RMCP Vol. 11, Num. 3 (2020): July-September [english version] by Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

Cultivo de girasol en el Centro de Investigaciones Agrarias de Mabegondo (CIAM). Galicia, España. Fotografía: Aurora Sainz Ramírez.

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 11 Número 3, JulioSeptiembre 2020. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 04-2016-060913393200-203. ISSN: 2448-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en agosto de 2020.

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dra. Elisa Margarita Rubí Chávez, UNAM, México Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dr. Martin Talavera Rojas, Universidad Autónoma del Estado de México, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dra. Silvia Elena Buntinx Dios, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, UAEH, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria.

total por publicar es de $ 5,600.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx.

Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados.

La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx.

The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products.

For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 325.00 per article in both printed languages.

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS REV. MEX. CIENC. PECU.

VOL. 11 No. 3

JULIO-SEPTIEMBRE-2020

CONTENIDO ARTÍCULOS

Pág. Pasta de higuerilla desintoxicada en dietas para pollos de engorda Detoxified castor meal in broiler chickens’ diets Anabel Maldonado Fuentes, Juan Manuel Cuca García, Arturo Pro Martínez, Fernando González Cerón, José Guadalupe Herrera Haro, Eliseo Sosa Montes, Pablo Alfredo Domínguez Martínez ……………. 605

Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol Effect of the cutting date and the use of additives on the chemical composition and fermentative quality of sunflower silage Aurora Sainz-Ramírez, Adrián Botana, Sonia Pereira-Crespo, Laura González-González, Marcos Veiga, César Resch, Juan Valladares, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete………………. 620

Suplementación de clorhidrato de zilpaterol en corderos finalizados con dieta sin fibra de forraje Supplementation with zilpaterol hydrochloride in lambs finished with a non-forage fiber diet Ricardo Vicente Pérez, Ulises Macías-Cruz, Ramón Andrade Mancillas, Rogelio Vicente, Enrique O. García, Ricardo Martínez, Leonel Avendaño-Reyes, Oziel D. Montañez …………………………………………………………………………………………………………………………..……638

Changes in myoglobin content in pork Longissimus thoracis muscle during freezing storage Cambios en el contenido de mioglobina en el músculo porcino Longissimus thoracis durante el almacenamiento en congelación Jonathan Coria-Hernández, Rosalía Meléndez-Pérez, Abraham Méndez-Albores, José Luis ArjonaRomán............................................................................................................................................... 651

Indicadores de competitividad de la carne bovina de México en el mercado mundial Indicators of the competitiveness of Mexican beef in the world market Miguel Ángel Magaña Magaña, Carlos Enrique Leyva Morales, Juan Felipe Alonzo Solís, Carlos Gabriel Leyva Pech……………………………………………………………………………………………….......…………. 669

III

Adición de extracto acuoso de ajo (Allium sativum) en dieta de conejos (Oryctolagus cuniculus) sobre productividad, calidad física y microbiológica de la carne Effect of the addition of aqueous extract of garlic (Allium sativum) to the diet of rabbits (Oryctolagus cuniculus) on the productivity and on the physical and microbiological quality of the meat Dora Luz Pinzón Martínez, María Dolores Mariezcurrena Berasain, Héctor Daniel Arzate Serrano, María Antonia Mariezcurrena Berasain, Abdelfattah Zeidan Mohamed Salem, Alfredo Medina García ….. 686

El aceite esencial y bagazo de orégano (Lippia berlandieri Schauer) afectan el comportamiento productivo y la calidad de la carne de conejo Essential oil and bagasse of oregano (Lippia berlandieri Schauer) affect the productive performance and the quality of rabbit meat Jesica Leticia Aquino-López, América Chávez-Martínez, José Arturo García-Macías, Gerardo MéndezZamora, Ana Luisa Rentería-Monterrubio, Antonella Dalle-Zotte, Luis Raúl García-Flores ………… 701

Las rizobacterias halófilas mantienen la calidad forrajera de Moringa oleifera cultivada en sustrato salino Halophilic rhizobacteria maintain the forage quality of Moringa oleifera grown on a saline substrate Verónica García Mendoza, Alex Edray Hernández Vázquez, José Luis Reyes Carrillo, Uriel Figueroa Viramontes, Jorge Sáenz Mata, Héctor Mario Quiroga Garza, Emilio Olivares Sáenz, Pedro Cano Ríos, José Eduardo García Martínez…………………………………………………………………………………………………………….…….718

Efecto del reemplazo folicular (GnRH) y de somatotropina bovina (bST) sobre la fertilidad de vacas lecheras expuestas a estrés calórico Effect of follicular replacement (GnRH) and bovine somatotropin (bST) on the fertility of dairy cows exposed to heat stress Renato Raúl Lozano-Domínguez, Carlos Fernando Aréchiga-Flores, Marco Antonio López-Carlos, Zimri Cortés-Vidauri, Melba Rincón-Delgado, José Ma. Carrera-Chávez, Ulises Macías-Cruz, Joel HernándezCerón ................................................................................................................................................ 738

Efecto del tamaño interno de la colmena en la producción de cría, miel y polen en colonias de Apis mellifera en el altiplano central de México Effect of the internal size of the hive on brood, honey, and pollen production in Apis mellifera colonies in the central Mexican plateau Alfonso Hernández Carlos, Ignacio Castellanos ................................................................................ 757

Seroprevalencia de agentes virales del Complejo Respiratorio Bovino en razas criollas del Centro de Investigación Turipaná de AGROSAVIA Seroprevalence of viral agents of the Bovine Respiratory Complex in Creole breeds of the Turipaná Research Center of AGROSAVIA Matiluz Doria-Ramos, Teresa Oviedo-Socarras, Misael Oviedo-Pastrana, Diego Ortiz-Ortega ......... 771

Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México Frequency and risk factors associated with the presence of Chlamydia abortus in flocks of sheep in Mexico Erika G. Palomares Reséndiz, Pedro Mejía Sánchez, Francisco Aguilar Romero, Lino de la Cruz Colín, Héctor Jiménez Severiano, José Clemente Leyva Corona, Marcela I. Morales Pablos, Efrén Díaz Aparicio ............................................................................................................................................. 783

Linfonodos y carne molida de res como reservorios de Salmonella spp. de importancia en salud pública Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp. Tania Palós Gutiérrez, María Salud Rubio Lozano, Enrique Jesús Delgado Suárez, Naisy Rosi Guzmán, Orbelin Soberanis Ramos, Cindy Fabiola Hernández Pérez, Rubén Danilo Méndez Medina………………………………………………………………………………………………………………………795

Uso de una PCR anidada para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI) en truchas de campo Diagnosis of the infectious pancreatic necrosis virus (IPNV) by nested PCR in wild trouts Catalina Tufiño-Loza, José Juan Marti ́nez-Maya, Amaury Carrillo-Gonzá lez, Diana Neria-Arriaga, Celene Salgado-Miranda, Edith Rojas-Anaya, Elizabeth Loza-Rubio ................................................ 811

Polymorphisms associated with the number of live-born piglets in sows infected with the PRRS virus in southern Sonora Mexico Polimorfismos asociados con el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS en el sur de Sonora México Carlos Martín Aguilar-Trejo, Guillermo Luna-Nevárez, Javier Rolando Reyna-Granados, Ricardo Zamorano-Algandar, Javier Alonso Romo-Rubio, Miguel Ángel Sánchez-Castro, R. Mark Enns, Scott E. Speidel, Milton G. Thomas, Pablo Luna-Nevárez ............................................................................... 828

Venta a granel de embutidos: una tendencia de comercialización asociada al riesgo de enfermedades trasmitidas por alimentos en Culiacán, México Bulk sales of cold cuts and sausages: a marketing trend associated to the risk of foodborne diseases in Culiacan, Mexico Maribel Jiménez-Edeza, Maritza Castillo-Burgos, Lourdes Janeth Germán-Báez, Gloria Marisol Castañeda-Ruelas ............................................................................................................................. 848

REVISIONES DE LITERATURA

Estudios de asociación genómica en ovinos de América Latina. Revisión Genome-wide association studies in sheep from Latin America. Review Karen Melissa Cardona Tobar, Diana Carolina López Álvarez, Luz Ángela Álvarez Franco ................ 859

NOTAS DE INVESTIGACIÓN

Crecimiento de corderos y productividad en ovejas Pelibuey mantenidas bajo condiciones tropicales de producción Lamb growth and ewe productivity in Pelibuey sheep under tropical conditions Carolina Atenea García-Chávez, Carlos Luna-Palomera, Ulises Macías-Cruz, José Candelario SeguraCorrea, Nadia Florencia Ojeda-Robertos, Jorge Alonso Peralta-Torres, Alfonso Juventino Chay-Canúl .......................................................................................................................................................... 884

Identification of candidate genes for reproductive traits in cattle using a functional interaction network approach La identificación de genes candidatos para rasgos de la reproducción en ganado utilizando un enfoque de redes de interacciones funcionales Francisco Alejandro Paredes-Sánchez, Daniel Trejo-Martínez, Elsa Verónica Herrera-Mayorga, Williams Arellano-Vera, Felipe Rodríguez Almeida, Ana María Sifuentes-Rincón ............................. 894

Tiempo de manejo y algunas conductas relacionadas con el estrés al manejar grupos grandes o reducidos de ganado en mangas rectas Effect of group size on processing time and some stress-related behaviors in cattle in straight chutes Miguel Ángel Damián, Virginio Aguirre, Agustín Orihuela, Mariana Pedernera, Saúl Rojas, Jaime Olivares ............................................................................................................................................. 905

Diversidad de la flora de interés apícola en el estado de Tamaulipas, México Diversity of melliferous flora in the State of Tamaulipas, Mexico Mario González-Suárez, Arturo Mora-Olivo, Rogel Villanueva-Gutiérrez, Manuel Lara-Villalón, Venancio Vanoye-Eligio, Antonio Guerra-Pérez ................................................................................ 914

Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros. 6.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes).

Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo.

El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte. Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales

VII

de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como referencias, aunque pueden insertarse en el texto (entre paréntesis).

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés.

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus.

12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias.

Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o

VIII

menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”). I)

forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56. XI)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones

http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

g gramo (s) ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003. 13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50%

Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt.

Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the â&#x20AC;&#x153;Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuariasâ&#x20AC;?. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts).

contain the following sections, and each one should begin on a separate page.

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

b) Technical Notes. They should be brief and be

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the names(s), the number of the edition, the country, the printing house and the year.

evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of t he research article but without section titles.

e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one.

III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article).

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as

XII

Organization as author

influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press

XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000.

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Books and other monographs

Author(s)

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XI)

12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the

Thesis

authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989. XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m Âľl Âľm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm Â°C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

versus

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV

https://doi.org/10.22319/rmcp.v11i3.5797 Article

Detoxified castor meal in broiler chickens’ diets

Anabel Maldonado Fuentes a Juan Manuel Cuca García a Arturo Pro Martínez a* Fernando González Cerón b José Guadalupe Herrera Haro a Eliseo Sosa Montes b Pablo Alfredo Domínguez Martínez c

Colegio de Postgraduados, Campus Montecillo, PRGP- Ganadería, Estado de México, México. b

Universidad Autónoma Chapingo, Departamento de Zootecnia, Estado de México, México. c

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, Departamento de Producción Animal, Estado de Durango, México.

*Corresponding author: aproma@colpos.mx

Abstract: Castor (Ricinus communis L.) meal contain highly toxic substances. Three detoxification methods were evaluated for their effectiveness and their inclusion in diets for broilers. Five treatments (experimental diets) were evaluated: control diet based on corn and soybean meal (SM), non-detoxified castor meal (NDC), autoclaved castor meal (AC), chemically treated castor meal (ChC) and autoclave and chemical methods treated castor meal (AChC). Each treatment was randomly assigned to seven experimental units with 10 chickens each. The variables evaluated were: feed consumption (FC), feed conversion ratio (FCR), weight gain (WG), carcass yield (CY), breast yield (BY), leg to thigh yield (LTY), digestive system development, walking ability (WA), valgus-varus angulation (VVA), and latency to lie down (LLD). Chickens 605

Rev Mex Cienc Pecu 2020;11(3):605-619

fed NDC and ChC had lower FC and WG (P<0.05). However, there was no difference among treatments for CA. There were differences among treatment (P<0.05) for WA and VVA, but there were not for LLD (P>0.05). The results showed that autoclave treatment (1 atm, 121 oC for 60 min) decreased toxicity in castor meal, since birds in the AC treatment had a similar productive behavior (P>0.05) to those in the control diet. Key words: Ricinus communis L., Detoxification methods, Autoclave, Calcium hydroxide, Broiler chickens.

Received: 29/08/2018 Accepted: 28/08/2019

Introduction

Castor oil plant (Ricinus communis L.) is native to Africa. It belongs to the family of Euphorbiaceae; it is distributed worldwide, mainly in India, China and Brazil, and is noted for its hardiness, drought tolerance and high oil content of its seeds(1). In Mexico, there are favorable agro-ecological conditions for the cultivation of castor oil plants, especially in the south and southeast(2). Castor plant has been used for the production of biodiesel, as a result of this process castor meal is obtained(3). Due to its nutritional composition, castor meal(4,5) can be included in animal feeds as an alternative to substitute protein ingredients and thereby decrease production costs. However, its use must be limited because it contains toxic products and allergens, mainly ricin, ricinine, and the allergen CB-1A, the former being the most toxic(6). Nevertheless, there are efficient methods for detoxifying castor meal, these are focused on decreasing or eliminating ricin, such as autoclave and calcium hydroxide treatments(7,8). Furthermore, fermenting the seeds in water and cooking them decreases the toxicity of castor meal and allows its inclusion in poultry diets without affecting the productive performance(9,10).

Ricin is inactivated at high temperatures and in strong alkalis; according to Anandan et al(7) no ricin residues were found in autoclaved castor meal (1 atm, 121 Â°C, 60 min) or calcium hydroxide (40 g/kg) samples, analyzed by polyacrylamide gel electrophoresis. Thus, the combination of these methods may potentiate their effect on the inactivation of toxic compounds in castor meal. No studies have been carried out where castor meal treated by these methods is included in the feed of broiler chickens. Probably, the use 606

Rev Mex Cienc Pecu 2020;11(3):605-619

of autoclave (1 atm,121 °C for 60 min), and chemical treatment (with 40 g Ca(OH)2/kg castor meal) methods, or their combination, would allow the inclusion of castor meal in broiler diets, without affecting the production and animal welfare variables. Thus, the aim of the present study was to evaluate the effect of autoclave and chemical treatment methods, or their combination on the productive performance and welfare variables of broilers.

Material and methods Detoxification of castor meal

Three methods described by Anandan et al(7) were used to detoxify the castor meal: Autoclave method (A), chemical method (Ch), and their combination (ACh).

Autoclave method

Forty samples of castor meal of 1,000 g each were placed in a Felisa autoclave, applying one atmosphere of pressure for 60 min, at 121 ºC. They were sun-dried 48 h and stored at room temperature(7).

Chemical method with calcium hydroxide Ca(OH)2

Twenty castor meal samples of 1,000 g each were treated with calcium hydroxide at a concentration of 40 g/kg, for 8 h and then they were sun dried 48 h, grounded with a hand mill (Estrella®, Mexico), and stored at room temperature. The calcium hydroxide was diluted in water before being mixed with the castor meal(7).

Combination of autoclave and chemical methods

The autoclave and calcium hydroxide methods described by Anandan et al(7) were used in consecutive order.

607

Rev Mex Cienc Pecu 2020;11(3):605-619

Birds and treatments

The experiment was conducted at the poultry facilities of the Postgraduate College (Colegio de Posgraduados), Campus Montecillo, Texcoco, State of Mexico. Located at an altitude of 2,247 m asl(11). Five treatments (experimental feeds) were evaluated: control diet corn and soybean meal (SM), non-detoxified castor meal (NDC), autoclaved castor meal (AC), chemical method treated castor meal (ChC) and autoclave and chemical methods treated castor meal (AChC). Each treatment was randomly assigned to seven experimental units with 10 chickens each. The birds were housed in 1.5 m2 pens with wood litter shavings. A 23 h light regime was provided during the first two weeks and then decreased to 12 h. The ambient temperature at the beginning of the experiment was 33 °C, which was reduced by 2 °C per week to a temperature of 21 °C. This study was conducted in accordance with the Guide for the Care and Use of Experimental Animals approved by the General Academic Council of the Postgraduate College. The feeding program was divided into two phases: starter diet (1-21 d) containing: 3,025 kcal of metabolizable energy (ME) kg-1, 22 % of crude protein (CP), 0.96 % of Ca and 0.48 % of available P, and finisher diet (22-42 d) containing: 3,100 kcal of ME kg-1, 19 of CP, 0.80 % of Ca and 0.40 % of available P (Table 1). The diets were formulated to cover or exceed the nutritional recommendations of the Ross 308 line(12).

608

Rev Mex Cienc Pecu 2020;11(3):605-619

Table 1: Composition of the experimental diets for broiler chickens Starter diet (1-21 days) Ingredients (%)

Finisher diet (22-42 days)

AC ChC 35.41 33.34 33.34 33.34 33.34 56.29 53.94 53.94 54.08 54.08 0.00 4.16 4.16 4.13 4.13 1.25 1.22 1.22 1.16 1.16 2.03 2.06 2.06 2.06 2.06 0.32 0.36 0.36 0.36 0.36 0.49 0.49 0.49 0.49 0.49 0.13 0.14 0.14 0.14 0.14 0.00 0.00 0.00 0.00 0.00 3.43 3.64 3.64 3.60 3.60 0.05 0.05 0.05 0.05 0.05 0.00 0.00 0.00 0.00 0.00 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 100 100 100 100 100 SM

Soybean meal Corn Castor meal Calcium carbonate Calcium phosphate L-lysine DL-methionine L-threonine L-tryptophan Oil Coccidiostat Pigment Salt Vitamins, minerals* Total Calculated analysis (%) Crude protein 21.0 EM, kcal/kg 3025 Calcium 0.96 Available phosphorus 0.48 Lysine 1.44 Methionine 0.83 Methionine+cystin 1.08 Threonin 0.97 Tryptophan 0.30

NDC AC

ChC

21.0 3025 0.96 0.48 1.44 0.83 1.08 0.97 0.30

AC ChC 30.44 28.36 28.36 28.36 28.36 61.91 59.56 59.56 59.70 59.70 0.00 4.16 4.16 4.13 4.13 1.07 1.04 1.04 0.98 0.98 1.61 1.64 1.64 1.64 1.64 0.12 0.17 0.17 0.17 0.17 0.34 0.34 0.34 0.34 0.34 0.02 0.03 0.03 0.03 0.03 0.00 0.00 0.00 0.00 0.00 3.49 3.70 3.70 3.66 3.66 0.05 0.05 0.05 0.05 0.05 0.35 0.35 0.35 0.35 0.35 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 100 100 100 100 100 SM

NDC AC

ChC

19.0 3100 0.80 0.40 1.15 0.47 0.90 0.78 0.18

19.0 3100 0.80 0.40 1.15 0.66 0.90 0.78 0.27

19.0 3100 0.40 0.40 1.15 0.66 0.90 0.78 0.27

SM= Control diet corn and soybean meal. NDC= Non-detoxified castor meal. AC= Autoclaved castor meal. ChC= Chemical method treated castor meal. AChC= Autoclave and chemical methods treated castor meal. 1 Vitamins and minerals premix per kilogram of feed: A, 12,000 UI; D3, 1,000 UI; E, 60 UI; K, 5.0 mg; B2, 8.0 mg; B12, 0.030 mg; pantothenic, 15 mg; niacin, 50 mg; folic acid, 1.5 mg; choline, 300 mg; biotin, 0.150 mg; thiamin, 3.0 mg. Fe, 50.0 mg; Zn, 110 mg; Mn, 100 mg; Cu, 12.0 mg; Se, 0.3 mg; I, 1.0 mg.

Productive performance, animal welfare and carcass yield traits

Feed consumption, weight gain, and feed conversion ratio were recorded from day one through d 42. At d 43, 35 birds per treatment were randomly selected to evaluate walking ability, valgus-varus angulation, and prostrate latency. Walking ability was evaluated according to the methodology described by Kestin et al(13) as modified by Garner et al(14). The measurement was carried out simultaneously by two assessors who 609

Rev Mex Cienc Pecu 2020;11(3):605-619

rated each bird on a scale of 0 to 5 where: 0. Birds that walk normally; 1. Birds with a slight difficulty for walking; 2. Birds with a defined and identifiable defect in their gait, but whose injury or damage does not impair movement or consumption of food and water; 3. Birds with an obvious defect that affects the ability to move; 4. Birds with a severe defect, and 5. Birds incapable of walking. Valgus-varus angulation was evaluated according to the methodology described by Leterrier and Nys(15). Depending on the tibia-metatarsal angle, 4 scores were defined: 0, normal chicken; 1, chicken with low angulation (tibia-metatarsal angle between 10 and 25 째); 2, bird with evident angulation (angle between 25 and 45 째) and 3, severe angulation (angle greater than 45 째). The birds were subjected to the latency-to-lie-down test as described by Berg and Sanotra(16). This test is based on the chicken's body contact with water, which is a novel and adverse experience for broilers. The birds were placed in a plastic container with water at 32 째C at a height of 3 cm. The time elapsed in seconds until each bird lay down was recorded. If the bird stood up after 600 seconds, the test was stopped. The birds were assessed individually, without visual contact among them. At 42 d of age, seven birds per treatment were randomly selected in order to assess the carcass yield, breast weight and leg-to-thigh weight. Feed was withdrawn 8 h before slaughter, and the chickens were slaughtered using a stun knife (model VS-200, input power 120 V-1 A, output power 50 V-0.1 A, Midwest Processing Systems, Minneapolis, MN, USA), according to the Mexican Official Standard NOM-033SAG/ZOO-2014(17).

Development of the digestive system and accessory organs

The chickens selected for the evaluation of carcass yield were used to assess the development of the digestive system. The length of the small intestine and the cecum was obtained with a measuring tape, and the empty weight of the proventricle, gizzard, small intestine and cecum were determined. The weight of liver, spleen, bursa of Fabricius, pancreas and heart was also estimated. The small intestine and the cecum were measured on a wet cloth in order to prevent them from contracting.

610

Rev Mex Cienc Pecu 2020;11(3):605-619

Statistical analysis

Feed consumption, weight gain, and feed conversion ratio were analyzed with a completely randomized design with a significance level of 0.05, using the SAS GLM procedure(18). Treatment means were compared using the Tukey adjusted test (P<0.05). The variables walking ability and angulation were analyzed with a completely randomized design using PROC GLIMMIX (for non-parametric data) and SAS PROC FREQ(18). The relative weights of the digestive system, accessory organs and prostrate latency were analyzed with a completely randomized experimental design with five treatments and seven repetitions per treatment using the GLM procedure of the SAS (18). Treatment means were compared using the Tukey test and presented as mean Âą standard error.

Results Productive performance and carcass yield

Chickens in the NDC and ChC treatments had lower (P<0.05) feed consumption and weight gain, compared to birds in the other treatments. No differences (P>0.05) were observed between treatments in feed conversion ratio. (Table 2). There were no differences between treatments in the carcass, breast, and leg and thigh yield variables. Table 2: Productive performance of broilers fed castor meal treated with different detoxification methods, from 1 to 42 d of age Treatment ChC AChC Variable SM NDC AC SE P-value FC, g 4499 a 3272 b 4492 a 3181 b 4575 a 66.41 0.0001 WG, g 2811 a 1980 b 2835 a 1923 b 2835 a 44.69 0.0001 FCR, g/g 1.60 1.65 1.58 1.65 1.61 0.03 0.2322 CY, % 79.96 78.31 78.91 78.03 79.91 0.66 0.1467 BY, % 28.31 25.28 25.86 25.01 26.85 0.81 0.0510 LTY, % 20.16 21.02 21.18 20.11 20.11 0.74 0.7002 SM= Control diet corn and soybean meal. NDC= Non-detoxified castor meal. AC= Autoclaved castor meal. ChC= Chemical method treated castor meal. AChC= Autoclave and chemical methods treated castor meal. FC= feed consumption; WG= weight gain; FCR= feed conversion ratio; CY= carcass yield; BY= breast yield; LTY= leg and thigh yield. ab Means with different letters are different (P<0.05). SE=Standard error.

611

Rev Mex Cienc Pecu 2020;11(3):605-619

Walking hability

Differences were found (P<0.05) by effect of the treatments on the walking ability; broilers fed the NDC and ChC diets exhibited a higher proportion of healthy birds (rating 0) compared to the birds of the other treatments. Birds rated 4 and 5 were not observed in this experiment (Table 3). Table 3: Walking ability, valgus/varus angulation, and latency to lie down of broilers fed castor meal treated with different detoxification methods, from 1 to 42 d of age Treatment SM NDC AC ChC AChC Score Walking ability 0 0.00 25.71 5.71 28.57 14.29 1 42.86 51.43 51.43 48.57 31.43 2 37.14 22.86 34.29 22.86 40.00 3 20.00 0.00 8.57 0.00 14.29 4 0.00 0.00 0.00 0.00 0.00 5 0.00 0.00 0.00 0.00 0.00 P-value 0.0009 Score Valgus-varus angulation 0 14.29 48.57 34.29 60.00 34.29 1 65.71 42.86 60.00 40.00 60.00 2 20.00 8.57 5.71 0.00 5.71 3 0.00 0.00 0.00 0.00 0.00 P-valor 0.0024 Latency to lie down Seconds (s) 84 118 103 103 114 P-value 0.6681 SM= Control diet corn and soybean meal. NDC= Non-detoxified castor meal. AC= Autoclaved castor meal. ChC= Chemical method treated castor meal. AChC= Autoclave and chemical methods treated castor meal.

Valgus-varus angulation

Valgus/ varus angulation was affected by treatments (P<0.05) on the degree of valgusvarus angulation. The highest proportion of birds with a 0 rating was found in the NDC and ChC treatments and, to a lesser proportion, in birds with a score of 1. No broilers with a degree of angulation rated 3 were observed (Table 3).

612

Rev Mex Cienc Pecu 2020;11(3):605-619

Latency to lie down

There was no difference (P>0.05) between treatments in latency to lie down (Table 3).

Development of the digestive system and accessory organs

There were not differences (P>0.05) in terms of relative weight of spleen and heart; however, the relative weight of liver was lower (P<0.05) in broilers fed the SM diet, compared to birds fed the treatments that included castor meal. Relative weight of bursa of Fabricius was lower (P<0.05) in chickens fed the NDC and ChC diets compared to chickens fed the SM, AC and AChC diets (Table 4). Relative weight of pancreas, gizzard, and small intestine and length of small intestine were greater (P <0.05) in chickens fed NDC and ChC diets, with respect to SM, AC and AChC. Relative weight of cecum of chickens fed SM, AC and AChC diets were lower (P <0.05) compared to the chickens of the ChC treatment and the length of the cecum was greater (P <0.05) in the chickens fed with NDC compared to AChC. Table 4: Relative weight (g/kg) and length (cm/kg) of the different sections of the digestive system and accessory organs of broilers fed castor meal treated with different detoxification methods, from 1 to 42 d of age Treatments

Spleen Heart Liver Bursa of Fabricius Pancreas Proventricle Gizzard Small intestine Cecum Cecum length Intestine length

NDC

ChC

AChC

1.65 4.08 18.27b 1.62 a 1.63 b 2.94c 10.50b 19.46b 4.91b 6.36bc 62.22b

1.79 4.38 24.16a 0.70 b 2.19 a 3.84ab 14.24a 25.17a 5.78ab 7.93a 84.19a

2.00 4.15 21.78a 1.49 a 1.82 b 3.35bc 10.50b 21.12b 5.43b 6.65bc 69.88b

1.77 4.35 24.34a 0.81 b 2.19 a 4.22a 14.24a 23.60a 7.13a 7.57ab 86.50a

1.99 4.26 21.78a 1.32 a 1.50 b 2.94c 8.61b 20.49b 5.21b 6.10c 63.81b

0.17 0.12 0.72 0.08 0.08 0.14 0.65 0.56 0.39 0.30 1.95

Pvalue 0.5189 0.3394 0.0001 0.0001 0.0001 0.0001 0.0001 0.0001 0.0047 0.0007 0.0001

Rev Mex Cienc Pecu 2020;11(3):605-619

Discussion The response of animals fed detoxified castor meal is determined by the effectiveness of the detoxification process, the concentration of castor meal in the diet, the feeding time, and the animal species(19). It has been recorded in the literature that heat treatments applied to castor seed meal reduce its toxic compounds, especially ricin which is the most toxic: high temperatures seem to inactivate it(20). These treatments have allowed the inclusion in diets for broilers up to 10% without affecting the productive performance or the carcass yield(21,22). In this study, birds fed AC and AChC had similar productive performance to that of birds fed SM, indicating that the heat and pressure used in the autoclave decreased the toxicity of the castor meal. In contrast, chickens fed NDC and ChC had a lower consumption and a lower weight gain, which could be attributed to the content of toxic substances(23). Treatment with Ca(OH)2 apparently did not reduce the toxic compounds which inhibit protein synthesis and mainly affect the digestive system, causing desquamation and a decrease in the length of the intestinal villi that prevents the absorption of nutrients and, therefore, the normal development of the birds(10,24). The use of 5% non-detoxified castor meal decreases feed consumption and weight gain in broilers(9,22,25). No studies on the use of castor meal in diets for broilers about animal welfare variables were found in the literature; however, in this study it was found that the degree of walking ability decreased in birds from the SM, AC and AChC treatments and the valgus/varus angulation was greater in these birds. This can be explained by the fact that birds with higher weight have lower ability to walk compared to lighter birds(26), since weight influences these characteristics(27). Broiler chickens with higher weight remain prostrate longer. Consequently, the balance and angulation condition of these birds are affected, causing discomfort when walking and deterioration in their well-being(28). The inclusion of castor meal in the diet leads to kidney damage (inflammation and congestion), enlargement of the liver, inflamed lungs, atrophy of the bursa of Fabricius, and necrosis of the spleen(21,29). In the present study, the size of the liver was larger in chickens fed castor meal; this may be accounted for by the increase in the metabolic activity in the face of residues of the toxic compounds(29). In addition, an increase in the size of pancreas, gizzard, proventricle, and intestine was observed in chickens fed NDC and ChC with respect to the control (corn-soybean meal). Organ weights have been studied in other species that were administered non-detoxified castor meal and castor meal treated with calcium hydroxide in the feed, and no differences were found in the weight of the liver, the heart, the kidneys and the spleen with respect to those of the animals fed the control diet (soybean meal)(30).

614

Rev Mex Cienc Pecu 2020;11(3):605-619

The weight or size of the bursa of Fabricius is an indicator of the state of immunocompetence or immunosuppression in birds at the level of the lymphoid organs(31). The ratio of the weight of the bursa of Fabricius to the body weight (BFW/BW) may be correlated with immunosuppression. Birds aged 3 to 6 wk normally have a BFW/BW ratio of 2 to 4; values of 1 or less to 1 are indicative of immunosuppression and are observed in clinically ill birds(32). In this study, the BFW/BW ratio of chickens fed NDC and ChC was less than 1, which indicates that the toxic compounds present in castor meal may have caused immunosuppression in the chickens. Okoye et al(21) observed a decrease in lymphoid organ size and necrosis of the bursa of Fabricius in chickens consuming feed with 10 and 15 % heat-treated castor meal.

Conclusions and implications It is possible to include castor meal detoxified with the autoclave method in the feeds of broilers without affecting the productive performance and welfare variables. However, since this study did not quantify the ricin resides in the meat, it was not possible to determine whether or not the meat of these chickens is suitable for human consumption. Therefore, it is suggested carrying out studies to quantify the ricin residues in the meat.

Acknowledgements The first author thanks the National Council for Science and Technology (CONACYT) for the financial support to carry out his postgraduate studies, as well as the Postgraduate College (Colegio de Postgraduados), Campus Montecillo, for the opportunity provided.

615

Rev Mex Cienc Pecu 2020;11(3):605-619

Literature cited: 1. Silva-Lima RL, Severino LS, Silva LMS, Ferreira JJ, Silva VL, Macedo BNE. Substratos para produção de mudas de mamoneira compostos por misturas de cinco fontes de matéria orgánica. Ciênc Agrotec 2006; 30(3):474-479. 2. Rodríguez RH, Zamarripa CA. Competitividad de la higuerilla (Ricinus communis) para biocombustible en relación a los cultivos actuales en el Edo. de Oaxaca, México. Rev Mex Agr 2013;32:306-318. 3. Azevedo DM, Lima EFO. Agronegócio da mamona no Brasil. Brasília: Embrapa Informação Tecnológica 2001;350. 4. Jiménez OR, Cervantes MR, Vallejo VJA, Rosales RS, Ríos SJC. Perfil de aminoácidos de pastas residuales de piñón tropical (Jatropha curcas) e higuerilla (Ricinus communis). Agrofaz 2011;12(3):173-176. 5. Rostagno HS, Albino LFT, Donzele JL, Gomes PC, Oliveira RF, Lopes DC, et al. Tabelas brasileiras para aves e suínos: composição de alimentos e exigências nutricionais. 2a ed. Viçosa, Brasil: Editora Universitária; 2011. 6. Matos JJB, Días AN, Bueno CFD, Rodríguez PA, Veloso ALC, Faria DE. Metabolizable energy and nutrient digestibility of detoxified castor meal and castor cake for poultry. R Bras Zootec 2011;40(11):2439-2442. 7. Anandan S, Anil KGK, Ghosh J, Ramachandra KS. Effect of different physical and chemical treatments on detoxification of ricin in castor cake. Anim Feed Sci Tech 2004;120:159-168. 8. Oliveira AS, Oliveira MRC, Campos JMS, Machado OLT, Valadares SC, Detmann E, et al. Eficácia de Diferentes Métodos de Destoxificação da Ricina no Farelo de Mamona Conferencia: En: II Congreso de la Red Brasileña de Tecnología y Producción de Biodiesel de 2007. Brasilia. 9. Oso AO, Olayemi WA, Bamgbose AM, Fowoyo OF. Utilization of fermented castor oil seed (Ricinus communis L) meal in diets for cockerel chicks. Arch Zootec 2011;60(229):75-82. 10. Ani AO, Okorie AU. Effects of processed castor oil bean (Ricinus communis L) meal and supplementary dl- methionine on nutrient utilization by broiler chicks. J Anim Plant Sci 2013;23(5):1228-1235.

616

Rev Mex Cienc Pecu 2020;11(3):605-619

11.Vázquez JC, Pérez PR. Valores gasométricos estimados para las principales poblaciones y sitios a mayor altitud en México. Rev Inst Nal Enf Resp Mex 2000;13(1):06-13. 12. Aviagen. Ross Broiler Management Manual. Aviagen Ltd., Midlothian, UK. 2017. 13. Kestin SC, Knowles TG, Tinch AE, Gregory NG. Prevalence of leg weakness in broiler chickens and its relationship with genotype. Vet Rec 1992;131:190-194. 14. Garner JP, Falcone C, Wakenel P, Martin M, Mench JA. Reliability and validity of a modified gait scoring system and its use assessing tibial dyschondroplasia in broilers. Br Poultry Sci 2002;43(3):355-363. 15. Leterrier C, Nys Y. Clinical and anatomical differences in varus and valgus deformities of chick limbs suggest different aetio‐pathogenesis. Avian Pathol 1992; 21(3):429-442. 16. Berg C, Sanotra GS. Can a modified latency-to-lie test be used to validate gaitscoring results in commercial broiler flocks. Anim Welf 2003;12(4):655-659. 17. Norma Oficial Mexicana. NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. Diario Oficial de la Federación. México. 26 de agosto de 2015. 18. SAS Institute, Inc. SAS User’s Guide: Statistics version. SAS Institute, Inc. Cary, NC. 2011. 19. Souheila A, Harinder PSM. Potential and constraints in utilizing coproducts of the non-edible oils-based biodiesel industry -an overview. Biofuel co-products as livestock feed Opportunities and challenges. FAO. Rome. 2012. 20. Gardner H, D'Aquin EL, Koltun SP, McCourtney EJ, Vix HLE, Gastrock EA. Detoxification and deallergenization of castor beans. J Amer Oil Chem Soc 1960;37(3):142-148. 21. Okoye JOA, Enunwaonye CA, Okorie AU, Anugwa FOI. Pathological effects of feeding roasted castor vean meal (Ricinus communis) to chicks. Avian Pathol 1987;16(2):283-290. 22. Nsa EE, Ukachukwu SN, Akpan IA, Okon B, Effiong OO, Oko OOK. Growth performance, internal organ development and hematological responses of broiler

617

Rev Mex Cienc Pecu 2020;11(3):605-619

birds fed diets containing different thermal treated castor oil seed meal (Ricinus communis). Glob J Agr Sci 2010;9(2):27-34. 23. Ani AO, Okorie AU. Effects of graded levels of dehulled and cooked castor oil bean (Ricinus communis) meal and supplementary l-lysine on performance of broiler finishers. J Trop Agr Food 2007;6(1):89-97. 24. Audi JMD, Belson MMD, Patel MMD, Schier JMD, Osterloh JMD. Ricin Poisoning. A Comprehensive Review. J Amer Med Assoc 2005;294(18):23422351. 25. Agbabiaka LA, Esonu BO, Madubuike FN. Effect of processing on nutrients and anti-nutrients of castor oil bean (Ricinus communis) seeds and by-products. Pak J Nutr 2011;10(6):561-563. 26. Toscano MJ, Nasr MAF, Hothersall B. Correlation between broiler lameness and anatomical measurements of bone using radiographical projections with assessments of consistency across and within radiographs. Poul Sci 2013;92(9):2251-2258. 27. Alves MCF, Almeida PICL, Nääs IA, García RG, Caldara FR, Baldo GAA, et al. Equilibrium condition during locomotion and gait in broiler chickens. Rev Bras Cienc Avic 2016;18(3):419-426. 28. Almeida ICL, Garcia RG, Bernardi RIA, Caldara FR, Freitas LW, Seno LO, et al. Selecting appropriate bedding to reduce locomotion problems in broilers. Rev Bras Cienc Avic 2010;12(3):189-195. 29. Mustapha GG, Igwebuike JU, Kwari ID, Adamu SB, Abba Y. The Effect of replacement levels of boiled and fermented castor seed (Ricinus cummunis) meal on the productive performance, nutrient digestibility, carcass characteristics and cost effectiveness in broilers. Int J Sci Nat 2015;6(4):675-682. 30. Gowda NkS, Pal DT, Bellur SR, Bharadwaj U, Sridhar M, Satyanarayana ML, et al. Evaluation of castor (Ricinus communis) seed cake in the total. J Sci Food Agric 2008;89(2):216–220. 31. Cheema MA, Qureshi MA, Havenstein GB. A Comparison of the immune response of a 2001 commercial broiler with a 1957 randombred broiler strain when fed representative 1957 and 2001 broiler diets. Poul Sci 2003;82(10):1519-1529.

618

Rev Mex Cienc Pecu 2020;11(3):605-619

32. Giambrone JJ, Clay R. Evaluation of the immunogenicity, stability, pathogenicity, and immunodepressive potential of four commercial live infectious bursal disease vaccines. Poul Sci 1986;65(7):1287-1290.

619

https://doi.org/10.22319/rmcp.v11i3.5092 Article

Effect of the cutting date and the use of additives on the chemical composition and fermentative quality of sunflower silage

Aurora Sainz-Ramírez a Adrián Botana b Sonia Pereira-Crespo c Laura González-González b Marcos Veiga b César Resch b Juan Valladares b Carlos Manuel Arriaga-Jordán a* Gonzalo Flores-Calvete b

Universidad Autónoma del Estado de México. Instituto de Ciencias Agropecuarias y Rurales (ICAR). Toluca, México. b

Instituto Galego de Calidade Alimentaria, Centro de Investigacións Agrarias de Mabegondo (INGACAL-CIAM) Apartado 10, 15080 A Coruña, España. c

Laboratorio Interprofesional Galego de Análise do Leite (LIGAL) A Coruña, España.

* Corresponding author: cmarriagaj@uaemex.mx

Abstract: The aim of this study was to evaluate cutting dates and the use of additives on the silage quality of the entire sunflower plant. The forage variety (Rumbosol-91) was harvested in weeks 1, 3 and 5 post-flowering (F1, F2 and F3, respectively) and treated with the following

620

Rev Mex Cienc Pecu 2020;11(3):620-637

additives: 1) 1.5 Ă&#x2014; 105 cfu of g-1 forage inoculant, based on homofermentative lactic acid bacteria Enterococcus faecium, Pediococcus pentosaceus and Lactobacillus plantarum (INOC), 2) 3 ml kg-1 forage of an 85% formic acid solution (FORM) and 3) without additive (Control); following a 3x3 factorial design with five replications. Effluent production and total dry matter (DM losses decreased, from 282 and 134 g kg-1 on D + 1 to 96 and 87 g kg-1 on D + 5 as a result of the high moisture content of the forage close to flowering. NIRS analysis of the silage samples showed that the protein, fiber and digestibility contents decreased significantly with the maturity of the plant; the rapid accumulation of oil in the DM made the energy concentration higher in the most advanced phenological state. The fermentative quality of the silages was satisfactory, regardless of the cutting moment and the use of additive. It is concluded that the cutting moment of the plant is better at five weeks post-flowering, when an acceptable fermentation is expected without the need to use preservatives. Key words: Sunflower, Maturity, Digestibility, in vitro, Preservatives.

Received: 02/10/2018 Accepted: 19/07/2019

Introduction The sunflower (Helianthus annuus L.) is an annual plant, with many genotypes or subspecies cultivated for ornamental, oilseed and forage purposes. Official data indicated that, in 2006, the surface area of the species cultivated in Mexico(1) was approximately 2,000 ha â&#x20AC;&#x2022;well below its potentialâ&#x20AC;&#x2022;, allocated to oil production, mainly in irrigated areas(2). On the other hand, it has been demonstrated that the cultivation of sunflower as silage forage is a viable option in the feeding of ruminants, given its characteristics of rapid development, tolerance to low temperatures and little demand for moisture and fertilization; therefore, it is considered a good option for rain-fed areas, being an alternative to the cultivation of corn for use in animal feed(3). The use of sunflower as green or summer silage was popular in the United States at the beginning of the 20th century, but today it has been surpassed by corn(4). It can be established as a monoculture or combined with corn(5), and it is used as silage in crops when its establishment was late or when it has been damaged by the climate(6). 621

Rev Mex Cienc Pecu 2020;11(3):620-637

Its use as silage is subject to controversy, since the optimal time of use has not been determined. On the one hand, some studies present a harvest point around flowering, based upon maximum digestibility and protein values(7), and on the other hand, other authors recommend more advanced stages, when the seeds are well formed(8) or even close to the physiological maturity of the plant (9), in order to avoid high effluent production and reduction of silage losses. The low dry matter content of sunflower, a moderate carbohydrate content and a relatively high buffer capacity, throughout its cycle are factors that can compromise the quality of fermentation and its conservation in the silo(10,11); despite this, various authors have demonstrated the possibility of obtaining well-preserved silages(12). The development in the use of additives to control fermentation and reduction of losses in the silage process was one of the most relevant technological advances of the last century. Today, inoculants, based on lactic acid bacteria are the most widely used additives in Europe and America(13); these are added to the forage with the aim of controlling the bacterial populations that cause silage losses from the inefficient fermentation of sugars(14). In addition, there is evidence of the usefulness of inoculants in forages with high moisture content, although results are inconsistent (15). In this situation, direct acidification of the forage with organic acids may be an alternative. There is extensive literature on the effectiveness of formic acid on improving the quality of fermentation in animal production when high moisture forage is used(15-18). Applied in the form of a commercial 85% solution and doses between 2 to 5 L t-1 of fresh forage, reduces pH immediately, favors the action of lactic bacteria against enterobacteria and clostridia and restricts the intensity of fermentation, which minimizes the risk of the presence of undesirable metabolites in the silage that may limit its chemical composition(17). Faced with these advantages, the use of formic acid in high moisture forages can, on certain occasions, increase the production of effluence and the level of total losses, compared to the control without additives(15). Therefore, the present work had the objective of assessing the effect of the cutting date and the use of additives on the level of losses, effluent production, chemical composition and fermentative quality of sunflower silage.

Material and methods The study was accomplished during the summer-fall 2016 period at the Mabegondo Agriculture Research Center (CIAM, Spanish acronym) ―located on the northwestern Atlantic coast of Galicia (Spain), at 43º 14’ 18.45’’ N and 8º 15’ 59.60’’ W, at 100 m asl ―, in humid rain-fed areas. Three cutting dates and three additives were assessed following a 622

Rev Mex Cienc Pecu 2020;11(3):620-637

factorial design with five replications. The assay lasted for 108 d, from sowing to the last harvest. During cultivation, the mean temperature was 18.2 Â°C and the accumulated precipitation was 137 mm, somehow lower than the usual amount in the location. The onset of flowering took place 72 d after sowing, according to the Schneiter and Miller scale(18) corresponding to the final R4 phase (opening of the flower buds, the yellow ligulate flowers beginning to be visible). The forage variety Rumbosol-91, sown in late June 2016, was harvested in wk 1, 3 and 5 after flowering (treatments D + 1, D + 3, and D + 5, respectively). On each cutting date, about 50 kg of chopped forage was collected at 2-3 cm, homogenized and divided into three sub-samples and the additives were assigned: i) an inoculant (INOC) based on homofermentative lactic bacteria Enterococcus faecium, Pediococcus pentosaceus and Lactobacillus plantarum (SILOSOLVE F100, 3F Technology) at the manufacturer's recommended dose (1.5 x 105 cfu g-1 of forage); ii) an 85% formic acid solution (FORM) at a dose of 3 mL kg-1 of forage and, iii) a control without additive (CONTROL). For each combination (cutting date and additive), five laboratory silos were produced in polyethylene bags (40x10 cm), inside a 2.2L PVC pipe with a useful capacity equipped with an effluent drainage system(19,20).

Chemical analysis

The net weight of the forage of each silo and the weight of the effluent produced by it were determined at the time of its preparation and immediately before its opening at 60 d, using a 0.1 g precision balance (AND, model HR-202). From each sample taken at the time of filling each silo, the dry matter (DM) content was determined by drying it in a forced air oven at 80 ÂşC for 16 h. The spectra of the dried and ground samples at 1 mm were obtained using a Foss NIRSystem 6500 monochromator spectrophotometer (Foss NIRSystem Silver Spring, Washington, USA), and their composition in organic matter (OM), crude protein (CP), acid detergent fiber (ADF), neutral detergent fiber (NDF), water soluble carbohydrates (WSC), in vitro digestibility of organic matter (OMdv) and ethereal extract (EE) were determined using the calibrations developed at CIAM(19). The buffer capacity (BCNaOH) was determined by reference methods(21), expressed as meq of NaOH kg-1 DM. The forage fermentability coefficient was estimated(22) according to the equation FC = (DM + 80 x WSC) / (BCNaOH x 0.127 - 0.3), where DM represents the % content of DM, WSC represents the concentration of soluble CHO in water expressed as % of DM and BCNaOH is the buffer capacity expressed in milliequivalents of alkali per 100 g of DM. FC values higher than 45 indicate ease of ensiling, while values lower than 35 are indicative of a high probability of bad fermentation.

623

Rev Mex Cienc Pecu 2020;11(3):620-637

Fermentative analysis The silos opened after 60 d. In a fresh silage sample, the DM content was determined and subsequently corrected for loss of volatiles for the fermentation products during drying(23). The values of OM, CP, ADF, NDF, OMdv and EE of the dry and ground samples at 1 mm were determined using NIRS calibrations developed at CIAM. The concentration in net energy value for lactation (NEl) of the silage was calculated(24) according to the NEl expression (Mcal kg-1 DM) = (178 x OMdv x MO + 0.008 x OMdv2 x MO2) x 10-6, where OMdv is expressed in %, and OM, in % of DM. The net energy corresponding to the oil of the samples was added to this, considering an average value of 4.9 Mcal of NEl kg-1 of oil(25) for EE values above 4 % DM, since the NIRS calibrations for estimating in vitro digestibility with ruminal fluid(20) were obtained with degreased samples when this EE value was exceeded, in order to avoid the depressor effect of the samples' oil on the activity of ruminal microorganisms(26). A second aliquot of silage was frozen at -18 ºC until the time when the fermentative analysis was performed, determining the pH by using a pH meter fitted with a combined electrode, ammonia nitrogen (N-NH3) with a selective electrode (Orion) and soluble nitrogen (Soluble N) by macro-Kjeldahl digestion. Fermentation acids (lactic, acetic, propionic, butyric, valeric, caproic, isobutyric and isovaleric) and alcohols (ethanol, butanol, propanol) were determined by gas chromatography(27). The total volatile fatty acids (VFA) value was calculated as the sum ―expressed in mmoles kg-1 DM― of the concentrations of the fermentation acids, excluding lactic acid. The total loss values, effluent production, chemical composition and fermentation quality parameters were analyzed by analysis of variance (ANOVA) using the GLM procedure of SAS (SAS Institute 2009 v. 9.2) according to the model: yijk = µ + αi F + βj A + (αβ)ij FxA + γk + εijk Where the cutting date (D, i = 3) and the additive (A, j = 3) were considered fixed factors, and the replication (R, k = 5), a random factor, and FxA represents the interaction. The separation of means of the variables when the F test in the ANOVA was significant was performed using the Duncan HSD test (α = 0.05).

624

Rev Mex Cienc Pecu 2020;11(3):620-637

Results and discussion Crop development and dry matter production

On the first cutting date (D + 1) the phase was R5.5 (50 % of the tubular flowers in anthesis or post-anthesis); the phase R6 (complete flowering, with the seeds formed and the wilted ray florets) was reached on D + 3, and the phase R7 (lower part of the chapter is pale yellow in color, with thickened seeds, in a milky-pasty state) was attained on D + 5. The yield on these three dates was estimated(28) at 9.1, 10.1, and 11.5 t DM ha-1, respectively. The highest unit production obtained at the latest cutting date coincides with that observed in other researches carried out at CIAM with the same forage variety(29), as well as in previous reports with various genotypes(8.30), according to which the most suitable phase for ensiling is when plants have yellow-green structures at the base and the seeds are well formed. The chemical composition, buffer capacity, fermentability coefficient and estimation of net energy for lactation of the sunflower in the fresh state, are shown in Table 1. The cutting moment significantly affected (P<0.001) the content of DM, the chemical composition (except for the ADF content), and the in vitro digestibility and net energy for lactation values of sunflower at the time of ensiling. The DM of the crop averaged 16 % in all the cuttings and increased with the age of the plant from a value of 12.1 % on D + 1 to 18.6 % on D + 5, at a rate of 1.53 % units per week. The OM content showed a quadratic trend, with a value on D + 3 (95.5 % DM) higher than that of the other two cutting dates (90.9 and 90.5 % DM). Sunflower maturity decreased the protein, cell wall, sugars and digestibility contents, with values of 9.4, 9.2 and 8.6 for CP; 41.8, 40.5, and 36.8 for NDF; 16.9, 15.3 and 10.6 for WSC, and 67.0, 65.7 and 58.4 for OMdv on D + 1, D + 3, and D + 5, respectively, in contrast with the DM values. The concentration of EE increased from 2.7 to 17.6% with advancing maturity as a consequence of the conversion of non-structural carbohydrates to oil in the seeds, which was especially evident on the last date of the silage. The energy concentration, which increased from NEl of 1.38, 1.57, and 1.83 Mcal kg-1 DM on D + 1, D + 3, and D + 5, respectively, exhibited the same behavior. The buffer capacity and the fermentability coefficient were not affected (Pâ&#x2030;Ľ0.05) by the cutting date, with the values of BCNaOH ranging between 320 and 346 meq NaOH kg-1 DM and FC between 45.7 and 38.6, although the latter exhibited a trend (P= 0.10) that suggests a greater ensilability of the plant in earlier stages of development, due to the higher sugar content, compared to later dates.

625

Rev Mex Cienc Pecu 2020;11(3):620-637

Table 1: Effect of the cutting date on the DM content, the buffer capacity, the fermentability coefficient, and the nutritional composition of fresh sunflower Cutting date D+1 D+3 D+5 SEM P c b a Dry matter (DM), % 12.1 14.1 18.6 0. 098 *** -1 BC (meq NaOH kg DM) 320 346 335 6.94 NS Fermentability coefficient 45.7 42.5 38.6 2.02 NS Chemical composition (% DM): OM 90.90 b 95.50 a 90.50 b 0.35 *** a a b CP 9.40 9.20 8.60 0.12 *** a b c NDF 41.80 40.50 36.80 0.23 *** ADF 34.10 33.40 33.80 0.26 NS c b a EE 2.70 6.90 17.60 0.18 *** a b c WSC 16.90 15.30 10.60 0.31 *** a b c OMdv, % 67.00 65.70 58.40 0.43 *** c b a NEl, Mcal/kg MS 1.38 1.57 1.83 0.018 *** n= number of observations; SEM: standard error of the mean; BC= buffer capacity; OM= organic matter; CP= crude protein; NDF= neutral detergent fiber; ADF= acid detergent fiber; EE= ethereal extract; WSC= water soluble carbohydrates; OMdv= organic matter digestibility in vitro. (*** P<0.001; ** P<0.01; * P<0.05; NS: non-significant P>0.05);

Several studies carried out in Brazil and Argentina with the Rumbosol-91 forage variety show the variation in the chemical composition with the maturity of the plant. In the first country, in a harvest carried out between 4 and 7 wk after flowering, CP values were obtained between 9.9 and 7.0 on a dry matter basis(31), while, another research with cuttings between 97 and 112 d after planting (Phases R7 to R9) obtained CP values between 10.0 and 9.3 and EE values from 9.9 to 14.3 on a dry matter basis, respectively(32). In another study, with a cutting date of 97 d since planting (DSP), a wide range of variation was obtained in the CP contents (9.4 to 14.5 % DM) and in NDF (40.6 to 48.7 % DM)(33). Values of 9.6 and 8.3 % DM were obtained for CP, of 37.9 and 40.1 % DM for NDF, and of 15.1 and 13. 4 % DM for EE were obtained for the same Runbosol-91 variety at phases R7 and R9(34). Two researches performed in the Rumbosol-91 variety at the CIAM experimental farm in different years and on different cutting dates(29,30) allowed comparing the cuttings from wk 2 to wk 6 after flowering; in this interval, the fresh forage contents were observed to increase in DM (from 15.6 to 22.4 %), in OM (from 89.9 to 85.8 % DM), in EE (from 2.3 to 17.0 % DM), and in NEl (from 1.34 to 1.61 Mcal kg- 1 DM), while exhibiting a decrease in those of soluble carbohydrates (from 22.4 to 8.4 % DM) and digestibility (from 66.4 to 52.7 % DM). Studies carried out in France at the beginning of the last third of the XXth century(32) indicate 626

Rev Mex Cienc Pecu 2020;11(3):620-637

digestibility values of 70 to 75 % at the onset of flowering, and 60 to 75 % for the plant at a fodder grain phase. However, more recent researches by Italian authors in the rainforests of the Po valley(35) report OMdv values close to 60 % for the plant in full bloom, which is more in line with the results obtained in the present work. According to the coefficients estimated on D1, D2 and D3, the ensilability of the sunflower at these three phases of development can be rated good to medium. Despite the fact that studies carried out in Germany(10) assign low values to this species, an extensive review by other authors(36) indicates that fresh sunflower usually has a sugar content and a buffer capacity that can be considered as average, of 120-200 g kg-1 DM and 350-550 meq NaOH kg-1 DM, like Italian ryegrass or forage peas, consistently with the results shown the present paper. The losses of dry matter, production of effluent, and nutritional composition of the silages are shown in Table 2. The cutting date had a strong significant effect (P<0.001) on the production of effluent, which was very high, especially in the first two cuttings (28.2 % of the fresh weight initially ensiled on D + 1, and 17.4 % on D + 3) due to the high moisture content of the forage, which subsequently decreased to 9.6 % in the last harvest. Thus, total DM losses in the first two cuttings (13.4 % in the first, and 12.5 % in the second) were significantly higher (P<0.001) than those of the last date (8.7 %). Studies evaluating the effect of harvest DM content on silage losses indicate that, with a DM content of 30 % or more, respiration and fermentation losses should not exceed 5 to 8 % of ensiled DM, while in the case of crops harvested under conditions of high moisture (DM <25 %), the losses are usually greater, due to a higher fermentation intensity and, above all, to the losses caused by the effluent(13,37).

627

Rev Mex Cienc Pecu 2020;11(3):620-637

Table 2: Effect of the cutting date and of the use of additives on the effluent production, total loss level and nutritional composition of sunflower silage Main effects

Interaction

Cutting n

Additive

D+1

D+3

D+5

TES INOC FORM P

SEM

1.14

8.8 b

10.9 b

14.8 a

***

16.8 b 17.50 b 20.9 a

***

0.666

16.3

16.5

0.227

90.1 a 90.1 a

88.5 b

***

0.154

10.7

10.6

Dry matter losses (%DM) DML

13.4 a 12.5 a 8.7 b

Effluent (% initial fresh matter) EFL

28.2 a 17.4 b 9.6 c

Dry matter (%) DM

14.8 b 15.3 b 19.0 a ***

16.3

Chemical composition (%DM) OM

89.3 b 90.3 a 89.0 b *** 11.4

45.5

ADF

37.5

2.7 c

CP NDF

11.3

43.9

35.7

7.8 b

9.3

***

38.9

32.3

10.7

0.057

***

43.5

0.259

36.4

***

0.161

***

9.7 a

***

0.094

***

49.5 b 49.6 b

54.2 a

***

0.414

***

1.23 c 1.25 b

1.34 a

***

0.009

42.1

***

34.3

18.0 a ***

9.1 b

***

42.6

34.8

9.7 a

in vitro Digestibility OMdv (%)

53.6 a 53.3 a 46.4 b *** -1

Net energy for lactation (Mcal kg MS) NEl

1.04 c 1.23 b 1.56 a ***

n= number of observations; SEM= standard error of the mean; OM= organic matter; CP= crude protein; NDF= neutral detergent fiber; ADF= acid detergent fiber; EE= ethereal extract; OMdv= in vitro organic matter digestibility. (*** P<0.001; ** P<0.01; * P<0.05); NS= non-significant P>0.05; ab Values with different superscripts on the same row for each main effect are different (P<0.05).

Comparison between the mean values of the fresh sunflower and the resulting silage evidences an increase in the content in DM (+1.4 %) and in the concentration (in % DM) of CP (+1.6 units), ADF (+3.0 units), NDF (+1.4 units), and EE (+0.4 units), as well as a sharp decrease in the value of OMdv (-12.6 %) and NEl (-0.31 Mcal kg-1DM), which can be attributed to the high production of effluent in all cuttings. As some studies indicate, an increase in the DM of silage is expected when the DM content of green forage placed in the silo is less than 23-25 %(38). Also, there will be little variation in the content of ash and total nitrogen when the corresponding values of the resulting silage are expressed on a dry matter basis corrected for the losses of volatile substances that take place during the drying process in the kiln(22), while the fiber content is usually significantly 628

Rev Mex Cienc Pecu 2020;11(3):620-637

affected by the silage, due to the passive increase caused by losses of dry non-cellulosic matter in a solid form in the effluent, or as gas during fermentation(39). On the other hand, although it is generally assumed that the digestibility of the silage is equal to or slightly lower than that of the original forage(40), there is evidence of a significant decrease in digestibility in the case of ensiled forages with low dry matter content, because the effluent contains highly digestible nutrients(41). An average decrease of 7.0 percentage points in the digestibility values of the DM(42) has been indicated for silages with dry matter contents close to 16%, a figure that was exceeded widely in our study, probably due to a higher moisture content. The cutting date significantly affected the DM content, the chemical composition, the digestibility, and the energy concentration of the silage. In general, the variation observed in the quality of the silage in the different cuttings was similar to that observed for the original fresh forage. Neither the values of total losses of DM or the DM or CP content were affected by the use of additive (P>0.05), whose effect on the characteristics of the silages was comparatively less than that exerted by the cutting date. Notably, formic acid significantly increased the production of effluent (P<0.001) and the level of total DM losses (P<0.01) in relation to the inoculant and to the control without additive, which exhibited values of 20.9 vs 17.2 and 16.8 % of the fresh silage weight for the effluent and 14.8 vs 10.9 and 8.8 % for the level of losses, respectively. In addition, the silages treated with formic acid showed significantly lower concentrations of OM (88.5 vs 90.1 and 90.1% DM) and higher concentrations of NDF (43.5 vs 42.6 and 42.1 % DM), of ADF (36.4 vs 34.8 and 34.3 % DM), and, above all, of OMdv (54.2 vs 49.6 and 49.5 % DM) and NEl (1.34 vs 1.25 and 1.23 Mcal kg-1 DM). The results obtained agree with the observations by other authors who point out the increase in the production of effluent and losses when formic acid is applied to high moisture forages(39), and an improvement in digestibility due to the lower expenditure of nonstructural carbohydrates during fermentation(15). The effect of the use of inoculants on the level of DM losses in silage varies: certain reports show a negative effect, with DM recovery values below those of a control without additive(43); but generally its effect on high moisture forages is low(44), as observed in this study.

Fermentative quality of silages

The harvesting date and the use of additives significantly affected the main parameters that define the fermentative quality (Table 3). The pH values increased with the cutting date, being different from each other in the three uses (D + 1: 3.77, D + 3: 3.94 and D + 5: 4.04, P<0.001). The acetic contents, VFA, soluble N, and N-NH3 were lower (P<0.001) on the first cutting date than on the two subsequent dates, which did not differ from each other 629

Rev Mex Cienc Pecu 2020;11(3):620-637

(acetic: 1.71 vs 2.54 and 2.41 % DM; VFA: 289 vs 426 and 405 mmol kg-1 DM; soluble N: 32.8 vs 45.2 and 46.7% of the total N; N-NH3: 3.87 vs 7.03 and 7.68 % of the total N). The contents of lactic acid and ethanol evolved in a contrary way, being higher in the earliest cuttings compared to the later ones (lactic: 9.06, 7.66 and 6.36 % DM; ethanol: 4.17, 4.92 and 3.39 % DM; D + 1, D + 3, and D + 5 respectively). The butyric content, propionic and longer chain VFA, as well as butanol and propanol, were very low at all cutting dates. Table 3: Effect of the cutting date and use of additives on the fermentative quality of sunflower silage Main effects

Interaction

Cutting

Additive

D+1

D+3

D+5

3.77 c

3.94 b

4.04 a

TES

INOC FORM P

SEM

***

3.8 b

3.77 c

4.18 a

***

0.007

***

11.2 a

11.48 a 0.35 b

***

3.05

***

0.481

***

0.086

Fermentation products (% DM) Lactic

9.06 a

7.66 b

6.36 b

Acetic

1.71

2.54

Propionic 0.013

2.41

0.016

0.021

0.016

0.012

0.003

***

0.007

0.006

0.008

0.001

0.005

0.003

0.002

0.001

0.000

0.005 a 0.002 b 0.001 b *

0.000

0.015

0.002

Valeric

0.002

Caproic

0.004

0.001

0.002

0.00

Isobutyric 0.003 a 0.001 ab 0.0 b Isovaleric 0.002

Butanol

0.010

Ethanol

4.17

Propanol

0.18

0.0

0.011 4.92

0.15

1.00

Butyric

2.61

0.002

0.001

0.000

0.005

0.003

0.002

0.001

0.000

0.007

0.009

0.01

0.000

***

0.261

***

0.041

513.6 c 437.9 b 169.1 a ***

14.9

***

45.2 a

43.3 a

36.2 b

***

0.707

***

0.161

***

3.39

0.09

1.85

0.13

1.95 0.17

8.68

0.12

-1

Volatile fatty acids (mmoles kg MS) VFA

289 b

426 a

405.7 a ***

Soluble and ammoniacal N (% N total) Soluble N 32.8 b

45.2 a

46.7 a

N-NH3

3.87

7.03

7.68

8.18

6.84

3.57

-1

n= number of observations; SEM= standard error of the mean; VFA= mmoles kg DM of acetic, butyric, isobutyric, propionic, valeric and isovaleric. (*** P<0.001; ** P<0.01; * P<0.05; NS: non-significant P>0.05); abc Values with different superscripts on the same row for each main effect are significantly different (P<0.05).

According to the criteria of the French INRA or the German DLG(45), a good fermentation quality of high moisture silages is defined by values of pH ď&#x201A;Ł4.0, absence or traces of butyric 630

Rev Mex Cienc Pecu 2020;11(3):620-637

and propionic acids, acetic acid content <2-3 % DM, a N-NH3 content ď&#x201A;Ł5-8 % of the total N, and a soluble N content equal to 50 % of the total N, with VFA content below 600 mmol kg-1 DM. In regard to these criteria, the results obtained in this study reflect an acceptable or good quality of sunflower fermentation throughout the growth cycle considered and suggest that, despite the higher moisture, the greater availability of sugars at the earliest dates favors a better fermentation quality compared to a later use, confirming the fermentability coefficients registered in the fresh state. The control silage showed values of pH (3.80), VFA (513 mmol kg-1 DM), soluble N (45.2 % of the total N), and N-NH3 (8.1 % of the total N), which is indicative of an acceptable fermentative quality, although it had a somewhat high concentration of acetic acid (3.05 % DM). Compared with the control group, the inoculant significantly (P<0.001) reduced the pH (3.77), and the contents of acetic acid (2.61 % DM), VFA (437 mmol kg-1 DM), and NNH3 (6.84 % of the total N), slightly improving the fermentation. The results obtained with the application of inoculant to the sunflower agree with those of the researches that show a positive effect of its use on the fermentation quality(43,46), its effectiveness being especially interesting, even on high moisture forages. As in in the present study, this effect is consistently observed with silage forages where the DM content is close to 30 % or higher(47). The addition of formic acid reduced the intensity of fermentation in the silage, evidenced by a higher average pH value (4.18) and lower average contents of lactic acid (0.35 % DM), acetic acid (1.0 % DM), VFA (169 mmol) kg-1 DM), soluble N (36.2 % total N), and N-NH3 (3.5 % of the total N), differing significantly (P<0.001) from those of the other two additive treatments. Another typical feature of the formic activity is the elevation of the ethanol content, compared to the inoculant and the control (8.68 vs 1.85 and 1.95 % DM), which is attributed to a higher activity of the yeasts, particularly tolerant to the action of formic acid(48), linked to the greater availability of sugars in less intense fermentation. In agreement with these observations, various studies have shown that the application of formic acid produces silages with low values of lactic and acetic acids, and a lower lactic: acetic acid ratio, as well as a lower ratio of ammoniac N over total N, as a consequence of the reduction of the intensity of the proteolytic processes caused by the additive(15,49). The effect of the different additives on the fermentation parameters was relatively homogeneous on the three cutting dates, as evidenced by the low quantitative importance of the interactions with a significant effect on pH and the contents of acetic, ethanol, VFA and N-NH3. While the effect of formic acid was similar at the three cutting dates of sunflower, the positive effect of the inoculant in improving fermentation is more evident when the plant is harvested in the vicinity of flowering, probably due to the greater amount of the sugary substrate available to the lactic bacteria added to the forage, which are effective despite the

631

Rev Mex Cienc Pecu 2020;11(3):620-637

higher moisture at this time, consistently with the anticipated coefficient of fermentability for fresh forage. To the evident improvement in fermentation induced by the use of formic acid, it must oppose, on the one hand, the difficulty of its application due to its strong, potentially corrosive acid character, and, on the other, the increased production of effluent, already high in the control treatment, caused by its application. From this point of view and taking into account the high polluting power of the effluent(50), it would not be advisable to use formic acid versus the inoculant and the control without additives. On the other hand, given the good fermentative quality of preservative-free sunflower silage, the justification of the expense in the addition of inoculant is subject to controversy, and, despite the improvement in the expected fermentative quality, its use should be compared, in economic terms, with improving the productivity of animals fed with different types of silage â&#x20AC;&#x2022;an aspect that lies outside the scope of the objective.

Conclusions and implications Sunflower silage has a good energy content and a moderate amount of protein. The cutting date affects dry matter and energy increasing as the plant becomes older, but the percentage of the first cutting is minimized. Because the use of additives provides a low margin of advantage in terms of silage quality, it is should be subjected to cost-benefit analyses. Due to its concentration of nutrients, its chemical composition values and fermentative characteristics, sunflower silage can be a complementary forage in the nutrition of dairy cattle; however, its high oil content near the optimal harvest time may represent a limitation to its use in the diet.

Acknowledgements and conflicts of interest This research was financed by the ATT 2016/106 projects of the Xunta de Galicia and RTA2012-00065-05-02 of the INIA. Aurora SĂĄinz-RodrĂguez was the beneficiary of a CONACYT grant to carry out a training stay at CIAM. The authors declare that they have no conflicts of interest.

632

Rev Mex Cienc Pecu 2020;11(3):620-637

Literature cited: 1. SAGARPA. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. Planeación agrícola nacional 2017-2030, Oleaginosas. México. 2017. 2. CONAGUA. Comisión Nacional del Agua. Estadísticas Agrícolas de los Distritos de Riego Año Agrícola 2013-2014. Secretaría de Medio Ambiente y Comisión Nacional del Agua. México. 2017. 3. Bravo-Quirino F. Guía para el aprovechamiento del girasol como forraje. Instituto de Investigación y Capacitación Agropecuaria del Estado de México. México. 2014. 4. Panciera MT, Kunkle WE, Fransen MT. Minor silage crops In: Buxton DR, et al. editors. Silage science and technology. American Soc Agronom Inc., Crop Science Soc. of America Inc, Madison, Wisconsin, USA. 2003. 5. Fransen SC. Corn and sunflower intercropped for silage. Proc Northwest Dairy Shortcourse. Pullman, USA. Washington State Univ. 1987. 6. Park CS, Marx GD, Moon YS, Wiesenborn D, Chang KC, Hofman VL. Alternative uses of sunflower. In: Schneiter AA. editor. Sunflower technology and production. Agronom Monogr ASA, CSSA and SSSA. Madison, WI, USA. 1997. 7. Donaldson E, Henderson AR, Edwards RA, Harper FF. Studies on sunflower silage. Edinburg School of Agriculture. 1980. 8. Demarquilly C, Andrieu J. Chemical composition, digestibility and ingestibility of whole sunflower plant before and after ensiling. Ann Zootech 1972;21(2):147-162. 9. Gonçalves LC, Tomich TR, Pereira LGR. Produção e utilização de silagem de girassol. Simpósio: Forragicultura e Pastagens. Lavras Anais Lavras. UFLA. 2000. 10. Weissbach D. The silaging qualities of sunflowers. Green Chemistry ADDCON. 2007. http://www.addcon.com/en/feed/silage-additives/ensiling-tips/sunflowers/ Accessed Feb 28, 2018. 11. Tomich TR, Gonçalves LC, Tomich RGP, Rodrigues JÁ, Borges I. Características químicas e digestibilidade in vitro de silagens de girassol. R Bras Zootec 2004;33(6):1672-1682. 12. Edwards RA, Harper F, Henderson AR, Donaldson E. The potential of sunflower as a crop for ensiling. J Sci Food Agric 1978;(29):332-338. 633

Rev Mex Cienc Pecu 2020;11(3):620-637

13. Wilkinson JM, Muck RE. The future of ensiling: challenges and opportunities. In: Gerlach K, Südekum KH Editors. Proc. XVIII Int. Silage Conf. Germany. 2018. 14. Jones BA, Hatfield RD, Muck RE. Effect of fermentation and bacterial inoculation on lucerne cell walls. J Sci Food Agric 1992;(60):147-153. 15. Mayne CS. The effect of formic acid, sulphuric acid and a bacterial inoculant on silage fermentation and the food intake and milk production of lactating dairy cows. Anim Prod 1993;56(1):29-42. 16. Mayne CS, Steen RWJ. Recent research on silage additives for milk and beef production. 63rd Annual Report 1989-1990, Agricultural Research Institute of Northern Ireland, 1990. 17. McDonald P, Henderson AR, Heron SJE. The biochemistry of silage. 2nd ed. Marlow, England: Chalcombe Publ. 1991. 18. Schneiter AA, Miller JF. Description of sunflower growth stages. Crop Sci 1981;(21):901-903. 19. Flores G, González A, Castro J. Evaluación de la utilidad de los silos a pequeña escala para experimentación en calidad de ensilados. Actas de la XXXVII R.C. SEEP. España 1997. 20. Pereira S, Fernández B, Valladares J, Díaz N, Resch C, González A, Flores G. Evolución del rendimiento y calidad del girasol (Helianthus annus L.), aprovechado para forraje tras la floración y desarrollo de calibraciones NIRS para la predicción del valor nutricional de los componentes morfológicos. Pastos 2014;44(2):19-30. 21. Playne MJ, McDonald P. The buffering constituents of herbage and of silage. J Sci Food Agric 1966;17(6):264-268. 22. Weissbach F, Schmidt L, Hein E. Method of anticipation of the run fermentation in silage making, based on the chemical composition of the green fodder. Proc 12th Int Grassld Congress. Moscow. 1974. 23. Dulphy JP, Demarquilly C. Problèmes particuliers aux ensilages In: INRA editor. Prévision de la valeur nutritive des aliments des ruminants. París, Francia. 1981: 81-104.

634

Rev Mex Cienc Pecu 2020;11(3):620-637

24. Flores G, Arráez AG, Castro J, Castro P, Cardelle M, Fernández B, Valladares J. Evaluación de métodos de laboratorio para la predicción de la digestibilidad in vivo de la materia orgánica de ensilajes de hierba y planta entera de maíz. Pastos 2005;(32):599. 25. FEDNA. Fundación Española para el Desarrollo de la Nutrición Animal. Tablas de composición y valor nutritivo de alimentos para la fabricación de piensos compuestos. 3ª ed. Fundación Española para el Desarrollo de la Nutrición Animal. España. 2010. 26. Valdez FR, Harrison JH, Fransen SC. Effect of feeding corn-sunflower silage on milk production, milk composition, and rumen fermentation of lactating dairy cows. J Dairy Sci 1988;71(9):2462-2469. 27. Stern M, Endres M. Laboratory manual. Research techniques in ruminant nutrition. Dep Anim Sci. University of Minnesota. USA. 1991. 28. Sáinz-Ramirez A, Botana A, Valladares J, Pereira S, Veiga M, Resch C, Flores G. Efecto de la variedad y de la fecha de corte sobre el rendimiento y el valor nutricional del girasol cosechado para ensilar en la zona atlántica de Galicia. 56a RC SEEP. Barcelona. 2017. 29. Flores G, Botana A, Pereira S, Valladares J, Pacio B, Aguión A, Resch C. Efecto del momento de corte sobre el rendimiento y valor nutricional de dos tipos de girasol (una variedad forrajera y otra de aceite) cultivados para ensilar a finales de verano en Galicia. Afriga 2016;(121):184-200. 30. Tosi H, Silveira AC, Faría VP, Pereira RL. Avaliação do girassol (Helianthus annuus) como planta para a ensilagem. Rev Soc Bras Zootec 2016;4(1):39-48. 31. Gonçalves LC, Rodriguez NM, Pereira LGR, Rodrigues JAS, Borges I, Borges ALCC, Saliba EOS. Evaluation of different harvest times of four genotypes of sunflower (Helianthus annuus L.) for ensiling. FAO Electronic Conference on Tropical Silage http://www.fao.org/ag/agp/agpc/gp/silage/PDF/7P5.pdf. Accessed Dec 15, 2017. 32. Hill JAG, Fleming JS, Montanhini Neto R, Camargo H, Flemming DF. Valor nutricional do girassol (Helianthus annuus L.) como forrageira. Arch Vet Sci 2003;8(1):41-48. 33. Mello R, Nörnberg JL, Restle J, Neumann M, César-Queiroz A, Barcellos-Costa P, Rodrigues-Magalhães AL, Bitencourt de David D. Características fenológicas, produtivas e qualitativas de híbridos de girassol em diferentes épocas de semeadura para produção de silagem. R Bras Zootec 2006;35(3):672-682.

635

Rev Mex Cienc Pecu 2020;11(3):620-637

34. Romero LA, Mattera J, Redolfi F, Gaggiotti M. Silaje de girasol: efecto del momento de corte sobre la producción y la calidad. Rev Arg Prod Anim 2009;29(1):401-610. 35. Peiretti PG, Meineri G. Evolution of Chemical Composition, Nutritive Value and Fatty Acids Content of Sunflower (Helianthus annuus L.) during the Growth Cycle. J Anim Vet Adv 2010;9(1):112-117. 36. Pitzz JW, Kaiser AG. Principles of Silage preservation. In: Kaiser AG et al. editors. Topfodder Successful Silage. New South Wales, Australia. 2004. 37. Rotz CA, Ford SA, Buckmaster DR. Silages in farming systems. In: Buxton DR, et al editors. Silage Science and Technology, Madison, WI, USA: Agronomy Publication 42, Am Soc Agronom. 2003. 38. Michalet-Doreau B, Demarquilly C. Prévision de la valeur énergétique des ensilages d´herbe. In: INRA editor. Prévision de la valeur nutritive des aliments des Ruminants. publications, París, Francia. 1981. 39. Haigh PM. Effluent production from grass silages treated with additives and made in large-scale bunker silos. Grass Forage Sci 1999;(543):208-218. 40. Harris CF, Raymond WF. The effect of ensiling on crop digestibility. Grass Forage Sci 1963;(18):204-212. 41. Demarquilly C, Dulphy JP, Andrieu JP. Valeurs nutritive et alimentaire des fourrages selon les techniques de conservation: foin, ensilage, enrubannage. Fourrages 1998;(155): 349-369. 42. Rogers GL, Bryant AM, Jury KE, Hutton JB. Silage and dairy cow production, N Z J Agric Res 1979;22(4):511-522. 43. Kung L, Muck RE. Animal Response to silage additives Proce Silage: Field to Feedbunk, North American Conference. 1997. 44. Gordon FJ. An evaluation through lactating cattle of a bacterial inoculant as an additive for grass silage. Grass Forage Sci 1989;(44):169-179. 45. Pflaum J, Gartner L, Demarquilly C, Andrieu JP. Silage additive testing: Comparison of the German DLG and the French INRA schemes BLT, Grub, Poing (Germany). 1996.

636

Rev Mex Cienc Pecu 2020;11(3):620-637

46. Oliviera AS, Weinberg ZG, Ogunade IM, Cervantes AP, Arriola KG, Jiang Y, Kim D, Li M. Meta-analysis of effects of inoculation with homofermentative and facultative heterofermentative lactic acid bacteria on silage fermentation, aerobic stability, and the performance of dairy cows. J Dairy Sci 2017;(100):4587-4603. 47. Kung LJ, Tung RS, Maciorowski KG, Buffum K, Knutsen K, Aimutis WR. Effects of plant cell-wall-degrading enzymes and lactic acid bacteria on silage fermentation and composition. J Dairy Sci 1991;(74):4284-4296. 48. Henderson AR, McDonald P, Woolford MK. Chemical changes and losses during the ensilage of wilted grass treated with formic acid. J Sci Food Agr 1972;(23):1079-1087. 49. Nagel SA, Broderick GA. Effect of formic acid or formaldehyde treatment of alfalfa silage on nutrient utilization by dairy cows. J Dairy Sci 1992;(75):140-154. 50. Wilkinson JM, Toivonen, MI. World silage: a survey of forage conservation around the world. Chalcombe Publications, Lincoln, Reino Unido. 2003.

637

https://doi.org/10.22319/rmcp.v11i3.5149 Article

Supplementation with zilpaterol hydrochloride in lambs finished with a diet formulated without forage fiber

Ricardo Vicente-Pérez a Ulises Macías-Cruz b* Ramón Andrade Mancilla a Rogelio Vicente a Enrique O. García a Ricardo Martínez a Leonel Avendaño-Reyes b Oziel D. Montañez c

Universidad de Guadalajara, Departamento de Producción Agrícola-CUCSUR, Autlán de Navarro. Jalisco, México. b

Universidad Autónoma de Baja California, Instituto de Ciencias Agrícolas, Valle de Mexicali, Baja California, México. c Universidad de Guadalajara, Departamento de Ciencias de la Naturaleza-CUSUR, Ciudad Guzmán. Jalisco, México.

* Corresponding author: ulisesmacias1988@hotmail.com

Abstract: A total of 24 hair male lambs were distributed under a completely randomized block design in two treatments to evaluate the effects of supplementing zilpaterol hydrochloride (ZH. 0 vs. 10 mg/d/animal) in a finishing diet with non-forage fiber source on productive performance, carcass characteristics, primary cut yields and non-carcass component 638

Rev Mex Cienc Pecu 2020;11(3):638-650

weights. A feedlot test was conducted during 30 d, and subsequently half the animals under each treatment (n= 6) were slaughtered. Supplementation with ZH did not affect the weight gain, but it improved (P≤0.02) feed efficiency, carcass weight and yield, and Longissimus dorsi muscle area, as well as leg and whole loin yields. Both KPH and mesenteric fat diminished (P≤0.05) due to ZH. The rest of percentages of non-carcass components remained unaffected by ZH. It can be concluded that dietary supplementation of generic ZH improved the muscle mass deposition by decreasing the internal fat deposition, favoring the feed efficiency of male lambs fattened with diet formulated without forage fiber. Key words: Hair sheep, Fattening of lambs, Adrenergic agonist, Grofactor®.

Received: 14/11/2018 Accepted: 1/07/2019

Introduction The Mexican ovine inventory grew by 20 % in the last decade; this generated a meat production of 62,939 t for 2018 and a considerable reduction in the importations of this product(1). The production of lamb meat has proven, for the last few decades, to be a niche of opportunity in the Mexican market and, in general, across the world, as the demand remains unmet and the kilogram of meat has a competitive price(2). In this sense, the search for strategies to improve the production of lamb meat is today a pressing need. The β2 adrenergic agonist (β2-AA) zilpaterol hydrochloride (ZH) is an effective growth promoter to improve productive performance and carcass characteristics with economic importance when administered 4 to 5 wk before slaughtering to feedlot-finished lambs(3-6), but not to lambs finished at pasture(7). This β2-AA acts as a growth promoter because it redistributes energetic substrate from the fatty tissue and of certain organs toward building muscle mass (hypertrophy)(4,8,9). Notably, the effectiveness of ZH as a growth promoter in fattening lambs has been proven by offering diets formulated with both grains and forage in order to favor the correct functioning of the rumen. However, the diets for fattening lambs are being formulated today with non-forage fibers, given that forage is scarce in certain regions and at certain seasons of the year, and also because it sometimes has a high cost(10). Sawdust and the agro-industrial wastes are two sources of alternate fiber that do not cause digestive problems in lambs when used to substitute 100 % of the forage fraction in the 639

Rev Mex Cienc Pecu 2020;11(3):638-650

fattening diet(11,12). However, the effectiveness of ZH as a growth promoter in lambs fed with non-forage fiber has not been determined. Therefore, the objective of this study was to evaluate the effect of ZH on productive performance, carcass characteristics and primary cut yields in hair breed lambs finished in feedlot, using a mixed diet based on grains without forage fiber.

Material and methods All the procedures involved in the management and slaughter of the animals were carried out according to the Mexican Official Norms of SAGARPA (NOM-051-ZOO-1995: Humanitarian care of animals during mobilization, and NOM-033-ZOO-1995: slaughter of domestic and wild animals). The study consisted of a 30-d feedlot test conducted at the “El Tilzapote” ranch, located in the town of Ayutita, Autlán de Navarro, Jalisco. Subsequently, half the lambs were slaughtered at a commercial slaughterhouse located in Tapalpa, Jalisco.

Animals, housing and pre-experimental management

Twenty-four entire Katahdin male lambs with age of 4 mo and average body weight of 35.8 ± 5.3 kg were used in the feedlot test. Lambs were housed in individual pens and adapted to a basal diet formulated for a daily weight gain of 300 g (Table 1)(13) 15 d before the test. In addition, they were subjected to cutaneous deworming with 1 ml of ivermectine at 1%/25 kg of live weight. The amount of diet used during the experimental period was mixed in one time, and two samples were drawn from the various sacks in order to determine the following chemical compounds: dry matter, crude protein, ether extract, total fiber, acid and neutral detergent fibers, and ash(14,15). The total digestible nutrients and the different types of energy (digestible, metabolizable, net for maintenance and gain) were estimated using formulas(16,17).

640

Rev Mex Cienc Pecu 2020;11(3):638-650

Table 1: Ingredients and chemical composition of the experimental basal diet Ingredients, as offered % Ground corn 57 Pine sawdust 20 Soybean meal 10 Wheat bran 8 Frying oil 2 Mineral pre-mixture 2 Urea 1 Chemical composition in a dry matter basis % Dry matter 94.2 Crude protein 14.4 Ether extract 11.2 Fiber 21.5 Ashes 11.2 Acid detergent fiber (ADF) 20.4 Neutral detergent fiber 30.6 Total digestible nutrients (TDN) 79.3 Energy from the diet in a dry matter basis Mcal/kg Digestible energy (DE) 3.5 Metabolizable energy (ME) 2.9 Net energy for maintenance (NEm) 1.9 Net energy for growth (NEg) 1.3 TDN = 102.56 – (%ADF X 1.140) (Alves et al., 16); DE = TDN x 0,044 (NRC 17); ME = 0.82 x DE (NRC 17); NME = 1.37 x ME – 0.14ME2 + 0.01ME3 – 1.12 (NRC 17); NEg = 1.42 x ME – 0.17ME2 + 0.012ME3 – 1.65 (NCR 17).

Treatments and experimental feeding

On the first day of the test, the lambs were weighed, and pairs of similar weight (blocking factor) were formed in order to assign them randomly within each block to one of the two dietary treatments (n=12): 1) basal diet without ZH (control) and 2) basal diet with 10 mg of generic ZH/d/head (Grofactor®, Virbac México, Guadalajara, México). The daily dose of ZH was estimated based on the amount of commercial product (208 mg) and was placed in a gel capsule to be administered orally to each animal treated with ZH before the morning feeding. In the control group, a gel capsule with 208 mg of soybean meal was administered daily to each sheep as a placebo. The dose of ZH was determined by the recommendations of previous studies(18,19). The ZH was offered during 28 d, followed by a 48 h withdrawal period before slaughter. 641

Rev Mex Cienc Pecu 2020;11(3):638-650

The daily amount of feed per pen was estimated for a rejection of approximately 10 % and was offered once, at 0700 h, immediately after administering the treatment capsules. Water was available ad libitum, and the health status of the animals was examined every day through direct observation.

Productive performance

The productive performance was assessed by registering the live weight at the beginning (d 1) and at the end (d 31), before the morning feeding. The amount of feed refused per pen was also registered. From this data, dry matter intake, total and daily weight gain, and feed efficiency were calculated for the overall period (d 1 to 30).

Carcass characteristics and primary cuts

For the assessment of the carcass traits, only half of the lambs of each treatment group (n= 6) were transported to the slaughterhouse, located 2 h away from the site of the feedlot test. Since the study was carried out in a private ranch, the producer determined that the heaviest lambs should be slaughtered. Accordingly, the lambs of blocks 7 to 12 were slaughtered using the exsanguination method. The individual live weight of the lambs was registered once more before the slaughter line. All bodies were eviscerated in order to register the hot carcass weight (HCW), as well as the weights of the head, blood, skin, heart, lungs, liver, kidneys, spleen, testicles, and feet. The weights of the mesenteric, omental, and kidneypelvis-heart fat (KPH) were also registered. Subsequently, the carcasses remained at 4 ° C during 24 h, and the following variables were registered, according to the methodologies described by Avendaño-Reyes et al(18) and Macías Cruz et al(20): cold carcass weight (CCW), Longissimus dorsi muscle area (LDM), and dorsal fat thickness. Other morphometric measurements of the carcass were the length of the carcass, leg and shoulder, and the circumference of the thorax, neck, leg and shoulder. Finally, the carcass was cut along the middle line, and the weight of the right half carcass was registered and later utilized to obtain the following primary cuts: neck, loin, ribs with flank, breast, leg, and shoulder. The live weight at slaughter was adjusted to 96 % because the content of the gastrointestinal tract was considered to be 4 %. With exception of KPH fat, the weights of all non-carcass components were expressed as a percentage of the adjusted live weight at slaughter. The KPH fat was expressed as a percentage of the HCW. The carcass yield was 642

Rev Mex Cienc Pecu 2020;11(3):638-650

estimated by expressing the HCW as a percentage of the live weight at slaughter. The carcass loss due to cooling was also estimated by expressing the difference between HCW and CCW as a percentage of the HCW. The yield of each primary cut was calculated by expressing the respective weight of each cut as a percentage of the half-carcass weight.

Statistical analysis

The statistical analysis consisted of a variance analysis under a completely randomized block design, using the GLM procedure of the SAS software(21). The means were compared with a Tukey test at α= 0.05. Trends were not considered, given the low number of repetitions for slaughter-related variables.

Results In the productive performance test, only feed efficiency was affected (P<0.01) by supplementation with ZH, having increased by 9.4 % due to the AA-β2 (Table 2). The feed intake tended to diminish (P=0.08) as a result of supplementation with ZH. As for the carcass traits (Table 3), supplementation with ZH increased (P≤0.02) HCW, CCW, carcass yield and LDM area by 7.5, 7.3, 5.7, and 10.2 %, respectively, while decreasing (P=0.05) the percentage of KPH fat. The rest of the of the carcass characteristics were similar (P≥0.17) between treatments. As for the non-carcass component weights expressed as a percentage of the adjusted live weight at slaughter, the mesenteric fat diminished (P<0.01) by 23.2 % due to the inclusion of ZH in the diet (Table 4). The rest of weights of the noncarcass components did not vary (P≥0.08) with ZH supplementation. Finally, ZH increased (P≤0.04) by 5.1 % the loin and leg yield, but reduced (P=0.03) by 8.1 % the yield of rib with flank (Table 5). The rest of primary cuts had similar (P≥0.18) yields between treatments.

643

Rev Mex Cienc Pecu 2020;11(3):638-650

Table 2: Productive performance of male lambs supplemented with generic zilpaterol hydrochloride during the feedlot finishing phase Zilpaterol hydrochloride (mg/head/day) SE P- values Variables 0 10 Live weight, kg Initial 35.7 35.8 0.2 0.83 Intermediate 41.5 41.2 0.3 0.49 Final 46.0 46.4 0.2 0.23 Total weight gain, kg 10.3 10.6 0.2 0.29 Daily weight gain, g/d 343.0 354.3 7.1 0.29 Feed intake, kg/d 1.7 1.5 0.1 0.08 Feed eficiency, g/kg 204.6 223.9 4.4 <0.01 SE= standard error.

Table 3: Characteristics and morphometric measures of the carcass in male lambs supplemented with generic zilpaterol hydrochloride during the feedlot finishing phase Zilpaterol hydrochloride (mg/head/day) SE P- values Variables 0 10 Hot carcass weight, kg 22.7 24.4 0.2 <0.01 Cold carcass weight, kg 21.9 23.5 0.2 <0.01 Carcass yield, % 49.1 51.9 0.4 <0.01 Weight loss by cooling, % 3.3 3.5 0.2 0.52 2 LDM area, cm 17.6 19.4 0.2 0.02 Dorsal fat thickness, cm 0.3 0.2 0.1 0.33 KPH fat, % 4.6 3.3 0.4 0.05 Carcass length, cm 63.2 63.3 0.6 0.92 Thorax circumference, cm 74.5 75.2 0.5 0.36 Neck circumference, cm 40.1 39.8 1.0 0.87 Leg length, cm 52.0 52.3 0.8 0.77 Leg circumference, cm 43.5 45.7 1.0 0.19 Shoulder length, cm 41.7 41.0 0.8 0.59 Shoulder circumference, cm 33.1 34.6 0.7 0.17 SE= standard error; LDM= Longissimus dorsi muscle; KPH fat= The sum of the fats accumulated in the kidneys, the pelvis, and the heart.

644

Rev Mex Cienc Pecu 2020;11(3):638-650

Table 4: Weights of the non-carcass components expressed as a percentage of the adjusted weight at slaughter in hair male lambs supplemented with generic zilpaterol hydrochloride during the feedlot finishing phase (%) Zilpaterol hydrochloride (mg/head/day) SE P- values Variables 0 10 Head 3.27 3.33 0.04 0.38 Blood 4.14 3.93 0.12 0.26 Skin 10.0 9.92 0.41 0.89 Heart 0.48 0.48 0.02 0.57 Lung 1.73 1.74 0.12 0.96 Liver 2.23 1.69 0.17 0.08 Kidney 0.31 0.28 0.02 0.48 Spleen 0.24 0.18 0.02 0.08 Mesenteric 0.99 0.76 0.03 <0.01 Omental 2.45 2.54 0.15 0.72 Testicles 0.89 0.86 0.04 0.74 Feet 2.22 2.29 0.06 0.46 SE= standard error.

Table 5: Primary cut yields in hair male lambs supplemented with generic zilpaterol hydrochloride during the feedlot finishing phase Zilpaterol hydrochloride (mg/head/day) SE P- values Variables* 0 10 Neck, % 9.20 8.70 0.40 0.42 Loin, % 19.20 20.17 0.26 0.04 Rib with flank, % 16.84 15.47 0.33 0.03 Breast, % 5.56 5.07 0.22 0.18 Leg, % 29.12 30.60 0.29 0.01 Shoulder, % 20.08 19.98 0.55 0.90 *All cut weights were expressed as percentages of the half-carcass weight. SE= standard error.

645

Rev Mex Cienc Pecu 2020;11(3):638-650

Discussion Supplementation with ZH was not effective to improve growth, but increased feed efficiency of lambs finished with diets without forage fiber. These results differ partially from those found in previous studies(5,22,23) where greater feed efficiency, weight gain and final weight by supplementing this β2-AA the last 30 d before slaughter. However, there are several studies that point out the absence of the effect of supplementation with ZH in the daily weight gain and final weight of the lambs(7,24,25). The control lambs exhibited lower feed efficiency because the diet had a low amount of effective fiber, as the sawdust was ground. This may have increased the gastrointestinal passage rate and decreased the degradation rate of ruminal microorganisms(26), increasing the feed intake and reducing the feed efficiency. The better feed efficiency observed in ZH-fed lambs was due to the fact that β2-AA improved the digestibility of the diet because it increased the ruminal bacterial population and reduced the motility of the gastrointestinal tract(27). Thus, the lambs treated with ZH tended to reduce their daily feed intake without affecting growth rate. Although the growth of the lambs did not improve with generic ZH supplementation, the muscle deposition increased significantly by including this β2-AA as part of the diet. So, in line with previous studies(23,28,29), ZH increased HCW, CCW, carcass yield and LDM area in our male lambs. These results were attributed to the fact that ZH promoted a redirection of energetic substrates to increase the protein synthesis while reducing the muscle proteolysis(8). Both processes led to a muscular hypertrophy in the lambs treated with ZH. Unexpectedly, results of the present study showed that the origin of the energetic substrate utilized to form muscle in lambs supplemented with ZH was mainly the adipose tissue, and not from organ, viscera, heat, feet or testicles. This finding agrees with other researches on lambs where ZH of the Zilmax® company was utilized(6,18,28), but not in those that used Grofactor® ZH(22,23), like the present study. The Grofactor® ZH(22,23) promotes the deposition of muscle mass in fattening lambs because it uses energetic substrates resulting from a better distribution of dietary energy, as well as those produced by certain organs, viscera or head, but not from fatty tissue. No explanation was found for the way in which the ZH acted in the present study, although there is evidence that this type of ZH removes fatty tissue and promotes muscle deposition(9). Nevertheless, the results suggest that the type of fiber used in the finishing diet of fattening lambs may modify the mechanisms of action of this β2-AA. Research is required at the level of ruminal metabolism and kinetics in order to elucidate how the type of dietary fiber modifies the mechanism of action of the ZH.

646

Rev Mex Cienc Pecu 2020;11(3):638-650

The morphometric measures of the carcass were not affected by generic ZH, even when at least a greater length and circumference of the legs were expected, considering that certain studies have reported that the greatest muscular development promoted by this β2-AA is physically evident in this region of the body(4,20). In hair lambs finished with different dosages of generic ZH(22), a quadratic increase was observed for carcass length, thorax depth and leg perimeter as the ZH dose increased from 0 to 0.20 mg/kg of live weight. An increase in the leg perimeter in both male(24,28) and female(19) lambs was also found, without any effect on other morphometric measurements as a result of supplementation with patent ZH. According to the literature, the results of the effect of patent or generic ZH in primary cut yields are inconsistent. In the present research, generic ZH improved the leg and loin yields, in partial agreement with the findings of other studies in which only the leg yield increased as a result of supplementation with generic ZH in fattening lambs(22,23). Other studies found no changes in the primary cut yields due to supplementation with patent ZH in lambs finished in feedlot(7,28). Results of the present study were attributed to the fact that. both legs and loin have high amount of type II muscle fibers, in which there is a great number of β2-adrenergic receptors(8,18). In this receptors are bonded the β2-AA offered exogenously in the diet to cause its biological effects

Conclusions and implications It was concluded that ZH supplementation in fattening male lambs enhances feed efficiency, carcass weight and yield, LDM area, without affecting the live weight gain, when they are fed diets formulated with non-forage fiber. In addition, supplementation with ZH improves the loin and leg yields. Finally, supplementation with ZH is a recommendable nutritional strategy for increasing the carcass weight gain and the yield of economically important primary cuts in lambs finished with diets formulated without forage fiber.

Acknowledgments The authors wish to thank Ramón Andrade Mancilla, VMD, for the facilities provided at his ranch “El Tilzapote”. They also express their gratitude for financial support provided to the first author by the South Coast University Center of the Universidad de Guadalajara, within the framework of the P3e 2018 project, No. 239754, on pertinent research in agropecuarias agriculture sciences and related to the same for the regional development”. 647

Rev Mex Cienc Pecu 2020;11(3):638-650

Literature cited: 1. SIAP. Estadísticas de la producción de ovinos del Servicio de Información Agroalimentario y Pesquera, SAGARPA. 2018. Disponible en: http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecResumen.jsp. Consultado 1 Mar, 2019. 2. Muñoz-Osorio GA, Aguilar-Caballero AJ, Sarmiento-Franco LA, Wurzinger M, Cámara-Sarmiento R. Technologies and strategies for improve hair lamb fattening systems in a tropical region: A review. Rev Ecosist Rec Agropecu 2016;3(8):267-277. 3. Lopez-Carlos MA, Ramirez RG, Aguilera-Soto JI, Plascencia A, Rodriguez H, Arechiga CF, et al. Effect of two beta adrenergic agonists and feeding duration on feedlot performance and carcass characteristics of finishing lambs. Livest Sci 2011;138(13):251-258. 4. Aguilar López EY, González Ronquillo M, Salem AZM, Partida de la Peña JAP. Use of zilpaterol hydrochloride in sheep feeding. In: Salem AZM, editor. Nutritional strategies of animal feed additives. Nova Science Publishers; 2013:115-117. 5. Macías-Cruz U, Álvarez-Valenzuela FD, Soto-Navarro SA, Águila-Tepato E, AvendañoReyes L. Effect of zilpaterol hydrochloride on feedlot performance, nutrient intake, and digestibility in hair-breed sheep. J Anim Sci 2013;91(4):1844-1849. 6. Ortiz Rodea A, Amezcua Barbosa M, Partida de la Peña JA, González Ronquillo M. Effect of zilpaterol hydrochloride on animal performance and carcass characteristics in sheep: A meta-analysis. J Appl Anim Res 2016;44(1):104-112. 7.

Macías-Cruz U, Avendaño-Reyes L, Vicente-Pérez R, Álvarez-Valenzuela FD, Correa-Calderón A, González-Ríos H, et al. Growth and carcass characteristics of lambs finished with zilpaterol hydrochloride in grazing alfalfa | Crecimiento y características de la canal de corderos finalizados con clorhidrato de zilpaterol en pastoreo de alfalfa. Rev Mex Cien Pecu 2016;7(2):243-252.

8. Mersmann HJ. Overview of the effects of beta-adrenergic receptor agonists on animal growth including mechanisms of action. J Anim Sci 1998;76(1):160-172. 9. Avendaño-Reyes L, Meraz-Murillo FJ, Pérez-Linares C, Figueroa-Saavedra F, Correa A, Álvarez-Valenzuela FD, et al. Evaluation of the efficacy of Grofactor, a betaadrenergic agonist based on zilpaterol hydrochloride, using feedlot finishing bulls. J Anim Sci 2016;94(7):2954-2961.

648

Rev Mex Cienc Pecu 2020;11(3):638-650

10. Iñiguez-Covarrubias G, Díaz-Teres R, Sanjuan-Dueñas R, Anzaldo-Hernández J, Rowell RM. Utilization of by-products from the tequila industry. Part 2: potential value of Agave tequilana Weber azul leaves. Bioresour Technol 2001;77(2):101-108. 11. Guerra-Medina CE, Cobos-Peralta MA, Montañez-Valdez OD, Pérez-Sato M. Uso de aserrín de pino (Pinnus patula) como fuente de fibra en dietas para borregos en cebo. Trop Subtrop Agroecosys 2010;12(3):667-673. 12. Guerra-Medina CE, Montañez-Valdez OD, Ley-de Coss A, Reyes-Gutiérrez JA, Gómez-Peña JE, Martínez-Tinajero JJ, et al. Fuentes alternas de fibra en dietas integrales para ovinos en engorda intensiva. Quehacer Cient Chiapas 2015;10(1):3-8. 13. NRC. Nutrient requirements of small ruminants: Sheep, goats, cervids, and new world camelids; 2007. 14. AOAC. Official Methods of Analysis . 15th ed. Association of Official Analytical Chemists. Arlington, VA, USA. 1990. 15. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):223-232. 16. Alves AR, Beelen PMG, de Medeiros AN, Neto SG, Beelen RN. Consumo e digestibilidade do feno de sabiá por caprinos e ovinos suplementados com polietilenoglicol. Rev Caatinga 2011;24(2):152-157. 17. NRC. Nutrient requirements of sheep. 6th ed. Washington, DC, USA: National Academy Press; 1985. 18. Avendaño-Reyes L, Macías-Cruz U, Álvarez-Valenzuela FD, Águila-Tepato E, Torrentera-Olivera NG, Soto-Navarro SA. Effects of zilpaterol hydrochloride on growth performance, carcass characteristics, and wholesale cut yield of hair-breed ewe lambs consuming feedlot diets under moderate environmental conditions. J Anim Sci 2011;89(12):4188-4194. 19. Dávila-Ramírez JL, Macías-Cruz U, Torrentera-Olivera NG, González-Ríos H, PeñaRamos EA, Soto-Navarro SA, et al. Feedlot performance and carcass traits of hairbreed ewe lambs in response to zilpaterol hydrochloride and soybean oil supplementation. J Anim Sci 2015;93(6):3189-3196. 20. Macías-Cruz U, Álvarez-Valenzuela FD, Torrentera-Olivera NG, Velázquez-Morales JV, Correa-Calderón, Robinson PH, et al. Effect of zilpaterol hydrochloride on feedlot performance and carcass characteristics of ewe lambs during heat-stress conditions. Anim Prod Sci 2010;50(10):983. 649

Rev Mex Cienc Pecu 2020;11(3):638-650

21. SAS institute. SAS/STAT: User’s Guide Statistics Released. 2004. 22. Avendaño-Reyes L, Torrentera-Olivera NG, Correa-Calderón A, López-Rincón G, Soto-Navarro SA, Rojo-Rubio R, et al. Daily optimal level of a generic beta-agonist based on zilpaterol hydrochloride for feedlot hair lambs. Small Ruminant Res 2018;165:48-53. 23. Rivera-Villegas A, Estrada-Angulo A, Castro-Pérez BI, Urías-Estrada JD, Ríos-Rincón FG, Rodríguez-Cordero D, et al. Comparative evaluation of supplemental zilpaterol hydrochloride sources on growth performance, dietary energetics and carcass characteristics of finishing lambs. Asian-Australas J Anim Sci 2018;00(00):1-8. 24. Dávila-Ramírez JL, Macías-Cruz U, Torrentera-Olivera NG, González-Ríos H, SotoNavarro SA, Rojo-Rubio R, et al. Effects of zilpaterol hydrochloride and soybean oil supplementation on feedlot performance and carcass characteristics of hair-breed ram lambs under heat stress conditions. J Anim Sci 2014;92(3):1184-1192. 25. Estrada-Angulo A, Barreras-Serrano A, Contreras G, Obregon JF, Robles-Estrada JC, Plascencia A, et al. Influence of level of zilpaterol chlorhydrate supplementation on growth performance and carcass characteristics of feedlot lambs. Small Ruminant Res 2008;80(1-3):107-110. 25. Salinas-Chavira J, Arzola C, García-Castillo RF, Briseño DA. Approaches to the level and quality of forage in feedlot diets for lambs. J Dairy Vet Anim Res 2017;5(3):9697. 27. McIntyre AS, Thompson DG. Review article: Adrenergic control of motor and secretory function in the gastrointestinal tract. Aliment Pharmacol Ther 1992:6:125142. 28. Rojo-Rubio R, Avendaño-Reyes L, Albarrán B, Vázquez JF, Soto-Navarro SA, Guerra JE, et al. Zilpaterol hydrochloride improves growth performance and carcass traits without affecting wholesale cut yields of hair sheep finished in feedlot. J Appl Anim Res 2018;46(1):375-379. 29. López-Carlos MA, Ramírez RG, Aguilera-Soto JI, Aréchiga CF, Méndez-Llorente F, Rodríguez H, et al. Effect of ractopamine hydrochloride and zilpaterol hydrochloride on growth, diet digestibility, intake and carcass characteristics of feedlot lambs. Livest Sci 2010;131(1):23-30.

650

https://doi.org/10.22319/rmcp.v11i3.5214 Article

Changes in myoglobin content in pork Longissimus thoracis muscle during freezing storage

Jonathan Coria-Hernández a* Rosalía Meléndez-Pérez a Abraham Méndez-Albores a José Luis Arjona-Román a

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán. Unidad de Investigación Multidisciplinaria. Carretera Cuautitlán-Teoloyucan km 2.5, 54740, Cuautitlán Izcalli, Estado de México, México.

*Corresponding author: jonathancoria@outlook.com

Abstract: In this study, pork Longissimus thoracis muscle was used, which was frozen in a chamber and thawed under controlled conditions. The color profile and the surface myoglobin were evaluated. A thermal analysis was performed by modulated differential scanning calorimetry (MDSC), and Fourier-transform infrared spectroscopy with attenuated total reflection (FTIRATR). It was found that there were important effects in myoglobin due to the freeze-thawing process in parameters such as pH, luminosity (L*), and chroma values, as well as in activation energies (Ea) and denaturation enthalpy (ΔH) between myoglobin forms. In raw meat, it was found that there was a greater proportion of deoxymyoglobin, and in frozen-thawed samples, metmyoglobin was the most abundant form, indicating that are significant effects which are correlated with the changes in tri-stimulus coordinates and with the thermal and chemical parameters in pork meat. Key words: Myoglobin, Freezing-Thawing, Pork Meat, MDSC, Color profile, FTIR spectroscopy.

651

Rev Mex Cienc Pecu 2020;11(3):651-668

Received: 10/01/2019 Accepted: 24/07/2019

Introduction Meat is a product that is highly susceptible to degradation due to its chemical composition, caused by factors such as storage temperature (chilling and freezing), modified atmospheres, microorganisms, among others. Pork is usually consumed as a main dish or in various byproducts such as sausages, ripened and cooked. However, there is a need to extend its shelf life by applying conservation techniques that do not alter its properties, mainly the sensory one which is the most important for consumers(1-3). With the increase in meat consumption in Mexico and its commercialization in places such as Asia, Europe, and South America, freezing storage in a chamber unit has been the most used method, because, among other factors, it is economical, control microbiological growth, and avoids enzymatic reactions and chemical deterioration. The method and the freezing rate are determinant for ice crystal formation (size and geometry); however, poor management of the process can cause damage to the meat fibers or develop important biochemical reactions such as proteolysis and lipid oxidation. The latter can irreversibly affects the physicochemical and functional properties of certain proteins such as: myofibrillar, sarcoplasmic, and connective(4-6). Myoglobin is the main protein responsible for the color in meat; it belongs to the group of sarcoplasmic proteins, which are soluble in water. Myoglobin consists of a single polypeptide chain (8 alpha helix) called globin, and a prosthetic heme group, with an iron atom at its center. Its molecular weight ranges between 14 to 18 kDa. Meat color is mainly influenced by the pigment content, and by the chemical form and structure of myoglobin. One of the factors which determine meat color is the iron oxidation status and the compounds (oxygen, water, or nitric oxide) bound to the molecule. The thermostability of this protein also depends on the chemical state, being the deoxymyoglobin (DMb) the more stable form to heat denaturation, followed by oxymyoglobin (OMb), and metmyoglobin (MMb). Therefore, the thermodynamics of the transformation reactions between DMb, OMb, and MMb are quite similar, with the exception of OMb to MMb transformation(7). This work aims to evaluate the changes that occur in the myoglobin oxidation state in pork muscle during freezing storage, and its effects on the various oxidative aspects that could affect the sensorial and quality characteristics of the system, such as the color profile and the thermal stability of the different chemical forms of myoglobin.

652

Rev Mex Cienc Pecu 2020;11(3):651-668

Material and methods Sample preparation

Longissimus thoracis muscle was obtained from Pietrain male castrated pigs (6 mo of age), weighing approximately 110 ± 2 kg. The pigs were housed in a pen (4.9 × 2.0 m) with a concrete floor and a 0.5-m-wide slatted dunging area. Fed and water were offered ad libitum. The feeds used were manufactured by Nutricion Tecnica Animal S.A. de C.V. (Cuautitlan Izcalli, State of Mexico, Mexico). No antibiotics and other growth-promoting agents were added to the diets. Five pieces of muscle were obtained from the 9th to 13th rib section from which cuttings of 1 cm3 were refrigerated for 24 h after rigor mortis. Subsequently, samples were vacuum sealed using flexible low-density polyethylene films and frozen in a chamber (REVCO Ultima II, New Castle DE, USA) at -18 ± 2 °C for 24 h and then thawed at 4 ± 2 °C for 5 h in a typical chamber (Nieto, Mexico) with 70 % relative humidity. All experiments were carried out at UNAM-FES Cuautitlan, Multidisciplinary Research Unit L13 (Thermal and Structural Analysis of Materials and Foods). Myoglobin was extracted following the methodology proposed by Warris (8). Briefly, 5 g of meat was homogenized for 1 min in 40 mM potassium phosphate solution (pH=6.8) at 2 °C; afterwards, homogenizates were centrifuged at 50,000g for 30 min at 5 °C in a K3 centrifuge (Centurion Scientific, UK) and the supernatant filtered through Whatman #1 filter paper.

Chemical analysis

The chemical analysis was conducted according to the methods proposed by the Association of Official Analytical Chemists(9): moisture content (986.21), total ash (990.08), lipid (960.39), and protein (977.14). The pH was determined using the methodology described by Koniecko(10), using a pH meter (HI99163, Hanna Instruments, RI, USA). In all cases, five repetitions were performed.

653

Rev Mex Cienc Pecu 2020;11(3):651-668

Color profile

The methodology described by the American Meat Science Association(4) was employed using a CM600d reflectance spectrophotometer (Konica Minolta, Tokyo, Japan). The measurements conditions were: type A coupled illuminant (incandescent with tungsten filament at 2856 K), aperture size of 8 mm and an observation angle of 10Â°. The tri-stimulus values (L*, a*, and b*) were obtained according to the CieLab system using the software Spectra Magic NXâ&#x201E;˘. The reflectance and absorbance phenomena were evaluated in the wavelength range from 400 to 700 nm. From the data, hue angle (Â°hue), chroma (C*), and the total color difference (Î&#x201D;E*) were calculated(11-14).

Surface myoglobin fraction

The quantification of the myoglobin fraction was made on the surface of the meat (perpendicular to the fibers), according to the recommendations of Tang et al(15). The following equations were used: (eq. 1) đ??ˇđ?&#x2018;&#x2019;đ?&#x2018;&#x153;đ?&#x2018;Ľđ?&#x2018;Śđ?&#x2018;&#x161;đ?&#x2018;Śđ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A; = â&#x2C6;&#x2019;0.543đ?&#x2018;&#x2026;1 + 1.594đ?&#x2018;&#x2026;2 + 0.552đ?&#x2018;&#x2026;3 â&#x2C6;&#x2019; 1.329 đ?&#x2018;&#x201A;đ?&#x2018;Ľđ?&#x2018;Śđ?&#x2018;&#x161;đ?&#x2018;Śđ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A; = 0.722đ?&#x2018;&#x2026;1 â&#x2C6;&#x2019; 1.432đ?&#x2018;&#x2026;2 â&#x2C6;&#x2019; 1.659đ?&#x2018;&#x2026;3 + 2.599

(eq. 2)

đ?&#x2018;&#x20AC;đ?&#x2018;&#x2019;đ?&#x2018;Ąđ?&#x2018;&#x161;đ?&#x2018;Śđ?&#x2018;&#x153;đ?&#x2018;&#x201D;đ?&#x2018;&#x2122;đ?&#x2018;&#x153;đ?&#x2018;?đ?&#x2018;&#x2013;đ?&#x2018;&#x203A; = â&#x2C6;&#x2019;0.159đ?&#x2018;&#x2026;1 â&#x2C6;&#x2019; 0.085đ?&#x2018;&#x2026;2 + 1.262đ?&#x2018;&#x2026;3 â&#x2C6;&#x2019; 0.520 đ??´582 đ?&#x2018;&#x2026;1 = đ??´525 đ??´557 đ?&#x2018;&#x2026;2 = đ??´525 đ??´503 đ?&#x2018;&#x2026;3 = đ??´525

(eq. 3) (eq. 4) (eq. 5) (eq. 6)

Thermal analysis

Samples were analyzed using a differential scanning calorimeter with temperature modulation (DSC 2920, TA Instruments, New Castle DE, USA). Cooling was carried out using a refrigerated cooling system. The temperature and heat capacity calibrations were performed using TA Instruments software with indium (melting point value of 156.6 Â°C) and sapphire (aluminum oxide), respectively. The TA Instruments universal analysis software (2000V 4.5A) was used to register and analyze all thermograms. Samples (12 Âą 0.53 mg) 654

Rev Mex Cienc Pecu 2020;11(3):651-668

were packed down in hermetic aluminum pans and were analyzed in triplicate by heating in the modulated DSC furnace at a rate of 5 Â°C/min with temperature modulation of 0.8 Â°C every 60 sec Nitrogen was used as purge gas at a constant flow rate of 60 mL/min. Thermal decomposition data were collected over the temperature range of 20 to 90 Â°C(6,16-18).

Activation energies (Ea)

The Ea required for protein denaturation was obtained using the methodology described by Coria et al(11), Calzetta and Suarez(19) and Cornillion(20). The reaction order (n), the Arrhenius constant (Z), the degree of conversion (Îą), and the conversion rate (dÎą/dt) were also determined using the following expressions: dÎą đ??¸đ?&#x2018;&#x17D; (eq. 7) ln ( ) = ln Z â&#x2C6;&#x2019; n ln(1 â&#x2C6;&#x2019; Îą) â&#x2C6;&#x2019; dt RT â&#x2C6;&#x2020;Hg (eq. 8) Îą= â&#x2C6;&#x2020;Ht Where Î&#x201D;Hg is the enthalpy for each temperature in the transition zone (J g-1), and Î&#x201D;Ht is the total enthalpy (J g-1). To obtain the value of the unknown factors (Z, n and Ea), a multiple linear regression (MLR) analysis of eq .7 was performed.

FTIR-ATR Spectroscopy

The functional groups in the meat were further characterized using a Frontier SP8000 spectrophotometer (Perkin Elmer, Waltham, MA, USA) following the recommendations of Coria et al(21). Briefly, samples were placed on top of the attenuated total reflection (ATR) crystal, and spectra were collected in the range of 400â&#x20AC;&#x201C;4000 cm-1 at a resolution of 4 cm-1 by co-adding 32 scans. A background spectrum was obtained against air every day during the experiment.

Statistical analysis

The experiment was conducted as a completely randomized design (the experimental unit consisted of 25 cubes of 1 cm3 randomly taken from five Longissimus thoracis muscles). Experimental data were subjected to 1 and 2-way analysis of variance (ANOVA), and the 655

Rev Mex Cienc Pecu 2020;11(3):651-668

means were separated using the Tukey test. A probability P<0.05 was used to distinguish significant differences employing the Minitab 16.0.1 software (Penn State University, Pennsylvania, USA). In multiple linear regression analysis, the Origin Pro 8 software (OriginLab Corp., Northampton, MA, USA) was utilized.

Results and discussion Chemical analysis

The chemical composition of raw and thawed meat is shown in Table 1. Results are in close agreement to those reported by Meléndez et al(6) and Karamucki et al(22). There were significant differences in moisture content (P<0.05) between treatments. Due to the freezing process, large crystals were formed causing rupture in the meat fibers; consequently, in these samples some water was lost by exudation. Moreover, the loss of water in thawed samples had also an important effect in the decrease of ashes, but not in the protein and lipid contents, as previously reported by Karamucki et al(22). Table 1: Chemical composition for the raw and thawed meat Thawed Component Raw 74.86±0.46b Moisture 75.30±1.19a 22.64±1.12a Proteins 21.83±2.54a 1.96±0.20a Lipids 1.87±0.09a 0.54±0.11b Ash 1.0±0.03a ab

Mean ± standard deviation Means with a different letter in the same row are statistically different (P<0.05).

There were significant differences (P<0.05) in the pH value in the frozen-thawed meat in comparison to raw meat, presenting values of 5.69 ± 0.08 and 5.63 ± 0.17, respectively. Therefore, it was confirmed that this conservation process produces important changes; among them, the modifications in the redox dynamics in the myoglobin due to a decrease in the formation of lactic acid from muscle glycogen by anaerobic glycogenolysis(23). The latter, generates several inter-conversions that structurally alter the meat and, therefore, significant changes occurred in color appreciation, which lead to quality defects that results in the 656

Rev Mex Cienc Pecu 2020;11(3):651-668

formation of PSE (pale, soft, and exudative) or DFD (dark, firm, and dry) meat(24). According to Krzywicki(25), reductions in pH values are usually accompanied by a diminution in light penetration depth and an increment in reflectance, which leads to an increase in luminosity (L*) and a decrement in the amount of the reduced form of myoglobin (DMb). At the same time, lower pH values are also associated with a greater susceptibility of the muscular pigments to oxygenation and oxidation and, consequently, the formation of greater amounts of OMb and MMb.

Color profile

The mean values of the color profile parameters are shown in Table 2. For raw meat, the values of L*, a* and b* are similar to those reported in other studies(26-30). In general, the freeze-thaw process generates significant changes in the luminosity (L*) coordinate. Intraand extracellular ice crystals have a molecular angle of 109.45° between hydrogen atoms(31,32); this angle was different from that of liquid water (104.50°), generating ruptures in the meat fibers and some bonds, allowing exudates to exit. Moreover, the L* value depends on the total amount of light absorbed and reflected by the meat surface. Therefore, the impact of absorption and reflection on the appreciation of color luminosity varies depending on the pigment content in the tissue and its structure. It is well known that the relative content of the chemical form of the myoglobin on the meat surface also influences the L* coordinate(22). The a* coordinate is usually correlated to a reddish coloration. In this research, the a* average value was slightly higher in the case of the thawed meat, which is attributed to the fact that the surface myoglobin underwent modifications when redox reactions were carried out by time effects in the freeze-thaw processes. The same phenomenon was observed in the b* coordinate. According to Lesiów and Xiong(27) and Skrlep and Candek-Potokar(30), the hue angle for pink and red meat should be in the range between 0 and 90°. In this research, the freeze-thaw process significantly affects the meat tone. Chroma values (C*) are consistent with those reported by other researchers(23, 30). Such differences in Chroma were statistically significant, indicating that changes in color saturation were not perceptible. The total color difference (ΔE*) between raw and frozen-thawed meat have an average value of 3.63 ± 0.68, indicating that the crystallization-melting process generates changes in the set of the threecolor profile coordinates. However, according to the AMSA(4) and Chmiel et al(33), up to 5 units in the total color difference were not perceptible to the human eye.

657

Rev Mex Cienc Pecu 2020;11(3):651-668

Table 2: Color profile parameters in the CieLab system of raw and thawed meat Sample L* a* b* Hue angle C* Raw 51.30±0.48a 4.98±1.14a 5.23±1.03a 46.38±3.51a 7.22±1.48a Thawed 50.91±1.75b 5.39±0.90b 7.91±0.94b 55.76±5.20b 9.57±0.98b ab

Mean ± standard deviation. Means with a different letter in the same column are different (P<0.05).

Figure 1-a shows the reflectance spectra of the raw and thawed meat, the characteristic band between 500 and 600 nm corresponds to myoglobin in its non-oxidized state(4). It is also important to note that the differences among samples were significant (P<0.05). The thawed samples presented a certain quantity of exuded liquids, causing slightly lower reflectance values. Light plays an important role in color appreciation, since the phenomenon of paleness in PSE meat can be explained by the contraction of myofibrils due to low pH values, which increases the difference of refractive index and the reflectance at the meat surface (34), opposite to the frozen-thawed meat. There are several theories that state that paleness is mainly originated from cold denaturation and precipitation of both myofibrillar and sarcoplasmic proteins(6). In addition, myoglobin in PSE pork meat is very susceptible to cold denaturation, causing a small change in the helical structure, which contributes to a modification in its optical properties. Figure 1: Spectral curves of raw and thawed meat (a) reflectance, (b) absorbance 27

1.4

(a)

(b) 1.3

1.2

Absorbance

Reflectance (%)

1.1

18 15 12

1.0 0.9 0.8 0.7

0.6

6 Raw Thawed

Raw Thawed

0.5

3 400

450

500

550

600

650

700

400

450

500

550

600

650

700

Wavelength (nm)

Surface myoglobin fraction

The absorbance spectra are also shown in Figure 1b. In general, samples with structural damage caused by the freeze-thaw processes presented strong absorption bands. This phenomenon was possible due to fiber ruptures by water crystallization. The above 658

Rev Mex Cienc Pecu 2020;11(3):651-668

mentioned effect generates surface differences, reflected in changes in color profile parameters and visual appreciation(4). Commonly, the absorbance for myoglobin in their different forms is found at 503, 525, 557 and 582 nm. According to the values presented in Table 3, in the raw meat, the greater amount of myoglobin was found under the form of DMb, without perceptible alterations in its structure. The cooling process of the meat after slaughter had significant effects that modify the sarcoplasmic protein structure. In frozen-thawed samples, myoglobin was reduced into the MMb form in a higher extent. Heat treatment and the contact with the atmosphere increased the pH value causing differences between samples(34). According to Cho and Choy(35), the conformational stability of the myoglobin molecule is strongly affected by the attachment of the heme group to the polypeptide chain. Authors suggested that the structure of the iron atom is the main factor affecting the stability of this particular protein. Table 3: Fraction of myoglobin molecules in pork meat Deoxymyoglobin Oxymyoglobin Metmyoglobin ab

Raw

Thawed

0.3884±0.0023a 0.2282±0.0021a 0.3843±0.0019a

0.3429±0.0006b 0.2769±0.0018b 0.3760±0.0012b

Mean ± standard deviation Means with a different letter in the same row are different (P<0.05).

In the pH range of meat after slaughter, changes in the myofibrillar refractive index occurred; consequently, there were increments and decrements in reflectance. As the pH decreases, the absorbance changed inversely proportional to the reflectance. The strong intrinsic birefringence of myofibrils does not necessarily contribute to the reflectance and absorbance, but this phenomenon depends directly on the amount of water on the surface and the chemical status of the myoglobin molecule(34,35).

Thermal analysis by MDSC

It has been reported that myoglobin has a denaturation temperature between 60 and 70 °C(3538) . Figure 2 shows the thermogram of the heat flow and the specific heat (Cp) for the myoglobin extract. The transition observed was at an initial temperature (To) of 63.51 °C, the denaturation temperature (Tp) was 68.58 °C with an enthalpy (ΔH) value of 1.334 J g-1. There were notorious changes in Cp values, indicating that the process significantly modified the protein structure.

659

Rev Mex Cienc Pecu 2020;11(3):651-668

Figure 2: Heat flow and specific heat (Cp) of the myoglobin extract 3.25 -0.35 3.20

3.15

3.10 -0.45

-1

Cp (J g ·°C )

3.05

-1

Heat Flow (W/g)

-0.40

-0.50 3.00 Heat Flow Cp

-0.55

2.95 90

Temperature (°C)

In the case of raw and frozen-thawed meat, the heat flow thermogram (Figure 3-a) shows the principal transitions of proteins. Significant differences between heat-flow values were observed. These endotherms are without exception associated with the phenomena of protein (myosin, actin, and myoglobin) denaturation(6,17,39,40). Figure 3: (a) Heat flow, (b) Derived heat flow as a function of the temperature of raw and thawed meat -0.27

(b)

(a) 0.001

-1

Deriv. Heat Flow (W g °C )

-0.28

Myosin

-1

Heat Flow (W/g)

-0.29

Myoglobin Actin

-0.30

-0.31

-0.32

0.000

-0.001

-0.002

Raw Thawed

-0.33

-0.003 40

Temperature (°C)

In the heat flow derivative graphic (Figure 3-b), no significant changes occurred, thus, merely denaturation effects of myosin, actin, and sarcoplasmic proteins were observed. The values of To, Tp, and ΔH of each transition are summarized in Table 4. In general, the To value of he thawed meat was lower than the raw one. The ΔH value for protein denaturation was significantly different (P0.05) between the raw and frozen-thawed meat samples. In the case of myoglobin, it was apparently unaffected in its native structure by the freeze-thaw process, 660

Rev Mex Cienc Pecu 2020;11(3):651-668

but the small differences in both transition temperatures and denaturation enthalpies could be possibly due to the chemical transformation occurring in DMb in raw to MMb in the frozen-thawed meat. Table 4: Temperatures (initial and maximum) and enthalpies of raw and thawed meat To (°C) Tp (°C) ΔH (J g-1) To (°C) Tp (°C) ΔH (J g-1) To (°C) Tp (°C) ΔH (J g-1)

Myosin

Myoglobin

Actin

Raw

Thawed

50.09±2.53a 55.07±1.98a 0.16±0.05a 59.75±1.34a 65.34±3.43a 0.25±0.04a 73.32±1.12a 77.88±1.28a 0.22±0.07a

48.12±1.88b 53.38±2.01b 0.26±0.03b 59.36±1.55b 64.49±2.26b 0.24±0.06b 72.01±1.01ab 76.59±1.46ab 0.36±0.09b

Mean ± standard deviation. Means with a different letter in the same row are different (P<0.05).

In the case of the frozen-thawed meat, the MMb was found in its highest proportion (Table 3). Therefore, there was a reversible dissociation in both the heme and apoprotein groups, which is more feasible in this chemical form of myoglobin. Thus, the Tp of the myoglobin in thawed meat shifts to a lower temperature and the ΔH decreases, although the myoglobin was predominantly in the non-oxidized state (DMb). These results suggest that water molecules —before and after freezing— contribute to the conformational stability of the myoglobin molecule(1). In this context, Chaijan et al(1), Ledward(37) and Atanasov and Mitova(41) reported that the Tp value of the myoglobin is shifted to a lower temperature when MMb formation increases during meat refrigeration. Authors conclude that DMb was the most heat stable form, followed by OMb and MMb, respectively. Results are in accordance with those reported in this research. In the MDSC studies, structural changes in proteins can be obtained from the heat flow by means of the Cp value, which is calculated from the ratio of the modulated amplitude of the heat flow and the modulated amplitude of the discrete Fourier transform(42). Thermograms for raw and thawed meat are shown in Figure 4. It can be noticed that similar changes in the protein structure occurred; however, these variations were only in magnitude.

661

Rev Mex Cienc Pecu 2020;11(3):651-668

Figure 4: Specific heat (Cp) of raw and thawed meat 2.7

-1

Cp (J g °C )

2.4

2.1

Raw Thawed

1.8 40

Temperature (°C)

Activation energies (Ea)

The activation energies required for protein denaturation were obtained by MLR analysis. The values for the myoglobin extract, raw meat, and thawed samples were 393.24 ± 2.14, 305.71 ± 3.74, and 327.89 ± 3.05 kJ mol-1, respectively. In general, the Ea showed significant variations attributable to several factors, including the concentration of the denatured and non-denatured proteins, as well as the structural modification of the proteins when subjected to the freezing process. In these conditions, conformational changes occurred, leading to a variation in the activation energy, which also influences the amount of soluble proteins, such as myoglobin. Moreover, variations in the Ea values could be also attributable to oxygenation reactions of myoglobin by air, as well as to the structural changes occurred from DMb to MMb. The structure of a protein is modified by the effects of redox reactions; generally, the MMb requires more energy and less temperature to initiate the denaturation process (Figures 3a and 4). Although the MMb is less thermostable; thus, more energy is required to cause conformational modifications.

662

Rev Mex Cienc Pecu 2020;11(3):651-668

FTIR-ATR Spectroscopy

Figure 5 shows the FTIR-ATR spectra, which were collected in the range of 4000-400 cm-1. The characteristic band at around 3280 cm-1 is associated with the stretching vibrations of water molecules (OH-), and the NH vibration in secondary amides. Information about the biochemical changes occurring during the freeze-thaw process is provided in the range of 1750-1000 cm-1(43). The band at 1640 cm-1 indicates the presence of primary amides in the molecular structure of the Îą-helix in DMb. The band at 1,550 cm-1 was assigned to vibrations in secondary amides (stretching between CN) of the myoglobin molecule. This single band seems stronger in the case of thawed meat than the one observed in the raw meat, indicating a higher quantity of amide groups. Moreover, there was a stretching vibration mode of C-N amides at 1,398 cm-1. At 1,311 and 1,246 cm-1 there were C-N stretching in amines, mainly from myoglobin and myofibrillar proteins, and at 1,165 and 1,128 cm-1 there were vibrations of amines, amino acids, and the C-N stretching. These bands were more intense after the freeze-thawing processes because the existence of water molecules. Finally, there were important changes between the 1292-1371 cm-1 region, belonging to amines and tertiary amides of soluble proteins(44,45). Figure 5: FTIR-ATR spectra of (a) raw meat, (b) thawed meat

663

Rev Mex Cienc Pecu 2020;11(3):651-668

Conclusions and implications Freeze-thaw processes had significant effects on myoglobin form, producing important changes in thermodynamics, activation energies, and in the functional groups, all of them associated with changes in meat color.

Acknowledgements The authors are grateful to UNAM for the financial support for this research through the PAPIIT Grant IT201417 as well as PIAPI Grant 1806 and 1820. Jonathan Coria-Hernández also acknowledges CONACYT for the PhD scholarship (447128).

Literature cited: 1. Chaijan M, Benjakul S, Visessanguan W, Faustman C. Characterization of myoglobin from sardine (Sardinella gibbosa) dark muscle. Food Chem 2007;100:156-164. 2. Kerth CR. The science of meat quality. USA: Wiley – Blackwell Ed.; 2013. 3. Zhou GH, Xu XL, Liu Y. Preservation technologies for fresh meat – A review. Meat Sci 2010;86:119-128. 4. AMSA. Meat color measurement guidelines. USA: American Meat Science Association. 2012. 5. Berk Z. Food process engineering and technology. 2nd ed. United Kingdom: Elsevier; 2013. 6. Meléndez PR, Arjona RJL, Velázquez CRR, Méndez AA, Vázquez DA. On the thermal properties of frozen, refrozen and freeze drying porcine Longissimus dorsi. J Anim Vet Adv 2011;10(22):2956-2960. 7. Mancini RA, Hunt MC. Current research in meat color. Meat Sci 2005;71:100-121.

664

Rev Mex Cienc Pecu 2020;11(3):651-668

8. Warris PD. The extraction of ham pigments from fresh meat. J Food Technol 1979;14:7580. 9. AOAC. Official methods of analysis 17th. ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2000. 10. Koniecko ES. Handbook for Meat Chemists. USA: Avery Publishing Group Inc. Wayne; 1979. 11. Coria HJ, Meléndez PR, Rosas MME, Llorente BA, Arjona RJL. Analysis of the color profile and shear force in ultrasonicated pork meat (Longissimus thoracis). Arctic J 2017;70(7):16-30. 12. Porras BLD, González HMI, Ochoa GOA, Sotelo DLI, Camelo MGA, Quintanilla CMX. Colorimetric image analysis as a factor in assessing the quality of pork ham slices during storage. Rev Mex Ing Quím 2015;14(2):243-252. 13. Tapp WN, Yancey JWS, Apple JK. How is the instrumental color of meat measured? Meat Sci 2011;89:1-5. 14. Yancey JWS, Kropf DH. Instrumental reflectance values of fresh pork are dependent on aperture size. Meat Sci 2008;79:734-739. 15. Tang J, Faustman C, Hoagland TA. Krzywicki revisited: Equations for spectrophotometric determination of myoglobin redox forms in aqueous meat extracts. J Food Sci 2004;69(9):717-720. 16. Agama AE, Bello PLA, Pacheco VG, Evangelista LS. Inner structure of plantain starch granules by surface chemical gelatinization: Morphological, physicochemical and molecular properties. Rev Mex Ing Quím 2015;14(1):73-80. 17. Coria HJ, Meléndez PR, Rosas MME, Llorente BA, Arjona RJL. Activation energy for protein denaturation in frozen and freeze-dried pork meat (Longissimus thoracis) by MDSC. Interciencia J 2017;47(7):22-32. 18. Zamudio FPB, Tirado GJM, Monter MJG, Aparicio SA, Torruco U, Salgado DR, Bello PLA. In vitro digestibility and thermal, morphological and functional properties of flours and oat starches of different varieties. Rev Mex Ing Quím 2015;14(1):81-97.

665

Rev Mex Cienc Pecu 2020;11(3):651-668

19. Calzetta AR, Suarez C. Gelatinization kinetics of amaranth starch. Int J Food Sci Technol 2001;36:441-448. 20. Cornillon P. Characterization of osmotic dehydrated Apple by NMR and DSC. LWT Food Sci Technol 2000;33:261-267. 21. Coria HJ, Méndez AA, Meléndez PR, Rosas MME, Arjona RJL. Thermal, structural, and rheological characterization of waxy starch as a cryogel for its application in food processing. Polymers 2018;10(359):1-13. 22. Karamucki T, Jakubowska M, Rybarczyk A, Gardzielewska J. The influence of myoglobin on the colour of minced pork loin. Meat Sci 2013;94:234-238. 23. Brewer MS, Zhu LG, Bidner B, Meisinger DJ, McKeith FK. Measuring pork color: effects of bloom time, muscle, pH and relationship to instrumental parameters. Meat Sci 2001;57:169-176. 24. Honikel KO. pH measurement. Encyclopedia of Meat Sciences, Vol. 1. United Kingdom: Elsevier; 2014. 25. Krzywicki K. Assement of relative content of myoglobin, oxymyoglobin and metmyoglobin at the surface of beef. Meat Sci 1979;3:1-10. 26. Irie M, Swatland HJ. Relationships between Japanese pork color standards and optical properties of pork before and after frozen storage. Food Res Int 1992;25:21-30. 27. Lesiów T, Xiong YL. A simple, reliable and reproductive method to obtain experimental pale, soft and exudative (PSE) pork. Meat Sci 2013;93:489-494. 28. Lindahl G, Karlsson AH, Lundström K, Andersen HJ. Significance of storage time on degree of blooming and colour stability of pork loin from different crossbreeds. Meat Sci 2006;72:603-612. 29. Lindahl G, Lundström K, Tornberg E. Contribution of pigment content, myoglobin forms and internal reflectance to the colour of pork loin and ham from pure breed pigs. Meat Sci 2001;59:141-151. 30. Skrlep M, Candek-Potokar M. Pork color measurement as affected by bloom time and measurement location. J Muscle Foods 2006;18:78-87. 666

Rev Mex Cienc Pecu 2020;11(3):651-668

31. Gap-Don K, Eun-Young J, Hyun-Jung L, Han-Sul Y, Seon-Tea J, Jin-Yeon J. Influence of meat exudates on the quality characteristics of fresh and freeze-thawed pork. Meat Sci 2013;95:323-329. 32. Kasaai MR. Use of water properties in food technology: A global view. Int J Food Prop 2014;17:1034-1054. 33. Chmiel M, Słowiński M, Dasiewicz K. Lightness of the color measured by computer image analysis as a factor for assessing the quality of pork meat. Meat Sci 2011;88:566580. 34. Swatland HJ. Spectrophotometry of beef muscle and adipose tissue during heating and cooling. J Muscle Foods 1997;8(1):1-12. 35. Cho KC, Choy CL. Thermal stability of hemoglobyn and myoglobin. Biochim Biophys Acta 1980;622:320-330. 36. Doster W, Bachleitner A, Dunau R, Hiebl M, Lüscher E. Thermal properties of water in myoglobin crystals and solutions at subzero temperatures. Biophys J 1986;50:213-219. 37. Ledward DA. Scanning calorimetric studies of some protein-protein interactions involving myoglobin. Meat Sci 1978;2:241-249. 38. Privalov PL, Griko YV, Venyaminov SY. Cold denaturation of myoglobin. J Mol Biol 1986;190:487-498. 39. Dina JB, Barón PJ, Zaritzky NE. Mathematical modeling of the heat transfer process and protein denaturation during the thermal treatment of Patagonian marine crabs. J Food Eng 2012;113:623-634. 40. Kazemi S, Ngadi OM, Gariépy C. Protein denaturation in pork Longissimus muscle of a different quality groups. Food Bioprocess Technol 2011;4:102-106. 41. Atanasov BP, Mitova SV. Thermal denaturation of Delphinus delphis ferromyoglobin derivates in alkaline pH regions. Biochim Biophys Acta 1971;243:457-466. 42. Verdonck E, Schaap K, Thomas LC. A discussion of the principles and applications of Modulated Temperature DSC (MTDSC). Int J Pharm 1997;192:3-20.

667

Rev Mex Cienc Pecu 2020;11(3):651-668

43. Wang Y, Boysen RI, Wood BR, Kansiz M, McNaughton D, Hearn MTW. Determination of the secondary structure of proteins in different environments by FTIR-ATR spectroscopy and PLS regression. Byopolymers 2008;89(11):895-905. 44. Prieto N, Roehe R, Lavín P, Batten G, Andrés S. Application of near infrared reflectance spectroscopy to predict meat and meat products quality: A review. Meat Sci 2009;83:175-186. 45. Uddin M, Okazaki E, Ahmad MU, Fukuda Y, Tanaka M. NIR spectroscopy: A nondestructive fast technique to verify heat treatment of fish-meat gel. Food Control 2006;17:660-664.

668

https://doi.org/10.22319/rmcp.v11i3.5798 Article

Indicators of the competitiveness of Mexican beef in the world market

Miguel Ángel Magaña Magaña b Carlos Enrique Leyva Morales a* Juan Felipe Alonzo Solís a Carlos Gabriel Leyva Pech a

Universidad Autónoma de Yucatán. Facultad de Economía. Km 1 carretera Mérida-Tizimin, Cholul, Yucatán, México. b

Tecnológico Nacional de México/Instituto Tecnológico de Conkal. Conkal, Yucatán, México.

*Corresponding author: clmoral@correo.uady.mx

Abstract: The purpose of the present research is to assess the position and tendency of the competitiveness of Mexican beef carcasses versus the foreign supply, as well as the relationship between this commercial advantage, the domestic production and exportation that may allow proposing strategies to enhance livestock production in the medium term. In order to meet this goal, four indicators of competitiveness were estimated based on the procedure set forth by the Interamerican Institute of Cooperation for Agriculture, and the degree of association between variables was determined using Pearson’s coefficient. The volume of the primary supply of beef positions Mexico in the seventh place worldwide, while as an exporter country it occupies the fifteenth place. The exportation of beef was found to have as its main destination the market of the United States of America, and the domestic production has a low level of competitiveness in the international market. The behavior of the production and exportation of Mexican beef is influenced by factors linked to the characteristics of the market and of the commercial process, as well as with natural

669

Rev Mex Cienc Pecu 2020;11(3):669-685

phenomena, which determine both the productivity and the generation of exportable surpluses of carcass meat and of value for the economy of the country. Key words: Competitiveness, Exportation, Beef farming, Carcass meat.

Received: 22/08/2018 Accepted: 05/07/2019

Introduction From the agroeconomic perspective, competitiveness is the ability of a productive sector, such as livestock farming for the production of carcass meat in Mexico, to face worldwide competition(1); this implies that its products can be sold in foreign markets, and that it must have the quality and efficiency for producing and for maintaining growing levels of gains of their resources, as well as to minimize the effect of imports. Thus, the inclusion and duration of a product in the world market depend on their level of competitiveness, which involves such factors as the productivity and characteristics of the product(2), movements of the exchange rate(3), availability of infrastructure for commercialization and the supply of production factors with low relative costs(4). According to the FAO(5), in 2014, the world production of beef was 64.7 millions of tons, of which the United States contributed 17.7 %; Brazil, 15.0 %; China, 10.2 %; Argentina, 4.13 %, and Australia, 4 %. That same year, Mexico was the sixth producer of beef, participating in foreign trade with 2.8 %; in 2913, Mexico had the fifteenth place in exports. On the other hand, the main beef importers in 2013 were Italy, with 257.9 mil t, followed by the Netherlands (214.1 mil t), Germany (141 mil t), France (120.9 mil t), and China (104.2 mil t). The evolution of the world beef market and the competitiveness of the countries that participate in it exert a positive or negative influence on the dynamics of bovine cattle farming in Mexico, depending on the level of competitiveness. This is relevant because livestock breeding is an economically important activity, of which meat production is the most productive activity, which is practiced across the country because it provides important raw materials, foreign currency, and jobs, which translate into greater social welfare in the population. This is evidenced by the corresponding statistics, which show that in general, from 1990 to 2000 the volume, the volume of production and exportation of this meat 670

Rev Mex Cienc Pecu 2020;11(3):669-685

exhibited the opposite behavior; the former grew by 26.5 %, while the latter decreased by 5.9 %. For the 2001-2013 period, the production grew (25.1 %), and the exportation increased very significantly (6,928.2 %)(5,6). The situation described above brought beneficial consequences in the livestock subsector in the domestic economy. Prominent among these is its effect on the level of income generated in little more than a million of production units; the creation of 1.1 million direct jobs, and 3 million of indirect jobs(7) and, in beef production, of over 24 billions of dollars. This figure amounts to 23.70 % of the value of the domestic livestock production of the year 2013(6). However, within the previous context, the competitiveness of Mexican beef in the world market is reflected in the exportable supply of merely 0.8 % of the production (2000-2013), while the volume of imports amounted to 0.7 % of the apparent domestic consumption. These participations evidence that the foreign market is small, but the surplus of the trade balance indicates the existence of favorable conditions for improving the position of Mexico. Therefore, and in order to contribute to the scarce information in relation to this topic, the present research proposes evaluating the position and the tendency of the competitiveness of Mexican carcass beef in the face of the foreign supply of the most important producer countries as the relationship established between this commercial advantage, production and exportation allowing to propose action strategies that may enhance livestock farming in the medium term.

Material and methods The general method utilized was the deductive of the longitudinal section of the trend, based on estimated indirect information parameters; the main source was FAOSTAT(5), and the supplementary source was SIACON(6). The parameters of interest, due to their scope and coverage, are the ones considered as indicators of results or ex post(8), as they allow the analysis of the behavior of a final product from the links of a production chain in relation to the respective products of the foreign competitors, in both the domestic and in the foreign market. The competitiveness level was measured using four indices calculated based on the procedures proposed by the Interamerican Institute of Cooperation for Agriculture (IICA), while the supplementary parameters, which are descriptive or correlational between variables, were estimated according to Levin and Rubin(9). The interest indices are described as follows:

671

Rev Mex Cienc Pecu 2020;11(3):669-685

1. Trade intensity index (TII). This measures the relationship between the net trade balance and the apparent domestic consumption (ADC); i.e. the participation of exports or imports in the consumption of a product. The formula utilized to estimate it was: Tij = (Xij – Mij) / (Qij+Mij-Xij) Where: Xij = exportations of product i by country j; Mij = importations of product i from country j; Qij = production of good i in country j. This index has two auxiliary indicators: the degree of the exporting aperture and the degree of penetration of importations. 2. Relative Trade Balance Index (RTBI). Measures the commercial balance between countries in regard to the same good and allows to establish the degree of existing comparative advantage or disadvantage. It was proposed by Bela Balassa as a variant of the Grubell-Lloyd Index(10). In terms of algebra, it is represented as: RTB= (Xij – Mij) / (Xij + Mij), Where: Xij = Exportations of product i by country j to the world market; Mij = Importations of product i by country j from the world market. It reflects a competitive advantage when it is positive, and a disadvantage when it is negative. 3. Lafay index of International Specialization (IS). This measures the relationship between the net trade balance and the worldwide exportations of a product and allows evaluating the exporter vocation and the ability of a country to build permanent competitive advantages. It is estimated using the following expression: IE = (Xij – Mij) / Xim Where: Xim = Exportations of good i by the world. When the value of this index is one or 100%, the country is the only exporter; but if it is negative, it has no degree of specialization and has competitive difficulties. 4. Comparative Revealed Advantage (CRA). This index compares the efficiency in the use of the resources in time both for the production and the consumption of all the goods of a country, revealed by its commercial flow, and where the one with the lowest opportunity cost is the most efficient(11). It represents the result of the assignation of these in the economy and reflects its specialization position in the market. It is expressed as: CRAia = CAEia - CAIia Where: CAE = revealed comparative advantage of the exports; CAI = revealed comparative advantage of the exports. These components of the CRA were calculated by: CRAia = In [( Xia / Xin) / (Xra / Xrn)] CAIia = In [(Mia / Min) / (Mra / Mrn)] The letters X and M express the value of the exports and imports; subscript (n) is the trade value of all the goods of all the sectors minus the product of interest (a); superscript (r) refers to the trade value of the world minus that of the reference country (i), and the expression (nl) indicates the natural logarithm. The potential results in the CRA depend on the combined value of the CAI and the CAE and are: 672

Rev Mex Cienc Pecu 2020;11(3):669-685

1. CAE>0, CAI<0; CRA>0. The country exhibits comparative advantage in the exports, which results in a positive CRA. 2. CAE>0, CAI>0; CRA> o <0. There are comparative advantages in the export and the import; the CRA will be above or below zero if the CAE is higher or lower than the CAI. 3. CAE<0, CAI>0; CRA<0. The country exhibits comparative disadvantage in exports and comparative advantage in imports, and the CRA is negative. 4. CAE<0, CAI<0; CRA<0. Evidences comparative disadvantages in the export as in the import of a product, and the CRA can be positive or negative. The meaning of the CRA is ambiguous and can lead to interpretation errors; for example, a positive value indicates that the country dos not intervene significantly in the world trade of exports or imports(12).

Results Mexican beef production and trade balance

The volume of production of carcass beef in Mexico exhibits an upward trend from 1990 to 2013 (Figure 1), its growth was 62.2 %, going from 1,114 to 1,806.8 thousand tons, with a mean annual volume of 1,554.6 thousand tons(6). However, the level of yield of carcass meat (204.7 kg in the 2004-2013 period) positioned the country in the 69th place in productivity. Figure 1: Production and exportation of beef in Mexico

673

Rev Mex Cienc Pecu 2020;11(3):669-685

In the world market, the country was characterized by occupying the fifteenth place as exporter of beef during the abovementioned period; Poland is at the head of this list, while the American continent occupies the second place. The mean annual volume of Mexican exports was 17.9 thousand tons, which amount to 1.2 % of the domestic production. This figure represents a significant progress, because the production was virtually inexistent â&#x20AC;&#x2022;of 0.004 %â&#x20AC;&#x2022; in the first five years of the 1990s(5,6). The average contribution of the exportable supply of Mexico to the world beef market in the 2004-2013 period was 1.1 %, i.e. 10 % of the contribution by the American continent. It is worth mentioning that this region contributes only 11.1 % of the world exportation of beef, which is led by Europe (80.1 %). The main destinations of the exportable supply of carcass beef in Mexico in the year 2013(5) were the United States of America (95.5 %), Vietnam (2.7 %), and Japan (0.6 %). In 2004, the United States of America captured 87.5 % of this exportation; the Corean Republic (12 %) was another important destination. The United States of America is the first importer of this meat in the world, and, in average, 97 % of the total domestic exportations in the study period were channeled to that country. As for the trade balance of beef in Mexico between 2004 and 2013, the volume of the exports showed an upward trend, increasing by 37.1 %. The imports also grew (58.9 %). However, since the volume of the exports exceeded that of the imports, the balance was favorable (annual average of 23.9 thousand tons). Nevertheless, the increase in imports evidences a loss of competitiveness of domestic beef farming due to the fact that the free trade agreement with the United States left Mexico at a disadvantage in terms of competitiveness, as the United States is the largest producer and exporter of beef in the world.

Competitiveness indicators

Trade intensity index

This index evidences that, among 139 beef producing countries, Poland occupies the first position in competitiveness (Table 1), as it exhibited the highest ratio between its net trade balance and the respective apparent consumption of this meat. This level of competitiveness agrees with its level of exporter aperture and its extremely low percentage of imports; Poland exports almost 40 % of its production, while the percentages for the United States, Brazil and Argentina were 0.5, 0.1 and 0.2 % respectively. This leads to the inference that the main producer countries maintain a low relationship between their exportation and their production 674

Rev Mex Cienc Pecu 2020;11(3):669-685

of beef, and that, regardless of the level of development of the country, exportation is relatively low compared with its domestic production. Table 1: Trade intensity index of beef in the world market, 2004-2013 Trade CompetiExport Import intensity Character. Country tive aperture penetration index position (%) (%) (%) United States

0.20

Brazil

0.00

China

-0.31

Argentina

0.15

Australia

2.65

-10.10

0.79

France

3.54

Canada

1.54

Germany

10.19

Poland

64.22

Russian Federation Mexico

Excess supply Excess demand Excess demand Excess supply Excess supply Excess demand Excess supply Excess supply Excess supply Excess supply Excess supply

0.54

0.34

0.05

0.03

0.34

0.20

0.06

2.66

0.02

0.00

10.10

1.07

0.28

12.19

8.65

2.44

0.90

18.94

8.75

65.22

1.00

Source: Prepared by the authors based on FAOSTAT data.

On the other hand, the availability of excess exports from Poland amounts to approximately 0.7 of the volume of its apparent domestic consumption of beef, far above the domestic consumption registered for the United States, Brazil, Argentina, and Australia. This contrasts with Italy, the eleventh beef producer country, but also a significant importer. The TII of Italy exhibits an excess demand of 18.6 % of its apparent domestic consumption (ADC), which is satisfied with volumes from various countries; its degree of import penetration (22.01 %) convers a low competitive position to its domestic production. 675

Rev Mex Cienc Pecu 2020;11(3):669-685

According to the TII, Mexico occupies the 17th place in competitiveness; its carcass beef exports amount to little more than 1 % of its ADC, while the imports represent less than one hundredth of this variable. Like most developing countries, these values evidence that, rather than exporting capacity, Mexico has the natural resources required for this productions (grasslands and natural vegetation), a low level of income per capita(13), and a limited preference for this meat(14), which together generate the exportable surpluses. The situation of India in the world beef market should be highlighted, as it occupies the 16th place in competitiveness due to its trade intensity index (1.1 %). However, it differs from other exporter countries because, firstly, it does not import this meat, and its domestic product satisfies 101 % of its ADC; secondly, its cattle herd is surpassed only by that of the United States; thirdly, more than 800 million people practice Hinduism, which forbids the slaughtering of cows (a sacred animal); therefore , its meat processing industry is focused on exportation, and fourth, it offers a low-priced product that supplies markets with little demand for quality (almost 40 % inferior to that of Brazil); through these characteristics it has conquered markets of southeastern Asia and the Middle East(15). Developing countries like Argentina and Mexico, do not have these traits.

Relative trade balance index The countries that exhibited the greatest advantage in the international beef market through this index were India and Vietnam, whose values were 100 % (Table 2), followed by Colombia (99.9 %), Uruguay (99.8 5) and Paraguay (99.7 %).

Country

Table 2: Relative trade balance (RTB) of Mexican beef RTB indicator Competitive Character. (%) position

United States Brazil China Argentina Australia Russian Federation Mexico France Canada Germany Italy

22.24 -1.21 -85.02 55.75 98.85 -99.93 58.03 16.97 46.09 36.78 -72.97

25 29 37 18 7 46 17 26 23 24 33

Advantage Disadvantage Disadvantage Advantage Advantage Disadvantage Advantage Advantage Advantage Advantage Disadvantage

Source: Prepared by the authors based on FAOSTAT data. 676

Net trade balance 229,701 -1,107 -184,151 43,050 552,522 -1940,720 131,702 515,858 194,312 1092,780 -2383,357

Rev Mex Cienc Pecu 2020;11(3):669-685

The competitive position of Mexico in the world, based on this indicator (58.03 %), remains the same as the position conferred by the TII: the seventeenth place. Mexican beef production is characterized by the fact that its foreign supply outweighs its demand, and therefore it has a surplus to export; however, it is surpassed by several countries of the American continent, such as Brazil and Argentina, which are at a better competitive advantage. Among the main producer countries, only the United States had a favorable RTB during the analyzed period (22.2 %), which positions it in the 25th place. In contrast, Brazil, China, and the Russian Federation exhibit a clear disadvantage in the market as they have an RTB of 1.2, -85.0 and -99.9 %, respectively. Of these, only China increased its potential deficit, going from 7,409 t of beef in 2004 to 102,285 t in 2013 â&#x20AC;&#x2022;an increase of 1,280.6 %. For its part, the Russian Federation reduced its commercial deficit, as its balance went from -184,363 t in 2004 to -92,807 t in 2013 â&#x20AC;&#x2022;a 49.7 % decrease. And Brazil overcame its commercial deficit since 2012, with a balance that went from -743 t in 2004 to a surplus of 5,695 in 2013.

Lafay International Specialization Indicator

The information contained in Table 3 confirms that Poland and Germany have the highest commercial specialization and competitiveness in the world carcass beef market, having reached indices of 96.9 and 72.9 %, respectively, in the 2004-2013 period. This shows their capacity to build competitive advantages in this market. Table 3: International specialization in the beef market, 2004-2013 Specialization CompetiContribution Country index tive Characteristic to world (%) position exports United States Brazil China Argentina Australia Russian Federation Mexico France Canada Germany Italy

1.53 -0.01 -1.23 0.29 3.69 -12.95 0.88 3.44 1.30 7.29 -15.91

13 35 43 19 5 49 16 6 14 2 50

Low Low Low Low Intermediate Low Low Low Low High Low

Source: Prepared by the authors based on FAOSTAT data. 677

4.21 0.30 0.11 0.40 3.71 0.00 1.20 11.87 2.06 13.56 2.95

Rev Mex Cienc Pecu 2020;11(3):669-685

Notably, according to the IS index, Australia is the only country with an intermediate competitiveness in the market, while the Russian Federation (-12.9 %) and Italy (-15.9 %), two of the main beef producing countries, did not exhibit any degree of specialization. Within this context, Mexico occupied the 16th place in the world, with a competitiveness considered as low (0.9 %). The two previous competitiveness indicators and this one confirm the competitive position of Mexico in the beef market, which is not ideal for a country with abundant natural resources and a livestock breeding activity generalized to its whole territory; this involves a limited productivity per surface area and per cow, as well as a low yield of carcass meat per finished animal(6).

Revealed comparative advantage index

The RCA index (Table 4) confirms that Australia is the country whose beef foreign supply has the highest level of competitiveness from the point of view of the opportunity cost of its production resources; its average index was 6.0 during the 2004-2013 period and, in general, it exhibited an upward trend; this value was higher than that of Mexico (1.7), which occupied the second place. Argentina occupied the third position (1.1), and the United States, the fourth (0.9). Brazil, China, and the Russian Federation, which have a relevant presence in the world market due to the value of their RCA and that of their trade intensity and international specialization indices, exhibited a lack of competitiveness in the said market. Table 4: Revealed comparative advantage per beef producing country, 2004-2013 Revealed comparative advantage index Country 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 U.S.A. Brazil China Argentina Australia Russian Fed. Mexico France Canada Germany Italy

-0.40 -0.73 -2.75 1.16 5.62 -8.85 0.42 2.36 1.43 1.77 -3.04

-0.15 -1.12 -2.76 1.21 6.32 -12.93 0.46 2.57 1.15 1.24 -2.93

0.35 -0.51 -1.91 1.44 6.39 0 0.68 1.51 1.26 0.62 -2.76

0.63 -0.66 -2.21 0.68 7.23 0 0.74 1.02 0.88 0.36 -2.56

1.48 -0.17 -2.58 1.38 6.54 -10.84 0.85 0.53 0.88 -0.03 -2.48

1.22 -0.68 -2.02 2.08 5.84 0 0.88 1.14 0.78 0.22 -2.69

1.33 -0.42 -2.47 0.45 5.40 -12.02 0.96 1.60 0.63 0.68 -2.50

1.35 -0.67 -2.72 1.34 4.95 -8.99 1.18 1.87 0.43 0.18 -2.30

Source: Prepared by the authors based on FAOSTAT data.

678

1.16 -0.01 -2.67 -0.10 5.26 -5.74 0.73 2.06 0.12 -0.05 -2.45

1.50 0.59 -4.20 0 6.12 -6.03 0.61 2.08 0.04 0.04 -2.46

Rev Mex Cienc Pecu 2020;11(3):669-685

According to the principle of comparative advantage(16), a country reaches the economic optimum when it produces and exports those goods for which it has an advantage and imports those that exhibit a disadvantage; this accounts for the allotment of resources in the three previously mentioned countries. Following this logic, in order to establish production companies at a lower opportunity cost, exporting less beef or importing it yields greater economic benefit; this, then, confirms the structure of the exchange relationship per producing country, as is the case in China, where the domestic industrial production has a greater economic importance than primary production. Likewise, only two countries in Latin America â&#x20AC;&#x2022;Mexico and Argentinaâ&#x20AC;&#x2022; have been proven to have positive competitiveness levels; although in both cases the RCA exhibited a slight downward trend with marked ups and downs (Figure 2), but the rank of variation of Argentina turned out to be slightly broader than that of Mexico. The RCA for Argentina decreased by 2.1 points and its coefficient of variation (CV) was 71.6 %, while for Mexico, the RCA was approximately 2.0, and its CV was 38.1 %. In contrast, this index for the United States and Australia was characterized by its greater stability, as its variation was 1.6 points (CV= 82.5 %) and 1.4 (CV= 60.8 %), respectively. Figure 2: Indicators of revealed comparative advantage indices

It is important to point out that most of the years between 2004 and 2013, the RCA coefficients of Argentina and Mexico registered a value above the unit, which evidenced a better performance of the beef producing livestock subsector. In fact, these turned out to be ambiguous because both their CAE and CAI indices were below zero in most years; thus, the 679

Rev Mex Cienc Pecu 2020;11(3):669-685

two countries are regarded as having a comparative disadvantage in both exports and imports and, therefore, they do not have a significant participation in the world beef market. This is not the case for Australia and Germany, which have a comparative advantage in exports and a disadvantage in imports, as indicated by the analysis criterion shown in the methodology section. Based on the above, it is possible to infer that, due to its negative CAE during the 2004-2013 period, Mexico exhibits a comparative disadvantage in the production of beef, with a tendency to decrease; however, the trend becomes positive in 2012 and 2013. This behavior by RCA component implies that the country gradually increased its level of competitiveness. Beef imports from 2004 to 2008 followed the logic of the opportunity cost for the availability of a product; the domestic production was less efficient in terms of price or quality than that of other countries, and therefore importation became a better alternative for the economy. Finally, as for the relationship established between the export volumes of Mexican beef and the value of the CAE index, as well as the relationship between the RCA index and the domestic supply of beef in 2004-2013, the former was consistent with the principles of the economic logic of international trade (Figure 3), where the correlation coefficient (r=0.92) evidences the existence of a high association and, in the same sense, of variation between the evidence cited and the corresponding advantage indicator. The second relationship exhibited a negative correlation coefficient (r= -0.09), which reveals that, with the increase in the level of competitiveness of the country in this market, its domestic supply of beef decreases in relative terms; this can be observed in the behavior of its exports, whose average rate was higher (37.1 %) during the period than the respective volumes of meat production (1.8 %). Figure 3: Relationship between the foreign sales of beef and the comparative advantage of export of Mexico

680

Rev Mex Cienc Pecu 2020;11(3):669-685

Discussion In relation to the quality and differentiation of the beef produced in Mexico and its carcass yield ―both of which are variables related to the production and competitiveness of exports―, it is important to mention that various economic factors have had a long term influence on their behavior. Most prominent among such factors are the signature and implementation of NAFTA in 1994(15), and the structural problems of the economic policy applied by the federal government since 1982, which have been reflected by specific aspects of this productive activity such as the loss of profitability and competitiveness (in costs and sales prices), the disappearance of production units and the loss of jobs during this process of transition from being a protected activity to becoming inserted into the free market. In the years that followed this phenomenon, the domestic livestock breeding has gradually recovered from its negative impact. As for the competitiveness of beef in the international market, the analysis of the TII showed that not all the countries that stand out as producers are also main exporters. A clear example of this is Italy, whose TII places it in the 49th position in competitiveness, when, according to its trade capacity, it was the eleventh exporter of beef from 2004 to 2013. Within this context, and according to the international specialization index, Mexican beef exhibited a low level of competitive advantage, as well as little exporter vocation, according to the reports for this country in the years 1980 to 2009(18) and as stated by Depetris et al(19) in relation to the competitive performance of the powdered milk production of Argentina and Uruguay during the 1990-2005 period. The cited degree of competitiveness of Mexico may be improved with increases in the quality and differentiation of beef, given that beef is exported in the form of fresh, refrigerated and frozen meat; however, the preferences of the consumers of the meat-importing countries are oriented toward select cuts and determined by the content of marbled fat, degree of tenderness, and meat type(15,17). In response to this demand in the domestic stockbreeding activity, traditional bovine races have been replaced with improved races, according to the demand of the market. In average, the carcass yield grew by 0.2 % per year from 1995 to 2014, which is low, compared to that of Australia, where this index increased by 1.4 %(5), an aspect related to the mean production cost. On the other hand, it is possible to infer that, in the medium term the RCA index ―whose relevance considers the allotment of productive resources in the economy(16)― exhibits a value above zero and a rising behavior, and does not fluctuate excessively, for an excessive fluctuation ―as in the case of Mexican beef― indicates that the competitiveness does not rely on a strong economic base, but rather is a product of volatile factors such as variation in 681

Rev Mex Cienc Pecu 2020;11(3):669-685

the exchange rate parity and the imposition of non-tariff barriers to competitor countries, and therefore these opportunities benefits the export sales of this meat only occasionally. This situation is consistent with the reports by Carrera and Bustamente(18), according to whom beef production in Mexico registered a low competitiveness in the world market from 1996 to 2003 because the CAE index was lower than the CAI index, the commercial aperture process in the country (NAFTA) having been the factor that reduced the competitiveness of the domestic production. Likewise, the findings of the present study agree with the results obtained by Carrera et al(17) and by Del Moral and Trujillo(20). The former authors indicate that the situation of the Mexican beef farming is reflected by general a negative RCA for the 1990-2009 period; however, it has been recovering since 2004 as a result of restrictions to the importation of beef from the United States and Canada due to the BSE disease. The latter authors evidenced that beef production from 1908 to 2010 was characterized by its revealed comparative disadvantage, which is reflected in the reduction of the production of this meat and in the worsening of its trade balance. Finally, the low degree of association found between the value of the indicator of RCA and beef production in Mexico is a result of the characteristics of the market and the commercial process. Firstly, there is in the country a deficient communication and commercialization infrastructure(21), as well as a growing participation by self-service stores in the distribution of meat products whose supply includes a large number of important products that have a negative impact on the value chain of domestic beef. Secondly, the gross margin of the commercialization process is relatively high compared to the price paid to the stockbreeders, who obtain merely a fourth of the total value generated and who are not organized to face the market power exercised by wholesalers and retailers; furthermore, imported beef at low prices conditions the price paid to the initial producers, resulting in a loss of profitability. The third important characteristic of this association is the deficient access to cattle feeds, whose prices and quality are not equal to those of the United States, and the scarcity of governmental subsidies for this activity. The fourth is the lack of integration and coordination of the beef production chain, which results in higher production costs, failure to benefit from the misuse scale economies(22), and, therefore, a lower competitiveness of the chain. The last characteristic is the presence of natural phenomena(20) such as floods due to extreme meteorological events and long droughts, which have reduced the national beef production and increased its cost.

682

Rev Mex Cienc Pecu 2020;11(3):669-685

Conclusions and implications During the 2004-2013 period, Mexican carcass beef exhibited a low level of competitiveness in the world market, as evidenced by the trade intensity, relative trade balance, international specialization and relative comparative advantage indices. A characteristic of the exportation of this meat is that it has a single main destination: The United States. Also, it has been proven that, since the 1990s, and as a result of various economic events, beef production has experimented a constant growth, which has had a positive impact on the generation of exportable surpluses; however, these represent only a small portion of the primary supply according to the competitive position. The exportation of beef does not rely on quality products or on institutional factors but is a result of volatile events related to the exchange rate and to the imposition of non-tariff barriers to competitor countries. Given the characteristics of the domestic beef production and its macroeconomic environment, the consolidation of a higher competitive position of the exportable supply that may allow the producers of the country to negotiate the prices requires improvement of both the quality and the differentiation of beef through the incorporation of added value, the meat yield per animal, and the aptitude of the commercial infrastructure to open new markets. These conditions will enable Mexico, in the medium term, to attain a better level of competitiveness and prominence in the international market of this meat. Furthermore, this scenario will also make it possible to increase the positive impacts of beef farming on the economy and the regional welfare of the country.

Literature cited: 1. Porter ME. Ventaja Competitiva. España: Editorial Pirámide; 2010. 2. Coronado F. Indicadores de productividad y competitividad regional relacionados al agro. CENTRUM Católica’s Working Paper. No. 2015-08-0010. Lima, Perú: Pontificia Universidad Católica del Perú; 2015. http://vcentrum.pucp.edu.pe/investigacion/wps/pdf/CECYM_WP2015-08-0010.pdf. 3. Vázquez A, Reyes A. Fundamentos sobre la competitividad para el desarrollo en el sector primario. TLATEMOANI, Revista Académica de Investigación 2013;(4):1-29. 4. Gonzalez J, Zamora A, Celaya R, Navarro JC. Competitividad y logística del comercio exterior de México. Primera ed. Sonora, México: Instituto Tecnológico de Sonora y Universidad Michoacana de San Nicolás de Hidalgo; 2016.

683

Rev Mex Cienc Pecu 2020;11(3):669-685

5. FAOSTAT. Organización de las Naciones Unidas para la Agricultura y la Alimentación. Base de datos estadísticos con relación a la alimentación y agricultura. http://faostat.fao.org/site/535/DesktopDefault.aspx?PageID=535#ancor. Consultado 16 Dic, 2015. 6. SIACON. Sistema de Información Agroalimentaria de Consulta. Base de datos de la actividad agrícola, pecuaria y pesquera en México. http://www.siap.gob.mx/optestadisticasiacon. Consultado 15 Dic, 2015. 7. AMEG. Carne de bovino. Indicadores económicos. 14 ed. México; 2012. 8. IICA. Instituto Interamericano de Cooperación para la Agricultura. Elementos para un enfoque de la competitividad en el sector agropecuario. Colección de documentos IICA. Serie competitividad No 3. Santa Fe de Bogotá, Colombia; 2000. 9. Levin R, Rubin D. Estadística para administración y economía. Séptima ed. México, DF: Pearson/Prentice Hall; 2004. 10. Sierra SL, Peláez SJ. Amenazas comerciales del acuerdo CAN-Mercosur, para los sectores productivos del Valle del Cauca. Economía, Gestión y Desarrollo 2009;(7):47– 62. 11. Cue M. Economía internacional. Primera ed. México: Grupo Editorial Patria; 2014. 12. Vollrath T. A theoretical evaluation of alternative trade intensity measures of revealed comparative advantage. Weltwirtschaftliches Archiv 1991;264-280. 13. CONEVAL. Comisión Nacional para la Evaluación de las Políticas de Desarrollo Social. Evolución de las carencias sociales 2015 y su comparativo con la serie 2010-2014. http://www.coneval.org.mx/Medicion/EDP/Paginas/Datos-del-Modulo-deCondiciones-Socioeconomicas.aspx. Consultado 15 Dic, 2015. 14. FIRA. Panorama agroalimentario: Carne de bovino 2015. México: Dirección de investigación y evaluación económica y sectorial; 2015. 15. Omaña JM, Almora I, Cruz B, Hoyos G, Quintero JM, Fortis M. Competitividad de la carne de ganado bovino entre los países miembros del TLCAN 1997-2008. Rev Mex Cienc Agr 2014;5(2):175-189. 16. Salvatore D. Economía internacional. Octava ed. México, DF: Ed. Limusa; 2005. 17. Carrera B, Gómez M, Schwentesius R. La ganadería bovina de carne en México: un recuento necesario después de la apertura comercial. Chihuahua, México: Universidad Autónoma de Ciudad Juárez; 2014. 684

Rev Mex Cienc Pecu 2020;11(3):669-685

18. Carrera ChB, Bustamante LT. ¿Es la ganadería bovina de carne una actividad competitiva en México? Noesis. Rev Cienc Soci Humanid 2013;22(43):19-50. http://www.redalyc.org/pdf/859/85927874002.pdf 19. Depetris GE, García AR, Rossini G. Desempeño competitivo de Argentina y Uruguay en la leche en polvo. Problemas del desarrollo 2009;40(157):163-187. 20. Del Moral L, Murillo VB. Dinámica del mercado de la carne bovina en México: un análisis de competitividad. Paradigma económico 2015;7(1):107-125. 21. Rodríguez D, Riveros H. Esquemas de comercialización que facilitan la vinculación de productores agrícolas. San José, Costa Rica: IICA; 2016. 22. Nicholson W. Teoría microeconómica. Novena imp. México, DF: Cengage Learning SA; 2008.

685

https://doi.org/10.22319/rmcp.v11i3.4669 Article

Effect of the addition of aqueous extract of garlic (Allium sativum) to the diet of rabbits (Oryctolagus cuniculus) on the productivity and on the physical and microbiological quality of the meat

Dora Luz Pinzón Martínez a María Dolores Mariezcurrena Berasain a* Héctor Daniel Arzate Serrano b María Antonia Mariezcurrena Berasain c Abdelfattah Zeidan Mohamed Salem c Alfredo Medina García a

Universidad Autónoma del Estado de México. Facultad de Ciencias Agrícolas, Instituto Literario 100, 50000, Toluca, Edo. de México, México. b

Universidad Autónoma del Estado de México. Programa de Maestría y Doctorado en Ciencias Agropecuarias y Recursos Naturales, Toluca, Edo. de México, México. c

Universidad Autónoma del Estado de México. Facultad de Medicina Veterianria y Zootecnia, Toluca, Edo. de México, México.

* Correspondng author: nekkane16@hotmail.com

Abstract: Garlic (Allium sativum), as a natural antimicrobial, has favored animal welfare, as well as the safety and quality of the meat. The objective of this study was to assess the production indicators and the physical and microbiological quality of the meat of rabbits fattened with the addition of aqueous extract of garlic (AEG) to their diet. A completely randomized design was carried out with three treatments of 28 New Zealand rabbits X Chinchilla (Oryctolagus cuniculus X Chinchilla chinchilla) each (LW 1 ± 0.6 kg, 30 ± 5 d); control group (food only), 686

Rev Mex Cienc Pecu 2020;11(3):686-700

treatment 1 (0.9% AEG) and treatment 2 (1.8% AEG, sprinkled on the food every 3 d). Daily weight gain and food conversion were determined to occur during four weeks after weaning. Aerobic mesophiles, fecal coliforms, and psychrophiles were quantified in the meat, and the pH and color (B*, a* and b*) were determined, all in Longissimus dorsi, at 1, 3, 5, 7 and 9 d of storage in refrigeration. A multivariate variance analysis (P≤0.05) and a Tukey test at 5 % were performed for the production indicators and the physical and microbiological variables. Unlike in psychrophiles and mesophiles, there were no significant differences (P≥0.05) in the production indicators throughout the time of conservation. No fecal coliforms were observed in any of the samples. The addition 1.8% of aqueous extract of garlic improved the shelf life by two days (total: 9 d) by reducing the content of psyschrophiles, without affecting the production indicators or the physical quality of the meat. Key words: Allium sativum, Shelf life, Microbiological analysis, Meat quality.

Received: 21/10/2017 Accepted: 26/09/2019

Introduction The meat industry employs various methods to delay the changes that impair the meat and prolong the period of acceptability —changes that are directly related to the presence of microorganisms— . Today, it is common to seek the combination of two or more factors (physical, chemical or biological, among others) that will interact additively or synergistically to control the microbial population and avoid the severe application of a single conservation factor; this to improves the quality of sensory and nutritional status of the food and allows the production of minimally processed foods(1). The use of non-natural antimicrobials is common in the industry of processed meat; however, these are currently being rejected by the consumers due to the effects that they can cause to health. Therefore, the need has emerged to search for other antimicrobial substances of natural origin(2). Garlic (Allium sativum) is a natural antimicrobial with a wide range of nutraceutical properties, due to its content of sulfur compounds, among them allicin. Equally, the beneficial effects of garlic extract on the health of animals have been demonstrated, as in the case of the rabbits and their meat, prolonging its shelf life and, therefore, consumer safety(3-6). The deterioration of rabbit meat in refrigeration is due to the activity of endogenous enzymes, along with the activity of microbial contaminants in the product during slaughtering and carving up. When the product is distributed at refrigeration temperatures, the meat has a shelf life of 6 to 8 d,

687

Rev Mex Cienc Pecu 2020;11(3):686-700

as some reports have mentioned(7-10). Other authors(11) marinated pork with garlic juice and onion in order to determine its effect on the quality during storage in refrigeration. As for their sensory effect, the juices of garlic and onion provided the meat with greater tenderness and a better taste. Although research has been carried out on the use of garlic extract in the meat of different species, the microbial load in the meat when adding the extract to the diet of rabbits has not been assessed. Therefore, the objective of this study was to evaluate the effect of the addition of aqueous extract of garlic to the diet of rabbits on the production indicators, as well as on the physical and microbiological quality of stored meat.

Materials and methods Biological material

There were used 84 male and female weaned New Zealand rabbits X Chinchilla (Oryctolagus cuniculus X Chinchilla chinchilla) (1.0 ± 0.6 kg, 35 ± 5 d), housed in the interior of ships with natural ventilation and in a temperate climate (22 ± 2°C), in a modular system of cages on a floor with automatic nipple-type water dispensers and feed chutes, during June-July, 2015.

Study site

The study was carried out in the head farm of the Distributor of Nezahualcoyotl Rabbits (DISCONNEZA), located in the Municipality of Nezahualcoyotl, State of Mexico. It is located between the parallels 19° 24' 02" N and 99° 00' 53" W, at an average altitude of 2,235 m asl.

Preparation of the extract The aqueous extract of garlic (AEG) was developed from a mother dilution of 0.125 g/ml(12), for which garlic was liquefied without the husk during 5 min (Oster 6630-13), and this extract was strained twice through gauze pads. The resulting AEG was stored in refrigeration at (4 °C) until its use (7 d)(13). The animals were divided into three treatments: control group CG (without added AEG), treatment 1 T1 (0.9 %), and treatment 2 AEG T2 (1.8 % AEG). 688

Rev Mex Cienc Pecu 2020;11(3):686-700

The extracts were sprayed on commercial food (Union Tepexpan Plus® rabbit feed; crude protein: 16.5%; crude fat: 3%; crude fiber: 15%; ashes: 9% and moisture: 12%) every three days from the beginning of the assay. The selected doses correspond to those reported by Mariezcurrena-Berasain(13) for the best production of gas and fermentative parameters as the best power available for producing short-chain fatty acids (SCFA) and metabolizable energy (ME), in her study on gas production in vitro. In order to evaluate the production indicators, the rabbits were weighed on a weekly basis (with a Dibatec digital scale), removing the food 12 h before, and the total weight gain was registered, along with the daily weight gain (individually) and the food intake during four weeks. Food and water were provided ad libitum.

Slaughter

The rabbits were deprived of food 24 h before being slaughtered. They were desensitized through atlanto-occipital dislocation(14); they were slaughtered and bled to death through a cut in the jugular vein and the carotid artery, and eviscerated through a cut in the linea alba for removal of the abdominal and thoracic viscerae. Finally, the limbs were severed, and the temperature of the carcass decreased to 4 °C. The carcasses were identified and transported, at refrigeration temperature, to the Agricultural Products Quality Laboratory of the Faculty of Agricultural Sciences of the Autonomous University of the State of Mexico, for the corresponding analyses (August-December 2015).

Physical analyses

A first reading of the pH (Hanna Instruments, model HI 99163) and color (Minolta Chroma meter CR 400, with lighting D65 and 10° observer) of samples of the right Longissimus dorsi muscle of the carcasses was taken in situ at 45 min post mortem (in hot carcass). Subsequent analyses were performed on the samples taken from the same muscle during the d 1, 3, 5, 7 and 9 in samples preserved in trays and covered with film at 4 °C and in duplicate.

Microbiological analyses

It was quantified by duplicate the colony-forming units (CFU) of fecal, mesophilic, and psychrophilic coliforms throughout the conservation period. The French standard AFNOR-

689

Rev Mex Cienc Pecu 2020;11(3):686-700

NF-V0860-1996(15) was used for the quantification of fecal coliforms, as there is no Official Norm for these microorganisms in Mexico(16).

Statistical analysis A variance analysis (Pâ&#x2030;¤0.05) was carried out for the production indicators, and when significant differences were found, a comparison was applied using the Tukey test at 5%. The study variables were the three treatments (CG, T1 and T2), and the response variables were weekly weight, weekly weight gain, and conversion efficiency, during a period of four weeks. A multivariate analysis of variance (Pâ&#x2030;¤0.05) was applied to the results obtained from the microbiological and physical-chemical study in order to determine the effect of the treatments and the days of conservation. The response variables were UFC of fecal coliforms, aerobic mesophiles, psychrophiles, pH, brightness, red index, and yellow index. The Tukey test at 5 % was carried out for those values that showed significant differences, using Stat Graphics Centurion XV. I

Results and discussion Production indicators

The results of the productive variables are shown in Tables 1, 2 and 3, in which, as can be observed, there were no significant differences for any of them. The effect of garlic on the productive variables in rabbits remains controversial; some authors have reported that its bioactive compounds have a positive effect on these aspects(17,18). More recent reports are in opposition, and, according to them, garlic reduces the plasma levels of cholesterol, the blood pressure, and platelet aggregation, or promotes the immune response without affecting these variables, although few studies cited good production results when garlic is supplied together with other aromatic plants. The present work agreed that there was no significant effect (Pâ&#x2030;Ľ0.05) for weekly weight, weekly weight gain, or food conversion efficiency. In broiler chickens, the garlic extract has been reported as a stimulator for weight gain; in rabbits, it is suggested that it is conditioned by the digestive physiology(19-22).

690

Rev Mex Cienc Pecu 2020;11(3):686-700

Table 1: Variable weight of rabbits per week (kg/LW) Teatment

Week 1

1.14±0.02

1.09±0.03

1.03±0.04

0.2617

Week 2

1.37±0.03

1.3±0.04

1.29±0.05

0.5028

Week 3

1.59±0.03

1.50±0.04

1.53±0.05

0.1182

Week 4

1.84±0.04

1.75±0.05

1.81±0.06

0.1721

CG= control group (without added AEG); treatment 1= 0.9 % AEG; treatment 2= 1.8 % AEG. AEG= aqueous extract of garlic.

Table 2: Variable weight gain per week (kg/LW) Treatment

Week 1

0.26±0.01

0.25±0.01

0.4845

Week 2

0.23±0.01

0.24±0.01

0.26±0.02

0.3897

Week 3

0.22±0.01a

0.16±0.0a

0.23±0.01a

0.0050

Week 4

0.24±0.01

0.25±0.01

0.28±0.01

0.8360

Total

0.96±0.02

0.91±0.02

1.24±0.05

0.1790

CG= control group (without added AEG); treatment 1= 0.9 % AEG; treatment 2= 1.8 % AEG. AEG= aqueous extract of garlic. a,b,c Means with different letters in the same row indicate statistically significant differences.

Table 3: Variable feed conversion per week (kg/LW) Treatment

Week 1

2.5±0.16

2.76±0.21

4.42±0.49

0.3474

Week 2

3.15±0.56

3.14±0.73

5.21±1.52

0.9950

Week 3

2.89±0.73

4.62±0.95

5.28±0.47

0.1541

Week 4

2.88±0.34

2.96±0.44

3.95±0.72

0.8903

Total

2.84±0.1

3.1±0.13

4.29±0.47

0.1308

CG= control group (without added AEG); treatment 1= 0.9 % AEG; treatment 2= 1.8 % AEG. AEG= aqueous extract of garlic.

691

Rev Mex Cienc Pecu 2020;11(3):686-700

In relation to the weekly weight gain, Table 2 shows that the treatment 2 with 1.8% of AEG resulted in a greater weekly weight gain. The foregoing is consistent with other studies(23,24), which showed that allicin in garlic promotes the performance of the intestinal flora, thus improving digestion and energy use, which leads to a better growth in broiler chickens. In relation to the conversion (Table 3), after four weeks, no differences were observed between treatments. However, a tendency to increase the variable when adding a greater dose of extract is apparent.

Physical and microbiological analyses After the variance analyses (per day and per treatment), significant differences (Pâ&#x2030;¤0.05) in shelf life were found for aerobic mesophiles and psychrophiles. When significant differences were found for these variables, a Tukey test at 5 % was applied, as shown in Table 4. Table 4: Physical and microbiological profile during the shelf life of rabbit meat Treatment P EEM CG 1 2 MA (log10 UFC/ cm2) Day 1

1.50x

2.15

2.23

0.092

0.208

Day 3

2.08xy

2.35

2.18

0.675

0.210

Day 5

2.58xy

2.65

2.54

0.960

0.258

Day 7

2.46xy

2.51

2.68

0.642

0.167

Day 9

3.01y

2.99

2.40

0.460

0.371

0.009

0.097

0.781

Day 1

1.57x

1.65x

2.01x

0.348

0.207

Day 3

2.43xy

2.30y

2.77xy

0.255

0.182

Day 5

2.90y

2.85z

2.99y

0.805

0.156

Day 7

2.01xy

2.21y

3.15y

0.064

0.286

Day 9

3.19y

3.40z

3.02y

0.474

0.206

0.015

â&#x2030;¤0.001

0.016

6.64ab

6.26aw

7.01bx

0.0058

0.101

PSI (log10 UFC/ cm2)

pH Day 1

692

Rev Mex Cienc Pecu 2020;11(3):686-700

Day 3

6.66

6.49x

6.97x

0.0995

0.101

Day 5

6.86ab

6.55ay

7.01bx

0.0278

0.090

Day 7

6.38a

7.11bz

6.21ay

0.0108

0.147

Day 9

6.64a

7.08bz

6.54az

0.0137

0.937

0.469

0.000

Day 1

61.17

59.76

61.38

0.762

1.645

Day 3

58.41

59.76

57.42

0.683

1.842

Day 5

58.11

56.79

56.51

0.680

1.326

Day 7

58.13

57.17

57.55

0.901

1.478

Day 9

58.68

56.94

58.37

0.588

1.218

0.789

0.065

0.255

Day 1

2.04

1.99

1.25

0.167

0.280

Day 3

1.21

1.63

2.17

0.205

0.330

Day 5

3.75

1.57

2.38

0.422

1.106

Day 7

3.16

1.58

1.805

0.345

0.756

Day 9

2.80

1.73

1.916

0.589

0.752

0.582

0.783

0.360

Day 1

4.27

3.69

4.17

0.436

0.320

Day 3

3.48

4.46

2.78

0.376

0.784

Day 5

5.10

3.14

4.53

0.349

0.901

Day 7

5.17

3.76

4.14

0.443

0.754

Day 9

5.30

3.71

4.02

0.289

0.683

0.599

0.263

0.550

CG= control group (without added AEG), treatment 1 (0.9 % AEG) and treatment 2 (1.8 % AEG). AEG= aqueous extract of garlic; SEM= standard error of the mean. AM= aerobic mesophiles; PSY= psychrophiles; B*= brightness; a*= intensity of red; b*= intensity of yellow. a,b,c Means with different letters in the same row indicate significant differences (P<0.05). x,y,z Means with different letters in the same column are significantly different (P<0.05).

693

Rev Mex Cienc Pecu 2020;11(3):686-700

Significant differences (P≤0.05) were found in aerobic mesophiles between days of exposure only in the CG, in which d 9 exhibited a larger population than d 1 (Table 4). The range at which the shelf life for this microbial population began in the three treatments was 1.50 to 2.23 log10 CFU/cm2. Although the Mexican Norm does not indicate a reference value for this microbial population in raw meats of any kind, it is suggested that the European Union, according to the European Commission’s Guideline 2001/471/EC(19), reports acceptable values of less than 3.50 log10 CFU/cm2. There are no reports for rabbit meat. Thus, on the last day of the shelf life of the meat used in the present experiment (d 9), all treatments were found to be within the permissible limits although there were no significant differences (P>0.05) between them. The presence of aerobic mesophiles is used as a general indicator of hygiene and of the population of microorganisms for estimating the quality of the handling and manipulation of the meat; it includes bacteria, molds and yeasts that can thrive at 30 °C(25). Other studies in rabbit meat without supplementation with antimicrobials in the diet reported higher values of for aerobic mesophiles (5.87 log10 CFU/cm2) that exceed the allowable limit at 7 d of exposure(26). In the present study, there was no significant difference (P≥0.05) for this variable at the end of the shelf life, which suggests that the handling and hygiene was adequate in all three treatments. In the case of psychrophiles, significant differences were found (P≤0.05) between days of exposure, but not between treatments. The range at the beginning of the shelf life was 1.57 to 2.01 log10 CFU/cm2. In the shelf life, the kinetics of growth showed that the T2 started with a greater burden (2.01 log10 CFU/cm2) than the CG and T1. However, on d 9 of the shelf life of T2, the number of UFCs (3.02 log10 CFU/cm2) was lower than in the CG and in T1 (3.19 and 3.40 log10 CFU/cm2, respectively). Therefore, the growth of psychrophiles was lower in the T2 (1.8 % AEG), compared with the control group (CG) and the lowest dose of AEG (T1). These microorganisms are important for predicting the stability of the product under conditions of refrigeration, and it is suggested that T2 (1.8 % AEG) exhibited the greatest stability, although there are no regulations determining permissible limits for stability in rabbit meat. It is problematic to establish maximum allowable limits in aerobic mesophiles and psychrophiles, since meat is a product that, in most cases, undergoes a cooking process before being consumed, reaching high temperatures that eliminate these microorganisms. Another research paper(27) mentions that the 24 h fast improves the microbiological quality, as the presence of undesirable microorganisms in the carcass decreases when the digestive tract is empty. No growth of fecal coliforms was observed in any of the treatments. The initial load is proportional to the final population reached by a meat during its shelf life. Bacteria reproduce exponentially, and therefore, a high initial population will result in less time to reach those levels at which the meat breaks down(27,28). Although there are no significant differences, in another research on the effects of added garlic (28) in which the antimicrobial capacity of extracts of garlic obtained using solvents added to minced pork 694

Rev Mex Cienc Pecu 2020;11(3):686-700

medallion was evaluated showed that all the extracts inhibited the growth of Listeria monocytogenes and Escherichia coli 0157:H7. Similarly, another study researched the antimicrobial potential of certain sulfur compounds present in garlic against microbial growth in beef. The results showed that these compounds inhibited the growth of five strains intentionally inoculated in the meat (Salmonella typhimurium, Escherichia coli, Listeria monocytogenes, Staphylococcus aureus, and Campylobacter jejuni)(29). Thus, the microbial growth behaved similarly to other results(28,29) when fresh and dry powdered garlic were added directly to camel meat, and a delay in microbial growth during its conservation was reported. Other studies have tested the effectiveness of extracts of garlic in the conservation of carcasses of fresh poultry stored in refrigeration and have shown a significant reduction in microbial contamination, inhibiting the growth of mesophilic microorganisms and reducing the growth of total and fecal coliforms(30), consistently with the inhibition of fecal coliforms in this study. On the other hand, it has been reported that aqueous solutions of garlic on slices of golden catfish (Brachyplatystoma rousseauxii) stored at 4°C showed an improvement in the microbiological quality through inhibition of psychrotrophic bacteria and lactic acid bacteria, among others, for at least 15 d(31). Allicin in garlic has been reported to be a successful antioxidant and antimicrobial agent worth researching, given its benefits in terms of the shelf life of rabbit meat through prevention or reduction of the oxidation of lipids and proteins. The presence of allicin in the carcass may have slowed the growth of microorganisms that contaminate the meat during the quartering(21,32); therefore, this study —like others on the use of thyme (Thymus vulgaris), lactic acid or sumac (Rhus coriaria L.) in the meat of this species— proposes that the shelf life can be extended under the tested conditions. However, further research is required. Significant differences (P≤0.05) were found for the variable pH, both in the treatments and in the shelf life. The range was 6.26 to 7.01 between treatments at the beginning of the shelf life. At its end (at d 9), the range between treatments was 6.54 to 7.08. The pH of the muscle of healthy animals ranges between 7.04 and 7.30, reaching values of 5.50 to 5.70 at 24 h post mortem(33,34,35). The present results for d 9 were slightly higher than those of other values reported(34) (pH 6.0); however, the authors report only for one day of shelf life. Therefore, it is once again suggested that the slight alkalization presented above improves the shelf life. The pH value is affected by the content of glycogen in the muscles, which, in turn, is affected by stress prior to slaughter. As shown in Table 4, the pH values were high during the shelf life, consistently with other reports that suggest that low concentrations of glycogen raise the pH, and that the meat is more susceptible to the microbiological alteration by an early use of amino acids(36,37). However, the present study does not evaluate whether or not glycogen prevented the pH from increasing; this is, therefore, an area of opportunity for future research. As in other protein foods kept in refrigeration and in aerobiosis, the pH of rabbit meat increases as the storage progresses, due to bacterial activity(38); this is consistent with the

695

Rev Mex Cienc Pecu 2020;11(3):686-700

results of the present research, in which the pH values exhibited an increase as the shelf life evolved in all the analyzed treatments. There were no significant differences (P≥0.05) between treatments for the variables brightness, intensity of red and intensity of yellow, or shelf life, (Table 4). The values obtained for b* ranged from 59.76 to 61.38 on the first day of shelf life, and between 56.94 and 65.20 for d 9. Thus, on day 9, the values were found to be slightly below those determined in rabbit meat by other assessments, which mentioned a brightness value of 59.48(39,40). The present values are slightly above those reported in other studies, of 54.9(41). In the case of a*, the range of these reports was 1.21 to 3.75, similar to those indicated by the authors mentioned above (2.49 and 2.84, respectively). In the case of b*, the meat analyzed in the present study had a slightly more yellow color, since the values of this variable ranged between 2.78 and 5.17, consistently with those of other studies, of 4.3(41). Finally, the color was not affected by the treatments, which suggests that the quality of meat treated with aqueous extract of garlic may not modify the purchase decision of the consumers.

Conclusions and implications The addition of aqueous extract of garlic in the diet of rabbits had an effect mainly on the shelf life variable, as it reduced the account of psychrophiles, whereby the quality of the meat was improved, its shelf life, increased by 2 d (adding up to a total of 9 d). However, it had no effect on the production indicators or on the physical quality of the meat (pH and color).

Acknowledgments The authors are grateful to the National Council for Science and Technology (CONACyT) for the support provided throughout the Master’s Program; to the Fund for Capacity Development in Meat Science and Characterization of the Nutritional Value of Commercialized Meats in Mexico and Uruguay for the funding provided, and to the PCARN (Master's and Doctoral Program in Agricultural Sciences and Natural Resources in the Academic Area of Food and Agro-industrial Technology) of the Autonomous University of the State of Mexico (Universidad Autónoma del Estado de México), through which Daniel Arzate Serrano obtained his Master’s Degree. The publication of this paper was funded with resources of PFCE2016.

696

Rev Mex Cienc Pecu 2020;11(3):686-700

Literature cited: 1. González-Miguel ME, López-Malo A. Frutas conservadas por métodos combinados. Temas Selec Ing Alim 2010;4-2: 58-67. https://www.udlap.mx/WP/tsia/files/No4-Vol2/TSIA-4(2)-Gonzalez-Miguel-et-al-2010.pdf. Consultado 30 Mar, 2019. 2. Hernández P. Enhancement of nutritional quality and safety in rabbit meat. Meat Quality and Safety. 9° Word Rabbit Congress. Spain. 2008:1287-1300. 3. Briens C, Arturo-Schaan M, Grenet L, Robert F. Effect of plant extracts on antioxidant status of fattening rabbits. Proc. 11émes Journées de la Recherche Cunicole. France. 2005:217-220. 4. López T. El ajo propiedades farmacológicas e indicaciones terapéuticas. Offarm: Farmacia y Soc 2007;(26):8-81. 5. Goulas AE, Kontominas MG. Combined effect of light salting, modified atmosphere packaging and oregano essential oil on the shelf-life of sea bream (Sparus aurata): Biochemical and sensory attributes. Food Chem 2007;(100):287-296. 6. Cardinali R, Cullere M, Dal-Bosco A, Mugnai C, Ruggeri S, Mattioli S, et al. Oregano, rosemary and vitamin E dietary supplementation in growing rabbits: Effect on growth performance, carcass traits, bone development and meat chemical composition. Livest Sci 2015;(175):83-89. 7. Badr HM. Use of irradiation to control foodborne pathogens and extend the refrigerated market life of rabbit meat. Meat Sci 2004;(67):541-548. 8. Rodríguez JM, García ML, Santos JA, Otero A. Development of the aerobic spoilage flora of chilled rabbit meat. Meat Sci 2005;(70):389-394. 9. Nakyinsige K, Sazili AQ, Aghwan ZA, Zulkifli I, Goh YM, Abu-Bakar F et al. Development of microbial spoilage and lipid and protein oxidation in rabbit meat. Meat Sci 2015;(108):125-31. 10. Pereira M, Malfeito-Ferreira M. A simple method to evaluate the shelf life of refrigerated rabbit meat. Food Control 2015;(49):70-74. 11. Kim YJ, Jin SK, Park WY, Kim BW, Joo ST, Yang HS. The effect of garlic or onion marinade on the lipid oxidation and meat quality of pork during cold storage. J Food Qual 2010;(33):171-185. 12. Salem AZM, Ryena AC, Elghandour MMY, Camacho LM, Kholif AE, Salazar MC, et al. Influence of Salix babylonica extract in combination or not with increasing levels of

697

Rev Mex Cienc Pecu 2020;11(3):686-700

minerals mixture on in vitro rumen gas production kinetics of a total mixed ration. Ital J Anim Sci 2014;(13):873-879. 13. Mariezcurrena-Berasain MD, Mariezcurrena-Berasain MA, Pinzón-Martínez DL, Arzate-Serrano HD, Ugbogu EA, Salem AZM. Influence of dietary supplementation of garlic (Allium sativum L.) extract on cecal productions of total gas, carbon dioxide and fermentation profiles in rabbits. Agroforest Syst 2018;(1):1-9. 14. NOM-033-SAG/ZOO-2014. Norma Oficial Mexicana, Métodos para dar muerte a los animales domésticos y silvestres. México, D.F., Diario Oficial de la Federación. 2014. 15. AFNOR. Microbiology of food and animal feedings stuffs. Enumeration of thermotolerant coliforms by colony-count technique at 44 °C, routine method. Association Française de Normalisation, Paris, France. 1996. 16. NOM-092-SSA1-1994. Norma Oficial Mexicana, Bienes y Servicios. Método para la cuenta de bacterias aerobias en placa. México, DF. Diario Oficial de la Federación. 1994. 17. Carreño WH, López LC. Extracto de ajo como alternativa a los promotores de crecimiento en pollos de engorde. Conexión Agrop JDC 2012;(2):35-43. 18. Ortserga DD, Andyar AC, Anthony TI. Growth performance of growing rabbits fed graded levels of garlic (Allium sativum). Proc 33rd Ann Conf Nigerian Soc Anim Protein. Nigeria. 2008:189-191. 19. Ademola SG, Farinu GO, Adelowo OO, Fadade MO, Babatunde GM. Growth performance antimicrobial activity of garlic and ginger mixture fed to broiler. Proc Nigerian Soc Anim Prod. Nigeria. 2005:71-74. 20. Alagawany M, Ashour EA, Reda FM. Effect of dietary suplementation of garlic (Allium sativum) and turmeric (Curcuma longa) on growth performance, carcass traits, blood profile and oxidative status in growing rabbits. Ann Anim Sci 2016;(16):489-505. 21. Dalle AZ, Celia C, Szendrὅ Z. Herbs and spices inclusion as feed stuf for additive in growing rabbit diets and as additive in rabbit meat: A review. Livestock Sci 2016;(189): 82–90. 22. Hossain MJ, Kamruzzaman M, Akbar MA, Haque MA. Feeding garlic powder on growth performance, nutrient digestibility and carcass characteristics of rabbit. Int J Nat Soc Sci 2015;2(5):74-81. 23. European Commission. Commission Regulation Directive of 8 June 2001 laying down rules for the regular checks on the general hygiene carried out by the operators in establishments according directive 64/433/EEC on health conditions for the productions 698

Rev Mex Cienc Pecu 2020;11(3):686-700

and marketing of fresh meat and directive 71/118/EEC on health problems affecting the production and placing on the market of fresh poultry meat, 471/20001/EEC. Spain. 2001:48-53. 24. López H, Braña VD, Hernández HI. 2013. Estimación de la Vida útil de la Carne. SAGARPA/CONACYT/COFUPRO/INIFAP/UAM/SNITT. SAGARPA 2013;1: 77. http://www.anetif.org/files/pages/0000000034/21-estimacion-de-la-vida-de-anaquelde-la-carne.pdf. Consultado 27 Feb, 2019. 25. Ponce AE, Braña VD, López HL, Delgado SE. Aspectos microbiológicos como indicadores de frescura de la carne. Evaluación de la frescura de la carne. INIFAP 2013;(1):10-23. 26. Rodríguez-Calleja JM, Santos JA, Otero A, García-López ML. Microbiological quality of rabbit meat. J Food Protec 2004;(67):966-971. 27. Margüenda I, Martín NN, Rebollar PG, Robinson MV, Fernández LS, Machota SV, et al. Bleeding efficiency and meat oxidative stability and microbiological quality of New Zealand White rabbits subjected to halal slaughter without stunning and gas stun-killing. Asian Australas J Anim Sci 2014;(27):406-413. 28. Zwietering MH, Jongenburger I, Rombouts FM, Van’t RK. Modeling of the bacterial growth curve. Appl Environ Microb 1990;(56):1875-1881. 29. Zwietering MH, De Koos JT, Hasenack BE, Wit JC, Van’t K. Modeling of bacterial growth as a function of temperature. Appl Environ Microb 1991;(57):109-110. 30. Park SY, Chin KB. Evaluation of pre-heating and extraction solvents in antioxidant and antimicrobial activities of garlic, and their application in fresh pork patties. International J Food Sci Tech 2010;(45):365-373. 31. Yin MC, Cheng WS. Antioxidant and antimicrobial effects of four garlic-derived organosulfur compounds in ground beef. Meat Sci 2003;(63):23-28. 32. Gheisari HR, Ranjbar VR. Antioxidative and antimicrobial effects of garlic in ground camel meat. Turk J Vet Anim Sci 2012;(36):13-20. 33. De Moura KA, Santos-Mendonça RC, De Miranda LA, Dantas MC. Aqueous garlic extract and microbiological quality of refrigerated poultry meat. J Food Process Pres 2005;(29):98-108. 34. Pacheco JV, Tomé E, Guerra M, Raybaudi R. Efecto antioxidante y antimicrobiano de sales de ácidos orgánicos y extractos naturales en filetes de bagre dorado (Brachyplatystoma rousseauxii) refrigerados. Rev Venez Cien y Tec Alim 2011;2(1):016-040. 699

Rev Mex Cienc Pecu 2020;11(3):686-700

35. Albarracín W, Sánchez I. Caracterización del sacrificio de corderos de pelo a partir de cruces con razas criollas colombianas. Revista MVZ Córdoba 2013;(18): 3370-3378. 36. SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Manual de análisis de calidad en muestras de carne. México. 2001. 37. Garrido MD, Bañon S, Álvarez D. Medida del pH. En Cañeque V, Sañudo C, editores. Estandarización de las metodologías para evaluar la calidad del producto (animal vivo, canal, carne y grasa) en los rumiantes. Cádiz, España: INIA; 2005. 38. Dainty RH, Mackey BM. The relationship between the phenotypic properties of bacteria from chill-stored meat and spoilage processes. J Appl Bacteriol 1992;(73):103-114. 39. Nychas JE, Drosinos EH, Board RG. Chemical changes in stored meat. In: Davies A, Board R. The microbiology of meat and poultry. Blackie Acad Prof 1998;1:288-326. https://es.scribd.com/doc/88599812/Microbiology-of-Meat-and-Poultry. Accessed Feb 24, 2019. 40. Liste G, María GA, Villarroel M, López M, Olleta JL, Sañudo C, et al. Efecto del trasporte sobre la calidad de la carne y el bienestar del animal en conejos comerciales durante la estación cálida en Aragón. XXIX Symposium de Cunicultura. Ciudad de México:2004:62-68. 41. Ramírez J. Características bioquímicas del músculo, calidad de la carne y de la grasa de conejos seleccionados por velocidad de crecimiento [tesis doctoral]. Centro de Tecnología de la Carne. Barcelona, España: Universidad de Barcelona; 2004.

700

https://doi.org/10.22319/rmcp.v11i3.5420 Article

Essential oil and bagasse of oregano (Lippia berlandieri Schauer) affect the productive performance and the quality of rabbit meat

Jesica Leticia Aquino-López a América Chávez-Martínez a José Arturo García-Macías a Gerardo Méndez-Zamora b Ana Luisa Rentería-Monterrubio a* Antonella Dalle-Zotte c Luis Raúl García-Flores a

a Universidad

Autónoma de Chihuahua. Facultad de Zootecnia y Ecología, Km. 1. Periférico Francisco R. Almada, Chihuahua, Chih. México. b

Universidad Autónoma de Nuevo León. Facultad de Agronomía. General Escobedo, Nuevo León, México. c

Universidad de Padua. Departamento de Medicina, Producción y Salud Animal. Legnaro, Italia.

* Corresponding author: arenteria@uach.mx

Abstract: The present study assessed the effect of incorporating essential oil of oregano (EOO) and oregano bagasse (OB) into the diet on the productive parameters and on the variables sacrifice and quality of rabbit meat. A total of 100 rabbits (30 d of age) were distributed in six treatments T1: control, T2: 0.25 g/kg of EOO, T3: 0.40 g/kg of EOO, T4: 20% of OB, T5: 0.25 g/kg of EOO + 20% of OB, and T6: 0.40 g/kg of EOO + 20% of OB. The greatest

701

Rev Mex Cienc Pecu 2020;11(3):701-717

live weight was that of T6 (PË&#x201A;0.0001). At d 37, 44 and 51, T3 exhibited the lowest food intake (P=0.0089), and T6 had the best weight gain (P=0.0172). Food conversion was best (P=0.0138) in T5 at d 37. The yield of the cold carcass and loin was highest in T2, T4 and T5 (P<0,001). The pH increased (P=0.0190) at 10 d post mortem in T1, T4, T5, and T6. The water retention capacity was greater (P=0.0500) in T2, T4, and T6; a* increased (P<0.0004) on d 10 post mortem, and b* was lower (P<0.0430) in T2 at 24 h and 1at 0 d post mortem. In conclusion, 0.25 and 0.40 g/kg of EOO with 20% of OB had a positive influence on the productive behavior and on the variables slaughter, carcass characteristics, and quality of rabbit meat. Key words: Essential oil, Productive behavior, Slaughter, Carcass, Meat, Color.

Received: 21/06/2019 Accepted: 28/08/2019

Introduction Rabbit meat stands out for its characteristics and nutritional properties, being a low-fat, lean meat (60 % of the total fatty acids are unsaturated), rich in minerals (potassium, phosphorus and magnesium), proteins and amino acids of high biological value, low in cholesterol and sodium(1-4). Oregano is an aromatic plant whose essential oil (EOO) contains thymol and carvacrol, which confer it an antioxidant and antimicrobial effect(5,6). By removing the essential oil of oregano, a residue called oregano bagasse (OB) â&#x20AC;&#x201D;rich in flavonoids, with antioxidant and antimicrobial activityâ&#x20AC;&#x201D; is obtained(7,8). In the industry of oregano, the marketing product is the essential oil, while the bagasse is considered as waste(9). Mexican oregano (Lippia berlandieri Schauer) is a species characterized by a strong odor and high yield of essential oils(10), characteristics ascribed to its high content of carvacrol, which exceeds that of Origanum vulgare(11). The main chemical compounds of the genus Lippia are carvacrol, thymol, cimene, pinene, and linalool. These components provide it with antibacterial, antioxidant, antiviral, anti-fungal, and insecticide activity(12). EOO has been used in the production and fattening of rabbits(13,14,15,16), as have other plant extracts and essential oils. However, no effect of OB on the productive behavior and the quality of the rabbit meat has been reported. Even the effect of essential oils on the productivity of rabbits is controversial and is still being researched.

702

Rev Mex Cienc Pecu 2020;11(3):701-717

The rabbit is able to benefit from a wide variety of ingredients in its diet because of its digestive physiology(17,18), which makes it possible to include different ingredients in its diet in order to improve the productive characteristics and modify the characteristics of its meat(13,19). The objective of this study was to evaluate the effect of the essential oil of oregano and oregano bagasse on the production parameters and quality of rabbit meat.

Material and methods Breeding and treatments

Mestizo rabbits (n= 100) of both sexes (44 females and 56 males) aged 30 ± 2 d and an initial weight of 0.778 ± 0.190 kg were utilized. The rabbits were randomly distributed into six treatments; T1: control (n=18), T2: 0.25 g/kg of EOO (n=14), T3: 0.40 g/kg of EOO (n=16), T4: 20% of OB (n=16), T5: 0.25 g/kg of EOO + 20% of OB (n=18), and T6: 0.40 g/kg of EOO + 20% of OB (n=18). The EOO was extracted from the leaves of oregano through dragging with water vapor, according to the protocol to the Biological Research Center of Northwest Mexico(20). The bagasse had the following composition: 11.5 7± 0.29 % of crude protein, 1.79 ± 0.18 % of ethereal extract, 14.05 ± 1.30 of fiber, 6.31 ± 0.25 of ashes, and 39.36 ± 0.25 of dry matter. The experimental unit (EU) consisted of two rabbits of the same sex per cage; T1 (9 repeats), 4 EU females and 5 EU males; T2 (7 repeats), 3 EU females and 4 EU males; T3 (8 repeats), 3 EU females and 5 EU males; T4 (8 repeats), 4 EU females and 4 EU males; T5 (9 repeats), 5 EU females and 4 EU males, and T6 (9 repeats), 3 EU females and 6 EU males. The rabbits were housed in wire cages (45 x 60 x 40 cm) during 42 days in an environment with 16 h of light and 8 h of darkness and were offered feed and water ad libitum (Table 1). The care and management of rabbits during the research were in accordance with the provisions of the Official Mexican Standard NOM-062-ZOO(21).

703

Rev Mex Cienc Pecu 2020;11(3):701-717

Table1: Experimental supplemented feed rations supplied to the rabbits Treatment T1 T2 T3 T4 T5 T6

Ingredients (%)

WB V&M CC

Salt

74.10 73.40 73.10 46.20 45.71 45.42

19.50 19.50 19.80 20.90 21.12 21.19

2.60 2.65 2.65 0.00 0.00 0.00

1.00 1.06 1.06 2.15 2.23 2.18

0.50 0.53 0.53 1.08 1.09 1.09

0.40 0.19 0.19 0.30 0.30 0.30

0.00 0.00 0.00 0.50 0.50 0.50

16.00 0.80 0.80 5.90 5.90 6.00

0.60 0.60 0.60 0.60 0.50 0.50

2.20 1.09 1.09 2.21 2.23 2.24

EOO (g/kg) 0.00 0.250 0.400 0.000 0.250 0.400

OB (%) 0.00 0.00 0.00 20.00 20.00 20.00

T1= control (n=18), T2= 0.25 g/kg of EOO (n=14), T3= 0.40 g/kg of EOO (n=16), T4= 20% of OB (n=16), T5= 0.25 g/kg of EOO + 20% of OB (n=18), T6= 0.40 g/kg of EOO + 20% of OB (n=18). C= corn; SM= soybean meal; WB= wheat bran; V&M= premix of vitamins and minerals; CC= calcium carbonate; DP= dicalcium phosphate; ME== methionine; LY= lysine; VO= vegetable oil; EOO= essential oil of oregano; OB= oregano bagasse.

Productive behavior

The initial weight (IW, kg) of each rabbit was registered at the beginning of the experiment. The studied variables were the weight of the rabbit (WR, kg), and food intake (FI, kg) at days 37, 44, 51, 58, 65 and 72 of fattening. The data obtained were utilized to estimate the daily weight gain per week [WWG; (finalWR – initialWR - IW) / days] and the food conversion (FC; FI / WR) as food intake depending on the weight of the rabbits.

Slaughtering, carving of the carcass and the meat sampling

After the period of fattening, the rabbits were identified and transported to the Complex of Meat Science of the University for slaughtering according to the guidelines of the Official Mexican Standard NOM-033-SAG/ZOO(22) and Simonová et al(23). The transportation time was less than 10 min. The rabbits were not given fasting time before being slaughtered. They were desensitized through dislocation of the atlanto-occipital joint, and immediately hung on slaughter hooks by the rear legs in the process line and quickly bled dry through a cut in the neck (jugular vein and carotid artery) during 3 min. Afterward, the front legs, the head, and the skin with the tail were carefully separated; immediately after, the rabbits were eviscerated, their rear legs were separated and the open carcasses were washed. Finally, the carcasses were drained during 5 min and stored at 4 ± 1.0 °C for 24 h. During this process, the weight at slaughtering (WS), the weight of the blood, the skin with the tail, the front and rear legs, the head, the viscera and the weight of the hot carcass (n= 100) were registered; thus, these weights were expressed as percentages of the WS and considered as slaughter variables: blood, skin, head, feet, viscera, and hot carcass yield (HCY). The weight of the 704

Rev Mex Cienc Pecu 2020;11(3):701-717

cold carcass took 24 h post mortem to determine the cold carcass yield (CCY). The average weight at slaughtering was 1.86 ± 0.44 kg. The primary cuts (quartering: spine, legs, arms and ribs) of the carcasses obtained (n= 100) were performed according to the harmonization criteria described by Blasco and Ouhayoub(24). The weights of the parts are expressed in terms of the WR. The carcass was devoid of the head, liver, kidneys and thoracic organs. Finally, the Longissimus lumborum muscles were separated and stored (4 ± 1.0 °C) until the quality of meat was assessed.

Physical-chemical properties of the meat

The physical-chemical evaluation of the meat was made by triplicate, using for this purpose the Longissimus lumborum muscle, at 24 h and 10 d post-mortem. The pH was measured with a potentiometer with a puncture electrode (Sentron® Integrated Sensor Technology, Model 101); these values were converted to antilogarithm for analysis. The water retention capacity (WRC) was determined according to the technique described by Owen et al(25); 0.3 g of meat were compacted under a weight of 5 kg per 10 min; the WRC was calculated based on the difference in weight before and after the pressure, expressed as a percentage. The color was assessed using the CIE Lab(26) system, L* (luminance), a* (tendency to red), and b* (tendency to yellow) with a spectrophotometer (Konica Minolta®, Tokyo, Japan; CIE standard illuminant/Observer: D65/10).

Statistical analysis

The data for the productive behavior were analyzed with the PROC MIXED(27), and the initial weight of rabbits was used as a covariate. The variables slaughter, carving and meat quality (24 h and 10 d) were analyzed using the general linear model(27). When there was difference (P≤0.05) between treatments, the averages of the variables were analyzed with Tukey’s statistical test.

705

Rev Mex Cienc Pecu 2020;11(3):701-717

Results and discussion Table 2 shows the productive behavior of rabbits supplemented with essential oil and bagasse of Mexican oregano. The rabbits supplemented with OB had higher weights. At the age of 37 ds (P<0.0001), the rabbits of the T4 exhibited the highest weight (1.12 kg), while the rabbits with the control diet (T1) had the lowest weighs (0.90 kg). At 44, 51, 58, 65 and 72 d of age (P<0.0001), the highest live weights were found in T6 (1.38, 1.51, 1.79, 1.88 and 2.08 kg), and the lowest, in T3 (1.03, 1.08, 1.32, 1.57 and 1.67 kg). The results obtained at 37 d of age may be associated with the fact that the adaptation period of the intestinal flora of the rabbits with oregano was still ongoing(28), so that a lower dose and the biological activity of the OB led to better weights. The above can be confirmed by the results of the subsequent periods, where the higher weights occurred in the rabbits supplemented with 400 ppm of EOO + OB; at this stage, the rabbits were already adapted to the dose of EOO, whose biological activity coupled with that of OB was expressed as positive. Abdel-Khalek(29) pointed out that supplementation of rabbits with antioxidants such as alpha tocopherol acetate and vitamin C has a positive effect on the production parameters. On the other hand, the supply of fiber from the OB was able to contribute to the balance of the intestinal flora, positively influencing the feed efficiency(30). T1 and the treatments with essential oil (T2 and T3) behaved in a similar way (P=0.9403). These results coincide with those obtained by Cardinali et al(15), who found no difference in the live weight of the rabbits when adding essential oils to their diet.

706

Rev Mex Cienc Pecu 2020;11(3):701-717

Table 2: Productive behavior of rabbits supplemented with essential oil of oregano and oregano bagasse (the least-squares mean ± standard error) Variable/ Age (days)

Treatments T1

0.36 ± 0.11ab 0.54 ± 0.11

0.37 ± 0.10b 0.27 ± ab 0.10 0.42 ± 0.10a 0.32 ± 0.10

Live weight (kg) 0.94 ± 1.12 ± bc a 0.08 0.08 1.03 ± 1.31 ± 0.08c 0.08ab 1.08 ± 1.45 ± 0.08c 0.08ab 1.32 ± 1.69 ± 0.08c 0.08ab 1.57 ± 1.78 ± 0.08b 0.08ab 1.67 ± 1.97 ± b ab 0.08 0.08 Feed intake (kg) 0.39 ± 0.79 ± 0.10b 0.10a 0.19 ± 0.32 ± b ab 0.10 0.10 0.20 ± 0.39 ± 0.10b 0.10ab 0.41 ± 0.10 0.42 ± 0.10

0.40 ± 0.12

0.53 ± 0.11

0.76 ± 0.11

37 44 51 58 65 72

0.90 0.08bc 1.07 0.08abc 1.16 0.09ab 1.44 0.09bc 1.53 0.09ab 1.72 0.09ab

± ± ± ± ± ±

0.34 ± 0.10b

0.26 ± 0.10b

0.92 0.08c 1.07 0.08bc 1.21 0.08bc 1.37 0.08bc 1.52 0.09b 1.68 0.09ab

± ± ± ± ± ±

0.35 ± 0.11

T5 1.10 0.08ab 1.33 0.08ab 1.44 0.08ab 1.62 0.08ab 1.77 0.08ab 1.99 0.08ab

Pvalue

T6 ± ± ± ± ± ±

1.09 0.08ab 1.38 0.08a 1.51 0.08a 1.79 0.08a 1.88 0.08a 2.08 0.08a

± ± ± ± ± ±

< 0.0001 < 0.0001 < 0.0001 < 0.0001 0.0002 0.0031

0.72 ± 0.10a 0.35 ± ab 0.10 0.45 ± 0.10a 0.35 ± 0.10

0.74 ± 0.10a 0.47 ± a 0.10 0.45 ± 0.10a 0.44 ± 0.10

< 0.0001

0.51 ± 0.10

0.39 ± 0.10

0.0520

0.0089 0.0170 0.4518

72 0.74 ± 0.11 0.59 ± 0.11 0.39 ± 0.11 0.63 ± 0.10 0.73 ± 0.10 0.70 ± 0.10 0.6343 T1= control (n=18), T2= 0.25 g/kg of EOO (n=14), T3= 0.40 g/kg of EOO (n=16), T4= 20% of OB (n=16), T5= 0.25 g/kg of EOO + 20% of OB (n=18), and T6= 0.40 g/kg of EOO + 20% of OB (n=18). abc Different letters between columns indicate significant difference (P˂0.05).

The food intake was influenced by the effect of the treatments (P<0.0001). At 37 d of age, the highest intake (0.79 kg) occurred in the T4 rabbits. At d 44 (P=0.0089), the rabbits of T6 exhibited a higher intake (0.47 kg), while the rabbits of T3 had the lowest intake (0.19 kg). At 51 d of age (P=0.0170), the animals of T2, T5 and T6 exhibited the highest consumption (0.42, 0.45 and 0.45 kg, respectively); in the same period, the rabbits of T3 had the lowest food intake (0.20 kg). From d 58 to d 72, the treatment did not influence the food intake (P=0.4518, 58 d; P=0.0520, 65 d; P=0.6343, 72 d). The results could be due to the fiber type provided by the OB; Marguenda et al(31) mentioned that the level and type of fiber are important factors to regulate the retention time in the caecum and, therefore, the food intake. On the other hand, Bakkali et al(5) indicated that some components of essential oils do not have specific cellular targets, but can cause some degree of membrane toxicity similar to the mechanism of bactericidal action. In eukaryotic organisms, they cause depolarization of the mitochondrial membranes, decreasing the membrane potential, which affects certain ion 707

Rev Mex Cienc Pecu 2020;11(3):701-717

channels, and, as a result, the pH decreases and modifies the digestive enzyme activity. In this regard, it has been noted(32) that phenolic compounds present in the oregano favor the absorption of nutrients and stimulate the secretion of digestive enzymes. This may have caused the animals fed with OB to have, at d 37, 44 and 51, a higher intake and live weight, while in the rest of the periods there was no difference between treatments, probably because the animals were already accustomed to the food and increased their intake with respect to previous periods. The weekly weight gain was influenced by effect of the treatments (Table 3). At d 37 (P<0.0001), the rabbits supplemented with OB (T4) exhibited the greatest gains (0.34 kg), while those of T1 and T2 had lower gains (0.13 kg). At 44 d of age, (P=0.0172) the best weight gain (0.28 kg) was observed in T6, whereas the lowest was found in T3 (0.09 kg). At d 51 (P=0.0126), the highest weight gains were registered in T2, T4 and T6 (0.14 kg), and lowest, in T3 (0.05 kg). At d 65 (P=0.0257), the rabbits of T3 had the greatest weight gain (0.23 kg), while the animals of T6 were the ones that gained the least weight (0.10 kg). At d 58 (P=0.3752) and 72 (P=0.7100), no difference in weight gain was found; this is consistent with the food intake during these periods, which was similar in all treatments. The greater weight gains at d 37, 44 and 51 of T6 can be accounted for by the higher food intake observed in this treatment during the same period. The results show a clear relationship between food intake and weight gain, suggesting that supplementation with oregano influences weight gain. Table 3: Productive efficiency of rabbits supplemented with essential oil and bagasse of Mexican oregano (least mean squares ± standard error) Varia ble/ Age (days)

Treatments T1

Pvalue

Weekly weight gain (kg) 37

0.13 ± 0.05b

0.15 ± 0.05b

0.34 ± 0.05a

0.32 ± 0.05a

0.31 ± 0.05a

< 0.0001

0.17 ± 0.05ab

0.16 ± 0.05ab

0.09 ± 0.05b

0.19 ± 0.05ab

0.22 ± 0.05ab

0.28 ± 0.05a

0.0172

0.11 ±

0.05ab

0.05a

0.0126

0.37 ± 0.05 0.05ab

0.11 ±

0.20 ± 0.05

0.14 ±

0.05a

0.17 ± 0.05 0.15 ±

0.05ab

0.17 ± 0.05

0.05 ±

0.05b

0.25 ± 0.05 0.23 ±

0.05a

0.10 ± 0.05

0.14 ±

0.05a

0.23 ± 0.05 0.09 ±

0.05b

0.19 ± 0.05

0.12 ±

0.18 ± 0.05 0.15 ±

0.05ab

0.14 ±

0.27 ± 0.05 0.10 ±

0.05b

0.3752 0.0257

0.22 ± 0.05

0.20 ± 0.05

0.7100

Feed conversion 0.26a

3.62 ±

3.48 ± 0.26

3.76 ± 0.28

3.00 ± 0.26ab

2.35 ± 0.26b

2.24 ± 0.26b

2.69 ± 0.26ab

0.0138

3.64 ± 0.26

4.61 ± 0.26

3.82 ± 0.26

3.30 ± 0.26

3.52 ± 0.26

0.1764

3.40 ± 0.26

4.09 ± 0.26

3.16 ± 0.26

3.97 ± 0.26

3.35 ± 0.26

0.1310

2.91 ±

0.26ab

708

Rev Mex Cienc Pecu 2020;11(3):701-717

3.67 ± 0.29

3.88 ± 0.26

3.93 ± 0.26

4.00 ± 0.27

3.51 ± 0.26

3.94 ± 0.26

0.5642

4.08 ± 0.30

4.31 ± 0.27

3.57 ± 0.27

4.02 ± 0.27

4.04 ± 0.26

4.15 ± 0.26

0.2297

4.13 ± 0.28

3.87 ± 0.27

4.05 ± 0.27

3.64 ± 0.27

3.57 ± 0.26

3.72 ± 0.26

0.1695

T1= control (n=18), T2= 0.25 g/kg of EOO (n=14), T3= 0.40 g/kg of EOO (n=16), T4= 20% of OB (n=16), T5= 0.25 g/kg of EOO + 20% of OB (n=18), and T6= 0.40 g/kg of EOO + 20% of OB (n=18). ab Different letters between columns indicate significant difference P˂0.05).

The food conversion (FC) was influenced by effect of the treatments at the start of the study. At d 37 (P=0.0138), the best conversion occurred in T5 (2.24), while the control treatment had the highest FC (3.62). At d 44 (P=0.1764), 51 (P=0.1310), 58 (P=0.5642), 65 (P=0.2297) and 72 of age (P=0.1695), the treatment did not influence the FC. The results found may be due to the fact that, during the first days of study, the rabbits had been recently weaned and moved to their new accommodations, which may have caused them a certain level of stress. However, the rabbits that consumed oregano exhibited the best conversion, and, according to Abdel-Khalek(29), the addition of antioxidants to the diet of the rabbits helps to reduce the negative effects of stress. The above can be corroborated by the findings of the subsequent weeks, which showed that the rabbits were already accustomed to the external conditions, and, therefore, they did not exhibit a significant difference for food conversion in these periods. Table 4 shows the effect of the essential oil and bagasse of oregano on the slaughtering and the characteristics of rabbit carcasses. The hot carcass yield (HCY) exhibited an effect of the treatments (P<0.0004); T2 (48.19 %), T4 (50.66 %) and T5 (49.87 %) had the highest yield, and T1 had the lowest (44.27 %). The yield of the organs of the digestive tract was also influenced by the treatments (P<0.0020); T4 had the lowest yield (21.02 %), while T1 and T3 had the highest yields (29.67 and 28.36 % respectively). The head yield (P<0.0050) was highest in the rabbits of T1 (10.28 %) and lowest in those of T4 (8.70 %) and T6 (8.68 %). The yield of the thoracic viscera (P=0.4064), legs (P=0.6988), skin (P=0.0542) and blood (P=0.0530) was not influenced by effect of the treatments. The lower yield of abdominal viscera can be attributed to the fiber provided by OB, as this can stimulate peristaltic movements mechanically, which promote the circulation of the contents of the gastrointestinal tract(33); at the same time, it may regulate these processes through the compounds generated by the fermentation of the ingested food(30). On the other hand, the greater yields observed in treatments with oregano can be ascribed to the fact, pointed out by Hernández and Dalle Zotte(19), that the rabbits have the ability to improve the incorporation of the fatty acids and nutrients provided by the diet into the muscle. This suggests that the rabbits supplemented with oregano incorporated some of its compounds into the meat, and, therefore, the chemical characteristics of the meat were modified, increasing the yield.

709

Rev Mex Cienc Pecu 2020;11(3):701-717

Table 4: Effect of the essential oil and bagasse of oregano on the yield of the meat and non-meat components of the rabbits (%) Treatment

Hot carcass Cold carcass

Pvalue

44.27±1.12b

48.19±1.00a

47.27±1.24a

50.66±1.18a

49.87±1.00

47.20±0.97a

<0.004

47.80±0.93a

46.62±1.16a

48.54±0.93

46.87±0.91a

23.39±0.76

23.44±0.74c

43.07±1.05b

49.63±1.10a

24.49±0.76b

28.36±0.94a

21.02±0.90c

<0.001

Digestive tract

29.67±0.85a

Thoracic viscera2

1.22±0.43

1.19±0.38

1.14±0.47

1.10±0.45

1.18±0.38

1.19±0.37

Head

10.28±0.31a

9.085±0.27b

10.27±0.34a

8.70±0.32c

9.07±0.27bc

8.68±0.27c

<0.005

Feet and hands

3.91±1.03

5.37±0.91

3.89±1.14

3.51±1.09

3.61±0.91

4.63±0.89

Skin

8.01±0.53

8.02±0.47

9.03±0.59

10.03±0.56

9.25±0.47

9.28±0.46

Blood

3.14±0.54

4.62±0.48

2.65±0.60

4.45±0.57

3.26±0.48

4.19±0.47

37.58 ± 0.92

14.30 ± 0.37

24.89 0.61a

<0.000 1

<0.002

Yield of technological cuts (%) Leg

37.72 ± 1.11

36.83 ± 0.97

37.63 ± 1.26

37.72 ± 1.15

39.22 0.97

Arms

14.56 ± 0.44

13.37 ± 0.38

14.46 ± 0.50

14.21 ± 0.46

14.57 0.38

Loin

20.94 0.74b

24.65 0.64a

23.46 0.84ab

25.27 0.76a

26.06 0.64a

Rib cage

20.24 ± 0.59

21.94 0.51

20.98 ± 0.51

21.90 ± 0.67

22.49 ± 0.61

21.90 ± 0.49

T1= control (n=18), T2= 0.25 g/kg of EOO (n=14), T3= 0.40 g/kg of EOO (n=16), T4= 20% of OB (n=16), T5= 0.25 g/kg of EOO + 20% of OB (n=18), T6= 0.40 g/kg of EOO + 20% of OB (n=18). Thoracic viscera: Lungs, trachea, esophagus, and heart. abc Different letters in the same row indicate significant difference (P˂0.05).

With respect to the yield of the technological cuts of the carcass, supplementation with EOO and OB did not influence the yield of the legs (P=0.6256), the arms (P=0.1585) or the ribs (P=0.1810); however, it did increase the yield of the loin (P<0.0001) in T2 (24.65 %), T4 (25.27 %), T5 (26.06 %), and T6 (24.89 %). According to Dalle Zotte and Szendrö(3), of the pieces that make up the carcass (legs, arms, ribs and spine), the spine exhibits a low fat content; however, the rabbit has the ability to incorporate the fatty acids provided by the diet into the lipid tissue and the inter- and intramuscular fat; this may account for the higher yield of the spine of the animals fed with oregano. As for the legs, arms and ribs, no significant difference was found (P>0.05) between the treatments, since they normally have a higher fat content.

710

Rev Mex Cienc Pecu 2020;11(3):701-717

On the other hand, Garcia et al(34) found that caecal fermentation generates varying amounts of volatile fatty acids from the fiber provided by the diet, which, when partially absorbed, cover 10 to 30 % of the energy requirements of maintenance energy(35,36,37), representing additional energy to what was expected at the time of balancing the food ration. As for pH, it was found that the pH of the meat of the rabbits in T1 and T4 increased (P=0.0190) with time (5.18 - 5.90 and 5.75 - 5.90, at 24 h and 10 d post-mortem, respectively), while the meat of T2 and T3 remained equal (P>0.5524) over time (Table 5). Table 5: Effect of the essential oil and bagasse of oregano on the pH, water retention capacity and color of the rabbit meat Treatments T1

Pvalue

24 h post mortem pH

5.18±0.03b

5.80±0.03ab

5.82±0.03a

5.75±0.03b

5.76±0.03b

5.73±0.02b

0.0002

WRC (%)

55.99±1.45ab

59.40±1.62a

53.07±1.77b

60.30±1.45a

57.52±1.45ab

60.59±1.45a

0.0500

62.26±0.82

56.60±0.73

59.78±1.01

56.66±0.91

57.06±0.76

57.19±0.66

0.3373

5.63±0.68

4.09±0.62

4.84±0.82

3.73±0.74

4.51±0.64

4.08±0.56

0.3111

7.51±0.44a

4.44±0.40c

6.34±0.52a

4.68±0.47bc

5.33±0.41bc

5.18±0.37bc

0.0430

10 days post mortem pH

5.90±0.03

5.87±0.03

6.00±0.04

5.90±0.03

5.89±0.03

5.92±0.03

0.5464

55.90±0.82

57.92±0.73

57.47±0.95

58.73±0.91

56.50±0.70

58.59±0.71

0.3373

9.23±0.68

6.95±0.62

7.71±0.78

6.89±0.74

7.63±0.60

6.25±0.60

0.3111

7.11±0.44a

4.94±0.40b

6.82±0.49a

5.81±0.47ab

5.57±0.39ab

5.76±0.39ab

0.0430

L* = luminance; a* = tendency to red; b* = tendency to yellow; pH= potential for hydrogen; WRC= water retention capacity. T1= control (n=18), T2= 0.25 g/kg of EOO (n=14), T3= 0.40 g/kg of EOO (n=16), T4= 20% of OB (n=16), T5= 0.25 g/kg of EOO + 20% of OB (n=18), T6= 0.40 g/kg of EOO + 20% of OB (n=18). ab Different letters between rows indicate difference between treatments in the post mortem time (P˂0.05).

711

Rev Mex Cienc Pecu 2020;11(3):701-717

The WRC was influenced by effect of the treatments (P=0.0500); the meat of T2, T4 and T6 showed higher WRC (48.89, 60.30 60.59 %, respectively), and T3 (53.07 %) exhibited the lowest WRC. The antioxidant activity of the oregano on muscle fibers(38) may have influenced the WRC, since in species such as the chicken, the addition of antioxidants in the diet has been found to preserve the functionality of the membranes and increase their activity as a semi-permeable barrier(39). Conversely, Meineri et al(40) did not find the same effect when adding Salvia hispanica to the diet of rabbits. On the other hand, the pH is directly related to the WRC, and this can vary according to the hydrolysis of proteins with the release of ammonia and the hydrolysis of lipids with the release of fatty acids(41). It has been said(42) that essential oils can coagulate the cytoplasm by damaging the lipids and proteins; damage to the cell membrane can cause the release of macromolecules and lysis(43,44) by modifying the pH(5), which would affect the stability of the proteins directly impacting the WRC(45). On the other hand, Dalle Zotte and Szendrรถ(3) mentioned that rabbit meat is characterized by being rich in unsaturated fatty acids; this entails a problem for the meat, because it renders it more sensitive to oxidation(29); as a result, the functionality of the cell membranes is partially or totally reduced(40). Various studies(2,3,46) reported antioxidant activity by the compounds of oregano; however, Cox et al(42) found that certain components of aromatic plants such as oregano can have a negative effect on lipids and proteins because they do not have specific cellular receptors(5); this may be attributed to the difference in pH found at 24 h and 10 d post mortem in the meat of T4. With regard to the color, the luminance (L*) was not influenced by the treatments (P=0.3373) at 24 h and 10 d post mortem, with the exception of the T1 at 24 h to 10 d, since the meat of T1 had more luminance at 24 h. The tendency to red (a*) was not influenced by the treatment (P=0.3111) but it was by the time (P<0.0004), as at 10 d post mortem the value of a* increased in all the treatments. The tendency to yellow (b*) was influenced by the effect of the treatments (P<0.0430); T1 and T3 showed the highest value, while T2 had the lowest. The results of this study differ from those reported by some authors who found no effects when adding oregano leaves(14) to the diet, and EOO to the water supplied to growing rabbits(23); this may be due to the fact that the dose of EOO administered was lower than the one evaluated in this research for the essential oil and bagasse of Mexican oregano, which may have influenced the color of the meat, and to the content of certain phenolic compounds(47). In other species such as birds, high doses of essential oil (500 mg kg-1) in the diet have been observed to cause a significant antioxidant effect(48). In addition, the presence of oxygen on the muscle fiber oxidizes the meat, taking up a darker color(45); this would explain the high value of a* found at 10 d post mortem in all treatments, and the lower L* in the control treatment (T1), which is indicative of the effect of the antioxidant activity of the compounds of the oregano(49). This could suggest changes in the nutritional and physical characteristics of the meat that may be of interest to researchers.

712

Rev Mex Cienc Pecu 2020;11(3):701-717

Conclusions and implications The results confirm that OB can be an integral part of the diet of rabbits for fattening. Including 20 % of bagasse of oregano into the diet positively influences the daily weight gain, the food conversion, and the carcass and loin yield, and increases the water retention capacity; likewise, the combination 0.25 g kg-1 of EOO + 20% of OB has a similar effect. Finally, the minimum concentration of essential oil of oregano (0.25 g kg-1 of EOO) is sufficient to influence the productive characteristics and quality of the rabbits. In conclusion, incorporating essential oil and bagasse of oregano (alone or in combination) into the diet of rabbits for fattening improves the productive characteristics and the quality of the carcass and the meat.

Literature cited: 1. Dalle Zotte, A. Perception of rabbit meat quality and major factors influencing the rabbit carcass and meat quality. Livest Prod Sci 2002;75(1):11-32. 2. Pla, MA. comparison of the carcass traits and meat quality of conventionally and organically produced rabbits. Livest Sci 2008;115(1):1-12. 3. Dalle-Zotte A, Szendrö Z. The role of rabbit meat as functional food. Meat Sci 2011;88: 319-331. 4. Cullere M, Dalle Zotte A. Rabbit meat production and consumption: State of knowledge and future perspectives. Meat Sci 2018;143;137-146. 5. Bakkali F, Averbeck S, Averbeck D, Idaomar M. Biological effects of essential oils, review. Food Chem Toxicol 2008;46(2):446-475. 6. García-Pérez E, Castro-Álvarez FF, Gutiérrez-Uribe JA, García-Lara S. Revision of the production, phytochemical composition, and nutraceutical properties of Mexican oregano. Rev Mex Cienc Agríc 2012;3(2):339-353. 7. Zavala N, Loarca P, García G. Evaluación del contenido fenólico, capacidad antioxidante y actividad citotóxica sobre células CaCo-2 del extracto acuoso de orégano (Lippia graveolens kunth). Congreso Nacional de Química Médica, Querétaro, México. 2006. 8. Corral TLC. Aprovechamiento de los residuos que se generan en la extracción del aceite esencial de orégano (Lippia graveolens HBK.s.l.) [tesis maestría]. Instituto Politecnico Nacional. Durango, Mexico; 2011.

713

Rev Mex Cienc Pecu 2020;11(3):701-717

9. Rolando A. Aceite esencial de orégano: tratamiento por digestión anaeróbica de los residuos generados en su obtención [tesis licenciatura]. Buenos Aires, Argentina. Universidad Nacional de Luján; 2007. 10. Avila-Sosa R, Gastelum-Franco MG, Camacho-Davila A, Torres-Muñoz JV, NervárezMoorillon GV. Extracts of Mexican Oregano (Lippia berlandieri schauer) with antioxidant and antimicrobial activity. Food Bioprocess Technol 2010;3(3):434-440. 11. Arcila-Lozano CC, Loarca-Piña G, Lecona-Uribe S, Gonzales de Mejía E. El orégano: propiedades, composición y actividad biológica de sus componentes. Arch Latinoam Nutr 2004;54(1):100-111. 12. Vazquez SR, Dunford NT. Bioactive components of Mexican oregano oil as affected by moisture and plant maturity. J Essent Oil Res 2005;17:668-671. 13. Soultos N, Tzikas Z, Christaki E, Papageorgiou K, Steris V. The effect of dietary oregano essential oil on microbial growth of rabbit carcasses during refrigerated storage. Meat Sci 2009;81:474-478. 14. Rotolo R, Gai F, Nicola S, Zoccarato I, Brugiapaglia A, Gasco L. Dietary supplementation of oregano and sage dried leaves on performances and meat quality of rabbits. J Integr Agr 2013;12:1937-1945. 15. Cardinali R, Dal-Bosco A, Mugnai C, Matiolis S, Ruggeri S, Dalle-Zotte A, Sartori A, Cullere M, Castellini C. Proc 10 th World Rabbit Congress. Effect of different dietary aromatic essences on meat quality of rabbit. W.R.S.A. Shark El-Sheikh, Egypt. 2012. 16. Méndez-Zamora G, Durán-Meléndez LA, Aquino-López JL, Santellano-Estrada E, SilvaVázquez R. Efecto del aceite de orégano (Poliomintha longiflora Gray) sobre la productividad y calidad de carne de conejos. Ecosistemas y Recursos Agropecuarios 2016;3:259-265. 17. Carabaño R, Piquer J, Menoyo D, Badiola I. The digestive system of the rabbit. In: de Blas C, Wiseman J editors. Nutrition of the rabbit. 2nd ed. Wallingford, UK: CAB International; 2010:1-18. 18. Mora-Valverde D. Usos de la morera (Morus alba) en la alimentación del conejo. El rol de la fibra y la proteína en el tracto digestivo. Agronomía Mesoamericana 2010;21:357366. 19. Hernández P, Dalle Zotte A. Influence of diet on rabbit meat quality In: de Blas C, Wiseman J editors. Nutrition of the rabbit. 2nd ed. Wallingford, UK: CAB International; 2010;163-178.

714

Rev Mex Cienc Pecu 2020;11(3):701-717

20. Rodríguez-Álvarez M, Alcaraz-Meléndez L, Real-Cosío SM. Procedimientos para la extracción de aceites esenciales en plantas aromáticas. Centro de Investigaciones Biológicas del Noroeste, SC. La Paz, Baja California Sur, México. 2012. 21. NOM-062-ZOO-1999. Especificaciones técnicas para la producción, cuidado y uso de animales de laboratorio. Norma Oficial Mexicana 1999. http://www.economianoms.gob.mx/noms/consultasAction.do. Consultado 15 May, 2019. 22. NOM-033-SAG/ZOO-2014. Métodos para dar muerte a los animales domésticos y silvestres. Norma Oficial Mexicana 2014. http://www.economianoms.gob.mx/noms/consultasAction.do. Consultado 15 May, 2019. 23. Simonová MP, Chrastinová L’, Mojto J, Lauková A, Szábová R, Rafay J. Quality of rabbit meat and phyto-additives. Czech J Food Sci 2010;28:161-167. 24. Blasco A, Ouhayoun J. Harmonization of criteria and terminology in rabbit meat research. Revised proposal. World Rabbit Sci 1993;4(2):93-99. 25. Owen J, Nuñez F, Arias M, Cano de los Ríos O. Manual de prácticas para cursos de tecnología de la carne. Facultad de Zootecnia. Universidad Autónoma de Chihuahua., Chihuahua, Chih., México; 1982. 26. CIE. International Commission on Illumination. Colorimetry. Vienna, Austria: Bureau Central de la CIE 1976. http://www.cie.co.at/. Consultado 15 May, 2019. 27. SAS. Statistical Analysis System. Version 9.1.3. SAS Institute Inc. Cary, North Carolina, 2006. 28. Botsoglou NA, Florou-Paneri P, Christaki E, Giannenas I, Spais AB. Performance of rabbits and oxidative stability of muscle tissues as affected by dietary supplementation with oregano essential oil. Arch Anim Nutr 2004;58(3):209-218. 29. Abdel-Khalek AM. Supplemental antioxidants in rabbit nutrition: A Review. Livest Sci 2013;158:95-105. 30. Gidenne T. Recent advances in rabbit nutrition: emphasis on fiber requirements. A review. World Rabbit Sci 2010;8(1):23-32. 31. Margüenda I, Nicodemus N, Vadillo S, Sevilla L, García-Rebollar P, Villarroel M, Romero C, Carabaño R. Effect of dietary type and level of fiber on rabbit carcass yield and its microbiological characteristics. Livest Sci 2012;145:7-12. 32. Hashemi SR, Davoodi H. Herbal plants and their derivatives as growth and health promoters in animal nutrition. Vet Res Commun 2011;35(3):169-180.

715

Rev Mex Cienc Pecu 2020;11(3):701-717

33. Trocino A, Xiccato G, Queaque PI, Sartori A. Effect of transport duration and gender on rabbit carcass and meat quality. World Rabbit Sci 2003;11(1):23-32. 34. García J, Carabaño R, de Blas JC. Effect of fiber source on cell wall digestibility and rate of passage in rabbits. J Anim Sci 1999;77(4):898-905. 35. Hoover WH, Heitmann RN. Effects of dietry fibre levels on weight gain, cecal volume and volatile fatty-acid production in rabbits. J Nutr 1972;102:375-380. 36. Parker DS. The measurement of production rates of volatile fatty acids in the caecum of the conscious rabbit. Br J Nutr 1976;36(1):61-70. 37. Marty J, Vernay M. Absorption and metabolism of the volatile fatty acids in the hind-gut of the rabbit. Br J Nutri 1984;51(2):265-277. 38. Stanley DW, Parkin KL. Biological membrane deterioration and associated quality losses in food tissues. Crit Rev Food Sci 1991;30(5):487-553. 39. Asghar A, Lin CF, Gray JI, Buckley DJ, Booren AM, Crackel RL, Flegal CJ. Influence of oxidised dietary oil and antioxidant supplementation on membrane-bound lipid stability in broiler meat. Brit Poultry Sci 1989;30(4):815-823. 40. Meineri G, Cornale P, Tassone S, Peiretti PG. Effects of Chia (Salvia hispánica L.) seed supplementation on rabbit meat quality, oxidative stability and sensory traits. Ital J Anim Sci 2010;9(10):45-49. 41. Dal Bosco A, Gerencsér Zs, Szendrö Zs, Mugnai C, Cullere M, Kovács M, et al. Effect of dietary supplementation of spirulina (Arthrospira platensis) and thyme (Thymus vulgaris) on rabbit meat appearance, oxidative stability and fatty acid profile during retail display. Meat Sci 2014;96(Issue 1):114-119. 42. Cox SD, Gustafson JE, Mann CM, Markham JL, Liew YC, Hartland RP, Bell HC, Warmington JR, Wyllie SG. Tea tree oil causes K+ leakage and inhibits respiration in Escherichia coli. Lett Appl Microbiol 1998;26:355-358. 43. Cox SD, Mann CM, Markham JL, Bell HC, Gustafson JE, Warmington JR, Wyllie SG. The mode of antimicrobial action of essential oil Melaleuca alternifolia (tea tree oil). J Appl Microbiol 2000;88:170-175. 44. Lambert RJW, Skandamis PN, Coote PJ, Nychas GJE. A study of the minimum inhibitory concentration and mode of action of oregano essential oil, thymol and carvacrol. J Appl Microbiol 2001;91:453-462. 45. Hui YH, Guerrero I, Rosmini MR. Ciencia y tecnología de carnes. LIMUSA. México; 2013.

716

Rev Mex Cienc Pecu 2020;11(3):701-717

46. Amadio C, Medina R, Dediol C, Zimmermann ME, Miralles S. Aceite esencial de orégano: un potencial aditivo alimentario. Rev FCA UNCUYO 2011;43:237-245. 47. Vijayalaxmi S, Jayalakshmi SK, Sreeramulu K. Polyphenols from different agricultural residues: Extraction, identification and their antioxidant properties. J Food Sci Technol 2015;52:2761-2769. 48. López-Bote CJ, Sanz M, Rey A, Castaño A, Thos J. Lower lipid oxidation in the muscle of rabbits fed diets containing oats. Anim Feed Sci Tech 1998;70:1-9. 49. Fasseas MK, Mountzouris KC, Tarantilis PA, Polissiou M, Zervas G. Antioxidant activity in meat treated with oregano and sage essential oils. Food Chem 2007;106:1118-1194.

717

https://doi.org/10.22319/rmcp.v11i3.5175 Article

Halophilic rhizobacteria maintain the forage quality of Moringa oleifera grown on a saline substrate

Verónica García Mendoza a Alex Edray Hernández Vázquez a José Luis Reyes Carrillo a Uriel Figueroa Viramontes b Jorge Sáenz Mata c Héctor Mario Quiroga Garza a Emilio Olivares Sáenz d Pedro Cano Ríos a José Eduardo García Martínez a*

Universidad Autónoma Agraria Antonio Narro. Posgrado en Ciencias Agrarias, Blvd. Raúl López Sánchez Km. 2. 27054, Torreón, Coah., México.

INIFAP, Campo Experimental La Laguna, Matamoros, Coah., México.

Universidad Juárez del Estado de Durango. Facultad de Ciencias Biológicas. Gómez Palacio, Durango, México.

Universidad Autónoma de Nuevo León. Facultad de Agronomía. Gral. Escobedo, Nuevo León, México.

* Corresponding author: edugarmartz@gmail.com

718

Rev Mex Cienc Pecu 2020;11(3):718-737

Abstract: In order to obtain an increase in the forage production of high-quality Moringa oleifera Lam., the use of cow dung manure can be combined with the inoculation of biofertilizers based on plant growth-promoting rhizobacteria (PGPR). This production was assessed in a greenhouse in TorreĂłn, Coahuila, Mexico. Cow dung manure was utilized as part of the substrate (50% compost, 40% sand, and 10% perlite). Three inoculations into the tree were scheduled (at 40, 74 and 152 d after planting) with four PGPR strains; the treatments were: T1: Bacillus paralicheniformis, T2: Acinetobacter guillouiae, T3: Aeromonas caviae, T4: Pseudomonas lini and Control: Bacteria-free; strains from Poza Salada, Valley of Sobaco, Coahuila, Mexico. Three harvests were collected in the 2016-2017 summer-fall-winter cycle. Agronomic and bromatological variables were assessed in order to determine the production and the quality of the tree leaves. The Pseudomonas lini and Bacillus paralicheniformis strains provided a positive response in the development of forage M. oleifera during the summer-fall period, increasing the height in the first weeks of development and providing thicker, firmer diameters. The yield and the bromatological variables exhibited no differences between treatments; however, a good-quality forage was produced. In average, the leaves exhibited 13.56 % ashes, 70.15 % total digestible nutrients, 93.16 % in vitro digestibility of dry matter, 19.72 % neutral detergent fiber, 25.35 % acidic detergent fiber, and 24.15 % crude protein. Key words: Biofertilizers, Biomass, Compost, Digestibility, Fertilizers, Inoculation, Protein, Ruminants.

Received: 04/12/2018 Accepted: 24/07/2019

Introduction The diet of ruminants, particularly of milk-producing cattle, must provide high levels of energy and protein(1). Conventional feed concentrates are usually expensive(2). The Moringa oleifera Lam. tree is a species with a high nutritional value and a good production of biomass, reaching an annual production of 25 t haâ&#x2C6;&#x2019;1 under dry tropical forest conditions(3). In addition, the feeding costs are relatively low, ten times lower when using M. oleifera than when using balanced feeds(4). Rations for milk-producing cattle formulated with M. oleifera forage provide a high protein value ranging between 15 and 30 % of NDF, with digestibility levels

719

Rev Mex Cienc Pecu 2020;11(3):718-737

of 52 to 85 %(5). The supply of a fresh M. oleifera diet may give an unpleasant taste and smell to the milk; however, if the diet contains M. oleifera silage, the milk will exhibit good organoleptic characteristics(6); therefore, M. oleifera is an option for supplementing the diet of the milk-producing cattle. On the other hand, the intensification of the production of the milk industry increases the generation of dung, which entails a risk of contamination(7). The excreta of the milkproducing cattle have less environmental impact when they are used as organic fertilizers(8). However, they must be used carefully, as the five soluble salts accumulated (Na, K, Ca, Mg and S) may generate adverse effects(9). The increase in salinity influences the quality of the forage, including organic matter (OM), crude protein (CP), and neutral detergent fiber (NDF)(10). More than half the Mexican territory is arid and semiarid, and its natural diversity, including its soil, is under threat(11). The scenarios predicted for the future according to the climate change show the growing risk of salinization in various latitudes, which would require a special effort for maintaining the production of crops under saline stress(12). The use of plant growth-promoting rhizobacteria (PFPR) based biofertilizers is an option for reducing the contamination of the soil, which is also partly caused by nitrogenous fertilizers(13). The PGPRs have beneficial effects on the plants through direct and indirect mechanisms, such as nitrogen fixation, synthesis of phytohormones, phosphorus solubilization, secretion of siderophores, increased permeability of the roots, and induced systemic resistance, among others(14,15). In fact, the inoculation of various strains of PGPR allows the development of plants in drought-stricken places, on soils that are contaminated with heavy metals, and even on saline soils(16). The hypothesis assumes that, if crops are produced on heavy soils or on substrates with a high electrical conductivity, it is possible to inoculate halophilic PGPR in order to obtain a good yield and increase the quality, in this case, of M. oleifera forage. The purpose of this research was to assess the quality of the production of M. oleiferea inoculated with halophilic PGPR as forage, using compost and compost tea ―both from cow dung ― to irrigate the substrate.

Material and methods This research was carried out at the “Antonio Narro” Autonomous Agricultural University, Lagoon Unit (Universidad Autónoma Agraria Antonio Narro Unidad Laguna, UAAAN-UL), located in Torreón, Coahuila, Mexico, at an altitude of 1,120 m asl, during the 2016-2017 summer-fall-winter cycle. The maximum and minimum temperatures were registered during the experiment.

720

Rev Mex Cienc Pecu 2020;11(3):718-737

A random blocks experimental design was utilized, with five treatments with four different PGPR (Table 1) and five repeats per treatment. The PGPR were provided by the Faculty of Biological Sciences of the Juárez University of the State of Durango, having been isolated from the rhizosphere of Distichlis spicata halophilic grass from Poza Salada in the Valley of Sobaco, in the municipality of Cuatrociénagas, Coahuila, Mexico(17). Table 1: Characteristics of plant growth-promoting rhizobacteria (PGPR) used in each treatment (T) Strain ID

Bacterium Genus/Species

Production of IAA (µg)

DPS (mm)

TS (%)

LBEndo1

Bacillus 23.444±2.531 + paralicheniformis

4.589±0.221 15

NFbEndo 2M2

Acinetobacter guillouiae

KBEndo3 Aeromonas caviae

KBEcto4

Bacteriafree

Pseudomonas lini 36.730±0.011 +

4.112±0.042 15

IAA= Indole-acetic-acid; PS= production of siderophores; DPS= degree of phosphate solubilization; TS= tolerance to salinity; Co= control. Source: Palacio-Rodríguez et al(17).

Direct planting of M. oleifera L. in black polyethylene bags with an 18 L capacity, on July 10, 2016. The utilized substrate was a mixture of compost (50 %), sand (40 %) and perlite (10 %). The compost was acquired at the Ampuero ranch; the solarization method was applied to it before use(18). One seed was placed in each bag at a depth of 5 cm. Before planting, the substrate was washed with one liter of water per kilogram of substrate, in order to reduce its salinity. The plant pots were arranged in four rows, with a topological herringbone arrangement, with a separation of 0.25 x 0.25 m between stems and with a density of 16 trees m-2. The bacteria were inoculated 40 d after the planting, placing 3 mL at a concentration of 1x108 ufc mL-1 of PGPR at the stem base; other inoculations were carried out 8 d after the first and second cuttings.

721

Rev Mex Cienc Pecu 2020;11(3):718-737

The variables evaluated were: yield, bromatological variables and leaf/stem ratio. The sampling was carried out when the tree reached an average height of 1.50 m and before the beginning of the flowering, leaving a remaining forage at a height of 0.25 m. Irrigation was applied with 1 L compost tea, every other day. This tea was obtained by submerging 5 kg of cow dung compost in a net within 200 L of water. The water was placed on the previous days in order to allow the chlorine that it might have contained to evaporate. In each preparation, 90 g of unrefined brown sugar were added, and aerators were placed within the 200 L container during 12 h. After this time, the net that contained the compost was removed, and the compost tea was ready to be used. Table 2 shows the chemical composition of the compost and of the compost tea thus obtained. Table 2: Chemical composition of macro- and micronutrients of the compost and compost tea utilized for the substrate and for irrigation of M. oleifera ----------Macronutrients----------Component

Organic carbon

mS/cm

-------------------------------------%------------------------------

Compost

8.35

12.77

0.11

0.45

2.95

18.8

0.94

17.75

30.60

Compost tea

7.52

3.27

0.25

0.15

0.28

1.33

0.12

-----

0.52

---------------Micronutrients-----------------Component

mS/cm

-------------------------ppm------------------------

Compost

8.35

12.77

0.43

5100.0 0

62.00 200.00 390.00 1.00

Compost tea

7.52

3.27

0.18

3.21

0.86

2.96

3.44

-----

The only infestation which occurred during the experiment was with Tetranychus urticae, which was controlled by means of applications of eBioluzión Plus vO® (Febea bio), a broad-spectrum organic insecticide.

The agronomic variables —height of the tree, stem diameter, number of stalks, number of leaves, leaf size, root weight, fresh and dry weight of the forage, yield, leaf/stem ratio— were evaluated once a week.

722

Rev Mex Cienc Pecu 2020;11(3):718-737

The height of the tree was measured with a grade rod placed at the basal part of the soil and measuring the height up to the apex of the apical branch. The stem diameter was measured with a caliper, 3 cm above the stem base. The leaf size was measured from the primary rachis to the apical foliole, using a measuring tape. A digital scale was used to weigh the root, for which purpose the stem was cut from the base, and all the substrate was removed in order to maintain the largest amount of root. The forage was weighed fresh in a digital scale at the moment of cutting with pruning shears, leaves and stems together and separately (leaves without the rachis and stalks including the rachis of the leaves). In order to estimate the dry weight, the forage samples were taken to the laboratory; each sample was placed in a paper bag with its respective label and dried in a forced-air oven at 60 Â°C during 24 h until obtaining a constant weight. The dry weight was estimated using an analytical scale and was subsequently utilized as a basis for estimating the dry matter yield, by adding the dry weight of the leaves and that of the stalks and stem. The leaf/stem ratio was estimated by dividing the dry weight of the leaves (DWL) by the dry weight of the stems (DWS) with the equation L/S = DWL/DWS. The bromatological variables were measured only at the last cutting and included: fresh matter (FM), dry matter (DM), ashes, fat, neutral detergent fiber (NDF), acidic detergent fiber (ADF), crude fiber (CF), crude protein (CP), nitrogen-free extract (NFE), non-fibrous carbohydrates (NFC), in vitro dry matter digestibility (IVDMD), net energy lactation (NEL), and total digestible nutrients (TDN). The samples were dried at 60 Â°C during 24 h, until a constant weight was obtained, and subsequently crushed through a 1 mm sieve before analysis. The ashes were analyzed using the AOAC procedure(19). The fat was drawn using the Goldfisch method. The NDF and the ADF were obtained using the Van Soest method(20). The CF was determined with the Weende method. CP was determined with the Kjedahl method. The IVDMD was obtained using a Daisy incubator (Ankom Technology). The NFE, NFC, NFE and TDN were calculated using the following formulas: NFE (%) = 100 â&#x20AC;&#x201C; (DM + CP + CF + Fat + Ashes), NFC (%) = 100 â&#x20AC;&#x201C; (CP + NDF + Fat + Ashes), NEL=1.044 - (0.0124*ADF) and TDN = 31.4 + (53.1* NEL). The variables were subjected to a variance analysis using the SAS statistical software for Windows, version 9.0. In those cases in which differences were found between means, the least significant difference (LSD) test was applied, with a significance of đ?&#x203A;ź= 0.05. The Microsoft Excel 2010 software was utilized to determine the regression equation for the variable height.

723

Rev Mex Cienc Pecu 2020;11(3):718-737

Results Growth

The growth of the M. oleifera tree from the time of the planting to the first harvest exhibited a significant difference between the treatments on the Julian days 216 to 247. In the last week before the first harvest, the growth was not affected by the applied treatments and exhibited no significant differences; this may be due to the onset of the flowering (Figure 1). This growth occurred in the summer, which shows a linear tendency. The tree height increased in average 3.16 cm per day, attaining a mean height of 1.76 m at d 66. During this period, the tree exhibited the greatest growth in the experiment. The temperatures shown in this period, ranging between 20-22 Â°C and 38-42 Â°C, favored growth. Figure 1: Growth of Moringa oleifera from the time of the planting to the first harvest (66 days) 2016

T1: Bacillus paralicheniformis, T2: Acinetobacter guillouiae, T3: Aeromonas caviae, T4: Pseudomonas lini, Co: Bacteria-free. (*, **: Indicates a significant and a highly significant difference, respectively, between treatments for the respective date).

724

Rev Mex Cienc Pecu 2020;11(3):718-737

In the second harvest of the tree, a significant difference in growth was obtained from Julian day 277 to Julian day 299, except for the five weeks that preceded the harvest. This second harvest took place in the fall; the growth also exhibits a linear tendency. However, it shows a reduction of 52 % with regard to the summer growth. The average increase is 1.51 cm per day. This decrease, along with the lowering of the temperature, ranging between and 15-16 째C and 36-40 째C, is ascribed to the change of season. The mean height of 1.50 m for cutting was reached 77 d after the first harvest. The tree required 11 d more to attain the average height before harvesting. After the second harvest, which coincided with the beginning of the winter, the tree did not exhibit any growth during the first month, due to the low temperatures, which ranged between 9.5-10.5 째C and 32.5-35.5 째C. Thus, the third harvest showed no significant difference between treatments. The data of the growth resemble a second-degree polynomial regression due its slowness. The average height for the cutting was reached after 117 d. The tree required 40 d more than the second harvest, and 51 d more than the first harvest, to attain the average height for cutting. The first flowerings (2 %) occurred during this last harvest. The pest that befell during the development of the experiment was Tetranychus urticae.

Agronomic variables

Of the assessed agronomic variables, the stem diameter exhibits a significant difference between treatments in the second and third harvest (Table 3). The treatments that had the largest stem diameter were T1: Bacillus paralicheniformis and T4: Pseudomonas lini, which are statistically equal. After the first harvest, growth begins again; the main stem, which is 0.25 cm high, has side shoots or secondary stems. The number of secondary stems varies; in the experiment, up to 8 side shoots were registered, but only 1 to 4 developed satisfactorily. The same happened after the third harvest.

725

Rev Mex Cienc Pecu 2020;11(3):718-737

Table 3: Means for the variables stem diameter (SD), number of stems (NoS), number of leaves (NoL), leaf size (LS) and root weight (RW), in the evaluation of M. oleifera First harvest Treatment T1 T2 T3 T4 Co T1 T2 T3 T4 Co T1 T2 T3 T4 Co

SD (cm) NoS 1.413 a 1.00 1.363 a 1.00 1.381 a 1.00 1.450 a 1.00 1.394 a 1.00 Second harvest 2.110 a 1.85 1.915 b 1.65 1.915 b 1.65 2.015 ab 1.60 1.930 b 1.60 Third harvest 2.440 a 2.85 2.230 bc 3.35 2.195 c 2.80 2.355 ab 2.75 2.190 c 2.70

a a a a a

NoL 14.56 14.88 14.31 14.13 14.19

a a a a a a a a a a

RW (g)

a a a a a

LS (cm) 41.75 41.72 41.66 43.69 42.59

a a a a a

11.90 11.70 11.35 11.65 11.50

a a a a a

40.95 42.45 37.25 42.75 43.00

a a b a a

14.60 14.65 16.40 15.00 11.65

a a a a b

34.05 33.20 33.85 36.50 36.35

a a a a a

220.35 b 178.90 bc 159.10 c 341.50 a 156.10 c

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Co= Bacteria-free. ab Different letters indicate a significant difference between treatments (P<0.05).

The root of M. oleifera is bulbous. The weight of the root collected in the third harvest exhibits a significant difference between treatments, being the largest ―341.54 g― in T4, Pseudomonas lini. In the third harvest, the number of leaves is statistically equal between the treatments, but higher than in the control. Treatment T3: Aeromonas caviae and T4: Pseudomonas lini have the largest number of leaves —16.4 and 15 leaves, respectively. The size of the leaves in the trees is not affected by the treatments applied to any of the three harvests. The leaf size decreases with successive cuttings. The lengths of treatment T4, Pseudomonas lini, are 43.69, 42.75 and 36.50 for the first, second and third harvest, respectively.

726

Rev Mex Cienc Pecu 2020;11(3):718-737

The average yield of fresh matter was 9.44 t haâ&#x2C6;&#x2019;1 , and that of leaf dry matter was 4.86 t. The average yield of stem fresh matter was 25.08 t, and that of stem dry matter, 7.08 t. The yield was not affected by the applied treatments (Table 4). Table 4: Means for the yield variable in t haâ&#x2C6;&#x2019;1 in the evaluation of M. oleifera inoculated with four PGPR for the first, second and third harvest First harvest LY SY Fresh matter T1 2.68 9.06 T2 2.58 9.10 T3 2.59 9.07 T4 2.52 10.04 Co 2.61 9.10 Dry matter T1 1.40 2.49 T2 1.36 2.46 T3 1.39 2.50 T4 1.41 2.64 Co 1.47 2.54

Second harvest LY SY

Third harvest LY SY

Total LY

3.47 3.30 2.80 3.19 3.50

9.08 7.95 6.26 8.73 8.85

3.64 3.66 3.51 3.83 3.31

8.20 7.14 6.37 8.53 7.92

9.79 9.54 8.90 9.54 9.42

26.34 24.19 21.70 27.30 25.87

2.04 2.04 1.95 2.06 2.07

2.79 2.60 2.40 2.75 2.74

1.43 1.41 1.41 1.49 1.39

2.01 1.82 1.72 2.03 1.90

4.87 4.81 4.75 4.96 4.93

7.29 6.88 6.62 7.42 7.18

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Co= bacteria-free; LY= leaf yield; SY= stem yield. (P>0.05).

The leaf/stem ratio exhibits an increase with successive harvests. The average leaf/stem ratio of the first harvest was 0.556; in the second harvest it was 0.768, and in the third, 0.754. The average leaf percentage was 35.72, 43.40 and 42.96 % for the first, second and third harvest, respectively. Table 5 shows the leaf/steam ratio and the leaf percentage exhibited by the tree; these variables were not affected by the treatments.

727

Rev Mex Cienc Pecu 2020;11(3):718-737

Table 5: Table of the leaf/stem ratio and leaf percentage in the evaluation of M. oleifera inoculated with four PGPR in each of the three harvests

First cutting T1 T2 T3 T4 Co Second cutting T1 T2 T3 T4 Co Third cutting T1 T2 T3 T4 Co

Leaf/stem ratio

Leaf percentage

0.561 0.552 0.555 0.534 0.580

35.9 35.5 35.7 34.8 36.7

0.731 0.787 0.813 0.751 0.757

42.2 44.0 44.8 42.9 43.1

0.709 0.775 0.822 0.734 0.731

41.5 43.7 45.1 42.3 42.2

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Co= bacteria-free. (P>0.05).

Bromatological variables

Although the chemical composition of the tree was determined only in the last harvest, the values obtained are very good. In average, 13.5 % of leaf ashes, 70.15 % of TDN, 93.6 % of IVDMD, 19.72 % of NDF, 25.35 % of ADF, and 24.15 % of CP. The averages obtained for the stems were 11.21 % of ashes, 45.32 % of TDN, 61.83 % of IVDMD, 59.07 % of NDF, 58.01 % of ADF and 7.23 % of CP. Table 6 lists the bromatological variables analyzed for each treatment.

728

Rev Mex Cienc Pecu 2020;11(3):718-737

Table 6: Means by treatment of the bromatological analyzes expressed as percentages Treatment Leaf FM DM Ashes Fat NDF ADF CF CP NFE NFC IVDMD NEL TDN Stem FM DM Ashes Fat NDF ADF CF CP NFE NFC IVDMD NEL TDN

74.01 25.99 13.55 4.49 19.26 24.77 9.70 23.79 22.48 38.91 94.89 0.737 70.53

74.87 25.13 14.55 4.70 20.24 24.06 9.33 24.45 21.84 36.06 91.70 0.746 70.99

73.22 26.78 13.78 4.77 20.09 25.53 9.61 23.46 21.61 37.91 93.49 0.727 70.02

73.62 26.38 12.89 4.92 19.33 26.39 9.12 23.57 23.11 39.28 93.98 0.717 69.46

73.23 26.77 13.07 4.29 19.70 26.01 9.05 25.49 21.33 37.45 91.76 0.722 69.71

81.78 18.22 11.21 2.02 58.62 60.71 37.62 7.49 23.44 20.66 60.38 0.291 46.87

82.76 17.24 11.47 1.99 56.77 57.99 38.67 7.00 23.64 22.79 65.38 0.325 48.66

81.71 18.29 11.07 1.95 58.27 67.94 38.06 7.28 23.37 21.44 61.90 0.202 42.10

82.82 17.18 10.68 1.74 60.94 64.66 39.18 6.84 24.38 19.82 60.86 0.242 44.26

82.72 17.28 11.63 1.61 60.75 63.95 41.36 7.55 20.57 18.46 60.65 0.251 44.73

T1= Bacillus paralicheniformis, T2= Acinetobacter guillouiae, T3= Aeromonas caviae, T4= Pseudomonas lini, Co= bacteria-free. Fresh matter (FM), Dry matter (DM), neutral detergent fiber (NDF), acidic detergent fiber (ADF), Crude fiber (CF), Crude protein (CP), Nitrogen-free extract (NFE), non-fibrous carbohydrates (NFC), in vitro dry matter digestibility (IVDMD), net energy lactation (NE L), total digestible nutrients (TDN). (P>0.05).

729

Rev Mex Cienc Pecu 2020;11(3):718-737

Discussion Growth

At the germination state, M. oleifera reaches a growth rate of 100 % when using direct planting in the bags, in a substrate with an electrical conductivity (EC) of 12.77 mS/cm. This agrees with the findings of Noreem et al.(21) in the sense that M. oleifera seeds germinate only at salinity levels of 5 and 10 dS/m and at EC levels â&#x2030;¤ 15 and 20 dS/m. The average growth of M. oleifera trees obtained with the 4 treatments and by the control of the experiment for the first, second and third harvests is 176.75 cm, 140.39 cm and 120.50 cm, respectively. The time intervals for each harvest were 66, 77 and 117 d, respectively. In a comparative study under similar conditions to those of this experiment, Moringa oleifera and Leucaena leucocephala obtained 95 % germination between the time of germination and the initial growth phase; at 13 weeks, the seedlings reached a height of 53.2 cm at d 91, using in the substrate 60 % alkaline loamy silt, 10 % sand, and 20 % composted cow dung(22). The halophilic PGPR inoculated into the M. oleifera trees allowed a satisfactory growth. T4 exhibited a significant height between treatments of 138.31 cm at d 47, which amounts to a 61.68 % increase, compared to that obtained by the abovementioned authors and in half the time. M. oleifera has a slow initial growth rate at the low temperatures of the fall-winter season(23). Tropical climates seem to be the best for growing M. oleifera; yet, a limited but satisfactory growth can be attained in less than optimal climates, since the trees seem to tolerate a lower growth temperature through physiological adaptations(24). The findings of the authors agree with those obtained through the present experiment. Evidently, the growth of the M. oleifera tree is affected by a reduction in the temperatures and by attack by T. urticae. However, the growth persisted.

Agronomic variables

The nutritious quality of M. oleifera is determined partly by the conditions in which it develops. Low temperatures delay its growth(22). The planting density affects the development of the roots, the stem diameter, and the biomass. The higher the planting density, the thinner and more fragile the stem diameter(25). In this experiment, the trees were planted in black polyethylene bags, with a density of 16 trees m-2, where none of the alterations indicated by the abovementioned authors are to be expected. Using lower planting

730

Rev Mex Cienc Pecu 2020;11(3):718-737

densities favors harvesting at greater heights, as well as the development of thicker stems and a larger number of side shoots(26). However, Figure 2 shows the lodging exhibited by the control treatment before the third harvest, due to the thin stems and to the salinity saturation resulting from constant irrigation with compost tea, which had an EC level of 3.27 mS/cm. It may be said that inoculation with halophilic PGPR provides greater firmness and thickness, and therefore greater resistance, to the stems. A comparative study of the germination and initial growth phases resulted in a 0.92 cm diameter at wk 7, which is far less than the stem thickness obtained in the present experiment. The number of leaves per branch obtained was 16, which is similar to that obtained in this experiment(21). The thinness of the stems is caused by the high concentrations of Na+ in the solution, which inhibits the absorption of nutrients, causing a reduction in the K+ and Ca+ concentrations in the tissues of the stems and the root(27). The root is an essential part for the development of plants. A well-developed root can draw more nutrients, as well as more Ca2+, which provides firmness and structure to the cell wall. Halophilic PGPR allow the absorption of nutrients in saline substrates without causing nutritional disorders in successive harvests. The experiment exhibits a reduction of the leaf size with successive harvests and with the changing seasons and temperatures. These changes cause the loss of basal leaves, which has an impact on the yield. Table 4 shows the yield of the M. oleifera tree, considering a density of 16 trees m-2. Most other researches by other authors are open-air, while a few others are carried out in a greenhouse, but only at germination and seedling level. In an open-air research carried out in northeastern Mexico with a density of 11 and 33 trees m-2, respectively, 14.4 and 14.5 t haâ&#x2C6;&#x2019;1 of total dry matter were obtained in all three harvests(28). In Nicaragua, the open-air biomass production was evaluated at various planting densities, reaching a DM production of 11.6 t ha-1 after one year, with a density of 100 000 trees per ha and eight harvests per year(3). A study on the open-air establishment of M. oleifera with various planting densities resulted in 100.98 g of DM at a density of 98,764 trees per ha(24).

731

Rev Mex Cienc Pecu 2020;11(3):718-737

Figure 2: Lodging of Moringa oleifera due to thin stem diameters in treatment Co, bacteria-free, during the period between the 2016-2017 second and the third harvests (117 days)

M. oleifera leaves are the part that contains the largest amount of usable nutrients. The stems provide nutrients in lower amounts. The leaf/stem ratio presented in Table 5 shows the proportion of grams of leaf DM per gram of stem. It may be observed that the average proportion increased by 0.22 g of leaf DM in the second harvest. This may be ascribed to the number of stalks. In the second and third harvest, the proportion remained similar. In the study carried out in northeastern Mexico, the leaf/stem ratio was lower in the second harvest, and higher in the third(27). The purpose of producing good forage with this type of trees is to obtain the largest amount of leaves and the lowest number of stems.

Bromatological variables

Forages are sensitive to salinity at various degrees. As salinity increases, its biomass is reduced(10). The bromatological analysis to which M. oleifera trees were subjected (Table 6) shows that the nutritional content is good, i.e. despite having grown on a saline substrate, the amount of forage did not diminish. Although no difference is shown between the treatments, It is possible to speculate that, at the fourth cutting, the control treatment will reduce its quality and biomass due to salinity saturation. A study of the chemical composition of the

732

Rev Mex Cienc Pecu 2020;11(3):718-737

leaves of M. oleifera trees planted at an altitude of 1,100 masl estimated a content of ashes of 13.3 %; 29 % of CP, 8.5 % of crude fiber (CF), 42.7 % of nitrogen-free extract (NFE), 16.8 % of NDF, 12.1 % of ADF, and 34.5 % of non-fibrous carbohydrates (NFC)(29). The data obtained by these authors are very similars to those obtained in this research at a similar altitude. The bromatological characterization of M. oleifera leaves carried out at different stages of growth without irrigation or fertilization determined that, as the age of the side shoot increases, its nutritional quality decreases; the amount of NDF and acidic detergent lignin increases, CP, IVDMD and TDN decrease(30). This situation did not occur in the present research. The various researches on M. oleifera have yielded different results as to the bromatological analyses, but the variations are due to the diverse conditions under which the tree is produced. Furthermore, attempts have been made to determine the optimal cutting time for M. oleifera in which the best quality forage may be obtained. The open-air and rain-fed production of M. oleifera and its chemical composition were assessed at various densities and cutting times, and a recommendation was made to harvest M. oleifera at intervals of 75 d in order to obtain a better quality forage and a larger DM yield, as the nutritional value of the M. oleifera forage in terms of CP and IVDMD remains constant at different intervals of the harvest. The first year, with 8 harvests, yielded 18.54 % of DM, 8.58 % of ashes, 32.12 % of NDF, 22.76 % of ADF, 22.63 % of CP, and 70.09 % of IVDMD(31). M. oleifera has been utilized as an alternative protein supplement. Various bovine and caprine species have been fed with different percentages of M. oleifera in combination with diverse forages and concentrates(2,32-34). This protein supplement may be administered fresh or as silage; the chemical composition does not present much variation. Fresh M. oleifera had 19.3 % DM, 24.10 CP, 45.3 % NDF, 29.9 % ADF, and 10.3 % ashes, while M. oleifera silage had 26.70 % of DM, 22.6 % of CP, 43.50 % of NDF, 29.10 % ADF, and 11.6 % ashes. The considerable difference between these two forms of supplement is the strong taste that fresh M. oleifera gives to milk, whereas M. oleifera silage does not change its organoleptic characteristics(6). The results obtained in this research meet the parameters required in a forage for its inclusion in the formulation of a balanced diet (Table 6). The CP and the IVDMD are indicative values of a good forage (24.15 and 93.16 %, respectively), which were obtained in this research. As stated above, the higher the percentage of IVDMD, the lower the content of lignin. A high percentage of IVDMD indicates that the consumption of DM in animals will increase. The previous researches show that, in average, the forage contains the elements required to benefit the animals that ingest it. Even when produced under saline conditions and inoculated with the halophilic PGPRs necessary for its development, it is possible to obtain a high quality forage, as was the case in the present experiment. 733

Rev Mex Cienc Pecu 2020;11(3):718-737

Conclusions and implications The results of this study show that growing M. oleifera under saline conditions and with inoculation with halophilic PGPRs does not lower its quality for use as forage and allows it to meet the characteristics required for its inclusion as a protein supplement in the nutrition of various animal species. The control treatment showed a systemic resistance to salinity; however, before the third cutting, it exhibited lodging of the stems. Further research using halophilic PGPRs inoculated into various forages grown on different soils with salinity issues is required to enable planting in places that have hitherto been considered uncultivable.

Literature cited: 1. Hoffmann EM, Muetzel S, Becker K. Effects of Moringa oleifera seed extract on rumen fermentation in vitro. Arch Anim Nutr 2003;57(1):65-81. 2. Mendieta-Araica B, Spörndly R, Reyes-Sánchez N, Spörndly E. Moringa (Moringa oleifera) leaf meal as a source of protein in locally produced concentrates for dairy cows fed low protein diets in tropical areas. Livest Sci 2011;137(1):10-17. 3. Mendieta-Araica B, Spörndly E, Reyes-Sánchez N, Salmerón-Miranda F, Halling M. Biomass production and chemical composition of Moringa oleifera under different planting densities and levels of nitrogen fertilization. Agrofor Syst 2013;87(1):81-92. 4. Pérez ÁR. Moringa oleifera: una alternativa forrajera para ovinos. Culiacán, Sin, Méx: Universidad Autónoma de Sinaloa; 2011. 5. García QII, Mora-Delgado J, Estrada AJ, Piñeros VR. ¿Cuál es el efecto de la Moringa oleifera sobre la Dinámica Ruminal? Revisión sistemática. Rev Inv Vet Perú 2017;28(1):43-55. 6. Mendieta-Araica B, Sporndly E, Reyes-Sanchez N, Sporndly R. Feeding Moringa oleifera fresh or ensiled to dairy cows - effects on milk yield and milk flavor. Trop Anim Health Prod 2011;43(5):1039-1047. 7. Sun J, Zeng B, Chen Z, Yan S, Huang W, Sun B et al. Characterization of faecal microbial communities of dairy cows fed diets containing ensiled Moringa oleifera fodder. Sci Rep 2017;7:1-9.

734

Rev Mex Cienc Pecu 2020;11(3):718-737

8. Galindo PFV, Hernández MF, Rangel PP, Valencia RT, Castruita MÁS, Vidal JAO. Caracterización físico-química de sustratos orgánicos para producción de pepino (Cucumis sativus L.) bajo sistema protegido. Rev Mex Cienc Agríc 2014;5(7):12191232. 9. Larney FJ, Olson AF, Miller JJ, Tovell BC. Soluble salts, copper, zinc, and solids constituents in surface runoff from cattle manure compost windrows. Can J Soil Sci 2014;94(4):515-527. 10. Robinson PH, Grattan SR, Getachew G, Grieve CM, Poss JA, Suarez DL et al. Biomass accumulation and potential nutritive value of some forages irrigated with saline-sodic drainage water. Anim Feed Sci Technol 2004;111(1):175-189. 11. Aguirre-Garrido JF, Montiel-Lugo D, Hernández-Rodríguez C, Torres-Cortes G, Millán V, Toro N et al. Bacterial community structure in the rhizosphere of three cactus species from semi-arid highlands in central Mexico. Antonie van Leeuwenhoek 2012;101(4):891-904. 12. Turral H, Burke J, Faurès JM. Climate change, water and food security. 36th ed. Roma, Italia: FAO; 2011. 13. Bhardwaj D, Ansari MW, Sahoo RK, Tuteja N. Biofertilizers function as key player in sustainable agriculture by improving soil fertility, plant tolerance and crop productivity. Microb Cell Fact 2014;13(66):1-10. 14. Ahemad M, Kibret M. Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective. J King Saud Univ Sci 2013;26(1):1-20. 15. Glick BR. Plant growth-promoting bacteria: mechanisms and applications. Scientifica 2012;2012:1-15 16. Parray JA, Jan S, Kamili AN, Qadri RA, Egamberdieva D, Ahmad P. Current perspectives on plant growth-promoting rhizobacteria. J Plant Growth Regul 2016;35(3):877-902. 17. Palacio-Rodríguez R, Coria-Arellano JL, López-Bucio J, Sánchez-Salas J, Muro-Pérez G, Castañeda-Gaytán G et al. Halophilic rhizobacteria from Distichlis spicata promote growth and improve salt tolerance in heterologous plant hosts. Symbiosis 2017;73(3):179-189. 18. Vázquez VC, Salazar SE, Fortis HM, Reyes OMI, Zúñiga TR, Antonio GJ. Uso de cubiertas plásticas para solarización de estiércol bovino. Rev Mex Cienc Agríc 2010;1(4):619-625.

735

Rev Mex Cienc Pecu 2020;11(3):718-737

19. AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. 20. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583-3597. 21. Noreen F, Muhammad A, Muhammad S, Ghulam A, Mubshar H, Muhammad N et al. Germination, growth and ions uptake of moringa (Moringa oleifera L.) grown under saline condition. J Plant Nutr 2018;41(12):1-11. 22. Medina MG, García DE, Clavero T, Iglesias JM. Estudio comparativo de Moringa oleifera y Leucaena leucocephala durante la germinación y la etapa inicial de crecimiento. Zootecnia Trop 2007;25(2):83-93. 23. da Costa PF, Rabello dOPS, Borsoi A, Soares dVE, Taffarel LE, Tiago PJ et al. Initial growth of Moringa oleifera Lam. under different planting densities in autumn/winter in south Brazil. Afr J Agric Res 2015;10(5):394-398. 24. Muhl QE, Du Toit ES, Robbertse PJ. Moringa oleifera (Horseradish Tree) leaf adaptation to temperature regimes. Int J Agric Biol 2011;13(6):1021-1024. 25. Goss M. A study of the initial establishment of multi - purpose moringa (Moringa oleifera Lam) at various plant densities, their effect on biomass accumulation and leaf yield when grown as vegetable. Afr J Plant Sci 2012;6(3):125-129. 26. Padilla C, Fraga N, Scull I, Tuero R, Sarduy L. Efecto de la altura de corte en indicadores de la producción de forraje de Moringa oleifera vc. Plain. Rev Cubana de Cienc Agríc 2014;48(4):405-409. 27. Hu Y, Schmidhalter U. Drought and salinity: A comparison of their effects on mineral nutrition of plants. J Plant Nutr Soil Sci 2005;168:541-549. 28. Meza-Carranco Z, Bernal-Barragán H, Olivares-Sáenz E, Aranda-Ruiz J. Crecimiento y producción de biomasa de moringa (Moringa oleifera Lam.) bajo las condiciones climáticas del Noreste de México. TECNOCIENCIA Chih 2016;10(3):143-153. 29. Melesse A, Steingass H, Boguhn J, Rodehutscord M. In vitro fermentation characteristics and effective utilisable crude protein in leaves and green pods of Moringa stenopetala and Moringa oleifera cultivated at low and mid-altitudes. J Anim Physiol Anim Nutr 2013;97(3):537-546. 30. Méndez Y, Suárez FO, Verdecia DM, Herrera RS, Labrada JA, Murillo B et al. Caracterización bromatológica del follaje de Moringa oleifera en diferentes estadios de desarrollo. Cuban J Agric Sci 2018;53(3):1-10. 736

Rev Mex Cienc Pecu 2020;11(3):718-737

31. Reyes SN, Ledin S, Ledin I. Biomass production and chemical composition of Moringa oleifera under different management regimes in Nicaragua. Agrofor Syst 2006;66(3):231-242. 32. Moyo B, Masika PJ, Muchenje V. Effect of supplementing crossbred Xhosa lop-eared goat castrates with Moringa oleifera leaves on growth performance, carcass and noncarcass characteristics. Trop Anim Health Prod 2012;44(4):801-809. 33. Reyes SN, Spรถrndly E, Ledin I. Effect of feeding different levels of foliage of Moringa oleifera to creole dairy cows on intake, digestibility, milk production and composition. Livest Sci 2006;101(1):24-31. 34. Sultana N, Alimon AR, Huque KS, Sazili AQ, Yaakub H, Hossain J et al. The feeding value of moringa (Moringa oleifera) foliage as replacement to conventional concentrate diet in Bengal goats. Adv Anim Vet Sci 2015;3(3):164-173.

737

https://doi.org/10.22319/rmcp.v11i3.4828 Article

Effect of follicular replacement (GnRH) and bovine somatotropin (bST) on the fertility of dairy cows exposed to heat stress Renato Raúl Lozano-Domínguez a Carlos Fernando Aréchiga-Flores a* Marco Antonio López-Carlos a Zimri Cortés-Vidauri a Melba Rincón-Delgado a José Ma. Carrera-Chávez b Ulises Macías-Cruz c Joel Hernández-Cerón d

Universidad Autónoma de Zacatecas. Unidad Académica de Medicina Veterinaria y Zootecnia. El Cordovel, General Enrique Estrada, Zacatecas, México. b

Universidad Autónoma de Ciudad Juárez. Instituto de Ciencias Biomédicas. Departamento de Ciencias Veterinarias. Ciudad Juarez, Chihuahua, Mexico. c

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas. Mexicali, Baja California, Mexico. d

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Departamento de Reproducción. Ciudad Universitaria, Ciudad de México, México.

*Corresponding author: arechiga.uaz@gmail.com arechiga@uaz.edu.mx

738

Rev Mex Cienc Pecu 2020;11(3):738-756

Abstract: Three reproductive protocols were evaluated: 1) PG: injection of PGF2 on d-50 postpartum and insemination (AI) based on estrus detection. 2) OVS (Ovsynch: d 0, GnRH; d 7, PGF2; d 9, GnRH; d 10, AI); 3) ROV (GnRH + Ovsynch: d- 7, GnRH; d 0, GnRH; d 7 PGF2; d 9, GnRB; d 10, AI). In addition, the effect of somatotropin (bST) to AI, on fertility at first postpartum service (FERT), and pregnancy rate at 99 d postpartum (PP) FERT was similar in ROV and OVS (36.2 vs 36.6 %) (P>0.05); and higher than PG (27.3 %) (P<0.05). Likewise, FERT was similar with and without bST (36.2 vs 30.6 %, P>0.05). PG and without bST (22.5 %) was lower than OVS with (38.5 %) and without bST (33.7 %), as well as than ROV with (37.0 %) and without bST (36.1 %), and PG with bST (32.9 %). The pregnancy rate at 99 d was: OVS (60.6 %); ROV (54.3 %), higher than PG group (46.8 %) (P>0.05). OVS with (64.7 %) and without bST (56.5 %) and ROV without bST were higher than PG without bST (41.1 %, P<0.05). In conclusion, GnRH before Ovsynch (ROV) and bST at AI did not increase fertility at the first service in Holstein cows under heat stress. OVS and ROV increased fertility of first service postpartum and pregnancy rate to 99 d postpartum. Somatotropin increased fertility of first postpartum service only in PG treated cows. Key words: Dairy cow, Ovsynch, Somatotropin, heat stress, GnRH.

Received: 28/03/2018 Accepted: 18/09/2019

Introduction Heat stress (HS) compromises the estrous non-return rates(1,2) and conception rates of dairy cows(1-6). Ovsynch protocols have increased the ovulation rate(7,8), the diameter of the ovulatory follicle(8), the fertility at first service(8-13) and the accumulated pregnancy rate at 120 d post-partum in high production dairy cows(9-11,14). Injection of a luteolytic (i.e. prostaglandin F2 or PG) prior to Ovsynch(7,12) increases the ovulation rate of a follicle suitable for fertilization by more than 40 %(7), and the percentage of cows with higher levels of circulating progesterone 3 d after beginning Ovsynch(12). The intravaginal insertion of a progesterone releasing device (PRD) increased the conception rate compared to cows that only receive Ovsynch(12,13). However, under environmental conditions of HS, reproductive programs may be less efficient than under thermal comfort(8,12,14,15). Double Ovsynch treatment has increased fertility by 10 %(16). Several studies have determined that 739

Rev Mex Cienc Pecu 2020;11(3):738-756

even though the fertility of in vitro fertilized oocytes are similar in winter and in the summer(17), the percentage of embryos that reached the blastocyst stage is compromised when using oocytes collected during the summer(17,18), especially in repeating cows(17). Holstein cows in full lactation(19) and non-lactating cows(20) exposed to heat stress during the summer(19), or during a follicular cycle(20), show a decrease in the number of healthy follicles(20), in the quality of the ovarian cluster(19), and in embryonic development(18-20). Follicle replacement is important for eliminating developed and affected follicles and is promoted with repeated GnRH treatments or by frequent aspiration of follicles 3 to 7 mm(19) or larger than 5 mm(20), and for generating the development of better-quality follicles and a higher percentage of embryos developed in vitro to the blastocyst stage. Follicle exchange prior to Ovsynch(21,22) did not improve fertility at the first service(21,22), but it did improve fertility in cows with uterine problems and low body condition(21). On the other hand, bovine somatotropin (bST) has been used in Holstein cows for its beneficial effect in increasing milk production(23-26). It was considered that this increase in milk production could have a detrimental effect on the reproduction of the dairy cows. Treatment with 500 mg bST from 61 to 63 ds in milk and with repeated applications of this hormone every 10 ds(25) or 14 d(24,26) does not compromise fertility, the pregnancy rate(24-26) or the elimination of cows from the herd; the number of ds open; the number of mastitis cases, the incidence of follicular cysts and abortions(26), or animal welfare or health(27). Several authors have established that the use of bST at the onset of the estrus(28) and 10 ds after AI in dairy cows(29) has a positive effect on the pregnancy rate, improves the development of the corpus luteum and increases the production of progesterone(28,29) in both repeating cows(30,31) and embryo receptor cows(32). This favorable effect of bST has also caused a higher percentage of transferable embryos and fewer unfertilized oocytes in superovulated cows(29,32,33), and seems to be associated with insulin-like growth factor (IGF-I), and with final oocyte maturation, follicular development, and steroidogenesis(30,34,35). Together, beginning Ovsynch and bST at d 69 PP increased fertility at first insemination(28,36) and the accumulated pregnancy percentage at 120 and 365 d postpartum(32), but decreased the detection of estrus in cows treated with bST(37), and failed to increase the fertility of cows under heat stress(24). The purpose of the present work was to evaluate the effect of follicular replacement (GnRH d-7) and the administration of bovine somatotropin (bST) at the time of insemination on fertility at the first postpartum service and the pregnancy rate in high production dairy cows exposed to heat stress.

740

Rev Mex Cienc Pecu 2020;11(3):738-756

Material and methods The study was conducted on Holstein dairy cows (n= 553) from two intensive-production commercial herds in the central highlands of Mexico (Aguascalientes, Mexico), during the warm season, with shade only in the pens of the cows in production and dry cows. After calving, the cows were divided into batches by number of lactations with a whole feed, according to their milk production level. The estimated milk production at 305 d from the herd was 8 493 ± 349.6, and 9 116.3 ± 307.02 kg, respectively, in primiparous and multiparous cows.

Climate variables During the study period from March to September, climate information regarding ambient temperature (°C) and relative humidity (RH) was recorded every 15 min at the INIFAP weather station in Aguascalientes, located at a distance of 5 km from the dairy herds where the study was conducted. The temperature-humidity index (THI) was calculated (Table 1) according to Ingraham et al(37), and the maximum temperature and average relative humidity were recorded using the following equation: THI= ° F – (0.55 – (((HR / 100) x 0.55)) * (° F – 58)).

Table 1: Temperature-humidity index (THI) during the study Month March April May June July August September

THI 73.4 ± 0.39 a 73.6 ± 0.39 a 76.6 ± 0.39 b 77.5 ± 0.39 b 77.1 ± 0.39 b 77.6 ± 0.41 b 76.5 ± 0.42 b abc

Different letters indicate significant difference (P<0.01).

Reproductive management The study included dairy cows that gave birth during the months of March and April. Reproductive management during early postpartum and the implementation of estrus synchronization programs took place during the warm months of the year, from May to

741

Rev Mex Cienc Pecu 2020;11(3):738-756

June. The evaluation of uterine involution and clinical aspects of the reproductive system was performed around ds 20 and 40 postpartum (PP), and 500 ď g of synthetic prostaglandin (Cloprostenol sodium, Virbac) were administered, approximately at d 50 PP. The voluntary waiting period and the target calving interval were 50 d and 13.8 mo, respectively. The study included cows in full lactation (n= 553) that were clinically healthy, exhibiting no anatomical-pathological problems of the reproductive system, and which calved in the months of March and April, and the number of lactations of each cow was recorded. The experimental design is shown in Figure 1. At the beginning of the study (voluntary waiting period (VWP: approximately 50 d in milk), the days in milk (DIM) were recorded; and cows with an acceptable physical body condition (BCS) with an approximation of 0.25 points were used as described by Ferguson et al(38).

Figure 1: Experimental design

Fresh cows VWP = 50 ds

Estrus and ovulation synchronization treatments estro y ovulaciĂłn Prostaglandin (PG)

Ovsynch (OVS)

With bST

GnRH- OvSynch (ROV)

Without bST

Fertility at the first service

Pregnancy diagnosis Pregnant repetidoras

Open Ovsynch treatments (Re-synch) AI Pregnancy diagnosis 742

Rev Mex Cienc Pecu 2020;11(3):738-756

The cows were randomly assigned to the following treatments (T): 1) Prostaglandin (PG) (n= 247 cows) Induction of estrus synchronization with prostaglandin (500 g of cloprostenol sodium, Virbac); the cows were given artificial insemination service 12 h after estrus detection through visual observation. 2) OVS (n= 161 cows). Ovsynch: d 0, GnRH; d 7, PG; d 9, GnRH; d 10, FTAI). Estrus synchronization and fixed time artificial insemination (FTAI) program, in which cows were administered 100 g of gonadotropin releasing factor (GnRH) (gonadorelin acetate, SYVA) on day zero (treatment start); subsequently, on ds seven and nine, the cows were given 500 g of PG and 100 g of GnRH, respectively. The artificial insemination was performed between 12 and 16 h after the last administration of GnRH. 3) ROV (n= 145 cows). GnRH + Ovsynch: Seven ds prior to the Ovsynch treatment (OVS), 100 g of GnRH (i.e., d-7) were administered. Artificial insemination was performed between 12 and 16 h after the last GnRH administration. For the evaluation of the fertility of the first postpartum service with similar ds in milk of this service, only the cows that presented estrus and were inseminated in the PG treatments, and all those with fixed time service (OVS and ROV), were considered. The cows in each treatment exhibiting estrus were randomly assigned to two groups: a) with bovine somatotropin (C-bST) (n= 221), i.e. the cows that received 500 g of bovine somatotropin (bST) (Lactotropine, Elanco) at the time of insemination, and b) without bovine somatotropin (S-bST) (n= 235), i.e., cows not treated with bST at the time of insemination. For the evaluation of the fertility of the first postpartum service with similar ds in milk of this service only the cows that presented estrus were inseminated in the PG treatments were considered, and all those with fixed time service (OVS and ROV). The cows of each treatment which exhibited estrus were randomly assigned to two groups: a) bovine somatotropin (C-bST) (n=221); cows received at the time of insemination 500 mg of bovine somatotropin (bST) (Lactotropine, Elanco). B) without bovine somatotropin (SbST) (n=235). Cows not treated with bST at the time of insemination. Based on the interaction of the main treatment effects and the administrations of bST at the time of the first service, six 3experimental groups were formed to be evaluated: 1. 2. 3. 4. 5. 6.

Estrus synchronization with PG without bST (PG / S-bST) (n=80) Synchronization of the strobe with PG plus bST at service (PG / C-bST) (n = 70). Ovsynch without bST (OVS / S-bST) (n=83). Ovsynch with bST at service (OVS / C-bST) (n=78). GnRH – Ovsynch without bST (ROV / S-bST) (n = 72) GnRH – Ovsynch with bST at service (ROV / C-bST) (n = 73).

743

Rev Mex Cienc Pecu 2020;11(3):738-756

The fertility of the first postpartum service (FERT) was the ratio of pregnant cows to the number of cows served. The date of the first service and conception was recorded. The calving at first service (FERT) and calving to conception intervals (CCI) were calculated. Regardless of the treatment received, all cows that were not pregnant at the first service were served again when a new natural estrus was observed; those that were empty at the time of the gestation diagnosis (approximately 30%) were resynchronized with a Re-synch protocol to provide a new artificial insemination service. A frequency distribution of the calving to conception interval of cows that responded to synchronization with prostaglandins and were inseminated, and of those with fixed time insemination, was carried out to determine the number of classes and the amplitude of this interval(39). The cumulative percentage of pregnant cows (CPPC) for each defined class was estimated thus: 1. Less than 100 d in milk 2. 101 to 150 d in milk. 3. 151 to 201 d of milk. 4. 2020 to 253 d in milk. 5. More than 253 d in milk. Likewise, the percentage of pregnant cows at the first, second, third or fourth or more services was determined by treatment, bST administration, and their interaction. The calving to conception interval and the number of services per conception were calculated for all cows in the study, including those that did not respond to estrus synchronization with prostaglandin treatment without administration of bovine somatotropin at the time of service.

Variables to be evaluated

The variables evaluated were the number of lactations; days in milk (DIM) and body condition (BC) at the beginning of the study; interval from calving to first service postpartum (CFSI); fertility of first postpartum service (FERT); cumulative percentage of pregnant cows in different postpartum periods (CPPC); distribution of calving-toconception interval of cows with response to synchronization up to 150 d in milk; as well as, the number of services per conception (NSC) and calving-to-conception interval (CCI), including in these last two parameters the cows with response to synchronization with prostaglandin and that were not treated with bST at the time of insemination.

744

Rev Mex Cienc Pecu 2020;11(3):738-756

Statistical analysis

The variables number of lactations (NL), ds in milk (DIM), body condition (BPC), calving to first service interval (CFSI), calving to conception interval (CCI) and number of services per conception (NSC) were analyzed by means of a randomized block analysis of variance. The cumulative percentage of pregnant cows in different postpartum periods and by number of services were analyzed by Chi-square. The expected value of the percentage of fertility of the first postpartum service was analyzed with a first-order multiple logistic regression model. The model was adjusted by the maximum likelihood method considering the effects: Treatment (T); the administration of bST (S); the interaction between treatment and bovine somatotropin (T x S); and the dairy herd was taken as a block(39).

Results The ds in milk at the beginning of the treatment (BT= 56.6 ± 0.3), the body condition (BCS=3.1 ± 0.4), the number of lactations (NL= 2.7 ± 0.1), and the calving to first service interval (CFSI= 59.7 ± 0.3) were similar between treatment groups (P>0.05) (Table 2). The fertility at the first postpartum service of the Ovsynch (OVS, 36.6) and GnRH-Ovsynch (ROV, 36.2) treatments was higher than that observed in the Prostaglandin treatment (27.3 %) (P<0.05) (Figure 2). Table 2: Body physical condition, days in milk at baseline, number of lactations and interval from birth to postpartum service per treatment Treatments Variables PG OVS ROV Number of observations 150 161 145 Initial fisical condition 3.1 ± 0.03 3.0 ± 0.03 3.1 ± 0.03 Lactation days 55.3 ± 0.3 57.6 ± 0.3 56.8 ± 0.3 Number of lactations 2.6 ± 0.1 2.8 ± 0.1 2.6 ± 0.1 Calving to first service interval 58.8 ± 0.3 60.5 ± 0.3 59.9 ± 0.3 (P>0.05).

745

Rev Mex Cienc Pecu 2020;11(3):738-756

Figure 2: Fertility rate at first service postpartum by treatment effect

No single effect of bST (P>0.05) on fertility was detected at the first postpartum service of the dairy cows (36.2 vs 30.6 %, with and without bST, respectively). PG without bST presented a lower fertility rate at the first postpartum service (22.5 %) than the rest of the treatments (P<0.05) (Figure 3). Figure 3: Fertility rate at first service postpartum (FERT) by treatment (PG â&#x20AC;&#x201C; OVS â&#x20AC;&#x201C; ROV) with (C-bST) or without (S-bST) somatotropin administration

a/b Different literals between columns indicate differences (P<0.05).

746

Rev Mex Cienc Pecu 2020;11(3):738-756

The percentage of pregnant cows at 99 d postpartum was higher with Ovsynch (60.6 %) and ROV (54.3 %) than with Prostaglandin (46.8 %) (P<0.05). Later, between days 100 and 150 postpartum, 28.8 % of the cows treated with Prostaglandin calved; this percentage is superior to those observed with the Ovsynch (17.5 %) and ROV (17.3 %) (P<0.05) treatments (Figure 4). No simple effect of bST (P>0.05) was detected on the percentage of pregnant cows at 99 d postpartum (P>0.05). Figure 4: Percentage distribution of pregnant cows during postpartum (DIM) by treatment effect

The percentage of pregnant cows at d 99 postpartum under treatment with Ovsynch with or without bST (64.7 and 56.5 %, respectively) and ROV without bST (61.7 %) was higher than that observed in PG treatment without bST (41.1 %) (P<0.01). On ds 100 to 150 postpartum, , 34.2 % of the cows treated with PG but without bST were pregnant; this value was higher than that observed with the OVS treatment with bST (13.2 %) and the ROV treatment without bST (11.7 %) (P<0.05) (Figure 5).

747

Rev Mex Cienc Pecu 2020;11(3):738-756

Figure 5: Distribution of pregnant cows during postpartum (DIM) by effect of treatment interaction with (C-bST) or without (S-bST) somatotropin administration

Figure 6 shows the percentage of pregnant cows accumulated in the first 150 d postpartum by effect of the synchronization treatment, in the OVS and ROV treatments from d 62 exhibited a cumulative percentage of pregnant cows (29.2 and 33.8 %) which is higher than that observed in the PG treatment (23.0 %) (P<0.05). This difference increased substantially towards d 65 in the OVS (38.7 %) and ROV (41.7 %) treatments, compared with the PG treatment (28.0 %) (P<0.05); the OVS and ROV treatments maintained this significant difference until the 109th and 145th ds in milk, respectively (P<0.05). After 150 d in milk, the cumulative pregnancy rate was similar for all three treatments (P>0.05).

748

Rev Mex Cienc Pecu 2020;11(3):738-756

Figure 6: Cumulative pregnancy rate during the postpartum period by treatment effect

Table 3 shows a higher calving to conception interval in cows treated with PG without bST (144.6 d) than in those that were subjected to the rest of the treatments (P<0.05); fewer services per conception were observed in the groups of cows treated with Ovsynch and with PG plus bST at the time of service (2.2 and 2.3, respectively) compared to those observed in cows treated only with PG without bST at service (2.8), in those of the ROV group with bST (2.7) (P<0.05). Table 3: Effect of treatment on calving-to-conception interval (CCI) and number of services per conception (NSC) Treatment n IPC NSC PG witout bST PG with bST OVS without bST OVS with bST ROV without bST ROV with bST

73 66 69 68 60 67

144.6 ± 6.7 a 108.4 ± 9.4 b 115.4 ± 9.2 b 106.4 ± 9.3 b 118.3 ± 9.9 b 125.3 ± 9.4 b

bST: Injection of somatotropin at the time of artificial insemination (AI) OVS: [d 0, GnRH; d 7, PG; d 9, GnRH; d 10, AI] ROV: [d -7, GnRH; plus Ovsynch]. a,b Different letters per column indicate significant statistical difference (P<0.05).

749

2.8 ± 0.1 a 2.3 ± 0.2 b 2.4 ± 0.2 ab 2.2 ± 0.2 b 2.4 ± 0.2 ab 2.7 ± 0.2 a

Rev Mex Cienc Pecu 2020;11(3):738-756

Discussion Estrus synchronization and fixed-time artificial insemination (FTAI) programs improved first postpartum fertility in dairy cows under heat stress; thus, these programs show their goodness in overcoming the negative effect of dairy cow productivity on first postpartum fertility(40,41), and even as an additive negative effect to heat stress(1-6). The fertility rates observed in the first postpartum service in the FTAIs coincide with those reported by other studies(7-16,20), which may be related to a higher ovulation rate of a follicle that is suitable for fertilization(7), and to a higher circulating concentration of the hormone progesterone(12,15), compared to schemes where cows were not pre-synchronized. However, other studies conducted in dairy cows under heat stress found a less efficient reproductive response than that observed in cows in thermal comfort(12,14,15). An established effect of heat stress on dairy cows is that it reduces the quality of follicles and oocyte competence(1620,42) , the ovulation rate(7,8), and the diameter size of the ovulatory follicles(8). Some studies determined that administering gonadotropin releasing factor (GnRH)(19) or replacing dominant follicles(20) in dairy cows during the summer season improved oocyte competence for fertilization and resulted in a higher percentage of embryos that would reach the blastocyst stage in in vitro studies, and concluded that oocyte competence has also been reported by other authors(17,18) under heat stress conditions, especially in the case of repeating cows(17,31), even though the fertility of in vitro fertilized oocyte was similar in winter and in the summer(17). This emphasizes the importance of minimizing the effect of heat stress and shows that the FTAI schemes may have had a beneficial effect, improving the follicular quality and oocyte competence. The administration of gonadotropin release factor (GnRH: i.e., ROV treatment) prior to the Ovsynch program with the intention of generating follicular replacement did not improve the fertility rate of the first postpartum service, which was similar to the one observed in cows of the OVS group (Ovsynch). These results may indicate that the latter scheme of fixed-time artificial insemination was in itself sufficient to improve the follicular quality and oocyte competence, and they agree with those observed in other studies(21,22), and that alone the follicular exchange prior to the start of the Ovsynch program can improve fertility in cows that exhibited uterine problems in the early postpartum period and in those with a low body condition(21). It has been determined that the loss of the cowâ&#x20AC;&#x2122;s physical body condition and the depth of the negative energy balance affect the fertility of the first postpartum service(43,44) by affecting oocyte competence(45,46); and given the acceptable health and physical body condition of the cows in this study, it may be inferred that these negative effects were controlled. On the other hand, the fertility rate of the first postpartum service of over 36% obtained in the fixed-time artificial insemination programs observed by the present study under heat stress is excellent, compared to the fertility reported in cows with a high productive potential(40,41,47) and under heat stress(1-6). On the other hand, the administration 750

Rev Mex Cienc Pecu 2020;11(3):738-756

of bovine somatotropin (bST) at the moment of the fixed-time artificial insemination did not have a determining effect as a main variable to improve fertility in the first postpartum service, as reported by Jousan et al.(24); therefore, it is possible that estrus synchronization and fixed-time artificial insemination programs were sufficient to eliminate the damaged follicle due to heat stress, induce the emergence of new follicles, and improve the quality of the ovulatory follicle and the competence of the oocyte as described in other studies(19,20). However, the fact that the group of cows treated only with prostaglandin without administration of somatotropin at the time of service had a fertility rate 10.4 to 16 percentage points lower in the first postpartum service than that observed in cows treated with somatotropin significantly indicates a positive effect of somatotropin on fertility in the first postpartum service, as documented in other studies with bST treatments from 61 to 63 ds in milk with repeated applications of this hormone every 10(25,48,49) or 14 d(26,35,36), having improved the development of the corpus luteum and increased its production of progesterone(28,29), both in repeating cows(30,31), and in embryo receptor cows(32). Furthermore, it has been inferred that this beneficial effect involves insulin-like growth factor type I (IGF-1), which appears to be associated with the process of final oocyte maturation, follicular development, and steroidogenesis(34,50,51) and which, in in vitro studies, increases the pregnancy rate of transferred embryos(52). On the other hand, in programs in which bST is administered every 14 ds to dairy cows in order to increase their milk production(24-26), the expression of the estrus has been observed to be negatively affected(25,36); therefore, it has been suggested that the use of bST should be accompanied by fixed-time insemination protocols in order to ensure insemination of 100% of the cows(36). Thus, although the application of bST as the main variable does not have a relevant effect on the fertility rate of the first postpartum service under heat stress, at least with the FTAI the risk of not detecting cows in heat is eliminated. Consequently, an increase of 15.4 to 23.6 % in the percentage of pregnant cows in the first third of lactation in fixed-time insemination programs compared to traditional management, as confirmed in other studies(9-11,14), ensures a new production cycle and reduces the risk of eliminating cows from the herd due to reproductive causes. On the other hand, pregnant cows using estrus synchronization treatments with prostaglandins without bST at service exhibited between 19.3 and 38.6 more open ds than with the other treatments; this implies the loss of at least one to two lost estrus cycles, which entails extra costs in the reproductive cycle of the dairy cows.

Conclusions and implications The administration of gonadotropin releasing factor (GnRH) prior to the Ovsynch program (ROV) and the administration of bovine somatotropin (bST) at the time of insemination did

751

Rev Mex Cienc Pecu 2020;11(3):738-756

not improve the fertility rate of the first postpartum service. Fixed-time artificial insemination schemes improved the fertility rate of the first postpartum service and increased the number of pregnant cows in the first 99 d postpartum. Under heat stress, bovine somatotropin increases the fertility rates at first service postpartum in cows treated with prostaglandin, but not in cows in fixed-time insemination programs.

Literature cited: 1. Al-Katanani MY, Webb DW, Hansen PJ. Factors affecting seasonal variation in 90-d nonreturn rate to first service in lactating Holstein cows in a hot climate. J Dairy Sci 1999;82:2611-2616. 2. Ravagnolo O, Misztal I. Effect of heat stress on nonreturn rate in Holsteins: fixed-model analyses. J Dairy Sci 2002;85:3101-3106. 3. Wolfenson D, Roth Z, Meidan R. Impaired reproduction in heat-stressed cattle: basic and applied aspects. Anim Reprod Sci 2000;60:535-547. 4. Lozano-Dominguez RR, Vásquez-Peláez CG, González-Padilla E. Factores asociados del estrés calórico y producción de leche sobre la tasa de gestación en bovinos en sistemas intensivos. Tec Pecu Mex 2005;43(2):197-210. 5. Lozano-Domínguez RR, Asprón-Pelayo MA, Vásquez-Peláez CG, González-Padilla E, Aréchiga-Flores CF. Efecto del estrés calórico sobre la producción embrionaria en vacas superovuladas y la tasa de gestación en receptoras. Rev Mex Cienc Pecu 2010; 1(3):189-203. 6. Huang C, Tsuruta S, Bertrand JK, Misztal I, Lawlor TJ, Clay JS. Environmental effects on conception rate of Holstein in New York and Georgia. J Dairy Sci 2008;9(2):818– 825. 7. Borman JM, Radcliff RP, McCormack BL, Kojima FN, Patterson DJ, Macmillan KL, Lucy MC. Synchronisation of oestrus in dairy cows using prostaglandin F2alpha, gonadotrophin-releasing hormone, and oestradiol cypionate. Anim Reprod Sci 2003; 76(3-4):163-176. 8. Pereira MHC, Wiltbank MC, Barbosa LF, Costa Jr WM, Carvalho MA, Vasconcelos JLM. Effect of adding a gonadotropin-releasing-hormone treatment at the beginning and a second prostaglandin F2α treatment at the end of an estradiol-based protocol for timed artificial insemination in lactating dairy cows during cool or hot seasons of the year. J Dairy Sci 2014;98(2):947-959.

752

Rev Mex Cienc Pecu 2020;11(3):738-756

9. Thatcher WW, De la Sota RL, Schmitt EJ, Diaz TC, Badinga L, Simmen FA, Staples CR, Drost M. Control and management of ovarian follicles in cattle to optimize fertility. Reprod Fertil Dev 1996;8(2):203-217. 10. De la Sota RL, Burke JM, Risco CA, Moreira F, DeLorenzo MA, Thatcher WW. Evaluation of timed insemination during summer heat stress in lactating dairy cattle. Theriogenology 1998;49(4):761-770. 11. Cartmill JA, El-Zarkouny SZ, Hensley BA, Rozell TG, Smith JF, Stevenson JS. An alternative AI breeding protocol for dairy cows exposed to elevated ambient temperatures before or after calving or both. J Dairy Sci 2001;84:799-806. 12. Peters MW, Pursley JR. Fertility of lactating dairy cows treated with ovsynch after presynchronization injections of PGF2α and GnRH. J. Dairy Sci 2002;85:2403-2406. 13. Diskin MG, Austin EJ, Roche JF. Exogenous hormonal manipulation of ovarian activity in cattle. Dom Anim Endocrinol 2002; 23(1-2):211-228. 14. Aréchiga CF, Staples CR, McDowell LR, Hansen PJ. Effects of timed insemination and supplemental β carotene on reproduction and milk yield of dairy cows under heat stress. J Dairy Sci 1998;81:390-402. 15. Stevenson JS, Kobayashi Y, Thompson KE. Reproductive performance of dairy cows in various programmed breeding systems including Ovsynch and combinations of gonadotropin-releasing hormone and prostaglandin F2α. J Dairy Sci 1999;82:506-515. 16. Carvalho PD, Guenther JN, Fuenzalida MJ, Amundson MC, Wiltbank MC, Fricke PM. Presynchronization using a modified Ovsynch protocol or a single gonadotropinreleasing hormone injection 7 d before an Ovsynch-56 protocol for submission of lactating dairy cows to first timed artificial insemination. J Dairy Sci 2014;97(10): 6305-6315. 17. Ferreira RM, Ayres H, Chiaratti MR, Ferraz ML, Araújo AB, Rodrigues CA, et al. The low fertility of repeat-breeder cows during summer heat stress is related to a low oocyte competence to develop into blastocysts. J Dairy Sci 2011;94(5):2383-2392. 18. Edwards JL, Bogart AN, Rispoli LA, Saxton AM, Schrick FN. Developmental competence of bovine embryos from heat-stressed ova. J Dairy Sci 2009;92(2):563570. 19. Roth Z, Arav A, Zeron Y, Braw-Tal R, Wolfenson D. Improvement of quality of oocytes collected in the autumn by enhanced removal of impaired follicles from previously heat-stressed cows. Reproduction 2001;122:737-744.

753

Rev Mex Cienc Pecu 2020;11(3):738-756

20. Guzeloglu A, Ambrose JD, Kassa T, Diaz T, Thatcher MJ, Thatcher WW. Long-term follicular dynamics and biochemical characteristics of dominant follicles in dairy cows subjected to acute heat stress. Anim Reprod Sci 2001; 66:15-34. 21. Friedman E, Voet H, Reznikov D, Wolfenson D, Roth Z. Hormonal treatment before and after artificial insemination differentially improves fertility in subpopulations of dairy cows during the summer and autumn. J Dairy Sci 2014;97(12):7465-7475. 22. Bruno RG, Farias AM, HernĂĄndez-Rivera JA, Navarrete AE, Hawkins DE, Bilby TR. Effect of gonadotropin-releasing hormone or prostaglandin F2Îą-based estrus synchronization programs for first or subsequent artificial insemination in lactating dairy cows. J Dairy Sci 2013;98(3):1556-1567. 23. Bauman DE, Everett RW, Weiland WH, Collier RJ. Production responses to bovine somatotropin in northeast dairy herds. J Dairy Sci.1999; 82(12):2564-2573. 24. Jousan FD, De Castro e Paula LA, Block J, Hansen PJ. Fertility of lactating dairy cows administered recombinant bovine somatotropin during heat stress. J Dairy Sci 2007; 90(1):341-351. 25. Rivera F, Narciso C, Oliveira R, Cerri RLA, Correa-Calderon A, Chebel RC, Santos JEP. Effect of bovine somatotropin (500 mg) administered at ten-d intervals on ovulatory responses, expression of estrus, and fertility in dairy cows. J Dairy Sci 2010; 93(4):1500-1510. 26. Collier RJ, Byatt JC, Denham SC, Eppard PJ, Fabellar AC, Hintz RL, McGrath MF, McLaughlin CL, Shearer JK, Veenhuizen JJ, Vicini JL. Effects of sustained release bovine somatotropin (Sometribove) on animal health in commercial dairy herds. J Dairy Sci 2001;84(5):1098-1108. 27. Bauman DE, St-Pierre NR, Milliken GA, Collier RJ, Hogan JS, Shearer JK, Smith KL, Thatcher WW. An updated meta-analysis of bovine somatotropin: effects on health and welfare of dairy cows. 24th Tri-State Dairy Nutrition Conference, Fort Wayne, Indiana, USA, 20-22 April, 2015. 28. Moreira F, Risco CA, Pires MF, Ambrose JD, Drost M, Thatcher WW. Use of bovine somatotropin in lactating dairy cows receiving timed artificial insemination. J Dairy Sci 2000;83(6):1237-1247. 29. Bilby CR, Macmillan KL, Verkerk GA, Peterson JA, Koenigsfeld A, Lucy MC. A comparative study of ovarian function in American (US) Holstein and New Zealand (NZ) Friesian lactating dairy cows [abstract]. J Dairy Sci 1998; 81(Suppl 1):222 .

754

Rev Mex Cienc Pecu 2020;11(3):738-756

30. Morales-Roura JS, Zarco L, Hernández-Ceron J, Rodríguez G. Effect of short-term treatment with bovine somatotropin at estrus on conception rate and luteal function of repeat-breeding dairy cows. Theriogenology 2001;55:1831-1841. 31. Mendoza-Medel G, Hernández-Cerón J, Zarco-Quintero LA, Gutiérrez CG. Porcentaje de concepción en vacas Holstein repetidoras tratadas con somatotropina bovina al momento de la inseminación. Rev Mex Cienc Pecu 2013;4(2):177-183. 32. Moreira F, Badinga L, Burnley C, Thatcher WW. Bovine somatotropin increases embryonic development in superovulated cows and improves post-transfer pregnancy rates when given to lactating recipient cows. Theriogenology 2002;57:1371-1387. 33. Moreira F, Orlandi C, Risco CA, Mattos R, Lopes F, Thatcher WW. Effects of presynchronization and bovine somatotropin on pregnancy rates to a timed artificial insemination protocol in lactating dairy cows. J Dairy Sci 2001;84(7):1646-1659. 34. Lucy MC. Reproductive loss in high-producing dairy cattle: where will it end? J Dairy Sci 2001;84(6):1277-1293. 35. Collier RJ, Miller MA, McLaughlin CL, Johnson HD, Baile CA. Effects of recombinant bovine somatotropin (rbST) and season on plasma and milk insulin-like growth factors I (IGF-I) and II (IGF-II) in lactating dairy cows. Domest Anim Endocrinol 2008;35(1):16-23. 36. Santos JEP, Juchem SO, Cerri RLA, Galvao KN, Chebel RC, Thatcher WW, Dei CR, Bilby CR. Effect of bST and reproductive management on reproductive performance of Holstein dairy cows. J Dairy Sci 2004;87(4):868-881. 37. Ingraham RH, Stanley RW, Wagner WC. Relationship of temperature and humidity to conception rate of Hosltein cows in Hawai. J Dairy Sci 1976;59(12):2086-2090. 38. Ferguson JD, Galligan DT, Thomsen N. Principal descriptors of body condition score in Holstein cows. J. Dairy Sci. 1994;77:2695-2703. 39. SAS. Statistical Analysis System. In: SAS/STATTM user's guide. Release 6.03. Cary, NC, SAS Institute Inc. 1988. 40. Royal M, Mann GE, Flint AP. Strategies for reversing the trend towards subfertility in dairy cattle. The Vet J 2000;160:53-60. 41. Ferris CP, Patterson DC, Gordon FJ, Watson S, Kilpatrick DJ. Calving traits, milk production, body condition, fertility, and survival of Holstein-Friesian and Norwegian Red dairy cattle on commercial dairy farms over 5 lactations. J Dairy Sci 2014; 97(8):5206–5218.

755

Rev Mex Cienc Pecu 2020;11(3):738-756

42. Al-Katanani YM, Paula-Lopes FF, Hansen PJ. Effect of season and exposure to heat stress on oocyte competence in Holstein cows. J Dairy Sci 2002;85:390-396. 43. Beam SW, Butler WR. Effects of energy balance on follicular development and first ovulation in postpartum dairy cows. J Reprod Fertil 1999;54(Suppl):411-424. 44. Pollott GE, Coffey MP. The effect of genetic merit and production system on dairy cow fertility, measured using progesterone proﬁles and on-farm recording. J Dairy Sci 2008;9(9):3649–3660. 45. Boland MP, Lonergan P, O'Callaghann D. Effect of nutrition on endocrine parameters, ovarian physiology, and oocyte and embryo development. Theriogenology 2001; 55:1323-1340. 46. Leroy JLMR, Vanholder T, Mateusen B, Christophe A, Opsomer GA, de Kruif G. Genicot G, Van Soom A. Non-esterified fatty acids in follicular fluid of dairy cows and their effect on developmental capacity of bovine oocytesin vitro. Reproduction 2005;130:485-495. 47. Royal MD, Darwash AO, Flint APF, Webb R, Wolliams JA, Lamming GE. Declining fertility in dairy cattle: changes in traditional and endocrine parameters of fertility. J Anim Sci 2000;70:487-501. 48. Bell A, Rodríguez OA, De Castro e Paula LA, Padua MB, Hernández-Cerón J, Gutiérrez CG, De Vries A, Hansen PJ. Pregnancy success of lactating Holstein cows after a single administration of a sustained-release formulation of recombinant bovine somatotropin. BMC Vet Res 2008;4:22. 49. Rodríguez A, Díaz R, Ortiz O, Gutiérrez CG, Montaldo H, García C, Hernández-Cerón J. Porcentaje de concepción al primer servicio en vacas Holstein tratadas con hormona del crecimiento bovina en la inseminación. Vet Méx 2009;40:1-7. 50. Lucy MC. Regulation of ovarian follicular growth by somatotropin and insulin-like growth factors in cattle. J Dairy Sci 2000;83(7):1635-1647. 51. Bilby TR, Sozzi A, Lopez MM, Silvestre FT, Ealy AD, Staples CR, Thatcher WW. Pregnancy, bovine somatotropin, and dietary n-3 fatty acids in lactating dairy cows: I. Ovarian, conceptus, and growth hormone-insulin-like growth factor system responses. J Dairy Sci 2006;89:3360-3374. 52. Block J, Hansen PJ. Interaction between season and culture with insulin-like growth factor-1 on survival of in vitro produced embryos following transfer to lactating dairy cows. Theriogenology 2007;67:1518-1529.

756

https://doi.org/10.22319/rmcp.v11i3.5019 Article

Effect of the internal size of the hive on brood, honey, and pollen production in Apis mellifera colonies in the central Mexican plateau

Alfonso Hernández Carlos a Ignacio Castellanos a*

Universidad Autónoma del Estado de Hidalgo. Centro de Investigaciones Biológicas. Km 4.5 carretera Pachuca-Tulancingo s/n, 42184, Hidalgo, México.

*Corresponding author: ignacioe.castellanos@gmail.com

Abstract: This study aimed to analyze the effect of the internal size on the strength (brood area) and productivity (honey and pollen areas) of the honeybee hives during the winter season in a semiarid region of the central Mexican plateau. Four Jumbo hive frames (45 x 28 cm) were used inside brood chambers with three internal sizes (52.2, 42.3, and 23.9 L), each chamber contained the same number of honeybees. Simultaneously, it was recorded the temperature inside the hives to determine if the brood chamber temperatures varied with the volume. The Jumbo hive, which is the largest hive, is the most used in the central Mexican plateau and showed the lowest strength and productivity values, as well as the lowest internal temperature. These results show that Jumbo hives can decrease the honey and pollen productivity for the central Mexican plateau beekeepers, which is why it is necessary to implement a practice or mechanism that allows maintaining strong beehives for the spring harvest. Key words: Apis mellifera, Hive, Brood chamber, Winter, Temperature, Honey. Received: 16/08/2018 Accepted: 09/06/2019

757

Rev Mex Cienc Pecu 2020;11(3):757-770

Introduction The climate plays an important role in the activity and behavior of social insects(1). For example, the flight activity of Apis mellifera has a positive linear response to the ambient temperature from 14 to 22 °C(2,3), and above 22 °C, the foraging activity decreases until it stops at 35 °C(3). The egg-laying by the queen bee of this species starts at 24 °C, and at around 33 °C it reaches its maximum capacity, subsequently decreasing(4). Additionally, the choice of flowers by the honey bee depends on several factors, mainly the floral availability, that is, it depends on the plant species whose flowering coincides with the foraging period, and this flowering depends on the climatic conditions(5,6). Bees storage large amounts of honey and pollen to provide energy and proteins to the brood, as well as for thermoregulation purposes, which allows maintaining the brood nest temperature between 32 and 36 °C for the correct development of larvae(7,8), despite having external temperatures that fluctuate between -20 and 48 °C. To maintain a stable internal temperature, bees employ active and passive mechanisms. Among the active mechanisms, physical activity can increase (e.g., contraction of wing muscles) and decrease (e.g., wingfanning) the temperature(1,7,8). Passive mechanisms include brood nest selection and moving the brood to regions with a more favorable temperature(1,8). Overall, A. mellifera wild bees choose a brood nest based on different characteristics like the size, height, entrance orientation, and internal volume(9,10,11). For example, A. mellifera worker bees choose brood nests with volumes between 15 and 100 L, although the most recurring size is 35 L(11). The characteristics that bees choose are important as the brood nest protects against adverse temperatures and provides thermal stability for bees(8,12,13). In beekeeping, humans determine the place and size of the brood nest; this space is known as a hive(14). In Mexico, in general, beekeepers use two types of technified hives: Jumbo and Langstroth(15). The internal space of the brood chamber of these hives is 52.1 and 41.7 L, respectively(16). The technified hives have mobile structures that allow increasing the space for egg-laying by the queen, increasing or decreasing the size of the colony when the external environmental factors are adverse(17). Therefore, the proper management of the space can influence the survival of the colonies during critical times(13,18). Recently, multiple changes in meteorological events have propitiated erratic gales and ground frosts, which does not favor optimal conditions for the development of bee flora(19,20,21). Therefore, it is necessary to evaluate how the internal space of the hives used in Mexico affects the maintenance of populations during winter (when temperatures drop

758

Rev Mex Cienc Pecu 2020;11(3):757-770

and bees must warm the brood nest using active mechanisms), and determine the effect of the hive size on bees and some of their products such as honey and pollen, under the specific conditions of each apicultural region. Therefore, this study aimed to determine the effect of the internal size of the hive on the production of offspring and the storage of honey and pollen, as well as the internal temperature of the brood nest in A. mellifera colonies during winter.

Material and methods Area of study

This study was performed in the locality of Huitzila, Tizayuca municipality, in the state of Hidalgo (19°47’50’’ - 19°53’50’’ N; 99°02’ - 98°54’ W) at an altitude of 2,260 masl(22) within the central Mexican plateau. This region has a humid subtropical climate with rainfall during summer, an annual mean temperature of 15.1 °C, and annual mean precipitation of 627 mm. The coldest month is January, with minimum and mean temperatures of 1.4 and 11.5 °C, respectively; the warmest month is May, with minimum and mean temperatures of 8.7 and 17.8 °C, respectively(23).

Preparation of bees

On December 2016, at the end of the nectar and pollen flows, a total of 10 colonies showing a homogeneous development were selected, from these colonies we extracted approximately 120,000 adult bees(24) for the experiment, from which 10,000 worker bees were assigned homogeneously to each of the 12 colonies used in the experiment. The number of bees was determined by immobilizing them in a growth chamber (Shel Lab, model LI15) at -2 °C for 10 min. Each of the 12 groups of 10,000 bees was placed inside 12 hives with different internal volumes and the capacity to house several Jumbo type frames (45 x 28 cm) (Figure 1). It was used four hives with external measurements of 51 x 30 x 21 cm to house four frames, four hives with external measurements of 51 x 30 x 34 cm to house eight frames, and four 51 x 30 x 41 cm hives to house 10 frames; the internal volumes were 23.9 L (experimental hive), 42.3 L (Langstroth hive), and 52.2 L (Jumbo hive), respectively. The hives were built of 2 cm thick pine wood and treated with paraffin. To each colony of 10,000 bees, we 759

Rev Mex Cienc Pecu 2020;11(3):757-770

placed four frames with wax foundation and a newly fertilized queen bee from the same breeding stock and from the same batch of a heterogeneous mixture of the Italian and Carniolan species, which allowed the colonies to start with the same initial conditions (queen bees were sisters). Each hive was supplied with 600 ml of syrup with a sugar to water ratio of 1:1 and 150 g of a protein supplement (Apitir plus, TirtĂŠcnica company) every eight days(25,26). The supply of syrup and protein supplement was maintained throughout the experiment. Figure 1: Hives with different internal volumes used during the experiment, A) experimental hive, B) Langstroth hive and C) Jumbo hive

Experiment

Four replications were used for each hive size, giving a total of 12 experimental units arranged in a completely randomized design, at a distance of 2 m between rows and 1 m between hives in the same row(17). The internal temperature of the hives was recorded using 24 data loggers (Thermochron iButton, model DS1921G). In each hive, two data loggers were placed in the third frame, one in the center and the second in the head to determine if the internal temperature varied with the brood chamber volume. Additionally, the ambient temperature in the shade was recorded using 12 dataloggers. Temperatures were recorded every 60 min during the experiment. The experiment started the first week of December and ended on April 28, at the beginning of flowering. The brood, honey, and pollen areas were quantified using a plastic laminate grid in centimeters(24) (Figure 2). The number of adult bees was not determined in order to maintain social cohesion(24). The brood, honey, and pollen areas on both sides of each

760

Rev Mex Cienc Pecu 2020;11(3):757-770

frame were recorded on only three dates (February 2, March 7, and April 28) to preserve social cohesion(24). Figure 2: A) Frame with and B) without the transparent grid used to quantify the brood, honey, and pollen areas

Statistical analysis

A one-way analysis of variance (ANOVA) was used to determine if there are significant differences between treatments (hive type) in the brood, honey, and pollen areas for each sampling date. The mean temperatures at the center and head throughout the experiment were also compared with an ANOVA, and assumptions were verified using the Kolmogorov-Smirnov test for normality and the Levene test for homogeneity of variances, and if not met, a non-parametric ANOVA (Kruskal-Wallis) was used. Turkey's multiple comparisons test was applied when significant differences were obtained (PË&#x201A;0.05). The statistical analyses were performed with the statistical program SigmaStat 3.5(27). Average Âą Standard Error is reported.

761

Rev Mex Cienc Pecu 2020;11(3):757-770

Results The brood area of A. mellifera on the first sampling date (February 2) was 1125.73 ± 136.65 cm2 for the 23.9 L hives, 1,016.75 ± 364.64 cm2 for the 42.3 L hives, and 1,398.63 ± 334.67 cm2 for the 52.2 L hives; these values were not significantly different from each other (F=0.44, g.l.=2,11, P>0.05) (Figure 3). The brood area of A. mellifera on the second sampling date (March 7) was 1,610.25 ± 83.37 cm2 for the 23.9 L hives, 1,654.75 ± 473.37 cm2 for the 42.3 L hives, and 1,692.75 ± 68.03 cm2 for the 52.2 L hives; these values were not significantly different from each other (H =0.50, g.l.=2, P>0.05). The brood area was significantly different between the hive types at the end of the experiment (April 28) (F=23.88, g.l.=2,11, P˂0.001). The brood area in hives with an internal volume of 23.9 L was on average 3,077.25 ± 81.81 cm2, and in the 42.3 L hives, 2,906.2 ± 94.6 cm2; both values were significantly higher than the value in the colonies developed in 52.2 L hives, whose brood area was 2,331.2 ± 59.5 cm2 (P˂0.01). The brood area in the 23.9 L hives was not significantly different from that in the 42.3 L hives (P>0.05). Figure 3: Brood area (average ± standard error) in three hive sizes at the end of the study period

Values with different letters indicate significant differences (P˂0.05).

The honey area on the first sampling date was 980.38 ± 263.64 cm2 for the 23.9 L hives, 952.75 ± 201.76 cm2 for the 42.3 L hives, and 992.50 ± 93.93 cm2 for the 52.2 L hives

762

Rev Mex Cienc Pecu 2020;11(3):757-770

(F=0.01, g.l.=2,11, P>0.05) (Figure 4). The honey area on the second sampling date was 905.75 ± 198.38 cm2 for the 23.9 L hives, 465.25 ± 167.03 cm2 for the 42.3 L hives, and 621.50 ± 184.88 cm2 for the 52.2 L hives (F =1.48, g.l.=2,11 P>0.05). The honey area at the end of the study period was significantly different between the hive types (F=8.80, g.l.=2,11, P˂0.01). The average of the honey area in the 23.9 L hives (1,424 ± 56.9 cm2) was significantly higher than that in the 52.2 L hives (849.5 ± 94.4 cm2, P˂0.05), but it did not differ significantly from the value in the 42.3 L colonies (1,056 ± 19.7, P>0.05). The honey area in the 42.3 and 52.2 L hives was similar (P>0.05). Figure 4: Honey area (average ± standard error) in three hive sizes at the end of the study period

Values with different letters indicate significant differences (P˂0.05).

The pollen area on the first sampling date was 136.38 ± 26.67 cm2 for the 23.9 L hives, 242.75 ± 147.59 cm2 for the 42.3 L hives, and 112.50 ± 13.14 cm2 for the 52.2 L hives (H =0.34, g.l.=2, P>0.05). The pollen area on the second sampling date was 252.75 ± 77.03 cm2 for the 23.9 L hives, 146.5 ± 35.11 cm2 for the 42.3 L hives, and 192.5 ± 43.19 cm2 for the 52.2 L hives (F =0.94, g.l.=2,11 P>0.05). The pollen area at the end of the study period was significantly different between the hive types (F =9.12, g.l.=2,11, P˂0.01) (Figure 5). The pollen area at the end of the study period was significantly larger in the 23.9 L hive (227.0 ± 37.0 cm2) than in the 42.3 L (87.7 ± 29.9 cm2) and 52.2 L (56.2 ± 21.3 cm2) hives (P˂0.05). The pollen area in the 42.3 and 52.2 L hives was not significantly different (P>0.05) (Figure 5).

763

Rev Mex Cienc Pecu 2020;11(3):757-770

Figure 5: Pollen area (average ± standard error) in three hive sizes at the end of the study period

Values with different letters indicate significant differences (P˂0.05).

The average temperature in the center of the hives was relatively stable throughout the day during the experiment, despite the fact that the ambient temperature varied on average between 7 and 33 °C (Figure 6). The temperature in the center of the 23.9 L hives was 33.6 ± 1.0 °C, 33.4 ± 0.8 °C in the 42.3 L hives, and 33.7 ± 0.9 °C in the 52.2 L hives (F=0.04, g.l.=2,11, P>0.05). The average temperature in the head varied throughout the day in the three hive types and was significantly higher in the 23.9 L (23.4 ± 0.5 °C) and 42.3 L (23.8 ± 0.6 °C) hives than in the 52.2 L hives (21.4 ± 0.4 °C) (F=6.92, g.l.=2,11, P˂0.05) (Figure 7). The head temperature in the 23.9 and 42.3 L hives was not significantly different (P>0.05).

764

Rev Mex Cienc Pecu 2020;11(3):757-770

Figure 6: Ambient and internal (center and head of the third frame) temperatures in three hive sizes

The values represent the average Âą standard error.

Figure 7: Head temperature (average Âą standard error) in three hive sizes at the end of the study period

Values with different letters indicate significant differences (PË&#x201A;0.05).

765

Rev Mex Cienc Pecu 2020;11(3):757-770

Discussion The results obtained in this study demonstrate that the colony development expressed as the brood area at the end of the experiment was lower when it was on the Jumbo type brood chamber, the larger one (Figure 3). Similarly, the honey and pollen area were lower in the hives with larger internal volumes (52.2 and 42.3 L) than the 23.9 L experimental hives (Figure 4,5). These results coincide with those reported by Abd-Elmawgood et al(15), who compared three internal hive sizes (38, 31, and 24 L) and obtained the best response (increased amount of brood, pollen, and honey) with the smaller hives. As in our work, they also found that the differences in the amount of brood, pollen, and honey between hives of different internal sizes manifested in late winter and early spring. Similarly, Ballesteros et al(28) reported that royal jelly production was higher in rearing hives with six frames than in hives with eight and ten frames. It was also found that the temperature in the center of the brood nest of A. mellifera was not significantly different concerning the size of the hive, indicating that regardless of the size of the hive, bees can thermoregulate and maintain the brood at temperatures around 33 Â°C for their offspring to develop properly(7,8). However, the head temperature was significantly lower in the Jumbo hives (52.2 L) than in the 42.3 and 23.9 L hives (Figures 6,7). These results show that bees can more efficiently conserve the heat generated during the heating of the brood nest in the smaller brood chambers, which had already been suggested(15,28). The lower percentage of brood, honey, and pollen areas found in the larger hives may be related to different factors. Bees have probably consumed more honey in the hives with a lower internal temperature to obtain the necessary metabolic energy to thermoregulate(29,30). Although the heat production was not directly quantified, we did observe that in the Jumbo hives the worker bees remained aggregated around the brood nest for a longer time than in the smaller hives, which suggests that the worker bees in the larger hives invested more time in thermoregulation than in brood production(31) or foraging(2,3,18). Additionally, a higher temperature inside the smaller hives could facilitate the nest construction since the wax elasticity increases, and the energy expenditure to mold it decreases as the temperature increases(32,33). Finally, it is necessary to consider that the colony development also depends on the adults present during the winter season(17); however, in this study, it was not quantified the adults to avoid affecting the social cohesion of the colonies(24), but it is necessary to consider these data in future studies. It has been suggested that it is necessary to use hives that allow increasing the internal temperature of the European beehives during the winter season(34,35,36). In this study, it was compared two hives commonly used in Mexico (Jumbo and Langstroth) and a smaller

766

Rev Mex Cienc Pecu 2020;11(3):757-770

experimental hive. The results show that the experimental hive provides better thermal conditions and increases in strength (greater amount of brood) and productivity of the honeybee. However, the thermal and internal space requirements of the A. mellifera hive can vary between breeds and climates(37-40); therefore, it is necessary to perform studies under the specific conditions of each apicultural region.

Conclusions and implications The best response of strength (greater amount of brood) and honey reserves were recorded when the hive with the smallest internal size (23.9 L) was used. The Jumbo hive, used in the central Mexican plateau, showed the lowest honey, pollen, and brood values at the end of winter. This can decrease the honey and pollen production of beekeepers that use this type of hive, which is why it is convenient to implement a practice or mechanism that allows maintaining strong bee colonies for the spring harvest. For example, bees can be fed water and nectar and pollen substitutes, and the internal size of the hive can be reduced using space reducers. Winter is traditionally considered a season in which the queen bee stops laying eggs, and the thermal and feeding requirements of the colony decrease. However, during this study, performed in the Tizayuca municipality, it was recorded ambient temperatures higher than 24 °C for more than six hours a day during the winter, which allowed the queen bee to maintain its egg-laying activity during this season. This different behavior requires better monitoring by the beekeeper to maintain the bee colonies with enough food reserves during the winter to avoid their weakening.

Acknowledgments To the Consejo Nacional de Ciencia y Tecnología (CONACYT). for the scholarship awarded to AHC during the performance of this study. We also thank the Centro de Investigaciones Biológicas, and the Programa Anual de Investigación (2016) of the Universidad Autónoma del Estado de Hidalgo, as well as REFAMA (REFAMA CONACYT code 251272 "Red Temática Biología, Manejo y Conservación de Fauna Nativa en Ambientes Antropizados” for the support given during this study. Finally, we thank Irina Zuria and two anonymous reviewers for their valuable contributions to improving the manuscript.

767

Rev Mex Cienc Pecu 2020;11(3):757-770

Literature cited: 1. Jones CV, Oldroyd BP. Nest thermoregulation in social insects. Adv Insect Physiol 2007;33:153-171. 2. Burril RM, Dietz A. The response of honey bees to variations in solar radiation and temperature. Apidologie 1981;12(4):319-328. 3. Reyes CJL, Cano RP. Manual de polinización apícola. Programa nacional para el control de la abeja africana-Instituto interamericano para la cooperación agrícola. Manual no. 7. Distrito Federal, México: Secretaría de Agricultura, Ganadería, Pesca y Alimentación (SAGARPA); 2003. 4. Dunham WE. Temperature gradient in the egg-laying activities of the queen bee. Ohio J Sci 1930;30(6):403-410. 5. Yuca-Rivas R. Variación intranual en el espectro polínico de la miel producida en Huarán (Cusco, Perú). Ecol Apl 2016;15(1):27-36. 6. Cho LH, Gynheung A. The control of flowering time by environmental factors. Plant J 2017;90:708-719. 7. Heinrich B. The hot-blooded insects: strategies and mechanisms of thermoregulation. Alemania, Berlin: Springer-Verlag; 1993. 8. Winston ML. The biology of the honey bee. Cambridge, Massachusetts, EUA: Harvard University Press; 1987. 9. Seeley TD, Morse RA. The nest of the honey bee (Apis mellifera L.). Insectes Soc 1976;23(4):495-512. 10. Seeley TD, Morse RA. Nest site selection by the honey bee, Apis mellifera. Insectes Soc 1978;25(4):323-337. 11. Seeley TD. Measurement of nest-cavity volume by the honey bee (Apis mellifera). Behav Ecol Sociobiol 1977;2(2):201-227. 12. Szabo TI. The Thermology of wintering honeybee colonies in 4-colony packs as affected by various hive entrances. J Apic Res 1985;24(1):27-37. 13. Toomemaa K, Mand M, Williams IH. Wintering of honey bee colonies in cylindrical nest cavities versus oblong box-hives in a North European climate. J Apic Res 2016;54(4):105-111. 14. Ros PJM. Iniciación a la apicultura. Murcia, España: Comunidad Autónoma de la Región de Murcia; 2009. 768

Rev Mex Cienc Pecu 2020;11(3):757-770

15. Romero NJM. Diseño de colmena [tesis maestría]. Ciudad de México, México; Universidad Nacional Autónoma de México; 2017. 16. SAGARPA. Manual de buenas prácticas pecuarias en la producción de miel. Distrito Federal, México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (SAGARPA);2010. 17. Jean-Prost P, Le Conte Y. Apicultura: conocimiento de la abeja, manejo de la colmena 4ª ed. Barcelona, España: Mundi-Prensa; 2006. 18. Abd-Elmawgood BH, Al-Rajhi MA, El-Ashhab AO. Effect of the internal size and thermal insulation of the hive on bee colonies strength and productivity. Egyptian J Agric Res 2015;93:185-195. 19. Hoover SER, Hoover TM. Impact of environmental change on honeybees and beekeeping. In: Gupta R, et al editors. Beekeeping for poverty alleviation and livelihood security. Nueva York, EUA: Springer; 2014:463-480. 20. Reddy PVR, Verghese A, Rajan VV, Potential impact of climate change on honeybees (Apis spp.) and their pollination services. Pest Manag Hortic Ecosyst 2012;18:121-127. 21. Contreras EF, Pérez AB, Echazarreta CM, Cavazos AJ, Macías MJO, Tapia GJM. Características y situación actual de la apicultura en las regiones Sur y Sureste de Jalisco, México. Rev Mex Cienc Pecu 2013;4(3):387-398. 22. SPDRMH. Secretaría de planeación y desarrollo regional y metropolitano del estado de Hidalgo, México. http://intranet.ehidalgo.gob.mx/NormatecaE/Archivos/archivo6405.pdf. Consultado 30 Ago, 2017. 23. DCM. Datos Climáticos Mundiales. https://es.climate-data.org/. Consultado 4 Jun, 2017. 24. Delaplane KS, Steen JVD, Guzman-Novoa E. Standart methods for estimating strength parameters on Apis mellifera colonies. J Apic Res 2013;52(1):1-12. 25. Cervantes GER. Incidencia de la alimentación suplementaria en la producción y productividad de la apicultura (Apis mellifera) [tesis licenciatura]. Colimbuela, Ecuador; Universidad Técnica del Norte; 2010. 26. Martínez GEG, Pérez LH. La producción de miel en el trópico húmedo de México: avances y retos en la gestión de la innovación 1ª ed. Texcoco, México: Universidad Autónoma Chapingo; 2013. 27. Systat Software. SigmaStat 3.5. Chicago, EUA: Systat Software; 2006.

769

Rev Mex Cienc Pecu 2020;11(3):757-770

28. Ballesteros HH, Vásquez RE. Determinación de jalea real en colmenas de recría de diferentes dimensiones. Revista Corpoica 2007;8(1):75-78. 29. Southwick E. Metabolic energy of intact honey bee colonies. Com Biochem Physiol 1982;71(2):277-281. 30. Seeley TD, Visscher PK. Survival of honeybees in cold climates: the critical timing of colony growth and reproduction. Ecol Entomol 1985;10(1)81-88. 31. Vogt FD. Thermoregulation in bumblebee colonies. I. Thermoregulatory versus broodmaintenance behaviors during acute changes in ambient temperature. Physiol Zool 1986;59(1):55-59. 32. Hepburn HR. Honeybees and wax, an experimental natural history. Heidelberg, Alemania: Springer; 1986. 33. Karihaloo BL, Zhang K, Wang J. Honeybee combs: how the circular cells transform into rounded hexagons. J R Soc Interface 2013;10(86):20130299. 34. Abou-Shaara HF, Oways AA, Ibrahim YY, Basuny NK. A review of impacts of temperature and relative humidity on various activities of honey bees. Insectes Soc 2017;64(4):455-462. 35. Wineman E, Lensky Y, Mahrer Y. Solar heating of honey bee colonies (Apis mellifera L.) during the subtropical winter and its impact on hive temperature, worker population and honey production. Am Bee J 2003;43(7):565-570. 36. Erdogan Y, Dodologlu A, Emsen B. Some physiological characteristics of honeybee (Apis mellifera L.). housed in heated, fan wooden and insulated beehives. J Anim Vet Adv 2009;8(8):1516-1519. 37. Gould JL. Why do honey bees have dialects? Behav Ecol Sociobiol 1982;10(1):53-56. 38. Schmidt JO, Hurley R. Selection of nest cavities by Africanized and European honey bees. Apidologie 1995;26(6):467-475. 39. Schneider S, Blyther R. The habitat and nesting biology of the African honey bee Apis mellifera scutellata in the Okavango River Delta, Botswana, Africa. Insectes Soc 1988;35(2):167-181. 40. Hoover SER, Hoover TM. Beehives in the world. In: Gupta R, Reybroeck W, van Veen J, Gupta A editors. Beekeeping for poverty alleviation and livelihood security. Nueva York, EUA: Springer; 2014:125-170.

770

https://doi.org/10.22319/rmcp.v11i3.5154 Article

Seroprevalence of viral agents of the Bovine Respiratory Complex in Creole breeds of the Turipaná Research Center of AGROSAVIA

Matiluz Doria-Ramos a* Teresa Oviedo-Socarras b Misael Oviedo-Pastrana a Diego Ortiz-Ortega c

Corporación Colombiana de Investigación Agropecuaria – AGROSAVIA, Centro de investigación Turipaná, Km 13 vía Montería. Cereté, Córdoba, Colombia. a

Universidad de Córdoba. Facultad Medicina Veterinaria y Zootecnia. Departamento de Ciencias Pecuarias. Montería, Colombia. Corporación Colombiana de Investigación Agropecuaria – AGROSAVIA. Centro de Investigación Tibaitatá, Mosquera-Cundinamarca. Colombia. c

* Corresponding author: mdoriar@agrosavia.co

Abstract: A descriptive cross-sectional study was conducted in order to determine the prevalence and epidemiological factors associated with viral diseases of the Bovine Respiratory Complex (BRC) in Creole breeds of the Turipaná Research Center - AGROSAVIA (Colombia). A total of 403 cattle of the Romosinuano breed and 445 of Horned Coastal Creole cattle (CCC, Spanish acronym) breeds were evaluated. The presence of antibodies for bovine viral diarrhea (BVD), infectious bovine rhinotracheitis (IBR), parainfluenza-3 (PI3) and bovine respiratory syncytial virus (BRSV) was determined through the indirect ELISA technique. The prevalences were estimated, and the associations between the viral agents and the variables of sex, age, herd type and breed were evaluated. The Chi-square test was applied with a level of 5% significance and the effect of the association was determined by the Odds

771

Rev Mex Cienc Pecu 2020;11(3):771-782

Ratio (OR). A logistic regression model was constructed to explain the most prevalent disease. The mean prevalences in both breeds were: BVD (33.02 %), BRSV (18.51 %), IBR (12.85 %) and PI3 (11.20 %); however, individually, the CCC breed had a higher prevalence for all diseases. The regression model showed an association between DVB, IBR and PI3, sex, age, females of more than 1 year of age, and the CCC breed. In order to address the diseases of the BRC, it is recommend actions with an emphasis on the control and prevention of BVD and deeper studies to understand the dynamics and co-endemicity of the BVD, IBR, BRSV and PI3 in the breeds studied. Key words: Seroprevalence, Bovine respiratory complex, Bovine respiratory disease, Romosinuano, Horned Coastal Creole.

Received: 20/11/2018 Accepted: 23/09/2019

Introduction Bovine respiratory complex (BRC) diseases are one of the main causes of economic losses in livestock farms(1). These losses are ascribed to decreased production efficiency, treatment costs, increased labor and death of animals due to pneumonia(2). The development of BRC is associated with environmental factors (management, stress and feeding), individual-specific factors (age, body condition and immunity), and the action of infectious agents (viruses, bacteria, and parasites)(1). Viral agents associated with BRC diseases include the IBR, PI3, BRSV and BVD viruses(3). Respiratory disease occurs when a pathogenic virus infects the host and allows opportunistic bacteria, normally present in the upper respiratory tract, to invade the lungs and cause severe pneumonia and death. These bacteria include Pasteurella multocida, Mannheimia haemolytica, Mycoplasma bovis, and Histophilus somni(1). Epidemiological studies in the municipality of Montería, department of Córdoba, Colombia, determined the seroprevalence of viruses associated with BRC, the percentages being 74.7 % for IBR(4), 29.4 % for BVD(5), 13.5 % for PI-3(6), and 13 % for BRSV(7). The aim of this study was to analyze the presence of the BVD, IBR, PI3, and BRSV viruses involved in the BRC diseases and the associated epidemiological factors in the two Creole bovine breeds at the Turipaná Research Center of AGROSAVIA, in the municipality of Cereté, Córdoba. 772

Rev Mex Cienc Pecu 2020;11(3):771-782

Material and methods Study site

The study was conducted at the research center, located at 8°50’79” N and -75°47’58” W, in the municipality of Cereté, department of Córdoba, Colombia. The area is classified as dry tropical forest; it is located an altitude of 14 m asl, and has an average temperature of 27.5 o C, a relative humidity of 81 %, and an average annual precipitation of 1,340 mm, 85 % of which falls between the months of April and November(8).

Type of study and sample size

A cross-sectional descriptive epidemiological study was conducted on all animals of the two Creole breeds, Romosinuano (403 animals) and Horned Coastal Creole (CCC), 445 animals, at the Turipaná research center in AGROSAVIA. The study was conducted from May to October, 2016.

Sample processing

After disinfection of the area, 5 ml of blood was collected from the coccygeal vein, in Vacutainer® tubes without anticoagulant. Samples were marked with the animal number and date of collection and stored at 4oC. They were then centrifuged at 3,500 rpm during 5 min in order to obtain serum, and subsequently placed in vials and stored at -20 oC until further analysis. They were processed in the laboratory at the Tibaitatá research center of AGROSAVIA, in the department of Cundinamarca, using commercial ELISA test kits (Synbiotics® for BVD and IBR, Biox Prionics® for BRSV and PI3), following the manufacturers’ recommendations.

773

Rev Mex Cienc Pecu 2020;11(3):771-782

Data analysis

The prevalence study was accompanied by an epidemiological survey aimed at determining factors that may be associated with the pathologies under study â&#x20AC;&#x201D;such as sex, breed (Romosinuano and CCC), age (<1 year and >1 year), and herd type (Germplasm Bank and Genetic Improvement)â&#x20AC;&#x201D; were analyzed. These factors were associated in a univariate way with the (positive or negative) serological results of each one of the studied infectious agents; the Chi-square statistic and a significance level of 0.05 were applied; additionally, probability ratio measures were determined. Finally, a logistic regression model was constructed to explain the correlation between the factors and diseases studied; as a response variable, the disease with the highest prevalence was selected. Data were analyzed using the EpiInfo 7.2.1.0ÂŽ software.

Results and discussion The BVD, IBR, PI3 and BRSV viruses, which are part of the BRC complex, have been reported in different cattle farms in Colombia. However, this study is the first one that seeks to determine their prevalence in the Romosinuano and CCC creole breeds. These breeds are claimed to be resistant and well adapted to the ecological conditions of the low tropics on the northern coast of Colombia(9,10). However, both exhibited seroprevalence for the four viral diseases of the BRC, with CCC being the most susceptible (Table 1). The virus with the greatest presence in both races was the BVD virus, with a prevalence rate of 33.60 %, followed by the BRSV, with almost half the percentage (18.51 %), while the agents with the least presence were IBR and PI3, with prevalence rates of 12.8 % and 11.20 %, respectively.

774

Rev Mex Cienc Pecu 2020;11(3):771-782

Table 1: Seroprevalence of BRC viral diseases in the races of the Turipaná Research Center (%) Disease

Variables Categories

DVB

Breed

BRSV

Breed

IBR

Breed

PI3

Breed

Romosinuano CCC Romosinuano CCC Romosinuano CCC Romosinuano CCC

Seroprevalence

100 185 60 97 47 62 29 66

303 265 343 348 356 383 374 379

24.81 40.45 14.89 21.80 11.66 13.93 7.20 14.83

As in this study, a high seroprevalence for BVD has been confirmed in other regions of Colombia; a previous study in the municipality of Montería reported 29.5 % seropositivity(6), and another study carried out in the department of Cesar obtained results of 46 %(11). BRSV is believed to be prevalent in cattle populations worldwide. Studies on this virus in animals with a history of infertility in Montería yielded seroprevalences of 13 %(5), and of 31 % in newborn calves(12). In England, 83 % of cattle have antibodies, and in the United States, this is implicated in more than 50 % or respiratory diseases among fattening cattle(13). The prevalence of IBR in cattle has been reported historically in several regions of Colombia. In 1982, seropositivity was found to be 51.7 % in the Caribbean region; 21.5%, in the Andean region, and 20.6% in the Pie de Monte Llanero region(14). Recently, prevalences of 55.5% were reported in the Magdalena region(15), and of 35.65 % in the municipality of Toca Boyacá(16). Among the reports analyzed(17), the highest seroprevalences for this virus have been reported in the municipality of Montería, where the seroprevalence in females with a history of infertility was 74.7 %(4), and 60 % in newborn calves(12); in the department of Antioquia, a prevalence of 68.9 %(18) was reported in the Creole White Black-eared breed. Seroprevalences of 44.6 % were found in Argentina(2) and 81.8 % in Peru(19). Tables 2, 3, 4 and 5 show the univariate analysis of the factors studied on the different BRC diseases. The greater susceptibility of females to BRC diseases could be explained as a consequence of the high number of handlings carried out on females, due to a greater productive and reproductive demand. Factors associated with milking, artificial insemination and embryo transfer are considered to be stress factors that may render the females more susceptible to disease than the males(20).

775

Rev Mex Cienc Pecu 2020;11(3):771-782

Table 2: Univariate analysis of factors associated with BVDV in the Creole cattle herd at the Turipaná Research Centre in Corpoica Variables Categories Sex

Age

Herd

Breed

Male

232

Female

239

336

˂ 1 year

185

˃ 1 year

233

383

Genetic Improvement

Germplasm Bank

269

497

Romosinuano 100

303

P-value

O.R.

95% CI Lower

Higher

<0.001

4.025

2.776

5.833

<0.001

2.395

1.672

3.430

<0.001

3.493

1.819

6.706

<0.001

2.058

1.532

2.763

Table 3: Univariate analysis of factors associated with IBR virus in the Creole cattle herd of the Turipaná Research Center of AGROSAVIA Variables Sex Age Herd

Breed

Categories

Male

247

Female ˂ 1 year ˃ 1 year

83 37 72

492 195 544

Genetic Improvement Germplasm Bank Romosinuano CCC

668

47 62

356 383

776

Pvalue

O.R.

95% CI Lower Higher

0.045

1.602

1.005

2.554

0.098

0.698

0.454

1.071

0.873

0.946

0.484

1.849

0.324

1.226

0.817

1.839

Rev Mex Cienc Pecu 2020;11(3):771-782

Table 4: Univariate analysis of factors associated with the VHL in the Creole cattle herd of the Turipaná Research Center of Corpoica Variables Categories

Sex

Age

Herd

Breed

Male

237

Female

121

454

˂ 1 year

182

˃ 1 year

107

509

Genetic Improvement

Germplasm Bank

138

628

Romosinuano

343

CCC

348

P-value O.R.

95% CI Lower Higher C

0.005

1.754

1.171

2.627

0.162

0.765

0.525

1.115

0.253

0.728

0.422

1.256

0.009

1.593

1.117

2.272

Table 5: Univariate analysis of factors associated with the PI3 virus in the Creole cattle herd at the Turipaná Research Center in Corpoica Variables Categories

Male

264

Female

489

˂ 1 year

222

Age

˃ 1 year

531

Herd

Genetic Improvement

Sex

Breed

Germplasm Bank 94 Romosinuano 29

672 374

CCC

379

P-value

O.R.

95% CI Lower Higher

<0.001

5.158

2.554

10.417

0.000

3.554

1.812

6.971

0.002

11.330

1.558

8.237

<0.001

2.245

1.418

3.555

Age was positively associated with BVD and PI3, with animals aged >1 year being most affected (2.39 and 3.55 times, respectively). Although cattle are susceptible to BVD infection at all ages, animals older than one year are more likely to be seropositive. This is probably

777

Rev Mex Cienc Pecu 2020;11(3):771-782

due to decreased passive immunity resulting from maternal antibodies and from a longer exposure time to the pathogens involved in the disease(21). The herd type was also associated with BVD and PI3. In this sense, the Germplasm Bank herd was more affected than that of the breeding program (3.49 and 11.33 times for BVD and PI3, respectively). The higher susceptibility of the cattle in the Germplasm Bank may be accounted for by the higher population density in this group, which favors the aerogenic dispersion of these viruses; the higher humidity in the pastures used by these animals is another factor that favors the occurrence of the disease(22). The univariate analysis showed a statistical association between the race variable and BVD, RSV and PI3 viruses, with CCC being the most seropositive to these three infectious agents, compared to the Romosinuano breed. The CCC was 2.05 times more seropositive for BVD, 1.59 times more seropositive for BRSV, and 2.24 times more seropositive for PI3. However, multivariate analysis only revealed a statistically significant association between CCC and BVD (OR= 1.845, 95 % CI = 1.349-2.523, P<0.001). There are no studies that demonstrate that the CCC breed has a higher exposure to these infectious agents than Romosinuano. Therefore, this study suggests conducting specific immunological studies in order to further research breed-specific susceptibility to these diseases. BVD and PI3 viruses were the only infectious agents that presented a statistical association with all the variables studied. However, since BVD was more frequent in the studied herds, the logistic regression model for viral diseases of the BRD complex was based on BVD. The logistic regression model (Table 6) showed that BVD has an association with female sex, animals aged over one year, and the CCC breed, suggesting that these factors may significantly contribute to the development of these infections. The association between BVD, IBR and PI3 was also demonstrated. IBR-positive animals are 3.04 times more likely to have BVD, while PI3-positive animals are 3.81 times more likely. However, given the type of serological diagnosis and because this is a cross-sectional study, it is not possible to detect a causal relationship between the three diseases or to evaluate a time sequence in their occurrence. Although the final model showed epidemiological relevance, the log-likelihood and Hosmer-Lemeshow statistics indicated a poor model fit. Nevertheless, variable elimination was not considered because all the variables left in the final model have epidemiological significance, as confirmed by the univariate statistics. Further epidemiological studies on these issues are required.

778

Rev Mex Cienc Pecu 2020;11(3):771-782

Table 6: Logistic regression model for BRC diseases, based on the BVD virus Variables Sex Age Breed IBR PI3

Categories Male Female ˂ 1 year ˃ 1 year Romosinuano CCC Negative Positive Negative Positive

P-value

O.R.

95% CI Lower

Higher

<0.001

3.833

2.587

5.678

<0.002

1.871

1.262

2.773

<0.001

2.564

1.846

3.561

<0.001

3.045

1.659

5.589

<0.001

3.811

1.966

7.386

Conclusions and implications

In conclusion, all the main viral agents involved in the BRD complex are present in the Creole livestock of the Turipaná Research Center. An action plan is recommended to control and prevent these diseases at the research center, with an emphasis on the control and prevention of BVD. In addition, further follow-up studies are required in order to understand the dynamics and co-endemicity processes of the BVD, IBR, BRSV and PI3 viruses in the Romosinuano and CCC breeds.

Acknowledgements The authors would like to thank the National System of Germplasm Banks for Food and Agriculture (Sistema de Bancos de Germoplasma de la Nación para la Alimentación y la Agricultura, SBGNAA), based at the Turipaná Research Center of AGROSAVIA, for allowing access to the cattle used in this research.

779

Rev Mex Cienc Pecu 2020;11(3):771-782

Conflict of interests

The authors declare that they have no conflict of interests.

Literature cited: 1.

Gershwin LJ, Van Eenennaam AL, Anderson ML, McEligot HA, Shao MX, ToaffRosenstein R et al. Single Pathogen Challenge with Agents of the Bovine Respiratory Disease Complex. PLoS One 2015; 10(11):142-479. https://doi.org/10.1371/journal.pone.0142479.

Carbonero A, Maldonado A, Perea A, García-Bocanegra I, Borge C, Torralbo A et al. Factores de riesgo del síndrome respiratorio bovino en terneros lactantes de Argentina. Arch Zoot 2011; 60 (229):41-51. https://dx.doi.org/10.4321/S000405922011000100005.

Grissett GP, White BJ, Larson RL. Structured literature review of responses of cattle to viral and bacterial pathogens causing bovine respiratory disease complex. J Vet Intern Med 2015;29(3):770-780. http://doi.org/10.1111/jvim.12597.

Betancur C, González M, Reza L. Seroepidemiología de la rinotraqueitis infecciosa bovina en el municipio de Montería, Colombia. Rev MVZ Córdoba 2006;11(2):830836. https://doi.org/10.21897/rmvz.447.

Betancur H, Rodas J, González M. Estudio seroepidemiológico del virus respiratorio sincitial bovino en el municipio de Montería, Colombia. Rev MVZ Córdoba 2011;16(3):2778-2784. https://doi.org/10.21897/rmvz.278.

Betancur H, Gogorza LM, Martínez FG. Seroepidemiología de la diarrea viral bovina en Montería (Córdoba, Colombia). Analecta Vet 2007;27(2):11-16. http://sedici.unlp.edu.ar/handle/10915/11204.

Betancur H, Orrego A, González M. Estudio seroepidemiológico del virus de parainfluenza 3 en bovinos del municipio de Montería (Colombia) con trastornos reproductivos. Rev Mev Vet 2010;20: 63-70. https://doi.org/10.19052/mv.583.

Saraz GA. Influencia de los factores genéticos y ambientales en caracteres productivos y reproductivos de la raza criolla colombiana Romosinuano (No. Doc. 22372, CO-BAC, Bogotá). 2004. 780

Rev Mex Cienc Pecu 2020;11(3):771-782

Ossa G, Abuabara Y, García JP, Martínez G. El ganado criollo colombiano Costeño con Cuernos (CCC). Anim Genet Resour 2011;48:101-107.

10. Elzo MA, Manrique C, Ossa G, Acosta O. Additive and nonadditive genetic variability for growth traits in the Turipana Romosinuano × Zebu multibreed herd. J Anim Sci 1998;76:1539-1549. https://doi.org/10.2527/1998.7661539x. 11. Peña IF. Estudio serológico de diarrea viral bovina en la microrregión del valle del Cesar. AICA 2011; 1:309-312. Disponible en: https://aicarevista.jimdo.com/. 12. Betancur HC, Castañeda TJ, González TM. Inmunopatología del complejo respiratorio bovino en terneros neonatos en Montería-Colombia. Rev Cient 2017;27(2):95-102. 13. Tjørnehøj K, Uttenthal Å, Viuff B, Larsen LE, Røntved C, Rønsholt L. An experimental infection model for reproduction of calf pneumonia with bovine respiratory syncytial virus (BRSV) based on one combined exposure of calves. Res Vet Sci 2003;74(1):5565. https://doi.org/10.1016/S0034-5288(02)00154-6. 14. Griffiths IB, Gallego M, Villamil L. Factores de infertilidad y pérdidas económicas en ganado de leche en Colombia (No. Doc. 4186)* CO-BAC, Santafé de Bogotá). 1982. 15. Piedrahita LE, Montoya LM, Pedraza FJ. Herpes Virus Bovino tipo 1 (BoHV-1) como posible causa de encefalitis en bovinos de la región del Magdalena Medio Colombiano: Estudio serológico y análisis epidemiológico. Rev Colom Cienc Pecu 2010;23(2):191198. 16. Ochoa X, Orbegozo M, Manrique F, Pulido M, Ospina J. Seroprevalencia de rinotraqueitis infecciosa bovina en hatos lecheros de Toca – Boyacá. Rev MVZ Córdoba 2012;17(2):2974-2982. 17. Sobhy NM, Mor SK, Bastawecy IM, Fakhry HM, Youssef CRB, Goyal SM. Surveillance, isolation and complete genome sequence of bovine parainfluenza virus type 3 in Egyptian cattle. Int J Vet Sci Med 2017;5(1):8-13. doi: 10.1016/j.ijvsm.2017.02.004. 18. Molina SH, Castaño J, Arboleda J, Cadavid J, Zapata M. Estudio serológico para el virus de parainfluenza-3 en el hato BON en el departamento de Antioquia. Rev Colomb Cienc Pecu 1998;11(2):81-86. 19. Cabello R, Quispe Ch, Rivera G. Frecuencia de los virus Parainfluenza-3, Respiratorio Sincitial y Diarrea Viral Bovina en un rebaño mixto de una comunidad campesina de Cusco. RIVEP 2006;17(2):167-172. http://dx.doi.org/10.15381/rivep.v17i2.1535. 20. Chamizo EG. Leucosis bovina enzootica: Revisión. REDVET 2005;6(7):21-25. http//www.redalyc.org/articulo.oa?id=63612652016. 781

Rev Mex Cienc Pecu 2020;11(3):771-782

21. Ellis J, West K, Cortese V, Konoby C, Weigel D. Effect of maternal antibodies on induction and persistence of vaccine-induced immune responses against bovine viral diarrhea virus type II in young calves. J Am Vet Med Assoc 2001;219(3):351-356. https://doi.org/10.2460/javma.2001.219.351. 22. Morรกn P, Di Santo M, Gogorza L. Transmisiรณn del virus de la diarrea viral bovina. Factores de riesgo en el ingreso y diseminaciรณn en los rodeos. Rev Vet 2006;17(1): 5058.

782

https://doi.org/10.22319/rmcp.v11i3.5269 Article

Frequency and risk factors associated with the presence of Chlamydia abortus in flocks of sheep in Mexico

Erika G. Palomares Reséndiz a Pedro Mejía Sánchez a Francisco Aguilar Romero a Lino de la Cruz Colín b Héctor Jiménez Severiano c José Clemente Leyva Corona d Marcela I. Morales Pablos d Efrén Díaz Aparicio a*

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias (INIFAP). CENID Salud Animal e Inocuidad. Carretera México –Toluca, colonia Palo Alto, 05110. Ciudad de México. México. b

INIFAP. CIRCE. Pachuca. Hidalgo. México.

INIFAP. CENID Fisiología. Ajuchitlán, Querétaro. México.

Instituto Tecnológico de Sonora. Ciudad Obregón, Sonora. México.

*Corresponding author: efredia@yahoo.com

783

Rev Mex Cienc Pecu 2020;11(3):783-794

Abstract: This study aimed to evaluate the individual and flock serological frequency and detect the risk factors of C. abortus infection in seven Mexican sheep producing states. It was performed a multifactor, cross-sectional, and stratified study with an analysis of 5,321 serological samples from 323 flocks in 61 municipalities. Serology frequency was determined using a commercial ELISA kit. The risk factors associated with the disease were determined through surveys and statistical analyses with a squared Chi test and a 95% confidence interval. Of the 5,231 serum samples, 581 (10.92 %) had positive ELISA test results. The results, by state, of positive sera were: Tlaxcala 13.08 % (73/558); Sonora 12.45 % (102/819); Chihuahua 11.56 % (107/925); Hidalgo 11.34 % (97/855); Chiapas 10.15 % (60/591); Querétaro 9.69 % (79/815); Estado de México 7.09 % (63/758). The frequency of seropositive herds was 43.34 % (140/323). The results, when grouped by state, were the following: Hidalgo 67.39 % (31/46), Querétaro 67.18 % (43/64); Sonora 40.92 % (19/47); Tlaxcala 33.33 % (12/36); Chiapas 31.57 % (12/38); Estado de México 25.45 % (14/55), and Chihuahua 24.32 % (9/37). The main risk factors that favor the presence of ovine enzootic abortion are gestation, 37 to 48 mo of age, and an intensive production system. These serology studies identified the presence of ovine enzootic abortion in Mexico and some of the risk factors associated with this infection. Key words: Chlamydia abortus, Ewes, Seroprevalence, Risk factors, Mexico.

Received: 20/02/2019 Accepted: 02/10/2019

Introduction The ovine enzootic abortion (OEA) or ovine chlamydiosis is an infectious disease caused by Chlamydia abortus, an obligate intracellular Gram-negative bacterium. This bacterium has an affinity for mucous membranes; therefore, after the placental invasion, it tends to cause ulceration of the endometrial epithelium, abortion, or birth of weak lambs(1-2). Abortion cases are critical for animal husbandry since they contribute to economic losses due to lack of lambs and milk production loss. C. abortus has zoonotic potential; it causes conjunctivitis, pneumonia, and abortion in humans(3-4).

784

Rev Mex Cienc Pecu 2020;11(3):783-794

The abortions caused by OEA occur in the last third of gestation without clinical signs before the abortion; these cases prevail in areas were flocks are kept in overcrowded spaces during calving seasons(3). The clinical signs observed in flocks include epididymitis, pneumonia, arthritis, and conjunctivitis(5-8). In Mexico, several studies have been performed in small ruminants; in 1996, Chlamydia psittaci was isolated from subclinical enteric infections in sheep flocks from five Mexican states(9), and in 1997, the first isolation of goat abortion was reported(10). In 2001, it was reported as a zoonotic disease in Mexico, as humans became infected with Chlamydia spp from goats(11). However, the fact that the disease was considered exotic in Mexico until May 2016 was a factor in the spread of the disease in our country, due to the lack of diagnostic methods(12). In Mexico, there are no thorough epidemiological studies in sheep populations; however, the OEA is estimated to be widespread in this domestic species and, as such, is causing damage to sheep breeding nationwide. Additionally, the disease will likely continue to be introduced in many of the Mexican Republic states due to the exchange of animals between producers and to contact with other infected species, such as cattle or goats(13,14). This study aimed to evaluate the serological frequency and the risk factors of C. abortus infection in the main sheep production areas in Mexico.

Material and methods A total of 5,321 serum samples were collected from ewes older than 6 mo of age from 323 flocks in 61 municipalities of seven Mexican states: Hidalgo, Tlaxcala, QuerĂŠtaro, Chihuahua, Sonora, Chiapas, and Estado de MĂŠxico. These states were chosen based on their productivity and the sample availability in different flocks. Most of the animals were of Mexican origin; imported sheep came from Australia, New Zealand, and the United States of America. This was a multifactor, cross-sectional, and stratified study; flocks were selected based on the facilities granted by producers. The number of sampled animals was determined with the Win Epinfo Ver 2.0 software, using the percentage estimation mode, for an estimated 5% frequency of infected sheep, a 5% error, and 95% confidence. To determine the risk factors and their association with the presence of C. abortus, flock owners were asked to answer two surveys. The first focused on general aspects and flock management, considering genetics, nutrition, animal health, reproduction, and facilities. The second survey collected information from the sampled ewes: age, number of calvings, and clinical and production history. 785

Rev Mex Cienc Pecu 2020;11(3):783-794

The serodiagnosis was determined using an indirect ELISA (PourquierÂŽ ELISA Chlamydiosis, IDDEX Maine, EE. UU.), which employs a recombinant protein antigen of 80-90 kDa, specific for C. abortus, without a cross-reaction with Chlamydia pecorum(15). The frequency values of C. abortus for infected individual sheep and flocks were evaluated and compared with a Chi squared test, considering the frequency and the confidence interval of the ewes and their lambs, and the test parameters in comparisons, using the Win Epinfo Ver 2.0 software. The values with a P value <0.05 were considered significant, with a 95% confidence interval(16). The risk factors associated with infection were evaluated with previously validated surveys. The data obtained were analyzed to determine the risk factors present in the flocks, which could be associated with the presence and epidemiological behavior of C. abortus in the sheep population (Table 1).

Table 1: Frequency and risk factors associated with the presence of C. abortus seropositive sheep Seropositive Frequency Factor Category animals OR 95% CI (%) Productive stage

Age

Origin

Pregnant ewe Lactating ewe Ewe nursing its lamb Ewe finishing lactation

132/538 235/1901 22/170

24.53 12.36 12.94

3.47 * 1.39 * 1.41 *

1.22-9.59 0.59-3.17 0.54-3.36

106/1367

7.75

0.69

0.19-1.87

Non-pregnant and non-lactating ewes

65/961

6.76

0.61

0.10-2.13

Pubescent ewes in non-reproductive stage 6 to 11 mo 12 to 24 mo 25 to 36 mo 37 to 48 mo Born in the flock Bought No data

21/384

5.46

0.49

0.06-3.92

46/949 78/1264 101/1017 356/2091 460/3897 116/1331 0/37

4.84 6.17 9.93 17.02 11.80 8.71 0.00

0.97 1.92* 2.10* 4.12* 1.9 0.7 0

0.20-3.30 0.50-4.10 1.15-4.07 2.62-6.34 0.70-4.90 0.30-1.60 0

786

Rev Mex Cienc Pecu 2020;11(3):783-794

Flock type

Total

Intensive Semi-intensive Extensive

95/525 370/3155 116/1536 581/5321

18.09 11.72 7.55 10.91

2.23* 1.46* 0.41

0.70-6.40 0.50-3.20 0.20-1.10

OR=odds ratio; CI= concordance index. * Statistical difference (P<0.05) associated with the risk factor.

Results Of the 5,231 serum samples, 581 (10.92 %) had positive ELISA test results for the detection of antibodies against C. abortus. The frequency of seropositive animals grouped by state was: 12.45 % (102/819) in Sonora; 10.15 % (60/591) in Chiapas; 67.18 % (43/64) in Querétaro; 24.32 % (9/37) in Chihuahua; 33.33 % (12/36) in Tlaxcala; 11.34 % (97/855) in Hidalgo; and 7.09 % (63/758) in Estado de México. Of the total 323 sampled flocks, 43.34 % (140/323) had at least one C. abortus seropositive ewe. The frequency values per flock were: 40.42 % (19/47) in Sonora; 31.57 % (12/38) in Chiapas; 67.18 % (43/64) in Querétaro; 24.32 % (9/37) in Chihuahua; 33.33 % (12/36) in Tlaxcala; 67.39 % (31/46) in Hidalgo; and 25.45 % (14/55) in Estado de México. Regarding the productive stage of the sampled animals, 24.53 % of the seropositive animals were pregnant; 12.36 % were seropositive lactating ewes; 12.94 % were ewes nursing their lambs; 7.75 % were ewes at the end of their lactation; 6.76 % were non-pregnant and nonlactating ewes, and 5.46 % were pubescent ewes in a non-reproductive stage. The productive stage was evaluated as a possible risk factor, and the study found that pregnant ewes were 3.5 times more likely to be seropositive to C. abortus (Table 1). Regarding seropositivity and age, 17.02 % of the seropositive animals were between 37 and 48 mo of age, in contrast with the groups between 6 to 11 mo, the frequencies of seropositive animals were very low since only 46 of the 949 sampled animals were positive. Based on the obtained odds ratio (OR), animals between the ages of 37 and 48 mo were 4.12 times more likely of infection than any other age (Table 1). Concerning animal origin, 11.8% were animals born in the same flock, and 8.71% were acquired from other places; after analyzing this variable, origin was not considered a risk factor (Table 1).

787

Rev Mex Cienc Pecu 2020;11(3):783-794

As for flock management, 18.09% (OR = 2.23; 95% CI: 0.70-6.40) of the studied flocks were from intensive production units, 11.72% (OR 1.46; 95% CI 0.50-3.20 were semi-intensive, and the remaining 7.55% (OR = 0.41; 95% CI 0.20-1.10) came from extensive flocks (Table 1).

Discussion The OEA was considered an exotic disease in Mexico until May 2016, when it became a notifiable disease; this study establishes a frequency of 10.92 % and confirms the presence and spread of the disease in the main sheep production areas in the country. Estado de MĂŠxico is the only state with previous OEA prevalence studies(9,12). In this study, the data for Estado de MĂŠxico show that 7.09 % (n= 758) of the sampled animals were positive, while previous studies(9,12) reported a prevalence of 40.64 % and 21.3 %, respectively. However, these authors worked in flocks with reproductive problems, while, in the present study, animals were sampled without considering their reproductive status. Moreover, the high prevalence reported by Escalante in 1996 could be because they used a soluble antigen for their ELISA, which differs from the one used in this study which had a sensitivity of 95.7% and a specificity of 100%, this antigen is specific for C. abortus, avoiding the possibility of crossreaction with C. pecorum or some Gram-negative bacterium such as Acinetobacter spp. The highest frequency of OEA (13.08 %) was found in Tlaxcala, in flocks under intensive and semi-intensive production. These frequency numbers coincide with those described by Aitken(4), who reported that, in intensive production systems, the prevalence of OEA and reproductive disorders are higher than in extensive production systems. The most important risk factor that promotes the spread of the disease in flocks is the introduction of animals not previously certified as negative to C. abortus(17), which was determined in the high percentage of positive flocks in the main sheep producing states in Mexico. Since OEA was considered an exotic disease, there were no commercial tests available to diagnose it, so it was not possible to prevent the spread of chlamydia. The countries of origin of the imported sheep are mainly Australia and New Zealand, which are free of C. abortus(4). However, imported animals are not tested before their arrival and are in close contact with the native sheep. This implies that the introduction of animals from endemic countries, like the United States of America, could be one of the factors associated with the spread of the disease, since this control is not carried out. This is supported by the fact that some imported ewes had late-stage abortions during quarantine periods and shortly after being introduced into the flocks. 788

Rev Mex Cienc Pecu 2020;11(3):783-794

Countries that are mainly dedicated to sheep farming show the greatest amount of problems related to abortions induced by OEA, the contact of infected sheep with contaminated material is one of the ways in which the disease can be transmitted to other animal species(1,18). A study performed in Iran(19) determined the risk factors in small ruminants with abortions, of the 300 aborted fetuses (183 goats and 117 ewes), 11 % were PCR positive to C. abortus, determining that animal handling is an important risk factor because being in contact with each other facilitates the transmission of the disease. The production system was identified as an associated risk factor; however, the highest seropositive frequency (18.9 %) was found in flocks under intensive production systems, which, due to the nature of this system, facilitates the spread of OEA and other diseases(20). Moreover, this study confirms that sheep farming under extensive production protects against OEA (OR= 0.41; 95% CI: 0.2-1.1), which confirms that the spread of the disease is accelerated by animal overcrowding, as the contact between healthy and infected sheep increases in intensive and semi-intensive flocks(17,19,21,). The relationship between the origin and the frequency of C. abortus seropositive ewes was considered an associated risk factor. Therefore, it is more likely that animals from production units in other states or countries, gathered upon arrival at distribution centers, are more easily infected due to their confining in facilities difficult to clean and disinfect(18). Different studies support the fact that one of the main risks for the transmission of OEA is the place of origin of the animals, this allows to infer that in animals from farms in other states or even from other countries that are confined in distribution centers before arriving to their final destination, due to overcrowding and the lack of adequate means to clean and disinfect the facilities, the infection can spread more easily(17). Regarding the animal origin; the only requirements that the producers consider before introducing a new sheep into their flock is the phenotype and that the animal looks clinically healthy, neglecting the diagnosis of the disease(1). This study indicates that the bacterium has spread all over the country, but at different rates and proportions in the different states. However, when determining whether there was a relationship between the origin and the frequency of C. abortus seropositive ewes, it was not considered a risk factor. This study identified that pregnant ewes are 3.4 times more likely to be infected. This could be because during gestation, ewes are immunosuppressed and, therefore, their nutritional demands increase, which is aggravated if their diet is inadequate. This is a result of the stress created by a deficient food source, which generates endogenous cortisol, a toxic substance for lymphocytes that increases immunosuppression(18).

789

Rev Mex Cienc Pecu 2020;11(3):783-794

The lack of strategies to separate infected ewes that are close to calving from the ones recently calved contributes enormously to infection because infected ewes shed high amounts of bacteria before, during, and after calving or abortion(1,22,23). It was observed that as the age increases, the probabilities of exposure to the disease increase proportionally; therefore, the number of seropositive ewes increases. Ewes that have been in the flock for extensive periods are good mothers, but, with age, they resent the consequences of the number of births they carry and, therefore, their susceptibility to the disease increases(24,25). Other factors may be involved in the spread of the disease, especially if proper biosecurity measures are not taken. For example, intensive production systems favor the contamination of pens, as there is a large accumulation of feces that cannot be recycled, therefore causing air, soil, and water pollution, which is related to the lack of equipment and the hygiene measures observed in the flocks examined in this study, and because the water is contaminated with feces and other organic materials(18,26). The elevated frequencies of 43.34 % (140/323) in flocks were constant in the main sheep production areas in Mexico, which indicates that the OEA is widely spread all over the country, and with it, the consequences that have been reported by different authors(9-11,15), pointing to OEA as one of the main causes of abortion, which has a high economic impact in European, North American, and African countries(27), and due to the lack of the necessary diagnostic tools, the causes of its introduction to the country have not yet been determined, it is possible to suffer similar consequences to those suffered by the countries indicated above. The spread of OEA does not only concern sheep production; previous studies have reported, through the diagnosis made by ELISA in dairy cattle with a history of abortion from eight Mexican states, a frequency of C. abortus positive animals of 14 % (145 /1,032)(14); in bovines, the presence of OEA-positive animals is related to the presence of abortions and other reproductive problems(28). Another study reported a 9.60 % frequency of C. abortus seropositive animals in six goat flocks in Guanajuato; the bacterium was isolated in 26.98 % of the sampled goats(13). In a study performed in goats with abortions in QuerĂŠtaro, Veracruz, Puebla, Jalisco, and the Comarca Lagunera region, C. abortus was isolated in 23.1 % of the samples(29).

790

Rev Mex Cienc Pecu 2020;11(3):783-794

Conclusions and implications It was concluded that the positive serology frequency observed in the flocks of main sheep producing areas in Mexico, as well as the detection of risk factors associated with the presence and spread of the disease, evidence the spread of the ovine enzootic abortion in Mexico.

Literature cited: 1. Longbottom D, Coulter LJ. Animal chlamydioses and zoonotic implications. J Comp Pathol 2003;128(4):217–244. 2. Rohde G, Straube E, Essig A, Reinhold P, Sachse K. Chlamydiale Zoonosen, Dtsch Arztebl Int 2010;107(10):174–1780. 3. Rodolakis A, Salinas J, Papp J. Recent advances on ovine chlamydial abortion, Vet Res 1998;29(3-4):275–288. 4. Aitken DI. Chlamydial abortion, Diseases of sheep. 3rd ed. Madrid, España: Blackwell Science; 2000. 5. Rekiki A, Sidi-Boumedine K, Souriau A, Jemli J, Hammami S, Rodolakis A. Isolation and characterization of local strains of Chlamydophila abortus (Chlamydia psittaci serotype 1) from Tunisia. Vet Res 2002;33(2):215–222. 6. Gerber A, Thoma R, Vretou E, Psarrou E, Kaiser C, Doherr MG, et al. Ovine enzootic abortion (OEA): A comparison of antibody responses in vaccinated and naturallyinfected Swiss sheep over a two-year period. BMC Vet Res 2007;28(3):24. 7. Zhong G. Killing me softly: chlamydial use of proteolysis for evading host defenses. Trends Microbiol 2009;17(10):467-474. 8. Polkinghorne A, Borel N, Becker A, Lu ZH, Zimmermann DR, Brugnera E, Pospischil A, Vaughan L. Molecular evidence for chlamydial infections in the eyes of sheep. Vet Microbiol 2009;135(1-2):142–146.

791

Rev Mex Cienc Pecu 2020;11(3):783-794

9. Escalante OC, Rivera FA, Trigo TF, Romero MJ. Detection of Chlamydia psittaci in enteric subclinical infections in adult sheep, through cell culture isolation. Rev Latinoam Microbiol 1996;38(1):17-23. 10. Escalante OC, Díaz AE, Segundo ZC, Suárez GF. Isolation of Chlamydia psittaci involved in abortion of goats in Mexico: first report. Rev Latinoam Microbiol 1997; 39(3-4):117-121. 11. Escalante OC, Lazcano C, Soberón A. Chlamydophila spp como agente zoonótico en México [resumen]. Reunión Nacional de Investigación Pecuaria. Tuxtla Gutiérrez, Chiapas. 2001. 12. Jiménez EJM, Escobedo GMR, Arteaga TG, López HM, De Haro CM, Montes De Oca JR, Guerra IFM. Detection of Chlamydophila abortus in sheep (Ovis aries) in Mexico. Am J Anim Vet Sci 2008;3(4):91-95. 13. Mora DJC, Díaz AE, Herrera LE, Suárez GF, Escalante OC, Jaimes VS, ArellanoReynoso B. Isolation of Chlamydia abortus in dairy goat herds and its relation to abortion in Guanajuato, Mexico. Vet Mex OA 2015;2(1). 14. Limón GM. Prevalencia de Leucosis y Clamidiosis en bovinos lecheros de Aguascalientes y Guanajuato [tesis licenciatura]. Cuautitlán, México: FES Cuautitlán, Universidad Nacional Autónoma de México; 2012. 15. Marques PX, Souda P, O'Donovan J, Gutierrez J, Gutierrez EJ, Worrall S, et al. Identification of immunologically relevant proteins of Chlamydophila abortus using sera from experimentally infected pregnant ewes. Clin Vaccine Immunol 2010;17(8):1274-1281. 16. Thrusfield M, Ortega C, de Blas I, Noordhuizen JP, Frankena K. Win Episcope 2.0: Improved epidemiological software for veterinary medicine. Vet Rec 2001;148:67-572. 17. Barkallah M, Jribi H, Ben Slima A, Gharbi Y, Mallek Z, Gautier M, et al. Molecular prevalence of Chlamydia and Chlamydia-like bacteria in Tunisian domestic ruminant farms and their influencing risk factors. Transbound Emerg Dis 2018;65(2):329-338.

792

Rev Mex Cienc Pecu 2020;11(3):783-794

18. Lenzko H, Moog U, Henning K, Lederbach R, Diller R, Menge C, Sachse K, Sprague LD. High frequency of chlamydial co-infections in clinically healthy sheep flocks. BMC Vet Res 2011;16(7):29. 19. Heidari S, Derakhshandeh A, Firouzi R, Ansari-Lari M, Masoudian M, Eraghi V. Molecular detection of Chlamydophila abortus, Coxiella burnetii, and Mycoplasma agalactiae in small ruminants' aborted fetuses in southern Iran. Trop Anim Health Prod 2018;50(4):779-785. 20. Thrusfield M. Vet Epi 2005. Oxford, England. Blackwell Science. 21. Rodolakis A, Mohamad KY. Zoonotic potential of Chlamydophila. Vet Microbiol 2010;140(3-4):382-391. 22. Maley SW, Livingstone M, Rodger SM, Longbottom D, Buxton D. Identification of Chlamydophila abortus and the development of lesions in placental tissues of experimentally infected sheep. Vet Microbiol 2009;16(135):122-127. 23. Longbottom DG, Entrican N, Wheelhouse N, Brough H, Milne C. Evaluation of the impact and control of enzootic abortion of ewes. Vet J 2013;195(2):257-259. 24. Zhou DH, Zhao FR, Xia HY, Xu MJ, Huang SY, Song HQ, Zhu XQ. Seroprevalence of chlamydial infection in dairy cattle in Guangzhou, southern China. Ir Vet J 2013;66(1):2. 25. Qin SY, Yin MY, Cong W, Zhou DH, Zhang XX, Zhao Q, Zhu XQ, Zhou JZ, Qian AD. Seroprevalence and risk factors of Chlamydia abortus infection in Tibetan sheep in Gansu province, northwest China. Sci World J 2014:193464. 26. Bagdonas J, Petkevicius S, Russo P, Pepin M, Salomskas A. Prevalence and epidemiological features of ovine enzootic abortion in Lithuania. Pol J Vet Sci 2007; 10(4):239-244. 27. Vega S, Roche M, García A, Gómez T. Estudio de la etiología de los abortos en los pequeños rumiantes en la Comunidad Valenciana. XXIX Jornadas Científicas de la SEOC. 2003:262–264.

793

Rev Mex Cienc Pecu 2020;11(3):783-794

28. Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A, Longbottom D. Recent developments in the laboratory diagnosis of chlamydial infections. Vet Microbiol 2009;135(1-2):2–21. 29. Sánchez RL. Presencia de Chlamydia abortus en cabras de México [tesis Maestría]. Cuautitlán, México: FES Cuautitlán, Universidad Nacional Autónoma de México. 2014.

794

https://doi.org/10.22319/rmcp.v11i3.5516 Article

Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp.

Tania Palós Gutiérrez a María Salud Rubio Lozano a* Enrique Jesús Delgado Suárez b Naisy Rosi Guzmán a Orbelin Soberanis Ramos b Cindy Fabiola Hernández Pérez c Rubén Danilo Méndez Medina d

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia (FMVZ), Centro de Enseñanza Práctica, Investigación en Producción y Salud Animal, Avenida Universidad 3000, Ciudad Universitaria, Ciudad de México, México. b

UNAM, FMVZ. Departamento de Medicina Preventiva y Salud Pública. Ciudad de México. México. c

Servicio Nacional de Sanidad, Inocuidad y Calidad Agroalimentaria. Departamento de Secuenciación y Bioinformática del Centro Nacional de Referencia de Plaguicidas y Contaminantes. Ciudad de México, México. d

UNAM, FMVZ. Departamento de Patología. Ciudad de México. México.

* Corresponding author:msalud65@gmail.com

795

Rev Mex Cienc Pecu 2020;11(3):795-810

Abstract: This study aimed to determine the frequency of contamination, serovar diversity, and multilocus sequence typing (MLST) of Salmonella enterica (SE) in lymph nodes and ground beef. A total of 1,545 samples from 400 beef carcasses were analyzed. Samples included peripheral (PLN) and deep lymph nodes (DLN), lean and fatty ground beef obtained in warm (April-July) and cold (September-December) seasons during 2017 and 2018. The pure isolates were subjected to complete genome sequencing. With these data, the in silico prediction of serovars and the MLST profile was performed. In total, 78 SE isolates were obtained (5 % of the total analyzed samples). The frequency of contamination was associated with the type of sample (Ď&#x2021;2=23.7, P<0.0001) and the time of year (Ď&#x2021;2=20.3, P<0.0001), being higher in PLN (9.7%) and during the warm season (7.0%). The predominant serovars were Anatum and Reading (each one with n= 23), Typhimurium (n= 11), and London (n= 9). The MLST profile of strains of the Typhimurium (ST 19 and 34) and Kentucky (ST 198) serovars has been previously reported in isolates involved in clinical cases. It was concluded that lymph nodes and ground beef are reservoirs of SE of public health importance, especially during the warm months of the year. Therefore, it is necessary to establish measures to prevent dissemination throughout the production chain of strains associated with apparently healthy animals. Key words: Salmonella, Cattle, Lymph nodes, Ground beef, Serovars, MLST.

Received: 21/09/2019 Accepted:25/11/2019

Introduction Foodborne salmonellosis is a public health concern worldwide(1). The meat of different species, including beef, functions as a reservoir for its primary etiologic agent: Salmonella enterica subsp. enterica, from now on referred to as Salmonella(2). In North America, ground beef has been linked to recent salmonellosis outbreaks(3), which is why it is considered one of the main vehicles of human exposure to Salmonella. In Mexico, percentages of positive samples range between 16 and 68 % in ground beef at points of sale(4,5), which is why research in this area is relevant from a public health perspective.

796

Rev Mex Cienc Pecu 2020;11(3):795-810

Recent experimental data report Salmonella isolates from apparently healthy cattle lymph nodes, in frequencies that range from <10 to >90%(6,7). Furthermore, it has been proven that peripheral lymph nodes show a higher contamination rate as compared to deep lymph nodes, while the number of animals with contaminated lymph nodes is much higher in commercial feedlot cattle than in culled cattle(7,8). However, results tend to vary significantly across geographical areas and season of the year, a phenomenon determined by unknown mechanisms. In studies with Salmonella strains obtained from culled cattle, the typification of isolates by pulsed field gel electrophoresis showed clonality between lymph node and ground beef strains(9). However, this type of study has not been performed in commercial feedlot animals. Despite the high rates of positivity to Salmonella reported in bovine samples in Mexico(4-6), the contribution of lymph nodes to this phenomenon has not been addressed. Therefore, this study aimed to estimate the frequency of contamination and the diversity of Salmonella serovars in lymph nodes and the meat and fat associated with them at different seasons of the year.

Material and methods Study design and sample size determination

The sample size was calculated with the statistical equation used to estimate a population proportion when the number of elements in that population is unknown(10): n=

đ?&#x2018;?đ?&#x203A;ź2 â&#x2C6;&#x2014;đ?&#x2018;?â&#x2C6;&#x2014;đ?&#x2018;&#x17E; đ?&#x2018;&#x2018;2

;

Where: n= sample size; ZÎą2= Z value in a normal distribution ZÎą= 1.96 when Îą= 0.05; p= population proportion with the studied characteristic (if unknown, 0.5 is used, as in this case); q= population proportion without the studied characteristic (1-p); d= desired error or precision, fixed at 10% (0.1). Thus, it was obtained a sample size of 96, which was rounded to 100. The sampling was performed twice a year for two consecutive years, and in two seasons of each year. The samples collected between April and July were labeled as â&#x20AC;&#x153;warmâ&#x20AC;? season samples, and those collected between September and December were labeled as â&#x20AC;&#x153;coldâ&#x20AC;? season samples.

797

Rev Mex Cienc Pecu 2020;11(3):795-810

Carcasses came from young bulls, crosses of Bos Indicus, with an average age of 24-36 months, processed in a Federal Inspection type slaughterhouse in Veracruz, and transported under refrigeration (<4 ยบC) for approximately eight hours, until they arrived at a selling point in Mexico City. Upon arrival, carcasses were kept under refrigeration for two days until sample collection (72 to 96 h postmortem). The sale point was visited each week on Monday and Tuesday until completing between five and ten carcasses per week, depending on the number of carcasses available.

Sampling

Peripheral (PLN, superficial cervical and subiliac) and deep lymph nodes (DLN, axillary and celiac) were collected from each carcass. Lymph nodes were selected based on the probability that they were included in the grinding process, due to their anatomical location. In addition to the lymph nodes, approximately 200 g of lean meat (LM, 50 % of the chuck roll and 50 % of the sirloin, as they are the most used cuts to produce ground beef) and fatty meat (FM) were collected from the surrounding areas of the PLN and DLN (approximately 50 % of each). Before analysis, the individual portions of each sample type were combined to form a single sample. On some occasions, certain parts of the carcass were compromised for sale and were not available for sampling. Therefore, it was not possible to obtain all sample types of 100% of the carcasses. Thus, the sampling unit was defined as the sample composites of PLN, DLN, LM, and FM. A total of 1,545 samples were collected from all sources in the two years of the study. Table 1: Distribution of the 1,545 meat and lymph node samples analyzed by season and year between April 3, 2017 and December 14, 2018 Warm season

Cold season

Sample type

2017

2018

Total

2017

2018

Total

PLN DLN

168 166

98 98

266 264

33 33

102 102

135 135

LM FM Total

130 149

98 98

228 247 1,005

33 33

102 102

135 135 540

Warm season: April-July, cold season: September-December. PLN= peripheral lymph nodes, DLN= deep lymph nodes, LM= lean meat, FM= fatty meat.

798

Rev Mex Cienc Pecu 2020;11(3):795-810

The individual portions of each sample type were placed in previously identified sterile plastic bags and kept in coolers with cooling gels (at approximately 4°C) during their transportation to the laboratory (maximum two hours).

Microbiological analysis Lymph node samples were prepared following the methods previously described(11), with some modifications. Lymph nodes were weighed and subsequently submerged in boiling water for 5 s to sterilize their surface. Then, half of the buffered peptone water (BPW) necessary to reach an approximate 1:10 dilution (8 g of DLN in 80 ml of BPW and 25 g of PLN in 225 ml of BPW) was added, and lymph nodes were ground for 3 s in a previously sterilized Oster blender. The ground samples were emptied in a previously identified Stomacher® bag, and, using the rest of the BPW, the remainder contained in the blender was recuperated, assuring the transfer of the whole sample to the Stomacher® bag, subsequently homogenizing the mixture for 1 min. For the analysis of the lean meat (LM) samples, 25 g were ground in a sterile Oster blender for 30 s. Subsequently, the content was placed in a previously identified Stomacher® bag with 225 ml of BPW, and the mixture was homogenized for 1 min. Finally, fatty meat (FM) samples were ground in a sterile Oster blender for 30 s, approximately 1/3 of fat and 2/3 of meat from the surrounding areas of PLN and DLN (50 % from each type of lymph node). After grinding, 25 g were aseptically weighed and subjected to the same procedure described for lean meat. Homogenates were left to rest for two hours at room temperature, before following the preenrichment, selective enrichment, isolation, and biochemical confirmation procedures for Salmonella spp., established in the current Official Mexican Standard(12). According to previously described methods, presumptive positive Salmonella spp. isolates were also molecularly confirmed by PCR using the invA gene (284 bp)(13). DNA was extracted with the Ez-10 Spin Column Bacterial Genomic DNA Miniprep Kit (BioBasic, Inc., Canada), following the instructions of the supplier, from pure strains, previously refreshed in tryptic soy broth (MCD Lab®, PRONADISA-CONDA®, Spain) for 18-24 h. Forward (CGCCATGGTATGGATTTGTC) and reverse (GTGGTAAAGCTCATCAAGCG) primers were used in PCR with a total volume of 10 μl, employing the MyTaqTM Mix reagents (Bioline, U. K.) with the following final concentrations: 5 μl of MyTaqTM Mix, 0.2 μl of each dNTP, and 2.1 μl of nuclease-free water. The thermocycling conditions were: 94 ºC/3 min of initial denaturation; 35 denaturation, annealing, and extension cycles (95 ºC/45 s, 62 ºC/30 s, 72ºC/45 s, respectively), and a final extension at 72 ºC/2 min. The PCR amplified products were subjected to a 2% agarose gel electrophoresis (SeaKem® LE

799

Rev Mex Cienc Pecu 2020;11(3):795-810

Agarose, Lonza, USA). Gels were run in a Tris/borate/EDTA buffer (TBE 1x) at 80 V for 50 min using SYBR Safe DNA Gel Stain (Invitrogen, USA) to reveal the DNA fragments. The visualization and digitization of images were performed in a Gel Logic 2200 imaging system (Kodak, USA) with the Care Stream® software (Carestream Health, Inc., USA). In each run, it was included a strain, from the laboratory, of S. enterica subsp. enterica ser. Typhimurium, previously confirmed by biochemical methods, PCR, and whole-genome sequencing. Confirmed isolates were preserved in two ways. In the first one, 1 ml inocula were prepared by taking fresh colonies and mixing them in brain-heart infusion broth (Merck, Germany) with 10% glycerol and kept at -70 °C in an ultra-low freezer. Moreover, a backup of the isolates was kept in tryptic soy agar (TSA, PRONADISA-CONDA®, Spain) at room temperature.

Serovar prediction and multilocus sequence typing (MLST)

The serovar of the obtained strains was predicted from the whole genome sequencing data (raw reads). Genomic DNA was extracted from fresh colonies in TSA broth with agitation at 37 °C for approximately 18 h. Then, it was centrifuged 1 ml of TSA broth at 5,000 xg for 10 min to obtain a cell pellet. Subsequently, following the instructions provided by the manufacturer, it was used the High Pure PCR Template Preparation Kit (Roche Molecular Systems, Inc., Switzerland) to obtain the genomic DNA. Sequencing was performed in an Illumina NextSeq (Illumina, USA) equipment, using the Nextera XT version 3 kit (Illumina, USA) to prepare the DNA library, with an insert of 150 bp and a minimum estimated depth of 30X. The obtained raw reads were used to predict the serovar through in silico analysis, with the help of the SeqSero program(14). Finally, a multilocus sequence typing (MLST) analysis was performed, based on seven housekeeping genes (aroC, dnaN, hemD, hisD, purE, sucA)(15), in the server of the Center for Genomic Epidemiology(16). As MLST has been used for decades and there is a public access database(17), it is possible to estimate the epidemiological importance of the isolates through comparison with the ST previously reported in human and animal clinical samples. Furthermore, the allele profile was used to create a minimum spanning phylogenetic tree, using the GrapeTree(18) program, to analyze the ST diversity in the sample under study.

800

Rev Mex Cienc Pecu 2020;11(3):795-810

Statistical analysis

To determine if there was an association between the type of sample, the season of year, and the Salmonella serovar with the frequency of contamination, it was employed a chisquare test. If a significant association was observed, the odds ratio was used to estimate the factors with the greatest influence on the contamination rate of the different studied matrices. Data were analyzed using the Statgraphics Centurion XV program (StatPoint, Technologies, USA).

Results Overall, it was observed a 5% Salmonella spp. contamination frequency, with 78 isolates obtained from the 1,545 samples analyzed in the two years (Figure 1). A strong association between the sample type and the pathogen positivity was observed (Ď&#x2021;2=23.7, P<0.0001), with a higher probability of finding positive samples in PLN than in other sources (odds ratio 3.2, 95 % confidence interval 2.0-5.0, P<0.0001). Figure 1: Frequency of contamination with Salmonella spp. in bovine samples of lean meat (LM, n=363), fatty meat (FM, n=382), deep lymph nodes (DLN, n=399), and peripheral lymph nodes (PLN, n=401), collected between April 2017 and December 2018 45

Absolute frequency

35 30 25 20 15 10 5 0 LM

DLN

801

PLN

Rev Mex Cienc Pecu 2020;11(3):795-810

There was also a significant association between the frequency of contamination and the season of year (Ď&#x2021; 2=20.3, P<0.0001). The probability of finding positive samples in the warm season was much higher than in the cold season (odds ratio 4.7, 95 % confidence interval 2.2-9.8, P<0.0001) (Figure 2). Figure 2: Frequency of contamination with Salmonella spp. in bovine samples of lean meat (LM, n=363), fatty meat (FM, n=382), deep lymph nodes (DLN, n=399), and peripheral lymph nodes (PLN, n=401), collected between April 2017 and December 2018 Warm season

Cold season

45 40

Absolute frequency

35 30 25 20 15 10 5 0 LM

DLN

PLN

The serovar was also associated with the sample type (Ď&#x2021;2=43.8, P=0.0025). Salmonella typhimurium was only detected in meat samples from the warm season. However, the Muenster (n= 2) and Kentucky (n= 5) serovars were only found in lymph nodes, also from the warm season (Figure 3). Furthermore, the only strain of the Give serovar was isolated from PLN in the cold season. Although serovar diversity was higher in both types of lymph nodes than in the lean or fatty meat, in general, strains from the Reading and Anatum (n= 23 of each), Typhimurium (n= 11), and London (n= 9) serovars were predominant.

802

Rev Mex Cienc Pecu 2020;11(3):795-810

Figure 3: Number of S. enterica subsp. enterica isolates by serovar and source in the warm (a) and cold (b) season. LM: lean meat (n=363), FM: fatty meat (n=382), DLN: deep lymph nodes (n=399), PLN: peripheral lymph nodes (n=401) a)

Anatum

Fresno

Give

Kentucky

London

Muenster

Reading

Typhimurium

DLN

PLN

DLN

PLN

Absolute frequency

12 10 8 6 4 2 0 b) 14

Absolute frequency

12 10 8 6 4 2 0

The MLST showed that the isolates of each serovar corresponded to the same ST (Figure 4). The exception was Salmonella typhimurium, which had two ST (19 and 34). However, both ST only differed in the dnaN allele. Therefore, they satisfy the criteria to be 803

Rev Mex Cienc Pecu 2020;11(3):795-810

considered a clonal complex, as they coincide in six of the seven alleles included in the MLST scheme(15). Figure 4: Minimum spanning phylogenetic tree obtained from the MLST profile of 78 isolates of S. enterica subsp. enterica.

**+

P* + P D P D D P D P P P P P PP P PP

Serovar Reading (n=23)

ST-1628

London (n=9) Typhimurium (n=11) Kentucky (n=5)

Anatum (n=23) Fresno (n=4) *

P P P D

Muenster (n=2)

* ST-155 * *

Give (n=1)

Isolation source 1

ST-34 *

ST-19 ** + + +

P: peripheral lymph nodes D D P P P

D: deep lymph nodes *: fatty meat +: lean meat

* *

+ ++

7 P

ST-198

ST-321

5 P

P PP P P P P P D P P * P * P * P D ++*

ST-654

D P

ST-649

ST-64

Each circle corresponds to a ST, and the divisions inside correspond to an isolate. The numbers in the tree branches indicate the number of alleles with different sequences between ST. Serovars are color-coded, and the source of isolation is indicated inside or adjacent to each circle (in red text, if they come from the warm season; or in blue, if they come from the cold season).

Discussion The frequencies of positivity to the pathogen observed here (2.5 to 9.7 %) are lower than those reported in other studies with ground beef (16-68%)(4,5) and lymph nodes (50804

Rev Mex Cienc Pecu 2020;11(3):795-810

94 %)(6,19,20). However, the variability of this phenomenon between geographical areas and season of the year is well documented(20,21). Overall, the study confirms the importance of apparently healthy cattle as a reservoir of various Salmonella serovars of epidemiological importance. This is demonstrated by the detection of ST 19 and 34 of the Typhimurium serovar, which are associated with human clinical cases and with the globally distributed DT104 strain(22). Similarly, isolates of the Kentucky serovar (ST 198) have been associated with human and animal infections in the United States(23). These findings highlight the need to continue investigating Salmonella populations of non-clinical origin, associated with animal production, due to their role as a reservoir of human infections. The results also support previous observations on the higher positivity rates to the pathogen in peripheral lymph nodes, especially in warm climate conditions(7,8). Although the environmental factors responsible for this variability have not been deciphered, the higher incidence of flies and other insect bites during the summer has been suggested as a conditioning factor of this seasonal variation(19,24). However, the scant experimental evidence related to this factor does not come from natural contexts but from challenge studies with flies artificially infected with Salmonella. The efforts made so far to prevent asymptomatic Salmonella infection in cattle have been unsuccessful. The use of vaccines based on genes involved in the uptake of iron, a mineral with a central role in the infectious process, had no effect on the frequency of contamination in the lymph nodes of fattening cattle(25). This is not an unexpected finding, considering the functional redundancy of Salmonella, which has multiple genes for the uptake and transport of iron (iroBCDE, fepBCDEG, fhuBCD, exbBD, sitD, and tonB)(26). Moreover, the intracellular survival of the bacterium, internalized in eukaryotic cells vacuoles(27), such as macrophages, suggests that antibiotics are an unlikely strategy. Thus, the administration of increasing concentrations of tylosin in the diet of Holstein cattle, previously inoculated with the pathogen, did not show any effect, as Salmonella was still recovered from the lymph nodes of treated animals(28). Apparently, the functional redundancy of Salmonella and its intracellular survival mechanisms indicate that the eventual pathogen elimination will ultimately depend on the immune system of the host. In animals experimentally inoculated with strains of the Montevideo serovar, the total elimination of the bacteria took about a month(29). In this context, the screening of Salmonella subclinical infections in feedlots, a poorly applied measure, could function as a method to segregate carrier animals and limit the spread of the pathogen. Additionally, the presence of strains of the same serovar and ST in ground beef and lymph nodes, observed in this study, suggests removal of lymph nodes could be a good strategy to drastically reduce the frequency of contamination with Salmonella in ground beef. This measure is relatively easy to perform at slaughterhouses, although only for 805

Rev Mex Cienc Pecu 2020;11(3):795-810

peripheral lymph nodes, not for the deep lymph nodes. However, it is precisely the peripheral lymph nodes that are of the greatest epidemiological relevance. Therefore, establishing this measure as mandatory in national regulations could function as a strategy to mitigate the risks associated with the presence of Salmonella in ground beef. Moreover, it is interesting to analyze why some serovars were only present in meat samples (e.g., Typhimurium), while others were detected in all matrices (e.g., Anatum and Reading). Notably, the Anatum serovar was previously reported as a predominant strain in non-clinical samples, especially in lymph nodes(19,20). These evidences suggest the possibility that some Salmonella strains are better adapted to colonize and survive in particular ecological niches. However, in the context of the present study, it is difficult to determine whether the relative representation of serovars in lymph nodes depends on specific genetic factors. It is also necessary to use analyses with greater discriminatory power than MLST to explore more precisely the intra- and interserovar phylogenetic relationships, and the evolutionary dynamics of these populations. This will be the focus of future contributions in the comparative genomics field.

Conclusions and implications The study shows that the lymph nodes and ground beef from animals approved for slaughter are reservoirs of Salmonella enterica strains of clinical importance in humans. Therefore, it is necessary to establish control measures to prevent the spread of this pathogen throughout the production chain.

Acknowledgments and conflicts of interest

This research was financed by the Universidad Nacional Autónoma de México, through the PAPIIT IN212817 project. We appreciate the collaboration of the Centro Nacional de Referencia de Plaguicidas y Contaminantes for its support in the sequencing of the isolates and in the preliminary bioinformatic analyses. We also appreciate the collaboration of the students Tavata Meneses, Rosaurora Medina, and Abril Viridiana García, as well as Professor Francisco Ruíz, from the Facultad de Medicina Veterinaria y Zootecnia of the UNAM, for their support in sampling and laboratory analysis activities. None of the authors has a conflict of interest regarding this publication.

806

Rev Mex Cienc Pecu 2020;11(3):795-810

Literature cited: 1. WHO. WHO estimates of the global burden of foodborne diseases. Foodborne disease burden epidemiology reference group 2007-2015. World Health Organization. http://www.who.int/foodsafety/areas_work/foodborne-diseases/ferg/en/. Accessed Oct 25, 2018. 2. Wilhelm BJ, Young I, Cahill S, Desmarchelier P, Nakagawa R, Rajic A. Interventions to reduce non-typhoidal Salmonella in pigs during transport to slaughter and lairage: Systematic review, meta-analysis, and research synthesis based infection models in support of assessment of effectiveness. Prev Vet Med 2017;145:133-144. 3. CDC. Outbreak of Salmonella Infections Linked to Ground Beef. Centers for Disease Control and Prevention (CDC) https://www.cdc.gov/salmonella/newport-1018/index.html. Accessed Feb 25, 2019. 4. Cabrera-Diaz E, Barbosa-Cardenas CM, Perez-Montano JA, Gonzalez-Aguilar D, Pacheco-Gallardo C, Barba J. Occurrence, serotype diversity, and antimicrobial resistance of Salmonella in ground beef at retail stores in Jalisco state, Mexico. J Food Prot 2013;76(12):2004-2010. 5. Ballesteros-Nova N, Rubio-Lozano MS, Delgado-Suárez EJ, Méndez-Medina RD, Braña-Varela D, Rodas Suárez O. Perfil de resistencia a antibióticos de serotipos Salmonella spp. aislados de carne de res molida en la Ciudad de México. Salud Pública México 2016;58(3):1-7. 6. Gragg SE, Loneragan GH, Nightingale KK, Brichta-Harhay DM, Ruiz H, Elder JR, et al. Substantial within-animal diversity of Salmonella isolates from lymph nodes, feces, and hides of cattle at slaughter. Appl Environ Microbiol 2013;79(15):4744-4750. 7. Webb HE, Brichta-Harhay DM, Brashears MM, Nightingale KK, Arthur TM, Bosilevac JM, et al. Salmonella in peripheral lymph nodes of healthy cattle at slaughter. Front Microbiol 2017;8:2214. 8. Gragg SE, Loneragan GH, Brashears MM, Arthur TM, Bosilevac JM, Kalchayanand N, et al. Cross-sectional study examining Salmonella enterica carriage in subiliac lymph nodes of cull and feedlot cattle at harvest. Foodborne Pathog Dis 2013;10(4):368-374.

807

Rev Mex Cienc Pecu 2020;11(3):795-810

9. Koohmaraie M, Scanga JA, De La Zerda MJ, Koohmaraie B, Tapay L, Beskhlebnaya V, et al. Tracking the sources of Salmonella in ground beef produced from nonfed cattle. J Food Prot 2012;75(8):1464-1468. 10. Jekel JF, Katz DL, Elmore JG. Epidemiology, biostatistics, and preventive medicine. Third ed. Philadelphia, PA, United States of America: Saunders Elsevier; 2007. 11. Brichta-Harhay DM, Arthur TM, Bosilevac JM, Kalchayanand N, Schmidt JW, Wang R, et al. Microbiological analysis of bovine lymph nodes for the detection of Salmonella enterica. J Food Prot 2012;75(5):854-858. 12. SSA. NORMA Oficial Mexicana NOM-210-SSA1-2014, Productos y servicios. Métodos de prueba microbiológicos. Determinación de microorganismos indicadores. Determinación de microorganismos patógenos. http://www.dof.gob.mx/nota_detalle.php?codigo=5398468&fecha=26/06/2015. Consultado 25 Feb, 2019. 13. Rahn K, De Grandis SA, Clarke RC, Curtiss R, Gyles CL. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992;6:271-279. 14. Zhang S, Yin Y, Jones MB, Zhang Z, Deatherage Kaiser BL, Dinsmore BA, Fitzgerald C, Fields PI, Deng X. Salmonella serotype determination utilizing high-throughput genome sequencing data. J Clin Microbiol 2015;53(5):1685-1692. 15. Achtman M, Wain J, Weill FX, Nair S, Zhou Z, Sangal V, et al, Group SEMS. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog 2012;8(6):e1002776. 16. Larsen MV, Cosentino S, Rasmussen S, Friis C, Hasman H, Marvig RL, et al. Multilocus Sequence Typing of Total Genome Sequenced Bacteria. J Clin Microbiol 2012;50(4):1355-1361. 17. Alikhan NF, Zhou Z, Sergeant MJ, Achtman M. A genomic overview of the population structure of Salmonella. PLoS Genet 2018;14(4):e1007261. 18. Zhou Z, Alikhan NF, Sergeant MJ, Luhmann N, Vaz C, Francisco AP, et al. GrapeTree: visualization of core genomic relationships among 100,000 bacterial pathogens. Genome Res 2018;28(9):1395-1404.

808

Rev Mex Cienc Pecu 2020;11(3):795-810

19. Belk AD, Arnold AN, Sawyer JE, Griffin DB, Taylor TM, Savell JW, Gehring KB. Comparison of Salmonella Prevalence Rates in Bovine Lymph Nodes across Feeding Stages. J Food Prot 2018;81(4):549-553. 20. Nickelson KJ, Taylor TM, Griffin DB, Savell JW, Gehring KB, Arnold AN. Assessment of Salmonella prevalence in lymph nodes of U.S. and Mexican cattle presented for slaughter in Texas. J Food Prot 2019;82(2):310-315. 21. Cetin E, Serbetcioglu T, Temelli S, Eyigor A. Nontyphoid Salmonella carriage, serovar profile and antimicrobial resistance phenotypes in slaughter cattle. J Food Safety 2018;39(2). 22. Balleste-Delpierre C, Sole M, Domenech O, Borrell J, Vila J, Fabrega A. Molecular study of quinolone resistance mechanisms and clonal relationship of Salmonella enterica clinical isolates. Int J Antimicrob Agents 2014;43(2):121-125. 23. Haley BJ, Kim SW, Pettengill J, Luo Y, Karns JS, Van Kessel JA. Genomic and evolutionary analysis of two Salmonella enterica Serovar Kentucky sequence types Isolated from bovine and poultry sources in North America. PLoS One 2016;11(10):e0161225. 24. Olafson PU, Brown TR, Lohmeyer KH, Harvey RB, Nisbet DJ, Loneragan GH, Edrington TS. Assessing transmission of Salmonella to bovine peripheral lymph nodes upon horn fly feeding. J Food Prot 2016;79(7):1135-1142. 25. Cernicchiaro N, Ives SE, Edrington TS, Nagaraja TG, Renter DG. Efficacy of a Salmonella siderophore receptor protein vaccine on fecal shedding and lymph node carriage of Salmonella in commercial feedlot cattle. Foodborne Pathog Dis 2016;13(9):517-525. 26. Delgado-Suรกrez EJ, Selem-Mojica N, Ortiz-Lรณpez R, Gebreyes WA, Allard MW, Barona-Gรณmez F, Rubio-Lozano MS. Whole genome sequencing reveals widespread distribution of typhoidal toxin genes and VirB/D4 plasmids in bovine-associated nontyphoidal Salmonella. Sci Rep 2018;8(1):9864. 27. Fabrega A, Vila J. Salmonella enterica serovar Typhimurium skills to succeed in the host: virulence and regulation. Clin Microbiol Rev 2013;26(2):308-341.

809

Rev Mex Cienc Pecu 2020;11(3):795-810

28. Holzer K, Weissend C, Huebner K, Metcalf J, Geornaras I, Belk K, Morley P, Martin J. Presence and characteristics of Salmonella enterica recovered from subiliac lymph nodes of beef feedlot cattle enrolled in a randomized clinical trial of dietary additives. Meat Muscle Biol 2017;1(3):131. 29. Edrington TS, Loneragan GH, Genovese K, Hanson DL, Nisbet DJ. Salmonella persistence within the peripheral lymph nodes of cattle following experimental inoculation. J Food Prot 2016;79(6):1032-1035.

810

https://doi.org/10.22319/rmcp.v11i3.5242 Article

Diagnosis of the infectious pancreatic necrosis virus (IPNV) by nested PCR in adult trouts

Catalina Tufiño-Loza a José Juan Martínez-Maya a Amaury Carrillo-González b Diana Neria-Arriaga c Celene Salgado-Miranda d Edith Rojas-Anaya e Elizabeth Loza-Rubio e*

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Ciudad de México, México. b

Universidad del Valle de México, Campus Toluca, Estado de México, México.

SENASICA, Ciudad de México, México.

Universidad Autónoma del Estado de México. Centro de Investigación y Estudios Avanzados en Salud Animal, Estado de México, México. e

INIFAP. Centro Nacional de Investigaciones Disciplinarias en Salud Animal e Inocuidad.

Carretera México-Toluca km 15.5, Colonia Palo Alto, Ciudad de México, México.

* Corresponding author: loza.elizabeth@inifap.gob.mx, eli_rubio33@hotmail.com

811

Rev Mex Cienc Pecu 2020;11(3):811-827

Abstract: The isolation of the infectious pancreatic necrosis virus (IPNV) in cell culture is currently the main diagnostic method. Although it is a reliable method, it is expensive, and the results take three weeks. This study aimed to establish and evaluate the use of a nested PCR (nPCR) for the rapid diagnosis of the IPNV, decreasing the diagnosis time and increasing its sensitivity. Therefore, two pairs of primers were designed based on Mexican sequences. The first pair (RT-PCR) amplified a 682 bp product, and the second pair (nPCR) 229 bp of the VP2 gene. Subsequently, 70 rainbow trout fry (Oncorhynchus mykiss) were infected with the virulent strain MEX3-CSM-05 at a dose of 1X105.8 TCID50/0.02 ml. From each organism, the kidney, spleen, pyloric caeca, liver, intestine, and gills were collected. To evaluate the tests, a total of 26 clinically healthy adult trouts from commercial farms in the State of Mexico were used. The detection frequency of the IPNV using RT-PCR was 87.1 % in gills, 61.4 % in liver, 61.4 % in pyloric caeca, 58.6 % in kidney, 35.7 % in the intestine, and 32.9 % in the spleen (P<0.05). RT-PCR negative samples were positive in the nPCR. Similarly, samples from the wild trout organs were positive. In conclusion, the RTPCR was less sensitive than the nPCR, which showed a sensitivity of 100 %. Therefore, nPCR is the best option for a reliable diagnosis of the IPNV in infected and sick fish. Key words: IPNV, Nested PCR, Rainbow trout, Diagnosis.

Received: 30/01/2019 Accepted: 09/12/2019

Introduction The constant growth of the aquaculture industry has increased the incidence and propagation of diseases, especially those generated by viruses due to their rapid dispersion and high-degree of infection. The infectious pancreatic necrosis (IPN) is an acute systemic disease that mainly affects fish from the salmonid family. It causes elevated mortality in alevins and fry, and the surviving fish become lifelong carriers of the virus(1,2). The etiological agent of the IPN belongs to the Birnaviridae family, Aquabirnavirus genus(3,4). It is a non-enveloped virus, with an icosahedral-shape capsid, and an approximate diameter of 60 nm(5). Its genome consists of two segments of double-stranded ribonucleic acid (RNA)(1). The IPN virus (IPNV) has a wide antigenic and genotypic variability. Its presence has been notified in wild and farmed salmonids in different countries around the world,

812

Rev Mex Cienc Pecu 2020;11(3):811-827

which is why it is considered a worldwide distributed disease(6,7). IPN outbreaks are often due to imports and sales of infected eyed eggs and fry(8). In Mexico, this disease was identified in the year 2000 in rainbow trout fry (Oncorhynchus mykiss) imported from the United States of America(9). In 2009, in the main national trout-cultural stations, the national prevalence was 11.9 % and spread to 62.5 %. However, the economic impact of the virus since its identification in 2002 to date has not been calculated(10). Viral isolation on fish cell lines, such as Lepomis macrochirus fry fibroblasts (BF-2), Chinook salmon embryo cells (CHSE-214), or rainbow trout gonad fibroblasts (RTG-2), followed by its identification through immunofluorescence in apparently healthy fish, is the suggested diagnosis by the World Organization for Animal Health(7). However, although it is a reliable method, it is also expensive and slow; it takes at least three weeks to confirm a negative result(11,12). Furthermore, this time is crucial in viral dissemination due to the rapid dispersion in lotic currents, which can cause important economic losses(2,13). There are other viral identification tests for antigen detection, such as immunohistochemistry and ELISA (Enzyme-linked immunosorbent assay)(7). However, problems like the dependence on these tests and monoclonal antibodies during importation, the autofluorescence of fish tissue, a high viral titer, the difficulty to obtain fresh samples from fish tissue, and the cross-reaction of antibodies frequently limit the universal and routine use of the techniques mentioned above(14,15). Therefore, several protocols have been proposed for an efficient and rapid identification of the IPNV in infected cell cultures or tissues using the reverse transcription-polymerase chain reaction (RT-PCR) and some of its variants(16-24). This study aimed to establish and evaluate the use of a nested PCR (nPCR) with primers designed based on Mexican viral sequences to diagnose the IPNV in tissues from experimentally infected trouts in aquaculture production units; this method would decrease the diagnosis time, which would allow implementing several IPN control strategies and prevent fish exposition in the production units.

Material and methods Cell line

The BF-2 cell line from Lepomis macrochirus (ATCCÂŽ CCL 91) was used to propagate the viral MEX2-CSM-05 strain(25). The BF-2 cell line was cultured at 20 Â°C in Leibovitzâ&#x20AC;&#x2122;s L15 medium (In vitro, Mexico) supplemented with 10 % fetal bovine serum (FBS) (Biowest,

813

Rev Mex Cienc Pecu 2020;11(3):811-827

Mexico), 100 IU/ml of penicillin, 100g/ml of streptomycin, and 0.25 g/ml of amphotericin B (In vitro, Mexico).

Virus

The MEX2-CSM-05 viral strain reported by Salgado-Miranda et al(25) was propagated in confluent monolayers of the BF-2 cell line at 15 °C in Leibovitz’s L-15 medium (In vitro, Mexico) supplemented with 2 % fetal bovine serum (FBS) (Biowest, Mexico). At 72 h post-infection, the monolayer showed signs of cytopathic effect (CPE), which consists of a gradual loss of the monolayer and rounding of infected cells. Hence, culture flasks were frozen at -20 °C and thawed twice. Subsequently, the cell suspension was collected and centrifuged at 1,200 xg for 15 min at 4 °C(7) to obtain the supernatant, from which the viral titer (Tissue Culture Infectious Dose, TCID) was determined by the Reed and Muench method.

Trouts

For the experimental study, 100 rainbow trout fry (O. mykiss) were acquired from the Aquaculture Center El Zarco of the Comisión Nacional de Acuacultura y Pesca (CONAPESCA). Fry had an average size of 3 cm, an average weight of 1 g, and 480 degrees-days (value obtained by multiplying the age in days by the average of temperature in Celsius degrees during the shelf life)(26). To evaluate the test, a total of 26 clinically healthy adult rainbow trouts (O. mykiss) were acquired from commercial farms in the Estado de México [State of Mexico]. The clinical evaluation of fish consisted of studying their behavior, as well as their external appearance; the species showed normal countercurrent swimming patterns, where it responds to noises and stimuli (escape response). The color of the fish was normal, greenish-yellow; fish had a white belly and black dots on their back and fins. Their skin was soft, without bruises, and with intact fins. Before starting the experiment, the health status of the fish was evaluated using ten organisms from the aquaculture center. The presence of bacteria, parasites, and the IPNV was determined by isolation and PCR in the Aquaculture Health Laboratory of the Centro de Investigación y Estudios Avanzados en Salud Animal [Animal Health Research and Advanced Studies Center] of the Universidad Autónoma del Estado de México; results were negative for bacteria, parasites, and the IPNV. Therefore, the use of clinically healthy animals for the experiment was assured. In trouts from the commercial production units of Estado de México, only the behavior and external appearance evaluation was performed

814

Rev Mex Cienc Pecu 2020;11(3):811-827

since they were used to evaluate the nested PCR for the detection of the IPNV. The fish were kept in polypropylene tanks with 60 L of recirculating water, with a photoperiod of 12 h of light/ 12 h of darkness and temperature between 14-17 °C. Fish were fed with a commercial product, supplying 3 % of their total biomass per day.

Experimental infection with the IPNV

From the 100 rainbow trouts acquired from the Aquaculture Center, 70 were inoculated intraperitoneally with 1X105.8 TCID 50/0.02 ml of the MEX3-CSM-05 viral strain. The 30 remaining organisms were kept in a different tank as a negative control for the tissue detection of the IPNV using the nPCR. After inoculation, daily clinical examinations were performed to identify and monitor the course of the disease with the clinical signs, which included decreased appetite, anorexia, hyperpigmentation, abdominal distension, moderate exophthalmos, and erratic spiral swimming. When the fish showed very advanced clinical signs, they were euthanized by overexposure to anesthesia with tricaine methanesulfonate (MS-222) (Sigma-Aldrich, 886-86-2, USA) at a concentration of 50 μg/ml(27). After euthanasia, the following organs were collected and preserved at -80 °C: kidney, spleen, pyloric caeca, liver, intestine, and gills. Additionally, and on the same dates, two trouts from the negative control tank were euthanized every day to collect the organs mentioned above. The fish from the commercial production units of Estado de México, upon their arrival to the laboratory, were euthanized to collect their organs. All the procedures that involved the handling of animals were performed according to the guidelines established by the Bioethics Committee for the care and reasonable use of experimental animals in research projects (Authorization number: CBCURAE-006) in the Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad of the Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias, where all procedures were performed.

RNA extraction and cDNA synthesis

Organs were macerated and homogenized with sterile phosphate-buffered saline (PBS) at a pH of 7.2, from this mixture, 250 l were taken for total RNA extraction with Trizol (Invitrogen, 15596018, USA), following the manufacturer’s instructions. The RNA was resuspended in DNase- and RNase-free water. The synthesis of the cDNA was performed using the M-MLV Reverse Transcriptase kit, oligo (dT)12-18 (0.5g/l) (Invitrogen, USA).

815

Rev Mex Cienc Pecu 2020;11(3):811-827

The RNA was incubated with 1 l of the oligo (dT)12-18 (0.5 µg/l) and 1l of 10 mM dinucleotide triphosphates (dNTP) for 5 min at 65 °C. After incubation, 4 l of 5X first strand buffer, 1 l of 0.1 M dithiothreitol (DTT), and 1 l of MML-V Reverse Transcriptase were added to the mixture, which was incubated for 1 h at 50 °C. Subsequently, the reaction was inactivated at 70 °C for 15 min and stored at -20 °C until use.

Primers

Table 1 shows the primers used in this study to detect a fragment of the VP2 gene of the IPNV and the EF-α constitutive gene(10,28). The primers were synthesized at the Instituto de Biotecnología of the Universidad Nacional Autónoma de México (Cuernavaca, Morelos, Mexico). Table 1: Sequence of primers used to detect the VP2 gene of the IPNV and the EF-α constitutive gene.

RT-PCR

nPCR

EF-α

Sequence

Position

For 5’ CCGAATCAGGAAGTGGMMTTCTTG 3’

137-160

Rev 5’ GTGACCACKGGGACGTCATTGTC 3’

796-818

For 5’ TCACCGTCCTGAATCTACCAAC 3’

482-503

Rev 5’ GTTGTGGAGTTSACGATGTCSGC 3’

688-710

For -5 'GATCCAGAAGGAGGTCACCA 3'

561-583

Rev -5' TTACGTTCGACCTTCCATCC 3'

694-713

GenBank access no.

AF498320

Size (bp)

689

60º

229

65º

150

55º

Ta= annealing temperature; bp= base pairs.

PCR and nPCR

To amplify all the PCR products we used the Dream Taq DNA Polymerase kit (Thermo Scientific, USA), reactions were prepared with a final concentration of 2 mM of MgCl2, 0.2 mM of dNTPs Mix, 0.2 mM of each of the previously described primers (forward and reverse), 5 l of the cDNA of each sample, and 1.25 U of DNA polymerase. The PCR amplification was performed under the following conditions: initial denaturation at 95 °C for 1 min, followed by 35 denaturation cycles at 95 °C for 30 s, annealing at 60 °C for 30 s,

816

Rev Mex Cienc Pecu 2020;11(3):811-827

and extension at 72 °C for 30 s, with a final extension at 72 °C for 7 min. Subsequently, the template used for the nPCR was the product from the previous PCR; this amplification occurred under the same conditions, except that the annealing temperature was 65 °C. The PCR and nPCR products were analyzed by electrophoresis in a 1 % agarose gel in TAE (40 mM Tris, 20 mM acetic acid, and 2 mM EDTA) buffer, stained with GelRed (Biotium, USA), and visualized in a Quantity One 1-D Analysis System (Bio-Rad, USA).

Statistical analysis

The frequency of RT-PCR and nPCR positive organs of experimentally infected trouts was analyzed in contingency tables and using a Ji-squared test(25). Additionally, for each test, we evaluated the sensitivity and specificity (Table 2). The proportion of RT-PCR positive samples in each organ was compared with the Tukey-type multiple comparison test with angular transformation, where a statistical significance of P<0.05 was considered(29). Table 2: Generation of cells with which the sensitivity and specificity calculations are performed Fish health status Infected

Halthy

True positives

False Sensibility = TP / (TP+FN)

Positive (TP)

positives (FP) Specificity =TN / (FP+TN)

Molecular True assay

False negatives negatives

Negative (FN)

(TN)

817

Rev Mex Cienc Pecu 2020;11(3):811-827

Results The experimentally infected trouts started to show clinical signs of IPN from d 7 and until d 11 post-inoculation (pi) (Table 3). Mortality was observed from d 7 pi, reaching 100 % on d 11 pi. The main findings at necropsy in inoculated trouts were an empty stomach, pale liver, and mucus in the intestine, while the trouts from the production units were clinically healthy and without injury at necropsy. Table 3: Kinetics of the appearance of clinical signs in rainbow trouts experimentally inoculated with the MEX2-CSM-05 strain Post-challenge day

Description of clinical signs

1-6

No clinical signs were observed.

Anorexia, hyperpigmentation, decreased appetite, abdominal distension, moderate exophthalmos, erratic spiral swimming in some trouts.

Increased number of trouts with erratic spiral swimming, hyperpigmentation, anorexia, abdominal distension.

9 10 11

Increased number of trouts with erratic spiral swimming, hyperpigmentation, anorexia, abdominal distension. Some organisms only remained at the bottom. Erratic spiral swimming, hyperpigmentation, anorexia, abdominal distension. Erratic spiral swimming, hyperpigmentation, anorexia, abdominal distension.

The results obtained from the RT-PCR in the different organs of experimentally inoculated trouts allowed the detection of the IPNV in different proportions. The organs with the highest frequency of viral detection were gills (87.1 %), liver (61.4 %), pyloric caeca (61.4 %), and kidney (58.6 %) (P<0.05). Moreover, the organs with the lowest frequency of viral detection were the intestine (35.7 %) and spleen (32.9 %) (Table 4) (P<0.05). However, in these last samples, the nPCR detected a product of 229 bp, previously confirmed by sequentiation to belong to the IPNV. The organs from the trouts in the control tank were negative to the nPCR amplification.

818

Rev Mex Cienc Pecu 2020;11(3):811-827

Table 4: Detection by RT-PCR and nPCR of the VP2 gene of the IPNV in the organs of rainbow trouts inoculated with the MEX2-CSM-05 strain RT-PCR nPCR Organ Positive samples % Positive samples % Kidney Liver Pyloric caeca Intestine Gills Spleen

41/70 43/70 43/70 25/70 61/70 23/70

58.6 61.4 61.4 35.7 87.1 32.9

29/70 27/70 27/70 45/70 9/70 47/70

41.4 38.6 38.6 64.3 12.9 67.1

Based on the previous results, the RT-PCR was less sensitive than the nPCR in each of the analyzed organs (Table 5); however, its specificity was of 100 %. The nPCR showed a sensitivity and specificity of 100 %. Trout organs from the commercial production units in Estado de MĂŠxico showed positive results only with the nPCR, the frequency of detection was 100 %.

Organ Kidney Liver Pyloric caeca Intestine Gills Spleen

Table 5: RT-PCR sensitivity Sensitivity (%) (CI) Specificity (%) 58.6 (47.0, 70.1) 100 61.4 (50.0, 72.8) 100 61.4 (50.0, 72.8) 100 35.7 (24.5, 46.9) 100 87.1 (79.3, 95.0) 100 32.9 (21.9, 43.9) 100 CI= 95 % confidence intervals.

Discussion Currently, the diagnosis of several fish diseases uses fast, sensitive, and specific molecular techniques; this has allowed the timely detection of a large number of infectious agents. Therefore, prevention and control measures for many diseases have been developed, implemented, and improved. Since its first detection in the Salvenilus fontinalis trout, the IPNV has been identified in a wide variety of fish and invertebrate species, but with significant impact in the salmonids distributed worldwide(30,31). Although evidence shows that the virus is currently present in

819

Rev Mex Cienc Pecu 2020;11(3):811-827

almost all of the trout productive States in the country(32), the reported clinical disease cases are few; this may be because the Mexican isolates of the IPNV are related to the VR-299 strain from the USA, initially reported by Ortega et al(9), which is considered of low virulence(33). Therefore, for this study, two pairs of specific primers were designed to detect the Mexican strains of the IPNV that circulate in the country and the reference strain Sp(10); since, due to the antigenic variability of this virus, it has been shown that the primers that recognize strains from other parts of the world do not recognize the strains currently circulating in the country(21,34). Recently, molecular techniques, such as the PCR, have been widely used to detect fish viruses(9,30). The RT-PCR has been applied to detect the IPNV due to its precision, speed, and high sensitivity(18,19,21,34). This technique can specifically detect the viral genome without previous isolation of the virus; this was conducted in Iran, where a RT-PCR confirmed the presence of the IPNV for the first time in rainbow trout farms in the Fars province, this isolate is similar to the Ab strain(35). The use of the RT-PCR has been described for the detection of the IPNV genome in cell cultures, experimentally inoculated fish, and naturally infected fish, crustaceans, and mollusks(35). The IPNV infection is lethal in young salmonids, although this virus can be isolated in different organs of infected fish at all ages(13). In this study, the nPCR efficiently detected a fragment of the genome of the IPNV in rainbow trout fry and in the trouts from commercial farms, which are heavier and older. Although the isolation of aquatic birnaviruses in apparently healthy species is common, it has been shown that the IPNV infection may not be detected even when the samples have been examined by cell culture(36,37). Several studies showed that the RT-PCR was more sensitive than cell culture isolation for the detection of the IPNV(38). The real-time RT-PCR is slightly more sensitive than viral isolation in cell culture; the OIE recommends the latter to detect the IPNV in carrier fish, which have low viral concentrations in kidneys, which can limit its detection by viral isolation(36,39). According to Milne et al(13), fish with advanced signs of IPNV infection have relatively high viral titers. Therefore, the use of an end-point RT-PCR as a qualitative molecular technique could facilitate viral genome detection. However, in this study, the RT-PCR assay detected a fragment of the IPNV genome in a percentage of the experimentally infected fish, depending on the evaluated organ. However, the RT-PCR negative samples turned out to be positive with the nPCR assay, which had an increased sensitivity of 100 %. The same was observed in the samples from apparently healthy juvenile trouts from commercial production units; these samples were positive using the nPCR; this could be explained by the frequently low concentration of viral particles in asymptomatic carriers, which difficult viral detection by RT-PCR(13). 820

Rev Mex Cienc Pecu 2020;11(3):811-827

In this study, the results obtained in adult fish determined that the studied animals could be healthy carriers; this happens when the fish survive the infection by the IPNV and continue with their productive cycle, contributing to the vertical transmission of the virus through ova or semen. These asymptomatic carriers may show no apparent clinical signs or pathological changes(40,41); and, depending on the progression of the disease over time and the immune response of each specimen, macro or microscopic changes may not be observed in the different fish organs. However, the persistently IPNV infected salmonids are a potential source of disease spread and potentially detectable by PCR. It is important to emphasize that it is very likely that the detected IPNV cases detected using the nPCR are related to the low virulence strains, and, therefore, cause no significant harm to the trout production. However, the potential risk of introducing and spreading other IPNV strains could also result from the eyed egg importation from the USA and other European, African, and South American countries(32). For this reason, the proposed nPCR in this study is of great importance for early, rapid, and reliable detection. The high sensitivity of this type of PCR has been demonstrated in numerous studies. A sensitivity of up to 10 pg has been detected in purified RNA samples from salmonid isolates(34). Lopez-Lastra et al(18) developed a nPCR to detect up to 1 pg of the IPNV in asymptomatic carriers from field samples. Suzuki et al(37) developed a nPCR using a pair of primers based in the detection of the VP2/NS gene junction region of aquatic birnaviruses with a sensitivity of 1 fg (femtogram) of viral genome in the sample. The nPCR increases the specificity and reduces the detection of false positives when the second pair of primers amplifies only if the first pair generated the expected DNA fragment(21,34,42). Another advantage of the proposed nPCR is the viral detection in the infected tissues without the need to isolate the virus in cell culture, as, although it is considered a reference test for diagnosis, it is a technique that is limited to laboratories with professionals trained in the use of cell lines, the necessary equipment for their maintenance and incubation, and the identification of the cytopathic effect(7). Other variants of PCR and testing have been proposed, but their adoption depends on the equipment available in the laboratories. For example, RodrĂguez et al(21) compared six diagnostic methods for the IPNV and found that the RT-PCR and flow cytometry were the most adequate and sensitive methods for routine detection of the IPNV. A different study(23) reported a low sensitivity (43 %) using RT-PCR; therefore, they used a short cell culture incubation protocol as a complementary technique, in addition to a multiplex PCR with three pairs of primers in one reaction to increase the probability to identify all the serotypes of the IPNV serogroup A and prevent a false negative result. Even though other molecular techniques have been proposed for a rapid and high sensitivity diagnosis, like the real-time RT-PCR and the RT-LAMP (Loop-mediated isothermal amplification), these require specialized equipment and training in designing primers and interpreting results(22,42). In 821

Rev Mex Cienc Pecu 2020;11(3):811-827

Mexico, the diagnosis of the IPNV is mainly made by viral isolation in cell culture and the detection of the viral genome by end-point RT-PCR, this technique is performed in most of the laboratories conventionally. Moreover, the detection of the IPNV in the different organs analyzed in this study confirms the wide spread of the virus. Usually, the organs recommended for the detection of the IPNV in cell culture are kidney, liver, spleen, and the ovarian fluid of broodfish or the entire alevin(7). However, the main target organ for propagation is the kidney, where the virus persists(39). Unlike the kidney, other target organs for viral detection are pancreas, intestine, liver, and gills. The pancreas is anatomically diffuse between the pyloric caeca, and it develops severe necrosis. The intestine develops an acute enteritis characterized by the necrosis of cells and glands in the digestive tract, which is responsible for the elimination of the virus in the feces and mucus that it produces(6). In the liver, the IPNV induces apoptosis markers, also found in the intestine and pancreas, that correspond to the viral accumulation and pathological changes in the tissue(43,44). Finally, the gills, which are responsible for oxygen exchange, may appear pale due to the degenerative and necrotic damage to the epithelium. In this study, the organs with the highest viral frequency of detection were the pyloric caeca, intestine, and gills, which, as mentioned before, have been identified as target organs for the early detection of the disease, since they are sites of early viral propagation(45).

Conclusions and implications The nPCR with the primers developed for the identification of Mexican isolates is useful for the diagnosis of the IPNV, not only in clinically infected fish but also to detect infected fish without clinical signs. Furthermore, this study suggests the use of this method to confirm an outbreak of IPN in a production unit. If necessary, viral isolation, histopathological, or immunohistochemical studies are recommended in suspected or nPCR positive cases.

Acknowledgments This research was carried out with the financial support of the Consejo Nacional de Ciencia y Tecnología (CONACYT) of project CB -2009-01-134099. Catalina Tufiño Loza received support from the CONACYT. The authors also thank A. Mejía, A. Fabián, and J.C. Gómez of the Universidad del Valle de México (UVM) for their excellent technical assistance.

822

Rev Mex Cienc Pecu 2020;11(3):811-827

Literature cited: 1.

Rodríguez SJS, Borrego JJ, Perez PSI. Infectious pancreatic necrosis virus: biology, pathogenesis, and diagnostic methods. Adv Virus Res 2003;62(1):113-165.

Salgado-Miranda C. Necrosis pancreática infecciosa: enfermedad emergente en la truticultura de México. Vet Méx 2006;37(4):467-477.

Dobos P, Roberts TE. The molecular biology of infectious pancreatic necrosis virus: a review. Can J Microbiol 1983;29(4):377-384.

King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, King AMQ, et al, editors. Virus taxonomy: ninth report of the International Committee on Taxonomy of Viruses. New York, USA: Academic Press; 2012:499-507.

Dobos P. Birnaviruses. Encyclopedia of life sciences. Nature Publishing Group 2001, London.

Dhar A, LaPatra S, Orry A, Allnutt T. Infectious pancreatic necrosis virus. In: Woo PTK, Cipriano RC editors. Fish viruses and bacteria: Pathobiology and protection. 1rst ed. Wallingford, Oxfordshire, UK: CAB International; 2017: 1-12.

OIE. Manual of diagnostic tests for aquatic animals. 5th ed. Paris, France: World Organization for Animal Health. 2006.

Munro ES, Midtlyng PJ. Infectious pancreatic necrosis and associated aquatic birnaviruses. In: Woo PT, Bruno DW, editors. Fish diseases and disorders. Volume 3: viral, bacterial and fungal infections, 2nd ed. Oxfordshire, UK: CABI; 2011:1-65.

Ortega SC, Montes de Oca R, Groman D, Yason C, Nicholson B, Blake S. Case report: viral infectious pancreatic necrosis in farmed Rainbow Trout from Mexico. J Aquat Anim Health 2002;14(4):305-310.

10. Salgado MC. Virulencia del virus de la necrosis pancreática infecciosa en trucha arcoíris (Oncorhynchus mykiss) a partir de aislamientos mexicanos [tesis doctorado]. México, DF: Universidad Nacional Autónoma de México; 2014. 11. Amos KH. Procedures for the detection and identification of certain fish pathogens, 3rd ed. Fish Health Section, American Fisheries Society, Corvallis; 1985.

823

Rev Mex Cienc Pecu 2020;11(3):811-827

12. Ahne W, Thomsen I. 1986. Infectious pancreatic necrosis: detection of virus and antibodies in rainbow trout IPNV-carrier (Salmo gairdneri). J Vet Med 1986;33(7):552-554. 13. Milne SA, Galachacher S, Cash P, Porter AJR. A reliable RTPCR-ELISA method for the detection of infectious pancreatic necrosis virus (IPNV) in farmed rainbow trout. J Virol Methods 2006;132(1-2):92-96. 14. Sanz F, Coll J. Techniques for diagnosing viral diseases of salmonid fish. Dis Aquat Org 1992;13:211-223. 15. LaPatra SE. The use of serological techniques for virus surveillance and certification of finfish. Annu Rev Fish Dis 1997;6:1-28. 16. Way-Shyan W, Yea-Ling W, Jainn-Shyan L. Single-tube, non-interrupted reverse transcription PCR for detection of IPNV. Dis Aquat Org 1997;28(3):229-233. 17. Pryde A, Melvin WT, Munro ALS. Nucleotide sequence analysis of the serotypespecific epitope of infectious pancreatic necrosis virus. Arch Virol 1993;129(1-4):287293. 18. Lopez-Lastra M, Gonzalez M, Jashes M, Sandino AM. A detection method for infectious pancreatic necrosis virus (IPNV) based on reverse transcription (RT)polymerase chain-reaction (PCR). J Fish Dis 1994;17(3):269-282. 19. Blake S, Lee MK, Singer J, McAllister PE, Nicholson BL. Detection and identification of aquatic birnavirus by polymerase chain reaction assay. J Clin Microbiol 1995;33(4):835-839. 20. Alonso M, RodrĂguez S, PĂŠrez-Prieto SI. Viral coinfection in salmonids: infectious pancreatic necrosis virus interferes with infectious hematopoietic necrosis virus. Arch Virol 1999;144(4):657-673. 21. Rodriguez SJ, Borrego JJ, Perez-Prieto SI. Comparative evaluation of five serological methods and RT-PCR assay for the detection of IPNV in fish. J Virol Methods 2001;97(1-2):23-31. 22. Bowers RM, Lapatra SE, Dhar AK. Detection and quantitation of infectious pancreatic necrosis virus by real-time reverse transcriptase-polymerase chain reaction using lethal and non-lethal tissue sampling. J Virol Methods 2008;147(2):226-34.

824

Rev Mex Cienc Pecu 2020;11(3):811-827

23. Barrera-Mejía M, Simón-Martínez J, Salgado-Miranda C, Vega F, Ortega C, Aragón A. Development and validation of a short-time cell culture and multiplex reverse transcriptase polymerase chain reaction assay for infectious pancreatic necrosis virus in Mexican farm-sampled rainbow trout. J Aquat Anim Health 2009;21(3):167-72. 24. Tapia D, Eissler Y, Torres P, Jorquera E, Espinoza JC, Kuznar J. Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile. Dis Aquat Org 2015;116(3):173-84. 25. Salgado-Miranda C, Rojas-Anaya E, García-Espinoza G, Loza-Rubio E. Molecular characterization of the VP2 gene of Infectious Pancreatic Necrosis Virus (IPNV) isolates from Mexico. J Aquat Anim Health 2014;26(1):43-51. 26. Dorson M, Touchy C. The influence of fish age and water temperature on mortalities of rainbow trout, Salmo gairdneri Richardson, caused by a European strain of infectious pancreatic necrosis virus. J Fish Dis 1981;4(3):213–221. 27. de las Heras A, Perez-Prieto S, Rodríguez Saint-Jean S. In vitro and in vivo immune responses induced by a DNA vaccine encoding the VP2 gene of the infectious pancreatic necrosis virus. Fish Shellfish Immunol 2009;27(2):120-129. 28. Ingerslev HC, Fausa EP, Jakobsen RA, Petersen CB, Wergeland HI. Expression profiling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon (Salmo salar L.). Mol Immunology 2006;43(8):1194-1201. 29. Zar JH. Biostatistical analysis. 5th ed. New Jersey, USA: Prentice Hall; 2010. 30. Wolf K. Fish viruses and fish viral diseases. Ithaca, New York: Cornell University Press; 1988. 31. Smail DA, Bain N, Bruno DW, King JA, Thompson F, Pendrey DJ, Morrice S, Cunningham CO. Infectious pancreatic necrosis virus in Atlantic Salmon, Salmo salar L., post-smolts in the Shetland Isles, Scotland: virus identification, histopathology, immunohistochemistry and genetic comparison with Scottish mainland isolates. J Fish Dis 2006;29(1):31–41. 32. Ortega C, Valladares B, Arguedas D, Vega F, Montes de Oca R, Murray A. Distribution of infectious pancreatic necrosis virus (IPNV) based on surveillance programs in freshwater trout farms of Mexico. J Aquat Anim Health 2016;28(1):21-26.

825

Rev Mex Cienc Pecu 2020;11(3):811-827

33. Barrera-Mejía M, Martínez S, Ortega C, Ulloa-Arvizu R. Genotyping of infectious pancreatic necrosis virus isolates from Mexico state. J Aquat Anim Health 2011;23(4):200-206. 34. Alonso MC, Cano I, Castro D, Perez-Prieto SI, Borrego JJ. Development of an in situ hybridization procedure for the detection of sole Aquabirnavirus in infected fish cell cultures. J Virol Meth 2004;116(2):133-138. 35. Akhlagi M, Hosseini A. First report on the detection of infectious pancreatic necrosis virus (IPNV) by RT-PCR in rainbow trout fry cultured in Iran. Bull Eur Ass Fish Pathol 2007;27(5):205-210. 36. Taksdal T, Ramstad A, Stangeland K, Dannevig BH. Induction of infectious pancreatic necrosis (IPN) in covertly infected Atlantic salmon Salmo salar L. post-smolts by stress exposure, by injection of IPN virus (IPNV) and by cohabitation. J Fish Dis 1998;21(3):193-204. 37. Suzuki S, Hosono N, Kusuda R. Detection of aquatic birnavirus gene from marine fish using a combination of reverse transcription and nested PCR. Mar Biotechnol 1997;5(4):205-209. 38. Taksdal T, Dannevig BH, Rimstad E. Detection of infectious pancreatic necrosis (IPN)-virus in experimentally infected Atlantic salmon parr by RT-PCR and cell culture isolation. Bull Eur Ass Fish Pathol 2001;21(5):214-219. 39. Ørpetveit I, Mikalsen AB, Sindre H, Evensen Ø, Dannevig BH, Midtlyng PJ. Detection of infectious pancreatic necrosis virus in subclinically infected Atlantic salmon by virus isolation in cell culture or real-time reverse transcriptase polymerase chain reaction: influence of sample preservation and storage. J Vet Diagn Invest 2010;22(6):886-895. 40. Gahlawat SK, Munro ES, Ellis AE. A non-destructive test for the detection of IPNV carriers in Atlantic halibut Hippoglossus hippoglossus (L.). J Fish Dis 2004;27(4):233239. 41. Rimstad E, Hornes E, Olsvik O, Hyllseth B. Identification of a double-stranded RNA virus by using polymerase chain reaction and magnetic separation of the synthesized DNA segments. J Clin Microbiol 1990;28(10):2275-2278. 42. Soliman H, Midtlyng PJ, El-Matbouli M. Sensitive and rapid detection of infectious pancreatic necrosis virus by reverse transcription loop mediated isothermal amplification. J Virol Methods 2009;158(1-2):77-83. 826

Rev Mex Cienc Pecu 2020;11(3):811-827

43. Imajoh M, Hirayama T, Oshima S. Frequent occurrence of apoptosis is not associated with pathogenic infectious pancreatic necrosis virus (IPNV) during persistent infection. Fish Shellfish Immunol 2005;18(2):163-177. 44. Santi N, SandtrĂ¸ A, Sindre H, Song H, Hong JR et al. Infectious pancreatic necrosis virus induces apoptosis in vitro and in vivo independent of VP5 expression. Virology 2005;342(1):13-25. 45. Shankar KM, Yamamoto T. Prevalence and pathogenicity of infectious pancreatic necrosis virus (IPNV) associated with feral lake trout, Salvelinus namaycush (Walbaum). J Fish Dis 1994;17(5):461-471.

827

https://doi.org/10.22319/rmcp.v11i3.5002 Article

Polymorphisms associated with the number of live-born piglets in sows infected with the PRRS virus in southern Sonora Mexico

Carlos Martín Aguilar-Trejo a Guillermo Luna-Nevárez a Javier Rolando Reyna-Granados a Ricardo Zamorano-Algandar a Javier Alonso Romo-Rubio b Miguel Ángel Sánchez-Castro c R. Mark Enns c Scott E. Speidel c Milton G. Thomas c Pablo Luna-Nevárez a*

Instituto Tecnológico de Sonora, Departamento de Ciencias Agronómicas y Veterinarias, Calle 5 de Febrero # 818 Sur, Colonia Centro, Ciudad Obregón Sonora, México. b

Universidad Autónoma de Sinaloa, Facultad de Medicina Veterinaria y Zootecnia, Culiacán Sinaloa, México. c

Colorado State University, Department of Animal Sciences, Fort Collins Colorado, USA.

*Corresponding author: pluna@itson.edu.mx

828

Rev Mex Cienc Pecu 2020;11(3):828-847

Abstract: The porcine reproductive and respiratory syndrome (PRRS) is a viral disease that decreases the reproductive performance in breeding sows and leads to economic losses to the swine industry. The objective of the present study was to identify single nucleotide polymorphisms (SNP) associated to the number of live-born piglets in the first (LBP1) and second birth (LBP2) in breeding sows exposed to PRRS virus. The study included 100 pregnant females of the Landrace(Âž)/ Yorkshire(Âź) line, 75 of which were infected with the PRRS virus and 25 were free of PRRS. Individual blood samples (6-8 drops) were obtained and spotted onto FTA cards and subsequently processed for DNA extraction, which was genotyped using a 10,000 SNP chip for genomic profile. Resulting genotypes were analyzed using a multi-locus mixed model that detected three SNP associated to LBP1 and five SNP associated to LBP2 (P<0.001). These eight SNP were validated using an associative mixed effects model which included the terms genotype and age of dam as fixed effects, and sire as random effect. Allele substitution effects were estimated using the same model including the term genotype as covariate. The SNP rs81276080, rs81334603 and rs80947173 were associated to LBP1 (P<0.001), whereas the SNP rs81364943, rs80859829, rs80895640, rs80893794 and rs81245908 were associated to LBP2 (P<0.001). Only two SNP were in functional chromosomal regions and the remainder SNP were within an intergenic position. In conclusion, these results suggest the existence of gene variants associated with the reproductive performance of sows infected with the PRRS virus. Key words: Alleles, Breeding sows, Genotype, Live-born piglets, PRRS, SNP.

Received: 27/07/2018 Accepted: 10/01/2020

Introduction The respiratory and reproductive syndrome (PRRS) is a worldwide disease that causes economic losses in the porcine industry estimated at approximately $3.08 American dollars per pig at market(1). The etiology agent of PRRS is an RNA virus of single chain belonging to Artevirus gender, whose main characteristics are an elevated mutation rate that confers a high antigenic variability, and its capacity to induce persistent infections(2,3). The initial report of PRRS

829

Rev Mex Cienc Pecu 2020;11(3):828-847

disease in Mexico described that infected sows showed a case of reproductive problem and mortality in the production line(4). The first clinical, epidemiological and productive description of the disease, as well as the first isolation of the PRRS virus, were reported in the states of Mexico, Guanajuato, Veracruz and Puebla(5). The PRRS virus infection is characterized by poor feed conversion that leads to a low weight in pigs, as well as fertility alterations in breeding sows such as estrus return, fetal mortality, mummification, abortions induction and low viability of piglets at birth(1). Vaccination is the most common method for PRRS control and currently it has achieved to prevent in some extent the PRRS infection. However, the efficiency of the vaccines is still far to be universal because of the virus has the ability to avoid the immune response of the host; moreover, there exist genetic differences among hosts in response to vaccine virus exposition(6,7). The vaccination is able to show some efficiency against homologous PRRS strains, but its efficiency against heterologous strains is drastically reduced. Therefore, the vaccination against the PRRS virus at present only guarantee a reduction in the length of the viremia and the elimination of the virus cycle, as well as a decrease in the intensity of signs and the appearance of clinical symptoms(8). The existence of genetic variants associated to the interaction between the PRRS virus and the host, as well as the evidence of a natural variability in the tolerance and/or susceptibility to the PRRS in the commercial porcine lines, they are opened the door for using molecular technologies as a valuable tool to battle the PRRS disease(9). In this regard, the marker assisted selection (MAS) can be used to study candidate genes in order to identify those animals that possess a superior genetic ability for the expression of economically important traits, which include resistance or tolerance to diseases(10). First examples of the application of these technologies in pigs were the selection against the halothane gene, and the identification of a significant association between the estrogen receptor gene and the number of live-born piglets(11). However, the current development of more robust computer systems has allowed to perform the whole genome selection, which involves an extensive use of molecular markers that cover the entire genome, in such a way that hundreds of thousands of molecular variants can be simultaneously studied in order to explain the generic variation of a phenotypic trait(12). This method allows to perform associative studies that include the simultaneous analysis of a great amount of markers through the use of low- (10k=10,000) or high-density devices (50k=50,000 to 60K=60,000 SNP). Several studies have been developed in pigs with the objective to identify regions within the DNA related to economically important traits such as the resistance to the PRRS virus(13,14,15). Initial reports suggest the existence of a genetic basis associated to the PRRS disease. In this regard, pigs from the breed Hampshire infected with PRRS showed pulmonary damages more serious than pigs from the breeds Duroc and Meishan(16). Furthermore, pigs from the 830

Rev Mex Cienc Pecu 2020;11(3):828-847

synthetic line Large White-Landrace showed a lower rectal temperature and a reduction in the viremia after be infected with the PRRS virus, in comparison with pigs from the synthetic line Hampshire-Duroc(17). Recently, it has been reported within the chromosome 4 a genomic region associated to the resistance to the PRRS virus, which evidenced the existence of a strong genetic component associated to such ability(3). Currently, there is scarce information that report genes and/or genetic variants related to the phenotypic differences observed in the reproductive efficiency of sows infected with the PRRS virus. Therefore, the genetic foundation analyses of the reproductive response of these sows could lead to the identification of genetic markers associated to an appropriate reproductive performance, which would be very useful for the implementation of more efficient selection programs that include sows with superior genetic ability to tolerate and/or resist the infection of the PRRS virus. Based on the previous information, the objective of the present study was to identify single nucleotide polymorphisms associated to the number of live-born piglets in the first (LBP1) and second birth (LBP2) in breeding sows infected with the PRRS virus.

Material and methods Location and experimental units

This study was performed in a full-cycle commercial porcine herd located in the Yaqui Valley, Sonora, Mexico (NL: 27°17’, WL: 109°56’). The study included 100 breeding sows from the commercial line Landrace(¾)/Yorkshire(/¼), 12-mo of age and proved to be free of PRRS disease.

Health and reproductive management

At 15 d after be admitted in the breeding area, 75 sows resulted as naturally infected with a wild strain of the PRRS virus (positive group; n= 75) because, even though the farm was PRRS-free at the beginning of the experiment, it was located within an PRRS endemic region affected by several Norte American strains (PRRSV NA). By the other hand, a negative control group was composed by 25 sows which were maintained free of PRRS infection (control; n= 25). This was confirmed by both serologic and molecular tests performed along

831

Rev Mex Cienc Pecu 2020;11(3):828-847

the experiment. The sows inside the breeding area started their reproductive management that consisted in providing two services after be observed in estrus, using boars with proved high-fertility. After be confirmed as pregnant, the sows were moved into the gestation area where they remained until the day before their programmed birth. At this time, the sows were moved again into the maternity area. Immediately after the birth, records for total number of piglets born, live-born piglets and dead-born piglets were collected and stored in the computer software PigWIN®. The same reproductive management and data collection described before was repeated for the second farrowing of each sow and its corresponding birth.

Laboratory analyses

Blood samples were individually collected through auricular vein puncture at d 7, 30, 120 and 240 after the sows came into the breeding area; the samples were used to the serum determination of specific antibody titles against the PRRS virus using the diagnostic tool “ELISA-IDEXX” (Enzyme Linked Immunoassay, Lab Inc.). The viral RNA was isolated from blood serum through an automatic extraction system of nucleic acids by magnetic separation (TACO System, Gene Reach Biotechnology Corporation). The RNA was purified and then analyzed by real-time PCR using a commercial kit (Tetracore Nextgen Real-Time QT-PCR) which recognizes an ORF-7 segment from the PRRS virus. Results were reported as the number of RNA copies from the PRRS virus per mL of sample (Cepheid Smart Cycler V2.0d).

Genome wide association study

An additional blood sample (0.5 ml) was collected from each sow and spotted onto FTA blood cards for collection of nucleic acids. The cards were stored at 25°C and subsequently sent to Neogen Lab for DNA extraction, purification and quantification. The DNA was genotyped using a device of low-density genomic profile (LDPorcine BeadChip, Neogen®, Lincoln, NE) with capacity to analyze 10,000 single nucleotide polymorphisms (SNP). The software PLINK (V1.07)(18) was used for quality control of genotyping results, which consisted in the elimination of SNP with genotyping call rate below 90 %, minor allele frequency lower than 5 % and Mendelian error rate higher than 0.1. After the quality control study, a total of 8,826 SNP resulted useful and informative for the genome-wide association study. To do this, a multi-locus mixed model was constructed in order to identify SNP associated with the reproductive traits LBP1 and LBP2, using the software Golden Helix

832

Rev Mex Cienc Pecu 2020;11(3):828-847

SVS 7 (Golden Helix Inc., Bozeman, Montana, USA). The “stepwise” procedure was performed to identify the significant SNP as fixed effect covariables. In addition, the model allowed to use a matrix for genomic relationships estimated from the available genotypes (SNP) for each animal. The SNP considered as associated to the evaluated phenotypes were those with α=0.001, and all SNP resulted as significant (P<0.001) were retained for validation analyses.

Statistical analyses

Descriptive statistics for the variables total born piglets, live-born piglets and dead-born piglets were calculated through the procedure MEANS from the statistical software SAS version 9.4 (SAS Inst. Inc., Cary, NC). An analyses of variance was utilized to determine if the variables mentioned before differed between sows positive and negative to PRRS disease (P<0.05) using the procedure PROC GLM. Normality and variance equality tests were performed using the procedure UNIVARIATE(19).

Validation of genetic markers associated to LBP1 and LBP2

The procedure ALLELE was used to calculate allelic and genotypic frequencies, and to perform Chi-squared (X2) test to verify possible deviations from the Hardy-Weimberg equilibrium(20). The SNP that resulted associated (P<0.001) to the traits LBP1 and LBP2, and accomplished with the criteria of minor allele frequency higher than 10 % (FAM>0.10) and no-deviation from the Hardy-Weinberg equilibrium (X2>0.05), were subjected to a validation analysis trough a genotype to phenotype association study, using the procedure MIXED for variables of continue distribution. Such analysis of individual validation for each SNP was performed trough a mixed effects model, which included fixed effects of polymorphism genotype and age of dam, the random effect of the sire (i.e., using Z statistics to test if Ho:δw2=0) and the residual effect (mean=zero, variance= δe2). Comparisons among means from the SNP genotypes associated with the traits LBP1 and LBP2 were obtained using the option PDIFF of the procedure LSMEANS, including the Bonferroni adjustment provided that genotype term resulted as significant source of variation (P<0.05) in the associative analysis. Substitution allelic effects were estimated using the mixed effects model previously described, which included for this analysis the term genotype as covariable(21).

833

Rev Mex Cienc Pecu 2020;11(3):828-847

Results Variables associated to PRRS

Descriptive statistics for reproductive traits analyzed in this study are showed in Table 1, as well as variables related to viability of piglets at birth and at weaning. Average values for the variables total piglets born, and live-born piglets at first and second births were significantly (P<0.01) lower for sows positive to PRRS compared to negative sows (control), whereas an opposite effect was observed for the variable dead-born piglets, which suggests such variables are associated to the infection of the PRRS virus in the present study. Table 1: Average values ± SE for reproductive and viability traits associated with first and second births in reproductive sows positive and negative to PRRS Positive to PRRS Negative to PRRS Trait N Average ± SE N Average ± SE First birth: Total born piglets 75 11.24 ± 3.12a 25 12.65 ± 3.56b Live-born piglets 75 10.17 ± 3.27a 25 11.48 ± 3.59b Dead-born piglets 75 1.16 ± 1.01a 25 0.91 ± 1.02b Number of weaning piglets 75 10.03 ± 3.02 25 10.96 ± 3.04 Weaned piglets total weight (kg) 75 56.67 ± 13.05 25 67.84 ± 13.01 Weaned piglets average weight 75 5.65 ± 0.86 25 6.19 ± 0.85 (kg) Second birth: Total born piglets 75 10.67 ± 3.02a 25 11.92 ± 3.10b Live-born piglets 75 9.85 ± 3.25a 25 10.75 ± 3.59b Dead-born piglets 75 0.94 ± 1.02a 25 0.75 ± 1.03b Number of weaning piglets 75 9.76 ± 1.64 25 10.92 ± 1.79 Weaned piglets total weight (kg) 75 48.89 ± 14.62 25 59.76 ± 14.51 Weaned piglets average weight 75 5.01 ± 0.84 25 5.47 ± 0.81 (kg)

Genome-wide association study

A total of 8,856 SNP fulfilled the criteria of quality to be included in the associative genomic analyses that detected genomic regions associated to LBP1 (chromosomes 6 and 7; Figure 1)

834

Rev Mex Cienc Pecu 2020;11(3):828-847

and to LBP2 (chromosomes 2, 5, 7 and 8; Figure 2), which explain 3.6 and 4.1 % of the variation associated to the traits LBP1 and LBP2, respectively. The individual genomic analyses detected three SNP associated to the variable LBP1 (P<0.001) and five SNP associated to the variable LBP2 (P<0.001). Only two of the eight SNP mentioned before are located within functional gene regions (introns), the rs81276080 within the gen TTR (Transthyretin) and the rs80893794 within the gen CWH43 (Cell wall biogenesis 43 Cterminal homolog). The record of the eight SNP detected as associated to the traits LBP1 and LBP2, as well as the genes and biological processes related to such SNP, are showed in Table 2. Figure 1: Manhattan plot showing the position of the SNP associated with the trait of LBP1. (significance threshold fixed to P<0.001)

Figure 2: Manhattan plot showing the position of the SNP associated with the trait of LBP2. (significance threshold fixed to P<0.001)

835

Rev Mex Cienc Pecu 2020;11(3):828-847

Table 2: Genes and biological processes related to the SNP associated with the traits of LBP1 and LBP2 in breeding sows positive and negative to PRRS Trait SNP Variant Associated Associated biological gene process LBP1 rs81276080 Intronic TTR Hormonal activation KCNQ4 Neuronal transmission rs81334603 Intergenic CTPS1 Immune response FLRT2 Neuronal development rs80947173 Intergenic ISOC1 Oogenesis LBP2 rs81364943 Intergenic ADAMTS19 Enzymatic activation IRAK4 Immune response rs80859829 Intergenic ADAMTS20 Enzymatic activation CD83 Immune response rs80895640 Intergenic CWH43 Cellular activation rs80893794 Intronic FAT4 Neuronal transmission rs81245908 Intergenic LBP1= Live-born piglets at 1st birth; LBP2= Live-born piglets at 2nd birth.

Validation of genetic markers

The eight SNP identified due to its association with the reproductive traits of LBP1 and LBP2 fulfilled the criteria for no-deviation of the Hardy-Weinberg equilibrium (X2=1.0, P>0.28) and minor allele frequency higher that 10 % (MAF>0.10; Table 3); therefore, these SNP were considered as candidate genes in this study. Three of these SNP were validated as predictors of LBP1 (P<0.001) and the other five SNP were validated as predictors of LBP2 (P<0.001). Table 4 shows the least square means for the genotypes of each SNP associated to the variables of LBP1 and LBP2. The most favorable SNP were rs81334603 and rs81364943 because they showed the higher values for LBP1 (GG= 13.47 ± 1.11) and LBP2 (TT= 16.30 ± 3.01), respectively, whereas the less favorable SNP were rs81276080 and rs80859829 because they showed the lower values for LBP1 (GG= 7.59 ± 0.61) and LBP2 (CC= 5.94 ± 0.78), respectively. However, the eight SNP validated in this study showed a favorable genotype associated with the analyzed reproductive traits.

836

Rev Mex Cienc Pecu 2020;11(3):828-847

Table 3: Allelic and genotypic frequencies of the SNP associated with LBP1 and LBP2 in breeding sows positive and negative to PRRS Trait SNP Position Allelic Frequency Genotypic Frequency

LBP1

rs81276080 SSA 6

0.1878 A

0.8122 G

0.0352 AA

0.3052 AG

0.6596 GG

rs81334603 SSA 6

0.3867 A 0.7431 C 0.8266 0.3133 0.3379 0.3099 A 0.3000

0.6133 C 0.2569 T 0.1734 0.6867 0.6621 0.6901 G 0.7000

0.1467 AA 0.5556 CC 0.6800 0.0533 0.1622 0.1268 AA 0.0667

0.4800 AC 0.3750 CT 0.2933 0.5200 0.3514 0.3662 AG 0.4667

0.3733 CC 0.0694 TT 0. 026 0.4267 0.4865 0.5070 GG 0.4667

rs80947173 SSA 7 LBP2

rs81364943 rs80859829 rs80895640 rs80893794

SSA 2 SSA 5 SSA 7 SSA 8

rs81245908 SSA 8

LBP1= Live-born piglets at 1st birth; LBP22 = Live-born piglets at 2nd birth.

Table 4: Least square means ± SE for genotypes of the SNP associated with the traits LBP1 and LBP2 in breeding sows positive and negative to PRRS Trait SNP N Means by genotype ± SE Prob

LBP1

LBP2

rs81276080

100

rs81334603

100

rs80947173

100

rs81364943

100

rs80859829

100

rs80895640

100

rs80893794

100

rs81245908

100

TT 12.33±1.16a GG 13.47±1.11a AA 12.59±1.48a TT 16.30±3.01a TT 12.21±3.04a TT 11.88±1.06a CC 13.42±1.07a GG 12.25±2.08a

TG 8.04±1.08b AG 10.51±0.75b AC 9.81±0.94b TC 12.94±0.95a TC 8.75±0.69 b TC 9.61±0.91b TC 10.08±0.74b GA 8.57±0.74b

GG 7.59±0.61b AA 8.56±0.77b CC 8.31±0.68b CC 9.23±0.62b CC 5.94±0.78b CC 8.11±0.85b TT 7.95±0.84c AA 7.50±0.75b

LBP1= Live-born piglets at 1st birth; LBP2= Live-born piglets at 2nd birth.

837

.0001 .0001 .0001 .0001 .0001 .0001 .0001 .0001

Rev Mex Cienc Pecu 2020;11(3):828-847

The substitution allelic effects for each SNP are showed in Table 5. The favorable alleles of the SNP rs81276080, rs81334603 and rs80947173 associated to LBP1 were T, G and A, because they increase 3.28 ± 0.74, 3.52 ± 0.62 and 2.35 ± 0.68 the number of LBP1, respectively (P<0.001). By the other hand, for the SNP rs81364943, rs80859829, rs80895640, rs80893794 and rs81245908 associated with LBP2, the favorable alleles were T, T, T, C and G, because they increase 3.66 ± 0.85, 3.38 ± 0.82, 1.92 ± 0.58, 2.64 ± 0.61 and 3.18 ± 0.77 the number of LBP2, respectively (P<0.001). The results described before indicate a favorable contribution of the eight validated SNP for the reproductive traits evaluated in the sows included in this study. Table 5: Allelic substitution effects for SNP associated with the traits LBP1 and LBP2 in breeding sows positive and negative to PRRS Allelic Substitution Effect Trait SNP Favorable Prob Estimated SE allele value LBP1 rs81276080 T 0.0005 3.28 1.1476 rs81334603 G 0.0002 3.52 0.6227 rs80947173 A 0.0013 2.35 0.6870 LBP2 rs81364943 T 0.0001 3.66 0.8525 rs80859829 T 0.0002 3.38 0.8201 rs80895640 T 0.0022 1.92 0.5893 rs80893794 C 0.0001 2.64 0.6162 rs81245908 G 0.0002 3.18 0.7732 LBP1= Live-born piglets at 1st birth; LBP2= Live-born piglets at 2nd birth.

Discussion The negative effect of the PRRS virus infection on the number of live-born piglets observed in the present study has been previously reported in sows from different parity(22,23). In a similar study conducted with PRRS infected sows which were compared to healthy sows, it was observed an increase in the average values of mummified and non-born piglets of 0.04 to 1.12 and 0.62 to 1.02, respectively, as well as a reduction in the number of live-born piglets of 10.3 to 9.8(24). Furthermore, the existence of genetic variability associated to the reproductive performance in sows infected with the PRRS virus has been also described in previous research reports. In this regard, Rashidi et al(15) reported a variation of 3.83 ± 0.31 in the number of live-born piglets infected with the PRRS virus, compared to a variation of 1.96 ± 0.06 observed in

838

Rev Mex Cienc Pecu 2020;11(3):828-847

healthy sows. Such variability, mainly in sows infected with PRRS, suggests the existence of a genetic basis associated to the reproductive response in the face of the disease. Therefore, it has been pointed out as an important strategy to reduce the negative impact of the PRRS in breeding sows, the identification of molecular markers that allow a better understanding about the genetic control of the response to the virus, which would be eventually incorporated in marker assisted selection (MAS) programs(25). In the present study, the genome-wide analyses identified genomic regions and a total of eight SNP associated to the variables LBP1 and LBP2 (P<0.001) in breeding sows infected and non-infected with the PRRS virus. Such SNP showed a minor allele frequency greater than 10 %, which in general terms is considered as a requirement to avoid false results in genotype to phenotype association studies(26). In the individual statistical analysis, the eight SNP previously identified were validated as predictors for the variables LBP1 and LBP2, from which only two of them are located within functional gene regions. On the one hand, the SNP rs81276080 (associated with LBP1) is located within the 5â&#x20AC;&#x2122;region from the TTR gene (Transthyretin), which codifies the synthesis of a transport protein of thyroid hormones in plasm and cerebrospinal fluid. The TTR gene has been proposed as a potential candidate gene associated with the physiological response in pigs exposed to heat stress, which seriously restrict their reproductive performance(27), because it reduces oocyte quality and embryo viability, and enhances the PRRS negative effects on fertility of infected sows. On the other hand, the SNP rs80893794 (associated with LBP2) is located within an intron region from the gen CWH43 (Cell wall biogenesis 43 Cterminal homolog). This gene is involved in lipids remodeling of the cell wall from yeasts(28), and it has been reported that this gene is homologous to the gene PGAP2 (Post-GPI attachment to proteins), which is involved in both di-acetylation and re-acetylation cycles of the proteins that synthesizes Phosphatidyl Inositol (PI) in mammal cells(29). The PI is a family of lipids that participates in the second messenger mechanism in the cell membrane. This mechanism is used by several hormones such as PGF2Îą which plays an important role in ovary function and uterine activity; then, it influences directly the variables LBP1 and LBP2. The remaining six SNP are located within intergenic regions (positional). In this regard, is important to point out that, when exploring the entire genome, it is complicated to detect a causal variant or a variant directly responsible of phenotypic changes within populations; however, because of the property of linkage disequilibrium in the genome, it is possible to identify indirect associations among the SNP and specific phenotypes. This information supports the importance for considering genes whose chromosomal location is close to resulting significant SNP that possess an intergenic position (at least in a range of 100 thousand of base pairs; 100 kbp)(30). One of these SNP is the rs81334603 associated to LBP1, which is located to a distance of 40.26 kbp from the gene KCNQ4 (Potassium voltage-gated channel subfamily Q member 4). This gene is under-expressed in tracheobronchial lymph 839

Rev Mex Cienc Pecu 2020;11(3):828-847

nodes from pigs infected with the North American strain VR-2332 of the PRRS virus(31). Moreover, approximately to 72.77 kbp from the SNP rs81334603 is located the gene CTPS1 (CTP Synthase 1), which codifies the production of the enzyme CTP synthase; the function of this enzyme is the biosynthesis of pyrimidine nucleotides (UTP and CTP), as well as the synthesis of ciclopentenilcitosine, a wide-spectrum antiviral agent(32). In relation to the SNP rs80947173, also associated to LBP1, the closest gene to this SNP is the FLRT2 (Fibronectin leucine rich transmembrane protein 2) gene which is located at 889.05 kbp of distance. Even though it is true that this gene is located considerably far away from the SNP rs80947173, useful levels of linkage disequilibrium (>0.3) appear to extend in pigs to a higher distance than Holstein cows, which implies that low-density SNP panels could provide reliably results in genome-wide association studies(33). In addition, it has been reported that the gene FLRT2 is associated to the number of live-born piglets in populations of Large White and Landrace pigs(34). In the case of the SNP associated to LBP2, one of them is the rs81364943, which is located to a distance of 88.74 kbp from the gene ISOC1 (isochorismatase domain containing 1) and 178.67 kbp from the gene ADAMTS19 (ADAM metallopeptidase with thrombospondin type 1 motif 19). The gene ISOC1 has been linked to a processes of catalytic activity in porcine oocytes according to a genetic co-expression study(35), whereas polymorphisms from the ADAMTS19 gene in women have been associated to the presence of the polycystic ovarian syndrome(36). Another SNP associated with LBP2 was the rs80859829 which is located to 31.75 and 177.73 kbp from the genes ADAMTS20 (ADAM metallopeptidase with thrombospondin type 1 motif 20) and IRAK4 (Interleukin 1 receptor associated kinase 4), respectively. The possible explanation for the association of this polymorphism with the reproductive performance at birth in PRRS infected sows is because the gene ADAMTS20 is over-expressed in organs such as brain and gonads(37), which are affected after the infection of the PRRS virus(38). Likewise, the kinase associated with the interleucine-1 receptor (protein product from the gene IRAK4), it has been involved in the mechanisms of PRRS virus replication because its production is reduced by the action of a well-known micro RNA (miRNA-373) with proviral effects(39). The SNP rs80895640 also associated with LBP2 is located to 34.3 kbp from the gene CD83 (CD83 molecule); this gene has been previously linked with the number of total born piglets and live-born piglets in hybrids pigs Iberic X Meishan(40,41). Interestingly, in the immunological context, the CD83 molecule has been recently indicated as a key piece of the scape mechanisms of the PRRS virus against the immune system, because this virus is able to regulate positively the expression in soluble form of the molecule CD83 (sCD83), which was associated to the immunosuppression of T-cell proliferation in the host(42). Similarly, 840

Rev Mex Cienc Pecu 2020;11(3):828-847

from 54.05 kbp of the SNP rs80895640 is located the gene RNF182, which is involved in neuronal apoptosis processes(43) that commonly occur after the infection of highly-infectious strains of the PRRS virus(44). Finally, the SNP rs81245908 (associated with LBP2) is located to an approximate distance of 53.52 kbp from the gene FAT4 (FAT atypical cadherin 4). The association of this polymorphism could be explained from a study which provides evidence that FAT4 gene expression in humans has been detected in fetal and infant brain tissues(45), because it has been also proved that PRRS maternal infection is able to affect neuronal development in piglets, reducing the number of neurons from the hippocampus and increasing the number of glia(46).

Conclusions and implications The detection of genomic regions that explain 3.6 and 4.2 % of the variance associated to the traits live-born piglets at first and second births, as well as the validation of eight SNP located within such regions, suggest the existence of a genetic basis that underlies the reproductive response in breeding sows infected with the PRRS virus. Therefore, this study proposes to consider these eight SNP associated with the variables LBP1 and LBP2, two functional and six positional, as genetic markers for selection programs focused to improve the reproductive efficiency in sows infected with the PRRS virus. It is suggested to conduct additional studies to evaluate the functionality of the detected SNP; in addition, it is important to consider the validation of the genomic regions and genes reported in this study in other breed populations of sows also infected with the PRRS virus.

Acknowledgments Thanks to Diagnostic Lab ITSON-UGRPS; Reproductive Biotechnology Lab ITSON; Unión Ganadera de Porcicultores del Estado de Sonora; Departament of Animal Science, Colorado State University (CSU), Facultad de MVZ de la Universidad Autónoma de Sinaloa; and Consejo Nacional de Ciencia y Tecnología (Becario 279847/302410).

841

Rev Mex Cienc Pecu 2020;11(3):828-847

Literature cited: 1. Holtkamp DJ, Kliebenstein JB, Neumann EJ, Zimmerman JJ, Rotto HF, Yoder TK, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome virus on United States pork producers. J Swine Health Prod 2013;21(2):72–84. 2. Lunney JK, Steibel JP, Reecy JM, Fritz E, Rothschild MF. Probing genetic control of swine responses to PRRSV infection: current progress of the PRRS host genetics consortium. BMC Proceedings 2011;5(4):S30. 3. Boddicker N, Waide EH, Rowland RRR, Lunney JK, Garrick DJ, Reecy JM, et al. Evidence for a major QTL associated with hot response to Porcine Reproductive and Respiratory virus syndrome challenge. J Anim Sci 2012;90(6):1733-1746. 4. Milian-Suazo F, Canto-Alarcón GJ, Weimersheimer-Rubí JE, Coba-Ayala MA, CorreaGirón P, Anaya-Escalera AM. Estudio seroepidemiológico para determinar la presencia de anticuerpos contra el virus del Síndrome Disgenésico y Respiratorio del Cerdo en México. Tec Pecu Mex 1994;32(3):139-144. 5. Ramírez R, Sierra N, Mota D. Aislamiento del virus de PRRS en México: Estudio clínico, serológico y virológico. Arch Med 2000;32(1):1-9. 6. Lewis CR, Ait-Ali T, Clapperton M, Archibald AL, Bishop, S. Genetic perspectives on host responses to porcine reproductive and respiratory syndrome (PRRS). Viral Immunol 2007;20(3):343-358. 7. Mateu E, Diaz I. The challenge of PRRS immunology. Vet J 2008;177(3):345-351. 8. Royaee AR, Husmann RJ, Dawson HD, Calzadanova G, Schnitzlein WM, Zuckermann A. Deciphering the involvement of innate immune factors in the development of the host response to PRRSV vaccination. Vet Immunol Immunopathol 2004;102(3):199-216. 9. Reiner G. Genetic resistance - an alternative for controlling PRRS?. Porcine Health Manag 2016;2(27):1-11.

842

Rev Mex Cienc Pecu 2020;11(3):828-847

10. Georges M. Mapping, fine mapping, and molecular dissection of quantitative trait loci in domestic animals. Annu Rev Genomics Hum Genet 2007;8:131-162. 11. Muñoz G, Ovilo C, Estellé J, Fernández A, Rodríguez C. Association with litter size of new polymorphisms on ESR1 and ESR2 genes in a Chinese-European pig line. Genet Sel Evol 2007;39(2):195-206. 12. Goddard ME, Hayes BJ. Genomic selection. J. Anim. Breed. Genet 2007;124(6):323330. 13. Long Y, Ruan GR, Su Y, Xiao SJ, Zhan ZY, Ren J, et al. Genome-wide association study identifies QTLs for EBV of backfat thickness and average daily gain in Duroc pigs. Genetika 2015;51(3):371-378. 14. Abella G, Pena R, Nogareda C, Armengol R, Vidal A, Moradell L, et al. A WUR SNP is associated with European Porcine Reproductive and Respiratory Virus Syndrome resistance and growth performance in pigs. Res Vet Sci 2016;104:117–122. 15. Rashidi H, Mulder HA, Mathur P, van Arendonk JAM, Knol EF. Variation among sows in response to porcine reproductive and respiratory syndrome. J Anim Sci 2014;92(1):95–105. 16. Halbur PG, Rothschild MF, Thacker BJ, Meng X-J. Paul PS, Bruna JD. Differences in susceptibility of Duroc, Hampshire, and Meishan pigs to infection with a high virulence strain (VR2385) of porcine reproductive and respiratory syndrome virus (PRRSV). J Anim Breed Genet 1998;115:181–189. 17. Petry DB, Holl JW, Weber JS, Doster AR, Osorio FA, Johnson RK. Biological responses to porcine respiratory and reproductive syndrome virus in pigs of two genetic populations. J Anim Sci 2007;83(7):1494–1502. 18. Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet 2007;81(3):559–575.

843

Rev Mex Cienc Pecu 2020;11(3):828-847

19. Littell, R, Stroup W, Freund R. SAS for linear models. 4th ed. SAS Institute Inc., Cary, NC. 2002. 20. Saxton AM, Balzarini MG, Cappio-Borlino A, Czika W, Fry JD, Gibson G, et al. Genetic analysis of complex traits using SAS. SAS Institute, Inc., North Carolina; 2004. 21. Sherman EL, Nkrumah JD, Murdoch BM, Li C, Wang Z, Fu A, et al. Polymorphisms and haplotypes in the bovine neuropeptide Y, growth hormone receptor, ghrelin, insulin–like growth factor 2, and uncoupling proteins 2 and 3 genes and their associations with measures of growth, performance, feed efficiency, and carcass merit in beef cattle. J Anim Sci 2008;86(1):11–16. 22. Lewis CRG, Torremorell M, Bishop SC. Effects of porcine reproductive and respiratory syndrome virus infection on the performance of commercial sows and gilts of different parities and genetic lines. J Swine Health Prod 2009;17(3):140–147. 23. Lewis CRG, Torremorell M, Galina-Pantoja L, Bishop SC. Genetic parameters for performance traits in commercial sows estimated before and after an outbreak of porcine reproductive and respiratory syndrome. J Anim Sci 2009;87(3):876–884. 24. Lewis CR, Ait-Ali T, Clapperton M, Archibald AL, Bishop S. Genetic perspectives on host responses to porcine reproductive and respiratory syndrome (PRRS). Viral Immunol 2007;20(3):343-358. 25. Serão NV, Matika O, Kemp RA, Harding JC, Bishop SC, Plastow GS, et al. Genetic analysis of reproductive traits and antibody response in a PRRS outbreak herd. J Anim Sci 2014;92(7):2905–2921. 26. Balding DJ. A tutorial on statistical methods for population association studies. Nat Reviews 2006;7(10):781–791. 27. Seibert JT, Graves KL, Hale BJ, Keating AF, Baumgard LH, Ross JW. Characterizing the acute heat stress response in gilts: I. Thermoregulatory and production variables. J Anim Sci 2018;3(96):941-949.

844

Rev Mex Cienc Pecu 2020;11(3):828-847

28. Umemura M, Fujita M, Yoko-O T, Fukamizu A, Jigami Y. Saccharomyces cerevisiae CWH43 is involved in the remodeling of the lipid moiety of GPI anchors to ceramides. Mol Biol Cel. 2007;18(11):4304-4316. 29. Ghugtyal V, Vionnet C, Roubaty C, Conzelmann A. CWH43 is required for the introduction of ceramides into GPI anchors in Saccharomyces cerevisiae. 2007;65(6):1493-1502. 30. Abo-Ismail MK, Brito LF, Miller SP, Sargolzaei M, Grossi DA, Moore SS, et al. Genome-wide association studies and genomic prediction of breeding values for calving performance and body conformation traits in Holstein cattle. Genet Sel Evol 2017;49(1):49–82. 31. Miller LC, Fleming D, Arbogast A, Bayles DO, Guo B, Lager KM, et al. Analysis of the swine tracheobronchial lymph node transcriptomic response to infection with a Chinese highly pathogenic strain of porcine reproductive and respiratory syndrome virus. BMC Vet Res 2012;8(1):208. 32. De Clercq E, Murase J, Marquez VE. Broad-spectrum antiviral and cytocidal activity of cyclopentenylcytosine, a carbocyclic nucleoside targeted at CTP synthetase. Biochem Pharmacol 1991;41(12):1821–1829. 33. Veroneze R, Bastiaansen JW, Knol EF, Guimarães SE, Silva FF, Harlizius B, et al. Linkage disequilibrium patterns and persistence of phase in purebred and crossbred pig (Sus scrofa) populations. BMC Genet 2014;15(1):126. 34. Bergfelder-Drüing S, Grosse-Brinkhaus C, Lind B, Erbe M, Schellander K, Simianer H, et al. A genome-wide association study in large white and landrace pig populations for number piglets born alive. PloS ONE 2015;10(3):e0117468. 35. Kimble K. Transcriptome profiles of porcine oocytes and their corresponding cumulus cells reveal functional gene regulatory networks [masters thesis]. Alabama, USA: Auburn University; 2018. 36. Russell DL, Brown HM, Dunning KR. ADAMTS proteases in fertility. Matrix Biol 2015;44(46):54–63.

845

Rev Mex Cienc Pecu 2020;11(3):828-847

37. Llamazares M, Cal S, Quesada V, López-Otín C. Identification and characterization of ADAMTS-20 defines a novel subfamily of metalloproteinases-disintegrins with multiple thrombospondin-1 repeats and a unique GON-domain. J Biol Chem 2003;278(15):13382–13389. 38. Sur JH, Doster AR, Christian JS, Galeota JA, Wills RW, Zimmerman JJ, et al. Porcine reproductive and respiratory syndrome virus replicates in testicular germ cells, alters spermatogenesis, and induces germ cell death by apoptosis. J Virol 1997;71(12):9170– 9179. 39. Chen J, Shi X, Zhang X, Wang A, Wang L, Yang Y, et al. MicroRNA-373 facilitated the replication of porcine reproductive and respiratory syndrome virus (PRRSV) by its negative regulation of type I interferon induction. J Virol 2016; JVI-01311. 40. Noguera JL, Rodríguez C, Varona L, Tomás A, Muñoz G, Ramírez O, et al. A bidimensional genome scan for prolificacy traits in pigs shows the existence of multiple epistatic QTL. BMC Genomics 2009;10(1):636. 41. Fernandez-Rodriguez A, Munoz M, Fernandez A, Pena RN, Tomas A, Noguera JL, et al. Differential gene expression in ovaries of pregnant pigs with high and low prolificacy levels and identification of candidate genes for litter size. Biol Reprod 2011;84(2):299– 307. 42. Chen X, Zhang Q, Bai J, Zhao Y, Wang X, Wang H, et al. The nucleocapsid protein and non-structural protein 10 of highly pathogenic porcine reproductive and respiratory syndrome virus enhance CD83 production via NF-κB and Sp1 signaling pathways. J Virol 2017;JVI-00986. 43. Nakamura N. The role of the transmembrane RING finger proteins in cellular and organelle function. Membranes 2011;1(4):354–393. 44. Chen XX, Quan R, Guo XK, Gao L, Shi J, Feng WH. Up-regulation of pro-inflammatory factors by HP-PRRSV infection in microglia: implications for HP-PRRSV neuropathogenesis. Vet Microbiol 2014;170(1):48–57. 45. Katoh Y, Katoh M. Comparative integromics on FAT1, FAT2, FAT3 and FAT4. Int J Mol Med 2006;18(3):523–528. 846

Rev Mex Cienc Pecu 2020;11(3):828-847

46. Balakrishnan B, Johnson RW. Altered brain development in fetal and neonatal piglets following maternal porcine respiratory and reproductive syndrome virus (PRRSV) infection. Brain Behav Immun 2015;49:e31.

847

https://doi.org/10.22319/rmcp.v11i3.5274 Article

Bulk sales of cold cuts and sausages: a marketing trend associated to the risk of foodborne diseases in Culiacan, Mexico

Maribel Jiménez-Edeza a Maritza Castillo-Burgos a Lourdes Janeth Germán-Báez a Gloria Marisol Castañeda-Ruelas a*

Universidad Autónoma de Sinaloa, Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación y Diagnóstico Microbiológico, Programa Regional de Posgrado en Biotecnología. Blvd. de las Américas and Josefa Ortiz de Domínguez S/N. Ciudad Universitaria, 80013, Culiacán, Sinaloa, México.

*Corresponding author: gloria.ruelas@uas.edu.mx

Abstract: The nature, production and consumption of cold cuts and sausages define these foods as vulnerable to contamination by pathogenic microorganisms that cause foodborne diseases. The aim of the study was to evaluate the influence of the bulk sale of cold cuts and sausages, on the hygienic quality and prevalence of L. monocytogenes and Salmonella. Thus, 96 samples of sausages (sausage and ham) from 15 national brands were collected and classified by type of sale: original package (n= 48) and bulk (n= 48). The detection of total coliforms, Escherichia coli, Salmonella, and L. monocytogenes was analyzed by traditional culture method. 42.7 % (41/96) of the samples of cold cuts and sausages failed to comply with the sanitary specifications in terms of total coliforms and E. coli. The statistical analysis showed that the type of sale is an indicator of the microbial risk in cold cuts and sausages (χ2 = 40.0, P= 0.000), since the number of samples with poor hygienic quality was higher for bulk sales (69.0%) compared to those sold in packages (17.0 %). Additionally, the risk analysis showed that bulk sale increases 41.8 and 5.9 times the risk of acquiring ham and frankfurters of poor

848

Rev Mex Cienc Pecu 2020;11(3):848-858

microbiological quality (P<0.05), respectively, while the type of sales did not influence the presence of L. monocytogenes (6.3 %). Consumers are advised to avoid bulk sale of cold cuts and sausages, and producers and sellers should reinforce good hygienic practices that will ensure food safety, and minimize the risk of infection. Key words: Bulk, L. monocytogenes, Package, Food safety, Cold cuts, Cold sausages.

Received: 21/02/2019 Accepted: 29/08/2019

Introduction Ready-to-eat (RTE) cold cuts and sausages are foods of great acceptance due to their organoleptic attributes and practicality of consumption. In Mexico, the per capita consumption of these products is increasing, since it is estimated that in 2014, 6.9 kg per person were consumed, while for 2018 the figure increased to 8.1 kg(1). However, the nature and the production of cold cuts and sausages render these foods vulnerable to contamination by microorganisms that cause their deterioration, as well as by pathogens associated to foodborne diseases (FBD)(2). Listeria monocytogenes is considered the main cause of withdrawal of cold cuts and sausages from the market in the USA.(3-6), and one of the main etiological agents of FBD, with a mortality rate of up to 30 % in certain high-risk groups (immunocompromised, elderly, infants, and pregnant women)(2,4-6). It has been reported as the cause of 1,455 cases (16 % mortality)(7), with an estimated economic cost of US $ 2.4 billion due to annual listeriosis(8). However, there are no official references for such estimates in Mexico. Fortunately, the Mexican Official Norm Project PROY-NOM-213-SSA1-2017(9), which already establishes the monitoring of this pathogen, has been published. However, because this project is recent, there is little information on the prevalence of Listeria monocytogenes in cold cuts and sausages(10,11). Furthermore, the National Epidemiological Surveillance System does not consider listeriosis as a mandatory notification disease, making it difficult to establish relationships between the presence of the bacteria in food and cases of disease. Even so, the microbiological quality of ham and sausage has already been questioned by the presence of aerobic mesophilic organisms, as well as of pathogenic microorganisms (Salmonella, Staphylococcus aureus)(12). Despite this, there has been no research aimed at establishing the origin of the microbiological contamination of these foods. 849

Rev Mex Cienc Pecu 2020;11(3):848-858

In order to guarantee the safety of cold cuts and sausages, the production process adheres to good hygienic practices and to the analysis of dangers and critical control points (4). In spite of this, poor hygienic handling of these foods in retail stores has been associated as the cause of most reported epidemiological outbreaks(5). Several brands of cold cuts and sausages are available in Mexico, which can be sold in bulk or in their original package. In particular, the Mexican consumers’ habit of acquiring cold cuts and sausages in bulk is a worrying aspect, given that it involves handling the food at the point of sale, and violating the brand's quality guarantee. Consequently, the population most affected is the one that seeks to save resources through this practice, and, in addition, does not go to see a doctor in case of contracting an FBD. Therefore, the aim of this study was to generate information on the influence of the type of sale on health quality (Salmonella, Escherichia coli, coliforms)(9,13) and the prevalence of L. monocytogenes in cold cuts and sausages traded in the state of Sinaloa, Mexico.

Material and methods Samples collection

An intentional sampling was carried out in order to assess the influence of two sales strategies (bulk and package) on cold cuts and sausages. The samples were selected according to the main brands of national distribution and the most popular among consumers. The selected points of sale (markets and supermarkets) were conditioned by the availability of the selected brands, as well as by offering the two types of sale of the product. A total of 96 samples of turkey cold cuts and sausages consisting of sausages (n= 48) and ham (n= 48) were collected from 15 different national brands (AP) and from 13 points of sale in Culiacan, Mexico, during the second half of 2017, samples of cold cuts and sausages were collected and classified equally by type of sale; original package (n= 48) and bulk (n= 48). The purchase of the “original package” samples was defined as the acquisition of the complete and closed unit of the product. Whereas, the purchase in "bulk" involved the manual handling of the sausage by the seller, the slicing or mechanical cutting, and the subsequent placement of the product in plastic bags provided by the retail service. The food storage temperature was observed to be 5 ± 2 °C, according to the digital readers of the refrigeration equipment at the points of sale. The samples were stored in a refrigerated box during transportation to the laboratory for microbiological analysis during a period of <4 h after collection. The outer surface of the original packaging and the plastic bags provided during the bulk sale were disinfected with alcohol (70%) prior to microbiological analysis. 850

Rev Mex Cienc Pecu 2020;11(3):848-858

Quantification of Escherichia coli and total coliforms Quantification of E. coli and total coliforms was performed on 3M™ Petrifilm™ plates according to the supplier's instructions. The quantification of each microorganism was performed according to the typical colonial morphology observed. Microbial concentrations were expressed as CFU/g, and were compared with the microbiological limit reported in NOM-213-SSA1-2002(13).

Isolation of Salmonella

For the isolation of Salmonella in the samples of cold cuts and sausages, the protocol described in the Bacteriological Analytical Manual(14) was followed. The Salmonella isolates were confirmed by amplifying a 244 bp fragment of the invA gene by PCR(15).

Isolation of L. monocytogenes

L. monocytogenes was isolated by the protocol described by the USDA-FSIS(16). Presumptive Listeria isolates were confirmed with the Microgen Listeria-ID system (Microgen LABTM). Further confirmation of L. monocytogenes isolates was performed using the polymerase chain reaction (PCR) method by amplifying a 234 bp fragment of the Listeriolysin-O gene(17). L. monocytogenes ATCC 7644 was included as a positive control.

Statistical analysis

IBM® SPSS software was used for the statistical analysis of the results. A non-parametric Pearson χ2 test was performed to determine the association of the type of sale with the microbiological quality of the sausage. The risk analysis was performed by calculating the odds ratio. A value of P <0.05 was considered statistically significant.

851

Rev Mex Cienc Pecu 2020;11(3):848-858

Results Table 1 shows the microbiological quality of the samples of cold cuts and sausages according to the type of sale and sausage. In general, 42.7 % (41/96) of the sausage samples included in the bulk (69.0 %) and package (17.0 %) category were outside the sanitary specification (<3 MPN/g) (9.13), since the values of quantification for E. coli and total coliforms were in the range of 10 to 2,860 CFU/g. The incidence rate of samples of sausage and ham that did not meet the health specification ranged from 29.2 % (14/38) to 56.3 % (27/48), respectively. Salmonella was not detected in any of the samples analyzed. Additionally, 6.3 % (6/96) of the samples were positive for L. monocytogenes; bulk (8.3 %) vs package (4.2 %). It should be noted that 60.0% (9/15) of the national brands are outside the sanitary specification(9,13), and four of these brands (26.6 %) were positive for L. monocytogenes. Table 1. Microbiological quality of samples of cold cuts and sausages sold in package and in bulk in Mexico Detection (%) of microorganisms Microbiological Package Bulk Total criterion * Sausage Ham Sausage Ham (n=96) (n=24) (n=24) (n=24) (n=24) Coliforms 8.3 4.2 45.8 91.7 37.5 E. coli 4.2 0 4.2 12.5 5.2 Salmonella 0 0 0 0 0 L. monocytogenes 4.2 4.2 4.2 12.5 6.3 Rejected** 12.0 21.0 46.0 92.0 42.7 Accepted 88.0 79.0 54.0 8.0 57.3 *The presence of coliforms and E. coli was based on the sanitary limit (<3 NMP/g for fecal coliforms) for cooked foods defined by NOM-213-SSA1-2002. **The samples classified as rejected contained at least one microorganism.

The microbiological quality profiles highlight that the type of sale is an indicator of the assurance of the safety of most brands of cold cuts and sausages (Ď&#x2021;2 = 40.0, P= 0.000) (Figure 1) in terms of coliforms, the bulk sale being a microbiological risk factor, mainly in ham. The type of sale did not influence the presence of L. monocytogenes and E. coli (P<0.05) in the samples of cold cuts and sausages. The risk analysis (odd ratio) determined that the sale in bulk increases 11 times the risk of acquiring a non-innocuous sausage, compared to the sale of the product in its original package. Likewise, the risk analysis by type of sausage shows that selling in bulk increases 41.8 and 5.9 times the risk of acquiring ham and sausages of poor microbiological quality, respectively (Table 2). No significance was observed between the risk of obtaining bulk or package products contaminated with L. monocytogenes; however, this risk may increase by 1-3 times if bulk purchase is chosen. 852

Rev Mex Cienc Pecu 2020;11(3):848-858

Figure 1: Classification of microbiological quality profiles of samples of ham (a) and sausages (b) collected from retail services in Mexico, by national brand

The letters A-O refer to national brands, and the number of samples per brand is in parentheses. The variability of the number of samples per category depended on the availability of the sample.

Table 2: Estimation of the risk of acquiring non-innocuous cold cuts and sausages for sale in bulk in Mexico Category Total coliforms and E. coli L. monocytogenes Odd ratio Significance Odd ratio Significance (IC 95%) P (IC 95%) P Cold cuts 11.0 0.0001 2.1 0.4079 (4.15 – 29.13) (0.36 – 11.99) Ham 41.8 0.0001 3.3 0.9970 (7.26 – 240.78) (0.32 – 34.08) Sausage 5.9 0.0163 1.0 1.0000 (1.39 – 25.30) (0.06 – 16.97)

Discussion The microbiological quality profiles revealed that most of the brands sold in Culiacan, Sinaloa did not meet the sanitary specifications required for their consumption(9). This indicates the poor hygienic conditions in which some cold cuts and sausages are processed (marks A, B, C, H), and the influence of the integrity of the original packaging during the sale on the microbiological quality. Although primary contamination of cold cuts and

853

Rev Mex Cienc Pecu 2020;11(3):848-858

sausages may occur(18), their subsequent handling in establishments and at home can increase the pathogenic microbial load(4-5). In this regard, the violation of the original packaging, the manual handling by the seller, the slicing and cutting, and the use of non-sanitary packaging for the bulk sale of cold cuts and sausages are attributes observed in the study and are pointed out as factors of microbial contamination of food(5). The detection of L. monocytogenes and the count of coliforms and E. coli in cold cuts and sausages are indicators of the risk of the development of listeriosis and gastroenteritis, since these foods can be consumed without heat treatment prior to their intake. It is important to highlight that these brands are distributed nationally, and that the habit of buying in bulk is a common practice carried out by the Mexican population, which exhibits a potential public health problem. An equal risk of contamination with L. monocytogenes has been observed regardless of whether the cold cuts and sausages are acquired in bulk or in packaging; this defines the pathogen as a potential contamination hazard at any stage of the food chain. Kurpas et al(4) agree that the final contamination of meat products by L. monocytogenes occurs at both the processing plant and the point of sale. This is due to the growth characteristics, propagation pathways and reservoirs of L. monocytogenes, as well as to the poor hygiene of the handler, since this bacterium is persistent in conditions related to food processing(4). Food contamination with L. monocytogenes is one of the most important challenges faced by the meat industry, due to the bacterium's ability to multiply during refrigerated food storage, and to the fact that a contaminated food may be consumed without additional cooking(19). Many studies have reported the presence of L. monocytogenes in cooked, raw, cured, salted cold cuts and sausages, among others(18,20). Other food safety concerns with regard to L. monocytogenes are virulence(21) and antibiotic resistance(22), both of which are important factors in the severity of listeriosis and the persistence of the pathogen in the processing environment. These phenotypic attributes have also been previously reported in L. monocytogenes strains recovered from certain foods in Mexico(10,11). Attention should be paid to the detection of L. monocytogenes in cold cuts and sausages sold in Mexico, since the clinical and epidemiological importance of listeriosis in the Mexican population has been previously documented, highlighting the high mortality rate and the severity of clinical manifestations(23). Listeriosis can be present in the form of sepsis, meningitis, endocarditis, miscarriage, localized infections and gastroenteritis(24). Additionally, CastaĂąeda et al(25) have established the clonal relationship of a strain of L. monocytogenes isolated from chicken meat as a potential etiological agent of listeriosis in Mexico. Since L. monocytogenes is considered a pathogen responsible for ATS(7), the 854

Rev Mex Cienc Pecu 2020;11(3):848-858

prevention and intentional control of the pathogen in the food chain is a guideline for minimizing infection by this bacterium. Since the sale in bulk is an indicator of high microbiological risk of cold cuts and sausages sold in retail stores, attention must be paid to this habit of buying by Mexican consumers, and actions should be designed to help minimize the risk of infection. The high risk of acquiring non-innocuous cold cuts or sausages due to purchase in bulk denotes the continuous exposure of consumers to microbiological hazards, and proposes this fact as a potential cause of the cases of intestinal infections (5,771,681) and food poisoning (38,815) reported annually in Mexico, and whose classification is not defined(26). The fulfillment of the regulatory provisions in the sale of these products, and the application of the protocols of good hygienic practices guarantee the safe sale to the consumers(4,9,13). Some studies suggest that sausages must be sold in their original packaging to maintain their production guarantee(4). Additionally, consumer education on safety issues is an important action for teaching the proper handling of food and minimizing the risk of FBD(27).

Conclusions and implications The high level of microbial contamination and the detection of L. monocytogenes in cold cuts and sausages of different national brands commercialized in bulk or package, is a common indicator of the lack of good hygiene practices in the food chain, and a high risk of acquiring FBD, since they are ready-to-eat products and are distributed throughout the country. For this reason, it is imperative to call the attention of the Mexican authorities to demand the monitoring of L. monocytogenes in cold cuts and sausages, as well as to implement microbial control strategies in the formulation and sale. Finally, consumers are encouraged to choose products in their original packaging to maintain food safety and brand assurance.

Acknowledgements This work was supported by a grant from the PROFAPI2014 / 043 Research Projects Promotion and Support Program of the Autonomous University of Sinaloa (Universidad Autรณnoma de Sinaloa).

855

Rev Mex Cienc Pecu 2020;11(3):848-858

Conflict of interests The authors declare that they have no conflicts of interest, financial or otherwise.

Literature cited: 1. COMECARNE. Consejo Mexicano de Carne. Compendio Estadístico 2018. México. 2018. https://comecarne.org/estadisticas/. Consultado 19 Sep, 2018. 2. Olaoye OA. Meat: An overview of its composition, biochemical changes and associated microbial agents. Int Food Res J 2011;18(3):877-885. 3. USDA-FSIS. United States Department of Agriculture Food Safety and Inspection Service. Recall Case Archive. http://www.fsis.usda.gov/wps/portal/fsis/topics/recallsand-public-health-alerts/recall-case-archive. Accessed Sep 19, 2018. 4. Kurpas M, Wieczorek K, Osek J. Ready-to-eat meat products as a source of Listeria monocytogenes. J Vet Res 2018;61(1):49-55. 5. Endrikat S, Gallagher D, Pouillot R, Quesenberry HH, Labarre D, Schroeder CM, Kause J. A Comparative risk assessment for Listeria monocytogenes in prepackaged versus retail-sliced deli meat. J Food Prot 2010;73(4):612–619. 6. Leonge D, Alvarez-Ordoñez A, Jooste P, Jordan K. Listeria monocytogenes in food: Control by monitoring the food processing environment. Afr J Microbiol Res 2016;10:101–114. 7. Scallan E, Griffin P, Angulo F, Tauxe R, Widdowson M, Roy S, Jones J, Griffin P. Foodborne illness acquired in the United States. Emer Infect Dis 2011;17:7–15. 8. Ivanek R, Grohn YT, Tauer LW. The cost and benefit of Listeria monocytogenes food safety measures. Crit Rev Food Sci Nutr 2004;44:513–523. 9. SSA. Secretaría de Salud Proyecto de Norma Oficial Mexicana, Productos y servicios. Productos cárnicos procesados y los establecimientos dedicados a su proceso. Disposiciones y especificaciones sanitarias. Métodos de prueba. PROY-NOM-213SSA1-2017. México. 2017. 10. Castañeda GM, Castro N, León J, Valdez JB, Guzmán JR, Luchansky JB, Porto-Fett ACS, Shoyer AB, Chaidez C. Prevalence, levels, and relatedness of Listeria monocytogenes isolated from raw and ready-to-eat foods at retail markets in Culiacan, Sinaloa, México. J Microbiol Res 2013;3(2):92–98. 856

Rev Mex Cienc Pecu 2020;11(3):848-858

11. Silva LE, Pérez C, Barreras A, Figueroa F. Identification of Listeria sp. in hams and frankfurters products exhibited for sale. J Anim Vet Adv 2007;6(3):314–316. 12. Sarti E, Parrilla MC, Saldate O. Calidad sanitaria del jamón que se consume en la ciudad de México. Salud Públ Méx 1989;31(3):326-333. 13. SSA. Secretaría de Salud. Productos y Servicios. Productos cárnicos procesados. Especificaciones sanitarias. Métodos de prueba. NOM-213-SSA1-2002. México. 2005. 14. BAM. Bacteriological Analytical Manual. Chapter 5: Salmonella. Bacteriological Analytical Method. USA. 2018. https://www.fda.gov/food/laboratory-methodsfood/bacteriological-analytical-manual-bam-chapter-5-salmonella. Accessed Sep 19, 2017. 15. Chiu C, Ou J. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol 1996;34(10):2619–2622. 16. United States Department of Agriculture-Food Safety and Inspection Services (USDAFSIS). 2017. MLG8: Isolation and identification of Listeria monocytogenes from red meat, poultry, egg and environmental samples. http://www.fsis.usda.gov/wps/wcm/connect/1710bee8-76b9-4e6c-92fcfdc290dbfa92/MLG-8.pdf?MOD=AJPERES. Accessed Sep 19, 2017. 17. Furrer B, Candrian U, Hoefelein C, Luethy J. Detection and identification of Listeria monocytogenes in cooked sausage products and in milk by in vitro amplification of haemolysin gene fragments. J Appl Bacteriol 1991;70(5):372-379. 18. Syne S, Ramsubhag A, Adesiyun A. Microbiological hazard analysis of ready-to-eat meats processed at a food plant in Trinidad, West Indies. Infect Ecol Epidemiol 2013;3(1):1–12. 19. Sofos JN. Challenges to meat safety in the 21st century. Meat Sci 2008;78(1-2):3–13. 20. Gómez D, Iguácel LP, Rota MC, Carramiñana JJ, Ariño A, Yangüela J. Occurrence of Listeria monocytogenes in ready-to-eat meat products and meat processing plants in Spain. Foods 2015;4(3):271–282. 21. Khan JA, Rathore RS, Khan S, Ahmad I. In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method. Braz J Microbiol 2013;44(3):751–758. 22. Lungu BC, O’bryan A, Muthaiyan A, Milillo SR, Johnson MG, Crandall PG, Ricke SC. Listeria monocytogenes: Antibiotic resistance in food production. Foodborne Pathog Dis 2011;8(5):569–578. 857

Rev Mex Cienc Pecu 2020;11(3):848-858

23. Castañeda-Ruelas G, Eslava C, Castro N, León J, Chaidez C. Listeriosis en México: importancia clínica y epidemiológica. Salud Públ Méx 2014;56(6):654–659. 24. Doganay M. Listeriosis: clinical presentation. FEMS Immunol Med Microbiol 2003;35(3):173-175. 25. Castañeda-Ruelas G, Eslava C, Castro N, León J, Chaidez C. Listeria monocytogenes y Listeriosis, problema de salud pública en México. Salud Públ Méx 2018;60(4):376–377. 26. DGE. Dirección General de Epidemiología. Distribución de casos nuevos de enfemedad por fuente de notificación Estados Unidos Mexicanos 2017. http://www.epidemiologia.salud.gob.mx/anuario/2017/morbilidad/nacional/distribucio n_casos_nuevos_enfermedad_fuente_notificacion.pdf. Consultado 29 Ene, 2019. 27. Nesbitt A, Thomas MK, Marshall B, Snedeker K, Meleta K, Watson B, Bienefeld M. Baseline for consumer food safety knowledge and behaviour in Canada. Food Control 2014;(38):157-173.

858

https://doi.org/10.22319/rmcp.v11i3.5372 Review

Genome-wide association studies in sheep from Latin America. Review

Karen Melissa Cardona Tobara * Diana Carolina López Álvarez a Luz Ángela Álvarez Franco a

Universidad Nacional de Colombia. Sede Palmira. Facultad de Ciencias Agropecuarias, Maestría en Ciencias Agrarias, Énfasis Producción Animal Tropical. Colombia. Grupo de Investigación en Recursos Zoogenéticos.

*Corresponding author: kmcardonat@unal.edu.co

Abstract: Sheep are one of the most important domestic species worldwide due to their productive and reproductive potential. Therefore, identifying the best animals with productive characteristics of economic interest is the main goal in flock breeding programs. However, in most of Latin American countries, animal selection is inefficient due to subjective selection and the complex nature of these characteristics; given their quantitative nature, their expression involves the interaction of multiple genes with the environment. Currently, due to the advances in new sequencing, genotyping, and genome-wide association studies (GWAS) technologies, it has been possible to identify numerous variations in the DNA of animals, mainly single nucleotide polymorphisms (SNP) that can be found in genes that affect the expression of traits of economic interest. This review presents the progress in implementing genome-wide association studies (GWAS) in Latin America, their use in sheep production systems, and the results obtained in productive, reproductive, functional, or quality traits. Key words: Candidate genes, GWAS, Breeding, Phenotypic traits, Genotypic traits, SNP.

859

Rev Mex Cienc Pecu 2020;11(3):859-883

Received: 09/05/2019 Accepted:18/09/2019

Introduction Sheep are one of the most distributed species worldwide; they live in every climate and ecosystem(1). In Latin America, there is an estimated population of 80 million heads, most in countries like Brazil, Argentina, Peru, Bolivia, Mexico, and Uruguay(2), making their breeding an activity of great economic and food impact in indigenous communities and small farmers(3). In these regions, systems are characterized by using creole ecotypes and traditional handling, which makes them less competitive against Asian and European countries, profiled as the main meat, milk, and wool producers(4,5). Currently, one of the main goals to improve flock production in Latin America is to identify and genetically improve superior animals for economically important traits; it has been recognized that one of the alternatives to increase flock productivity, through selection, is the use of biotechnological tools that combine traditional breeding techniques with molecular information(6). These tools involve DNA sequencing technologies, which allow identifying a considerable amount of animal genetic markers, especially single nucleotide polymorphisms (SNP), which can affect important productive traits(7,8). Therefore, genomics has begun to impact the genetic study of production animals through methodologies such as genome-wide association studies (GWAS), which use the information from thousands of SNP distributed throughout the entire genome and from the estimation of their effects to select and identify regions or loci involved in the variation of quantitative traits (QTL)(9). These markers are used to define candidate genes where those nucleotides that influence phenotypic variation (QTN) are located and discover the molecular mechanisms that direct the expression of complex traits in domestic species(10,11). In sheep, GWAS have mainly focused on the study of productive and some phenotypic traits, such as coat color, presence or absence of horns, among others(9).

860

Rev Mex Cienc Pecu 2020;11(3):859-883

Current state of sheep in Latin America

The importance of sheep as a domestic species lies in their high productive and reproductive potential, since in addition to using ecosystems that are not useful for other species, a greater number of animals can be bred per unit area, they have a short generation interval, high prolificity, high growth rates, and good feed efficiency; they are excellent weed controllers, and added value can be obtained from dairy and meat products(12-14). As with other economically important species, sheep result from the domestication of wild species, the majority coming from the Middle East in the so-called Fertile Crescent of Asia(15,16). Due to evolution and human selection, there is a great variety of breeds worldwide with traits and aptitudes for different types of production(17). The racial base of wool and hair sheep in Latin America is composed mainly of genotypes brought during the colonization era, which were bred without any reproductive order more than 500 years ago; this situation produced a miscegenation that lasted for centuries and that gave rise to a variety of sheep adapted to different ecosystems and the special conditions in each region, called creole(16,18,19). In Latin America, most of the sheep population is creole, except for Argentina, Chile, and Uruguay whose population is mainly composed of improved animals imported from Australia and Europe. Creole sheep constitute an important zoogenetic resource for Latin America because they are animals adapted to the tropical environment, prolific, and easy to handle; additionally, they play an important social and economic role, as they guarantee food security and economic income to marginalized and extremely poor populations(13,14,18). In recent years, the sheep population in Latin America has been fluctuating, going from having, together with Oceania and Europe, more than 60 % of the population in the 80s and 90s to currently having less than 30 %(20,21). The population of Latin America participates with 6.4 % of the total population in America, with the highest number of animals in Brazil, Argentina, Peru, Bolivia, Mexico, and Uruguay (Table 1)(2). The decrease in this type of sheep is mainly due to the lack of information about these animals and the fact that producers have limited themselves to using foreign breeds for absorbent crosses, under the assumption that the productive performance of these cattle is better, which has threatened the genetic wealth of these sheep, endangering their conservation(22,23).

861

Rev Mex Cienc Pecu 2020;11(3):859-883

Table 1: Sheep heads in Latin America (2014-2019) Country Sheep population Brazil 17’976,367 Argentina 14’866,000 Peru 12’415,395 Bolivia 9’499,147 Mexico 8’575,908 Uruguay 6’567,000 Cuba 2’173,400 Chile 2’037,516 Colombia 1’578,684 Ecuador 739,475 Guatemala 692,900 Venezuela 550,000 Dominican Republic 123,000 Costa Rica 35,800 Panama 18,665 Honduras 16,000 Nicaragua 13,800 El Salvador 11,493 Puerto Rico 10,759 Adapted from(2, 21).

In Latin America, sheep production systems generally develop with wool and hair animals, obtaining from the first milk and its derivatives, wool, and artisan products, and from the second meat products and female breeding stock, some producers are engaged in both activities(24,25). The main meat producing countries in Latin America are: Brazil with 21.13 %, Mexico with 14.26 %, and Argentina with 12.05 %; while the main wool producing countries are: Argentina (30.59 %) and Uruguay (24.47 %). Moreover, in America, sheep milk production represents only 0.9 % of the world total. FAO reported for 2017 the following production data: 57,754 t for Mexico, 35,000 t for Bolivia, and 4,300 t for Ecuador(26). There are different production systems with specific characteristics, highlighting mainly the intensive, extensive, and semi-extensive systems; the intensive system is characterized by the use of advanced technologies and improved breeds such as Texel, Ile de France, Suffolk, Hampshire, and Dorper in Brazil; Merino, Corriedale, Rommey Marsh, Lincoln, Frisona, Manchega, and Pampinta in Argentina; Black Belly, Charollais, Dorper, Dorset, East Friesian, Katahdin, Cubano Pelibuey, Rambouillet, Romanov, Saint Croix, Damara, and Texel in México, among others; in the intensive system, the productive and reproductive indices are better than in the extensive and semi-extensive systems(27). The extensive system 862

Rev Mex Cienc Pecu 2020;11(3):859-883

is characterized by the use of creole animals or their crosses with improved breeds, located in large areas of land, generally with low agricultural capacity and few handling practices(3). Finally, semi-extensive systems possess characteristics from the intensive and extensive systems; animals graze and are also fed with forage, alternate protein concentrates or banks; in this system, animals are generally bred for dual purposes, for meat and milk production or meat and wool production, the productive parameters are better than those from the extensive system(12). The main creole ecotypes used in semi-extensive and extensive systems in Latin America are: Morada nova and Santa InĂŠs in Brazil(28-30), Pantaneira in Argentina and Brazil, Junin, Piura, Criollo de la Sierra and Criollo de Arequipa in Peru(31), Pelibuey in Cuba and MĂŠxico(32,33), EtĂope and Sudan in Colombia(34-36), Ovino Criollo Uruguayo in Uruguay(37), Ovino Criollo Araucano in Chile(38), among others.

Genome-wide association studies GWAS and their use in sheep

GWAS are a relatively new technology in sheep; they were initially used in human medicine and genomics as a tool to characterize and find variants associated with pathologies or predisposing to their development(39); also applied to know existing gene interactions, their modification and to detect high-risk haplotypes or combinations of multiple SNP within a single gene(40). Due to the popularity of these studies in humans, their use expanded to animal medicine and production(41), where they are a useful tool to identify genes or genomic regions responsible for the genetic variations in the most important productive traits(10,19,40,42). In sheep, GWAS have quickly evolved in domestic and wild ecotypes due to the collaboration and benefits of projects led in recent years by institutions such as the International Sheep Genomics Consortium (ISGC, http://www.sheephapmap.org), the European Bioinformatics Institute (EBI ), and the Baylor College of Medicine Human Genome Sequencing Center, who sequenced the genome of the domestic (Ovis aries), wild (Ovis aries musimon), and some economically important breeds such as Rambouillet(43). Currently, this information is in public databases such as NCBI, ENSEMBL, and UCS, and different versions of the domestic sheep genome can be found, Ovis_aries_1.0 (2010), Oar_v3.1 (2012), and Oar_v4.0 (2015); these data have made it easier for the scientific community to popularize the use of GWAS in different fields(44). The use of this technique in sheep has also been possible due to the development of large collections or panels of molecular markers known as microarrays or DNA chips, which allow to identify and explore the genome in search of polymorphic regions or markers associated with traits of productive interest(10,45). Overall, the polymorphisms included in these panels are the SNP, since they represent the highest genetic variation in an individual, they are the 863

Rev Mex Cienc Pecu 2020;11(3):859-883

most common in the genome, and can be located in different areas of the genome: both in regions that preside over RNA codification and replication control, such as promoters, microRNA target zones, and protein-coding regions; they also have a low mutation rate, low levels of homoplasy, and are easy to genotype(7,46-49). Commercial houses like Illumina and Affymetrix, together with the Sheep Genomics Consortium, and other entities around the world have developed genotyping matrices with different types of coverage within the genome. Illumina features: Ovine Infinium® HD SNP BeadChip, Ovine SNP50 BeadChip, OvineLD BeadChip with probes directed to 606.000, 54.241, and 15.000 SNP and high, medium, and low coverage, respectively. Affymetrix features the Axiom™ Ovine Genotyping Array with medium density and coverage of 54.236 SNP(50). Currently, the most used chip in sheep is the OvineSNP50, which was designed with more than 3.000 samples from 75 breeds of domestic sheep (Ovis aries) and wild species such as mouflons (Ovis aries musimon), North American bighorn sheep (Ovis canadensis), thinhorn sheep (Ovis dalli), Asiatic urials (Ovis vignei), and argali (Ovis ammon)(19,51-53). With this chip, 12 samples can be simultaneously analyzed in a micro-matrix with the 54.241 probes; each matrix is of medium density because the average distance between each SNP in the genome is 50.9 kb(54). The first GWAS in sheep aimed to identify the genetic structure of the polymorphisms associated to the presence or absence, and type of horns in wild sheep phenotypes; these studies found that by analyzing the genome with 36.000 SNP, the main candidate gene for the horn trait was RXFP2, an autosomal gene with a known implication in determining the primary sexual characteristics in humans and mice(43). Moreover, Zhao et al(55) performed a GWAS to search for causal mutations in the genome of Corriedale sheep with rickets and found that the R145X mutation in the DMP1 gene was responsible for the appearance and inheritance of this pathology. Other studies have been performed to elucidate the phylogenetic structure of sheep populations and the result of centuries of evolution, Kijas et al(53) found the relationship, in terms of divergence times, between 74 breeds of sheep estimated from the haplotype exchange(44). In 2012, they identified 31 genomic regions that contain genes for coat pigmentation, skeletal morphology, body size, growth, and reproduction(53). Nanekarani et al(56) reported that the Calpastatin (CAST) and Callipyge (CLPG) genes were associated with meat quality traits; for example, animals that express the Callipyge gene have higher percentages of muscle deposition, a greater loin eye area, and leaner meat. Guðmundsdóttir(42) found 13 candidate genes for muscle formation in Icelandic sheep: SF3R, ADAM17, GADD45B, GRID2, SPG11, DAB2, FREM3, GAB1, KLF13, AKAP6, PNN, DOCK1, TRRAP, and GADD45B.

864

Rev Mex Cienc Pecu 2020;11(3):859-883

Other authors(57) focused on the functional mechanisms that regulate the production of glucocorticoids induced by stress and their effect on the health of sheep; their study consisted in identifying key genetic aspects that influence the cortisol response to a bacterial endotoxininduced stress model (BEIS)(57). Results showed that 16 SNP were significantly associated with the cortisol levels; these SNP were located near important genes like CD14, ITGAM, ITGAL, and SNX2. Aali et al(58) studied the relationship between the polymorphisms in exon 6, the intronic limits of the CAST gene, and the fatty acid profiles, the physicochemical composition, and the quality characteristics of the muscle Longissimus dorsi (LD); they found that the selection of lambs with the “I” genotypes, the CAST-10 haplotype, the “AA” genotype of SNP G62A, and the “GT” genotype of SNP G65T results in a greater proportion of healthy fatty acids and more tender meat(58). Other researchers(59) studied the body size of Frizarta dairy sheep and found evidence about the influence of 39 genes on this trait, including some previously described in other studies and some new ones such as TP53, NTN1, and ZNF521. In France, they analyzed the structure of a population of 547 sheep and found selection markers such as ABCG2, LCORL NCAPG, MSTN, and genes involved in coat pigmentation (ASIP, MC1R, MITF, TYRP1, EDN3, and BNC2), height and morphology (NPR2, MSTN (GDF-8), LCORL, NCAPG, ALX4, and EXT2), milk production (ABCG2), horns (RXFP2), and wool (IRF2BP2)(60).

GWAS in sheep in Latin America

In Latin America, traditional breeding techniques are still the most widely used in most species; these are based on the identification and selection of superior individuals based on the phenotypic expression of the traits of productive interest(61); the results from these techniques allow to characterize and categorize animals from the estimation of population genetic parameters such as heritability (h2), genetic correlations, variances (σ2), and covariances(46). From these data, it is possible to identify and evaluate the polymorphisms of the gene sequences that may have effects on productive traits and thus carry out evaluations in which molecular information is incorporated into the evaluation models of productive data, generating as a result more precise genetic parameters(8). Therefore, the trend in some countries is to use tools such as GWAS that combine the use of genomic and genealogical information, production records (detailed information on the activities performed in production systems), and phenotypic traits (any detectable trait of an organism (structural, biochemical, physiological, or behavioral, determined by an interaction between its genotype and its environment) to improve the estimation of genetic values for complex traits, such as

865

Rev Mex Cienc Pecu 2020;11(3):859-883

growth, prolificity, meat quality, among others(7). The reports of GWAS in sheep are few compared to the ones performed in cattle and pigs, finding that most of the studies in sheep correspond to Brazil(29,30,62), Colombia(23,34,63), Chile(38,64), and Uruguay(65). These studies have focused on finding genes related to growth, an important trait associated with meat production, which has an economic impact on the producer and the industry. In Colombia, they studied the genetic variability of 23 SNP from creole sheep and found that 21 were located in genes with known functions and two in proteins not yet characterized; these and their different loci are related to the immune system and growth (muscle and bone formation)(66) (Table 3). Moreover, the genome of a population of creole Camuros genotyped with the OvineSNP50 BeadChip was evaluated to establish the relationship between the genetic component and the tenderness of the meat from the Longissimus dorsi muscle(63), finding a significant effect of three SNP located in the OAR3, OAR4, and OAR9 chromosomes; the OAR3_130491628.1 SNP, whit a [C/T] nucleotide change, is associated with an exonic portion of the MGAT4C gene, which has been mapped in the q arm of the chromosome, close to the DCN (Decorin) gene responsible for collagen degradation postmortem. The OAR4_118954127.1 SNP, whit a [A/G] nucleotide change, is not associated with any specific locus, but the s43296.1 SNP, in the chromosome 9 and with a [A/G] nucleotide change, was found associated with a locus not yet characterized. A different GWAS associated the muscular growth and carcass quality traits in Colombian, Ethiopian, Sudan, and Pelibuey hair sheep in the Cesar, Cรณrdoba, and Valle del Cauca departments, finding eight candidate genes (SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1, and PIAS2; Table 2) related to cellular growth, apoptosis, and angiogenesis; additionally, this association allowed to identify differences between the breed varieties despite that in Colombia, the Ethiopian and Sudan sheep are not yet recognized as breeds(34). Lenis found polymorphisms in the SNP of the CAPN, CAST, LEP, GH, and IGF1 loci (Table 2), as well as a significant association between the CAST gene and the PN trait in creole sheep absorbed by Pelibuey. A study similar to the previous ones, but in Uruguay, reported SNP located within genes associated with growth, meat and carcass quality PPARGC1A, DGAT1, CAST, GHR, GHRHR(67)(Table 2).

866

Rev Mex Cienc Pecu 2020;11(3):859-883

Table 2: Genes reported by some Latin American authors for economically important traits Gene Trait Author Country CYP11A1, CYP1A1, CYP19, SFXN1 B2M, SFXN1, IL25, BMP4, TSHR, CCL28, PIK3R1, FGF10, IL15, IL2, TP-1, BPMG, BCL10, HSPD1, MALT1 ADAM10, IL6ST, TNFRF13B, SIVA1, JUN, PAX1, PIK3R1, SIT1, AKT1 SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1, PIAS2 NPAS2, MRPS30, TPH2, TRHDE, CDH12, PARP14, DGAT2, WNT11 COPB2, DGAT2, ALCAM, PARP14, TPH2, TRHDE, FOXO3, OSTM1, TPH2, TRHDE, TNFAIP8, UBE3D, ME1, PLCXD3, C6, C7, CCDC88C, FBLN5, CACNA1C DGAT2, TRHDE, TPH2, ME1, C6, C7, UBE3D, PARP14, and MRPS30 GDF9, BMPR1-B, BMP15 TNNT2, HTRA3 CARTPT, PIK3R1, GHR MSX1, DRD5, SLCO4C1, OOEP, GATA6, CUL4A, ZFAND5, OPEP, PAGS LDHA, MYC, BHLH, MDFIC, MSTN

Transport and construction of iron molecules, indicator of anemia.

Immune response and defense of the body

Berton 2017

al., Brazil

T cell differentiation

Growth and carcass quality

Palacios, 2018

Colombia

Saturated fatty acid profile

Monounsaturated fatty acid profile

Rovadoscki, 2017 Brazil

Polyunsaturated fatty acid profile

Fat composition Prolificity Adult weight Maternal ability

Rovadoscki et al., Brazil 2018 Lacerda, 2016 Brazil

Maternal metabolic efficiency Amorim et al., 2018

Twinning

Adult metabolic weight

867

Brazil

Rev Mex Cienc Pecu 2020;11(3):859-883

AOX1, LTBP1, PAK1, THRSP ADAMTS12, AMHR2, AQP3, ARHGAP24, C6, C9, COL1A1, COPS7B, DAB2, DROSHA, FGR, FYB, GDNF, GOLPH3, GPR158, GPR65, IL1RL1, KR8, MACROD2, MAPKAP1, MSRB3, NIPBL, PIK3CB, PLCB1, SKAP2, SMAD6, SNX27, SPEF2, TRPM8 CNTNAP2, FUT9, GDNF, ISPD, LIFR, MACROD2, MAPKAP1, NIPBL, CPLPP.P COL1A1, NIPBL, PDE6D, and TRPM8 AMHR2, KRT8, NIPBL, PLAG1, PLCB1, RXFP2, SP1, SPAG6, and SPEF2 CAPN, CAST, LEP, GH, and IGF-1 UBE2N, SOCS2, LAMC1, EPS15, ATP2B1, LRP8, GALNT4, MUC15 CAST, GHR, DGAT1, SERPINA3, GHRHR, HSPB1, DGAT2, SCAP, SCD5, ITGB1,

Body condition score

Immunity

Simoni Gouveia Brazil et al., 2017

Nervous system development

Sensory perception

Reproduction

Lenis, 2019

Growth

Colombia

Benavides et al., Brazil 2015

Immunity

Carcass quality, growth, and meat quality

Armstrong et al., 2018

Uruguay

In Brazil, main sheep meat producer in Latin America, studies have focused in improving the nutritional aspects of the final product, such as the fatty acid profile and the meat quality; therefore, Rovadoscky(29), by analyzing genotypic and phenotypic information of Santa Inés sheep found 28 candidate genes associated with the mentioned traits, of which only the DGAT2 and TRHDE genes are annotated and related to the fatty acid profile (Table 2). Rovadoscki and other researchers studied the genetic architecture of the composition of fatty acids in the Longissimus dorsi muscle in Santa Inés sheep, finding genetic variation for the evaluated traits; therefore, it is possible to alter the fatty acid profiles through selection (30). From the GWAS they obtained ten SNP associated with 27 genomic regions that influence the composition of fatty acids, these were located on the 1, 2, 3, 5, 8, 12, 14, 15, 16, 17, and 868

Rev Mex Cienc Pecu 2020;11(3):859-883

18 chromosomes; these regions correspond to 23 genes, among which are DGAT2, TRHDE, TPH2, ME1, C6, C7, UBE3D, PARP14, and MRPS30 (Table 2). Another characteristic of economic importance studied in Latin America is prolificity. In Chile, researchers studied the size of the litter through the BMP15 and GDF9 genes in the Araucana creole sheep, one of the most important zoogenetic resources for farmers in the Mapuche ethnic group. For the GDF9 gene they found eight SNP, seven previously documented for this gene and a new one, called FecGA; of the SNP, c.978A and c.994G are fertility genetic markers in Araucana creole sheep(38). The polymorphisms of the BMPR1B, BMP15, and GDF9 genes were previously studied in three creole sheep breeds; Chilota, Araucana, and Austral; the FecG1 allele was associated with the litter size in the three breeds(64) (Table 3).

SNP

Table 3: Summary of genes reported by different authors in Latin America OAR Gene Trait Author Country

GDF9

Growth differentiation factor-9

FecBB 6 FecXI, FecXB, FecXH, FecXG X

BMPR1B BMP15

Litter size

FecGH, FecG1

GDF9

Prolificity

FecXG , FecXL

Bravo et Chile al., 2016 ArgĂźello et al., 2014

BMP15

OAR18_52089434.1

OAR5_37738161.1

OAR8_87794040.1

SLC44A3, PAM, CEP135, EMCN, PRDM13, BEND3, CHAMP1, and PIAS2

Birth weight, year weight, pre-weaning gain, loin eye area, Palacios, carcass compactness 2018 index, and cold carcass weight

MC1R

Coat pigmentation

OAR14_14650208.1, s50332.1, s26449.1, 14 s72056.1, s56356.1, OAR14_15968361.1

Multiple birth

Paz et al., Chile 2014

OAR10_55949918.1

SPRY-2

Myogenesis

s11567.1 OAR3_56021384.1

14 3

CDH13

Melanoma 869

Mexico

Colombia

Muniz et Brazil al., 2016

Rev Mex Cienc Pecu 2020;11(3):859-883

OAR7_82985623.1

YLPM1

OAR21_52583090.1,

KAPS

OAR12_17005059.1

CAPN2

OAR8_91253490_X.1

QTL-OPG

s23985.1, OAR2_148350187.1, s26633.1

2 6

QTL-CE SPP1

OAR1_189179554.1 OAR1_23734999.1

Cellular apoptosis

Endoparasite resistance

Biagiotti, 2016

Brazil

CD200 1

LOC105605154

s12060.1

PLPPR4

s25125.1 OAR2_96008804.1 OAR3_61737307.1 OAR3_89348294.1 s62226.1 OAR5_107977075.1 OAR5_112451694.1 s11274.1 OAR6_27552838.1 OAR6_77919148.1 OAR7_85269064.1 OAR8_39977285.1 OAR8_50320412.1 s33129.1 OAR10_59207797.1 OAR10_91128145.1 OAR12_20575087.1 s01263.1 OAR23_49635171_X.1 DU261801_281.1 OAR3_130491628.1

PDE4DIP MTAP RFN103 TMEM178A RDH14 PAM EFNA5 GABRG2 EMCN CEP135 CIPC PRDM13 MAP3K7 CNGB3 SLITRK1 CHAMP1 USH2A LOC101113879 PIAS2 PSD3 MGAT4C

2 3 5

6 7 8 9 10 12 14 23 26 3

870

Growth

Noriega Colombia et al., 2018

Meat tenderness

Ortiz et Colombia al., 2015

Rev Mex Cienc Pecu 2020;11(3):859-883

In Brazil, prolificity (number of lambs born per ewe) was studied through genomic association in sheep of the Morada Nova breed, finding that the GDF9, BMP15, and BMPR1b genes express in multiple birth animals(62) (Table 2). With the SNP obtained in this study, a low-density panel was performed for prolificity, after being validated in sheep of prolific breeds with a history of single and multiple calving. Amorim et al.(68) studied prolificity in Santa InĂŠs sheep. After performing GWAS for maternal efficiency, maternal metabolic efficiency, twinning, adult weight, adult metabolic weight, and body condition score variables, they found six common candidate regions. Moreover, for adult weight and adult metabolic weight, 15 regions were found in common, and finally, adult weight and body condition coincided in a region located on chromosome 21. The only trait that was not related to the other variables was twinning. Among the genes found in chromosomes 16 and 5, CARTPT, MSX1, DRD5, SLCO4C1, OOEP, GATA6, CUL4A, ZFAND5, OOEP, TNNT2, LDHA, MYC, and MDFI were identified; as associated with appetite regulation, energy balance, maintenance of body weight and stress response, muscle growth, embryonic development, reproductive behavior, membrane transporters, progesterone secretion, oocyte maturation and oogenesis, subcortical maternal complex, muscle contraction, calcium regulation, glycolysis and transcription regulation. In Mexico, the FecXG and FecXL polymorphisms of the BMP15 gene (Table 3) were reported for the first time in Pelibuey sheep; after the GWAS, they found that the homozygous genotypes of these polymorphisms were related with a higher number of lambs, as there were more double births(32). In Latin America, one of the main causes that affect the efficiency of production systems is parasitic infestation; animals that are less resistant and adapted to environmental conditions are more susceptible to lose weight and even die, since they do not recover from the parasitic infestation. Therefore, some genomic association and selection studies in breeding programs have focused on finding and selecting animals that show resistance to gastrointestinal infection by parasites. Biagiotti(69) performed a GWAS to evaluate the resistance to parasites in Santa InĂŠs sheep and found SNP (Table 3) significantly associated with body condition score in chromosome 2, tremors in chromosome 21, and presence of Strongylus eggs in chromosomes 8 and 12. Subsequently, in sheep from the same breed, they also studied the resistance to parasites, particularly to Haemonchus contortus, using a low-density panel (SNP12k BeadChip) of 12.785 SNP, where several candidate genes were located in the chromosomes OAR1, OAR2, OAR3, OAR5, OAR8, and OAR15, related to the development and activation of the immune system, inflammatory response, and regulation of the proliferation of lymphocytes and leukocytes(61). These genes (Table 2) can assist in selecting animals with greater resistance to parasites, and the BeadChip Ovine SNP12k could be a useful tool to identify genomic regions associated with traits related to the resistance to gastrointestinal parasites.

871

Rev Mex Cienc Pecu 2020;11(3):859-883

In a different study, after performing a GWAS to determine an association between resistance to parasites and type of host in Maasai and Dorper sheep adapted to the tropical environment of Brazil, where extreme exposure to the parasite is constant, especially Haemonchus contortus(70), candidate immune variants were found for genes involved in response to infection, as well as additional information on SNP useful for selection by resistance to gastrointestinal parasites in sheep with a genetic background similar to the population studied. Among the genes that were found are: UBE2N, SOCS2, LAMC1, EPS15, ATP2B1, LRP8, GALNT4, MUC15 (Table 2). Periasamy et al(71) performed a study in 713 non-related sheep, involving Junin, Corriedale, and Pampinta sheep from Peru and Argentina, respectively; they identified 41 SNP in 38 candidate genes, associated with resistance to gastrointestinal nematodes. Other parameters are related to phenotypic characteristics such as coat color, breed assignment, and population structure; important in selection programs aimed at pure individuals, such as the case of the Morada Nova hair sheep in Brazil, which presents white and red animals recognized by the Brazilian Association of Sheep Breeders, but there are other black color variants with pigmented noses that are not accepted in genealogical records and some studies suggest that they are similar. Other researchers(72) performed a GWAS to identify genomic regions associated with the coat color and confirm that the black sheep are similar to other varieties of Morada Nova; their results show that the differences between the black and red coat sheep result from the expression of different alleles of the same gene (MC1R located in the OAR14 chromosome) without directly affecting the productive/reproductive traits. Moreover, they concluded that these two varieties showed low genetic variation, insufficient to consider them different groups. In Uruguay, researchers studied the genetic diversity of three sheep breeds (Corriedale, Merino, and Criolla) to confirm the breed assignment and analyze the population structure of commercial and creole breeds; their results show that when using a subset of 18.181 SNP, the principal component analysis and the STRUCTURE yielded the stratification of the population within breeds(52). The divergent lines of Merino and Corriedale showed high levels of polymorphism (89.4 and 86%, respectively) and a moderate genetic differentiation between them (Fst= 0.08). However, creole sheep only had 69 % polymorphic SNP and showed greater genetic differentiation (Fst= 0.17) with the other two breeds. In Brazil, a similar study was performed in the Brazilian creole sheep breeds Morada Nova and Santa InĂŠs to find genomic regions that may have been under selection and therefore explain the ecological and production differences observed between the three breeds(19); Table 2. The performed analyzes allowed them to identify 86 candidate genes; the functional analysis revealed genes related to immunity, nervous system development, reproduction, and sensory perception, some of the genes are of particular interest, including: RXFP2, which was recently associated with the presence/absence and morphology of horns in sheep; the TRPM8 gene, involved in body temperature regulation at low temperatures; DIS3L2, PLAG1, and 872

Rev Mex Cienc Pecu 2020;11(3):859-883

NIPBL, associated with height variation; and finally, SPEF2 and SPAG6, important for spermatogenesis. De Simoni Gouveia et al(19) also found specific signals of each breed, which are related to the adaptation to the environmental conditions of Brazil.

Advantages and disadvantages of GWAS and genomic selection

GWAS and tests based on genomic information allow the selection of the best animals and increase their breeding efficiency(9,10) through the exploration of the Linkage disequilibrium, that is, the association between genes that is not a product of chance due to the proximity of these in the same chromosomal segment(73-75); and a large number of SNP markers distributed throughout the genome(9,72). In this way, the sum of all the small effects of the SNP will allow predicting breeding values with greater precision, by recovering the favorable haplotype combinations for the traits of interest throughout the genome(33,42) and identifying genes that affect the production traits in domestic animals(43,72,76). In genomic selection, the most favored traits are those with low heritability and that are strongly influenced by the environment (birth weight, weaning weight, age at first calving, calving interval, and daily weight gain at weaning, among others)(34,36,77), which represents an important advance in the genetic improvement of animals since there is greater control of genetic aspects and environmental effects are separated. Regarding traits that are difficult to measure, the selection from genomic information is a disadvantage since the availability to discover new variants or validate those that already exist requires infrastructure, resources, significant samples, and, above all, the generation of phenotypes(33). Genomic information can also help identify individuals who carry congenital defects, with the SNP50 BeadChip in GWAS, the genes responsible for many sheep diseases, such as microphthalmia(78), epidermolysis bullosa(79), rickets(55), ovine lentivirus(75), and chondrodysplasia(80), have been successfully identified. Identifying the carrier animals will help reduce the risk of loss or incidence of carriers of these diseases in flocks. A disadvantage is that these studies are useful if the patterns to be studied follow a recessive inheritance model, since only genomic regions fixed for a haplotype that is shared only among affected individuals can be identified; otherwise, the homozygosity mapping does not apply to dominant traits where symptomatic individuals may be homozygous or heterozygous in the causal mutation(76). Through the information obtained by the GWAS it has also been possible to identify the modifications that domestic species have undergone and that are of interest from a morphological, behavioral, productive, adaptive, and, consequently, genetic point of view; 873

Rev Mex Cienc Pecu 2020;11(3):859-883

aspects that have allowed a better understanding of the processes involved in the evolution of their genome, as well as discovering and validating genomic regions involved in the manifestation of traits of economic and ecological interest(19). Finally, genomics generates a large amount of information about the genetic composition of domestic animals; the complete genome of cattle, poultry, pigs, sheep, horses, fish, and other species of agricultural interest is currently available(9,10). In recent years, the assembly of genomes has been improved in order to functionally annotate all the genetic information; once the functional annotation is completed, the new genomes would provide more efficient tools to study the genetic mechanisms that control the traits of interest of the animals and use or improve studies based on this information(42). A different type of information generated by genomics are the SNP, which can be used simultaneously as population markers to verify affiliations, pedigree, and to perform phylogenetic studies(81).

Perspectives and challenges of sheep farming regarding the use of GWAS and genomic selection

The discovery and development of new markers for traits of interest, or that solve a problem in production systems, is conditioned by the availability or generation of phenotypic information (records), an aspect that does not differ from traditional selection. In Latin America, the use and availability of records is scarce; therefore, genetic progress is also scarce. Several GWAS and genomic selection studies have found that creole animals are important biodiversity reservoirs, have resistance to diseases, high prolificity, good yield and productivity in difficult environments, traits that are genetically determined and that would be of great importance to introduce in other populations. Therefore, the sheep production chain in Latin America should consider the usefulness of zoogenetic resources since these animals constitute a future alternative to support commercial production. A challenge for Latin American producers is to improve the traceability of products obtained from sheep farming. With the current molecular techniques, it is possible to establish traceability mechanisms in which by identifying the DNA of the products, these can be traced, which would contribute to revalue the traditional production systems.

874

Rev Mex Cienc Pecu 2020;11(3):859-883

Implementing conservation and breeding programs for local breeds in Latin America, which are generally maintained by small-scale producers, implies a great challenge. Recording behavioral data under these conditions is extremely difficult and, in some situations, impossible. The cost-benefit relationship of the implementation of DNA tests to assist the genomic selection of traits of economic interest in sheep is related to the objectives of each production system. That is, the investment in this kind of tests is justified if the magnitude of the positive change provided by them generates economic profit through the expected results. In Latin America, the use of these tools has been effective in commercial production, generally intensive with purebred or improved animals, where it is possible to obtain phenotypes that can validate the usefulness of genetic markers. In Latin America there is a wide variety of breeds, without considering those that have disappeared and that are important due to their adaptation to various ecosystems, determining factors in some regions. Therefore, the use of this type of study to detect genes or selection footprints that may be of importance for the conservation of these animals is very useful.

Conclusions Although genomics is a helpful tool for understanding the architecture of complex traits of productive interest and improving sheep production systems, its use in Latin America is limited to a few countries; generally, those with the largest sheep population and a worldwide representative production. Therefore, it is relevant to continue researching the use of GWAS in Latin America and thus identifying more genes that influence the productivity of sheep, which are generally creole animals adapted to tropical conditions.

Acknowledgments To the Universidad Nacional de Colombia-Sede Palmira for their support through the call for the strengthening of research and artistic creation of the Faculty of Agricultural Sciences 2017-2018.

875

Rev Mex Cienc Pecu 2020;11(3):859-883

Conflicts of interest The authors declare that they have no conflicts of interest regarding the work presented in this report.

Literature cited: 1.

Peacock C. Goats - A pathway out of poverty. Small Ruminant Res 2005;60:179-86.

FAO. Población de ovinos en el mundo. FAO; 2016.

Moreno D, Grajales H. Caracterización de los sistemas de producción ovinos de trópico alto en Colombia: manejo e indicadores productivos y reproductivos. Rev Med Vet Zoot 2017;64:36-51.

Mueller JP. Programas de mejora genética de rumiantes menores basados en comunidades. Arch. Latinoam. Prod Anim 2017;25:61-75.

Martínez H, Amezquita J, Espinal C. Cadena ovinos y caprinos en Colombia. Min Agricultura y Desarrollo Rural, Obs Agrocadenas Colombia 2006;125:40.

Jahuey F. Análisis del genoma completo de caracteres de crecimiento en ganado Charolais de registro: Instituto Politécnico Nacional; 2014.

Bejarano D. Estudio de asociación genómica para características de crecimiento en las razas bovinas Criollas Blanco Orejinegro y Romosinuano. Universidad Nacional de Colombia; 2016.

Martínez C, Manrique C, Elzo M. Cattle genetic evaluation: a historical perception. RCCP 2012;25:293-311.

Zhang L, Liu J, Zhao F, Ren H, Xu L, Lu J, et al. Genome-wide association studies for growth and meat production traits in sheep. PLoS ONE 2013;8:1-12.

10. Zhang H, Wang Z, Wang S, Li H. Progress of genome wide association study in domestic animals. J Anim Sci Biotechnol 2012;3:1-10.

876

Rev Mex Cienc Pecu 2020;11(3):859-883

11. Hu ZL, Park CA, Reecy JM. Building a livestock genetic and genomic information knowledgebase through integrative developments of Animal QTLdb and CorrDB. Nucleic Acids Res 2019;47:701-710. 12. Aréchiga C, Aguilera J, Rincón R, Méndez De Lara S, Bañuelos V, Meza-Herrera C. Situación actual y perspectivas de la producción caprina ante el reto de la globalización. Trop Subtrop Agroecosyst 2008;9:1-14. 13. Arcos J, Romero H, Vanegas M, Riveros E. Ovinos Colombianos de pelo. 1 ed. Tolima: Corporación Colombiana de Investigación Agropecuaria; 2002. 14. Simanca J, Vergara O, Bustamante M. Description of growth in sheep Santa Ines x Creole in extensive grazing in two populations from Cordoba, Colombia. Arch Med Vet 2016;57:61-67. 15. Salazar O. Evaluación de la implementación de Buenas Prácticas Pecuarias en la producción de ovinos y caprinos en la zona metropolitana de los municipios de Bucaramanga y Lebrija. Universidad de Manizales; 2015. 16. Delgado J, Nogales S. Biodiversidad Ovina Iberoamericana. Caracterización y uso sustentable. Libro Diversidad Ovina Latinoamericana; 2009. 17. Scintu MF, Piredda G. Typicity and biodiversity of goat and sheep milk products. Small Ruminant Res 2007;68:221-31. 18. Vivas N. Diversidad genética de ovinos criollos colombianos. Universidad Nacional de Colombia, Sede Palmira; 2013. 19. De Simoni Gouveia J, Paiva S, McManus C, Rodrigues A, Kijas J, Facó O, et al. Genome-wide search for signatures of selection in three major Brazilian locally adapted sheep breeds. Livest Sci 2017;197:36-45. 20. Rubianes E, Ungerfeld R. Perspectivas de la investigación sobre reproducción ovina en América Latina en el marco de las actuales tendencias productivas. Arch Latinoam Prod Anim 2002;10:117-25. 21. SAGARPA. Plan Rector Sistema Productivo Ovinos 2015-2024. 2016;1-47. 22. Montes D, Moreno J, Lugo NH, Ramirez R, Celis A, Garay G. Caracterización faneróptica y morfológica de la hembra ovina de pelo criollo (Camura) colombiana, en la subregión sabanas y golfo de Morrosquillo departamento de Sucre. RECIA 2013;5(1):104-115. 877

Rev Mex Cienc Pecu 2020;11(3):859-883

23. Lenis CP. Asociación de SNPs con características de crecimiento muscular en una población de ovinos criollos de pelo con alto mestizaje de Pelibuey en el Valle del Cauca. Universidad Nacional de Colombia, Sede Palmira; 2019. 24. Oliveros A. Comportamiento productivo de ovinos alimentados con dietas a base de fruta de pan (Artocarpus altilis). Universidad Técnica de Ambato; 2017. 25. Martínez R, Vásquez R, Vanegas J, Suárez M. Parámetros genéticos de crecimiento y producción de lana en ovinos usando la metodología de modelos mixtos. Cienc Tecnol Agropecu 2006;7(1):42-49. 26. FAO. Producción de ovinos en el mundo. FAO; 2017. 27. Mueller J. La Producción Ovina en la Argentina. INTA 2013:1-10. 28. Lima M, Júnior FV, Martins C. Características de carcaça de cordeiros nativos de Mato Grosso do Sul terminados em confinamento. Rev Agrarian 2012;5:384-92. 29. Rovadoscki GA. Associação genômica e parâmetros genéticos para características de perfil de ácidos graxos e qualidade de carne em ovinos da raça Santa Inês. Universidad de São Paulo; 2017. 30. Rovadoscki GA, Pertile SFN, Alvarenga AB, Cesar ASM, Pértille F, Petrini J, et al. Estimates of genomic heritability and genome-wide association study for fatty acids profile in Santa Inês sheep. BMC Genomics 2018;19:1-14. 31. Vargas SA. Biometría del ovino criollo en tres localidades de la sierra del Perú. Universidad Agraria la Molina; 2016. 32. Argüello-Hernández HJ, Cortez-Romero C, Rojas-Martínez RI, Segura-León OL, Herrera-Haro JG, Salazar-Ortiz J, et al. Polimorfismos de la proteína 15 morfogénica ósea (BMP15) y su relación con el tipo de parto en la oveja Pelibuey. Agrociencia 2014;48:53-69. 33. Landi V, Quiroz J. Los avances de las nuevas tecnologías genéticas y su aplicación en la selección animal. AICA 2011;33-43. 34. Palacios Y. Análisis genómico de características de crecimiento muscular y de calidad de la canal en poblaciones ovinas de pelo. Universidad Nacional de Colombia, Sede Palmira; 2018.

878

Rev Mex Cienc Pecu 2020;11(3):859-883

35. Ocampo RJ, Martinez RA, Rocha JJ, Cardona H. Genetic characterization of Colombian indigenous sheep. RCCP 2017;30(2):116-125. 36. Montes Vergara D, Lenis Valencia C, Hernández Herrera D. Polimorfismos de los genes Calpaína y Calpastatina en dos poblaciones de ovinos de pelo Colombiano. Rev MVZ Córdoba 2018:7113-7118. 37. Mernies BM, Filonenko F, Fernández YG. Índices zoométricos en una muestra de ovejas Criollas Uruguayas. Arch Zootec 2007;56:473-478. 38. Bravo S, Larama G, Paz E, Inostroza K, Montaldo HH, Sepúlveda N. Polymorphism of the GDF9 gene associated with litter size in Araucana creole sheep. Anim Genet 2016;47(3):390-391. 39. Chavez YA, Martinez B. Estudios de asociación mediante rastreo genómico y su contribución en la genética del asma. Salud Uninorte 2010;26(2):269-284. 40. Pasandideh M, Rahimi-Mianji G, Gholizadeh M. A genome scan for quantitative trait loci affecting average daily gain and Kleiber ratio in Baluchi sheep. Sari Agric Sci Natural Resour Univ 2018;97(2):493-503. 41. Zolezzi I. Genómica y medicina. Educ Quím 2011;22(1):15-27. 42. Guðmundsdóttir ÓÓ. Genome-wide association study of muscle traits in Icelandic sheep. Agricultural University of Island; 2015. 43. Johnston SE, McEwan JC, Pickering NK, Kijas JW, Beraldi D, Pilkington JG, et al. Genome-wide association mapping identifies the genetic basis of discrete and quantitative variation in sexual weaponry in a wild sheep population. Mol 2011;20(12):2555-2566. 44. Miller JM, Poissant J, Kijas JW, Coltman DW. A genome-wide set of SNPs detects population substructure and long-range linkage disequilibrium in wild sheep. Mol 2011;11:314-322. 45. Kawȩcka A, Gurgul A, Miksza-Cybulska A. The use of SNP microarrays for biodiversity studies of sheep - A review. Ann Anim Sci 2016;16(4):975-987. 46. Ángel P, Cardona H, Cerón M. Genómica en la producción animal. Rev Col Cienc Anim 2013;5(2):497-518.

879

Rev Mex Cienc Pecu 2020;11(3):859-883

47. Heaton M, Leymaster K, Kalbfleisch T, Kijas J, Clarke S, McEwan J, et al. SNPs for parentage testing and traceability in globally diverse breeds of sheep. PLoS ONE 2014;9(4):1-10. 48. Munnier N. Identificación y validación de Single Nucleotide Polymorphism (SNPs) distribuidos en el genoma de Eucalyptus globulus. Universidad de Concepción; 2015. 49. Sevilla S. Metodología de los estudios de asociación genética. Insuficiencia cardiaca 2007;2(3):111-114. 50. Chitneedi PK, Gutiérrez-Gil B, Arranz JJ. Evaluación de la imputación de genotipos desde un chip de baja densidad (3K) a media (Chip-50K) y alta (Chip-HD) densidad en el ganado ovino. AIDA 2017;522-524. 51. Goldammer T, Di Meo GP, Lühken G, Drögemüller C, Wu CH, Kijas J, et al. Molecular cytogenetics and gene mapping in sheep (Ovis aries, 2n =54). Cytogenet Genome Res 2009; 126:63-76. 52. Grasso AN, Goldberg V, Navajas EA, Iriarte W, Gimeno D, Aguilar I, et al. Genomic variation and population structure detected by single nucleotide polymorphism arrays in Corriedale, Merino and Creole sheep. Genet Mol 2014;37(2):389-395. 53. Kijas JW, Lenstra JA, Hayes B, Boitard S, Neto LR, Cristobal M, et al. Genome-wide analysis of the world's sheep breeds reveals high levels of historic mixture and strong recent selection. PLoS Biology 2012;10(2):1-14. 54. Agrigenomics. OvineSNP50 Genotyping BeadChip; 2015. 55. Zhao X, Dittmer KE, Blair HT, Thompson KG, Rothschild MF, Garrick DJ. A novel nonsense mutation in the DMP1 gene identified by a genome-wide association study is responsible for inherited rickets in Corriedale sheep. PLoS ONE 2011;6(7):1-6. 56. Nanekarani S, Goodarzi M. Polymorphism of candidate genes for meat production in Lori sheep. IERI Procedia 2014; 8:18-23. 57. Pant SD, You Q, Schenkel LC, Voort GV, Schenkel FS, Wilton J, et al. A genome-wide association study to identify chromosomal regions influencing ovine cortisol response. Livest Sci 2016;187:40-47.

880

Rev Mex Cienc Pecu 2020;11(3):859-883

58. Aali M, Moradi-Shahrbabak H, Moradi-Shahrbabak M, Sadeghi M, Yousefi AR. Association of the calpastatin genotypes, haplotypes, and SNPs with meat quality and fatty acid composition in two Iranian fat- and thin-tailed sheep breeds. Small Ruminant Res 2017;149:40-51. 59. Kominakis A, Hager-Theodorides AL, Zoidis E, Saridaki A, Antonakos G, Tsiamis G. Combined GWAS and ‘guilt by association’-based prioritization analysis identifies functional candidate genes for body size in sheep. Genet Sel Evol 2017;49(41):1-16. 60. Rochus CM, Tortereau F, Plisson-Petit F, Restoux G, Moreno-Romieux C, TosserKlopp G, et al. Revealing the selection history of adaptive loci using genome-wide scans for selection: An example from domestic sheep. BMC Genomics. 2018;19:1-17. 61. Berton MP, Oliveira Silva RM, Peripolli E, Stafuzza NB, Martin JF, Álvarez MS, et al. Genomic regions and pathways associated with gastrointestinal parasites resistance in Santa Inês breed adapted to tropical climate. J Anim Sci Biotechnol 2017;8(73):1-16. 62. Lacerda T. Genes relacionados à prolificidade e seu potencial uso em programas de conservação e melhoramento de ovinos. Universidade de Brasília; 2016. 63. Ortiz Y, Ariza M, Castro S, Ríos M, Sierra L. Identificación genómica de Snps asociados a terneza de la carne de ovino de pelo Criollo Colombiano. AICA 2015;6(1):388-397. 64. Paz E, Montaldo HH, Quiñones J, Sepúlveda N, Bravo S. Genotyping of BMPR1B, BMP15 and GDF9 genes in Chilean sheep breeds and association with prolificacy. Anim Genet 2014;46:98-99. 65. Casas E, White SN. Aplicación de la genómica en características de importancia económica en poblaciones ovinas. X Seminario internacional de producción de ovinos en el trópico 2015;35-44. 66. Noriega J, Hernández D, Bustamante M, Alvarez L, Ariza M, Vergara O. Polymorphisms of candidate genes to growth in two populations of Colombian Creole sheep. INDJSRT 2017;11(46):1-9. 67. Armstrong E, Ciappesoni G, Iriarte W, Da Silva C, Macedo F, Navajas EA, et al. Novel genetic polymorphisms associated with carcass traits in grazing Texel sheep. Meat Sci 2018;145:202-208. 68. Amorim ST, Kluska S, Berton MP, de Lemos MVA, Peripolli E, Stafuzza NB, et al. Genomic study for maternal related traits in Santa Inês sheep breed. Livest Sci 2018;217:76-84. 881

Rev Mex Cienc Pecu 2020;11(3):859-883

69. Biagiotti D. Associação e seleção genômica ampla em ovinos Santa Ines para caracteristicas relacionadas a resi A resistência à endoparasitas. Universidade Federal du Piauí; 2016. 70. Benavides MV, Sonstegard TS, Kemp S, Mugambi JM, Gibson JP, Baker RL, et al. Identification of novel loci associated with gastrointestinal parasite resistance in a red Maasai x Dorper backcross population. PLoS ONE 2015;10(4):1-20. 71. Periasamy K, Pichler R, Poli M, Cristel S, Cetra B, Medus D, et al. Candidate gene approach for parasite resistance in sheep-variation in immune pathway genes and association with fecal egg count. PLoS ONE 2014;9(2):1-16. 72. Muniz MMM, Caetano AR, McManus C, Cavalcanti LC, Façanha DA, Leite JH, et al. Application of genomic data to assist a community-based breeding program: A preliminary study of coat color genetics in Morada Nova sheep. Livest Sci 2016;190:8993. 73. Suazo J, Santos JL, Silva V, Jara L, Palomino H, Blanco R. Estudio de asociación por desequilibrio de ligamiento entre los genes TGFA, RARA, y BCL3 y fisura labiopalatina no sindrómica (FLPNS) en la población chilena. Rev Med Chile 2005;133:1051-1058. 74. Cacheiro P. Métodos de selección de variables en estudios de asociación genética. Aplicación a un estudio de genes candidatos en Enfermedad de Parkinson. Universidad de Santiago de Compostela; 2011. 75. White SN, Mousel MR, Herrmann-Hoesing LM, Reynolds JO, Leymaster KA, Neibergs HL, et al. Genome-wide association identifies multiple genomic regions associated with susceptibility to and control of ovine lentivirus. PLoS ONE 2012;7(10):1-10. 76. Kijas JW, Serrano M, McCulloch R, Li Y, Salces J, Calvo JH, et al. Genome wide association for a dominant pigmentation gene in sheep. J Anim Breed Genet 2013; 130:468-475. 77. Galeano AP, Manrique C. Estimación de parámetros genéticos para características productivas y reproductivas en los sistemas doble propósito del trópico bajo colombiano. Rev Med Vet Zoot 2010;57(2):119-131. 78. Becker D, Tetens J, Brunner A, Burstel D, Ganter M, Kijas J, et al. Microphthalmia in Texel sheep is associated with a missense mutation in the paired-like homeodomain 3 (PITX3) gene. PLoS One 2010;5(1):1-9.

882

Rev Mex Cienc Pecu 2020;11(3):859-883

79. Momke S, Kerkmann A, Wohlke A, Ostmeier M, Hewicker-Trautwein M, Ganter M, et al. A frameshift mutation within LAMC2 is responsible for Herlitz type junctional epidermolysis bullosa (HJEB) in black headed mutton sheep. PLoS ONE 2011;6(5):16. 80. Zhao X, Onteru SK, Piripi S, Thompson KG, Blair HT, Garrick DJ, et al. In a shake of a lamb's tail: using genomics to unravel a cause of chondrodysplasia in Texel sheep. Anim Genet 2012;43(1):9-18. 81. Kijas JW, Townley D, Dalrymple BP, Heaton MP, Maddox JF, McGrath A, et al. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds. PLoS ONE 2009;4(3):1-13.

883

https://doi.org/10.22319/rmcp.v11i3.5157 Research note

Lamb growth and ewe productivity in Pelibuey sheep under tropical conditions

Carolina Atenea García-Chávez a Carlos Luna-Palomera a* Ulises Macías-Cruz b José Candelario Segura-Correa c Nadia Florencia Ojeda-Robertos a Jorge Alonso Peralta-Torres a Alfonso Juventino Chay-Canúl a

Universidad Juárez Autómoma de Tabasco. División Académica de Ciencias Agropecuarias, Laboratorio de Reproducción y Genética Animal. Av. Universidad S/N, Zona de la Cultura, Col. Magisterial. Villahermosa, Tabasco, México. b

Universidad Autónoma de Baja California. Instituto de Ciencias Agrić olas. Valle de Mexicali, Baja California, México. c

Universidad Autónoma de Yucatán. Campus de Ciencias Agropecuarias. Mérida Yucatán México.

*Corresponding author: carlos.luna@ujat.mx

Abstract: Preweaning growth of lambs and ewe productivity are vital indicators of sheep production system success. An evaluation was done of the effects of birth season and year, birth type, sex and parturition number on preweaning growth and ewe productivity in Pelibuey sheep in a semi-extensive system in the humid tropics of Mexico. Data were from the production

884

Rev Mex Cienc Pecu 2020;11(3):884-893

records of 323 ewes over a 7-yr period (2011-2017). Birth weight (BW), weaning weight (WW, at 60 d) and litter weight at weaning (LWW) were evaluated. Other evaluated factors included ewe prolificacy, preweaning mortality and lamb weight per ewe in a 240-d cycle (LW240d). All the factors affected (Pâ&#x2030;¤0.05) the response variables. Lambs from multiple births had lower (P<0.05) BW and WW, but higher (P<0.05) LWW, LW240d, and mortality than lambs from single births. Lambs born in the dry season had higher (P<0.05) BW and WW, and ewes had higher LWW and LW240d, than in other seasons. Compared to multiparous ewes (â&#x2030;Ľ3 parturition), primiparous ewes had lighter lambs (P<0.05) at birth and weaning, as well as lower (P<0.05) prolificacy, LWW and LW240d. Birth year affected (P<0.05) BW, WW, mortality and productivity characteristics. Preweaning growth performance was best in lambs born from multiparous sheep with a single parturition in the dry season. However, ewe productivity was highest in the dry season in multiparous ewes with two parturitions a year. Key words: Hair sheep, Birth weight, Preweaning growth, Lambs.

Recibido: 20/11/2018 Aceptado: 29/07/2019

Preweaning growth in lambs and ewe productivity are critical aspects of sheep production that impact herd profitability. They must be constantly evaluated on sheep ranches since they function as productivity indicators used to adjust existing or incorporate new management, nutritional and genetic improvement strategies(1,2). Lambs births, their birth weight, weaning weight adjusted to 60 days, parturition interval and preweaning mortality are financially important characteristics used in estimating productivity parameters(3,4,5). Ewe productivity is a composite characteristic determined by herd fertility, number of lambs per parturition, total litter weight at birth, average weaned lamb weight, total litter weight at weaning and the number of lambs weaned(6). Each of these parameters can be used as a selection criterion, but combining them into in an appropriate selection index can result in more efficient genetic improvement gains per generation and/or year(3,7,8,9). Productivity and other financially important characteristics are the result of interaction between genotype and environment. Genetic components include factors such as ewe age, prolificacy, and calving number, while environmental factors include herd nutritional management, birth year, birth season environmental conditions and forage availability(10).

885

Rev Mex Cienc Pecu 2020;11(3):884-893

All these genetic and environmental factors significantly impact ewe reproductive performance and productivity, as well as lamb development and growth(10,11). Establishing management and selection strategies in Pelibuey sheep herds in the humid tropics requires identification of the genetic and environmental factors that influence lamb preweaning growth, and short- and long-term ewe productivity(4). Further research is needed on the factors associated with lamb growth and Pelibuey ewe productive capacity. These data will inform decision making on management practices and establishment of genetic improvement strategies aimed at conserving Pelibuey sheep in their natural habitat. The present study objective was to evaluate the effects of some environmental factors on lamb preweaning growth and ewe productivity in Pelibuey sheep under a semi-extensive production system in the humid tropics. The analyzed data is from 7 yr (2011-2017) of production records for Pelibuey sheep (n = 323) in a production unit in the state of Tabasco, Mexico. Regional climate is humid tropical with rains year-round (2,550 mm on average). Based on seasonal variations in climatic variables, three seasons are identified in the region: dry (March to May), rainy (June to October) and northwinds (November to February). Average temperatures are 18 Â°C minimum and 36 ÂşC maximum, with an annual average of 27 ÂşC. Relative humidity fluctuates between 60 and 95 % depending on season(12). During the study period the production unit had two modules. The first was a 15-ha area designed for breeding which included sheds, mating pens, a grazing area (2 ha Panicum maximum grass and 9.5 ha Cynodon dactylon grass), and a 3.5 ha field of corn for silage. The second consisted of 5 ha of roofed birthing sheds housing pregnant sheep, for parturition and lamb care. General animal management during the study period consisted of controlled natural mounting, with continuous breeding at a 25 to 30 ewe to ram ratio. After birth lambs were confined with their mothers for the first few weeks. The ewes were later allowed to graze. Lambs were provided free access to concentrate in creep feeding cages during the 60-d preweaning period. At the end of the postpartum period male lambs were fattened for slaughter or selected as sires, while the best female lambs were set aside as replacements and housed in raised-floor pens. The ewes received commercial dietary supplements to ensure fulfillment of nutritional requirements according to physiological state: breeding (crude protein [CP] = 12%, metabolizable energy [ME] = 2.4 Mcal/kg dry matter [DM]); gestation (CP = 11-12%, ME = 2.4 Mcal/kg DM); and lactation (CP = 12-16%, ME = 2.2.2.5 Mcal/kg DM). When pasture forage availability was low hay was provided in pens with a commercial concentrate supplement.

886

Rev Mex Cienc Pecu 2020;11(3):884-893

Parasites were monitored monthly using the FAMACHA© test. Deworming was done alternately with 2.5% albendazole (Valbazen, Zoetis®) and 12.0% levamisole (Riperocol, Zoetis®), after coprological parasite testing every three months. Animals were vaccinated against clostridiasis and pneumonic pasteurellosis every six months (April and October), and the herd was brucellosis-free. A database was created using the records of 343 ewes that gave birth between 2011 and 2017, producing 2,335 lambs. The data collected for each ewe was parturition number; season, parturition date, litter size, number of lambs weaned and weaned lambs at 240 d postpartum. The data collected for each offspring included identification number; sex; birth weight (BW); weaning weight (WW); and weight at 240 d postpartum. Calculations were done of prolificity (number offspring born per parous ewe); preweaning mortality rate (percentage offspring mortality during weaning period); litter weight at weaning (LWW); total litter weight adjusted to 60 d; and total litter weight adjusted to 240 d postpartum (LW240d). Productivity adjusted to 240 d(2) was defined as LWW adjusted by ewe parturition interval and multiplied by 240 d (i.e. the optimal time for attaining three gestations in two years under a continuous breeding system). All results were analyzed with the SAS statistical package(13). For BW and WW the model included the fixed effects of birth year, birth season, type of birth, sex, birth number, and first-order interactions. This previous model was also used for LWW and LW240d, but without including the effect of sex and interactions. In the case of prolificacy the model included the effects of birth year, birth season, birth number and simple interactions. The interactions were not significant (P>0.05) for any of the study variables. Preweaning mortality was analyzed using Chi-square test. All the preweaning and productivity traits were affected (P≤0.05) by the studied factors, with the exception of season for prolificity and preweaning mortality. In terms of birth type, lambs that were sole progeny had higher (P<0.05) BW and WW, but lower LWW and LW240d, than lambs born as part of a multiple birth (Table 1). Mortality was highest for lambs in triple births, followed by those in single births. Lambs born in the dry season had higher (P<0.05) BW, WW, LWW and LW240d, but no difference in prolificacy and mortality rates (P>0.05), compared to those born during the rainy and northwinds seasons. Male lambs were heavier (P<0.05) at birth and weaning than female lambs. Sex had no affect (P>0.05) on preweaning mortality rate.

887

Rev Mex Cienc Pecu 2020;11(3):884-893

Table 1: Least means squares (±standard error) for the effects of birth type, birth season and lamb sex on preweaning growth and ewe productivity variables in Pelibuey sheep LW240d Mort BW (kg) WW (kg) LWW (kg) Prol (kg) (%) Birth type Single Doble Triple Birth season Dry Rainy Northwin ds Lamb sex Male Female

<0.0001 3.14±0.03a 2.52±0.02b 2.04±0.05c <0.0001

<0.0001 12.82±0.15a 10.56±0.17b <0.0001

<0.0001 12.92±0.20a 20.76±0.22b <0.0001

<0.0001 11.56±0.39a 19.15±0.43b <0.0001

0.36

<0.01 21.34b 15.07c 30.17a >0.05

2.63±0.04a 2.53±0.03b 2.54±0.03b

12.45±0.23a 11.79±0.16b 10.82±0.17c

18.09±0.31a 16.84±0.21b 15.59±0.22c

16.67±0.46a 15.02±0.76b 14.36±0.39b

1.61+0.04a 1.51+0.05a 1.56+0.05a

22.10a 22.10a 22.38a

<0.0001 2.64±0.03a 2.50±0.03b

<0.0001 12.11±0.16a 11.26±0.15b

>0.05 21.24a 23.14a

BW= birth weight; WW= weaning weigh; LWW= litter weaning weight; LW240d= litter weight adjusted to 240 d; Prol= prolificity; Mort= preweaning mortality. abc Different letter superscripts in the same column and within the same effect indicate significant difference (P<0.01).

Lambs born to primiparous ewes had the lowest (P<0.01) BW, WW, LWW, LW240d and prolificity. Ewe mortality was highest for those with one or six parturitions. Table 2: Least means squares (±standard error) for the effect of parturition number on preweaning growth and ewe productivity variables in Pelibuey sheep LWW LW240d BW (kg) WW (kg) Prol Mort (%) (kg) (kg) Part. No. 1 2 3 4 5 6 ≥7

<0.0001

2.20±0.03d 2.48±0.03c 2.59±0.03b 2.65±0.04a,b 2.72±0.04a 2.72±0.05a 2.61±0.05a,b

10.82±0.17d 11.94±0.20b 12.15±0.23ab 11.94±0.26b 11.92±0.30b 12.52±0.37a 11.40±0.32c

15.52±0.22b 17.02±0.26a 17.43±0.30a 17.18±0.34a 16.73±0.39a 17.32±0.47a 16.69±0.45a

<0.001

<0.01

13.50±0.43b 1.39+0.03c 15.42±0.47a 1.45+0.04c 15.89±0.50a 1.54+0.04b 15.74±0.55a 1.72+0.05a 15.84±0.64a 1.62+0.05a 15.58±0.76a 1.50+0.05bc 15.50±0.88a 1.60+0.06ab

<0.01 24.77a 19.99b 19.79b 23.08ab 20.15b 26.58a 20.99b

BW= birth weight; WW= weaning weight adjusted to 60 d; LWW= litter weaning weight; LW240d= litter weight adjusted to 240 days; Prol= prolificity; Mort= preweaning mortality. a,b,c,d Different letter superscripts in the same column indicate significant difference (P<0.01).

888

Rev Mex Cienc Pecu 2020;11(3):884-893

The improved BW and WW of lambs from single births did not result in better productivity since multiple-birth ewes exhibited higher LWW and LW240d. Similar results on lamb preweaning growth and ewe productivity in Pelibuey sheep have been reported previously in sub-humid(2) and arid tropical climates(1). Lower BW and preweaning growth in offspring from multiple births may be due to delayed fetal scheduling of growth in the prenatal period(14). Another possible cause is undernourishment in response to insufficient breast milk production to adequately nourish two or more lambs(15). Limited space in the uterus in pregnancies with multiple products can also be reflected in low BW(1,15). Although lambs born in multiple births exhibit less growth and a higher preweaning mortality rate, litter size at weaning per ewe is larger, which increases the overall weight of lambs weaned per ewe. The effect of sex on BW and WW in Pelibuey and Pelibuey cross lambs has been reported previously(15,16,17). This occurs because during the prenatal to postnatal stages male lambs secrete testosterone, a steroidal hormone important in growth due to its anabolic effects and stimulation of growth hormone(18). Birth season and year also influenced lamb growth and ewe productivity, which is to be expected due to climatic variations, as well as year-to-year differences in forage availability and quality in extensive and semi-extensive systems(19). Years and seasons with more rainfall and more thermoneutral temperatures for sheep tend to result in better lamb growth due to greater forage availability (16,20). Preweaning mortality consequently decreases while weaned lamb weight per parous ewe increases during the most favorable season. This explains why lamb growth and ewe productivity varied between years, which coincides with previous studies in tropical regions of Mexico(11,17,21). The improved lamb growth and ewe productivity observed in Pelibuey sheep during the dry season in the present study partially coincides with a previous study from the same region in which preweaning growth in Pelibuey lambs was best in the dry and rainy seasons(17). Another study found ewe productivity at weaning to increase during the dry and northwinds seasons(21). These discrepancies in results may be due to inter-study variations in facilities, management practices, and feed regime. Lambs born from multiparous ewes exhibited higher BW and WW than lambs born from primiparous ewes, which was reflected in better productivity levels for multiparous ewes. An eweâ&#x20AC;&#x2122;s number of parturitions is financially important because it influences the efficiency of her productive life and lamb growth. For example, in Pelibuey(21,22) and Blackbelly(23) sheep BW, WW, prolificity and ewe productivity at weaning improve after the second parturition. The fact that primiparous ewes produce lambs with light weights and lower preweaning growth capacity may be due to inadequate nutrient allocation during gestation to support fetus development and growth; prenatal lambs require large amounts of 889

Rev Mex Cienc Pecu 2020;11(3):884-893

nutrients for proper development(24). There is also evidence suggesting that the uterus of primiparous ewes is smaller and less flexible than in multiparous ewes, with the consequent lack of uterine space limiting fetal growth capacity and offspring birth weight(24). Preweaning mortality rate in the present study was generally higher than reported for Black Belly(3) and Katahdin(25) lambs, but comparable to mortality rates found for Pelibuey x Katahdin lambs(5). The high preweaning mortality rates in sheep production systems in the humid tropics of Mexico deserves serious attention since they negatively impact herd productivity. It is a complex issue involving multiple factors such as lamb survival, ewe maternal capacity, pre- and postpartum sanitary management practices, milk production, and climate, among others(26,27,28). The present mortality results suggest that climate, maternal capacity and herd management practices may have been vital to increasing lamb survival rates. Under the semi-extensive conditions in a humid tropical climate studied here lamb preweaning growth and ewe productivity in Pelibuey sheep were affected by environmental and breed-intrinsic factors. Single-birth lambs grew faster than multiple-birth lambs but resulted in less productivity per ewe at weaning and in 240-d cycles. Lamb preweaning growth and ewe productivity were highest in the dry season and in multiparous ewes.

Acknowledgments The authors thank Juan Carlos Domínguez García for access to the herd data and permission to publish the results.

Literature cited: 1. Macías CU, Álvarez VFD, Correa CA, Molina RL, González RA, Soto NS, Avendaño RL. Pelibuey ewe productivity and subsequent pre-weaning lamb performance using hair sheep breeds under confinement system. J Appl Anim Res 2009;36:255-260. 2. Magaña MJG, Huchin CM, Ake LJR, Segura CJC. A field study of reproductive performance and productivity of Pelibuey ewes in Southeastern Mexico. Trop Anim Health Prod 2013;45:1771-1776.

890

Rev Mex Cienc Pecu 2020;11(3):884-893

3. Knights M, Siew N, Ramgattie R, Singh-Knights D, Bourne G. Effect of time of weaning on the reproductive performance of Barbados Blackbelly ewes and lamb growth reared in the tropics. Small Ruminant Res 2012;103:205-210. 4. Nasrat MM, Segura CJC, Magaña MJG. Breed genotype effect on ewe traits during the pre-weaning period in hair sheep under the tropical Mexican conditions. Small Ruminant Res 2016;137:157-161 5. Mellado M, Macías U, Avendaño L, Mellado J, García E. Crecimiento y mortalidad predestete de corderos híbridos Katahdin. Rev Colomb Cienc Pecu 2016;29:288-295. 6. Wildeus, S. Hair sheep genetic resources and their contribution to diversified small ruminant production in the United States. J Anim Sci 1997;75:630–640. 7. Afolayan RA, Gilmour AR, Fogarty NM. Selection indexes for crossbred ewe reproduction and productivity. Proc Assoc Advt Anim Breed Genet 2007;17:491-494. 8. Vanimisetti HB, Notter DR, Kuehn LA. Genetic (co) variance components for ewe productivity traits in Katahdin sheep. J Anim Sci 2007;85:60-68. 9. Mohammadi H, Shahrbabak MM, Shahrbabak HM. Genetic analysis of ewe productivity traits in Makooei sheep. Small Ruminant Res 2012;107:105-110. 10. Bermejo LA, Mellado M, Camacho A, Mata J, Arévalo JR. Factors affecting birth and weaning weights in Canarian hair lambs. J Appl Anim Res 2010;37:273–275. 11. Hinojosa CJA, Oliva HJ, Torres HG, Segura CJC, González GR. Productividad de ovejas F1 Pelibuey x Blackbelly y sus cruces con Dorper y Katahdin en un sistema de producción del trópico húmedo de Tabasco, México. Arch Med Vet 2015;47:167-174.

12. De Dios-Vallejo OO. Ecofisiología de los bovinos en sistemas de producción del trópico húmedo. Colección José N. Rovirosa. Villahermosa, Tabasco. México. 2001. 13. SAS. SAS/STAT User´s Guide (version 9.2 ed), Cary, NC, USA: SAS, Inst. Inc. 2009. 14. Macías CU, Vicente PR, Mellado M, Correa A, Meza HCA, Avendaño RL. Maternal undernutrition during the pre- and post-conception periods in twin-bearing hair sheep ewes: Effects on fetal and placental development at mid-gestation. Trop Anim Health Prod 2017;49:1393-1400.

891

Rev Mex Cienc Pecu 2020;11(3):884-893

15. Macedo R, Arredondo V. Efecto del sexo, tipo de nacimiento y lactancia sobre el crecimiento de ovinos Pelibuey en manejo intensivo. Arch Zootec 2008;57:219-228. 16. Hinojosa CJA, Oliva HJ, Torres HG, Segura CJC, Aranda IE, González CJM. Factores que afectan el crecimiento predestete de corderos Pelibuey en el trópico húmedo de México. Universidad y Ciencia 2012;28:163-171. 17. Hinojosa CJA, Oliva HJ, Torres HG, Segura CC, González GR. Crecimiento pre y postdestete de corderos Pelibuey en clima cálido húmedo. Nova Scientia 2018;10:328351. 18. O’Shaughnessy P. Testicular development. In: Knobil and Neill's Physiology of Reproduction. Plant TM, Zeleznik AJ editors. 4th ed. USA: Elsevier Inc.; 2015. 19. Kosgey IS, van Arendonk JAM, Baker RL. Economic values for traits of meat sheep in medium to high production potential areas of the tropics. Small Ruminant Res 2003; 50:187-202. 20. Chay CAJ, Magaña MJG, Chizzoti ML, Piñeiro VAT, Canul SJR, Ayala BAJ, Ku VJC, Tedeschi LO. Requerimientos energéticos de ovinos de pelo en las regiones tropicales de Latinoamérica. Revisión. Rev Mex Cienc Pecu 2016;7:105-125. 21. Tec CJE, Magaña MJG, Segura CJC. Environmental effects on productive and reproductive performance of Pelibuey ewes in Southeastern Mexico. J Appl Anim Res 2016;44:508-512. 22. López LY, Arece GJ, Torres HG, González GR. Efecto del número de partos en el comportamiento productivo de ovejas Pelibuey y mestizos de Pelibuey en condiciones de producción. Pastos y Forrajes 2017;40:73-77. 23. Cadena CPJ, Oliva HJA, Hinojosa CA. Productivity of Blackbelly ewes and their hybrid litter under grazing. J Anim Vet Adv 2012;11:97-102. 24. Gootwine E, Spencer TE, Bazer FW. Litter-size-dependent intrauterine growth restriction in sheep. Animal 2007;1:547-564. 25. Rastle SS, D´Souza K, Redhead A, Singh KD, Baptiste Q, Knights M. Effect of system of lamb rearing and season on early post-partum fertility of ewes and growth performance of lambs in Katahdin sheep. J Anim Physiol Anim Nutr 2017;101:e21e30.

892

Rev Mex Cienc Pecu 2020;11(3):884-893

26. Mandal A, Prasad H, Kumar A, Roy R, Sharma N. Factors associated with lamb mortalities in Muzaffarnagari sheep. Small Ruminant Res 2007;71:273â&#x20AC;&#x201C;279. 27. Dwyer CM. Behavioral development in the neonatal lamb: effect of maternal and birthrelated factors. Theriogenology 2003;59:1027- 1050. 28. Wallace J. Young maternal age, body composition and gestational intake impact pregnancy outcome: Translational perspectives. In: Green L, Hester R editors. Parental obesity: Intergenerational programming and consequences. Physiology and health disease. New York, USA: Springer; 2016.

893

https://doi.org/10.22319/rmcp.v11i3.5279 Technical note

Identification of candidate genes for reproductive traits in cattle using a functional interaction network approach

Francisco Alejandro Paredes-Sánchez a Daniel Trejo-Martínez b Elsa Verónica Herrera-Mayorga c Williams Arellano-Vera d Felipe Rodríguez Almeida e Ana María Sifuentes-Rincón d*

Universidad Autónoma de Tamaulipas. IA-UAMM. Mante, México.

Instituto Politécnico Nacional. UPIIZ-, Zacatecas, México.

Universidad Autónoma de Tamaulipas IBI. UAMM. Mante, México

Instituto Politécnico Nacional. Centro de Biotecnología Genómica. Laboratorio de Biotecnología Animal. Blvd. Del Maestro esq. Elías Piña. Col. Narciso Mendoza s/n. Cd. Reynosa, Tam. México. e

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Chihuahua, México.

*Corresponding author: asifuentes@ipn.mx

Abstract: Reproduction is a key element in cattle production systems. Systems biology approaches, including those involving gene networks, have been applied to genetic dissection complex phenotypes in cattle. A set of 385 genes associated with reproductive traits in cattle were included in a protein-protein network analysis to identify and prioritize candidate genes 894

Rev Mex Cienc Pecu 2020;11(3):894-904

related to phenotypic differences in cattle reproduction. Genes belonging to the ubiquitin family - Ubiquitin C (Ubc, Gene ID: 444874) and Ubiquitin B (Ubb, Gene ID: 281370) -had the highest probability of being associated with these traits in cattle. Both proteins were identified as important hubs in a protein-protein interaction network, each having 3,775 interactions of 3,856 possible. Resequencing of the Ubb gene coding region to evaluate the presence of SNPs in a discovery population identified the G/T (rs110366695) transversion. This causes emergence of a stop codon and a protein truncated by 287 aa. The allelic frequency distributions found in two beef cattle breeds highlight the promise of further research into the effects of protein truncation and the potential of these proteins as molecular markers for semen quality. Key words: Bovine, Molecular markers, Semen quality, Ubiquitylation.

Received: 25/02/2019 Accepted: 28/08/2019 The identification of genes encoding complex traits has traditionally been achieved by genome-wide scanning and the candidate gene approach, but these methods do not constitute a reliable strategy for the systematic exploration of a genetic network that causes phenotypic variation in complex traits(1). Protein networks provide a systems-level overview of genetic organization and enable the functional modules underlying complex traits to be dissected, which facilitates the prediction of novel candidate genes for a trait(2). In cattle, some approaches related to interaction networks have been utilized to identify candidate genes related to phenotypic differences such as marbling(3), genes involved in estrus (behavior) in dairy cattle(4), and single nucleotide polymorphisms (SNPs) associated with growth traits in Mexican Charolais cows(5). Reproduction is an essential element of livestock production, and fertility traits are of particularly significant economic importance; it is a very complex process that involves numerous consecutive events, including gametogenesis, fertilization, and early embryo development, that must be accomplished in a well-orchestrated manner to achieve a successful pregnancy(6). An improved understanding of the mechanisms that control fertility traits at the organ, cellular, and molecular levels could aid the development of strategies to improve and/or monitor fertility(4). The objective of this work was to conduct a search guided by a functional interaction network to identify key genes controlling reproductive traits in cattle and explore

895

Rev Mex Cienc Pecu 2020;11(3):894-904

genetic variation in those identified genes with potential to be associated with reproductive traits. A literature review was conducted, and the Genie software (http://cbdm-01.zdv.unimainz.de/~jfontain/cms/?page_id=6) was used to perform PubMed-based text mining of genes that had been previously associated with bovine reproductive traits (reference genes). To identify and prioritize candidate genes for the functional network, the interactions of the reference genes were extracted, and the degree of association with reproduction (DAR) was calculated for each of the genes in the subnet as follows: đ??ˇđ??´đ?&#x2018;&#x2026; = ÎŁđ?&#x2018;&#x2014;â&#x2C6;&#x2C6;đ?&#x2018;&#x;đ?&#x2018;&#x2019;đ?&#x2018;&#x201C;đ?&#x2018;&#x201D;đ?&#x2018;&#x2019;đ?&#x2018;&#x203A;đ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x160;đ?&#x2018;&#x2013;đ?&#x2018;&#x2014; . ÎŁđ?&#x2018;&#x2014;â&#x2C6;&#x2C6;đ?&#x2018;&#x;đ?&#x2018;&#x2019;đ?&#x2018;&#x201C;đ?&#x2018;&#x201D;đ?&#x2018;&#x2019;đ?&#x2018;&#x203A;đ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x192;đ?&#x2018;&#x2013;đ?&#x2018;&#x2014; Where Wij is the weight of the linkage connecting protein i and reference protein j, and Pij is the number of links connecting protein i and reference protein j (excluding itself). Thus, the probability that each of these proteins is associated with reproduction was evaluated based on their interactions with genes whose biological function had already been associated with this trait(5). To select the candidate genes associated with phenotypic variations in reproductive traits, the DAR score was used to calculate the positive predictive value (PPV), which indicates the likelihood that a gene is associated with reproduction, so the selection criterion was the highest value of PPV obtained in this analysis, i.e., 0.3(5,7). From candidate genes, the Ubiquitin B (Ubb) gene was selected as a target. The genetic variation in the Ubb gene was investigated using eleven DNA samples from four different cattle breeds (3 Holstein, 2 Charolais, 3 Brahman and 3 Angus). Primers UBB-F 5â&#x20AC;&#x2122;GAGAGATTTGTGAGAGATCTTGACG-3â&#x20AC;&#x2122; and UBB-R 5â&#x20AC;&#x2122;CCATTTTAACCTGTTGAGTACCCA-3â&#x20AC;&#x2122; were designed to cover and resequence the bovine Ubb gene (GenBank accession number AC_000176.1). The resulting PCR fragments were purified using Exo-SAP-it (Thermo Fisher Scientific, Waltham, MA, USA), and bidirectional sequencing was achieved using the BigDyeÂŽ Terminator procedure and an ABI PRISM 3100 Genetic Analyzer DNA sequencer (Applied Biosystems, Foster City, CA, USA). Sequences were aligned with ClustalX 2.0.8(8). The presence of SNPs in the resulting sequences was determined by visual inspection of the sequence chromatograms, and the SNPs were defined according to their presence in the screening population associated with the three expected genotypes. Amplification-created restriction sites coupled to PCR (PCR-ACRS) were designed to genotype the nonsynonymous SNP rs110366695 identified in the previous sequencing screening, and following PCR, the fragments were digested using 2.5 U of Hinf I enzyme

896

Rev Mex Cienc Pecu 2020;11(3):894-904

and analyzed on a 2.5% agarose gel. The following digestion patterns were observed: 210+132+130+18 bp (allele G) and 210+155+150 bp (allele T). A population of sixty-seven young Angus and Charolais bulls were genotyped with PCRACRS. The allelic and genotypic frequencies were calculated for each breed, and deviations from Hardy-Weinberg equilibrium were tested by running GENEPOP statistical package version 4.2(9). A set of 385 reference genes associated with reproductive traits in cattle, through SNPs, expression profiles or their biological function, were identified. According to the PPV, the genes that presented a DARâ&#x2030;Ľ11 had a greater than 33% probability of being associated with reproductive traits in cattle, and those meeting this criterion belonged to the ubiquitin family: Ubiquitin C (Ubc; Gene ID: 444874) and B (Ubb; Gene ID: 281370). The importance of these proteins in the topology of the interaction network was determined according to the number of interactions; in this case, Ubb and Ubc have 3,775 interactions of 3,856 possible, so they are very important hubs. According to BiNGO, a Biological Network Gene Ontology tool (https://www.psb.ugent.be/cbd/papers/BiNGO), in the subnet that forms Ubb and Ubc, the annotation of Gene Ontology 51094, "positive regulation of developmental process", is overrepresented with a p-value of 4.8 E-09. This result makes sense and relates to reproduction in cattle, as this term of biological process refers to any process that activates or increases the rate or extent of development and whose specific outcome is the progression of an organism over time from an initial condition (e.g., a zygote, or a young adult) to a later condition (e.g., a multicellular animal or an aged adult). Figure 1 depicts the Ubb and Ubc interaction with 23 reference gene modules, i.e., genes previously associated with reproduction in cattle(8-33). The ubiquitin protein (Ub) is widespread in all eukaryotic cells, it has a conserved structure which has been interpreted as an indication of its important role in cell metabolism. Through the process of ubiquitination, Ub lead protein degradation and regulate a different biological events including cell cycle progression, membrane-receptor endocytosis, antigen occurrence in the immune system, and even retroviral infection(34). Ubiquitination is achieved through the covalent binding of 76-AA, 8.5 kDa ubiquitin to the Îľ-amino group on the Lys-residues of the substrate via the C-terminal AA residuum of ubiquitin (G76). This process requires ATP hydrolysis and a set of ubiquitin-conjugating factors including ubiquitin-activating (UBA) and conjugating (Ubc) enzymes(11). Among multiple functions of Ub system, those involved in developmental and reproductive processes are relevant. In the former case, there are studies in different models including developmental transitions in Dictyostelium discoideum and development specificity in C. elegans(35,36). In chicks it has been involved in embryogenesis, and also in the human 897

Rev Mex Cienc Pecu 2020;11(3):894-904

myogenesis and brain development(34). At reproductive processes level, human Ub has been reported as the main protein in seminal plasma and the ubiquitination system has been implicated with fertility problems in humans and other species including cattle(37,38). It has been reported that a high proportion of ubiquitinated spermatozoa in the ejaculates of different species is related to infertility(38). In cattle, increased ubiquitin levels have been associated with both increased levels of damage to sperm DNA and with reduced fertility(39). A negative correlation between sperm ubiquitin and sperm count, swirl and % normal morphology has been reported in bulls and evidence that increased ubiquitin levels in bull sperm are predictive of both poor semen quality and fertility has been also found (39). This evidence has allowed the use of ubiquitinated spermatozoa as an useful tool to identify fertility problem(40,41). Even though there is some evidence that the biological mechanisms through ubiquitination systems affect the different species fertility, the process of spermatozoon ubiquitin tagging and the role of this process in sperm biology remains unclarified. Searching for additional evidence to consider these genes as candidate genes, molecular characterization was achieved on the Ubb gene. According to the NCBI database, the length of the gene is 1898 bp, and it contains one exon at position 841 to 1758. In this database, 19 and 15 SNPs have been reported in the coding and noncoding sequences, respectively, and the amplified 1328-bp fragment enabled the identification of 5 SNPs in the study population, 3 (rs109592218, rs110007734 and rs110366695) in the coding region and 2 (rs720990890 and rs439271103) in the noncoding region. The transversion rs110366695 (G/T) located at exon 1 is particularly interesting because it causes a nonsynonymous functional change, and the GAG codon that produces glutamic acid (Glu, E) changes to UAG, which is a stop codon, thus predicting a truncated protein that is 287 amino acids shorter than the nonmutated protein. Figure 1 shows the allelic frequencies of SNP rs110366695 evaluated in the Angus and Charolais beef cattle breeds; allele G showed the highest frequencies (0.542 and 0.750, respectively). SigniďŹ cant departures (P<0.001) from Hardy-Weinberg equilibrium were identiďŹ ed for the Angus breed, and lower-than-expected numbers of heterozygotes were found for these loci.

898

Rev Mex Cienc Pecu 2020;11(3):894-904

Figure 1: Ubb and Ubc interaction network

A) Heifer conception rate, SNPs related to interval to insemination. B) Effects of the Well of the Well (WOW) system and embryo density on developmental rates, genes differentially regulated in embryos cultured in vitro. C) Daughter pregnancy rate, heifer conception rate, cow conception rate. D) Term survival in embryos of differentially regulated genes, potential of pretransfer endometrial and embryo gene expression patterns E) Blocking apoptosis in bovine embryos, gene differentially regulated embryos treated with CSF2. F) Immune function and developmental genes expressed in the endometrium, endometrial genes differentially regulated in lactating cows. G) Genes differentially regulated in oocytes compared to 8-cell embryos, global activation of the embryonic genome. H) Cow conception rate. I) Igf1 acts in thermoprotection on bovine embryos, genes differentially regulated in embryos treated with Igf1. J) Endometrial genes differentially regulated in pregnant cows and associations with fertility of lactating dairy cows. K) Genes differentially regulated in oocytes compared to blastocysts, candidate genes for the characterization of the development. L) Liver genes differentially regulated during the transition period, determination of hepatic adaptations occurring from late pregnancy. M) Genes differentially regulated in the oviduct of cows at diestrus compared to estrus. N) Genes in cumulus cells regulated by the LH surge, cumulus cells in development and fertility of oocytes. O) Genes differentially regulated at different stages of oocyte maturation. P) Estimated relative conception rate, net merit, and fat yield. Q) Calving rate (beef cattle), net merit, fat percent, and productive life. R) SNPs related to interval to insemination. S) Embryo development on the blastocyst stage. T) Differential regulation in cumulus cells from in vivo embryos compared to in vitro embryos. U) Antiapoptotic in embryos improves embryo competence. V) Mammary genes differentially regulated during lactation.

To the current knowledge, there have been no previous molecular studies aimed at evaluating the effects of Ubb genetic variation on semen quality despite the demonstrated physiological importance of the Ubb gene. The obtained results support the Ubb gene as a strong candidate gene with genetic variations to be tested for association with reproductive traits.

899

Rev Mex Cienc Pecu 2020;11(3):894-904

Unfortunately, in Mexico, phenotyping for reproductive traits is not a common practice, and additional efforts must be made to prepare a wide database that allows confirmation of its genetic influence on these traits, particularly of the transversion rs110366695 (G/T). An analysis-based protein-protein interaction network has been previously validated as a useful tool for identifying causal genes associated with economic traits in bovines and other species. The obtained results provide information about the potential of Ubb and Ubc as candidate genes for reproductive traits, particularly semen quality, and justify further research aimed at exploring both the effects of protein truncation and its potential as a molecular marker.

Acknowledgments The authors acknowledge the financial support received from the research grant project CONACYT 294826 and SIP 20195072.

Literature cited: 1. Jiang Z, Ott TL. Reproductive genomics in domestic animals. Iowa, USA: WileyBlackwell; 2010. 2. Lee T, Hwang S, Kim CY, Shim H, Kim H, Ronald P, et al. WheatNet: A genome-scale functional network for hexaploid bread wheat, Triticum aestivum. Mol Plant 2017;(8):1133-1136. 3. Lim D, Kim NK, Park HS, Lee SH, Cho YM, Oh SJ, et al. Identification of candidate genes related to bovine marbling using protein-protein interaction networks. Int J Biol Sci 2011;(7):992-1002. 4. Hulsegge I, Woelders H, Smits M, Schokker D, Jiang L, Sørensen P. Prioritization of candidate genes for cattle reproductive traits, based on protein-protein interactions, gene expression, and text-mining. Physiol Genomics 2013;(10):400-406. 5. Paredes-Sánchez FA, Sifuentes-Rincón AM, Segura CA, García PCA, Parra BGM, Ambriz MP. Associations of SNPs located at candidate genes to bovine growth traits, prioritized with an interaction networks construction approach. BMC Genet 2015;(91):1-12. 6.- Han Y, Peñagaricano F. Unravelling the genomic architecture of bull fertility in Holstein cattle. BMC Genet 2016;(1):143.

900

Rev Mex Cienc Pecu 2020;11(3):894-904

7. Garza-Brenner E, Sifuentes-Rincón AM, Randel RD, Paredes-Sánchez FA, ParraBracamonte GM, et al. Association of SNPs in dopamine and serotonin pathway genes and their interacting genes with temperament traits in Charolais cows. J Appl Genet 2016;(3):1-9. 8. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007;(21):2947-2848. 9. Raymond M, Rousset F. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. J Heredity 1995;(3):248-249. 10.- Cory AT, Price CA, Lefebvre R, Palin MF. Identification of single nucleotide polymorphisms in the bovine follicle-stimulating hormone receptor and effects of genotypes on superovulatory response traits. Anim Genet 2013;(2):197-201. 11.- Hoelker M, Rings F, Lund Q, Ghanem N, Phatsara C, Griese J. Effect of the microenvironment and embryo density on developmental characteristics and gene expression profile of bovine preimplantative embryos cultured in vitro. Reproduction 2009;(3):415-425. 12.- Cochran SD, Cole JB, Null DJ, Hansen PJ. Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle. BMC Genet 2013;(49):14-49. 13.- Fair T, Carter F, Park S, Evans AC, Lonergan P. Global gene expression analysis during bovine oocyte in vitro maturation. Theriogenology 2007;(68):91-97. 14.- Salilew WD, Hölker M, Rings F, Ghanem N, Ulas-Cinar M, Peippo J, et al. Bovine pretransfer endometrium and embryo transcriptome fingerprints as predictors of pregnancy success after embryo transfer. Physiol Genomics 2010;(2):201-218. 15.- Loureiro B, Oliveira LJ, Favoreto MG, Hansen PJ. Colony-stimulating factor 2 inhibits induction of apoptosis in the bovine preimplantation embryo. Am J Reprod Immunol 2011;(65):578-588. 16.- Cerri RL, Thompson IM, Kim IH, Ealy AD, Hansen PJ, Staples CR, et al. Effects of lactation and pregnancy on gene expression of endometrium of Holstein cows at day 17 of the estrous cycle or pregnancy. J Dairy Sci 2012;(10):5657-575. 17.- Fayad T, Lévesque V, Sirois J, Silversides DW, Lussier JG. Gene expression profiling of differentially expressed genes in granulosa cells of bovine dominant follicles using suppression subtractive hybridization. Biol Reprod 2004;(2):523-533.

901

Rev Mex Cienc Pecu 2020;11(3):894-904

18.- Misirlioglu M, Page GP, Sagirkaya H, Kaya A, Parrish JJ, First NL, et al. Dynamics of global transcriptome in bovine matured oocytes and preimplantation embryos. Proc Natl Acad Sci 2006;(50):18905-18910. 19.- Cochran SD, Cole JB, Null DJ, Hansen PJ. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle. Biol Reprod 2013;(3):1-7. 20.- Bonilla AQ, Oliveira LJ, Ozawa M, Newsom EM, Lucy MC, Hansen PJ. Developmental changes in thermoprotective actions of insulin-like growth factor-1 on the preimplantation bovine embryo. Mol Cell Endocrinol 2011;(1-2):170-179. 21.- Mamo S, Sargent CA, Affara NA, Tesfaye D, El-Halawany N, Wimmers K, Gilles M, Schellander K, Ponsuksili S. Transcript profiles of some developmentally important genes detected in bovine oocytes and in vitro-produced blastocysts using RNA amplification and cDNA microarrays. Reprod Domest Anim 2006;(6):527-534. 22.- Graber M, Kohler S, Kaufmann T, Doherr MG, Bruckmaier RM, van Dorland HA. A field study on characteristics and diversity of gene expression in the liver of dairy cows during the transition period. J Dairy Sci 2010;(1):5200-5215. 23.- Bauersachs S, Rehfeld S, Ulbrich SE, Mallok S, Prelle K, Wenigerkind H, et al. Monitoring gene expression changes in bovine oviduct epithelial cells during the oestrous cycle. J Mol Endocrinol 2004;(2):449-466. 24.- Assidi M, Dieleman SJ, Sirard MA. Cumulus cell gene expression following the LH surge in bovine preovulatory follicles: potential early markers of oocyte competence. Reproduction 2010;(6):835-852. 25.- Salhab M, Tosca L, Cabau C, Papillier P, Perreau C, Dupont J, et al. Kinetics of gene expression and signaling in bovine cumulus cells throughout IVM in different mediums in relation to oocyte developmental competence, cumulus apoptosis and progesterone secretion. Theriogenology 2011;(1):90-104. 26.- Khatib H, Monson RL, Huang W, Khatib R, Schutzkus V, Khateeb H, et al. Short communication: Validation of in vitro fertility genes in a Holstein bull population. J Dairy Sci 2010;(93):2244-2249. 27.- Rosenkrans Jr C, Banks A, Reiter S, Looper M. Calving traits of crossbred Brahman cows are associated with Heat Shock Protein 70 genetic polymorphisms. Anim Reprod Sci 2010;(3-4):178-182.

902

Rev Mex Cienc Pecu 2020;11(3):894-904

28.- Pimentel EC, Bauersachs S, Tietze M, Simianer H, Tetens J, Thaller G, et al. Exploration of relationships between production and fertility traits in dairy cattle via association studies of SNPs within candidate genes derived by expression profiling. Anim Genet 2011;(3):251-262. 29.- Gad A, Besenfelder U, Rings F, Ghanem N, Salilew-Wondim D, Hossain MM, et al. Effect of reproductive tract environment following controlled ovarian hyperstimulation treatment on embryo development and global transcriptome profile of blastocysts: implications for animal breeding and human assisted reproduction. Hum Reprod 2011;(7):1693-1707. 30.- Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, et al. Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. Mol Reprod Dev 2009;(7):665-677. 31.- Jousan FD, Hansen PJ. Insulin-like growth factor-I promotes resistance of bovine preimplantation embryos to heat shock through actions independent of its anti-apoptotic actions requiring PI3K signaling. Mol Reprod Dev 2007;(2):189-196. 32.- Mani O, Kรถrner M, Sorensen MT, Sejrsen K, Wotzkow C, Ontsouka CE, et al. Expression, localization, and functional model of cholesterol transporters in lactating and nonlactating mammary tissues of murine, bovine, and human origin. Am J Physiol Regul Integr Comp Physiol 2010;(2):642-654. 33.- Fortes MR, Reverter A, Nagaraj SH, Zhang Y, Jonsson NN, Barris W, et al. A single nucleotide polymorphism-derived regulatory gene network underlying puberty in 2 tropical breeds of beef cattle. J Anim Sci. 2011;(6):1669-1683. 34.- Bebington C, Doherty FJ, Fleming SD. The possible biological and reproductive functions of ubiquitin. Hum Reprod Update 2001;(1):102-111. 35.- Clark A, Nomura A, Mohanty S, Firtel RA. A ubiquitin-conjuganting enzyme is essential for developmental transitions in Dictiostelium. Mol Biol Cell 1997;(8):1989-2002. 36.-Zhen M, Schein JE, Baille DL, Peter E, Candido M. An essential ubiquitin conjugating enzyme with tissue and developmental specificity in the nematode C. elegans. EMBO J 1996;(15):3229-3237 37.-Muratori M, Marchiani S, Forti G, Baldi E. Sperm ubiquitination positively correlates to normal morphology in human semen. Hum Reprod 2005;(20):1035-1043. 38.- Sutovsky P, Geary T, Baska KM, Manandhar G, Feng D, Lovercamp KW, Sutovsky M. Ubiquitin as an objective marker of semen quality and fertility in bulls. Proc Nebraska Appl Reprod Strat in Beef Cattle 2004;185-199.

903

Rev Mex Cienc Pecu 2020;11(3):894-904

39.- Rodríguez-Lozano I, Ávalos-Rodríguez A, Castillo-Juárez H, Borderas-Tordesillas F, Roa-Vidal JJ, Rosales-Torres AM. Percentage of ubiquinated spermatozoa does not correlate with fertilizing capacity of thawed bovine semen. Reprod Dom Anim 2013;(1):27-31. 40.- Sutovsky P, Terrada Y, Schatten G. Ubiquitin-based sperm assay for the diagnosis of male factor infertility. Hum Reprod 2001;(2):250–258. 41.- Sutovsky P, Hauser R, Sutovsky M. Increased levels of sperm ubiquitin correlate with semen quality in men from an andrology laboratory clinic population. Hum Reprod 2004;(3):628–638.

904

https://doi.org/10.22319/rmcp.v11i3.5127 Technical note

Effect of group size on processing time and some stress-related behaviors in cattle in straight chutes

Miguel Ángel Damián a Virginio Aguirre a Agustín Orihuela a* Mariana Pedernera a Saúl Rojas b Jaime Olivares b

Universidad Autónoma del Estado de Morelos. Facultad de Ciencias Agropecuarias. Avenida Universidad 1001 Colonia Chamilpa, 62210, Cuernavaca, Morelos. México. b

Universidad Autónoma de Guerrero. Facultad de Medicina Veterinaria y Zootecnia, Cd. Altamirano, Guerrero. México.

* Corresponding author: aorihuela@uaem.mx

Abstract: Stress during handling can affect welfare in beef cattle and pose a risk to handlers. An evaluation was done of processing time and stress-related behavior (vocalization, turning, jumping, hitting, falling) in cattle during transit through a straight chute. Eight herds of 50 Brahman x Swiss Brown animals each were processed over an 8-d period. Each herd contained the same proportions of young to adult animals, and female to male ratios. Four herds were processed in small groups of four to five animals (TS), and the remaining four in groups of ten to twelve animals (TG). Processing involved moving the animals through a 13m long straight chute during which they were injected with 1% Ivermectin. Processing time was shorter (P<0.05) in the TS (42.5 ± 2.2 min) than in the TG (51.04 ± 1.9 min). Vocalization (5.5 ± 0.6 vs 7.7±0.2), turning (6.3 ± 0.4 vs. 9.5 ± 0.6), and jumping (2.7 ± 0.5

905

Rev Mex Cienc Pecu 2020;11(3):905-913

vs. 5.2 ± 0.5) occurred less frequently (P<0.05) in the TS than in the TG. No differences between treatments (P>0.05) were observed for hitting (TS: 2.7 ± 0.4; TG: 5.5 ± 1.7) or falling (TS: 2 ± 0.4; TG: 3.7 ± 1.0). Processing small groups resulted in shorter processing times, less stress to animals and lower risk of injury to animals and handlers. This practice is a viable option for improving processing efficiency and animal welfare in semi-intensive tropical beef cattle systems. Key words: Animal welfare, Behavior, Installations, Straight chute.

Received: 24/10/2018 Accepted: 25/07/2019

In extensive and semi-extensive cattle systems animals graze most of the time and are only driven to corrals once or twice a year for management practices such as marking, castration and administration of preventive medicine(1). Under some circumstances management practices are implemented in inadequate facilities; for example, in tropical rural areas in Mexico infrastructure is often deficient and rustic, consisting of a straight handling chute and sometimes a corral, generally built with local materials(2). Lack of facilities prevents management of homogeneous lots (size, age and sex), and infrequent management does not allow livestock to adjust to facilities and the presence of wranglers. These factors, in conjunction with inadequate wrangler training(3), can cause stress in the animals and difficulty in handling, which in turn can increase risk of injury for both wranglers and animals(4,5). Economic losses can result due to misapplication of treatments, livestock injuries, personnel accidents(6), weight loss, reproductive failures or mortality in animals, and compromised meat quality(7). Overcrowding and handling of large groups are among the variables that generally increase tension and stress in cattle(8). Animals stressed during handling exhibit important physiological alterations that stimulate behaviors such as urinating, defecating and salivating, as well as vocalizations, falls, slips, blows and jumping(9). Stressful conditions can cause animals to emit pheromones that can be perceived by other animals, leading to alertness and stress, and preventing them from being moved easily(10). In contrast, calm cattle more easily enter a squeeze chute; however, if an animal struggles and becomes stressed, the remaining animals in the group often refuse to enter easily, hindering flow(11,12).

906

Rev Mex Cienc Pecu 2020;11(3):905-913

Handling small groups can facilitate animal flow through chutes, reducing stressful situations and risky behaviors. This can help to improve animal well-being and promote more efficient handling. The present study objective was to evaluate transit speed and stress-related behavior incidence during processing of cattle groups of different sizes through a straight chute for application of medication. The study was done in conjunction with commercial beef cattle producers in the state of Guerrero, Mexico (18°25’ N; 100°31’ W). Regional climate is dry warm (AW0), vegetation in the study area is dry tropical forest, and altitude is 250 m asl. The study was done during the dry season, with a 35 to 40 °C high temperature and 25 % average relative humidity. Cattle in this region are handled once to twice a year using a straight chute and a basic corral shared by different ranchers in the area. Handling was done using a 13 x 0.8 m straight chute, built of steel pipe and concrete posts, with a dirt floor and no shade. At one end the chute was a sliding steel pipe gate and at the other a pipe crossbar to prevent the last animal in the group from backing out. After transport and before handling the animals were housed for 20 min in a 300 m2 holding pen with 50 % shade and free access to water in a 2.0 x 1.0 x 0.8 m trough. Corral walls formed a funnel feeding into the chute. Upon exiting the chute the animals were housed in another corral very similar to the previous one. Here they remained until the entire herd had been processed, and were then returned to grazing areas. Eight commercial herds were involved in the experiment. Each consisted of fifty Brahman x Swiss Brown individuals (crosses in different proportions) reared in a semi-extensive management system. Each herd contained 20% animals between 8 months and 2 yr of age (n = 10), 30 % between 2 to 4 yr (n = 15) and 50 % of 4 or more yr of age (n = 25). The sex ratio in each herd was 90 % female to 10 % male. A different herd was processed each day for eight contiguous days (13 to 20 February 2018). General handling conditions were uniform throughout the evaluation period. On the day a herd was to be processed the animals were moved at 0600 h from the grazing area to the handling facilities. Movement was done by herding for 30 or 40 min using low intensity handling techniques until they entered the holding pen. The eight herds were randomly assigned to one of two treatments: small groups (TS) or large groups (TG). In the TS, groups of four to five animals were randomly chosen from the herd, moved into the chute and the medication (1% Ivermectin) applied. Once processing of the group was complete, a group of similar size was moved into the chute, and this repeated until the entire herd was processed. In the TG, groups of ten to twelve animals (i.e. maximum chute capacity) were moved into the chute and processed. Again this was repeated until the entire herd was processed. The treatments were conducted alternately during the eight-day period. Handling was low intensity and done by four experienced wranglers. A veterinary

907

Rev Mex Cienc Pecu 2020;11(3):905-913

doctor applied the subcutaneous injection while the animals were in the chute. Data (i.e. times, behavior) was recorded by a trained technician (Table 1). Table 1: Ethogram of behaviors evaluated during cattle processing in a straight chute using small and large groups Variable

Measurement

Vocalization Falling Hitting

Animals emitted sounds or calls from throat or snout. Animals lost support of limbs and fell to ground. Animals hit or tried to hit other animals, wranglers and/or installations using hooves or head, or tried to trample. Animals advanced or tried to advance over other animals in group. Animals turned around in chute and tried to move against the flow.

Jumping Turning

During evaluation only the number of animals that exhibited the recorded behaviors was considered, regardless of the frequency with which they occurred. Animal processing time was analyzed with a Student t test comparing TS vs TG. Each animal was considered an experimental unit within each replicate, and each herd was treated as a replicate within each treatment. Behavioral variable data was compared between the two treatments using the Mann-Whitney test. Finally, a correlation analysis of Kendall’s Tau ranges was run between the variables of time and number of animals that vocalized, fell, hit, jumped and/or turned. The average time required to process the fifty animals in each herd was shorter (P<0.05) in the TS (42.5 ± 2.2 min) than in the TG (51.04 ± 1.9 min). Fewer (P<0.05) animals vocalized, turned, and jumped in the TS than in the TG: vocalization, 5.5 ± 0.6 vs 7.7 ± 0.2; turning, 6.3 ± 0.4 vs. 9.5 ± 0.6, jumping, 2.7 ± 0.5 vs. 5.2 ± 0.5 (Figure 1). No differences between treatments (P>0.05) were observed in the number of animals that fell or hit. Processing time was significantly correlated (r= 0.56 to 0.79; P˂0.01) with the number of animals that vocalized, fell, hit, jumped and turned (Table 2).

908

Rev Mex Cienc Pecu 2020;11(3):905-913

Figure 1: Average (Âą SE) processing time and number of animals exhibiting stress-related behaviors in cattle in small (TS) and large (TG) groups in a straight chute

Different letters above columns in the same factor indicate difference (P<0.05).

Table 2: Correlation of ranges (Kendallâ&#x20AC;&#x2122;s Tau) for studied stress-related variables in cattle in small and large groups in a straight chute

Time Vocalizing Falling Hitting Jumping

Vocalizing 0.677**

Falling 0.624** 0.733***

Hitting 0.562** 0.699** 0.760***

Jumping 0.790*** 0.758*** 0.803*** 0.688**

Turning 0.717*** 0.794*** 0.678** 0.740*** 0.812***

*(P<0.05), **(P<0.01), ***(P<0.001).

Processing smaller groups led to more efficient handling that was apparently safer for animals and wranglers since less frequent occurrence of stress-related behaviors reduces the risk of injury to animals or wranglers during chute transit. The number of animals which exhibited the evaluated behaviors was highly correlated to processing time. This suggests that the longer processing time required for larger groups causes animals to exhibit aggressive behaviors, perhaps due to longer exposure to extreme climate conditions, invasion of individual space when inside the facilities, and contact with unfamiliar handlers. More frequent occurrence of these behaviors slows overall processing time, further exacerbating

909

Rev Mex Cienc Pecu 2020;11(3):905-913

the conditions causing these behaviors. These results coincide with previous reports indicating that animals exhibit progressively more aggressive behaviors as containment time increases(13,14). Group size determined the difference between the TS and TG treatments. When the chute was filled to maximum capacity with animals of different sizes, ages and sexes it caused inevitable invasion of individual space. Submissive animals were thus forced into proximity with dominant animals, propitiating a greater number of animals manifesting behaviors indicative of stress. Well-established dominance-submission relationships exist in established herds, and are important in allowing animals to coexist(15). Forced interaction between animals of different hierarchical levels is a biological stressor, as are increased density and creation of new groups containing different age and weight ranges(16). Stressors such as these are indicative of poor livestock management practices and are associated with greater reactivity, more undesirable behaviors and a higher risk of accidents(17,18). In other words, any situation that unsettles normal social organization in an animal population can trigger different degrees of stress(14,19). In the present study this was caused by changes in the spatial environment during chute loading. Processing of larger groups may also have particularly negative effects on the final animals in the chute. Due to the number of animals in line before them, they may perceive a larger number of stress signals and consequently balk at advancing. Longer processing times can also promote increased emission of stress signals, both behavioral and chemical, generating stress among the final animals in a group(20). Similar results have been reported previously in Bos taurus cattle in which small groups were found to move to slaughter more easily, with fewer vocalizations, slips and falls(21,22,23). The present results suggest that processing cattle in smaller groups is a relatively simple way of reducing stress-related behaviors at no extra cost. A main advantage is that it can be implemented using the basic infrastructure existing at most ranches in semi-extensive tropical conditions. Processing cattle in small groups requires less time overall and fewer animals exhibit stress-related behaviors during their time in the chute. This minor change in practices can therefore increase system efficiency while improving animal welfare.

Conflict of interest The authors declare no conflict of interest in the present study.

910

Rev Mex Cienc Pecu 2020;11(3):905-913

Acknowledgements

The authors thank the participating ranchers for allowing the use of their facilities, herds and wranglers. The research reported here was supported by a Ph.D. scholarship from the Consejo Nacional de Ciencia y Tecnología (CONACYT).

Literature cited: 1.

Garcia MA, Albarran PB, Avilez NF. Dynamics and trends in dual purpose cattle management in southern Estado de México. Agrociencia 2015;9(2):125-139.

Nájera GA, Piedra MR, Albarrán PB, García MA. Changes in dual purpose livestock farming system in the dry tropic of Estado de Mexico. Agrociencia 2016;50(6):701-710.

Sant´Anna CA, Paranhos da Costa MJR. Como as práticas de bea podem mehorar a bovinocultura moderna. Simpósio da Ciência do Bem-estar Anima. Escola de veterinária da UFMG Belo Horizote MG, Brazil. 2009:42-47.

Breuer K, Hemsworth PH, Barnett JL, Matthews LR, Coleman GR. Behavioral response to humans and the productivity of commercial dairy cows. Appl Anim Behav Sci 2000;66(4):273-288.

Sutherland AM, Dowling KS. The relationship between responsiveness of first-lactation heifers to humans and the behavioral response to milking and milk production measures. J Vet Behav 2014;9(1):30-33.

Paranhos da Costa MJR, Macedo de Toledo L, Schidek A. Boas Pácticas de manejo, Vacinação. 1a ed. Jaboticabal, Brazil: Livraria & Editora Funep; 2006.

Gallo C, Tadich N. Transporte terrestre de bovinos: efectos sobre el bienestar animal y la calidad de la carne. Agrociencia 2005;21(2):37-49.

Costa A, Dasso L. Manejo de bovinos en sistemas productivos: Caracterización de dos estilos de manejo y niveles sanguíneos de cortisol. Red Vet 2007;8(1):1695-7504.

911

Rev Mex Cienc Pecu 2020;11(3):905-913

Vieuille TC, Signoret JP. Pheromonal transmission of an aversive experience in domestic pig. J Chem Ecol 1992;18(9):1551-1557.

10. Grandin T. Assessment of stress during handling and transport. J Anim Sci 1997;75(1):249–257. 11. Muñoz D, Strappini A, Gallo C. Indicators of animal welfare to detect problems in the box of desensitization of bovines. Arch Vet Med 2012;44(3):297-302. 12. Romero PM, Sanchez VJ. Animal welfare during transport and its relationship with meat quality. J MVZ Cordoba 2012;17(1):2936-2944. 13. Burdick NC, Rundel RD, Carroll JA, Welsh Jr TH. Interaction between temperament, stress, and immune function in cattle. Int J Zool 2011;20(11):1-9. 14. Proudfoot K, Habing G. Social stress as a cause of diseases in farm animals: current knowledge and future directions. Vet J 2015;206(1):15-21. 15. Fukasawa M, Tsakada H. Relationship between milk cortisol concentration and the behavioral characteristics of postpartum cows introduced to a new group. Anim Sci J 2010;81(5):612-617. 16. Asres A, Amha N. Efect of stress on animal health: a review. J Biol Agric Health 2004;4(27):116-121. 17. Ceballos MC, Sant´Anna AC, Góis KCR, Ferraudo AS, Negrao JA, Paranhos da Cosdta MJR. Investigating the relation-ship between human-animal interactions, reactivity, stress response and reproductive performance in Nellore heifers. Livest Sci 2018;217(1):65-75. 18. Ceballos MC, Sant´Anna AC, Boivin X, Oliveira Costa FO, Carvalhal MV de L, Paranhos da Costa MJR. Impact of good practices of handling training on beef cattle welfare and stock people attitudes and behaviors. Livest Sci 2018;216(1):24-31. 19. Enríquez D, Hotzel M, Ungerfeld R. Minimizing the stress of beef calves: a review. Acta Vet Scand 2011;53(1):2-8. 20. Orihuela JA, Solano JJ. Relationship between order of entry in slaughterhouse raceway and time to traverse raceway. Appl Anim Behav Sci 1994;40(3):313-317. 21. Grandin T, Deesing MJ, Struthers JJ, Swinker AM. Cattle with hair whorl patterns above the eyes are more behaviorally agitated during restraint. Appl Anim Behav Sci 1995;46(1-2):117-123.

912

Rev Mex Cienc Pecu 2020;11(3):905-913

22. Grandin T. Improving animal welfare: A practical approach. 2nd ed. Wallingford, UK: CABI International; 2015. 23. EnrĂquez DH, Ungerfeld R, Quintans G, Guidoni AL, Hotzel MG. The effects of alternative weaning methods on behaviour in beef calves. Livest Sci 2010;128(1-3):2027.

913

https://doi.org/10.22319/rmcp.v11i3.4717 Technical note

Diversity of melliferous flora in the State of Tamaulipas, Mexico

Mario González-Suárez a Arturo Mora-Olivo a* Rogel Villanueva-Gutiérrez b† Manuel Lara-Villalón a Venancio Vanoye-Eligio a Antonio Guerra-Pérez a

Universidad Autónoma de Tamaulipas, Instituto de Ecología Aplicada. Cd. Victoria, Tamaulipas, México. b

El Colegio de la Frontera Sur, Unidad Chetumal. Chetumal, Quintana Roo, México.

*Corresponding author: amorao@uat.edu.mx

Abstract: Apiculture continues to grow steadily in Mexico as does interest in potential nectariferous and polliniferous flora in different states. An inventory was made of melliferous plant species in the state of Tamaulipas, Mexico, visited by Apis mellifera L. in different annual seasons. Field work was done between 2012 and 2015. Plant species whose flowers were visited by A. mellifera were documented, including data on life form, growth form, origin, resource production, vegetation type and flowering time. A total of 215 species were recorded belonging to 173 genera and 60 families of phanerogamic plants. Most are native species (87.91 %) and herbaceous (42.32 %). Fabaceae and Asteraceae are the most common families. The highest proportion of plants are nectariferous (45.12 %), followed by nectariferous-polliniferous (40 %) and polliniferous (14.88 %). Secondary vegetation and dry tropical forest contain the largest number of these species, and provide the greatest floral resources during the summer season. 914

Rev Mex Cienc Pecu 2020;11(3):914-932

Key words: Melliferous flora, Flowering season, Nectar, Pollen, Tamaulipas.

Received: 11/12/2017 Accepted: 18/04/2019

Wild and cultivated flora are vital natural resources for humans because they provide multiple benefits. Seeds, flowers and fruit can be used directly by humans, while other products such as nectar can be processed by bees to produce honey(1). Use of honey began in prehistory when people harvested honeycombs from beehives in holes or cracks in trees and rocks(2). Before European contact in the 16th Century, beekeeping in Mexico concentrated on native bees (meliponiculture). It was not until the early 20th Century, about 1920, that modern apiculture practices employing Apis mellifera began to spread(3). Wulfrath and Speck(4), and Ordetx et al(5) published the first studies on flora in Mexico used by A. mellifera, including nationwide inventories of melliferous plants. Regions such as the Yucatan Peninsula have been intensively studied to identify nectariferous-polliniferous flora(6-10). Additional studies on apiculturally important flora have been done in states such as Michoacán(11), Colima(12), Guerrero(13), Chiapas(14) and Veracruz(15). Various local studies of melliferous flora have been done throughout Mexico, the south having received much more attention than the north. In the state of Tamaulipas, in Mexico’s northeast, a preliminary list was collated of the plants visited by Apis mellifera L. in the El Cielo Biosphere Reserve(16). This was followed at the turn of the century by a catalog of the main nectariferous and polliniferous species in the state(1), and then a list of 147 wild and cultivated polliniferous and nectariferous plant species(17). Floral diversity in Tamaulipas has been estimated at 5,000 wild species(18); to date 4,278 species have been recorded(19). The state’s flora is distributed in twenty vegetation types defined by the Rangeland Coefficients Technical Advisory Commission (Comisión Técnico Consultiva de Coeficientes de Agostadero – COTECOCA), and there are extensive citrus orchards and other introduced melliferous agricultural crops(1). Although Tamaulipas contains extensive floral resources it has not met its full potential for honey production; in other words, current honey production is not proportional to the existing plant resources. One reason for this underutilization is limited knowledge of melliferous native and introduced plant species(1).

915

Rev Mex Cienc Pecu 2020;11(3):914-932

Honey production in Tamaulipas ranks eighth nationwide and apiculture and honey consumption has increased significantly in recent years. For example, 14,069 beehives were registered in 2000, which increased to 17,764 in 2008 and 22,000 in 2010(20,21). There are currently 350 registered producers in the state belonging to twelve beekeeping associations, which have an overall annual honey production of 716 t, valued at approximately 30 million pesos (~1.5 million dollars)(22). The present study objective was to expand current knowledge of melliferous flora diversity in Tamaulipas, concentrating on the nectariferous and polliniferous plant species visited by A. mellifera in the different seasons and at various study sites. This data will help beekeepers to take full advantage of floral resources and more efficiently manage them, potentially resulting in greater honey production. Located in northeast Mexico (22°12’31”, 27°40’52” N; 97°08’38”, 100°08’51” W), Tamaulipas is the seventh largest state in the country (7,982,900 ha). To the north is the border with the United States of America, to the south the states of Veracruz and San Luis Potosí, to the west the state of Nuevo León and to the east the Gulf of Mexico(23). Its varied topography includes dry, semi-dry, warm, semi-warm and temperate climates. Semi-dry warm and dry very warm climates predominate on the coastal plain. In mountainous areas sub-humid semi-warm to sub-humid temperate climates occur, depending on slope orientation and altitude. The most characteristic soils of Tamaulipas are phaeozems, vertisols, luvisols, xerosols, cambisols, regosols, rendzines and lithosols. Others such as gleysols are common throughout the coastal zone and fluvisols are found on the banks of rivers and streams(23). Tamaulipas includes a large portion of the Northeast Coastal Plain, which extends south from the Rio Grande along the Gulf of Mexico coastline. This is bordered to the west by the Sierra Madre Oriental mountains, with altitudes as high as 3,450 m. The twenty vegetation types defined by the COTECOCA include jungle, forest, bush, palm groves, grasslands, halophyte and wetlands groups, as well as agricultural areas(1). Of the state’s total area, 557,566 ha are used for irrigated agriculture; 1,118,412 ha for seasonal agriculture; 852,454 ha for forestry; 4,683,528 ha for livestock production; and 770,940 ha for other uses(1). Field work was done between 2012 and 2015, during all four annual seasons. A sample of 27 apiaries was selected in eleven municipalities with different vegetation types (natural and agricultural) and physiographic characteristics (Table 1, Figure 1). Each apiary location was GPS logged (Garmin GPS73 geopositioner), using the Universal Transverse Mercator (UTM) coordinate system (Zone 14, WGS 84 datum). Flowering specimens were collected from a 2 km area surrounding each apiary, a distance based on the estimated average flight distance of A. mellifera(12). Specimens were collected using scissors, plastic bags and a 916

Rev Mex Cienc Pecu 2020;11(3):914-932

botanical press. Plant species frequently visited by A. mellifera were recorded by visually monitoring bee flower visits to a specific plant species for 5 to 10 min(24,25).

No. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

Municipality Llera Llera Llera Güémez Güémez Victoria Mante Hidalgo Hidalgo Hidalgo Güémez Güémez Güémez Padilla Padilla Padilla Soto la Marina Jaumave Jaumave Jaumave Tula Tula Tula Tula San Fernando San Fernando Burgos

Table 1: Data for selected apiaries Apiary N W Alt. (m asl) ANG 2582494 498097 497 LLE 2580148 500744 255 SAJ 2573323 494835 396 PLA1 2659910 486284 203 SJU 2646193 485295 447 CAB 2635979 482723 263 CIN 2519777 494694 75 HID 2681353 453907 333 IND1 2678359 446361 398 IND2 2679732 445890 397 SAL1 2644211 491819 193 SAL2 2644273 488584 202 SAL3 2643413 486990 211 ELQ 2655879 494452 184 LAS 2662991 491708 187 PLA 2658774 505310 161 LAV 2605370 597070 41

Veg. type MET/MEZ CA CA CA MET/MEZ CA CA CA CA MEZ MSM MSM SBS MSM MSM SBS CA

SJO1 SJO2 SJO3 FME SAU1 SAU2 TUL LMA1 LMA2 MAR

CA CA MET/MEZ MET/MEZ SBC MEZ MEZ MEZ MEZ MET

2603597 2601748 2601306 2553554 2550791 2550342 2538716 2716847 2717125 2764173

467749 467889 466370 433556 429774 431098 422565 627994 626482 534345

631 621 650 1453 1293 1298 1118 7 8 127

CA= agricultural crop; MET= Tamaulipan thorny scrub; MEZ= mesquite; MSM= submontane scrub; SBS= semi-evergreen tropical forest, SBC= dry tropical forest.

917

Rev Mex Cienc Pecu 2020;11(3):914-932

Figure 1: Apiary location in study area

Collected botanical specimens were botanized and deposited in the Francisco Gonzรกlez Medrano Herbarium of the Institute of Applied Ecology of the Autonomous University of Tamaulipas (Universidad Autรณnoma de Tamaulipas). First-hand data on local floral resources was collected from local beekeepers during field trips. They provided information on the plant species visited by bees and their flowering time and duration. Using field data, databases and the literature, a species inventory was produced containing information on species grouping by life form (tree, bush, herbaceous); growth form (erect, ascending, decumbent, prostrate, creeping, climbing, rosette, epiphytic and floating); origin (native, introduced); and resource production (nectariferous, polliniferous or both). Species flowering period was recorded as well as the surrounding vegetation type. Family classification was done based on the international system established by the Angiosperm Phylogeny Group APG III(26). A total of 215 species (including 1 subspecies and 1 variety) were found to be of interest for apiculture in Tamaulipas; these belong to 173 genera and 60 vascular plant families (Annex 1). The best represented family is Fabaceae (traditionally known as Leguminosae) with 35 species (16.28 %), followed by Asteraceae with 26 species (12.09 %). More than 50 % of these melliferous plant species belong to just eleven families (Table 2). The predominant genera were Acacia (6 species) and Croton and Mimosa (5 species each).

918

Rev Mex Cienc Pecu 2020;11(3):914-932

Table 2: Best represented families and genera among melliferous flora in Tamaulipas Families Genera % Species % Fabaceae 22 12.72 35 16.28 Asteraceae 21 12.14 26 12.09 Convolvulaceae 5 2.89 9 4.19 Euphorbiaceae 5 2.89 9 4.19 Malvaceae 6 3.47 9 4.19 Lamiaceae 6 3.47 8 3.72 Rutaceae 6 3.47 7 3.26 Boraginaceae 3 1.73 5 2.33 Sapindaceae 5 2.89 5 2.33 Scrophulariaceae 3 1.73 5 2.33 Verbenaceae 5 2.89 5 2.33 Subtotal 87 50.29 123 57.21 Remaining (49) 86 49.71 92 42.79 Total 173 100.00 215 100.00

Most (87.91 %) of the recorded species are native and the rest (12.09 %) are introduced. Of the 215 species, 91 are herbaceous, 74 are shrubs and 50 are trees. Growth forms varied with 169 erect, 24 climbing, 6 ascending, 6 prostrate, 5 rosette, 2 floating, 1 creeping and 1 epiphytic species. Melliferous plants were identified in 26 different vegetation types, including agricultural crops. Species diversity was highest (58 species) in secondary vegetation, although the natural vegetation types with the highest number of species were the dry tropical forest and Tamaulipan thorn scrub (Table 3). Cultivated species were not very diverse, with twelve agricultural crops and thirteen ornamentals. Of the 215 collected species, most (n= 97) are nectariferous, followed by the nectariferous-polliniferous (n= 86) and polliniferous species (n= 32).

919

Rev Mex Cienc Pecu 2020;11(3):914-932

Table 3: Melliferous species by vegetation type in Tamaulipas Vegetation Species % Secundary vegetation 58 26.85 Dry tropical forest 23 10.65 Tamaulipan thorn scrub 18 8.33 Aquatic vegetation 15 6.94 Mesquite 14 6.48 Semi-evergreen tropical forest 14 6.48 Ornamental crops 13 6.02 Annual agricultural crops 12 5.56 Submontane scrub 12 5.56 Oak forest 11 5.09 Microphyll desert scrub 8 3.70 Evergreen tropical forest 7 3.24 Pine forest 4 1.85 Rosetophyll desert scrub 4 1.85 Halophyte vegetation 2 0.93 Pine-oak forest 1 0.46 During the annual seasonal cycle flowering tended to decrease during the colder seasons. For example, in Tamaulipas 355 species are reported to flower in the spring, 364 in the summer, 288 in the autumn and 233 in the winter. During the study period the month with the most floral resources was June, with 130 available species, and that with the least was December, with 64 species (Figure 2). Figure 2: Monthly flowering distribution of important melliferous plant species in Tamaulipas

920

Rev Mex Cienc Pecu 2020;11(3):914-932

The 215 species recorded here indicate that melliferous plant richness in Tamaulipas is notable, particularly since northern Mexico generally has a less diverse flora than southern Mexico. The present inventory constitutes the largest number of nectariferous-polliniferous plant species reported to date for Tamaulipas: far more than the 174 reported by Lara(16), the 150 reported by Villegas et al(1) and the 146 reported by González-Rodríguez et al(17). As observed in these previous studies, the most important melliferous plant families are the legumes (Fabaceae) and the compounds (Asteraceae), which has also been reported in other states(12,13,27). As mentioned previously(19), the largest proportion of melliferous species consists of natives since they are the most common floral resources in Tamaulipas. However, during winter citrus orchards (especially oranges) become a highly relevant nectar source for A. mellifera due to their vast extension in the state’s central area(1). Herbaceous plants (91 species) represented a higher proportion than did shrubs and trees, a trend reported elsewhere(28,29). In terms of growth form, erect plants were the most common at the studied sites; in contrast, climbing plants have been reported to account for a large proportion of melliferous species in the states of Yucatan, Michoacán, Veracruz, Guerrero and Chiapas(7,10,13-15). Secondary vegetation contains the greatest diversity of melliferous plant species in Tamaulipas (26.98%), perhaps due to the large number of herbaceous plants present in this and other vegetation types; a similar trend has been reported in Michoacán(28) and the Valley of Mexico(29). Of note is that weed species such as Argemone spp. and Helianthus annuus subsp. annuus are common year-round in Tamaulipas. Weeds have also been reported as important melliferous plant species in countries such as India(30). Of the natural vegetation communities, the dry tropical forest offers the most floral resources in the state; El Cielo Biosphere Reserve is an excellent example of this(16). Both the dry tropical forest and the Tamaulipan thorn scrub are among the most widely distributed vegetation types in the state(23). Nectariferous plants were the most diverse in the present study. This coincides with a report on melliferous flora in the state of Colima(11), although nectariferous-polliniferous species have been found to be more diverse in other studies(17-30). In contrast to previous studies(11,27), melliferous floral resources were most abundant in Tamaulipas during summer. June was the most productive month since most species were flourishing, regardless of life form and vegetation type. However, all these species do not always provide abundant floral resources, as is the case with mesquite (Prosopis spp.) and citrus (Citrus spp.). Indeed, based on the current apicultural calendar, these species have the

921

Rev Mex Cienc Pecu 2020;11(3):914-932

greatest influence on monofloral honey production in Tamaulipas during the February-April period. Tamaulipas clearly offers extensive melliferous floral resources, as shown in the present study of species visited by Apis mellifera. The Fabaceae and Asteracea families provide the most floral resources for bees. The highest proportion of melliferous species are native (87.91 %) and herbaceous (42.32 %), and are mainly nectar producers. Secondary vegetation and dry tropical forest are the most important plant communities for honey production in the state, particularly during the summer. The data provided in the present study can be the foundation for more efficient apiculture practices in Tamaulipas by allowing beekeepers to manage apiaries and thus take greater advantage of melliferous floral resources year-round.

Acknowledgements The authors thank the beekeepers who provided valuable information for this study. MGS received a grant and financial support from the Ecología y Manejo de Recursos Naturales Program and the Consejo Nacional de Ciencia y Tecnología.

Literature cited: 1. Villegas G, Bolaños A, Miranda JA, García J, Galván OM. Flora nectarífera y polinífera en el Estado de Tamaulipas. México, DF. Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2000. 2. Crane E. Honey: A comprehensive Survey. London, UK: Heinemann; 1975. 3. Labougle JM, Zozaya JA. La apicultura en México. Cienc Desar 1986;69:17-36. 4. Wulfrath A, Speck JJ. La flora melífera. México DF: Editora Agrícola Mexicana; 1953. 5. Ordetx GS, Zozaya-Rubio JA, Franco MW. Estudio de la flora apícola nacional. Chapingo, México: Dirección General de Extensión Agrícola; 1972. 6. Souza-Novelo N, Suárez-Molina V, Barrera-Vázquez A. Plantas melíferas y poliníferas de Yucatán. Mérida, México: Fondo Editorial de Yucatán; 1981.

922

Rev Mex Cienc Pecu 2020;11(3):914-932

7. Villegas G, Cajero AS, Bolaños A, Miranda JA, Pérez MA, Ku Y, Yam F, et al. Flora nectarífera y polinífera en la península de Yucatán. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 1998. 8. Villanueva-Gutiérrez R. Nectar sources of European and africanized honey bees (Apis mellifera L.) in the Yucatan Peninsula, Mexico. J Apicult Res 1994;33(1):44-58. 9. Villanueva-Gutiérrez R. Polliniferous plants and foraging strategies of Apis mellifera in the Yucatán Peninsula, Mexico. Rev Biol Trop 2002;50(3/4):1035-1044. 10. Villanueva-Gutiérrez R, Moguel-Ordóñez YB, Echazarreta-González CM, Arana-López G. Monofloral honeys in the Yucatán Peninsula, Mexico. Grana 2009;48(3):214-223. 11. Villegas G, Bolaños A, Miranda JA, Quintana IL, Guzmán EO, Zavala JM. Flora nectarífera y polinífera en el estado de Michoacán. D.F, México: Secretaría de Agricultura Ganadería y Desarrollo Rural. 1999. 12. Santana-Michel FJ, Cervantes AN, Jiménez RN. Flora melífera del estado de Colima. B IBUG 2000;6:251-277. 13. Villegas G, Bolaños A, Miranda JA, González U. Flora nectarífera y polinífera en el estado de Guerrero. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. 2002a. 14. Villegas G, Bolaños A, Miranda JA, Zenón AJ. Flora Nectarífera y polinífera en el estado de Chiapas. México: Secretaría de Agricultura, Ganadería y Desarrollo Rural. 2002b. 15. Villegas DG, Bolaños MA, Miranda JA, Sandoval HR, Lizama MJM. Flora nectarífera y polinífera en el estado de Veracruz. México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación. 2003. 16. Lara M. Estudio preliminar de las especies vegetales visitadas por Apis mellifera en la Reserva de la Biosfera El Cielo. Biotam 1989;1(1):14-19. 17. González-Rodríguez LE, Mora-Olivo A, Guerra-Pérez A, Garza-Torres HA, CámaraArtigas R. Ordenamiento sustentable de la apicultura en Tamaulipas. Saltillo, México: Editorial Dolores Quintanilla; 2012.

923

Rev Mex Cienc Pecu 2020;11(3):914-932

18. Rzedowski J. Diversidad y orígenes de la flora fanerogámica de México. Acta Bot Mex 1991;14:3-21. 19. Villaseñor JL. Checklist of the native vascular plants of Mexico. Rev Mex Biodiver 2016;87:559-902. 20. SIAP. Servicio de Información Agroalimentaria y Pesquera. D.F., México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2008. URL: http://www.siap.gob.mx/. Consultado 17 May, 2010. 21. González-Rodríguez, LE, Mora-Olivo A, Guerra-Pérez A, Garza-Torres H. La apicultura en Tamaulipas, una actividad muy dulce y nutritiva. Ciencia UAT 2010;16:8-12. 22. SIACON. Sistema de Información Agroalimentaria de Consulta. D.F., México: Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación; 2016. http://www.siap.gob.mx/optestadisticasiacon2012parcialsiacon-zip/ Consultado 15 Abr, 2016. 23. SPP. Secretaría de Programación y Presupuesto. Síntesis Geográfica del Estado de Tamaulipas. Instituto Nacional de Estadística, Geografía e Informática. México. 1983. 24. Sakagami SF, Laroca S, Moure JS. Wild bees biocenotics in São José dos Pinhais (PR), South Brazil. Preliminary report. J Fac Sci Hokkaido U. Series 6, Zoology 1967;19:25391. 25. Lopes CA, Marchini LC. Plantas visitadas por Apis mellifera L. no vale do rio Paraguaçu, Município de Castro Alves, Bahia. Rev Bras Bot 1999;22(2):333-338. 26. APG III. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III. Bot J Linn Soc 2009;161:105-121. 27. Roman L, Palma JM. Árboles y arbustos tropicales nativos productores de néctar y polen en el estado de Colima, México. Avanc Investig Agrop 2007;11(3):3-24. 28. Bello MA. Plantas melíferas silvestres de la Sierra Purépecha, Michoacán, México. Rev Cienc Forest Mex 2007;32(102):103-126.

924

Rev Mex Cienc Pecu 2020;11(3):914-932

29. Piedras B, Quiroz DL. Estudio melisopalinológico de dos mieles de la porción sur del Valle de México. Polibotánica 2007;23:57-75. 30. Bhalchandra W, Baviskar RK, Nikam TB. Diversity of nectariferous and polleniferous bee flora at Anjaneri and Dugarwadi hills of Western Ghats of Nasik district (M. S.) India. J Entomol Zool Stud 2014;2(4):244-249.

925

Rev Mex Cienc Pecu 2020;11(3):914-932

Annex 1. Melliferous plant species inventory in Tamaulipas, Mexico. AR = Tree; AB = Bush; HI = Herbaceous; ER = Erect; AS = Ascending; DE = Decumbent; PS = Prostrate; RA = Creeping; RO = Rosette; TR = Climbing; FL = Floating; NA = Native; IN = Introduced; NE = Nectar; PO = Pollen; NP = Nectarpollen; BP = Pine forest; BE = Oak forest; BE = Oak-pine forest; MDM = Microphyll desert scrub; MDR = Rosetophyll desert scrub; MSM = Submontane scrub; MET = Tamaulipan thorn scrub; MEZ = Mesquite; SMS = Semi-evergreen tropical forest; SBS = Low semi-evergreen tropical forest; SBC = Dry tropical forest; VH = Halophyte vegetation; VA = Aquatic vegetation; VS = Secondary vegetation; CA = Agricultural crop; CO = Ornamental crop.

FAMILY

ACANTHACEAE ASPHODELACEAE AMARANTHACEAE ANACARDIACEAE

ANNONACEAE APOCYNACEAE

ARECACEAE

ASPARAGACEAE

ASTERACEAE

Scientific Name

Avicennia germinans (L.) L. Aloe vera (L.) Burm. f. Amaranthus hybridus L. Mangifera indica L. Rhus microphylla Engelm. Rhus virens Lindh. ex A. Gray Schinus terebinthifolia Raddi Annona globiflora Schltdl. Asclepias angustifolia Schweigg. Asclepias curassavica L. Cascabela thevetia (L.) Lippold Acrocomia aculeata (Jacq.) Lodd. ex Mart. Brahea berlandieri Bartlett Sabal mexicana Mart. Agave lecheguilla Torr. Dasylirion berlandieri S. Watson Yucca filifera Chabaud Yucca treculeana Carrière Baccharis salicifolia (Ruiz & Pav.) Pers. Bidens odorata Cav. Bidens pilosa L. Bidens squarrosa Kunth Borrichia frutescens (L.) DC. Chromolaena odorata (L.) R.M. King & H. Rob. Cirsium mexicanum Dc.

Life form /Growth form /Origin/Vegetation Common (Spanish) type AR/ER/NA/VA HI/RO/IN/CA HI/ER/NA/VS AR/ER/IN//CA AB/ER/NA/MDM AB/ER/NA/BPE AR/ER/IN/CO AB/ER/NA/SBC HI/ER/NA/BE HI/ER/NA/VS AB/ER/NA/CO AR/ER/NA/SMS

Mangle blanco Sábila Quelite Mango Correoso Lantrisco Cimarrón Chirimoya

AB/ER/NA/BE AR/ER/NA/SBC AB/RO/NA/MDR AB/RO/NA/MDR AR/ER/NA/MET AR/ER/NA/MET AB/ER/NA/VA HI/ER/NA/VS HI/ER/NA/VS HI/TR/NA/SMS HI/ER/NA/VH HI/TR/NA/MET

Palmito Palma real Lechuguilla Sotol Palma china Pita Jara Aceitilla Aceitilla Té huasteco Saladilla

HI/ER/NA/VS

Cardo

Spring Name Floral Resource

Quiebra muelas Cabeza de víbora Coyol

Limpiatuna

926

Summer

Fall

Winter

N N N N N N NP NP N N N NP

x x x x

x x

x x x

N NP NP NP N N NP NP NP N P NP

x x x

x x

x x x x

x x

x x x x

x x

x x x x x x

x x

x x x x

x x

x x x

x x

x x x x

x x x

Rev Mex Cienc Pecu 2020;11(3):914-932

BASELLACEAE BIGNONIACEAE

BORAGINACEAE

BROMELIACEAE

Conoclinium coelestinum (L.) DC. Elephantopus mollis Kunth Flourensia laurifolia DC. Gochnatia hypoleuca (DC.) A. Gray Helianthus annuus L. subsp. annuus Helianthus annuus var. macrocarpus (DC.) Cockerell Mikania cordifolia (L. f.) Willd. Parthenium hysterophorus L. Pluchea carolinensis (Jacq.) G. Don Pluchea salicifolia (Mill.) S.F. Blake Roldana aschenborniana (S. Schauer) H. Rob. & Brettell Senecio salignus DC. Simsia eurylepis S.F. Blake Sonchus oleraceus L. Tithonia diversifolia (Hemsl.) A. Gray Tridax coronopifolia (Kunth) Hemsl. Tridax procumbens L. Verbesina encelioides (Cav.) Benth. & Hook. f. ex A. Gray Verbesina persicifolia DC. Zinnia elegans Jacq. Anredera vesicaria (Lam.) C.F. Gaertn. Amphilophium crucigerum (L.) L.G. Lohmann Tecoma stans (L.) Juss. ex Kunth Crescentia alata Kunth Parmentiera aculeata (Kunth) Seem. Cordia boissieri A. DC. Cordia dentata Poir. Ehretia anacua (Terán & Berland.) I.M. Johnst. Heliotropium angiospermum Murray Heliotropium calcicola Fernald Tillandsia usneoides (L.) L. Bromelia pinguin L. Hechtia glomerata Zucc.

HI/ER/NA/VA HI/ER/NA/VS AB/ER/NA/MSM AB/ER/NA/MSM HI/ER/NA/VS HI/ER/NA/CA

Hoja ancha Ocotillo Polocote Girasol

HI/TR/NA/VA HI/ER/NA/VS AB/ER/NA/VA AB/ER/NA/VA AB/ER/NA/BE

Guaco Amargoso Santa María Santa Isabel

AB/ER/NA/VA HI/ER/NA/VS HI/ER/IN/VS HI/ER/IN/VS HI/AS/NA/VS HI/PO/NA/VS HI/ER/NA/VS

Jarilla Chimalaco Borraja Botón de oro Coronilla Hierba del monte

AB/ER/NA/VS HI/ER/IN/CO HI/TR/NA/SBC HI/TR/NA/SMS

Hierba del toro Cartulina Hierba de la difunta

AB/ER/NA/SBC AR/ER/NA/SBC AB/ER/NA/SBC AR/ER/NA/MET AR/ER/NA/SBC AR/ER/NA/MEZ

Tronadora Guaje cirial Chote Anacahuita Baboso

HI/ER/NA/VS HI/ER/NA/MSM HI/EP/NA/BE AB/RO/NA/SBC HI/RO/NA/MDR

Alacrancillo

Barba

Hierba de la bruja

Lengua de vaca

Anacua

Paixtle Huapilla Huapilla

927

P NP NP NP NP NP NP N NP NP P NP NP NP NP P NP NP N NP NP NP N N N NP N N N N N NP N

x x x x

x x x

x x

x x x

x x x x

x x x x x

x x

x x x

x x x x x

x x

x x x

x x x x x

x x

x x x x

x x

x x x x

x x

x x x

x x

Rev Mex Cienc Pecu 2020;11(3):914-932

CACTACEAE

CANNABACEAE CANNACEAE CAPPARACEAE COMBRETACEAE COMMELINACEAE CONVOLVULACEAE

CUCURBITACEAE

CUPRESACEAE EBENACEAE EUPHORBIACEAE

Cylindropuntia leptocaulis (DC.) F.M. Knuth Opuntia engelmannii Salm-Dyck ex Engelm. Pachycereus marginatus (DC.) Britton & Rose Stenocereus griseus (Haw.) Buxb. Celtis pallida Torr. Canna indica L. Quadrella incana (Kunth) Iltis & Cornejo Conocarpus erectus L. Commelina erecta L. Evolvulus alsinoides (L.) L. Ipomoea batatas (L.) Lam. Ipomoea carnea subsp. fistulosa (Mart. ex Choisy) D.F. Austin Ipomoea pes-caprae (L.) R. Br. Jacquemontia nodiflora (Desr.) G. Don Jacquemontia oaxacana (Meisn.) Hallier f. Jacquemontia pentantha G. Don Operculina pinnatifida (Kunth) O'Donell Turbina corymbosa (L.) Raf. Citrullus lanatus (Thunb.) Matsum. & Nakai Cucumis melo L. Luffa aegyptiaca Mill. Momordica charantia L. Taxodium mucronatum Ten. Diospyros palmeri Eastw. Diospyros texana Scheele Jatropha dioica Sessé Croton argenteus L. Croton cortesianus Kunth Croton niveus Jacq. Croton punctatus Jacq. Croton reflexifolius Kunth Cnidoscolus multilobus (Pax) I.M. Johnst. Euphorbia heterophylla L.

AB/ER/NA/MET AB/ER/NA/MET AB/ER/NA/MDM

Tasajillo Nopal Órgano

AB/ER/NA/MET AB/ER/NA/MET HI/ER/NA/VS AB/ER/NA/MSM AB/ER/NA/VA HI/AS/NA/VS HI/PS/NA/MET HI/TR/NA/SBS AB/ER/NA/VS

Pitayo Granjeno Platanillo Vara blanca Mangle botoncillo Hierba del pollo Ojo de víbora Frijolillo

HI/RA/NA/VH HI/TR/NA/MEZ HI/TR/NA/SBS

Riñonina Campanita

HI/TR/NA/SBS HI/TR/NA/VS HI/TR/NA/SBS HI/PS/IN/CA

Campanita azul Gallinita

HI/PS/IN/CA HI/TR/IN/VS HI/TR/IN/SBS AR/ER/NA/VA AR/ER/NA/MSM AR/ER/NA/MSM AB/ER/NA/MDM HI/ER/NA/VS HI/ER/NA/MEZ AR/ER/NA/SBC HI/ER/NA/VS AB/ER/NA/SBC AB/ER/NA/SBC HI/ER/NA/VS

Melón Estropajo Guadalupana Sabino Chapote Chapote prieto Sangre de drago Puntilla Palillo Olivo Hierba del jabalí Matilla Mala mujer Contrahierba

Mañanita

Campanita azul

Sandía

928

NP NP N

P N NP NP NP P N N N

x x x

x x

NP N N N N N NP NP N N N N N NP NP P NP NP NP NP N

x x

x x x x

x x

x x x

x x x x

x x x

x x

x x x x x

x x

x x x x x

x x x x x x

x x

Rev Mex Cienc Pecu 2020;11(3):914-932

FABACEAE

Ricinus communis L. Acacia angustissima (Mill.) Kuntze Acacia constricta Benth. Acacia coulteri Benth. Acacia farnesiana (L.) Willd. Acacia rigidula Benth. Acacia schaffneri (S. Watson) F.J. Herm. Bauhinia divaricata L. Caesalpinia mexicana A. Gray Canavalia villosa Benth. Dalea greggii A. Gray Dalea lutea (Cav.) Willd. Delonix regia (Bojer ex Hook.) Raf. Ebenopsis ebano (Berland.) Barneby & J.W. Grimes Erythrina herbacea L. Eysenhardtia polystachya (Ortega) Sarg. Eysenhardtia texana Scheele Gliricidia sepium (Jacq.) Kunth ex Walp. Havardia pallens (Benth.) Britton & Rose Leucaena leucocephala (Lam.) de Wit Lysiloma divaricatum (Jacq.) J.F. Macbr. Mimosa biuncifera Benth. Mimosa diplotricha C. Wright ex Sauvalle Mimosa monancistra Benth. Mimosa pigra L. Mimosa pudica L. Parkinsonia aculeata L. Parkinsonia texana var. macra (I.M. Johnst.) Isely Piscidia piscipula (L.) Sarg. Pithecellobium dulce (Roxb.) Benth. Prosopis glandulosa Torr. Prosopis laevigata (Humb. & Bonpl. ex Willd.) M.C. Johnst. Prosopis tamaulipana Burkart Senna atomaria (L.) H.S. Irwin & Barneby

AB/ER/IN/VS AR/ER/NA/BE AB/ER/NA/MDM AR/ER/NA/SBC AB/ER/NA/VS AB/ER/NA/MET AB/ER/NA/MDM AB/ER/NA/SBC AB/ER/NA/VS HI/TR/NA/SBC AB/DE/NA/BE AB/AS/NA/BE AR/ER/IN/CO AR/ER/NA/MEZ

Higuerilla Barba de chivo Huizachillo Palo de arco Huizache Gavia Huizache chino Pata de vaca Hierba del potro Frijolillo Oreganillo Pinito Framboyán Ébano

AB/ER/NA/SBC AB/ER/NA/MEZ AB/ER/NA/MET AR/ER/IN/CO AR/ER/NE/MET AR/ER/IN/VS AR/ER/NA/SBC AB/ER/NA/MDM AB/TR/IN/VS

Colorín Vara dulce Vara dulce Palo de sol Tenaza Guaje Rajador Uña de gato

AB/ER/NA/MET AB/ER/NA/VA HI/ER/NA/VS AR/ER/NA/VS AR/ER/NA/MEZ

Charrasquillo Choveno Vergonzosa Retama

AR/ER/NA/SBC AR/ER/NA/SBC AR/ER/NA/MET AR/ER/NA/MET

Chijol Guamúchil Mezquite

AR/ER/NA/MEZ AR/ER/NA/SBC

Mezquite

Sierrilla

Palo verde

Mezquite

Palo de zorrillo

929

NP P P P P P P N N NP N P N N

NP N N NP N NP N P P

P P P N N N NP NP NP N N

x x x x x x

x x

x x x

x x

x x x

x x x x

x x

x x x x

x x x

x x

x x x

x x x x x

x x x x x x x x

x x

x x x x x x

x x x

x x

x x x

x x

Rev Mex Cienc Pecu 2020;11(3):914-932

FAGACEAE SALICACEAE

LAMIACEAE

LAURACEAE

LOASACEAE LYTHRACEAE MALPIGHIACEAE MALVACEAE

MELIACEAE

MUSACEAE MYRTACEAE NYCTAGINACEAE NYMPHAEACEAE

Stizolobium pruriens (L.) Medik. Tamarindus indica L. Quercus polymorpha Schltdl. & Cham. Neopringlea integrifolia (Hemsl.) S. Watson Xylosma flexuosa (Hemsl.) S. Watson Callicarpa acuminata Kunth Leonotis nepetifolia (L.) R. Br. Marrubium vulgare L. Salvia ballotiflora Benth. Salvia connivens Epling Salvia sp. Teucrium cubense Jacq. Vitex negundo L. Litsea glaucescens Kunth Nectandra salicifolia (Kunth) Nees Persea americana Mill. Cevallia sinuata Lag. Lagerstroemia indica L. Malpighia glabra L. Abutilon abutiloides (Jacq.) Garcke ex Hochr. Abutilon trisulcatum (Jacq.) Urb. Gossypium hirsutum L. Malvastrum americanum (L.) Torr. Malvastrum coromandelianum (L.) Garcke Malvaviscus arboreus Cav. Melochia pyramidata L. Melochia tomentosa L. Waltheria indica L. Trichilia havanensis Jacq. Azadirachta indica A. Juss. Melia azedarach L. Musa paradisiaca L. Psidium guajava L. Boerhavia coccinea Mill. Boerhavia erecta L. Nymphaea ampla (Salisb.) DC.

HI/TR/NA/SMS AR/ER/IN/CA AR/ER/NA/BE AR/ER/NA/MSM

Picapica Tamarindo Encino

AR/ER/NA/SBC AR/ER/NA/SBC HI/ER/NA/VS AR/ER/IN//VS AB/ER/NA//MSM HI/ER/NA/BE HI/ER/NA/BE HI/ER/NA/VS AB/ER/IN/CO AB/ER/NA/BE AR/ER/NA/SBS AR/ER/NA/CA HI/AS/NA/VS AB/ER/IN/CO AB/ER/NA//SBS HI/ER/NA/VS

Capulín de corona Uvilla Betónica Manrubio Santa Isabel

HI/ER/NA/VS HI/ER/NA//CA HI/ER/NA/VS HI/ER/NA/VS

Tronadora Algodón Malva

AB/ER/NA/SBS HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/SMS AR/ER/IN/CO AR/ER/IN/CO AB/ER/IN/CA AB/ER/NA/SBC HI/ER/NA/VS HI/AS/NA/VS HI/FL/NA/VA

Manzanita Malva Malva rosa Hierba del soldado Estribillo Neem Canelo Plátano Guayabo Pegajosa Pega pega Panza de vaca

Corva gallina

Verbena Árbol de la miel Laurel Aguacatillo Aguacate Ortiguilla ceniza Crespón Manzanita Malva rasposa

Malva loca

930

N N N NP

x x

NP N NP NP N N N NP N N NP N NP P NP P

x x

x x x x

x x x x x

x x x x

x x x x x x x

x x x x x

x x x

x x x x x x x x x

x x x

NP NP NP P

x x x

NP NP P NP NP N NP N NP N P P

x x x

x x x x

x x x x x x x x x x

x x

x x x x x

x x x

x x x x x x

x x x

x x x x x

x x

x x x x

x x x

x x x x

x x x

x x

x x x

x x x x x x

x x x

x x

x x x

x x

x x x x

x x

Rev Mex Cienc Pecu 2020;11(3):914-932

OLEACEAE ONAGRACEAE PAPAVERACEAE

PASSIFLORACEAE PETIVERIACEAE PINACEAE

PLANTAGINACEAE PLUMBAGINACEAE POACEAE POLYGONACEAE RHAMNACEAE ROSACEAE RUBIACEAE RUTACEAE

SAPINDACEAE

SAPOTACEAE

Nymphaea elegans Hook. Fraxinus berlandieriana A. DC. Ludwigia octovalvis (Jacq.) P.H. Raven Oenothera rosea L'Hér. ex Aiton Argemone grandiflora Sweet Argemone ochroleuca Sweet Argemone mexicana L. Bocconia frutescens L. Turnera diffusa Willd. Rivina humilis L. Pinus cembroides Zucc. Pinus teocote Schltdl. & Cham. Maurandya antirrhiniflora Humb. & Bonpl. ex Willd. Plumbago auriculata Lam. Sorghum halepense (L.) Pers. Zea mays L. Antigonon leptopus Hook. & Arn. Persicaria glabra (Willd.) M. Gómez Condalia hookeri M.C. Johnst. Karwinskia humboldtiana M.C. Johnst. Lindleya mespiloides Kunth Vauquelinia corymbosa Bonpl. Hamelia patens Jacq. Casimiroa greggii (S. Watson) F. Chiang Citrus aurantifolia Swingle Citrus sinensis (L.) Osbeck Esenbeckia runyonii C.V. Morton Helietta parvifolia (A. Gray ex Hemsl.) Benth. Murraya paniculata (L.) Jack Zanthoxylum fagara (L.) Sarg. Koelreuteria bipinnata Franch. Serjania brachycarpa A. Gray ex Radlk. Urvillea ulmacea Kunth Paullinia tomentosa Jacq. Sapindus saponaria L. Sideroxylon celastrinum (Kunth) T.D. Penn.

HI/FL/NA/VA AR/ER/NA/VA HI/ER/NA/VA HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/SBS HI/ER/NA/MSM HI/ER/NA//SBC AR/ER/NA/BP AR/ER/NA/BP HI/TR/NA/MSM

Lampazo Fresno Jarcia Hierba del golpe Chicalote blanco Chicalote Chicalote amarillo Calderona Damiana Cordilínea Pino piñonero Ocote

HI/ER/IN/CO HI/ER/IN/VS HI/ER/NA/CA HI/TR/NA/VS HI/ER/NA/VA AR/ER/NA/MEZ AB/ER/NA/MEZ AB/ER/NA/BP AR/ER/NA/BP AB/ER/NA/SBS AR/ER/NA/SBS AR/ER/IN/CA AR/ER/IN/CA AR/ER/NA/SBS AB/ER/NA/MSM

Jurica Zacate Johnson Maíz Flor de San Diego Chilillo Brasil Coyotillo Manzanilla silvestre Sierrilla Chacloco Chapote amarillo Limón Naranjo Limoncillo

AB/ER/IN//CO AB/ER/NA/MET AR/ER/IN/CO HI/TR/NA/MEZ HI/TR/NA/MEZ HI/TR/NA/SBS AR/ER/NA/SBC AR/ER/NA/MEZ

Limonaria Colima Chino Guía Coronilla Arete de novia Jaboncillo

Hierba del corazón

Barreta

Coma

931

P N N NP P N N NP N N N N NP

x x

x x x x x x

x x x x x x x x x x x

x x x x x x

x x x x x x x

x x

x x x x

x x x x x

N NP N N N N N N

x x x

x x

x x x

x x

x x x x x x

x x x x

x x x

x x x x x x

x x

x x x x x x x

x x

x x x x x x x x x

x x

x x x x x x x x

P P P N N NP N N P NP N N N NP NP

x x x x

x x

x x x

x x

x x x x

Rev Mex Cienc Pecu 2020;11(3):914-932

SCROPHULARIACEAE

SOLANACEAE

TAMARICACEAE VERBENACEAE

VITACEAE ZYGOPHYLLACEAE

Buddleja scordioides Kunth Buddleja sessiliflora Kunth Capraria mexicana Moric. ex Benth. Leucophyllum frutescens (Berland.) I.M. Johnst. Leucophyllum pruinosum I.M. Johnst. Datura stramonium L. Lycopersicon esculentum Mill. Solanum erianthum D. Don. Tamarix aphylla (L.) H. Karst. Verbena carolina L. Citharexylum berlandieri B.L. Rob. Lantana hirta Graham Lippia graveolens Kunth Petrea volubilis L. Cissus verticillata (L.) Nicolson & C.E. Jarvis Guaiacum angustifolium Engelm. Kallstroemia maxima (L.) Hook. & Arn. Kallstroemia parviflora Norton Larrea tridentata (DC.) Coville

HI/ER/NA/MSR AB/ER/NA/VS AB/ER/NA/VS AB/ER/NA/MET

Escobilla Tepozán Jara

AB/ER/NA/MDM HI/ER/NA/VS HI/ER/NA/VS AB/ER/NA/VS AR/ER/IN/CO HI/ER/NA/VS AB/ER/NA/MEZ HI/ER/NA/MEZ HI/ER/NA/MSM AB/TR/NA/SMS HI/TR/NA/SBS

Cenizo Toloache Tomate Salvadora Rompevientos Hierba del negro Revienta cabras Peonía colorada Orégano Guirnalda

AB/ER/NA/MET HI/PS/NA/VS HI/PS/NA/VS AB/ER/NA/MDM

Guayacán Verdolaga de abrojo Quesillos Gobernadora

Cenizo

Hierba del buey

TOTAL

932

N NP NP NP NP NP N NP NP NP NP N N N N N N P NP

x x

x x x x x

x x

x x x x x x

x x x

x x x x x

x x x x

130

124 110

115 124

x x

x x x

116

x x x x

x x

103 100

64 71

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

ISSN: 2448-6698

Pags. Pasta de higuerilla desintoxicada en dietas para pollos de engorda

Detoxified castor meal in broiler chickens’ diets Anabel Maldonado Fuentes, Juan Manuel Cuca García, Arturo Pro Mar�nez, Fernando González Cerón, José Guadalupe Herrera Haro, Eliseo Sosa Montes, Pablo Alfredo Domínguez Mar�nez…………………………………….....….…….....….…….....….…….....….…….....….…….....….…….....….…….....….…….....….....….....….…...……. 605

Efecto de la fecha de corte y del uso de aditivos en la composición química y calidad fermentativa de ensilado de girasol

Effect of the cutting date and the use of additives on the chemical composition and fermentative quality of sunflower silage Aurora Sainz-Ramírez, Adrián Botana, Sonia Pereira-Crespo, Laura González-González, Marcos Veiga, César Resch, Juan Valladares, Carlos Manuel Arriaga-Jordán, Gonzalo Flores-Calvete…………………………………………………………………………………………………………………………………….………………………………….….....……….620

Suplementación de clorhidrato de zilpaterol en corderos finalizados con dieta sin fibra de forraje

Supplementation with zilpaterol hydrochloride in lambs finished with a non-forage fiber diet Ricardo Vicente Pérez, Ulises Macías-Cruz, Ramón Andrade Mancillas, Rogelio Vicente, Enrique O. García, Ricardo Mar�nez, Leonel Avendaño-Reyes, Oziel D. Montañez………….…………………………………….…….638

Changes in myoglobin content in pork Longissimus thoracis muscle during freezing storage

Cambios en el contenido de mioglobina en el músculo porcino Longissimus thoracis durante el almacenamiento en congelación Jonathan Coria-Hernández, Rosalía Meléndez-Pérez, Abraham Méndez-Albores, José Luis Arjona-Román………………………………………………………………………………………………………………………………………………….…….651

Indicadores de competitividad de la carne bovina de México en el mercado mundial

Indicators of the competitiveness of Mexican beef in the world market Miguel Ángel Magaña Magaña, Carlos Enrique Leyva Morales, Juan Felipe Alonzo Solís, Carlos Gabriel Leyva Pech..………………………………………...............……....…....…....…....…....……………………………...……………….669

Adición de extracto acuoso de ajo (Allium sativum) en dieta de conejos (Oryctolagus cuniculus) sobre productividad, calidad física y microbiológica de la carne

Effect of the addition of aqueous extract of garlic (Allium sativum) to the diet of rabbits (Oryctolagus cuniculus) on the productivity and on the physical and microbiological quality of the meat Dora Luz Pinzón Mar�nez, María Dolores Mariezcurrena Berasain, Héctor Daniel Arzate Serrano, María Antonia Mariezcurrena Berasain, Abdelfa�ah Zeidan Mohamed Salem, Alfredo Medina García …………………………………………………………………………………………………………………………………...……………………….686

El aceite esencial y bagazo de orégano (Lippia berlandieri Schauer) afectan el comportamiento productivo y la calidad de la carne de conejo

Essential oil and bagasse of oregano (Lippia berlandieri Schauer) affect the productive performance and the quality of rabbit meat Jesica Le�cia Aquino-López, América Chávez-Mar�nez, José Arturo García-Macías, Gerardo Méndez-Zamora, Ana Luisa Rentería-Monterrubio, Antonella Dalle-Zo�e, Luis Raúl García-Flores…………………………………………………………………………………………………………………………………………………………………………………………………………………………………….…....……….701

Las rizobacterias halófilas mantienen la calidad forrajera de Moringa oleifera cultivada en sustrato salino

Halophilic rhizobacteria maintain the forage quality of Moringa oleifera grown on a saline substrate Verónica García Mendoza, Alex Edray Hernández Vázquez, José Luis Reyes Carrillo, Uriel Figueroa Viramontes, Jorge Sáenz Mata, Héctor Mario Quiroga Garza, Emilio Olivares Sáenz, Pedro Cano Ríos, José Eduardo García Mar�nez…………………………………………………………………………………………….………………………………………………………………….718

Efecto del reemplazo folicular (GnRH) y de somatotropina bovina (bST) sobre la fertilidad de vacas lecheras expuestas a estrés calórico

Effect of follicular replacement (GnRH) and bovine somatotropin (bST) on the fertility of dairy cows exposed to heat stress Renato Raúl Lozano-Domínguez, Carlos Fernando Aréchiga-Flores, Marco Antonio López-Carlos, Zimri Cortés-Vidauri, Melba Rincón-Delgado, José Ma. Carrera-Chávez, Ulises Macías-Cruz, Joel Hernández-Cerón……………………………………………………………………………………………………………………………………………………………………………………………………….……….738

Efecto del tamaño interno de la colmena en la producción de cría, miel y polen en colonias de Apis mellifera en el altiplano central de México

Effect of the internal size of the hive on brood, honey, and pollen production in Apis mellifera colonies in the central Mexican plateau Alfonso Hernández Carlos, Ignacio Castellanos……………………………………………………………………………………………………………………………………………………………………………….………………………………………………………….……. 757

Seroprevalencia de agentes virales del Complejo Respiratorio Bovino en razas criollas del Centro de Investigación Turipaná de AGROSAVIA

Seroprevalence of viral agents of the Bovine Respiratory Complex in Creole breeds of the Turipaná Research Center of AGROSAVIA Ma�luz Doria-Ramos, Teresa Oviedo-Socarras, Misael Oviedo-Pastrana, Diego Or�z-Ortega………………………………………………………………………………………………………….....…………………………………………………………….771

Frecuencia y factores de riesgo asociados a la presencia de Chlamydia abortus, en rebaños ovinos en México

Frequency and risk factors associated with the presence of Chlamydia abortus in flocks of sheep in Mexico Erika G. Palomares Reséndiz, Pedro Mejía Sánchez, Francisco Aguilar Romero, Lino de la Cruz Colín, Héctor Jiménez Severiano, José Clemente Leyva Corona, Marcela I. Morales Pablos, Efrén Díaz Aparicio………………………………………………………………………………………………………………………………………………………………………………....……………….783

Linfonodos y carne molida de res como reservorios de Salmonella spp. de importancia en salud pública

Lymph nodes and ground beef as public health importance reservoirs of Salmonella spp. Tania Palós Gu�érrez, María Salud Rubio Lozano, Enrique Jesús Delgado Suárez, Naisy Rosi Guzmán, Orbelin Soberanis Ramos, Cindy Fabiola Hernández Pérez, Rubén Danilo Méndez Medina………………………………………………………………………………………………….....……………………………………………………………………….795

Uso de una PCR anidada para el diagnóstico del virus de la necrosis pancreática infecciosa (VNPI) en truchas de campo

Diagnosis of the infectious pancreatic necrosis virus (IPNV) by nested PCR in wild trouts Catalina Tuﬁño-Loza, José Juan Mar�nez-Maya, Amaury Carrillo-González, Diana Neria-Arriaga, Celene Salgado-Miranda, Edith Rojas-Anaya, Elizabeth Loza-Rubio……………………………………………………………….811

Polymorphisms associated with the number of live-born piglets in sows infected with the PRRS virus in southern Sonora Mexico

Polimorfismos asociados con el número de lechones nacidos vivos en cerdas infectadas con el virus del PRRS en el sur de Sonora México Carlos Mar�n Aguilar-Trejo, Guillermo Luna-Nevárez, Javier Rolando Reyna-Granados, Ricardo Zamorano-Algandar, Javier Alonso Romo-Rubio, Miguel Ángel Sánchez-Castro, R. Mark Enns, Sco� E. Speidel, Milton G. Thomas, Pablo Luna-Nevárez…………………………………………………………………………………………………………………………………………………………….828

Venta a granel de embutidos: una tendencia de comercialización asociada al riesgo de enfermedades trasmitidas por alimentos en Culiacán, México

Bulk sales of cold cuts and sausages: a marketing trend associated to the risk of foodborne diseases in Culiacan, Mexico Maribel Jiménez-Edeza, Maritza Cas�llo-Burgos, Lourdes Janeth Germán-Báez, Gloria Marisol Castañeda-Ruelas……………………………………………………………………………….........………………………………………………….848

REVISIONES DE LITERATURA Estudios de asociación genómica en ovinos de América Latina. Revisión

Genome-wide association studies in sheep from Latin America. Review Karen Melissa Cardona Tobar, Diana Carolina López Álvarez, Luz Ángela Alvarez Franco……………………………………………………………………………………………………………………………………………………….………………….…….859

NOTAS DE INVESTIGACIÓN Crecimiento de corderos y productividad en ovejas Pelibuey mantenidas bajo condiciones tropicales de producción

Lamb growth and ewe productivity in Pelibuey sheep under tropical conditions Carolina Atenea García-Chávez, Carlos Luna-Palomera, Ulises Macías-Cruz, José Candelario Segura-Correa, Nadia Florencia Ojeda-Robertos, Jorge Alonso Peralta-Torres, Alfonso Juven�no Chay-Canúl........884

Identification of candidate genes for reproductive traits in cattle using a functional interaction network approach

La identificación de genes candidatos para rasgos de la reproducción en ganado utilizando un enfoque de redes de interacciones funcionales Francisco Alejandro Paredes-Sánchez, Daniel Trejo-Mar�nez, Elsa Verónica Herrera-Mayorga, Williams Arellano-Vera, Felipe Rodríguez Almeida, Ana María Sifuentes-Rincón………………………………………........894

Tiempo de manejo y algunas conductas relacionadas con el estrés al manejar grupos grandes o reducidos de ganado en mangas rectas

Effect of group size on processing time and some stress-related behaviors in cattle in straight chutes Miguel Ángel Damián, Virginio Aguirre, Agus�n Orihuela, Mariana Pedernera, Saúl Rojas, Jaime Olivares……………………………………………………………………………………………......…………………………………………….…….905

Diversidad de la flora de interés apícola en el estado de Tamaulipas, México

Diversity of melliferous flora in the State of Tamaulipas, Mexico Mario González-Suárez, Arturo Mora-Olivo, Rogel Villanueva-Gu�érrez, Manuel Lara-Villalón, Venancio Vanoye-Eligio, Antonio Guerra-Pérez...........................…………………………………………………………………….914

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 11 Núm 3, pp. 605-932, JULIO-SEPTIEMBRE-2020

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 11 Núm. 3, pp. 605-932, JULIO-SEPTIEMBRE-2020