

There were five patients with congenital and/or acquired cardiac lesions. Three demonstrated improvement in OI with epoprostenol, two had no significant change in OI, and one had insufficient data with which to calculate the OI. For the five patients with data, the mean pretreatment OI was 23.8±20.3 compared to mean post-treatment OI of 18.2±15.3, which was not a significant change (P=0.18). Only one patient in the cardiac subgroup showed demonstrable improvement in RV function or PAP on echocardiography. Two patients had insufficient data for analysis. There was no difference in mean pretreatment OI (31.3±6.6) and mean post-treatment OI (31.7 ± 21.5) for the three patients with ARDS (P=0.98). Echocardiographic data were available for analysis for two of the patients with ARDS: One showed no change and one showed worsening RV function. The largest subgroup by diagnosis was the MAS/PPHN group. Mean OI during treatment (14.8 ± 14.6) was significantly improved when compared with mean OI prior to treatment (27.5 ± 16.5) for the 11 patients in this group (P=0.03). Two of the patients with MAS/PPHN had echocardiographic improvement, 4 had no change, and 5 were on ECMO and had echocardiograms that were not interpretable. (Fig. 2) shows the OI data by diagnostic subgroup.

ECMO data

Six patients (30%) in the study group were placed on venoarterial ECMO during therapy with epoprostenol. Four of these patients received epoprostenol therapy prior to ECMO initiation. Three patients had improvement in OI, but were placed on ECMO based on other criteria. One patient had worsening of OI during administration of epoprostenol and was placed on ECMO. Two patients were started on inhaled epoprostenol while on ECMO. Both were subsequently weaned from ECMO and decannulated. As the patients were on ECMO, OI data could not be accurately determined.

Echocardiographic data for these two patients showed no change in RV function or PAP. However, medical records for both patients indicate that subjective improvement in RV function was noted during clamp trials following epopostenol initiation.

Potential side effects of therapy and mortality data

Six of 20 patients experienced at least one studied side effect during inhaled epoprostenol therapy. Five patients who experienced side effects were neonates. The most common side effect both during and after treatment with inhaled epoprostenol was a drop in SBP requiring fluid boluses or circulotropic drugs. The most common respiratory problem requiring brief interruption of therapy was transient difficulty with the nebulizer-ventilator interface—most commonly causing inconsistent mean airway pressure during high-frequency oscillatory ventilation. No patients experienced continued respiratory compromise after treatment cessation. No changes in renal function were documented. A neonate with undiagnosed total anomalous pulmonary venous return (TAPVR) experienced a decrease in SBP, worsening respiratory failure, and elevation of liver enzymes, but all of these resolved with surgical repair (and cessation of therapy). There were four patient deaths, none of which were directly attributable to epoprostenol.

DISCUSSION

Figure 2: Response to inhaled epoprostenol therapy for patients by diagnosis. Mean oxygenation indices with standard error prior to therapy and during therapy are shown for each diagnosis. 64

In this retrospective analysis of 20 patients who received inhaled epoprostenol, we found a significant decrease in OI from 26.4±15.8 to 18.6±16.1 (P=0.04). Echocardiographic improvement in PA pressures or RV function was seen in 29% of patients who were not on ECMO. The majority of our patients were neonates with PPHN, and in subgroup analysis by age and diagnosis, significant improvement in OI was only noted in the neonatal group, and those with MAS/ PPHN. ECMO was used for five neonates with MAS/PPHN in our series (45% of patients with this diagnosis)—a higher than expected rate of ECMO therapy for these diagnoses. This may be due to the fact that the majority of neonates in this study were referred to the PICU for consideration for Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Brown et al.: Inhaled epoprostenol

ECMO therapy, so that our neonatal population may be more severely ill than average neonates with MAS/PPHN. We did not observe significant change in OI in patients greater than 30 days of age, infants and children with congenital or acquired heart disease or in children with ALI/ARDS (although we recognize that OI is not the best indicator of response to therapy in all of these patients).

Developmental and clinical factors could explain enhanced responsiveness to inhaled epoprostenol in the neonatal group with MAS/PPHN. A late gestation nadir in the expression and function of vasoactive compounds derived from the pulmonary endothelium may lead to discrete dysfunction of the pulmonary microcirculation. [14-17] Additionally, neonates with acute pulmonary endothelial injury may not mount the normal perinatal increase in endothelial nitric oxide synthase (eNOS) expression. [16] Further, diminished cGMP activity may occur due to both decreased expression of the paracrine eNOS-inducing agent VEGF, and by prenatally increased levels of phosphodiesterases 3 and 5.[14] A hypoxemic or acidemic perinatal event can then trigger a cascade of events and PPHN. [18] The principal dysfunction in this syndrome involves vasoactive pathways in the pulmonary circulation, and this may make these neonates ideal targets for direct pulmonary delivery of vasodilator therapy.

This study provides further evidence that inhaled prostanoids have a good safety profile in neonates, infants, and children, and adds momentum toward what is now needed most: A multi-institutional, randomized, controlled trial of inhaled prostanoids in children with acute PH in the ICU setting.[19,20] Three lessons gleaned from the experience of this study and the current literature will improve the design and impact of this future study. The first is early initiation of therapy. The initiation of therapy before all other options were exhausted led to the engagement of both cAMP and cGMP pathways to enhance pulmonary arteriolar smooth muscle relaxation, and both timing and strategic pharmacology may explain the efficacy of inhaled epoprostenol for those neonates that responded in the experience reported here. Inhaled epoprostenol needs to be started soon after the inadequacy of nitric oxide therapy for PH is suspected in order to decrease the need for ECMO and the risk of death. This underlines a second priority— early diagnosis. Careful protocols for echocardiography and more persistence in pursuit of adequate windows by trans-thoracic or trans-esophageal study may be needed. Consistent focus on right ventricular systolic and diastolic performance using the Tei index, tricuspid valve tissue annular excursion or volumetric three-dimensional analysis may also help to build consensus on a consistent diagnostic approach for PH in these patients.[21-23] Finally, the availability and efficacy of prostanoids specifically formulated for inhalation therapy may improve the Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

consistency, reliability and safety of drug delivery, and further supports the need and feasibility of studying these agents in critically ill patients.[18,20,24,25] We hope that the present study and others like it will prompt a collaborative effort in pediatric critical care medicine and neonatology that will answer important questions about therapy for acute PH, providing a response to the urgent need for effective therapies for neonates, infants and children with this severe critical illness.[18]

In conclusion, inhaled epoprostenol may be an effective therapy for the treatment of PH and RV failure in selected subsets of the pediatric population. Our data indicate that neonates with PPHN with or without MAS showed significant improvement in oxygenation with this therapy, and this population therefore warrants priority consideration for further trials. Further study is needed that incorporates prospective, randomized and multiinstitutional design, as well as consideration of whether this therapy best serves the target population as an early intervention option or as a rescue therapy.

ACKNOWLEDGMENTS

The authors thank the Department of Anesthesiology and Critical Care Medicine for support for this study, Elizabeth White for her invaluable assistance during the IRB approval process, Dave Ani for deidentification of the echocardiographic data to facilitate evaluation by the cardiologists, and Tzvi Ursuy for his work on the database.

REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.

Walsh-Sukys MC, Tyson JE, Wright LL, Bauer CR, Korones SB, Stevenson DK, et al. Persistent pulmonary hypertension of the newborn in the era before nitric oxide: Practice variation and outcomes. Pediatrics 2000;105:14-20. Inhaled nitric oxide in full-term and nearly full-term infants with hypoxic respiratory failure. The Neonatal Inhaled Nitric Oxide Study Group. N Engl J Med 1997;336:597-604. Gailloud P, O’Riordan DP, Burger I, Levrier O, Jallo G, Tamargo RJ, et al. Diagnosis and management of vein of galen aneurysmal malformations. J Perinatol 2005;25:542-51. Bohn D. Congenital diaphragmatic hernia. Am J Respir Crit Care Med 2002;166:911-5. Barst RJ, McGoon M, Torbicki A, Sitbon O, Krowka MJ, Olschewski H, et al. Diagnosis and differential assessment of pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:40S-7S. Vane JR, Botting RM. Pharmacodynamic profile of prostacyclin. Am J Cardiol 1995;75:3A-10A. Eronen M, Pohjavuori M, Andersson S, Pesonen E, Raivio KO. Prostacyclin treatment for persistent pulmonary hypertension of the newborn. Pediatr Cardiol 1997;18:3-7. Yung D, Widlitz AC, Rosenzweig EB, Kerstein D, Maislin G, Barst RJ. Outcomes in children with idiopathic pulmonary arterial hypertension. Circulation 2004;110:660-5. Rosenzweig EB, Barst RJ. Pulmonary arterial hypertension in children: A medical update. Curr Opin Pediatr 2008;20:288-93. Santak B, Schreiber M, Kuen P, Lang D, Radermacher P. Prostacyclin aerosol in an infant with pulmonary hypertension. Eur J Pediatr 1995;154:233-5. Bindl L, Fahnenstich H, Peukert U. Aerosolised prostacyclin for pulmonary hypertension in neonates. Arch Dis Child Fetal Neonatal Ed 1994;71:F214-6.

Brown et al.: Inhaled epoprostenol

12. 13. 14. 15. 16. 17. 18. 19. 20.

Kelly LK, Porta NF, Goodman DM, Carroll CL, Steinhorn RH. Inhaled prostacyclin for term infants with persistent pulmonary hypertension refractory to inhaled nitric oxide. J Pediatr 2002;141:830-2. Dahlem P, van Aalderen WM, de Neef M, Dijkgraaf MG, Bos AP. Randomized controlled trial of aerosolized prostacyclin therapy in children with acute lung injury. Crit Care Med 2004;32:1055-60. Abman SH. Recent advances in the pathogenesis and treatment of persistent pulmonary hypertension of the newborn. Neonatology 2007;91:283-90. Levy M, Maurey C, Dinh-Xuan AT, Vouhe P, Israel-Biet D. Developmental expression of vasoactive and growth factors in human lung. Role in pulmonary vascular resistance adaptation at birth. Pediatr Res 2005;57:21R-5R. Porta N, Steinhorn R. Inhaled NO in the experimental setting. Early Human Development 2008;84:717-23. Wojciak-Stothard B, Haworth S. Perinatal changes in pulmonary vascular endothelial function. Pharmacol Ther 2006;109:78-91. Rao S, Bartle D, Patole S. Current and future therapeutic options for persistent pulmonary hypertension in the newborn. Expert Rev Cardiovasc Ther 2010;8:845-62. Ivy DD. Prostacyclin in the intensive care setting. Pediatric Critical Care Medicine 2010;11:S41-5. Tissot C, Beghetti M. Review of inhaled iloprost for the control of pulmonary artery hypertension in children. Vasc Health Risk Manag 2009;5:325-31.

21. 22.

23.

24.

25.

Grignola JC, Gines F, Guzzo D. Comparison of the Tei index with invasive measurements of right ventricular function. Int J Cardiol 2006;113:25-33. Mullen MP. Diagnostic strategies for acute presentation of pulmonary hypertension in children: Particular focus on use of echocardiography, cardiac catheterization, magnetic resonance imaging, chest computed tomography, and lung biopsy. Pediatric Critical Care Medicine 2010; 11: S23-6. Sugiura T, Suzuki S, Hussein MH, Kato T, Togari H. Usefulness of a new Doppler index for assessing both ventricular functions and pulmonary circulation in newborn piglet with hypoxic pulmonary hypertension. Pediatr Res 2003;53:927-32. Winterhalter M, Simon A, Fischer S, Rahe-Meyer N, Chamtzidou N, Hecker H, et al. Comparison of inhaled iloprost and nitric oxide in patients with pulmonary hypertension during weaning from cardiopulmonary bypass in cardiac surgery: A prospective randomized trial. J Cardiothorac Vasc Anesth 2008;22:406-13. Rex S, Busch T, Vettelschoss M, de Rossi L, Rossaint R, Buhre W. Intraoperative management of severe pulmonary hypertension during cardiac surgery with inhaled iloprost. Anesthesiology 2003;99:745-7.

Source of Support: Nil, Conflict of Interest: None declared.

Author Help: Reference checking facility The manuscript system (www.journalonweb.com) allows the authors to check and verify the accuracy and style of references. The tool checks the references with PubMed as per a predefined style. Authors are encouraged to use this facility, before submitting articles to the journal. • The style as well as bibliographic elements should be 100% accurate, to help get the references verified from the system. Even a single spelling error or addition of issue number/month of publication will lead to an error when verifying the reference. • Example of a correct style Sheahan P, O’leary G, Lee G, Fitzgibbon J. Cystic cervical metastases: Incidence and diagnosis using fine needle aspiration biopsy. Otolaryngol Head Neck Surg 2002;127:294-8. • Only the references from journals indexed in PubMed will be checked. • Enter each reference in new line, without a serial number. • Add up to a maximum of 15 references at a time. • If the reference is correct for its bibliographic elements and punctuations, it will be shown as CORRECT and a link to the correct article in PubMed will be given. • If any of the bibliographic elements are missing, incorrect or extra (such as issue number), it will be shown as INCORRECT and link to possible articles in PubMed will be given.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Estimation of endothelin-mediated vasoconstriction in acute pulmonary thromboembolism John Y. C. Tsang1 and Wayne J. E. Lamm2 James Hogg Research Laboratory and Department of Medicine, University of British Columbia, Vancouver, British Columbia, Canada, 2 Department of Medicine, Division of Pulmonary and Critical Care Medicine, University of Washington, Seattle, Washington, USA

ABSTRACT We aimed to investigate the role of endothelin-mediated vasoconstriction following acute pulmonary thromboembolism (APTE). Thirteen anesthetized piglets (~25 kg) were ventilated with 0 PEEP. Cardiac output (Qt) and wedge pressure (Pw) were measured by a Swan Ganz catheter, along with arterial and venous blood gases. APTE was induced by autologous blood clots (~0.8 g/kg, 12–16 pieces) via a jugular venous catheter at time = 0 minutes until the mean pulmonary arterial pressure (Ppa) was about 2.5 times the baseline at 30 minutes. Eight control animals (Group 1) received only normal saline afterward, while the remaining five (Group 2) received at time = 40-minute saline plus Tezosentan, a nonspecific endothelin antagonist. The drug was initially given as an intravenous bolus (10 mg/kg), followed by an infusion (2 mg/min) until the end of the experiment at 2 hours. Hemodynamic data were measured before APTE and then at 30-minute intervals. Pulmonary vascular resistance index (PVRI) was calculated as (Ppa-Pw)/CI, where CI was cardiac index or Qt/W (body weight). Fluorescent microspheres (FMS) were used to mark regional blood flows and ventilation for cluster analysis. PVRI acutely increased within minutes and remained high despite some recovery over time. With Tezosentan treatment, the results showed that endothelin-mediated vasoconstriction persisted significantly up to 2 hours and accounted for about 25% of the increase in PVRI while clot obstruction accounted for the remaining 75%. CI remained relatively constant throughout. Tezosentan also affected PVRI indirectly by mitigating the shift of regional blood flow back to the embolized areas over time, possibly by attenuating vasoconstriction in the nonembolized areas. We conclude that following APTE, although the increased PVRI is mostly due to mechanical embolic obstruction, secondary factors such as vasoconstriction and pattern of regional blood flow over time also play important roles. Key Words: endothelin antagonist, pulmonary embolism, pulmonary vascular resistance, pulmonary vasoconstriction, smooth muscle contraction

INTRODUCTION Following acute pulmonary thromboembolism (APTE), the increase in pulmonary vasculature resistance (PVR) arises not only from vascular obstruction but also from vasoconstriction. However, there are still some controversial opinions with regard to the importance of the latter mechanism.[1,2] Some suggested that vasoconstriction existed but soon became insignificant afterward,[3,4] while others showed that its magnitude depended on the embolic size, with Address correspondence to:

Dr. John Y. C. Tsang James Hogg Research Lab. 1081 Burrard Street Vancouver B. C. Canada V6Z 1Y6 Email: jtsang@mail.ubc.ca Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

the smaller ones causing more vasoconstriction than the larger ones. [5] In a standardized, angiographic obstruction model using embolic beads, some investigators concluded that there was no significant component of vascular tone.[1] Thus, it remained unclear whether these disagreements could be accounted for by the differences in their experimental preparations, animal species, sizes of embolic materials, timing of hemodynamic measurements or even interpretation of data. Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94836 How to cite this article: Tsang JY, Lamm WJ. Estimation of endothelin-mediated vasoconstriction in acute pulmonary thromboembolism. Pulm Circ 2012;2:67-74.

Tsang and Lamm: Vasoconstriction in acute embolism

In order to resolve these issues, we aimed to use a novel approach to study the impact of pulmonary vasoconstriction after APTE by examining regional blood flow after APTE using fluorescent microspheres (FMS) instead of MIGET or pressure flow plots. Specifically, the degree of vasoconstriction mediated by endothelins after APTE was studied, focusing on the first 2 hours when the mortality among these patients was the highest.[6] This pathway was chosen because endothelins, which were found omnipresent in the lung along with their ubiquitous receptors, have been considered to be one of the key mediators in the pathogenesis.[7,8] Lee et al. reported that endothelin-1 was expressed locally in the embolized lung at the tissue level and its antagonist mitigated the subsequent pulmonary hypertension.[9] Similarly, others have confirmed its role in pulmonary air embolism.[10] It has also been established that they play important parts in many other pulmonary vascular diseases, such as primary or secondary pulmonary hypertension[11] as well as different forms of acute lung injury.[12] Finally, Bosentan, an oral endothelin antagonist, has been used successfully for some time for patients with chronic thromboembolic pulmonary hypertension,[13] implying that this same vasoconstrictor is likely to be also relevant in the acute phase. We hypothesize that endothelin-mediated vasoconstriction persists to a significant degree after APTE in the first 2 hours and that it affects the redistribution of regional blood flow, which could also impact pulmonary hemodynamics. The data will then serve to quantify its relative importance.

MATERIALS AND METHODS

Surgical preparations and physiological measurements The experimental protocol was approved by the University of Washington Animal Care and Use Committee. Thirteen piglets (25±5 kg) were premedicated with ketamine 20 mg/ kg i.m. and xylazine 2 mg/kg i.m. They were then maintained under a general anesthetic using intravenous pentothal, initially set at 100 mg/h and the dose occasionally titrated afterward.

One femoral arterial line was inserted for the purpose of monitoring systemic blood pressure (BP) and blood gases. Two femoral venous lines allowed for fluid infusion and fluorescent microspheres (FMS) injection. A Swan Ganz catheter (Edwards Lab, CA) was inserted in the right external jugular vein for measuring pulmonary arterial pressure (Ppa), pulmonary capillary wedge pressure (Pw), and cardiac ouput (Qt) by thermodilution technique. A large bore catheter (5 mm internal diameter) was inserted in the left external jugular vein for the rapid infusion of preformed blood clots (see below). No heparin was used. 68

Eighty ml of blood were withdrawn from the femoral arterial line and mixed with 2500 units of Thrombin - JMI at room temperature. Clots were allowed to form and fibrinize over the next 2 hours.

Upon completion of the surgical procedures, animals were placed in the prone posture and received at least three consecutive stacked breaths to peak airway pressures (Paw) ~25 cmH2O to remove residual atelectasis. Their ventilatory settings were adjusted to maintain PaCO2 at 35±2 Torr, PEEP at 0, tidal volume (TV) at 12-15 ml/kg, respiratory rate (RR) at 18–20/min and FIO2 at 21% or room air at sea level. No further adjustments of these settings occurred afterward. At each of the subsequent data collection times, hemodynamic parameters such as BP, Ppa, Pw, heart rate, and Qt were measured, along with hemoglobin (Hb), arterial and venous blood gases, Fowler dead space (MacLab at 100 mm/s), TV, RR, and Paw. Each measurement of Qt was the mean of at least three consistent readings at the same experimental setting.

FMS of 10 different colors and 2 different sizes (Molecular Probes, Eugene, OR) were used to mark both regional blood flow (15 μm) and regional lung ventilation (1 μm), respectively, in random order at five time points, beginning at t = − 30 minutes. The details of the FMS techniques were as previously described.[14] After control runs at −30 and −5 minutes and all physiological measurements had been recorded, APTE was induced for all 13 animals at time = 0 minutes. All other previous and subsequent events would be recorded relative to that time. Preformed fibrinized clots, 12–16 pieces (1.5×0.5×0.5 cm3), were cut into uniform size[5,15], suspended in normal saline in a large catheter tip syringe, and injected into the left external jugular vein over the next 10–15 minutes until Ppa was stabilized at about 2.5 times the baseline value at 30 minutes. Immediately after initial clot infusion, Ppa often reached over 40 mm Hg temporarily. At t = 30 minutes after achieving a stable Ppa, we repeated physiological measurements, blood sampling, and FMS mapping as in the control runs.

After time = 30 minutes, the animals were randomly divided into two groups. In group 1 (control, n=8) the animals continued to receive only normal saline at 100 ml/h for the remainder of 2 hours. In group 2 (n=5), the animals received similar volumes of normal saline but also Tezosentan, a nonspecific endothelin antagonist[16] (Courtesy Actelion Ltd., Switzerland) at t=40 minutes, initially as an intravenous bolus of 10 mg/kg over 20 minutes, followed by 2 mg/min infusion until t=120 minutes. This approach was preferred because it would allow us to establish a steady level of Tezosentan prior to the Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Tsang and Lamm: Vasoconstriction in acute embolism

hemodynamic measurements in our interested time frame (i.e., between 60 and 120 minutes). On the other hand, pretreatment of Tezosentan before APTE would not allow standardization of similar embolic load in both groups to the same Ppa end point, about 2.5 times the baseline. The size of the emboli was quite uniform, rarely exceeding 50% from each other. At t=60, 90 and 120 minutes, we repeated all the measurements done at t=30 minutes except that FMS mappings were omitted at t=90 minutes. There were no data for 90 minutes because the maximum number of FMS available for the same experiment was reached at 10. Any additional color would compromise the accuracy of spectrum analysis.[17] No other vasoactive substance was administered.

Post mortem lung preparation

After t=120 minutes, the animals from both groups were treated identically. They were all deeply anesthetized with intravenous pentothal, heparinized with 5000 units and exsanguinated. The lungs were removed after a gentle saline vascular flush, suspended vertically and inflated to no more than 25 cm H2O. The lobes were kept in their in vivo anatomical positions by a few spot adhesions using cyanoacrylate glue. Lungs were then dried for 72 hours by blowing warm, dry air at Paw ~20 cmH2O into the trachea, exiting via 10–20 small puncture holes.

Dried lungs were sectioned into cubes (~2 cm3), with each sample carefully assigned to a three-dimensional (3D) coordinate according to a pre-established grid pattern. The injected thromboemboli, readily seen in the major pulmonary arteries, had not been macerated. Approximately 1000 pieces were analyzed per animal (see the “Results” section). For each piece, we recorded its spatial location, dry weight, estimated airway tissue, and the presence or absence of blood clots in arteries >1 mm.

The fluorescent intensities of FMS, which were used to mark both the regional blood flow and ventilation, were each measured at five time points (−30, −5, 30, 60, and 120 minutes) as previously described.[14] Briefly, the FMS were mixed with saline and either injected via the femoral vein to mark regional blood flow, or nebulized into the lung to mark regional ventilation. The FMS signal per piece, reflecting the number of trapped microspheres, was determined by measuring its intensity in a spectrofluorometer (PerkinElmer LS-50B), following elution after 4 days of soaking in 2 ml of organic solvent (Cellosolve, Sigma-Aldrich, Mo.). Overlaps from adjacent colors were then corrected using a matrix inversion method.[17]

Data analysis

For both groups, hemodynamic and gas exchange parameters before and after APTE were recorded (i.e., Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ppa, Pw, Qt, PaO2, PVO2, and PaCO2). Averages of Qt prior to APTE at –30 and –5 minutes were plotted against the corresponding body weight (W) in kg for the 13 animals to establish a linear correlation. Once confirmed, each Qt was then normalized by W of the same animal to derive cardiac indices or CI=Qt/W. W was also used to normalize PVR to the pulmonary vascular resistance index [18] (PVRI) and calculated as (Ppa − Pw)/CI. We quantified pulmonary vasoconstriction after APTE from the differences in PVRI between the two groups at 60, 90 and 120 minutes. This consideration was intended to reduce the confounding effects of the variations in Qt with body size among animals and also to provide a better estimate of the vasoactive component of vascular resistance.

Cluster analysis

Hemodynamically, Ppa at 30 minutes was standardized to about 2.5 times the pre-APTE value. Furthermore, in order to ensure that the two groups were comparable after APTE, we checked the patterns of embolic obstruction beforeTezosentan by cluster analysis. These measured regional flows in all the samples, approximately 1000 of them, were then separated into three clusters a priori, according to how they changed between -5 minutes and +30 minutes (i.e., immediately before and after APTE). After their grouping, each cluster would act as cohort and be followed in the remainder of the experiment to see their physiological behavior over time.

Weight normalized relative flow (WNRQ) was the parameter used for defining the characteristics of these 3 clusters. It was calculated in the following steps: 1. After obtaining each regional blood flow from the FMS intensity of a specific color and Qt at a given time, the flow value (Qi, ml/min) of each piece was first normalized for its size, by dividing Qi by the weight of that piece (wi). These weight normalized piece flow (WNQi) values or Qi / wi , were then normalized a second time by dividing it by the mean of WNQi values for all pieces at that corresponding time, i.e.,.

(WNQ )i =

1 n (WNQ )i n ∫i =1

2. This resulted in a weight normalized relative flow, namely WNRQi=WNQi / ( WNQ )i or WNRQi %=100*

WNQi /( WNQ )i, where the mean WNRQi or ( WNQ )i was represented as either 1 or 100% respectively. WNRQi could now be fairly compared within and between clusters, despite some minor variations in Qt, at different conditions and times.

Subsequently, in order to identify how different areas of the lung were affected by blood clots in terms of regional 69

Tsang and Lamm: Vasoconstriction in acute embolism

blood flows, we proceeded to portion the lung pieces into three clusters according to the change in WNRQi from the baseline condition prior to APTE (t=−5 minutes) to the first measurement after APTE (t=30 minutes) in the following manner: Cluster 1 included lung pieces that had an absolute decrease of 50% or more in WNRQi from time = −5 minutes to +30 minutes after APTE; cluster 2 included lung pieces in which WNRQi was relatively unchanged; cluster 3 included lung pieces that had an absolute increase of 50% or more in WNRQi from time = −5 minutes to 30 minutes after APTE. It was important to note that these clusters were created prior to the initiation of Tezosentan at time = 40 minutes. The absolute increase or decrease of 50% in WNRQi was chosen because this would clearly differentiate the three cluster patterns, particularly when WNRQi of most samples was about 1 before embolization. From our current and previous studies, these subpopulations represented anatomically those regions distal to the emboli (Cluster 1), those in the central regions (Cluster 2) and those in the least embolized and more cephalad regions (Cluster 3).[19]

Weight normalized relative ventilations (WNRV)i were similarly obtained from the aerosolized microspheres (1 μm) data, using the same clusters which were already defined according to WNRQ, at all the designated times.

Statistics

PVRI was considered as the primary variable and all other hemodynamic parameters as secondary ones. Paired

and 2-sample t-tests were performed to compare PVRI within groups at different times and between groups at the same times. These tests were then similarly done for other physiological variables but Bonferroni adjustment of P values was not performed for the secondary variables. CI was compared between groups at the same time point to see if there was statistical difference. Repeated measure ANOVA was performed to assess any difference in the same group over time. Two- and 1-sample Hotelling T2 tests were used to compare the distribution of regional blood flow and regional ventilation in the three clusters, in the same time between groups and in the same group across time respectively. All data were expressed as mean±standard deviation unless indicated otherwise. P<0.05 was used to designate statistical significance.

RESULTS

Table 1 shows the hemodynamic parameters over time. During early APTE, Ppa increased quickly and reached a plateau at around 40 Torr despite some early dissipation between clot injections. It gradually stabilized prior to 30 minutes and over time it recovered gradually toward baseline. Pw itself was relatively constant at 5±2 Torr for all the animals as they were regularly hydrated during the experiments. Systemic blood pressure (BP) dropped after the initiation of Tezosentan, which was given in Group 2 at 40 minutes to abolish any endothelin-mediated pulmonary vasoconstriction after APTE but its systemic effect was also seen. Sufficient dose was given.

Table 1: The hemodynamic parameters during the experiment Group Ppa Group 1 Group 2 Pw Group 1 Group 2 BP Group 1 Group 2 CI (l/min*kg) Group 1 Group 2 Total PVRI Group 1 Group 2 ∆ PVRI after APTE Group 1 (R1) ∆ PVRI after APTE Group 2 (R2) % ∆ PVRI due to vasoconstriction = 100*(R1-R2)/R1

−30 minutes

−5 minutes

30 minutes

60 minutes

90 minutes

120 minutes

17±4 15±2

17±4 16±2

40±2* 39±6*

34±3+ 28±4+

32±3 27±4^

31±3 26±2^

5±2 4±2

4±1 4±2

8±3* 6±2*

5±2 5±2

5±2 5±1

94±6 96±7

96±5 99±7

105±13* 104±14*

104±14 80±8^

101±14 75±8^

96±5 73±10^

0.120±0.013 0.107±0.011

0.117±0.010 0.095±0.013

0.114±0.011 0.105±0.007

0.108±0.013 0.103±0.008

0.104±0.012 0.097±0.006

0.101±0.018 0.097±0.005

100±22 107±19

110±34 128±26

290±45* 317±34*+

266±38 238±23+

251±18 229±35+

251±29 210±17+

–

185±34

162±34

146±21

147±37

– –

201±39+ –

121±35+ 25%

113±29+^ 23%

105±23+^ 28%

All vascular pressures were measured in mmHg, cardiac index in l/min*kg and PVRI = (Ppa – Pw)/CI. *Denotes signifi cant difference between the average of baseline (−30 and −5 minutes) vs. +30 minutes, using paired t test. +Denotes significant difference in the same group across time (60–120 minutes). ^Denotes significant difference at the same time between groups

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Tsang and Lamm: Vasoconstriction in acute embolism

The square of the correlation coefficient (r2) between Qt and W was 0.62, indicating a good correlation. When Qt was normalized with W in the same animal, cardiac index CI was calculated. It shows that CI remained stable and relatively constant during the experiments in both groups and there was no statistical significance between them.

Table 1 and Figure 1 show the pulmonary vascular resistance index (PVRI) during the experiment. The average total PVRI at –30 and –5 minutes for Groups 1 and 2 were calculated and used as the baseline values for both of them respectively. They were not statistically different. The total PVRI in Group 1 at 30 minutes and thereafter represented the total pulmonary vascular resistance index immediately after APTE due to a combination of the obstructive and vasoconstrictive components, plus the baseline value. It would remain so for Group 1 until the end of the experiment. However, for Group 2 at 60 minutes onward when Tezosentan was already started, their total PVRI represented the pulmonary vascular resistance index due to the obstructive component plus the baseline value only, without the contribution from the vasoconstriction mediated by endothelins.

Table 3 shows the percentage of regional blood flow summed up in different clusters during the experiments. Once the clusters were defined by WNRQi, the percentage of regional blood flow in each cluster was calculated by the summation of all raw regional flow from those samples within that cluster and dividing it by the corresponding total pulmonary blood flow or Qt.

At −30 and –5 minutes, the percentage of regional blood flow in each cluster was roughly proportional to the percentage of total pieces (Tables 2 and 3) at ~2 cm3 each, indicating their homogeneity. They were quite similar between groups. At +30 minutes, the distributions of the regional blood flow in the three clusters immediately after embolization between groups were also comparable, indicating that the measurements at these times were reproducible. Thus, these data indicated that the animals in groups 1 and 2 were similarly embolized at 30 minutes in terms of embolic load (about 20 g), Ppa end points and the resulted blood flow pattern among these clusters. It was part of our experimental goal to complete the embolization process in both groups toward similar end points.

By comparing the net increase (∆) in PVRI after APTE , i.e., R1 and R2 for Groups 1 and 2 respectively, and adjusting for their slightly different baseline PVRI, the vasoconstriction component as mediated by endothelins after APTE was estimated to be about 25%, 23% and 28% at 60, 90, and 120 minutes, respectively (Table 1).

Table 2 shows that percentage of the lung samples distributed to the three clusters, assigned by WNRQ according to the definition determined a priori (see the “Methods” section). The patterns of embolization before Tezosentan at 30 minutes were similar in groups 1 and 2 and there was no statistical difference between them. For both groups, roughly 50% of the pieces were assigned to cluster 1, while about 25% of the pieces were assigned to clusters 2 and 3 each, namely half of the lung tissue received reduction of regional blood flow after APTE.

Figure 1: The total pulmonary vascular resistance index (PVRI) during the experiment for Group 1 (APTE only, solid circles) and Group 2 (APTE + Tezozentan, open squares). *Denotes significant difference between the average of baseline (−30 and -5 minutes) vs. +30 minutes, using paired t test. +Denotes significant difference in the same group across time (60–120 minutes). ^Denotes significant difference at the same time between groups.

Table 2: Cluster definition and sample distribution within lung at 30 minutes after APTE Group

Treatment

Cluster WNRQ definition

Cluster

No. of pieces

% Total pieces

Mean

Mean (%)

SD (%)

Group 1 n=8

APTE only

Decrease >50% Same Increase >50%

1 2 3

405 244 215

78 46 43

46.8 28.3 24.9

4.2 3.7 2.8

Group 2 n=5

APTE+ Tezosentan

Decrease >50% Same Increase >50%

1 2 3

517 236 262

77 119 69

51.8 22.6 25.6

9.4 8.4 3.8

WNRQ: weight normalized relative flow. It shows that cluster distribution was similar in Groups 1 and 2, i.e., they were similarly embolized

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Tsang and Lamm: Vasoconstriction in acute embolism

Table 3: Regional blood flow in each cluster as a percentage of total pulmonary blood flow over time Group

Cluster

Time (minutes) −30

−5

120

Group 1, n=8

1 2 3

49.1±7.3 23.7±4.9 27.2±3.6

49.2±7.1 23.1±4.5 27.7±3.7

6.4±1.4* 20.2±4.6 73.4±4.1*

14.2±5.1^+ 24.1±5.0^ 61.7±4.5^+

19.6±6.3^+ 26.6±4.6^ 53.8±4.8^+

Group 2, n=5

1 2 3

53.1±9.2 18.2±6.2 28.7±4.6

53.8±8.2 18.0±6.2 28.3±4.0

6.2±0.9* 15.7±5.6 78.1±6.0*

10.7±3.7^ 18.2±4.3^ 71.2±7.2^

12.9±4.1^ 18.7±6.1^ 68.4±7.2^

*Denotes significant difference between the average of baseline (−30 and −5 minutes) vs. +30 minutes. +Denotes significant difference in the same group across time (60–20 minutes). ^Denotes significant difference at the same time between groups in corresponding clusters

Note that at time = +30 minutes after APTE, cluster 1 in both groups, which by definition received less than 50% of WNRQ % (Table 3), actually received only 6.4% and 6.2% of total pulmonary blood flow respectively, since some of these samples, located distal to the emboli, received almost no flow at all. The percentage of regional blood flow in Cluster 2 at 30 minutes for both groups remained comparable to the pre-embolic state, as their WNRQ, by definition (Table 2), remained relatively unchanged.

Cluster 3 at 30 minutes, located in the least embolized regions, received disproportionately more flow after APTE, mostly diverted from Cluster 1, because their WNRQ % was at least 50% higher after embolization. However, at time = 60 and 120 minutes, the distributions of regional blood flow between Groups 1 and 2 were different. While there was progressively more percentage of regional blood flow returning to Cluster 1 from Cluster 3 over time in both groups, the recovery was sooner and more significant in Group 1 than in Group 2. The latter was treated with Tezosentan which caused relative vasodilatation in these less embolized areas (Cluster 3) and facilitated persistent recruitment there.

The data for the percentage of regional ventilation did not show any significant difference between groups or after Tezosentan and will not be presented here.

DISCUSSION AND CONCLUSIONS

In our experiments, we ensured that all the animals received comparable embolic load and similar hemodynamic profiles before those in Group 2 were given the endothelin antagonist. There was no difference in Ppa and embolic load between groups prior to Tezosentan. A pre-treatment approach was not used because the embolic load during the experiment would be different at the same hemodynamic end point at 30 minutes or the hemodynamic end point would be different at the same embolic load. Instead, a bolus of Tezosentan was given after APTE at 40 minutes, followed by an infusion. This quickly resulted in achieving 72

a good plasma level of this drug and reached a steady state at the earliest time. Its impact was seen in their systemic blood pressure. However, the animals were never in shock with a steady CI and PvO2 throughout (37±4 Torr).

We were able to maintain CI relatively constant during the experiments (Table 1). Although the CI in both groups across time was not strictly constant, because it could not be rigidly controlled as in isolated perfusion models, we considered them to be sufficiently steady for our present investigation (i.e., to fairly compare the pulmonary vascular resistance index (PVRI) between groups and over time).

Ppa acutely increased as embolization begun and did so after each additional injection of clots, sometimes exceeding 40 Torr. However, its magnitude intermittently dissipated within minutes until a sufficient embolic load was finally given. Thereafter, a more steady state was achieved. It is reasonable to suggest that these early temporaryincreases in pulmonary vascular resistance were possibly due to the more severe but transient vasoconstriction[3] at the early stage of embolic lung injury. Indeed, if the very early vasomotor response was disproportionately intense due to one large embolic load rather than the gradual accumulation of many over time, we speculated that these patients might succumb more readily[6], accounting for their early mortality.

However, we were also interested to see if significant vasoconstriction persisted beyond the immediate phase. In our experimental model, the data showed that PVRI nearly tripled at 30 minutes after APTE. At and after 60 minutes, PVRI in Group 1 represented both obstructive and vasoconstrictive components of PVRI after APTE, plus the baseline PVRI. On the other hand, for Group 2, the PVRI represented only the obstructive component after APTE plus the baseline PVRI, but did not include the vasoconstrictive component mediated by endothelins, as they were well antagonized by Tezosentan at our chosen doses (Fig. 1). Our data showed that the vasoconstrictive component, as mediated by the endothelins pathway in the early hours Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Tsang and Lamm: Vasoconstriction in acute embolism

after APTE, was consistently about 25% of the total while the obstructive component accounted for the remaining 75%. We recognized that the result did not include all vasoconstrictive pathways.

After 30 minutes, Ppa and PVRI slowly recovered toward baseline condition, but more so in Group 2 than Group 1 (Table 1 and Fig. 1). The differences in their changes, even though they were moving in the same direction, could be explained by both the abolition of endothelin-mediated vasoconstriction in the entire pulmonary circulation in Group 2 and the more persistent recruitment of blood flow to the nonembolized regions (Cluster 3, Group 2) which effectively lowered the PVRI, presumably due to the relative vasodilatation there. These data were unique in that they gave insight on the relationship between regional blood flow pattern and PVRI in real time, which was measured only indirectly by MIGET[18,20,21] and not at all in pressure flow plots. Endothelin antagonism also had some unexpected consequences beyond the pure reduction of vasomotor tone in the pulmonary vasculature. It has been previously reported that treating APTE with vasodilators, such as hydralazine, might result in more extensive pulmonary infarction. [22] This observation was compatible with our data in that vasodilatation might further reduce blood flow into the embolized areas over a longer period of time, resulting in ischemia and potential harm. Table 1 shows that Tezosentan at sufficient dose could cause moderate systemic hypotension. It is a nonspecific endothelin antagonist that broadly abolishes vasoconstriction when it is activated. Its dosage was chosen to assert undisputed effect on the designated pulmonary vasoconstriction without detrimental changes in CI.

It was observed that among patients with prior normal cardiopulmonary condition, their Ppa rarely exceeded 40 Torr after APTE. [23] The phenomenon was usually explained by the fact that the less muscular right ventricle (RV) could not generate sufficient pressure to overcome the increased pulmonary vascular resistance,[24] while patients with previous lung diseases could, because this same cardiac chamber was chronically hypertrophied under stress. While this explanation could certainly account for the observation, we proposed another plausible consideration relating to regional blood flow. Pulmonary vessels in an otherwise healthy subject, with their larger potential cross sectional area for recruitment, could allow for more ready accommodation of increased flow into the nonembolized regions, if APTE was not Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

massive and central. Beyond the strength of the RV, this compensatory mechanism in Poiseuille flow might also mitigate to some extent the subsequent pulmonary hypertension at normal Qt (i.e., Ppa reached a maximum round 40 Torr).[25] On the other hand, if the patient had emphysema, with a reduction of recruitment potential from loss of vasculature, their Ppa might reach a higher level more readily after APTE, along with their stronger RV. In both cases, if the patient was in shock, Ppa would remain low as it could not be interpreted in isolation without the simultaneous CI. In summary, our data show that endothelin-mediated vasoconstriction persists in the early hours after APTE and accounts significantly for about 25% of the increase in pulmonary vascular resistance. Tezosentan also facilitates continual redistribution of regional blood flow into the nonembolized regions, which may also mitigate pulmonary hypertension.

ACKNOWLEDGMENTS

The authors thank Dr. Jack Hildebrandt at the University of Washington for his insights and constructive criticisms in the preparation of this manuscript.

REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9.

10. 11. 12. 13.

Melot C, Delcroix M, Closset J, Vanderhoeft P, Lejeune P, Leeman M, et al. Starling resister vs distensible vessel models for embolic pulmonary hypertension. Am J Physiol 1995;267:H817-27. Smulders YM. Pathophysiology and treatment of hemodynamic instability in acute pulmonary embolism: The pivotal role of pulmonary vasoconstriction. Circ Res 2000;48:23-33. Smulders YM. Contribution of pulmonary vasoconstriction to hemodynamic instability after acute pulmonary embolism: Implications for treatment? Netherland J Med 2001;58:241-7. Torbicki A, Perrier A, Konstantinides S, Agnelli G, Gallie N, Pruszczyk P, et al. Guidelines on the diagnosis and management of acute pulmonary embolism. Eur Heart J 2008;29:2276-315. Delcroix M, Melot C, Vachiery JL, Lejune P, Leeman M, Naeije R. Effects of embolus size on hemodynamics and gas exchange in canine embolic pulmonary hypertension. J Appl Physiol 1990;69:2254-61. Wood KE. Major pulmonary embolism. Review of a pathophysiologic approach to the golden hour of hemodynamically significant pulmonary embolism. N Eng J Med 2002;121:877-905. Battistini B, Dussault P. Biosynthesis, distribution and metabolism of endothelins in the pulmonary system. Pul Pharmacol Therapeut 1998;11:79-88. Benigni A, Remuzzi G. Endothelin antagonists. Lancet 1999;353:133-8. Lee J, Chun Y, Lee I, Tudor R, Hong S, Shim T, et al. Pathogenic role of endothelin-1 in hemodynamic dysfunction in experimental acute pulmonary thromboembolism. Am J Respir Crit Care Med 2001;164: 1282-7. Schmeck J, Koch T, Patt B, Heller A, Neuhof H, Ackern K. The role of endothelin-1 as a mediator of the pressure response after air embolism in blood perfused lungs. Intens Care Med 1998;24:605-11. Giaid A, Yansgisawa M, Langleben D, Michel RP, Levy R, Shennib H, et al. Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. New Engl J Med 1993;328:1732-9. Michael J, Markewitz B. Endothelins and the lung. Am J Respir Crit Care Med 1996;154:555-81. Hoeper MM, Kramm T, Wilkens H, Schulze C, Schafers HJ, Welte T, et al. Bosentan therapy for inoperable chronic thromboembolic pulmonary

Tsang and Lamm: Vasoconstriction in acute embolism

14. 15. 16. 17. 18. 19.

hypertension. Chest 2005;128:2363-7. Altemeier W, Robertson H, Glenny R. Pulmonary gas exchange analysis by using simultaneous deposition of aerosolized and injected microspheres. J Appl Physiol 1998;85:2344-51. Clark AR, Burrows KS, Tawhai MH. The impact of micro-embolism size on hemodynamic changes in the pulmonary microcirculation. Respir Physiol Neurbiol 2011;175:365-74. Clozel M, Ramuz H, Clozel J, Breu V, Loffler B, Coassolo P, et al. Pharmacology of Tezosentan, a new endothelin receptor antagonist designed for parenteral use. J Pharmacol Exp Ther 1999;290:840-6. Schimmel C, Frazer D, Glenny RW. Extending fluorescent microsphere methods for regional blood flow to 13 simultaneous colors. Am J Physiol Heart Circ Physiol 2001;280:H2496-506. Melot C, Naeije R, Mois P, Hallemans R, Lejeune P, Jasper N. Pulmonary vascular tone improves pulmonary gas exchange in the adult respiratory distress syndrome. Am Rev Respir Dis 1987;136:1232-6. Tsang J, Lamm W, Starr I, Hlastala M. Spatial pattern of ventilation-perfusion mismatch following acute pulmonary thromboembolism in pigs. J Appl Physiol 2005;99:662-9.

20. 21. 22. 23. 24. 25.

Dantzker DR, Bower JS. Pulmonary vascular tone improves V/Q matching in obliterative pulmonary hypertension. J Appl Physiol 1981;51:607-13. Melot C, Hallemans R, Naeije R, Mois P, Lejeune P. Deleterious effect of nifedipine on pulmonary gas exchange in chronic obstructive pulmonary disease. Am Rev Respi Dis 1984;130:612-6. Schraufnagel DE, Tsao MS, Yao YT, Wang NS. Factors associated with pulmonary infarction. Am J Clin Pathol 1985;84:15-8. McIntyre KM, Sasahara AA. The hemodynamic response to pulmonary embolism in patients without prior cardiopulmonary disease. Am J Cardiol 1971;28:288-94. Sasahara AA. Pulmonary vascular response to thromboembolism. Modern Concepts of Cardiovas Disease 1967;36:55-60. Sharma GV, McIntyre KM, Sharma S, Sasahara AA. Clinical and hemodynamic correlates in pulmonary embolism. Clinics in Chest Med 1984;5:421-37.

Source of Support: B. C. Lung Association, Conflict of Interest: None declared.

New features on the journal’s website Optimized content for mobile and hand-held devices HTML pages have been optimized of mobile and other hand-held devices (such as iPad, Kindle, iPod) for faster browsing speed. Click on [Mobile Full text] from Table of Contents page. This is simple HTML version for faster download on mobiles (if viewed on desktop, it will be automatically redirected to full HTML version) E-Pub for hand-held devices EPUB is an open e-book standard recommended by The International Digital Publishing Forum which is designed for reflowable content i.e. the text display can be optimized for a particular display device. Click on [EPub] from Table of Contents page. There are various e-Pub readers such as for Windows: Digital Editions, OS X: Calibre/Bookworm, iPhone/iPod Touch/iPad: Stanza, and Linux: Calibre/Bookworm. E-Book for desktop One can also see the entire issue as printed here in a ‘flip book’ version on desktops. Links are available from Current Issue as well as Archives pages. Click on View as eBook

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Research A r t i cl e

Pulmonary acceleration time to optimize the timing of lung transplant in cystic fibrosis Thibaud Damy1, Pierre-Régis Burgel2, Jean-Louis Pepin3, Pierre-Yves Boelle4, Claire Cracowski5, Marlène Murris-Espin6, Raphaele Nove-Josserand7, Nathalie Stremler8, Tabassome Simon9, Serge Adnot10, and Brigitte Fauroux11 Department of Cardiology, AP-HP, Henri Mondor Hospital, Créteil, 2Department of Pulmonary, AP-HP, Cochin Hospital, Paris Descartes University, Paris, 3INSERM ERI17, HP2 Laboratory (Hypoxia: Pathophysiology), Grenoble University Hospital, Department of Physiology and rehabilitation, Grenoble, 4Department of Biostatistic, AP-HP, Saint Antoine Hospital, Pierre and Marie CurieParis6 University, INSERM UMR-S 707, Paris, 5Department of Pulmonary, Grenoble University Hospital, Grenoble, 6Department of Respiratory, Adult Cystic Fibrosis Center, Larrey Hospital, Toulouse Hospitals, 7Adult Cystic Fibrosis Center, Lyon Sud Hospital, Pierre-Bénite, Lyon, 8Department of Pediatric, Pediatric Cystic Fibrosis Center, La Timone Hospital, Marseille, 9URC Est, AP-HP, Saint Antoine Hospital, Pierre and Marie Curie-Paris6 University, Paris, 10IMRB, UPEC Créteil, AP-HP, Henri Mondor Hospital, 11Pediatric Pulmonary Department, AP-HP, Armand Trousseau Hospital, Pediatric Cystic Fibrosis Center, Pierre and Marie Curie-Paris6 University, INSERM UMR S-893, Paris, France 1

ABSTRACT Pulmonary hypertension (PH) may affect survival in cystic fibrosis (CF) and can be assessed on echocardiographic measurement of the pulmonary acceleration time (PAT). The study aimed at evaluating PAT as a tool to optimize timing of lung transplant in CF patients. Prospective multicenter longitudinal study of patients with forced expiratory volume in 1 second (FEV1) ≤60% predicted. Echocardiography, spirometry and nocturnal oximetry were obtained as part of the routine evaluation. We included 67 patients (mean FEV1 42±12% predicted), among whom 8 underwent lung transplantation during the mean follow-up of 19±6 months. No patients died. PAT was determined in all patients and correlated negatively with systolic pulmonary artery pressure (sPAP, r=−0.36, P=0.01). Patients in the lowest PAT tertile (<101 ms) had lower FEV1 and worse nocturnal oxygen saturation, and they were more often on the lung transplant waiting list compared to patients in the other tertiles. Kaplan–Meier curves showed a shorter time to lung transplantation in the lowest PAT tertile (P<0.001) but not in patients with sPAP>35 mmHg. By multivariate analysis, FEV1 and nocturnal desaturation were the main determinants of reduced PAT. A PAT<101 ms reduction is a promising tool for timing of lung transplantation in CF. Key Words: cystic fibrosis, echocardiography, pulmonary acceleration time, pulmonary hypertension, pulmonary transplantation

INTRODUCTION Cystic fibrosis (CF) is among the leading causes of chronic respiratory insufficiency in adolescents and young adults. Lung transplantation is the treatment of last resort for end-stage lung disease. Given the shortage of lungs for transplantation, adequate selection of transplant recipients, and optimal timing of lung transplantation in individual patients are crucial.

Address correspondence to:

Prof. Brigitte Fauroux AP-HP, Hôpital Armand Trousseau Pediatric Pulmonary Department Université Pierre et Marie Curie-Paris6, INSERM UMR S-938 28 Avenue du Docteur Arnold Netter Paris, F-75012 France Email: brigitte.fauroux@trs.aphp.fr Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pulmonary hypertension (PH) is a major component of advanced CF lung disease.[1,2] Although PH is usually moderate in CF, its severity varies greatly across patients and its presence may negatively affect outcomes.[3] Therefore, evaluating PH may help to guide treatment decisions in CF patients, including referral for lung transplantation. However, studies on the prognostic impact Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94838 How to cite this article: Damy T, Burgel P, Pepin J, Boelle P, Cracowski C, MurrisEspin M et al. Pulmonary acceleration time to optimize the timing of lung transplant in cystic fibrosis. Pulm Circ 2012;2:75-83.

Damy et al.: PH in cystic fibrosis

of PH in CF are scarce, and most of them are retrospective, have small sample sizes, or are confined to patients with end-stage lung disease.[1-7] Furthermore, limited data are available on the prevalence and determinants of PH in CF.

PH is classically defined as a mean pulmonary artery pressure (PAP) greater than 25 mmHg as measured by right heart catheterization. In practice, however, noninvasive echocardiography is used to estimate systolic PAP (sPAP) from the peak tricuspid regurgitation velocity (TRV) using the modified Bernouilly equation.[3] PH is defined as an echocardiographic sPAP value greater than 35 mmHg. However, tricuspid regurgitation may be absent in patients with CF, particularly those in the pediatric age range. The pulmonary artery acceleration time (PAT) measured on the Doppler pulmonary artery flow correlates strongly with mean PAP[8] and can be measured in most children and adults.[8,9]

We hypothesized that the severity of PH affected survival and that PAT was more informative than echocardiographic sPAP in CF. We assessed these hypotheses by conducting a large, prospective multicenter study in children and adults with CF who underwent echocardiography with echocardiographic sPAP and PAT determination, spirometry, and nocturnal oximetry during their routine annual evaluation. Patients were then followed up for at least 1 year. The primary endpoint was the number of patients who died or underwent lung transplantation during follow-up. No death occurred, and the prognosis was therefore evaluated based only on time to lung transplantation.

MATERIALS AND METHODS Patients

Patients with CF were recruited prospectively during their routine annual evaluation at two pediatric and four adults CF centers between April 2008 and April 2009. Inclusion criteria were presence of two CFTR mutations or one CFTR mutation with a sweat chloride test >60 mmol/l and a characteristic phenotype, age ≥ 7 years, ability to perform a reproducible forced expiratory maneuver with a forced expiratory volume in one second (FEV1) ≤ 60% of predicted value in a stable clinical state defined by the absence of a respiratory exacerbation since at least one month or a patient finishing an at least 10 days intravenous antibiotic treatment. Sputum bacteriology and lung function tests including arterial blood gas measurements were obtained routinely.[10-12] We determined the vital status and lung transplantation status of each patient on 1 May 2010. All the parents of children, children with sufficient understanding, 76

and all adults, gave informed written consent for the study, which was approved by the local ethics committee.

Echocardiographic measurements

Echocardiograms were performed as recommended by the American Society of Echocardiography.[13] TRV was measured and the transtricuspid pressure gradient was calculated using the modified Bernoulli equation.[14,15] Right atrial pressure was evaluated by measuring the inferior venous cava diameter and its variations over the breathing cycle. Systolic pulmonary artery pressure (PAP) was estimated by the sum of right atria pressure and transtricuspid gradient. The right ventricular end-diastolic diameter (RVEDD) and the left end-diastolic diameter were measured in M-mode in parasternal view and indexed to body surface area (LVEDVI). PAT was defined as the time in milliseconds from the onset of right ventricular ejection to peak systolic velocity of the forward pulmonary flow.[8] In normal individuals, pulmonary acceleration time (PAT) exceeds 110 ms and progressively shortens with the increase in pulmonary hypertension (PH).

Overnight pulse oximetry and transcutaneous carbon dioxide recording

Overnight pulse oximetry (SpO 2) and transcutaneous carbon dioxide (PtcCO2) recordings were performed in room air (SenTec Digital Monitor, SenTec AG, Therwil, Switzerland).[16] We recorded the mean and minimal SpO2, number of desaturations ≥ 4%/h of recording, percentage of time spent at specific SpO2 values, mean and maximum PtcCO2 and percentage of time spent at specific PtcCO2 values. Six patients had received intermittent nocturnal oxygen therapy and seven patients intermittent noninvasive positive pressure ventilation (NPPV) but all lung function tests and sleep recordings were performed on room air.

Statistical analysis

The distribution of continuous variables was checked for normality using the Kolmogorov-Smirnov test. Values for normally distributed variables are given as mean±standard deviation (SD) for quantitative data and as numbers and percentages for categorical data. We separated the patients into the following subgroups: Children (age <18 years) and adults; patients on the lung transplantation waiting list and other patients; PAT tertiles (with cut-off values of 101 and 122 ms); and sPAP < or ≥ 35 mmHg. Differences between continuous data were tested using the Mann-Whitney test for two-group comparisons and the Kruskal-Wallis test for three-group comparisons. Proportions were compared using Pearson’s Chi-square test. Univariate regression analysis was performed to assess correlations linking clinical, laboratory, and echocardiographic variables. To identify variables independently associated with low PAT values, we entered the clinical, lung function and sleep variables yielding P values <0.10 by univariate analysis of Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Damy et al.: PH in cystic fibrosis

associations with PAT into a binomial regression analysis model comparing the lowest PAT tertile to the two other tertiles pooled. The relationship between PAT tertile and time-to-lung transplantation was evaluated using Kaplan–Meier curves and the chi-square log-rank test. P values <0.05 were considered significant. Analyses were performed using SPSS 16.0 (SPSS Inc., Chicago, Ill., USA).

RESULTS

Characteristics of the study population Table 1 reports the main characteristics of the 67 CF patients by age and lung transplantation status. Table 2

shows the patients according to lung transplantation waiting list status at baseline.

Compared to adults, children had significantly lower values for body mass index (BMI) and diastolic blood pressure, significantly higher heart rates and FEV1 values, and significantly lower values for mean daytime and nocturnal CO2. Among the echocardiographic variables, isovolumetric relaxation time (IVRT) and right ventricular end-diastolic diameter (REVDD) were significantly lower in children than in the adults. Median follow-up was 19 months. No patients died, and 8 patients underwent lung transplantation. As expected,

Table 1: Clinical, echocardiographic, respiratory treatment, day time blood gases, spirometry, and nocturnal gas exchange characteristics of all the patients Variables

All

Children <18 years

Adults ≥18 years

Without pulmonary transplant

With pulmonary transplant

N Clinical characteristics Age (years) Adult, n (%) Men, n (%) BMI, kg/cm² Respiratory rate, rpm Systolic BP, mmHg Diastolic BP, mmHg Heart rate, bpm Echocardiography LVEDD, mm/m² Fractional shortening, % LVMind, g/m² IVRT, ms E/A Decc time E, ms Systolic PAP* (N=50) Systolic PAP, class (>=35 mmHg) PAT, ms RVEDD, mm Respiratory treatment LTOT, n (%) NPPV, n (%) Spirometry VC, l VC (% pred) FEV1, l FEV1 (% pred) Daytime blood gases PaO2 (mmHg) PaCO2 (mmHg) pH Nocturnal gas exchange Mean SpO2 (%) Minimal SpO2 (%) % of sleep time spent with a SaO2<90%, min Desaturation index Mean PtcCO2 (mmHg) Maximal PtcCO2 (mmHg)

67±10 45 (67) 32 (48) 17.9±2.3 20±5 110±13 65±10 86±14

13±3 9 (41) 16.4±2.0 25±5 110±9 64±9 90±17

27±8* 23 (51) 18.7±2.0* 18±4* 110±15 68±10* 85±11*

24±10 40 (68) 29 (49) 18.0±2.3 20±5 110±14 65±10 85±15

25±12 5 (63) 3 (38) 17.2±2.2 22±5 110±12 70±14 93±11*

32±5 37±6 75±18 80±17 1.3±0.3 175±17 30±9 10 (15) 110±30 22±5

35±7 38±6 71±17 59±15 1.6±0.3 147±46 28±4 0 108±19 19±3

30±3* 36±8 76±18 78±18* 1.3±0.3 179±41 30±10 10 (22) 112±33 23±5*

32±5 37±6 75±18 80±17 1.3±0.3 177±40 30±9 8 (19) 112±29 22±6

28±5 36±9 74±9 81±12 1.5±0.4 145±40 33±8*=0.03 2 (25) 85±16* 23±5

6 (9) 7 (11)

3 (14) 2 (9)

3 (7) 5 (11)

4 (7) 4 (7)

2 (25) 3 (38)*

2.2±0.9 62±14 1.2±0.5 42±12

1.52±0.8 59±13 1.1±0.5 48±13

2.5±0.8* 63±14 1.3±0.4 41±11*

2.5±0.8 65±12 1.3±0.4 43±11

1.2±0.7* 42±10* 0.74±0.2* 26±7*

74±10 40±4 7.42±0.03

72±9 37±3 7.43±0.03

75±10 40±4* 7.41±0.03

75±9 40±4 7.42±0.03

65±12* 41±4 7.43±0.02*

93±3 87±6 0±23 1.0±2.4 43±5 40±4

94±2 88±7 0±19 1.0±2.8 42±5 37±3

93±3 87±5 0±25 1.0±2.4 44±7 40±4*

94±3 88±6 0±20 1.0±2.2 43±7 46±6

92±2* 84±5* 5±29 3±2* 41±5* 46±6

The patients are divided by age, acceleration tertiles and with or without pulmonary transplant; BMI: body mass index; BP: blood pressure; LVEDD: left ventricular end-diastolic diameter; LVM: left ventricular mass; IVRT: isovolumetric relaxation time; E: peak velocity of the early transmitral flow. A: peak velocity of the late atrial transmitral flow; Dec time E: Decceleration time of the E wave; Systolic PAP: systolic pulmonary artery pressure; PAT: pulmonary acceleration time; RVEDD: right ventricle end-diastolic diameter; LTOT: long term oxygen therapy; NPPV: noninvasive positive pressure ventilation; VC: vital capacity, FEV1: forced expiratory volume in one second; PaO2: partial arterial oxygen pressure; PaCO2: partial arterial carbon dioxide pressure; SpO2: pulse oximetry; PtcCO2: transcutaneous carbon dioxide pressure; *P<0.05.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Damy et al.: PH in cystic fibrosis

compared to the 59 nontransplanted patients, these 8 patients had significantly higher values for heart rate and sPAP and significantly lower values for PAT, lung function parameters, nocturnal oxygenation and mean nocturnal PtcCO2, with similar maximal PtcCO2 values. Children and adults were not significantly different regarding the CFTR genotype, bacteriological status (except for a significantly higher prevalence of Pseudomonas aeruginosa pulmonary infection in adults), PAT tertile distribution or the lung transplant list status (Table 3). Table 2: Characteristics of the patients divided by waiting for pulmonary transplant or not Variables

N Clinical Age (years) Adult, n (%) Men, n (%) BMI, kg/cm² Respiratory rate, rpm Systolic BP, mmHg Diastolic BP, mmHg Heart rate, bpm Echocardiographic LVEDD, mm/m² Fractional shortening, % LVMind, g/m² TRIV, ms E/A E wave decceleration time ms PAT, ms Systolic PAP* (N=50) Systolic PAP, class (>=35 mmHg) RVEDD, mm Respiratory treatment LTOT, n (%) NPPV, n (%) Spirometry VC, l VC (% pred) FEV1, l FEV1 (% pred) Daytime blood gases PaO2 (mmHg) PaCO2 (mmHg) PH Nocturnal gas exchange Mean SpO2 (%) Minimal SpO2 (%) % of sleep time spent with a SoO2 <90%, min Desaturation index Mean PtcCO2 (mmHg) Maximal PtcCO2 (mmHg)

Lung transplant Unlisted

Listed

24±10 36 (71) 23 (45) 18.4±2.16 20±5 110±14 65±9 84±13

25±12 9 (13) 9 (56) 17.4±2.6 21±5 111±10 70±12 92±15*

32±5 37±6 75±17 80±17 1.3±0.3 177±40 112±30 30±9 8 (21) 22±6

28±5 36±6 76±22 78±17 1.4±0.3 173±50 95±27* 31±8 2 (18) 22±4

2 (4) 4 (8)

4 (25)* 3 (19)

2.5±0.8 65±12 1.3±0.4 43±11

2.0±0.9* 50±16* 0.9±0.4* 30±11*

75±9 40±4 7.42±0.03

65±11* 40±4 7.43±0.02*

94±3 88±6 0±20

91±2* 85±5* 60±31*

1.0±2.2 44±7 46±6

3±3 41±5* 46±5

BMI: body mass index; BP: blood pressure; LVEDD: left ventricular enddiastolic diameter; LVM: left ventricular mass; IVRT: isovolumetric relaxation time; E: peak velocity of the early transmitral flow. A: peak velocity of the late atrial transmitral flow; Dec time E: Decceleration time of the E wave; Systolic PAP: systolic pulmonary artery pressure; PAT: pulmonary acceleration time; RVEDD: right ventricle end-diastolic diameter; LTOT: long term oxygen therapy; NPPV: noninvasive positive pressure ventilation; VC: vital capacity, FEV1: forced expiratory volume in one second; PaO2: partial arterial oxygen pressure; PaCO2: partial arterial carbon dioxide pressure; SpO2: pulse oximetry; PtcCO2: transcutaneous carbon dioxide pressure; *P<0.05.

Clinical, biological, and left ventricle echocardiographic characteristics of the population divided into PAT tertiles or systolic PAP categories The clinical characteristics did not differ according to PAT tertiles, whereas all patients with sPAP ≥ 35 mmHg were adults and mean age in this subgroup was significantly higher than in the subgroup with sPAP<35 mmHg (Table 4). The mean deceleration time differed significantly across PAT tertiles but not between sPAP categories. The patients in the lowest PAT and those with sPAP ≥ 35 mmHg had significantly lower mean FEV1 values than the patients in the other groups. Mean vital capacity (VC) was lower in the PAT tertile than in the two other tertiles pooled, but not significantly different between the two sPAP categories. Daytime PaCO2 values were not significantly higher in the lowest PAT tertile and significantly higher in the sPAP ≥ 35 mmHg category. Finally, mean nocturnal desaturation index and maximal PtcCO2 were significantly higher in the lowest PAT tertile, and not significantly higher in the highest sPAP category. Figure 1 shows patient distribution by sPAP category and PAT tertile. The sPAP value was ≥ 35 mmHg in 10 patients, <35 mmHg in 40 patients, and not measurable in 17 patients. Mean sPAP was not significantly different between patients listed for lung transplantation and other patients. PAT was significantly lower in the listed patients (Table 2).

Correlation of echocardiographic variables with clinical, spirometric, and sleep variables

Table 5 shows that left ventricular morphology, assessed on the left end-diastolic diameter (LVEDVI), correlated negatively with age, BMI, and diastolic blood pressure, and positively with respiratory rate and heart rate. The IVRT correlated positively with age, BMI, and daytime PaCO2. The ratio of early (E) over late atrial (A) transmitral peak velocities (E/A) correlated positively with age and respiratory rate, and negatively with BMI and maximal nocturnal PtcCO 2, whereas the E-wave deceleration time correlated negatively with BMI. RVEDD correlated negatively with respiratory rate.

As expected, PAT correlated negatively with respiratory rate, nocturnal desaturation index and maximal PtcCO2, and positively with VC, FEV1 and minimal nocturnal SpO2. Systolic PAP correlated positively with daytime and maximal nocturnal PaCO2 and the nocturnal desaturation index, and negatively with VC, FEV1 and mean nocturnal PtcCO 2. Finally, PAT correlated negatively with sPAP (r=–0.36, P=0.01).

Variables associated with low PAT

Table 6 lists the determinants of PAT<101 ms (tertile 3 versus tertiles 1 and 2) identified by multivariate binomial logistic regression. Minimal nocturnal SpO 2 Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Damy et al.: PH in cystic fibrosis

Table 3: Genetic and bacteriological status Variables

N CFTR genotype, n (%) F508del/F508del F508del/other Other/other Bacteriological status, n (%) H. influenza S. aureus methiS S. aureus methiR P. aeruginosa (non mucous) P. aeruginosa (mucous) B. cepacia complex

All

Children

Adults

PAT

Lung transplant

Tert1

Tert2

Tert3

Unlisted

Listed

35 (52) 19 (28) 12 (18)

15 (68) 3 (14) 4 (18)

20 (46) 16 (36) 8 (18)

11 (50) 6 (27) 5 (23)

14 (64) 5 (23) 3 (14)

10 (46) 8 (36) 4 (18)

24 (48) 15 (30) 11 (22)

11 (69) 4 (25) 1 (6)

1 (5) 9 (43) 1 (5) 4 (19) 4 (19) 1 (5)

1 (2) 14 (33) 4 (9) 18 (42) 20 (47)* 1 (2)

2 (9) 6 (27) 1 (5) 8 (36) 7 (32) 2 (9)

0 6 (27) 1 (5) 7 (32) 11 (50) 0

0 11 (55) 3 (15) 7 (35) 6 (30) 0

1 20 4 18 18

2 23 5 22 24 2

(3) (36) (8) (34) (38) (3)

(2) (42) (8) (38) (38) 0

1 (6) 3 (19) 1 (6) 4 (25) 6 (38) 2 (13)

CFTR: cystic fibrosis transmembrane regulator; H influenzae: Haemophilus influenza; S. aureus: Staphyloccocus aureus; P. aeruginosa: Pseudomonas aeruginosa; B. cepacia: Burkholderia cepacia

Of the 8 patients who underwent lung transplant during the follow up, only 3 had sPAP ≥ 35 mmHg and 5 had sPAP <35 mmHg, whereas 7 had PAT values in the lowest tertile (Fig. 1). Figure 2 shows the Kaplan–Meier curves for timeto-lung transplantation according to sPAP categories and PAT tertiles. Time-to-lung transplantation did not differ significantly between the two sPAP categories. In contrast, patients in the lowest PAT tertile had significantly shorter times to lung transplantation than the patients in the two other tertiles pooled.

DISCUSSION AND CONCLUSIONS

In this large, prospective multicenter study, PH, as PAT <101 ms was associated with a significantly shorter timeto-lung transplantation than higher PAT values. Thus, PAT <101 ms may hold promise as a prognostic marker in patients with CF. In addition, PAT was more informative than sPAP estimated by echocardiography; PAT but not sPAP was measurable in all patients, and the association with time-to-lung transplantation was stronger for PAT than for sPAP. Figure 1: Distribution of the patients according to the systolic pulmonary arterial pressure (sPAP) (A) and pulmonary acceleration time (PAT) (B). The black bars represent the lung transplant recipients, dark gray bars the lung transplant waiting list patients, and light gray the other patients.

was not significantly associated with lowest-tertile PAT. The only variables significantly associated with lowest-tertile PAT were FEV1 and nocturnal desaturation index.

Prognosis value of PAT

As none of the patients died during the follow up, only time to lung transplantation was used to assess prognosis. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Right heart catheterization is considered the reference standard for mean PAP determination, with a value above 25 mmHg defining PH. However, this procedure is too invasive to be suitable for screening or monitoring over time. [17-19] In clinical practice, PH is often based on the sPAP value estimated from the TRV measured during echocardiography. Systolic PAP estimation by echocardiography may be difficult in CF because of lung hyperinflation, absence of tricuspid regurgitation in some patients and variations in TRV depending on respiration time and regurgitation severity. [17,20] Interestingly, a strong inverse relationship between PAT and mean PAP has been reported,[8] and we found a strong association between PAT and sPAP. A weaker association was reported previously between echocardiographic PAT and both diastolic and sPAP 79

Damy et al.: PH in cystic fibrosis

Table 4: Clinical, echocardiographic, respiratory treatment, day time blood gases, nocturnal gas exchange characteristics of the patients Variables

N Clinical characteristics Age (years) Adult, n (%) Men, n (%) BMI, kg/cm² RespR SBP, mmHg DBP, mmHg HR, bpm Echocardiography LVEDD, mm.m−² FS, % LVMind, g/m² IVRT, ms E/A Decc Time E, ms N with TR Systolic PAP, mmHg PAT, ms RVEDD, mm Respiratory treatment LTOT, n (%) NPPV, n (%) Spirometry VC, l VC (% pred) FEV1, l FEV1 (% pred) Daytime blood gases PaO2 (mmHg) PaCO2 (mmHg) PH Nocturnal gas exchange Mean SpO2 (%) Minimal SpO2 (%) % of sleep time spent with a SoO2<90%, min Desaturation index Mean PtcCO2 (mmHg) Maximal PtcCO2 (mmHg)

Tert1

PAT Tert2

Tert3

24±7 17 (77) 9 (41) 18.6±2.3 20±5 111±16 65±11 84±12

21±11 15 (65) 13 (57) 17.9±1.9 21±4 110±13 66±9 84±15

23±13 13 (59) 10 (46) 17.2±2.6 20±7 110±9 64±10 90±15

31±5 36±6 73±18 75±19 1.3±0.3 195±46 14 30±8 149±23 23±6

32±5 37±7 77±17 80±17 1.4±0.2 180±35 18 28±10 110±6 21±6

1 (5) 0 (0)

Systolic PAP mmHg

<35

>=35

0.91 0.43 0.56 0.38 0.50 0.35 0.70 0.27

23±9 25 (63) 17 (43) 18±2 20±6 41±4 65±11 86±13

33±10 10 (100) 5 (50) 18±2 18±4 110±12 68±9 91±15

0.003 0.02 0.67 0.91 0.17 0.89 0.75 0.61

30±6 36±8 76±20 81±17 1.2±0.4 145±40 18 30±7 89±9 21±3

0.60 0.70 0.55 0.97 0.26 0.029 0.29 0.001 0.21

31±5 36±7 78±29 81±17 1.3±0.3 177±40 29±7 112±29 22±5

30±4 36±9 94±12 90±17 1.1±0.2 165±54 39±6 103±22 25±6

0.24 0.77 0.46 0.24 0.02 0.58 0.0001 0.10 0.07

1 (4) 2 (9)

4 (19) 5 (24)

0.16 0.038

7 (18) 5 (13)

0 0

0.22 0.35

2.43±0.80 65±12 1.39±0.43 43±9

2.46±.83 64±13 1.24±0.40 47±14

1.9±0.84 55±15 0.91±0.39 38±10

0.026 0.037 0.0001 0.012

2.1±0.9 62±13 1.3±0.5 43±11

2.1±0.9 62±13 1.3±0.4 32±10

0.97 0.14 0.38 0.01

78±8 37±4 7.43±0.03

75±10 41±5 7.41±0.04

69±12 40±3 7.42±0.03

0.35 0.25 0.25

78±11 38±5 7.42±0.04

71±9 41±4 7.42±0.02

0.27 0.03 0.99

94±2 89±5 0±11 0.5±1.9 42±8 43±6

94±4 87±5 0±30 1±2.3 44±6 46±6

93±3 85±6 0.5±23 3±3 43±6 47±5

0.44 0.08 0.12 0.0001 0.60 0.02

93±3 87±6 0±22 1±2 42±7 45±6

93±3 86±6 0±27 3±3 45±5 50±5

0.97 0.91 0.69 0.12 0.60 0.06

The patients are divided by pulmonary acceleration time tertiles and systolic pulmonary artery pressure category; BMI: body mass index; BP: blood pressure; LVEDD: left ventricular end-diastolic diameter; LVM: left ventricular mass; IVRT: isovolumetric relaxation time; E: peak velocity of the early transmitral flow. A: peak velocity of the late atrial transmitral flow; Dec time E: Decceleration time of the E wave; Systolic PAP: systolic pulmonary artery pressure; PAT: pulmonary acceleration time; RVEDD: right ventricle end-diastolic diameter; LTOT: long term oxygen therapy; NPPV: noninvasive positive pressure ventilation; VC: vital capacity, FEV1: forced expiratory volume in one second; PaO2: partial arterial oxygen pressure; PaCO2: partial arterial carbon dioxide pressure; SpO2: pulse oximetry; PtcCO2: transcutaneous carbon dioxide pressure; *P<0.05.

in children.[21] PAT is known to be inversely correlated with heart rate, which was increased in lung transplant recipients in our study. However, correcting PAT for heart rate did not improve the correlation with sPAP in other studies.[21-24]

In the present study, sPAP could not be determined in 17 (25%) patients whereas PAT could be measured in all patients. PAT correlated better with the level of lung function and nocturnal gas exchange than did sPAP. Both VC and FEV1 were significantly lower in the lowest PAT tertile compared to the two other tertiles, whereas only FEV1 % predicted was lower in the patients with sPAP ≥ 35 mmHg compared to patients with sPAP<35 mmHg. Nocturnal gas exchange did not differ significantly 80

between the two sPAP categories, whereas the patients in the lowest PAT tertile had a significantly higher desaturation index and maximal PtcCO2 than the patients in the other two tertiles. Mean PAT was also significantly lower in a group of 103 CF patients on a lung transplant list, who had a mean FEV1 of 20±5% predicted than 17 controls (91 vs. 121 ms, P<0.01).[6] The prevalence of PH in our group of stable patients with FEV1<60% predicted was 33% when PH was defined as PAT<101 ms and 15% when PH was defined as sPAP > 35 mmHg. These data are difficult to compare with those from other studies because of differences in patient status and selection. However, prevalence of PH in other studies Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Damy et al.: PH in cystic fibrosis

Figure 2: Kaplan–Meier time to lung transplantation curves according to the level of systolic pulmonary arterial pressure (sPAP) (< or ≥ 35 mmHg) (A), and according to the tertile of pulmonary acceleration time (PAT), tertile 3 representing the lowest tertile, <101 ms (B). Time to lung transplantation was significantly shorter in the lowest PAT tertile compared to the two other tertiles (P<0.001) whereas no difference was observed according to the level of sPAP.

Table 5: Univariate correlation between echocardiographic variables and clinical and respiratory variables Variables

Clinical Age (years) BMI, kg/cm² RespR, rpm Systolic BP, mmHg DiastolicBP, mmHg Heart Rate, bpm Spirometry VC (l) VC (% pred) FEV1 (l) FEV1 (% pred) Daytime blood gases PaO2 (mmHg) PaCO2 (mmHg) PH Nocturnal gas exchange Mean SpO2 (%) Minimal SpO2 (%) Desaturation index Mean PtcCO2 (mmHg) Maximal PtcCO2 (mmHg)

Left ventricle

Pulmonary

Right ventricle

LVEDDind

IVRT

E/A

Decc time E

PAT

Systolic PAP

RVEDD

−0.56* −0.54* 0.42* −0.20 −0.34* 0.22*

−0.08 0.12 −0.13 −0.02 0.11 −0.14

0.45* 0.26* −0.20 0.07 0.09 −0.20

0.39* −0.35* 0.25* −0.35 −0.20 −0.07

0.08 0.31* −0.19 0.09 −0.03 0.04

0.01 0.19 −0.24* 0.19 0.14 −0.17

0.13 0.01 −0.09 0.06 0.10 −0.04

−0.02 0.08 −0.23* 0.18 0.08 −0.19

−0.41* −0.01 −0.35* 0.13

−0.13 −0.06 −0.02 0.12

0.23 0.19 0.11 −0.04

−0.01 0.05 0.01 0.04

0.10 0.22 0.12 0.17

0.32* 0.27* 0.45* 0.29*

0.13 −0.41* −0.28 −0.42*

0.14 −0.12 0.06 −0.25

−0.18 −0.15 0.21

0.03 0.06 −0.08

0.16 0.34* −0.10

0.03 0.11 −0.09

−0.10 0.25 −0.22

0.22 −0.07 −0.12

−0.25 0.29* 0.3

−0.09 0.30* −0.29*

0.06 0.09 −0.08 −0.13 −0.07

0.11 0.20 −0.10 −0.11 −0.01

0.14 0.20 −0.08 0.04 0.25

−0.09 −0.007 −0.17 0.12 −0.24*

−0.07 −0.07 −0.01 −0.05 0.04

0.12 0.26* −0.43* 0.15 −0.36*

0.05 −0.17 0.34* −0.34* 0.34*

0.05 −0.06 0.06 −0.21 0.08

BMI: body mass index; BP: blood pressure; VC: vital capacity, FEV1: forced expiratory volume in one second; PaO2: partial arterial oxygen pressure; PaCO2: partial arterial carbon dioxide pressure; SpO2: pulse oximetry; PtcCO2: transcutaneous carbon dioxide pressure; LVEDD: left ventricular end-diastolic diameter; FS: fractional shortening; IVRT: isovolumetric relaxation time; E: peak velocity of the early transmitral flow. A: peak velocity of the late atrial transmitral flow; Dec time E: Decceleration time of the E wave; PAT: pulmonary acceleration time; Systolic PAP: systolic pulmonary artery pressure; RVEDD: right ventricle end-diastolic diameter; *P<0.05

was very high, ranging from 30% to 63% in patients on lung transplant lists.[3,7,25]

FEV1 was one of the two main determinants of PAT in our study, in keeping with earlier reports.[3,25] FEV1 has been shown to be the best marker of lung disease severity and a major predictor of respiratory morbidity and mortality in CF. [26] Nocturnal desaturation was the other determinant of PH in our patients. The analysis of nocturnal gas exchange is among the main, Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

strongest points of our study, as the potential impact of nocturnal oxygen desaturation episodes on PH has not been specifically addressed in previous work. [3] Nocturnal desaturation is a well-recognized determinant of secondary PH in chronic obstructive pulmonary disease and other diseases such as heart failure. [27] One study investigated awake and sleep SpO2 values in 33 adult patients with CF. [3] By multivariate analysis, echocardiographic sPAP correlated only with awake SpO2 and not with nocturnal SpO2,[3] also in agreement 81

Damy et al.: PH in cystic fibrosis

Table 6: Determinants of pulmonary acceleration time less than 101 ms (tertile 3 versus tertiles 1 and 2) by mutlivariate binomial logistic regression analysis Variables

FEV1 Minimal nocturnal SpO2 (%) Desaturation index

All patients HR

95%CI

17.0 1.05 0.50

2.05-140.9 0.99-1.10 0.30-0.85

0.009 0.072 0.009

All the variables contained in Table 3 which correlated with PAT with a P value less than 0.10 were included in the model.

with another study.[25] Of note, PAT was not investigated in these studies. A previously reported determinant of PH that was not identified in the present study is bacterial colonization. An earlier study by our group showed that PH was more frequent and more severe in patients with Burkholderia multivorans infection than in patients with infections due to other bacteria, despite a similar level of blood oxygenation, lung function and bronchiectasis. [28] The vicious circle of excessive and uncontrollable pulmonary inflammation and infection, a hallmark of CF lung disease, could play a major role in the development of PH, especially in patients who have episodes of hypoxemia. Interestingly, the two patients in the present study who harbored Burkholderia cepacia in their sputum were in the lowest PAT tertile (Table 3).

The most interesting result of our study is the correlation of PAT with time to-lung-transplantation. Of the eight patients who received lung transplants during follow up, seven had PAT values <101 ms. Numerous factors associated with mortality in CF patients have been identified. The level of lung function and exercise capacity, and above all the rate of FEV1 decline, have emerged as major risk factors.[19,26,29-31] However, survival may also be affected by other factors such as microbiology, nutritional status, age, female sex, pancreatic insufficiency, CF-related diabetes mellitus, number of respiratory exacerbations and environmental and center-related factors.[26] PH is one of the recognized risk factors for premature death. [3,19,28] In a large cohort of 149 CF patients who were listed for lung transplantation, a higher sPAP value measured during cardiac catheterization was associated with higher mortality before transplantation.[19] Interestingly, in the present study, PAT but not sPAP correlated with time-tolung transplantation during the relatively short follow-up. This finding suggests that individual patients with PAT <101 ms may deserve consideration for inclusion on the lung transplant waiting list. Our study has several limitations. Both practical and ethical reasons precluded routine cardiac catheterization. None of the patients died during follow-up, as all patients with very severe disease were able to undergo lung transplantation (Table 1). Therefore, survival could not be used as an 82

endpoint, and prognosis was evaluated on time-to-lung transplantation.

PAT, which is easily and noninvasively measured during echocardiography, holds potential for diagnosis and assessing PH severity in children and adults with CF. PAT was of prognostic significance, with values lower than 101 ms being associated with a shorter time-tolung transplantation, compared to higher values. Larger prospective studies are warranted to assess the usefulness of low PAT for determining the optimal time for listing individual patients as lung transplantation candidates.

REFERENCES 1. 2. 3. 4. 5. 6. 7.

8. 9.

10.

11. 12. 13.

14. 15. 16.

Royce SW. Cor pulmonale in infancy and early childhood; report on 34 patients, with special reference to the occurrence of pulmonary heart disease in cystic fibrosis of the pancreas. Pediatrics 1951;8:255-74. Ryland D, Reid L. The pulmonary circulation in cystic fibrosis. Thorax 1975;30:285-92. Fraser KL, Tullis D, Sasson Z, Hyland RH, Thornley KS, Hanly PJ. Pulmonary hypertension and cardiac function in adult cystic fibrosis. Role of hypoxemia. Chest 1999;115:1321-8. Goldring RM, Fishman AP, Turino GM, Cohen HI, Denning CR, Anderson DH. Pulmonary hypertension and cor pulmonale in cystic fibrosis of the pancreas. J Pediatr 1964;65:501-24. Ionescu AA, Ionescu AA, Payne N, Obieta-Fresnedo I, Fraser AG, Shale DJ. Subclinical right ventricular dysfunction in cystic fibrosis. Am J Respir Crit Care Med 2001;163:1212-8. Florea VG, Florea ND, Sharma R, Coats AJ, Gibson DG, Hodson ME, et al. Right ventricular dysfunction in adult severe cystic fibrosis. Chest 2000;118:1063-8. Tonelli AR, Fernandez-Bussy S, Lodhi S, Akindipe OA, Carrie RD, Hamilton K, et al. Prevalence of pulmonary hypertension in end-stage cystic fibrosis and correlation with survival. J Heart Lung Transplant 2010;29:865-72. Kitabatake A, Inoue M, Asao M, Masuyama T, Tanouchi J, Morita T, et al. Noninvasive evaluation of pulmonary hypertension by a pulsed Doppler technique. Circulation 1983;68:302-9. van Dijk AP, Hopman JC, Klaessens JH, van der Werf T, Daniëls O. Is noninvasive determination of pulmonary artery pressure feasible using deceleration phase Doppler flow velocity characteristics in mechanically ventilated children with congenital heart disease? Am J Cardiol 1996;78:1394-9. Gaultier C, Boulé M, Allaire Y, Clément A, Burry A, Girard F. Determination of capillary oxygen tension in infants and children: Assessment of methodology and normal values during growth. Bull Europ Physiopath Resp 1978;14:287-94. Knudson RJ, Lebowitz MD, Holberg CJ, Burrows B. Changes in the normal maximal expiratory flow-volume curve with growth and aging. Am Rev Respir Dis 1983;127:725-34. Quanjer PH. Standardized lung function testing. Eur Resp J 1993;6 (Suppl. 16):5-30s. Lang RM, Bierig M, Devereux RB, Flachskampf FA, Foster E, Pellikka PA, et al. Recommendations for chamber quantification: A report from the American Society of Echocardiography’s Guidelines and Standards Committee and the Chamber Quantification Writing Group, developed in conjunction with the European Association of Echocardiography, a branch of the European Society of Cardiology. J Am Soc Echocardiogr 2005;18:1440-63. Badesch DB, Champion HC, Sanchez MA, Hoeper MM, Loyd JE, Manes A, et al. Diagnosis and assessment of pulmonary arterial hypertension. J Am Coll Cardiol 2009;54:S55-S66. Yock PG, Popp RL. Noninvasive estimation of right ventricular systolic pressure by Doppler ultrasound in patients with tricuspid regurgitation. Circulation 1984;70:657-62. Paiva R, Krivec U, Aubertin G, Cohen E, Clément A, Fauroux B. Carbon dioxide monitoring during long-term noninvasive respiratory support in

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Damy et al.: PH in cystic fibrosis

17.

18.

19. 20.

21.

22. 23. 24.

children. Intensive Care Med 2009;35:1068-74. Arcasoy SM, Christie JD, Ferrari VA, Sutton MS, Zisman DA, Blumenthal NP, et al. Echocardiographic assessment of pulmonary hypertension in patients with advanced lung disease. Am J Respir Crit Care Med 2003;167:735-40. Fisher MR, Forfia PR, Chamera E, Housten-Harris T, Champion HC, Girgis RE, et al. Accuracy of doppler echocardiography in the hemodynamic assessment of pulmonary hypertension. Am J Respir Crit Care Med 2009;179:615-21. Vizza CD, Yusen RD, Lynch JP, Fedele F, Alexander Patterson G, Trulock EP. Outcome of patients with cystic fibrosis awaiting lung transplantation. Am J Respir Crit Care Med 2000;163:819-25. Topilsky Y, Tribouilloy C, Michelena HI, Pislaru S, Mahoney DW, EnriquezSarano M. Pathophysiology of tricuspid regurgitation: Quantitative Doppler echocardiographic assessment of respiratory dependence. Circulation 2010;122:1505-13. Serwer GA, Cougle AG, Eckerd JM, Armstrong BE. Factors affecting use of the Doppler-determined time from flow onset to maximal pulmonary artery velocity for measurement of pulmonary artery pressure in children. Am J Cardiol 1986;58:352-6. Kosturakis D, Goldberg SJ, Allen HD, Loeber C. Doppler echocardiographic prediction of pulmonary arterial hypertension in congenital heart disease. Am J Cardiol 1984;53:1110-5. Matsuda M, Sekiguchi T, Sugishita Y, Kuwako K, Iida K, Ito I. Reliability of non-invasive estimates of pulmonary hypertension by pulsed Doppler echocardiography. Br Heart J 1986;56:158-64. Dabestani A, Mahan G, Gardin JM, Takenaka K, Burn C, Allfie A, et al.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

25.

26. 27.

28.

29. 30. 31.

Evaluation of pulmonary artery pressure and resistance by pulsed Doppler echocardiography. Am J Cardiol 1987;59:662-8. Rovedder PM, Ziegler B, Pinotti AF, Menna Barreto SS, Dalcin Pde T. Prevalence of pulmonary hypertension evaluated by Doppler echocardiography in a population of adolescent and adult patients with cystic fibrosis. J Bras Pneumol 2008;34:83-90. Belkin RA, Henig NR, Singer LG, Chaparro C, Rubenstein RC, Xie SX, et al. Risk factors for death of patients with cystic fibrosis awaiting lung transplantation. Am J Respir Crit Care Med 2006;173:659-66. Gottlieb JD, Schwartz AR, Marshall J, Ouyang P, Kern L, Shetty V, et al. Hypoxia, not the frequency of sleep apnea, induces acute hemodynamic stress in patients with chronic heart failure. J Am Coll Cardiol 2009;54:1706-12. Fauroux B, Hart N, Belfar S, Boulé M, Tillous-Borde I, Bonnet D, et al. Burkholderia cepacia is associated with pulmonary hypertension and increased mortality among cystic fibrosis patients. J Clin Microbiol 2004;42:5537-41. Milla CE, Warwick WJ. Risk of death in cystic fibrosis patients with severely compromised lung function. Chest 1998;113:1230-4. Liou TG, Adler FR, FitzSimmons SC, Cahill BC, Hibbs JR, Marshall BC. Predictive 5-year survivorship model of cystic fibrosis. Am J Epidemiol 2001;153:345-52. Mayer-Hamblett N, Rosenfeld M, Emerson J, Goss CH, Aitken ML. Developing cystic fibrosis lung transplant referral criteria using predictors of 2-year mortality. Am J Respir Crit Care Med 2002;166:1550-5.

Source of Support: Nil, Conflict of Interest: None declared.

Met hodol ogi cal A p p r o ach fo r Re s e a r c h

Identification of functional progenitor cells in the pulmonary vasculature Amy L. Firth1 and Jason X.-J. Yuan2 1

The Salk Institute of Biological Studies, La Jolla, California, 2Departments of Medicine and Pharmacology, Institute for Personalized Respiratory Medicine, Center for Cardiovascular Research, University of Illinois at Chicago, Chicago, Illinois, USA

ABSTRACT The pulmonary vasculature comprises a complex network of branching arteries and veins all functioning to reoxygenate the blood for circulation around the body. The cell types of the pulmonary artery are able to respond to changes in oxygen tension in order to match ventilation to perfusion. Stem and progenitor cells in the pulmonary vasculature are also involved, be it in angiogenesis, endothelial dysfunction or formation of vascular lesions. Stem and progenitor cells may be circulating around the body, residing in the pulmonary artery wall or stimulated for release from a central niche like the bone marrow and home to the pulmonary vasculature along a chemotactic gradient. There may currently be some controversy over the pathogenic versus therapeutic roles of stem and progenitor cells and, indeed, it is likely both chains of evidence are correct due to the specific influence of the immediate environmental niche a progenitor cell may be in. Due to their great plasticity and a lack of specific markers for stem and progenitor cells, they can be difficult to precisely identify. This review discusses the methodological approaches used to validate the presence of and subtype of progenitors cells in the pulmonary vasculature while putting it in context of the current knowledge of the therapeutic and pathogenic roles for such progenitor cells. Key Words: differentiation, pulmonary hypertension, self-renewal, stem cell, technique and method, vascular remodeling

INTRODUCTION The current exploitation of stem cells as a therapeutic approach and research tool is due to their extraordinary ability to both self renew through mitotic cell division and differentiate into a vast array specialized cell types.[1] Stem cells, as a broad terminology, reflect two distinct cell types: (1) embryonic stem cells (ESC), which are pluripotent, having the ability to both self renew indefinitely and differentiate into cells of all 3 germ layers (endoderm, ectoderm and mesoderm); and (2) adult stem cells, which have differentiated but retain some capacity to self-renewal and are more restricted in their potential to differentiate.â&#x20AC;&#x2030;[2,3] For example, some adult stem cells (or tissue specific stem cells) are capable of giving rise to several specialized cell types (multipotent stem cells) while others are limited to a single specialized cell type (unipotent stem cell).[4] The descendants of stem cells and representing the next level of differentiation are Address correspondence to: Prof. Jason X.-J. Yuan Department of Medicine University of Illinois at Chicago 909 South Wolcott Avenue COMRB 3131 (MC719) Chicago, IL 60612, USA Email: jxyuan@uic.edu 84

progenitor cells. These cells have lost the ability for self-renewal. Stem cells and progenitor cells exist in a hierarchical system gradually becoming more lineage restricted. This system has been most comprehensively studied in the hematopoietic system as highlighted in Fig. 1. This intricate hierarchy system exists to preserve a homeostatic repair and maintenance of the body, replenishing specialized cells and sustaining the routine cellular turnover in regenerative organs.[5] Adult stem and progenitor cells may be either circulating or resident in a particular tissue/organ system. Several are known to be present in the lung and pulmonary vasculature including endothelial progenitor cells (EPC), mesenchymal stem cells (MSC), and hematopoietic stem cells (HSC).[3] This review describes commonly used methods to identify adult stem and progenitor cells currently known to be present in the pulmonary vasculature. This review also Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94841 How to cite this article: Firth AL, Yuan JX. Identification of functional progenitor cells in the pulmonary vasculature. Pulm Circ 2012;2:84-100.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

provides a practical instruction of the methodological approaches used to study pathogenic and therapeutic role of stem/progenitor cells in pulmonary vascular disease.

DISCUSSION

Stem cells in the pulmonary vasculature

Paradoxically, stem cells may have both a therapeutic benefit and a pathogenic role in the pulmonary vasculature. Evidence to date suggests that hematopoietic stem cells likely have a pathogenic role being elevated in perivascular regions of chronically hypoxic mice and pulmonary hypertension (PH) being attenuated when homing of HSC to these regions is prevented.[6] The potential roles of mesenchymal stem cells (MSC), or mesenchymal progenitor cells (MPC), and endothelial progenitor cells (EPC) seems to be a paradox between pathogenic and therapeutic roles. There are many studies supporting both roles and all are likely to be correct reflections. The conditions in which these cells are recruited and the niche in which they reside are hugely influential of their characteristics. Furthermore, ex vivo manipulation of these cells may have significant effects on the properties of the cells. The bone marrow is a niche where an expansive repertoire of stem and progenitor cells resides. In response to tissue injury or disease, these cells can be mobilized and are capable of homing to the lung. Such cells include HSC, MSC, and EPC and the key characteristics of each of these will be briefly described below with particular reference to their roles in pulmonary vascular disease. In addition, there are potentially many resident tissue progenitor cells that are either poorly characterized to date or have yet to be identified. A population of such cells has been identified in vascular walls and are, like most stem cell types, identified by their cell surface and intracellular marker expression, including CD133, CD44, and nestin. In the lung particularly these cells have been denoted side population cells (SP) and they can be further identified by their ability to efflux Hoechst 33342[7] due to a high expression level of the ATP binding cassette transporters (ABC) (e.g., ABCG2 enabling active efflux of the dye).[8]

HSC and the pulmonary circulation

Hematopoietic stem cells are perhaps the best characterized stem cells with their differentiation capacity fully delineated (Fig. 1). A single HSC is capable of differentiation to all blood cells which includes (1) myeloid cells encompassing monocytes, macrophages, neutrophils basophils, eosinophils, erythrocytes, megakaryocytes/platelets and dendritic cells, and (2) lymphoid cells comprising T-cells, B-cells, and natural killer cells. Mammalian hematopoiesis occurs in three distinct phases, the first two of which are Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 1: Hematopoietic stem cell hierarchy. Self-renewing HSC give rise to several multipotent progenitors (colony forming units (CFU), common myeloid progenitor (CMP) and common lymphoid progenitors (CLP)), which, in turn, produce oligopotent progenitors, unipotent progenitors and eventually fully differentiated cells. The CMP is able to produce granulocyte-macrophage progenitors (GMP) and megakaryocyte/erythrocyte progenitors (MEP) giving rise to monocyte/macrophages/granulocytes and megakaryocytes/platelets/ erythrocytes, respectively. Erythoid burst forming unite (BFU-E) give rise to pro-erythroblast colony forming unit–erythroid (CFU-E) before erythrocytes are formed and the CLP gives rise to pre-B and pre-T cells which continue to mature into mature B and T lymphocytes. (Adapted with permission from reference 84).

primitive and definitive originate in the yolk sac where hemangioblasts develop. These multipotent precursors give ride to endothelial as well as primitive and definitive hematopoietic progeny. The emergence of the HSC is, however, uncertain and is postulated to be either from the yolk sac or the paraaortic splanchnopleure/aorta-gonadmesonephros (P-Sp/AGM) prior to their detection in the fetal liver. For in-depth analysis of the current data for human HSC emergence, readers are encouraged to read the articles by Robertson et al., Dzierzak, Medvinsky et al., and Tavian et al.[9-12] Adult HSC are round, nonadherent cells with a high nucleuscytoplasm ratio and they reside primarily in the bone marrow and have the ability to leave the niche and home back to it. The stromal-derived factor-1 (SDF-1/CXCL12)/ CXCR4 axis is critical for such homing and mobilization of HSC.[13] In the pulmonary circulation, this mechanism 85

Firth and Yuan: Progenitor cells in pulmonary artery

has also been shown to be important for homing of c-Kit+ hematopoietic progenitor cells to a perivascular niche in mice.[6] It is worth noting that in mice exposed to chronic hypoxia (CH) the expression levels of CXCR4, CXCR7, and CXCL12 are all elevated after onset of pulmonary hypertension. Administration of an antagonist of CXCR4 has been observed to prevent PH and reduce the associated vascular remodeling and perivascular accumulation of hematopoietic progenitor cells.[6] It will be interesting to see if similar mechanisms exist in humans.

Cell surface markers commonly used in combination to select for mononuclear HSC include CD34, CD133, and CD117 (c-Kit) in the human, in addition to a lack of differentiation markers CD2, CD3, CD14, CD16, CD19, CD24, CD56, CD66b, glycophorin A (Lin–). HSC can also be distinguished by their poor ability to accumulate metabolic fluorochromes such as DNA stain Hoechst 33342, rhodamine 123 or mRNA marker pyronin Y.[14,15] Low incorporation of mitochondrial dye (e.g., rhodamine 123) occurs due to its rapid efflux through activity of P-glycoprotein, a multidrug efflux pump.[16] Furthermore, the expression of integrin α6 (CD49f) in conjunction with Thy-1 (CD90), CD34 and the absence of CD45-RA and CD38 with low rhodamine 123 incorporation, has recently been shown to identify a single HSC capable long-term, multilineage reconstitution of an immunocompromised mouse though a single-cell intrafemoral transplant.[17] Collection of HSC from blood samples requires a FicollPaque density gradient centrifugation to deplete the erythrocytes and granulocytes from an anticoagulanttreated and diluted blood sample.[18] Ammonium chloride buffer can be used to lyse the erythrocytes in the sample enriching for HSC and other blood cells. Subsequent purification steps involve separation by cell surface marker expression using FACS or paramagnetic beads. Identification of HSC in tissue samples can be carried out by multicolor immunohistochemistry as detailed in this review.

Ficoll-Paque density gradient centrifugation[18]

It is imperative that all solutions and equipment must be sterile and used with proper aseptic technique.

Procedure 1. Place 15 ml of Ficoll-Paque solution into a 50 ml centrifuge tube 2. Carefully layer 30 ml of diluted blood on the FicollPaque solution. Do not mix the blood and Ficoll-Paque solution 3. Centrifuge for 40 minutes at 400×g at 20°C 4. Collect the mononuclear cell fraction carefully using a Pasteur pipette at the interface between plasma and Ficoll-Paque and transfer into a clean centrifuge tube 86

5. If erythroid cells are present in the interface try treatment with 8% ammonium chloride or 3% diethylene glycol a. Centrifuge cells for 10 minutes at 700×g b. Add 5-20 ml of lysis solution to the pellet, mix the suspension, and incubate 5-10 minutes at room temperature c. Centrifuge for 10 minutes at 700×g. Discard supernatant and proceed 6. Add 40 ml PBS/EDTA to wash the mononuclear fraction and centrifuge for 10 minutes at 300×g at 20°C 7. Discard the supernatant and repeat the wash with 40 ml PBS/EDTA and centrifuge again 8. Discard the supernatant and resuspend the mononuclear cells in 5-10 ml of PBS/0.5% BSA/2 mM EDTA and count the cells.

Functional activity of true HSC can be confirmed by in vitro differentiation to both myeloid and lymphoid lineages or be transplanted into immunocompromised mice and the long-term engraftment potential assessed. For more detail on intrafemoral injections for the transplantation of human HSC into immunocompromised mice please refer to the papers by Mazurier et al.[19] and McDermott et al.[20] Myeloid differentiation can be assessed by a methylcellulose colony forming unit assay. Methylcellulose is a semisolid media complete with cytokines supporting differentiation to myeloid cells (Stem Cell Technologies). Hematopoietic colonies grow in a three-dimensional nature and can be scored dependent upon the cell type they are formed from. A true HSC will be able to generate all myeloid cells from a single cell (thus a single myeloid colony forming unit containing granulocytes, erythrocytes, monocytes, megakaryocytes (CFU-GEMM)).

Methylcellulose assay for myeloid colony forming units

Procedure 1. After magnetic or FACS sorting carefully mix approximately 1×105 CD34+ cells in 2 ml of MethoCult GF H4434 (Stem Cell Technologies: 1% methylcellulose, 30% FBS, 1% BSA, 0.1 mM 2-mercaptoethanol, 2 mM l-glutamine, 50 ng/ml rhSCF, 10 ng/ml rhGMCSF, 10 ng/ml rhIL-3, and 3 U/ml rhEPO. Ensure that no bubbles are generated 2. Dispense the mix carefully into petri dishes using a syringe and blunt end needle and incubate in a humidified incubator at 37°C, 5 % CO2 3. Hematopoietic colonies can be enumerated and identified at days 14–21.

MSC and the pulmonary circulation

Mesenchymal stem cells are also referred to as multipotent mesenchymal stromal cells or multipotent progenitor cells (MPC) and are known to reside in niches where a turnover of mesenchymal-derived tissues occurs; this includes but Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

may not be limited to the bone marrow, muscle, fat, skin, and cartilage. These cells demonstrate a great plasticity and, in the right conditions/niche, they are capable of changing from one lineage to another thus making characterization of this cell type particularly difficult. Due to the difficulties in defining MSC, the International Society for Cellular Therapy set a minimal criterion for putative MSC. To fulfill this criterion MSC must be adherent to plastic, they must express cell surface markers CD105, CD73, and CD90 and lack the expression of CD45, CD34, CD14 or CD11b, CD79α or CD19 and HLA-DR, and finally they should have the ability to differentiate osteoblasts, adipocytes, and chondroblasts in vitro.[21] Figure 2 shows a clear representation of MSC self-renewal and differentiation to all potential progeny.

Due to their great plasticity and homing capabilities, MSC have a huge potential as a therapeutic approach.[22] On the other hand, these same properties make them candidates for contributing to the vascular remodeling characteristic of PH. The therapeutic potential of MSC has been widely studied in the cardiovascular system where they are used as autologous cell therapy.[23] Recently an intravenous injection of MSC was used to treat experimentally induced PH in rats (monocrotaline model); significant improvements were observed in the right ventricular (RV) impairments in these rats. MSC were still alive and capable of endothelial cell differentiation in these rats 2 weeks post-transplantation. [24,25] The significant improvements in pulmonary arteriolar thickness are clearly seen in Figure 3.

MSC also have the potential to be a vehicle for gene therapy for lung disease due to their preferential homing to the lung. Several studies have now investigated the use of MSC as a tool for drug/gene delivery and considerable improvements in the pathogenesis of PH have been observed. This approach has been used to deliver agents including angiopoietin-1 for acute lung injury,[26] endothelial nitric oxide synthase (eNOS) for PAH-related RV impairment,[27] heme-oxygenase-1 for PH[28] calcetonin gene-related peptide in vascular smooth cell proliferation,[29] and prostacyclin-synthase for PH.[30] They have been similarly exploited in other diseases with positive benefits observed, for example hetatocellular carcinoma[31] and metastatic cancers.[32] There are now several studies demonstrating a contribution of MSC to the pathogenesis of PH. The vascular adventitia itself is known to contain MSC/MPC[33] and the vasculature is also known to contain a side population of CD45 –, c-kit –, CD11b –, CD34 –, CD14 –, CD44 +, CD90 +, CD105 +, CD106+, CD73+, and Sca-I+ with adipogenic, osteogenic, and chrondrogenic potential.[34] The exact roles of such resident stem cells are yet to be fully elucidated and it is established that the environmental niche is critical in regulating the maintenance and differentiation of stem cells, thus making the pathogenic roles of such cells difficult to fully understand in animal models and in vitro conditions. Fibrocytes are a progenitor cell derivative of an MSC capable of differentiating into fibroblasts and myofibroblasts. Circulating fibrocytes have been

Figure 2: The mesengenic process. MSC self-renewal, proliferation, and potential lineage specific differentiation pathways are depicted in this diagram. MSC differentiate by committing, differentiating, and maturing in a lineage specific fashion. (Reproduced with permission from reference 84.). Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

(A)

(B)

(C)

(D)

Figure 3: Immunoperoxidase images of paraffin sections of lung tissue stained with anti-α-smooth muscle actin antibody. (A) Representative pulmonary arterioles of control, monocrotaline treated (MCT60), and monocrotaline and MSC treated (MCT + MSC) rats. Images were acquired using a ×100 objective. (B) Pulmonary arteriolar wall thickness (in %) of control, MCT60, and MCT + MSC rats. Values are means ± SD. ***P<0.001 vs. the control group; ###P<0.001 vs. the MCT60 group. (C) Immunoperoxidase images of paraffin sections of lung tissue stained with anti-α-smooth muscle actin antibody. The lung histology of rats in the control, MCT60, and MCT + MSC is shown. Images were acquired using a ×20 objective. (D) Pulmonary alveolar septum thickness (in %) of control, MCT60, and MCT+MSC rats. Values are means ± SD. ***P<0.001 vs. the control group; ###P< 0.001 vs. the MCT60 group. (Reproduced with permission from reference 25).

shown to contribute to the deposition of extracellular matrix in pulmonary fibrosis. [35] Fibrocytes and MSC have also been shown to be recruited and contribute to pulmonary vascular remodeling in hypoxia-induced pulmonary hypertension. [36,37] Inhibition of CXCR4 signaling is a potential therapeutic approach in hypoxic induced PH as evidence suggests that its inhibition prevents the mobilization of bone-marrow-derived MSC to the pulmonary vasculature.[38] Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELM α) may also act as a chemotactic agent for bone-marrow-derived MSCmediated remodeling of the pulmonary vasculature in chronic hypoxia-mediated PH.[39]

Pulmonary hypertension is known to be an extremely complex phenomena with multiple pathways existing and contributing to the various aspects of the disease.[40-44] While it may be impossible to define the triggering event, research continues to show interaction of the pathways. Recently the roles of seretonin signaling and MPC were linked, with the expression of 5-HT2B receptors on bone-marrow-derived MPC shown to be critical for the development of PAH in mice.[45] Furthermore, mesenchymal cells with all the traits of an MSC have been found to have a high presence in endarterectomized tissues from patients with chronic thromboembolic pulmonary hypertension (CTEPH).[46] The 88

role of fibrocytes, a mesenchymal-derived progenitor cell, in the pulmonary vasculature is comprehensively reviewed by Stenmark et al.[47]

Functional activity of putative MSC can be confirmed by verification of their differentiation capacity once their cell surface markers expression has been assessed. A true MSC should be capable of differentiation to adipocytes, chondrocytes, osteocytes, and myocytes. Complete kits designed for adiopcyte, chondrocyte, and osteocyte differentiation from MSC are commercially available or medias can be made in-house. The protocols described below are adapted from the commercially available Invitrogen protocols and the paper by Reger et al. [48] Figure 4 demonstrates a basic characterization of bonemarrow-derived MSC by FACS and their differentiation to adipocytes and osteocytes. In addition, human MSC have recently been shown to be an excellent source of SMC for arterial engineering.[49,50] The differentiation is pushed by the addition of transforming growth factor β (TGFβ) and cells acquire a contractile smooth muscle cell phenotype. [51] With the ever increasing need for rapid tests to confirm differentiation to validate the stem cell phenotype, Boucher et al. developed a PCR screen designed to detect the early stages of mesenchymal stem cell differentiation.[52] Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

C A Figure 4: Characterization of bone-marrow-derived MSC. This figure highlights a core set of marker expression patterns used in flow cytometry to isolate putative MSC (A) and differentiation to osteocytes (B) stained with alizarin red and adipocytes (C) stained with oil red O.

Adipocyte differentiation (adapted from reference 48) Grow putative MSC in a suitable growth medium (e.g., αMEM minus deoxy- and riboxynucleosides, 15% FBS, 1% Pen/Strep, 1% Glutamax) to 60–80% confluence. Aspirate medium and gently wash the cells in PBS.

Procedure 1. Add 2-7 ml of prewarmed TrypLE™ Express (Invitrogen), sufficient to cover the culture surface and incubate until cells have detached (~3-8 minutes at 37°C) 2. Gently triturate the detached cells to form a single cell solution using a wide bore glass pipette 3. Pellet the cells at 100×g for 5 minutes 4. Cell viability and total cell density may be determined at this stage using Trypan Blue Stain and counting the cells using a hemocytometer (or other suitable cell counting method) 5. Resuspend the pellet in appropriate volume of prewarmed MSC Media and seed the putative MSC into the selected culture vessel at a density of 1×104 cells/ cm2. Culture vessels should be selected as follows: a. For classical stain differentiation assay use a 12well plate b. For gene expression profiling use a T-75 flask c. For immunocytochemistry use a 16-well Culture Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Well chambered cover glass 6. Incubate in a humidified atmosphere at 37°C, 5% CO2 for 2 hours to 4 days 7. Replace media with prewarmed adipogenesis differentiation medium consisting of αMEM minus de- and rib-oxynucleosides, 15% FBS, 1% Pen/ Strep, 1% Glutamax, 0.5 μM dexamethasone, 0.5 μM isobutylmethylxanthine and 50 μM indomethacin and continue incubation changing media every 3-4 days. It should be noted that MSC may continue to undergo limited expansion as they differentiate 8. After determined periods of incubation (up to 21 days) staining the cultures with oil red O will confirm the presence of adipocytes.

Oil red O stain analysis

Procedure 1. Prepare the oil red O stain as follows: 0.5% oil red O stock solution: 2.5 g oil red O into 500 ml isopropyl alcohol and dissolve completely. From the stock make a working solution of three parts 0.5% oil-red-O Stock; two parts PBS. Mix this thoroughly and wait 10 minutes. Filter and wait a further 10 minutes before use 2. After 21 days of differentiation aspirate the medial and wash twice with PBS 3. Add 2 ml of neutral buffered formalin (NBF) and 89

Firth and Yuan: Progenitor cells in pulmonary artery

incubate for 1 hour at room temperature 4. Aspirate the NBF and wash the wells with 2 ml PBS. 5. Add 2 ml of oil red O and incubate for 20 minutes at room temperature, then aspirate 6. Rinse the wells twice with 2 ml of PBS and aspirate 7. Add a final 2 ml of PBS and examine plate on an inverted microscope for evidence of fat deposits and/or bone differentiation.

Chondrocyte differentiation (adapted from reference 48)

Procedure 1. Repeat steps 1-5 from the adipogenesis differentiation protocol 2. Resuspend the pellet in appropriate volume of prewarmed chondrocyte media with cytokines (DMEM High Glucose, 50 μg/ml L-ascorbic acid-2-phosphate, 40 μg/ml L-Proline, 100 μg/ml sodium pyruvate, ITS Culture Supplement (BD Biosciences) 10 ng/ml rhTGF-β3, 10 nM dexamethasone, 500 ng/ml rhBMP-2 or rhBMP-6) and generate a cell solution of viable cells at a density of 1.6×107 cells/ml 3. Count cells and assess viability. Adjust to approximately 400 viable cells/μl with chondrocyte media with cytokines 4. Transfer approximately 200,000 MSC in 500 μl to a 15 ml falcon tube and centrifuge at 450×g for 10 minutes 5. Do not resuspend or remove the media and incubate in a humidified atmosphere at 37°C, 5% CO2 6. Fresh medium should be added every 3 days 7. After determined periods of incubation the chondrogenic pellets can be confirmed by staining with alcian blue or safranin O (21 days).

Alcian blue stain analysis

Procedure 1. After differentiation for 21 days remove medium, wash cells and fix in 4% PFA for 10-30 minutes 2. Wash fixed cells and stain with 1% alcian blue solution prepared in 0.1 N HCL for 30 minutes 3. Wash ×3 with 0.1 N HCl, add distilled water to neutralize the acidity and visualize under light microscope. Blue staining is indicative of proteoglycan synthesis by chondrocytes.

Osteocyte differentiation (adapted from reference 48)

Procedure 1. Repeat steps 1-8 from the adipogenesis differentiation protocol, except: 2. Seed the MSC into the selected culture vessel at a density of 5×103 cells/cm2 3. Replace media with prewarmed osteogenesis differentiation media (.αMEM minus deoxy- and riboxynucleosides, 15% FBS, 1% Pen/Strep, 1% 90

glutamax, 10 nM dexamethasone, 20 mM β glycerol phosphate, 50 μM L-ascorbic acid-2-phosphate) 4. After specific periods of cultivation, osteogenic cultures can be processed for alkaline phosphatase staining (7-14 days) or alizarin red S staining (>21 days).

Alizarin red S stain analysis

Procedure 1. After 21 days, remove media and wash once in DPBS. Fix with 4% PFA for 10–30 minutes or NBF for 1 hour at room temperature 2. Wash fixed cells twice with distilled water and stain with 2% alizarin red S solution for 2-3 minutes. Alizarin red should be prepared as follows: 1 g alizarin red S in 100 ml DI water and the pH should be adjusted to 4.1 and 4.3 using 0.1% ammonium hydroxide before filtering 3. Wash ×3 with distilled water and visualize under light microscope.

My ocy t e di ffe r e n t i at i on (adapt e d f r om reference 49) Procedure 1. Repeat steps 1-8 from the adipogenesis differentiation protocol, except: a. Seed MSC into the selected culture vessel at a density of 2.4×103 cells/cm2 b. Replace media with prewarmed MesenPro RS™ with 1 ng/ml TGFβ and change media twice a week 2. After approximately 14 days cultures can be processed for expression of smooth muscle marker including, but not exclusively; SM-22α (transgelin), smooth muscle-myosin heavy chain (SM-MHC), smoothelin, and caldesmon.

Simplified PCR screen for early stages of mesenchymal stem cell differentiation (adapted from reference 52)

Procedure 1. Follow suitable differentiation protocols as outlined above 2. Harvest RNA from cultures after 7 days of differentiation. 3. Isolate total RNA and synthesize first strand cDNA using an appropriate commercially available kit 4. Run the PCR using the primer pairs listed below and run agarose gel to resolve the PCR products.

Primers required for screen

B2M (β-2-microglobin), a housekeeping gene, (314 bp) F`: GCGTACTCCAAAGATTCAG, R`: CAAACCTCCATGATGCTG: CD73 (5` ecto nucleotidase) an MSC cell surface marker, (414 bp) F`: CAATTGTCTATCTGGATGGC, R`: GACACTTGGTGCAAAGAAC: RGC32 (response gene to complement 32) an early osteocyte cell marker, ( 1 6 6 b p ) F ` : G C C A C T T C C A C TA C G A G G A G , R ` : Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

GCTGGGGTAGAGTCTGTTGG: FABP4 (fatty acid-binding protein 4) an early adipocyte cell marker, (215 bp) F`: TCATACTGGGCCAGGAAT, R`: TCCCTTGGCTTATGCTCT: SPP1 (bone sialoprotein 1) an early chondrocyte cell marker, (229 bp) F`: CTCCATTGACTCGAACGACTC R`: CAGGTCTGCGAAACTTCTTAGAT.

EPC and the pulmonary circulation

EPC exist in a hierarchy with individual subdivisions identified by the ability of the cell to divide in a clonogenic nature and to proliferate.[53,54] EPC is the all-encompassing term used to refer to the entire group of these cells but really should be restricted cells with the correct cell surface marker expression and with the ability of form de novo vessels. The first recognition of EPCs was back in 1997 when a population of circulating CD34 positive cells capable of in vitro differentiation and de novo vessel formation was identified.[55] Prior to this discovery, new blood vessel formation was thought to rise from the proliferation, migration and remodeling of mature endothelial cells. EPC function in the pulmonary vascular system is, however, currently controversial. The diagram in Figure 5 overviews this current paradox.

In a monocrotaline (MCT)-induced canine model of PH, neovascularization and a reduction in mean pulmonary arterial pressure (mPAP), cardiac output (CO), and pulmonary vascular resistance (PVR) were observed after transplantation of ex vivo expanded autologous EPC from peripheral blood.[56] Similar results where EPC engraft, restoring microvasculature structure, and function

were observed in MCT induced PH in rats.[57] In mice, the endogenous erythropoietin/erythropoietin receptor (Epo/EpoR) system is important in recruiting EPC to the pulmonary vasculature and a therapeutic benefit is observed with an attenuation of the development of PH.[58] In support of a therapeutic benefit of EPC it has been noted that a severe depletion of circulating EPCs correlates to the development of chronic lung disease, idiopathic pulmonary fibrosis (IPF) and PH.[59,60] Furthermore, in IPF patients who developed secondary PH, the depletion of EPC was comparatively worse implicating a clinical benefit of therapies positively modulating EPCs.[60] In 2007, the therapeutic benefit of EPC in PH was explored further by the initiation of clinical trials. A prospective, randomized trial comparing the effects of conventional therapy with or without the intravenous infusion of EPC in patients with IPAH demonstrated significant improvements in the mean walk test, mPAP, PVR, and CO in the patients with the EPC treatment.[61] There is also evidence suggesting that the clinical benefit of prostanoids may be due to/enhanced by EPC.[62] With evidence supporting the number of circulating EPC correlating to cardiovascular risk, a group designed a disposable microfluidic platform capable of selectively capturing and enumerating EPC directly from human whole blood. Using this chip they confirmed a 50% reduction in EPC in PAH subjects versus matched controls.[63] This EPC capture chip may be used in the screening and monitoring of patients with PAH in the future. EPC are capable of being mobilized in response to vascular injury. For example, VEGF is known to effectively mobilize EPC and potently induces angiogenesis; shear stress can also promote EPC

Figure 5: The EPC paradox: Contribution to disease development or vascular healing in pulmonary hypertension. IL: Interleukin; TNF: Tumor necrosis factor; VEGF: Vascular endothelial growth factor; SDF: Stromalcell-derived factor; CCL: Chemokine (C-C motif) ligand. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

differentiation into mature endothelial cells.[64] Homing of EPC to a site of injury is likely due to cell surface expression of chemokine receptor CXCR4 and the chemoattractant pull of SDF-1, released from EPC and platelets. Furthermore, high levels of β2 integrins on EPC can interact with their ligands P-selectin, E-selectin, and ICAM-1 that are expressed on EPC.[65]

Despite the wealth of research supporting a therapeutic benefit of EPC, there are also studies providing evidence for a pathogenic role of these cells. The contribution of progenitor cells to pulmonary vascular remodeling was recently reviewed and readers are encouraged to read Yeager et al. for a detailed discussion.[42] Briefly, EPCs have been found to contribute substantially to the development of plexiform lesions in PH,[66] endothelial to mesenchymal transition resulting in fibrosis,[67,68] and to the fibrotic embolism in patients with CTEPH. [69] The increased expression of CXCR4 and SDF-1 in plexiform lesions from patients with idiopathic pulmonary hypertension is nicely demonstrated in Figures 6 and 7, clearly showing the characteristics of CD133, von Willebrand factor, CCD34 and CD146 positive late outgrowth EPC isolated from the plexiform lesions.[66]

Mead et al. [70] describe in detail the isolation and characterization of EPC. Table 1 provides a detailed comparison of the cellular markers and vasculogenic activity of derivatives of EPCs. Identification of functional EPC can be carried out using acylated-LDL (low-density lipoprotein), readily uptaken by endothelial cells through the “scavenger cell pathway” of LDL metabolism.[71] By examining the fluorescent signals, uptake of DiI-Ac-LDL (1,1’-dioctadecyl3,3,3’,3’-tetramethyl-indocarbocyanine perchlorate) has been used to demonstrate how putative progenitor populations take on properties of functional endothelial cells.[72,73] EPC functionality may also be assessed through the formation of bona fide tubes in vitro in Matrigel; this characteristic is unique to endothelial cells. [74] The most rigorous test of

putative EPC is the engraftment into, or de novo formation of, functional blood vessels in vivo. An intravenous injection of EPCs directly into injured tissues, or implanted within a matrix or tumor environment, is utilized, and by prelabeling the cells of interest with a fluorescent dye[75] or transducing cells with a viral-driven fluorescent reporter,[76] precise microscopic examination of vasculature within these injured or implantation sites can be carried out via confocal image analysis. Transmission electron microscopy may be used to further demonstrate the ultrastructure of the tube formed in the in vitro assay and the blood vessels formed in the in vivo assay. Examples of both in vitro and in vivo vessel formation by EPC are shown in Figure 8.

Uptake of DiI-Ac-LDL (adapted from reference 53) Procedure 1. Propagate endothelial cells on glass-bottom chamber slides 2. Aspirate culture medium and wash the cells with PBS 3. Incubate the attached cells with 10 mg/ml DiI-Ac-LDL in complete endothelial growth media (e.g., EGM, Lonza) for 4 hours at 37°C 4. Aspirate media and wash twice in PBS to remove free DiI-Ac-LDL 5. Fix the cells with 3% PFA/PBS for 10 minutes 6. Mount the slide with Vectashield with DAPI (Vector Lab) 7. Examine the slide with rhodamine filter for DiI-AcLDL and Hoechst filter for DAPI in a fluorescence microscope and acquire images.

Assessment of tube formation in vitro (adapted from reference 54)

Procedure 1. Seed putative progenitor cells at 2×104 cells/cm2 in Matrigel (BD Biosciences)-coated (100 µl/cm2) 48-well plates, ~20,000 cells/well. Each well should contain 400 µl standard culture medium. Lung fibroblasts are suitable to use as a control. Each putative progenitor

Figure 6: Representative photomicrographs of peripheral lung tissue from (A and B) normal control lung and (C–H) a patient with pulmonary arterial hypertension (PAH); samples were immunostained for CXCR4 and stromal-cell-derived factor (SDF)-1. Minimal staining is seen in normal lung. (C and D) In PAH lung low-level staining was observed in concentric intimal lesions. (E and G) CXCR4 expression was generally increased in the lung parenchyma of patients with PAH, but was also present in the endothelium of plexiform lesions. (F and H) SDF-1 was less prevalent but showed clear staining of the endothelium of plexiform lesions. Scale bars: 50 μm. (Reproduced with permission from reference 66).

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

Table 1: Endothelial progenitor cells populations Markers

PECAM-1 VE-Cad. eNOS vWF Mucosialin VEGFR-2 Prominin-1/CD133 CD45 Integrin αM/CD11b M-CSFR CXCR4 Vessel formation Morphology

Circulating EPCs

Resident EPCs

Early-outgrowth EPCs CFU-EC

Late-outgrowth EPCs ECFC

Conduit-intimaderived EPCs

Conduit-vessel wall-derived EPCs Vw-EPC

+ +/+ + + + + + + + + No Spindle-like shape

+ + ? + + + + Yes Cobble-stone-like pattern

+ + ? + ? + ? ? ? ? Yes

+ −/lo ? + + + + + ? ? ? Yes

Micro-circulationderived EPC RMEPC + + + + + + − − ? ? ? Yes

These data were collated from independent studies: References 54 and 85-87. Abbreviations: PECAM-1: Platelet endothelial cell adhesion molecule or CD31; VEGFR2: Vascular endothelial growth factor receptor 2 or Flk-1 or CD309; VE-Cad.: Vascular endothelial cadherin or CD144; eNOS: Endothelial nitric oxide synthase; vWF: Von Willebrand Factor; M-CSFR: Macrophage colony-stimulating factor receptor or CD115; CXCR-4: C-X-C chemokine receptor type 4 or CD184; Adapted from reference 84

Figure 7: Phase-contrast photomicrographs of cultured late-outgrowth endothelial progenitor cells (EPCs) showing (A) a colony-forming unit at 3 days, and a late-outgrowth colony at (B) 2 weeks and (C) 3 weeks. Confocal immunofluorescence images using conjugated fluorescein isothiocyanate (green) demonstrate that occasional cells were positive for (D) CD133 and that the majority of cells were positive for (E) von Willebrand factor, (G) CD34, and (H) CD146. Nuclear counterstaining was performed with 4′,6-diamidino-2-phenylindole (blue). (F and I) Isotype controls for anti-mouse and anti-rabbit secondary antibodies. Scale bars: 50 μm. (Reproduced with permission from reference 66).

cell phenotype should be seeded triplicate 2. Incubate the plates in a humidified atmosphere at 37°C with 5% CO2-21% O2. Media should be changed 4 days after initial seeding

3. Take images on phase-contrast microscope at ×10 magnification at 8, 24, and 48 hours, and at 1 week after seeding 4. Determine the network formation by counting the

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

number of branches that connect 2 distant cells 5. Average counts from three wells at ×10 magnification were classed as one experiment; three separate experiments should be completed to determine a result.

Assessment of de novo vessel formation in vivo (adapted from reference 54)

Procedure 1. Resuspend the cells in 1.7 ml microtubes containing 250 µl standard culture medium at 4°C. The cell density should be 375,000 cells per tube 2. Mix the cell-containing solution with 500 µl of unpolymerized Matrigel at 4°C . The cold temperature is critical prevent polymerization of the Matrigel 3. Mildly sedate a rat (e.g., i.p. ketamine 75 mg/kg) 4. Inject the 750 µl of the cell/Matrigel mix subcutaneously into left and right lumbar abdominal regions of rats using a 23-gauge needle. This will create two plugs per animal. The injected mixture polymerizes at body temperature and forms a plug following subcutaneous contact 5. Controls should be carried out in parallel consisting of a Matrigel mix with no cells 6. Anesthetize the animal using sodium pentobarbital (i.p. 50 mg/kg) 7. Excise the Matrigel plugs from the abdominal wall of animals at 4 and 10 days postinjection and fix by immersion in 4% PFA for 18-24 hours 8. Dehydrate the fixed plugs in ethanol and embed in paraffin 9. Attach the tissue block to a plastic block by melting the back of the tissue block with a warm spatula and firmly pressing the two together and then use a standard 94

Figure 8: EPC tube formation in vitro. Bright-field image of human microvascular endothelial cells (HMECS) forming vascular networks on Matrigel after 12 hours (A). Fluorescent images of CellTracker Redlabeled HMECs at 9 hours on Matrigel (B). A sculpture designed from five snapshots of a computer simulation of branching morphogenesis illustrating the forces lung cells exert as they form capillaries. (A and B are reproduced with permission from reference 88, C is reproduced with permission from reference 89).

microtome to cut 5 µm sections 10. Stain the sections with hematoxylin and eosin (H and E) following a standard protocol 11. Examine the stained sections with a light microscope to count the total number of tubes containing red blood cells (i.e., blood vessels) within the gel.

General techniques for the identification of adult stem and progenitor cells in the pulmonary vasculature The identification of adult stem and progenitor cells require a rigorous characterization process, especially as there is no single feature or marker specific to each stem cell type capable of identification alone. Identification and isolation of cells based upon a panel of cell surface and cytosolic markers can be followed by functional assays to confirm the self-renewal and differentiation potential of the isolated cell population. Table 2 summarizes the cell surface and cytosolic markers known to be present (or absent) on the stem and progenitor cells. The expression of these markers can be utilized by a variety of techniques to identify and isolate stem cells in the pulmonary vasculature including immunohistochemistry, immunofluorescence, reverse transcription polymerase chain reaction (RT-PCR), protein detection by Western blot and flow activated cell sorting (FACS). Another characteristic of stem cells is their telomerase activity. Telomere length or telomerase activity measurements serve as a criterion to identify stem and progenitor cells. Telomeres are portions of genetic material involved in stabilizing the chromosome ends.[77,78] Long telomeres are prominently found in rapid-growing cells while short Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

Table 2: Cell surface markers expression of stem and progenitor cells known to be present in the pulmonary vasculature Marker

A.K.A.

CD10 CD11b CD13 CD14 CD29 CD31 CD34 CD38 CD44 CD45 CD49A CD49B CD49C CD49E CD49f CD51 CD54 CD58 CD59 CD61 CD62L CD71 CD73 CD79α CD90 CD102 CD104 CD105 CD106 CD117 CD120A CD122 CD124 CD126 CD127 CD133 CD144 CD166 CD309

Neural endopeptidase Integrin α M Alanine aminopeptidase Co-receptor Integrin β 1 PECAM-1 Mucosialin Receptor for hyaluronic acid LCA Half of α1β1 integrin duplex Half of α2β1 integrin duplex Integrin α 3 Integrin α 5 Integrin α 6 Integrin α V Intercellular adhesion molecule 1 Lymphocyte function-associated antigen 3 Protectin Integrin β 3 L-selectin Transferrin receptor 5’-nucleotidase, ecto Ig-α Thy-1 Intercellular adhesion molecule 2 Integrin β 4 Endoglin Vascular cell adhesion molecule 1 c-kit Tumor necrosis factor receptor Interleukin-2 receptor Interleukin 4 receptor Interleukin 6 receptor Interleukin 7 receptor Promimin-1 VE-Cadherin ALCAM VEGFR2

HSC

MSC

MPC -

+ + + -

+ +LO +

+ + + + +

+LO -

EPC

+ +

+/-

+ + + + +

+ + + + + + + + + + + + + +

+LO

+ + + +

HSC: Hematopoietic stem cell; MSC: Mesenchymal stem/stromal cell; MPC: Mesenchymal progenitor cell; EPC: Endothelial progenitor cell; PECAM: Platelet endothelial cell adhesion molecule or CD31; LCA: Leukocyte common antigen; VE-Cadherin: Vascular endothelial cadherin or CD144; ALCAM: Activated leukocyte cell adhesion molecule; VEGFR2: Vascular endothelial growth factor receptor 2 or Flk-1 or CD309. The absence of a +/− indicates no data found; Adapted from reference 84

telomeres are associated with replicative senescence and loss of stem cell proliferation capacity in vitro. Finally, the clonogenic potential of a cell is a rigorous test indicative of their stem/progenitor capacity, a single stem cell having the ability to divide and form a colony of cells in the absence of other cells.[53,79] A clonogenic assay has been utilized effectively to delineate a hierarchy of EPCs.[80]

Immunhistochemistry

Immunhistochemistry (IHC) is used to detect selected antigens within a tissue section by use of specific antibodies raised against the antigen in question. The technique can be used to investigate the distribution and localization of stem cells in tissue sections from the lung and pulmonary vasculature. There are two steps to the process: (1) preservation of the tissue; (2) detection of antigens specific to stem and progenitor cells. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Frozen section preparation

Procedure 1. Lung tissue should be carefully harvested and washed in chilled PBS. Place the sample in 30% sucrose/PBS solution at 4°C for 8-10 hours, then wash twice in PBS (5 minutes each) 2. Make sure all samples, bags and cryomolds are accurately labeled 3. To freeze the sample prepare a mix of dry ice and 2-methlylbutane in a plastic beaker, the temperature should approximately −40°C 4. Blot the excess sucrose from the tissue with gauze 5. Fill a cryomold halfway with Optimal Cutting Temperature (OCT) compound (Sakura Inc.) ensuring there are no bubbles in the OCT 6. Place the tissue in the OCT with the desired area of analysis facedown. Continue to fill the remainder of the mold with OCT 7. Carefully immerse the entire mold into the 95

Firth and Yuan: Progenitor cells in pulmonary artery

2-methylbutane for 30-40 seconds, remove, place in a labeled plastic bag and store at –80°C 8. Prior to sectioning, the samples should be placed in a cryostat for 1 hour to bring them to 20°C. Cut the tissue block to 5-8 µm thickness and place the sections on microscope slides. Store the slides at –20°C until use.

Immunohistochemistry—detection

Procedure 1. Thaw the frozen tissue sections from -20°C freezer at room temperature 2. Fix the tissue sections in 4% PFA/PBS for 5-10 minutes and then wash with PBS for 3×5 minutes 3. Slides may be incubated for 5–10 minutes in 0.1–1% hydrogen peroxide diluted in PBS, deionized H2O or methanol to quench endogenous peroxidase activity. Wash twice in PBS 4. Incubate sections for 1 hour in 1.5% normal blocking serum in PBS + 2% serum + 0.1% Triton X-100 (for permeabilization). The blocking serum should be derived from the same species as the secondary antibody was raised 5. Incubate with primary antibody for 1 hour at room temperature or overnight at 4°C. Optimal antibody concentration should be determined by titration; recommended range is 0.5–5.0 µg/ml diluted in PBS with 1.5% normal blocking serum. Wash with PBS for 3×5 minutes 6. Immunoperoxidase staining using the ABC staining system (Santa Cruz Biotechnology). Incubate for 30 minutes with biotin-conjugated secondary antibody as provided, or at approximately 1 µg/ml diluted in PBS with 1.5% normal blocking serum. Wash with PBS for 3×5 minutes 7. Incubate for 30 minutes with avidin biotin enzyme reagent. Wash with PBS for 3×5 minutes 8. Incubate in peroxidase substrate, as provided, for 0.510 minutes, or until desired stain intensity develops. Individual slides should be monitored to determine the best development time. Wash sections in deionized H2O for 5 minutes. If desired, counter-stain in Gill’s formulation #2 hematoxylin for 5–10 seconds. Immediately wash with several changes of deionized H2O 9. Dehydrate through alcohols and xylenes as follows: Soak in 95% ethanol 2 × 10 seconds, then 100% ethanol 2×10 seconds, then xylene 3×10 seconds. Wipe off excess xylene and immediately add 1–2 drops of permanent mounting medium (e.g., CC/Mount, Sigma), cover with a glass cover slip and observe by light microscopy

Fluorescent-activated cell sorting

Fluorescent-activated cell sorting (FACS) using antibodies for specific protein markers can be used to serrate cells one at a time by the light scatter of fluorescent labeled antibodies/probes. Advancements in FACS equipment 96

have enabled multicolour detection enabling multiple fluorescent probes to be detected on a single cell. Cells can be sorted in sterile conditions ready for further analysis. Magnetic bead separation can also be used and readers are encouraged to read Wills et al. for more detail.[81]

Procedure 1. Create a single cell suspension by using Accutase (Innovative Cell Technologies) or TrypLE (Invitrogen) or other suitable agent. Accutase helps to preserve cell surface antigens where trypsin-based products may have better dissociation activity 2. Wash cells once or twice with 2 ml cold PBS by centrifuging at 150-300×g at 4°C 3. Resuspend cells in Buffer (PBS + 1% BSA + 0.1% NaN3) and aliquot into 1-100×105 cells per 100 µl (total volume once antibodies added) in Falcon #2052 or #2054 tubes on ice 4. Add 20 µl of monoclonal antibody (1-10 µg/ml final concentration) or isotype control antibody. Antibodies will need to be titrated to determine optimal concentration 5. Incubate 30 minutes on ice or at 4°C, in the dark if using directly conjugated antibodies 6. Wash with 2 ml cold azide buffer 7. Resuspend in 100 µl of secondary antibody (e.g., fluorophore conjugated goat antimouse IgG). Skip to step 10 if using directly conjugated mAb 8. Incubate 30 minutes on ice in the dark and then wash with azide buffer 9. Resuspend in 100–500 µl cold wash buffer and add equal volume of cold buffered 3% PFA to fix cells and analyze or; leave in wash buffer and analyze live, add propidium iodide, 0.5 µg/ml final concentration. Live cells can be sorted by a Becton Dickinson FACS Aria machine into tubes containing 100% serum. Ideal final concentration of cells should be 1×106/ml.

Immunofluorescence imaging

Immunofluorescent labeling is essentially a combination of the three approaches described thus far. Individual cells and cells within tissues can be detected by use of specific antibodies. Like with FACS, direct immunofluorescence staining takes advantage of direct conjugation of a fluorescent probe to a primary antibody whereas indirect immunofluorescence staining uses a fluorochrome labeled secondary antibody to detect the specific primary antibody. Cell expression of a specific factor can then be studied in detail on a suitable microscope.

Procedure 1. For frozen tissue sections, remove from -20°C freezer and thaw at room temperature. For adherent cells on cover slips, wash ×3 in PBS 2. Fix the tissue/cells in 4% PFA/PBS for 5-10 minutes Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

and then wash in PBS 3×5 minutes 3. For tissue sections, clean the slide to remove water around tissue. Use water-resistant pen to circle the tissue sections 4. Incubate the tissue/cells in 100 µl of blocking solution (PBS + 0.1% Triton X-100 + 2% normal blocking serum) at room temperature for 1 hour 5. Incubate in 50-100 µl of primary antibody diluted in blocking solution for 1 hour at room temperature or 4°C for overnight. Incubate a negative control in blocking solution without primary antibody 6. Wash the slide in PBS for 3×10 minutes at room temperature 7. Incubate the tissue/cells in 50-100 µl of secondary antibody conjugated with fluorophore diluted in blocking solution at room temperature for 45 minutes (protect from light) 8. Incubate the tissue/cells in 50-100 µl of 4’,6-diamidino2-phenylindole dihydrochloride (DAPI) (5 µM) diluted in PBS for 5 minutes at room temperature to counter stain the nucleus 9. Wash the slide in PBS for 3×10 minutes at room temperature (protect from light) 10. Mount the slide/cover slip using with anti-fade mounting medium (e.g., Fluoromount G, Electron Microscopy Sciences), and observe the cells under fluorescence microscope.

Telomere length

Telomerase activity and telomere length measurement

Single cell clonogenic assay (adapted from reference 53)

Procedure 1. Expand the cells to 60-80% confluence 2. Resuspend and transfer the cells to 1.7 ml microtubes at 1×106 cells/tube 3. Following the manufacturer’s directions, suspend the cells in a hybridization solution containing a FITC-conjugated telomere probe or in a probe-free hybridization solution provided in, for example, a Telomere Assay Kit (Dako Cytomation) 4. Hybridize each phenotype overnight at room temperature, in duplicate 5. Wash the cells and incubate the cells with propidium iodide (0.5 µg/ml) to select the cells in G0/G1 of the cell cycle to normalize the data to equivalent genome loads 6. Analyze the cells in FACS machine to detect the fluorescence intensity of the samples 7. The fluorescence intensity reflects the relative telomere length (telomere fluorescence per chromosome/ genome in the sample with respect to that in control (no fluorescent probe)) 8. Each duplicate forms 1 experiment, an average of 3 experiments is required to determine the significance.

Telomerase activity

Important Note: For double immunofluorescence staining, use two antibodies raised in different species in step 6 and 2 secondary antibodies conjugated with different colors of fluorophores in step 8. The blocking solution should include the sera from both of the animals that secondary antibodies were raised in.

Procedure 1. Lyse 10 3 cells with lysis buffer provided by the Telomeric Repeat Amplification Protocol (TRAP)-eze telomerase detection kit (Chemicon, CA, USA) 2. After following the manufacturer’s detailed instructions, the PCR products and a 6-base pair incremental ladder are electrophoresed on a 12.5% nondenaturing polyacrylamide gel and visualized by SYBR gold staining (Molecular Probes , Eugene, OR).

Several techniques may be used to assess telomere length: Terminal Restriction Fragment (TRF) Southern blot; [82] quantitative-fluorescent in situ hybridization (Q-FISH); RT-PCR; and Flow-FISH. RT- PCR and FlowFISH overcome the necessity for large amounts of genomic DNA required for Q-FISH. RT-PCR establishes the telomere to single copy gene ration which is proportional to the averaged telomere length within a cell whereas Flow-FISH is adapted from Q-FISH and uses median fluorescence detected by flow cytometry. Gordon et al. describe a TRAP (telomeric repeat amplification protocol) assay to measure telomerase activity in cells, TRF to estimate telomere length, and the anaphase bridge index and the frequency of dicentric chromosomes to detect telomere dysfunction, and readers are encouraged to refer to their paper for these protocols. [82] Protocols to assess telomere length and activity are also described briefly below.

Procedure 1. Wash 96-well collagen-coated plates with sterile PBS 200 μl per well and replace with 200 μl standard medium (e.g., DMEM + 10% FBS + Pen/Strep) 2. Resuspend adherent cells using TrypLE (Invitrogen) and strain the cells using a 40 µm filter 3. Transfer the cells to flow cytometry tubes containing the standard culture medium at 1×106 cells/tube 4. Sort the cells with a FACS Vantage sorter or equivalent (BD Biosciences) at a rate of 100 events/s; gate the cells based on viability and morphology 5. Seed each phenotype in triplicate in the 96-well collagen-coated plates with media. Culture the cells at 37°C with 5% CO2-21% O2, and add 100 μl media per well at the top of the old media every 4 days for 12 days 6. After colonies start to form, remove them using TrypLE (Invitrogen) and expand cells into 6-well plates. Clearly label the individual clones, approximately 20

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

Figure 9: A schematic diagram outlining the key methodology for characterization of putative progenitor cells in the pulmonary vasculature.

clones should be generated from each 96-well plate utilized.

SUMMARY

The methodology described in this review should enable a basic identification and characterization of stem and progenitor cells in the pulmonary vasculature. Figure 9 outlines a potential flow of characterization of the putative stem cells that have been discussed in this review. Currently, easy identification is limited due to the lack of exclusively specific identifying markers for different progenitor cells. There is no single marker that can identify a specific stem/progenitor cell; thus investigations still rely upon immunophenotyping of the cell population and sorting of putative stem and progenitor cells prior to confirmation by rigorous functional characterization. Furthermore, the field of stem and progenitor cells in pulmonary vascular disease is continually progressing and becoming more complex. For example, recent progress has been made in defining micro RNAs (miRNAs) capable of modulation vascular cell phenotypes highlighting both a functional and therapeutic significance for small noncoding RNAs in PH.[83] Despite many advancements in the diagnosis and treatment of pulmonary hypertension, it remains a progressive disease with poor prognosis. The role of progenitor cells, be it pathogenic or therapeutic, still remains controversial. All that can be concluded is that preliminary clinical trials utilizing EPC-based therapies in patients with pulmonary hypertension are showing positive effects and indicate that potential therapeutic benefit identified in animal studies may exist. 98

ACKNOWLEDGMENTS The authors thank Ruby Fernandez for her assistance in reproducing and preparing the schematic diagram shown in Figure 5.

REFERENCES 1.

2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Becker AJ, Mc CE, Till JE. Cytological demonstration of the clonal nature of spleen colonies derived from transplanted mouse marrow cells. Nature 1963;197:452-4. Thomson J, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145-7. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, OrtizGonzalez XR, et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002;418:41-9. Chao MP, Seita J, Weissman IL. Establishment of a Normal Hematopoietic and Leukemia S tem Cell Hierarchy. Cold Spring Harb Symp Quant Biol 2008;73:439-49. Leblond CP. Classification of Cell Populations on the basis of their proliferative behavior. Natl Cancer Inst Monogr 1964;14:119-50. Gambaryan N, Perros F, Montani D, Cohen-Kaminsky S, Mazmanian M, Renaud JF, et al. Targeting of c-kit+ haematopoietic progenitor cells prevents hypoxic pulmonary hypertension. Eur Respir J 2011;37:1392-9. Asakura A, Rudnicki MA. Side population cells from diverse adult tissues are capable of in vitro hematopoietic differentiation. Exp Hematol 2002;30:1339-45. Budak MT, Alpdogan OS, Zhou M, Lavker RM, Akinci MA, Wolosin JM. Ocular surface epithelia contain ABCG2-dependent side population cells exhibiting features associated with stem cells. J Cell Sci 2005;118:1715-24. Robertson S, Kennedy M, Keller G. Hematopoietic commitment during embryogenesis. Ann N Y Acad Sci 1999;872:9-15; discussion 15-6. Dzierzak E. The emergence of definitive hematopoietic stem cells in the mammal. Curr Opin Hematol 2005;12:197-202. Medvinsky A, Rybtsov S, Taoudi S. Embryonic origin of the adult hematopoietic system: Advances and questions. Development 2011;138:1017-31. Tavian M, Biasch K, Sinka L, Vallet J, Peault B. Embryonic origin of human hematopoiesis. Int J Dev Biol 2010;54:1061-5.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Firth and Yuan: Progenitor cells in pulmonary artery

13.

14.

15. 16. 17.

18.

19.

20.

21.

22. 23. 24.

25.

26.

27.

28.

29.

30.

31.

32. 33.

34.

35.

36.

Sharma M, Afrin F, Satija N, Tripathi RP, Gangenahalli GU. Stromal-derived factor-1/CXCR4 signaling: Indispensable role in homing and engraftment of hematopoietic stem cells in bone marrow. Stem Cells Dev 2011;20:933-46. McKenzie JL, Takenaka K, Gan OI, Doedens M, Dick JE. Low rhodamine 123 retention identifies long-term human hematopoietic stem cells within the Lin-CD34+CD38-population. Blood 2007;109:543-5. Bertoncello I, Williams B. Hematopoietic stem cell characterization by Hoechst 33342 and rhodamine 123 staining. Methods Mol Biol 2004;263:181-200. Chaudhary PM, Roninson IB. Expression and activity of P-glycoprotein, a multidrug efflux pump, in human hematopoietic stem cells. Cell 1991;66:85-94. Notta F, Doulatov S, Laurenti E, Poeppl A, Jurisica I, Dick JE. Isolation of single human hematopoietic stem cells capable of long-term multilineage engraftment. Science 2011;333:218-21. Jaatinen T, Laine J. Isolation of mononuclear cells from human cord blood by Ficoll-Paque density gradient. Curr Protoc Stem Cell Biol 2007;Chapter 2:Unit 2A 1. Mazurier F, Doedens M, Gan OI, Dick JE. Rapid myeloerythroid repopulation after intrafemoral transplantation of NOD-SCID mice reveals a new class of human stem cells. Nat Med 2003;9:959-63. McDermott SP, Eppert K, Lechman ER, Doedens M, Dick JE. Comparison of human cord blood engraftment between immunocompromised mouse strains. Blood 2010;116:193-200. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini FC, Krause DS, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8:315-7. Sordi V. Mesenchymal stem cell homing capacity. Transplantation 2009;87:S42-5. Loebinger MR, Sage EK, Janes SM. Mesenchymal stem cells as vectors for lung disease. Proc Am Thorac Soc 2008;5:711-6. Luan Y, Zhang ZH, Wei DE, Zhao JJ, Kong F, Cheng GH, et al. Implantation of mesenchymal stem cells improves right ventricular impairments caused by experimental pulmonary hypertension. Am J Med Sci 2011 Aug 26. [Epub ahead of print]. Umar S, de Visser YP, Steendijk P, Schutte CI, Laghmani el H, Wagenaar GT, et al. Allogenic stem cell therapy improves right ventricular function by improving lung pathology in rats with pulmonary hypertension. Am J Physiol Heart Circ Physiol 2009;297:H1606-16. Xu J, Qu J, Cao L, Sai Y, Chen C, He L, et al. Mesenchymal stem cellbased angiopoietin-1 gene therapy for acute lung injury induced by lipopolysaccharide in mice. J Pathol 2008;214:472-81. Kanki-Horimoto S, Horimoto H, Mieno S, Kishida K, Watanabe F, Furuya E, et al. Implantation of mesenchymal stem cells overexpressing endothelial nitric oxide synthase improves right ventricular impairments caused by pulmonary hypertension. Circulation 2006;114:I181-5. Liang OD, Mitsialis SA, Chang MS, Vergadi E, Lee C, Aslam M, et al. Mesenchymal stromal cells expressing heme oxygenase-1 reverse pulmonary hypertension. Stem Cells 2011;29:99-107. Deng W, St Hilaire RC, Chattergoon NN, Jeter JR Jr, Kadowitz PJ. Inhibition of vascular smooth muscle cell proliferation in vitro by genetically engineered marrow stromal cells secreting calcitonin gene-related peptide. Life Sci 2006;78:1830-8. Takemiya K, Kai H, Yasukawa H, Tahara N, Kato S, Imaizumi T. Mesenchymal stem cell-based prostacyclin synthase gene therapy for pulmonary hypertension rats. Basic Res Cardiol 2010;105:409-17. Gao Y, Yao A, Zhang W, Lu S, Yu Y, Deng L, et al. Human mesenchymal stem cells overexpressing pigment epithelium-derived factor inhibit hepatocellular carcinoma in nude mice. Oncogene 2010;29:2784-94. Loebinger MR, Eddaoudi A, Davies D, Janes SM. Mesenchymal stem cell delivery of TRAIL can eliminate metastatic cancer. Cancer Res 2009;69:4134-42. Hoshino A, Chiba H, Nagai K, Ishii G, Ochiai A. Human vascular adventitial fibroblasts contain mesenchymal stem/progenitor cells. Biochem Biophys Res Commun 2008;368:305-10. Martin J, Helm K, Ruegg P, Varella-Garcia M, Burnham E, Majka S. Adult lung side population cells have mesenchymal stem cell potential. Cytotherapy 2008;10:140-51. Strieter RM, Keeley EC, Hughes MA, Burdick MD, Mehrad B. The role of circulating mesenchymal progenitor cells (fibrocytes) in the pathogenesis of pulmonary fibrosis. J Leukoc Biol 2009;86:1111-8. Nikam VS, Schermuly RT, Dumitrascu R, Weissmann N, Kwapiszewska G, Morrell N, et al. Treprostinil inhibits the recruitment of bone marrow-derived circulating fibrocytes in chronic hypoxic pulmonary hypertension. Eur Respir J 2010;36:1302-14.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

37.

38. 39.

40. 41. 42. 43. 44. 45. 46.

47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57.

58.

59.

60. 61.

Li M, Riddle SR, Frid MG, El Kasmi KC, McKinsey TA, Sokol RJ, et al. Emergence of fibroblasts with a proinflammatory epigenetically altered phenotype in severe hypoxic pulmonary hypertension. J Immunol 2011;187:2711-22. Yu L, Hales CA. Effect of chemokine receptor CXCR4 on hypoxia-induced pulmonary hypertension and vascular remodeling in rats. Respir Res 2011;12:21. Angelini DJ, Su Q, Kolosova IA, Fan C, Skinner JT, Yamaji-Kegan K, et al. Hypoxia-induced mitogenic factor (HIMF/FIZZ1/RELM alpha) recruits bone marrow-derived cells to the murine pulmonary vasculature. PLoS One 2010;5:e11251. Kim GH, Ryan JJ, Marsboom G, Archer SL. Epigenetic mechanisms of pulmonary hypertension. Pulm Circ 2011;1:347-56. Fessel JP, Loyd JE, Austin ED. The genetics of pulmonary arterial hypertension in the post-BMPR2 era. Pulm Circ 2011;1:305-19. Yeager ME, Frid MG, Stenmark KR. Progenitor cells in pulmonary vascular remodeling. Pulm Circ 2011;1:3-16. Firth AL, Remillard CV, Platoshyn O, Fantozzi I, Ko EA, Yuan JX. Functional ion channels in human pulmonary artery smooth muscle cells: Voltagedependent cation channels. Pulm Circ 2011;1:48-71. Morrell NW, Adnot S, Archer SL, Dupuis J, Jones PL, MacLean MR, et al. Cellular and molecular basis of pulmonary arterial hypertension. J Am Coll Cardiol 2009;54:S20-31. Launay JM, Herve P, Callebert J, Mallat Z, Collet C, Doly S, et al. Serotonin 5-HT2B receptors are required for bone-marrow contribution to pulmonary arterial hypertension. Blood 2011;119:1772-80. Firth AL, Yao W, Ogawa A, Madani MM, Lin GY, Yuan JX. Multipotent mesenchymal progenitor cells are present in endarterectomized tissues from patients with chronic thromboembolic pulmonary hypertension. Am J Physiol Cell Physiol 2010;298:C1217-25. Stenmark KR, Frid MG, Yeager ME. Fibrocytes: Potential new therapeutic targets for pulmonary hypertension? Eur Respir J 2010;36:1232-5. Reger RL, Tucker AH, Wolfe MR. Differentiation and characterization of human MSCs. Methods Mol Biol 2008;449:93-107. Gong Z, Calkins G, Cheng EC, Krause D, Niklason LE. Influence of culture medium on smooth muscle cell differentiation from human bone marrowderived mesenchymal stem cells. Tissue Eng Part A 2009;15:319-30. Gong Z, Niklason LE. Small-diameter human vessel wall engineered from bone marrow-derived mesenchymal stem cells (hMSCs). Faseb J 2008;22:1635-48. Kinner B, Zaleskas JM, Spector M. Regulation of smooth muscle actin expression and contraction in adult human mesenchymal stem cells. Exp Cell Res 2002;278:72-83. Boucher SE. Simplified PCR assay for detecting early stages of multipotent mesenchymal stromal cell differentiation. Methods Mol Biol 2011;698:387-403. Ingram DA, Mead LE, Tanaka H, Meade V, Fenoglio A, Mortell K, et al. Identification of a novel hierarchy of endothelial progenitor cells using human peripheral and umbilical cord blood. Blood 2004;104:2752-60. Alvarez DF, Huang L, King JA, El Zarrad MK, Yoder MC, Stevens T. Lung microvascular endothelium is enriched with progenitor cells that exhibit vasculogenic capacity. Am J Physiol Lung Cell Mol Physiol 2008;294:L419-30. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, et al. Isolation of putative progenitor endothelial cells for angiogenesis. Science 1997;275:964-7. Takahashi M, Nakamura T, Toba T, Kajiwara N, Kato H, Shimizu Y. Transplantation of endothelial progenitor cells into the lung to alleviate pulmonary hypertension in dogs. Tissue Eng 2004;10:771-9. Zhao YD, Courtman DW, Deng Y, Kugathasan L, Zhang Q, Stewart DJ. Rescue of monocrotaline-induced pulmonary arterial hypertension using bone marrow-derived endothelial-like progenitor cells: Efficacy of combined cell and eNOS gene therapy in established disease. Circ Res 2005;96:442-50. Satoh K, Kagaya Y, Nakano M, Ito Y, Ohta J, Tada H, et al. Important role of endogenous erythropoietin system in recruitment of endothelial progenitor cells in hypoxia-induced pulmonary hypertension in mice. Circulation 2006;113:1442-50. Junhui Z, Xingxiang W, Guosheng F, Yunpeng S, Furong Z, Junzhu C. Reduced number and activity of circulating endothelial progenitor cells in patients with idiopathic pulmonary arterial hypertension. Respir Med 2008;102:1073-9. Fadini GP, Schiavon M, Rea F, Avogaro A, Agostini C. Depletion of endothelial progenitor cells may link pulmonary fibrosis and pulmonary hypertension. Am J Respir Crit Care Med 2007;176:724-5. Wang XX, Zhang FR, Shang YP, Zhu JH, Xie XD, Tao QM, et al. Transplantation of autologous endothelial progenitor cells may be beneficial in patients with idiopathic pulmonary arterial hypertension: A pilot randomized controlled trial. J Am Coll Cardiol 2007;49:1566-71.

Firth and Yuan: Progenitor cells in pulmonary artery

62.

63.

64. 65. 66. 67. 68.

69.

70.

71.

72.

73.

74. 75.

76.

Smadja DM, Mauge L, Gaussem P, d’Audigier C, Israel-Biet D, Celermajer DS, et al. Treprostinil increases the number and angiogenic potential of endothelial progenitor cells in children with pulmonary hypertension. Angiogenesis 2011;14:17-27. Hansmann G, Plouffe BD, Hatch A, von Gise A, Sallmon H, Zamanian RT, et al. Design and validation of an endothelial progenitor cell capture chip and its application in patients with pulmonary arterial hypertension. J Mol Med (Berl) 2011;89:971-83. Obi S, Yamamoto K, Shimizu N, Kumagaya S, Masumura T, Sokabe T, et al. Fluid shear stress induces arterial differentiation of endothelial progenitor cells. J Appl Physiol 2009;106:203-11. Zampetaki A, Kirton JP, Xu Q. Vascular repair by endothelial progenitor cells. Cardiovasc Res 2008;78:413-21. Toshner M, Voswinckel R, Southwood M, Al-Lamki R, Howard LS, Marchesan D, et al. Evidence of dysfunction of endothelial progenitors in pulmonary arterial hypertension. Am J Respir Crit Care Med 2009;180:780-7. Nataraj D, Ernst A, Kalluri R. Idiopathic pulmonary fibrosis is associated with endothelial to mesenchymal transition. Am J Respir Cell Mol Biol 2010;43:129-30. Diez M, Musri MM, Ferrer E, Barbera JA, Peinado VI. Endothelial progenitor cells undergo an endothelial-to-mesenchymal transition-like process mediated by TGFbetaRI. Cardiovasc Res 2010;88:502-11. Yao W, Firth AL, Sacks RS, Ogawa A, Auger WR, Fedullo PF, et al. Identification of putative endothelial progenitor cells (CD34+CD133+Flk-1+) in endarterectomized tissue of patients with chronic thromboembolic pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2009;296:L870-8. Mead LE, Prater D, Yoder MC, Ingram DA. Isolation and characterization of endothelial progenitor cells from human blood. Curr Protoc Stem Cell Biol 2008;Chapter 2:Unit 2C 1. Voyta JC, Via DP, Butterfield CE, Zetter BR. Identification and isolation of endothelial cells based on their increased uptake of acetylated-low density lipoprotein. J Cell Biol 1984;99:2034-40. Reyes M, Dudek A, Jahagirdar B, Koodie L, Marker PH, Verfaillie CM. Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 2002;109:337-46. Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, et al. Intravenous transfusion of endothelial progenitor cells reduces neointima formation after vascular injury. Circ Res 2003;93:e17-24. Madri JA, Pratt BM. Endothelial cell-matrix interactions: In vitro models of angiogenesis. J Histochem Cytochem 1986;34:85-91. Yoon CH, Hur J, Oh IY, Park KW, Kim TY, Shin JH, et al. Intercellular adhesion molecule-1 is upregulated in ischemic muscle, which mediates trafficking of endothelial progenitor cells. Arterioscler Thromb Vasc Biol 2006;26:1066-72. Brunt KR, Hall SR, Ward CA, Melo LG. Endothelial progenitor cell and mesenchymal stem cell isolation, characterization, viral transduction.

77. 78. 79. 80. 81. 82. 83. 84.

85. 86.

87. 88.

89.

Methods Mol Med 2007;139:197-210. Allsopp RC, Morin GB, Horner JW, DePinho R, Harley CB, Weissman IL. Effect of TERT over-expression on the long-term transplantation capacity of hematopoietic stem cells. Nat Med 2003;9:369-71. Artandi SE. Telomeres, telomerase, and human disease. N Engl J Med 2006;355:1195-7. Ingram DA, Mead LE, Moore DB, Woodard W, Fenoglio A, Yoder MC. Vessel wall-derived endothelial cells rapidly proliferate because they contain a complete hierarchy of endothelial progenitor cells. Blood 2005;105:2783-6. Alvarez DF, Huang L, King JA, ElZarrad MK, Yoder MC, Stevens T. Lung microvascular endothelium is enriched with progenitor cells that exhibit vasculogenic capacity. Am J Physiol Lung Cell Mol Physiol 2008;294:L419-30. Wills TB, Heaney AM, Jane Wardrop K, Haldorson GJ. Immunomagnetic isolation of canine circulating endothelial and endothelial progenitor cells. Vet Clin Pathol 2009;38:437-42. Gordon KE, Parkinson EK. Analysis of telomerase activity and telomere function in cancer. Methods Mol Biol 2004;281:333-48. Joshi SR, McLendon JM, Comer BS, Gerthoffer WT. MicroRNAs-control of essential genes: Implications for pulmonary vascular disease. Pulm Circ 2011;1:357-64. Firth AL, Yao W, Yuan JXJ. Identification of Adult Stem and Progenitor Cells in the Pulmonary Vasculature Textbook of Pulmonary Vascular Disease. In: Yuan JX, Garcia JG, West JB, Hales CA, Rich S, Archer SL, editors. US: Springer; 2011. p. 621-36. Mukai N, Akahori T, Komaki M, Li Q, Kanayasu-Toyoda T, Ishii-Watabe A, et al. A comparison of the tube forming potentials of early and late endothelial progenitor cells. Exp Cell Res 2008;314:430-40. Timmermans F, Van Hauwermeiren F, De Smedt M, Raedt R, Plasschaert F, De Buyzere ML, et al. Endothelial outgrowth cells are not derived from CD133+ cells or CD45+ hematopoietic precursors. Arterioscler Thromb Vasc Biol 2007;27:1572-9. Ranjan AK, Kumar U, Hardikar AA, Poddar P, Nair PD. Human blood vessel-derived endothelial progenitors for endothelialization of small diameter vascular prosthesis. PLoS One 2009;4:e7718. Prigozhina NL, Heisel A, Wei K, Noberini R, Hunter EA, Calzolari D, et al. Characterization of a novel angiogenic model based on stable, fluorescently labelled endothelial cell lines amenable to scale-up for high content screening. Biol Cell 2011;103:467-81. Lloyd Jones P, Lucia A, Sabin JE. Illustration. Science 2010;327:946-8.

Source of Support: This work was supported in part by grants from the National Heart, Lung, and Blood Institute of the National Institutes of Health (R01HL066012, P01HL098053, and P01HL098050). ALF is currently supported by a CIRM Postdoctoral Training Fellowship., Conflict of Interest: None declared.

Staying in touch with the journal 1) Table of Contents (TOC) email alert Receive an email alert containing the TOC when a new complete issue of the journal is made available online. To register for TOC alerts go to www.pulmonarycirculation.org/signup.asp. 2) RSS feeds Really Simple Syndication (RSS) helps you to get alerts on new publication right on your desktop without going to the journal’s website. You need a software (e.g. RSSReader, Feed Demon, FeedReader, My Yahoo!, NewsGator and NewzCrawler) to get advantage of this tool. RSS feeds can also be read through FireFox or Microsoft Outlook 2007. Once any of these small (and mostly free) software is installed, add www.pulmonarycirculation.org/rssfeed.asp as one of the feeds. 100

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

C ase Repor t

Severe pulmonary hypertension in idiopathic nonspecific interstitial pneumonia Robert W. Hallowell1, Robert M. Reed2, Mostafa Fraig3, Maureen R. Horton1, and Reda E. Girgis1 2

1 Johns Hopkins University School of Medicine, Division of Pulmonary and Critical Care Medicine, Baltimore, Maryland, University of Maryland School of Medicine, Division of Pulmonary and Critical Care Medicine, 3Department of Pathology, University of Louisville School of Medicine, Louisville, Kentucky, USA

ABSTRACT Pulmonary hypertension (PH) is a common complication of interstitial lung disease (ILD), particularly in idiopathic pulmonary fibrosis (IPF) and ILD associated with connective tissue disease, where the underlying pathology is often a nonspecific interstitial pneumonia (NSIP) pattern. The degree of PH in ILD is typically mild to moderate and radiographic changes of ILD are usually prominent. We describe four patients with idiopathic NSIP and severe PH (mPAP > 40 mmHg). The average mean pulmonary artery pressure was 51±7 mmHg and pulmonary vascular resistance was 13±4 Wood’s units. Pulmonary function was characterized by mild restriction (total lung capacity 63–94% predicted) and profound reductions in DLCO (19–53% predicted). Computed tomographic imaging revealed minimal to moderate interstitial thickening without honeycombing. In two of the cases, an initial clinical diagnosis of idiopathic pulmonary arterial hypertension was made. Both were treated with intravenous epoprostenol, which was associated with worsening of hypoxemia. All four patients died or underwent lung transplant within 4 years of PH diagnonsis. Lung pathology in all four demonstrated fibrotic NSIP with medial thickening of the small and medium pulmonary arteries, and proliferative intimal lesions that stained negative for endothelial markers (CD31 and CD34) and positive for smooth muscle actin. There were no plexiform lesions. Severe pulmonary hypertension can therefore occur in idiopathic NSIP, even in the absence of advanced radiographic changes. Clinicians should suspect underlying ILD as the basis for PH when DLCO is severely reduced or gas exchange deteriorates with pulmonary vasodilator therapy. Key Words: interstitial lung disease, pulmonary artery pressure, vasculopathy

INTRODUCTION Pulmonary hypertension (PH) is a common complication of interstitial lung disease (ILD). It is associated with reduced exercise capacity, derangements in gas exchange,[1-3] and increased mortality.[1,2,4-6] Estimates of the prevalence of PH in ILD have varied from 28% to 85%, with the highest rates observed in idiopathic pulmonary fibrosis (IPF). [1,2,5,7- 11] PH is particularly common in ILD associated with connective tissue diseases, where the underlying pathology is frequently a nonspecific interstitial pneumonia (NSIP) pattern. There are sparse data regarding the prevalence and clinical features of PH in idiopathic NSIP. In the absence of connective tissue disease, ILD-associated PH is typically not severe, with mean pulmonary artery pressures (mPAP) usually under 40 mmHg.[1,6,12] We report the clinical and Address correspondence to: Dr. Reda E. Girgis 1830 Building 5th Floor Pulmonary Division 600 North Wolfe Street Baltimore, MD 21205, USA Email: rgirgis@jhmi.edu

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

pathological features of four patients with idiopathic NSIP and severe PH (mPAP > 40 mmHg).

Methods

We identified four patients referred to a specialized pulmonary hypertension program with pathologically proven NSIP and severe pulmonary hypertension (defined by a mPAP > 40 mmHg). While two patients (#2 and #3) had low-level antinuclear antibody (ANA) titers (1:40, 1:80), there was no other clinical evidence of a connective tissue disorder. HIV antibody was undetectable in all four patients, and thromboembolic disease was excluded through perfusion lung scanning. None of the patients Access this article online Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94842 How to cite this article: Hallowell RW, Reed RM, Fraig M, Horton MR, Girgis RE. Severe pulmonary hypertension in idiopathic nonspecific interstitial pneumonia. Pulm Circ 2012;2:101-6.

101

Hallowell et al.: Idiopathic NSIP and severe PH

demonstrated significant left heart abnormalities on echocardiography.

The pathologic specimens were reexamined by an experienced pulmonary pathologist to confirm the NSIP pattern and to characterize the pulmonary vascular morphology. Fivemicron thick tissue sections were stained with routine H and E stains and Movat pentachrome histochemical stain. Immunohistochemical staining for CD31, CD34, smooth muscle actin (SMA), and factor VIII was performed by an automated stainer (BOND-MAX, Leica Microsystems, Inc.) All immunohistochemical staining was performed with corresponding positive and negative controls. The presence of NSIP was confirmed based upon the presence of uniform interstitial fibrosis and chronic mononuclear interstitial fibrosis with temporal homogeneity and lack of granulomas, hyaline membranes, or fibroblastic foci. The histologic sections were also evaluated for features of pulmonary hypertension, including arterial medial thickening, subintimal proliferation, muscularization of the venous walls, plexiform lesions, a chronic perivascular inflammatory infiltrate and, a perivascular deposition of hemosiderin and capillary angiomatosis. The number of sections available for evaluation ranged between 4 and 12 sections.

scan of the chest showed minimal interstitial thickening and bronchiectasis in the lung bases (Fig. 1). Pulmonary function tests (PFTs) and right heart catheterization (RHC) findings are shown in (Table 1). A clinical diagnosis of pulmonary arterial hypertension (PAH) was made and he was treated initially with bosentan, followed by subcutaneous treprostinil, with a subsequent switch to intravenous epoprostenol and sildenafil. There was no clinical benefit appreciated with any of these regimens. Over the course of 3 years, his WHO functional class worsened from class III–IV and his 6-minute walk distance fell from 401 to 253 m. Oxygenation deteriorated progressively, eventually requiring 6 l/minute of supplemental oxygen. A bilateral lung transplant was performed 4 years after initial presentation. Pathologic examination of the explanted lungs revealed a diffuse cellular and fibrotic nonspecific interstitial pneumonia pattern (Fig. 2). Patient 2 presented with progressive exertional dyspnea over the preceding 9 years. She had been given a diagnosis of

CASE REPORTS

Patient 1 was seen in-clinic following 3 years of progressive dyspnea with exertion and an episode of syncope. Past medical history was notable for remote intravenous cocaine and heroin use resulting in chronic hepatitis C infection. He had been treated with interferon and ribavirin to achieve an undetectable viral load. Liver function tests and prothrombin time were normal and there was no evidence of portal hypertension. A computed tomography (CT)

Figure 1: Representative CT cuts from patients 1-4 demonstrating interstitial changes with reticular ground-glass opacities predominantly in the lower lobes.

Table 1: Patient characteristics Age at symptom onset Gender Race RAP (mmHg) mPAP (mmHg) PAWP (mmHg) CI (l/min/m2) PVR (Wood’s units) FEV1/FVC FEV1 % predicted FVC % predicted TLC % predicted DLCO % predicted ABG room air (pH/CO2/O2)

Patient 1

Patient 2

Patient 3

Patient 4

40 Male Caucasian 14 44 16 1.74 7.91 77.6 81.9 87.5 82.9 46.1 7.4/36/78

58 Female Caucasian 18 55 12 1.33 19 68.6 74 85 94 19 7.47/27/50

46 Female African American 20 57 12 1.54 14.2 78.8 52.7 54 66 52.9 7.43/42/44

53 Male African American 16 47 16 1.64 9.48 85.9 78.1 72 63.2 33.9 7.48/32/44

RAP: Right atrial pressure; mPAP: Mean pulmonary artertial pressure; PAWP: Pulmonary arterial wedge pressure; CI: Cardiac index; PVR: Pulmonary vascular resistance; FEV1: Forced expiratory volume in 1 second; FVC: Forced vital capacity; TLC: Total lung capacity; DLCO: Diffusion capacity of the lung for carbon monoxide; ABG: Arterial blood gas

102

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Hallowell et al.: Idiopathic NSIP and severe PH

chronic obstructive pulmonary disease (COPD) and treated with bronchodilators and intermittent oral corticosteroids. The latter were often associated with temporary symptomatic improvement. Her past medical history was notable for longstanding diabetes and hypertension. She had a remote 20 pack-year smoking history. Four months prior to her initial assessment, RHC demonstrated severe pre-capillary pulmonary hypertension. PFTs revealed normal lung volumes with a profound reduction in diffusing capacity (DLCO; Table 1). Chest CT imaging was free of parenchymal lung disease, but demonstrated mediastinal and hilar lymphadenopathy measuring up to 25 mm in maximal nodal diameter. Intravenous epoprostenol was started for a clinical diagnosis of idiopathic PAH. After transient symptomatic improvement, the patient experienced progressive worsening of dyspnea and an increase in oxygen requirement from 2 to 10 l/minute on an epoprostenol dose of 14 ng/kg/min. At presentation to our clinic, she reported WHO functional class IV limitations and demonstrated decompensated right heart failure on physical examination. A thin-section (1-mm) CT of the chest exhibited a subtle pattern of diffuse reticulation with patchy ground-glass opacities in the lung bases (Fig. 1). Given these findings and the poor clinical response to PAH therapy, a diagnosis of pulmonary veno-occlusive disease was suspected. The epoprostenol dose was tapered and sildenafil introduced. Two months later, sudden death occurred. Autopsy demonstrated an extensive fibrotic NSIP pattern. There was also severe 3-vessel coronary artery disease (CAD) without evidence of myocardial infarction. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 2: Representative pathology. (A) Uniform interstitial fibrosis and mild chronic inflammation characteristic of fibrotic NSIP (H and E, ×4). (B) CD34 (×20) and (C) CD31 stains demonstrate subintimal proliferation by non-endothelial cells (×20). (D) H and E staining (×10) and (E) Movat staining (×20) demonstrate arterial medial hypertrophy with eccentric intimal proliferation. (F) Medial thickening and subintimal proliferation consisting of smooth muscle cells (smooth muscle actin stain, ×20). (G) Concentric intimal proliferation (H and E, ×20). (H) Venous muscularization (Movat statin, ×20).

Patient 3 presented to the pulmonary clinic with chronic cough and mild dyspnea. Her past medical history was significant for hypertension, obesity (BMI of 38), and active smoking (40 pack-years). Initial pulmonary function testing demonstrated normal lung volumes (TLC: 86%) with a mild reduction in DLCO (73%). Chest CT imaging revealed subtle, diffuse reticular opacities without traction bronchiectasis or honeycombing (Fig. 1). A surgical lung biopsy demonstrated a fibrotic NSIP pattern. Baseline physical exam and echocardiogram done at presentation were not suggestive of PH. Prednisone (0.5 mg/kg/day) was initiated for declining PFTs 3 months later with subsequent improvement in symptoms and pulmonary function, after which steroid therapy was tapered off. Five years later she experienced a non-ST elevation myocardial infarction. A right heart catheterization in this setting showed a pulmonary artery pressure of 90/36 (mean 56 mmHg) with a pulmonary artery wedge pressure of 16 mmHg. Echocardiography at that time showed a dilated right heart with normal left sided function. The interstitial process was more prominent on imaging, and hypoxemia was now present (Table 1). Mild obstructive sleep apnea (Apnea Hypopnea Index: 11.1) was also diagnosed. Continuous positive airway pressure therapy and supplemental oxygen were initiated. Her cardiopulmonary status continued to decline, with recurrent hospitalizations for right heart failure. A repeat RHC 7 years after her initial presentation with ILD demonstrated severe PAH with RV failure. Progressive restriction and diffusion defects were noted on PFT’s (Table 1). The patient subsequently expired due to refractory hypoxemic respiratory failure. 103

Hallowell et al.: Idiopathic NSIP and severe PH

Patient 4 was referred to the clinic with a concomitant diagnosis of ILD and PH. His symptoms had begun 4 years prior with progressive exertional dyspnea (WHO class IV), cough and development of lower extremity edema. His past medical history was significant for diabetes mellitus, singlevessel CAD, and poorly controlled systemic hypertension. Physical examination demonstrated signs of PH and right heart failure, as well as crackles on lung auscultation. Chest CT scan demonstrated mild patchy subpleural and peribronchovascular reticular opacities with minimal honeycombing and traction bronchiectasis. There was also moderate mediastinal adenopathy up to 22 mm. in maximal diameter (Fig. 1). PFT and RHC findings are shown in Table 1. An open-lung biopsy showed extensive fibrotic nonspecific interstitial pneumonia. He was started on prednisone and azathioprine with a good initial response. Fifteen months later, right heart failure associated with atrial fibrillation occurred. He subsequently died suddenly at home.

Pulmonary vascular morphology

Lung pathology of all 4 patients demonstrated interstitial fibrosis and mild chronic inflammation characteristic of fibrotic NSIP (Fig. 2). An extensive pulmonary arterial vasculopathy was also present in all cases, and was characterized by varying degrees of medial thickening. In addition, there were widespread intimal lesions in medium and small pulmonary arteries resulting in considerable luminal narrowing and obliteration. The majority of these lesions consisted of eccentric and concentric, nonlaminar intimal fibrosis. In three of the four cases, there were clear concentric “onion-skin” intimal proliferation lesions focally. The intimal lesions stained negative for CD31 and CD34 (endothelial cell markers), but positive for smooth muscle actin. Movat staining also demonstrated muscularization of the pulmonary veins, without evidence of pulmonary veno-occlusive disease. Plexiform or angiomatoid lesions were absent.

DISCUSSION

We report four cases of severe pulmonary hypertension associated with pathologically proven NSIP and no evidence of connective tissue disease (CTD). In each case, the vascular proliferation consisted of smooth muscle cells, which is in contrast to the intimal proliferation of endothelial cells observed in idiopathic PAH.[13] Studies evaluating the prevalence and severity of PH in idiopathic interstitial pneumonia (IIP) have been small, and generally have not focused on NSIP.[14,15] One study included 13 patients with NSIP and reported a 46% incidence of pulmonary hypertension. The average mean pulmonary arterial pressure (mPAP) in that study was 27.6 mmHg.[16] An echocardiographic study reported the incidence of PH to 104

be 28% among 70 patients with IIP, 11 of whom had NSIP. The average sPAP in this group was 30.2 mmHg, though the individual sPAP of the NSIP patients was not reported. [7] In a study by Dorfmüller et al., three patients with severe pulmonary hypertension (mPAP range 51-62 mmHg) were found to have NSIP. However, all three patients carried a known diagnosis of either limited scleroderma or mixed CTD.[17] To our knowledge, this is the first clinicopathologic description of severe pulmonary hypertension, defined as an mPAP >40 mmHg, in a group of patients with idiopathic NSIP. Patient 1 had a history of hepatic cirrhosis and treatment with interferon-alpha, both of which have been associated with an increased incidence of PH.[18,19] However, there was no evidence of portal hypertension or liver dysfunction, and his symptoms of dyspnea preceded his treatment with interferon. Therefore, these are unlikely to be significant contributors to his PH. Patient 3 had a history of mild obstructive sleep apnea (OSA). While OSA can be associated with mild pulmonary hypertension, severe PH, as seen in this patient is rare.[3,20,21]

Pathogenesis of PH in ILD

PH in patients with ILD is thought to result largely from vascular destruction and remodeling with vessel fibrosis.[22] Remodeled vessels lack an elastin layer and have decreased vascular compliance.[23] Chronic hypoxemia likely also plays a limited role.[3] All four patients in our series had a prominent vasculopathy with medial thickening and intimal proliferation. Concentric intimal proliferation, as is often seen in cases of severe pulmonary arterial hypertension (PAH)[13,17] was present in three patients.

In contrast to the intimal proliferation of endothelial cells observed in idiopathic PAH,[13] the intimal proliferative process observed in these cases seems to be one involving smooth muscle cells. This is evidenced by the absence of staining with CD34 and CD31, and positive smooth muscle actin staining. Other lesions often associated with pulmonary hypertension of this severity, such as plexiform and angiomatoid lesions,[13] were notably absent in these patients. Severe pulmonary hypertension [24-27] in the absence of plexiform lesions[24,26,28] has been described in pulmonary veno-occlusive disease. In addition, arteriolar medial hypertrophy [25,26] and intimal proliferation of pulmonary arterioles,[26] as was seen in our patients, have also been reported in patients with pulmonary venoocclusive disease (PVOD). However, despite the fact that three patients demonstrated venous muscularization, there was no evidence of occlusion of pulmonary venules or preseptal pulmonary veins. There is evidence that PH in ILD is caused in part by endothelial injury and dysfunctional endothelial cells with a resultant imbalance of vasoconstricting and vasodilating agents.[29] Endothelin-1 is known to cause vasoconstriction Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Hallowell et al.: Idiopathic NSIP and severe PH

and smooth muscle cell proliferation of the pulmonary vasculature,[29] and increased serum,[30] endothelial cell,[29] and alveolar epithelial cell[31] expression of endothelin-1 has been associated with pulmonary hypertension.[32] Likewise, serotonin may also contribute to the development of idiopathic PAH[33,34] through a similar vasoconstricting effect on pulmonary vasculature.[35] Moreover, dysfunctional endothelial cells from lungs of patients with PH also demonstrate decreased levels of vasodilators, including prostacyclin,[29,36] nitric oxide,[29,37] and vasoactive intestinal peptide.[38] Finally, there is also evidence that factors such as platelet-derived growth factor (PDGF)[39] and TGF-β[40-42] may play a role in the development of PH. Whether or not similar mechanisms are responsible for PH in NSIP remains to be seen.

Pulmonary function tests

Despite severely elevated mean pulmonary pressures, the degree of restriction on pulmonary function testing was relatively modest. The patients in our series demonstrated a mild restrictive defect (total lung capacity 63-94% predicted) with a severe reduction in DLCO (19%-53% predicted). Several studies show PH to correlate poorly with the degree of restriction, and only modestly with DLCO in patients with IPF[5,10] and other forms of ILD.[7] Other reports regarding PFT abnormalities in patients with both idiopathic and nonidiopathic forms of NSIP have also demonstrated similar reductions in TLC and DLCO, though no correlation with mPAP was made.[43-45] The degree of pulmonary hypertension in our patients was not predicted by the degree of restriction on their PFTs, though a severe reduction in DLCO may have served as a clue to the presence of pulmonary vascular disease.

Radiographic data

CT imaging demonstrated interstitial changes with reticular groundglass opacities, predominantly in the lower lobes, and two patients had evidence of mild traction bronchiectasis (Fig. 1). The severity of pulmonary hypertension in our patients was relatively disproportionate to the radiographic findings, which is consistent with previous studies in ILD that also demonstrated a lack of correlation between the amount of fibrosis/interstitial thickening and the degree of pulmonary hypertension.[46,47] In Patients 1 and 2 the radiographic changes were quite subtle and led to an erroneous diagnosis of Idiopathic PAH.

Response to targeted PAH therapy

Patients 1 and 2 demonstrated worsening oxygenation in the setting of intravenous epoprostenol, likely due to increased perfusion of poorly ventilated areas of diseased lung. While similar clinical worsening with epoprostenol has been reported in patients with pulmonary venoocclusive disease, such cases were associated with Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

concomitant pulmonary edema,[25,27] which was absent in our patients. Patients 1 and 4 demonstrated no clinical improvement with bosentan therapy. In patients with sclerodermarelated ILD, bosentan did not significantly improve 6-minute walk distance,[48] hemodynamics, or survival. [49] A similar lack of benefit in 6-minute walk, [50] time to clinical worsening, mortality or quality of life[51] was also seen in trials of bosentan in IPF. In a recent randomized, placebo-controlled trial of sildenafil in IPF, 6-minute walk distance was not improved after 12 weeks of therapy. However, there was a small but significant benefit in arterial oxygenation, carbon monoxide diffusion capacity, degree of dyspnea and quality of life.[52] The pulmonary arteries of our patients demonstrated intimal lesions consisting of smooth muscle cells, as opposed to the endothelial cells observed in idiopathic PAH,[13] and this may explain the lack of clinical response to therapy traditionally used in the treatment of PAH.

CONCLUSIONS

Severe pulmonary hypertension with prominent pulmonary vascular remodeling can occur with NSIP in the absence of known CTD. Pulmonary function and radiographic abnormalities in these patients can be subtle. In contrast to the endothelial cell proliferation observed in IPAH, the vascular pathology observed in these cases involved abnormal proliferation of vascular smooth muscle cells. Recognition of NSIP or other parenchymal lung disease as the basis for severe PH is critical, as PAH therapy in such cases could result in worsening of gas exchange. Clinical outcomes are poor as illustrated here. Carefully designed clinical trials are required to identify effective treatment.

REFERENCES 1. 2. 3. 4. 5. 6.

Lettieri CJ, Nathan SD, Barnett SD, Ahmad S, Shorr AF. Prevalence and outcomes of pulmonary arterial hypertension in advanced idiopathic pulmonary fibrosis. Chest 2006;129:746-52. Leuchte HH, Baumgartner RA, Nounou ME, Vogeser M, Neurohr C, Trautnitz M, et al. Brain natriuretic peptide is a prognostic parameter in chronic lung disease. Am J Respir Crit Care Med 2006;173:744-50. Girgis RE, Mathai SC. Pulmonary hypertension associated with chronic respiratory disease. Clin Chest Med 2007;28:219-32, x. Nadrous HF, Pellikka PA, Krowka MJ, Swanson KL, Chaowalit N, Decker PA, et al. The impact of pulmonary hypertension on survival in patients with idiopathic pulmonary fibrosis. Chest 2005;128:616S-7S. Nadrous HF, Pellikka PA, Krowka MJ, Swanson KL, Chaowalit N, Decker PA, et al. Pulmonary hypertension in patients with idiopathic pulmonary fibrosis. Chest 2005;128:2393-9. Hamada K, Nagai S, Tanaka S, Handa T, Shigematsu M, Nagao T, et al. Significance of pulmonary arterial pressure and diffusion capacity of the lung as prognosticator in patients with idiopathic pulmonary fibrosis. Chest 2007;131:650-6. Handa T, Nagai S, Miki S, Ueda S, Yukawa N, Fushimi Y, et al. Incidence of pulmonary hypertension and its clinical relevance in patients with interstitial pneumonias: Comparison between idiopathic and collagen vascular disease associated interstitial pneumonias. Intern Med

105

Hallowell et al.: Idiopathic NSIP and severe PH

8. 9.

10. 11. 12. 13. 14.

15. 16.

17.

18. 19. 20.

21.

22. 23. 24. 25.

26. 27. 28. 29. 30. 31.

2007;46:831-7. Nathan SD, Noble PW, Tuder RM. Idiopathic pulmonary fibrosis and pulmonary hypertension: Connecting the dots. Am J Respir Crit Care Med 2007;175:875-80. Colombat M, Mal H, Groussard O, Capron F, Thabut G, Jebrak G, et al. Pulmonary vascular lesions in end-stage idiopathic pulmonary fibrosis: Histopathologic study on lung explant specimens and correlations with pulmonary hemodynamics. Hum Pathol 2007;38:60-5. Nathan SD, Shlobin OA, Ahmad S, Urbanek S, Barnett SD. Pulmonary hypertension and pulmonary function testing in idiopathic pulmonary fibrosis. Chest 2007;131:657-63. Nathan SD, Shlobin OA, Ahmad S, Koch J, Barnett SD, Ad N, et al. Serial development of pulmonary hypertension in patients with idiopathic pulmonary fibrosis. Respiration 2008;76:288-94. Shorr AF, Wainright JL, Cors CS, Lettieri CJ, Nathan SD. Pulmonary hypertension in patients with pulmonary fibrosis awaiting lung transplant. Eur Respir J 2007;30:715-21. Tuder RM, Marecki JC, Richter A, Fijalkowska I, Flores S. Pathology of pulmonary hypertension. Clin Chest Med 2007;28:23-42, vii. Tan RT, Kuzo R, Goodman LR, Siegel R, Haasler GB, Presberg KW. Utility of CT scan evaluation for predicting pulmonary hypertension in patients with parenchymal lung disease. Medical College of Wisconsin Lung Transplant Group. Chest 1998;113:1250-6. Weitzenblum E, Ehrhart M, Rasaholinjanahary J, Hirth C. Pulmonary hemodynamics in idiopathic pulmonary fibrosis and other interstitial pulmonary diseases. Respiration 1983;44:118-27. Ahmad S, Barnett, SD, Shlobin, OA, Nathan, SD. Comparison of the Prevalence of Pulmonary Arterial Hypertension (PAH) in Patients with Idiopathic Pulmonary Fibrosis (IPF) and Non-Specific Interstitial Pneumonia (NSIP). Am J Respir Crit Care Med 2006;3:S242. Dorfmuller P, Humbert M, Perros F, Sanchez O, Simonneau G, Müller KM, et al. Fibrous remodeling of the pulmonary venous system in pulmonary arterial hypertension associated with connective tissue diseases. Hum Pathol 2007;38:893-902. Naschitz JE, Slobodin G, Lewis RJ, Zuckerman E, Yeshurun D. Heart diseases affecting the liver and liver diseases affecting the heart. Am Heart J 2000;140:111-20. Dhillon S, Kaker A, Dosanjh A, Japra D, Vanthiel DH. Irreversible pulmonary hypertension associated with the use of interferon alpha for chronic hepatitis C. Dig Dis Sci 2010;55:1785-90. Arias MA, Garcia-Rio F, Alonso-Fernandez A, Martinez I, Villamor J. Pulmonary hypertension in obstructive sleep apnoea: Effects of continuous positive airway pressure: A randomized, controlled cross-over study. Eur Heart J 2006;27:1106-13. Alchanatis M, Tourkohoriti G, Kakouros S, Kosmas E, Podaras S, Jordanoglou JB. Daytime pulmonary hypertension in patients with obstructive sleep apnea: The effect of continuous positive airway pressure on pulmonary hemodynamics. Respiration 2001;68:566-72. Nathan SD. Pulmonary hypertension in interstitial lung disease. Int J Clin Pract 2008. Renzoni EA, Walsh DA, Salmon M, Wells AU, Sestini P, Nicholson AG, et al. Interstitial vascularity in fibrosing alveolitis. Am J Respir Crit Care Med 2003;167:438-43. Thomas de Montpreville V, Dulmet E, Fadel E, Dartevelle P. Lymph node pathology in pulmonary veno-occlusive disease and pulmonary capillary heamangiomatosis. Virchows Arch 2008;453:171-6. Montani D, Achouh L, Dorfmuller P, Le Pavec J, Sztrymf B, Tchérakian C, et al. Pulmonary veno-occlusive disease: Clinical, functional, radiologic, and hemodynamic characteristics and outcome of 24 cases confirmed by histology. Medicine (Baltimore) 2008;87:220-33. Holcomb BW Jr, Loyd JE, Ely EW, Johnson J, Robbins IM. Pulmonary venoocclusive disease: A case series and new observations. Chest 2000;118:1671-9. Palmer SM, Robinson LJ, Wang A, Gossage JR, Bashore T, Tapson VF. Massive pulmonary edema and death after prostacyclin infusion in a patient with pulmonary veno-occlusive disease. Chest 1998;113:237-40. Montani D, O’Callaghan DS, Savale L, Jaïs X, Yaïci A, Maitre S, et al. Pulmonary veno-occlusive disease: Recent progress and current challenges. Respir Med 2010;104 Suppl 1:S23-32. Humbert M, Morrell NW, Archer SL, Stenmark KR, MacLean MR, Lang IM, et al. Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol 2004;43:13S-24S. Stewart DJ, Levy RD, Cernacek P, Langleben D. Increased plasma endothelin-1 in pulmonary hypertension: Marker or mediator of disease? Ann Intern Med 1991;114:464-9. Giaid A, Michel RP, Stewart DJ, Sheppard M, Corrin B, Hamid Q. Expression of endothelin-1 in lungs of patients with cryptogenic fibrosing alveolitis. Lancet 1993;341:1550-4.

106

32. 33. 34.

35.

36.

37. 38. 39. 40. 41.

42. 43.

44. 45.

46.

47. 48.

49.

50. 51. 52.

Giaid A, Yanagisawa M, Langleben D, Michel RP, Levy R, Shennib H, et al. Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. N Engl J Med 1993;328:1732-9. Herve P, Launay JM, Scrobohaci ML, Brenot F, Simonneau G, Petitpretz P, et al. Increased plasma serotonin in primary pulmonary hypertension. Am J Med 1995;99:249-54. Eddahibi S, Humbert M, Fadel E, Raffestin B, Darmon M, Capron F, et al. Serotonin transporter overexpression is responsible for pulmonary artery smooth muscle hyperplasia in primary pulmonary hypertension. J Clin Invest 2001;108:1141-50. Morecroft I, Heeley RP, Prentice HM, Kirk A, MacLean MR. 5-hydroxytryptamine receptors mediating contraction in human small muscular pulmonary arteries: Importance of the 5-HT1B receptor. Br J Pharmacol 1999;128:730-4. Tuder RM, Cool CD, Geraci MW, Wang J, Abman SH, Wright L, et al. Prostacyclin synthase expression is decreased in lungs from patients with severe pulmonary hypertension. Am J Respir Crit Care Med 1999;159: 1925-32. Giaid A, Saleh D. Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N Engl J Med 1995;333:214-21. Petkov V, Mosgoeller W, Ziesche R, Raderer M, Stiebellehner L, Vonbank K, et al. Vasoactive intestinal peptide as a new drug for treatment of primary pulmonary hypertension. J Clin Invest 2003;111:1339-46. Antoniades HN, Bravo MA, Avila RE, Galanopoulos T, Neville-Golden J, Maxwell M, et al. Platelet-derived growth factor in idiopathic pulmonary fibrosis. J Clin Invest 1990;86:1055-64. Coker RK, Laurent GJ, Jeffery PK, du Bois RM, Black CM, McAnulty RJ. Localisation of transforming growth factor beta1 and beta3 mRNA transcripts in normal and fibrotic human lung. Thorax 2001;56:549-56. Corrin B, Butcher D, McAnulty BJ, Dubois RM, Black CM, Laurent GJ, et al. Immunohistochemical localization of transforming growth factor-beta 1 in the lungs of patients with systemic sclerosis, cryptogenic fibrosing alveolitis and other lung disorders. Histopathology 1994;24:145-50. Machado RD, Pauciulo MW, Thomson JR, Lane KB, Morgan NV, Wheeler L, et al. BMPR2 haploinsufficiency as the inherited molecular mechanism for primary pulmonary hypertension. Am J Hum Genet 2001;68:92-102. de Carvalho EF, Parra ER, de Souza R, A’B Saber AM, Machado Jde C, Capelozzi VL. Arterial and interstitial remodelling processes in non-specific interstitial pneumonia: Systemic sclerosis versus idiopathic. Histopathology 2008;53:195-204. Park IN, Jegal Y, Kim DS, Do KH, Yoo B, Shim TS, et al. Clinical course and lung function change of idiopathic nonspecific interstitial pneumonia. Eur Respir J 2009;33:68-76. Daniil ZD, Gilchrist FC, Nicholson AG, Hansell DM, Harris J, Colby TV, et al. A histologic pattern of nonspecific interstitial pneumonia is associated with a better prognosis than usual interstitial pneumonia in patients with cryptogenic fibrosing alveolitis. Am J Respir Crit Care Med 1999;160:899-905. Zisman DA, Karlamangla AS, Ross DJ, Keane MP, Belperio JA, Saggar R, et al. High-resolution chest CT findings do not predict the presence of pulmonary hypertension in advanced idiopathic pulmonary fibrosis. Chest 2007;132:773-9. Devaraj A, Wells AU, Meister MG, Corte TJ, Hansell DM. The effect of diffuse pulmonary fibrosis on the reliability of CT signs of pulmonary hypertension. Radiology 2008;249:1042-9. Seibold JR, Denton CP, Furst DE, Guillevin L, Rubin LJ, Wells A, et al. Randomized, prospective, placebo-controlled trial of bosentan in interstitial lung disease secondary to systemic sclerosis. Arthritis Rheum 2010;62:2101-8. Launay D, Sitbon O, Le Pavec J, Savale L, Tchérakian C, Yaïci A, et al. Long-term outcome of systemic sclerosis-associated pulmonary arterial hypertension treated with bosentan as first-line monotherapy followed or not by the addition of prostanoids or sildenafil. Rheumatology (Oxford) 2010;49:490-500. King TE Jr, Behr J, Brown KK, du Bois RM, Lancaster L, de Andrade JA, et al. BUILD-1: A randomized placebo-controlled trial of bosentan in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 2008;177:75-81. King TE Jr, Brown KK, Raghu G, du Bois RM, Lynch DA, Martinez F, et al. BUILD-3: A randomized, controlled trial of bosentan in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 2011;184:92-9. Zisman DA, Schwarz M, Anstrom KJ, Collard HR, Flaherty KR, Hunninghake GW. A controlled trial of sildenafil in advanced idiopathic pulmonary fibrosis. N Engl J Med 2010;363:620-8.

Source of Support: Nil, Conflict of Interest: None declared.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Images in Pulmonary Vascular Disease

The WHO classification of pulmonary hypertension: A case-based imaging compendium John J. Ryan1, Thenappan Thenappan1, Nancy Luo1, Thanh Ha2, Amit R. Patel1, Stuart Rich1, and Stephen L. Archer1 1

Department of Medicine, Section of Cardiology, 2Department of Pathology, University of Chicago, Chicago, Illinois, USA

ABSTRACT Pulmonary hypertension (PH) is defined as a resting mean pulmonary artery pressure greater than 25 mmHg. The World Health Organization (WHO) classifies PH into five categories. The WHO nomenclature assumes shared histology and pathophysiology within categories and implies category-specific treatment. Imaging of the heart and pulmonary vasculature is critical to assigning a patient’s PH syndrome to the correct WHO category and is also important in predicting outcomes. Imaging studies often reveal that the etiology of PH in a patient reflects contributions from several categories. Overlap between Categories 2 and 3 (left heart disease and lung disease) is particularly common, reflecting shared risk factors. Correct classification of PH patients requires the combination of standard imaging (chest roentgenograms, ventilation-perfusion scans, echocardiography, and the 12-lead electrocardiogram) and advanced imaging (computed tomography, cardiac magnetic resonance imaging, and positron emission tomography). Despite the value of imaging, cardiac catheterization remains the gold standard for quantification of hemodynamics and is required before initiation of PH-specific therapy. These cases illustrate the use of imaging in classifying patients into WHO PH Categories 1-5. Key Words: CREST, Eisenmenger’s syndrome, late gadolinium enhancement, pulmonary artery acceleration time, pulmonary capillary hemangiomatosis, pulmonary veno-occlusive disease, right ventricular hypertrophy

INTRODUCTION Reviews of pulmonary hypertension (PH) almost invariably begin with a hemodynamic definition accompanied by a reference to the five categories or groups of PH.[1,2] The hemodynamic definition of PH (mean pulmonary artery pressure, mPAP, at rest greater than 25 mmHg) is relatively straightforward, although estimations of PA pressures by echocardiography can be unreliable.[3] The clinician’s challenge arises when reviewing the differential diagnosis to place the PH patient into one of the five WHO categories (Table 1). This classification has practical importance because there are category-specific treatments, such as medical therapies for pulmonary arterial hypertension (PAH) (Category 1 PH), [4,5] supplemental oxygen or continuous positive airway pressure (CPAP) for Category 3, and pulmonary artery endarterectomy for Category 4 PH, chronic thromboembolic PH (CTEPH).

Address correspondence to:

Dr. Stephen L. Archer Harold Hines Jr. Professor of Medicine, University of Chicago, 5841 South Maryland Ave., MC6080, Chicago IL 60637 USA Email: sarcher@medicine.bsd.uchicago.edu Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Despite the importance of imaging to the categorization of PH, there is a paucity of articles showing representative diagnostic images for the WHO categories of PH. This visual compendium of images obtained in patients in each of the PH categories is meant to illustrate key diagnostic imaging features of each PH category and demonstrates the role of multimodality imaging in the categorization of PH. Conventional imaging (computed tomography (CT), echocardiography and Ventilation-perfusion scans (VQ scans)) are used to identify cardiac shunts, pulmonary emboli and to characterize parenchymal lung disease. Doppler echocardiography is used to estimate pulmonary artery pressure (PAP). Although the ECG is technically not an imaging tool, it offers a noninvasive assessment of the status of the RV. Advanced imaging can Access this article online

Quick Response Code:

Website: www.pulmonarycirculation.org DOI: 10.4103/2045-8932.94843 How to cite this article: Ryan JJ, Thenappan T, Luo N, Ha T, Patel AR, Rich S et al. The WHO classification of pulmonary hypertension: A case-based imaging compendium. Pulm Circ 2012;2:107-21.

107

Ryan et al.: Images in PVD

monitor pulmonary vascular density and compliance and evaluate the metabolism, function, and vascularity of the hypertrophied right ventricle (RV). Although pulmonary angiography is largely reserved for Category 4 PH, the role of left and right heart catheterization in achieving correct categorization remains paramount.

OVERVIEW OF THE WHO PH CLASSIFICATION

Category 1 PH (PAH) is diverse and is unified by histological similarities amongst the represented diseases and the shared elevation of pulmonary vascular resistance (PVR). Category 1 includes idiopathic and familial PH, as well as PH associated with conditions such as collagen vascular disease, congenital shunts, cirrhosis and portal hypertension, HIV, hemoglobinopathies, and schistosomiasis. It also includes PH associated with drugs, such as anorexigens Table 1: Updated WHO PH classification

1. Pumonary arterial hypertension (PAH) 1.1. Idiopathic PAH 1.2. Heritable 1.2.1. BMPR2 1.2.2. ALK1, endoglin (with or without hereditary hemorrhagic telanglectasla) 1.2.3. Unknown 1.3. Drug- and toxin-induced 1.4. Associated with 1.4.1. Connective tissue diseases 1.4.2. HIV infection 1.4.3. Portal hypertension 1.4.4. Congenital heart diseases 1.4.5. Schistosomiasis 1.4.6. Chronic hemolytic anemia 1.5. Persistent pulmonary hypertension of the newborn 1.6Pulmonary veno-occlusive disease (PVOD) and/or pulmonary capillary hemangiomatosis (PCH) 2. Pulmonary hypertension owing to left heart disease 2.1. Systokic dysfunction 2.2. Diasgokic dysfunction 2.3. Valvular disease 3. Chronic obstructive pulmonary disease 3.1. Chronic obstructive pulmonary disease 3.2. Interstitial drug disease 3.3. Other pulmonary diseases with mixed restrictive and obstructive pattern 3.4. Sleep-disordered breathing 3.5. Alveolar hypoventillation disorders 3.6. Chronic exposure to high altitude 3.7. Developmental abnormalities 4. Chronic thromboembolic pulmonary hypertension (CTEPH) 5. Pulmonary hypertension with unclear multifactorial mechanisms 5.1. Hematologic disorders: Myeloproliferative disorders, splenectomy 5.2. Systemic disorders: Sarcold, pulmonary Langerhans cell histlocytosis: Lymphangiolelomyomatosis, neurofibromatosis, vasculitis 5.3. Metabolic disorders: Glycogen storage disease, Gaucher disease, thyrold disorders 5.4. Others: Tumoral obstruction, fibrosing medlastinitis, chronic renal failure on dialysis Reproduced with permission from reference 2

108

or amphetamines.[2] The diagnosis of Category 1 PH is largely a diagnosis of exclusion (i.e., excluding Categories 2-5 PH), a process in which imaging is crucial. Images of idiopathic PAH and PAH due to atrial septal defect (ASD) with Eisenmenger’s physiology are shown (Figs. 1-7). In addition, complications of severe Category 1 PH are illustrated, including compression of the left main coronary artery (Fig. 5) and calcification of the proximal pulmonary artery (PA) (Fig. 3). Imaging can also provide clues to the subcategory of Category 1 PH, as illustrated in a patient with pulmonary capillary hemangiomatosis (PCH) (Figs. 6 and 7). Cardiac magnetic resonance imaging (CMR) can quantify RV volumes and size and, when performed using gadolinium as a contrast agent, provides prognostic information.

Classification into Category 1 is not as simple as identifying that a patient has a Category 1-associated disease. For example, while sickle cell disease is in Category 1 (because some patients develop pulmonary vascular remodeling), sickle cell patients can often develop Category 2 PH, due to secondary hemochromatosis and a secondary restrictive cardiomyopathy. Certain subsets of Category 1 PH have significant lung disease that can complicate attribution of their PH to a single category (notably scleroderma patients who often have parenchymal lung disease, Category 3). Category 2 is the collection of PH syndromes resulting from left ventricular (LV) or left-sided valvular disease. Whether due to mitral stenosis, cardiomyopathy or LV diastolic dysfunction, Category 2 patients have PH due in large part to increased left atrial pressure. Category 2 is the most common form of PH and while there is no approved PH-specific therapy for this category, PH does confer adverse prognosis to these patients (as is the case in Categories 3 and 5). Classically, Category 2 patients are defined at catheterization by an elevated pulmonary-wedge pressure and a modest transpulmonary gradient (usually <10 mmHg difference between mean PA and wedge pressure). However, increasingly cases are identified where the transpulmonary gradient is increased disproportionately.[6] In such cases, there is likely pulmonary vascular remodeling. Such a case of disproportionate Category 2 PH is illustrated in Figure 8. In Figures 9 and 10, we present cases of restrictive physiology causing PH.

Category 3 PH is PH secondary to chronic lung diseases, hypoxia or both (e.g., sleep apnea). This category of PH is characterized by mild elevations in PAP. [7] As with Category 2, however, there are Category 3 patients in whom the PH is disproportionately severe, as compared to their lung disease. We present a case of obstructive sleep apnea with severe PH (Fig. 11). Category 4 PH (CTEPH) is unique because it represents the form of PH that is curable without transplantation.[8] In this Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

G B

Figure 1: Images obtained in a 43-year-old female with idiopathic PAH. (A) S1Q3T3 pattern noted consistent with right ventricle strain. T-wave inversion on anterior leads and ST depression is also suggestive of RVH with strain (note early R wave predominance in V1-V2 consistent with RVH). (B) Chest X-ray showing enlarged pulmonary artery and pruning of the distal pulmonary vasculature. (C) Lateral chest X-ray showing filling of the retrosternal space by an enlarged RV. (D) Parasternal long axis echocardiography view showing dilated RV. (E) Parasternal short axis echocardiography view showing flatted interventricular septum (thin white arrow), severely dilated RV and pericardial effusion (thick white arrow). (F) Tricuspid regurgitation velocity (represented by *) is proportional to right ventricular systolic pressure and estimated by Bernoulli’s equation. (G) Measurement of PAAT (time from onset of flow to peak velocity) (thin white arrow). Note the notching of the PA Doppler envelope, suggestive of pulmonary vascular hypertension (thick white arrow). (H) “Moth eaten” appearance of ventilation/ perfusion scan in idiopathic PAH with patchy perfusion defects, in this case predominantly in the left lower lobe. (I, J) Histopathology from a different patient with Category 1 PAH showing medial hypertrophy and intimal fibrosis of small (<200 µm) PAs.

review, we present a severe case of CTEPH (Fig. 12). Perfusion lung scanning can be helpful for the diagnosis, but will not reveal the proximal extent of the thromboemboli. In addition, patients with nonocclusive thrombi may have normal distal lung perfusion in those segments giving a false negative impression. While noninvasive imaging is key to the diagnosis of CTEPH, there are cases in which the CT angiography fails to detect the intimately incorporated thrombus, which forms a neointima.[9] This reminds one of the need for pulmonary angiography when the index of suspicion is high. Category 5 PH represents a heterogeneous collection of PH syndromes secondary to systemic diseases (i.e., sarcoidosis, histiocytosis X), hematological disorders (such as polycythemia vera or chronic myeloid leukemia) Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

and extrinsic compression of the pulmonary artery. Two Category 5 PH cases due to examples of extrinsic PA compression, one caused by mediastinal calcification and the other by nonsmall cell lung cancer, are shown (Figs. 13 and 14, respectively).

CATEGORY 1 PH

Category 1 PH: 43-year-old female with pulmonary arterial hypertension A 43-year-old female was referred for management of PH. She had initially presented 1 year prior for evaluation of progressive dyspnea and fatigue. Her ECG showed right axis deviation with right ventricular hypertrophy (RVH) 109

Ryan et al.: Images in PVD

and a strain pattern (manifest as early R-wave transition in V1-V2 with ST depression in V1-V4). She also had the S1Q3T3 pattern, defined as a prominent S wave in lead I, Q wave in lead III and T wave inversion in lead III. S1Q3T3 is more commonly seen with pulmonary embolism but can reflect RV strain of any cause, as shown in Figure 1A.[10]

Chest X-ray was consistent with PH with enlarged pulmonary arteries bilaterally, distal pruning of the pulmonary blood vessels and filling-in of the retrosternal airspace on the lateral film, consistent with right ventricular enlargement (Fig. 1B and C). Enlargement of the right descending PA >20 mm is quite specific for PH.[11]

C Figure 2: (A) Cardiac MRI image showing late gadolinium enhancement in the RV insertion site (thick white arrow). (B, C) Cardiac MRI showing dilated right ventricle.

Her transthoracic echocardiogram showed severe RV dilatation with flattening of the interventricular septum and LV compression consistent with RV pressure and volume overload (Fig. 1D and E). Flattening of the interventricular septum that occurs only in diastole reflects right-sided volume overload; however, systolic septal flattening indicates that there is also right-sided pressure overload with right-sided systolic pressures approximating left ventricular systolic pressures.

The tricuspid regurgitation (TR) velocity, obtained using continuous-wave Doppler (Fig. 1F), is used to estimate RV systolic pressure, which is equal to the PA systolic pressure in the absence of pulmonic stenosis, by applying Bernoulli’s equation (PAPsystolic=4V2+estimated RA pressure; where V is the average peak TR velocity). Difficulties in aligning the Doppler parallel to the TR jet or the paucity of TR may preclude accurate assessment of PA systolic pressures.[3] Moreover, although TR velocity can quantify PA pressure, the morphology of the TR jet does not vary with changes in the compliance of the pulmonary vasculature, unlike PAAT, and thus the TR signal does not help categorize PH. In contrast, a less frequently used measure, the pulmonary artery acceleration time (PAAT), can be readily obtained in most patients and provides evidence of the state of pulmonary vascular remodeling (Fig. 1G).[12] To obtain the PAAT, defined as the time from the onset of flow to the peak of the ejection flow velocity (Fig. 1G), the pulsed-wave Doppler sample volume is placed parallel

F 110

Figure 3: Calcified PAs in a patient with atrial septal defect (ASD) and Eisenmenger’s physiology. (A) ECG shows first-degree AV block, right bundle branch block. (B, C) Chest X-ray showing enlarged and calcified pulmonary artery. (D, E) Axial CT scan below the carina demonstrates calcification of the left and right pulmonary arteries. (F) Apical four-chamber echocardiography view showing ASD. (G) Color-flow Doppler echocardiogram showing flow through the ASD with right-toleft shunt that caused her paradoxical embolic stroke. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

Figure 4: Congenital heart disease patient (ASD) with out-of-hospital sudden cardiac death. (A) ECG showing severe RVH. (B) Severe RV hypertrophy and dilatation. (C, D) Ostium secundum atrial septal defect.

to flow in the main PA. Because the difference in PAAT between normal PA pressure and severe PH is small, it is crucial to record the signal at high sweep speed and optimize the filtering and velocity scale. The shorter the acceleration time, the more severe the PH with a value of <80 ms being regarded as abnormal.[13] In order to estimate mean PAP using PAAT, each echocardiography Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 5: Patient with ASD and left main coronary artery compression. (A) ECG showing right atrial enlargement and severe RVH. (B) Chest X-ray showing severely enlarged PA. (C) Lateral chest X-ray showing filling of the retrosternal space. (D, E) Coronary angiogram showing compression of left main coronary artery (small caliber of left main, white arrow). (F) Transverse section at level of bifurcation of pulmonary artery showing proximity of left pulmonary artery (LPA) to the left main coronary artery and compression (white arrow). RPA: Right pulmonary artery; Ao: Aorta. (G) Sagittal views left main coronary artery (white arrow) compressed by pulmonary artery (PA).

laboratory should determine a regression equation correlating mean PAP, measured by catheterization, with PAAT. In PH due to pulmonary vascular disease the PA Doppler envelope develops systolic notching. This notch results from a reflection wave from the noncompliant pulmonary vasculature that “cancels” forward velocity. In rodent models, shortening of the PAAT with notching 111

Ryan et al.: Images in PVD

Figure 6: Category 1 PH diagnosed postmortem as secondary to pulmonary capillary hemangiomatosis (PCH). (A) ECG shows mild left ventricular hypertrophy and right atrial enlargement. (B, C) Chest X-ray shows PA enlargement and cephalization with Kerly B lines. (D) Gross dissection of the heart shows thickened and dilated right ventricle. (E) Pulmonary capillary hemangiomatosis, seen as increased numbers of pulmonary capillaries swollen with large numbers of red blood cells, sharply demarcated from normalappearing lung parenchyma (H and E, ×100). (F) Muscularization of a small-caliber arteriole. Surrounding alveolar septal capillaries with changes of pulmonary capillary hemangiomatosis (H and E, ×200).

routinely develops as PAH progresses and these changes resolve with experimental therapies.[14] A nuclear ventilation/perfusion (VQ) scan which shows some patchy perfusion defects is consistent with Category 1 PH (Fig. 1H). Both this “moth-eaten” appearance on the perfusion scan and the pruning on chest X-ray (loss of 112

Figure 7: Category 1 PH due to a second case of pulmonary capillary hemangiomatosis. (A) ECG showing sinus tachycardia and right atrial enlargement. (B) Chest X-ray on presentation with cardiomegaly and clear lung fields. (C) Chest X-ray after initiation of sildenafil showing pulmonary edema. (D) Ventilation-perfusion scan showing accentuation of basilar perfusion images. (E) Gross dissection of the heart shows thickened and dilated RV. (F) Patchy areas of pulmonary capillary proliferations engorged with red blood. (G) Concentric intimal fibrosis and medial hypertrophy of pulmonary arteries and arterioles.

arterial markings in the lung periphery) reflect the small vessel obliteration that typifies Category 1 PH. These are the imaging correlates of the histological changes seen in PAH (Fig. 1I and J). Hemodynamic measurements by right heart catheterization (RHC) at the time of diagnosis are shown in the table in Figure 1. The patient was started on sildenafil and subcutaneous treprostinil and ultimately Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

transitioned to intravenous prostaglandins. This therapy was maintained for 6 years before the patient succumbed to RV failure.

Imaging lesson

The vascular remodeling of the distal resistance pulmonary arterioles, which is a hallmark of Category 1 PH, can be detected by the notching observed in PA Doppler at echocardiogram as well as the vascular pruning seen in Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 8: Category 2 PH after mitral valve repair. (A) Normal sinus rhythm with lateral T wave flattening. (B) Chest X-ray showing splaying of carina and left atrial enlargement. (C) Lateral chest X-ray showing mitral ring in place and RV enlargement. (D) Representative long axis echocardiography view showing RV enlargement, left ventricular hypertrophy (RVDd: Right ventricular diastolic diameter; LVDd: Left ventricular diastolic diameter; IVS: Interventricular septum). (E) Parasternal short axis echocardiography view showing septal flattening. (F) Color flow Doppler showing severe TR. (G) TR velocity and waveform. (H) Turbulence across the prosthetic mitral valve. (I) CW Doppler flow across mitral valve showing normal gradient for size (dashed tracing) and short half-time (dashed line) suggesting normally functioning mitral valve repair. Pressure half-time of >180 ms may be abnormal. (J) Pulmonary artery pressure tracing and pulmonary capillary wedge pressure tracing showing pulmonary hypertension and normal pulmonary wedge (PW) pressure.

Figure 9: Category 2 PH secondary to restrictive physiology. (A) ECG showing diffuse T wave inversion. (B) Chest X-ray with right-sided pleural effusion on presentation. (C) Chest X-ray after pleurocentesis left-sided heart enlargement is apparent. (D) Apical 4-chamber echocardiography view showing thickening of the lateral LV wall (black arrow). (E) CT scan showing fibrotic lung disease with right pleural effusion and left ventricle wall mass (white arrow). (F) Cardiac MRI showing right-sided pleural effusion and LV wall mass secondary to growth from non-Hodgkins lymphoma in thorax (white arrow). (G) Still-frame left ventriculogram showing restriction of filling due to extrinsic compression. (H) Simultaneous right and left heart catheterization showing equalization of diastolic filling pressures at ~28 mmHg. PVR in this study was normal (1.9 Wood Units), indicating that the PH was not due to pulmonary vascular disease.

chest X-ray and the â&#x20AC;&#x153;moth-eatenâ&#x20AC;? appearance of the VQ scan. The RVH and strain pattern on ECG and RV pressure-volume overload, on transthoracic echocardiogram, help quantify the disease severity but are not specific for Category 1 PH.

Category 1 PH: CMR imaging to assess the RV

In Figure 2, we present two patients with PAH who have dilated right ventricles. Panel A is a 36-year-old female with WHO functional class IV PAH on intravenous (IV) 113

Ryan et al.: Images in PVD

C E

Figure 10: (A) ECG showing left ventricular hypertrophy. (B, C) Chest X-ray showing cardiomegaly. (D) T2 Star Cardiac MRI short axis images demonstrating reduced T2 star time <10 ms suggesting significant iron overload and no signal from dark liver (white arrow). (E) CT transverse section of abdomen showing hepatomegaly. (F) T2 Star MRI of the liver showing total darkness consistent with iron overload (white arrow). (G) Simultaneous right and left heart catheterization showing near-equalization of diastolic filling pressures at ~20 mmHg.

D F

treprostinil. Panel 2B-C is a 61-year-old male with PAH who was WHO functional class II on sildenafil. In Figure 2A, the late gadolinium enhancement at the RV insertion is shown. In Figure 2B and C, a severely dilated RV is seen.

Imaging lesson

CMR has contributed greatly to the evaluation of PH patients. RV morphology on CMR can predict the extent of PAP elevation.[15] Also, late gadolinium enhancement at the 114

Figure 11: Images obtained in 35-year-old male with cor pulmonale. (A)Â S1Q3T3 pattern noted consistent with right ventricle strain. RVH is evident from the prominent R wave in the early precordial leads. Evidence of pulmonary disease, with failure of R wave transition and presence of Rs in V4. (B, C) PA and lateral chest X-ray with severe 4-chamber cardiomegaly with pulmonary vascular redistribution and visible obesity. (D, E) Normal VQ scan, performed anteriorly due to excess obesity. (F-H) CT showing moderate to severe cardiomegaly with normal lung parenchyma, mild dependent hypoventilatory changes and abdominal obesity. (I) PA pressure measurements decrease over the course of first 5 days of hospitalization while receiving CPAP and intensive diuresis (red line: Systolic PAP, green line: Diastolic PAP).

insertion point of the RV has been studied as a prognostic indicator in PH patients.[16] CMR permits reproducible measurements of RV volumes.[17] Arguably, CMR should be a routine part of the diagnosis and follow-up of PH patients.

C a t e g o r y 1 P H : A S D w i t h p a r a d ox i c a l embolization and calcified pulmonary arteries This 56-year-old female has Category 1 PH secondary Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

G B

E B

Figure 12: WHO Group 4 – chronic thromboembolic pulmonary hypertension. (A) Twelve-lead electrocardiogram showing S1Q3T3 suggestive of right ventricular strain, and right axis deviation. (B, C) Chest X-ray: Massively enlarged central pulmonary arteries. (D-E) Ventilation perfusion scan revealing perfusion defect in left lower lobe (F-H) Computed tomographic pulmonary angiogram demonstrating massively dilated main pulmonary artery, eccentric mural thrombus in the right main pulmonary artery and its proximal branches (dashed white arrow).

to an ostium secundum atrial septal defect (ASD) and Eisenmenger’s physiology, with bidirectional interatrial flow after a failed pericardial patch repair 12 years prior. She had a paradoxical embolism causing a right hemispheric stroke 1 year prior to admission. ECG shows first-degree atrial-ventricular and right bundle branch block, both Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure 13: WHO Group 5 – Pulmonary hypertension with unclear or multifactorial etiologies. (A) ECG showing left ventricular hypertrophy. (B, C) Chest X-ray, PA and lateral with no edema or cardiomegaly. (D) Computerized tomographic scan of the chest showing a 4.9 × 2.9 cm calcified mediastinal mass compressing the right main pulmonary artery (white arrow). (E) A filling defect from a thrombus in the right main pulmonary artery (dashed white arrow). (F) CT scan showing oligemia of the entire right lung. (G, H) VQ scan showing a complete absence of perfusion to the entire right lung (white arrow).

common in ASD (Fig. 3A). Chest X-ray (Fig. 3B and C) shows enlargement and calcification of the proximal PAs and pruning of the peripheral PAs. PA calcification reflects long-standing PAH typically associated with congenital heart disease with shunt lesions.[18,19] Extensive calcification within both pulmonary arteries was also confirmed on 115

Ryan et al.: Images in PVD

Figure 14: Category 5 PH. (A) ECG showed non-specific TW flattening. (B, C) Chest X-ray showed left-sided pleural effusion. (D, E) CT scan showed extensive confluent mediastinal and bihilar lymphadenopathy, compressing both pulmonary arteries, right more so than left. The tumor was also seen around the pericardium. Left-sided pleural effusion is visualized. (F) Right ventricular outflow tract echocardiogram color flow view showing turbulence distal to the pulmonic valve. (G) Pulsed wave Doppler across stenosis showing flow acceleration, with flow of 2 m/s (compared with normal of 1 m/s).

C E

chest CT (Fig. 3D and E). Echocardiogram showed an atrial septal defect with bidirectional flow and concentric RVH with preserved RV systolic function (Fig. 3F and G). Her RHC confirmed that the PH was pulmonary vascular in origin (i.e., high transpulmonary gradient and PVR, table in Fig. 3) and demonstrated that she was a vasodilator “nonresponder.” Despite declining IV epoprostenol, the patient remains WHO functional class II on sildenafil and bosentan after 7 years.

Imaging lesson

This patient’s concentric RVH and preserved RV systolic function portend a good outcome, as does the etiology of her subcategory of PH 1 (congenital heart disease). The essential role of echocardiography in assessing the interatrial septum and evaluating RV function is illustrated. Calcified PAs are most commonly seen with Category 1 PH associated with congenital heart diseases (patent ductus or ASD), although calcified PA thrombi have been reported in Category 4 PH.[20]

Category 1 PH: Cardiac arrest in Eisenmenger’s syndrome In contrast to Figure 3, whose subject was WHO functional class II despite severe PAH, Figure 4 shows the autopsy findings of a female in her third decade. This patient also had a secundum ASD and Eisenmenger’s physiology but suffered out-of-hospital cardiac arrest. An ECG obtained shortly before her death shows severe right axis deviation and RVH (Fig. 4A). This is consistent with the dilated right 116

ventricle with focal thinning noted at autopsy (Fig. 4B). Figure 4C and D shows the anatomy of the ostium secundum ASD.

Imaging lesson

Most PH patients develop symptoms or die when the RV thins, dilates and/or becomes hypokinetic.

Category 1 PH: Compression of the left main coronary artery by hypertensive PAs

This case demonstrates an uncommon but well-described clinical complication of severe PH secondary to ASD. This WHO functional class IV 28-year-old female was referred for evaluation of PH. She had been doing well until 4 years prior to presentation when she developed progressive dyspnea and syncope. Transthoracic echocardiogram at that time showed severe RV dilatation and ASD. The ASD was deemed unsuitable for closure due to systemic desaturation and elevation in RV pressures on transient occlusion of the ASD. Transthoracic echocardiography confirmed the presence of ASD and RV dilatation. The patient underwent RHC (Table 2). Based on the negative response to vasodilator therapy (a rise in PAP and fall in cardiac output), the patient was referred for evaluation for lung transplantation. As part of the evaluation, the patient underwent coronary angiography and was found to have left main compression resulting from severe enlargement of her main PA (Fig. 5D and E). CT scan confirmed this and the proximity of the PA to left main coronary artery is illustrated (Fig. 5F and G). Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

Table 2: Hemodynamics and shunt study in a patient with ASD and left main coronary artery compression by a dilated main pulmonary artery Hemodynamics and shunt run Baseline RA (mmHg) RV (mmHg) PA (mmHg) PCWP CO (L/min) PA sat Ao sat PVR (WU)

13 115/15 112/40 10 3.46 52.40% 79% 16

Adenosine 12 130/50 10 3.27 68.50% 82% 22

Baseline PV sat PA sat Ao sat IVC sat SVC Qp Qs L→R flow R→L flow (Bidirectional shunt)

97% 52.4% 79% 49% 49% 2.32 3.46 0.16 L/min 1.3 L/min

Adenosine 97% 68.5% 89.2% 57.3% 56.7% 3.68 3.27 1.06 L/min 0.64 L/min

PA: pulmonary artery; ASD: atrial septal defect; RA: right atrium; RV: right ventricle; PCWP: pulmonary capillary wedge pressure; CO: cardiac output; Ao: aorto; sat: Saturation; PVR: pulmonary vascular resistance; WU: wood units; PV: pulmonary vein; IVC: inferior vena cava; SVC: superior vena cava; Qp: pulmonic blood flow; Qs: systemic blood flow; L: left, R: right

Most cases of left main compression due to PA enlargement are complications of ASD, ventricular septal defect (VSD) or tetralogy of Fallot (TOF).[21] They can be an incidental finding or present with angina or dyspnea. Enlarged PAs in PH can also compress the proximal airways. The optimal management of this PH complication is uncertain with some proponents for left main stenting if LV ischemia is demonstrated.[22] In this case the patient was referred for consideration of combined heart and lung transplantation.

Imaging lesson

Mitsudo et al. reported narrowing of left main coronary artery in 44% of 16 ASD patients with PH,[23] indicating that it is not an uncommon complication.

Category 1 PH: Apparent mixture of categories 2 and 3 PH diagnosed as PCH on autopsy

A 69-year-old male with a history of essential hypertension, coronary artery disease, and past smoking history developed worsening dyspnea and fatigue 1 year before presentation. He had a history of sleep apnea but was poorly compliant with CPAP. A drug-eluting stent was placed in his left circumflex coronary artery 1 year prior to his presentation. ECG showed right atrial hypertrophy (and mild left ventricular hypertrophy [Fig. 6A]). Chest X-ray (Fig. 6B and C) showed cephalization of pulmonary vasculature with bilateral PA enlargement and hyperinflated lungs. There were increased interstitial markings and Kerley B lines. Echocardiogram showed normal left ventricular function, dilated right ventricle and elevated left-sided filling pressures. Right heart catheterization showed elevated PAP and a pulmonary capillary wedge pressure of 19 mmHg (table in Fig. 6). The patient’s DLCO was 43% of the predicted level on PFTs without significant evidence of obstructive or restrictive airway disease. Therapy included improved blood pressure control (using an angiotensin receptor Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

blocker) and the off-label use of the phosphodiesterase-5 inhibitor, sildenafil, for presumptive Category 2 PH.[24] The patient’s functional class improved from WHO IV to WHO II and he did well for 2 years but ultimately expired due to azotemia and decompensated RV failure (which persisted despite admission for diuresis and inotropic support). His autopsy revealed an enlarged heart weighing 645 g with four-chamber dilatation (Fig. 6D). The RV wall thickness was at the upper limit of normal (0.5 cm, consistent with the absence of RVH on ECG). Lung histology (Fig. 6E and F) revealed medial hypertrophy and muscularization of small PAs and surprisingly demonstrated PCH, highlighting the frequent overlap in categories that can occur within patients and also the limitations of imaging in definitive classification.

Imaging lesson

This case illustrates one of the persistent difficulties in appropriately categorizing patients and in turn determining the best treatment options for patients with a new diagnosis of PH. The interstitial changes seen on chest X-ray, although initially concerning for pulmonary edema, can also be seen with PCH or pulmonary veno-occlusive disease. This patient responded well both clinically and hemodynamically to offlabel phosphodiesterase-5 inhibition. He satisfied clinical diagnostic criteria for diastolic dysfunction (Category 2 PH); however, post-mortem results showed features of PCH, illustrating the importance of obtaining an autopsy whenever possible in PH patients.

Category 1 PH: Pulmonary edema with vasodilators in a patient with post-mortem diagnosis of PCH

A 54-year-old female presented with a 5-month history of dyspnea, orthopnea, lower leg swelling, and a recent 15-lb weight gain. The patient had a history of CREST syndrome with limited scleroderma, an antiphospholipid antibody syndrome and a recent diagnosis of PAH by RHC. Chest X-ray on presentation (Fig. 7B and C) showed cardiomegaly and no 117

Ryan et al.: Images in PVD

interstitial disease. VQ scan (Fig. 7D) showed accentuation of basilar perfusion. RHC (table in Fig. 7) results classified the patient as a borderline vasodilator responder (mean PAP fell from 56 mmHg to 43 mmHg with adenosine). The right coronary artery (RCA) was also found to be stenotic and the 80% lesion in her relatively small RCA was stented. The patient was started on sildenafil. The following day the patient became hypotensive and dyspneic. Chest X-ray at that time (Fig. 7C) was significant for subtle signs of pulmonary edema. Pressures and PVR on a repeat RHC were increased (table in Fig. 7). The patient was managed supportively in the ICU with vasopressors and diuretics before being discharged home 1 week later. While at home, the patient experienced in-stent thrombosis of her RCA. On readmission, care was ultimately withdrawn and the patient expired. On autopsy, the heart was enlarged (690 g) with biventricular dilatation (Fig. 7E). In all lung sections, there were multifocal and patchy areas of pulmonary capillary proliferations engorged with red blood cells (Fig. 7F). There was marked and diffuse concentric intimal fibrosis and medial hypertrophy of the small PAs. Some vessels were almost entirely occluded (Fig. 7G). No plexiform lesions were identified. The extensive multifocal proliferation of capillaries along with arteriolar thickening supports a diagnosis of PCH.

Imaging lesson

PCH remains a very difficult diagnosis to make antemortem. In retrospect it was suggested in this case by the development of pulmonary edema and worsened pulmonary hypertension after the introduction of a vasodilator (sildenafil),[25] and the accentuation of basilar perfusion on the VQ scan.[26]

CATEGORY 2 PH

Category 2 PH: Persistent PH after correction of aortic stenosis and mitral insufficiency disease

A 56-year-old female presented 1 month after an aortic valve replacement (AVR) for aortic stenosis (AS) with concomitant mitral and tricuspid valve repair for mitral regurgitation (MR) and TR. The accompanying chest X-ray showed left atrial enlargement, evident from flattening of the left heart border and splaying of the carina (Fig. 8B and C). The echocardiogram showed RV enlargement and LVH (Fig. 8D and E) as well as significant TR with elevated estimated RVSP (Fig. 8F and G). The aortic prosthesis functioned normally. Although there was mild gradient across the mitral valve prosthesis (Fig. 8H and I), the normal pressure half-time was indicative of a nonstenotic repaired valve (Fig. 8I). The pulmonary capillary wedge pressure was mildly elevated at 12 mmHg (Fig. 8J); however, the transpulmonary gradient was increased and was dynamic, decreasing with inhaled nitric oxide. 118

Imaging lesson

This patient’s dyspnea and PH following mitral surgery reflect an elevated transpulmonary gradient as a result of a dynamic elevation in pulmonary vascular tone. The vasodilator responsiveness in this case suggests a possible role for therapy with sildenafil (off-label) and would only be identified if the noninvasive diagnosis of PH were investigated by a RHC.

Category 2 PH: Restrictive cardiomyopathy caused by tumor infiltration

This 72-year-old male had non-Hodgkin’s lymphoma presenting as a neck mass 20 years prior to presentation. He was treated with chemotherapy and local radiation therapy. Six months prior to presentation, he developed a large mass on his right neck which on biopsy was found to be recurrent non-Hodgkin’s lymphoma and he was treated with local radiation therapy. One month prior to admission he developed dyspnea, pedal edema, and ascites, with a 30-lb weight gain. On exam, the patient had a JVP 18 cm above the manubrio-sternal angle with a steep Y descent, 2+ pitting edema to shin, ascites, hepatomegaly, and decreased breath sounds on the right lung with dullness to percussion and decreased vocal fremitus. Chest X-ray confirmed right-sided pleural effusion (Fig. 9B), which after pleurocentesis showed cardiomegaly (Fig. 9C). Echocardiogram was significant for right ventricular enlargement, flattening of interventricular septum, and thickening of the lateral wall of the left ventricle (Fig. 9D). CT chest showed fibrotic lung disease likely secondary to radiation therapy, pleural effusion, but most importantly, a left ventricular wall mass (Fig. 9E). On CMR, the mass was extrinsic to the heart and deformed the inferior wall of the LV (Fig. 9F). The patient underwent left ventriculography (Fig. 9G) confirming that the mass impinged upon and distorted the inferior wall of the left ventricle. Simultaneous right and left heart catheterization confirmed that the PH reflected restrictive physiology diagnosed by the near equalization of diastolic pressures, the steep Y descent and the “square root sign” of the RV diastolic pressure trace (Fig. 9H). This PH resulted from recurrent non-Hodgkin’s Lymphoma causing LV restrictive physiology. Upon receiving therapy for his tumor, the mass shrank and the RV failure signs and symptoms resolved.

Imaging lesson

This case illustrates the utility of imaging in identifying the PH as Category 2 based on the presence of an extracardiac mass. However, the key role of hemodynamics in confirming that the etiology of the PH and right heart failure reflected restrictive physiology is paramount.

Category 2 PH: The complexities of categorization of PH – not all Sickle cell PH is Category 1 PH A 53-year-old African-American female with sickle cell disease was admitted to the coronary care unit with a diagnosis of Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

RV failure. She had multiple hospital admissions for dyspnea and volume overload, and Doppler echocardiography had identified elevated PAP. She had previously been presumptively classified as Category 1 PH (without a RHC), based on the history of sickle cell disease. During the current admission, she had hepatic encephalopathy with hyperammonemia (ammonia: 276 mcg/dl. normal values 20-70 mcg/dl) and was found to have hepatomegaly on CT (Fig. 10E). Her ferritin level was 9811 ng/ml (normal values: 10-220 ng/ml). Invasive hemodynamics confirmed PH (table in Fig. 10) but showed near-equalization of diastolic pressures consistent with the restrictive physiology of an infiltrative cardiomyopathy (Fig. 10G). Ultimately, myocardial iron overload secondary to chronic blood transfusion was confirmed by CMR (Fig. 10D). In the CMR, the T2-star short axis images should retain an intense (“bright”) myocardial signal for the entirety of the series of images presented here. T2-star time in the normal myocardium is >20 ms. This patient’s T2-star time is <10 ms, consistent with significant iron overload and has been associated with a very poor prognosis and ventricular arrhythmia independently of liver iron content and serum ferritin.[27,28] Also, on T2-star imaging, the liver appears very dark, again consistent with severe iron overload (Fig. 10F). The patient was subsequently initiated on IV desferrioxamine therapy, which has been shown to improve LV function in patients with secondary hemochromatosis.[29]

Image lesson

This case reinforces the fact that the presence of a PHassociated disease is insufficient to categorize a patient. PH is prevalent among patients with sickle cell disease, recently shown to be present in 6% of patients.[30] While the presumed etiology of PH associated with hemolytic anemias such as thalassemia is pulmonary vascular disease, histologically similar to other disease entities within Category 1 PH,[31] a RHC is required to accurately categorize PH and in this case dramatically altered therapy.

CATEGORY 3 PH

Category 3 PH: The Pickwick Papers redux

A 35-year-old welder with Class IV obesity (BMI 65 kg/m ) presented to the emergency room for a 3-month history of weight gain, dyspnea and edema. His family reported he had periods of apnea and daytime hypersomnolence. He had cirrhosis and thrombocytopenia with portal hypertension, possibly secondary to alcohol use. ECG showed right axis deviation, incomplete right bundle branch, S1Q3T3 pattern and delayed R wave transition consistent with lung disease (Fig. 11A). Initial chest X-ray showed severe four-chamber cardiomegaly with pulmonary vascular redistribution (Fig. 11B and C). Transthoracic echocardiogram showed a severely dilated RV and severely reduced RV performance but normal left ventricular systolic function. A Swan-Ganz 2

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

catheter revealed PA pressures of >80/40 mmHg (table in Fig. 11). The wedge pressure could not be obtained due to patient size. A VQ scan was low probability for pulmonary emboli (Fig. 11D and E). His CT angiogram showed moderate to severe cardiomegaly with evidence of elevated right heart pressures and normal lung parenchyma other than mild dependent hypoventilation (Fig. 11F-H). The patient, however, did exhibit daytime hypoxemia and hypercapnia on room air as evidenced by an arterial blood gas, which showed pH 7.35, PaCO2 49 mmHg, PaO2 70 mmHg, and SaO2 93%. Given the patient’s extreme obesity and evidence of daytime alveolar hypoventilation, his case is consistent with obesity hypoventilation syndrome (OHS) causing cor pulmonale. With diuresis, ultrafiltration and nocturnal positive airway pressure his PH was reduced and he lost >65 lbs of fluid over 25 days (Fig. 11I). In classic “Pickwickian” syndrome,[32] an early description of what is now characterized as OHS, overall daytime hypoventilation related to markedly restricted lung volumes is coupled with significant nocturnal hypoxemia and episodes of obstructive sleep apnea (OSA). Episodic and eventually chronic hypoxia induces vasoconstriction of the small pulmonary arteries, leading to transient but repetitive elevations of PAP and RVH.[33]

Imaging lesson

Imaging (and RHC) in obese patients is challenging. Elevations in PAP from obesity, OHS, and respiratory disease are typically milder than in other forms of PH;[34] however the chamber dilation and volume overload that ensues can be dramatic, as in this case. In addition, patients often have risk factors for PH that ultimately contribute to their PH syndrome. This patient did have portal hypertension; however, his PH decreased substantially with CPAP, suggesting sleep apnea was the predominant cause.

CATEGORY 4 PH

Category 4 PH: Chronic thromboembolic pulmonary hypertension

This 50-year-old male presented to an outside hospital with exertional dyspnea, and was referred to our institution for further evaluation of PH. He has a history of chronic liver disease secondary to hepatitis C infection and chronic obstructive lung disease. His ECG showed right axis deviation and an S1Q3T3 pattern (Fig. 12A). His chest X-ray showed an enlarged RV, a severely dilated main pulmonary artery, and dilated bilateral pulmonary arteries, consistent with long-standing PH (Fig. 12B and C). Echocardiogram showed severe RV dilatation and dysfunction and a flattened interventricular septum, consistent with RV volume and pressure overload. 119

Ryan et al.: Images in PVD

RHC (table in Fig. 12) revealed severely elevated PAP. Pulmonary function testing was consistent with severe obstructive lung disease with a FEV1/FVC ratio of 49%, total lung capacity of 105%, residual volume of 162% and a DLCO of 21.26 ml/min/mmHg (72% predicted). Although he had risk factors for Category 1 and 3 PH (i.e., chronic liver disease and chronic obstructive pulmonary disease), adherence to the recommended diagnostic algorithm[35] led to a VQ scan that showed small unmatched perfusion defect in the left lower lobe (Fig. 12D and E). Subsequently, a CT pulmonary angiogram showed a filling defect in the right main pulmonary artery and the right middle lobe branch suggestive of pulmonary embolism (Fig. 12F-H). The thrombus in the right main PA had recanalized, evident from the contrast within the thrombus and the absence of right-sided perfusion defect on the VQ scan. The CT scan also confirmed the massive enlargement of the pulmonary arteries. The patient was started on warfarin and sildenafil. Although pulmonary endarterectomy (PEA) represents a definitive cure of CTEPH,[8] this patient was not referred for PEA due to his other significant co-morbidities (liver disease and thrombocytopenia).

Imaging lesson

This case demonstrates the complementary role of CT pulmonary angiography and VQ scans in detecting CTEPH (both modalities being fallible).

pulmonary arteries and involving the pericardium (Fig. 14D and E). Obstruction to RV outflow was visualized on the echocardiogram as flow acceleration detected by color- and pulsed-wave Doppler (Fig. 14F and G).

Imaging lesson

CT scan and MRI are the usual modes of imaging by which Category 5 PH is detected. Extrinsic compression of the PA can obstruct flow, causing RV hypertension. However, if the obstruction is proximal (as in these cases) it is probable that there will be no PH and that PVR will be normal.

CONCLUSIONS

These cases offer representative examples of each category of PH in the WHO classification.

ACKNOWLEDGMENTS

The authors are grateful to the family of Mr. Ernie Nafpliotis, who supported our PH research with a generous donation, and to Dr. Mardi Gomberg-Maitland for providing access to patient images in Figure 3.

REFERENCES 1.

CATEGORY 5 PH

Category 5 PH: PH due to extrinsic PA obstruction A 29-year-old male who was recently diagnosed with testicular cancer was referred for a radical orchiectomy and abdominal lymph node dissection. On post-operative day 1, he developed sudden dyspnea and hypoxemia. ECG and chest X-ray were unremarkable (Fig. 13AC). Echocardiography showed normal left ventricular function with moderately dilated and reduced RV function. Pulmonary artery systolic pressure was estimated at 40 mmHg+RA pressure. A CT pulmonary angiogram revealed a calcified mediastinal mass compressing the right main PA (Fig. 13D and E). There was a filling defect adherent to the vessel wall extending from the right main PA to the right lower lobe PA suggestive of a thrombus (Fig. 13E and F). The VQ scan showed normal ventilation in both lungs (Fig. 13G) with absence of perfusion in the right lung, consistent with right PA compression (Fig. 13H). Figure 14 shows the case of a 54-year-old male with non-small cell lung cancer. He presented to a clinic with worsening dyspnea and cough. Chest X-ray showed pleural effusion (Fig. 14B and C). CT scan showed extensive confluent mediastinal and bihilar lymphadenopathy, compressing both 120

2. 3.

5. 6. 7. 8.

10.

McLaughlin VV, Archer SL, Badesch DB, Barst RJ, Farber HW, Lindner JR, et al. ACCF/AHA 2009 expert consensus document on pulmonary hypertension: A report of the American College of Cardiology Foundation Task Force on Expert Consensus Documents and the American Heart Association: Developed in collaboration with the American College of Chest Physicians, American Thoracic Society, Inc., and the Pulmonary Hypertension Association. Circulation 2009;119:2250-94. Simonneau G, Robbins IM, Beghetti M, Channick RN, Delcroix M, Denton CP, et al. Updated clinical classification of pulmonary hypertension. J Am Coll Cardiol 2009;54:S43-54. Rich JD, Shah SJ, Swamy RS, Kamp A, Rich S. Inaccuracy of Doppler echocardiographic estimates of pulmonary artery pressures in patients with pulmonary hypertension: Implications for clinical practice. Chest 2011;139:988-93. Califf RM, Adams KF, McKenna WJ, Gheorghiade M, Uretsky BF, McNulty SE, et al. A randomized controlled trial of epoprostenol therapy for severe congestive heart failure: The Flolan International Randomized Survival Trial (FIRST). Am Heart J 1997;134:44-54. Rietema H, Holverda S, Bogaard HJ, Marcus JT, Smit HJ, Westerhof N, et al. Sildenafil treatment in COPD does not affect stroke volume or exercise capacity. Eur Respir J 2008;31:759-64. Thenappan T, Shah SJ, Gomberg-Maitland M, Collander B, Vallakati A, Shroff P, et al. Clinical characteristics of pulmonary hypertension in patients with heart failure and preserved ejection fraction. Circ Heart Fail 2011;4:257-65. Elwing J, Panos RJ. Pulmonary hypertension associated with COPD. Int J Chron Obstruct Pulmon Dis 2008;3:55-70. Ryan JJ, Rich S, Archer SL. Pulmonary Endarterectomy Surgery-A Technically Demanding Cure for WHO Group IV Pulmonary Hypertension: Requirements for Centres of Excellence and Availability in Canada. Can J Cardiol 2011;27:671-4. Thistlethwaite PA, Mo M, Madani MM, Deutsch R, Blanchard D, Kapelanski DP, et al. Operative classification of thromboembolic disease determines outcome after pulmonary endarterectomy. J Thorac Cardiovasc Surg 2002;124:1203-11. Al-Naamani K, Hijal T, Nguyen V, Andrew S, Nguyen T, Huynh T. Predictive values of the electrocardiogram in diagnosing pulmonary hypertension. Int J Cardiol 2008;127:214-8.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Ryan et al.: Images in PVD

11. 12. 13. 14.

15.

16.

17. 18.

19. 20. 21.

22. 23.

Satoh T, Kyotani S, Okano Y, Nakanishi N, Kunieda T. Descriptive patterns of severe chronic pulmonary hypertension by chest radiography. Respir Med 2005;99:329-36. Isobe M, Yazaki Y, Takaku F, Koizumi K, Hara K, Tsuneyoshi H, et al. Prediction of pulmonary arterial pressure in adults by pulsed Doppler echocardiography. Am J Cardiol 1986;57:316-21. Kitabatake A, Inoue M, Asao M, Masuyama T, Tanouchi J, Morita T, et al. Noninvasive evaluation of pulmonary hypertension by a pulsed Doppler technique. Circulation 1983;68:302-9. Urboniene D, Haber I, Fang YH, Thenappan T, Archer SL. Validation of high-resolution echocardiography and magnetic resonance imaging vs. high-fidelity catheterization in experimental pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2010;299:L401-12. Alunni JP, Degano B, Arnaud C, Tétu L, Blot-Soulétie N, Didier A, et al. Cardiac MRI in pulmonary artery hypertension: Correlations between morphological and functional parameters and invasive measurements. Eur Radiol 2010;20:1149-59. Freed B, Gomberg-Maitland M, Chandra S, Mor-Avi V, Rich S, Archer SL, et al. Late gadolinium enhancement cardiovascular magnetic resonance predicts clinical worsening in patients with pulmonary hypertension. Journal of Cardiovascular Magnetic Resonance 2012, 14:11 Grothues F, Moon JC, Bellenger NG, Smith GS, Klein HU, Pennell DJ. Interstudy reproducibility of right ventricular volumes, function, and mass with cardiovascular magnetic resonance. Am Heart J 2004;147:218-23. Steinberg I. Calcification of the pulmonary artery and enlargement of the right ventricle: A sign of congenital heart disease. Eisenmenger syndrome-pulmonary hypertension, increased pulmonary resistance, and reversal of blood flow. Am J Roentgenol Radium Ther Nucl Med 1966;98:369-77. Prasad K, Radhakrishnan S, Sinha N. Extensive calcification of pulmonary arteries with left-to-right shunting across the arterial duct. Int J Cardiol 1992;35:419-21. Bloodworth J, Tomashefski JF Jr. Localised pulmonary metastatic calcification associated with pulmonary artery obstruction. Thorax 1992;47:174-8. Kajita LJ, Martinez EE, Ambrose JA, Lemos PA, Esteves A, Nogueira da Gama M, et al. Extrinsic compression of the left main coronary artery by a dilated pulmonary artery: Clinical, angiographic, and hemodynamic determinants. Catheter Cardiovasc Interv 2001;52:49-54. Rich S, McLaughlin VV, O’Neill W. Stenting to reverse left ventricular ischemia due to left main coronary artery compression in primary pulmonary hypertension. Chest 2001;120:1412-5. Mitsudo K, Fujino T, Matsunaga K, Doi O, Nishihara Y, Awa J, et al.

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

24. 25. 26. 27. 28. 29. 30. 31. 32. 33.

34. 35.

[Coronary arteriographic findings in the patients with atrial septal defect and pulmonary hypertension (ASD + PH)–compression of left main coronary artery by pulmonary trunk]. Kokyu To Junkan 1989;37:649-55. Guazzi M, Vicenzi M, Arena R, Guazzi MD. Pulmonary hypertension in heart failure with preserved ejection fraction: A target of phosphodiesterase-5 inhibition in a 1-year study. Circulation 2011;124:164-74. Humbert M, Maitre S, Capron F, Rain B, Musset D, Simonneau G. Pulmonary edema complicating continuous intravenous prostacyclin in pulmonary capillary hemangiomatosis. Am J Respir Crit Care Med 1998;157:1681-5. Frazier AA, Franks TJ, Mohammed TL, Ozbudak IH, Galvin JR. From the Archives of the AFIP: Pulmonary veno-occlusive disease and pulmonary capillary hemangiomatosis. Radiographics 2007;27:867-82. Kirk P, Roughton M, Porter JB, Walker JM, Tanner MA, Patel J, et al. Cardiac T2* magnetic resonance for prediction of cardiac complications in thalassemia major. Circulation 2009;120:1961-8. Wood JC, Tyszka JM, Carson S, Nelson MD, Coates TD. Myocardial iron loading in transfusion-dependent thalassemia and sickle cell disease. Blood 2004;103:1934-6. Davis BA, Porter JB. Long-term outcome of continuous 24-hour deferoxamine infusion via indwelling intravenous catheters in high-risk beta-thalassemia. Blood 2000;95:1229-36. Parent F, Bachir D, Inamo J, Lionnet F, Driss F, Loko G, et al. A hemodynamic study of pulmonary hypertension in sickle cell disease. N Engl J Med 2011;365:44-53. Gladwin MT, Sachdev V, Jison ML, Shizukuda Y, Plehn JF, Minter K, et al. Pulmonary hypertension as a risk factor for death in patients with sickle cell disease. N Engl J Med 2004;350:886-95. Dickens C. The Posthumous Papers of the Pickwick Club. London: Chapman & Hall; 1837. Guidry UC, Mendes LA, Evans JC, Levy D, O’Connor GT, Larson MG, et al. Echocardiographic features of the right heart in sleep-disordered breathing: The Framingham Heart Study. Am J Respir Crit Care Med 2001;164: 933-8. Chaouat A, Bugnet AS, Kadaoui N, Schott R, Enache I, Ducoloné A, et al. Severe pulmonary hypertension and chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2005;172:189-94. McLaughlin VV, McGoon MD. Pulmonary arterial hypertension. Circulation 2006;114:1417-31.

Source of Support: Nil, Conflict of Interest: None declared.

121

Let t ers t o E d i t o r

Regarding “Isolated large vessel pulmonary vasculitis and chronic obstruction of the pulmonary arteries” Sir,

The report on isolated large vessel pulmonary vasculitis and chronic obstruction of the pulmonary arteries by Hagan et al. is very interesting[1]. Hagan et al. noted the usefulness of positron emission tomography and magnetic resonance imaging. It is agreeable for the usefulness of the new imaging technology, but there are some limitations in using. First, the cost of the test and the availability of the analyzer are the main obstacles. The careful history taking and examination might still be helpful in the setting limited resources.[2] Second, the practitioners have to keep in mind for the differential diagnosis.[2] In the present case, the cases were firstly misdiagnosed to be chronic thromboembolic pulmonary hypertension.

Author’s reply We thank Joob and Wiwanitkit for their interest in our article[1,2]. Careful history taking and examination should always form part of the initial assessment of suspected vasculitis, as large vessel vasculitis limited to the pulmonary arteries is likely to be a rare entity and both patients described went on to develop asymptomatic aortitis. Radiographic features that may help distinguish large vessel pulmonary vasculitis from CTEPH in CT pulmonary angiography have been described;[3] as Joob and Wiwanitkit highlight the key to identifying large vessel pulmonary vasculitis for it to be considered in the initial differential diagnosis. In countries with a higher incidence of large vessel vasculitis such as Japan the diagnosis is sometimes made using the combination of laboratory data, radiographic findings and HLA associations,[4] although the validity of this approach to European patients is unclear.

Joanna Pepke-Zaba

Pulmonary Vascular Disease Unit, Papworth Hospital, London, Papworth Hospital, PapworthEverard, Cambridgeshire, UK Email: joanna.pepkezaba@papworth.nhs.uk

Beuy Joob1 and Viroj Wiwanitkit2

Sanitation 1 Medical Academic Center, 2Wiwanitkit House, Bangkhae, Bangkok, Thailand Email: beuyjoob@hotmail.com

REFERENCES 1. 2.

Hagan G, Gopalan D, Church C, Rassl D, Mukhtyar C, Wistow T, et al. Isolated large vessel pulmonary vasculitis as a cause of chronic obstruction of the pulmonary arteries. Pulm Circ 2011;1:425-9 Kerr KM, Auger WR, Fedullo PF, Channick RH, Yi ES, Moser KM. Large vessel pulmonary arteritis mimicking chronic thromboembolic disease. Am J Respir Crit Care Med 1995;152:367-73. Access this article online Quick Response Code:

Website: www.pulmonarycirculation.org

DOI: 10.4103/2045-8932.94844

122

REFERENCES

2. 3. 4.

Hagan G, Gopalan D, Church C, Rassl D, Mukhtyar C, Wistow T, et al. Isolated large vessel pulmonary vasculitis as a cause of chronic obstruction of the pulmonary arteries. Pulm Circ 2011;1:425-9 Joob B, Wiwanitkit V. Isolated large vessel pulmonary vasculitis and chronic obstruction of the pulmonary arteries. Pulm Circ 2012:2:122 Marthen K, Schnyder P, Schirg E, Prokop M, Rummeny EJ, Engelke C. Pattern based differential diagnosis in pulmonary vasculitis using volumetric CT. Am J Roentgenol 2005;184:720-33. Yamazaki I, Ichikawa Y, Ishii M, Hamada T, Kajiwara H. Surgical case of isolated pulmonary Takayasu;s arteritis, Circ J 2005:69:500-2.

Access this article online Quick Response Code:

Website: www.pulmonarycirculation.org

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Abstr ac t s

5th International Conference of Neonatal and Childhood Pulmonary Vascular Disease San Francisco, California, USA, 9-10 March, 2012

1.1

Pulmonary arterial stroke volume: A new and strong prognostic factor in pediatric pulmonary arterial hypertension Douwes JM, Roofthooft MT, Talsma MD, Hillege JL, and Berger RM Center for Congenital Heart Diseases, Departments of Pediatric Cardiology and Epidemiology, Beatrix Children’s Hospital, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands

In the current era of evolving treatment options, there is a need for reliable prognostic parameters in pediatric pulmonary arterial hypertension (PAH). The purpose of this study was to determine the prognostic value of pulmonary stroke volume (PSV) and pulmonary arterial compliance (stroke volume /pulse pressure; PAC) in pediatric PAH. Cardiac catheterization data of 50 consecutive children with idiopathic/hereditary PAH (iPAH/HPAH; n=30) or PAH associated with congenital heart disease (PAH-CHD; n=20) were retrospectively reviewed. PSVi and PACi (both indexed for body surface area) were determined at baseline and during acute vasodilator response tests (AVR). Survival analyses were performed using Kaplan Meier curves and (multivariate) Cox Regression analyses, using death or lung transplantation as endpoints. PSVi (38.4±25.4 ml/ m2) and PACi (0.97±0.83 ml/mmHg/m2) were both age-independent and did not differ between iPAH/HPAH and PAH-CHD. During AVR, PSVi increased to 45.6±25.4 ml/m2 (P<0.01) and PACi to 1.80±2.87 ml/mmHg/ m2 (P<0.01). In univariate analysis, higher baseline PSVi and PACi were associated with improved outcome. In multivariate analysis, corrected for diagnosis, systemic to pulmonary shunt, gender, age, drug-treatment, mean right atrial pressure, cardiac index and pulmonary vascular resistance index, baseline PSVi independently predicted prognosis (HR 0.25 [95% CI 0.07-0.88] per SD P=0.03); in contrast, PACi did not predict prognosis. PSVi and PACi during AVR did not have additional prognostic value. Baseline PSVi is a strong independent predictor for prognosis in pediatric PAH and may be used to identify higher-risk patients and guide therapy.

1.2

High morbidity and mortality in premature infants with pulmonary arterial hypertension secondary to bronchopulmonary dysplasia Aluquin VPR and Sabharwal G Children’s Heart Group, Penn State Children’s Hospital, Hershey, Pennsylvania, USA

Pulmonary arterial hypertension (PAH) is the most significant cardiovascular complication of bronchopulmonary dysplasia (BPD), a chronic lung disease affecting 15,000 premature infants in the US yearly. Despite reported high mortality in these patients, there is paucity of data on its onset and clinical outcomes. We reviewed the characteristics, onset of PAH, medical therapy, morbidity and mortality in 24 BPD patients with PAH. PAH was established by echocardiography and/or cardiac catheterization. Their mean gestational age was 25.7±1.7 weeks and mean birth weight was 679±259 grams. Among the 24 babies, 54% were Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

females and 46% were born small for gestational age. PAH was initially diagnosed at 106±36 days of life, mainly by echocardiography. Since they had a previous normal echocardiogram at 47±44 days, we predict that PAH can be manifested in BPD patients as early as 2 months of life. Eighty-three percent of patients had Nissen fundoplication and G tube placement, 50% had patent ductus arteriosus ligation and 75% had tracheostomy tubes. Five out of 24 infants died (21%) with 2 occurring in-hospital. Twenty-two survivors were discharged on either a home ventilator or nasal cannula at 6.9±2.7 months. All except 2 were on pulmonary vasodilators, most frequently sildenafil (91%). During the first year after discharge, there was an average of 3 hospital readmissions per patient, with 30/62 (48%) readmissions due to pneumonia and BPD exacerbation. On follow-up (28.2±14 months), 50% of children continued to have weights below the 10th percentile. Clinically significant PAH may begin at 2 months of age in preterm babies with BPD. These infants have poor growth, significant co-morbidities, frequent readmissions after discharge and a high mortality rate. There is a need to improve surveillance and management of these high-risk patients.

1.3

Non-invasive assessment of right heart and pulmonary vascular coupling in children with pulmonary hypertensive vascular disease: A simultaneous echocardiographic and catheterization study Colen T, Trines J, Khoo NS, Kaneko S, and Adatia I Division of Pediatric Cardiology and Pulmonary Hypertension Clinic, Department of Pediatrics, Stollery Children’s Hospital, University of Alberta, Edmonton, Alberta, Canada

Cardiac catheterization is the gold standard for assessment of hemodynamics in children with pulmonary hypertensive vascular disease (PHVD). There is a need for accurate, non-invasive correlates of these hemodynamics. The aim of this study was to identify correlations between echocardiographic and catheter parameters in children undergoing cardiac catheterization to investigate PHVD. Echocardiograms were performed on patients with PHVD undergoing cardiac catheterization, after induction of anesthesia. Echocardiographic parameters assessed included tricuspid valve (TV) annular tissue Doppler velocities (TDI), TV inflow Doppler, right atrial (RA) and right ventricular (RV) dimensions and function. Cardiac catheterization data included RA and RV pressures, pulmonary arterial pressure (PAP), pulmonary blood flow, pulmonary vascular resistance index (PVRI), pulmonary capacitance index (PCI) and cardiac index (CI). We studied 14 consecutive patients (8 male; median age 6 years, range 1 - 15) with mean PAP 42±22 mmHg and PVRI 13±6 WUm2. TV peak regurgitant velocity correlated with systolic PAP (r=0.79, P<0.01) suggesting patients were studied under the same hemodynamic conditions. RA mean pressure correlated with TV E/e prime ratio (r=0.67, P=0.02). There was no correlation between echocardiographic parameters of RV function (TAPSE, MPI, TV S prime) and catheter parameters. PVRI correlated with TV TDI a prime (r=0.56, P=0.03). CI correlated with TV inflow E velocity time integral (VTI) (r=0.82, P<0.01). PCI correlated negatively with RA fractional area change (FAC) (r=-0.62, P=0.03) and TV inflow E (r=-0.72, P=0.01). In conclusion, we have demonstrated a correlation between invasive hemodynamic data and echocardiographic 123

Abstracts

parameters in children with PHVD. TV inflow Doppler and annular TDI velocities correlate to PVRI, PCI, CI and RA pressure. These measures may be useful non-invasive markers of PHVD progression or treatment response. This data also suggests increased reliance on atrial function for RV filling in patients with PVHD. This requires further investigation in our patient population.

1.4

Right ventricular adaptation in a mouse model of sickle cell disease: Does N-terminal deletion of cardiac troponin play a role? Hines PC, Prior M, Bradley K, Campbell A and Jin J-P Department of Physiology, Department of Pediatrics, Division of Pediatric Critical Care Medicine, Wayne State University School of Medicine; Children's Hospital of Michigan, Detroit, Michigan, USA; Department of Pediatrics, Division of Hematology and Oncology, University of Michigan School of Medicine, Ann Arbor, Michigan, USA

Sickle cell disease (SCD) is characterized by disturbances in pulmonary vascular blood flow, predisposing patients to pulmonary hypertension (PH), subsequent elevation of right ventricular pressure and complete right ventricular failure in severe cases. Although the response of the right ventricle to pressure overload is a critical determinant of outcome, little is known about the molecular determinants of right ventricular adaptation to elevated pressure. Jin and colleagues recently described a novel post-translational restricted N-terminal proteolysis of cardiac troponin T (cTnT-ND) in response to left ventricular pressure overload. This novel adaptation modifies cardiac muscle contractility in response to left ventricular pressure overload to maintain cardiac output. We hypothesized that the right ventricle in a sickle cell mouse model undergoes a similar molecular adaptation in response to pressure overload. N-terminally deleted cTnT was measured in hearts from wildtype (AA), heterozygote (AS) and homozygous (SS) sickle mice (UAB). Hearts were extracted, right and left ventricles dissected, homogenized, prepared in sample buffer and resolved via SDS gel electrophoresis. cTnT fragments were detected via Western blot. The right ventricle to total heart weight ratio was significantly larger in SS mice (0.1367±0.0376) versus AS and AA mice (0.0995g±0.0148). Quantitation analysis showed a higher ratio of modified cTnT-ND to full length cTnT in right ventricular tissue from homozygous SS mice (0.296; n=10) compared to heterozygote AS (0.122; n = 9) and wild type mice (0.157; n = 6). The increased posttranslationally modified cTnT-ND observed in SS mice right ventricular tissue is the first description of this adaptive response selectively in the right ventricle and the first description of this adaptive response in a chronic disease model. The increased RV weight in SS vs AA/AS mice is also consistent with previous data confirming that SCD mice have elevated pulmonary vascular pressures. As observed in previous models of left ventricular pressure overload, we believe the increased cTnT-ND levels reflect a functional adaptation to elevated right ventricular pressure. This is the first demonstration of cTnT post-translational modification in the context of an intact chronic disease model, and suggests a novel role for cTnT-ND in right ventricular functional adaptation in the context of sickle cell disease.

1.5

Acute hemodynamic effects of inhaled treprostinil and nitric oxide in children with pulmonary arterial hypertension Parker DK, Doran AK, and Ivy DD Children’s Hospital Colorado, University of Colorado School of Medicine, Aurora, Colorado; United Therapeutics Corporation, Research Triangle Park, North Carolina, USA

The safety and acute pharmacodynamic effects of inhaled treprostinil (iTRE) in children with pulmonary arterial hypertension (PAH) is 124

unknown. This study describes the feasibility and safety of delivering iTRE to sedated or anesthetized children during cardiac catheterization. Twelve children, median age 10.9 years (range 4.6-18.8) with known and treated PAH underwent cardiac catheterization as part of routine follow-up while sedated or anesthetized. Diagnoses included IPAH (n=5), PAH-CHD (n=5) and other APAH (n=2). Standard reactivity testing was first performed with oxygen plus nitric oxide (iNO-O2, 40 ppm). Following return of the hemodynamic status to baseline, 3-6 breaths of iTRE was delivered, followed by 3-6 additional breaths for a maximum of 9 breaths if tolerated. iTRE was administered using the OPTINEB-ir Model ON-100/7 ultrasonic nebulizer via either a non-self inflating bag or manual mode of the anesthesia system in synchrony with the Optineb’s inhalation indicator. iTRE was successfully delivered to children during cardiac catheterization. The median tolerated dose was 9 breaths (1.6 mcg/kg). Acute hemodynamic response to iTRE and iNO-O2 were similar. Baseline mPAP of 38±9 mmHg decreased to 32±8 mmHg with both agents. Pulmonary resistance index decreased from 7.3±2.9 units x m2 at baseline to 5.7±2.6 and 5.6±2.2 units x m2 with iNO-O2 and iTRE respectively, without a decrease in SVRI overall. A mild fall in systemic blood pressure was noted in 2 children when dosed beyond 6 breaths and 1 child experienced cough. In a small cohort of pediatric PAH patients, iTRE was successfully delivered during cardiac catheterization. The acute hemodynamic response to iTRE was similar to iNO-O2; however, higher dose iTRE may be associated with a mild fall in systemic blood pressure. Further investigation is warranted regarding use of iTRE the critical care setting and chronic use in children.

1.6

Pulmonary interstitial glycogenosis: An unrecognized etiology of PPHN in congenital heart disease? Radman MR, Goldhoff P, Jones KD, Azakie A, Datar S, Adatia I, Oishi PE and Fineman JR University of California, San Francisco, California, USA; University of Alberta, Edmonton, Canada.

Pulmonary interstitial glycogenosis (PIG) arises from a developmental disorder of the pulmonary mesenchyme, and presents clinically with reversible neonatal respiratory distress and/or persistent pulmonary hypertension of the newborn (PPHN). We report 2 cases of PIG in patients with congenital heart disease (CHD) and evidence of PPHN. Case #1: A term female infant with d-transposition of the great arteries, intact ventricular septum, an adequate patent foramen ovale and a patent ductus arteriosus, presented with persistent cyanosis and hemodynamic instability. PPHN was suspected, and inhaled nitric oxide was started with minimal response. Stress-dose hydrocortisone was started due to concern for cortisol deficiency. This coincided with clinical improvement. Normal ACTH and cortisol levels ruled out adrenal insufficiency, but an intraoperative lung biopsy confirmed the diagnosis of PIG. The post-operative course following an arterial switch procedure was uncomplicated. Case #2: A 37-day-old term male infant with a postnatal diagnosis of heterotaxy, double-outlet right ventricle with pulmonary stenosis, underwent surgical repair. Intra-operatively, the distal pulmonary artery pressures and right ventricular pressure were noted to be near systemic. Surgical anatomic abnormalities were excluded, and a trial of inhaled NO had no response. The infant was extubated on postoperative day 1 and discharged home on oxygen. An intraoperative lung biopsy subsequently confirmed the diagnosis of PIG. Both cases demonstrated the hallmark PIG histologic finding of diffuse, uniform interstitial thickening due to the presence of immature interstitial cells containing abundant cytoplasmic glycogen. We report the second and third patients with PIG associated with CHD. Since histologic examination is required to establish the diagnosis, we speculate that PIG, while rare, may be under-recognized in neonates presenting with PPHN in the setting of CHD. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Abstracts

1.7

Measurement of oxygen consumption in children undergoing cardiac catheterization: A comparison between mass spectrometry and breath by breath methods Guo L, Cui Y, Pharis S, Walsh M, Atallah J, Coe Y, Rutledge J and Adatia I Pediatric Pulmonary Hypertension Clinic, Stollery Children’s Hospital, Mazankowski Heart Institute, University of Alberta, Edmonton, Alberta, Canada

Oxygen consumption (VO2) is important in the calculation blood flow using the Fick equation. Measurement of VO2 is difficult in intubated ventilated patients during the cardiac catheterization and reactivity testing. Assumed VO2 introduces important errors in the calculation of pulmonary blood flow. VO2 may be measured by mass spectroscopy (MS) using mixed expirate argon dilution or by a breath-by-breath method (BBM) of gas exchange analysis. However, MS is expensive, demanding and unsuited to routine clinical use. BBM is simple to use but is unvalidated in mechanically ventilated children. We sought to compare VO2 measurements by MS and BBM. Once a stable baseline was reached, we measured VO2 continuously and simultaneously for 10 minutes by MS (Amis 2000, Innovision, Denmark) and BBM (Innocor, Innovision, Denmark) in consecutive anesthetized children, intubated with a cuffed endotracheal tube, mechanically ventilated and hemodynamically stable with normal body temperature undergoing cardiac catheterization. We studied 9 patients (7 female, median age 6 years range 0.4 -18, median weight 18 kg, 4 -73). Median VO2 measured by MS was 5.4 ml/kg/min, interquartile range (IQR) 4.3-6.1 and by BBM was 4.9 ml/kg/min (IQR 4.7-5.5). The median difference between MS and BBM (0.4 ml/kg/min, 0.2-0.6) was not significant (P=0.074). The Spearman correlation between MS and BBM was high (R =0.86, P=0.003). Both MS and BBM may be used to measure VO2 in anesthetized, intubated mechanically ventilated children undergoing cardiac catheterization. We found no difference in VO2 measured by both methods in children >4 kg. We suggest that BBM method may be a useful alternative to MS to measure VO2. BBM is ideal for clinical use with short set up times, easy calibration and inexpensive maintenance.

1.8

Pulmonary interstitial glycogenosis associated with pulmonary hypertension and hypertrophic cardiomyopathy Guo L, Alkhorayyef A, Ryerson L, Chan A, Phillipos E, Lacson A, Adatia I Department of Pediatrics, Medical Genetics, Pathology, Stollery Children’s Hospital, University of Alberta, Edmonton, Canada

We describe a neonate with pulmonary interstitial glycogenosis, pulmonary hypertension and hypertrophic cardiomyopathy. The fatal outcome in our patient contrasts with the reported favourable prognosis associated with isolated pulmonary interstitial glycogenosis. The association of pulmonary interstitial glycogenosis and hypertrophic cardiomyopathy to our knowledge, has not been reported previously. A male infant was born to a 36-year-old gravida 3, para 2, mennonite mother following an uncomplicated pregnancy and term spontaneous vaginal delivery with a birth weight of 3.1 kg. The initial diagnosis was transient tachypnea of

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

the newborn. At 12 days of age an echocardiogram demonstrated severe pulmonary hypertension (RVsp 90 mmHg: systemic BP 57/28 mmHg). The patient was treated with NO at 20 ppm via nasal cannula and enteral sildenafil. At 16 days of age, he deteriorated with increasing respiratory distress, hypotension and clinical signs of a low cardiac output. He was intubated, mechanically ventilated and intravenous pressors administered. An open lung biopsy was performed at 27 days of age. The biopsy demonstrated features of pulmonary interstitial glycogenosis with well inflated lung tissue and diffusely expanded interstitium. The interstitial cells possessed vacuolated cytoplasm staining positively with periodic acid Schiff reagent for glycogen. The alveolar pneumocytes, pulmonary arteries and arterioles appeared normal. We did not administer steroids in case they would exacerbate the hypertrophic cardiomyopathy. The infant died at 71 days of age with sustained pulmonary hypertension and low cardiac output. The case is unusual because of the associated pulmonary hypertension and fatal, progressive hypertrophic cardiomyopathy. We have broadened the phenotype of pulmonary interstitial glycogenosis and demonstrated the diagnostic value of lung biopsy in a case of unexplained neonatal pulmonary hypertension.

1.9

Aggressive treatment of pulmonary hypertension in children with restrictive cardiomyopathy improves outcomes after cardiac transplant Weinberger S, Reardon L, Reemtsen B and Alejos JC Loma Linda University Children’s Hospital, Loma Linda, California, USA; UCLA Mattel Children’s Hospital, Los Angeles, California, USA

This study examines the effect of aggressive management of pulmonary hypertension in pediatric patients with restrictive cardiomyopathy, and assesses perioperative and one-year outcomes following heart transplant. Fifteen children with restrictive cardiomyopathy listed for transplant had cardiac catheterization for hemodynamic assessment and pulmonary reactivity. Patients were then placed on oral pulmonary vasodilators for mean pulmonary artery pressure greater than 25 mmHg or pulmonary vascular resistance (PVR) greater than 2.5 Wood Units (WU). Post-transplant, patients were followed with cardiac catheterization at weeks 1, 3, and 12; 6 months and one year. Seven treated patients were compared to three patients with normal pressures and 5 patients with untreated pulmonary hypertension. Five of the treated patients with pulmonary hypertension had documented changes in hemodynamics to the normal range prior to transplant; 2 patients had persistently elevated PVR. In the patients with adequately controlled pulmonary hypertension, postoperative outcomes were virtually identical to those patients without pulmonary hypertension. There was a significant difference in mean length of intubation (1.2 vs 19.5 days, P=0.02) and mean postoperative length of stay (9.4 vs 27 days, P=0.05) compared to untreated patients. Four of the treated patients were able to stop oral pulmonary vasodilators on day of transplant; the remaining 3 continue on treatment with PVR ranging from 2.2-4.3 WU. The 2 patients with persistently elevated PVR at time of transplant, as well as 3 of the untreated pulmonary hypertensives, suffered acute pulmonary hypertensive crises requiring prolonged ventilatory and circulatory support. Three of the patients with untreated pulmonary hypertension were treated for episodes of rejection within the first year, and 2 of those patients died; 2 patients without pulmonary hypertension experienced episodes of rejection with 1 death. In conclusion, aggressive treatment of altered pulmonary hemodynamics promotes favorable outcomes in children with restrictive cardiomyopathy undergoing heart transplant.

125

Inst ruct i ons fo r Au t h o r s GENERAL COMMENTS

AUTHORS AND CONTRIBUTIONS

Identity and Nature

Author Requirements

Pulmonary Circulation (ISSN 2045-8932) is a peer-reviewed, international, quarterly journal with editorial offices in Chicago USA, Cambridge UK, and London UK, and with contributing editors and editorial board members from more than 20 countries. Each quarter’s issue is published in the last week of the previous quarter. Each issue’s full text is available online (www. pulmonarycirculation.org).

Author perspectives Pulmonary Circulation welcomes contributions—from original research articles to letters to the editor—from clinicians, clinical scientists, investigators, and any other professional working in the pulmonary circulation, pulmonary vascular medicine, or pulmonary vascular disease.

Focus

Pulmonary Circulation is designed to be the main communicating medium connecting clinicians and researchers who are interested in the pulmonary circulation and pulmonary vascular disease. It is expected to serve the interests of people in all parts of the world.

Affiliation

The Journal is a publication of the Pulmonary Vascular Research Institute (PVRI), an independent international medical research organization devoted to increasing awareness and knowledge of pulmonary vascular disease (www. pvri.info).

Indexing

Pulmonary Circulation is indexed/listed with Caspur, DOAJ, EBSCO Publishing’s Electronic Databases, Expanded Academic ASAP, Genamics JournalSeek, Google Scholar, Hinari, Index Copernicus, OpenJGate, PrimaCentral, ProQuest, PubMed, Pubmed Central, SCOLOAR, SIIC databases, Summon by Serial Solutions and Ulrich’s International Periodical Directory.

Fees

Pulmonary Circulation charges authors no fee of any kind, neither for submission nor for processing or publication of manuscripts, nor even for the reproduction of color photographs.

While other journals require authors to transfer copyright ownership of their articles to them, Pulmonary Circulation follows the modern trend of open-access journals to allow authors to retain ownership of their own articles, as specified by the ICMJE (International Committee of Medical Journal Editors). To ensure originality, we merely require authors to assign us First Serial Rights (first publication in a periodical); and we ask only that for any subsequent publication of their articles (as in an anthology or a textbook) the following parenthetical statement appear at the end of it: “(This article was first published in Pulmonary Circulation, volume, number [year] pages.)”

Access

The Journal allows free access (open access) to its contents and permits authors to self-archive the final accepted version of articles on any OAIcompliant institutional/subject-based repository. To achieve faster and greater dissemination of knowledge and information, the Journal publishes articles online as “Ahead of Print” immediately on acceptance.

Reprints

Pulmonary Circulation provides no free reprints. Reprints may be purchased directly from Medknow, the world’s largest publisher of open-access journals (www.medknow.com).

Languages

The Journal is published in English, and there are simultaneous editions (both hard copies and online) in other languages.

For precision in key-word searches online, and as a matter of stylistic consistency, the Journal editors use American English. • •

Spellings and words, for example: “pediatrics” rather than “paediatrics,” “caption” rather than “legend,” and (conceivably) “hood and trunk” rather than “bonnet and boot.” Punctuation, for example: “sample,” rather than ‘sample’, Details of how to compose your manuscript in American English automatically are provided in “The Writing Process,” below.

126

Authorship criteria Authorship should be based on substantial contributions to each of these 3 components: concept and design of study or acquisition of data or analysis and interpretation of data; crafting the article or revising it critically for important intellectual content; and final approval of the version to be published.

Participation solely in the acquisition of funding or the collection of data does not justify authorship. General supervision of the research group is not sufficient for authorship. Each contributor should have participated sufficiently in the work to take public responsibility for appropriate portions of the content of the manuscript. The order of naming the contributors should be based on the relative contribution of each contributor toward the study and the writing of the manuscript. Once submitted, the order cannot be changed without the written consent of all the contributors. The Journal does not require the publication in its articles of statements of who did what during the preparation of a multiple-author article. For such articles, the authors may make special mention of particular authors’ efforts in the article’s Acknowledgments.

The corresponding author Teams of authors must nominate one individual to be the Corresponding Author who first communicates with the Journal’s editorial office for all matters related to the manuscript (especially any revisions and final approval of the proof pages [“galley proofs”]), and who thereafter will field reader inquiries (his or her name, mailing address and email address having been published on the first page of the article).

Contribution Components Defined (in order of appearance in journal)

*Components added by Journal staff from information provided by authors:

*Article type The word or words identifying a contribution above and to the left of the title, where appropriate (e.g., for articles, not for letters to the editor—all defined below in “Your Contribution Type”). Title The descriptive name of an article. (Detailed below in “The Manuscript Preparation Process.”) By-line The authors’ names—without the word “by.”

Affiliations Institutions of the authors (e.g., universities, research institutes), named beneath the by- line, identified by superscripted numbers.

Running head (a.k.a. running headline) The line that appears as a header for each page of an article after the first page, identifying the article with condensed versions of its authors and its titles. (Detailed below in “The Manuscript Preparation Process.”)

*Correspondence (box) The name, physical mailing address, and email address of the individual authorized by all the authors of the manuscript to communicate with the Journal’s editorial office for all matters related to the manuscript, and to receive communications from readers of the Journal. Abstract A succinct description of the article’s main points.

Key words 3-5 words that describe the content of the manuscript but that are not included in the title of the manuscript. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Contributions to Pulmonary Circulation

Introduction Preliminary remarks to introduce the article’s major subjects and rationale.

Materials and methods Description of any materials or methods you used which a researcher would need to know in order to duplicate your results. Results Your findings.

Discussion Discussion of your findings or results—the body of the article.

Acknowledgements In this optional section you may specify: contributions that need acknowledging but do not justify authorship, such as general support by a departmental chair or individuals who helped collect blood samples and tissue specimen; contributions of technical help; and contributions of financial and material support, which should specify the nature of the support. If the manuscript was presented as part at a meeting, then the organization, place and exact date on which it was presented should be included. Sources of support, conflicts of interest Disclosures of any funding sources and potential conflicts of interest. Please see “Legal Requirements,” below.

Table A boxed arrangement of data, usually in columns and rows, each table with its own title, its own caption, and, if necessary, its own footnotes to explain any symbols used in the table. Tables with more than 10 columns and/or 25 rows may not be accepted.

References The published sources cited in an article, in the text indicated by a superscripted number, all appearing at the end of the article in the order in which the article cited them (not alphabetically by author names). Pulmonary Circulation employs the same format of reference citation as The New England Journal of Medicine.

Figure captions Sometimes called legends, these are the lines of text beneath a figure describing the figure. If a figure came from an existing source, then the caption must end with this parenthetical statement: “(Adapted from [source]),” as in: “(Adapted from ref. 53)” Figures With the exception of tables, “figures” are all non-text components of a manuscript—graphs, photographs, line drawings, etc. (Specifications for figures are given below in “The Manuscript Preparation Process.”) Footnotes Used only in tables to define symbols.

Study design for an original design article Selection and Description of Participants: Clearly describe your selection of the observational or experimental participants (patients or laboratory animals, including controls), including eligibility and exclusion criteria and a description of the source population.

Technical Information: Identify the methods, apparatus (give the manufacturer’s name and address in parentheses), and procedures in sufficient detail to allow other workers to reproduce the results. Give references to established methods, including statistical methods (see below); provide references and brief descriptions for methods that have been published but are not well known; describe new or substantially modified methods, give reasons for using them, and evaluate their limitations. Identify precisely all drugs and chemicals used, including generic name(s), dose(s), and route(s) of administration. Reports of randomized clinical trials should present information on all major study elements, including the protocol, assignment of interventions (methods of randomization, concealment of allocation to treatment groups), and the method of masking (blinding), based on the CONSORT Statement (www.consort-statement.org).

Review article Description: A comprehensive review on a topic related to the pulmonary circulation and/or pulmonary vascular disease. Review articles usually are invited by the editors; but unsolicited manuscripts will also be considered for publication. It is expected that these articles will be written by individuals who have done substantial work on the subject or are considered experts in the field. Suggested length: 10,000-15,000 words excluding Abstract, figure captions, tables, and References

Components: Abstract, Key Words, Introduction, Discussion (text), Conclusions (including future directions), References (up to 200), figures (ideally 3-8 schematic diagrams, color images, flow charts, etc.), and tables Case Report Two types: (1) Traditional; and (2) Extensive

Description : New, interesting and rare cases can be reported. They should be unique, describing a great diagnostic or therapeutic challenge and providing a learning point for the readers. Cases with clinical significance or implications will be given priority. Suggested length: • Traditional—up to 1,000 words, up to 10 references • Extensive—up to 5,000 words, up to 60 references

Components: Abstract, Key Words, Introduction, Case Description, Discussion, Reference, ideally with tables and figures

*Access this article online (box) Created by the editors, not the authors.

Field report Description: A clinical article that could be described by any of these titles: Guidelines and Consensus, Clinical Trials, Clinical Debates, Personal Perspectives, Clinical Practice.

Your Contribution

Components: As necessitated by the article’s contents

Permissions. Permission to use copyrighted text or trademarked material. Please see “Legal Requirements,” below. Guidelines and Consensus

Suggested length: up to 8,000 words

Components: Abstract, Introduction, Discussion, References, figures, and tables *Components added by Journal staff from information provided by authors.

Original research article Description: Pulmonary Circulation considers all types of original research articles including clinical and basic research conducted in human subjects and laboratory animals and in vitro, randomized controlled trials, intervention studies, studies of screening and diagnostic tests, outcome studies, cost effectiveness analyses, case-control series, and surveys with high response rates. Suggested length: up to 9,000 words

Components: Abstract, Key Words, Introduction, Materials and Methods, Results, Discussion, References, figures and tables Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Suggested length: 1,500 words

Special research report Description: A short clinical research paper describing the novel observations from a small cohort of patients, or a short, basic, important and translational research paper describing extremely novel results. Suggested length: 1,500 words

Components: Key Words, text (including a brief Abstract, background and rationale, brief description of methodology, Results, and Discussion); up to 20 references; figures and tables Editorial Description : An informal (“plain English”) statement of opinions or a position on an issue relevant to Pulmonary Circulation readers, by a Journal editor or editorial board member, or an invited contributor. Suggested length: 500-1,000 words Components : Text only

Editor’s highlight Description: A Journal editor’s “behind the scenes” or “sneak preview” focus 127

Contributions to Pulmonary Circulation

on a particular topic or paper.

Suggested length: 500-1,000 words

Components: text, possibly with figures

Guest editorial Description: An informal (“plain English”) statement of opinions or a position on an issue relevant to Pulmonary Circulation readers, by a Journal reader or readers, or an invited contributor. Suggested length: 500 words Components: text only

Letter to the editor Description: Letters to the Editor pertain directly to an article published in the journal within the preceding 8 weeks. Authors of the original article cited in the letter will be invited to reply. Letters to the Editor should be submitted via the online manuscript submission process described below. Suggested length: 300 words Components: text only

Reporting guidelines for specific study designs For this refer Table 1.

Statistics: Whenever possible quantify findings and present them with appropriate indicators of measurement error or uncertainty (such as confidence intervals). Authors should report losses to observation (such as, dropouts from a clinical trial). When data are summarized in the Results section, specify the statistical methods used to analyze them. Avoid non-technical uses of technical terms in statistics, such as “random” (which implies a randomizing device), “normal,” “significant,” “correlation,” and “sample.” Define statistical terms, abbreviations, and most symbols. Specify the computer software used. Use upper italics (P=0.048). For all P values include the exact value, not less than 0.05 or 0.001. Mean differences in continuous variables, proportions in categorical variables and relative risks including odds ratios and hazard ratios, should be accompanied by their confidence intervals.

Results: Present your results in a logical sequence in the text, tables, and figures, giving the main or most important findings first. Do not repeat in the text all the data in the tables or figures; emphasize or summarize only important observations. Extra or supplementary materials and technical detail can be placed in an appendix where it will be accessible but will not interrupt the flow of the text; alternatively, it can be published only in the electronic version of the journal. When data are summarized in the Results section, give numeric results not only as derivatives (for example, percentages) but also as the absolute numbers from which the derivatives were calculated, and specify the statistical methods used to analyze them. Restrict tables and figures to those needed to explain the argument of the paper and to assess its support. Use graphs as an alternative to tables with many entries; do not duplicate data in graphs and tables. Where scientifically appropriate, analyses of the data by variables such as age and sex should be included.

Discussion: Include summary of key findings (primary outcome measures, secondary outcome measures, results as they relate to a prior hypothesis); strengths and limitations of the study (study question, study design, data collection, analysis and interpretation); interpretation and implications in the context of the totality of evidence (“Is there a systematic review to refer to, if not, could one be reasonably done here and now?” or “What this study adds to the available evidence,” or, “Effects on patient care and health policy, possible mechanisms,” etc.); controversies raised by this study; and future research

Table 1: Reporting guidelines for specific study designs

directions (for this particular research collaboration, underlying mechanisms, or clinical research).

General Comments: Do not repeat in detail data or other material given in the Introduction or the Results section. In particular, contributors should avoid making statements on economic benefits and costs unless their manuscript includes economic data and analyses. Avoid claiming priority and alluding to work that has not been completed. New hypotheses may be stated if needed; however, they should be clearly labeled as such.

The Processes

The writing process Since all manuscripts published by Pulmonary Circulation must conform to the latest version of the ICMJE’s (International Committee of Medical Journal Editors) “Uniform Requirements for Manuscripts Submitted to Biomedical Journals” (www. icmje.org), we at Pulmonary Circulation strongly recommend that you write your article according to those requirements (as opposed to first writing it and then checking to see if it conforms). Please write, or compose, your manuscript in a Word or WordPerfect document that has the settings shown below for Text under “The Manuscript Preparation Process.”

The manuscript preparation process All submissions must be made online through our website (www.journalonweb. com/pc). First-time authors will have to register at the website. (Registration is free but mandatory.) Instructions for submission are also available at the Journal’s website (www.pulmonarycirculation.org). For “simpler” contributions (i.e., those having no figures or abstracts, such as a letter to the Editor or a guest editorial), you need to prepare only a Manuscript file (described below) to be submitted. For “full article” contributions, please prepare the required 4 separate files for submission at the same time. (You may certainly send them at different times; but Journal policy specifies that no article is put into production until its 4 files have been received). The 4 are: the MANUSCRIPT file (including all tables and all captions); the FIGURES file (all non-text components other than tables—graphs, photos, color images, illustrations, etc.); the SIGNS file; and the LEGALITIES file.

Your MANUSCRIPT file (“the text file”) [1st of the 4 files to be submitted for an article-type contribution] • The acceptable format is Word. • Maximum file size is 1 MB (.rtf or .doc). • Please do not zip the files, nor use a pdf, and kindly do not incorporate figures in this file. • Begin with a cover page (a.k.a. title page) showing: the total number of pages, total number of figures, and word counts for the text (excluding the References, tables and Abstract); type of contribution (original article, review article, case report, letter to editor, etc.); article title and running head (see below); names of all authors (with their highest academic degrees); name(s) of affiliations (department(s) and/or institution(s) to which the work should be credited); and the name and contact information of the corresponding author. • Following your References section, please type the information that Journal staff will put in the little box (Sources of Support and Conflicts of Interest, if any). Your published article will end there, with that little box; however, here in your Manuscript File to be submitted, please follow that (the information to be boxed) with these two things, in this order: • Each actual table with its own title and its own caption; and then all figure captions. Title (of article): Only the first word of your title is capitalized, with 3 exceptions:

Initiative

Type of Study

Source

CONSORT STARD QUOROM STROBE MOOSE

randomized controlled trials studies of diagnostic accuracy systematic reviews and meta-analyses observational studies in epidemiology meta-analyses of observational studies in epidemiology

http://www.consort-statement.org http://www.consort-statement.org/stardstatement.htm http://www.consort- statement.org/Initiatives/MOOSE/moose.pdf http://www.strobe-statement.org http://www.consort- statement.org/Initiatives/MOOSE/moose.pdf

128

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Contributions to Pulmonary Circulation

the word following a colon is capitalized; acronyms are all capital letters; and any word which is always capitalized is capitalized in the title (e.g., “Smith,” “United Kingdom,” etc.). • Table titles follow this same rule.

By-line (the authors’ names—without the word “by”): • Spell out the first name and use an initial with a period for middle name: “John Q. Public” • 2 authors: use only the word “and”: “Abdul al-Nafis and Mary T. Smith” • 3 or more authors: use commas, and between the last 2 the word “and” preceded by a comma: “John Q. Public, Abdul al-Nafis, and Mary T. Smith” Running Head: The line that appears as a header for each page of an article after the first page, identifying the article with condensed versions of its authors and its titles, usually consisting of not more than 50 characters (including spaces). Example: Article:

Functional ion channels in human pulmonary artery smooth muscle cells: Voltage-dependent cation channels Amy L. Firth, Carmelle V. Remillard, Oleksandr Platoshyn, Ivana Fantozzi, Eun A. Ko, and Jason X.-J. Yuan

Running head: •

Firth et al.: Ion channels in human PASMC

Because “et” means “and,” it is not preceded by a comma in the running head.

Text (all word components from Abstract to Conclusions) • Language setting (Tools, Language): English (US) • Document size: US Letter (8.5 x 11) • Font type and size: Times New Roman (or equivalent serif font—not a sans-serif or “block letter” • Font like Helvetica or Arial), 11-pt • Paragraphs: single-spaced; no paragraph indents; double-space between paragraphs • Spacing: please do not use either the “Spacing Before” or “Spacing After” functions in the paragraph formatting options (both setting should read “0 pt.”) • Kerning: please do not kern your text (expand or condense words or lines). • Justification: left-justified text a.k.a. flush left a.k.a. quad left (do not justify margins) • Page numbers: use automatic page numbers in the footer • When submitting your manuscript, please do not send the file with “Track Changes.” Tables and Table Captions Tables should be self-explanatory and should not duplicate textual material. The tables along with their numbers should be cited at the relevant place in the text. • All tables for your article, and each one’s caption, should be placed (in the same Word or WordPerfect document as the text) at the very end of the manuscript’s text, after the References • Place each table on its own separate manuscript page • Tables must be numbered consecutively in the order of their first citation in the text • The table number should be Arabic, followed by a period and a brief title • Type the table caption double-spaced • For both the table title and the table caption, use the same size type as the text (11-pt.) • Explain in a footnote beneath the table’s caption all non-standard abbreviations that are used in each table • Supply a brief column heading for each column in a table • Do not use vertical lines between columns. Use horizontal lines above and below the column headings and at the bottom of the table only. Use extra space to delineate sections within the table • Obtain permission for all borrowed, adapted, and modified tables and provide a credit line in the footnote • Please remember that tables prepared with Excel are not accepted unless embedded within your text document. Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Figure Captions • • • • • •

Your figure captions must be carefully numbered to reflect the numbers you assigned to your figures (which are submitted separately from your manuscript—in your Figures file, described below) For your figure captions, please type them in the order in which they are cited in your text, and so number them here: 1, 2, 3, etc When symbols, arrows, numbers, or letters are used to identify parts of a figure, identify and explain each one in the caption Explain any internal scale (magnification) and identify the method of staining in photomicrographs If your figure was inspired by a published figure of any kind, please end your caption with a parenthetical credit line: (Adapted from [source]) If a figure has been published elsewhere, please submit written permission from the copyright owner to reproduce the material—in your Legalities file, described below.

References • • • • • •

References should be numbered consecutively in the order in which they are first mentioned in the text (not in alphabetic order) Identify references in text, tables, and legends by Arabic numerals in superscript within brackets after the punctuation marks References cited only in tables or figures’ captions should be numbered in accordance with the sequence established by the first identification in the text of the particular table or figure List all authors for each reference; do not use “et al.” The format of references—examples of which may be seen in any previous issue of Pulmonary Circulation—is based on the formats used by the National Library of Medicine (NLM) in Index Medicus and The New England Journal of Medicine Please verify all references against original sources, as the accuracy of reference data is the responsibility of the author.

Your FIGURES file (all non-text components of your manuscript other than tables) [2nd of the 4 files to be submitted for an article-type contribution] • All figures must be submitted electronically • Acceptable formats are: jpg, gif, png • Maximum file size is 4 MB • Please do not zip the files • Submit high-quality figures, either color or black-and-white • Figures should be actual size • Figures should be numbered consecutively according to the order in which they are first cited in the text • Labels, numbers, and symbols should be clear and of uniform size. The lettering for figures should be large enough to be legible • Symbols, arrows, or letters used in photomicrographs should contrast with the background • Titles and detailed explanations belong in the captions for figures, not on the figures themselves • (i.e., in your Manuscript file, not in this Figures file). • Line art should not contain hair-thin lines (which are easily lost in reproductions) • Line art must be saved at a resolution of at least 1200 dpi; photographs, CT scans, radiographs, etc, should be saved at a resolution of at least 300 dpi. Figures saved at 72 dpi are not acceptable • When graphs, scatter-grams or histograms are submitted, the numerical data on which they are based should also be supplied • The Journal reserves the right to crop, rotate, reduce, or enlarge photographs • If needed, videos can also be uploaded (mpg, mpeg, mp4, wmv; maximum file size 20 MB). Your SIGNS file [3rd of the 4 files to be submitted for an article-type contribution]

As an umbrella term, Pulmonary Circulation uses the word “sign” as it is used in the discipline of semiotics: “something that stands for something.” With the exception of numbers (which are symbols of amounts), this file must list and define all signs you use in your manuscript—in the text and in figure 129

Contributions to Pulmonary Circulation

and table captions—including especially: • acronyms (e.g., PASMC, α-SNAP, PPARγ, WHO, BMPR2, BMPRII, etc.); • abbreviations (e.g., ctl., ibid., Disp., b.i.d. [bis in die, “twice daily”], etc.); and • symbols (e.g., mV, Rm(GΩ), Qa, Kv, etc.). There is no need to alphabetize your list of signs. Your LEGALITIES file [4th of the 4 files to be submitted for an article-type contribution] • • • • •

A statement affirming that the manuscript has been read and approved by all the authors, that the requirements for authorship have been met, and that each author believes that the manuscript represents honest original work. Rights and permissions. (Please see Legal Requirements, below.) Ethical considerations. (Please see Legal Requirements, below.) Sources of support of each author. (Please see Legal Requirements, below.) Conflicts of interest of each author. (Please see Legal Requirements, below.)

The submission process To submit your first manuscript to Pulmonary Circulation, simply follow these 10 easy steps. (For subsequent submissions, you already have your log-in name and password.) STEP 1: Make sure you have your file or your 4 files ready to send (for textonly contributions, your Manuscript file; for article-type contributions, your Manuscript file, your Signs file, your Figures file, and your Legalities file). STEP 2: Access www.journalonweb.com/pc

STEP 3: Create a login name and set a password through a few simple steps. STEP 4: Log in as author using your login name and password.

STEP 5: Enter the Article Type, Title, Key Words (3-5) and Abstract. (The Abstract, which should not exceed 2,000 characters, can be typed in or cutand-pasted in the slot in the website.) STEP 6: Upload the files applicable to your contribution (either “Manuscript” only, or “Manuscript,” “Figures,” “Signs,” “Legalities”) by browsing to locate the files in your computer.

STEP 7: Click “Next” to include suggested reviewers if you want, or to skip this step, click “Next.” STEP 8: Next page is the Preview page. Preview using links to all the files you have submitted. STEP 9: Click the “Submit the Manuscript” button at the end of the page.

STEP 10: You will receive a notification in your email (please check your “junk” email folder if you don’t see the mail in a few minutes). The receiving process All manuscripts received are duly acknowledged as having been received and successfully opened.

Before being sent out for review of its contents, each manuscript is checked for its compliance with the Legal Requirements detailed below. Manuscripts that ignore those requirements are returned.

The review process A received manuscript will be reviewed for possible publication with the understanding that it is being submitted solely to Pulmonary Circulation and has not been published anywhere, simultaneously submitted, or already accepted for publication elsewhere. Pulmonary Circulation editors review all submitted manuscripts initially for suitability for formal peer review. Manuscripts with insufficient originality, ethical or legal problems, serious scientific or technical flaws, or lack of a significant message, are rejected before proceeding to formal peer-review.

A manuscript deemed to be acceptable for review is then sent to reviewers (who many include ones named by the author in the Manuscript Preparation Process).

The disposition process A reviewed manuscript is assigned to an editor who, based on the comments from the reviewers, makes a final decision on its disposition—rejection, acceptance, or acceptance with amendments.

The editor conveys to the author the comments and/or suggestions received from reviewers. The author may be requested to provide a point-by-point response to reviewers’ comments and to submit a revised version of the 130

manuscript. This process is repeated until reviewers, editors, and authors are all satisfied with the manuscript. The editing process Manuscripts accepted for publication are copy-edited for grammar, punctuation, and other considerations. Page proofs are sent to the corresponding author.

The corresponding author is expected to return the corrected proofs within a specified time period. It may not be possible to incorporate corrections received after that period. The publishing and printing process An article will be published online and will remain online for 2 weeks, after which it will go for printing.

The tracking and troubleshooting process Registered authors can keep track of their articles after logging into the website. Instructions are also available at our website (www.pulmonarycirculation.org).

If you experience any problems during any of these various processes, please don’t hesitate to email the nearest of our editorial offices: the USA (gordonk@uic. edu); India (drharikrishnan@hotmail.com); and the UK (n.krol@imperial.ac.uk).

STYLE REQUIREMENTS Dashes

None of the dashes ever has either a space before it or a space after it (hyphen: “a one-page article”; en dash: “4–23”; em dash: “The subjects—who were mice—responded well.”). The only exception: multiple hyphens (“In both midand long-range plans . . .”).

Ellipses

An ellipsis always has spaces between the 3 periods (“. . .”). While ellipses may be used in informal documents (e.g., emails) to indicate pregnant pauses, their use in scholarly journals is restricted to quotations to indicate that text has been deleted: “The test was conducted in X township of Y province of Z region in Thailand.” “The test was conducted . . . in Thailand.”

Italics

Latin terms are never italicized—et al., per, e.g., etc. Words giving directions are italicized: Table 2 continued See Case Studies, below.

Numbers

For conversational-type usage, spell out numbers from one to eleven, then use numbers—12, etc. For describing data, always use numbers: “We had two stages, the first involving 2 units, the second involving 4.6 units.” In Pulmonary Circulation, all numbers of 4 or more digits use commas: 245 1,399 15,000,987

Scientific Names

The genus name is always capitalized and always italicized. The species (and subspecies) name is always italicized but never capitalized, even when country names are used: Homarus americanus (Maine lobster)

For naming species of the same genus, the genus name is spelled out only for the first one: “Species of lobster include Homarus americanus, sometimes called the American lobster, and H. gammarus, the European lobster.”

All categories above genus are never italicized and always capitalized (as, for the Maine lobster): Kingdom Animalia Phylum Arthropoda Class Malacostraca Order Decapoda Family Nephropidae

Units of Measure

Use the International System of Units, SI (from French Système international d’unités), the modern form of the metric system. A more conventionally Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Contributions to Pulmonary Circulation

used measurement may follow in parentheses. Make all conversions before manuscript submission.

Zip Codes

For US states, a physical mailing address is—by US Postal regulations—the one and only place that Zip Codes may be used (e.g., NJ, AK, NM); in every other usage, including the body of your manuscript, a state should be spelled out or, if parenthetical, abbreviated: “Massachusetts,” “(Boston, Mass.)” For the answer to any other question about a Pulmonary Circulation style requirements, simply email: Christina Holt (chris88@uic.edu) at The University of Illinois at Chicago in Chicago, Illinois USA

LEGAL REQUIREMENTS

Rights and Permissions It is the responsibility of the authors to obtain permissions for reproducing any copyrighted text or trademarked material used in their articles. A copy of all permissions obtained must accompany the manuscript. • If a photograph of individuals is used, their pictures must be accompanied by written permission from them to publish the photograph.

Ethical Considerations

The Journal will not publish any manuscript found to be ethically unacceptable. When reporting studies on humans, indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation (institutional or regional) and with the Helsinki Declaration of 1975, as revised in 2008 (available at www.wma.net). For prospective studies involving human participants, authors are expected to mention approval of a regional or national or institutional or independent Ethics Committee or Review Board, obtaining informed consent from adult research participants and obtaining assent for children aged over 7 years participating in the trial. Ensure confidentiality of subjects by refraining from using participants’ names, initials or hospital numbers, especially in illustrative material. When reporting experiments on animals, indicate whether the institution’s or a national research council’s guide for, or any national law on the care and use of laboratory animals, was followed. Documentation of approval by a local Ethics Committee (for both human and animal studies) must be supplied by the authors on demand.

Patients’ Right to Privacy

Identifying information should not be published in written descriptions,

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

photographs, sonograms, CT scans, etc., and pedigrees unless the information is essential for scientific purposes and the patient (or parent or guardian, wherever applicable) gives written informed consent for publication. Authors should remove patients’ names from figures unless they have obtained written informed consent from the patients. When informed consent has been obtained, it should be indicated in the article and a copy of the consent should be included in your Legalities file.

Warranties of Originality and Compliance • •

Manuscripts are considered only on the legal understanding that they contain original material never before published in article form in any venue. Manuscripts are considered only on the legal understanding that they are in full compliance with any applicable NIH or other funding agency requirements.

Sources of Support

All sources of support for the research described in your article must be identified. Such sources include but are not limited to grants, fellowships and scholarships. (See Note following “Conflicts of Interest.”)

Conflicts of Interest

All authors must disclose any and all conflicts of interest they may have with an institution or product that is mentioned in the manuscript and/or is important to the outcome of the study presented. Authors must also disclose: • any income which may be perceived as a conflict of interest (including but not limited to employment by an industrial concern, consulting fees, and honoraria); and • any conflict of interest with products that compete with those mentioned in their manuscripts (including but not limited to any relationship with pharmaceutical companies, device manufacturers, or other corporations whose products or services are related to an article’s subject matter). NOTE: Both Sources of Support and Conflicts of Interest are published in a box following an article’s References. For example:

Sources of Support: National Institutes of Health (grant ID number). Conflicts of Interest: None declared.

131

Request for Proposal

The Cardiovascular Medical Research and Education Fund (CMREF) is seeking proposals from qualified academic medical centers with the ability to coordinate and conduct a clinical study evaluating right ventricular function in patients with pulmonary hypertension, its adaptive and maladaptive responses, and the effects of therapy. For more information, please go to the CMREF website: www.ipahresearch.org

Studies of the Right Ventricular Response to Therapy in Patients with Pulmonary Arterial Hypertension Introduction The Cardiovascular Medical Research and Education Fund (CMREF) is seeking proposals from qualified academic medical centers with the ability to coordinate and conduct a clinical study evaluating right ventricular function in patients with pulmonary hypertension, its adaptive and maladaptive responses, and the effects of therapy. Background The purpose of this clinical feasibility study is to better characterize the status of the right ventricle in patients with advanced pulmonary hypertension (PH) who are candidates for a new or additional treatment. Research in this field has identified changes in the right ventricle as predictive of survival in chronic PH. Understanding how the right ventricle adapts to pulmonary hypertension, and how that response may be altered with medical therapies appears to be critical. Scientific studies that may be relevant to this project cover a broad spectrum of disciplines that include genomics, imaging, and assessments of RV contractility, hypertrophy and metabolism. It is hoped that knowledge gained from this study will impact clinical trials of future therapies developed to treat advanced pulmonary hypertension. Project Guidelines • Study hypotheses: Maladaptation to the pulmonary hypertensive state is largely responsible for right ventricular failure in chronic pulmonary hypertension. Changes that occur in the right ventricle predict clinical improvements in patients undergoing treatments for pulmonary hypertension. The applicant is requested to propose one or more related hypotheses that will be tested in this study. • The patient inclusion criteria for the study should include Category 1 pulmonary arterial hypertension, preferably from one specific etiology, and advanced disease in which a new or additional medical therapy is clinically indicated. • This can be an open label study where the patients will serve as their own controls, or randomized, placebo controlled. • It is suggested that the number of patients enrolled be adequate to test the hypotheses, rather than powered to show statistically significant drug efficacy.

132

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

• •

The follow-up assessments should be over 6 months, and patient enrollment should be completed within a 2 year period. The state of the right ventricle should be characterized with multiple parameters that will provide insight into the adaptive and maladaptive state, and reflect changes that occur from therapy that will further the understanding of how therapies may work. These parameters may include measures of: o Genetics and genomics o Metabolism o Cellular signaling o Imaging (ultrasound, PET and MRI) o Contractility and hypertrophy o Hemodynamics o RV function o Myocardial ischemia and/or perfusion

The applicant is expected to develop a clinical research study plan that will identify several assessments that will be studied in the enrolled patients. While it is desirable for a single center to enroll all patients in this study and perform all of the assessments, this may not be practical or feasible. Because PAH is an uncommon disease, it is understood that multiple clinical centers may need to participate in patient enrollment (a clinical center is one that will enroll patients into the study). In addition, given the uniqueness of some of the promising assessments, it is also understood that multiple centers may need to participate as core laboratories to evaluate specific measures (a core laboratory is one that will perform analyses of specific measured assessments collected at the clinical centers). Thus, the research plan should include an organizational plan that identifies the Principle Center, collaborating clinical centers, and core laboratories. The Principle Center will be responsible for all of the data management, and for providing oversight of the entire conduct of the study. The Principle Center should also serve as a clinical center and a core laboratory. Having other clinical centers also serving as core laboratories to expand the different types of assessments will be considered a strength of the proposal. This award can be made to the Principle Center, with subcontracts to clinical and core centers, or to each participating center directly. The applicant should submit a research plan using the NIH R01 format that will include the collaborating investigators for all phases of the study. Required activities by the applicant include, but are not limited to: • finalizing the clinical protocol and protocol-related documents (e.g. informed consent form, case report forms, etc.); • implementation and conduct of the clinical study in accordance with Federal requirements; • management and oversight of the conduct of the clinical study; • providing clinical research support services; • providing monitoring and safety oversight; • organizing investigator meetings and teleconferences; • recruiting patients; • organizing, conducting, and reimbursing for patient protocol evaluations and tests (including follow-up); • analyzing the data and authoring and submitting papers on the study for publication. Application Guidelines • The deadline for grant submission is July 1, 2012. Funding will begin October 1, 2012. All applicants are requested to submit a letter of intent with a brief description of their proposal, and the collaborating institutions. • The direct award for this study will be limited to $2 million, inclusive of all subcontracts. Overhead of 20% will be added to the amount awarded. The award may not be used to cover healthcare related costs that are otherwise clinically indicated, including but not limited to the costs of the medical therapy to be studied if it is clinically indicated. • Because of the high expense of healthcare costs, the applicant is advised to recruit patients where the preponderance of tests and treatments are otherwise clinically indicated and thus will not need to be covered by the grant. • The project should be constructed to meet the following timelines: o 6 months start-up  Case report form completion  Study protocols completed  Research assessments specified  Consent and IRB approvals

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

133

•

o 24 months patient enrollment  Enrollment monitors o 6 months close-out  Data analyses  Publications The NIH R01 research application form should be used, including Specific Aims, Background and Importance and Approach (Research Plan), Human Subjects Section, and Biosketches and description of facilities and resources. The following should be included in the response to the RFP: o The research strategy should include a clear description of the study design, study population, subject eligibility and inclusion/exclusion criteria, recruitment and enrollment plans, and outcome measures.  State concisely the goals of the proposed research and summarize the expected outcome(s), including the impact that the results of the proposed research will exert on the research field(s) involved. The major research question and hypothesis being studied should be clearly stated. o The significance of the proposed clinical trial must be clearly stated. The application should make clear how the results will advance our knowledge of theory and practice in this area and the potential impact of the results of the trial. o Explain how the application challenges and seeks to shift current research or clinical practice paradigms. o A list of subject eligibility and inclusion and exclusion criteria should be provided. A recruitment and enrollment plan, including a discussion of the availability of subjects for the proposed study, the ability of enrollment sites to recruit the required number of subjects, and the timeline for completion of recruitment, should be described. o There should be a detailed description of the assessments to be tested. Potential biases and approaches for minimizing bias should be described. The primary and secondary endpoints, and methods/measures to be used to assess these, should be clearly described. The link between endpoints, outcome measures, and hypotheses should be stated clearly. o Data collection plans and statistical methods appropriate for the particular design proposed should be presented. Methods to be used for data collection, preparation, management, quality control should be thoroughly described. o Data from preliminary or pilot studies which show the need for and the feasibility of the trial should also be presented. Additional supporting data from other research should be included so that the approach chosen is clearly justified. This information will also help to establish the experience and competence of the investigators to pursue the proposed project. o A timetable for completion of the various stages of the trial must be included.

Data Safety and Monitoring All applications must include a general description of the monitoring plan, policies, procedures, responsible entities, and approaches to identifying, managing and reporting reportable events (adverse events and unanticipated problems), to the applicable regulatory agencies (e.g., Institutional Review Board (IRB), the NHLBI/NIH, the Office of Biotechnology Activities, Office of Human Research Protections (OHRP), the (FDA), and the Data and Safety Monitoring Board (if one is used). Contact information Inquiries, letters of intent, applications or questions should be addressed to: Cardiovascular Medical Research and Education Fund 510 Walnut Street, Suite 500 Philadelphia, PA 19106, USA Phone: 215-413-2414 Fax: 215-592-4663 Email: patt.wolfe@ipahresearch.org Website: www.ipahresearch.org

134

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pulmonary Circulation

on Web

http://www.journalonweb.com/pc Pulmonary Circulation now accepts articles electronically. It is easy, convenient and fast. Check following steps:

Registration • Register from http://www.journalonweb.com/pc as a new author (Signup as author) • Two-step self-explanatory process

New article submission • Prepare your files (Article file, First page file and Images, if any) • Login into your area • Click on ‘Submit a new article’ under ‘New Article’ • Follow the steps (three steps for article without images and five for with images) • On successful submission you will receive an acknowledgement quoting the manuscript numbers

Tracking the progress • Click on ‘In Review Article’ under ‘Submitted Articles’ • The table gives status of the article and its due date to move to next phase • More details can be obtained by clicking on the ManuscriptID • Comments sent by the editor and referee will be available from these pages

Submitting a revised article • Click on ‘Article for Revision’ under ‘Submitted Articles’ • Click on ‘Revise’ • From the first window, you can modify Article Title, Article Type • First Page file and Images could be modified from second and third window, respectively • The fourth step is uploading the revised article file. • Include the referees’ comments along with the point to point clarifications at the beginning of the revised article file. • Do not include authors’ name in the article file. • Upload the revised article file against New Article File - Browse, choose your file and then click “Upload” OR Click “Finish” • On completion of revision process you will be able to check the latest file uploaded from Article Cycle (In Review Articles-> Click on manuscript ID -> Latest file will have a number with ‘R’)

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Facilities • Submission of new articles with images • Submission of revised articles • Checking of proofs • Track the progress of article in review process

Advantages • Any-time, any-where access • Faster review • Cost saving on postage • No need for hard-copy submission (except on acceptance images should be sent) • Ability to track the progress • Ease of contacting the journal

Requirements for usage • Computer and internet connection • Web-browser (preferably newer versions IE 5.0 or NS 4.7 and above) • Cookies and javascript to be enabled in web-browser

Online submission checklist • First Page File (text/rtf/doc/pdf file) with title page, covering letter, acknowledgement, etc. • Article File (text/rtf/doc/pdf file) - text of the article, beginning from Title, Abstract till References (including tables). File size limit 1 MB. Do not include images in this file. • Images (jpeg): Submit good quality colour images. Each image should be less than 4096 kb (4 MB) in size.

Help • Check Frequently Asked Questions (FAQs) on the site • In case of any difficulty contact the editor 135

Keystone Symposia is pleased to present

Pulmonary Vascular Disease and Right Ventricular Dysfunction: Current Concepts and Future Therapies Scientific Organizers: Georg Hansmann, Stephen L. Archer and Margaret R. MacLean September 10–15, 2012 | Portola Hotel & Spa | Monterey, California, USA

ulmonary arterial hypertension (PAH) is characterized by progressive obliteration of pulmonary arterioles leading to increased pulmonary vascular resistance, right heart failure, and death in 40-60% of PAH patients five years after diagnosis. Proliferation, migration, and resistance to apoptosis of vascular cells, as well as proliferative-inflammatory responses mediated by blood and fat cells, contribute to disease development. Despite more than 15 published randomized controlled trials (RCT) that demonstrated moderate effectiveness in improving exercise capacity, the approved PH drugs have not led to a cure. Hence, basic science and translational research focusing on the discovery of novel pathways in pulmonary vascular disease and right ventricular dysfunction, new drug targets, development of novel therapeutic paradigms, cellbased and pharmacotherapies, and their translation into RCTs are urgently needed. This Keystone Symposia meeting will gather basic and clinical researchers working in the field of pulmonary vascular disease and right ventricular dysfunction. The focus is on basic science with strong impact on 1) our understanding of this fatal disease, and 2) discoveries with great potential to be translated into clinical practice in the near future. Late-breaking clinical studies on novel PAH therapies will also be presented.

Session Topics:

1.970.262.1230 | 1.800.253.0685 (US & Canada)

Keystone Symposia on Molecular and Cellular Biology is a nonprofit organization headquartered in Colorado, USA directed and supported by the scientific community.

> The Role of Stem Cells, Progenitor and Differentiated Blood Cells in Pulmonary Vascular Disease and Repair > Workshop 1: How to Translate Basic Research Findings into Improvement of Patient Care – The Role of Industry > Growth Factors, TGF-b/BMP Signaling and Pulmonary Vascular Disease > Metabolic Regulators in Pulmonary Vascular Disease > Workshop 2: MicroRNAs and iPS Cells – Novel Tools and Targets in Cardiovascular Biology and Pulmonary Vascular Research > The Right Ventricle in Pulmonary Hypertension: Cardiomyocyte Function and Hemodynamic Performance > MicroRNAs in Proliferative Vascular Disease > Innovative Clinical PAH Trials > Pulmonary Hypertension in Parenchymal Lung Diseases > Workshop 3: Vascular Metabolomics and Proteomics: Where Are the Novel Biomarkers for Pulmonary Vascular Diseases? > Pulmonary Arterial Hypertension – Current Concepts and Future Therapies

Abstract & Scholarship Deadline: May 10, 2012 Late-Breaking Abstract Deadline: June 7, 2012 Early Registration Deadline: July 10, 2012

Note: Scholarships are available to students and postdoctoral fellows. Short talk speakers will be selected from abstracts. Early registration saves US$150 on later fee.

www.keystonesymposia.org/12S1 136

Pulmonary Circulation | January-March 2012 | Vol 2 | No 1

Pulmonary Circulation is an Editors-in-Chief: Jason X.-J. Yuan, MD, PhD Nicholas W. Morrell, MD Harikrishnan S., MD

open-access, peer-reviewed, international journal devoted to research in the fields of the pulmonary circulation, pulmonary vascular disease,

Senior Editor: Ghazwan Butrous, MD

and lung injury. Pulmonary Circulation is published

Executive Editor: Harikrishnan S., MD

quarterly and sponsored by the Pulmonary Vascular

Editors: Kurt R. Stenmark, MD Kenneth D. Bloch, MD Stephen L. Archer, MD Marlene Rabinovitch, MD Joe G.N. Garcia, MD Stuart Rich, MD Martin R. Wilkins, MD Hossein A. Ghofrani, MD Candice D. Fike, MD Werner Seeger, MD Sheila G. Haworth, MD Patricia A. Thistlethwaite, MD, PhD Chen Wang, MD, PhD Antonio A. Lopes, MD Scientific Advisory Board: Robert F. Grover, MD, PhD Charles A. Hales, MD, PhD E. Kenneth Weir Joseph Loscalzo, MD John B. West, MD, PhD, DSc Magdi H. Yacoub, MD, DSc, FRS

Research Institute.

 The first journal dedicated exclusively to the pulmonary circulation and pulmonary vascular disease  Indexed and Accessible on PubMed  Devoted to high quality clinical and basic research in the field  No charge for submission, processing or publication of your manuscripts and for color photographs  Open access  Prompt peer review with online submission and review  Immediate publication on acceptance

Want to learn more? Visit www.pulmonarycirculation.org Ready to submit? Visit http://www.journalonweb.com/PC/ View all Author Instructions at http://www.pulmonarycirculation.org/contributors.asp

CONTENTS Editorial A one-year-old baby… into the Year of the Dragon

Jason X.-J. Yuan, Nicholas W. Morrell, S. Harikrishnan, and Ghazwan Butrous

Review Articles

Targeting the adventitial microenvironment in pulmonary hypertension: A potential approach to therapy that considers epigenetic change Kurt R. Stenmark, Maria G. Frid, Michael Yeager, Min Li, Suzette Riddle, Timothy McKinsey, and Karim C. El Kasmi

Risk factors for persistent pulmonary hypertension of the newborn Cassidy Delaney, and David N. Cornfield

3 15

Research Articles

Serum osteoprotegerin is increased and predicts survival in idiopathic pulmonary arterial hypertension

Robin Condliffe, Josephine A. Pickworth, Kay Hopkinson, Sara J. Walker, Abdul G. Hameed, Jay Suntharaligam, Elaine Soon, Carmen Treacy, Joanna Pepke-Zaba, Sheila E. Francis, David C. Crossman, Christopher M. H. Newman, Charles A. Elliot, Allison C. Morton, Nicholas W. Morrell, David G. Kiely, and Allan Lawrie

Three-dimensional analysis of right ventricular shape and function in pulmonary hypertension

Peter J. Leary, Christopher E. Kurtz, Catherine L. Hough, Mary-Pierre Waiss, David D. Ralph, and Florence H. Sheehan

Depolarization-dependent contraction increase after birth and preservation following long-term hypoxia in sheep pulmonary arteries Demosthenes G. Papamatheakis, Jay J. Patel, Quintin Blood, Travis T. Merritt, Lawrence D. Longo, and Sean M. Wilson

28 34

Estimation of endothelin-mediated vasoconstriction in acute pulmonary thromboembolism John Y. C. Tsang and Wayne J. E. Lamm

Pulmonary acceleration time to optimize the timing of lung transplant in cystic fibrosis

Thibaud Damy, Pierre-Régis Burgel, Jean-Louis Pepin, Pierre-Yves Boelle, Claire Cracowski, Marlène Murris-Espin, Raphaele Nove-Josserand, Nathalie Stremler, Tabassome Simon, Serge Adnot, and Brigitte Fauroux

61 67

Methodological Approach for Research Identification of functional progenitor cells in the pulmonary vasculature Amy L. Firth and Jason X.-J. Yuan

Case Report

Severe pulmonary hypertension in idiopathic nonspecific interstitial pneumonia

101

The WHO classification of pulmonary hypertension: A case-based imaging compendium

107

Regarding “Isolated large vessel pulmonary vasculitis and chronic obstruction of the pulmonary arteries”

122

Robert W. Hallowell, Robert M. Reed, Mostafa Fraig, Maureen R. Horton, and Reda E. Girgis

Images in Pulmonary Vascular Disease

John J. Ryan, Thenappan Thenappan, Nancy Luo, Thanh Ha, Amit R. Patel, Stuart Rich, and Stephen L. Archer

Letters to Editor

Beuy Joob, and Viroj Wiwanitkit

Author’s Reply

Joanna Pepke-Zaba

122

Abstracts

123

Instructions for Authors

126

Printed and published by Medknow Publications and Media Pvt. Ltd on behalf of Pulmonary Vascular Research Institute (PVRI), London, UK and printed at Dhote Offset Technokrafts Pvt. Ltd., Jogeshwari, Mumbai, and published at B5-12, Kanara Business Centre, Ghatkopar, Mumbai, India.