RMCP Vol. 12 Num 3 (2021): July-September [english version] by Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

ISSN: 2448-6698

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

REVISTA MEXICANA DE CIENCIAS PECUARIAS Volumen 12 Numero 3, JulioSeptiembre 2021. Es una publicación trimestral de acceso abierto, revisada por pares y arbitrada, editada por el Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias (INIFAP). Avenida Progreso No. 5, Barrio de Santa Catarina, Delegación Coyoacán, C.P. 04010, Cuidad de México, www.inifap.gob.mx Distribuida por el Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Colonia Palo Alto, Cuidad de México, C.P. 05110. Editor responsable: Arturo García Fraustro. Reservas de Derechos al Uso Exclusivo número 042021-051209561700-203. ISSN: 2428-6698, otorgados por el Instituto Nacional del Derecho de Autor (INDAUTOR). Responsable de la última actualización de este número: Arturo García Fraustro, Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Km. 15.5 Carretera México-Toluca, Colonia Palo Alto, Ciudad de México, C.P. 015110. http://cienciaspecuarias. inifap.gob.mx, la presente publicación tuvo su última actualización en julio de 2021. 1er Concurso de Dibujo Infantil INIFAP 2021 “Futuros Investigadores” 3er Lugar, Categoría A (5 años o menos) Autor: Derek Sánchez Serra Título: Ayudemos a la naturaleza

DIRECTORIO EDITOR EN JEFE Arturo García Fraustro

FUNDADOR John A. Pino EDITORES ADJUNTOS Oscar L. Rodríguez Rivera Alfonso Arias Medina

EDITORES POR DISCIPLINA Dra. Yolanda Beatriz Moguel Ordóñez, INIFAP, México Dr. Ramón Molina Barrios, Instituto Tecnológico de Sonora, Dr. Alfonso Juventino Chay Canul, Universidad Autónoma de Tabasco, México Dra. Maria Cristina Schneider, Universidad de Georgetown, Estados Unidos Dr. Feliciano Milian Suazo, Universidad Autónoma de Querétaro, México Dr. Javier F. Enríquez Quiroz, INIFAP, México Dra. Martha Hortencia Martín Rivera, Universidad de Sonora URN, México Dr. Fernando Arturo Ibarra Flores, Universidad de Sonora URN, México Dr. James A. Pfister, USDA, Estados Unidos Dr. Eduardo Daniel Bolaños Aguilar, INIFAP, México Dr. Sergio Iván Román-Ponce, INIFAP, México Dr. Jesús Fernández Martín, INIA, España Dr. Maurcio A. Elzo, Universidad de Florida Dr. Sergio D. Rodríguez Camarillo, INIFAP, México Dra. Nydia Edith Reyes Rodríguez, Universidad Autónoma del Estado de Hidalgo, México Dra. Maria Salud Rubio Lozano, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dra. Elizabeth Loza-Rubio, INIFAP, México Dr. Juan Carlos Saiz Calahorra, Instituto Nacional de Investigaciones Agrícolas, España Dr. José Armando Partida de la Peña, INIFAP, México Dr. José Luis Romano Muñoz, INIFAP, México

Dr. Alejandro Plascencia Jorquera, Universidad Autónoma de Baja California, México Dr. Juan Ku Vera, Universidad Autónoma de Yucatán, México Dr. Ricardo Basurto Gutiérrez, INIFAP, México Dr. Luis Corona Gochi, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Juan Manuel Pinos Rodríguez, Facultad de Medicina Veterinaria y Zootecnia, Universidad Veracruzana, México Dr. Carlos López Coello, Facultad de Medicina Veterinaria y Zootecnia, UNAM, México Dr. Arturo Francisco Castellanos Ruelas, Facultad de Química. UADY Dra. Guillermina Ávila Ramírez, UNAM, México Dr. Emmanuel Camuus, CIRAD, Francia. Dr. Héctor Jiménez Severiano, INIFAP., México Dr. Juan Hebert Hernández Medrano, UNAM, México Dr. Adrian Guzmán Sánchez, Universidad Autónoma Metropolitana-Xochimilco, México Dr. Eugenio Villagómez Amezcua Manjarrez, INIFAP, CENID Salud Animal e Inocuidad, México Dr. José Juan Hernández Ledezma, Consultor privado Dr. Fernando Cervantes Escoto, Universidad Autónoma Chapingo, México Dr. Adolfo Guadalupe Álvarez Macías, Universidad Autónoma Metropolitana Xochimilco, México Dr. Alfredo Cesín Vargas, UNAM, México Dra. Marisela Leal Hernández, INIFAP, México Dr. Efrén Ramírez Bribiesca, Colegio de Postgraduados, México

TIPOGRAFÍA Y FORMATO: Oscar L. Rodríguez Rivera

Indizada en el “Journal Citation Report” Science Edition del ISI . Inscrita en el Sistema de Clasificación de Revistas Científicas y Tecnológicas de CONACyT; en EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org); en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec); en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier. com).

REVISTA MEXICANA DE CIENCIAS PECUARIAS La Revista Mexicana de Ciencias Pecuarias es un órgano de difusión científica y técnica de acceso abierto, revisada por pares y arbitrada. Su objetivo es dar a conocer los resultados de las investigaciones realizadas por cualquier institución científica, relacionadas particularmente con las distintas disciplinas de la Medicina Veterinaria y la Zootecnia. Además de trabajos de las disciplinas indicadas en su Comité Editorial, se aceptan también para su evaluación y posible publicación, trabajos de otras disciplinas, siempre y cuando estén relacionados con la investigación pecuaria. Se publican en la revista tres categorías de trabajos: Artículos Científicos, Notas de Investigación y Revisiones Bibliográficas (consultar las Notas al autor); la responsabilidad de cada trabajo recae exclusivamente en los autores, los cuales, por la naturaleza misma de los experimentos pueden verse obligados a referirse en algunos casos a los nombres comerciales de ciertos productos, ello sin embargo, no implica preferencia por los productos citados o ignorancia respecto a los omitidos, ni tampoco significa en modo alguno respaldo publicitario hacia los productos mencionados. Todas las contribuciones serán cuidadosamente evaluadas por árbitros, considerando su calidad y relevancia académica. Queda entendido que el someter un manuscrito implica que la investigación descrita es única e inédita. La publicación de Rev. Mex. Cienc. Pecu. es trimestral en formato bilingüe Español e Inglés. El costo

total por publicar es de $ 7,280.00 más IVA por manuscrito ya editado. Se publica en formato digital en acceso abierto, por lo que se autoriza la reproducción total o parcial del contenido de los artículos si se cita la fuente. El envío de los trabajos de debe realizar directamente en el sitio oficial de la revista. Correspondencia adicional deberá dirigirse al Editor Adjunto a la siguiente dirección: Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. Correo electrónico (C-ele): rodriguez_oscar@prodigy.net.mx. La correspondencia relativa a suscripciones, asuntos de intercambio o distribución de números impresos anteriores, deberá dirigirse al Editor en Jefe de la Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx o arias.alfonso@inifap.gob.mx. Inscrita en la base de datos de EBSCO Host y la Red de Revistas Científicas de América Latina y el Caribe, España y Portugal (RedALyC) (www.redalyc.org), en la Red Iberoamericana de Revistas Científicas de Veterinaria de Libre Acceso (www.veterinaria.org/revistas/ revivec), indizada en el “Journal Citation Report” Science Edition del ISI (http://thomsonreuters. com/) y en los Índices SCOPUS y EMBASE de Elsevier (www.elsevier.com)

VISITE NUESTRA PÁGINA EN INTERNET Artículos completos desde 1963 a la fecha y Notas al autor en: http://cienciaspecuarias.inifap.gob.mx Revista Mexicana de Ciencias Pecuarias is an open access peer-reviewed and refereed scientific and technical journal, which publishes results of research carried out in any scientific or academic institution, especially related to different areas of veterinary medicine and animal production. Papers on disciplines different from those shown in Editorial Committee can be accepted, if related to livestock research. The journal publishes three types of papers: Research Articles, Technical Notes and Review Articles (please consult Instructions for authors). Authors are responsible for the content of each manuscript, which, owing to the nature of the experiments described, may contain references, in some cases, to commercial names of certain products, which however, does not denote preference for those products in particular or of a lack of knowledge of any other which are not mentioned, nor does it signify in any way an advertisement or an endorsement of the referred products. All contributions will be carefully refereed for academic relevance and quality. Submission of an article is understood to imply that the research described is unique and unpublished. Rev. Mex. Cien. Pecu. is published quarterly in original lenguage Spanish or English. Total fee charges are US $ 425.00 per article in both printed languages.

Part of, or whole articles published in this Journal may be reproduced, stored in a retrieval system or transmitted in any form or by any means, electronic, mechanical, photocopying or otherwise, provided the source is properly acknowledged. Manuscripts should be submitted directly in the official web site. Additional information may be mailed to Associate Editor, Revista Mexicana de Ciencias Pecuarias, Calle 36 No. 215 x 67 y 69 Colonia Montes de Amé, C.P. 97115 Mérida, Yucatán, México. Tel/Fax +52 (999) 941-5030. E-mail: rodriguez_oscar@prodigy.net.mx. For subscriptions, exchange or distribution of previous printed issues, please contact: Editor-in-Chief of Revista Mexicana de Ciencias Pecuarias, CENID Salud Animal e Inocuidad, Km 15.5 Carretera México-Toluca, Col. Palo Alto, D.F. C.P. 05110, México; Tel: +52(55) 3871-8700 ext. 80316; garcia.arturo@inifap.gob.mx or arias.alfonso@inifap.gob.mx. Registered in the EBSCO Host database. The Latin American and the Caribbean Spain and Portugal Scientific Journals Network (RedALyC) (www.redalyc.org). The Iberoamerican Network of free access Veterinary Scientific Journals (www.veterinaria.org/ revistas/ revivec). Thomson Reuter´s “Journal Citation Report” Science Edition (http://thomsonreuters.com/). Elsevier´s SCOPUS and EMBASE (www.elsevier.com) and the Essential Electronic Agricultural Library (www.teeal.org).

VISIT OUR SITE IN THE INTERNET Full articles from year 1963 to date and Instructions for authors can be accessed via the site http://cienciaspecuarias.inifap.gob.mx

REVISTA MEXICANA DE CIENCIAS PECUARIAS

REV. MEX. CIENC. PECU.

VOL. 12 No. 3

JULIO-SEPTIEMBRE-2021

CONTENIDO Contents ARTÍCULOS Articles

Pág.

Diversidad genética y factores de virulencia de cepas de Staphylococcus aureus aisladas de la piel de ubre bovina Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin Roberto Adame-Gómez, Jeiry Toribio-Jimenez, Natividad Castro-Alarcón, Karina Talavera-Alarcón, Jacqueline Flores-Gavilan, Sandra-Alheli Pineda-Rodríguez, Arturo Ramírez-Peralta ……………….…665 Molecular prediction of serotypes of Streptococcus suis isolated from pig’s farms in Mexico Predicción molecular de serotipos de Streptococcus suis aislados de granjas porcinas en México Arianna Romero Flores, Marcelo Gottschalk, Gabriela Bárcenas Morales, Víctor Quintero Ramírez, Rosario Esperanza Galván Pérez, Rosalba Carreón Nápoles, Ricardo Ramírez R., José Iván Sánchez Betancourt, Abel Ciprián Carrasco, Susana Mendoza Elvira……………………………………………………..681 La coexistencia de Desmodus rotundus con la población humana en San Luis Potosí, México The coexistence of Desmodus rotundus with the human population in San Luis Potosí, Mexico Ximena Torres-Mejía, Juan José Pérez-Rivero, Luis Alberto Olvera-Vargas, Evaristo Álvaro BarragánHernández, José Juan Martínez-Maya, Álvaro Aguilar-Setién……………………………………………..……694 Detection of Pasteurella multocida, Mannhemia haemolytica, Histophilus somni and Mycoplasma bovis in cattle lung Detección de Pasteurella multocida, Mannhemia haemolytica, Histophilus somni y Mycoplasma bovis en pulmón de bovinos Seyda Cengiz, M. Cemal Adıgüzel, Gökçen Dinç………………………………………………………………….…710 Treating horse chronic laminitis with allogeneic bone marrow mesenchymal stem cells Tratamiento de la laminitis crónica en equinos utilizando células troncales mesenquimales alogénicas de la médula ósea Alma A García-Lascuráin, Gabriela Aranda-Contreras, Margarita Gómez-Chavarín, Ricardo Gómez, Adriana Méndez-Bernal, Gabriel Gutiérrez-Ospina, María Masri…………………………………………….…721

III

Composición nutricional de la carne equina y grado de sustitución de la carne bovina por equina en expendios de la Ciudad de México Nutritional composition of equine meat and degree of substitution of bovine for equine meat in stores in Mexico City Guillermo Reséndiz González, Baldomero Alarcón Zúñiga, Itzel Villegas Velázquez, Samuel Albores Moreno, Gilberto Aranda Osorio ……………………………………………………………………………………….…742 Supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits Suplementación con polvo de Agave fourcroydes en el crecimiento, características de la canal, peso de los órganos, morfometría intestinal y bioquímica sanguínea en conejos de engorda Yordan Martínez, Maidelys Iser, Manuel Valdivié, Jorge Galindo, David Sánchez…………………….…756 Evaluación de los componentes del manejo antes, durante y después de la matanza y su asociación con la presencia de carne DFD en bovinos del noreste de México Evaluation of the components of management before, during and after slaughter and their association with the presence of DFD beef in cattle from northeastern Mexico Jorge Loredo Osti, Eduardo Sánchez López, Alberto Barreras Serrano, Fernando Figueroa Saavedra, Cristina Pérez Linares, Miguel Ruiz Albarrán …………………………………………………………………………773

In vitro methane production and fermentative parameters of wild sunflower and

elephant grass silage mixtures, either inoculated or not with epiphytic lactic acid bacteria strains Producción de metano in vitro y parámetros fermentativos de mezclas de ensilado de girasol silvestre y pasto elefante, inoculadas o no con cepas de bacterias ácido-lácticas epífitas Vilma Amparo-Holguín, Mario Cuchillo-Hilario, Johanna Mazabel, Steven Quintero, Siriwan Martens, Jairo Mora-Delgado ……………………………………………………………………………………………………………789 Fases de desarrollo y propagación de ecotipos destacados de Tithonia diversifolia (Hemsl.) A. Gray Phases of development and propagation of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray Julián Esteban Rivera-Herrera, Tomás Ruíz-Vásquez, Julián Chará-Orozco, Juan Florencio GómezLeyva, Rolando Barahona-Rosales …………………………………………………………………………………….…811 Structure of forage sward with Urochloa brizantha cultivars under shading Estructura del pasto forrajero con cultivares de Urochloa brizantha bajo sombra Estella Rosseto Janusckiewicz, Luísa Melville Paiva, Henrique Jorge Fernandes, Alex Coene Fleitas, Patricia dos Santos Gomes ………………………………………………………………………………………………….828 Características de la producción de leche en La Frailesca, Chiapas, México Characteristics of milk production in La Frailesca, Chiapas, Mexico Joaquín Huitzilihuitl Camacho-Vera, Juan Manuel Vargas-Canales, Leticia Quintero-Salazar, Gregorio Wenceslao Apan-Salcedo ……………………………………………………………………………………………………845

Análisis de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018 Analysis of the demand for live beef cattle in slaughter centers in Mexico, 2000-2018 Nicolás Callejas Juárez, Samuel Rebollar Rebollar……………………………………………………………….…861

Effect of two phantom parent grouping strategies on the genetic evaluation of growth traits in Mexican Braunvieh cattle Efecto de dos estrategias de agrupación de padres fantasmas en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano Luis Antonio Saavedra-Jiménez, Rodolfo Ramírez-Valverde, Rafael Núñez-Domínguez, Agustín RuízFlores, José Guadalupe García-Muñiz, Mohammad Ali Nilforooshan ………………………………………..878 Evaluación mineral de los componentes del sistema silvopastoril intensivo con Leucaena leucocephala en tres épocas del año Mineral evaluation of the components of the intensive silvopastoral system with Leucaena leucocephala in three seasons of the year Andrés Camilo Rodríguez-Serrano, Alejandro Lara-Bueno, José Guadalupe García-Muñiz, Maximino Huerta-Bravo, Citlalli Celeste González-Aricega ………………………………………………………………….…893 REVISIONES DE LITERATURA Reviews Termorregulación y respuestas reproductivas de carneros bajo estrés por calor. Revisión Thermoregulation and reproductive responses of rams under heat stress. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo VicentePérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ….910 NOTAS DE INVESTIGACIÓN Technocal notes Evaluación de las condiciones predisponentes a enfermedades en granjas porcinas a pequeña escala en un ambiente urbano en el noroeste de la Ciudad de México Evaluation of disease-predisposing conditions in small-scale swine farms in an urban environment in northwestern Mexico City Roberto Martínez Gamba, Gerardo Ramírez Hernández …………………………………………………………932 Determinación de aflatoxinas en especias, ingredientes y mezclas de especias usados en la formulación de productos cárnicos comercializados en la Ciudad de México Determination of aflatoxins in spices, ingredients and spice mixtures used in the formulation of meat products marketed in Mexico City Montserrat Lizeth Ríos Barragán, José Fernando González Sánchez, Rey Gutiérrez Tolentino, Arturo Camilo Escobar Medina, José Jesús Pérez González, Salvador Vega y León………………………………944

Efecto de la altura de corte de sorgo a la cosecha sobre el rendimiento de forraje y el valor nutritivo del ensilaje Effect of the cutting height of sorghum at harvest on forage yield and nutritional value of silage Jorge A. Granados-Niño, David G. Reta-Sánchez, Omar I. Santana, Arturo Reyes-González, Esmeralda Ochoa-Martinez, Fernando Díaz, Juan I. Sánchez-Duarte……………………………………..…958 The effects of Pyrantel-Oxantel on the Dipylidium caninum tapeworm: An in vitro study Efecto del Pyrantel-Oxantel en la tenia Dipylidium caninum: estudio in vitro Jair Millán-Orozco, Jersson Millán-Orozco, Miguel Ángel Betancourt-Alonso, América Ivette BarreraMolina, María Soledad Valledor, Virginia Méndez, Alejandra Larrea, Martín Sebastián Lima, Javier Morán-Martínez, Nadia Denys Betancourt-Martínez, Liliana Aguilar-Marcelino .………………………...969 Definición y análisis del panel de polimorfismos de nucleótido simple a utilizar en pruebas de paternidad para tres razas de bovinos Definition and analysis of the panel of SNPs to be used in paternity tests for three breeds of cattle Joel Domínguez-Viveros, Adán Medellín-Cazares, Nelson Aguilar-Palma, Francisco Joel JahueyMartínez, Felipe Alonso Rodríguez-Almeida …………………………………………………………………………987

Actualización: marzo, 2020 NOTAS AL AUTOR La Revista Mexicana de Ciencias Pecuarias se edita completa en dos idiomas (español e inglés) y publica tres categorías de trabajos: Artículos científicos, Notas de investigación y Revisiones bibliográficas.

Los autores interesados en publicar en esta revista deberán ajustarse a los lineamientos que más adelante se indican, los cuales en términos generales, están de acuerdo con los elaborados por el Comité Internacional de Editores de Revistas Médicas (CIERM) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Página del título Resumen en español Resumen en inglés Texto Agradecimientos y conflicto de interés Literatura citada

Sólo se aceptarán trabajos inéditos. No se admitirán si están basados en pruebas de rutina, ni datos experimentales sin estudio estadístico cuando éste sea indispensable. Tampoco se aceptarán trabajos que previamente hayan sido publicados condensados o in extenso en Memorias o Simposio de Reuniones o Congresos (a excepción de Resúmenes). Todos los trabajos estarán sujetos a revisión de un Comité Científico Editorial, conformado por Pares de la Disciplina en cuestión, quienes desconocerán el nombre e Institución de los autores proponentes. El Editor notificará al autor la fecha de recepción de su trabajo. El manuscrito deberá someterse a través del portal de la Revista en la dirección electrónica: http://cienciaspecuarias.inifap.gob.mx, consultando el “Instructivo para envío de artículos en la página de la Revista Mexicana de Ciencias Pecuarias”. Para su elaboración se utilizará el procesador de Microsoft Word, con letra Times New Roman a 12 puntos, a doble espacio. Asimismo se deberán llenar los formatos de postulación, carta de originalidad y no duplicidad y disponibles en el propio sitio oficial de la revista.

Por ser una revista con arbitraje, y para facilitar el trabajo de los revisores, todos los renglones de cada página deben estar numerados; asimismo cada página debe estar numerada, inclusive cuadros, ilustraciones y gráficas.

Los artículos tendrán una extensión máxima de 20 cuartillas a doble espacio, sin incluir páginas de Título, y cuadros o figuras (los cuales no deberán exceder de ocho y ser incluidos en el texto). Las Notas de investigación tendrán una extensión máxima de 15 cuartillas y 6 cuadros o figuras. Las Revisiones bibliográficas una extensión máxima de 30 cuartillas y 5 cuadros.

Los manuscritos de las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. deberán contener los componentes que a continuación se indican, empezando cada uno de ellos en página aparte.

Página del Título. Solamente debe contener el título del trabajo, que debe ser conciso pero informativo; así como el título traducido al idioma inglés. En el manuscrito no es necesaria información como nombres de autores, departamentos, instituciones, direcciones de correspondencia, etc., ya que estos datos tendrán que ser registrados durante el proceso de captura de la solicitud en la plataforma del OJS (http://ciencias pecuarias.inifap.gob.mx).

Resumen en español. En la segunda página se debe incluir un resumen que no pase de 250 palabras. En él se indicarán los propósitos del estudio o investigación; los procedimientos básicos y la metodología empleada; los resultados más importantes encontrados, y de ser posible, su significación estadística y las conclusiones principales. A continuación del resumen, en punto y aparte, agregue debidamente rotuladas, de 3 a 8 palabras o frases cortas clave que ayuden a los indizadores a clasificar el trabajo, las cuales se publicarán junto con el resumen.

Resumen en inglés. Anotar el título del trabajo en inglés y a continuación redactar el “abstract” con las mismas instrucciones que se señalaron para el resumen en español. Al final en punto y aparte, se deberán escribir las correspondientes palabras clave (“key words”).

10. Texto. Las tres categorías de trabajos que se publican en la Rev. Mex. Cienc. Pecu. consisten en lo siguiente: a) Artículos científicos. Deben ser informes de trabajos originales derivados de resultados parciales o finales de investigaciones. El texto del Artículo científico se divide en secciones que llevan estos encabezamientos:

VII

Introducción Materiales y Métodos Resultados Discusión Conclusiones e implicaciones Literatura citada

referencias, aunque pueden insertarse en el texto (entre paréntesis).

Reglas básicas para la Literatura citada Nombre de los autores, con mayúsculas sólo las iniciales, empezando por el apellido paterno, luego iniciales del materno y nombre(s). En caso de apellidos compuestos se debe poner un guión entre ambos, ejemplo: Elías-Calles E. Entre las iniciales de un autor no se debe poner ningún signo de puntuación, ni separación; después de cada autor sólo se debe poner una coma, incluso después del penúltimo; después del último autor se debe poner un punto.

En los artículos largos puede ser necesario agregar subtítulos dentro de estas divisiones a fin de hacer más claro el contenido, sobre todo en las secciones de Resultados y de Discusión, las cuales también pueden presentarse como una sola sección. b) Notas de investigación. Consisten en modificaciones a técnicas, informes de casos clínicos de interés especial, preliminares de trabajos o investigaciones limitadas, descripción de nuevas variedades de pastos; así como resultados de investigación que a juicio de los editores deban así ser publicados. El texto contendrá la misma información del método experimental señalado en el inciso a), pero su redacción será corrida del principio al final del trabajo; esto no quiere decir que sólo se supriman los subtítulos, sino que se redacte en forma continua y coherente.

El título del trabajo se debe escribir completo (en su idioma original) luego el título abreviado de la revista donde se publicó, sin ningún signo de puntuación; inmediatamente después el año de la publicación, luego el número del volumen, seguido del número (entre paréntesis) de la revista y finalmente el número de páginas (esto en caso de artículo ordinario de revista). Puede incluir en la lista de referencias, los artículos aceptados aunque todavía no se publiquen; indique la revista y agregue “en prensa” (entre corchetes).

c) Revisiones bibliográficas. Consisten en el tratamiento y exposición de un tema o tópico de relevante actualidad e importancia; su finalidad es la de resumir, analizar y discutir, así como poner a disposición del lector información ya publicada sobre un tema específico. El texto se divide en: Introducción, y las secciones que correspondan al desarrollo del tema en cuestión.

En el caso de libros de un solo autor (o más de uno, pero todos responsables del contenido total del libro), después del o los nombres, se debe indicar el título del libro, el número de la edición, el país, la casa editorial y el año. Cuando se trate del capítulo de un libro de varios autores, se debe poner el nombre del autor del capítulo, luego el título del capítulo, después el nombre de los editores y el título del libro, seguido del país, la casa editorial, año y las páginas que abarca el capítulo.

11. Agradecimientos y conflicto de interés. Siempre que corresponda, se deben especificar las colaboraciones que necesitan ser reconocidas, tales como a) la ayuda técnica recibida; b) el agradecimiento por el apoyo financiero y material, especificando la índole del mismo; c) las relaciones financieras que pudieran suscitar un conflicto de intereses. Las personas que colaboraron pueden ser citadas por su nombre, añadiendo su función o tipo de colaboración; por ejemplo: “asesor científico”, “revisión crítica de la propuesta para el estudio”, “recolección de datos”, etc. Siempre que corresponda, los autores deberán mencionar si existe algún conflicto de interés. 12. Literatura citada. Numere las referencias consecutivamente en el orden en que se mencionan por primera vez en el texto. Las referencias en el texto, en los cuadros y en las ilustraciones se deben identificar mediante números arábigos entre paréntesis, sin señalar el año de la referencia. Evite hasta donde sea posible, el tener que mencionar en el texto el nombre de los autores de las referencias. Procure abstenerse de utilizar los resúmenes como referencias; las “observaciones inéditas” y las “comunicaciones personales” no deben usarse como

En el caso de tesis, se debe indicar el nombre del autor, el título del trabajo, luego entre corchetes el grado (licenciatura, maestría, doctorado), luego el nombre de la ciudad, estado y en su caso país, seguidamente el nombre de la Universidad (no el de la escuela), y finalmente el año. Emplee el estilo de los ejemplos que aparecen a continuación, los cuales están parcialmente basados en el formato que la Biblioteca Nacional de Medicina de los Estados Unidos usa en el Index Medicus. Revistas

Artículo ordinario, con volumen y número. (Incluya el nombre de todos los autores cuando sean seis o menos; si son siete o más, anote sólo el nombre de los seis primeros y agregue “et al.”).

VIII

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

XI)

Sólo número sin indicar volumen. II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10.

XII) Cunningham EP. Genetic diversity in domestic animals: strategies for conservation and development. In: Miller RH et al. editors. Proc XX Beltsville Symposium: Biotechnology’s role in genetic improvement of farm animals. USDA. 1996:13.

III) Chupin D, Schuh H. Survey of present status ofthe use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

Tesis.

No se indica el autor.

XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Suplemento de revista.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

Organización como autor. XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984.

Organización, como autor. VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282-284.

XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996.

En proceso de publicación. VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide treated area by cattle. J Range Manage [in press] 2000.

XVII) AOAC. Oficial methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990.

Libros y otras monografías

XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988.

Autor total. VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Publicaciones electrónicas

Autor de capítulo. IX)

XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accessed Jul 30, 2003.

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Memorias de reuniones. X)

Olea PR, Cuarón IJA, Ruiz LFJ, Villagómez AE. Concentración de insulina plasmática en cerdas alimentadas con melaza en la dieta durante la inducción de estro lactacional [resumen]. Reunión nacional de investigación pecuaria. Querétaro, Qro. 1998:13.

XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Ago, 2003.

Loeza LR, Angeles MAA, Cisneros GF. Alimentación de cerdos. En: Zúñiga GJL, Cruz BJA editores. Tercera reunión anual del centro de investigaciones forestales y agropecuarias del estado de Veracruz. Veracruz. 1990:51-56.

XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect. com/science/journal/03016226. Accessed Sep 12, 2003.

ha hectárea (s) h hora (s) i.m. intramuscular (mente) i.v. intravenosa (mente) J joule (s) kg kilogramo (s) km kilómetro (s) L litro (s) log logaritmo decimal Mcal megacaloría (s) MJ megajoule (s) m metro (s) msnm metros sobre el nivel del mar µg microgramo (s) µl microlitro (s) µm micrómetro (s)(micra(s)) mg miligramo (s) ml mililitro (s) mm milímetro (s) min minuto (s) ng nanogramo (s)Pprobabilidad (estadística) p página PC proteína cruda PCR reacción en cadena de la polimerasa pp páginas ppm partes por millón % por ciento (con número) rpm revoluciones por minuto seg segundo (s) t tonelada (s) TND total de nutrientes digestibles UA unidad animal UI unidades internacionales

13. Cuadros, Gráficas e Ilustraciones. Es preferible que sean pocos, concisos, contando con los datos necesarios para que sean autosuficientes, que se entiendan por sí mismos sin necesidad de leer el texto. Para las notas al pie se deberán utilizar los símbolos convencionales. 14 Versión final. Es el documento en el cual los autores ya integraron las correcciones y modificaciones indicadas por el Comité Revisor. Los trabajos deberán ser elaborados con Microsoft Word. Las fotografías e imágenes deberán estar en formato jpg (o compatible) con al menos 300 dpi de resolución. Tanto las fotografías, imágenes, gráficas, cuadros o tablas deberán incluirse en el mismo archivo del texto. Los cuadros no deberán contener ninguna línea vertical, y las horizontales solamente las que delimitan los encabezados de columna, y la línea al final del cuadro. 15. Una vez recibida la versión final, ésta se mandará para su traducción al idioma inglés o español, según corresponda. Si los autores lo consideran conveniente podrán enviar su manuscrito final en ambos idiomas. 16. Tesis. Se publicarán como Artículo o Nota de Investigación, siempre y cuando se ajusten a las normas de esta revista. 17. Los trabajos no aceptados para su publicación se regresarán al autor, con un anexo en el que se explicarán los motivos por los que se rechaza o las modificaciones que deberán hacerse para ser reevaluados.

versus

gravedades

Cualquier otra abreviatura se pondrá entre paréntesis inmediatamente después de la(s) palabra(s) completa(s).

18. Abreviaturas de uso frecuente: cal cm °C DL50 g

caloría (s) centímetro (s) grado centígrado (s) dosis letal 50% gramo (s)

19. Los nombres científicos y otras locuciones latinas se deben escribir en cursivas.

Updated: March, 2020 INSTRUCTIONS FOR AUTHORS Revista Mexicana de Ciencias Pecuarias is a scientific journal published in a bilingual format (Spanish and English) which carries three types of papers: Research Articles, Technical Notes, and Reviews. Authors interested in publishing in this journal, should follow the belowmentioned directives which are based on those set down by the International Committee of Medical Journal Editors (ICMJE) Bol Oficina Sanit Panam 1989;107:422-437. 1.

Title page Abstract Text Acknowledgments and conflict of interest Literature cited

Only original unpublished works will be accepted. Manuscripts based on routine tests, will not be accepted. All experimental data must be subjected to statistical analysis. Papers previously published condensed or in extenso in a Congress or any other type of Meeting will not be accepted (except for Abstracts). All contributions will be peer reviewed by a scientific editorial committee, composed of experts who ignore the name of the authors. The Editor will notify the author the date of manuscript receipt. Papers will be submitted in the Web site http://cienciaspecuarias.inifap.gob.mx, according the “Guide for submit articles in the Web site of the Revista Mexicana de Ciencias Pecuarias”. Manuscripts should be prepared, typed in a 12 points font at double space (including the abstract and tables), At the time of submission a signed agreement co-author letter should enclosed as complementary file; coauthors at different institutions can mail this form independently. The corresponding author should be indicated together with his address (a post office box will not be accepted), telephone and Email.

Title page. It should only contain the title of the work, which should be concise but informative; as well as the title translated into English language. In the manuscript is not necessary information as names of authors, departments, institutions and correspondence addresses, etc.; as these data will have to be registered during the capture of the application process on the OJS platform (http://cienciaspecuarias.inifap.gob.mx).

Abstract. On the second page a summary of no more than 250 words should be included. This abstract should start with a clear statement of the objectives and must include basic procedures and methodology. The more significant results and their statistical value and the main conclusions should be elaborated briefly. At the end of the abstract, and on a separate line, a list of up to 10 key words or short phrases that best describe the nature of the research should be stated.

Text. The three categories of articles which are published in Revista Mexicana de Ciencias Pecuarias are the following:

a) Research Articles. They should originate in primary

works and may show partial or final results of research. The text of the article must include the following parts:

To facilitate peer review all pages should be numbered consecutively, including tables, illustrations and graphics, and the lines of each page should be numbered as well.

Introduction Materials and Methods Results Discussion Conclusions and implications Literature cited

Research articles will not exceed 20 double spaced pages, without including Title page and Tables and Figures (8 maximum and be included in the text). Technical notes will have a maximum extension of 15 pages and 6 Tables and Figures. Reviews should not exceed 30 pages and 5 Tables and Figures.

In lengthy articles, it may be necessary to add other sections to make the content clearer. Results and Discussion can be shown as a single section if considered appropriate.

Manuscripts of all three type of articles published in Revista Mexicana de Ciencias Pecuarias should contain the following sections, and each one should begin on a separate page.

b) Technical Notes. They should be brief and be evidence for technical changes, reports of clinical cases of special interest, complete description of a limited investigation, or research results which

should be published as a note in the opinion of the editors. The text will contain the same information presented in the sections of the research article but without section titles.

names(s), the number of the edition, the country, the printing house and the year. e. When a reference is made of a chapter of book written by several authors; the name of the author(s) of the chapter should be quoted, followed by the title of the chapter, the editors and the title of the book, the country, the printing house, the year, and the initial and final pages.

c) Reviews. The purpose of these papers is to

summarize, analyze and discuss an outstanding topic. The text of these articles should include the following sections: Introduction, and as many sections as needed that relate to the description of the topic in question.

f. In the case of a thesis, references should be made of the author’s name, the title of the research, the degree obtained, followed by the name of the City, State, and Country, the University (not the school), and finally the year.

10. Acknowledgements. Whenever appropriate, collaborations that need recognition should be specified: a) Acknowledgement of technical support; b) Financial and material support, specifying its nature; and c) Financial relationships that could be the source of a conflict of interest.

Examples The style of the following examples, which are partly based on the format the National Library of Medicine of the United States employs in its Index Medicus, should be taken as a model.

People which collaborated in the article may be named, adding their function or contribution; for example: “scientific advisor”, “critical review”, “data collection”, etc. 11. Literature cited. All references should be quoted in their original language. They should be numbered consecutively in the order in which they are first mentioned in the text. Text, tables and figure references should be identified by means of Arabic numbers. Avoid, whenever possible, mentioning in the text the name of the authors. Abstain from using abstracts as references. Also, “unpublished observations” and “personal communications” should not be used as references, although they can be inserted in the text (inside brackets).

Key rules for references a. The names of the authors should be quoted beginning with the last name spelt with initial capitals, followed by the initials of the first and middle name(s). In the presence of compound last names, add a dash between both, i.e. Elias-Calles E. Do not use any punctuation sign, nor separation between the initials of an author; separate each author with a comma, even after the last but one. b. The title of the paper should be written in full, followed by the abbreviated title of the journal without any punctuation sign; then the year of the publication, after that the number of the volume, followed by the number (in brackets) of the journal and finally the number of pages (this in the event of ordinary article). c. Accepted articles, even if still not published, can be included in the list of references, as long as the journal is specified and followed by “in press” (in brackets).

Journals

Standard journal article (List the first six authors followed by et al.) I)

Basurto GR, Garza FJD. Efecto de la inclusión de grasa o proteína de escape ruminal en el comportamiento de toretes Brahman en engorda. Téc Pecu Méx 1998;36(1):35-48.

Issue with no volume II) Stephano HA, Gay GM, Ramírez TC. Encephalomielitis, reproductive failure and corneal opacity (blue eye) in pigs associated with a paramyxovirus infection. Vet Rec 1988;(122):6-10. III) Chupin D, Schuh H. Survey of present status of the use of artificial insemination in developing countries. World Anim Rev 1993;(74-75):26-35.

No author given IV) Cancer in South Africa [editorial]. S Afr Med J 1994;84:15.

Journal supplement V) Hall JB, Staigmiller RB, Short RE, Bellows RA, Bartlett SE. Body composition at puberty in beef heifers as influenced by nutrition and breed [abstract]. J Anim Sci 1998;71(Suppl 1):205.

d. In the case of a single author’s book (or more than one, but all responsible for the book’s contents), the title of the book should be indicated after the

XII

Organization, as author VI) The Cardiac Society of Australia and New Zealand. Clinical exercise stress testing. Safety and performance guidelines. Med J Aust 1996;(164):282284.

In press VII) Scifres CJ, Kothmann MM. Differential grazing use of herbicide-treated area by cattle. J Range Manage [in press] 2000. Books and other monographs

Author(s) VIII) Steel RGD, Torrie JH. Principles and procedures of statistics: A biometrical approach. 2nd ed. New York, USA: McGraw-Hill Book Co.; 1980.

Organization as author XV) NRC. National Research Council. The nutrient requirements of beef cattle. 6th ed. Washington, DC, USA: National Academy Press; 1984. XVI) SAGAR. Secretaría de Agricultura, Ganadería y Desarrollo Rural. Curso de actualización técnica para la aprobación de médicos veterinarios zootecnistas responsables de establecimientos destinados al sacrificio de animales. México. 1996. XVII) AOAC. Official methods of analysis. 15th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 1990. XVIII) SAS. SAS/STAT User’s Guide (Release 6.03). Cary NC, USA: SAS Inst. Inc. 1988. XIX) SAS. SAS User´s Guide: Statistics (version 5 ed.). Cary NC, USA: SAS Inst. Inc. 1985.

Chapter in a book IX)

Roberts SJ. Equine abortion. In: Faulkner LLC editor. Abortion diseases of cattle. 1rst ed. Springfield, Illinois, USA: Thomas Books; 1968:158-179.

Conference paper X)

XI)

Thesis XIII) Alvarez MJA. Inmunidad humoral en la anaplasmosis y babesiosis bovinas en becerros mantenidos en una zona endémica [tesis maestría]. México, DF: Universidad Nacional Autónoma de México; 1989.

Electronic publications XX) Jun Y, Ellis M. Effect of group size and feeder type on growth performance and feeding patterns in growing pigs. J Anim Sci 2001;79:803-813. http://jas.fass.org/cgi/reprint/79/4/803.pdf. Accesed Jul 30, 2003. XXI) Villalobos GC, González VE, Ortega SJA. Técnicas para estimar la degradación de proteína y materia orgánica en el rumen y su importancia en rumiantes en pastoreo. Téc Pecu Méx 2000;38(2): 119-134. http://www.tecnicapecuaria.org/trabajos/20021217 5725.pdf. Consultado 30 Jul, 2003. XXII) Sanh MV, Wiktorsson H, Ly LV. Effect of feeding level on milk production, body weight change, feed conversion and postpartum oestrus of crossbred lactating cows in tropical conditions. Livest Prod Sci 2002;27(2-3):331-338. http://www.sciencedirect.com/science/journal/030 16226. Accesed Sep 12, 2003. 12. Tables, Graphics and Illustrations. It is preferable that they should be few, brief and having the necessary data so they could be understood without reading the text. Explanatory material should be placed in footnotes, using conventional symbols.

13. Final version. This is the document in which the authors have already integrated the corrections and modifications indicated by the Review Committee. The works will have to be elaborated with Microsoft Word. Photographs and images must be in jpg (or compatible) format with at least 300 dpi resolution. Photographs, images, graphs, charts or tables must be included in the same text file. The boxes should not contain any vertical lines, and the horizontal ones only those that delimit the column headings, and the line at the end of the box.

XIV) Cairns RB. Infrared spectroscopic studies of solid oxigen [doctoral thesis]. Berkeley, California, USA: University of California; 1965.

XIII

14. Once accepted, the final version will be translated into Spanish or English, although authors should feel free to send the final version in both languages. No charges will be made for style or translation services.

MJ m µl µm mg ml mm min ng

mega joule (s) meter (s) micro liter (s) micro meter (s) milligram (s) milliliter (s) millimeter (s) minute (s) nanogram (s) P probability (statistic) p page CP crude protein PCR polymerase chain reaction pp pages ppm parts per million % percent (with number) rpm revolutions per minute sec second (s) t metric ton (s) TDN total digestible nutrients AU animal unit IU international units

15. Thesis will be published as a Research Article or as a Technical Note, according to these guidelines. 16. Manuscripts not accepted for publication will be returned to the author together with a note explaining the cause for rejection, or suggesting changes which should be made for re-assessment.

17. List of abbreviations: cal cm °C DL50 g ha h i.m. i.v. J kg km L log Mcal

calorie (s) centimeter (s) degree Celsius lethal dose 50% gram (s) hectare (s) hour (s) intramuscular (..ly) intravenous (..ly) joule (s) kilogram (s) kilometer (s) liter (s) decimal logarithm mega calorie (s)

versus

gravidity

The full term for which an abbreviation stands should precede its first use in the text. 18. Scientific names and other Latin terms should be written in italics.

XIV

https://doi.org/10.22319/rmcp.v12i3.5646 Article

Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin

Roberto Adame-Gómez a Jeiry Toribio-Jimenez b Natividad Castro-Alarcón c Karina Talavera-Alarcón a Jacqueline Flores-Gavilan a Sandra-Alheli Pineda-Rodríguez d Arturo Ramírez-Peralta a*

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Patometabolismo Microbiano. Chilpancingo, Guerrero, México. b

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Microbiología Molecular y Biotecnología Ambiental. Chilpancingo, Guerrero, México. c

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Microbiología. Chilpancingo, Guerrero, México. d

Universidad Autónoma de Guerrero. Facultad de Ciencias Químico Biológicas, Laboratorio de Investigación en Parasitología. Chilpancingo, Guerrero, México.

*Corresponding author: ramirezperaltauagro@gmail.com

Abstract: Staphylococcus aureus is a pathogen recognized as a cause of mastitis in cattle worldwide, so the objective of this work was to determine the presence of Staphylococcus aureus in the teat skin of the bovine udder and relate it to the presence of mastitis, as well as to determine 665

Rev Mex Cienc Pecu 2021;12(3):665-680

the virulence factors and genetic diversity of the strains. Samples of 250 milking cows were taken in three farms, in two seasons of the year, dry and rainy. In addition, the California test was performed. Staphylococcus aureus was isolated in salt agar and mannitol and biochemically identified and confirmed with amplification of the femA gene. For the identification of virulence factors, the genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD and seE were used by end-point PCR. For the typing of S. aureus, amplification and restriction of the coag gene was performed. The frequency of S. aureus was 13.4 %. No statistical relationship between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis was found. The most frequent enterotoxin gene in the strains was enterotoxin A. Although the percentage of typing is low, it was possible to identify two restrictotypes that group strains isolated from different cows, which shows the infectious and contagious capacity of the microorganism. Key words: Bovine udder, Staphylococcus aureus, Genetic diversity, Mastitis.

Received: 20/03/2020 Accepted: 08/01/2021

Introduction Bovine mastitis (MB) is the inflammation of the mammary gland caused in most cases by a microorganism, which invades the udder through the teat canal(1,2). This disease is classified, according to the clinical manifestations it presents, into clinical mastitis (CM) and subclinical bovine mastitis (SCM), the latter being the most common clinical entity(3). Although there are numerous bacterial genera that cause mastitis, only a small number of species are prevalent and constitute a real public health problem(2). Staphylococcus aureus is recognized as a pathogen worldwide for causing mastitis(4), being responsible for approximately one third of cases of clinical and subclinical mastitis in cattle(5,6), being considered a problem in the livestock industry due to its pathogenicity, persistence in the environment, ease of contagion between cow and cow during the milking process(2,7), due to the low rates of resolution of the disease with current treatments(8), leading to chronic infections, which persist between periods of lactation, with intermittent clinical episodes occurring from the elevation of temperature, degrees of anorexia, the appearance of clots in milk(1), which increases the risks of slaughter of the animal, work, treatment and replacement costs, veterinary visits, incorporation of protocols to avoid risk with investment 666

Rev Mex Cienc Pecu 2021;12(3):665-680

in infrastructure as well as the implementation of diagnostic methods more frequently(9). However, mastitis not only has an impact on the producer’s economy, but also becomes a public health problem by being a potential source of zoonotic transmission, since S. aureus has been described as capable of causing disease in humans(10,11). Bovine mastitis has relevance in the context of food poisoning in humans. Ingestion of products contaminated with staphylococcal enterotoxins results in poisoning characterized by violent vomiting and diarrhea(12). Among the factors related to an infection by S. aureus in the mammary gland is hygiene both in milking and in the udder of the animal(13,14). In recent years, it has been suggested that the colonization of the udder skin could be a predominant factor in the development of mastitis by dragging the microorganism during milking towards the animal’s teat; however, several studies differ in relation to this assertion. Cases of S. aureus mastitis have been described as being caused by strains highly adapted to the mammary gland and that they are different from skin isolates(2,15). While other studies suggest that most S. aureus isolated from the skin and teat canal as well as extra mammary sites such as vagina, nostrils and skin of the jaws are genetically the same as those found in mammary glands or milk(16-18). Therefore, the objective of this study was to determine the frequency of S. aureus in the skin of the teats of udders of cows from three dairy farms located in the south of the state of Guerrero, Mexico, the genetic diversity and virulence factors of the strains of S. aureus, as well as the possible relationship with bovine mastitis.

Material and methods Farms and sampling

Three farms were included in the study. Based on the permission of the owners and the size of the farm. A sample of the teat skin was taken from the four quarters of the 250 milking cows, in two different seasons of the year: rains and dryness, having a total of 500 samples. The samples were taken with a cotton swab, which was slid on each edge of the teat and around it, covering an area of 2 cm. The California test was then performed, considering the interpretation of the test described above. All farms sell raw milk directly to consumers and one of them is characterized for being a site for the production of cheeses made with raw milk. On this farm, raw milk is collected during the morning and directly processed in a small artisanal cheese production plant.

667

Rev Mex Cienc Pecu 2021;12(3):665-680

Isolates

Samples taken with swabs from the teat skin were cultured in salt agar and mannitol. The isolates were presumptively identified as S. aureus according to the following scheme: mannitol positive, catalase positive, Gram positive cocci and coagulase positive in 6 h. The isolates were preserved at -20 °C in BHI (Brain Heart Infusion) broth with 15 % (V / V) of glycerol.

Molecular identification of S. aureus The strains were cultured in brain-heart infusion broth and incubated at 37 °C. The control strains used in this study were S. aureus ATCC29231 (sea), S. aureus ATCC14458 (seb), S. aureus ATCC19095 (sec), S. aureus ATCC13563 (sed), S. aureus ATCC27664 (see) and S. aureus ATCC25923 (femA, coag, hlb, sak). The total DNA was obtained from 1 ml from an 18 h culture of all bacterial strains including ATCC strains. The cells were sedimented from the centrifugation of cultures at 10,000 rpm for 10 min and suspended in 300 μl of lysis buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0, lysozyme 1 mg/ml) and incubated at 37 °C for half an hour or until viscosity is observed. DNA from all preparations was subsequently extracted with phenol chloroform and precipitated with ethanol. DNA samples were diluted in TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0)(19). An end-point PCR of the femA gene was performed on the strains for molecular confirmation of S. aureus with the oligonucleotides described in Table 1. The final PCR reaction mixture contained 0.2 mM of each dNTP, 3 mM of MgCl2, 0.2 mM of oligonucleotides, 1 U taq DNA polymerase (Amplicon, Denmark) 5 μl of 10X buffer and 100 ng of DNA as a template. Table 1: Oligonucleotides used for molecular identification, detection of enterotoxin genes, and molecular typing Gene (virulence Sequence (5'- 3') APS Ref. factor) femA coa (coagulase)

femaF- AAAAAAGCACATAACAAGCG femaR- GATAAAGAAGAAAACCAGCAG coaF- CGAGACCAAGATTCAACAAG coaR- AAAGAAAACCACTCACATCA

130

(20)

600900

(22)

seA (enterotoxin A)

seaF- TGCAGGGAACAGCTTTAGGC seaR- GTGTACCACCCGCACATTGA

250

seB (enterotoxin B)

sebFATTCTATTAAGGACACTAAGTTAGGG

400

668

(20)

Rev Mex Cienc Pecu 2021;12(3):665-680

sebR- ATCCCGTTTCATAAGGCGAGT

seC (enterotoxin C)

seD (enterotoxin D)

seE (enterotoxin E) hlB (hemolysin β)

secF- GTAAAGTTACAGGTGGCAAAACTTG secRCATATCATACCAAAAAGTATTGCCGT sedFGAATTAAGTAGTACCGCGCTAAATAATA TG sedR- GCTGTATTTTTCCTCCGAGAGT seeFCAAAGAAATGCTTTAAGCAATCTTAGGC seeR- CACCTTACCGCCCAAAGCTG hlbF- GTGCACTTACTGACAATAGTGC hlbR- GTTGATGAGTAGCTACCTTCAGT

297

492

480

300

sakF- ATCCCGTTTCATAAGGCGAGT sakR- CACCTTACCGCCCAAAGCTG

260

In this study

mecA (Methicillin resistance)

mecaF- TCCAGATTACAACTTCACCAGG mecaR- CCACTTCATATCTTGTAACG

180

(21)

tsst-1 (toxic shock syndrome toxin)

tsstF- CATCTACAAACGATAATATAAAGG tsstRCATTGTTATTTTCCAATAACCACCCG

476

In this study

saK (staphylokinase)

APS= amplified product size (pb); Ref.= reference.

Identification of coding genes for virulence factors The detection of the genes hlB, mec, saK, pvL, tsst-1, seA, seB, seC, seD and seE encoding β-hemolysin, methicillin resistance region, staphylokinase, Panton Valentine toxin, toxic shock syndrome toxin and enterotoxins respectively, was based end-point PCR with the oligonucleotides described in Table 1. The final PCR reaction mixture contained: 0.2 mM of each dNTP, 3 mM MgCl2, 0.2 μM of oligonucleotides, 1 U of Taq DNA polymerase (Ampliqon®, DEN), 1X Buffer and 100 ng of DNA as a template. The reaction mixtures were subjected to the following amplification conditions: initial denaturation for 5 min, at 94 °C; 30 cycles of 30 sec at 94 °C, 30 sec at 52 °C, 30 sec at 72 °C; and a final extension for 5 min at 72 °C for mec, hlB, pvL, tsst-1, seA and seE. Initial denaturation for 5 min at 94 °C; 30 cycles of 30 sec at 94 °C, 45 sec at 52 °C, 45 sec at 72 °C; and a final extension for 5 min at 72 °C for saK, seB, seC and seD(20,21). The electrophoresis of the PCR products was performed in 2 % agarose gels at 80 V for 60 min. The gels were stained with Midori green (Nippon Genetics®, GER) and visualized with LED light (Nippon Genetics®, GER) at 470 nm. 669

Rev Mex Cienc Pecu 2021;12(3):665-680

Phenotypic test to show the expression of the hlB gene To demonstrate the expression of the β-hemolysin, the strains were cultured by cross-streak in 5 % ram blood agar, being incubated at 37 °C in CO2 tension for 24 h. Strains that had a halo of transparency in the perimeter of the colonies are considered β-hemolytic (hlB+). Strains that presented α and γ-hemolysis are considered hlB-.

Molecular typing of S. aureus In the strains molecularly confirmed as S. aureus, the coag gene was amplified by end-point PCR with the oligonucleotides described in Table 1 and with the following final mixture for each PCR reaction: 0.2 mM of each dNTP, 3 mM MgCl2, 0.2 μM oligonucleotides, 1 U of Taq DNA polymerase (Ampliqon®, DEN), 1X Buffer and 100 ng of DNA as a template. The PCR protocol begins with initial denaturation for 5 min, at 94 °C; 30 cycles of 30 sec at 94 °C, 30 sec at 52 °C, 60 sec at 72 °C; and a final extension for 5 min at 72 °C (22). PCR products were digested for 2 h at 37 °C with 10 U of the restriction enzyme AluI (Thermo Scientific®, USA) according to the protocol recommended by the manufacturer. Restriction fragments were detected by electrophoresis in 2 % agarose gels at 70 V for 60 min. The gels were stained with Midori green (Nippon Genetics®, GER) and visualized with LED light (Nippon Genetics®, GER).

Statistical analysis The STATA V. 12 statistical package (STATA®, USA) was used to calculate simple frequencies and the Chi-square statistical test was used for possible relationships between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis, values of P= <0.05 are considered as statistically significant.

Results and discussion In this study, of the total number of cows analyzed in the two periods, a frequency of subclinical mastitis of 6.6 % (33/500) and clinical mastitis of 0.8 % (4/500) was determined. The frequency of subclinical mastitis per dairy farm was higher in farm A (12 %) in relation to B (4 %) and C (1 %) (P=0.001) (Table 2). These differences in frequency may be related to the implementation or compliance with well-characterized strategies for the control of intra mammary infections or known as the 5-point plan, which includes the milking sequence, use of gloves, change of paper or cloth towel between the udder quarters, pre-seal and post-seal of the teat (23). In addition to other factors such as the presence of infections and their time of evolution(24), the nature of the infectious agent, the parity and the state of lactation of the animal, as well as the nutrition and the environment where it is(25). In this last point, it is 670

Rev Mex Cienc Pecu 2021;12(3):665-680

known that the rainy season (summer) is an environmental risk factor for the development of mastitis, being more frequent the appearance of cases during this season in relation to others such as winter(26), which was observed in our study, in which, during the rainy period, the frequency of subclinical mastitis was higher (10.8 %) in relation to the dry season (2.4 %) (P=0.001). Several authors agree on this statement, considering that humidity may have an important role; however, they also conclude that this period could coincide with the onset of lactation or the end of gestation, which should generally be considered for cows of first parity during the season with the most desirable climate, in this case summer, during which the availability of grass and therefore of feed is greater(27,28). Table 2: Frequency of subclinical and clinical mastitis in relation to dairy farms, season and presence of S. aureus in the teat of cows’ udders California Test Characteristic Total p Subclinical Clinical Negative Traces mastitis mastitis Dairy farm A 200 8 (4) 164 (82) 24 (12) 4 (2) B 200 4 (2) 188 (94) 8 (4) 0 0.001 C 100 0 99 (99) 1 (1) 0 Season Rainy 250 11 (4.4) 208 (83.2) 27 (10.8) 4 (1.6) Dry 250 1 (0.4) 242 (97.8) 6 (2.4) 0 0.001 S. aureus in udder Positive 67 0 66 (98.5) 1 (1.5) 0 0.106 Negative 433 12 (2.7) 385 (88.9) 32 (7.5) 4 (0.9) Cases of clinical mastitis only occurred in dairy farm A (2 %) and in the rainy season (1.6 %) (P=0.001). In the case of the isolation of the microorganism of interest from the teat skin of the udder of the cows analyzed, the frequency of S. aureus from the identification of the femA gene was 13.4 % (67/500) (Figure 1, Table 2). Other markers are used to determine the species of S. aureus such as the thermonuclease gene (nuc)(29) and the region of the 16 rRNA gene(30); however, the nuc gene can be found in other Staphylococcus species coagulase-positive (S. hyicus, S. delphini, S. intermedius, S. pseudointermedius, S. schleiferi) and negative (S. capitis, S. caprae, S. epidermidis, S. warneri, S. simulans, S. carnosus, S. kloosii, S. saprophyticus)(31), so it was decided to work with this gene, which is related to the synthesis of peptidoglycan and has a high identification power for S. aureus resistant to methicillin(32).

671

Rev Mex Cienc Pecu 2021;12(3):665-680

Figure 1: Electrophoresis of femA gene amplification of S. aureus strains of bovine udder skin

A) 1, S522 (PL); 2, S528 (PL), 3; S519 (PL); 4, S529 (PL); 5, S521 (CL); 6, MPM; 7, negative control; 8, positive control (S. aureus ATCC25923); 9, S517 (PL); 10, S643 (CS). B) 1, negative control; 2, S522 (PL); 3, S528 (PL); 4, S529 (PL); 5, S521 (CL); 6, MPM (100 PB); 7, S517 (PL); 8, S643 (CS); 9, S650 (CS). A= barn a; B= barn B; L= rainy; S= dry; MPM= Molecular weight marker of 100 pb. En b, las cepas débilmente positivas y positivas se volvieron a repetir y se modificaron las condiciones de electroforesis

S. aureus was isolated from most quarters that only had traces or low number of somatic cells, and isolated only from a cow with subclinical mastitis. Determining that there is no relationship between S. aureus isolates from the teat skin of cows’ udder with the development of mastitis symptoms (P=0.106). Several factors could explain the absence of this relationship, from the immune status of the animal, the inoculum of the microorganism and the genetic characteristics of the strain. Even in recent years, the role of the microbiota of cow’s udder has been described as an important factor in the development of mastitis, with the presence of other microorganisms that could act as antagonists of pathogens restricting their multiplication or establishment of the infection; for example, S. chromogenes has been described as producing bacteriocins capable of inhibiting the growth of most intramammary pathogens(33,34). Considering that factors such as parity and the state of immunosuppression generated during gestation, lactation, metabolic profile and genetic load of the animal could 672

Rev Mex Cienc Pecu 2021;12(3):665-680

positively or negatively impact the composition of the udder microbiota and therefore the susceptibility of mastitis(35). Although no relationship was found with the cases of subclinical mastitis in the study, other relationships were sought, such as the distribution of S. aureus in the three dairy farms (A, B and C), which was 14, 11.5 and 16 % respectively, with no statistically significant differences observed (P=0.531) (Table 3). These results could be explained by the ubiquity of the microorganism, the infectious and contagious capacity, as well as its persistence in the dairy environment(2). In this study, the most frequently observed differences in seasonality for S. aureus were in the dry season (23.6 %, 29/250) in relation to the rainy season (3.2 %, 8/250), they could be explained by the accelerated growth of microorganisms associated with the temperature and humidity of the season(36), as well as an altered metabolic state, including some type of immunocompromise due to food restriction(35), which favors the colonization of the microorganisms. Table 3: Presence of S. aureus in the teat of cows’ udders in relation to dairy farms and season S. aureus Characteristics Total P Positive Negative Dairy farm A 200 28 (14.0) 172 (86.0) B 200 23 (11.5) 177 (88.5) 0.531 C 100 16 (16.0) 84 (84.0) Season Rainy 250 8 (3.20) 242 (96.8) 0.001 Dry 250 59 (23.6) 191 (76.4) Similarly, no statistical relationship between the presence of S. aureus in the bovine udder skin and the development of subclinical mastitis was found; however, virulence factors that are key in both the development of infections and food poisoning were determined (37,38). The most frequent enterotoxin gene in S. aureus strains was enterotoxin A (10.44 %), highlighting that no strains with the genes for enterotoxins B and C were found. As for toxins, 23 strains with the β hemolysin gene (34.32 %) were found; it is important to mention that this data is adjusted with the phenotypic test of hemolysis in ram’s blood, which was considered because oligonucleotides designed for this gene do not amplify it completely and this gene is susceptible to the insertion of phages and the inclusion of genes such as enterotoxin A and staphylokinase (saK)(39,40). In this study, no strains with one of the genes associated with Panton Valentine toxin were found.

673

Rev Mex Cienc Pecu 2021;12(3):665-680

Finally, only two strains with the saK gene (2.98 %) were found and three strains were defined as MRSA from the amplification of the mecA gene (4.47 %) (Table 4). In this sense, several studies have sought to establish a profile of virulence characteristic of the strains of S. aureus capable of causing subclinical mastitis, assuming that the microorganism must adapt to a certain environment when invading the bovine udder, the results have been diverse, however, as points in common, they converge in that hemolysin b and Panton Valentine toxin are virulence factors that could participate in the development of subclinical mastitis, having as their main function, the formation of pores or lysis of leukocytes (2,41,42). Which could be confirmed with the results in this study, the strains having in low or no frequency, the genes of these toxins (both that of hemolysin and Panton Valentine toxin) were not associated with cases of subclinical mastitis. A relationship of these strains with particular clinical pictures in the bovine udder was not established; however, the strains have epidemiological importance due to the presence of enterotoxin genes, these could contaminate by dragging during milking and ultimately be found in the final dairy product and cause a problem of food poisoning(43). Table 4: Virulence factors of S. aureus strains isolated from cow udders Virulence factor

n(%), N= 67

Enterotoxins seA seB seC seD seE tsst-1 Toxins hlB pvL Enzymes saK mecA

7 (10.44) 2 (2.98) 1 (1.49) 4 (5.97) 23 (34.32) 2 (2.98) 3 (4.47)

As for the molecular typing of the strains of S. aureus, the percentage of typing has shown important variations in relation to time; in the years close to the beginning of the use of the PCR-RFLP technique of the coag gene, the typing of 100 % of the strains was achieved(44-48); however, in recent years this percentage decreases to 40 %(29,30,49), which is still higher than the percentage determined in this study (19.47 %) (Figure 1a). In this sense, two events must be considered, in the first instance it has been proposed that the decrease in the percentage of typing could be related to mutations in the coagulase gene that impact on the specificity of the proposed oligonucleotides, but do not affect the activity of the enzyme, 674

Rev Mex Cienc Pecu 2021;12(3):665-680

noting that oligonucleotides are the same as those used in the original technique and were established since 1992(22); on the other hand, it is important to compare the results in relation to the type of host from which S. aureus was isolated, because the change of host could involve important changes in the strain including the variability of the coag gene; however, if the percentage of typing in studies of S. aureus in cows is compared, results vary considerably between typing percentages(29,30,44,49). Although the percentage of typing is low, it was possible to identify a restrictotype (400 bp, 350 bp) that groups strains isolated from different cows from both barn A (Figure 2c, lane 4) and barn B (Figure 2b, lane 2, 3 and 4; Figure 2c, lane 1, 2 and 3), as well as the rainy season (Figure 2b, lane 2; Figure 2c, lane 1, 2 and 3) and dry season (Figure 2b, lane 3 and 4), which shows the infectious and contagious capacity of S. aureus, and this reaffirms the role of this microorganism in cases of mastitis of infectious type, which also emphasizes the importance of adopting measures that prevent the transmission of the microorganism in the dairy environment, being able to infect cattle, altering the quality of milk and cattle should be considered as a major source of contamination in the production of dairy products. Figure 2: Electrophoresis of coag gene restriction of strains isolated from bovine udder skin

(A) 1, S528; 2, positive control (S. aureus ATCC25923); 3, negative control; 4, MPM; 5, S519 (PL); 6, S520 (PL); 7, S530 (PL); 8, S618; 9, S673 (PS). (B) 1, S673 (PS); 2, S665 (PL); 3, 668 (PS); 4, 669 (PS); 671 (PS); 6, MPM (c) 1, S522 (PL); 2, S528 (PL); 3, S529 (PL); 4, S521 (CL); 5, MPM (100 PB); 6, S517 (PL); 7, S643 (CS); 8, S650 (CS); 9, S618. A= barn A, B= barn B; L= rainy; S= dry.

675

Rev Mex Cienc Pecu 2021;12(3):665-680

Conclusions and implications In this study, no relationship was found between the presence of S. aureus in the teat skin of cattle udder and the development of mastitis; however, strains with genes for enterotoxins, which are a public health problem, were determined. In addition, the transmission of strains in dairy farms was evidenced, which highlights the importance of good milking practices. Acknowledgments and conflicts of interest Thanks are extended to all the owners of the cattle included in this study, who agreed to participate and collaborated in the handling of the cattle during the sampling and who also always expressed their concern for the health of their cattle. Special thanks to Dr. Elvia Rodríguez Bataz for the final comments on the manuscript review. Literature cited: 1. Pumipuntu N, Tunyong W, Chantratita N, Diraphat P, Pumirat P, Sookrung N, et al. Staphylococcus spp. associated with subclinical bovine mastitis in central and northeast provinces of Thailand. Peer J 2019;7:e6587. doi:10.7717/peerj.6587. 2. Rainard P, Foucras G, Fitzgerald JR, Watts JL, Koop G, Middleton JR. Knowledge gaps and research priorities in Staphylococcus aureus mastitis control. Transbound Emerg Dis 2018;65:149–165. 3. Islam MA, Islam MZ, Islam M, Rahman M, Islam MT. Prevalence of subclinical mastitis in dairy cows in selected areas of Bangladesh. Trop Anim Health Prod 2012;9(1):73– 78. 4. Zecconi AA, Calvinho LFL, Fox K. Staphylococcus aureus intramammary infections. International Dairy Federation; 2006. Report No 408. 5. Botrel MA, Haenni M, Morignat E, Sulpice P, Madec JY, Calavas D. Distribution and antimicrobial resistance of clinical and subclinical mastitis pathogens in dairy cows in Rhône-Alpes, France. Foodborne Pathog Dis 2010;7(5):479–487. 6. Bradley AJ, Leach KA, Breen JE, Green LE, Green MJ. Survey of the incidence and aetiology of mastitis on dairy farms in England and Wales. Vet Rec 2007;160(8):253– 258. 7. da Costa LB, Rajala-Schultz PJ, Hoet A, Seo KS, Fogt K, Moon BS. Genetic relatedness and virulence factors of bovine Staphylococcus aureus isolated from teat skin and milk. J Dairy Sci 2014;97(11):6907–6916.

676

Rev Mex Cienc Pecu 2021;12(3):665-680

8. Peton V, Le Loir Y. Staphylococcus aureus in veterinary medicine. Infect Genet Evol 2014;21:602–615. 9. Halasa T, Huijps K, Østerås O, Hogeveen H. Economic effects of bovine mastitis and mastitis management: A review. Vet Q 2007;29(1):18–31. 10. Balaban N, Rasooly A. Staphylococcal enterotoxins. Int J Food Microbiol 2000;61(1):1– 10. 11. Honeyman AL, editor. Staphylococcus aureus infection and disease. New York, NY: Kluwer Acad./Plenum Publ; 2001. 12. Fetsch A, Johler S. Staphylococcus aureus as a foodborne pathogen. Curr Clin Microbiol Rep 2018;5(2):88–96. 13. Neave FK, Dodd FH, Kingwill RG, Westgarth DR. Control of mastitis in the dairy herd by hygiene and management. J Dairy Sci 1969;52(5):696–707. 14. Schreiner DA, Ruegg PL. Relationship between udder and leg hygiene scores and subclinical mastitis. J Dairy Sci 2003;86(11):3460–3475. 15. Zadoks RN, van Leeuwen WB, Kreft D, Fox LK, Barkema HW, Schukken YH, et al. Comparison of Staphylococcus aureus isolates from bovine and human skin, milking equipment, and bovine milk by phage typing, pulsed-field gel electrophoresis, and binary typing. J Clin Microbiol 2002;40(11):3894–33902. 16. Capurro A, Aspán A, Ericsson UH, Persson WK, Artursson K. Identification of potential sources of Staphylococcus aureus in herds with mastitis problems. J Dairy Sci 2010;93(1):180–191. 17. Haveri M, Hovinen M, Roslof A, Pyorala S. Molecular types and genetic profiles of Staphylococcus aureus strains isolated from bovine intramammary infections and extramammary sites. J Clin Microbiol 2008;46(11):3728–3735. 18. Mørk T, Kvitle B, Jørgensen HJ. Reservoirs of Staphylococcus aureus in meat sheep and dairy cattle. Vet Microbiol 2012;155(1):81–87. 19. Asadollahi P, Delpisheh A, Hossein MM, Azizi JF, Alikhani MY, Asadollahi K, et al. Enterotoxin and exfoliative toxin genes among methicillin-resistant Staphylococcus aureus isolates recovered from Ilam, Iran. Avicenna J Clin Microb Infec 2014;1(2):20208. doi:10.17795/ajcmi-20208. 20. Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect Immun 2002;70(2):631–341. 677

Rev Mex Cienc Pecu 2021;12(3):665-680

21. Milheiriço C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrob Agents Chemother 2007;51(9):3374–3377. 22. Goh SH, Byrne SK, Zhang JL, Chow AW. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J Clin Microbiol 1992;30(7):1642–1645. 23. Keane OM. Symposium review: Intramammary infections—major pathogens and strainassociated complexity. J Dairy Sci 2019;102(5):4713–4726. 24. Bradley AJ. Bovine Mastitis: An evolving disease. Vet J 2002;164(2):116–128. 25. Moyes KM. Triennial lactation symposium: Nutrient partitioning during intramammary inflammation: A key to severity of mastitis and risk of subsequent diseases? J Anim Sci 2015;93(12):5586–5593. 26. Joshi S, Gokhale S. Status of mastitis as an emerging disease in improved and periurban dairy farms in India. Ann N Y Acad Sci 2006;1081(1):74–83. 27. Morse D, DeLorenzo MA, Wilcox CJ, Collier RJ, Natzke RP, Bray DR. Climatic effects on occurrence of clinical mastitis. J Dairy Sci 1988;71(3):848–853. 28. Smith KL, Todhunter DA, Schoenberger PS. Environmental mastitis: cause, prevalence, prevention. J Dairy Sci 1985;68(6):1531–1553. 29. Javid F, Taku A, Bhat MA, Badroo GA, Mudasir M, Sofi TA. Molecular typing of Staphylococcus aureus based on coagulase gene. Vet World 2018;11(4):423–430. 30. Sharma V, Sharma S, Dahiya DK, Khan A, Mathur M, Sharma A. Coagulase gene polymorphism, enterotoxigenecity, biofilm production, and antibiotic resistance in Staphylococcus aureus isolated from bovine raw milk in North West India. Ann Clin Microbiol Antimicrob 2017;16(1):65. doi:10.1186/s12941-017-0242-9. 31. Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K. Rapid and accurate identification of human-associated Staphylococci by use of multiplex PCR. J Clin Microbiol 2011;49(10):3627–3631. 32. Vannuffel P, Heusterspreute M, Bouyer M, Vandercam B, Philippe M, Gala JL. Molecular characterization of from and-based discrimination of staphylococcal species. Res Microbiol 1999;150(2):129–141. 33. Braem G, Stijlemans B, Van Haken W, De Vliegher S, De Vuyst L, Leroy F. Antibacterial activities of coagulase-negative Staphylococci from bovine teat apex skin and their inhibitory effect on mastitis-related pathogens. J Appl Microbiol 2014;116(5):1084– 1093. 678

Rev Mex Cienc Pecu 2021;12(3):665-680

34. Carson DA, Barkema HW, Naushad S, De Buck J. Bacteriocins of Non-aureus Staphylococci isolated from bovine milk. Appl Environ Microbiol 2017;83(17) doi:10.1128/AEM.01015-17. 35. Derakhshani H, Fehr KB, Sepehri S, Francoz D, De Buck J, Barkema HW, et al. Invited review: Microbiota of the bovine udder: Contributing factors and potential implications for udder health and mastitis susceptibility. J Dairy Sci 2018;101(12):10605–10625. 36. Hogan J, Smith KL. Managing environmental mastitis. Vet Clin North Am Food Anim Pract 2012;28(2):217–224. 37. Kadariya J, Smith TC, Thapaliya D. Staphylococcus aureus and Staphylococcal Foodborne disease: An ongoing challenge in public health. BioMed Res Int 2014;2014:1–9. 38. Tong SYC, Davis JS, Eichenberger E, Holland TL, Fowler VG. Staphylococcus aureus infections: epidemiology, pathophysiology, clinical manifestations, and management. Clin Microbiol Rev 2015;28(3):603–661. 39. van Wamel WJB, Rooijakkers SHM, Ruyken M, van Kessel KPM, van Strijp JAG. The innate immune modulators Staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on hemolysin-converting bacteriophages. J Bacteriol 2006;188(4):1310–1315. 40. Argudín MÁ, Mendoza MC, Rodicio MR. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010;2(7):1751–1773. 41. Foster TJ. Immune evasion by staphylococci. Nat Rev Microbiol 2005;3(12):948–958. 42. van Kessel KPM, Bestebroer J, van Strijp JAG. Neutrophil-mediated phagocytosis of Staphylococcus aureus. Front immunol 2014;26(5):467. doi: 10.3389/fimmu.2014.00467. 43. Piccinini R, Cesaris L, Daprà V, Borromeo V, Picozzi C, Secchi C, et al. The role of teat skin contamination in the epidemiology of Staphylococcus aureus intramammary infections. J Dairy Res 2009;76(1):36–41. 44. Aarestrup FM, Dangler CA, Sordillo LM. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis. Can J Vet Res 1995;59(2):124–128. 45. Hookey JV, Richardson JF, Cookson BD. Molecular typing of Staphylococcus aureus based on PCR restriction fragment length polymorphism and DNA sequence analysis of the coagulase gene. J Clin Microbiol 1998;36(4):1083–1099.

679

Rev Mex Cienc Pecu 2021;12(3):665-680

46. Schlegelová J, Dendis M, Benedík J, Babák V, Rysánek D. Staphylococcus aureus isolates from dairy cows and humans on a farm differ in coagulase genotype. Vet Microbiol 2003;92(4):327–334. 47. Schwarzkopf A, Karch H. Genetic variation in Staphylococcus aureus coagulase genes: potential and limits for use as epidemiological marker. J Clin Microbiol 1994;32(10):2407–2412. 48. Su C, Herbelin C, Frieze N, Skardova O, Sordillo LM. Coagulase gene polymorphism of Staphylococcus aureus isolates from dairy cattle in different geographical areas. Epidemiol Infect 1999;122(2):329–336. 49. Momtaz H, Tajbakhsh E, Rahimi E, Momeni M. Coagulase gene polymorphism of Staphylococcus aureus isolated from clinical and sub-clinical bovine mastitis in Isfahan and Chaharmahal va Bakhtiari provinces of Iran. Comp Clin Path 2011;20(5):519–522.

680

https://doi.org/10.22319/rmcp.v12i3.5668 Article

Molecular prediction of serotypes of Streptococcus suis isolated from pig’s farms in Mexico

Arianna Romero Flores a Marcelo Gottschalk b Gabriela Bárcenas Morales a Víctor Quintero Ramírez a Rosario Esperanza Galván Pérez c Rosalba Carreón Nápoles c Ricardo Ramírez R. d José Iván Sánchez Betancourt c Abel Ciprián Carrasco a Susana Mendoza Elvira a *

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Cuautitlán. Cuautitlán Izcalli Estado de México, México. b

University of Montreal. College of Veterinary Medicine. Canada. 3200 Sicotte, SaintHyacinthe, Québec, Canada. c

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad de México, México. d

John Innes Centre, UK. Norwich Research Park Norwich, NR4 7UH, UK.

* Corresponding author: seme_6@yahoo.com.mx

681

Rev Mex Cienc Pecu 2021;12(3):681-693

Abstract: Infections caused by Streptococcus suis (S. suis) pose a problem for the pig industry worldwide. Pigs often carry multiple serotypes of S. suis in the upper respiratory tract, where S. suis is frequently isolated from. The clinical diagnosis of the infection is presumptive and is generally based on clinical signs, the age of the animal and macroscopic lesions. In the laboratory, identification of S. suis is performed biochemically, and then, serotyping is performed with antisera to determine the serotype, but these tests can be inconclusive. To date, there are few studies that have documented the presence and diversity of S. suis serotypes in Mexico. In the present study, it was characterized S. suis strains from Mexican pig farms using molecular approaches; samples were first processed by PCR of the gdh gene to detect S. suis. Positive samples were then subjected to a two-step multiplex PCR (cps PCR) to detect and characterize each strain; the first step consisted of a grouping PCR and the second step consisted of a typing PCR. The serotypes detected in the pig farming areas of Mexico included 1/2, 2, 3, 5, 7, 8, 9, 17, and 23. These findings are important for the characterization of serotypes present in Mexico and for outbreak prevention. Key words: gdh PCR, Pig farms, Serotypes, Streptococcus suis.

Received: 21/04/2020 Accepted: 04/12/2020

Introduction Streptococcus suis (S. suis) is an important pathogen in various countries in Europe, Asia, and the Americas. This bacterial species causes septicemia, meningitis, endocarditis, encephalitis, and bronchopneumonia in pigs and is a zoonotic agent(1). Most pigs carry strains of multiple serotypes in their upper respiratory tract(2,3). Symptoms of infection are often found in piglets from 2 wk of age but are more common in newly weaned pigs(4). S. suis grows on blood agar plates (BAPs) and appears as small α-hemolytic colonies with a diameter of 0.5-1 mm. The colonies are grayish or transparent and are slightly mucoid. When using Gram staining, the cocci appear isolated, in pairs, and in short chains. S. suis is a facultatively anaerobic, immobile, and catalase- and oxidasenegative bacterium, which exhibits fermentative metabolism and produces acid from sugars, including mannitol. S. suis is also amylase positive, Voges–Proskauer negative, NaCl positive, and resistant to optochin; this bacterium has a capsule with epitopes that allow identification of 35 serotypes. 682

Rev Mex Cienc Pecu 2021;12(3):681-693

The identification of S. suis is performed by bacteriological methods, and it is recommended that biochemical tests be complemented with confirmatory serotyping. Serotyping is an important part of routine diagnostics and is based on capsular polysaccharide antigens found on the surface of S. suis strains, although some strains from clinical cases have been considered non-typable(3). In the last 12 yr, more than 4,500 strains have been serotyped from diseased pigs worldwide; the serotypes that were isolated most frequently were, in decreasing order, 2 (28 %), 9 (19.4 %), and 3 (15.9 %), followed by serotypes 1/2 and 7(5). The distribution of serotypes isolated from infected pigs varies by geographic location(6), but serotype 2 is isolated most frequently in meningitis cases from both pigs and humans(7) . The presumptive diagnosis of S. suis infection in piglets is often based on clinical signs and macroscopic lesions; confirmation is achieved by isolating the infectious agent and observing microscopic lesions in the affected tissues(3). For clinical cases in pigs, isolation and identification of strains are relatively easy; successful identification can be achieved using a minimum of biochemical tests, and confirmation can be achieved by serotyping based on capsular polysaccharide antigens. However, the use of rapid, multitest biochemical kits may be misleading since some strains of S. suis can be misidentified as Streptococcus pneumoniae, S. bovis, and viridans group streptococci (e.g., S. anginosus and S. vestibularis). Likewise, although serotyping should be a part of routine identification of S. suis strains recovered from diseased pigs and humans to further confirm the pathogen’s identity, there may be cross-reactions between serotypes. Serotyping techniques are relatively simple; however, the production of antisera is laborious, time consuming, and expensive. In addition, there are strains that cannot be serotyped using antisera(1). One disadvantage of serotyping with antisera is that non-encapsulated strains cannot be characterized and are called non-typable. These strains are identified using molecular techniques such as PCR as long as the genes of the capsule gene cluster (cps) have not been modified(8). Cloned the gene encoding glutamate dehydrogenase (gdh) from S. suis type 2, they observed that, similar to genes encoding other GDHs, the S. suis gene was highly conserved and had a very low mutation rate relative to that in other genes. With the help of gdh PCR, S. suis isolates can be identified. gdh PCR has been used as a quick and reliable diagnostic technique for samples from healthy and diseased animals, and it is also valuable in human cases(7). In the present study, characterization of S. suis strains isolated from sick animals, including serotype determination, was performed using molecular techniques, PCR of the gdh gene and multiplex PCR(8,9). The goal of this study was to determine the serotypes of S. suis present in pig farms located in different areas of the Mexican Republic.

683

Rev Mex Cienc Pecu 2021;12(3):681-693

Material and methods Microbiological sample collection and identification

Sixty-three (63) samples of organs were obtained from pigs with characteristic clinical signs of S. suis infection from different farms in the Mexican Republic. The samples were macerated in sterile phosphate-buffered saline, streaked onto 5% BAPs, and then incubated at 37 °C for 24 h. Colonies that were formed by α-hemolytic, Gram-positive cocci, grouped in chains, catalase and oxidase negative, were selected.

PCR of the gdh gene

DNA extraction was performed using the Wizard Plus SV minipreps DNA purification system (Promega, Madison, WI, USA), followed by gdh PCR to identify S. suis strains using an Invitrogen kit (Thermo Fisher Scientific, Carlsbad, CA, USA). The reactions were run on a Techne Progene thermal cycler under the following conditions: 2 min at 40 °C, 5 min at 94 °C, 35 cycles (1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C), and 7 min at 72 °C. The GenBank accession number of the sequence used to design the primers was AF229683.1. The sequence of the primers is JP4 (5´ GCAGCGTATTCTGTCAAACG 3´) y JP5 (5´CCATGGACAGATAAAGATGG 3´). The reaction products were visualized on a 2% agarose gel, stained with GelRed, using a Gene Genius bioimaging system (Artisan Technology Group, Champaign, IL, USA)(9). Table 1. Primer sequences (5’ to 3’) used in this study and the predicted sizes of the PCR products [ Okura, et al 2014] (8) Target cps group Size (bp) of Forward Reverse or type products TGGTTCAAATATCAA ATTGGTTGTGAGTGC I 933 TGCTC ATTG TCAAAATACGCACCT CACTCACCTGCCCCA II 823 AAGGC AGAC TGATTTGGGTGAGAC CTCATGCTGGATAAC III 583 CATG ACGT ACAGTCGGTCAAGAT TCAGCTTGGGTAATA IV 455 AATCG TCTGG GGAAAGATGGAGGAC CCAACCAGACTCATA V 265 CAGC TCCCC

684

Rev Mex Cienc Pecu 2021;12(3):681-693

III and VI

For PCR typing

GATGCCCCAAGCGAT ATGCC GACGCACCAAGTGAT ATGCC

GGACCAACAATGGC CATCTC

Forward

Reverse

146

GGTCCGACAATAGCCATTTC Size (bp) of products

GROUP I GGTTTTGATTGGTCTA GTTG TATGGTTAAAGGTGG 13 AACTG TAATGGGATAGTTGC 18 GTTAC

CTCTAAAGCTCGATA TCTAC CCTTGTATATATTCC CTCCA ATACATAAAGTTGTC CTGCG

TTAGCAACGTTGCCA ATAAG GCTCACTATTTTTACA 6 TTACAC TTAGACAGACACCTT ATAGG AAGGTTATCCACGAA 16 AGATG AGACACTGCTTGCAT 27 TATTG

AATCCTCCATTAAAA CCCTG TATTACTCCGCCAAA TACAG CTAGCTTCGTTACTT GATTC TCCGGCAATATTCTT TCAAG TCAGAATTACTTCCT GTTGC

TATCATATTGAGAAT CTTCCC ATTATGTTGGTTGCAG 28 AAGG TTCTGGGATTTTAGGA 29 ATGC TATTGCACTAGCTTCA 30 GAAC

TTGCGTAGCATACAA AGTTC CGACTCAATTGTTGT AGTAG CATGAAATACGCACT TGTAC TGCATCCATAGTTGT ATTCG

GACTATCTGTATACCC AAAC ATCTTAGGAATGATT CGGAC AACTACCTACCTGAA CTTTG TAGCATCAGTTTATAC GAGG GTGTCGCAAATCAAG TATTG TAATGTATGCTCTGTC ACTG

TCCTTCCAAGTATTC TCTAG ACCAGATATCTGAGC AAATG AGTCTAAAAGTGATC GAGTC TAGTTTATCTGTGAC ACACC AAGCTAGTACAACA AGCATG AACGAAACGGAATA GTTTGC

214 408 617

GROUP II 2 and 1/2

1 and 14

173 278 386 494 655

GROUP III 21

160 272 415 568

GROUP IV 4 5 7 17 19 23

685

903 720 566 455 348 221

Rev Mex Cienc Pecu 2021;12(3):681-693

GROUP V AAATAAGGTAGGAGC TACTC ATCGTTTTGAGATTGA GTGG TGTGGATTTCTGGGAT AATC GCATTATCAGGATTCT TTCC GTTTGCTCCGATCATA ATAG

ATCCAACCTTAGCTT TCTGT TAAACGGATTCGGTT ACTCA TGTGGACGAATTACT ACTTG CCAATTGGGTGTTCA AAAAG CCAGTAAAAGGACT CAATAC

GAAAGTAGGTATATC TCAGC TTTCCCATTTGCTTAT GGAC ATGCGATTGCAACAA TTGAC AACAGGTATTTCAGG ATTGC TACTGAGATTTATTGG GACG TTATACCGAAATTTTG TTGCC GATGTTTTCAACAGG TGTAC

GGGCTATTAAAACTC CTATC GGAATAAAAACGAT TGGGAG AGGCATGAGTAATA CATAGG CTCGGATAAAGATA ATCAGC AAGCGATTGGATTAC ATTGC CGTCAATCATATAAA GTGGG CAAAGTACCTATTTT CAGCG

ACAATCGTTTCTGCA ATACG AACCGCTGTTGAATT 32 AAGAG AAGTTTCATTCGAGG 34 ACTTC Internal control GAGTTTGATCCTGGCT 16S rRNA CAG

GATGAAAACATCGTT GGTAG TTCGTTAGTTGAACT GTTCC GTATATAACACCGCA AGAAG

8 15 20 22 25

446 542 698 296 174

GROUP VI 9 10 11 12 24 26 33

368 633 833 131 224 472 710

GROUP VII 31

AGAAAGGAGGTGAT CCAGCC

842 570 246

1542-1553

Two-step multiplex PCR

To determine serotypes, it was used a two-step multiplex PCR. First, a grouping PCR was carried out under the following thermal cycler conditions: 15 min at 95 °C, 30 cycles (30 sec at 94 °C, 90 sec at 90 °C, and 60 s at 72 °C), and 10 min at 72 °C. Second, a typing PCR was performed under 686

Rev Mex Cienc Pecu 2021;12(3):681-693

the following thermal cycler conditions: 15 min at 95 °C, 30 cycles (30 sec at 94 °C, 90 sec at 53 °C, and 90 sec at 72 °C), and 10 min at 72 °C, using a Biometra thermocycler (Biometra, Göttingen, Germany). Qiagen multiplex PCR master mix was used, and the PCR products were visualized by electrophoresis on a 2% agarose gel (100 V, 40 min) stained with GelRed(8). The primer sequences and predicted product size(s) for each type of PCR(10) are showed in Table 1 .

Results Microbiological sample collection and identification

Of the 63 samples (lung, heart, and brain) collected from animals, 23 were positive for S. suis by PCR, with a product of 688 bp in length amplified by gdh PCR (Figure 1). Figure 1: Agarose gels (2%) showing results of the gdh PCR

Lane 1, 100–1,000-bp marker; lane 2, negative control, C(−); lane 3, positive control, C(+) = S. suis serotype 2; lanes 4 to 8, samples from diseased animals.

PCR of the gdh gene

The results of the grouping PCR are shown in Figure 2; the samples were assigned to the following groups based on the sizes of the PCR products: I, II, IV, V, and VI, corresponding to the PCR product sizes of 933, 823, 455, 265, and 146 bp, respectively. Figure 3 shows the results of the typing PCR, wherein the serotype of each sample was determined. Serotypes 1/2 and 2 were characterized by the same size of their PCR products (173 bp); serotypes 3, 5, 7, 8, 9, 17, and 23 produced PCR fragments of 214, 720, 566, 446, 368, 445, and 221 bp, respectively. To differentiate serotypes 1/2 and 2, co-agglutination with specific antisera was used. 687

Rev Mex Cienc Pecu 2021;12(3):681-693

Figure 2: Agarose gels (2%) showing results of the grouping PCR

Gel A: lane Mbp, 100–1,000-bp marker; lane C(−), negative control; lane C(+), S. suis serotype 2; lanes 1 to 5, S. suis samples. Gel B: lane Mbp, 100–1,000-bp marker; lane C(−), negative control; lane C(+), S. suis serotype 2; lanes 1 to 8, samples.

Figure 3: Agarose gel (2%) showing results of the typing PCR

Lane pb, 100–1,000-bp marker; lane 1, S. suis serotype 3; lanes 2 to 5, samples positive for serotypes 2 and 1/2; lane 6, S. suis serotype 5; lanes 7 and 8, S. suis serotype 7.

Two-step multiplex PCR

The results of multiplex the PCR are shown in Table 2, which summarizes the information on the geographical areas where the samples were collected, the organs processed, and the serotypes identified. 688

Rev Mex Cienc Pecu 2021;12(3):681-693

Table 2: Results with the geographical area where the samples were collected, the processed organs and the serotypes Geographical area Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote-Veracruz Perote, Veracruz Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Jalisco Puebla Puebla Puebla Puebla Puebla La Piedad Michoacán

Organ

Serotype

brain brain brain brain lung brain brain lung heart lung heart heart heart lung lung heart heart heart heart heart heart heart heart

7 7 2 2 1/2 3 9 9 7 9 17 9 9 3 7 23 5 8 8 8 8 9 9

Discussion PCR of the gdh gene is an attractive technique for use in both clinical laboratories and epidemiological studies(9). Nevertheless, owing to the complexity of serotyping of S. suis strains(8), have developed a two-step multiplex PCR. They sequenced and analyzed a group of genes from strains belonging to the 35 serotypes and reported that 31 of the serotypes (3 to 13 and 15 to 34) had specific genes, while serotypes 1 and 14 as well as 2 and 1/2 were almost identical. In the first step of the multiplex PCR, strains are classified into seven groups of cps genes, called homology groups (HGs). These cps genes are grouped within the same locus on the chromosome. Each HG is assigned a number (I–VII) and includes specific serotypes of S. suis. The typing PCR detects 689

Rev Mex Cienc Pecu 2021;12(3):681-693

cps genes specific for each group and identifies the serotype. Molecular serotyping using multiplex PCR is attractive because animals are no longer required for the production of all 35 antisera since antisera are only needed to identify serotypes 1, 1/2, 2, and 14(11). Previously, S. suis had been classified into 35 serotypes (1/2 and 1–34), and then, the number of serotypes was reduced to 33 because strains of serotypes 32 and 34 were re-classified as Streptococcus orisratti. More recently, it has been proposed to remove strains of serotypes 20, 22, 26, and 33 from the S. suis taxon(12); however, in the present study, none of the isolated Mexican strains belonged to these serotypes. In this study, there were determined serotypes of S. suis strains isolated from diseased animals from Mexican pig farms, and the diagnostic time was reduced, which was an advantage over routine diagnostic methods. It was found that serotype 9 was predominant in seven samples, isolated either from Jalisco (four samples), Veracruz, Michoacán, or Puebla (one sample each), followed by serotype 7, with four samples from Jalisco and Veracruz (two samples each), and serotype 8, with four samples from Puebla. Two samples from Veracruz were positive for serotype 2, and two samples from Jalisco and Veracruz were positive for serotype 3. One sample each was positive for serotypes 1/2, 5, 17, and 23. Jalisco was the state that presented the highest variation in serotypes, with six different lung and heart isolates belonging to serotypes 3, 5, 7, 9, 17, and 23. In Veracruz, five serotypes were detected in the lung and brain samples. Puebla was represented by two serotypes from heart samples. Only one serotype was detected in a heart sample from Michoacán. Serotype assessment is a valuable tool for understanding the epidemiology of a particular outbreak, and serotyping also increases the success of vaccination programs within farms. It is possible that, this is the first report on the distribution of S. suis serotypes in areas dedicated to pig farming in Mexico. It was found that the predominant S. suis serotypes were comparable to those reported by Gottschalk et al(10) between 2008 and 2011, who confirmed a relatively low prevalence of serotype 2 in North America compared with that in European and Asian countries. Among other serotypes, serotypes 1/2, 5, 9, and 14 have also been associated with outbreaks in pigs in North America and Europe(10). Although it was not assess the prevalence, serotype 9 was the most frequent, followed by serotypes 7 and 8. These results support a previous hypothesis suggesting that a lower prevalence of S. suis serotype 2 is common for North American countries(3). Since strains serotype 2 from North America and from Europe are genotypically and phenotypically different (with different virulence potential)(13), it would be interesting to further study strains from Mexico to determine to which group of strains they belong. Similarly, it has been reported that serotype 9 strains from Europe are more homogenous and probably more virulent than North American strains(14). Further evaluation of the Mexican strains is also needed to predict the level of pathogenicity of such strains. In addition, more studies, with a greater number of isolates from Mexico, are necessary to confirm this hypothesis. Although there is no clear association between serotypes and a given pathological condition, it has been reported that in Asian countries, strains isolated from diseased pigs primarily belonged to serotype 2, followed by serotypes 3, 4, 5, 7, 8, 690

Rev Mex Cienc Pecu 2021;12(3):681-693

and 1/2(15). In some European countries, serotype 9 is most frequently recovered from diseased animals, followed by serotypes 1 and 14. However, in Canada, serotypes 1/2, 2, and 3 are the three most prevalent serotypes, followed by serotypes 4, 7, and 8(16). In humans, serotype 2 is the most prevalent serotype isolated, but serotypes 1, 4, 5, 14, 16, and 24 have also been reported(5). In South America, only two studies have been published, both from Brazil, which reported serotype 2 as the most prevalent, with a mean of 57.6 % of all cases, followed, in decreasing order of prevalence, by serotypes 1/2, 14, 7, and 9. Important pig-producing European countries, such as Denmark, Belgium, France, Germany, Italy, and the United Kingdom, have not recently reported the distribution of serotypes recovered from clinical cases in pigs. The latest reports from these countries published data on strains isolated between 1990 and 2000, and this lack of information is important. The only two countries with more recent data are Spain and the Netherlands. In fact, in Spain, serotype 2 is no longer the most prevalent serotype; it is now the second behind serotype 9, followed by serotypes 7, 8, and 3. In the Netherlands, serotype 9 was the most prevalent between 2002 and 2007, followed by serotypes 2, 7, 1 and 4. In studies conducted prior to 2002, serotype 1 appeared to be prevalent in countries such as Belgium and the United Kingdom(1).

Conclusions and implications The serotypes detected in the pig farming areas of Mexico included 1/2, 2, 3, 5, 7, 8, 9, 17, and 23. Jalisco was the state that presented the highest variation in serotypes, with six different serotypes. In Veracruz, five serotypes were detected in samples. Puebla was represented by two serotypes from samples. Only one serotype was detected in a sample from Michoacán. Serotype assessment is a valuable tool for understanding the epidemiology of a particular outbreak, and serotyping also increases the success of vaccination programs within farms. These findings are important for the characterization of serotypes present in Mexico and for outbreak prevention. To the best of our knowledge, this is the first report on the distribution of S. suis serotypes in areas dedicated to pig farming in Mexico. Research should continue to gain a better understanding of this microorganism and to have more complete data. The MALDI TOF MS is alternative methods for identify S. suis and the gdh test was considered specific for S. suis. The recN PCR is the test recognized as being specific for S. suis and so continue with the investigations.

691

Rev Mex Cienc Pecu 2021;12(3):681-693

Acknowledgements

Grants: DGAPA PAPIIT IN228516 and PIAPI2032; Scholarship: CONACYT-492133, Doctorado (Posgrado de Producción y Salud Animal). Literature cited: 1. Goyette-Desjardins G, Auger JP, Xu J, Segura M, Gottschalk M. Streptococcus suis, an important pig pathogen and emerging zoonotic agent-an update on the worldwide distribution based on serotyping and sequence typing. EMI 2014;3:45. doi:10.1038/emi.2014.45. 2. Flores JL, Higgins R, D'Allaire S, Charette R, Boudreau M, Gottschalk M. Distribution of the different capsular types of Streptococcus suis in nineteen swine nurseries. Can Vet J 1993;34(3):170–171. 3. Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Gregory WS, Zhang J. Diseases of swine. 11th ed. Streptococcosis. John Wiley & Sons, Inc; 2019. 4. Wisselink HJ, Smith HE, Stockhofe-Zurwieden N, Peperkamp K, Vecht U. Distribution of capsular types and production of muramidase-released protein (MRP) and extracellular factor (EF) of Streptococcus suis strains isolated from diseased pigs in seven European countries. Vet Microbiol 2000;74:237–248. doi:10.1016/s0378-1135(00)00188-7. 5. Liu Z, Zheng H, Gottschalk M, Bai X, Lan R, Ji S, Xu J. Development of multiplex PCR assays for the identification of the 33 serotypes of Streptococcus suis. PLoS One 2013;8(8):e72070. doi:10.1371/journal.pone.0072070. 6. Haas B, Grenier D. Understanding the virulence of Streptococcus suis: A veterinary, medical, and economic challenge. Méd Mal Infect 2018;48(3):159–166. doi:10.1016/j.medmal.2017.10.001. 7. Gottschalk M. Porcine Streptococcus suis strains as potential sources of infections in humans: An underdiagnosed problem in North America? JSAP 2004;12(4):197–199. 8. Okura M, Lachance C, Osaki M, Sekizaki T, Maruyama F, Nozawa T, Takamatsu D. Development of a two-step multiplex PCR assay for typing of capsular polysaccharide synthesis gene clusters of Streptococcus suis. J Clin Microbiol 2014;52:1714–1719. doi:10.1128/jcm.03411-13. 9. Okwumabua O, O'Connor M, Shull E. A polymerase chain reaction (PCR) assay specific for Streptococcus suis based on the gene encoding the glutamate dehydrogenase. FEMS Microbiology Letters 2003;218(1):79–84. doi:10.1111/j.1574-6968.2003.tb11501.

692

Rev Mex Cienc Pecu 2021;12(3):681-693

10. Gottschalk M, Lacouture S, Bonifait L, Roy D, Fittipaldi N, Grenier D. Characterization of Streptococcus suis isolates recovered between 2008 and 2011 from diseased pigs in Quebec, Canada. Vet Microbiol 2013;162:819–825. doi:10.1016/j.vetmic.2012.10.028. 11. Kerdsin A, Akeda Y, Hatrongjit R, Detchawna U, Sekizaki T, Hamada S, Oishi K. Streptococcus suis serotyping by a new multiplex PCR. J Med Microbiol 2014;63:824–830. doi:10.1099/jmm.0.069757-0. 12. Okura M, Osaki M, Nomoto R, Arai S, Osawa R, Sekizaki T, Takamatsu D. Current Taxonomical situation of Streptococcus suis. Pathogens 2016;5(3):45. 13. Straw BE, Zimmerman, JJ, D´Allaire S, Taylor DJ. Diseases of swine. 9th ed. Streptococcosis. Blackwell Publishing. 2006. 14. Zheng H, Du P, Qiu X, Kerdsin A, Roy D, Bai X, Xu J, Vela AI, Gottschalk M. Genomic comparisons of Streptococcus suis serotype 9 strains recovered from diseased pigs in Spain and Canada. Vet Res 2019;49(1):1. doi: 10.1186/s13567-017-0498-2. Erratum in: Vet Res. 2019;16;50(1):62. PMID: 29316972; PMCID: PMC5759227. 15. Wei Z, Li R, Zhang A, He H, Hua Y, Xia J, Jin M. Characterization of Streptococcus suis isolates from the diseased pigs in China between 2003 and 2007. Vet Microbiol 2009;137(12):196–201. doi:10.1016/j.vetmic.2008.12.015. 16. Gottschalk M, Lacouture S. Canada: Distribution of Streptococcus suis (from 2012 to 2014) and Actinobacillus pleuropneumoniae (from 2011 to 2014) serotypes isolated from diseased pigs. Can Vet J 2015;56(10):1093-1094.

693

https://doi.org/10.22319/rmcp.v12i3.5670 Article

The coexistence of Desmodus rotundus with the human population in San Luis Potosí, Mexico

Ximena Torres-Mejía a Juan José Pérez-Rivero b* Luis Alberto Olvera-Vargas c Evaristo Álvaro Barragán-Hernández d José Juan Martínez-Maya d Álvaro Aguilar-Setién e

Universidad Nacional Autónoma de México. Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Ciudad de México. México. b

Universidad Autónoma Metropolitana. Unidad Xochimilco. Departamento de Producción Agrícola y Animal. Calzada del Hueso 1100, Col. Villa Quietud, Alcaldía Coyoacán, 04960, Ciudad de México. México. c

Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, A.C.

Universidad Nacional Autónoma de México. Departamento de Medicina Preventiva y Salud Pública, Facultad de Medicina Veterinaria y Zootecnia, Ciudad de México. México. e

Instituto Mexicano del Seguro Social. Unidad de Investigación Médica, Ciudad de México. México.

*Corresponding author: jperezr@correo.xoc.uam.mx

Abstract: Desmodus rotundus is a transmitter of zoonotic and emerging diseases to humans and livestock, such as rabies. Most infectious diseases are spatially limited by the presence of the 694

Rev Mex Cienc Pecu 2021;12(3):694-709

transmitter, whose abundance and survival are influenced by environmental conditions and the presence of food sources. A tool that facilitates its study is the use of Geographic Information Systems. The objective of this study was to analyze the interaction of populations of hematophagous bats and humans, through the development of a probable model of dispersal of D. rotundus based on known shelters and different environmental variables, in addition to analyzing the relationship between shelters identified for three years and their proximity to human settlements, as a process of coexistence. The study was conducted in the state of San Luis Potosí from 2014 to 2016. A total of 180 shelters of D. rotundus distributed towards the Huasteca region were identified, 80 % of these were built by man and 57 % were inhabited. A buffer of 5 km around from the location of each shelter was calculated, finding inside a total of 976 rural communities and 15 cities, with 337,836 inhabitants. The average distance from shelters to the first human settlement was 518.65 ± 11.33 m. It is necessary to continue studying the association between urbanization and the emergence of zoonoses, through the understanding of the interactions between wild animalslivestock-humans. Key words: Vampire bat, Zoonoses, Human population, Coexistence, GIS.

Received: 20/04/2020 Accepted: 28/10/2020

Introduction Bats are the mammals that are recognized as reservoirs of potentially zoonotic viruses. They have been associated with different infectious agents such as those of the Filoviridae family (Ebolavirus, Marburgrvirus), coronaviruses (including severe acute respiratory syndrome or SARS coronavirus)(1,2), rabies and other Lyssaviruses, a lineage of Influenza A and several of the Paramyxoviridae family (Hendra [VHe] and Nipah [VNi])(3). These emerging diseases have the potential to cause epidemics, caused by interactions between infected bats, the infectious agent and the host(2). Sometimes there is an intermediate host such as companion animals, wild animals or livestock, these come into contact and infect humans even amplifying the virus(2,3). It is evident that the interactions that occur between wildlife, livestock and humans are not yet well understood, they are likely to occur on different scales of time, space and in a certain ecological organization, where vectors change their distribution mainly due to change in land use (agriculture, urbanization, recreation) or climate changes(1,4). Changes in the environment, mainly those caused by temperature, rainfall and

695

Rev Mex Cienc Pecu 2021;12(3):694-709

humidity, as well as the height above sea level and those given by interactions influence the frequency and duration of contact between humans and bats, which can favor the transmission of pathogens to the former, which even seems to be increasing(3,5,6). Viruses such as hepatitis C, parainfluenza, canine distemper, among others, which are common in animals and humans, originated in bats(7). Rabies is the most widely studied viral disease from bats(3). There are three species of hematophagous bats in Latin America, Diaemus youngi, Diphylla ecaudata and Desmodus rotundus (D. rotundus)(8). D. rotundus belongs to the Phyllostomatidae family, which is characterized by feeding exclusively on the blood of mammals including humans, it has been considered the main transmitter of rabies in humans and bovine paralytic rabies (BPR) in cattle, from Mexico to South America(9,10,11). The economic impact of vampire bats is difficult to quantify, because they weaken cattle through blood loss, lead to secondary infections, reduce milk and meat production and lead to death if cattle develop BPR(12). In Mexico, this disease occurs endemically in 25 states, from the Pacific through southern Sonora to Chiapas and from the Gulf of Mexico south of Tamaulipas to the Yucatán Peninsula(13,14). Of the 255 cases of BPR reported during 2019, thirty (11.76 %) were reported in San Luis Potosí(14), where despite the prevention and control measures established (treatment with vampiricide and vaccination), they continue to occur, even expanding their geographical coverage. Until 2017 the state of Nuevo León was considered free of BPR, however, in 2018 three cases were reported, demonstrating an increase in the dispersal of the vector(14,15). Because the transmission of rabies and other infectious diseases can have devastating effects on public health and even wildlife conservation, it is clear that understanding has been limited and it becomes necessary to have different approaches to hematophagous bat-pathogenhuman interactions. Knowledge of the ecology of the host is essential for the relationship with the human population in disease transmission and dynamics. It is important that the predictions are reliable to improve the knowledge of the elements that push the dynamics of the space-time infection, to prevent diseases such as rabies in humans, as well as in livestock, the understanding of the dispersal of these vectors is required, since they are recognized as the main transmitters of this virus to these species(3,5,16). Most infectious diseases are considered to be spatially limited by the presence of the transmitter, whose abundance and survival are influenced by environmental conditions and the presence of food sources(17). A tool that facilitates the study of the distribution of vectors and these variables is the use of Geographic Information Systems (GIS)(18,19,20). Through spatial models, such as those of “Ecological Niche”, the areas of greatest risk of transmission of infectious diseases can be predicted, which allows establishing priorities for their attention through programs such as MaxEnt® or DivaGis®(19,21,22). The maximum 696

Rev Mex Cienc Pecu 2021;12(3):694-709

entropy (MaxEnt) model is one of the most used methods to study the distribution of different species, predicting the relative suitability of the habitat with functions derived from environmental variables, preventing the model from overfitting the data(22,23). Like MaxEnt, DivaGis supports the analysis of exploration or occurrence databases to identify ecological and geographic patterns in the distribution of wild species(24). In this way, it has even been allowed to predict the influence of climate change on the distribution of species and diseases, most models correlate the current occurrence of the species or disease with climatic variables or through the knowledge of the natural history of the disease and the estimation of the physiological response of the species to climate change, estimating its possible redistribution for future climate scenarios(19). Due to climate change and urbanization patterns and that D. rotundus is a species with the potential to transmit diseases such as rabies to humans and livestock, epidemiological surveillance activities and the control of this transmitter become relevant, the objective of this study was to analyze the close relationship between D. rotundus and humans, through the development of a probable MaxEnt dispersal model of D. rotundus based on known shelters and different environmental variables, and analyze the relationship between the shelters found and their proximity to human settlements, as a process of coexistence with the use of Diva Gis.

Material and methods The study was carried out in the state of San Luis Potosí, which is located between 98°19'33.6 WL, 102°17'45.6 WL and 21°9'36.72" NL at 24°29'29.4 NL. The climate that predominates is the dry and semi-dry, present in 71 % of the state, the average annual temperature is 21 °C, the average minimum temperature is 8.4 °C in January and the average maximum is around 32 °C in May. Rainfall occurs during the summer from June to September, the average rainfall of the state is around 950 mm per year(25).

Desmodus rotundus dispersal model using MaxEnt

It was carried out through the records of location of shelters notified and visited during the years 2014-2016, obtained by the State Committee for the Promotion and Protection of Livestock of San Luis Potosí (CEFPPSLP, for its acronym in Spanish). Obtaining their longitude, latitude and altitude, in addition to the municipality, the reason for the action, the number of vampires captured and treated.

697

Rev Mex Cienc Pecu 2021;12(3):694-709

With the location records of these shelters, 24 environmental variables (EV) were used for the dispersal model, 19 of them were downloaded from the Worldclim database at a 1 km2 spatial resolution(26,27). In addition to five other variables of climate(28) obtained from the National Institute of Statistics, Geography and Informatics (INEGI, for its acronym in Spanish), land use(29), soil(30), geology(31) and altitude(32) (Table 1). All were converted to raster format with an equal spatial resolution of the climatic layers. With a total of 181 data sorted in a database and exported to a comma-separated values (CSV) file, for later incorporation into the MaxEnt software. Table 1: Environmental variables considered for the dispersal model in the state of San Luis Potosí Code Environmental variable EV1 EV2 EV3 EV4 EV5 EV6 EV7 EV8 EV9 EV10 EV11 EV12 EV13 EV14 EV15 EV16 EV17 EV18 EV19 EV20 EV21 EV22 EV23 EV24

Average annual temperature (°C) Diurnal temperature oscillation (°C) Isothermality (quotient between parameters EV2 and EV7) Temperature seasonality (coefficient of variation, %) Average maximum temperature of the warmest period (°C) Average minimum temperature of the coldest period (°C) Annual temperature oscillation (difference between parameters EV5 and EV6) Average temperature of the rainiest quarter (°C) Average temperature of the driest quarter (°C), Average temperature of the warmest quarter (°C) Average temperature of the coldest quarter (°C) Annual precipitation (mm) Precipitation of the rainiest period (mm) Precipitation of the driest period (mm) Precipitation seasonality (coefficient of variation, %) Precipitation of the rainiest quarter (mm) Precipitation of the driest quarter (mm) Precipitation of the warmest quarter (mm) Precipitation of the coldest quarter (mm) Climate map (types of climate) Land use (types) Soils (type of soil) Geology (type of rocks) Altitude (m.a.s.l)

Having only presence data, MaxEnt created pseudo-absence points and divided the base into two groups randomly: data for training, which is the spatial model and where 80 % of the

698

Rev Mex Cienc Pecu 2021;12(3):694-709

location records of the shelters were considered, and validation (test) data of the model, which considers the remaining 20 % and measures predictive capacity. The output model was logistic with predicted presence probabilities among the binary range(33). The result of the model then expresses the value of the suitability of the habitat for the presence of D. rotundus as a function of environmental variables, through a statistical validation test called area under the curve (AUC) that indicated sensitivity, understood as the probability of obtaining a presence result when the species is present, and the closer it is to 1 the more reliable the result. Additionally, the software calculated from iterations the percentage of contribution to the model of each of the environmental variables used for the creation of the model. This analysis marks the climatic similarity between the sites where the shelters are and where the species possibly lives.

Analysis of potential contact or coexistence between Desmodus rotundus and human settlements or localities

With the coordinates of the shelters inhabited by D. rotundus, the database was exported to a shapefile (shp), where a buffer layer with a radius of 5 km(34) was generated, through the Qgis program. Additionally, another shp layer was added with the information of the location of rural communities, of which only those that were within the created buffer were selected, and another with urban areas, selecting those that touched that same buffer. The number of human settlements (rural localities and urban areas) was counted, as well as their population, which are potentially within the buffer and therefore maintain interactions with colonies of D. rotundus, in addition, the average distance from the shelter to the nearest dwelling was calculated.

Results Shelter Information

From 2014 to 2016, a total of 180 shelters were identified, of which 67 were identified during 2014, 46 in 2015 and 67 in 2016. Eighty (80) percent of the shelters were artificial, of these, 3 abandoned houses, 1 school, 1 warehouse, a bus station and a bridge stand out. The remaining 20 % are natural shelters such as caves. The distribution of both natural and

699

Rev Mex Cienc Pecu 2021;12(3):694-709

artificial shelters is greater towards the Huasteca region in the southeast of the state in various municipalities. Regarding the occupation of the shelters according to the presence of D. rotundus of the total identified, in 102 shelters (56.7 %) between 6 and 18 individuals were captured; the rest were found empty despite being visited on average twice in that year (Figure 1). Figure 1: Geographical location of the empty shelters and shelters occupied by Desmodus rotundus from 2014 to 2016 by the State Committee for the Promotion and Protection of Livestock of San Luis Potosí (CEFPPSLP)

Analysis of potential contact or coexistence between Desmodus rotundus and human settlements or localities

An average flight radius of D. rotundus of 5 km from the location of each shelter was considered(34,35,36), and buffers were made, finding within these a total of 976 rural communities, which were inhabited from 1 or up to 3,124 inhabitants, making a total of 124,884 inhabitants. Of these, 375 (38.4 %) had 10 or fewer inhabitants. As well as 15 cities with an estimated population of 212,952, representing a total of 337,836 inhabitants (Figure 2). Since the shelters of D. rotundus show connection between them, these can occupy an area of 3 to 6 km on average, giving them the opportunity for short flights to locate prey(37), however, the minimum distance that has been found of the movements in vampire bats in Argentina was 1.5 km(38). As for the average distance from the shelters to the first settlement with a human population was 518.65 ± 11.33 m, this distance can be easily traveled for the 700

Rev Mex Cienc Pecu 2021;12(3):694-709

search for food, which implies that there is an interaction directly or indirectly at different levels and frequency of contact with humans, who could potentially be exposed to the rabies virus. The coexistence between human population and D. rotundus colonies is occurring due to their dispersal, concentration of shelters, and the distance between shelters to human communities. Figure 2: Rural and urban localities within a radius of 5 km from the shelters inhabited in San Luis Potosí during 2014-2016

Desmodus rotundus dispersal prediction model in the state

The prediction model obtained with MaxEnt shows that environmental conditions have changed moderately from 2014 to 2016, generating more sites of environmental suitability towards the northern region of the state for the location of D. rotundus, but it is in the southwestern region where there is a greater probability of development of colonies of D. rotundus, as shown in Figure 3. Consistently, the climatic variables with the greatest effect on the model were the annual temperature oscillation, temperature seasonality, precipitation of the dry quarter, precipitation seasonality and for 2016 the diurnal temperature oscillation, as can be seen in Table 2. The overall AUC for the model was 0.992 over the entire period under study, specifically for 2014 (AUC 0.992), 2015 (AUC 0.993), and 2016 (AUC 0.992). These results allow making a robust prediction model regarding the dispersal of D. rotundus.

701

Rev Mex Cienc Pecu 2021;12(3):694-709

Figure 3: The prediction model with MaxEnt for the presence of Desmodus rotundus, for 2014 (A), 2015 (B), 2016 (C)

Note the increase in the potential distribution towards the northern region (dotted circle).

Year 2014

2015

2016

Table 2: Percentage of contribution of the variables of the MaxEnt model Variable Contribution (%) Temperature seasonality 30.0 Precipitation of the driest quarter 16.1 Annual temperature oscillation 14.9 Precipitation seasonality 14.3 Annual temperature oscillation 26.8 Precipitation of the driest quarter 16.7 Precipitation seasonality 11.8 Temperature seasonality 11.5 Annual temperature oscillation 22.8 Temperature seasonality 20.0 Precipitation of the driest quarter 14.9 Diurnal temperature oscillation 12.5

Discussion

The importance of the D. rotundus bat lies not only in its ability to transmit diseases due to its feeding and social habits, such as rabies to cattle and occasionally to humans, but also because it has managed to adapt to new environments, and to the changes generated in land use, which possibly favors its wide geographical distribution in different regions of Latin America and Mexico(5,36). This study confirms that the hematophagous bat D. rotundus is distributed in large areas of San Luis Potosí, but also, that it has been looking for new niches since cases of BPR have been observed towards the north of the state, where, apparently, the climatic conditions were not suitable for the presence of these bats. The presence of new

702

Rev Mex Cienc Pecu 2021;12(3):694-709

human settlements, especially rural ones, favors the creation of artificial shelters, where new colonies of these Chiroptera can migrate; in addition, new settlements usually develop livestock activities that in turn facilitate the food source of these vectors(34).

A study in Mexico found that, regardless of environmental characteristics, the distribution of vampire bats increased(39). In this regard, another study conducted in Mexico using MaxEnt determined through bioclimatic conditions for the period 2050-2070, that 30 % of the Mexican landscape will provide an ideal habitat for D. rotundus due to changes in climate regimes. This expansion will occur in northern and central Mexico, where San Luis Potosi is located(13). Agreeing with the above, another study, using the multi-species distribution model (SDM), estimated the potential distribution of vampire bats in North America under current and future climate scenarios, finding that these can be distributed in various habitats throughout much of southern, central and northern Mexico, including up to the southern region of the United States, the only limitation to reach this latitude being its poor capacity to thermoregulate when they are exposed to temperatures below 10 ºC(12).

Considering studies carried out in Mexico, D. rotundus can be in places with temperatures between 21 and 25 ºC, altitude below 2,300 masl and relative humidity of 45 %(13). The environmental suitability has been changing in the different years of study, increasing the area of dispersal towards the north of the state, in the arid region, however, the variables related to temperature: annual oscillation, seasonality and diurnal oscillation (>11.5 %), together with the precipitation variables: of the driest quarter and precipitation seasonality (>14.3 %) remained as the factors that contribute mostly to detect areas of potential dispersal of D. rotundus during the study period. In a study carried out with multivariate geostatistical methods, where the spatial distribution of BPR cases was evaluated from climatic variables and disease frequency, it was found that the greatest risk of the presence of BPR cases is found in the Huasteca region of the state of San Luis Potosí, which agrees with the present work(39).

During the three years studied, shelters of D. rotundus were found in abandoned sites, where despite being visited on more than one occasion, no specimen was captured, the percentage of abandonment of 58 % (34 shelters) in 2014 was higher than that found east of Sao Paulo, Brazil, where 260 shelters were identified, of which only 29 (11.2 %) were empty(36). The abandonment of shelters may be due to factors such as food availability, deforestation, but above all, to the execution of lethal vampire control activities(16,36,40). Usually, after some time, abandoned shelters can be recolonized, bringing with them new outbreaks of rabies or other emerging diseases(10,16,41).

703

Rev Mex Cienc Pecu 2021;12(3):694-709

The change of land use from rural to urbanized favors the shelters of the D. rotundus to be artificial(5). In this work some vampire bats were captured in urbanized sites, such as bus stops, schools, uninhabited houses, which is consistent with what was found in Sao Paulo, where 67 % of the shelters used by bats are artificial(42). This situation favors the interaction between humans, companion animals and vampire bats, which increases the risk of spread and persistence of infectious diseases(5,43).

The 337,836 people living within the 5 km flight radius of bats found in shelters would suggest a considerable risk; however, the events of aggression against humans reported by health authorities are few, which suggests a possible stable coexistence between these species. There are no studies that make the degree of interaction evident, so it is considered necessary to establish more precisely the implications of the relationship between these two species. Since the results of a work carried out in the east of Sao Paulo in Brazil shows the presence of a shelter of D. rotundus for every six farms, which relates the information with the size of the herd, but not of the human population. It is important to continue with studies such as that of Rocha et al(34), which allow establishing values on the potential number of vampire bats per shelter, the frequency of bites to livestock in a region and cases of rabies. With data like the above, the researchers were able to build a model to facilitate the location of shelters and thus be able to identify other vulnerable farms, where surveillance of vampire bat attacks and other control measures must be reinforced(36).

Considering that the presence of livestock is one of the main factors of the presence and proximity of D. rotundus to human communities, at the same time it could be a protection to humans, since vampires have more easily accessible food with domestic animals(8,44).

Conclusions and implications

It is common to identify shelters in sites near human populations of San Luis Potosí, which shows a relationship in the ecosystem between people and D. rotundus, in which, a higher frequency of aggressions by Chiroptera could be expected; however, that does not happen, which indicates an adaptation of coexistence between both species, especially in the southeast of the state. The fact that 80 % of the shelters have been artificial makes it necessary to study the role that urbanization plays in the distribution of D. rotundus, as well as the presence of wild and domestic animals as a buffer against attacks on humans. To date there is not enough

704

Rev Mex Cienc Pecu 2021;12(3):694-709

information on the distribution of this chiropter and its spatial organization and considering the projections of climate change in the coming years, it is important to be able to predict the sites of environmental suitability for the location of possible shelters associating them with human settlements. This will improve epidemiological surveillance activities for rabies and other zoonotic diseases in the animal and human populations, given the potential of these species to transmit infectious diseases, which may allow serving more vulnerable localities given the close interaction with the species.

Acknowledgements

Ximena Torres Mejía received a scholarship for doctoral studies from the National Council for Science and Technology (CONACYT, for its acronym in Spanish), in the Master's Degree and Doctoral Program in Production and Animal Health Sciences of the National Autonomous University of Mexico (UNAM, for its acronym in Spanish). Biologist Ignacio Amezcua, of the State Committee for the Promotion and Protection of Livestock of San Luis Potosí (CEFPPSLP, for its acronym in Spanish) for his support in data collection and fieldwork.

Conflict of interest

The authors declare that they have no conflict of interest.

Literature cited: 1.- Plowright RK, Eby P, Hudson PJ, Smith I, Westcott D, Bryden WL, et al. Ecological dynamics of emerging bat virus spillover. Proc Biol Sci 2015;282(1798):20142124. 2.- Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. Bats: important reservoir hosts of emerging viruses. Clin Microbiol Rev 2006;19:531–545. 3.- Hayman DT, Bowen RA, Cryan P M, McCracken GF, O'Shea TJ, Peel AJ, et al. Ecology of zoonotic infectious diseases in bats: current knowledge and future directions. Zoonoses Public Health 2013;60(1):2-21. 705

Rev Mex Cienc Pecu 2021;12(3):694-709

4.-Becker DJ, Czirják GÁ, Volokhov DV, Bentz AB, Carrera JE, Camus MS, et al. Livestock abundance predicts vampire bat demography, immune profiles and bacterial infection risk. Phil Trans R Soc B 2018;373:e1745. 5.- Joffrin L, Dietrich M, Mavingui P, Lebarbenchon C. Bat pathogens hit the road: But which one?. PLoS Pathog 2018;14(8):e1007134. 6.- Barcenas-Reyes I, Loza-Rubio E, Zendejas- Martinez H, Luna-Soria H, Canton-Alarcon G, Milian-Suazo F. Comportamiento epidemiológico de la rabia paralitica bovina en la región central de México, 2001-2013. Rev Panam Salud Publica 2015;38(5):396–402. 7.- Quan P, Firth C, Conte JM, Williams SH, Zambrana-Torrelio CM, Simon J. et al. Bats are a major natural reservoir for hepaciviruses and pegiviruses. Proc Natl Acad Sci USA 2013;110:8194–8199. 8.- Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A. Vampire bat rabies: Ecology, epidemiology and control. Viruses 2014;6:1911-1928. 9.- Velasco-Villa A, Mauldin MR, Shi M, Escobar LE, Gallardo-Romero NF, Damon I, Olson VA, Streicker DG, Emerson G. The history of rabies in the western hemisphere. Antiviral Res 2017;146:221-232. 10.- Blackwood JC, Streicker DG, Altizer S, Rohani P. Resolving the roles of immunity, pathogenesis, and immigration for rabies persistence in vampire bats. Proc Natl Acad Sci USA 2013;110(51):20837-20842. 11.- Condori-Condori RE, Streicker DG, Cabezas-Sanches C, Velasco-Villa A. Enzootic and epizootic rabies associated with vampire bats, Peru. Emerg Infect Dis 2013;19(9)1463– 1469. 12.- Hayes MA, Piaggio AJ. Assessing the potential impacts of a changing climate on the distribution of a rabies virus vector. PLoS ONE 2018;13(2):e0192887. 13.- Zarza H, Martínez-Meyer E, Suzán G, Ceballos G. Geographic distribution of Desmodus rotundus in Mexico under current and future climate change scenarios: implications for bovine paralyticc rabies infection. Vet Mex OA 2017;4(3). 14.- SENASICA.2019. Informe Semanal sobre Enfermedades y Plagas de Reporte Obligatorio Inmediato. Semana 51. https://www.gob.mx/cms/uploads/attachment/file/524294/SEM_51_2019_WEB.PDF. Consultado 22 Feb, 2020. 15.-Moran D, Juliao P, Alvárez D, Lindblade KA, Ellison JA, Gilbert AT, et al. Knowledge, attitudes and practices regarding rabies and exposure to bats in two rural communities in Guatemala. BMC Res Notes 2015;8:955. 706

Rev Mex Cienc Pecu 2021;12(3):694-709

16.- Streicker DG, Allgeier JE. Foragingn choices of vampire bats in diverse landscapes: potential implications for land-use change and disease transmission. J App Ecol 2016;53:1280-1288. 17.- Zaidi F, Fatima SH, Jan T, Fatima M, Ali A, Khisroon M. Environmental risk modeling and potential sand fly vectors of cutaneous leishmaniasis in Chitral district: a leishmanial focal point of mount Tirich Mir, Pakistan. Trop Med Int Health 2017;22(9):1130–1140. 18.- Escobar LE, Peterson AT, Papeş M, Favi M, Yung V, Restif O, Huijie-Qiao H, MedinaVogel G. Ecological approaches in veterinary epidemiology: mapping the risk of batborne rabies using vegetation indices and night-time satellite imagery. Vet Res 2015;46(1):92. 19.- Portilla-Cabrera CV, Selvaraj JJ. Geographic shifts in the bioclimatic suitability for Aedes aegypti under climate change scenarios in Colombia. Heliyon 2020;24: 6(1):e03203. 20.- Tran A, Ippoliti C, Balenghien T, Conte A, Gely M, Calistri P, Goffredo M, Baldet T, Chevalier V. A geographical information system-based multicriteria evaluation to map areas at risk for rift valley fever vector-borne transmission in Italy. Transbound Emerg Dis 2013;60:14–23. 21.- Rousseau R, McGrath G, McMahon BJ, Vanwambeke SO. Multi-criteria decision analysis to model Ixodes ricinus habitat suitability. EcoHealth 2017;14(3):591–602. 22.- West AM, Kumar S, Brown CS, Stohlgren TJ, Brombergc J. Field validation of an invasive species Maxent model. Ecol Inform 2016;36:126-134. 23.- Lee DN, Papeş M, Van den Bussche RA. Present and potential future distribution of common vampire bats in the Americas and the associated risk to cattle. PloS one 2012;7(8):e42466. 24.- Sunil N, Sivaraj N, Anitha K, Abraham B, Kumar V, Sudhir E, Vanaja M, Varaprasad KS. Analysis of diversity and distribution of Jatropha curcas L. germplasm using Geographic Information System (DIVA-GIS). Genet Resour Crop Evol 2008;56(1): 115–119. 25.- INEGI. Cuéntame, información por entidad. San Luis Potosí. Disponible en el URL http://cuentame.inegi.org.mx/monografias/informacion/slp/territorio/clima.aspx?tema= me&e=24. Consultado 8 Feb,2020.

707

Rev Mex Cienc Pecu 2021;12(3):694-709

26.- Hesami N, Reza Abai M, Vatandoost H, Alizadeh M, Fatemi M, Ramazanpour J, HanafiBojd AA. Using ecological niche modeling to predict the spatial distribution of Anopheles maculipennis s.l. and Culex theileri (Diptera: Culicidae) in Central Iran. J Arthropod-Borne Dis 2019;13(2):165–176. 27.- Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A. Very high resolution interpolated climate surfaces for global land areas. Int J Climatol 2005;25:1965–1978. 28.-García E. Modificaciones al sistema de clasificación climática de Köppen. Serie Libros núm. 6. México: Instituto de Geografía, UNAM;2004. 29.- INEGI, 2007. Carta edafológica. Escala 1:250,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825235673.Consultado 22 Feb, 2020. 30.- INEGI, 2008. Unidades climáticas. Escala 1:1,000,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825267568. Consultado 22 Feb, 2020. 31.- INEGI, 2015. Carta de uso de suelo y vegetación. Escala 1:250,000. Serie V. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=702825570385. Consultado 22 Feb, 2020. 32.- INEGI, 2017. Topográfica. Escala 1:50,000. Instituto Nacional de Estadística y Geografía. México. URL: https://www.inegi.org.mx/app/biblioteca/ficha.html?upc=889463532200. Consultado 22 Feb, 2020. 33.- Phillips SJ, Robert P. Anderson RP, Schapire RE. Maximum entropy modeling of species geographic distributions. Ecol Modell 2006;190:231–259. 34.- Rocha F, Ulloa-Stanojlovic FM, Rabaquim VCV, Fadil P, Pompei JC, Brandão PE, Dias RA. Relations between topography, feeding sites, and foraging behavior of the vampire bat, Desmodus rotundus. J Mammal 2019;101(1):164-171. 35.- Delpietro HA, Russo RG,Carter GG, Lord RD, Delpietro GL. Reproductive seasonality, sex ratio and philopatry in Argentina’s common vampire bats. R Soc Open Sci 2017;4:160959.

708

Rev Mex Cienc Pecu 2021;12(3):694-709

36.- Rocha F, Dias RA. The common vampire bat Desmodus rotundus (Chiroptera: Phyllostomidae) and the transmission of the rabies virus to livestock: A contact network approach and recommendations for surveillance and control. Prev Vet Med 2020;174:104809. 37.- Romero ML, Aguilar SA, Sanchez, HC. Murciélagos benéficos y vampiros, características, importancia, rabia y conservación. Mexico: AGT Editor SA; 2006. 38.- Delpietro HA, Russo RG, Carter GG, Lord RD, Delpietro GL. Reproductive seasonality, sex ratio and philopatry in Argentina’s common vampire bats. R Soc Open Sci 2017;4:160959. http://dx.doi.org/10.1098/rsos.160959. 39.- Bárcenas-Reyes I, Nieves-Martínez DP, Cuador-Gil JQ, Loza-Rubio E, González-Ruíz S, Cantó-Alarcón GJ, Milian-Suazo F. Spatiotemporal analysis of rabies in cattle in central Mexico. Geospat Health 2019;14(2). 40.- Olival KJ. To cull, or Not to Cull, Bat is the Question. EcoHealth 2016;13:6-8. 41.- Woodroffe R, Donnelly CA, Jenkins HE, Johnston WT, Cox DR, Bourne FJ, et al. Culling and cattle controls influence tuberculosis risk for badgers. Proc Natl Acad Sci USA 2006;103:14713–14717. 42.- Mialhe P. Characterization of Desmodus rotundus (E. Geoffroy, 1810) (Chiroptera, Phyllostomidae) shelters in the Municipality of São Pedro - SP. Braz J Biol 2013;73(3):521–526. 43.- Hassell JM, Begon M, Ward MJ, Fèvre EM. Urbanization and disease emergence: Dynamics at the wildlife–livestock–human interface. Trends Ecol Evol 2016;32(1):5567. 44.- Bobrowiec PED, Lemes MR, Gribel R. Prey preference of the common vampire bat (Desmodus rotundus, Chiroptera) using molecular analysis. J Mammal 2015;96(1):5463.

709

https://doi.org/10.22319/rmcp.v12i3.5469 Article

Detection of Pasteurella multocida, Mannhemia haemolytica, Histophilus somni and Mycoplasma bovis in cattle lung

Seyda Cengiz a* M. Cemal Adıgüzel a Gökçen Dinç b

Atatürk University Faculty of Veterinary Medicine Department of Microbiology 25240 Erzurum. Turkey. b

Erciyes University Faculty of Medicine Department of Microbiology Kayseri. Turkey.

Corresponding author: seydacengiz@atauni.edu.tr

Abstract: In this study, it was aimed to determine of P. multocida, M. haemolytica, H. somni and M. bovis in macroscopically healthy cattle lungs by PCR. The study was carried out on 82 macroscopically healthy cattle lung. DNA extraction was performed to the lung samples. PCR was then performed using all specific primers. By molecular evaluation, positive results were achieved for P. multocida, M. haemolytica, H. somni and M. bovis in 4 (4.8 %), 4 (4.8 %), 6 (7.3 %) and 3 (3.6 %) of the samples, respectively. Mix infections were detected in five samples. Of the samples, two were positive for both P. multocida and M. haemolytica, two were positive for both M. haemolytica and H. somni and one was positive for both P. multocida and H. somni. However, a positive sample, which carried all of pathogens, was not detected. In conclusion, P. multocida, M. haemolytica, H. somni and M. bovis are the important opportunistic pathogens of respiratory tract in cattle and these pathogens have a major role during infections. But multifactorial nature of bovine respiratory disease and immune system affected the formation of the disease. Hence, firstly cattle’s immunity should be strengthened and other conditions should be kept under control. Key words: Cattle, Molecular analysis, Lung, Respiratory disease. 710

Rev Mex Cienc Pecu 2021;12(3):710-720

Received: 07/08/2019 Accepted: 07/12/2020

Introduction Bovine respiratory disease (BRD) is one of the major health problems in calves and adult cattle, and has great economic impact on the cattle industry(1-3). BRD in herds causes economic losses due to increased treatment costs, decreased production and culling(4). BRD has a complex etiology, which involves bacterial and viral agents. Additionally, some predisposing factors such as management failures, environmental and host defense problems are influential on infection occurrence(5). The most frequent bacterial agents isolated from respiratory disease are Pasteurella multocida (P. multocida), Mannheimia haemolytica (M. haemolytica), Histophilus somni (H. somni) and Mycoplasma bovis (M. bovis)(6,7). Pasteurella multocida is one of the primary bacterial pathogens and leads to clinical symptoms during BRD in neonatal calves and cattle. The bacterium, which is detected not only in infected but also healthy cattle, is isolated from lung, nasopharyngeal and nasal swabs and trans-tracheal washes. Therefore, diagnose of P. multocida becomes an issue, if clinical symptoms associated with pneumonia are detected in cattle(8). Similarly, M. haemolytica is normally presented in nasal pharyngeal mucosa in healthy cattle. However, the bacterium becomes a pathogen under inadequate conditions such as nutritional deficiency and overcrowded housing, and viral infections. Following to rapid proliferation of M. haemolytica within the infected lung, severe fibrinopurulent bronchopneumonia is presented. Additionally, it produces a potent leukotoxin that destroys the macrophages and neutrophils(9,10). Because of these properties, this bacterium is accepted as the most harmful pathogen for lung. H. somni is a bacterium which is normally presented not only in respiratory but also in reproductive tract. Similar with mentioned pathogens above, H. somni is also causing infections such as thrombotic meningoencephalitis (TME), pneumonia, septicemia, mastitis, arthritis, myocarditis and reproductive infections under inappropriate conditions with clinical symptoms(5,11-13). M. bovis is not only respiratory disease but also arthritis, mastitis, genital infections and abortus(3). Moderate infections in cattle has the potential to cause an infection with severe

711

Rev Mex Cienc Pecu 2021;12(3):710-720

clinical manifestations, as well as difficulty diagnosis; penicillin and its derivates are also an important problem in cattle breeding enterprises with the resistance mechanism of antibiotics(14). At the same time, the rapid spread of bacteria in the cattle herd was a result of M. bovis makes it important(15). BRD is known as polymicrobial infection in cattle herds and mainly recorded in younger cows(13). Thus, diagnosis of BRD is required to use different methods (conventional and molecular) to determine the bacteria that are effective in etiology. In particular, the use of different media, incubation conditions (temperature and O2 ratio), and differences between methods in conventional diagnostic methods require the use of faster methods. Molecular diagnosis of the pathogens based on Polymerase Chain Reaction (PCR) techniques can be used for identification and detailed evaluations. Molecular techniques, which are more sensitive than bacteriological methods, are preferred especially for direct identification of pathogens from tissue samples (8,9,15,16). The aim of this study was to determine of P. multocida, M. haemolytica, H. somni and M. bovis of macroscopically healthy cattle lungs by PCR.

Material and methods Sampling procedure

A total of 83 lung samples were collected from the different slaughterhouses. A piece of lung sample was taken from lungs without any lesions and placed in sterile tubes transported to the laboratory in cool chain.

Culture and DNA extraction

A piece of sample was taken and placed in eppendorf tube. Briefly, each sample was put into sterile petri dishes and then samples were break into parts using sterile bistouries and pens. Broth culture was only used for M. bovis. A piece of lung sample for M. bovis isolation inoculated in PPLO broth medium and incubated at 37 oC in %5 CO2 for 5 d. PPLO broth cultures were used for M. bovis DNA extraction, lyzed lung samples were used for other bacteria DNA extraction. DNA was extracted from the lung samples by using genomic DNA purification kit (Qiagen-DNeasy Blood and Tissue Kit-USA). Manufacturer instructions

712

Rev Mex Cienc Pecu 2021;12(3):710-720

were followed.

Polymerase Chain Reaction

PCR procedures, which involved cycle conditions and reaction mixture, were performed according to previous reports(17,18,19) (Table 1). The reaction mixture was prepared with a total volume of 50 μl contained 3 mM MgCl2, 200 μl dNTP, 0.5 μM each of primer and 1.25 units Taq DNA polymerase (Vivantis, MY) with minor revisions for pathogens. Extracted DNA (1 μL) was used as template. Amplification was carried by thermalcycler (The SuperCycler Trinity, Kyratech, AU). All samples of PCR amplification products (10 μL) were subjected to electrophoresis. DNA was visualized by UV fluorescence after staining with ethidium bromide.

Pathogen P. multocida

M. haemolytica

H. somni

M. bovis

Table 1: PCR conditions and oligonucleotids sequences Cycle Base condition Oligonucleotids pair (°C/min) (bp) 94/1 F:GGCTGGGAAGCCAAATCAAAG 1432 69/1 30 cyc R:CGAGGGACTACAATTACTGTAA 72/1 94/1 F:TGTGGATGCGTTTGAAGAAGG 1145 55/1 30 cyc R:ACTTGCTTTGAGGTGATCCG 72/1 94/1 F:GAAGGCGATTAGTTTAAGAG 400 55/1 35 cyc R:TTCGGGCACCAAGTRTTCA 72/1 94/1 F: TATTGGATCAACTGCTGGAT 447 54/1 30 cyc R: AGATGCTCCACTTATCTTAG 72/1

713

Reference Miflin and Blackall, 2001 Akan et al, 2006

Angen et al, 1998

Foddai et al, 2005

Rev Mex Cienc Pecu 2021;12(3):710-720

Results In molecular evaluation, positive results were achieved for P. multocida, M. haemolytica, H. somni and M. bovis in 4 (4.8 %), 4 (4.8 %), 6 (7.3 %) and 3 (3.6 %) of the samples, respectively (Figure 1-3). Mix infections were detected in five samples. Of the samples, two were positive for both P. multocida and M. haemolytica, two were positive for both M. haemolytica and H. somni and one was positive for both P. multocida and H. somni. However, a positive sample, which carried all of the pathogens, was not detected. Figure 1: Molecular evaluation of P.multocida

M= Marker (100 bp DNA Ladder Plus), 1-3= P.multocida

Figure 2: Molecular evaluation of M. haemolytica

M= Marker (100 bp DNA Ladder Plus), 1-2= M. haemolytica

714

Rev Mex Cienc Pecu 2021;12(3):710-720

Figure 3: Molecular evaluation of H. somni and M.bovis

M= Marker (100 bp DNA Ladder Plus), 1-2= H. somni, 3= M.bovis

Discussion Bovine respiratory diseases, which cause economic losses due to production decrease and culling, have major importance in cattle herds. Although, cattle of all ages and sex are susceptible to the disease, it is more harmful for calves(6,20,21). Bacteria that cause respiratory infections can be transmitted to sensitive animals from healed or immunologically strong animals (no clinical signs)(2,22). In addition to pathogens, some predisposing factors such as overcrowded and bad-ventilated barns, inadequate feeding and other infectious diseases increased the infection risk. In these herds, transmission usually occurs horizontally(7,9,23). Previous studies were usually focused on the detection of P. multocida, M. haemolytica, H. somni and M. bovis in the tonsils, nasopharynx and upper respiratory tract in carrier animals(2,24,25). Various results about the presence of pathogens in cows were achieved in the reports. Positivity of P. multocida, M. haemolytica, H. somni and M. bovis in cattle varied between 0.4-57.4 %, 1.6-35 %, 2-45 % and 14-59 % in previous reports (Figure 4)(9,19,26-30). In the present study, the number of positive animals identified for P. multocida was found lower than Onat et al(28) but was found higher than others(24,27). Positivity of M. haemolytica was found lower than some other works(2,27,29), but was found higher than Hajikolaei et al(20). In terms of positivity H. somni and M. bovis was found different from other studies. In studies, in both bacteria was evaluated different diagnostic method in pneumonic

715

Rev Mex Cienc Pecu 2021;12(3):710-720

cows(15,30,31). Additionally, the variation among the results may be associated with difference in diagnostic methods, vaccination, and bacterial properties(2,23,29). For instance, conventional culture methods can be inadequate in detection of the pathogens in healthy cows due to lower bacterial count in the samples. Likewise, vaccination can reduce bacteria carriage and lesions(16,32,33). In addition, detection of some respiratory system pathogens as H. somni and M. bovis in culture media is difficult although the samples are collected from infected cows(9,19). Thus, PCR tests, which involve specific primers for 16S rRNA, are suggested for identification of this bacterium during mix respiratory infections(5,13). Therefore, genetic material basis molecular technics, which allow the detection of the pathogens even though lower bacterial count, would be preferable rather than culture methods in determining of carrier cows (16,34) Figure 4: Proportional change of pathogens according to studies (9,20,24,27,29,30,31)

The presence of these bacteria in the absence of clinical symptoms in animals or macroscopic lesions in the necropsy supports the opportunistic character of these bacteria. However, in these cases, histopathological examinations should be done and the animal's health status should be questioned. Additionally, because the occurrence of the disease has association with carriage(22,24,27,35), detection of reservoir animals is important for reduction of the risk in herds. So that, detection of carrier cows, which have potential risk for contamination, is an approach for control(22).

Conclusions and implications In conclusion, P. multocida, M. haemolytica, H. somni and M. bovis, which cause economic losses and death in animals, are also important opportunistic pathogens. Therefore, the

716

Rev Mex Cienc Pecu 2021;12(3):710-720

immune system should be developed by vaccination in animals. Moreover, housing conditions and management, awareness of the staff (owner) should be improved to establish an effective and sustainable control program for respiratory system diseases. Literature cited: 1.

Headley SA, Alfieri AF, Oliveira VHS, Beuttemmüller EA, Alfieri AA. Histophilus somni is a potential threat to beef cattle feedlots in Brazil. Vet Rec 2014;175:249-250.

Jaramillo-Arango CJ, Hernandez-Castro R, Suarez-Guemes F, Martinez-Maya JJ, Aguilar-Romero F, Jaramillo-Meza L, Trigo FJ. Characterisation of Mannheimia spp. strains isolated from bovine nasal exudate and factors associated to isolates, in dairy farms in the Central Valley of Mexico. Res Vet Sci 2008;84:7-13.

Margineda GA, Zielinski GO, Jurado S, Alejandra F, Mozgovoj M, Alcaraz AC, López A. Mycoplasma bovis pneumonia in feedlot cattle and dairy calves in Argentina. Braz J Vet Pathol 2017;10(2):79 – 86.

Angen Ø, Thomsen J, Larsen LE, Larsen J, Kokotovic B, Heegaard PMH, Enemark JMD. Respiratory disease in calves: Microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein respons. Vet Microbiol 2009;137:165-171.

Tegtmeier C, Angen SNG, Riber U, Friis NF. Aerosol challenge of calves with Haemophilus somnus and Mycoplasma dispar. Vet Microbiol 2000;72:229-239.

Klima CL. Characterization of the genetic diversity and antimicrobial resistance in Mannheimia haemolytica from feedlot cattle [Thesis]. Alberta, Canada: University of Lethbridge; 2009.

Kurćubić VS, Đoković RD, Ilić ZŽ, Stojković JS, Petrović MP, Petrović VC. Modern approach to the enigma of bovine respiratory disease complex: A review. Pak Vet J 2014; 34:11-17.

Dabo SM, Taylor JD, Confer AW. Pasteurella multocida and bovine respiratory disease. Anim Health Res Rev 2008;8:129-150.

Tegtmeier C, Angen Ø, Ahrens P. Comparison of bacterial cultivation, PCR, in situ hybridisation and immunohistochemistry as tools for diagnosis of Haemophilus somnus pneumonia in cattle. Vet Microbiol 2000;76:385-394.

10. Bielsa JM. New solution for the control of the bovine respiratory complex. Congress of the Mediterranean Federation for Health and Production of Ruminants (FeMeSPrum) Zadar, Croatia, 2008;35-42.

717

Rev Mex Cienc Pecu 2021;12(3):710-720

11. Humphrey JD, Stephens LR. Haemophilus somnus: a review. Vet Bull 1983;53:9871004. 12. Corbeil LB, Widders PR, Gogolewski RP, Arthur JE, Inzana TJ, Ward ASC. Haemophilus somnus: bovine reproductive and respiratory disease. Can Vet J 1986;27: 90-93. 13. Angen Q, Ahrens P, Tegtmeier C. Development of a PCR test for identification of Haemophilus somnus in pure and mixed cultures. Vet Microbiol 1998;63:39-48. 14. Nicholas RAJ. Recent developments in the diagnosis and control of mycoplasma infections in cattle. 23rd. World Buiatric Congress, Canada. 2004. 15. Petersen MB. Mycoplasma bovis in dairy cattle. [PhD Thesis] Denmark, Department of Veterinary and Animal Sciences Faculty of Health and Medical Sciences. University of Copenhagen; 2018. 16. Casademunt S. The role of Histophilus somni in bovine respiratory disease: An update. 2011. www.hipra.com. Accesed 30 May, 2018. 17. Miflin JK, Blackall P. Development of a 23S rRNA-based PCR assay for the identification of Pasteurella multocida. Lett App Microbiol 2001;33:216-221. 18. Akan M, Oncel T, Sareyyupoglu B, Hazıroglu R, Tel OY, Cantekin Z. Vaccination studies of lambs against experimental Mannheimia (Pasteurella) haemolytica infection. Small Ruminant Res 2006;65:44–50. 19. Foddai A, Idini G, Fusco M, Rosa N, Fe A, Zinellu S, Corona L, Tola S. Rapid differential diagnosis of Mycoplasma agalactiae and Mycoplasma bovis based on a multiplex-PCR and a PCR-RFLP. Mol Cell Prob 2005;19:207-212. 20. Hajikolaei HMR, Ghorbanpour M, Sayfi-Abadshapouri MR, Rasooli A, Ebrahimkhani D, Jabbari AR. Bacteriological and serological studies on Mannheimia haemolytica infection in cattle slaughtered at Ahvaz (southwestern Iran) abattoir. Iranian J Vet Res 2010;11:84-87. 21. Headley SA, Oliveira VH, Figueira GF, Bronkhorst DE, Alfieri AF, Okano W, Alfieri AA. Histophilus somni-induced infections in cattle from southern Brazil. Trop Anim Health Prod 2013;45:1579–1588. 22. Dziva F, Muhairwa A, Bisgaard M, Christensen H. Diagnostic and typing options for investigating diseases associated with Pasteurella multocida. Vet Microbiol 2007;128:1-22.

718

Rev Mex Cienc Pecu 2021;12(3):710-720

23. Taylor JD, Fulton RW, Mady DS, Lehenbauer TW, Confer AW. Comparison of genotypic and phenotypic characterization methods for Pasteurella multocida isolates from fatal cases of bovine respiratory disease. J Vet Diagn Invest 2010;22:366-375. 24. Hajikolaei HMR, Ghorbanpour M, Seyfi-Abadshapouri MR, Rasooli A, Moazeni Jula GR, Ebrahimkhani D. Study on the Prevalence of Pasteurella multocida carriers in slaughtered cattle and relationship with their immunity status at Ahvaz Abattoir. J Vet Res 2008;63:31-35. 25. Aebi M, Borne BHP, Raemy A, Steiner A, Pilo P, Bodmer M. Mycoplasma bovis infections in Swiss dairy cattle: a clinical investigation. Acta Vet Scan 2015;57:1-11. 26. Hajikolaei HMR, Ghorbanpour M, Sayfi-Abadshapouri MR, Rasooli A, Jahferian H. Occurrence of Pasteurella multocida in the nasopharynx of healthy buffaloes and their immunity status. Bull Vet Inst Pulawy 2006;50:435-438. 27. Barbour EK, Nabbut NH, Hamadeh SK, Al-Nakhli HM. Bacterial identity and characteristics in healthy and unhealthy respiratory tracts of sheep and calves. Vet Res Commun 1997;21:421- 430. 28. Onat K, Kahyaoğlu S, Çarlı KT. Frequency and antibiotic susceptibility of Pasteurella multocida and Mannheimia haemolytica isolates from nasal cavities of cattle. Turk J Vet Anim Sci 2010;34:91-94. 29. Alexander TW, Cook S, Klima CL, Topp E, McAllister TA. Susceptibility to tulathromycin in Mannheimia haemolytica isolated from feedlot cattle over a 3-year period. Front Microbio 2013;4:1-8. 30. Tenk M. Examination of Mycoplasma bovis infection in cattle [PhD Thesis]. Budapest: Szent Istvan University; 2005. 31. D’Amours GH, Ward TI, Mulvey MR, Read RR, Morck DW. Genetic diversity and tetracycline resistance genes of Histophilus somni. Vet Microbiol 2011;150:362–372. 32. Pérez DS, Pérez FA, Bretschneider G. Histophilus Somni: Pathogenicity in cattle. An update. An Vet (Murcia) 2010;26:5-21. 33. Lipsitch M. Vaccination against colonizing bacteria with multiple serotypes. Proc Natl Acad Sci 1997;94:6571–6576. 34. Deressa A, Asfaw Y, Lubke B, Kyule MW, Tefera G, Zessin KH. Molecular Detection of Pasteurella multocida and Mannheimia haemolytica in sheep respiratory infections in Ethiopia. Intern J Appl Res Vet Med 2010;8:101-108.

719

Rev Mex Cienc Pecu 2021;12(3):710-720

35. Derosa DC, Mechor GD, Staats JJ, Chengappa MM, Shryock TR. Comparison of Pasteurella spp. simultaneously isolated from nasal and transtracheal swabs from cattle with clinical signs of bovine respiratory disease. J Clin Microbiol 2000;38:327–332.

720

https://doi.org/10.22319/rmcp.v12i3.5765 Article

Treating horse chronic laminitis with allogeneic bone marrow mesenchymal stem cells

Alma A García-Lascuráin a,b Gabriela Aranda-Contreras c Margarita Gómez-Chavarín d Ricardo Gómez e Adriana Méndez-Bernal f Gabriel Gutiérrez-Ospina g María Masri a*

Universidad Nacional Autónoma de México (UNAM). Facultad de Medicina Veterinaria y Zootecnia. Departamento de Medicina, Cirugía y Zootecnia para Équidos. 04510 Ciudad de México, México. b

UNAM. Facultad de Medicina Veterinaria y Zootecnia, Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Ciudad de México, México. c

UNAM. Facultad de Estudios Superiores Cuautitlán. Hospital para Equinos, Cuautitlán Izcalli, Estado de México, México. d

UNAM. Facultad de Medicina, Departamento de Fisiología. México.

Instituto Nacional de Rehabilitación “Luis Guillermo Ibarra Ibarra”. Unidad de Ingeniería de Tejidos, Terapia Celular y Medicina Regenerativa. Ciudad de México, México. e

UNAM. Facultad de Medicina Veterinaria y Zootecnia. Departamento de Patología. Ciudad de México, México. g

UNAM. Instituto de Investigaciones Biomédicas, Departamento de Biología Celular y Fisiología, Ciudad de México, México.

* Corresponding author: masri@unam.mx

721

Rev Mex Cienc Pecu 2021;12(3):721-741

Abstract: Chronic laminitis is a disabling condition that affects the laminar corium of the horse’s hooves. Commonly, it develops as a collateral injury of numerous primary systemic diseases. It is believed that the critical physiopathological event that renders a hoof laminitic is the loss of mesenchymal stem cells. This loss greatly impairs the ability of the laminar corium to regenerate. Although previous work provides credibility to this notion, there remain unsettled issues that must be addressed before accepting it as a wellfounded fact. Here, it was reexamined the central tenet of the physiopathological model of laminitis by infusing allogeneic bone marrow-derived mesenchymal stem cells (ABMMSCs), through the digital palmar vein, into the hooves of horses afflicted by chronic laminitis. Horses were clinically monitored during 6 mo by evaluating them monthly using the lameness-modified Obel-Glasgow’s scale and hooves thermography. Venograms and lamellar biopsies were taken at the beginning and at the end of the study period to gathered evidence on vascular remodeling and laminar corium regeneration. The results showed that ABM-MSCs infusion promotes vascular remodeling and laminar corium regeneration, further supporting that the loss of stem cells is the critical event leading to chronic laminitis. This work also demonstrated that the infusion of ABMMSCs is safe since the treated horses did not develop local or systemic, negative clinical manifestations attuned with rejection reactions, at least during the 6-mo period they were follow up and under the therapeutic scheme proposed. Key words: Horses, Laminitis, ABM-MSCs, aMSCs, MMP, MSCs, PRP, Platelet rich plasma.

Received: 13/08/2020 Accepted: 30/11/2020

Introduction Chronic laminitis is an incapacitating podal condition in horses. Its prevalence ranges 7 to 14 % worldwide(1). Laminitis is the negative collateral outcome of numerous primary digestives, respiratory, urinary, metabolic, orthopedic and reproductive diseases(2-4). Faleiros et al(5) and Leise et al(6) have elaborated a three-phase model to understand the progression of laminitis: the developmental phase, the acute phase, and the chronic phase. It has been proposed that the laminar corium in hooves of horses afflicted by chronic laminitis loses its abilities to sustain regenerative processes(3). Since mesenchymal stem cells are responsible for carrying out this task, a central piece of the puzzle to understand the physiopathology of chronic laminitis is therefore the loss of mesenchymal stem cells 722

Rev Mex Cienc Pecu 2021;12(3):721-741

during the inflammatory process(3). This notion is not incongruous since mesenchymal stem cells keep under tight control the homeostasis, remodeling and repair of the laminar corium(7-8), promote tissue regeneration by secreting growth factors(9-12); and antiinflammatory cytokines(11,13,14). They also protect against oxidative damage and against hypoxia / reperfusion injury by preserving endothelial integrity and promoting angiogenesis(3). In 2017, Angelone et al(3) pioneered an experimental work aimed at assessing whether the loss of mesenchymal stem cells was indeed a fundamental piece of the physiopathological mechanism leading to chronic laminitis. Their results answered positively their enquiry, only to some extent. Unfortunately, they could not irrefutably ascribe the clinical improvement and the venographic evidence of angiogenesis observed in the treated horses solely by the infused adipose tissue-derived mesenchymal stem cells because the cells were co-infused with platelet-rich plasma. In addition, even though previous evidence has revealed that allogeneic stem cells have no deleterious effects on the horses’ health even if they may trigger immune responses in the treated horse against foreign antigens(15-21), they opted to first infused allogeneic and then infused autologous adipose tissue-derived mesenchymal stem cells, thus confounding the interpretation of their results. Lastly, even though treated horses improved significantly when clinically assessed and despite the evidence presented supporting ongoing angiogenesis in the infused laminitic hooves, the cytological regeneration within the hoof can only be inferred. The present work was designed to overcome some of the technical pitfalls of the pioneer experimental assessment conducted by Angelone, while evaluating the role of mesenchymal stem cells in the pathophysiological process underlying laminitis. To successfully do this, it was infused allogeneic bone marrow-derived mesenchymal cells (ABM-MSCs), suspended in culture media, into both front hooves of horses chronically affected by laminitis, monitored the clinical progress of infused horses through clinical and venographic assessments. In addition, the study included hooves biopsies to directly evaluate laminar corium regeneration and hooves thermography to keep track of hooves temperature. Overall, the results showed that ABM-MSCs infusions: 1) restore to a significant extent the cytoarchitecture of the laminar corium, 2) regenerate segments of the vascular bed and 3) notoriously improves the clinical stance of the treated horses, while having no local nor systemic deleterious effects on the horses’ health at least for up to the time the horses were followed and under the treatment protocol devised here. Hence, our observations support that the loss of mesenchymal stem cells play a fundamental role in the pathogenesis of chronic laminitis; their restitution may well reverse the condition. As subsidiary corollaries, clinicians must investigate measures aimed at preventing mesenchymal stem cell loss through inducing hooves protective immune tolerance or by encouraging hooves beneficial auto-immunity in horses coursing with primary, pro-laminitis diseases. Lastly, it is worth to emphasize the need to investigate the possibility of using mesenchymal stem cells to manage pain in horses.

723

Rev Mex Cienc Pecu 2021;12(3):721-741

Material and methods Animals

Female (n= 5) and male (n= 5) horses of different breeds, age and different activities afflicted by chronic laminitis were used to conduct this study (Table 1), none of the horses were under any current treatment. All of the animals displayed distal phalanx rotation but were not sinkers. Blood cell count (CBC) was drawn from the jugular vein was used to appraise the initial inflammatory state. All horses were kept and treated in their corresponding regular stalls. Animals had free access to water and were fed with oat hay twice a day. Informed consent forms were signed by the owners. Horse clinical and experimental procedural and handling protocols were approved by the Veterinary College (FMVZ-UNAM) Institutional Animal Care and Use of Animal Committee (No. MC2016/2-5; “Evaluación terapéutica del uso de células troncales mesenquimales alogénicas, en el control del dolor, inflamación y estructura lamelar en caballos con lamintis crónica”).

724

Rev Mex Cienc Pecu 2021;12(3):721-741

Table 1: Horses of different breeds, age and different activities afflicted by chronic laminitis No.

Breed

Sex

Age (years)

Quarter Horse

Mare

Appendix

Mare

3 4

Thoroughbred Quarter horse

Male Gelding

8 3

Quarter horse

Male

Quarter horse

Mare

Thoroughbred

Mare

Quarter horse

Gelding

Santa Gertrudis Mare

Thoroughbred

Male

Activity

Laminitis cause

Laminitis duration

Initial prognosis

Initial weight

Final weight

Initial ObelGlasgow

Final ObelGlasgow

Shoeing

Mexican sport Police service Jumper Pet

Colic

13 months Poor

480

408

Orthopaedic

Abortion

430

450

None

Diet Trimming

+24 Bad months 1 month Poor 12 months Poor

450 320

465 360

2 7

1 2

Orthopaedic None

Mexican sport Police service Race

Colic

24 months Bad

360

370

Orthopaedic

Placental retention Unknown

+24 Bad months 12 months Bad

460

470

None

496

490

Orthopaedic

Mexican sport Military service Race

Diet change

+24 months 2 months

Bad

365

330

Standard

Poor

455

460

None

4 months

Poor

400

470

Orthopaedic

Colon displacement Running

725

Rev Mex Cienc Pecu 2021;12(3):721-741

Lameness assessment

An orthopedic evaluation was made by observing the static and dynamic postures of each horse. It was used the modified multifactorial evaluation pain score adapted for laminitic horses that rates signs of pain and altered behavior by combining, respectively, Obel’s and Glasgow’s criteria(4). The highest the score (maximum 14), the greatest the pain.

Hooves temperature assessment

Lamellar inflammation leads to increments in hooves temperature(20). Infrared thermography may be used to estimate the change in temperature through hoof imaging. It was utilized the infrared FLIR XX5 camera (FlirTM, USA) to image real time front limb hooves of horses once a month for six months. The temperature of the coronary band was recorded in situ and graphed individually. It was decided to use the coronary band as an anatomical reference to measure the temperature because it lacks hoof wall. This feature makes this region amenable for obtaining reliable temperature readings; the anatomy of hoof wall in chronic laminitic horses may become greatly deformed. Imaging sessions were conducted at the same hour ( 8 AM), while keeping horses stood in its stall and before being hand-walked. Hooves were always cleaned before imaging. Lateral and dorsal views were taken at a distance of 30 centimeters away from the hoof. Color coded images were obtained based on a calibrated linear scale built up on the camera acquisition program.

Venography

Horses were sedated with 10% xylazine hydrochloride injected through the jugular vein. The lateral and medial palmar digital nerve were blocked using 2% lidocaine at level of proximal sesamoids; previously the area was shaved and cleaned with a solution containing 20% chlorhexidine gluconate. A tourniquet was placed with an Esmarch bandage at the fetlock. The lateral digital vein was then punctured using a butterfly catheter 23G and the contrast medium Iopamidol (Scanlux, San Chemia, México) injected through it slowly. To assure an adequate distribution of Iopamidol throughout the entire horse’s digit vascular bed, the knee dorsal aspect was flexed dorsally, and the heels lifted from the ground. At the end of the administration, the heels were weight bearing, the syringe removed, and the catheter clamped with a Halsted tweezers. Latero-medial and dorso-palmar views were taken at 60 sec from the contrast medium(21).

726

Rev Mex Cienc Pecu 2021;12(3):721-741

Lamellar biopsy

The fetlock and pastern were washed and dried. Horses were sedated and abaxial lateral and medial nerves blocked following the guidelines provided above. A tourniquet was placed in the fetlock using an Esmarch bandage to reduce bleeding. The dorsal hoof wall was drilled with a 4.8 mm diameter polishing stone (Dremel, Bosch, USA), 2 cm distal from the coronary band. The cavity made (9 mm diameter) traversed the external and medium strata of the hoof’s wall until reaching the white line, an anatomical landmark that indicates proximity to the lamellar corium. Saline solution was constantly irrigated to avoid overheating during drilling. Once in the white line, the laminar corium was incised with a scalpel armed with a No. 11 blade, oriented perpendicular to the hoof wall. The scalpel was moved clockwise following the perimeter of the cavity until reaching the third phalanx. Then, with a No. 4 Frahm’s scaler, the laminar tissue was removed from third phalanx(22). A cylindrical-shaped laminar sample, measuring approximately 7 mm at the base and 7 mm in height, was obtained. The biopsy was fixed in buffered paraformaldehyde (4%) for 24 h, then submerged into a buffered sucrose solution (15 %) for 24 h, and finally transferred to a buffered 30% sucrose solution at 4 C until evaluation. The surgical area was dried with gauzes and sealed with methyl-methacrylate. The tourniquet was removed after methyl-methacrylate dried.

Histology

Biopsies were embedded in Tissue-Tek (Neg-50, Richard-Allan Scientific, USA), frozen in dry ice and cut longitudinally (30 μm thick) in a cryostat (SLEE), at -25 °C. Serial sections were mounted on to gelatin subbed slides and stored at -4 °C until used. A total of 15 slides were obtained per sample. A slide was taken every third to be stained with Cresyl violet, Periodic Acid-Schiff’s base and Masson’s Trichromic stain. Slides were cover slipped with CytosealTM 60 (Richard-Allan Scientific) and observed through an Olympus BX51-WI microscope. The tissue cytological integrity and degree of inflammatory infiltration was estimated qualitatively, and representative fields of this material were digitally photomicrographed, under bright-field microscopy, by using the Stereo Investigator Software (10X).

Transmission electronic microscopy

Samples of the lamellar corium obtained from a healthy and a laminitic horses were fixed in a tampon solution containing 4% paraformaldehyde / 2.5% glutaraldehyde (Electron Microscopy Sciences) for 72 h. After three gentle washes with phosphate buffer-saline

727

Rev Mex Cienc Pecu 2021;12(3):721-741

(0.1M; pH 7.2), the samples were post-fixed with osmium tetroxide (1%) for 1 h, then dehydrated and embedded in Epon 812. Polymerized at 60 C for 24 h. Semi-thin sections (150 nm) were mounted in slides and dyed with Toluidine blue, the interest area was chosen and Ultra-thin sections (70 nm) were mounted on cupper grids, contrasted with uranyl acetate (2%) and lead citrate (50%) (Electron Microscopy Sciences) and observed through a Jeol 1010 transmission electron microscope (60kV). The tissue ultrastructural integrity and degree of inflammatory infiltration was estimated qualitatively, and representative fields of this material were digitally photomicrographed.

Bone marrow sampling and mesenchymal stem cell collection, isolation and expansion

Bone marrow (BM) samples (15 mL) were collected (using 20 mL syringes containing 1,000 UI heparin/ml BM) through a sternal puncture from male and female healthy horses (3-8 yr-old) of different breeds. Samples were stored at 4 – 8 C and transferred in aseptic conditions to the cell culture facility within an hour from collection. Bone marrow was transferred to sterile tubes filled with Ficoll Hypaque at a 1:2 proportion. The samples were centrifuged at 400 xg for 30 min and the mononuclear fraction was isolated in a sterile tube at 4C. The fraction was centrifuged at 300 xg for 10 minutes at 4 C. The supernatant was discarded and the cells were re-suspended and seeded, at a density of 5x104 cells/cm2, in 25 cm3 flasks containing DMEM:F12 (1:1) supplemented with 20% fetal bovine Serum, 500 U/mL of penicillin, 50 g/mL of streptomycin and 2.5 g/mL amphotericin B. The cells were incubated at 37 °C and 5% CO2 and the culture media were changed every three days until reaching an 80% confluence(23).

Equine mesenchymal stem cell subculture and scaling

After the 80 % confluence was reached, the cells were sub-cultured weekly as follows: the monolayer was washed with DPBS and the cells were detached using HBSS with 7.5 mg of porcine trypsin and 0.6 mg of EDTA. The cells were seeded at a density of 5x10 4 cells/cm2 in 75 cm3 flasks (first subculture) and then in 175 cm3 (subsequent subcultures) with DMEM F12 (1:1) supplemented with 20% Fetal Bovine Serum.

Flow-cytometry

Allogenic, bone marrow mesenchymal stem cells were characterized through flowcytometry. Three sets of antibodies were used to immunophenotype them. ABM-MSC 728

Rev Mex Cienc Pecu 2021;12(3):721-741

used for infusion were positive to the surface markers CD73, CD90, CD105, CD28 and CD44 (CD28/CD44 specific for equine MSC), negative to CD45, CD34, CD14 and CD79. Flow cytometry was conducted based upon protocols previously reported(24-28).

Administration of ABM-MSC’s Horses were sedated and prepared for administration of ABM-MSC’s as previously described (see venography section). ABM-MSCs were diluted in physiologic saline solution and administered (10-30 x 106) into the lateral (or medial) digital palmar vein under sterile conditions via a 21-gauge butterfly catheter, attached to a 20 mL syringe, in the standing horse. Tourniquet was removed 20 min after administration of cells. The digit was kept bandaged for one day. ABM-MSCs were injected three times at one-month intervals.

Results Clinical condition of horses treated with ABM-MSCs Horses with chronic laminitis had Obel-Glasgow’s scores that range between 2 to 14 before ABM-MSCs treatment onset (Figure 1A). In contrast, the healthy horse displayed neither lameness or pain, nor hooves temperature increments at any time along the period evaluated. As the study progressed, all ABM-MSCs treated horses improved their clinical condition after the second or third month of having received ABM-MSCs venous infusions. By the end of the six months’ period, all ABM-MSCs treated horses decreased their Obel-Glasgow scores and significantly improved their mobility and clinical condition. Overall, the horses with the worst initial condition, improved the most (Figure 1A). All horses had an improvement in mobility, quality and shape of the hoof, they also improved their behavior and the factions of their faces (Grimace scale), having a good quality of life. This improvement was attributable to ABM-MSCs infusion, since the sham horse treated only with vehicle did not improve through the course of the experimental time (Figure 1A). In contrast, hooves’ temperature in laminitic horses ranged between 27 C and 35.5 C (average 33.26 C + 2.58) before ABM-MSCs treatment started. As a reference, the temperature in the healthy horse’s hooves ranged between 27 C and 30 C (average 28.56 C + 0.79). ABM-MSCs treatment had no major impact on hooves temperature (Figure 1B). In a handful of treated horses, hoof’s temperature tended to decrease slightly (1 to 3 C) after ABM-MSCs infusions (average 32.27 C + 1.78). In others, temperature shifts 729

Rev Mex Cienc Pecu 2021;12(3):721-741

were highly variable throughout the experimental timeline. In all cases, nonetheless, ABM-MSCs treated horses and the sham horse (average 33.01 C + 1.29) never reached steady healthy values of hooves’ temperature. Figure 1: Clinical evolution of horses after being treated with allogenic bone marrow, mesenchymal stem cells (ABM-MSCs)

(A) ABM-MSCs treated horses, monitored by the Obel-Glasgow scale and infrared thermography, (B) Hooves temperature.

Hooves vascular pattern and histology of the laminar corium after ABM-MSCs treatment The horse’s hooves are irrigated by a highly anastomosed vascular bed formed by the coronary plexus and papillae, the sublamellar venous plexus, the terminal papillae, the circumflex vessels and the sole and heel’s venous plexuses (Figure 2A). In laminitic horses, the chronic dislocation stands of the distal phalanx significantly disrupted this neat vascular pattern. As seen in Figure 2B, hooves virtually become avascular; the entire vascular bed showed severe contrast media filling defects except for stem vessels in coronary and heel’s plexus where vessels looked irregular and somewhat engorged. In general, the severity of vascular damage correlated with the severity of the symptoms (not shown). In contrast to the venographic findings described for the vascular landscape in laminitic hooves, images from the hooves obtained by the end of the 6th month of having begun ABM-MSC treatment revealed, in all horses regardless of the initial clinical condition and degree of vascular damage, hints of vascular recovery. Commonly, stem vessels of the coronary and heel plexus became widened and images of vascular sprouts were frequently observed as were vessels traversing somewhat “aberrant” trajectories (Figure 2C). In other words, a process of angiogenesis is clearly on its way. None of the horses treated, however, showed a full recovery of the vascular pattern, even though their clinical improvement was evident. Lastly, the sham horse showed no clinical improvement, nor venographic patterns of vascular recovery (not shown).

730

Rev Mex Cienc Pecu 2021;12(3):721-741

Histological features

ABM-MSC-infused, but not the sham, horses improved their clinical condition and their hooves’ vascular patterns by the end of the 6th mo of treatment. To evaluate whether this recovery might be associated to hooves’ tissue restoration, it was biopsied and histologically evaluated the laminar corium of a healthy, sham/laminitic and laminitic horses; the second and the third groups were sampled before and by the end of the treatment, 6 mo later from the first biopsy taken. Representative results are exhibited in Figure 2. In the healthy horse’s hoof (Figure 2D), it was observed primary epidermal and dermal lamellae interdigitating regularly. Secondary epidermal and dermal lamellae, on the other hand, ran in opposite directions, but parallel next to each other. Secondary lamellae displayed rounded ends thanks to the basal cell’s covering that progressed continuously up to the tip. The epidermal basal cells’ nuclei were juxtaposed opposite to the basal membrane (not shown). Finally, the basal membrane formed a thin and continuous layer underneath the epithelia lining (Figure 2G) and the collagen regularly organized in parallel bundles across the dermis (Figure 2J). In sharp contrast, the hooves histology in horses with chronic laminitis showed a virtual loss of the laminar architecture (Figure 2E), basal cell hyperplasia with numerous picnotic cell profiles, (Figure 2H), abundant connective tissue, as well as perivascular mononuclear cell infiltration (not shown). No basal membrane (Figure 2H) or collagen (Figure 2K) was observed. Finally, ABM-MSC-infused, but not the sham, horses’ hooves regained the laminar arrangement, the integrity of the epithelial monolayer upon a regular, continuous basal membrane and the organization and presence of collagen (Figure 2F, I and L). No evidence of significant perivascular mononuclear infiltration was detected. Lastly, it was conducted electron microscopic observations to further evaluate the epithelial integrity in hooves of ABM-MSC-infused horses. In the healthy horse (Figure 2M), basal cells join one another by numerous desmosomes. Their eu-chromatic nuclei displayed irregular shapes characterized by indentations. They also presented a conspicuous cytoplasmic arrangement of tonofilaments. The electron dense basal lamina they were attached on was thin, regular and continuous. Laminitic hooves (Figure 2N), on the other hand, showed scarce desmosomes, abundant electro-lucid intercellular spaces. Basal cells tended to show nuclei with chromatin clumps. Cytoplasmic tonofilament aggregates were also frequent, and no evidence of basal membrane was observed. Hooves in ABM-MSC-infused horses (Figure 2O) showed a marked reduction of electro-lucid intercellular spaces. Desmosomes become a regular finding and cell nuclei return to their regular shape and chromatin arrangement.

731

Rev Mex Cienc Pecu 2021;12(3):721-741

Figure 2: Vascular pattern and histology of the laminar corium after ABM-MSCs treatment

A-C. Representative hoof venographies of a healthy (A), laminitic (B) and ABM-MSCs infused horses (C). Notice the vascular response in hooves of ABM-MSCs-infused horses. CP, Coronary Plexus; SP: Sublamellar Plexus; DPA: Distal Phalanx Apex; TP: Terminal Plexus; CV: Circumflex Vessels; A: Terminal Arch of the palmar digital vessels; B: Heel plexus; SVP: Soleal Venous Plexus. D-L. Representative photomicrographs of sagittal sections of the laminar corium of a healthy (D, G, J), laminitic (E, H, K) and ABM-MSCs infused horses (F, I, L) stained with Cresyl Violet (cell nuclei; D-F), PAS (Basal membrane; G-I) or Masson’s (Collagen; J-L) histochemical techniques. Notice the restoration

732

Rev Mex Cienc Pecu 2021;12(3):721-741

of the laminar corium in ABM-MSCs infused horses. PEL: Primary Epidermal Lamellae; PDL: Primary Dermal Lamellae; SEL: Secondary Epidermal Lamellae; SDL: Secondary Dermal Lamellae; BM: Basal Membrane. M-O. Representative electron micrographs showing ultrastructural features of basal cells in healthy (M), laminitic (N) and ABM-MSCs infused horses (O). Notice the recovery of the chromatin and tonofilaments arrangement, as well as of desmosomes in ABM-MSCs infused horses. Nu: Nucleus; Tf: Tonofilaments; Ds and arrowheads: Desmosomes; : oedema; Arrows in insets pinpoint the basal membrane. Refer to the text for a detailed description of Figure 2.

Discussion Chronic laminitis is an inflammatory disease that affects the horse’s hooves. Angelone et al(3) proposed that the loss of mesenchymal stem cells is the fundamental event that underlies the physiopathology of chronic laminitis. Although their results support their claim, they could not irrefutably ascribe their clinical and venographic findings to the infused adipose tissue-derived mesenchymal stem cells because the cells were co-infused with platelet-rich plasma. In addition, they confound the interpretation of their results because they infused first allogeneic and then autologous adipose tissue-derived mesenchymal stem cells in the laminitic horses. Lastly, they did not provide direct proof of laminar corium regeneration in the recovered horses. In this work overcome all these technical issues by infusing only ABM-MSCs, suspended in culture media, into both front hooves of horses chronically affected by laminitis. According to Angelone’s prediction, infusion of ABM-MSCs into the lateral digital vein of laminitic hooves significantly improved the clinical conditions of all horses treated, while restoring considerably the cytoarchitectural features of the hooves’ laminar corium. This was accompanied by a reduction of the inflammatory perivascular infiltration of mononuclear cells, as also predicted by Angelone et al(3) based upon their molecular biological results; they found increased mRNA expression of anti-inflammatory cytokines and anti-oxidative proteins. The specificity of these findings is supported by the fact that the sham horse, infused only with culture media, remained symptomatic and his hooves displayed the characteristic histological deterioration of the laminar corium by the end of the experimental time. Even though these results circumstantially support that ABM-MSCs promotes hooves tissue regeneration by, in part, reducing local inflammation, in this case, this notion still awaits direct confirmation by estimating pro-inflammatory cytokines in the laminar corium of ABM-MSCs-treated and untreated laminitic horses. As far as it is known, up to date, there is no reliable way to conduct such estimations(29,30). In any event, as commented already, these results back up those reported by Angelone et al(3), who suggested that mesenchymal stem cells would promote laminar corium regeneration by exerting not only anti-inflammatory actions, but also by inhibiting MMPs-mediated extracellular matrix degradation, buffering ROS damage and recruiting local and circulating stem and endothelial cells. Certainly, the venographic evidence obtained in this research from treated horses also supports Angelone´s call.

733

Rev Mex Cienc Pecu 2021;12(3):721-741

A clinically relevant finding was that, even though ABM-MSCs-infused horses improved their clinical condition and restored to a great extent hooves’ cytoarchitecture, hooves’ temperature remained elevated in treated horses. At first glance, one might think that these findings rule out temperature monitoring as a sensitive procedure to follow up treatment progress. However, the fact that vascular restoration is partial in all treated horses by the end the experimental period suggests otherwise. On one hand, this finding might indicate that there remains some degree of inflammation that promotes temperature to stay high through the relatively avascular tissue in the still regenerating hooves. However, higher than normal hooves temperature is likely unrelated to an enduring inflammation since lameness and pain were found reduced significantly in ABM-MSCs-infused horses. Alternatively, the lack of full recovery of the vascular bed may jeopardize heat dissipation from the hooves. Although, as far as is known, such a function has not been attributed to the horse’s hooves vascular network, it is well known that vascular beds may work as cooling devices in other parts of the mammalian body [for the Radiator Theory see Falk, 1990(31)]. In any event, long-time monitoring of hooves vascular bed and temperature in treated horses may help in evaluating this possibility. Angiogenesis is a process by which blood vessels are newly formed budding off from extant precursor vessels(32-34). In agreement with Angelone’s results, it was obtained venographic evidence of ongoing angiogenesis from the coronary and heel’s plexuses of ABM-MSCs-treated, laminitic horses. These data may be interpreted in three nonmutually excluding ways. First, they may show that damaged hooves’ blood vessels retain their ability to produce endothelial cells, themselves capable to recreate functional vessels; so, ABM-MSCs infusion may unleash local vascular stem cells. Second, infused ABM-MSCs commit to the endothelial cell lineage thus propelling angiogenesis in hooves of the treated horses once seeded. Third, the infused ABM-MSCs may favor the recruitment of autologous, circulating stem cells that commit themselves to the endothelial lineage. Although current evidence supports that MSCs promote angiogenesis(34), the other alternatives remain open to investigation. So, future cell lineage labeling studies would surely help in disentangle this conundrum. In either case, what seems to be clear is, under the experimental conditions used, that the coronary and heel’s plexuses contain niches that facilitate angiogenesis to proceed given adequate conditions. This process seems to recapitulate the embryonic sequence since vasculogenesis in the embryonic hoof proceeds following a proximal to distal gradient(35). Another interesting finding in this work is that tissue restoration, up to the point the last biopsy was taken from ABM-MSCs-infused horses, was remarkable, having no evidence of vicious healing, nor scars of any sort, at least in the sampled site of all horses evaluated. Such an observation suggests that horse hooves may retain a biochemical ambient similar to that seen at ontogenetic stages. This possibility gains support from observation in the brain where the adult hypothalamus exhibits tremendous potential of plasticity due to the presence of poly-syalilated glycan molecules that greatly easy tissue remodeling(36,37). Studies aimed at comparing the molecular composition of the hooves connective tissue at different ages may provide evidence to evaluate the merit of this presumption. 734

Rev Mex Cienc Pecu 2021;12(3):721-741

In a previous study(3) it was found that a mixture of aMSCs combined with PRP improves the clinical condition of horses afflicted by chronic laminitis. As they recognized, they could not determine whether the clinical improvement observed in the treated horses was due to aMSCs or PRP or responded to a synergistic effect of both, since they did not test the administration of either one alone. In this work, although stem cells are not of the same class, clearly the clinical improvement and tissue restoration can be better ascribed to the infused ABM-MSCs, since the infusion of the vehicle (i.e., culture media) had no noticeable effect on either of the parameters evaluated in the sham horse (future studies must increase the number of sham horses to strengthen these observations). What this study did not unveiled, however, is how ABM-MSCs promote tissue regeneration since vascular reconstitution was only partial [see Angelone(3), King(32), Gu(38), for theoretical considerations]. In this regard, ABM-MSCs might have migrated from the reconstituting vascular bed and colonize relatively avascular territories. Also, ABM-MSCs may produce and release soluble factors or exosomes(33,39-41), that could invigorate local stem cells to proliferate, differentiate and restitute the damaged tissue. Lastly, ABM-MSCs may promote recruiting of autologous circulating stem cells and their invasion of hooves avascular regions. Linage studies combined with additional biopsies taken in places of the hooves distant to the site of administration would help to evaluate these possibilities. They might also help in ruling out possible bias during biopsy taken since biopsies might have been obtained inadvertently from places where the vasculogenesis front was actively ongoing. A final consideration with regard of the use of allogenic stem cells must be made. One might think that the possibility of inducing immunological reactions would increase by using allogeneic cells(42). These results and the ones published by others(3,43,44), support that allogeneic stem cell infusion is sufficiently safe since treated horses had no evidence of rejection up to the time point they were evaluated. In contrast, even though many consider the use of autologous stem cells to be safer, recent studies show that they may develop de novo mutations in mitochondrial DNA that produce immunogenic neoepitopes(45), thus increasing the possibility of immunological rejection(46-49). In addition, it has been shown that adipose-derived stem/stromal cells that recapitulate the expression of aging biomarkers show reduced stem cell plasticity(50), thus precluding their potential use as an autologous source of therapeutic cells; this might also be the case for allogeneic cells.

Conclusions and implications In conclusion, ABM-MSCs infusions improved the clinical conditions and promote hooves histological restoration in laminitic horses. The procedure was innocuous, sex independent and effective at least for up to a period of 6 mo. Future studies must increase the sample size and the follow up time to really appreciate the long-term benefits of the

735

Rev Mex Cienc Pecu 2021;12(3):721-741

treatment and whether additional infusions of ABM-MSCs are needed. A less invasive method for administration must also be evaluated, although previous studies showed that administration through this via does not affect stem cells therapeutic efficiency and efficacy if dosage is correctly calculated. The effects of shoeing and trimming of the foot must also be evaluated. Finally, the use of ABM-MSCs to pain management is other topic that deserved investigation based on current results. In any event, the data support that the loss of mesenchymal stem cells is indeed the critical event leading to chronic laminitis. Hence, measures aimed at inducing immune tolerance against hooves’ mesenchymal tissue may help in preventing such a loss. In this regard, the infusion of mesenchymal antigens obtained from laminitic hooves into the eye’s anterior chamber may be a path to investigate in the coming years(51).

Funding

Alma Angélica García Lascuráin was a doctoral student from Programa de Doctorado en Ciencias de la Producción y de la Salud Animal, Facultad de Medicina Veterinaria y Zootecnia UNAM and received fellowship No.133213 from Consejo Nacional de Ciencia y Tecnología (CONACyT), México. Authors thanks National Autonomous University of Mexico (UNAM), project PAPIIT IN225316 and Dirección General de Asuntos del Personal Académico (DGAPA), for the financial support of this investigation.

Acknowledgments

Authors thank to MVZ Roberto Oropeza, MVZ, MSc Abraham Pineda Aranda, MVZ Roberto Juárez Cervantes and MVZ Jennifer A. Michel Mancilla for medical and zootechnical support. We are also indebted with MVZ Jorge Rodríguez Lezama for his technical support when conducting the venographic studies. Stem cell culturing and flow cytometry were instrumented by IBT Antonia Lizbeth Mireles Ruiz and MC Moisés López Dávila to whom we are grateful. Lastly, we are also thankful to MVZ MSc José Ramírez Lezama, Biol. Maribel Nieto Miranda and MVZ MC Araceli Lima Melo for the conceptual and technical input provided to obtain and analyze the histological samples. Laura Padierna Mota, Karyna Pérez Saldaña, Jaime Rodríguez Manuel from UNe Aplicaciones Biológicas, Laboratorios de Especialidades Inmunológicas.

Conflict of interes

Authors acknowledge that there are no competing financial interests or interest of any other source, to disclose. 736

Rev Mex Cienc Pecu 2021;12(3):721-741

Literature cited: 1.

Lecchi C, Dalla CE, Lebelt D, Ferrante V, Canali E, Ceciliani F, et al. Circulating miR-23b-3p, miR-145-5p and miR-200b-3p are potential biomarkers to monitor acute pain associated with laminitis in horses. Animal 2018;12(2):366-375.

Pollit CC. Lamellar function at the cellular level. In: Belknap JK, Geor R, editors. Equine laminitis. Willey, Blackwell, Iowa, USA; 2017:22-38.

Angelone M, Conti V, Biacca C, Battaglia B, Pecorari L, Piana F, et al. The contribution of adipose tissue-derived mesenchymal stem cells and platelet-rich plasma to the treatment of chronic equine laminitis: A proof of concept. Int J Molecular Sci 2017;18(2122).

Driessen B, Bauquier SH, Zarucco L. Neuropathic pain management in chronic laminitis. Vet Clin North Am Equine Pract 2010;(26):315-337.

Faleiros RR, Belknap JK. Leukocytes and inflammatory signaling in laminitis: Leukocytes. In: Belknap JK, Geor R, editors. Equine laminitis. Iowa, USA: Willey, Blackwell; 2017:91-101.

Carter R, Engiles J, Megee S, Senoo M, Galantino-Homer H. Decreased expression of p63, a regulator of epidermal stem cells, in the chronic laminitic equine hoof. Equine Vet J 2011;43(5):543-551.

Salem H, Thiemermann C. Mesenchymal stromal cells: Current understanding and clinical status. Stem Cells 2010;28(3):585-596.

Keating A. Mesenchymal stromal cells: New directions. Stem Cell. Elsevier Inc. 2012;10(6):709-716.

Ma S, Xie N, Li W, Yuan B, Shi Y, Wang Y. Immunobiology of mesenchymal stem cells. Cell Death Differentiation 2014;21(2):216-225.

10. Yu H, Fischer G, Ebert AD, Wu H, Bai X, Hogan QH. Analgesia for neuropathic pain by dorsal root ganglion transplantation of genetically engineered mesenchymal stem cell: initial results. Molecular Pain 2015;11(5). 11. Ghannam S, Bouffi C, Djouad F, Jorgensen C, Noel D. Immunosuppression by mesenchymal stem cells: mechanisms and clinical applications. Stem Cell Res Ther 2010;1(1):2. 12. Cassano J, Schnabel L, Betancourt A, Antczak D, Fortier L. Mesenchymal stem Cell therapy: Clinical progress and opportunities for advancement. Current Pathol Reports 2015;3(1):1-7. 13. Renzi S, Ricco S, Dotti S, Sesso L, Grolli S, Cornali M, et al. Autologous bone marrow mesenchymal stromal cells for regeneration of injured equine ligaments and tendons: A clinical report. Res Vet Sci 2013;(95):272-277. 737

Rev Mex Cienc Pecu 2021;12(3):721-741

14. Carrade DD, Borjesson DL. Immunomodulation by mesenchymal stem cells in veterinary species. Comp Med 2013;(63):207-217. 15. Kol A, Wood JA, Carrade HDD, Gillette JA, Bohannon-Worsley LK, Puchalski SM, et al. Multiple intravenous injections of allogeneic equine mesenchymal stem cells do not induce a systemic inflammatory response but do alter lymphocyte subsets in healthy horses. Stem Cells Res Ther 2015;6:73. 16. Pezzanite LM, Fortier LA, Antczak DF, Cassano JM, Bronahan MM, Miller D, et al. Equine allogeneic bone marrow-derived mesenchymal stromal cells elicit antibody responses in vivo. Stem Cell Res Ther 2015;6(54). 17. Ardanaz N, Vázquez FJ, Romero A, Remacha AR, Barrachina L, Sanz A, et al. Inflammatory response to the administration of mesenchymal stem cells in an equine experimental model: Effect of autologous, and single and repeat doses of pooled allogeneic cells in healthy joints. BMC Vet Res 2016;12(65). 18. Owens SD, Kol A, Walker NJ, Borjesson DL. Allogeneic mesenchymal stem cells treatment induces specific alloantibodies in horses. Stem Cells Internat 2016; doi: 10.1155/2016/5830103. 19. Brandao JS, Alvarenga ML, Pfeifer JPH, dos Santos VH, Fonseca-Alves CE, Rodrigues M, et al. Allogeneic mesenchymal stem cells transplantation in healthy equine superficial digital flexor tendon: A study of the local inflammatory response. Res Vet Sci 2018;118:423-430. 20. Douthit TL, Bormann JM, Bello NM. Assessing the association between hoof thermography and hoof Doppler ultrasonography for the diagnosis of lameness in horses. J Equine Vet Sci 2014;34(2):275-280. 21. Rucker A, Redden RF, Arthur EG, Reed SK, Hill BW, Dziuban EM, et al. How to perform the digital Venogram. In: AAEP Proc (USA). 2006;52:526-530. 22. Gravena K, Sampaio R, Dias D, Canola P, Peiró J, de Lacerda-Neto J. Evaluation of the integrity of horse hoof dermal and epidermal tissues collected by dorsal transmural access. J Equine Vet Sci 2012;32(12):858-862. 23. Barberini DJ, Paiva-Freitas NP, Sartori-Magnoni M, Maia L, Listoni AJ, Heckler MC, et al. Equine mesenchymal stem cells from bone marrow, adipose tissue and umbilical cord: immunophenotypic characterization and differentiation potential. Stem Cell Res Ther 2014;5(25). 24. De Schauwer C, Meyer E, Van de Walle GR, Van Soom A. Markers of stemness in equine mesenchymal stem cells: A plea for uniformity. Theriogenology 2011;75:1431-1443.

738

Rev Mex Cienc Pecu 2021;12(3):721-741

25. De Schauwer C, Piepers S, Van de Walle GR, Demeyere K, Hoogewijs MK, Govaere JL, et al. In search for cross-reactivity to immunophenotype equine mesenchymal stromal cells by multicolor flow cytometry. Cytometry Part A, 2012;81(4):312-323. 26. Carvalho AM, Yamada ALM, Golim MA, Álvarez LEC, Jorge LL, Conceiçao ML, et al. Characterization of mesenchymal stem cells derived from equine adipose tissue. Arq Bras Med Vet Zootec 2013;65(4):939-945. 27. Carvalho AM, Yamada ALM, Martins JRB, Maia L, Gloim MA, Deffune E, et al. Isolation and characterization of equine peripheral blood-derived multipotent mesenchymal stromal cells. Pesq Vet Bras 2013;33(9):1151-1154. 28. Michler JK, Hillmann A, Saykovic V, Mulling CKW. Horse hair follicles: A novel dermal stem cell source for equine regenerative medicine. Cytometry Part A, 2018;93(1):104-114. 29. Steelman SM, Chowdhary BP. Plasma proteomics shows an elevation of the antiinflammatory protein APOA-IV in chronic equine laminitis. Vet Res 2012;8(179). 30. Steelman SM, Johnson D, Wagner B, Stokes AM, Chowdhary BP. Cellular and humoral immunity in chronic equine laminitis. Vet Immunol Immunopathol 2013;153:217-226. 31. Falk D. Brain evolution in Homo: The “radiator” theory. Behavioral Brain Sci 1990;13:333-381. 32. King A, Balaji S, Keswani SP, Crombleholme TM. The role of stem cells in wound angiogenesis. Adv Wound Care 2014;10:614-625. 33. Schabbir A, Cox A, Rodríguez-Menocal L, Salgado M, Van Badiavas E. Mesenchymal stem cell exosomes induce proliferation and migration of normal and chronic wound fibroblasts, and enhance angiogenesis in vitro. Stem Cells Develop 2015;24(14):1635-1647. 34. Cortez-Toledo E, Rose M, Agu E, Dahlenburg H, Yao W, Nolta JA, et al. Enhancing retention of mesenchymal stem cells with prosurvival factors promotes angiogenesis in a mouse model of limb ischemia. Stem Cells Develop 2018;28:114-119. 2019 Jan 15;28(2):114-119. doi: 10.1089/scd.2018.0090. 35. Parks AH. Anatomy and function of the equine digit. In: Belknap JK, Geor R editors. Equine laminitis. USA: Willey, Blackwell, Iowa; 2017:22-38. 36. Theodosis DT, Poulain DA, Oliet SH. Activity-dependent structural and functional plasticity of astrocyte-neuron interactions. Physiology Rev 2008;88:983-1008. 37. Bonfanti L, Theodosis DT. Polysialic acid and activity-dependent synapse remodeling. Cell Adhesion Migration 2009;3(1):43-50.

739

Rev Mex Cienc Pecu 2021;12(3):721-741

38. Gu W, Hong X, Potter C, Qu A, Xu Q. Mesenchymal stem cells and vascular regeneration. Microcirculation 2017;24:e12324. 39. Ching RC, Wiberg M, Kingham PJ. Schwann cell-like differentiated adipose stem cells promote neurite outgrowth via secreted exosomes and RNA transfer. Stem Cell Res Ther 2018;9:266. 40. Zhang JC, Zceng GF, Wu L, Ou-Yang LY, Li WX. Bone marrow mesenchymal stem cells overexpressing human basic fibroblast growth factor increase vasculogenesis in ischemic rats. Brazilian J Medical Biol Res 2014;47(10):886-894. 41. Bier A, Berenstein P, Kronfeld N, Morgoulis D, Ziv-Av A, Goldstein H, et al. Placenta-derived mesenchymal stromal cells and their exosomes exert therapeutic effects in Duchenne muscular dystrophy. Biomaterials 2018;174:67-78. 42. Kim SC, Adams AB. Pluripotent stem cells that evade the immune radar. Nature Biotechnol 2017;35(8):722-723. 43. Augello A, Tasso R, Negrini SM, Cancedda R, Pennesi G. Cell therapy using allogeneic bone marrow mesenchymal stem cells prevents tissue damage in collageninduced arthritis. Arthritis Rheumatism 2007;56(4):1175-1186. 44. Kol A, Wood J, Carrade HD, Gillette J, Bohannon-Worsley L, Puchalski S, et al. Multiple intravenous injections of allogeneic equine mesenchymal stem cells do not induce a systemic inflammatory response but do alter lymphocyte subsets in healthy horses. Stem Cell Res Ther 2015;6(73). 45. Deuse T, Hu X, Agbor-Enoh S, Koch M, Spitzer MH, Gravina A, et al. De novo mutations in mitochondrial DNA of iPSCs produce immunogenic neoepitopes in mice and humans. Nature Biotechnology. Letters. 2019. 46. Nishikawa S, Goldstein RA, Nierras C. The promise of human induced pluripotent stem cells for research and therapy. Nature Review Molecular Cell Biol 2008;9:725729. 47. Bix M, Liao NS, Zijlstra M, Loring J, Jaenisch R, Raulet D. Rejection of class I MHC-deficient haemopoietic cells by irradiated MHC-matched mice. Nature 1991;349:329-331. 48. De Almeida PE, Ransohoff JD, Nahid A, Wu JC. Immunogenicity of pluripotent stem cells and their derivatives. Circ Res 2013;112:549-561. 49. Barrachina L, Remacha AR, Romero A, Vázquez FJ, Albareda J, Prades M, et al. Priming equine bone marrow-derived mesenchymal stem cells with proinflammatory cytokines: Implications in immunomodulation-immunogenicity balance, cell viability and differentiation potential. Stem Cells Dev 2017;26(1).

740

Rev Mex Cienc Pecu 2021;12(3):721-741

50. Jung JS, Volk C, Marga C, Navarrete Santos A, Jung M, Rujescu D, et al. Adiposederived stem/stromal cells recapitulate aging markers and show reduced stem cell plasticity affecting their adipogenic differentiation capacity. Cellular Reprograming 2019;21(4):187-199. 51. Martínez-Alcantar L, Talavera-Carrillo DK, Pineda-Salazar JU, Ávalos-Viveros M, Gutiérrez-Ospina G, Philips-Farfán BV, et al. Anterior chamber associated immune deviation to cytosolic neural antigens avoids self-reactivity after optic nerve injury and polarizes the retinal environment to an anti-inflammatory profile. J Neuroimmunology 2019;333(476964).

741

https://doi.org/10.22319/rmcp.v12i3.5462 Article

Nutritional composition of equine meat and degree of substitution of bovine for equine meat in stores in Mexico City

Guillermo Reséndiz González a Baldomero Alarcón Zúñiga a Itzel Villegas Velázquez b Samuel Albores Moreno c Gilberto Aranda Osorio a*

Universidad Autónoma Chapingo. Posgrado en Producción Animal, Km. 38.5 Carretera México-Texcoco, 56230, Chapingo, México. b

Colegio de Posgraduados. Campus Montecillo. Montecillo, México.

Universidad de Ciencias y Artes de Chiapas. Facultad de Ingeniería, Villa Corzo, Chiapas, México.

* Corresponding author: garanda@correo.chapingo.mx, gilberto.aranda@gmail.com

Abstract: The degree of substitution of bovine meat for equine meat in different points of sale of the different boroughs of Mexico City was evaluated, and the benefits or similarities with bovine meat as a strong alternative of nutrients were identified. One hundred sixty-one samples of bovine meat were collected, which were subjected to near-infrared reflectance spectroscopy (NIR’s – Food Scan) to determine nutritional composition (moisture content, protein, fat and collagen), meat color (Hunter Lab L*, a* and b*) and polymorphism of repeated sequences to characterize the bovine or equine origin by polymerase chain reaction in agarose gels (PCR). The variables of nutritional composition and meat color were analyzed in a completely randomized design. It was found that nine of the samples were positive for equine meat and 152 samples were positive for bovine meat; resulting in that 742

Rev Mex Cienc Pecu 2021;12(3):742-755

5.59 % of bovine meat was replaced by equine meat in the commercialization centers in Mexico City. Likewise, the moisture, protein, fat and collagen content fluctuated between the samples from 73.1 to 75.1 %, from 22.0 to 23.5 %, from 2.0 to 2.3 %, and from 1.3 to 1.4 mg g-1, respectively; observing a slight increase (P<0.05) in the concentration of moisture and protein in bovine meat compared to equine meat. The L* (luminosity) of meat between animal species was different (P<0.05); while in the indicators of meat color a* (from red to green) and b* (from yellow to blue), it fluctuated from 29.80 to 37.50 and 15.00 to 16.20 (P>0.05). It is concluded that the percentage of substitution of bovine meat for equine meat (5.59 %) is considered low and constitutes consumer fraud. However, equine meat has the potential to be a viable alternative for human consumption, as the nutritional composition was similar to bovine meat. Key words: Meat, Bovine, Equine, PCR, Substitution.

Received: 25/07/2019 Accepted: 23/09/2020

Introduction In recent years, molecular techniques for the identification of the species origin of meat and its by-products have been developed(1,2). Especially, the use of techniques of polymorphism of repeated sequence and polymerase chain reaction (PCR), which have been effective in differentiating between wild Asian ass (Equus hemionus) meat and domestic horse (Equus domesticus) meat from markets in the city of Ulaanbatar, Mongolia (3). Also, the PCR technique has been used to determine the origin of different animal species in concentrates, flours or meat by-products destined to food or animal food(4,5,6). Therefore, it is important to note that meat is considered one of the main sources of nutrients to meet nutritional requirements in human food; due to its high content of protein of high biological value, its contribution of minerals, vitamins (7), essential fatty acids and fat-soluble vitamins(8). In this sense, meat for human consumption comes mostly from bovine, porcine and avian species, and to a lesser extent meat from sheep, goats, fish and some wild species(9). However, socioeconomic, environmental and nutritional trends have generated in the last decade a growing interest in alternatives to replace bovine meat (10). Regarding the above, an alternative that has been used to replace bovine meat is equine meat, which supplies 0.25 % of world meat production(11).

743

Rev Mex Cienc Pecu 2021;12(3):742-755

Mexico is one of the main producers of equine meat and during 2013 contributed 11.2 % (83,500 t) of world production (745,966 t), exporting 17.3 % of national production(12). While 82.7 % of equine meat production remains in the country and is mainly used to supply the pet and zoo animal food industry. However, the level of acceptance and consumption of equine meat for humans is not favorable because its commercialization is not known to the consumer(13). This allows a fraudulent commercialization route that could promote the substitution of bovine for equine meat and a price premiun, since the economic cost of selling equine meat is well below bovine meat in butcher shops, and stores of this item in the large cities of the country(14). On the other hand, equine meat has nutritional values equivalent to other conventional meats(15). However, it can present clear risks to human health, as they are not reared for food production, they are treated or injected with various chemicals, dangerous for humans, many of which are prohibited for use in farmed animals (16). For this reason, it is important that the consumer is informed about the origin of the meat, nutritional quality and the market price. It is therefore important to evaluate the degree of substitution of bovine for equine meat in different points of sale of the different boroughs of Mexico City and to identify the benefits or similarities with the bovine meat as a strong alternative of nutrients.

Material y methods Sampling sites

Meat samples were collected in 69 commercialization centers, including the main distribution centers such as La Merced, Calle 7, Rastro Viejo, Central de Abastos and Ferrería, located in the different boroughs of Mexico City.

Sampling design

One hundred sixty-one (161) samples of bovine meat were collected; 23 samples were from butcher shops in large distribution centers and 138 of borough markets, sampling a total of 69 butcher shops that correspond to 22.5 % of total butcher shops in Mexico City (307). The sampled bovine meat commercialization points were identified on the portal of the Institute for Access to Public Information and Protection of Personal Data (IPPDP, for its

744

Rev Mex Cienc Pecu 2021;12(3):742-755

acronym in Spanish) of Mexico City. Considering the following assumptions: (a) the economic level (high, medium and low) of the region and (b) that the sampling be carried out randomly, distributed homogeneously in all the borough regions (North, South, East and West). The number of samples were determined with the central limit theorem (CLT) with a standard deviation of 8.9 % according to preliminary tests (17), being random the selection of the market. Likewise, that of the establishments, two markets were selected for each borough (Table 1), being representative of the total number of points of sale under the CLT at a standard deviation of 7.3% in the sampling variables. Table 1: Number of markets, sampled markets and number of samples per borough of Mexico City Butcher shop Borough Samples collected Total Sampled Álvaro Obregón 15 3 6 Azcapotzalco 20 5 10 Benito Juárez 16 4 8 Coyoacán 17 4 8 Cuajimalpa 5 1 2 Cuauhtémoc 34 8 16 Gustavo A. Madero 49 11 22 Iztacalco 17 4 8 Iztapalapa 20 5 10 La Magdalena 5 1 2 Miguel Hidalgo 19 4 8 Milpa Alta 9 1 2 Tláhuac 19 4 8 Tlalpan 18 4 8 Venustiano Carranza 33 8 16 Xochimilco 11 2 4 Centros de comercialización 23

Sample size

The sample of raw meat was 250 g obtained from the cut called sirloin steak (Biceps femoris) and simulating the usual conditions of the consumers. To reduce the risk of contamination during the sampling period, these were kept in identified and sealed plastic bags, which were kept inside an isothermal container at a temperature of 4 °C. Once the samples of a day of sampling were collected, they were taken to the Laboratory of the Postgraduate Degree in 745

Rev Mex Cienc Pecu 2021;12(3):742-755

Animal Production for separation into subsamples and storage in freezing at -20 °C until their several analysis.

Nutritional composition of meat

The moisture, protein, fat, and collagen contents of the meat were determined by nearinfrared reflectance spectroscopy (NIR’s) in the Foodscan Meat Analyzer (FOSS®, Denmark). One hundred eighty grams of sample was weighed and a grinding was carried out with a Picalica food processor (Moulinex®, France) for 30 sec (two series of 15 sec) according to the methodology proposed by the AOAC (18).

Determination of meat color

The color of the meat sample was determined in the Miniscan (Hunterlab®, USA), performing five readings per sample in an upper, lower, right, left and center quadrant according to the methodology proposed by the International Commission of L'Eclairage (1976)(19).

DNA extraction from meat tissue

For the identification of the species of bovine or equine meat, the extraction of deoxyribonucleic acid (DNA) from the initial sample of 250 g was carried out, 500 mg of meat were taken, placed in microtubes and frozen at -80 °C for 48 h in deep-freezing (ThermoSientific®, model 2186). Subsequently, the samples were lyophilized (Labconco®, model Freezone 4.5) for 5 d and the dried tissue was ground with the help of a TissueLyser II® cell disruptor (Qiagen, Germany). Once the sample was ground, the extraction procedure of DNA was performed, placing in each microtube 1 ml of lysis solution [Tris base (C4H11NO3) 50mM pH8, EDTA (C10H16N2O8) 0.1M, SDS (NaC12H25SO4) 0.5%, 7 μl of proteinase K] and they were incubated at 50 °C for 2 continuous hours. Afterwards, 500 μl of Phenol:Chloroform:Isoamyl (C6H5OH: CHCl3:C5H12O) (12:24:1) was added and it was centrifuged at 10,000 rpm for 10 min (Centrifugue eppendorf 5810 R). The supernatant was transferred to another microtube, adding 1 ml of 70 % ethanol (C2H5OH) at a temperature of -20 °C, mixing by inversion until DNA precipitated. Finally, it was

746

Rev Mex Cienc Pecu 2021;12(3):742-755

centrifuged at 10,000 rpm for 10 min, a pellet formed and it was dried in a vacuum centrifuge (Vacufuge plus). To resuspend the DNA pellet, 50 μl of molecular grade H 2O was used.

PCR test for determination of the species of the meat

Prior to DNA amplification by PCR, it was verified that the extracted DNA was sufficiently pure and free of protein contamination. To measure the concentration of DNA, a Nanodroop® spectrophotometer (Thermo Scientific, model ND-100) was used under the following indicators: DNA has a maximum absorbance at 260 nm (50 μg/mL have an OD at 260=1), while proteins have it at 280 nm. DNA purity was calculated, considering absorption between A260/A280 (1.9 and 1.7). Table 2 shows the sequences selected from the literature of oligonucleotides used for the amplification of specific DNA fragments by animal species(14); these consisted of a forward universal primer and the equine and bovine species-specific reverse oligonucleotides. Amplification of the specific fragments was performed by conventional PCR. DNA amplification by PCR was carried out considering a final volume of 50 μL [5μL of 10 x PCR buffer, 1 μL of 2 0μM of dNTPs, 2 μL of universal oligonucleotide [10 pmol/μL], 2 μL of equine oligonucleotide [10 pmol/μL], 2 μL of bovine oligonucleotide [10 pmol/μl], 0.25 μL of Taq polymerase (Roche®), 250 ng of DNA and 32. 75 μL of nuclease-free PCRgrade water]. For the amplification of the selected sequences, a Maxygen (Axygene®) thermocycling program was used, which consisted of: an initial denaturation phase, in which the reaction mixture was maintained at 94 °C for 30 sec so that the two template DNA strands separated. The reaction mixtures were then subjected to 35 cycles of three stages each [alignment (60 °C for 30 sec), extension (72 °C for 30 sec) and refrigeration (4 °C)]. Table 2: Sequence of pairs of oligonucleotides for the determination of fresh meat cuts for bovine and equine from different borough markets of Mexico City Species Primer Sequence Size Universal Forward GAC CTC CCA GCT CCA TCA AAC ATC TCA TCT TGA GAA TGA AA Bovine Reverse CTA AAG TGT AAG ACC CGT AAT ATA AG

274 bp

Equine

439 bp

Reverse CTC AGA TTC ACT CGA CGA GGG TAG TA NA=Not reported.

747

Rev Mex Cienc Pecu 2021;12(3):742-755

Electrophoresis gel Once the reactions were finished, 5 μL amplified fragments (amplicons) of the PCR products of the samples were taken to be analyzed by conventional electrophoresis. Five microliters of the amplicon was mixed with 3 μL of 5x loading buffer, placing 8 μL in each well of agarose gel [Seakem (Lonza®) 3 % (P/V) in 1,500 ml TAE 1x, with 25 μL of Ethidium Bromide (Invitrogen®)]. It was run at 100 Volts for 45 min to later perform the reading of amplicons in a UV light photodocumenter. The similarity of the selected sequences was analyzed by applying the BLAST® software (http://www.ncbi.nlm.nih.gov/BLAST).

Statistical analysis

The variables of nutritional quality of bovine and equine meat (moisture, protein, fat, collagen and color) were analyzed by a completely randomized design(20), the treatments were the meat type factor, equine meat had 9 repetitions and bovine meat 152 repetitions. A general linear model was used with the SAS statistical package(21). The means of the treatments were analyzed using Tukey’s multiple comparison test, and results were considered significant when P<0.05(20). The following mathematical model was used: Yij= μ + Ti + Eij Where: Yij were the nutritional characteristics; μ corresponds to the value of the mean of the respective variables; Tj represents the effect of the species; Eij represents the experimental error. Also, a Chi-square (X2) test was carried out in order to compare the results of the meat DNA amplicons with those expected, so the hypothesis was that all the meat samples acquired from butcher shops will be of bovine species.

748

Rev Mex Cienc Pecu 2021;12(3):742-755

Results Species identification

The amplicons, product of conventional PCR tests, had fragments of 439 and 274 base pairs (pb) that correspond to the molecular weight of the DNA of bovine and equine meat, respectively (Figure 1). Resulting in a total of 152 positive samples for bovine meat and 9 of the samples were positive for equine meat (Figure 2). Figure 1: Electrophoresis gel of the PCR test of the samples of bovine and equine meat from stores in Mexico City

M50pb= Standard of 50pb; +B1-3 Bovine positive control (274pb); +E1-3 Equine positive control (439pb).

Figure 2: Electrophoresis gel of the PCR test of the samples of bovine and equine meat from stores in Mexico City

- Negative control, +B Bovine positive control, +E Equine positive control, and sample number.

749

Rev Mex Cienc Pecu 2021;12(3):742-755

Nutritional composition

A slight increase (P<0.05) was observed in the concentration of moisture and protein in bovine meat compared to equine meat (Table 3). While the fat and collagen content showed no differences (P>0.05) between species and fluctuated from 22.0 to 23.5 %, from 2.0 to 2.3 %, from 73.1 to 75.1 % and from 1.3 to 1.4 mg g-1. On the other hand, the color of bovine meat was higher (P<0.05) compared to equine meat in terms of luminosity (L) (Table 4); while no differences (P>0.05) were observed in meat colors of a* (red to green) and b* (yellow to blue) and they fluctuated from 29.80 to 37.50 and 15.00 to 16.20, respectively. Table 3: Nutritional chemical composition of equine and bovine meat samples from stores in Mexico City Species

Protein a

Fat a

Moisture a

Collagen b

Bovine

23.51 ± 0.11

2.3 ± 0.05

75.13 ± 0.19

1.46 ± 0.02

Equine

22.00 ± 0.50

2.0 ± 0.44

73.16 ± 0.69

1.38 ± 0.09

Pr>F

0.001

0.25

0.01 b

0.32 -1

Values expressed as a percentage; values expressed in mg g .

Table 4: Color indicators (L, a and b) of samples of equine and bovine meat from stores in Mexico City Species L a b Bovine 37.50 ± 0.22 16.20 ± 0.01 14.90 ± 0.01 Equine 29.80 ± 0.88 15.00 ± 0.11 13.40 ± 0.11 Pr>F 0.0001 0.27 0.26 L=luminosity; a= red/green color; b=yellow/blue color.

Discussion Identification of equine meat in different points of sale in Mexico City

The PCR technique and the sequence of oligonucleotide pairs reported by Matsunaga(4) were useful for the identification in cuts of fresh meat for bovine and equine in the present study(22), and to detect that 5.59 % of the meat sampled in stores in Mexico City belonged to the equine species. The substitution of bovine for equine meat represents a consumer fraud, since the price of one meat and another, at national level, differs by almost 100 %, which is neither

750

Rev Mex Cienc Pecu 2021;12(3):742-755

ethically nor commercially acceptable(23). Although equine meat is a viable alternative for human consumption, similar to other types of meat obtained from traditional species such as bovine, porcine and poultry(10), the acceptance in Mexico is limited due to cultural reasons(9), since in other countries such as Italy, Belgium, Russia and Germany, it is perfectly accepted. On the other hand, the sale of equine meat in the domestic market represents a potential risk to health, since this activity is not regulated by government agencies, and there may be the presence of drugs used in production that can leave hazardous residues in meat, as evidenced by Rubio’s study(23), where it was found that 9.93 % of meat samples analyzed in different states of Mexico tested positive for horse meat and 93.10 % of the selected samples exceeded the maximum residue limits (LMR) for clenbuterol –established by FAO(24)– and 100 % – according to the zero tolerance limit of Mexican laws, which confirms that there is a latent health risk for national consumers.

Nutritional composition of bovine and equine meat

The nutritional composition of equine meat is similar to bovine meat(25,26). Moisture constitutes about 70 %, protein 22 %, intramuscular fat ranges from 0.5 to 6 %, and minerals account for about 1.5 %(27). In this sense, the findings on moisture content were higher (P<0.05) for bovine meat compared to equine meat, and it could be related to the type of muscle, age at slaughter and sex of the animals(9). The type of muscle significantly influences the moisture content of bovine and equine meat, being greater in the semimembranosus muscle(27). These results were similar to those reported by Lorenzo and Pateiro(28), who, when evaluating the influence of muscle type on the nutritional value of calf meat, observed moisture content values from 53 to 77 %, respectively. While Tateo et al(29) presented meat samples from males and females of the “Heavy Draft Italian” breed with moisture values similar to those reported in the present study (70 and 73 %, respectively). On the other hand, the concentration of protein in bovine and equine meat are in the values reported as ideal (15 to 23 %) for human consumption(11,29). Bovine meat showed an increase in protein concentration, which could be mainly related to factors such as sex, age, muscle type and production system(8,9). While the protein concentration of equine meat was similar to those reported by other authors(9,27,29),who observed levels ranging between 20 and 22 % and who conclude that the factors that influence the concentration of protein are similar to those that affect cattle. It is important to note that the fat / protein ratio is a key characteristic of the healthy qualities of meat for human consumption(30). The low intramuscular fat content of equine meat is due to the fact that they tend to store adipose tissue subcutaneously(31). For this reason, some

751

Rev Mex Cienc Pecu 2021;12(3):742-755

authors call it “healthy meat”(32). This characteristic is included in commercialization strategies. Mainly for people trying to keep their weight under control(33); since the World Health Organization(34) recommends that only 30 % of the daily energy intake of the human being from the diet should be originated by the concentration of fat, so equine meat seems to be a good source of protein with low fat content(10). The importance of color as a characteristic of physical assessment and quality of meat allows showing the variations of the chemical state (degree of oxidation) of the pigment of a certain moment of the meat and the physical state of the meat, the structure of the muscle fibers and the amount of light reflected (L*a*b)(19). In this sense, the lower luminosity (L) of equine meat may be due to the amount of oxygenation of myoglobin that is related to the value of a*(35). In this sense, equine meat has a higher concentration of myoglobin in adult life(36). In addition, the value of a* increases and the value of L* reduces, and it tends to a darker color(37), which explains the similarity values of the meat color for the species in the present study.

Conclusions and implications The degree of substitution of bovine meat for equine meat (5.59 %) in the commercialization centers in Mexico City is low. However, if equine meat is produced and handled according to the regulations applied to bovine meat, it has great potential as an alternative meat for the national consumer, since the nutritional composition was similar to bovine meat.

Acknowledgements

To the National Council for Science and Technology (CONACyT, for its acronym in Spanish) for the scholarship granted to the first author and the project funded by the General Directorate of Research and Postgraduate Studies of the Chapingo Autonomous University (Number 135502006).

Conflict of interest statement

The authors declare that they have no conflict of interest for the publication of this scientific paper.

752

Rev Mex Cienc Pecu 2021;12(3):742-755

Literature cited: 1. Moreno RMA. Contribución al estudio de la frecuencia de cecina elaborada con carne de equino que se expide en el Distrito Federal [tesis profesional]. México, DF: Universidad Nacional Autónoma de México; 1972. 2. García MJG, Erosa VE, Prieto C, Núñez GYF. Identificación del origen de especie animal en carne fresca utilizando inmunodifusión doble. Téc Pecu Méx 2000;38(3):231-237. 3. Kuehn R, Kaczensky P, Lkhagvasuren V, Pietsch S, Walzer C. Differentiation of meat samples from domestic horses (Equus caballus) and asiatic wild asses (Equus hemionus) using a species-specific restriction site in the mitochondrial cytochrome b region. Mong J Biol Sci 2006;4(2):57-62. 4. Matsunaga T, Chikuni K, Tanabe R, Muroya S, Shibata K, Yamada J, Shinmura Y. A quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci 1999;51(2):143-148. 5. Corona B, Lleonard R, Carpio Y, Uffo O, Martínez S. Short communication. PCR detection of DNA of bovine, ovine-caprine and porcine origin in feed as part of a bovine spongiform encephalopathy control program. Span J Agric Res 2007;5(3):312-317. 6. Kesmen Z, Yetim H, Şahin F. Identification of different meat species used in sucuk production by PCR assay. GIDA: J Food 2010;35(2):81-87. 7. Pereira PMDCC, Vicente AFDRB. Meat nutritional composition and nutritive role in the human diet. Meat Sci 2013;93(3):586-592. 8. Cabrera MC, Saadoun A. An overview of the nutritional value of beef and lamb meat from South America. Meat Sci 2014;98(3):435-44. 9. Vanegas AAM, Gutiérrez LF. Horse meat: production, consumption and nutritional value. CES Medicina Veterinaria y Zootecnia 2016;11(3):86-103. 10. Poławska E, Cooper RG, Jóźwik A, Pomianowski J. Meat from alternative species– nutritive and dietetic value, and its benefit for human health–a review. CyTA Food 2013;11(1):37-42. 11. FAO. Food and Agriculture Organization of the United Nations. Food and Agriculture data. http://faostat3.fao.org/browse/Q/QL/S 2015. Accessed Jun 27, 2015. 12.

FAO. FAOSTAT Producción http://www.fao.org/faostat/es/#data/QL.

753

Agrícola.

2017

disponible

en:

Rev Mex Cienc Pecu 2021;12(3):742-755

13. Kane DE, Hellberg RS. Identification of species in ground meat products sold on the U.S. commercial market using DNA-based methods. Food Cont 2016;(59):58-163. 14. Premanandh J. Horse meat scandal – A wake-up call for regulatory authorities. Food Cont 2013;(34):568-569. 15. Seong PN, Park KM, Kang GH, Cho SH, Park BY, Chae HS, Ba HV. The differences in chemical composition, physical quality traits and nutritional values of horse meat as affected by vario retail cut types. Asian-Australas J Anim Sci 2016;29(1):89-99. 16. González HG, Mota RD, Becerril HM, Casas GC, Zermeño M, Ramírez-NR, et al. Horse meat for human consumption in México: Slaughter performance and carcass morphometry. J Food Technol;2006:106-110. 17. Miller I, Miller M, John E. Freunds mathematical statistics. 6th ed. London UKA: Prentince Hall Int; 1999. 18. AOAC. Official methods of analysis. 18th ed. Washington. USA: Association of Official Analytical Chemists. 2007. 19. Sañudo AC, Gonzales C. Aspectos estratégicos para obtener carne ovina de calidad en el cono sur americano. Buenos Aires ed: Buenos Aires, Argentina; 2008. 20. Montgomery DC. Design and analysis of experiments. Eighth ed, New Jersey, USA: Wiley & Sons; 2013. 21. SAS. Institute Inc., SAS/STAT. Software, Ver. 9.00. SAS, Cary, NC, USA. 2006. 22. Iwobi A, Sebah D, Spielmann G, Maggipinto M, Schrempp M, Kraemer I, et al. A multiplex real-time PCR method for the quantitative determination of equine (horse) fractions in meat products. Food Cont 2017;(74):89-97. 23. Rubio LMS, Ruíz LAF, Medina MR, Espinosa P. Estudio del mercado de carne de caballo en México y pruebas de ADN. Reporte convenio HSI-UNAM DGEL/3817/15. Laboratorio de Ciencia de la Carne. Facultad de Medicina Veterinaria y Zootecnia. Universidad Nacional Autónoma de México 2017;1-39. 24. Food and Agriculture Organization of the United Nations, Codex Alimentarius Commision. Maximum residue limits for veterinary drugs in foods (Updated as at the 35th Session of the Codex Alimentarius Commision), Roma, Julio de 2012. ftp://ftp.fao.org/codex/weblinks/MRL2_e_2012.pdf. 25. Lanza M, Landi C, Scerra M, Galofaro V, Pennisi P. Meat quality and intramuscular fatty acid composition of Sanfratellano and Haflinger foals. Meat Sci 2009;81(1):142149.

754

Rev Mex Cienc Pecu 2021;12(3):742-755

26. Franco D, Rodríguez E, Purriños L, Crecente S, Bermúdez R, Lorenzo JM. Meat quality of “Galician Mountain” foals breed. Effect of sex, slaughter age and livestock production system. Meat Sci 2011;88(2):292-298. 27. Lorenzo JM, Sarriés MV, Tateo A, Polidori P, Franco D, Lanza M. Carcass characteristics, meat quality and nutritional value of horsemeat: A review. Meat Sci 2014;96(4):1478-1488. 28. Lorenzo JM, Pateiro M. Influence of type of muscles on nutritional value of foal meat. Meat Sci 2013;93(3):630-638. 29. Tateo A, De Palo P, Ceci E, Centoducati P. Physicochemical properties of meat of Italian Heavy Draft horses slaughtered at the age of eleven months. J Anim Sci 2008;86(5):1205-1214. 30. Paleari MA, Soncini G, Beretta G, Rossi MT. Microbiological and chemical aspects of corned, cooked and vacuum-packed horsemeat. Ital J Food Sci 1992;(4):205-212. 31. De Palo P, Maggiolino A, Centoducati P, Tateo A. Colour changes in meat of foals as affected by slaughtering age and post-thawing time. Asian Australas J Anim Sci 2012;25(12):1775-1779. 32. Badiani A, Nanni N, Gatta PP, Tolomelli B, Manfredini M. Nutrient profile of horsemeat. J Food Composition Analysis 1997;10(3):254-269. 33. Cooper RG. Ostrich meat, an important product of the ostrich industry: A southern African perspective. World’s Poultry Sci J 1999;(55):389–402. 34. Organización Mundial de la Salud (OMS), Organización de las Naciones Unidas para la Agricultura y la Alimentación (FAO). Dieta, nutrición y prevención de enfermedades crónicas. En: Informe de una Consulta Mixta de Expertos. Serie de Informes Técnicos, 916. Ginebra 2003; https://www.who.int/mediacentre/news/releases/2003/pr20/es/. 35. Segato S, Cozzi G, Andrighetto I. Effect of animal morphotype, sex and age on quality of horsemeat imported from Poland. Proceedings of the A.S.P.A. XIII Congress, Piacenza 1999:21–24. 36. Badiani A, Manfredini M. The production of horsemeat. Italian J Anim Sci 1994;(20): 35–43. 36. Rossier E, Berger C. La viande de cheval: des qualités indiscutables et pourtant méconnues. Cahiers de Nutrition et de Diétologie 1988;(23):35–40.

755

https://doi.org/10.22319/rmcp.v12i3.5892 Article

Supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits

Yordan Martínez a* Maidelys Iser b Manuel Valdivié c Jorge Galindo d David Sánchez d

Universidad de Zamorano. Departamento de Ciencia y Producción Agropecuaria, Valle de Yeguare, San Antonio de Oriente 96, Honduras. b

Universidad de Granma. Facultad de Ciencias Agropecuarias. Granma, Cuba.

Centro Nacional para la Producción de Animales de Laboratorio. La Habana, Cuba.

Universidad de Guadalajara, Centro Universitario de Ciencias Biológicas y Agropecuarias (CUCBA). Departamento de Producción Animal. Jalisco, México.

*Corresponding author: ymartinez@zamorano.edu

Abstract: The aim of this study was to evaluate the effect of dietary supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits. A total of 40 male rabbits (New Zealand × Californian) weaned at 35 d were randomly selected for a control diet (CD) and CD + 1.5% of A. fourcroydes powder, with 10 replicates and two rabbits per replicate. After 60 d, A. fourcroydes powder increased body weight, feed intake, and weight gain (P<0.05), without affecting feed conversion ratio and viability (P>0.05). Furthermore, this natural product did not affect the edible portions and the indicators determined in the Longissimus dorsi, nor the organ relative weights and the intestinal morphometry (P>0.05); however, a decrease in cecal pH was observed and consequently an increase in 756

Rev Mex Cienc Pecu 2021;12(3):756-772

cecal beneficial bacteria (P<0.05) were found. Also, A. fourcroydes powder reduced (P<0.05) the serum concentration of glucose, harmful lipids, HDL and atherogenic index although without change for the ureic nitrogen, creatinine and VLDL (P>0.05). Agave fourcroydes powder as a zootechnical additive promoted better growth, in addition, it showed lipid-lowering and hypoglycemic effects, without modifying the edible portions and organs digestive. Key words: Agave fourcroydes, Zootechnical additive, Rabbit; Natural growth promoter, Hypoglycemic effect, Lipid-lowering effect.

Received: 08/12/2020 Accepted: 08/02/2021

Introduction Modern rabbit production is characterized by high productive intensity, in which animals are subjected to different stress situations. These, in turn, cause in some cases imbalances on intestinal microbiota, with the development of pathogenic microorganisms, immunosuppression, inefficient feed conversion, high mortality, and decreased zootechnical response(1). For the above reasons, over the decades, antibiotics are used as animal growth-promoting additives. However, as a consequence of food security problems, especially due to the indiscriminate use of preventive antibiotics, effective dietary alternatives have been identified, with acceptable results in the growth performance and edible portions of non-ruminant animals(2). The scientific community and the industry of the livestock sector study and introduce new safe and innocuous additives to improve the health and productive indicators of animals, such as organic acids, prebiotics, probiotics, phytobiotics, enzymes, or their combination(3,4). These natural products currently have various beneficial characteristics such as hypocholesterolemic, hypoglycemic, anti-inflammatory, antioxidants, immunity modulators, morphology, pH and intestinal microbiology(4), thus its constant use in small concentrations in diets, could contribute to maximize the genetic expression of animals, and in turn, the growth performance of farm animals(5). The Agave genus, part of the Agavaceae family, is native to Mexico. The stem of the Agave fourcroydes is known to be high in oligosaccharides (fructans) and beneficial antiinflammatory and bactericidal secondary metabolites such as saponins, flavonoids, anthocyanins, coumarins, reducing sugars and tannins(6). In this sense, Iser et al(7) reported

757

Rev Mex Cienc Pecu 2021;12(3):756-772

that the use of Agave fourcroydes powder as a dietary supplement in rabbits promoted the body weight gain due to higher the feed intake and better gut health, which increased the villi height in the small intestine and IgG concentration, with a decrease in the crypts depth and unchanged in hematological parameters. Despite the prebiotic benefits of Agave spp. according to our knowledge, no studies were found to demonstrate its effect on edible portions, chemical composition of Longissimus dorsi muscle, serum metabolic profile, cecal lactic acid bacteria and relative weight of immune and visceral organs in rabbits. For this study, it was hypothesized that dietary supplementation with Agave fourcroydes rich in fructans could promote the growth of cecal lactic acid bacteria and, therefore, modify the edible portions and decrease the harmful lipids of growing rabbits. Thus, the objective of this experiment was to evaluate the effect of dietary supplementation with A. fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits.

Material and methods Animal, treatment, and housing

This study was carried out in accordance with the Mexican guidelines for animal welfare and experimental protocol, which is approved by the Animal Care Committee (Document CINV.106/12). The experiment was carried out in the "Cofradia" experimental area of the University Center for Biological and Agricultural Sciences, University of Guadalajara, Mexico. The temperature was kept at 21 oC (±2), and relative humidity was maintained between 63 % (±2). A total of 40 male rabbits (New Zealand × Californian) weaned at 35 d with an initial BW of 768 ± 2 g were randomly selected to two dietary treatments, with 10 replicates and two rabbits per replicate. For the size of the experimental sample, the recommendations of García et al(8) were considered. The dietary treatments consisted of a control diet (CD) and CD+1.5% dried-stem powder of A. fourcroydes. For the level of Agave fourcroydes supplementation of the diet, the recommendations by Iser et al(7) were considered. Control diet was prepared according to the nutritional requirements of broiler rabbits(9). It was used the same diet from a previous work(7), which met the nutritional requirements of rabbits from 35 to 95 d. The dried-stem meal of Agave tequilana was provided by the University Center for Biological and Agricultural Sciences.

758

Rev Mex Cienc Pecu 2021;12(3):756-772

The rabbits were placed in metal cages 76 x 76 x 45 cm long, wide, and high, respectively. Feed and water in tubular feeders and automatic nipple drinkers respectively were freely available during the entire experimental period.

Growth performance

During the experimental phase, the initial and final body weight (35 and 95 d old) of the rabbits were measured individually, always at the same time and before feeding them. For this, an OSBORNE® brand digital scale (Kansas, USA), model 37473®, was used with an accuracy of ± 0.1 g. Viability was computed by the number of rabbits during the experimental stage among those housed at the start of the experiment. The average feed intake (FI) was determined daily by the offer and reject method. The average daily gain (ADG) was determined considering the final and initial body weight and the number of experimental days. The feed conversion ratio (FCR) was calculated as the amount of feed eaten, for a gain of 1 kg of body weight.

Carcass traits

Ten (10) rabbits by treatment at 95-d old were sacrificed, by the method of bleeding from the jugular vein, in the experimental slaughterhouse of the University of Guadalajara, Jalisco, Mexico. Before slaughter, the animals for 12 h were fasted, only with water ad libitum(10). For the characterization of the carcass and evaluation of its properties, the dissection of the carcasses was proceeded in fore legs, hind legs, loin, and abdominal wall and ribs(11). The edible portions were weighed on an OSBORNE® digital scale (Kansas, USA), model 37473®, with an accuracy of ± 0.1 g and the relative weight was calculated according to the carcass weight. Also, the Longissimus dorsi muscle (LD, at the level of the 5th lumbar vertebra) was taken from each sacrificed animal and kept at -20 oC for future analysis.

759

Rev Mex Cienc Pecu 2021;12(3):756-772

pH, color tones, chemical composition, and sensorial quality of the Longissimus dorsi muscle

After 24 h of sacrifice, the chilled samples (10 rabbits per treatment) reached room temperature (23 °C) and the pH was determined by a Bantex digital potentiometer model 300 A calibrated with buffer solutions of pH 7 and 10. Also, the color tones of the Longisimus dorsi muscle, such as L* (lightness), a* (redness), and b* (yellowness) values were measured using a Minolta CR-400/410 chromameter (Konica Minolta Sensing Inc., Osaka Japan). Moreover, in the samples the dry matter (DM), crude fat (CF), ashes and crude protein (CP) was prescribed, according to the methodology described by AOAC(12). The sensory quality was evaluated by a panel of 16 trained tasters who consume rabbit meat daily, in excellent health and between the ages of 20 and 55 yr of age. Tasters were selected from the University Center of Biological and Agricultural Sciences of the University of Guadalajara, Jalisco, Mexico. The samples (50 g) were cooked without salt or spice at a temperature of 70 oC for 1 h(13). The criteria for the evaluation were: Aroma (normal and abnormal), juiciness (normal and abnormal), tenderness (normal, hard, very hard and very soft) and color (normal, pale, and intense).

Relative weight of the organs, morphometry, and gut pH

In the rabbit slaughter (at 95-d old), the viscera (liver and heart), spleen as an immune organ, and stomach were extracted and weighed. In addition, the small intestine, large intestine and cecum was weighed and measured using an OSBORNE® digital scale (Kansas, USA), model 37473®, with an accuracy of ± 0.1 g and a measuring tape, respectively. The relative weight of the organs was calculated according to the body weight at slaughter. At the time of sacrifice, several portions of stomach, small intestine, colon, and caecum were cut and homogenized in paste form in a porcelain mortar. Two grams of sample was weighed on a watch glass; 10 ml of distilled water was added and homogenized in a vortex for 2 min. The pH was determined by a Bantex digital potentiometer model 300 A (USA) calibrated with buffer solutions of pH 7 and 10.

760

Rev Mex Cienc Pecu 2021;12(3):756-772

Total count of viable mesophilic bacteria and cecal acid-lactic acid

The cecum sac of each animal was taken by treatment (10 animals per treatment). Then, each sample (1 g) was placed in a tube containing 9 mL of sterile peptone water (Cultimed Parnreac-Química-SAU), homogenized in distilled water at a ratio of 1/10 (w/v) and performed serial dilutions (1/10) until dilution 1012. From each dilution, 1 mL was taken and seeded deep into plates with MRS agar (Difco Laboratories, Detroit, Mich.) and pH 6.2 at 37 oC for 48 h in anaerobiosis (Gas Pak system, BBL, Cockeysville, USA). Subsequently, to determine the lactic acid bacteria, visual counting was carried out with a colony counter (XK97A, China).

Blood biochemistry

Of the rabbits sacrificed for each treatment (10 rabbits per treatment), 10 ml of blood was taken. To obtain the blood serum, the samples were left to stand for one hour in 20 ml vials, then centrifuged (Eppendorf centrifuge) at 10,000 rpm and 20 oC for 25 min. In blood serum, glucose, creatinine, urea nitrogen, total lipids, triglycerides, total cholesterol, HDL, LDL and VLDL were determined by colorimetric methods, using a Humalyzer ultraviolet brand spectrophotometer and enzymatic kits. The atherogenic index was determined according to the formula of Dobiášová et al(14).

Statistical analysis

Results are expressed as mean ± SEM. The statistical analysis was performed by unpaired t-test according to a completely randomized design, using SPSS 20.0 (SPSS Inc., Chicago, IL, USA). P values < 0.05 were taken to indicate significance.

761

Rev Mex Cienc Pecu 2021;12(3):756-772

Results

Table 1 shows the effect of dietary supplementation with A. fourcroydes powder on growth performance of broiler rabbits. Viability was excellent for both treatments (100 %), also the experimental treatment increased the final BW, ADG and ADFI when was compared with control diet, although the FCR was not affected by the effect of the treatments (P>0.05). Table 1: Effects of dietary supplementation with dried-stem powder of A. fourcroydes

Items (n=40 rabbits) Finish BW, g ADFI, g/d ADG, g/d FCR Viability, %

on growth performance of broiler rabbits at 95-d old Treatments Control A. fourcroydes SEM ± powder 2,395.69 2,468.13 13.025 121.42 123.40 0.425 27.12 28.33 0.229 4.48 4.36 0.031 100 100

P value <0.001 0.031 0.022 0.323

SEM= standard error of the mean; BW= body weight, ADFI= average daily feed intake, ADG= average daily gain, FCR= feed conversion ratio.

Table 2 shows that dietary supplementation with Agave fourcroydes powder had no significant effect (P˃0.05) on the edible portion yields and chemical composition, colorimetry, pH, and sensory quality of Longissimus dorsi muscle in rabbit broilers.

762

Rev Mex Cienc Pecu 2021;12(3):756-772

Table 2: Effect of dietary supplementation with dried-stem powder of Agave fourcroydes on carcass traits of broiler rabbits at 95-d old Treatments Items (n=20 rabbits) Control A. fourcroydes SEM ± P-value powder Edible portions (%) Carcass 57.08 56.55 1.073 0.734 Fore legs 16.44 15.54 0.753 0.420 Hind legs 34.13 32.86 1.291 0.505 Ribs 23.11 24.72 1.688 0.519 Chemical composition (%) Dry matter 32.87 33.57 0.492 0.541 Crude fat 3.53 3.06 0.283 0.089 Ashes 0.92 1.33 0.170 0.148 Crude protein 23.44 23.22 0.481 0.447 Colorimetry L* 52.05 51.18 1.173 0.614 a* 5.61 6.03 0.327 0.517 b* 1.78 1.36 0.189 0.772 pH, 24 h post-mortem 5.41 5.38 0.042 0.665 Sensory quality Aroma Normal Normal Juiciness Normal Normal Tenderness Normal Normal Color Normal Normal SEM= standard error of the mean; L*: lightness; a*: redness; b*: yellowness.

Similarly, dietary supplementation with A. fourcroydes did not indicate notable differences (P>0.05) (Table 3) for the relative weight of the organs, intestinal morphometry and pH of the digestive system, except for the cecum pH, which decreased due to the use of A. fourcroydes (P<0.05). Also, this natural product (A. fourcroydes) increased the count of viable mesophilic bacteria and cecal lactic acid bacteria (P<0.05).

763

Rev Mex Cienc Pecu 2021;12(3):756-772

Table 3: Effect of dietary supplementation with dried-stem powder of Agave fourcroydes on organ weights, morphometry, and gut pH of broiler rabbits at 95-d old Treatments Control A. fourcroydes SEM ± P-value Items (n=20 rabbits) powder Relative weight (%) Liver 2.38 2.36 0.137 0.941 Heart 0.30 0.29 0.019 0.529 Spleen 0.06 0.05 0.011 0.826 Stomach 4.27 3.97 0.404 0.432 Small intestine 2.15 2.41 0.189 0.350 Large intestine 9.30 8.66 0.803 0.200 Cecum 7.48 7.03 0.785 0.240 Gut morphometry (cm) Small intestine 272.83 268.66 5.625 0.681 Large intestine 113.00 110.16 4.225 0.646 Cecum 47.50 47.83 1.267 0.856 pH Stomach 5.94 5.54 0.249 0.285 Small intestine 6.93 6.90 0.006 0.798 Cecum 6.77 6.44 0.018 0.046 Colon 6.90 6.80 0.113 0.544 Cecum (CFU/ml) Mesophilic viable bacteria 10.42 11.6 0.309 0.021 Lactic acid bacteria 6.36 8.05 0.520 0.044 SEM= standard error of the mean.

Dietary supplementation with 1.5% A. fourcroydes reduced (P<0.05) the serum concentration of glucose, total lipids, total cholesterol, triacylglycerides, HDL and LDL, while the concentration of ureic nitrogen, creatinine and VLDL showed no differences (P>0.05) among treatments (Table 4).

764

Rev Mex Cienc Pecu 2021;12(3):756-772

Table 4: Effect of dietary supplementation with dried-stem powder of Agave fourcroydes on blood biochemistry and atherogenic index of broiler rabbits at 95-days

Items (n=20 rabbits) Ureic nitrogen Glucose Creatinine Total lipids Total cholesterol Triacylglycerides HDL LDL VLDL Atherogenic index

old (mg/dL) Treatments Control A. fourcroydes powder 39.20 37.00 129.80 104.20 0.98 0.92 512.00 494.80 213.60 192.80 180.20 163.80 65.44 53.60 184.60 102.82 36.40 35.20 2.82 1.93

SEM ±

P-value

0.906 1.338 0.150 3.077 2.302 2.447 1.392 2.056 0.739 0.048

0.124 <0.001 0.091 0.004 <0.001 <0.001 <0.001 <0.001 0.284 <0.001

SEM= standard error of the mean; HDL= high-density lipoproteins, LDL= low density lipoproteins, VLDL= very low-density lipoproteins.

Discussion

The use of new feeds and additives in the diets of experimental animals causes changes in morphophysiology, immune response and microbiology. Being more accentuated in rabbits, with characteristic of a non-ruminant herbivore(9); that is why the viability can show in the first instance the biological effectiveness of these products. In this sense, Agave fourcroydes as a nutraceutical additive did not cause morbidity and mortality in rabbits; similar results were found in a previous experiment(7). Therefore, Ayala et al(3) and Abd El‐Hack et al(5) indicated that natural products have no residual effects in animal products. Furthermore, it appears that the organoleptic characteristics of A. fourcoydes powder contributed to an increase in feed intake of 1.98 g/d/rabbit in relation to the control. According to Iser et al(6) the A. fourcroydes powder, have a moderately sweet flavor due to the presence of fructans and fructose, this could stimulate feed intake, without affecting the feed conversion ratio. Likewise, Bovera et al(15) reported a higher feed intake in rabbits, due to the effect of MOS (mannan-oligosaccharides) compared to the control group. 765

Rev Mex Cienc Pecu 2021;12(3):756-772

Moreover, a higher feed intake with 1.5 % of A. fourcroydes could increase the body weight in this treatment, due to the presence of beneficial secondary metabolites and fructans in the diet, which modified the animal response as observed in Table 1. The fructans found in this natural product (A. fourcoydes) increase the population of lactic acid bacteria, which causes a competitive exclusion, with favorable influences on body weight(1). On the other hand, the possible action of secondary metabolites on the beneficial intestinal microbiota of rabbits, could improve the absorption of nutrients, weight gain and therefore the final body weight(5). Some studies(16,17), found a positive relationship between the incorporation of small concentrations of beneficial secondary metabolites in the diets and the final body weight. Currently, the Longissimus dorsi (LD) muscle is taken as a reference to assess the composition and meat quality(11). Agave fourcroydes as a nutraceutical additive did not affect the protein, fat and ash content of rabbit meat. Dalle-Zotte et al(18) indicated protein values (23 to 23.1 %) similar to this research. The fat values in the LD muscle (3.53 to 3.06 %) are within the permissible range for this species, similar to that published by Carrilho et al(19), who reported levels of 3.7 to 4.3%. The pH value is directly related to the maturation and color of the meats(3). According to Składanowska‐Baryza et al(20), the evolution of post-mortem pH in meat affects luminosity and tenderness. In rabbits, the pH ranges range from 5.3 to 6.4(21), similar to this study. Also, Vázquez et al(22), considered the most important chromatic coordinates in meat: L * (lightness), a * (red tones) and b * (yellow tones). There are many factors that influence the value of these indicators, such as muscle type, pH, age, breed, myoglobin content, method of slaughter and feeding(13). In this sense, it was reported similar values of a* (5.53), although low values of b* (0.85) than those shown in Table 2(23). On the other hand, Agave fourcrydes powder as nutraceutical additives in diets did not alter (P˃0.05) the sensory quality of the LD muscle of fattening rabbits (Table 2), a result that is considered positive, since an alteration in these parameters decreases the choice of this product by the consumer and affects significant economic losses. Apparently, the presence of beneficial fructans and secondary metabolites in the diets(6) due to supplementation with A. fourcroydes did not cause abnormalities in rabbit meat. The results in the relative weight of the liver, heart, and spleen of rabbits (Table 3), showed that the Agave fourcroydes stem meal did not affect the organic functions of the rabbits, verified by the growth performance of the rabbits in this group. Similar results were reported for the viscera relative weight, when using a dry extract of A. fourcroydes 766

Rev Mex Cienc Pecu 2021;12(3):756-772

in laboratory animals(24). However, in several works(25,26) when using nutraceutical feeds, reported variable weights in the viscera. Another interesting fact is that the relative weight of the spleen did not increase (P>0.05) when A. fourcroydes was supplemented on rabbit diets. The increase in the weight of the immune organs is not always associated with increased immunological activity and a productive response(22), as observed in this study, that T1 improved performance, without influence on the relative weight of this immune organ. In rabbits, studies have shown that the physical-chemical characteristics of feed (mainly high concentrations of NDF) modify the weight and intestinal morphometry due to the greater permanence of the food chyme in these portions(9). In this sense, A. fourcoydes as a nutraceutical additive has a low content of NDF, DAF and LAD(6) and its dietary supplementation did not cause significant changes in GIT (Table 3). Likewise, Mourão et al(27) found no variations in the relative weight of the digestive gitorgans in rabbits when they used fructooligosaccharides as a prebiotic supplement. It should be noted that the GIT of rabbits is an organ system, which reacts very sensitively due to its anatomical specialties against strong alterations(28). Moreover, fructans stimulate the proliferation of beneficial microorganisms, mainly lactic acid bacteria (LAB)(29). An increase in LAB may influence a favorable competitive exclusion at a GIT level in the rabbits under study, which could increase the inhibition of the proliferation of pathogenic microorganisms(30). Also, the secondary metabolites, such as tannins, coumarins, reducing carbohydrates and flavonoids identified in the A. fourcroydes by having a proven antimicrobial effect(6), which could reduce intestinal pathogenic bacteria, such as E. coli, Clostridium spp. and Salmonella spp. and cause a favorable competitive exclusion, due to the greater proliferation of LAB. Dietary supplementation with 1.5% A. fourcroydes caused a decrease (P<0.05) of the cecal pH, perhaps due to the fact that the cecal lactic acid bacteria in rabbits totally degrade the fructans(24). Authors as Pinheiro et al(31), who used diets rich in fructans found similar responses in the cecal pH of rabbits. Apparently, the dietary supplementation of A. fourcroydes did not decrease the protein efficiency of the diet due to the values of blood urea nitrogen(32). Many reports indicate that feeds rich in fructans such as A. fourcoydes lower serum glucose by increasing the secretion of glucagon-like peptide 1 (GLP 1) in endocrine L cells in the intestine, authors have found similar results when using extracts from Agave fourcroydes in the diets of laboratory mice(24). This natural product was shown to have a significant hypoglycemic 767

Rev Mex Cienc Pecu 2021;12(3):756-772

effect, since it decreased serum glucose by 25 mg/dL compared to the control. Likewise, perhaps, the presence of secondary metabolites (especially polyphenols) in A. fourcroydes could influence serum glucose concentration due to the astringent effect of these metabolites (main polyphenols)(6), which cause slow intestinal release and maintenance of dietary glucose. A relevant fact in this study is that the addition of A. fourcroydes has an important hypolipidemic effect. The high concentration of fructans and the presence of beneficial secondary metabolites in A. fourcroydes, as well as a larger BAL population and better intestinal health(7), could have influenced the decrease in serum cholesterol by 21 mg/dL with respect to the control. Perhaps this caused a decrease in LDL by 82 mg/dL, compared to the control. Also, triacylglycerides decreased due to the effect of A. fourcroydes powder by 17 mg/dL compared to the control. The results showed that dietary supplementation with A. fourcroydes decreased both lipoproteins (LDL and HDL) (Table 4). However, A. fourcroydes powder reduced the atherogenic index by 0.89 compared to the basal diet. Currently, there are no defined patterns of atherogenic indices for rabbits. However, a decrease in this index should favor the health of these growing animals(33).

Conclusions and implications

Dietary supplementation with Agave fourcroydes powder promoted better growth, with a decrease in cecal pH and an increase in the count of cecal lactic acid bacteria, in addition to reducing harmful lipids (cholesterol, triacylglycerides and LDL), the atherogenic index and serum glucose, without significant changes in the relative weight of the edible portions, digestive organs and chemical composition and sensory quality of the Longissimus dorsi muscle.

768

Rev Mex Cienc Pecu 2021;12(3):756-772

Literature cited: 1. Falçao-e-Cunha L, Castro L, Maertens L, Marounex M, Pinheiro V, Freire J, Mourão J. Alternatives to antibiotic growth promoters in rabbit feeding: a review. World Rabbit Sci 2007;15(3):127-140. 2. Dalle-Zotte A, Celia C, Szendrő, Z. Herbs and spices inclusion as feedstuff or additive in growing rabbit diets and as additive in rabbit meat: A review. Livest Sci 2016;189(7):82-90. 3. Ayala L, Silvana N, Zocarrato I, Gómez S. Use of vulgar oregano (Origanum vulgare) as phytobiotic in fatting rabbits. Cuban J Agr Sci 2011;45(2):159-161. 4. Abd-El-Aziz AH, El-Kasrawy NI, Abd-El-Hack ME, Kamel SZ, Mahrous UE, ElDeeb EM, et al. Growth, immunity, relative gene expression, carcass traits and economic efficiency of two rabbit breeds fed prebiotic supplemented diets. Anim Biotechnol 2020;1-12. 5. Abd-El‐Hack ME, Alagawany M, Abdelnour S. Responses of growing rabbits to supplementing diet with a mixture of black and red pepper oils as a natural growth promoter. J Anim Physiol Anim Nutr 2019;103(2):509-517. 6. Iser M, Valdivié M, Figueredo L, Nuñez E, Más D, Martínez Y. Secondary metabolites, quality indicators and organoleptic characteristics of stems meal from Agave fourcroydes (Henequen). Cuban J Agr Sci 2020;54(1):1-10. 7. Iser M, Martínez Y, Ni H, Jiang H, Valdivié M, Wu X, et al. Effects of Agave fourcroydes powder as a dietary supplement on growth performance, gut morphology, concentration of IgG and hematology parameters of broiler rabbits. Biomed Res Int 2016;2016. 8. García J, Nicodemus N, Carabaño R, Villamide M, de Blas C. Determination of the number of replicates required to detect a significant difference between two means in rabbit’s traits. World Rabbit Sci 2001;9(1):27-32. 9. de Blas J, Mateos G. Feed formulation. In: de Blas C, Wiseman J, editor. The nutrition of the rabbit. 2nd ed. Wallingford, Oxon, UK: CABI Publishing; 2010:223-232. 10. NORMA Oficial Mexicana NOM-033-SAG/ZOO. Métodos para dar muerte a los animales domésticos y silvestres. México. 2014. 11. Blasco A, Ouhayoun J, Masoero G. Harmonization of criteria and terminology in rabbit meat research. World Rabbit Sci 1993;4(2):93-99. 769

Rev Mex Cienc Pecu 2021;12(3):756-772

12. AOAC: Official Methods of Analysis. 18th ed. Arlington, VA, USA: Association of Official Analytical Chemists. 2006. 13. Capra G, Martínez R, Fradiletti F, Cozzano S, Repiso L, Márquez R, Ibáñez F. Meat quality of rabbits reared with two different feeding strategies: with or without fresh alfalfa ad libitum. World Rabbit Sci 2013;21(1):23-32. 14. Dobiášová M. Atherogenic index of plasma theoretical and practical implications. Clin Chem 2004;50(7):1113-1115. 15. Bovera F, Nizza S, Marono S, Mallardo K, Piccolo G, Tudisco R, de Martino L, Nizza A. Effect of mannan oligosaccharides on rabbit performance, digestibility and rectal Bacterial anaerobic populations during an episode of epizootic rabbit enteropathy. World Rabbit Sci 2010;18(1):9-16. 16. Fathi M, Abdelsalam M, Al-Homidan I, Ebeid T, Shehab-El-Deen M, Abd-El-Razik M, Abou-Emera O, et al. Supplemental effects of eucalyptus (Eucalyptus camaldulensis) leaves on growth performance, carcass characteristics, blood biochemistry and immune response of growing rabbits. Ann Anim Sci 2019;19(3):779-791. 17. Wang J, Lin L, Li B, Zhang F, Liu N. Dietary Artemisia vulgaris meal improved growth performance, gut microbes, and immunity of growing Rex rabbits. Czech J Anim Sci 2019;64(4):174-179. 18. Dalle-Zotte A, Cullere M, Tasoniero G, Gerencsér Z, Szendrő Z, Novelli E, Matics Z. Supplementing growing rabbit diets with chestnut hydrolyzable tannins: Effect on meat quality and oxidative status, nutrient digestibilities, and content of tannin metabolites. Meat Sci 2018;146(8):101-108. 19. Carrilho M, Campo M, Olleta J, Beltrán J, López M. Effect of diet, slaughter weight and sex on instrumental and sensory meat characteristics in rabbits. Meat Sci 2009;82(1):37-43. 20. Składanowska‐Baryza J, Ludwiczak A, Pruszyńska‐Oszmałek E, Kołodziejski P, Bykowska M, Stanisz M. The effect of transport on the quality of rabbit meat. Anim Sci J 2018;89(4):713-721. 21. Hulot F, Ouhayoun J. Muscular pH and related traits in rabbits: a review. World Rabbit Sci 2010;7(1):15-36.

770

Rev Mex Cienc Pecu 2021;12(3):756-772

22. Vázquez Y, Bernal H, Valdivié M, Gutiérrez E, Mora LM, Sánchez E, et al. Efecto de la inclusión de granos secos de destilería con solubles (DDGS) en la calidad de la canal y de la carne de conejos en crecimiento. Rev Mex Cienc Pecu 2019;10(3):522535. 23. Castellini C, dal Bosco A, Bernardini M, Cyril HW. Effect of dietary vitamin E on the oxidative stability of raw and cooked rabbit meat. Meat Sci 1998;50(2):153-161. 24. García Y, Bocourt R, Savón LL, García-Vieyra MI, López MG. Prebiotic effect of agave Fourcroydes fructans: an animal model. Food Funct 2015;6(9):3177-3182. 25. Tarek A, Zabut BM, Al-Krenawie A I. Effect of kefir intake on growth performance and some biochemical profiles among domestic rabbits. World J Pharm Pharm Sci 2017;6(3):223-240. 26. de Blas J, Chamorro S, García J, García P, García A, Gómez M, Menoyo D, Nicodemus N, Romero C, Carabaño R. Nutritional digestive disturbances in weaner rabbits. Anim Feed Sci Tech 2012;173(4):102-110. 27. Mourão J, Pinheiro V, Alves A, Guedes C, Pinto L, Saavedra M, Spring P, Kocher A. Effect of mannan oligosaccharides on the performance, intestinal morphology and cecal fermentation in rabbits. Anim Feed Sci Tech 2006;126(2):107-120. 28. Dihigo L, Savón L, Sierra F. Morphometric studies of the gastrointestinal tract and internal organs of rabbits fed with feed containing sugar canmeal. Cuban J Agr Sci 2001;35(4):337-341. 29. Depeint F, Tzortzis G, Vulevic J, I’anson K, Gibson G. Prebiotic evaluation of a novel galactooligosaccharide

mixture

produced

the

enzymatic

activity

Bifidobacterium bifidum NCIMB 41171: in healthy humans: a randomized, doubleblind, crossover, placebo-controlled intervention study. Am J Clin Nutr 2008;87(3):785-791. 30. Sharma KG, Vidyarthi VK, Zuyie R. Probiotics supplementation and performance of broiler rabbits. Indian J Anim Sci 2016;33(3):331–335. 31. Pinheiro V, Guedes C, Outor D, Mourao J. Effects of fibre level and dietary mannanoligosacharides on digestibility, caecal volatile fatty acids and performances of growing rabbits. Anim Feed Sci Technol 2009;148(2-4):288–300.

771

Rev Mex Cienc Pecu 2021;12(3):756-772

32. Farías-Kovac C, Nicodemus N, Delgado R, Ocasio-Vega C, Noboa T, Abdelrasoul RA, et al. Effect of dietary insoluble and soluble fibre on growth performance, digestibility, and nitrogen, energy, and mineral retention efficiency in growing rabbits. Animals 2020;10(8):1-19. 33. Oršolić N, Landeka Jurčević I, Đikić D, Rogić D, Odeh D, Balta V, Perak E J, Terzi S, Jutrić D. Effect of propolis on diet-induced hyperlipidemia and atherogenic indices in mice. Antioxidants 2019;8(6):1–22.

772

https://doi.org/10.22319/rmcp.v12i3.4866 Article

Evaluation of the components of management before, during and after slaughter and their association with the presence of DFD beef in cattle from northeastern Mexico

Jorge Loredo Osti a,b Eduardo Sánchez López a* Alberto Barreras Serrano a Fernando Figueroa Saavedra a Cristina Pérez Linares a Miguel Ruiz Albarrán b

Universidad Autónoma de Baja California. Instituto de Investigaciones en Ciencias Veterinarias. Laguna Campestre, Mexicali. BC. México. Universidad Autónoma de Tamaulipas. Facultad de Medicina Veterinaria y Zootecnia “Dr. Norberto Treviño Zapata”. Tamaulipas, México. b

* Corresponding author: edsanmxl@hotmail.com

Abstract: A total of 27 management variables (before, during and after slaughter) in 394 bovines were analyzed and used to determine their association and explanatory value with the presence of DFD (Dark, Firm, Dry) beef, using probability ratios in a multiple logistic regression model. The study was conducted from November 2016 to August 2017 on a Federal Inspection Type slaughterhouse located in northeastern Mexico. The presence of DFD beef was 13.45%. A contrast was made between classes for the factors evaluated by means of Student’s t and Chisquare according to the nature of the variable as a criterion for inclusion in logistic modeling. Ten of the variables showed statistical significance (P<0.05) in these tests, but only four of

773

Rev Mex Cienc Pecu 2021;12(3):773-788

them presented explanatory value in the final multiple logistic model (P<0.01), which were: the waiting time prior to death, poor desensitization, the thickness of the subcutaneous fat and pH differential of the carcass established with 24 h of difference. The first two increased the possibility in the presence of DFD beef, on the contrary, the fat thickness and pH differential were inversely proportional. The four variables included in the final model were present at different stages and are of a different nature. For this reason, to effectively prevent this problem, a multicausal evaluation is needed throughout the slaughter process. Key words: Meat, Dark cutting, DFD, Bovine.

Received: 26/04/2018 Accepted: 29/11/2019

Introduction DFD (Dark, Firm, Dry) beef is a problem that affects the sanitary, physicochemical and sensory quality of the product(1,2), due to a high final pH (>5.8) that favors the growth of bacterial flora and decreases shelf life(3,4). In addition, DFD beef exhibits a dark red color and sticky texture, which gives the appearance of being meat from old animals or that has been stored for a long time(5,6). This leads to low consumer acceptance and causes economic losses to producers(7,8). In Mexico, it is estimated that the loss for each carcass with DFD characteristics is 88.58 US dollars(9), higher than the 5.43 dollars of loss per carcass found in the USA(10). DFD beef has the following characteristics: increase in water retention capacity, poor palatability, less tenderness and greater light absorption, which affects its technological aptitude for the production of various meat products(11,12,13). The speed in the decrease of the post-mortem pH is directly related to the level of stress suffered by the animal before slaughter(14,15). Chronic stress and long-term exposure to acute stress, just before being slaughtered, cause muscle glycogen stores to be consumed quickly(2), reducing the amount of lactic acid that is formed by anaerobic glycolysis in the muscle after the death of the animal, which causes the presence of DFD beef, also called Dark Cutting(16,17). There are different intrinsic factors that increase the risk of a greater presence of DFD beef such as: breed origin (more frequent in Bos indicus)(18,19), sex (greater in entire males)(7,20), weight (less common in cattle of greater live weight)(21,22), amount of fat (it occurs more frequently with low values in the thickness of subcutaneous fat)(4,23) and age (it 774

Rev Mex Cienc Pecu 2021;12(3):773-788

is more frequent in old animals)(24,25). Environmental conditions also influence the presence of DFD beef, extreme temperatures cause heat or cold stress(26,27). Improper handling in ante-mortem processing is one of the main triggers of dark cutting, long distances in transport and high animal density in small spaces influence their presence, as well as long times in waiting pens, sleeves and in the slaughter drawer(15,20), the use of stressful instruments (electric prods, lariats, sticks, etc.) in the herding towards the desensitization drawer and poor effectiveness of the latter has also been reported as risk factors(28,29). The post-slaughter process also affects the presence of DFD beef, the rate of decrease in pH and muscle temperature interact continuously during rigor mortis and are probably two of the most important post-mortem factors that affect the properties of the meat, such as: color, final pH, water retention capacity and tenderness(30,31,32), some characteristics of the carcass such as its weight and the thickness of subcutaneous fat influence this interaction(33,34). Studies such as the above have been conducted to establish the association between the presence of DFD beef and the factors evaluated; however, most of them have established this association by analyzing these factors individually and in isolation, which does not allow analyzing the effect of the variables together or their interactions. Therefore, the objective of this work was to evaluate the association of factors with explanatory value, as well as their interactions, related to the management before, during and after slaughter, on the presence of DFD beef.

Material and methods Twenty-seven (27) intrinsic and extrinsic variables were evaluated before, during and after slaughter, in the four seasons of the year. The work was carried out between November 2016 and August 2017 in a Federal Inspection Type (TIF) slaughterhouse located in Cd. Victoria, Tamaulipas. Records of the variables were taken in 16 periods of 3 d each: on arrival, during slaughter and processing of the carcass. The genotype of the animals corresponded, mainly, to commercial crosses of Bos taurus x Bos indicus. The bovines arrived from different parts of the region and in different types of vehicles.

775

Rev Mex Cienc Pecu 2021;12(3):773-788

Sample size

The number of animals was determined for simple random sampling by attributes, considering a finite population(35). The components of the formula were a confidence value of 95% (Z = 1.96), accuracy of 5%, an estimator of variance equal to 0.25 [ σ2 = π(1-π)] and an N value generated from the slaughterhouse of the last three years (n= 38,950 animal/year). The sample size obtained (n= 394) was distributed proportionally by the number of slaughters in the seasons of the year: spring= 95, summer= 110, autumn= 78 and winter= 110. Data collection was carried out in November 2016, February, May and August 2017.

Information gathering

Ante-mortem variables

Upon arrival at the slaughterhouse, intrinsic and extrinsic variables such as transport practices, form of acquisition of the animal, season of the year, temperature and relative humidity were recorded (thermohygrometer with a probe, Hanna instruments, model HI9565). In the rest pens, the presence of visible lesions and variables concerning the space and time of permanence was recorded. The separation of an animal in individual pens for behavioral or health reasons (surly, mounts or lesions) was also recorded. Before the slaughter, the day of the week and the individual data referring to the time spent in the sleeve that leads the animals to the desensitization drawer and the conditions of the herding of the cattle were recorded. Temperature and relative humidity were measured before entering the slaughter drawer. The temperature-relative humidity index (ITHR) was obtained by the following formula: ITH = [0.81*T] + HR/100*(T–14.4) + 46.4, where T= Ambient temperature (°C) and HR = Relative humidity (%)(36).

Variables during slaughter

The stunning was carried out by means of a captive bolt gun. During the hanging of the animal’s body, the effectiveness of desensitization was assessed by recording the following behavioral indicators: spontaneous blinking, total rotation of the eyeball, rhythmic breathing, attempt to get up, straightening and vocalizations. It was considered an incorrect 776

Rev Mex Cienc Pecu 2021;12(3):773-788

desensitization of the animal when it presented any of the previous signs. The stunningbleeding interval from the time the animal collapsed to the slaughter was also determined(37,38).

Variables in the hot carcass

The weight of the hot carcass was recorded; in addition, 45 min after slaughter, the pH value (pH45min) was recorded (in triplicate) in order to establish a differential (ΔpH) between the pH45min and the last pH (pHu) evaluated 24 h later, the pH was measured with a potentiometer that had a puncture device for meat (Hanna instruments, model HI99163). The temperature of the carcass was also recorded (in triplicate) at 45 min, in the Longissimus dorsi muscle at 5 cm penetration (thermometer with penetration probe, Hanna instruments, model HI935007N).

Variables in the cold carcass

In the cold room (2 °C) 24 h after slaughter, the values of the final pH, the thickness of the subcutaneous fat and the colorimetric parameters were recorded: L* = Luminosity (0 to 100), a* = red index (-60 to 60) and b* = yellow index (-60 to 60). All these records were made in triplicate in the area of the Longissimus dorsi muscle between the 10th and 12th rib of the left half carcass, 30 min after having made the cut. The thickness of the subcutaneous fat was determined with a stainless-steel Vernier calibrator and the color values with a Minolta spectrophotometer with 5 cm aperture, illuminant C and 2° observer (Model CR-410, Minolta Co., Ltd., Osaka, Japan,). The Chroma (0 to 200) was calculated using the following equation: C* =(a*2 + b*2)1/2(39). Finally, the density in the cold chamber (number of carcasses/m2) was recorded.

Classification variables

According to the established criteria, the carcass was classified into dark, firm and nonexudative (DFD) based on the following: pHu ≥ 5.8, L* < 40 and C* < 30(40). Carcasses that presented different criteria were classified as normal.

777

Rev Mex Cienc Pecu 2021;12(3):773-788

Analysis of variables

The contrast between the DFD and normal classes for the studied variables was made according to the nature of the variable: Student’s t was used for the continuous quantitative variables, while Chi-square and Fisher’s exact test (for frequency <5 in one box) were used for the categorical variables. Significance was established when P<0.05.

Association study

The association of the study factors with the classification of meat (dependent variable) of binomial nature (1 = DFD, 0 = normal) was carried out by applying a logistic model with multiple independent variables, as well as their interactions. As a first step in the use of the logistic model, the variables with statistical significance (P<0.05) in the comparison between DFD and normal classes were included. Factors that were not significant (P≥0.05) according to Wald’s test were excluded from the complete model. This allowed obtaining the final model with its probability ratios (OR), standard errors (EE) and confidence intervals (95% IC). The final model underwent the Hosmer-Lemeshow goodness of fit test(41,42). The contrasts between DFD and normal classes for the studied variables, as well as the analysis of the logistic model with multiple independent variables were performed when applying the TTEST, FREQ and LOGISTIC procedures of the SAS 9.4 statistical package(43).

Results and discussion The percentage of DFD beef found in this study was 13.45 %, lower than the 38.99 % observed in the last study conducted in another region of Mexico(41). Regional differences between the presence of DFD beef suggest that the factors influencing this condition are multiple and varied(44). In addition, an increase in the frequency of this problem has been observed in other North American countries: in the US, it went from 1.9 % in 2005(45) to 3.2 % in 2012(46) and in Canada from 1.0 % to 1.3 % in a span of just over a decade(47,48). Of the variables included in this study, only 10 showed significance in DFD vs normal contrast (Tables 1 and 2). However, when performing the analysis of the multiple logistic regression model, only four of them showed explanatory value (P<0.05), which were: time in the waiting pen, stunning efficiency, subcutaneous fat thickness (EGS) and the pH 778

Rev Mex Cienc Pecu 2021;12(3):773-788

differential (ΔpH) (Table 3). None of the interactions between these variables or with the remaining ones showed significant value within the model (P>0.05). In the Hosmer– Lemeshow goodness of fit test, the null hypothesis was not rejected (P=0.963). Table 4 presents the OR values, along with their 95% confidence interval. Table 1: Effect of quantitative, intrinsic and extrinsic variables on the type of beef Variable DFD Normal Mean SE Mean SE P-value Unloading Temperature, °C 30.4 1.00 32.5 0.28 0.010 HR–T Index 77.1 10.5 79.7 0.28 0.934 Transport Animal density, m2/ head 3.1 0.29 2.6 0.09 0.061 Rest pen Animal density, m2/ head 9.6 1.17 11.5 0.55 0.214 Time, h 15.4 0.23 14.8 0.10 0.021 Conductive sleeve to the slaughter drawer N° of people in herding 1.5 0.13 1.7 0.07 0.449 Temperature, °C 23.6 0.80 25.4 0.24 0.009 HR–T Index 71.2 1.12 74.1 0.33 0.002 Time, min 68.2 6.47 54.4 2.18 0.023 Slaughter Stunning-bleeding interval, sec 179.8 10.04 147.7 4.49 0.008 Hot carcass Weight, kg 284.7 10.32 295.8 3.78 0.289 pH45min 7.0 0.03 6.9 0.02 0.131 Temperature, °C 45min 33.2 0.31 33.5 0.11 0.351 Cold carcass ΔpH 0.95 0.04 1.45 0.02 < 0.001 Fat thickness, cm 0.40 0.04 0.55 0.02 0.007 2 Density in the cold room, m / carcass 2.3 0.06 2.2 0.03 0.667 P-value of Student’s t test.

779

Rev Mex Cienc Pecu 2021;12(3):773-788

Table 2: Effect of categorical, intrinsic and extrinsic variables on the type of beef Variable DFD Normal Frequency Percentage Frequency Percentage P-value Animal Sex 0.186(1) Male 11 20.00 44 80.00 Female 42 12.39 297 87.61 Origin Form of acquisition 0.895(1) Auction 18 14.17 109 88.89 Farm 35 13.11 232 86.49 Unloading Season 0.097(1) Spring 6 6.32 89 93.68 Summer 15 13.51 96 86.49 Autumn 14 17.95 64 82.05 Winter 18 16.36 92 83.64 Transport Distance 0.048(1) >60 min 9 25.71 26 74.29 30-60 min 6 8.45 65 91.55 <30 min 38 13.19 250 86.81 Type of transport 0.191(1) <2m long 24 13.87 149 86.13 2-4 m long 6 25.00 18 75.00 >4m long 23 11.68 174 88.32 Rest pens Separation 0.741(2) Yes 3 15.00 17 85.00 No 50 13.37 324 86.63 Visible lesions 0.293(2) Yes 2 25.00 6 75.00 No 51 13.21 335 86.79 Conductive sleeve to the slaughter drawer Herding instrument 0.070(1) Prod 25 15.92 132 84.08 Other 6 6.38 88 93.62 None 22 15.38 121 84.62 Falls 0.089(2) 780

Rev Mex Cienc Pecu 2021;12(3):773-788

Yes No Slaughter Day of the week Monday Thursday Efficacy in stunning Correct Wrong

2 51

50.00 13.08

2 339

50.00 86.92 0.771(1)

30 23

14.15 12.64

182 159

85.85 87.36 < 0.001(1)

25 28

9.29 22.40

244 97

90.71 77.60

P-value of χ2 test (1) and Fisher’s exact test (2).

Table 3: Coefficient, standard error and P-value of the variables included in the multiple logistic model Variable Coefficient Standard error P-value Time in corral, h 0.522 0.126 <0.0001 Stunning efficacy 1.251 0.375 0.0009 Subcutaneous fat thickness, cm -1.883 0.636 0.0031 pH differential [ΔpH] -4.554 0.695 <0.0001 Constant -5.308 Table 4: Probability ratio (OR) and confidence interval (CI) of the variables included in the logistic model Variable OR 95% CI Time in pen, h 1.686 1.317 a 2.159 Incorrect stunning 3.492 1.674 a 7.287 Subcutaneous fat thickness, cm 0.152 0.044 a 0.529 pH differential [ΔpH] 0.011 0.003 a 0.041 The time prior to slaughter that cattle spend in the waiting pens is associated with the presence of DFD beef, the OR value indicates that the possibility of this defect occurring in the carcasses is 1.69 times greater for each hour that elapses. Some authors recommend a rest time of 3 hours as sufficient for the animal to recover from the negative effects derived from transport(15,49), however, the regulations of Mexico and other countries indicate that the rest time of the animals in the slaughterhouse should be from 12 to 24 h(50,51), considering the OR value obtained in this study, the application of the maximum time of these standards implies a significant increase in the risk of presence of DFD beef. Waiting times higher than 15.8 h and 12.0 h in retention pens, evaluated in two different studies, have resulted in OR values of 2.20 and 2.03 respectively, estimated by applying logistic regression models for carcasses 781

Rev Mex Cienc Pecu 2021;12(3):773-788

with final pH ≥5.8(7,52). The results of this work, as well as those referred to above, show that the longer the animal spends in the rest pen, the more stressful elements may occur, increasing the possibility of greater frequency of DFD beef. Poor desensitization of the animal on this slaughterhouse showed a 3.49 times greater chance of resulting in dark-cutting type meat; therefore, in the slaughter of cattle, it is important to determine if the animal is insensitive after the shot, since the bleeding and processing of the carcass cannot begin without having carried out this stage correctly(16,53). For the efficacy of desensitization in hoisting to be recognized as ‘’acceptable’’, a percentage of no more than 0.2 % of animals with signs of sensitivity must be present(29). In this study, the percentage of animals with signs of sensitivity in hoisting was 31.7 %, which indicates that, in addition to negatively affecting the quality of meat, there is a serious animal welfare problem; this problem is not exclusive to the slaughterhouse evaluated, since the percentage found was less than the 49.0 % reported in another TIF slaughterhouse in northwestern Mexico(54) and 66.9 % in another slaughterhouse in Chile(15). In relation to the number of shots, the following percentages were observed: 1 (88.1 %), 2 (9.6 %) and 3 or more (2.3 %). It is considered as ‘‘acceptable’’ when the percentage of animals instantly stunned with a single shot is 95 % or more, and as “serious problem’’ when it does not reach 90 %(29); in this slaughterhouse this last figure was not reached, evidencing the problem of animal welfare at this stage. The most frequent causes of the low efficacy in desensitization by firing with retractable bolt are improper maintenance of the gun or fatigue that the operator experiences due to a high speed of the flow of animals in the stunning drawer(55). Although there are studies that have examined the impact of a poor desensitization on the presence of DFD beef(28), most research on desensitization in cattle has paid greater attention to behavioral and physiological reactions related to animal welfare(29,56). However, the efficiency of stunning in the quality of the carcass should be assessed more thoroughly(57), as desensitization is a very important part of the slaughter process and therefore can affect the quality of the final product(58). The EGS showed an inversely proportional relationship on the presence of DFD beef. The value of OR of 0.15 indicates that it is a protective factor. Its inverse indicates that for each cm of increase in EGS, there is a 6.67 times greater chance of resulting in meat normal. This result was similar to that obtained in another research that applied the SEUROP carcass fatness grade classification system, where an OR of 0.18 was observed for carcasses with a good fatness grade(7). It is estimated that carcasses with an EGS of less than 0.76 cm have a higher probability of presenting DFD beef(4). Carcasses with greater fatness maintain a temperature similar to the live animal for longer when they are introduced to the cold room(23), accelerating muscle metabolism and presenting a greater decrease in pH in the process of establishing rigor mortis(30).

782

Rev Mex Cienc Pecu 2021;12(3):773-788

The rate of pH decrease in the muscle post-rigor has a direct influence on the pHu and the color of the carcasses. The relationship observed between ΔpH and the presence of DFD beef was inversely proportional, with a value of 0.011 for OR. Its inverse indicates that, for each increment by a unit, the chance of normal meat being presented will be 90.9 times greater. There is a direct relationship between the rate of pH decline and the temperature of the carcass(32,59). Carcasses with higher temperatures in the pre-rigor period generate higher ΔpH values, therefore, with less possibility of resulting in dark cutting(30).

Conclusions and implications The percentage in the presence of DFD beef obtained in this study was 13.45 %. Of the 27 variables evaluated, 10 of them, intrinsic and extrinsic, revealed statistical association with the presence of DFD beef, however, only four of these ten showed explanatory value to quantify the risk of dark cutting within the mathematical model used; these were: time in the waiting pen, efficacy of the desensitization (where animal welfare problems were observed), ΔpH and EGS. The first three are present throughout the slaughter process; from the handling that is given to animals before and during death, as well as in post-mortem metabolism, the latter is typical of the animal. Therefore, a multicausal evaluation is necessary throughout the slaughter process to adequately prevent this problem. Overall, this study presents concrete data on what factors actually favor the presence of DFD beef, with a direct interest for the slaughterhouse itself and for those working under similar conditions (TIF), but also for scientific purposes. Literature cited: 1.

Alende M, Volpi-Lagreca G, Pordomingo AJ, Pighín D, Grigioni G, Carduza F, et al. Efectos del tiempo de transporte, espera pre-faena y maduración en novillos sobre indicadores de estrés, calidad instrumental y sensorial de la carne. Arch Med Vet 2014;(46):217-227.

Adzitey F, Nurul H. Pale soft exudative (PSE) and dark firm dry (DFD) meats: causes and measures to reduce these incidences - a mini review. Int Food Res J 2011;(18):1120.

Lawrie RA, Ledward DA. Lawrie’s meat science. 7th ed. Abington Hall, England. Published by Woodhead Publishing Limited; 2006.

Page JK, Wulf DM, Schwotzer TR. A survey of beef muscle color and pH. J Anim Sci 2001;79(3):678-687. 783

Rev Mex Cienc Pecu 2021;12(3):773-788

Hughes J, Clarke F, Purslow P, Warnerd R. High pH in beef Longissimus thoracis reduces muscle fibre transverse shrinkage and light scattering which contributes to the dark colour. Food Res Int 2017;(101):228-238.

Sawyer J, Apple J, Johnson Z, Baublits R, Yancey J. Fresh and cooked color of dark cutting beef can be altered by post-rigor enhancement with lactic acid. Meat Sci 2009;83(2):263-270.

Mach N, Bach A, Velarde A, Devant M. Association between animal, transportation, slaughterhouse practices, and meat pH in beef. Meat Sci 2008;(78):232–238.

Viljoen HF, de Kock HL, Webb EC. Consumer acceptability of dark, firm and dry (DFD) and normal pH beef steaks. Meat Sci 2001;(61):181–185.

Leyva-García IA, Figueroa-Saavedra F, Sánchez-López E, Pérez-Linares C, BarrerasSerrano A. Economic impact of DFD beef in a Federal Inspection Type (TIF) slaughterhouse. Arch Med Vet 2012;(44):39-42.

10. Miller M. Dark firm and dry beef. Beef facts product enhancement. Texas Tech University. 2007 https://fyi.extension.wisc.edu/wbic/files/2011/04/Dark-Firm-andDry-Beef.pdf. Accessed Aug 20, 2019. 11. Apple JK, Kegley EB, Galloway DL, Wistuba TJ, Rakes LK. Duration of restraint and isolation stress as a model to study the dark-cutting condition in cattle. J Anim Sci 2005;(83):1202-1214. 12. Zhang SX, Farouk MM, Young OA, Wieliezko KJ, Podmore C. Functional stability of frozen normal and high pH beef. Meat Sci 2005;(69):765–772. 13. Huff-Lonergan E, Lonergan SM. Mechanisms of water-holding capacity of meat: The role of postmortem biochemical and structural changes. Meat Sci 2005;(71):194–204, 14. Ferguson DM, Warner RD. Have we underestimated the impact of pre-slaughter stress on meat quality in ruminants? Meat Sci 2008;(80):12–19. 15. Gallo C, Teuber M, Cartes M, Uribe H, Grandin T. Improvements in stunning of cattle with a pneumatic stunner after changes in equipment and employee training. Arch Med Vet 2003;(35):159-170. 16. Chambers PG, Grandin T. Guidelines for humane handling, transport and slaughter of livestock. FAO-HIS. 2001.

784

Rev Mex Cienc Pecu 2021;12(3):773-788

17. Mota D, Huertas SM, Alarcón AD, Pérez C, Guerrero I, Carrasco A, et al. Músculo oscuro, firme y seco: mecanismos involucrados. En: Mota D, et al, editores. Bienestar animal. Una visión global en Iberoamérica. 3a ed. Barcelona, España: Elsevier; 2016: 447-493. 18. Curley KO, Paschal JC, Welsh TH, Randel RD. Technical note: Exit velocity as a measure of cattle temperament is repeatable and associated with serum concentration of cortisol in Brahman bulls. J Anim Sci 2006;(84):3100-3103. 19. King DA, Schuehle CE, Randel RD, Welsh TH, Oliphint RA, Baird BE, et al. Influence of animal temperament and stress responsiveness on the carcass quality and beef tenderness of feedlot cattle. Meat Sci 2006;74(3):546-556. 20. Panea B, Ripoll G, Olleta JL, Sañudo C. Efecto del sexo y del cruzamiento sobre la calidad instrumental y sensorial y sobre la aceptación de la carne de añojos de la raza Avileña-negra ibérica. ITEA. 2011:107(3):239-250 21. Mahmood S, Basarab JA, Dixon WT, Bruce HL. Can potential for dark cutting be predicted by phenotype? Relationship between sex, carcass characteristics and the incidence of dark cutting beef. Can J Anim Sci 2016;(96):19-31. 22. McGilchrist P, Alston CL, Gardner GE, Thomson KL, Pethick DW. Beef carcasses with larger eye muscle areas, lower ossification scores and improved nutrition have a lower incidence of dark cutting. Meat Sci 2012;(92):474–480. 23. Sañudo C, Monsón F, Campo MM, Beltrán JA, Bello JM. Variación del pH en canales comerciales de cordero. En: Casasús-Pueyo I editor. XXXVII Jornadas de estudio y XI Jornadas sobre producción animal. Zaragoza, España 2005:703-705. 24. Hopkins DL, Stanley DF, Martin LC, Toohey ES, Gilmour AR. Genotype and age effects on sheep meat production. 3. Meat quality. Aus J Exp Agric 2007;47(10):11551164. 25. Vestergaard M, Oksbjerg N, Henckel P. Influence of feeding intensity, grazing and finishing feeding on muscle fibre characteristics and meat colour of semitendinosus, Longissimus dorsi and supraspinatus muscles of young bulls. Meat Sci 2000;54(2):177185. 26. Kadim IT, Mahgoub O, Al-Ajmi DS, Al-Maqbaly, RS, Al-Mugheiry SM, Bartolome DY. The influence of season on quality characteristics of hot-boned beef Longissimus thoracis. Meat Sci 2004;66(4):831-836.

785

Rev Mex Cienc Pecu 2021;12(3):773-788

27. Gregory NG. How climatic changes could affect meat quality. Food Research Int 2010;43(7):1866-1873. 28. Chulayo AY, Bradley G, Muchenje V. Effects of transport distance, lairage time and stunning efficiency on cortisol, glucose, HSPA1A and how they relate with meat quality in cattle. Meat Sci 2016;(117):89-96. 29. Grandin T. Return sensibility problems after penetrating captive bolt stunning of cattle in commercial beef slaughter plants. J Am Vet Med Assoc 2002;(221):1258-1261. 30. Cadavez VAP, Xavier C, Gonzales-Barrona U. Classification of beef carcasses from Portugal using animal characteristics and pH/temperature decline descriptors. Meat Sci 2019;(153):94-102. 31. Jacob RH, Surridge VSM, Beatty DT, Gardner GE, Warner RD. Grain feeding increases core body temperature of beef cattle. Animal Prod Sci 2014;(54):444–449. 32. Warner RD, Thompson JM, Polkinghorne R, Gutzke D, Kearney GA. A consumer sensory study of the influence of rigor temperature on eating quality and ageing potential of beef striploin and rump. Animal Prod Sci 2014;(54):396–406. 33. Hargreaves A, Barrales L, Peña I, Larraín R, Zamorano L. Factores que influyen en el pH último e incidencia de corte oscuro en canales de bovinos. Cien Inv Agr 2004;31(3):155-166. 34. Lonergan HE, Zhang W, Lonergan SM. Biochemistry of postmortem muscle - lessons on mechanisms of meat tenderization. Meat Sci 2010;86(1):184-195. 35. Daniel WW, Cross CL. Biostatistics: A foundation for analysis in the health sciences. Tenth edition. New York, NY, USA; 2013. 36. Hahn GL. Dynamic responses of cattle to thermal heat loads. J Anim Sci 1999;77(2):10–20. 37. FAO. Manual de buenas prácticas para la industria de la carne. Organización de las Naciones Unidas para la Agricultura y la Alimentación. Roma, Italia; 2007. 38. HSA. Aturdimiento de animales por perno cautivo. Humane Slaughter Association. Wheat hampstead, Herts. AL4 8AN, UK; 2016. 39. Konica-Minolta. Precise color communication. Konica Minolta Sensing Inc. Japan. 2007.https://www.konicaminolta.com/instruments/knowledge/color/pdf/color_comm unication.pdf. Accessed 21 Aug, 2019. 786

Rev Mex Cienc Pecu 2021;12(3):773-788

40. Pérez-Linares C, Barreras A, Sánchez E, Herrera B, Figueroa-Saavedra F. The effect of changing the pre-slaughter handling on bovine cattle DFD meat. Rev MVZ Córdoba. 2015;20(3):4688-4697. 41. Lattin J, Green PE, Carroll D. Analyzing multivariate data. Pacific Grove, CA, USA. Brooks/Cole Editor; 2003. 42. Hosmer DW, Lemeshow S. Applied logistic regression. 2nd ed. New York, NY, USA. Wiley-Interscience publication; 2000. 43. SAS Inc. Base SAS® 9.4 Procedures Guide: Statistical procedures. 2nd ed. SAS Institute Inc. Cary, NC, USA: 2013. 44. Sánchez E, Navarro C, Sayas ME, Sendra E, Fernández J, Pérez JA. Análisis de diferentes factores que afectan la calidad de la carne: factores intrínsecos y ante mortem. En: Mota D, et al, editores. Bienestar animal. Una visión global en Iberoamérica. 3a ed. Barcelona, España: Elsevier; 2016: 495-510. 45. Garcia LG, Nicholson KL, Hoffman TW, Lawrence TE, Hale DS, Griffin DB, et al. National Beef Quality Audit-2005: Survey of targeted cattle and carcass characteristics related to quality, quantity, and value of fed steers and heifers. J Anim Sci 2008;(86):3533- 3543. 46. Moore MC, Gray GD, Hale DS, Kerth CR, Griffin DB, Savell JW, et al. National beef quality audit–2011: In-plant survey of targeted carcass characteristics related to quality, quantity, value, and marketing of fed steers and heifers. J Anim Sci 2012;90(13):51435151. 47. Donkersgoed JV, Jewison G, Bygrove S, Gillis K, Malchow D, McLeod G. Canadian beef quality audit 1998-99. Can Vet J 2001;(42):121-126. 48. Beef Cattle Research Council. National beef quality audit 2010/11 plant carcass audit. Canadian Cattlemen’s Association; 2013. 49. Tadich N, Gallo C. Echeverría R, Van Schaik G. Efecto del ayuno durante dos tiempos de confinamiento y de transporte terrestre sobre algunas variables sanguíneas indicadoras de estrés en novillos. Arch Med Vet 2003;35(2):171-185. 50. NOM-033-SAG/ZOO-2014. Norma Oficial Mexicana NOM-033-SAG/ZOO-2014, Métodos para dar muerte a los animales domésticos y silvestres. Diario Oficial de la Federación; 2015.

787

Rev Mex Cienc Pecu 2021;12(3):773-788

51. MINAGRI, Reglamento sobre estructura y funcionamiento de mataderos, establecimientos frigoríficos, cámaras frigoríficas y plantas de desposte y fija equipamiento mínimo para tales establecimientos. Diario Oficial. Ministerio de Agricultura de Chile; 2009. 52. Amtmann VA, Gallo C, Van-Schaik G, Tadich N. Relaciones entre el manejo antemortem, variables sanguíneas indicadoras de estrés y pH de la canal en novillos. Arch Med Vet 2006;38(3):259-264. 53. Grandin T. Recommended animal handling guidelines & audit guide: a systematic approach to animal welfare. American Meat Institute Foundation; 2013. 54. Miranda-de-la-Lama GC, Leyva-García IG, Barreras-Serrano A, Pérez-Linares C, Sánchez-López E, Figueroa-Saavedra F, et al. Assessment of cattle welfare at a commercial slaughter plant in the northwest of Mexico. Trop Anim Health Prod 2012;(44):497–504. 55. Méndez-Medina RD, de Aluja AS, Rubio-Lozano MS, Braña-Varela D. Bienestar animal para operarios en rastros de bovinos. 1ª ed. DF, México. SAGARPACONACYT-COFUPRO; 2013. 56. Muñoz D, Strappini A, Gallo C. Animal welfare indicators to detect problems in the cattle stunning box. Arch Med Vet 2012;(44):297-302. 57. Velarde A, Gispert M, Diestre A, Manteca X. Effect of electrical stunning on meat and carcass quality in lambs. Meat Sci 2003;63(1):35-38. 58. Ríos-Rincón FG, Acosta-Sánchez DC. Sacrificio humanitario de ganado bovino e inocuidad de la carne. Nacameh 2008;2(2):106-123. 59. Warris PD. Ciencia de la carne. 1a ed. Zaragoza, España: Editorial Acribia; 2003.

788

https://doi.org/10.22319/rmcp.v12i3.5577 Article

In vitro methane production and fermentative parameters of wild sunflower and elephant grass silage mixtures, either inoculated or not with epiphytic lactic acid bacteria strains

Vilma Amparo-Holguín a,b Mario Cuchillo-Hilario c,d* Johanna Mazabel e Steven Quintero e Siriwan Martens e Jairo Mora-Delgado b

National University of Colombia (UNAL). Palmira, Colombia.

University of Tolima. Livestock Agroforestry System Research Group. Ibagué, Colombia.

Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán. INCMNSZ. Departamento de Nutrición Animal Fernando Pérez-Gil Romo. Ciudad de México, México. d

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores de Cuautitlán. Estado de México, México. e

The Alliance of Bioversity International and CIAT. Cali, Colombia.

*Corresponding author: mario.cuchilloh@incmnsz.mx

Abstract: The present investigation was carried out to determine the extent of the incorporation of Tithonia diversifolia (TD) and the possibility of blending it with Pennisetum purpureum (PP) to obtain the maximum benefit for ensilability and for animal nutrition. Silage mixtures of wild sunflower (TD) and elephant grass (PP) were evaluated based on chemical composition, 789

Rev Mex Cienc Pecu 2021;12(3):789-810

quantification of gas production, methane release and fermentation parameters. The silage blends were arranged in four T. diversifolia / P. purpureum proportions, namely: 100/0; 67/33; 33/67; and 0/100 (fresh weight). Silages with higher proportions of T. diversifolia increased crude protein content, in vitro digestibility while decreasing NDF and ADF fractions (P<0.05). High amounts of T. diversifolia showed the lowest gas production values (160.2 ml), while treatments with higher grass inclusion produced a greater amount of gas up to 194.5 ml. Methane production was higher by increasing the proportion of P. purpureum into the silage blends. The silage inoculum did not have any impact on in vitro gas production (P<0.05). Also, higher proportions of T. diversifolia reduced acidification process while P. purpureum inclusion facilitated lower pH values. Lactic acid bacteria inoculum tended to decrease pH of silages but no clear effects on silage temperature were observed. Silages with high proportions of T. diversifolia (67 % of inclusion) would be more palatable for animals and might also translate into larger animal performance due to greater protein supply and better digestibility than silages with larger proportion of P. purpureum (67 and 100 % of inclusion). Key words: Gas production, Inoculum, Ruminal fermentation, Mexican sunflower, Tropical forage.

Received: 11/12/2019 Accepted:02/11/2020

Introduction The current growing competition between human food production and animal feed resources calls for new animal feed alternatives that do not compromise human food supply. There is a special interest in research on non-conventional forage species that can be offered as hay or silage all year round, particularly at times of feed scarcity as in case of drought or floods(1,2,3). Tithonia diversifolia (TD) is a non-leguminous species that is widely distributed in humid and sub-humid areas of America, Africa, Asia, and in regions close to the tropical and subtropical belts(4,5). It has been described as a multi-purpose shrub with considerable potential for animal production due to its valuable source of protein and high palatability(6,7). Also, low quality tropical forages constitute some of the main factors that limit the development of livestock production systems due to poor animal performance. This is the reason for which high-quality excessive forage produced during the rainy season should be

790

Rev Mex Cienc Pecu 2021;12(3):789-810

preserved as silage(2,8). Considering that TD shows high natural distribution in tropical countries, this underutilized plant can contribute to livestock production if its foliage is conserved as silage(5,9,10). Among tropical forages, some legumes and non-leguminous forbs as TD show better nutritional values than grasses, thus including TD in animal diets favors crude protein content, reduced fiber values and enhance digestibility of feeds(7). Despite the high protein content of TD ranging from 10.3 to 25.6 %(4,5), only a few silage production studies have been conducted to investigate the ensilability potential of TD. Therefore, it is necessary to determine the extent of incorporation of TD and the possibility of blending it with grass to obtain the maximum benefit for animal nutrition and for farmer's households. Appropriate ensiling procedure means that lactic acid fermentation is produced in the absence of oxygen. A rapid acidification normally occurs when a sufficient amount of lactic acid is produced by lactic acid bacteria (LAB) present on the plant surfaces(9,11). In this sense, it is important to improve lactic acidification for achieving a successful fermentation process. This effect can be facilitated by inoculating LAB(12,13). Selected homofermentative lactic acid bacteria have been traditionally developed in temperate countries to favor lactic acidification and to lower pH of silages(8,9,11). However, most of the commercially available strains up to date have a poor performance when they are inoculated to tropical silages(12). Thus, selected epiphytic bacteria seem to be a good alternative for improving fermentative parameters of tropical forages during the ensiling process. Research works have studied epiphytic LAB strains isolated from tropical forage species as promising candidates that could be used as silage additives to overcome the limitations of commercial inoculants and to minimize the nutritional value losses of silage(11,12,14). However, methane emissions studies dealing with silages and LAB additives are also scarce(15). On the other hand, one of the commonly accepted methods for determining animal feed quality is the gas production technique. The in vitro gas production methodology determines the extent and kinetics of feed degradation based on the released gas volume, both directly as a fermentation product and indirectly from neutralization of the ruminal fluid(16,17,18). In this respect, it has been established that accumulated enteric CH4 production in ruminants increases with fermentation time, but also decreases the energy utilization efficiency and contributes to the global greenhouse gas effect(19,20). Methane is produced under anaerobic conditions by rumen microorganisms called methanogenic archaea, which gain energy by reducing CO2 with H2 to form CH4(19,21). Methane production depends primarily upon the quantity and quality of forages consumed by animals(22,23,24). Thus, the mitigation of methane production from ruminants could be achieved by altering their diet(21,25). Previous studies have suggested that increased forage quality decreases the CH4 proportion in the emitted gas, which means reduced emissions per unit of weight gain or per unit of animal product produced as milk or meat due to improvement of animal productivity(22,26,27). Therefore, the 791

Rev Mex Cienc Pecu 2021;12(3):789-810

aim of this study was to evaluate the effect of four different inclusion levels of T. diversifolia (100, 67, 33 and cero %) in mixture with P. purpureum as well as the enrichment or not with an epiphytic or commercial LAB strain. Nutritional quality (DM, CP, NDF, ADF, IVDMD and ash), methane release and ensilability of silages parameters were assessed.

Material and methods Plant material

Samples of TD forage were harvested (40 cm above-ground biomass, including leaves and stems) at pre-flowering stage in February 2014 and 60 d of age. The dry matter of TD at harvest was 17.6 %. The cultivars were located at the experimental farm of the Universidad Nacional de Colombia in Palmira, at 1,000 m asl, 24°C, annual precipitation 1,020 mm, and relative humidity 72 %. Complementary, P. purpureum (PP) was harvested at vegetative stage, 10 cm above ground level and 75 d of age at the same time and location. Dry matter of PP at that age averaged 18.7 %. Plant biomass of TD and PP was collected by hand and was moved to the lab to elaborate forty-eight micro-silos mixtures of one kilogram each. After that, vegetation samples were mechanically chopped into sections of a particle size ranging from two to three cm using an electrical grass chopper (7.5 hp, 1400 rpm; Gaitan).

Silage preparation

Forage material of TD and PP were wilted to 30 % and 35 % dry matter before ensiling. The different silage mixtures were made as follows: TD and PP were arranged in four different proportions. Proportion 1: 100/0; Proportion 2: 67/33; Proportion 3: 33/67; and Proportion 4: 0/100, FM basis. Later, every proportion was either inoculated or not: 1) control sample (no inoculum); 2) epiphytic lactic acid bacteria (LAB) strain T735; and 3) SIL-ALL®4x4, resulting in 12 treatments in total. T-735 is an epiphytic LAB strain (Lactobacilus paracasei) isolated from TD tissue surface and has been tested in previous studies as silage inoculant(9,10). SIL-ALL®4x4 is a commercial inoculum blend of Streptococcus faecium; L. plantarum; Pediococcus acidilactici and L. salivarius. The bacterial inoculum was diluted to apply 1 ml per kg of fresh forage. Each inoculant was previously cultivated as follows: 0.1 ml of an inoculum 4x109 CFU ml-1 cultivated into 10 ml MRS broth at 37 °C for 24 h. The

792

Rev Mex Cienc Pecu 2021;12(3):789-810

forage mixtures of 1,000 g each, were packed in vacuum-packed plastic bags (18.5 cm × 29 cm; Quart micro channel vacuum sealer bags, model No. 30-0101-W, 0.9 L, China) as Rostock Model Silages guidelines(28,29) TD and PP forage mixtures were compressed by hand. Later micro-silos were air evacuated and heat-sealed to assure hermeticity. A vacuum sealer (Westonbrand PRO 2300 stainless steel, Vista, CA, USA) was used to provide the anaerobic conditions to facilitate lactic fermentation and silage acidification. Micro-silos were wrapped up using adhesive tape to avoid deformations of micro-silos because of bloating. Later the polyethylene bags were punctured using disinfected injection needle. Every wrapped bag was placed immediately into a second bag (26 cm × 39 cm; micro channel vaccum sealer bags, model No. 30-0102-W, China) that was air-evacuated under the same conditions. Two additional replicates of samples (~250 g) were filled in smaller bags to be opened after three days of ensiling at 25 °C storage temperature for the determination of DM. Later, micro-silos were stored in darkness for 90 d at room temperature of about 25 °C. At d 90, the bags were opened and pH and temperature were measured. pH was measured using a pH meter (Mettler Toledo, o SevenGo, with pH electrode InLab@ 41356/2mat), disinfecting the electrode with 70% ethanol before each record. Temperature was measured using a digital indoor–outdoor min–max thermometer. A sensor was introduced into the silage material while a second one was used to record the ambient temperature simultaneously. Further, samples were lyophilized and ground in a Thomas Wiley mill laboratory mill rotor model 4 provided with a 1.0 mm mesh screen to perform the test gas. Thus, 12 treatments in total were analyzed, with four replicates, resulting in 48 micro-silos as a hole.

Nutritional value

A set of silage samples was analyzed at the Forage Quality Laboratory at CIAT. The content of dry matter (DM) was determined using a forced air oven at 65 °C until constant weight during 72 h. The following determinations were also made: i) crude protein (CP) by the Micro-Kjeldahl method; ii) insoluble fiber in neutral and acid detergent (NDF and ADF) following the sequence described by Van Soest et al(30); iii) and ether extract (EE) by soxhlet extraction described by Palmquist and Jenkins(31). Tilley and Terry(18) methodology modified by Moore(32) was use to determinate digestibility. The ash content was determined by direct incineration of the dried material in a muffle furnace at 500 °C as per the AOAC official method(33). The analysis was done in the twelve treatments (with the four corresponding repetitions) in triplicate.

793

Rev Mex Cienc Pecu 2021;12(3):789-810

In vitro gas production

The fresh forage underwent a drying process in a conventional oven at a temperature of 65 °C for 72 h. It was then processed in a model 4 Thomas Wiley Laboratory Mill with a 1.0 mm mesh sieve. The ruminal fluid was obtained from two young cannulated Brahman bulls pasturing Cynodon plestotachyus (star grass) and supplemented mineralized salt ad libitum. The cannulated bulls did not have access to feed for an hour before starting the collection of ruminal fluid. Collection of ruminal samples was carried out by hand. Then, it was squeezed through a piece of gauze to extract the solid rumen contents, stored in 2.0 L thermos, and preserved in hot water at 39 °C for about 10 min, to be sent to the laboratory. Then, the ruminal fluid was liquefied for 20 sec and refiltered before transferring it into Erlenmeyer flasks. The ruminal liquor was then saturated with CO2. Following Theodorou et al(17) a digestion medium with some modifications was prepared. Incubation was performed in flasks with a capacity of 160 ml each. To this end, one dried and ground gram of sample was weighed, and 85 ml of digestion medium gassed with CO2 were added. Later, four ml of reducing agent were added (prepared at the time of use by mixing cysteine-HCl (625 mg), 1M NaOH (4 ml) and Na2S • 9H2O (625 mg) in 100 ml distilled water); the rubber lids were placed and secured with metal seals. Lastly, the bottles were cooled in the refrigerator to 4 °C for 24 h. After this period elapsed, the bottles were removed from the refrigerator and placed into a water bath at 39 °C. When the incubation system was at temperature equilibrium, inoculation to each bottle was conducted using 10 ml of ruminal liquor. Together with the samples, six bottles containing only the “digestion medium” were inoculated. These were considered “blanks”, which were used to correct gas production caused by the inoculum fermentation and the medium. To this end, a pressure transducer (Sper Scientific®, USA) connected to a digital reader and a three-way valve were used. The first way was connected to a 22G needle (25 mm x 0.7 mm); the second to the transducer, and the third to a 60 ml syringe. The latter made it possible to measure the volume. Prior to beginning the incubation and fermentation process, all bottles were reset to zero psi, removing any volume produced in the upper section of each bottle. Volume and pressure measurements were performed at 3, 6, 9, 12, 24, 33, 48, 60, 72, 96, 120, and 144 h. After each reading, the bottles were shaken and incubated again in a water bath at 39 °C. On completion of the incubation period, the content of each flask was filtered (filter paper; 5 µm pore size) using a vacuum pump and dried in an oven at 104 °C overnight. Degraded dry matter was calculated as the difference between the sample weight at the beginning of incubation and the weight of the residue on the crucible at the end of incubation. The samples were done in quadruplicate.

794

Rev Mex Cienc Pecu 2021;12(3):789-810

Methane release

The concentration of CH4 in the gas produced was determined at the Greenhouse Gas Laboratory at the International Center for Tropical Agriculture (CIAT) using a Shimadzu GC-2014 gas chromatograph (Shimadzu®, Japan) with a flame ionization detector (FID) at a temperature of 250 °C and an electron capture detector at 325 °C under the following conditions: oven at 80 °C and columns Shimadzu 4mH-D 80/100.07m S-Q and 1.5 P-N. The direct injector operated at room temperature. The carrier gas was nitrogen and column flow rate was 30.83 ml/min. The injection volume was handled by a loop with a capacity of 2 ml. The samples were done in quadruplicate.

Regression model

Different non-linear models were tested and the Gomperztz model was the one that presented the best goodness of fit determined by the Bayesian information criterion (BIC) and Akaike information criterion (AIC) statistics. Thus, a Gompertz equation(34,35,36) was used to model gas accumulation from different mixtures used in the silages, where parameters α, β, and γ, were estimated by non-linear regression analysis using the Infostat software. The following equation (Eq. 1) was employed: Y = α*exp(-β*exp(-β*γ)); Where: Y is equal to the cumulative production of gas at time x, α> 0 is the maximum gas production; parameter β> 0 is the difference between the initial gas and the gas at time x, and parameter γ> 0 describes the specific gas accumulation rate. The practical application of this model requires translating parameters α, β, γ into their biological relevance. For the purposes of this study, the parameters are: time to point of inflection (HIP, hours), gas inflection point (GIP ml), maximum gas production rate (MRGP, ml/h), and lag phase (LP or microbial accommodation h). To estimate the biological parameters, the following formulas were used Eq. 2: HIP = α/γ; Eq. 3: GIP = α/e; Eq. 4: MRGP = (α*γ)/e; and Eq. 5: FL = ((β/γ) - (1/γ)); where e is Euler's number, which equals approximately 2.718281828459.

Statistical analysis

The gas production values were analyzed with the InfoStat program, using the subroutine "Estimation of General and Mixed Linear Models", assuming heterogeneous variances(37). For the general model applied to the factors studied, the proportion T. diversifolia / P.

795

Rev Mex Cienc Pecu 2021;12(3):789-810

purpureum - (TD/PP) in the diet and inoculum were the predictor variables (factors). It was used a two-factor experimental design, where the first factor was the inclusion level of TD in the silages, and the second the type of inoculant used: Yij= μ + PTDi + Ij + PTDij x I + ε ; whereas Y= is the target variable; μ is the overall mean; PTD = proportion of TD in the silage (100, 67, 33 and cero %); I= inoculant (control; T735; SIL-ALL®4x4) and ε= the random experimental error. In the present experiment, twelve treatments in total were evaluated. To perform the statistical analysis, the n value employed was 156, while twelve iterations were used. In turn, different analysis of the variance corresponding to each sampling hour was carried out to show the statistical differences between treatments, and statistical differences were detected by Duncan mean comparisons (α<0.05).

Results The results showed that as the level of inclusion of PP in the silage mixtures increased, lower levels of protein (P<0.05) were obtained (Table 1). This effect was opposite for TD; i.e., larger TD inclusion yielded higher CP contents in the silage mixtures. In 100 and 67 % of T. diversifolia inclusion, CP was superior in silages without inoculum (18.1 and 15.1 %) than both inoculated silages. However, no effects of inoculum on silages with larger inclusion of PP were observed. The values of CP on average for 100, 67, 33 and cero % of TD inclusion were 16.9, 13.4, 8.7 and 5.2 %, respectively. Depicting a negative trend as the inclusion of TD diminished. In contrast, (NDF and ADF) fibers have an opposite response. When TD was ensiled alone; the values were lowest: 36.1 and 25.2 % for NDF and ADF, respectively. However, when TD ensiled at 67 % (41.9 and 29.0), 33 % (44.7 and 33.9) and cero % (58.0 and 38.5) of inclusion, the values of both NDF and ADF increased. Also, the data shows that the inclusion of TD significantly improves IVDMD in comparison to silage with PP at 100 %; e.g TD ensiled alone (67.2 %) was more digestible than PP ensiled alone (63.6 %). The highest rates of fractionated gas (ml/h) from the ensiled mixtures occurred between 9 h and 12 h. Most gas was produced by the 67:33 TD/PP ensiled mixture at 12 h (Figure 1A). Although there were no significant differences with respect to silages prepared exclusively from TD (100:00 TD/PP) and from silages prepared with high proportion of grass (33:67 TD/PP), but there were differences (P<0.05) respect to silages prepared exclusively from PP (00:100 TD/PP). Gas production after 12 h dropped significantly from the previous peak with gas production between 3.2 ml/h and 3.9 ml/h, which means a 50 % drop. The largest effect of the interaction between treatments and inocula on gas production (ml) per hour was observed during the first hours of fermentation (Figure 1B). No great differences were observed after 32 h of observation for the fractionated gas production.

796

Rev Mex Cienc Pecu 2021;12(3):789-810

Figure 1: Gas fractional rate of silage mixtures of Tithonia diversifolia/Pennisetum purpureum either enriched or non-enriched with lactic acid bacteria strains

A= effect of the treatment. B= effect of the inoculum. TD/PP= proportions of Tithonia diversifolia/Pennisetum purpureum [Fresh matter (FM) base]. NI= no inoculum. T-735= is an epiphytic lactic acid bacteria strain. SA= Sil-all is a commercial inoculum blend of lactic acid bacteria.

The results showed lower gas production accumulated at 144 h in silages prepared exclusively from TD (160 ml) compared to the other treatments (Figure 2A). An increased gas production was found in silages prepared exclusively from grass (194 ml). The results of the interaction between the mixture (TD/PP) and inoculum indicate that, regardless of LAB inoculation, silages prepared with a higher inclusion of TD produced a lesser amount of gas, which means that a larger rate of inclusion of PP in the ensiling process increases gas production. The Gompertz equation results indicate that the highest gas production rates were the following: silages prepared exclusively from grass+Silall; silages prepared exclusively from grass+T735; and silages prepared exclusively from grass without inoculum, respectively (Table 2). On the contrary, lower values were reported for the treatments with 797

Rev Mex Cienc Pecu 2021;12(3):789-810

larger proportions of TD [TD/PP: 100/0 and 67/33 % of inclusion, respectively]. An analysis of the accumulative gas revealed that the α parameter, which represents the maximum gas production rate was higher in silages prepared with high proportion of grass and silages prepared exclusively from grass (194.5 and 189.7 mL) where the proportion of grass was the highest. Ensiled mixtures showed increases in the cumulative gas production per gram of dry matter over time. The same occurred with the GIP parameter, where silages prepared with high proportion of grass and silages prepared exclusively from grass (67 and 100 inclusion of PP) showed higher values than the silages prepared exclusively from TD (TD/PP: 100/0) and low proportions of grass (TD/PP: 67/33) (P<0.05). Silages prepared exclusively from grass had the longest time of inflection point (HIP) close to 64 h and the same trend for microbial colonization time (LP; 44.8) with a statistically significant delay versus the rest of the treatments. Figure 2: Cummulative gas production of silages mixture of Tithonia diversifolia/Pennisetum purpureum either enriched or non-enriched with lactic acid bacteria strains

A= effect of the treatment. B= effect of the inoculum. DDM: Degraded dry matter. TD/PP= proportions of Tithonia diversifolia/Pennisetum purpureum [Fresh matter (FM) base]. NI= no inoculum. T-735= is an epiphytic lactic acid bacteria strain. SA= Sil-all is a commercial inoculum blend of lactic acid bacteria. 798

Rev Mex Cienc Pecu 2021;12(3):789-810

Table 2: Parameters of the Gompertz model for the production of gas observed at different levels of inclusion of Tithonia diversifolia (TD) and Pennisetum purpureum (PP) silage mixtures either enriched or non-enriched with lactic acid bacteria strains HPI GIP MRGP Inclusion α β γ (h) (mL) (mL/h) LP (h) TD/PP: 100/0 160.2±1.62c 3.09±0.17c 0.08±0.0a 39.08c 58.93c 4.67a 26.43c TD/PP: 67/33 170.11±1.75b 3.03±0.15c 0.07±0.0b 42.35c 62.58b 4.48a 28.36c TD/PP: 33/67 189.65±1.19a 3.20±0.09b 0.06±0.0c 51.36b 69.77a 4.36a 35.29b TD/PP: 0/100 194.45±1.33a 3.34±0.10a 0.05±0.0d 63.96a 71.53a 3.76b 44.79a TD/PP = proportions of Tithonia diversifolia/Pennisetum purpureum [Fresh matter (FM) base]. α= is the maximum gas production volume; β= is the difference between the initial gas and the gas at time x; γ= describes the specific gas accumulation rate. HPI= time to point of inflection; GIP= gas inflection point; MRGP= maximum gas production rate. LP= lag phase (LP or microbial accommodation).

Analyses were performed of the net production of CH4 from the gas generated at 72 h of incubation of 1 g of silage (Figure 3). The DM degradation ranged between 63.7 % and 64.4 %. It must be noted that at 60 h after start of incubation and close to the inflection point (HIP), approximately from 80 to 88 % of the total gas produced during the experiment was obtained. A lesser amount of methane was produced in silages prepared exclusively from TD (TD/PP: 100/0) in relation to silages prepared with high proportion of grass and silages prepared exclusively from grass (67 and 100 inclusion of PP), but was no significant different from silages prepared with low proportions of grass (TD/PP: 67/33). Larger methane release was observed as the proportion of PP in the blend increased while the lowest methane production was found in silages containing the largest share of TD (100/0 of TD/PP).

799

Rev Mex Cienc Pecu 2021;12(3):789-810

Figure 3: Methane production per gram of dry matter silage (at 70 h) incubated at different levels of inclusion of Tithonia diversifolia/Pennisetum purpureum

TD/PP= proportions of Tithonia diversifolia/Pennisetum purpureum. [Fresh matter (FM) base]. DDM: Degraded dry matter. Different letters in the same column mean significant differences between treatments (P<0.05).

Also, the findings of the experiment indicate the pH tended to diminish as the proportion of PP in the mixtures increased, but no statistical differences were observed (Figure 4). Somehow, the LAB addition decreased the acidification of the silages. Though the extent of the acidification was maximum whit the addition of T735 strain followed by Silall and the control treatment, no statistical differences were obtained. An opposite trend was observed in the temperature parameter, which increased as the proportion of PP in the blends increased, except for silages prepared exclusively from TD (TD/PP: 100/0). Also, no clear effect of the inoculum was observed on silage temperature, however, T735 and Silall, were more effective as the share of PP increased in the silage mixtures (Figure 5; P<0.05).

800

Rev Mex Cienc Pecu 2021;12(3):789-810

Figure 4: pH at opening of Tithonia diversifolia/Pennisetum purpureum silages either enriched or non-enriched with lactic acid bacteria strains

TD/PP= proportions of Tithonia diversifolia/Pennisetum purpureum [Fresh matter (FM) base]. NI= no inoculum. SA= Sil-all is a commercial inoculum blend of lactic acid bacteria. T-735= is an epiphytic lactic acid bacteria strain.

Figure 5: Temperature at opening of Tithonia diversifolia/Pennisetum purpureum silages either enriched or non-enriched with lactic acid bacteria strains

NI= no inoculum. SA= Sil-all is a commercial inoculum blend of lactic acid bacteria. T-735= is an epiphytic lactic acid bacteria strain.

801

Rev Mex Cienc Pecu 2021;12(3):789-810

Discussion Distinct proportions of Tithonia diversifolia (TD) and Pennisetum purpureum (PP) were tested to obtain the maximum benefit for silage making and for animal nutrition. Also, as divergent shares of forages in the silage mixtures determine the neutral detergent fiber (NDF) and crude protein (CP) content, which further shift the methane release parameters. In the present study, increasing the proportion of PP in the silage mixtures decreased the CP and the IVDMD while increasing the NDF and ADF values. This results are in accordance with other studies were the gramineous forages are a source of readily available energy as fermentative carbohydrates but with lower contents of protein ranging from 5 to 11 g/100 g(9,38). As NDF and ADF traits are close related to forage intake and forage digestibility, these findings might have further implications on animal’s performance; i.e. silages with high proportions of TD would be more palatable for animals and might also translate into larger animal performance due to greater protein supply and better digestibility than silages with larger proportion of PP. Therefore, it should be prudent to corroborate these findings on in vivo models. Also, during the ruminal fermentation process, the plant material is colonized by ruminal microorganisms causing different degradation rates depending on the concentration of structural carbohydrates. It is recommended that at the beginning of the ensiling process, should not be a limitation of carbohydrates to initiate the fermentation process; as in the case of silages with high proportion of PP. When acidification takes place, there is a depletion of substrates for LAB metabolism and stabilization phase of silage starts(8). Despite, a rapid acidification of silages is highly desirable and it is promoted by using high shares of grasses in the silage mixtures. The protein content is another parameter that deserve a special attention because most of the conserved materials for animal feeding show low values of this component(6). Here, this problem is clearly overcome with the use of TD in the blends. The most significant effects were observed when TD was included in larger proportions (TD/PP: 100/0 and 67/33), as this forage is a source of crude protein in the evaluated silages. However, this effect is negligible on treatments with larger proportion of grass in the silage mixtures (TD/PP: 33/67 and 0/100). This finding might be useful to discriminate the use the LAB for silage acidification. High proportion of PP in silage mixtures might not require LAB addition to produce favorable conditions to facilitate lactic acid fermentation and to preserve moderate content of crude protein. On the contrary, forage blends, which need to preserve a considerable crude protein content, should be highly desirable to use LAB to prevent proteolysis.

802

Rev Mex Cienc Pecu 2021;12(3):789-810

During fermentation, ruminal microorganisms and their enzymes first attack easily fermentable carbohydrates. Thus, gas production after the first 12 h was significantly reduced in relation to the first hours after ensiling. It is evident that in the early hours of fermentation a portion of the substrate containing soluble sugars ferments immediately; soluble sugars, however, generally represent only a small portion of potentially digestible materials(2). After that, with colonization of fiber by cellulolytic bacteria and their degradation, an increase of gas production is achieved. In the derivation of the Gompertz equations, an increase of gas production was observed over time. The behavior of the cumulative gas production was characterized by an increase in the exposure time of the plant material from silages to microorganism attack. Bezabih et al(23) suggest that this increase can be interpreted as an increase in microbial activity per unit of feed, but it does not involve any assumptions on the constancy of microbial growth yield. The substrate degradation rate reduction is possibly related to the higher amount of cell wall in silage after the inflection point (HIP), further decreasing the fractional growth rate and consequently reducing microbial yield. In the maximum gas production rate parameter no significant differences were observed among silages prepared exclusively from TD (TD/PP: 100/0), silages prepared with low proportions of grass (TD/PP: 67/33), and silages prepared with high proportion of grass (TD/PP: 0/100). However, differences were significant compared to silages prepared exclusively from grass, which is presumably related to the higher digestibility of the proteinaceous material (24) represented in TD. Besides, lower gas production is related to propionic fermentation as in the case of silage prepared exclusively from TD. To build a propionic acid molecule it is necessary H2. In comparison with propionic acid, acetate and butyric acid production release H2(16). Therefore, larger proportion of PP in the silage mixtures would lead to butyric and acetic fermentation which is associated to higher CO2 and methane production. This would have direct implication on animal performance, since propionic fermentation would promote better animal performance due to better efficiency on energy utilization of feeds. It is highly advisable to link the in vitro findings of methane emissions of this study to aim high animal productivity while mitigating methane production. In contrast to the proportion of TD and PP in the mixtures that modified methane release and fermentation indicators, LAB additives did not change these parameters. A reason for this observation, is that LAB has the major impact at the beginning of the fermentation process with an important impact on readily digestible carbohydrates to facilitate silage acidification, but this effect stopped during the stabilization phase of silage with no further effects on other chemical components as NDF or ADF; thus null impact on methane release was observed(8). This finding is in line with the results of Bureenok et al(11) whom reported no reduction of NDF content in PP silages treated with LAB additives with respect to untreated silages. Additionally, such authors indicated that addition of a rich source of readily fermentable carbohydrates modified NDF content by a dilution effect and by means of improving lactic fermentation(11).

803

Rev Mex Cienc Pecu 2021;12(3):789-810

It is important to note that microbial growth yield vary with factors such as microbial population, pH, and availability of N substrates(13). It is clear that these factors can change over the incubation period. The findings indicate that in only-grass silage, methane production is high but may diminish as the inclusion of TD increases. This is consistent with data reported by La O et al(38) who in fresh forage TD/PP mixtures found a declining methane production (166.5, 150.3, and 84.2 mL/g) by adding TD in the blends (15, 30, and 100 %, respectively). Clearly, the values obtained from this study were higher (up to 204 mL/g) than those obtained by the above authors. Forages with a high cell wall content represent low quality feed, thus, depending on quality and diet composition, about from 2 to 12 % of feed gross energy (GE) could be emitted in the form of CH4(16,21). The use of gramineous forages as PP seems to increase the release of methane. Therefore, the benefits for animal production from TD seems to be the nitrogenous content and larger extent of digestibility. However, this should be balanced due to the buffer capacity as acidification is lower in silages with larger proportion of gramineous species that would compromise ensilability of forages(10,12). Thus, the use of high proportions of TD in the silage mixtures would increase buffer capacity(12). This effect would be maximized if high protein content is observed and buffering ability of the amino groups is activated. An associated factor that should be taken into account is that buffer capacity is improved with high amounts of ammonia (NH3) due to deamination of protein. Additionally, high fiber content of forages has been also related to high buffer capacity, since the ability of fiber components to exchange cation during ensiling process may affect forage buffer capacity. Also, high temperature of silages at opening is related to microbial activity. This effect was more evident in silages with superior shares of PP in the silage mixtures. Increase of the temperature might further impact aerobic stability of silages after exposure of preserved material to oxygen during the opening of the silo(1,8).

Conclusions and implications Silages with higher proportions of Tithonia diversifolia increased crude protein content, in vitro digestibility while decreasing NDF and ADF fractions. Low amounts of TD showed the lowest gas production values, while treatments with higher grass inclusion produced a greater amount of gas. Methane production was higher by increasing the proportion of Pennisetum purpureum into the silage blends. The silage inoculum did not have any impact on in vitro gas production. Higher proportions of TD decreased acidification process while PP inclusion facilitated lower pH values. Lactic acid bacteria inoculum tended to decrease pH of silages but no clear effects on temperature were observed. Silages with high proportions of T. diversifolia (67 % of inclusion) would be more palatable for animals and might also translate into larger animal performance due to greater protein supply and better digestibility than

804

Rev Mex Cienc Pecu 2021;12(3):789-810

silages with larger proportion of P. purpureum (67 and 100 % of inclusion). Therefore to corroborate should be prudent these findings on in vivo models.

Conflict of interest

The authors declare that they have no competing interests.

Acknowledgements

To the International Center for Tropical Agriculture (CIAT) and the University of Tolima for the financial support. The technical support of Patricia Avila and Orlando Trujillo from the Forage Quality Laboratory of CIAT is greatly acknowledged.

Literature cited: 1. Muck RE, Nadeau EMG, McAllister TA, Contreras-Govea FE, Santos MC, Kung L. Silage review: Recent advances and future uses of silage additives. J Dairy Sci 2018;101(5):3980-4000. 2. Martens SD, Korn U, Roscher S, Pieper B, Schafft H, Steinhöfel O. Effect of tannin extracts on protein degradation during ensiling of ryegrass or lucerne. Grass Forage Sci 2019;74(2):284-296. 3. Rao I, Peters M, Castro A, Schultze-Kraft R, White D, Fisher M, et al. LivestockPlus: sustainable intensification of tropical forage-based systems for improving livelihood and environmental benefits. Trop Grassl - Forr Trop 2015;3(2):59-82. 4. Holguín VA, Ortiz Grisalez S, Velasco Navia A, Mora-Delgado J. Multi-criteria evaluation of 44 introductions of Tithonia diversifolia (Hemsl.) A. Gray in Candelaria, Valle del Cauca. Rev Med Vet Zoot 2015;6257-72. 5. Mauricio RM, Ribeiro RS, Silveira SR, Silva PL, Calsavara L, Pereira LG, et al. Tithonia diversifolia for ruminant nutrition. Trop Grassl-Forr Trop 2014;2(1):82-84.

805

Rev Mex Cienc Pecu 2021;12(3):789-810

6. Vega GE, Sanginés GL, Gómez GA, Hernández BA, Solano L, Escalera VF, et al. Reemplazo de alfalfa con Tithonia diversifolia en corderos alimentados con ensilado de caña de azúcar y pulidura de arroz. Rev Mex Cienc Pecu 2019;10(2):267-282. 7. Ribeiro RS, Terry SA, Sacramento JP, Silveira SRE, Bento CBP, da Silva EF, et al. Tithonia diversifolia as a supplementary feed for dairy cows. PLoS One 2016;11(12):e0165751. 8. Wilkinson JM, Muck RE. Ensiling in 2050: Some challenges and opportunities. Grass Forage Sci 2019;74(2):178-187. 9. Holguín VA, Cuchillo HM, Mazabel J, Martens SD. In-vitro assessment for ensilabillity of Tithonia diversifolia alone or with Pennisetum purpureum using epiphytic lactic acid bacteria strains as inocula. Acta Sci Anim Sci 2018;40. e37940 1-7. 10. Holguín VA, Cuchillo HM, Mazabel J, Quintero S, Mora DJ. Effect of a Pennisetum purpureum and Tithonia diversifolia silage mixture on in vitro ruminal fermentation and methane emission in a RUSITEC system. Rev Mex Cienc Pecu 2020;11(1):19-37. 11. Bureenok S, Yuangklang C, Vasupen K, Schonewille JT, Kawamoto Y. The effects of additives in napier grass silages on chemical composition, feed intake, nutrient digestibility and rumen fermentation. Asian-Australas J Anim Sci 2012;25(9):12481254. 12. Heinritz SN, Martens SD, Avila P, Hoedtke S. The effect of inoculant and sucrose addition on the silage quality of tropical forage legumes with varying ensilability. Anim. Feed Sci Technol 2012;174(3-4):201-210. 13. Martens SD, Hoedtke S, Avila P, Heinritz SN, Zeyner A. Effect of ensiling treatment on secondary compounds and amino acid profile of tropical forage legumes, and implications for their pig feeding potential. J Sci Food Agr 2014;94(6):1107-1115. 14. Rabelo CHS, Basso FC, Lara EC, Jorge LGO, Härter CJ, Mari LJ, et al. Effects of Lactobacillus buchneri as a silage inoculant or probiotic on in vitro organic matter digestibility, gas production and volatile fatty acids of low dry-matter whole-crop maize silage. Grass Forage Sci 2017;72(3):534-544. 15. Macome FM, Pellikaan WF, Schonewille JT, Bannink A, van Laar H, Hendriks WH, et al. In vitro rumen gas and methane production of grass silages differing in plant maturity and nitrogen fertilisation, compared to in vivo enteric methane production. Anim Feed Sci Technol 2017;23096-102.

806

Rev Mex Cienc Pecu 2021;12(3):789-810

16. Posada SL, Noguera RR. Técnica in vitro de producción de gases: Una herramienta para la evaluación de alimentos para rumiantes (In vitro technique of gas production: A tool for feed assesment for ruminants). Livest Res Rural Dev 2005;17Art. #36. 17. Theodorou MK, Williams BA, Dhanoa MS, McAllan AB, France J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim Feed Sci Technol 1994;48(3):185-197. 18. Tilley JMA, Terry RA. A two stage technique for in vitro digestion of forage crops. Grass Forage Sci 1963;18104-111. 19. Albores-Moreno S, Alayón-Gamboa JA, Miranda-Romero LA, Alarcón-Zúñiga B, Jiménez-Ferrer G, Ku-Vera JC, et al. Effect of tree foliage supplementation of tropical grass diet on in vitro digestibility and fermentation, microbial biomass synthesis and enteric methane production in ruminants. Trop Anim Health Prod 2019;51(4):893-904. 20. Ku-Vera JC, Valencia-Salazar SS, Piñeiro-Vázquez AT, Molina-Botero IC, ArroyaveJaramillo J, Montoya-Flores MD, et al. Determination of methane yield in cattle fed tropical grasses as measured in open-circuit respiration chambers. Agric Forest Meteorol 2018;258:3-7. 21. Haque MN. Dietary manipulation: a sustainable way to mitigate methane emissions from ruminants. J Anim Sci Technol 2018;60(1):15. 22. Vélez OM, Gaona RC, Guerrero HS. Propiedades antimetanogénicas in vitro de algunas plantas adaptadas a las condiciones de sabana inundable del Departamento de Arauca, Colombia. (In vitro antimethanogenic properties of some plants adapted to the floodable savanna conditions of Arauca Department, Colombia). Trop Subtrop Agroecosyst 2015;18(3):335-345. 23. Bezabih M, Pellikaan WF, Tolera A, Khan NA, Hendriks WH. Chemical composition and in vitro total gas and methane production of forage species from the Mid Rift Valley grasslands of Ethiopia. Grass Forage Sci 2014;69(4):635-643. 24. Navarro-Villa A, O'Brien M, López S, Boland TM, O'Kiely P. In vitro rumen methane output of grasses and grass silages differing in fermentation characteristics using the gas-production technique (GPT). Grass Forage Sci 2013;68(2):228-244. 25. Patra AK. Recent advances in measurement and dietary mitigation of enteric methane emissions in ruminants. Front Vet Sci 2016;3(39).

807

Rev Mex Cienc Pecu 2021;12(3):789-810

26. Gemeda BS, Hassen A. In vitro fermentation, digestibility and methane production of tropical perennial grass species. Crop Pasture Sci 2014;65(5):479-488. 27. Patra A, Park T, Kim M, Yu Z. Rumen methanogens and mitigation of methane emission by anti-methanogenic compounds and substances. J Anim Sci Biotecnol 2017;8(1):13. 28. Hoedtke S, Zeyner A. Comparative evaluation of laboratory-scale silages using standard glass jar silages or vacuum-packed model silages. J Sci Food Agric 2011;91(5):841-849. 29. Pieper B, Hoedtke S, Wensch-Dorendorf M, Korn U, Wolf P, Zeyner A. Validation of the Rostock fermentation test as an in vitro method to estimate ensilability of forages using glass jar model silages as a basis for comparison. Grass Forage Sci 2016;72(3):568-580. 30. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74(10):3583-3597. 31. Palmquist DL, Jenkins TC. Challenges with fats and fatty acid methods. J Anim Sci 2003;81(12):3250-3254. 32. Moore JE. Procedures for the two-stage in vitro digestion of for ages. In: Nutrition research techniques for domestic and wild animals, Harris LE, editor. Vol. 1. Utah State Univ., Logan. 1970. 33. AOAC, Determination of ash in animal feed. Official method 942.05. 18th edition (Chapter 4) ed.; Association of Official Analytical Chemists: Gaithersburg, DC. USA. 2005. 34. France J, Dijkstra J, Dhanoa MS, Lopez S, Bannink A. Estimating the extent of degradation of ruminant feeds from a description of their gas production profiles observed in vitro:derivation of models and other mathematical considerations. Br J Nutr 2000;83(2):143-150. 35. Schofield P, Pitt RE, Pell AN. Kinetics of fiber digestion from in vitro gas production. J Anim Sci 1994;72(11):2980-2991. 36. García II, Mora-Delgado J, Estrada J, Piñeros R. Kinetics of gas production of fodder of Moringa oleifera Lam grown in tropical dry forest areas from Colombia. Agrofor Syst 10.1007/s10457-019-00409-0 2019.

808

Rev Mex Cienc Pecu 2021;12(3):789-810

37. InfoStat. InfoStat, versión 2008, Grupo InfoStat, FCA, Universidad Nacional de Córdoba, Argentina. 2008. 38. La OO, Valenciaga D, González H, Orozco A, Castillo Y, Ruíz O, et al. Effect of the combination of Tithonia diversifolia and PP vc. Cuba CT-115 in the kinetics and gas production in vitro. (In spanish) Efecto de la combinación de Tithonia diversifolia y PP vc. Cuba CT-115 en la cinética y producción de gas in vitro. Rev Cubana Cienc Agrí 2009;43149-152.

809

Rev Mex Cienc Pecu 2021;12(3):789-810

Table 1: Nutritive value of Tithonia diversifolia (TD) and Pennisetum purpureum (PP) silage mixtures either enriched or non-enriched with lactic acid bacteria strains ADM CP NDF ADF IVDMD Treatments Inoculum (%±EE) (%±EE) (%±EE) (%±EE) (%±EE) ASH (%±EE) d b f e a TD/PP: 100/0 T-735 88.0±0.3 16.8±0.4 34.9±0.7 23.1±0.7 68.9±0.6 13.2±0.2de Silall 88.3±0.3cd 15.9±0.4bc 34.7±0.7f 24.4±0.7e 68.8±0.6 a 13.3±0.2bcde Control 88.9±0.3c 18.1±0.4a 38.6±0.7e 28.1±0.7d 63.9±0.6 d 14.1±0.2a Average 88.4±0.2b 16.9±0.3d 36.1±0.4a 25.24±0.7a 67.2±0.3b 13.5±0.1ab TD/PP: 67/33 T-735 87.9±0.3de 12.7±0.4d 40.8±0.7d 28.3±0.7cd 68.3±0.6ab 13.2±0.2cde Silall 87.2±0.3e 12.3±0.4d 41.7±0.7cd 28.7±0.7cd 66.6±0.6 c 12.9±0.2e Control 87.8±0.3de 15.1±0.4c 43.3±0.7c 30.0±0.7c 66.7±0.6 c 13.6±0.2abcd Average 87.6±0.2 a 13.4±0.3c 41.9±0.4b 29.0±0.4b 67.2±0.3b 13.2±1.2a TD/PP: 33/67 T-735 88.5±0.3cd 8.6±0.4e 49.1±0.7b 33.4±0.7b 65.8±0.6c 13.9±0.2a Silall 89.1±0.3bc 9.0±0.4e 41.7±0.7cd 34.0±0.7b 67.1±0.6bc 12.9±0.2e Control 88.4±0.3cd 8.4±0.4e 43.3±0.7c 34.4±0.7b 67.4±0.6abc 13.6±0.2 abcd Average 88.7±0.2b 8.7±0.3b 44.7±0.4c 33.9±0.4c 66.8±0.3b 13.5±0.1ab TD/PP: 0/100 T-735 89.9±0.3ab 5.3±0.4f 57.3±0.7a 38.1±0.7a 64.0±0.6d 13.7±0.2ab Silall 89.8±0.3ab 5.1±0.4f 57.9±0.7a 38.3±0.7a 63.0±0.6d 14.0±0.2a a a a d Control 90.6±0.3 5.1±0.4f 58.9±0.7 39.1±0.7 63.8±0.6 13.7±0.2abc Average 90.1±0.2c 5.2±0.3a 58.0±0.4d 38.5±0.4d 63.6±0.3a 13.8±0.1b TD/PP = proportions of Tithonia diversifolia/Pennisetum purpureum [Fresh matter (FM) base]. ADM: analytical dry matter; CP: crude protein; NDF: neutral detergent fiber; ADF: acid detergent fiber; IVDMD; In vitro dry mater digestibility. T-735= is an epiphytic lactic acid bacteria strain. Sil-all is a commercial inoculum blend of lactic acid bacteria.

810

https://doi.org/10.22319/rmcp.v12i3.5720 Article

Phases of development and propagation of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray

Julián Esteban Rivera-Herrera a* Tomás Ruíz-Vásquez b Julián Chará-Orozco a Juan Florencio Gómez-Leyva c Rolando Barahona-Rosales d

Centro para la Investigación en Sistemas Sostenibles de Producción Agropecuaria – CIPAV. Carrera 25 # 6 – 62 Cali, Colombia. a

Instituto de Ciencia Animal, San José de las Lajas. La Habana, Cuba.

Instituto Tecnológico de Tlajomulco, TecNM. Laboratorio de Biología Molecular. Jalisco, México. d

Universidad Nacional de Colombia, Sede Medellín, Colombia.

*Corresponding author jerivera@fun.cipav.org.co

Abstract: The efficient propagation of plant species with high food potential plays a fundamental role in their adoption and use by producers. It is important, therefore, to develop economical and rapid methods for the successful establishment of more productive systems. In order to know some reproductive aspects of different outstanding genotypes of T. diversifolia and thus favor its propagation and improve its use in animal feeding, its germination potential, seed production and duration of the reproductive cycle were evaluated. Forty-two (42) plots were used in a randomized complete block design with seven genotypes of T. diversifolia and two levels (without and with fertilization). Genotypes had differences in all agronomic and seed production variables except for achene drying time and rudimentary seed percentage (P<0.01). In relation to the production of true seed, fertilization had a significant effect (P<0.05) and, in general,

811

Rev Mex Cienc Pecu 2021;12(3):811-827

increased the time of the phases evaluated. The highest seed production occurred in genotypes 7 and 5 and the percentage of germination had significant differences between genotypes and between pre-germinative treatments (P= 0.0001) with higher percentages in genotypes 3 and 6. It is concluded that despite the low viability of the true seed of T. diversifolia, there are genotypes with a greater potential for seed production and germination percentage, parameters that can be improved by means of pre-germinative treatments and the use of fertilizers. Key words: Reproductive phase, Germination, Plant propagation, True seed, Seed viability.

Received: 26/06/2020 Accepted:28/10/2020

Introduction The inclusion of high-protein forage plants with low fiber content in the diet of bovines results in an increase in the quality of forage biomass, which, in turn, results in an increase in milk and meat production(1,2). For this reason, an adequate and efficient propagation should be an objective of study to improve their use. Tithonia diversifolia (Hemsl.) A. Gray is a shrub of the Asteraceae family that, due to its ability to adapt to multiple environmental, edaphic and handling conditions, capacity for regrowth and rapid growth, and high value and nutritional contribution, has demonstrated its potential for animal feeding(3,4,5). T. diversifolia can reproduce by both gamic seed and asexual seed, giving it great capacity for reproduction and colonization of new habitats(6,7). This species flowers and produces seeds throughout the year, especially in October and November, although due to environmental conditions it can be of annual flowering(8,9). However, some studies have reported germination percentages of less than 30 % under natural conditions(7,10). Although field observations indicate that T. diversifolia has a great capacity to grow clonally(6), it is now known that material from true seed can favor the development of more extensive root systems, more vigorous plants, greater persistence of crops and faster recovery after cutting or grazing(11). Nevertheless, it is still difficult to reach seminal material of good quality, and additionally, within this species there are genotypes with different germination capacities(11,12). When studying the development of microsporogenesis, chromosomal abnormalities are recognized in 32 % of cells in metaphase I and anaphase I, identifying lagging chromosomes. On the other hand, the

812

Rev Mex Cienc Pecu 2021;12(3):811-827

reasons for the sterility of pollen in Tithonia could converge on the irregularities observed in its meiotic division(13). In order to know some reproductive aspects of outstanding genotypes of T. diversifolia in Colombia and thus favor its propagation and better use towards animal feeding, the potential for germination, production of viable seeds and duration of the growth phases were evaluated.

Material and methods Genotypes evaluated

Seven outstanding genotypes of T. diversifolia, for animal feeding, previously identified in a genetic diversity analysis(14) and collected at different sites in Colombia, were evaluated.

Location

The measurements were carried out in experimental plots located in the municipality of San Luis de Cubarral (Meta, Colombia), at 3°47'21.43"N, 73°49'15.93"W and at a height above sea level of 530 m. The site has an average annual rainfall of 4,100 mm, an average temperature of 24.8 ºC and is located in the tropical rainforest life zone (bh-T)(15).

Measurement of environmental conditions

During the entire sampling period, the environmental variables of precipitation (mm), temperature (ºC), relative humidity (%), solar radiation (W/m2), dew point (ºC), wind speed (m/s) and THSW index (thermal sensation due to wind, relative humidity, irradiance [instantaneous solar radiation] and temperature [ºC]) were monitored by means of a Vantage Pro 2TM (Davis ®) weather station.

813

Rev Mex Cienc Pecu 2021;12(3):811-827

Soil analysis

The chemical and physical variables of pH, E.C. (dS/m), field capacity (%), permanent wilting point (%), bulk density (g/cc), organic carbon (%), organic matter (%), texture, exchangeable potassium (mg/kg), exchangeable calcium (mg/kg), exchangeable magnesium (mg/kg), exchangeable sodium (mg/kg), exchangeable acidity (mg/kg), iron (mg/kg), manganese (mg/kg), copper (mg/kg), zinc (mg/kg), boron (mg/kg), phosphorus (mg/kg), sulfur (mg/kg) and the C.E.C. (meq/100 g), were determined in the soil where the experimental plots were located.

Growth and reproduction variables

The variables of duration of the vegetative phase (days), duration of the reproductive phase (days), duration of drying of achenes (days), flowering phase (days), flower heads per plant (#), seeds per flower head (#), seeds per plant (#), full seeds (%), empty seeds (%) and rudimentary seeds (%) were measured in the seven genotypes evaluated. The duration of the vegetative phase was determined from the moment of the uniformization cut in which the plants were pruned to 15 cm in height until the beginning of flowering of more than 50 % of the individuals that made up the experimental plots; the duration of the reproductive phase was from the moment of the appearance of flower buds until the fall of petals in 50 % of the plants; the duration of drying of achenes was from the fall of petals in the plants until achieving a dark brown color of flower heads, and the flowering phase was the sum of the vegetative, reproductive and achene drying phases. The variables of flower heads per plant (#), seeds per flower head (#), seeds per plant (#), full seeds (%), empty seeds (%) and rudimentary seeds (%) were measured manually and in five plants chosen at random from each of the experimental plots from the calculation of the sample size, assuming a maximum accepted estimation error and confidence level of 10 %. The crop evaluated was 13 months old and the measurements were made in the rainy season during the second period of 2019.

Germination of the true seed

Two pre-germinative treatments and one treatment without prior process (Treat 1) were evaluated. The pre-germinative treatments were: water at 80 ºC for 10 min (Treat 2)(16,17,18), and 50 % sulfuric acid (H2SO4) for 5 min (Treat 3)(19). The seed was stored for four months after being collected with the aim of decreasing the physiological dormancy of the seed(17,20), and germination was evaluated in pots for 25 d using 50 seeds per site.

814

Rev Mex Cienc Pecu 2021;12(3):811-827

Experimental design and information analysis

The seven genotypes of T. diversifolia were established in experimental plots in a randomized complete block design with two factors (genotype and fertilization level). Each material had three repetitions which were made up of 36 plants each (0.8 m x 0.8 m) and two levels of fertilization (zero fertilization and fertilization according to the extraction of nutrients at 40 days of growth). According to evaluations, 40-day-old T. diversifolia plants extract 8.26 g of nitrogen, 4.3 g of potassium and 1.07 g of phosphorus(21). This amount of nutrients was applied by fertilizing with urea (46 % of N), diammonium phosphate (DAP) ((NH4)2HPO4) (46 % of P2O5, 18 % of N) and potassium chloride (KCl, K2O from 60 to 63 % and Cl from 45 to 47 %) at a rate of 16.22, 2.15 and 4.89 g/plant of urea, DAP and KCl, respectively. Germination evaluations were also analyzed under the same experimental design, assigning pots according to the plots arranged in the field. The mathematical model of the experimental design was: yklj =μ+αk+γl +ξkl+ξkl+βj+ǫklj Where: yklj = Observation in the experimental unit of the variable to be evaluated; μ = it is the mean of the general effect; αk = effect of the factor k (collected materials 1, 2, 3...7); γl = effect of factor l (fertilization level 1, 2...); βj = effect of block j; ξkl = interaction of the two factors; ǫklj = random value, experimental error of the experimental unit lkj. All analyses were performed in the RStudio tool using the library “agricolae”(22). For the analyses, normality, homogeneity of variance and additivity were evaluated, in addition, when the difference between the means was identified, the Tukey contrast test was used, with a significance level of 0.05. Finally, in the variables of reproductive phase and full seeds, when the data sets did not meet the conditions for a parametric analysis, the Kruskal-Wallis and Mann-Whitney test was used for comparisons.

815

Rev Mex Cienc Pecu 2021;12(3):811-827

Results Environmental conditions

Figure 1 shows the environmental conditions observed during the evaluation period. According to the records obtained at the experimentation site, the average temperature was 23.9 ± 1.2 ºC, the relative humidity was 83.4 ± 5 %, the average dew point was 20.8 ± 0.6 ºC, the wind speed was 0.7 ± 0.2 m/sec, the average THSW index was 26.7 ± 2.1 ºC, solar radiation 147 ± 53.3 W/m2 and the accumulated precipitation was 556.2 mm. Figure 1: Environmental conditions observed during the experimental period

The main chemical and physical characteristics of the soils where the experimental plots were located are shown in Table 1. The soils were acidic and presented low fertility due to limited supply of nutrients, characteristics usually found under tropical conditions.

816

Rev Mex Cienc Pecu 2021;12(3):811-827

Table 1: Chemical and physical characteristics of soil Item Block 1 Block 2 Block 3 pH 4.71 4.73 4.67 EC (dS/m) 0.07 0.06 0.06 Field capacity, % 18.5 15.8 13.8 Permanent wilting point, % 9.25 7.90 6.91 Bulk density, g/cc 1.51 1.46 1.44 Organic carbon, % 1.02 0.88 0.62 Organic matter, % 1.76 1.52 1.07 Sand, % 68 60 50 Silt, % 12 16 18 Clay, % 20 24 32 loam - clay loam - clay loam - clay Texture sandy sandy sandy Exchangeable potassium, 23.4 23.4 15.6 mg/kg Exchangeable calcium, mg/kg 274 130 132 Exchangeable magnesium, 24.0 16.8 18.1 mg/kg Exchangeable sodium, mg/kg 23.2 18.4 16.1 Exchangeable acidity, mg/kg 218 219 172 Iron, mg/kg 305 358 459 Manganese, mg/kg 9.6 6.0 3.3 Copper, mg/kg 1.1 0.75 0.53 Zinc, mg/kg 0.7 0.4 0.4 Boron, mg/kg 0.11 0.17 0.13 Phosphorus, mg/kg 7.6 3.7 5.5 Sulphur, mg/kg 7.8 9.6 3.6 CEC, meq/100 g 3.64 3.35 2.82 pH= potential of hydrogen; EC= electrical conductivity; mg= milligrams; kg= kilograms; CEC= cation exchange capacity.

Development phases

The genotypes evaluated had significant differences in all the variables of development (P<0.05), except for the drying time of achenes and the percentage of rudimentary seeds (P>0.05) (Table 2). Genotype 1 was the material that had the longest time (140.1 d) in the sum of the growth and development stages (flowering phase) and genotype 4 was the one that presented the shortest times (127.2 d) with significant differences (P<0.001). In relation to the production of true seed, fertilization had an effect (P<0.001) by generating 2.14 times more seeds, and in general increased the time of the phases evaluated by approximately 5 d. Genotypes 5 and 7 were the materials with the highest production of 817

Rev Mex Cienc Pecu 2021;12(3):811-827

flower heads per plant, the highest percentage of full seeds and presented the highest number of seeds per plant, this probably associated with their higher number of branches. Similarly, the high percentage of empty seeds in all genotypes, as well as rudimentary seeds, is highlighted, which determine that more than 30 % of seeds do not have physical viability.

Germination

Table 3 presents the percentage of germination of the true seed of the genotypes evaluated with the three pre-germinative treatments used. According to the results obtained, there were significant differences between genotypes and treatments (P= 0.0001). On average, the germination percentages were 46.87, 53.53 and 25.97 for the control treatment, use of water at 80 ºC and 50 % sulfuric acid, respectively, and this process began three days after sowing. Seed germination without treatment was significantly lower in genotype 1 compared to the other 6 genotypes (P<0.0001). In addition, this same material had the lowest values when the treatment with water and the treatment with sulfuric acid were used, although it did not have significant differences with genotypes 2 and 7. On average, fertilization increased the germination of the different genotypes by 9.2 % and the treatment that achieved greater germination was the use of water at 80 ºC and the treatment with less germination was the one that used sulfuric acid. In general, genotypes 3 and 6 were the ones with the highest percentage of germination, but only had significant differences compared to genotype 1.

Discussion

Knowing the phenology of shrub species and their potential for propagation allow not only to achieve greater use, but also a more efficient and economical use. The results of the times of each of the phases evaluated coincide with what was reported by Saavedra(23). In general, the times of growth and development were modified by fertilization, probably due to the decrease of some stress factors. An adequate use of fertilization favors seed production and generates better development(24). Saavedra(23), when evaluating three origins of T. diversifolia, found a very similar duration of the development process among the materials, with a duration of vegetative development between 88 and 137 d, the flowering process between 18 and 22 days, and a fruit formation between 13 and 18 d. As for the full, empty and rudimentary seeds, this same author found values between 65

818

Rev Mex Cienc Pecu 2021;12(3):811-827

and 75 %; 15.75 to 26 % and 9.31 to 12 %, respectively, similar to those of the present study.

Seed production for T. diversifolia has also been determined by different authors. In a study in Africa, it was found that this species can produce between 35 and 212 capitula per plant, between 32 and 62 seeds per capitulum, between 1,120 to 13,144 seeds per plant and that 1,000 seeds weigh between 6.42 and 7.5 g. These results show great variability in this species, and the results agree with those found in this evaluation, except for the number of seeds per capitulum, since in this study a higher number was identified(7).

Seed production was related to the number of branches, which favors a greater production of flower buds. The handling at the time of cutting, such as the height of pruning, favors a greater number of branches and biomass production(25,26). T. diversifolia can reproduce by both gamic seed and asexual seed, which gives it great capacity for reproduction and colonization of new habitats(7,27). This species flowers and produces seeds throughout the year, especially in October and November, although due to environmental conditions it can be annual(8,9). Mature plants produce 80,000 to 160,000 seeds per square meter annually, of which 70 % fully develop, but germination percentages below 30 % under natural conditions have been reported(7,10), as occurred in genotypes 1 and 5 of the present study.

The results found in this study indicate that the germination of T. diversifolia during the first months of postharvest is acceptable, although variable between genotypes. Some authors highlight that this variability may be due to physiological dormancy(20) and irregularities observed in its meiotic division(10,13,28). There are differences between ecotypes in their germination capacity. The results found coincide with a study of 29 materials collected in Cuba, where significant differences were found in the percentages of germination, which ranged between 5 and 67 %(29,30). But the results are lower than reported in other studies where percentages greater than 70 % were reached in some materials(17,20). Also, studies conducted in China demonstrate the variability of the gamic reproduction of this species in five regions of Yunnan Province(30). In that study, the highest germination ranges (29.5 to 55.5 %) were determined with temperatures between 20 and 30 ºC. The results obtained coincide with those of the present study in that the greatest germination occurs between the first five to ten days for both conditions studied(30). It has been identified that approximately 65 % of pollen grains lack sperm nuclei, indicating fertility close to 30 %(10). Similarly, when studying the development of microsporogenesis, chromosomal abnormalities were recognized in 32 % of cells in metaphase I and anaphase I, identifying lagging chromosomes, and in metaphase II,

819

Rev Mex Cienc Pecu 2021;12(3):811-827

47 % of the cells presented asynchrony of a set of chromosomes and lagging chromosomes. It has been observed that in some species of dicotyledons the two nuclei resulting from the first meiotic division enter asynchronously in the second(31), which could result in male sterility, an anomaly that has also been related to spindle orientation, lagging chromosomes and anaphase bridges that affect the conformation of tetrads(32). The presence of lagging chromosomes in anaphase I may be due to the lack of tension that the kinetochore sensory enzymes exert on the spindle forces, thus preventing the dragging of the chromosomes towards the poles, or to the fact that at least one of the chromosomes is misaligned, generating negative signals that the cell identifies(13). It is also important to mention that there are divergent criteria on the viability and dormancy of T. diversifolia seed. It has been reported that seed storage and collection timing play an important role in the viability of the true seed of this species. Several authors reported that a storage for more than four months and a seed collection when the achenes are brown can increase the percentage of germination up to 90 %(25,33). Other authors also report that pre-germinative processes, such as sulfuric acid and water at high temperatures for a few minutes (80 to 100 ºC), can increase germination (16,19) as those used in this work.

Improving the reproduction of this species via true seed would increase its potential as a forage shrub in livestock production systems. Field observations indicate that T. diversifolia has a great capacity to grow clonally(6), but at present it is known that material from true seed can favor the development of more extensive root systems, more vigorous plants, greater persistence of crops over time and faster recovery after cutting or grazing, although it is still difficult to reach seminal material of good quality(11). In different studies, T. diversifolia has been considered as a forage shrub of high nutritional quality due mainly to its high contents of minerals (Ca and P), PC (>20 %), nonstructural carbohydrates and percentage of degradation (>70 %), and its low contents of NDF (<45 %) and ADF (<40 %)(3,4). The PC values found in this species are as high or even higher than those observed in some tropical legumes such as Stylosanthes guianensis (20 %)(34), Arachis pintoi (19.7 %)(35) and Gliricidia sepium (18.23 %)(36), and are much higher than those observed in most tropical grasses, such as Urochloa brizantha (9.3 %)(3) and Cynodon plectostachyus (9.23 %)(37). In addition, the NDF and ADF are lower than the common values observed for tropical forages(38), an aspect that probably does not limit voluntary consumption, the degradability of nutrients and their potential use by animals(1,3,4). On the other hand, the consumption of T. diversifolia has been associated with increases in animal productivity and load capacity in the systems. In Colombia, the effect of this shrub under grazing conditions on the production and quality of bovine milk was evaluated and it was found that its consumption had significant effects on milk production, observing 9.70 and 15.4 kg milk/ha/day, respectively. In addition, the

820

Rev Mex Cienc Pecu 2021;12(3):811-827

production of protein, fat and total solids was also higher when the animals consumed T. diversifolia (P<0.05)(39). Finally, the productive increase that has been obtained in systems with T. diversifolia favors lower emission intensities by reducing CH4 emissions by enteric fermentation. The results did not find differences in daily emissions between conventional diets and diets with 25 % inclusion of T. diversifolia (P= 0.351), however, they identified differences in emissions per kg of weight gained in fattening animals (P= 0.002), going from 22.3 kg of CO2-eq/kg of weight gained in the diet with brachiarias to 14.9 kg of CO2-eq/kg of weight when the animals had access to T. diversifolia(40).

Conclusions and implications

T. diversifolia has genotypes with significantly different growth and development phases between them, modifying their reproductive moment and true seed production. According to the results found, there are genotypes with a higher production of viable true seed per plant, such as genotypes 5 and 7 evaluated in this study, which can be profiled as those most suitable to improve the propagation of this species. Although this species has a low germination (<50 %), there are pre-germinative processes with the ability to increase the percentage of germination such as the use of water at 80 ºC by 15 %. Also, the use of fertilizer increases not only the production of viable seed but also its germination, which is why it can be a viable alternative to treat seed-producing plants (20 % more germination). Finally, this study confirms that the species T. diversifolia has a high percentage of nonviable seeds, an aspect that invites to develop work aimed at understanding the factors responsible for this phenomenon in order to improve and facilitate its use, especially that of the outstanding genotypes identified in this work, since this species offers a high potential in animal feeding, product of its wide adaptation to different edaphoclimatic conditions, offer of high values of PC (>20 %), low content of ADF and NDF (<20 and 40 %, respectively), presence of different secondary compounds that modify the fermentative efficiency at the rumen level, and a high degradation that can be above 70 %.

Acknowledgements

To the Sustainable Colombian Livestock project, funded by the Government of the United Kingdom and the Global Environment Facility, for providing the necessary resources for the evaluations and collection of materials. Also, to the El Porvenir property for allowing evaluations to be carried out in its facilities, as well as to Minicienciasin its call for National Doctorates 727 of 2015. 821

Rev Mex Cienc Pecu 2021;12(3):811-827

Literature cited: 1. Barahona R, Sánchez S. Limitaciones físicas y químicas de la digestibilidad de pastos tropicales y estrategias para aumentarla. Cienc Tecnol Agropec 2005;6(1):69-82. https://dialnet.unirioja.es/servlet/articulo?codigo=5624715. 2. Schultze-Kraft R, Rao IM, Peters M, Clements RJ, Bai C, Liu G. Tropical forage legumes for environmental benefits: An overview. Trop Grassl 2018;6(1):1–14. http://www.tropicalgrasslands.info/index.php/tgft/article/view/394/241. 3. Ribeiro RS, Terry SA, Sacramento JP, Silveira S, Bento CB, Silva EF, et al. Tithonia diversifolia as a supplementary feed for dairy cows. PloS One 11 2016;e0165751. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5132235/ 4. Mauricio RM, Calsavara LHF, Ribeiro RS, Pereira LGR, Freitas DS, Paciullo DS, et al. Feeding ruminants using Tithonia diversifolia as forage. JDVAR 2017;5(4):00146. http://medcraveonline.com/JDVAR/JDVAR-05-00146.php. 5. Rivera JE, Chará J, Gómez-Leyva JF, Ruíz TE, Barahona R. Variabilidad fenotípica y composición fitoquímica de Tithonia diversifolia A. Gray para la producción animal sostenible. Livest Res Rural Dev 2018;30, Article #200. http://www.lrrd.org/lrrd30/12/rive30200.html . 6. Ruiz TE, Febles G, Díaz H, Achang G. Efecto de la sección y el método de plantación del tallo en el establecimiento de Tithonia diversifolia. Rev Cubana Cienc Agr 2009;43(1):91-96. https://www.redalyc.org/pdf/1930/193015398016.pdf . 7. Obukohwo E, Umar B. Seed production, germination, emergence and growth of Tithonia diversifolia (HEMSL) A. Gray as influenced by different sowing depths and soil types. Am Eurasian J Agric Environ Sci 2014;14(5):440-444. https://www.idosi.org/aejaes/jaes14(5)14/9.pdf . 8. Pérez A, Montejo I, Iglesias J, López O, Martín GJ, García DE, Milián I, Hernández A. Tithonia diversifolia (Hemsl.) A. Gray. Pastos y Forrajes 2009;32(1):1–15. http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S0864-03942009000100001. 9. Chagas-Paula DA, Oliveira RB, Rocha BA, Da Costa FB. Ethnobotany, chemistry, and biological activities of the genus Tithonia (Asteraceae). Chem Biodivers 2012;9(2):210235. 10. Alcorcés N, Lárez A, Mayz J. Adiciones al conocimiento citogenético de Tithonia diversifolia (Hemsl.) A Gray (Asteraceae). Acta Bot Venez 2007;30(2):267–275. http://ve.scielo.org/scielo.php?script=sci_arttext&pid=S0084-59062007000200001.

822

Rev Mex Cienc Pecu 2021;12(3):811-827

11. Romero O, Galindo A, Murgueitio E, Calle Z. Primeras experiencias en la propagación de botón de oro (Tithonia diversifolia, Hemsl. Gray) a partir de semillas para la siembra de sistemas silvopastoriles intensivos en Colombia. Subtrop Agroecosystems 2014;17,524–528. https://pdfs.semanticscholar.org/3dff/1f62f0898f9df00e320078b4b8ba80864462.pdf. 12. Ruiz TE, Febles GJ, Alonso J, Crespo G, Valenciaga N. Agronomy of Tithonia diversifolia in Latin America and the Caribbean región. In: Savon LL, Gutierrez O, Febles F, editors. Mulberry, moringa and tithonia in animal feed, and other uses. Results in Latin America and the Caribbean. ICA / EDICA. La Habana, Cuba; 2017:171-20. 13. Taylor S, Scott M, Holland A. The spindle checkpoint: a quality control mechanism which ensures accurate chromosome segregation. Chromosome Res 2004;12:599-616. https://link.springer.com/article/10.1023/B:CHRO.0000036610.78380.51. 14. Rivera JE, Gómez-Leyva JF, Castaño K, Morales JG, Chará J, Barahona R. Diversidad molecular, química y morfológica en materiales de Tithonia diversifolia (hemsl.) Gray para la alimentación animal en Colombia y México. En: Chará J, et al editores. Congreso Internacional Sobre Sistemas Silvopastoriles. Manizales, Colombia. 2017:249–255. 15. Holdridge LR. Ecología basada en zonas de vida. Leslie Holdridge. IICA. San José, Costa Rica. 1986. 16. Akinola JO, Larbi A, Farinu GO, Odunsi AA. Seed treatment methods and duration effects on germination of wild sunflower. Exp Agric 2000;36:63–69. 17. Agboola DA, Idowu WF, Kadiri M. Seed germination and seedling growth of the Mexican sunflower Tithonia diversifolia (Compositae) in Nigeria, Africa. Rev Bio Trop 2005;54(2):395-402. https://www.scielo.sa.cr/scielo.php?script=sci_arttext&pid=S003477442006000200017 18. Nasreen S, Khan MA, Uddin S. Response of sunflower to various pre-germination techniques for breaking seed dormancy. Pak J Bot 2015;47(2):413-416. 19. Muoghalu JI, Chuba DK. Seed germination and reproductive strategies of Tithonia diversifolia (Hemsl.) A. Gray and Tithonia rotundifolia (P.M.) Blake. Appl Ecol Environ Res 2005;3(1):39-46. http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.541.352&rep=rep1&type=pd f

823

Rev Mex Cienc Pecu 2021;12(3):811-827

20. Santos-Gally R, Muñoz M, Franco G. Efecto de la latencia sobre la germinación de Tithonia diversifolia (Asteraceae). En: Rivera J, et al, editores. Congreso internacional sobre sistemas silvopastoriles: por una producción sostenible. Libro de Actas. Editorial CIPAV, Cali. 2019:417–425. 21. Botero J. Potencial de extracción y utilización de nutrientes de Tithonia diversifolia y su relación con el rendimiento y calidad nutricional. [tesis doctorado]. Palmira, Colombia. Universidad Nacional de Colombia; 2017. http://bdigital.unal.edu.co/56938/2/2021-Julian_Mauricio_Botero.pdf. 22. RStudio Team. RStudio Version 1.1.447: Integrated Development for R. RStudio, Inc., Boston, MA. 2019. https://rstudio.com/. 23. Saavedra S. Fenología y fisiología de semillas de botón de oro Tithonia diversifolia (Hemsl.) Gray. [Tesis maestría]. Medellín, Colombia. Universidad Nacional de Colombia 2016 http://www.bdigital.unal.edu.co/55663/1/1128408177.2016.pdf 24. Márquez F, Sánchez J, Urbano D, Dávila C. Evaluación de la frecuencia de corte y tipos de fertilización sobre tres genotipos de pasto elefante (Pennisetum purpureum). Zootec Trop 2007;25(4):253-259. http://ve.scielo.org/scielo.php?script=sci_arttext&pid=S0798-72692007000400003. 25. Partey SY. Effect of pruning frequency and pruning heighton the biomass production of Tithonia diversifolia (Hemsl)A. Gray. Agrofor Syst 2011;83:181–187. 26. Rodríguez I, Padilla C, Ojeda M. Características de la germinación de la semilla gámica de Tithonia diversifolia (Hemsl.) Gray y su comportamiento en condiciones de vivero. Livest Res Rural Dev 2019;31, Article #69. http://www.lrrd.org/lrrd31/5/idalma31069.html. 27. Ruíz TE, Febles G, Torres V, González J, Achan G, Sarduy L, Díaz H. Evaluación de materiales recolectados de Tithonia diversifolia (Hemsl.) Gray en la zona centrooccidental de Cuba. Rev Cubana Cienc Agríc 2010;44:291–296. https://biblat.unam.mx/hevila/Revistacubanadecienciaagricola/2010/vol44/no3/13.pdf 28. Rodríguez I, Padilla C, Torres V. Evaluación de tres métodos de poda de Tithonia diversifolia (Hemsl.) Gray bajo condiciones de pastoreo. Livest Res Rural Dev 2020; 32, Article #73. from http://www.lrrd.org/lrrd32/5/idal32073.html. 29. Ruiz TE, Febles G, Achan G, Díaz H, González J. Capacidad germinativa de semilla gámica de materiales colectados de Tithonia diversifolia (Hemsl.) Gray en la zona centrooccidental de Cuba. Livest Res Rural Dev 2018;30, Article #81. http://www.lrrd.org/lrrd30/5/ruiz30081.html.

824

Rev Mex Cienc Pecu 2021;12(3):811-827

30. Wang SH, Sun WB, Cheng X, Yang YM. Reproductive characteristics of Tithonia diversifolia and its geographical spread in Yunnan Province of South-West China. Acta Entomol Sin 2008;28(3). https://www.researchgate.net/publication/288293086. 31. González F, Rudall P, Furness C. Microsporogenesis and systematics of Aristolochiaceae. Bot J Linn Soc 2001;137:221-242. https://academic.oup.com/botlinnean/article/137/3/221/2557156 . 32. Mendes-Bonato AB, Junqueira R, Pagliarini MS, Valle CB Oliveira MI. Unusual cytological patterns of microsporogenesis in Brachiaria decumbens abnormalities in spindle and defective cytokinesis causing precocious cellularization. Cell Biol Int 2002; 26 (7):641-646. https://www.sciencedirect.com/science/article/abs/pii/S1065699502909297 33. Padilla C, Rodríguez I, Ruiz TE, Herrera M. Determinación del mejor momento de cosecha de semilla gámica, Tithonia diversifolia (Hemsl.) Gray. Livest Res Rural Dev 2018;30, Article #71. http://www.lrrd.org/lrrd30/4/idal30071.html. 34. La OO, González H, Vásquez M C, Estrada A. Composición química, digestibilidad ruminal in situ y fraccionamiento proteico de Stylosanthes guianensis. Ciencia en la frontera: revista de ciencia y tecnología de la UACJ 2018;15(2):29–35. http://erevistas.uacj.mx/ojs/index.php/cienciafrontera/article/view/2890. 35. Khan MT, Khan NA, Bezabih M, Qureshi M S, Rahman, A. The nutritional value of peanut hay (Arachis hypogaea L.) as an alternate forage source for sheep. Trop Anim Health Prod 2013;45:849–853. 36. Silva SF, Carneiro MS, Edvan RL, Pereira ES, Neto L, Pinto AP Camilo D. Agronomic characteristics and chemical composition of Gliricidia sepium grown under different residual heights in different seasons. Cienc Investing Agrar 2017;44(1):35-42. 37. Montoya E, Barahona R, Chará J. The nutritional balance of early lactation dairy cows grazing in intensive silvopastoral systems. Ciênc Anim Bras 2017;18:1-12. https://www.scielo.br/scielo.php?script=sci_arttext&pid=S1809-68912017000100218. 38. Souza LF, Mauricio RM, Gonçalves L C, Saliba EOS, Moreira GR. Produtividade e valor nutritivo da Brachiaria brizantha cv. Marandu em um sistema silvipastoril. Arq Bras Med Vet Zootec 2007;59(4):1029-1037. https://www.scielo.br/scielo.php?script=sci_arttext&pid=S0102-09352007000400032.

825

Rev Mex Cienc Pecu 2021;12(3):811-827

39. Rivera JE, Cuartas CA, Naranjo JF, Tafur O, Hurtado EA, Arenas FA, Chará J, Murgueitio E. Efecto de la oferta y el consumo de Tithonia diversifolia en un sistema silvopastoril intensivo (SSPi), en la calidad y productividad de leche bovina en el piedemonte Amazónico colombiano. Livest Res Rural Dev 2015;27, article #189. http://www.lrrd.org/lrrd27/10/rive27189.html. 40. Molina IC, Donneys G, Montoya S, Villegas G, Rivera JE, Chará J, Barahona R. Emisiones in vivo de metano en sistemas de producción con y sin inclusión de Tithonia diversifolia. Congreso Nacional de Sistemas Silvopastoriles y Congreso Internacional de Sistemas Agroforestales. Puerto Iguazú, Misiones, Argentina, 2015:678-682.

826

Table 2: Phases of agronomic development and true seed production of different genotypes of Tithonia diversifolia Treatments-Genotypes Fert Ge Fert Parameter 1 2 3 4 5 6 7 No Yes P-value a a ab c bc ab bc Vegetative phase, days 86.8 84.2 80.6 74.3 76.2 80.7 76.3 77.1 82.4 <0.001 <0.001 a ab ab ab ab b ab Reproductive phase, days 31.8 29.2 28.8 31.5 29.3 27.5 31.3 29.9 30 0.022 0.845 Drying of achenes, days 21.8 21.7 22.7 21.5 23.3 23.3 21.7 22.7 21.7 0.67 0.134 a ab bc c bc bc bc Flowering phase, days 140 135 132 127 129 131 129 130 134 <0.001 0.001 b a ab ab a ab a Flower heads per plant, # 32.1 62.9 46.1 53.6 70.1 45.1 71.9 36.3 72.7 0.002 <0.001 c ab bc ab ab ab c Seeds per flower head, # 142 155 149 152 153 156 164 147 159 <0.001 <0.001 c ab bc abc ab bc a Seeds per plant, # 4,668 10,112 6,958 8,238 10,908 7,217 11,946 5,460 11,697 <0.001 <0.001 b a b a a ab Full seeds, % 63.5 69.5 62.3 71.3 69.3 67.0 62.7b 65.5 67.5 0.025 0.244 ab ab a b b ab a Empty seeds, % 23.1 22.8 25.0 20.0 20.8 22.8 25.7 21.5 24.3 0.041 0.006 Rudimentary seeds, % 13.5 7.67 12.7 8.83 9.83 10.2 11.7 11.1 10.2 0.059 0.418

SEM 0.92 0.4 0.36 0.91 4.14 1.59 713 0.91 0.56 0.56

Fert= fertilization; Ge= genotypes, SEM= standard error of the mean. abc Different letters in the same row denote difference (P<0.05).

Tr 1 2 3

Table 3: Percentage of germination of true seed of different genotypes of Tithonia diversifolia Genotypes (Ge) Fert Ge 1 2 3 4 5 6 7 No Yes p- value b a a a a a a 32.6 45.4 54.1 45.8 47.7 53.9 48.6 42.6 51.1 0.001 b a a a a a a 39.5 51.6 58.2 54.1 52.9 62.2 56.9 46.9 59.7 0.001 c abc a ab c a abc 17.5 22.3 31.9 30.3 19.7 31.8 26.9 23.7 30.2 0.001

Fert 0.002 0.001 0.025

SEM 1.52 1.89 1.31

Tr=Treatment; SEM= standard error of the mean; Fert= fertilization; Tr 1= without prior treatment; Tr 2= water at 80 ºC for 10 min; Tr 3= immersion in 50 % sulfuric acid. abc Different letters in the same row denote difference (P<0.05).

811 827

https://doi.org/10.22319/rmcp.v12i3.5742 Article

Structure of forage sward with Urochloa brizantha cultivars under shading

Estella Rosseto Janusckiewicz a* Luísa Melville Paiva a Henrique Jorge Fernandes a Alex Coene Fleitas b Patricia dos Santos Gomes a

State University of Mato Grosso do Sul. University Unit of Aquidauana, Rodovia Graziela Maciel Barroso, Km 12 Zona Rural, 79200000, Aquidauana, MS, Brazil. b

Federal University of Mato Grosso do Sul. Faculty of Veterinary Medicine and Animal Science, Campo Grande, MS, Brazil.

* Corresponding author: estella_rosseto_janusckiewicz@yahoo.com.br

Abstract: This study evaluated the structure of swards planted with Urochloa brizantha cv. BRS Paiaguas and BRS Piata under the eucalyptus shading system, fertilized via foliar at the beginning of the dry and rainy seasons. The experiment followed a randomized block design with a 4×2×2 (4 leaf fertilizer levels × 2 systems × 2 seasons) factorial arrangement. The results were analyzed using the GLIMMIX PROC of SAS University while means were compared by the T-test at 5%. Foliar fertilizer had a significant (P≤0.05) effect on cv. BRS Paiaguas stem mass under shading while the 3 and 6 L/ha levels produced the lowest (P≤0.05) masses. The forage and root masses were not significantly affected (P≥0.05) by the systems and seasons whereas the dead material mass was not influenced by the seasons. The shading system resulted in (P≤0.05) significantly lower dead material mass for both cultivars and higher (P≤0.05) leaf and stem masses for the cv. BRS Piata. In the rainy season, leaf and stem masses were greater (P≤0.05). Foliar fertilization up to 6 L/ha favored the stem control in cv. BRS Paiaguas under shading. The resulting masses of forage, dead material, and root allow concluding

828

Rev Mex Cienc Pecu 2021;12(3):828-844

that the cultivars adapted well to the shading and dry season. Key words: Brachiaria brizantha, Foliar fertilizer, Full sun, Seasons, Silvopastoral system.

Received:23/07/2020 Accepted:04/02/2021

Introduction From the sustainability viewpoint, silvopastoral systems are important for being a valuable tool to assist the recovering of degraded pastures. The pasture degradation process is related to soil physical and chemical deterioration that can be reduced or avoided when trees are introduced to reduce rain impact on the soil and the wind speed in the area, besides helping to sustain and improving soil physical properties(1). Besides, the Brazilian government has undertaken reducing greenhouse gas emissions forecasted for 2020 between 36.1 % and 38.9 %, and to increase the use of degraded pasture recovery technologies and the integration between farming-animal husbandry-forestry, among other commitments(2). The presence of trees alters the microclimate, reducing solar radiation and temperature and increasing the humidity of the air and soil(1). Thus, according to the authors, the environmental conditions of the soil and its interface with the litter, improve the microbiological activity and the mineralization rate of nutrients. Well-established and managed pastures can contribute to increasing the rate of soil C sequestration(3). In the pastures, the shade provided by the trees provides animal ambience, decreasing thermal stress and improving animal performance(4). Regarding the sward, shading around 35 % increases the crude protein content, reduces the neutral detergent fiber content, and increases the digestibility of grass growing under the canopy of trees(5). In addition, changes in the amount of chlorophyll occur. Oliveira et al(6), observed an increase in the levels of chlorophyll a in shade plants of Panicum maximum cv. Tanzania and Andropogon gayanus cv. Planaltina, in relation to full sun. The advantages of trees in pasture production, however, depend on the degree of shading, which varies a lot depending on the age, spacing and arrangement of the tree componente(7). Even though not selected for this purpose, the main forages grown in Brazil can be used in silvopastoral systems(8). The forage response to shading depends on plant tolerance,

829

Rev Mex Cienc Pecu 2021;12(3):828-844

treetop architecture, and soil fertility, while the positive effect is associated with increased N availability in the soil(1). From the viewpoint of productivity as well as environmental and economic sustainability, successful cattle ranching in pastures requires great attention to soil fertility. Several studies in the literature consider the influence of soil fertilization on the morphological or productive parameters of Urochloa brizantha cultivars: nitrogen and/or phosphorus(9-14), and nitrogen and potassium(15). However, there are few specific studies on foliar fertilization in forages. Forage management requires careful monitoring of important sward structural parameters such as pasture height, forage mass, leaf density, and quantity since they affect forage production and animal the most(16). The stem mass is also of great importance because it affects animal consumption while decreasing the nutritive value of the available forage. Besides the aerial shoot, the root system is responsible for absorbing nutrients from the soil and for accumulating plant organic reserves, which are fundamental to plant recovery after defoliation. To this end, it becomes clear the importance of silvopastoral systems, as well as knowing forage behavior under shading, and using foliar fertilization as a complementary technique to conventional fertilization. Hence, this work evaluates the structure of a forage sward planted with Urochloa brizantha cv. BRS Paiaguas and BRS Piata fertilized via foliar in three different levels and control, under Eucalyptus shading and full sun and during rainy and dry seasons. The results should contribute new information on the use and management of the studied forages in silvopastoral systems.

Material and methods The study was conducted in Aquidauana, MS (20˚27'S and 55˚40'W, 170 m average altitude). The regional climate is Aw (tropical savannah), according to Köppen(17), and the soil is Ultisol sandy loam texture(18). Two simultaneous experiments were conducted in two areas each, the first under a Eucalyptus shading system and another in full sun (control). The evaluated forages were Urochloa brizantha (Hochst. ex A. Rich.) R.D. Webster [syn. Brachiaria brizantha (Hochst. ex A. Rich.) Stapf.] cv. BRS Paiaguas and cv. BRS Piata. Each cultivar was used in one experiment. In 2015, soil samples were collected and sent for chemical analysis. The soil was prepared by applying 3 L/ha glyphosate, followed by harrowing to control matocompetition in the area. The soil chemical analysis indicated the following results: pH in water 5.32; 15.85 g/dm3 organic matter; 3.96 mg/dm3 P; 0.15 cmol/dm³ K; 1.9 cmol/dm³ Ca; 1.0 cmol/dm³ Mg; 0.10 cmol/dm³ Al; 2.68 cmol/dm³ H + Al; 3.05 cmol/dm³ base sum, and 53.23% base saturation. Based on these results, limestone was applied followed by harrowing to incorporate the lime into the soil.

830

Rev Mex Cienc Pecu 2021;12(3):828-844

In the areas designated for the shading system, subsoiling was performed in the tree planting rows between 30 and 40 cm deep. Before planting at the end of 2015, the Eucalyptus seedlings were treated with mono-ammonium phosphate (1.5%) and imidacloprid based insecticide (0.5%). The tree seedlings were planted in East-West single rows, spaced 14 m between rows and 3 m between trees. The clones I-144 and 1277 of Eucalyptus grandis x Eucalyptus urophylla hybrids were planted, fertilized with 80 g NPK/plant (06-30-06) and irrigated with approximately 4L water per plant. After 60 d, matocompetition was controlled by manual weeding between trees and mechanical brushing between rows. Subsequently, the Eucalyptus trees were fertilized with 80 g NPK/plant three more times, at 90 and 180 d (20-00-20), and 12 mo (00-00-60). At the end of the experimental period, the eucalyptus trees had an average height of 11.98 m (ranging from 7.92 to 14.97 m) and approximately 2 yr of age. The cv. BRS Paiaguas and cv. BRS Piata grasses were sown in both areas, in November 2016. The areas were divided into three blocks, with four experimental units per block, totaling 12 experimental units (10 m x 9 m each) for each system (shaded and full sun). Twenty (20) rows of forage were sown per experimental unit, using the recommended amount in grams. The experimental units were irrigated until the plants were able to develop without irrigation and, from then on, the experimental units were submitted to 15cm tall uniformity cuts at the beginning of every season. Also, the 2.4 D herbicide was applied to control the weeds in the rows between the experimental units. The evaluation period from August 2017 to March 2018 was divided into dry (82 d from August to November 2017) and rainy (88 d from December 2017 to March 2018) seasons. The average temperatures and accumulated rainfalls were 27.2 ºC and 183.6 mm and 26.6 ºC and 673.0 mm in the dry and rainy seasons, respectively. Besides evaluating the shaded and full sun systems, three levels of foliar fertilization were evaluated, Quimiorgen Pasto® (3, 6 and 9 L/ha) with 2 L/ha Niphokam®, and the control (without foliar fertilization). The Quimiorgen pasto® nutrient percentage and concentration were 20% and 270.0 g/L phosphorus (P2O5); 0.5% and 6.75 g/L boron (B); 3% and 40.5 g/L manganese (Mn), and zinc (Zn). Whereas, Niphokam® composition was 10% and 135.0 g/L nitrogen; 8% and 108.0 g/L phosphorus (P2O5), and potassium (K2O); 1% and 13.5 g/L calcium (Ca), and zinc (Zn); 0.5% and 6.75 g/L magnesium (Mg), boron (B), and manganese (Mn); and 0.2% and 2.70 g/L copper (Cu). The foliar fertilizer was applied using a CO2 pressurized backpack spray. The total amount applied to each experimental unit was calculated according to the equipment calibration, considering the recommendation of 200 L/ha syrup (the two foliar fertilizers plus water) and the levels recommended in the treatments. Fertilization was conducted in the afternoon to avoid day hottest hours while seeking to maximize humidity so that the fertilizer was better absorbed by the leaves. In all experimental areas, fertilizer was applied at the beginning of each season, one week after the uniformity cut, to ensure enough leaf absorption area. 831

Rev Mex Cienc Pecu 2021;12(3):828-844

The evaluated structural parameters were average sward height and total forage mass, as well as leaf, stem, dead material and root mass. Except for root mass, evaluations were performed at 28-d intervals, on 28, 56, and 84 d after foliar fertilization, totaling three evaluations in each season (dry and rainy). In the dry season, foliar fertilization occurred in early August and the three evaluations occurred in early September, October, and November 2017, respectively. In the rainy season, foliar fertilization occurred in early December 2017 and the evaluations in early January, February, and March 2018. Root samples were collected at the end of October 2017 and February 2018, for the dry and rainy seasons, respectively. The average sward height was measured in 20 random points representing the mean height of each experimental plot, using a cm-graduated ruler. Two forage samples inside a 0.0625 m² area defined by a metal frame were cut close to the soil. Each sample was divided into two subsamples. One subsample was weighed, dried in a forced circulation oven at 65 ºC for 72 h, and weighed again to obtain the total dry matter. The other subsample was separated into leaf, stem and dead material morphological fractions, which were weighed, oven-dried at 65 °C for 72 h, and weighed again. The total forage mass and masses of the different morphological components were obtained from the fresh and dry weights. In each experimental area, root samples were collected at places representing the average sward height, which was determined the day before sampling by measuring the height in 20 random points using a cm-graduated ruler. A 15cm-tall steel cylinder with 15 cm diameter was completely introduced into the soil for sampling the roots and shoot parts. The first part of each sampling consisted of cutting the sample aerial shoot at 5 cm from the ground, followed by the complete introduction of the cylinder into the soil for root and soil removal. These samples were always taken between 6 and 10 h in the morning to avoid the variations of reserve carbohydrate contents(19) and nitrogen compounds(20) that occur throughout the day in the plant accumulation organs. After removal, the root samples (plus stem basis) were packed in plastic bags and placed in a polystyrene box with ice to avoid losses of soluble compounds and, consequently, mass, and immediately taken to the laboratory. To remove the soil from the roots, each sample was washed in running water over a 3 mm mesh sieve and immediately frozen(21) for subsequent drying. After thawing, the samples were again washed to remove the remaining soil, weighed, dried at 65 °C for 72 h and reweighed. The root mass was determined using the fresh and dry weights. The experimental design consisted of a randomized block with 3 blocks and 4 plots per block, for each shading system, totaling 12 experimental units per system in each season. The data were analyzed as a 4x2x2 factorial arrangement (four phosphate fertilizer levels x two shading systems x two annual seasons (rainy and dry)), considering the data collected in each plot in each season, as time-repeated measures in the same experimental

832

Rev Mex Cienc Pecu 2021;12(3):828-844

unit. All interactions were evaluated, and removed from the model when not significant, or adequately unfolded. The data were analyzed using PROC GLIMMIX of SAS University (SAS Institute Inc, Cary, CA, USA) and, where appropriate, the minimum square means of the shading systems or the seasons were compared by the pdiff of the LSmeans command. When the effect of the fertilization levels was identified, the average fertilization levels were compared to the control (without fertilization) using an adjustment for the Dunnett test in the pdiff option. In this case, the linear-to-quadratic effects of the used fertilizer levels were also evaluated using orthogonal contrasts. A significance level of 5% was adopted for all statistical analyses.

Results The forage sward height and mass, leaf and root masses of the two cultivars of Urochloa brizantha were not significantly (P≥0.05) affected by the studied foliar fertilizer levels (Table 1). Similarly, the dead material mass of the cv. BRS Paiaguas was not significantly (P≥0.05) changed by foliar fertilizer levels. However, the dead material mass of the cv. BRS Piata was significantly (P≤0.05) altered by the interaction between foliar fertilizer level × growing days, which after unfolding, indicated that the average dead material mass was similar (P≥0.05) among the treatments in each period: 3,937.14 kg DM/ha for the treatment without fertilization and 3,738.75; 3,993.97 and 3,984.56 kg DM/ha for the 3, 6 and 9 L/ha of foliar fertilizer, respectively.

833

Rev Mex Cienc Pecu 2021;12(3):828-844

Table 1: Height (cm), forage mass (kg DM/ha), leaf mass (kg DM/ha), dead material mass (kg DM/ha), and root mass (kg DM/ha) of the two cultivars, for the different foliar fertilization levels (Mean±SEM) Foliar fertilization levels (L Quimiorgen/ha) 0 3 6 9 cv. BRS Paiaguas Height

51.81 ± 1.74

54.62 ± 1.74

54.64 ± 1.74

52.63 ± 1.74

Forage mass

14,585.0 ± 758.95 4,893.58 ± 315.25 4,314.33 ± 331.99 22,335 ± 3077.19

12,838.0 ± 758.95

13,278.0 ± 758.95

16,392 ± 3077.19

13,547.0 ± 758.95 4,921.72 ± 315.25 3,812.67 ± 331.99 17,881 ± 3077.19

Leaf mass Dead material mass Root mass

4,728.92 ± 315.25 3,787.58 ± 331.99

4,779.61 ± 315.25 3,857.00 ± 331.99 19,955 ± 3077.19

cv. BRS Piata Height

58.32 ± 1.60

58.13 ± 1.60

55.63 ± 1.60

55.99 ± 1.60

Forage mass

17,662.0 ± 931.13 6,746.17 ± 348.36 6,978.31 ± 409.71 21,813 ± 3473.95

16,012.0 ± 931.13

17,625.0 ± 931.13 6,995.42 ± 348.36 6,635.61 ± 409.71 23,146 ± 3473.95

17,496.0 ± 931.13

Leaf mass Stem mass Root mass

6,220.08 ± 348.36 6,053.64 ± 409.71 31,738 ± 3473.95

6,732.44 ± 348.36 6,778.75 ± 409.71 27,481 ± 3473.95

The stem mass of cv. BRS Paiaguas was significantly (P≤0.05) affected by the foliar fertilizer level × system interaction (Table 2). In the shaded system, the stem mass was lower (P≤0.05) for 3 and 6 L/ha compared to 9 L/ha and control. In the full sun system, the stem mass was similar (P≥0.05) for foliar fertilizer levels and control. On the other hand, the stem mass of cv. BRS Piata did not change significantly (P≥0.05) for the studied foliar fertilizer levels (Table 1). Table 2: Stem mass (kg DM/ha) of cv. BRS Paiaguas regarding the foliar fertilizer level × system interaction (Mean±SE) Foliar fertilization levels (L Quimiorgen/ha) 0 3 6 9 Shading system 6818.67 ± 4307.72 ± 4975.33 ± 5138.11 ± a b b b 515.85 515.85 515.85 515.85 Full sun system 3935.28 ± 4334.67 ± 4649.00 ± 4144.44 ± a a a a 448.77 448.77 448.77 448.77 ab

Means in the same row, followed by different letters, differ by T-test at 5%.

The systems and seasons had a significant effect (P≤0.05) on the sward height of the cv. BRS Paiaguás, which was significantly greater in the shading compared to the full sun system and in the rainy season compared to the dry season (Table 3). For the cv. BRS Piata, the sward height was significantly (P≤0.05) affected by the system × season 834

Rev Mex Cienc Pecu 2021;12(3):828-844

interaction. In both dry and rainy seasons, sward height was greater (P≤0.05) in the shaded system. Table 3: Height (cm) for the cv. BRS Paiaguas regarding systems and seasons and cv. BRS Piata regarding system × season interaction (Mean±SE) Shading system Full sun system a cv. BRS Paiaguas 59.13 ± 1.23 47.72 ± 1.23 b Dry season Rainy season b cv. BRS Paiaguas 34.25 ± 1.23 72.60 ± 1.23 a cv. BRS Piata Shading system Full sun system a Dry season 37.87 ± 0.97 33.64 ± 0.97 b Rainy season 86.27 ± 1.43 a 70.28 ± 1.43 b ab

Means in the same row, followed by different letters, differ by T-test at 5%.

The forage and root masses of the Urochloa cultivars were not significantly affected (P≥0.05) by the shaded and full sun systems (Table 4). This effect was also not observed (P≥0.05) on the leaf mass of cv. BRS Paiaguas. The cv. BRS Piata morphological components were affected (P≤0.05) by the different systems, resulting in greater leaf and stem masses (P≤0.05) and lower dead material mass (P≤0.05) in the shaded system. Table 4: Means and standard error of the mean of forage mass, leaf mass, dead material mass and root mass of the cv. BRS Paiaguas and cv. BRS Piata and stem mass of the cv. BRS Piata, for the systems (kg DM/ha) Shading system Full sun system cv. BRS Paiaguas Forage mass 13,900.00 ± 536.66 13,223.00 ± 536.66 Leaf mass 5,068.64 ± 222.91 4,593.28 ± 222.91 b Dead material mass 3,521.47 ± 234.75 4,364.32 ± 234.75 a Root mass 2,1174 ± 2,175.90 17,108 ± 2,175.90 cv. BRS Piata Forage mass 17,787.00 ± 658.41 16,611.00 ± 658.41 a Leaf mass 7,034.43 ± 246.33 63,12.63 ± 246.33 b Stem mass 7,429.56 ± 289.71 a 5,793.60 ± 289.71 b Dead material mass 3,322.76 ± 287.71 b 4,504.44 ± 287.71 a Root mass 30,690 ± 2456.45 21,399 ± 2456.45 ab

Means in the same row, followed by different letters, differ by T-test at 5%.

The seasons had no significant effect (P≥0.05) on the masses of forage, dead material and roots of both cultivars, (Table 5). However, the leaf and stem masses were significantly (P≤0.05) higher in rainy season.

835

Rev Mex Cienc Pecu 2021;12(3):828-844

Table 5: Mean and standard error of the mean of forage mass, leaf mass, stem mass, dead material mass, and root mass for the cultivars BRS Paiaguas and BRS Piata in the seasons (kg DM/ha) Dry season Rainy season Forage mass Leaf mass Stem mass Dead material mass Root mass Forage mass Leaf mass Stem mass Dead material mass Root mass

cv. BRS Paiaguas 11,249.00 ± 536.7 4,018.50 ± 222.91 b 3,173.93 ± 243.18 b 4,056.82 ± 234.75 16,032 ± 2,175.90 cv. BRS Piata 15,330.00 ± 658.41 6,327.14 ± 246.33 b 4,818.93 ± 289.71 b 4,184.24 ± 287.71 24,933 ± 2,456.45

15,874.00 ± 536.7 5,643.42 ± 222.91 a 6,401.87 ± 243.18 a 3,828.97 ± 234.75 22,250 ± 2,175.90 19,067.00 ± 658.41 7,019.92 ± 246.33 a 8,404.22 ± 289.71 a 3,642.97 ± 287.71 27,156 ± 2,456.45

Means in the same row, followed by different letters, differ by T-test at 5%.

The growing days affected (P≤0.05) significantly the height and mass of sward leaves and stem of both Urochloa cultivars, but not (P≥0.05) the forage mass (Table 6). As the experimental period advanced, sward height increased for both studied forages so that the highest leaf and stem masses were (P≤0.05) measured in the last evaluation at 83 growing days. The dead material mass of the cv. BRS Paiaguas was affected (P≤0.05) by the growing days, being higher (P≤0.05) at 29 d and remaining unchanged at 83 d. However, for the cv. BRS Piata, as previously mentioned, after unfolding the interaction foliar fertilizer level × growing days, no significant difference (P≥0.05) was observed throughout the evaluations.

836

Rev Mex Cienc Pecu 2021;12(3):828-844

Table 6: Height (cm), forage mass (kg DM/ha), leaf mass (kg DM/ha), and stem mass (kg DM/ha) and dead material mass (kg DM/ha) of the two cultivars, regarding growing days (Mean ± SE) Growing days 29 55 83 cv. BRS Paiaguas Height 37.97 ± 1.51 c 48.40 ± 1.51 b 73.90 ± 1.51 a Forage mass 10,524.00 ± 657.27 10,680.00 ± 657.27 19,481.00 ± 657.27 Leaf mass 3,281.58 ± 273.01 b 3,538.67 ± 273.01 b 7,672.63 ± 273.01 a Stem mass 2,791.77 ± 297.84 b 3,515.81 ± 297.84 b 8,056.12 ± 297.84 a Dead material mass 4,450.48 ± 287.51 a 3,625.79 ± 287.51 b 3,752.42 ± 287.51 ab cv. BRS Piata Height 42.45 ± 1.39 c 51.53 ± 1.39 b 77.07 ± 1.39 a Forage mass 13,977.00 ± 806.38 12,459.00 ± 806.38 25,160.00 ± 806.38 Leaf mass 5,388.54 ± 301.69 b 4,628.52 ± 301.69 b 10,004.00 ± 301.69 a Stem mass 4,454.31 ± 354.82 b 4,876.69 ± 354.82 b 10,504.00 ± 354.82 a abc

Means in the same row, followed by different letters, differ by T-test at 5%.

Discussion Most of the evaluated structural characteristics of the cultivars BRS Paiaguas and BRS Piata were not significantly affected (P≥0.05) by the treatments, indicating that the foliar fertilizer levels used were not enough to interfere with sward development. This result may also be probably attributed to the fact that fertilization was conducted only once at the beginning of each season, allowing to infer that a higher frequency of foliar fertilization can modify this picture. On the other hand, specifically, the cv. BRS Paiaguas stem mass was affected (P≤0.05) by the treatment × system interaction, differing only in the pastures under shading. The stem mass was significantly (P≤0.05) lower for the 3 and 6 L/ha fertilization levels compared to control, allowing to conclude that foliar fertilization up to 6 L/ha applied at the beginning of the seasons can help control stem mass in the cv. BRS Paiaguas sward under shading. The mass of forage, leaves, and roots of the BRS Paiaguas cultivar was not significantly affected (P≥0.05) by the studied systems. A similar result was observed for the mass of forage and roots of the cultivar BRS Piata. Additionally, the dead material mass was lower (P≤0.05) for the two cultivars in the shaded system. Therefore, it can be infer that the evaluated forages are adapted to the shading imposed by the silvicultural design (Eucalyptus planted in East-West single rows, spaced 14 m between rows and 3 m 837

Rev Mex Cienc Pecu 2021;12(3):828-844

between trees) since the productivity was maintained, with less senescence and death of different plant parts. Likewise, Soares et al(22) worked with Pinus taeda in a similar arrangement, 15 m space between rows and 3m between trees, and reported similar dry matter content for Urochloa brizantha cv. Marandu cultivated in full sun. These authors found that the production decreased with decreasing light intensity, especially for 9 m spacing between rows and 3 m between trees, correlating this low production with less space between trees, and the quality and quantity of radiation reaching the sward. The photosynthetic radiation was three and six times lower in the 15 and 9 m spacing between rows, respectively, under crown projection than in the full sun. Urochloa decumbens and Urochloa ruziziensis evaluated in full sun and under 36 and 54 % shading, maintained the forage production, but reduced the number of tillers and root mass, with increasing shading(23). These authors concluded that both forages were shading tolerant but severe shading should be avoided because it reduces tillering and root mass, which may in the long run compromise the persistence of pastures. This adverse effect of increasing shade on the growth of tropical forages has also been confirmed by other authors. In Urochloa brizantha cv. Marandu swards with 50 % and 70 % shading, the DM accumulation rates decreased by 13 % and 60 % compared to full sun, respectively(24). In Urochloa decumbens swards, forage mass, tillering density, and leaf area index decreased for 65 % shading but remained unchanged for 35 % shading compared to full sun(5). In the BRS Piata pastures, the systems had a significant effect (P≤0.05) on leaf and stem masses, which were greater (P≤0.05) in the shaded system than in the full sun. The plants possibly lengthened their leaves to increase leaf area and capture more light, contributing to the increasing leaf mass. Also, when less light enters the sward, the plants lengthen their stems to position the leaves in the higher strata to facilitate capturing the incident light. The stem elongation contributed to the increasing sward height. Shading changed the Urochloa decumbens pasture morphologically since leaf and stem, as well as leaf blades, elongated(25) to increase the interception of the photosynthetic active radiation(5). These authors worked in a consortium pasture of Eucalyptus grandis forest and tree legumes and reported higher leaf elongation rates than in the full sun, indicating alterations in the photoassimilate allocation pattern with a consequent greater leaf area to capture light. The masses of forage, dead material, and roots of the BRS Paiaguas and Piata forages were not significantly (P≥0.05) affected by seasons. The results indicate that the Urochloa cultivars might be used during the dry season, when water becomes scarce since forage production was maintained, without losses due to senescence and tissue death. Tiller mortality and leaf area reduction due to accelerated senescence of older leaves and 838

Rev Mex Cienc Pecu 2021;12(3):828-844

higher growth of the root system are a few plant strategies used to limit transpiration surface and aggravating water deficiency(26). The lack of significant results in the root mass is probably related to the free growth (without cutting or grazing) of pastures during the experimental period. In defoliation absence, the forages did not need to relocate the reserve compounds to promote new growth of the aerial part, not altering, therefore, the root system. Removal of the aerial part stresses the plants to a degree directly correlated with the defoliation intensity(27). As the aerial part is used, photosynthesis and nutrient uptake by the roots decrease to recover the remaining leaf area, damaging the development of new tillers and, consequently, of the roots(28). The recovery speed of the aerial shoot and root growth depends on physiological mechanisms such as the use of organic reserves(29). In both forages, the seasons affected significantly (P≤0.05) masses of the morphological components. Leaf and stem masses were higher (P≤0.05) in the rainy season due to the better growing conditions provided to the plants, especially rainfall. The higher plant development culminated in greater height (P≤0.05) of the forage sward in this season. Greater elongation of leaves and stems and, consequently, greater masses are expected in climatic conditions that maintain soil moisture, favoring plant development. Urochloa decumbens in the silvopastoral system showed lower rates of leaf and stem elongation in winter compared to other seasons, mainly due to water deficit and low temperature(25). In Urochloa brizantha cv. Marandu, leaf elongation, appearance, and final length decreased with reduced irrigation(30). During the study, the accumulated rainfall was 183.3 mm in the dry season as opposed to the 673.0 mm in the rainy season, indicating that the water quantity affected the most the variation of sward structural characteristics for the two Urochloa brizantha cultivars evaluated. The water deficit during the dry season in most of Brazil is responsible for the seasonality of forage production(26). The author pointed out that water deficiency changes plant anatomy, physiology, and biochemistry, affect plant growth to an extent that depends on the water deficit degree and duration, as well as the plant species. Taller swards are commonly observed under conditions favorable to the growth of forage plants. In Urochloa brizantha cv. Marandu, Setaria sphacelata cv. Kazungula and Panicum maximum cv. Tanzania pastures that were cut at 35 growing days, greater heights were observed in spring and summer, between December and February(31). The authors also observed that the variation in pasture heights followed the same behavior observed for dry matter production in the different seasons of the year. The growing days affected significantly (P≤0.05) the height and mass of leaves and stems of both cultivars, but not (P≥0.05) the forage mass. Leaf and stem masses were higher (P≤0.05) at 83 growing days. These results were expected because the pastures did not undergo defoliation, causing accumulation of non-grazed leaves and stems. 839

Rev Mex Cienc Pecu 2021;12(3):828-844

The lack of defoliation can diminish the photosynthetic capacity of the sward and the capture of light. Shortly after defoliation, photosynthesis decreases, especially due to the removal of the younger leaves from upper strata, so that the process becomes more dependent on less photosynthetically active leaves(29). Additionally, the size and activity of the photosynthetic apparatus are directly related to the amount of assimilated light, which becomes available to the dry matter accumulation process of the pastures. Another point to consider when allowing pasture free growth is the mutual shading between plants. In this situation, the light intercepted by the canopy decreases causing the plants to lengthen their stems to that the leaves are placed higher in the sward strata, to increase light uptake. Consequently, the height of the sward increases. Casagrande et al(32) observed stem elongation in Urochloa brizantha cv. Marandu, as the forage supply increased, that is, with the reducing defoliation intensity. These authors explained that the greater sward height in the greater forage allowances resulted in the mutual shading of the tillers and intense light competition in the swards, concluding that pastures managed with fodder offerings close to 4% LW/day have lower stem elongation and tend to reduce senescence losses.

Conclusions and implications Foliar fertilization up to 6 L/ha favors the control of stem mass of cv. BRS Paiaguas under shading. Can be suggest further studies using higher fertilizer application frequency to obtain conclusive results on the impact of foliar fertilizer levels on other structural variables of Urochloa brizantha of the BRS Paiaguas and BRS Piata cultivars. Considering the masses of forage, leaves, dead material and roots, it is possible to affirm that the two cultivars are adapted to shading of Eucalyptus grandis x Eucalyptus urophylla hybrids, planted in East-West single rows, spaced 14 m between rows and 3 m between trees, with an average height of 11.98 m and approximately two years of age. A long-term study is indicated since the height of the trees and, consequently, the level of shading, change over time and may show more significant differences in the results obtained between shaded plants and in full sun. Furthermore, the masses of forage, dead material, stems, and roots indicate that the studied forages tolerate well dry season conditions, especially, the low precipitation.

Acknowledgments

To National Council for Scientific and Technological Development (CNPq, process nº 454622/2014-7) and Foundation for Support to the Development of Education, Science

840

Rev Mex Cienc Pecu 2021;12(3):828-844

and Technology of the State of Mato Grosso do Sul (FUNDECT, process nº 23/200.256/2014) for the financial support to the project. To Coordination of Improvement of Higher Level Personnel/ National Postdoctoral Program (CAPES/PNPD) for the awarded grant (process nº 88882.317872/2013-01). To Universidade Estadual de Mato Grosso do Sul, in Aquidauana, for offering the necessary conditions and the opportunity to do the work. To Quimifol for providing the foliar fertilizer. This study was financed in part by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brazil (CAPES) – Finance code 001.

Conflict of interest

The authors declare that they have no conflict of interest. Literature cited: 1. Bernardino FS, Garcia R. Sistemas silvipastoris. Pesq Flor Bras 2009;(60):77-87. 2. Balbino LC, Cordeiro LAM, Martínez GB. Contribuições dos sistemas de integração lavoura-pecuária-floresta (iLPF) para uma agricultura de baixa emissão de carbono. Rev Bras Geogr Fís 2011;(6):1163-1175. 3. Rosendo JS, Rosa R. Comparação do estoque de c estimado em pastagens e vegetação nativa de Cerrado. Soc Nat 2012;(2):359-376. 4. Castro AC, Lorenço Junior JB, Santos NFA, Monteiro EMM, Aviz AB, Garcia AR. Sistema silvipastoril na Amazônia: ferramenta para elevar o desempenho produtivo de búfalos. Cienc Rural 2008;38(8):2395-2402. 5. Paciullo DSC, de Carvalho CAB, Aroeira LJM, Morenz MJF, Lopes FCF, Rossiello ROP. Morfofisiologia e valor nutritivo do capim-braquiária sob sombreamento natural e a sol pleno. Pesq Agropec Bras 2007;42(4):573-579. 6. Oliveira FLRD, Mota VA, Ramos MS, Santos LDT, Oliveira NJFD, Geraseev LC. Comportamento de Andropogon gayanus cv.‘planaltina’ e Panicum maximum cv.‘tanzânia’sob sombreamento. Cienc Rural 2013;43(2):348-354. 7. Paciullo DSC, Gomide CDM, Muller M, Pires MDFÁ, Castro CRT. Potencial de produção e utilização de forragem em sistemas silvipastoris. In: Embrapa Gado de Leite-Artigo em anais de congresso (ALICE). In: Simpósio de pecuária integrada, 1., 2014, Sinop, MT. Intensificação da produção animal em pastagens: anais. Brasília, DF: Embrapa, 2014:51-82.

841

Rev Mex Cienc Pecu 2021;12(3):828-844

8. Almeida RG, Barbosa RA, Zimmer AH, Kichel AN. Forrageiras em sistemas de produção de bovinos em integração. In: Bungenstab DJ editor. Sistemas de integração lavoura-pecuária-floresta: a produção sustentável. 2nd ed. Brasília, Distrito Federal, Brasil: EMBRAPA; 2012:88-94. 9. Martuscello JA, Faria DJG, Cunha DDNFVD, Fonseca DMD. Adubação nitrogenada e partição de massa em plantas de Brachiaria brizantha cv. Xaraés e Panicum maximum x Panicum infestum cv. Massai. Cienc Agrotec 2009;33(3):663-667. 10. Ramos SJ, Faquin V, Rodrigues CR, Silva CA, Boldrin PF. Biomass production and phosphorus use of forage grasses fertilized with two phosphorus sources. Rev Bras Cienc Solo 2009;33(2):335-343. 11. Silva CD, Bonomo P, Pires AJV, Maranhão CDA, Patês NDS, Santos LC. Características morfogênicas e estruturais de duas espécies de braquiária adubadas com diferentes doses de nitrogênio. R Bras Zootec 2009;38(4):657-661. 12. Paciullo DSC, Fernandes PB, Gomide CADM, Castro CRTD, Sobrinho FDS, Carvalho CABD. The growth dynamics in Brachiaria species according to nitrogen dose and shade. R Bras Zootec 2011;40(2):270-276. 13. Lucena Costa N, Townsend CR, Santos Fogaça FH, Magalhães JA, Bendahan AB, Seixas Santos FJ. Produtividade de forragem e morfogênese de Brachiaria brizantha cv. Marandu sob níveis de nitrogênio. Pubvet 2016;10(10):731-735. 14. Sá Medica JA, Reis NS, Santos MER. Caracterização morfológica em pastos de capim-marandu submetidos a frequências de desfolhação e níveis de adubação. Ciênc Anim Bras 2017;18:01-13. 15. Rodrigues RC, Mourão GB, Brennecke K, Luz PDC, Herling VR. Produção de massa seca, relação folha/colmo e alguns índices de crescimento do Brachiaria brizantha cv. Xaraés cultivado com a combinação de doses de nitrogênio e potássio. R Bras Zootec 2008;37(3):394-400. 16. Hodgson J. Grazing management: science into practice. Longman handbooks in agriculture. New York, USA: Longman Scientific and Technical and John Wiley; 1990. 17. Peel MC, Finlayson BL, Mcmahon TA. Updated world map of the Köppen-Geiger climate classification. Hydrol Earth Syst Sci 2007;11:1633-1644. 18. EMBRAPA. Empresa Brasileira de Pesquisa Agropecuária. Sistema Brasileiro de Classificação de Solos. Rio de Janeiro, Brasil: Embrapa/CNPS; 2013. 19. White LM. Carbohydrate reserves of grasses: a review. J Range Management 1973;26:13-18.

842

Rev Mex Cienc Pecu 2021;12(3):828-844

20. Schjoerring JK, Husted S, Mäck G, Mattsson M. The regulation of ammonium translocation in plants. J Exp Bot 2002;53(370):883-890. 21. Cecato U, Cano CCP, Bortolo M, Herling VR, Canto MWD, Castro CRDC. Teores de carboidratos não-estruturais, nitrogênio total e peso de raízes em Coastcross-1 (Cynodon dactylon (L.) Pers) pastejado por ovinos. R Bras Zootec 2001;30(3):644650. 22. Soares AB, Sartor LR, Adami PF, Varella AC, Fonseca L, Mezzalira JC. Influência da luminosidade no comportamento de onze espécies forrageiras perenes de verão. R Bras Zootec 2009;38(3):443-451. 23. Faria BM, Morenz MJF, Paciullo DSC, Lopes FCF, Gomide CAM. Growth and bromatological characteristics of Brachiaria decumbens and Brachiaria ruziziensis under shading and nitrogen. Rev Ciênc Agron 2018;49(3):529-536. 24. Andrade CMS, Valentim JF, da Costa Carneiro J, Vaz FA. Crescimento de gramíneas e leguminosas forrageiras tropicais sob sombreamento. Pesq Agropec Bras 2004;39(3):263-270. 25. Paciullo DSC, Campos NR, Gomide CAM, de Castro CRT, Tavela RC, Rossiello ROP. Crescimento de capim-braquiária influenciado pelo grau de sombreamento e pela estação do ano. Pesq Agropec Bras 2008;43(7):917-923. 26. Duarte ALM. Efeito da água sobre o crescimento e o valor nutritivo das plantas forrageiras. Revis Pesq Tecn 2012;9(2):1-6. 27. Gomide CAM, Gomide JA, Huaman CAM, Paciullo DSC. Fotossíntese, reservas orgânicas e rebrota do capim-Mombaça (Panicum maximum Jacq.) sob diferentes intensidades de desfolha do perfilho principal. R Bras Zootec 2002;31(6):2165-2175. 28. Donaghy DJ, Fulkerson WJ. Priority for allocation of water-soluble carbohydrate reserves during regrowth of Lollim perene. Grass Forage Sci 1998;53(3):211-218. 29. Corsi M, Martha Júnior GB, Pagotto DS. Sistema radicular: dinâmica e resposta a regimes de desfolha. In: Da Silva SC, Pedreira CGS editors. A produção animal na visão dos brasileiros. Piracicaba, São Paulo, Brasil: FEALQ; 2001:838-852. 30. Magalhães JA, Carneiro MDS, Andrade AC, Rodrigues BHN, Costa NDL, Santos FDS, Edvan RL. Características morfogênicas e estruturais do capim-Marandu sob irrigação e adubação. Holos 2016;8:113-124. 31. Gerdes L, Werner JC, Colozza MT, Carvalho DD, Schammass EA. Avaliação de características agronômicas e morfológicas das gramíneas forrageiras Marandu, Setária e Tanzânia aos 35 dias de crescimento nas estações do ano. R Bras Zootec 2000;29(4):947-954.

843

Rev Mex Cienc Pecu 2021;12(3):828-844

32. Casagrande DR, Ruggieri AC, Janusckiewicz ER, Gomide JA, Reis RA, Valente ALDS. Características morfogênicas e estruturais do capim-Marandu manejado sob pastejo intermitente com diferentes ofertas de forragem. R Bras Zootec 2010;39(10):2108-2115.

844

https://doi.org/10.22319/rmcp.v12i3.5375 Article

Characteristics of milk production in La Frailesca, Chiapas, Mexico Joaquín Huitzilihuitl Camacho-Vera a Juan Manuel Vargas-Canales b* Leticia Quintero-Salazar c Gregorio Wenceslao Apan-Salcedo d

Universidad de la Sierra Sur. División de Estudios de Posgrado, Guillermo Rojas Mijangos s/n, Col. Ciudad Universitaria, 70800 Miahuatlán de Porfirio Díaz, Oaxaca, México. b

Universidad de Guanajuato. División de Ciencias Sociales y Administrativas. Departamento de Estudios Sociales. Campus Celaya-Salvatierra. Guanajuato, México. c

Coinnova Consultores S. C. Guadalajara, México.

El Colegio de la Frontera Sur. Departamento de Agricultura, Sociedad y Ambiente. Chiapas, México.

* Corresponding author: jm.vargas@ugto.mx

Abstract: Historically, the Frailesca region has been one of the main livestock farming areas of the state of Chiapas, so it can be assumed that the current structure of its dairy system is a good approximation of that of the state. This work aimed to characterize and analyze the production units that are part of the dairy system of the Frailesca region, with the intention of describing their structure in terms of size and type of production units. For this purpose, production parameters, production costs and profitability indicators were used. The main characteristics of the production units, in terms of their size and operating conditions by locality of origin, were determined in order to construct a typology of producers and to 845

Rev Mex Cienc Pecu 2021;12(3):845-860

make a contrast by locality. It was found that the productive structure of the region is based on small-scale units that constitute about 76.7 % of the total units of the sample, while medium-sized producers represent 14.6 % of the total and large ones only 8.7 %. Between these types of producers, there is a significant difference in terms of the size of the productive herd, yield, costs and profitability. In summary, the structure of the productive system of the Frailesca region, like other tropical dairy systems in the country, is made up of small-scale production units with characteristics of labor-intensive family units, low technological level and high supplementation costs. Key words: Dairy production system, Profitability, Seasonality.

Received: 11/05/2019 Accepted: 30/10/2020

Introduction The state of Chiapas, along with other states in the southeast, is part of the states where the economic units of cattle farming follow an extensive-production, grazing and dual-purpose pattern(1,2,3). Throughout its history as a milk-producing state, the state has advanced within the top ten positions in terms of its production volume, although with less significant increases than those that occurred in regions with family livestock farming (Jalisco) or intensive livestock farming (Coahuila)(4). In Chiapas, cattle farming is a relevant activity for the state’s economy and has enormous relative importance in the primary sector. Since 2005, milk production has maintained a slight upward trend, which has placed the state as the ninth producer, even above states with higher levels of technification such as Hidalgo(4); despite the fact that it had been one of the states where the lowest prices paid to the producer had been reported until 2010. However, from that same year, there was a turning point in the behavior of this variable, which marked a modification towards a growing trend in terms of the real income paid to the producer(4). Historically, the Frailesca region has been one of the main livestock farming areas in Chiapas. In 2018, Villaflores, La Concordia and Villa Corzo, three municipalities of La Frailesca, ranked among the main milk-producing municipalities of the state, along with Ocozocuatla, Tecpatan and Tapachula(4). The region concentrates 10 % of the livestock

846

Rev Mex Cienc Pecu 2021;12(3):845-860

production units in the state and it is in milk production where it has the greatest relevance, given that 20 % of the units with dairy activity are located within its limits (5). In La Frailesca, according to the latest livestock censuses, 85 % of the dairy herd is maintained under some type of grazing system and the remaining proportion under stabling(5). In the current configuration of the value chain, five main links can be distinguished: supply, production, collection, processing and commercialization(6). The primary link has commercial linkages backwards with local and regional suppliers of inputs. Of these, those related to the supply of supplements for livestock feeding stand out for their importance, especially producers and marketers of poultry manure, grains and fodder(6). The links that producers have “forward” in the chain are diverse and depend, among other things, on the type of production units and their spatial and technological situation. The main linkage of producers forward is carried out with a key link in processing: cheese production. A good part of milk production becomes a raw material for the local and regional cheese industry, both for the artisanal industry and for that with industrial processes(6). To deepen the analysis of the behavior of milk production systems, it is necessary to identify the characteristics of milk production units (MPU), which is done in this work through a cluster analysis as a way to obtain better explanations about the economic activity and as a resource for the design of better management strategies(7). The production potential of MPUs in the country could increase if differentiated technological intervention policies and strategies were generated(8). For this purpose, an effective characterization is necessary. Although different variables have been used for the typification of production units, the ones that provide the best results for the analysis of milk production systems are the size of the production unit and the level of production(9). This method of analysis, at present, is one of the most used, as evidenced in recent case studies in Brazil, Colombia and Mexico (10-13), because it allows finding more relationships between the variables studied. This is especially relevant because milk production is carried out in all agroecological regions of the country, which range from highly technified to those of subsistence(12). In this sense, this work aimed to characterize the milk production systems in the main producing localities of the Frailesca region, through an analysis of the main production parameters of the MPUs and an analysis of the production costs and the benefit-cost ratio (profitability) for comparative purposes.

847

Rev Mex Cienc Pecu 2021;12(3):845-860

Material and methods A convenience sampling was carried out in the main localities with milk production within the municipalities that make up the Frailesca region. Three of the municipalities with the highest dairy activity were considered: La Concordia, Villaflores and Villa Corzo. Of these municipalities, eight localities were selected in such a way that there was an adequate representation of the production systems linked to artisanal cheese making and, on the other hand, those most linked to the larger processing (industrial). The selected localities were Benito Juárez, La Concordia (municipal seat) and Las Toronjas in the municipality of La Concordia; San Pedro Buena Vista, Revolución Mexicana and Ricardo Flores Magón for the municipality of Villa Corzo; Calzada Larga and Los Ángeles in the municipality of Villaflores. In total, information was obtained from 104 MPUs (46 units from La Concordia, 22 from Villa Corzo and 36 from Villaflores). In each locality, recognizable producers were detected and, later, through the snowball technique, other producers were found by reference of the previous ones. Through a structured questionnaire, information on technical-productive and economic variables regarding the characteristics of production, and the commercialization of milk produced in the different localities of the region, was obtained. The economic variables were obtained at prices of the immediately preceding cycle, according to the producer’s information. Most of the variable costs could be related to the monthly management of the herd, however, all were annualized in order to relate them to production and estimate the costs per cow and per liter. The calculation of the costs incorporated the sum of direct labor; costs of feeding, supplementation and medicines, costs for the purchase of feed for the herd (corn, fodder, silage, concentrate and poultry manure) and other direct costs related to the management of the herd (transport and freight, maintenance of meadows, payment of electricity, production of fodder, rent of paddocks and payment of professional services). Unpaid labor was not taken into account because its inclusion was considered to underestimate the profitability of family MPUs. It is generally assumed that unpaid labor should be evaluated based on its opportunity cost in a hypothetical market. However, the labor of women, children or the elderly hardly has a reference market, in that sense, including its cost as an artificial opportunity cost implies incorporating a negative bias in the calculation of profitability. To calculate the profit of the production units from the sale of milk, seasonal changes in production and price variations throughout the year were taken into account, that is, the annual income was obtained as the sum of the monthly value of the

848

Rev Mex Cienc Pecu 2021;12(3):845-860

production. In this quantification, the seasonality of production and prices faced by each unit of production were considered. The main characteristics of the production units, in terms of their size and operating conditions, were determined in order to construct a typology of producers and to make a contrast according to this characterization and their location by locality. The information obtained and the analyses constructed were cross-linked with information collected through focused interviews(14) with key actors in the dairy system of the region and the state, in order to have elements to discuss and interpret. With the information collected, a statistical analysis was carried out with the IBM SPSS® software. To contrast the characteristics of the different types of producers, a cluster analysis was carried out, in order to construct a typology based on the size of the production unit. Only the variable size was considered as a grouping factor, in order to have a better definition of the small, medium and large categories that are used by the official agencies related to the sector and in most investigations that seek to perform characterizations. For this purpose, the technique of grouping by furthest neighbors was used, since this method allows avoiding inconsistencies and undefinitions in the formation of groups(15). Cluster analysis is a technique used to resolve group belonging and has been widely used in the characterization and classification of agricultural and livestock production systems(16,17). An analysis of variance was performed to delimit the existence of differences by size and location locality. To define the contrasts between the groups, a Scheffé test was used, given the characteristics of disparity in the size of the groups and the robustness of this method(18,19,20). Both the design of the research and the analysis of the results and the interpretation of the information were carried out under the perspective of a single case study with multiple units of analysis(18), understanding that it was the situation of the milk production system in La Frailesca, the main object of the work and, therefore, the case study of interest.

Results and discussion According to the data obtained, about 65 % of the producers in the sample do not exceed herd sizes greater than 15 head of cattle in milking and 89 % do not reach 30 cows in milking. The average herd is 32.6 producing cows, a figure in which non-pregnant dry cows are also considered, while the average number of cows in milking is 16.37. This can be understood as the expression of a small-scale livestock farming where family labor(13,21)

849

Rev Mex Cienc Pecu 2021;12(3):845-860

and low technological levels predominate. This type of productive structure is typical of the dual-purpose tropical livestock farming in southern, southeastern Mexico and Latin America(11,22,23). As a result of the conglomeration process carried out based on the number of producing heads existing in each farm, three conglomerates were defined. The first group is made up of the largest production units that have herds in a range between 75 to 90 producing cows. It is important to mention that this group of producers obtain the highest milk yields in the region, significantly higher than the average of the yields of the other two groups, which suggests that they have a better control of the production process or better conditions to carry it out. The second group of production units, considered of medium size, ranges from 44 to 66 producing cows and obtain average milk yields. And finally, the third group of small production units (the most numerous), which range from 6 to 42 producing cows and obtain the lowest milk yields (Table 1), however, statistically there is no difference between these last two groups. Table 1: Herd characteristics by type of production unit (MPU) Yield

Area (ha)

11.9±5.7a 25.2±11.5b

6.8±3.6a 8.0±4.7a

24.6±19.0a 51.4±43.7b

Stocking rate (cows/ha) 1.52 ±1.47a 1.50 ±0.83a

41.1±12.5c

9.8±6.0b

76.4±53.2c

1.79 ±1.45a

Type of MPU

No. of MPU

Number of cows

Milking cows

Small Medium

80 15

23.3±9.1a 52.3±7.8b

Large

81.7±5.3c

abc

Yield= yield (L/cow/d). Shared superscript implies that there is no significant difference (P<0.05).

This classification gives a better idea of the productive structure of the region and corroborates that it is based on small-scale units that constitute about 76.7 % of the total units of the sample. For the sample obtained, medium-sized producers represent 14.6 % of the total and large producers only 8.7 %. Between these types of producers, there is a significant difference (P<0.05) in terms of the size of the producing herd and other parameters such as yield (not significant between small and medium-sized, but statistically different from the larger production units) and area measured in hectares (Table 1). As for the area of the livestock production units, the size is very variable, so, farms ranging from 2 to 180 ha of paddocks can be found. However, the stocking rate is similar between small, medium and large production units. It is the small ones that present the maximum stocking rate values, a situation that can be explained by the lower availability of land and the fragmentation of the agricultural area in the region. These production units generally have a high dependence between the availability of pastures and the level of milk

850

Rev Mex Cienc Pecu 2021;12(3):845-860

production, in addition to a higher incidence of parasitic diseases and less access to the market(24). The MPUs show a clear negative correlation between the available paddock area and the stocking rate to which it is subjected. That is, the smaller the paddock area available to the producer, the greater the stocking rate to which they subject that area. This fact is corroborated when analyzing the area of the ranches according to the locality in which they are located. As shown in Table 2, three of the localities with the smallest paddock area are also those with the highest number of animal units per hectare. Table 2: Stocking rate of production units (MPU) by locality Average area of Stocking rate Yield Locality MPU (ha) (AU/Ha) (L/cow/d) a a Calzada Larga 19.68±13.65 2.3±1.5 12.22±5.4d Las Toronjas 30.80±26.33a 2.0±2.4a 7.52±6.0c Revolución Mexicana 18.50±13.24a 1.8±0.7a 7.42±1.4c Benito Juárez 36.54±45.8a 1.6±1.6a 4.96±2.4a La Concordia 32.11±26.22a 1.4±0.7a 7.21±2.9bc Sn. Pedro Buenavista 42.27±41.53a 1.3±1.0a 6.79±1.0ab Los Ángeles 53.22±30.31a 0.8±0.4a 5.51±2.1ab Ricardo Flores Magón 38.60±26.95a 0.7±0.5a 5.32±1.5ab abcd

Shared superscript implies that there is no significant difference (P<0.05).

In the case of the locality of Calzada Larga, the units could be classified as more intensive and specialized, hence their smaller paddock area and their higher milking yields are natural, a feature that has already been described for milk producers in central Chiapas (25) and in Colombia where a higher production per animal and yield per hectare are obtained(11). These systems usually have more advanced technology, genetic improvement and a balanced food supply(24). Due to the extensive characteristics of the dairy system of La Frailesca, a low cost of production in the primary link would be expected, compared to the costs of the specialized and family production systems of the center and north of the country(26). However, proportionally higher costs related to feeding the herd can be found, due to the orientation of recent years towards supplementation during milking. According to the data obtained from the fieldwork, feeding costs represent more than 60 % of the total costs, a proportion higher than the 50 % reported for the family backyard systems of the center and south of the country(27,28) but below the 70 % of the production units of the specialized systems. This proportion is above the costs reported for other dual-purpose systems, such as that of the state of Jalisco, which is at 38.9 %(29) and those of the state of Veracruz of 46 %(21).

851

Rev Mex Cienc Pecu 2021;12(3):845-860

Of the general structure of the operating costs of the livestock production units, four concepts stand out for their high proportion with respect to the total: those of corn production, the purchase of ground corn, the payment of labor and the acquisition of poultry manure, the latter being the third in relevance. This value reflects the structural importance of the input and its enormous impact on the profitability of milk production due to the marked seasonality of prices in the face of food demand during the dry season (Figure 1). The specific weight of the poultry manure in the feeding of the herd can largely explain the recent findings of aflatoxins, both in fluid milk and in derivatives of the milk production chain of Chiapas(30,31,32), since this input is frequently contaminated with these mycotoxins. Poultry manure is an input of relatively recent introduction, given that in the mid-nineties it was not a regular part of the processes of livestock farming(33), despite the fact that there was already a developed poultry culture in the region(6).

Veterinary services

Electric power

Tick killers

Artificial insemination

Grassland rental

Other inputs

Forage

Forage production

Small

Concentrated feed

Medium

Silage corn

Mineral salts

Grassland maintenance

Corn production

Freight and transportation

Ground corn

Chicken manure

Large

Antibiotics

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Labor

1$ K/cow.year

Figure 1: Cost structure according to the type of production unit

As shown in Figure 1, permanent labor represents the largest component of the cost structure, which corresponds to the characteristics of production units with a low technological component and intensive in the use of labor. This concept refers to the wages paid to the person responsible for milking and herd management, who is often part of the family structure of the production unit. Therefore, it is important to consider that this expenditure is usually an income within the extended family unit and becomes a strategy of households to value the labor force of young members and generate a job option. These values coincide with what has been found by other economic studies of milk production in the Mexican tropics regarding that food and labor are the two main components of costs(34).

852

Rev Mex Cienc Pecu 2021;12(3):845-860

On average, the cost of production per liter of milk is $4.22, which implies that in the months that producers sell their production below this value, they are incurring losses, a situation that happens at least three months a year during the rainy season. However, the increase in prices during the dry season allows most of the units to operate with a positive profitability and an average benefit-cost ratio close to 3.1. This index shows that for each peso invested in the farm, that peso plus an additional $2.1 is obtained, that is, the operating costs of the dairy unit are covered, and a surplus is obtained. Differentiating costs according to the type of production unit, some important contrasts are perceived. Figure 1 shows that smaller producers are the ones who make more intensive use of the poultry manure in the feeding of their herds, as well as ground corn. This is consistent with other studies for the region, where it is recognized that the relationship of corn consumption by MPUs is in relation to the number of hectares of grazing available, hence the largest producers, in terms of the number of heads, are also those with the lowest consumption of poultry manure and corn, foods related to more intensive systems(23). Large and medium-sized producers, for their part, also use this resource, however, not in the same proportion. In terms of labor, larger producers make more intensive use of this resource, which is clearly reflected in their cost structure. This labor force is predominantly external (75 %), unlike small and medium-sized productive units where the non-family labor is between 50 % and 25 %, respectively. With the above data it can be inferred that smaller MPUs are closer to the behavior of family-type production units, while larger ones have more specialized and business characteristics as mentioned by other authors(12,24). Figure 1 shows that small production is more fragile due to the lack of resources for the maintenance of the herds. It is understood that, given the insufficiency of resources due to the small area and quality of pastures, they must resort to a greater expense for the rent of paddocks and the acquisition of fodder than those made by larger producers. For example, the cost of renting additional paddocks spent by small producers is up to $257 for each head of cattle, an amount that represents 3.7 times more than what is spent by large producers and 6.4 times more than medium-sized producers. These conditions explain the higher relative costs per head of producing cattle. While medium and large production units face costs of MXN$ 4,371 and MXN$ 4,967 annually per cow respectively, for small ones, each producing cow costs $5,815. As in other production systems, the smallest-scale producer faces the highest production costs, both in absolute and relative terms. This condition is reflected in both the total annual cost per cow and the cost per liter of milk produced. Although, in absolute terms, the milk yield per producing cow is very similar in the three strata, the smallest is the one that produces with the highest costs and, therefore, the one that receives the lowest profits from 853

Rev Mex Cienc Pecu 2021;12(3):845-860

the sale of their product. Higher unit costs per liter of milk also imply greater risk and uncertainty during the dry season. The threshold of the costs found is close to what was reported in other studies for the municipality of Villa Flores and the state capital(35). While medium and large units can withstand price decreases below the range of $3.50 without making losses, small ones begin to face them at the threshold of $4.50, which means that they assume this deficit for at least five months of the year (Table 3). Even with these vicissitudes, the small production presents a favorable benefit-cost ratio of 1.7, which implies a profit of seventy cents for each peso invested in the operation of the unit. On the other hand, large and medium-sized farms have better yields, the latter standing out with a benefit-cost ratio of 2.6. Table 3: Competitiveness indicators by type of production unit (MPU) Large MPU Medium MPU Small MPU a b Liters-cow/day 9.8±6.0 8.0±4.7 6.8±3.6c Total cost, M$ 405.60±116.9a 224.28±155.9b 126.49±112.7c Cost/cow, M$ 4.97±1.4a 4.37±3.2a 5.81±6.4a Cost/liter, M$ 3.68±2.4a 3.39±1.9a 4.44±2.8a Total income, M$ 834.30±488.2a 591.23±497.6b 211.12±117.6c B/C ratio 2.1 2.6 1.7 abc

Shared superscript implies that there is no significant difference (P<0.05).

The current structure of the bovine milk value chain in La Frailesca has a clear predominance of the processing link over the production link, a normal situation for the constitution of the structure of the country’s dairy systems(36). This influence is reflected in a very important way in the level of prices paid to the producer and in their seasonality. In each locality and in general throughout the region, an oligopsony of few demanding buyers has formed, whose volume of processing (and therefore of purchase) gives them the possibility of significantly influencing the price of milk in each locality, because the dairy industry focuses on buying from the most specialized producers(11), possibly because they produce more milk and of higher quality and hygiene(24). It is evident that the system reflects the historical vertical integration of dairy systems in Mexico, of both intensive and family and tropical dairy systems(36). Regarding the discrepancies between localities, the data showed significant differences in the yields obtained by livestock farms depending on their geographical location. In general, the locality of Calzada Larga stood out for having the highest milk yields of the entire sample of the Frailesca region (Table 2), which coincides with a significant difference in terms of supplementation with ground corn and poultry manure, as well as with the peculiarity that it is the only locality in which the practice of daily double milking is widespread. 854

Rev Mex Cienc Pecu 2021;12(3):845-860

In reinforcement of the idea of a relationship between supplementation and yield, the localities with the lowest milk production per head were also those with the lowest use of poultry manure. Clearly, the higher level of supplementation is related to higher yields and, therefore, higher costs. As in yields, the locality of Calzada Larga has the highest annual costs per head, the intensive characteristic of its production standing out, but also its greater dependence on the use of supplements and its vulnerability due to the variation of input prices. For its part, at the other extreme is the locality of Los Ángeles, in the municipality of Villaflores, with the lowest costs per animal unit and with also low yields, although statistically similar to most of the localities, but below Calzada Larga. Undoubtedly, the management of the level of intensity is a critical factor that affects overall productivity(37); however, the producer decides what level of intensity to adopt, seeking to increase their profits and within the limitations of the resources available in the production unit(24). As for the efficiency of the production units, their relationship with their low-cost system can be seen. As shown in Table 4, the localities with the lowest costs are also those with the highest relative profitability measured by their benefit-cost ratio (B/C). Of the B/C contrasts, it stands out that the farms with higher costs of supplementation are those that show less efficiency in the use of resources, however, their high yields result in higher incomes, generating the greatest absolute benefits. In other words, they are less efficient (since they have the lowest B/C ratios) but, thanks to their high production volumes, they generate the highest income for family units. Table 4: Economic indicators of production units (MPU) by locality Average income per Average cost per Locality B/C ratio MPU (MXN$) MPU (MXN$) Ricardo Flores Magón 138.49±57.4a 50.64±61.7a 5.72±5.1a Los Ángeles 248.77±99.9ab 93.90±57.5a 4.03±3.8 ab Benito Juárez 247.98±398.5ab 104.91±108.3a 2.94±2.2 ab Las Toronjas 201.23±160.2a 87.26±81.6a 3.07±2.0ab Sn. Pedro Buenavista 403.34±249.8ab 198.56±160.4ab 5.20±6.4ab La Concordia 357.74±223.3ab 194.59±99.5ab 1.97±0.9 ab Calzada Larga 587.78±485b 325.77±178.14b 1.73±0.7b Revolución Mexicana 251.69±130.3ab 199.80±87.9ab 1.32±0.6b abcd

Shared superscript implies that there is no significant difference (P<0.05).

855

Rev Mex Cienc Pecu 2021;12(3):845-860

Conclusions and implications The structure of the production system of the Frailesca region is made up of small-scale production units with characteristics of family units, with intensive use of labor and low technological level. In the region, an oligopsony of few buyers has formed, which gives them the possibility of significantly influencing the price of milk. Milk production can be described as profitable in general, for both smaller and larger units. The difference between the MPUs is very marked depending on the locality. Those with more intensive production systems are more closely linked to larger processing industries. On the other hand, those of smaller dimensions are more linked to transformation systems of an artisanal nature.

Acknowledgements

To educational and research institutions, civil society organizations, government institutions, the private sector and especially the producers of the milk value chain of the region La Frailesca, Chiapas, for their total availability to provide information for the development of this research. Part of this study has been possible thanks to the support of the people of the United States through the United States Agency for International Development (USAID) under the terms of its Cooperation Agreement No. AID-523-A-1100001 (Project for Reducing Emissions from Deforestation and Forest Degradation of Mexico) implemented by the main awardee The Nature Conservancy and its partners (Rainforest Alliance, Woods Hole Research Center and Espacios Naturales y Desarrollo Sustentable).

Literature cited: 1. Vera R, García O, Botero R, Ullrich C. Producción de leche y reproducción en sistemas doble propósito: Algunas implicancias para el enfoque experimental. Past Trop 1994;18(3):25-32. 2. Cortés H, Aguilar C, Vera R. Sistemas bovinos doble propósito en el trópico bajo de Colombia, modelo de simulación. Arch Zootec 2003;52(197):25-34. 3. Orantes MÁ, Platas D, Córdova V, De los Santos MC, Córdova A. Caracterización de la ganadería de doble propósito en una región de Chiapas, México. Ecosist Recur Agropecu 2014;1(1):49-58.

856

Rev Mex Cienc Pecu 2021;12(3):845-860

4. SIAP. 2018. Servicio de Información Agroalimentaria y Pesquera. Datos abiertos. Estadísticas de producción pecuaria 2018. 5. INEGI. 2007. Instituto Nacional de Estadística y Geografía. Censo Agropecuario 2007, VIII Censo Agrícola, Ganadero y Forestal. 6. Camacho VJH, Vargas CJM, Quintero SL, Apan SGW. Evolución del sistema productivo de leche de bovino en La Frailesca, Chis. Rev Geograf Agríc 2018;(61):67-84. 7. Bonora F, Benni S, Barbaresi A, Tassinari P, Torreggiani D. A cluster-graph model for herd characterization in dairy farms equipped with an automatic milking system. Biosyst Eng 2018;167:1-7. 8. Cuevas-Reyes V, Rosales-Nieto C. Characterization of the dual-purpose bovine system in northwest Mexico: producers, resources and problematic. Rev. MVZ Córdoba 2018;23(1):6448-6460. 9. Bedoya ODM, Cassoli LD, Ángel MO, Muñoz MFC. Caracterización de sistemas de producción lechera de Antioquia con sistemas de ordeño mecánico. Livest Res Rural Dev 2018;30:1-10. 10. Kuwahara KC, Damasceno JC, Bánkuti FI, Prizon RC, Rossoni DF, Eckstein II. Sustainability and typology of dairy production systems. Semina: Ciênc Agrár 2018;39(5):2081-2092. 11. Nivia A, Beltrán E, Marentes D, Pineda A. Caracterización técnico-administrativa de los sistemas de producción bovino de leche de pequeña escala en una región central de Colombia. Idesia 2018;36(2):259-268. 12. Koerich G, Damasceno JC, Bánkuti FI, Parré JL, Santos GTD. Influence of forage production area, concentrate supply, and workforce on productive results in milk production systems. R Bras Zootec 2019;48:e20170177. 13. Albarrán-Portillo B, García-Martínez A, Ortiz-Rodea A, Rojo-Rubio R, VázquezArmijo JF, Arriaga-Jordán CM. Socioeconomic and productive characteristics of dual purpose farms based on agrosilvopastoral systems in subtropical highlands of central Mexico. Agroforest Syst 2019;93(5):1939-1947.

857

Rev Mex Cienc Pecu 2021;12(3):845-860

14. Merton R, Marjorie F, Kendall P. Propósitos y criterios de la entrevista focalizada. EMPIRIA 1998;(1):215-227. 15. Hair JF, Anderson RE, Tatham RL, Black WC. Análisis multivariante, 5a ed. Prentice Hall, Iberia, Madrid, España, 1999. 16. Viera GG, Viera RG, Olivera RMP, Morales A. Clasificación dinámica de los sistemas de producción lechera de la cuenca Camagüey-Jimaguayú, Cuba. Rev Prod Anim 2004;16(1):17-26. 17. Forclaz MA, Mazza SM, Giménez LI. Clasificación de los sistemas de producción algodonera en la provincia del Chaco, mediante el uso de análisis de conglomerados. RIA. Rev Investig Agropecu 2004;33(3):15-25. 18. Yin R. Case study research: Design and methods. USA: Sage Publications; 1994. 19. Stake R. Investigación con estudio de casos. España, Ediciones Morata, 1998. 20. Gundermann H. El método de los estudios de caso. Tarrés ML (coord.). Observar, escuchar y comprender sobre la tradición cualitativa en la investigación social, México: Facultad Latinoamericana de Ciencias Sociales; 2004. 21. Cervantes EF, Santoyo CH, Álvarez MA. Lechería familiar, factores de éxito para el negocio. UACh/CIESTAAM-PIAI, México, Plaza y Valdés, 2001. 22. Vilaboa J, Díaz P, Ruiz O, Platas DE, González S, Juárez F. Caracterización socioeconómica y tecnológica de los agroecosistemas con bovinos de doble propósito de la región del Papaloapan, Veracruz, México. Trop Subtrop Agroecosystems 2009;10(1):5362. 23. Cuevas V, Loaiza A, Espinosa JA, Vélez A, Montoya MD. Tipología de las explotaciones ganaderas de bovinos doble propósito en Sinaloa, México. Rev Mex Cienc Pecu 2016;7(1):69-83. 24. Ramírez-Rivera EJ, Rodríguez-Miranda J, Huerta-Mora IR, Cárdenas-Cágal A, JuárezBarrientos JM. Tropical milk production systems and milk quality: a review. Trop Anim Health Prod 2019;51(6):1295-1305.

858

Rev Mex Cienc Pecu 2021;12(3):845-860

25. Castro HG, Tewolde AM, Toral JN. Análisis de los sistemas ganaderos de doble propósito en el centro de Chiapas, México. Arch Latinoam Prod Anim 2002;10(17):5-183. 26. Carranza RG, Macedo R, Cámara J, Sosa J, Meraz AJ, Valdivia AG. Competitividad en la cadena productiva de leche del estado de Aguascalientes, México. Agrociencia 2007;41(6):701-709. 27. García LA. Estrategias de las agroindustrias lecheras latinoamericanas: Estudio comparativo ante el proceso de globalización económica. Rev Mex Agronegocios 2001;5(9):263-273. 28. Vázquez E, Aguilar U, Villagómez JA. Comparación de la eficiencia productiva y económica de grupos ganaderos organizados de doble propósito y de lechería familiar/semiespecializada. Ciencia Administrativa 2016;1:226-237. 29. Lara D, Mora JS, Martínez MA, García G, Omaña JM, Gallegos J. Competitividad y ventajas comparativas de los sistemas producción de leche en el estado de Jalisco, México. Agrociencia 2003;37(1):85-94. 30. Vázquez JA, Herrera JG, Ruíz B, Ortega ME, Barreras A, Rojas RI. Niveles de aflatoxinas en alimento y leche cruda en ranchos de la región centro de Chiapas. Ciencia e Innovación 2018;1(1):155-164. 31. Ruíz JL, Gutiérrez R, Orantes MA, Manzur A. Contaminación por micotoxinas de la leche y derivados lácteos. Quehacer Científico en Chiapas 2017;12(1):90-102. 32. Gutiérrez R, Vega S, Pérez JJ, Ruiz JL, Yamazaki A, Rivera JG, Urbán G, Escobar A. Evaluación de aflatoxina M1 en leche orgánica producida en Tecpatán, Chiapas, México. Rev Salud Anim 2013;35(1):33-37 33. Álvarez A, Barajas V, Montaño E. La reorganización del sistema lechero inducida por la Nestlé en La Frailesca, Chiapas. Comer Exter 1997;47(12):947-954. 34. Zárate JP, Esqueda VA, Vinay JC, Jácome SM. Evaluación económico-productiva de un sistema de producción de leche en el trópico. Agron Mesoam 2010;21(2):255-265. 35. Lau A, Barrientos JM, Torres JM, Torres SI, Manzur A, Orea RI, Metodología de costos unitarios en microempresas de bovinos de doble propósito del estado de Chiapas, México. Quehacer Científico en Chiapas 2017;12(1):64-68.

859

Rev Mex Cienc Pecu 2021;12(3):845-860

36. Del Valle C, Hernández A, Aguilar C. La integración vertical en los sistemas lecheros de la frailesca, Chiapas y los Altos de Jalisco en el contexto de la globalización. Martínez E, et al (Coord.). Dinámica de sistema lechero en el marco regional y global. México: Plaza y Valdés; 1999:203-220. 37. Mezgebe G, Gizaw S, Urge M. Growth, reproductive, and productive performance of Begait cattle under different herd management systems in northern Ethiopia. Trop Anim Health Prod 2018;50(6):1313-1318.

860

https://doi.org/10.22319/rmcp.v12i3.5569 Article

Analysis of the demand for live beef cattle in slaughter centers in Mexico, 2000-2018

Nicolás Callejas Juárez a* Samuel Rebollar Rebollar b

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada Km 1, Chihuahua, Chihuahua, México. b

Universidad Autónoma del Estado de México. Centro Universitario UAEM Temascaltepec, Estado de México, México.

* Corresponding author: ncallejas@uach.mx

Abstract: The analysis of the value chain in beef cattle of Mexico has focused mainly on production and final consumer; however, slaughter centers represent the main link between producers and consumers. The objective was to analyze the demand for live beef cattle in the slaughter centers of Mexico, 2000-2018. The sample considered 50 slaughterhouses, in 26 of 32 states and the demand models were estimated using the ordinary least squares method. It was possible to estimate the four best demand models by product; the price explained 43.4 % of the variability in the quantity of beef in the slaughter centers; 60.4 % for cull cows, 37.7 % steers, 33.5 % cull bulls and 28.8 % heifers. All products behaved inelastic in price (-0.17), but the demand for steers had the lowest elasticity (-0.06). The beef market presented a low average density of connections between the producers and slaughter centers analyzed (25.2 ± 43.4 %), which indicates its inefficiency. The state of Jalisco represented the main slaughter center in steers and cull cows, while Aguascalientes in heifers and cull bulls. Key words: Steer meat, Heifer meat, Cow meat, Bull meat, Elasticity of demand, Market density.

861

Rev Mex Cienc Pecu 2021;12(3):861-877

Received: 05/12/2018 Accepted:18/03/2021

Introduction Is the price the most important variable that determines the quantity of cattle demanded in slaughter centers in Mexico? Market information in beef production systems is a public good, allowing for an allocation of resources based on maximum productivity. In Mexico, the availability of market data lacks sufficient and relevant information (data analysis), in time and in due form, for decision making. The National System of Information and Market Integration (SNIIM, for its acronym in Spanish) is one of the official institutions that provides data related to the price, quantity supplied and demanded of cattle in slaughter centers in Mexico. However, it only provides a random sample of the slaughter centers (private, TIF and municipal), price and live weight that allows estimating the demand functions. Market research on beef in Mexico has been conducted for the consumption of live beef cattle and carcass, not so for slaughter centers, none on the efficiency of slaughter centers and all refer to case or local studies(1,2,3). In addition, a study on the main meats consumed in Mexico confirmed a substitution effect between beef and chicken(4); on the other hand, in other works on the regional demand for Mexican beef, an inverse and inelastic relationship between the quantity and price of beef in carcass was found(5), associated with an inelastic effect of the producer price and an elastic effect of the consumer price(6). For its part, another study examined the effect of pork imports on domestic beef consumption and it was concluded that pork imports have a negative effect on the beef substitute market in Mexico(7); confirming that, globally, 70 % of production is concentrated in India, Brazil, Australia, United States (USA) and New Zealand and demand in USA, Canada, EU (European Union) and Russia(8). In another similar study, it was found that the demand for livestock products was a function of income and that, according to the trend, the volume produced and the demand for chicken meat will be satisfied, but not that of beef. Therefore, the need to do research at the level of supply center (producers) and slaughter center (consumers) in Mexico(9). The market of meat of live cattle in Mexico is characterized by four products: steer, heifer, cull bull and cull cow(10); steer and heifer meats are targets of the production system and the other two by-products are from the production process. The supply of the four types of meat is a function of the composition of the herd; that is, the proportion of cows, bulls, heifers, steers and calves(11). The inventory of beef cattle in Mexico was 31.9 million head of cattle; in fattening 33.4 %, calves 25.1 %, cull 11.6 %, in development 10.3 %, replacement heifers 862

Rev Mex Cienc Pecu 2021;12(3):861-877

7.2 %, cows only for reproduction of calves 5.5 %, cows only for milk production 4.4 % and others 2.5 %. As a result, 41.8 % was marketed through intermediaries, 11.4 % in TIF slaughterhouse, 5.4 % export, 2.8 % municipal slaughterhouse, 1.9 % private slaughterhouse and others 36.7 %(12). In 2000, just over 4.2 million t of live beef were supplied in Mexico; 43 out of every 100 t corresponded to chicken, 33 to cattle and 24 to pig; in 2018, it was just over 6.8 million t; 49 out of every 100 t corresponded to chicken, 39 to cattle and 22 to pig. This meant a 6 % increase in the supply of chicken meat and a 4 and 2 % decrease in beef and pork(13). In turn, in 2018, the national monthly installed capacity for the slaughter of cattle was 1’108,043 heads; 49.14 % in TIF slaughterhouses, 43.36 % in municipal slaughterhouses and 7.5 % in private slaughterhouses(14). However, only 54 % of the national monthly installed capacity is used; 63 % of TIF slaughterhouses, 47 % municipal slaughterhouses and 43 % private slaughterhouses. None of the TIF and private slaughterhouses are at 100 % of their installed capacity; and of the private sector, only Chiapas reported 100 % of its capacity used (15). So, there is an area of opportunity in research to analyze and propose strategies to improve the productivity of beef slaughter centers in Mexico. The productivity of a production system is measured by four elements: efficiency, effectiveness, quality and economy(16). The efficiency of livestock production in Mexico, measured in the slaughter centers of live cattle to meat in carcass, showed that in 2019 the production of pork had the highest efficiency among meats with 79.0 %, poultry 78.1 %, turkey 74.4 %, bovine 54.8 %, ovine 51.6 % and caprine 51.4 %. In the case of beef cattle, efficiency decreased by 21.8 %, which would imply a greater number of animals slaughtered to supply national consumption(13). Therefore, the study aimed to analyze the demand for live beef cattle in the slaughter centers of Mexico, 2000-2018. The central hypothesis is that the low capacity used of the slaughter centers is due to the location of the supply centers and slaughter centers, an installed capacity greater than that required, and that the price paid to the producer or supply center determines the number of steers, cows, bulls and heifers demanded in the slaughter centers of Mexico.

Material and methods Four products of live beef cattle were analyzed: steer (ST), heifer (HE), cull bull (BU) and cull cow (CO) demanded in the slaughter centers of Mexico. As a demand, the number of heads of cattle slaughtered in the slaughter centers (private slaughterhouses, TIF slaughterhouses and municipal slaughterhouses) reported by the National System of 863

Rev Mex Cienc Pecu 2021;12(3):861-877

Information and Market Integration (SNIIM, for its acronym in Spanish) in the period 20002018 was considered. Of 90 slaughter centers that reported activities in the analysis period, however, the sample (n= 54) considered those that reported activities throughout the analysis period: 19 municipal, 10 TIF and 4 private. These are located in 26 of the 32 states. The slaughter centers that reported activities also specialize by type of product in: steer 27 slaughterhouses, heifer 11, cull bull 17 and cull cow 23. Since the data reported by the SNIIM lack the live weight of slaughtered animals, the heads of cattle, which allowed being in accordance with the installed slaughter capacity, were considered as the quantity demanded, instead of volume in kilograms (kg). The market price of products was deflated with the national consumer price index (INPC 2018=100)(15). Theoretical models consider that the quantity demanded (𝐷𝑗 , j= 1, 2, 3, 4) of live steer (STD), heifer (HED), bull (BUD) and cow (COD) have a linear relationship with the price (𝑃𝑗 , 𝑗 = 1, 2, 3, 4) of the live steer (STP), heifer (HEP), bull (BUP) and cow (COP), respectively. In its statistical form, Dj was written as: Dj = f(Pj ) + e The models used were estimated through the Ordinary Least Squares (MCO) method proposed by Gauss and Legendre in 1808, which minimize the sum of squares of errors. The economic validation of the models was carried out by considering the economic theory that indicates an inverse relationship between the quantity demanded of heads of cattle and the price in slaughter centers. Although, the slope of the demand function allows measuring the amount and direction of the quantity demanded in the face of changes in the price; there is the price elasticity of demand (𝐸𝑃𝐷 ), which measures the change or sensitivity of the quantity demanded (∆𝑄) to changes in price (∆𝑃𝑗 ). The 𝐸𝑃𝐷 were obtained using a log-log regression model for each meat product analyzed. Ln(Dj ) = ln(β0 ) + β1 ln(Pj ) + ui In this way, 𝛽1 represents the price elasticity of demand for each of the products analyzed and measures the percentage change in the quantity demanded of heads of cattle in the face of a percentage change in their price.

864

Rev Mex Cienc Pecu 2021;12(3):861-877

The analysis of the demand for beef in slaughter centers was carried out through the analysis of social networks, which allows identifying the most important actors (slaughter centers and supply centers) and their commercial relationships(17). Finally, to validate the results and make inference about the demand for live cattle, the statistical significance of the models was performed by considering the p-value and t-Student for the price regression coefficient(18).

Results On average, during the analysis period, 2000-2018, 2.7 million head of cattle were slaughtered, distributed as follows: 40.9 % steer, 34.7 % cow, 13.8 % bull and 10.6 % heifer. The average weight at slaughter for steer was 465.6 ± 124.4 kilograms of live weight (kgLW), heifer 472.5 ± 43.3, cow 471.5 ± 117.4 and bull 466.7 ± 53.7. The real prices of live cattle were higher for steer 32.8 ± 9.0 $/kg, heifer 27.73 ± 8.4 $/kg, cow 23.3 ± 7.6 $/kg and bull 30.0 ± 9.1 $/kg. In general, the price of the four products was homogeneous (CV= 24 %), the price of the cow presented the greatest variability (CV= 32.7 %) and that of steer the lowest variability (CV= 27.5 %). The specialization of the supply centers for the slaughter of cattle showed that 23 of them specialize in steer meat, five in heifer, 17 in cow and 11 in bull; the other slaughter centers are based on the seasonality of meat production.

Steer meat

According to the sample, of the 37 steer slaughter centers that reported operations in 2000, in 2018 only 27 did so; while the number of steers slaughtered decreased by 10.6 %. In 2010, the four main slaughter centers slaughtered 41.0 % of the steers in Mexico (Municipal Slaughterhouse of Guadalajara 21.3 %, Naucalpan 7.3 %, La Paz 6.4 % and TIF 78 Frigorífico del Sureste 5.9 %; while, in 2018, four slaughter centers demanded 55.8 % (Slaughterhouse TIF 111 22.2 %, Municipal Slaughterhouse of Guadalajara 16.6 %, Sukarne slaughterhouse 10.5 % and Procarne slaughterhouse 6.5 %). The supply of steers occurred in 27 of the 32 states. Likewise, in the analysis period, the three main steer suppliers changed their position and importance; while in 2000, they were Jalisco (29.3 %), Nuevo León

865

Rev Mex Cienc Pecu 2021;12(3):861-877

(11.5 %) and Chiapas (11.2 %); in 2018, they were Sinaloa (22.2 %), Nuevo León (18.6 %) and Jalisco (18.2 %).

Heifer meat

In 2000 there were 11 centers specialized in the slaughter of heifers, in 2018 the same number was counted, but not the same centers; some stopped providing information and others disappeared. In 2000, a single center slaughtered 74.0 % of heifer (TIF 111 Vizur Sin) and the states with the most important slaughter centers were Guanajuato 23.6 %, Chiapas 22.3 % and San Luis Potosí 12.0 %; in 2018, Sinaloa 74.1 %, Guanajuato 10.24 % and Michoacán 8.2 %. The supply of heifer was made by 19 states in 2000, the most important were Chiapas 21.9 %, Guanajuato 14.1 % and Jalisco 11.8 %; while in 2018, there were 14 states, Sinaloa 74.1 %, Michoacán 8.2 % and Jalisco 8.0 %.

Cow meat

The cow is mainly a cull product in Mexico in all production systems. Some states are characterized by a greater slaughter for having dairy basins, such is the case of Coahuila, Durango, Jalisco, Aguascalientes, Querétaro, Chihuahua and Hidalgo. In 2000, there were 34 supply centers specialized in cow slaughter and in 2018 they reduced by 32.3 %, the most important was M.S. Guadalajara that slaughtered 27.6 % of cows. In 2000, the most important states in cow slaughter were Jalisco 34.8 %, Guanajuato 7.88 % and Chiapas 7.5 %. In 2018, they were Jalisco 30.9 %, Sinaloa 28.2 % and Aguascalientes 12.2 %. The supply of cows in 2000 was meet with production from 25 states, the most important were Jalisco 36.9 %, Chiapas 7.4 % and Zacatecas 6.6 %; while, in 2018, the supply corresponded to 21 states and the main suppliers were Sinaloa with 28.2 %, Jalisco 27.4 % and Aguascalientes 11.3 %.

Bull meat

As in the case of cow meat, bull meat comes from cull animals. In 2000, there were 14 supply centers specialized in bull slaughter, the most important were P.S. León Servicios Integrales in Guanajuato (20.7 % of slaughtered bulls), TIF 78 Frigorífico del Sureste in Chiapas (19.9%), and M.S. of San Luis Potosí (10.5%). In 2018, there were the same number of slaughter centers, but some were new; now the main slaughter centers were TIF 111 Visur in 866

Rev Mex Cienc Pecu 2021;12(3):861-877

Sinaloa with 46.5 % of bulls slaughtered, TIF Slaughterhouse in Sonora 11.7 % and Frigorífico y Empacadora de Aguascalientes 11.6 %. In 2000, the supply of bull was concentrated in 19 states; the most important were Chiapas 19.5 %, Sonora 12.47 % and Guanajuato 12.3 %. In 2018, only 14 supplied bull, the most important Sinaloa 46.5 %, Aguascalientes 16.1 % and Sonora 12.2 % of bulls offered.

Demand functions

All models for beef demand, by product, coincided with economic theory, except for bull, and were statistically significant in the coefficient of the price (P<0.05). For the four types of meat, the price explained 46.4 % of the number of heads of cattle slaughtered in slaughter centers, while, for all three products, just over 28 % (Table 1). Therefore, the estimated models are considered good (the law of demand holds, the price explains the variability of the quantity demanded, the P-value is <0.05, the coefficient of variation is low, and the standard error of estimate represented less than 21.2 % of the average number of heads of cattle demanded in the slaughter centers).

Intercept* Slope 𝑅2 F-Ratio Prob(F) S.E. T-Test Prob(T)

Table 1: Demand models STD HED BUD COD 1.5 0.5 0.2 1.4 -9,736.9 -5,686.5 4,354.6 -19,599.0 0.4 0.3 0.3 0.6 16.5 15.3 0.2 25.9 0.0 0.0 0.7 0.0 3,012.6 1,474.6 13,676.1 3,852.0 -3.2 -3.9 0.3 -5.1 0.0046 0.0012 0.7538 0.0001

All 3.7 -29,737.1 0.5 14.7 0.0 7,756.3 -3.8 0.00012

STD= quantity demanded of steers; HED= quantity demanded of heifers; BUD= quantity demanded of bulls; COD= quantity demanded of cows; *Millions of heads.

Price elasticity of demand

The price elasticity of demand for meat of live cattle in slaughter centers was 0.36 %; that is, inelastic and indicates that for every 1 % that the real price of beef changes in Mexico, the quantity demanded of cattle in the slaughter centers will change 0.36 %. The price elasticity of demand, by product, was also inelastic; thus, the price elasticity of demand for the steer 867

Rev Mex Cienc Pecu 2021;12(3):861-877

was 0.33 % (0.33) for 1 % of real change in its price, for the steer 0.65, bull 0.39 and cow 0.60 % (Table 2).

Demand

Table 2: Estimated demands by product and slaughter center Intercept Slope R2

Steers M.S. Aguascalientes M.S. La Paz B.C.S. M.S. Campeche TIF 78 Frigorífico del Sureste P.S. Perecederos y Derivados Municipal meat processor of Colima M.S. Cerro Gordo M.S. Naucalpan M.S. Nezahualcóyotl M.S. Tlalnepantla M.S. Guadalajara M.S. Tlaquepaque M.S. Tonalá M.S. Morelia Bodega de Productos Internacional Chamar Alimentos TIF 356 Procesadora Selecta, S.A. de C.V. TIF 15 Emp. Trevino Procesadora de carnes "La Alianza" M.S. of San Luis Potosí Bovine TIF Cd. Obregón Aric Planta TIF 170 M.S. Zacatecas Heifers M.S. Aguascalientes M.S. Campeche P.S. León, Serv. Integral M.S. Morelia Procesadora de carnes “La Alianza” M.S. of San Luis Potosí TIF Bovinos Cd. Obregón M.S. of Xalapa Aric Plant TIF 170 M.S. Zacatecas 868

Prob(T)

36103.90 7574.20 12530.50 35372.60 84715.20 20119.00 29763.10 165418.30 159118.40 26727.50 252444.00 24994.70 21284.60 46452.30 158031.90 100326.20 90551.00 58460.80 6694.80 35077.90 12133.30 14011.30 5823.20

-1207.70 -150.50 -172.70 -570.50 -4019.90 -410.50 -475.30 -5588.00 -6746.60 -321.00 -2608.80 -352.80 -308.70 -594.30 -6484.60 -1186.60 -1627.70 -1007.80 -108.70 -496.40 -203.40 -325.90 -106.60

0.70 0.70 0.30 0.40 0.80 0.90 0.60 0.50 0.80 0.60 0.50 0.60 0.60 0.50 0.80 0.30 0.30 0.30 0.80 0.40 0.30 0.40 0.40

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

12204.00 21591.90 95873.10 34700.10 6393.50 31448.00 12831.10 12555.40 15498.10 4025.80

-391.90 -865.60 -2067.80 -326.50 -110.20 -442.40 -225.30 -360.40 -449.10 -66.80

0.40 0.50 0.60 0.20 0.80 0.30 0.40 0.60 0.50 0.40

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Rev Mex Cienc Pecu 2021;12(3):861-877

Bulls M.S. La Paz B.C.S. M.S. Campeche TIF 78 Frigorífico del Sureste P.S. León, Serv. Integral M.S. Queretaro M.S. of San Luis Potosí Bovine TIF slaughterhouse Cd. Obregón M.S. Zacatecas Cows M.S. La Paz B.C.S. M.S. Campeche TIF 78 Frigorífico del Sureste P.S. La Torrena Municipal meat processor of Colima M.S. Tlalnepantla P.S. León, Serv. Integral M.S. Guadalajara M.S. Tlaquepaque M.S. Tonalá M.S. Morelia A.M. Tepic M.S. of San Luis Potosí

9013.50 14448.40 35465.70 90598.60 65717.70 32320.80 14144.40 4375.10

-233.70 -322.40 -650.70 -1530.50 -1069.50 -246.30 -366.00 -69.90

0.70 0.40 0.40 0.50 0.20 0.20 0.50 0.40

0.00 0.00 0.00 0.00 0.10 0.00 0.00 0.00

9516.30 13642.80 34722.70 61715.70 17857.40 21154.20 91272.80 242265.20 23580.10 19068.80 46044.10 24111.70 30994.00

-340.60 -327.70 -646.30 -3717.70 -825.90 -347.40 -2275.10 -3116.50 -422.80 -310.20 -813.50 -517.80 -248.10

0.80 0.30 0.40 0.80 0.60 0.20 0.70 0.40 0.50 0.50 0.40 0.60 0.20

0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.10

M.S.= municipal slaughterhouse; P.V.= private slaughterhouse; TIF= federal inspection type.

In addition, Table 2 presents the estimated demand functions both by slaughter center and by each of the products in which the theory is verified, the estimated functions were statistically significant (P>0.05) at the predetermined confidence level.

Networks

In Figure 1, it can be seen that in the most important supply (n= 33) and slaughter (n= 25) centers in Mexico, the concentration of live beef cattle is in four slaughter centers, near the four centers of meat consumption (Mexico City, Jalisco, State of Mexico and Nuevo León); in addition, Aguascalientes has become a collection center for the supply centers of the north of the country. Overall, the market has an efficiency of 25.2 %, which means the set of possible relationships between production centers and slaughter centers. The variance 869

Rev Mex Cienc Pecu 2021;12(3):861-877

(43.4 %) indicates that supply centers and slaughter centers receive the heads of cattle from different origin or that both seek the best price. The main slaughter center was Jalisco with 82.9 ± 38.6 % of the possible market relations, other important ones were State of Mexico 77.8 ± 42.9 %, Aguascalientes 63.7 ± 48.1 %, Guanajuato 51.5 ± 50.0 % and Nuevo León 45.6 ± 49.8 % of possible relationships. Likewise, the most important supply center was Aguascalientes, which was related to 84.0 ± 36.7 % of the slaughter centers, Jalisco 44.0 ± 49.7 % and Zacatecas 40.0 ± 49.1 % of the slaughter centers. Figure 1: Mexico, network of cattle supplies and slaughter centers

Blue color = slaughter centers and red color = supply centers.

The most important slaughter centers in steer slaughter are located in the State of Mexico, Jalisco and Aguascalientes; they receive steer from the highest proportion of states. The remotest states of the country meet their demand for steer with local production (Baja California Sur and Yucatan). The low relation (25.2 %) that the supply centers have with all the slaughter centers can be explained by the distance between supply centers and slaughter centers, in addition to the specialization in the type of animals slaughtered. In the case of Jalisco, which was related to more than 80 % of the supply centers or states, it can be explained by the geographical location, the installed capacity and the specialization in steer and cow (Figure 2).

870

Rev Mex Cienc Pecu 2021;12(3):861-877

Figure 2: Slaughter and supply centers for steer meat

In the case of heifers, the relation of the slaughter and supply market reduces. The market of Baja California Sur is isolated from the domestic market. The average of all possible relationships was 19.4 ± 39.5 %, which means low network density and variability. The slaughter centers with the highest nodal degree or degree of influence were Aguascalientes and Guanajuato with 54.9 ± 50.1 %. Likewise, the supply centers with the greatest influence were Aguascalientes 66.7 ± 47.1 % of the supply centers, Zacatecas 38.9 ± 48.8 %, Jalisco and Yucatán 33.3 ± 47.1 %, respectively (Figure 3). Figure 3: Slaughter and supply centers for heifer meat

871

Rev Mex Cienc Pecu 2021;12(3):861-877

The market density for cow meat was 22.9 ± 42.0 %, meaning that approximately 23 % of the trades that could occur between suppliers and slaughter centers were achieved. The slaughter centers of Jalisco have market relations with 84.4 ± 36.3 % of the supply centers. Aguascalientes and Guanajuato are the other centers that have a commercial relationship with 53.1 ± 49.9 % of the supply centers. For supply centers, the states of Aguascalientes, Jalisco and Zacatecas had 80.0 ± 40.0, 44.0 ± 49.0 and 40.0 ± 49.1 % of their commercial relations (Figure 4). Figure 4: Slaughter and supply centers for cull cows

For the bull meat market, a density of 19.7 ± 39.8 % was found, the lowest of the four products analyzed. The slaughter centers of Aguascalientes and Guanajuato had exchanges of bull meat with 58.6 ± 49.3 % of the supply centers, others such as San Luis Potosí 31.0 ± 46.26 %, Durango and Nayarit 31.0 ± 46.3 %. The supply centers of Aguascalientes had exchanges with 72.2 ± 44.8 % of the slaughter centers, Jalisco and Zacatecas 38.9 ± 48.8 %, in addition to Guanajuato, Querétaro and Sonora with 27.8 ± 44.8 % of their relations with the supply centers (Figure 5).

872

Rev Mex Cienc Pecu 2021;12(3):861-877

Figure 5: Slaughter and supply centers for bull meat

Discussion Price elasticity of demand

The slaughter centers with elastic price elasticity of demand were Guanajuato, Nuevo León, San Luis Potosí, Jalisco, Durango, Coahuila and Sinaloa; while the rest behaved in an elastic way. One of the hypotheses of this behavior is the specialization they have in the meat products of the slaughtered animals (steer 74.1 %, heifer 90.0 %, cow 82.3 % and bull 60.2 %). The second is that, having such a low used capacity forces them to respond in an elastic manner to price changes to remain in the market; in this case, the slaughter centers with elastic price had a used capacity of 63.2 %, against 40.1 % of the inelastic ones. Studies that discuss these results were almost nil; however, elastic price elasticities of demand for beef in Mexico were found(19). However, this result is far from a study where a price elasticity of the demand for beef in Mexico was confirmed inelastic (-0.07) for the period 1990-2012(20) and close to that of Chile, focused on demand for beef cattle at the national level for a different period(21). On the other hand, in an another study, an inverse response of the price of beef to the quantity demanded was found, confirming an inelastic effect(22); while in other related works, an elastic response (-1.41) of the price of beef to the quantity demanded was confirmed, for the case of Colombia(23), while for Mexico, regionally, 873

Rev Mex Cienc Pecu 2021;12(3):861-877

inelastic price responses (between -0.15 and -0.53) to the quantity demanded of beef in carcass during the period 1996-2017(5) were confirmed.

Capacity of slaughter centers

The number of cattle slaughter centers are distributed throughout Mexico, which is consistent with the dispersion of the supply centers or production units, as well as the livestock population, they are present in 30 of 32 states. However, TIF slaughter centers exist in 20 states, private ones in 13 and municipal ones in all states. Currently, cattle slaughter centers have an inefficiency of 46 %, which means that they could slaughter 509,700 more heads. So, the question arises: How to make slaughter centers more efficient? In this regard, it has been verified that the farmer destines cattle for supply through three marketing channels: introducer (34.8 %), butcher (58.8 %) or on their own account (6.4 %)(24); while other studies concluded that they found that 73.0 % of cattle are sold directly to slaughterhouses and 26.0 % to intermediaries; which could explain why producers prefer to slaughter their cattle in slaughter centers far from the nearest center(25,26).

Prices in slaughter centers

The highest national average price in the slaughter centers was paid in San Luis Potosí (64.08 $/kg) for cattle from Michoacán; the lowest (15.66 $/kg) was in Nuevo León for cattle from San Luis Potosí. The slaughter centers of Jalisco (main national center) paid an average of 29.56 ± 2.90 $/kg, State of Mexico 34.27 ± 4.48 $/kg and Aguascalientes 23.93 ± 3.52 $/kg; however, the difference is not significant (P>0.05). The average price for steer meat was 32.03 ± 5.59 $/kg, the maximum 58.22 $/kg in Sonora for cattle from Sinaloa and the lowest 22.20 in Baja California Sur for cattle from Baja California. The most important slaughter centers, due to their relationship with the supply centers, (San Luis Potosí) paid an average of 36.89 ± 7.33 $/kg, which is not statistically different from the national average price (P>0.05), nor from the second most important state slaughter center (State of Mexico). The monitoring of the beef market in slaughter centers is carried out by the SNIIM. What can be observed is that the municipal slaughter centers maintained a decreasing trend in their monitoring from 2002 in 1.37 centers per year; in 2000 of the total number of centers 874

Rev Mex Cienc Pecu 2021;12(3):861-877

monitored, TIF centers maintained an increasing trend until 2005, constant until 2010, but decreasing to date. Private centers, since 2005, have had increasing monitoring; in 2005, of the slaughter centers monitored, 17.58 % were private and in 2018 they represented 52.47 %.

Conclusions and implications The economic and statistical theory holds for linear models of the demand for steer, heifer and cow meat, not so for bull meat; which allowed inference to be made about the situation of the demand for meat of live beef in the main slaughter centers of Mexico. The price elasticity of demand for beef in its four products classifies them as inelastic; but it shows a greater sensitivity in the demand for heifer and less in steer. The most important slaughter centers in steer were Jalisco, State of Mexico and Aguascalientes; in heifer, Aguascalientes, Guanajuato and San Luis Potosí; in cow, Jalisco, Guanajuato, State of Mexico and Aguascalientes; and in bull, Aguascalientes, San Luis Potosí and Guanajuato. Finally, even when secondary information is available, it is insufficient, and the time to generate information for the market becomes a weakness for the first link in the value chain of beef cattle in Mexico. Literature cited: 1. Vilaboa AJ, Díaz RP, Ruiz RO, Platas RD, González MS, Juárez LF. Patrones de consumo de carne bovina en la región del Papaloapan, Veracruz, México. Agricultura, Sociedad y Desarrollo 2009;6(2):145-159. 2. Taddei C, Preciado M, Robles J, Garza C. Patrones de consumo de carne en el noroeste de México. Estudios Sociales. Rev Aliment Contempor Desarrollo Regional 2012;(2):7796. 3. Bravo FJP, Mata RG, Delgado GG, López EL. Márgenes de comercialización de la carne de res proveniente de la Cuenca del Papaloapan, en el mercado de la ciudad de México. Agrociencia 2002;36(2):255-266. 4. Pérez VFC, Martínez DMA, García MR, Espinosa TMA. El efecto simultaneo entre los precios al consumidor de las principales carnes consumidas en México. Rev Mex Cienc Agríc 2015;6(2):239-251. 5. Rebollar RS, Hernández MJ, Rebollar RE. Determinantes de la demanda de carne bovina en México, 1996-2017: un análisis por regiones. Debate Económico 2020;9(1):65-84. 6. Jiménez JC, Sánchez RCG. El mercado de la carne de bovino en México, 1970-2011. Estudios Sociales 2014;22(43):87-110. 875

Rev Mex Cienc Pecu 2021;12(3):861-877

7. San Juan-Mejía ZM, Martínez DMA, García MR. Efecto de las importaciones de carne de cerdo sobre el mercado de carne de res en México. Agrociencia 2007;41(8):929-938. 8. Errecart V, Lucero M, Sosa MA. Análisis del mercado mundial de carnes. Facultad de Economía y Negocios, Universidad Nacional de San Martín: Tarapoto, Perú; 2015. 9. Salazar JAA, Escoto FC, Cruz MAG, Mohanty S, Málaga J. La demanda de productos pecuarios en México por deciles de ingreso: Proyección al año 2025. Téc Pecu Méx 2006;44(1):41-52. 10. SNIIM. Anuario estadístico de ganado en pie. 2018. Disponible en http://www.economiasniim.gob.mx/nuevo/Home.aspx?opcion=/SNIIM-PecuariosNacionales/e_MenPec.asp?var=Bov 11. Callejas NJ, Gutiérrez J AO, Viveros JD, Rebollar SR. La producción de becerros en Chihuahua: un análisis económico marginal. Avances en Investigación Agropecuaria 2015;19(2):51-66. 12.

INEGI. Encuesta nacional agropecuaria. 2017. Disponible https://www.inegi.org.mx/programas/ena/2017/default.html#Tabulados

13. SIAP. Resumen nacional de la producción agropecuaria. 2018. Disponible en http://infosiap.siap.gob.mx/repoAvance_siap_gb/pecResumen.jsp 14. SADER. Capacidad instalada para sacrificio de especies pecuarias. 2019. Disponible en https://www.gob.mx/cms/uploads/attachment/file/466106/Capacidad_instalada_para_s acrificio_de_especies_pecuarias_mayo_2019.pdf 15.

INEGI. Índice nacional de precios al https://www.inegi.org.mx/temas/inpc/default.html#Tabulados

consumidor.

2019.

16. Callejas JN, Rebollar RS, Ortega GJA, Domínguez VJ. Parámetros bio-económicos de la producción intensiva de la carne de bovino en México. Rev Mex Cien Pecu 2017;8(2):129-138. 17. Borgatti SP, Everett MG, Freeman LC. Ucinet for Windows: Software for Social Network Analysis. Harvard, MA: Analytic Technologies. 2002. 18. Karl P, David H. On theories of association. Biometrika 1913;9(1/2):159-315. doi:10.2307/2331805. 19. Márquez SI, Mata RG, Delgado GG, Flores JSM, López EL. El efecto de las importaciones de carne bovina en el mercado interno mexicano, 1991-2001. Agrociencia 2004;38(1):121-130.

876

Rev Mex Cienc Pecu 2021;12(3):861-877

20. Olivares JR. Factores determinantes de la carne de res en México [Tesis Licenciatura] Universidad Autónoma del Estado de México-Centro Universitario UAEM Temascaltepec; 2014. 21. ODEPA. Caracterización de la demanda de carne bovina y evaluación de bienes sustitutos. Gobierno de Chile. https://www.odepa.gob.cl/odepaweb/publicaciones/Estudio_Demanda_Carne_Bovina. pdf. Consultado 14 ene 2019. 22. López GMDR, Ramírez VG, Ramírez VB, Terrazas GGH. Estimadores encogidos en modelos de ecuaciones simultáneas para el análisis del mercado de carne de bovino en México. EconoQuantum 2019;16(1):103-123. 23. Galvis ALA. La demanda de carnes en Colombia. Un análisis econométrico. Centro de Estudios Económicos-Regionales. Banco de la República, Cartagena de Indias. Colombia. 2000; http://www.banrep.gov.co/docum/Lectura_finanzas/pdf/DTSER13Carnes.pdf. Consultado 19 Feb, 2019. 24. Vilaboa AJ, Díaz RP, Platas RDE, Ruiz RO, González MSS, Juárez LF. Fallas de mercado y márgenes de comercialización en bovinos destinados al abasto de carne en la región del Papaloapan, Veracruz. Economía, Sociedad y Territorio, 2010;10(34):813833. 25. Martínez JH, Rebollar SR, Razo FDJG, Soria EG, Portillo BA, Martínez AG. La cadena productiva de ganado bovino en el sur del Estado de México. Rev Mex Agronegocios 2011;29:672-680. 26. Romero RM, Fuenmayor JV. Proceso de comercialización de productos derivados de la ganadería bovina doble propósito. Negotium 2017;13(37):47-61.

877

https://doi.org/10.22319/rmcp.v12i3.5562 Article

Effect of two phantom parent grouping strategies on the genetic evaluation of growth traits in Mexican Braunvieh cattle

Luis Antonio Saavedra-Jiménez a Rodolfo Ramírez-Valverde a Rafael Núñez-Domínguez a* Agustín Ruíz-Flores a José Guadalupe García-Muñiz a Mohammad Ali Nilforooshan b

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal. Km. 38.5 Carretera México-Texcoco. 56230, Chapingo, Estado de México. México. b

University of Otago, Department of Mathematics and Statistics, Dunedin, New Zealand.

*Corresponding author: rafael.nunez@correo.chapingo.mx

Abstract: The study aimed to compare two grouping strategies for unknown parents or phantom parent groups (PPG) on the genetic evaluation of growth traits for Mexican Braunvieh cattle. Phenotypic data included birth (BW), weaning (WW) and yearling (YW) weights. Pedigree included 57,341 animals. The first strategy involved 12 PPG (G12) based on the birth year of the unknown parent’s progeny and the sex of the unknown parent, while the second involved 24 PPG (G24) based on the birth year of the unknown parent’s progeny and 4-selection pathways. The animal models included fixed effects and the random direct additive genetic effect; WW also included random maternal genetic and maternal permanent environmental effects. Product-moment correlations between EBV from G0 (no PPG) and G12 were 0.96, 0.77 and 0.69 for BW, WW and YW, respectively, and between EBV from G0 and G24 were 0.91, 0.54, and 0.53, respectively. Corresponding rank correlations between G0 and G12 were 0.94, 0.77, and 0.72, and between G0 and G24 were 0.89, 0.61, and 0.60. Genetic trends showed a base deviation from the genetic 878

Rev Mex Cienc Pecu 2021;12(3):878-892

trend of G0, except for BW of G12. The results did not support the use of the two grouping strategies on the studied population and traits, and further research is required. Introducing PPG to the model, enough phenotype contribution from descendants to PPG, and avoiding collinearity between PPG and fixed effects are important. Genetic groups should reflect changes in the genetic structure of the population to the unknown parents, including different sources of genetic materials, and changes made by selection over time. Key words: Braunvieh cattle, EBV, Genetic groups, Rank correlation, Unknown parents.

Received: 27/11/2019 Accepted: 23/11/2020

Introduction Mexican Braunvieh is a dual-purpose breed of cattle. Since June 2003, national genetic evaluations for growth traits have been undertaken for this breed in Mexico(1). Like in any livestock population, there are unknown parents in the pedigree. Unknown parents are assumed to be unrelated, non-inbred, and to have a single descendant. Unknown parents might correspond to base animals in the first generation or spread over generations. They affect genetic progress in several ways: (i) reducing selection intensity for animals with unknown parents, (ii) parentage uncertainty decreases the accuracy of genetic evaluations, (iii) miss-identification of parents yields both biased estimated breeding values (EBV) and heritability estimates(2). Best linear unbiased prediction (BLUP) regresses genetic merit predictions of animals to unknown parents of mean zero. Depending on the genetic background, and the generation to which unknown parents belong to, their expected genetic merit could be different from zero. Quass(3) established a methodology for considering phantom parent groups (PPG) or genetic groups in BLUP. Although PPG are not of interest per se, they are considered to facilitate modeling and computation(4). Furthermore, along with statistical correction for non-random missing pedigree information, PPG enables direct estimation of quantitative genetic parameters(5). Because there are no specific rules for determining PPG, its definition is mainly based on the researcher’s criteria, but it usually includes a time component(6). Other factors commonly considered in grouping strategies are the sex of the parent or selection intensity(4,7,8). All descendants of an individual with PPG contribute to the estimation of the PPG effect(5), so having PPG with an equal number of individuals is unlikely to affect the animal model’s ability to estimate the PPG effect with acceptable precision. However, any strategy for assigning unknown parents to PPG should reflect the average genetic level of unknown parents(9).

879

Rev Mex Cienc Pecu 2021;12(3):878-892

Due to the inclusion of PPG in the model, Theron et al(7) observed a significant change and a reduction of bias in the genetic trend of milk yield for South African Holsteins. Similarly, a reduction in EBV bias was detected by including PPG in the genetic analyses for weaning, post-weaning and yearling weights, scrotal circumference, and muscling score in Nelore cattle(10). The purpose of this study was to compare two strategies of grouping unknown parents to PPG on the genetic evaluation of growth traits in Mexican Braunvieh cattle.

Material and methods Data

Pedigree and phenotypic records on Mexican Braunvieh cattle were obtained from Asociación Mexicana de Criadores de Ganado Suizo de Registro (Mexico City). Phenotypic records were birth (BW), weaning (WW), and yearling weights (YW) from animals born between 1985 and 2017, in 229 farms across Mexico. Weaning and yearling weights were adjusted to 240 d and 365 d of age, respectively, according to the procedure proposed by the Beef Improvement Federation(11). Records outside the mean ± 3 SD range for the trait of interest were not included in the analyses. Also, WW and YW records outside 240 ± 45 d and 365 ± 45 d age were excluded from the analyses, respectively. The pedigree was extracted (parents), starting from animals with an available phenotype (for any of the three traits), and limited to animals born since 1970. Final pedigree included 57,341 individuals, 18,689 males, 38,652 females, 2,746 sires, and 27,015 dams. Contemporary groups were formed considering herd, year, and season of birth (rainy or dry). Records from contemporary groups with less than four animals were excluded from the analyses. Table 1 shows the final number of records and descriptive statistics for each trait. Table 1: Descriptive statistics for growth traits in the Mexican Braunvieh population Trait N Minimum Mean ± SD Maximum Birth weight 31,654 23.00 38.11 ± 4.84 53.00 Weaning weight 21,333 100.59 235.07 ± 42.85 372.62 Yearling weight 14,439 146.66 324.07 ± 56.07 504.84

880

Rev Mex Cienc Pecu 2021;12(3):878-892

Genetic analyses

The genetic analyses comprised estimation of genetic parameters and BLUP(12) for the Mexican Braunvieh population, using the following single-trait models: y = Xb + Z1u + e, for BW and YW, and

(1)

y = Xb + Z1u + Z2m + Z3mpe + e, (2) for WW, where y, b, u, m, mpe, and e are vectors of phenotypic records, fixed effects, direct additive genetic, maternal additive genetic, maternal permanent environmental, and residuals effects, respectively. X, Z1, Z2, and Z3 are incidence matrices relating records to b, u, m, and mpe, respectively. The fixed effects were: bBW = [sex, Braunvieh purity, age of dam, (age of dam)2, birth contemporary group] bWW = [sex, Braunvieh purity, age of dam, (age of dam)2, pre-weaning contemporary group, milk feeding condition] bYW = [sex, Braunvieh purity, post-weaning contemporary group, post-weaning feed] There were 1,778, 1,450, and 1,038 birth contemporary groups, pre-weaning contemporary groups, and post-weaning contemporary groups, respectively. Milk feeding conditions were suckling without milking, suckling with additional milking, and feeding with a milk substitute. Post-weaning feed regimes were grazing, semi-confined, and total confinement. The sex ratios were close to 1. Age of dam at calving had a minimum, mean, SD, and maximum of 1.70, 6.64, 3.04, and 17.00 yr, respectively. Braunvieh purity had a minimum, mean, SD, and maximum of 0.88, 0.99, 0.01, and 1.00, respectively. It was used the official models for the evaluation of the studied traits in Mexican Braunvieh cattle. The (co)variance structures were: 𝐀𝜎 2 0 𝐮 𝑉𝑎𝑟 ( ) = ( 𝑢 ), 𝐞 0 𝐈𝑁 𝜎𝑒2 for BW and YW, and 0 0 𝐀𝜎𝑢2 0 𝐮 2 0 0 𝐦 ) = ( 0 𝐀𝜎𝑚 𝑉𝑎𝑟 (𝐩𝐞 ), 2 𝐈 𝜎 0 0 𝑁𝑑 𝑚𝑝𝑒 0 2 𝐞 0 0 0 𝐈𝑁 𝜎𝑒 for WW, where A is the pedigree-based additive genetic relationship matrix, INd and IN 2 2 are identity matrices of order equal to the number of dams and observations. 𝜎𝑢2 , 𝜎𝑚 , 𝜎𝑚𝑝𝑒 , 2 and 𝜎𝑒 are the direct additive genetic, maternal additive genetic, maternal permanent environmental, and residual variances, respectively. Applying PPG, the term Z1Qg is added to the model (Eq. [1] and Eq. [2]), where g is the vector of PPG effects, and Q is 881

Rev Mex Cienc Pecu 2021;12(3):878-892

the matrix relating animals to PPG. Variance components were obtained without PPG, based on derivative-free REML, using the MTDFREML software(13).

Genetic groups

Evaluation of the genetic grouping strategies was carried out through the comparison of EBV from BLUP with and without PPG. Criteria used to form unknown parents’ groups were: 1) Year of birth: Year of birth of the unknown parent was five years before the year of birth of its progeny. Unknown parent birth years were grouped into six classes: 1965-69, 1970-74, 1975-79, 1980-84, 1985-89, and 1990-96. 2) Sex of the unknown parent. 3) Selection pathway (sire of sire, sire of dam, dam of sire, and dam of dam). The two genetic grouping strategies were: G12: Class of birth year (6 levels) × sex of the unknown parent (2 levels). G24: Class of birth year (6 levels) × pathway of selection (4 levels). Genetic groups based on criteria such as sex of missing ancestor or paths of selection allow evaluation of different genetic selection differentials(4). Likewise, the inclusion of the year of birth category allows us to model the genetic improvement over time(3,7). Table 2 shows the number of unknown parents in each PPG for each strategy. Table 2: Criteria and frequency of unknown parents in phantom parent groups Year group2 Unknown Strategy1 196519701975- 1980- 19851990parent 1969 1974 1979 1984 1989 1996 Sire 540 513 820 941 678 433 G12 Dam 647 457 664 891 564 35 Sire of sire 119 58 72 90 87 143 Sire of dam 421 455 748 851 591 290 G24 Dam of sire 145 57 51 84 73 9 Dam of 502 400 613 807 491 26 dam 1

Phantom parent group with 12 (G12) and 24 (G24) levels. 2 Progeny’s birth year – 5.

Without including PPG in the model, the mixed model equations were (for BW and YW): ̂ 𝐗′𝐲 𝐗′𝐙 𝐛 [𝐗′𝐗 (3) ′ −1 ] [ ] = [𝐙′𝐲], 𝐙′𝐗 𝐙 𝐙 + 𝐀 𝜆 𝐮 ̂ 882

Rev Mex Cienc Pecu 2021;12(3):878-892

where 𝜆 = 𝜎𝑒2 /𝜎𝑢2 . Adding the effect of PPG to the model, the mixed model equations become(3): ̂ 𝐗′𝐲 𝐗′𝐗 𝐗′𝐙 𝐗′𝐙𝐐 𝐛 −1 [ 𝐙′𝐗 𝐙′𝐙 + 𝐀 𝜆 𝐙′𝐙𝐐 ] [𝐮 (4) ̂ ] = [ 𝐙′𝐲 ]. 𝐐′𝐙′𝐲 𝐐′𝐙′𝐗 𝐐′𝐙′𝐙 𝐐′𝐙′𝐙𝐐 𝐠̂ Incorporating PPG effects into the genetic merit of animals (i.e., EBV = û + Qĝ) can be made directly in the mixed model equations, using Quaas and Pollak(14) transformation that involves absorption of PPG equations, which gives(3): ̂ 𝐗′𝐗 𝐗′𝐙 𝟎 𝐛 𝐗′𝐲 −1 −1 [𝐙′𝐗 𝐙′𝐙 + 𝐀 𝜆 −𝐀 𝐐𝜆 ] [𝐮 (5) ̂ + 𝐐𝐠̂] = [𝐙′𝐲]. −1 −1 𝟎 −𝐐′𝐀 𝜆 𝐐′𝐀 𝐐𝜆 𝐠̂ 𝟎 This procedure avoids the extra step of calculating û + Qĝ after Eq. [4], and the need for re-creating matrix Q, which is computationally expensive. Quaas and Pollak(14) transformation is not implemented in MTDFREML software. Therefore, Eq. [3, 4] were applied for BLUP with and without PPG, respectively (additional terms of the maternal genetic and maternal permanent environmental effects were involved for WW). Estimated breeding values accounting for PPG (û + Qĝ) were obtained using functions “qmat” and “Qgpu” from R package “ggroups”(15), where the matrix of PPG contributions to individuals in a pedigree (Q) was calculated, and PPG contributions (Qĝ) were added to the genetic merit of animals (û), with ĝ and û obtained from MTDFREML(13).

Grouping strategy comparisons

Comparisons between grouping strategies were made by: Pearson product-moment and Spearman rank correlations between EBV obtained with and without PPG. Genetic trends obtained for each analysis, by averaging EBV per birth year.

Results and discussion There were 3,925 animals with unknown sire, 3,258 animals with unknown dam, and 2,430 animals with both unknown sire and dam. Unknown parents were assigned to 12 or 24 PPG (G12 and G24; Table 2). Variance components obtained with and without PPG are shown in Table 3. Estimates of parameters for the studied traits under different scenarios were closely similar. Thus, the model choice should not interfere with the estimation of genetic parameters.

883

Rev Mex Cienc Pecu 2021;12(3):878-892

Table 3: Variance components for birth weight (BW), weaning weight (WW) and yearling weight (YW) for the Mexican Braunvieh population estimated with 12 (G12), 24 (G24) and without (G0) phantom parent groups 𝝈𝟐𝒎𝒑𝒆 Strategy Trait 𝝈𝟐𝒖 𝝈𝟐𝒎 𝝈𝟐𝒆 BW 2.69 8.54 G0 WW 87.76 8.80 23.12 435.85 YW 86.27 692.96 BW 2.69 8.53 G12 WW 83.14 8.43 23.06 436.58 YW 81.30 695.01 BW 2.71 8.52 G24 WW 90.27 10.09 21.37 435.37 YW 85.72 692.52 2 2 𝜎𝑢2 = additive genetic variance, 𝜎𝑚 = maternal genetic variance, 𝜎𝑚𝑝𝑒 = maternal permanent environmental 2 variance, 𝜎𝑒 = residual variance.

Theron et al(7) reported that the inclusion of PPG has a minor influence on the estimation of co(variance) components, also, Shiotsuki et al(16) showed that the use of a relationship matrix that includes genetic groups does not generate differences in the variance estimates contrasted with the use of a matrix without genetic groups. In some studies(7,8,10) variance components were obtained considering a "control" model, which did not include genetic groups, and those variance components were used in predicting breeding values in a model including PPG, similar to the procedure applied in this research. Descriptive statistics for EBV obtained with models including or excluding PPG are shown in Table 4. In a basic animal model, the existence of a single genetic group is assumed(17). Given that breeding values are deviations from the genetic group mean, all values in the base population have an expectation of zero(5,17). Genetic group methodology allows to assign genetic effects to multiple groups within the base population, which could have a different mean(5). The EBV including genetic groups considers that each individual inherits the mean of the effects in the genetic group of their parents plus the mean of the genetic value of their parents; therefore, the expectation of EBV for the population is not zero(5,17) because the assumption of breeding values distribution is not met. Assigning unknown parents to PPG with a possibly non-zero average of genetic merit would change their descendants’ EBV. Consequently, the expected mean of the EBV obtained after considering genetic groups change to the product Qg(3).

884

Rev Mex Cienc Pecu 2021;12(3):878-892

Table 4: Descriptive statistics of estimated breeding values for growth traits obtained with 12 (G12), 24 (G24) and without (G0) phantom parents groups for Mexican Braunvieh cattle Strategy Trait Minimum Mean ± SD Maximum BW -5.36 0.03 ± 0.79 5.13 G0 WW -26.67 -0.17 ± 3.87 25.32 YW -24.06 0.32 ± 3.39 24.34 BW -5.24 0.31 ± 0.83 5.37 G12 WW -18.73 14.19 ± 5.20 39.77 YW -50.60 -7.77 ± 4.81 18.08 BW -3.67 2.06 ± 0.88 7.57 G24 WW -53.15 -10.75 ± 8.17 32.23 YW -49.13 31.10 ± 7.27 82.12 BW= Birth weight, WW= Weaning weight, YW= Yearling weight.

Pearson product-moment and Spearman rank correlations between EBV with and without PPG are shown in Table 5. Correlation coefficients between EBV without PPG (G0) and G12 were higher than those of G0 and G24, for all the traits and groups of animals (i.e., males and females, with and without phenotype). The correlations were lower for animals without phenotype than with phenotype, and lower for females than males. Generally, the correlations were higher for BW than for WW, and higher for WW than for YW (Table 5). It has been proposed that correlation coefficients between EBV lower than 0.90 could change the ranking of animals for genetic evaluation(18). Estimates of correlation coefficients obtained here suggest possible changes in the ranking mainly for WW and YW. Petrini et al(8) also remarked changes in the rank for WW due to the inclusion of PPG (Pearson and Spearman correlation estimates ranged from 0.50 to 0.70). On the other hand, the inclusion of PPG resulted in small changes in the ranking for BW in this study. Results for BW agree with what was observed for milk production(7), YW, and postweaning weight gain(16), scrotal circumference, or muscle score(8). Rank changes are due to the shifts that genetic groups make in the EBV of their descendants. Figure 1 illustrates the effect of PPG on genetic trends. The trends were relatively similar for males and females. For BW, G12 increased the slope of the genetic trend, compared to G0; G24 also increased the slope of the genetic trend, but it showed a base deviation from G0. For WW, both G12 and G24 showed large fluctuations in the early years. Genetic trends from G12 and G24 showed positive and negative base differences with G0, respectively (Figure 1). For YW, the genetic trend of G24 showed a large base deviation from the G0 and G12 genetic trends (Figure 1). Generally, if a genetic trend does not pass over zero, it indicates a base problem for EBVs. Therefore, G24 is ruled out for BW and YW, and G12 is ruled out for WW, since G24 does not cross zero for BW and YW, and G12 does not cross zero for WW (Figure 1). On the other hand, a robust 885

Rev Mex Cienc Pecu 2021;12(3):878-892

grouping strategy is expected to perform well for different traits(16), as a trait-specific grouping strategy would be a burden for routine genetic evaluations. Table 5: Pearson (and Spearman) correlation coefficients between estimated breeding values without phantom parent groups (EBV_G0), with 12 phantom parent groups (EBV_G12), and 24 phantom parent groups (EBV_G24), in the Mexican Braunvieh population Trait Correlation type Birth weight Weaning weight Yearling weight Total animals n =57,341 n = 57,341 n = 57,341 r(EBV_G0, EBV_G12) 0.959 (0.942) 0.766 (0.766) 0.692 (0.717) r(EBV_G0, EBV_G24) 0.912 (0.891) 0.538 (0.610) 0.535 (0.605) Males with phenotype r(EBV_G0, EBV_G12) r(EBV_G0, EBV_G24)

n = 15,810 0.988 (0.982) 0.975 (0.964)

n = 10,748 0.914 (0.886) 0.786 (0.763)

n = 7,384 0.853 (0.846) 0.743 (0.737)

Males without phenotype r(EBV_G0, EBV_G12) r(EBV_G0, EBV_G24)

n = 2,879 0.941 (0.923) 0.861 (0.830)

n = 7,941 0.796 (0.797) 0.606 (0.627)

n = 11,305 0.719 (0.760) 0.587 (0.636)

Females with phenotype r(EBV_G0, EBV_G12) r(EBV_G0, EBV_G24)

n = 15,844 0.986 (0.979) 0.972 (0.960)

n = 10,585 0.901 (0.879) 0.752 (0.749)

n = 7,055 0.844 (0.840) 0.710 (0.743)

Females without phenotype r(EBV_G0, EBV_G12) r(EBV_G0, EBV_G24)

n = 22,808 0.895 (0.877) 0.799 (0.781)

n = 28,067 0.635 (0.659) 0.407 (0.491)

n = 31,597 0.596 (0.634) 0.445 (0.515)

886

Rev Mex Cienc Pecu 2021;12(3):878-892

Figure 1: Genetic trends of growth traits for BLUP (EBV (solid line)), BLUP with 12 phantom parent groups (EBV_G12 (dashed line)), and BLUP with 24 phantom parent groups (EBV_G24 (dotted line)), with six classes of birth year considered in phantom parent groups

However, in practice, a grouping strategy may perform well for a trait, but not well for another trait, especially if the fixed effects are different for the two traits (8). Possible problems with PPG implementation are likely to be due to collinearity or confounding between PPG and fixed effect(3,5). Considering PPG as random effect is a solution to this problem. The effect of inclusion of PPG on the genetic trend has been variable. Theron et al(7) showed that including PPG in genetic evaluation had a drastic effect on the genetic trend 887

Rev Mex Cienc Pecu 2021;12(3):878-892

for milk production traits, having a higher response (almost double) when PPG was included. Besides, Shiotsuki et al(16) observed higher genetic trends for post-weaning weight and YW when the model included PPG. In contrast, PPG inclusion in genetic analyses for WW, scrotal circumference, and muscling score showed a lower genetic trend than when PPG was not included(8). It could be concluded that the effectiveness of PPG on genetic evaluations depends on the population structure, studied traits and criteria adopted to define PPG. It has been proposed that the definition of PPG should balance between the complexity of genetic groups and the representation of genetic differences(8). Also, genetic groups should consider the selection criteria adopted by breeders. Two possible reasons are considered for the problems observed with the genetic trends: the shortage of progeny phenotypes supporting the inference of some PPG, and possible confounding or collinearity between PPG and the fixed effects in the model, especially contemporary groups. Figure 2 shows the frequency of animals, missing sires, and missing dams across birth years, and Figure 3 shows the frequency of phenotypes per birth year. It can be interpreted that there were not enough phenotypes supporting the prediction of PPG solutions in early years (unknown parents born before 1990, i.e., their progeny born before 1995). The phenotypes’ contribution decreases as the number of generations between the PPG and the phenotyped descendant increases, lower with lower heritability. Figure 2: Number of animals (solid line), unknown sires (dashed line) and unknown dams (dotted line) per year of birth

888

Rev Mex Cienc Pecu 2021;12(3):878-892

Figure 3: Number of birth weight (solid line), weaning weight (dashed line), and yearling weight (dotted line) phenotypes per year of birth

Figure 2 shows that the studied population was not in real need of PPG in the animal model, or PPG could be limited to only a few groups, so that phenotypes from distant generations of descendants could support the estimation of those few PPG. Animal models with PPG are more beneficial to populations with a higher and broader prevalence of missing pedigree information, especially if different genetic backgrounds (e.g., imported genetic materials) or different selection strategies/pressure are involved in different groups of animals (e.g., males vs. females or different selection pathways). The genetic trends (Figure 1) show that the population has not been under efficient selection, and there is an excellent opportunity for genetic improvement toward sustainable production in Mexican production systems and environments. Figures 2 and 3 also show data collection problems between years 2003 and 2014, and between 2014 and 2017. Data completeness and correctness are essential for accurate and reliable genetic evaluations. As mentioned in the Data subsection, pedigree (parentage) was extracted, starting from phenotyped animals. The number of animals and missing parents (Figure 2) were higher without this restriction. However, in that case, there were extra missing parents with no contribution from progeny performance; therefore, no information to make inferences upon them. It is recommended to extract pedigree from phenotyped animals, making decisions about forming genetic groups, then adding animals that had not been extracted and assigning their unknown parents to the existing PPG. Ideally, there should be fixed group connectedness between different PPG (i.e., like the concept of genetic connectedness among fixed groups (levels of a fixed effect)). In other words, phenotypes from different groups of fixed effects should contribute information to different PPG. It has even been recommended to form (some) PPG composite of both sires and dams(8). The R package “ggroups”(15) allows to perform PPG from both sexes. Similar definitions of PPG and some fixed effects may cause collinearity. In that situation, 889

Rev Mex Cienc Pecu 2021;12(3):878-892

the number of fixed-effect groups contributing information to each PPG decreases. One way of checking the collinearity within and between fixed effects and PPG is checking the minimum eigenvalue of [X Qp]ʹ[X Qp], where Qp is Q with rows limited to phenotyped animals. Estimability problems for PPG in the model are not limited to this study. Such problems are often observed due to confounded effects (collinearity) between PPG(19). Even, reducing such confounding by changing the composition of PPG, there might be confounding between PPG and other fixed effects. Those estimability problems were removed and estimated breeding values look normal by considering PPG as random effects via adding 𝜎𝑒2 /𝜎𝑢2 to the diagonals of the PPG equations in the animal model(19).

Conclusions and implications Two strategies of grouping unknown parents to PPG (G12 and G24) were tested on BW, WW, and YW in Mexican Braunvieh cattle. The two strategies used the most common criteria for defining PPG (birth year of the progeny, sex of the unknown parent for G12, and selection pathway for G24). Genetic trends had an offset deviation from BLUP´s genetic trend without PPG, except for BW of G12. Also, including PPG in the model may have caused collinearity between PPG and some fixed effects. The shortage of phenotypes supporting the solutions for some PPG effects was another reason for the lack of benefit from the two grouping strategies on the studied population and traits. It is recommended to define PPG based on a subset of pedigree, in which parents are connected to phenotyped descendants, then adding the rest of animals and assigning their unknown parents to the existing PPG, to avoid an excessive and unnecessary number of genetic groups. More important than the number of progeny per PPG or equal year intervals defining PPG, is the amount of phenotype contributions for predicting PPG effects. It is recommended to have less overlap between PPG definitions and fixed effects to reduce collinearity between them.

Acknowledgments

The authors thank Consejo Nacional de Ciencia y Tecnología (CONACyT, México) for the financial support to the first author during his Doctoral studies. The authors also thank to Asociación Mexicana de Criadores de Ganado Suizo de Registro for allowing the use of their data, and Dr. Dale Van Vleck for providing help and support with MTDFREML software. Literature cited: 1. AMCGSR. Asociación Mexicana de Criadores de Ganado Suizo de Registro. Resumen de evaluaciones genéticas para ganado Suizo Americano 2017. Techn Bull. Mexico. 2018. 890

Rev Mex Cienc Pecu 2021;12(3):878-892

2. Van Vleck LD. 1970. Miss-identification in estimating the paternal sib correlation. J Dairy Sci 1970;53:1469-1474. 3. Quaas RL. Additive genetic model with groups and relationships. J Dairy Sci 1988;71:1338-1345. 4. Westell RA, Quass RL, Van Vleck LD. Genetic groups in an Animal Model. J Dairy Sci 1988;71:1310-1318. 5. Wolak ME, Reid JM. Accounting for genetic differences among unknown parents in microevolutionary studies: How to include genetic groups in quantitative genetics animal models. J Anim Ecol 2017;86:7-20. 6. Fikse F. Fuzzy classification of phantom parent group in an animal model. Genet Sel Evol 2009;41:1-8. 7. Theron HE, Kanfer FHJ, Rautenbach L. The effect of phantom parent groups on genetic trend estimation. South African J Anim Sci 2002;32:130-135. 8. Petrini J, Pertile SF, Eler JP, Ferraz JB, Mattos EC, Figuereido LG, et al. Genetic grouping strategies in selection efficiency of composite beef cattle (Bos taurus x Bos indicus). J Anim Sci 2015;93:541-552. 9. Pollak EJ, Quass RL. Definition of group effect in sire evaluation models. J Dairy Sci 1983;66:1503-1509. 10. Oliveira Junior GA, Eler JP, Ferraz JBS, Petrini J, Mattos EC, Mourão GB. Definição de grupos genéticos aditivos visando melhor predição de valores genéticos em bovinos de corte. Rev Bras Saúde Prod Anim 2013;14:277-286. 11. BIF. Beef Improvement Federation. Guidelines for Uniform Beef Improvement Programs. 9th ed. North Carolina State University, Raleigh, NC, USA. 2018. 12. Henderson CR. Best linear unbiased and prediction under a selection model. Biometrics 1975;31:423-447. 13. Boldman KG, Kriese LA, Van Vleck LD, Van Tassell CP, Kachman SD. A manual for use of MTDFREML, a set of programs to obtain estimates of variances and (co)variances. Washington, DC: USDA, ARS. 1995. 14. Quass RL, Pollack EJ. Modified equations for sire models with groups. J Dairy Sci 1981;64:1868-1872. 15. Nilforooshan MA, Saavedra-Jiménez LA. ggroups: a R package for pedigree and genetic groups data. Hereditas 2020;157:17. 16. Shiotsuki L, Cardoso FF, Silva JAIIV, Albuquerque LG. Comparison of a genetic group and unknown paternity models for growth traits in Nellore cattle. J Anim Sci 2013;91:5135-5143. 891

Rev Mex Cienc Pecu 2021;12(3):878-892

17. Van Vleck LD. Breeding value prediction with maternal genetic groups. J Anim Sci 1990;68:3998-4013. 18. Crews DH, Franke DE. Heterogeneity of variances for carcass traits by percentage Brahman inheritance. J Anim Sci 1998;73:1803-1908. 19. Schaeffer LR. Necessary changes to improve animal models. J Anim Breed Genet 2018;135:124-131.

892

https://doi.org/10.22319/rmcp.v12i3.5431 Article

Mineral evaluation of the components of the intensive silvopastoral system with Leucaena leucocephala in three seasons of the year

Andrés Camilo Rodríguez-Serrano a Alejandro Lara-Bueno a* José Guadalupe García-Muñiz a Maximino Huerta-Bravo a Citlalli Celeste González-Aricega a

Universidad Autónoma Chapingo. Departamento de Zootecnia, Posgrado en Producción Animal, Km 38.5 carretera México -Texcoco, Chapingo, Estado de México, México.

*Corresponding author: alarab_11@hotmail.com

Abstract: A mineral evaluation of the components of the intensive silvopastoral system, soil, drinking water, forage (Leucaena leucocephala, Megathyrsus maximus) and blood serum of calves and dairy cows was performed. Three samplings were carried out in the cold, dry and rainy seasons. Cu, Fe, Zn, Ca, Mg, K, Na and P were determined and analyzed. Elevated levels of Fe, Ca, K and Mg were found in the soil, while minerals from drinking water remained within adequate ranges, with the exception of Fe (0.61 and 0.57 mg kg-1) at the ranches El Vivero and Los Huarinches, respectively. The concentration of Ca, Mg, K and Na was higher in Leucaena leucocephala than in Megathyrsus maximus, while the content of Cu (6.16 and 5.66 mg kg-1), Zn (17.9 and 24.4) and P (2,584.5 and 2,682.8 mg kg-1) in both ranches do not meet the requirements of the cows, which could generate low levels of these elements in blood serum, in both cows and calves: Cu (0.64 and 0.54 mg kg-1), Zn (0.74 and 0.60 mg kg-1) and P (49.24 and 39.43 mg kg-1), respectively.

893

Rev Mex Cienc Pecu 2021;12(3):893-909

Key words: Minerals, Animal nutrition, Megathyrsus maximus, Agroforestry, Silvopastoral system.

Received: 25/06/2019 Accepted: 18/11/2020

Introduction The basic components of a silvopastoral system, pastures, trees, animals and soil, interact with each other under a constant flow of elements(1) in such a way that the production levels and nutritional status of the animals depend on the degree to which nutritional requirements are met. This is directly related to the concentration of nutrients present, both in pastures and in the foliage of forage trees, and these in turn are influenced by soil fertility and the amount of minerals that forage plants can absorb(2). Normally, forage grasses do not provide enough macronutrients (N, Ca, Mg, K and P), micronutrients (Cu, Zn, Fe) and other elements(3,4) required by animals to achieve certain productive parameters, for this reason, the establishment of intensive silvopastoral systems (more than 7,000 trees ha-1) with legumes such as Leucaena leucocephala (LL) has been promoted(5). The cultivation of LL associated with forage grasses is a strategy that, in addition to increasing the supply of feed for ruminants in grazing, contributes to improving its quality, and to correct possible nutritional imbalances of pastures alone. However, despite the fact that legumes are normally richer in macro and microelements than forage grasses(6), various factors affect the content of each element in LL plants. Among these factors are the species, genotype, parts of the plant, growth status and soil fertility(7). Similarly, serum mineral concentrations in animals are affected by interactions between the amount of each element the animal ingests in the feed and drinking water. Some minerals may interact in ways that can trigger the correct absorption of other minerals in the digestive tract and jointly fulfill various metabolic functions(8), or they may inhibit the absorption of one or more elements and produce antagonistic effects by forming non-absorbable complexes, through competition between cations and anions(6), which can generate a decrease in the expected productive parameters. Given the above, the mineral state of an intensive silvopastoral system is determined by the contribution of mineral elements of each factor that makes up the system, over time. For this reason, the objective of this research was to evaluate the mineral content of the components 894

Rev Mex Cienc Pecu 2021;12(3):893-909

of intensive silvopastoral systems (animal, pasture, tree foliage, soil and water) in three seasons of the year, in two cattle ranches located in Apatzingán and Tepalcatepec, Michoacán, Mexico, to determine the contribution of minerals and nutrients and propose alternatives to correct possible nutritional imbalances.

Material and methods The research was carried out in two cattle ranches (El Vivero and Los Huarinches) located, respectively, in the municipalities of Apatzingán and Tepalcatepec, in the Tierra Caliente region, in the State of Michoacán, Mexico. Both ranches are pioneers in the implementation of intensive silvopastoral systems (ISPS) with Leucaena leucocephala and Tanzania grass, with experience of more than 10 years of establishing the grazing system and in the production of milk for the elaboration of cotija cheese (ranch Huarinches) and more recently in the maintenance and development of bovines of the tropical dairy Creole breed and Romosinuano (ranch El Vivero). The study area is located at 350-370 masl, has a warm subhumid climate with rains in summer, with average annual temperature of 28.5 °C and average annual rainfall of 822 mm, the pH of the soil (7.34) is between neutral to alkaline(9,10).

Intensive silvopastoral system

In the two cattle ranches, ISPS consists of Leucaena leucocephala bushes in rows every 1.60 m, with densities of 34,500 plants ha-1, in association with Tanzania grass (Megathyrsus maximus), which make up the food supply of 60 % grass and 40 % legume. Grazing is carried out following a rotating scheme of 4 d x 40 d of rest, with irrigation in dry seasons.

Samplings

Three samplings corresponding to the most decisive agroecological periods for agricultural production in the area(10,11,12) were carried out. Rains (August), Cold (January) and Dry (May) for a total of three collections.

895

Rev Mex Cienc Pecu 2021;12(3):893-909

Grasses and trees

Samplings were carried out in each cattle ranch in the established seasons, adapting the methodology used by Bacab-Pérez et al(13), quadrants of 1.60 x 1.60 m were implemented, which were located on the LL furrow, which was considered as the middle line of each quadrant; eight quadrants were randomly distributed on the paddocks that the next day would be used by the animals, and that in turn fulfilled 40 d of regrowth. Tanzania grass was harvested 30 cm from the ground and LL was defoliated manually by taking tender leaves and stems, simulating grazing and browsing carried out by animals; the plant material was homogenized and a subsample of 1 kg of each plant species was selected. The samples were dried in a forced air oven at 60 °C until constant temperature and taken to the laboratory for subsequent analysis.

Blood serum

Blood samples were collected from 8 cows and 8 calves of each breed present on the ranches (Tropical Dairy Creole, Brown Swiss and commercial cross). In adult animals, the blood sample was drawn from the coccygeal vein, and in young animals from the jugular vein. The blood was centrifuged at 3,000 rpm for 15 min for the separation of the blood serum and its conservation at -20 ºC.

Soil and water

Eight soil samples were collected in order to cover the greatest variety of forage supply levels present in each paddock, at depths of 0 to 15 and 15 to 30 cm, in each cattle ranch and in each season of the year, which were dried and sieved with a 0.2 mm mesh. Three water samples were taken directly from the drinking troughs of each paddock of each cattle ranch and each season of the year.

Mineral analysis

The concentrations of Cu, Fe, Zn, Ca, Mg, K and Na, in forage, blood serum, soil and water, were determined by the procedures described by Fick et al(14), using an atomic absorption

896

Rev Mex Cienc Pecu 2021;12(3):893-909

spectrophotometer model AAnalyst 700 from PerkinElmer. The concentration of P was determined by colorimetry(14).

Statistical analysis

For the data on the mineral content of the soil samples, the following statistical model was used: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝑃𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Where Yijk= concentration of the mineral; Pi= effect of the i-th depth (0-15, 15-30 cm); Sj= effect of the j-th season of the year (rainy, cold, dry); Rk= effect of the k-th ranch (Los Huarinches, El Vivero); SRjk= effect of the interaction between the season of the year and the cattle ranch. For the analysis of the data on the mineral composition of the water, the following statistical model was used: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Where Yijk= concentration of the mineral in water; Sj= effect of the j-th season of the year (rainy, cold, dry); Rk= effect of the k-th cattle ranch (Los Huarinches, El Vivero); SRjk= effect of the interaction between the season of the year and the cattle ranch. For the analysis of the data on the nutritional content of the foliage of LL and Tanzania grass, the following statistical model was used: 𝑌𝑖𝑗𝑘 = 𝜇 + 𝐸𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙 Where Yijk= concentration of the nutrient; Si= effect of the i-th season (rainy, cold, dry); Ej= effect of the j-th forage species (Tanzania grass, leucaena); Rk= effect of the k-th cattle ranch (Los Huarinches, El Vivero). For the analysis of the mineral concentration of the blood serum samples, the following statistical model was used: 𝑌𝑖𝑗𝑘𝑙 = 𝜇 + 𝐸𝑖 + 𝑆𝑗 + 𝑅𝑘 + (𝑆𝑅)𝑗𝑘 + (𝐸𝑅)𝑖𝑘 + (𝐸𝑆)𝑖𝑗 + (𝐸𝑆𝑅)𝑖𝑗𝑘 + 𝜀𝑖𝑗𝑘𝑙

897

Rev Mex Cienc Pecu 2021;12(3):893-909

Where Yijkl= concentration of the mineral in the blood serum; Ei= effect of the i-th physiological stage of the animal (cow, calf); Sj= effect of the j-th season of the year (rainy, cold, dry); Rk= effect of the k-th ranch (Los Huarinches, El Vivero); ERik= effect of the interaction between the physiological stage of the animal and the cattle ranch; ESij= effect of the interaction between the physiological stage of the animal and the season of the year; ESRijk= effect of the interaction between the physiological stage of the animal, season of the year and cattle ranch. The data were analyzed using the GLM procedure of the SAS statistical software (15) and the comparison of means between the treatments was made using the Tukey test with a significance level of 0.05.

Results and discussion Soil and water

The concentration of Cu (14.73 vs 14.04 mg kg-1), Zn (49.07 vs 47.37 mg kg-1), Fe (1661 vs 1672 mg kg-1), Ca (9412 vs 9679 mg kg-1), K (1963 vs 1870 mg kg-1) and Mg (5275 vs 5328 mg kg-1) was similar (P>0.05) at the two soil depths (0 to 15 and 15 to 30 cm), respectively. This is probably due to the fact that in both cattle ranches the soil is deep, which facilitates the transport of water and nutrients to the deep roots(16), in addition, silvopastoral systems can maintain and improve the porosity, infiltration and aeration of the soil(17,18). However, the mineral concentration of the soil showed differences between the cattle ranches studied, evidencing different soil conditions at the evaluation sites (Table 1). In the soils of both ranches, there are adequate levels of Cu and Zn for the development of plants; while, the levels of Fe are high, since in soils with neutral or alkaline pH, the fixation of these minerals is favored(19); while the levels of Ca, K and Mg, despite being high, especially in the ranch El Vivero, agree with the availability generated by the pH of the soil. The high content of minerals in the soil of both ranches may be influenced by the proximity of the study area to other agricultural properties dedicated to the production of lemon, which demands constant fertilization with macro and microelements such as N, P, K Ca, Mg, S, Mn, Fe, Zn, Cu and B(20). However, in soils with high content of organic matter, nitrogen and phosphorus, as is the case of soils with silvopastoral management, the availability of Cu can be hindered, which

898

Rev Mex Cienc Pecu 2021;12(3):893-909

can create induced deficiency of that element in pastures and in the animal that consumes those pastures, and these deficiencies of Cu can be accentuated by an excess of zinc or manganese(21). It should be noted that several mineral elements, including zinc, increase bioavailability in the soil in a range between 5 to 77, but outside this range they change their ionic state and precipitate as hydroxide, carbonate or sulfide, so the solubility, mobility of these compounds decrease as the pH increases or decreases in the soil(22). Table 1: Effects of cattle ranch and season of the year on the mineral concentration (mg kg-1) of the soil in the intensive silvopastoral system Ranch effect

16.2 a 64.5 a 12.5 b 31.8 b 0.34 1.36 Season effect × ranch El Vivero Cold 12.85 a 31.43 a Rainy 11.76 b 32.55 a a Dry 13.04 31.65 a SEM 0.31 1 Season effect × ranch Los Huarinches Cold 16.06 a 57.5 b Rainy 17.9 a 78.74 a Dry 14.84 b 57.45 b SEM 0.65 2.03 Appropriate 5-30x 20-150x level Los Huarinches El Vivero SEMy

1,858 a 1,478 b 75.59

5,042 b 14,049 a 541.8

4,637 b 5,965 a 111.8

2,460 a 1,373 b 319.8

1,711 a 1,606 a 1,115 b 97.25

12,875 b 12,368 b 16,903 a 875.2

6,970 a 5,378 a 5,547 a 616

1,926 a 1,712 a 482.6 b 136.28

1,928 b 2,245 a 1,400 b 152.3

4,540 a 4,976 a 5,585 a 4,241 a 5,001 a 4,693 a 997.7 482.2 1,000 – 80-200v 2,000w

50-500x

2,219 b 3,231 a 1,930 b 482.2 60-180 v

SEM= standard error of the mean; x(25) v(26) w(27). Means in the same column with different literal show differences (P<0.05).

The interaction between cattle ranch and season of the year in the concentration of Cu, Zn, Ca and K in the soil was important (P<0.05, Table 1). The highest concentration of total Cu in soil in the ranch El Vivero was higher in the dry season, while in Los Huarinches it was in the rainy season; in the case of Zn, the concentration in soil was higher in the ranch Los Huarinches, where the highest level of the element occurred during the rains, while in the ranch El Vivero, there were no significant differences between the seasons of the year (P>0.05); the opposite occurred in the ranch El Vivero for the Ca content in the soil, since during the dry season, the level of this element was higher, while in Los Huarinches, there were no significant differences in the concentration of Ca in the soil between the different seasons of the year (P>0.05). These results show that in the face of similar environmental conditions (temperature and precipitation), specific particularities of each ranch can modify the degree of influence on the mineral concentration in the soil; for example, the availability 899

Rev Mex Cienc Pecu 2021;12(3):893-909

of Cu can be affected by soil moisture and texture, competition with elements such as Fe and Zn and high levels of organic matter (OM), on the contrary, Zn, in addition to competing with Cu, can decrease its availability due to low levels of OM(23). Roberts(24) found different modifications in the concentration of minerals in two regions of New Zealand, in the same seasons of sampling, attributed, among other things, to the ability of the silvopastoral system to reincorporate nutrients into the soil, through contributions of biomass or animal excreta. It should be noted that the ranches analyzed work with different stocking rates and have different objectives of production, so the differences in the management of the animals (according to each objective of production) could affect changes in the concentration of minerals in the soil. The variations in the mineral concentration in the soil of the ranches evaluated, in relation to the season of the year, may be caused by aspects inherent in the management of each production system and environmental conditions of each place, although the similarities present in temperature and precipitation are not sufficient to explain the behavior of the mineral concentration in the soil. Minerals in soil have complex interactions with pH, which control ion mobility and exchange, their precipitation and dissolution, oxide-reduction reactions, microbial activity and nutrient availability(28). There are also strong interactions with soil organic matter (OM); an excess of organic matter in the soil reduces the absorption of various minerals by plants(29). For this reason, it is important to note that the management of production methods will be decisive for the accumulation of mineral elements, rather than aspects of environmental condition, as can happen in intensive silvopastoral systems that modulate the content of organic matter, pH and N contributors to the soil. Mineral concentrations, except Fe, in drinking water on both cattle ranches and in the different seasons evaluated, were below the suggested adequate levels(30): Cu (<1 mg L-1), Zn (<8 mg L-1), Fe (<0.4 mg L-1), Ca (<1,000 mg L-1), Mg (<1,000 mg L-1) and K (<20 mg L-1). However, the levels of Ca and Mg registered in drinking water were higher than those required (P<0.05) at the ranch El Vivero (30.55 and 46.15 mg L-1 for each element, respectively) compared to the status of those elements at the ranch Los Huarinches (10.35 and 9.01 mg L-1 for each element, respectively). Similarly, the level of Fe in drinking water for the cattle at the ranch El Vivero and the ranch Los Huarinches was 0.61 and 0.57 mg L-1, respectively, concentrations higher than the maximum tolerable level suggested by Puls (30) (<0.4 mg L-1), from which symptoms of Fe poisoning may appear in animals. These data are consistent with the high concentration of Fe present in the soils of both cattle ranches.

900

Rev Mex Cienc Pecu 2021;12(3):893-909

Forage

Concentrations of Ca, Mg, K, and Na were higher in LL foliage than in Tanzania grass (Table 2); however, the concentration of Zn was higher in grass than in legume. Both forage species had concentrations of Cu, Zn and P below those required for bovines. These results are consistent with those already reported(31), where it is mentioned that P deficiency is a predominant condition in grazing systems in the tropics. Additionally(32), average values of Zn and Cu, lower than the requirement of bovines for different species of grasses and legumes, are reported showing that grazing production systems, including SPSs, may be limited to meet the minimum requirements of these elements. The contents of Ca, Mg, K and Na of leucaena were higher than those required for dairy cows, which is consistent with the high concentration of Ca, Mg and K in the soils of both cattle ranches, also evidencing the ability of the legume over the grass to absorb more of these elements from the soil, since the species develops better in soils with higher content of exchangeable Ca(33). Thus, levels of Ca, Mg and K in leucaena of up to 30,000, 23,000 and 11,000 mg kg-1, respectively, have been reported(34,35,36). Table 2: Effects of the forage species on the mineral concentration of leucaena and Tanzania grass in the intensive silvopastoral system (mg kg-1) Nutrient Leucaena Tanzania SEM Requirementu Copper 6.1 a 5.6 a 0.35 10 – 11 a a Iron 94.1 83.9 4.85 12 – 18 b a Zinc 17.9 24.4 0.89 43 – 55 a b Calcium 11,569 3,320 426.7 5,700 – 6,700 a b Magnesium 2,532 1,858 136.5 1,800 – 2,100 a b Potasium 16,411 9,981 1,203 11,000 – 11,900 a b Sodium 4,595 2,409 337.8 2,000 – 2,200 a a Phosphorus 2,585 2,683 132 3,200 – 3,700 a b Ca:P 4.5 1.2 0.20 1.5 – 2t ab

SEM = Standard error of the mean; u(37) t(38). Means in the same row with different literal show differences (P<0.05).

The contents of Ca, Na and P, as well as the Ca:P ratio in Tanzania grass were different between the two cattle ranches (Table 3); these, except for Na, are below the requirement for dairy cows in grazing, showing that, regardless of the specific conditions of each region, the grass alone does not provide these minerals for the maintenance and production of animals, especially Ca. This may occur because grasses of warm climates usually have lower mineral contents than grasses of temperate climate(32), and because of the environmental conditions of each region, which is also observed in the results of the work carried out by Morales et 901

Rev Mex Cienc Pecu 2021;12(3):893-909

al(39), who recorded maximum concentrations of Ca and P in Lolium perenne, in the Central Valley of Mexico, up to 5,830 mg kg-1 and 4,400 mg kg-1 and minimum concentrations of 2,540 mg kg-1 and 2,400 mg kg-1, respectively, evidencing the influence of the environment on the concentration of these elements in grasses. On the contrary, the contents of Cu, Mg, K and Na of LL showed differences (P>0.05) between the ranches studied (Table 3), possibly due to the ability of the trees to store more minerals and to extract them from deeper horizons of the soil(40,41). Table 3: Effects of the cattle ranch on the mineral concentration of leucaena and Tanzania grass in the intensive silvopastoral system (mg kg-1) Leucaena Mineral El Vivero Los Huarinches SEM Requirementx Copper 6.8 b 5.39 a 0.38 10 – 11 a a Iron 96.3 91.2 5.7 12 – 18 a a Zinc 17.1 18.3 0.49 43 – 55 a a Calcium 12,257 10,908 830 5,700 – 6,700 a b Magnesium 2,943 2,075 122.5 1,800 – 2,100 a b Potasium 18,560 13,984 1,490 11,000 – 11,900 b a Sodium 3,452 5,604 421.9 2,000 – 2,200 a a Phosphorous 2,542 2,630 85.6 3,200 – 3,700 a a Ca:P 4.46 4.41 0.044 1.5 – 2w Tanzania a Copper 5.8 5.5 a 0.22 10 – 11 a a Iron 82.7 86.7 3.62 12 – 18 a a Zinc 25.4 23.4 1.29 43 – 55 b a Calcium 2784 3,894 135.4 5,700 – 6,700 a a Magnesium 1,925 1,839 92.7 1,800 – 2,100 a a Potasium 9,340 10,386 964 11,000 – 11,900 a b Sodium 2,806 2,095 155.8 2,000 – 2,200 a b Phosphorous 2,540 2,822 70.6 3,200 – 3,700 b a Ca:P 1.14 1.37 0.06 1.5 – 2w SEM = Standard error of the mean; x(36), w(37). ab Means in the same row with different literal show differences (P<0.05).

The concentrations of Ca for LL are higher than those obtained in another study(42) in the Huasteca potosina of Mexico, where Ca levels of 2,300 mg kg-1 and a Ca:P ratio of 0.81 were recorded; the higher concentration of Ca in LL obtained in the present study led to the increase in the Ca:P ratio (4.5), which is higher than recommended.

902

Rev Mex Cienc Pecu 2021;12(3):893-909

The season of the year influenced the mineral content of leucaena and Tanzania grass, in such a way that the levels of Cu during the dry period were lower than in the rainy season, this was contrary to what was reported by other researchers(43), who found higher concentration of Cu in the dry season (9.4 mg kg-1) compared to the rainy season (8.9 4 mg kg-1) in the warm humid region of Pangasinan, Philippines; however, for Tanzania grass, there was lower Cu content in the cold season. Potassium registered higher concentration in leucaena during the cold season, while the grass showed maximum concentrations of K of 14,823 mg kg-1 during the rainy season, in accordance with the fluctuations of that element in the soil. The concentrations of Mg and P in LL were similar (P>0.05) between the three seasons of the year, contrary to what was observed in the Tanzania grass, in which these elements registered greater concentration in the cold season, while the levels of Fe, K and Ca in LL were higher than in star grass during the cold season, probably due to the reduction in the growth rate of the legume in the fresh season of the year (Table 4). Table 4: Effect of the season of the year on the mineral concentration (mg kg-1) of leucaena and Tanzania grass in the intensive silvopastoral system Season Cu Zn Fe Ca Mg K Na P Ca:P Leucaena Cold Rainy Dry SEM

6.8 a 7.4 a 4b 0.47

21.1 a 16.3 b 16.4 b 0.60

114.4 a 86.2 b 80.4 b 7.04

24.3 a 22.2 a 26.6 a 1.6 43 - 55

100.9 a 67.2 b 86.1 a 4.4 12 – 18

13,094 a 9,673 a 11,979 a 1,025

2,758 a 2,295 a 2,476 a 151.2

20,927 a 15,782 b 12,106 b 1,839

3,196 b 3,000 b 7,521 a 520.7

2,759 a 2,411 a 2,588 a 105.6

4.8 a 3.88 a 4.9 a 0.54

Tanzania Cold Rainy Dry SEM Req.

4,245 a 2,799 a 5,590 b 3,501 a 2,891 a 2,363 c 1,091 c 14,823 a 1,769 b 2,584 b b b b 3,409 1,755 9,176 2,081 b 2,570 b 164.8 112.8 1,173 189.7 86 5,700 – 1,800 – 11,000 – 2,000 – 3,200 – 6,700 2,100 11,900 2,200 3,700 SEM = Standard error of the mean; Req= requirement (36) w(37). abc Means in the same column with different literal show differences (P<0.05).

4.2c 6.9 a 5.9 b 0.27 10 – 11

1.47 a 0.95 b 1.34 a 0.07 1.5 – 2w

Blood serum

There was no effect of the interaction between cattle ranches and the physiological stage of the animal (P>0.05) on the concentration of the minerals analyzed. However, the interaction between the season of the year and the physiological stage was important (P<0.05) in the content of Zn, Ca, and Na, since the concentration of Zn in the blood serum of the cows was lower than that of the calves, and lower in the rainy and dry season than in the cold season; similarly, Ca levels were lower in the dry season, although serum concentrations of Ca 903

Rev Mex Cienc Pecu 2021;12(3):893-909

remained within adequate ranges. The triple interaction (cattle ranch, season of the year and physiological stage of the animal) was important (P<0.05) for serum concentrations of Cu and Mg. Likewise, the individual effects of cattle ranch, physiological stage of the animal and season of the year influenced the concentrations of most minerals in blood serum (Table 5). Table 5: Mineral concentration (mg kg-1) in blood serum of cows and calves grazing in the intensive silvopastoral system on two ranches, in three seasons of the year Cu a

Huarinches 0.6 El Vivero 0.5 b SEM 0.01 Season Cold 0.6 a Rainy 0.5 a Dry 0.5 b SEM 0.02 Physiological stage Calf 0.6 a Cow 0.5 b SEM 0.017 Appropriate 0.8 range 1.5 Effects and interactions Ranch ** Season * Stage *** R*S NS R*T NS S*T NS R*S*T **

Ca:P

19.7 a 19.6 a 0.50

238.3 a 196.7 b 6.88

2,791 a 2,371 b 62.24

45.4 a 43.2 a 1.01

2.6 a 2.5 a 0.06

0.7 0.6 b 0.018

2.7 1.7 b 0.15

Ranch 110.1 a 109.0 a 2.42

0.7 a 0.6 a 0.6 a 0.21

2.2 a 2.4 a 2.1 a 0.20

130.1 a 100.7 b 97.8 b 3.07

19.7 a 20.9 a 18.5 b 0.6

231.4 a 192.4 b 228.6 a 8.5

2,575 a 2,741 a 2,427 b 77.6

39.2 b 48.8 a 44.8 a 1.23

3.4 a 2.1 b 2.2 b 0.08

0.7 a 0.6 b 0.019 0.81.4

2.5 a 2.0 b 0.16 1.32.5

108.7 a 110.4 a 2.50 80-110

17.4 b 21.9 a 0.51 18-35

219.1 a 215.8 a 7.03 159198

2,634 a 2,528 a 63.50 3,0153,450

49.2 a 39.4 b 1.03 45-60

2.2 b 2.9 a 0.06 1.32.7

.** NS *** ** NS ** NS

*** NS * *** NS NS NS

NS *** NS *** NS ** NS

NS * *** NS NS NS *

** .** NS *** NS NS NS

*** *** NS ** NS * NS

NS *** *** NS NS NS NS

NS *** *** ** NS NS NS

SEM = Standard error of the mean; Appropriate range (26); R=ranch, S=season, T=physiological stage. ab Means in the same column with different literals show differences (P<0.05). NS= Not significant; *= (P<0.05); **= (P<0.01); *= (P<0.001).

In none of the ranches evaluated, the level of Cu and Zn is sufficient to meet the recommended(27), which is consistent with the low levels of these mineral elements in the forage, both in leucaena and in Tanzania grass. Likewise, the serum concentration of P in the animals of the ranch El Vivero is below the recommended level(27), both for adult and young bovines (45-60 and 60-90 mg kg-1, respectively); while in the ranch Los Huarinches, the serum content of P barely meets the minimum recommended for adult bovines, which is

904

Rev Mex Cienc Pecu 2021;12(3):893-909

consistent with the low P content in the two forage species of the intensive silvopastoral system. Serum levels of Na are also deficient in the animals of both ranches, despite the fact that, in both leucaena and Tanzania, this element is in an acceptable range to meet the requirement of cows in production(27). Although the season of the year influenced the serum concentration of almost all minerals, the concentrations of Zn, Cu and Na did not reach the adequate minimum, contrary to what happened with P during the rainy season, which reached only the minimum level required. Ca and Mg concentrations in the three seasons of the year are within adequate ranges, despite the fact that these minerals in leucaena were above the requirement for dairy cows, although they could be compensated by the Tanzania grass forage. This shows that both the grass and the legume contribute to correct mineral imbalances generated by their biochemical properties. Contrary to the above, the levels of K in blood serum were higher than the appropriate range, both in the cold and rainy seasons, which is consistent with the contributions of K in Leucaena and Tanzania grass in both ranches. According to some reports(26), excesses of K in the soil lead to increase the content of this element in pastures, which can subsequently have negative effects on the animal health when the tolerable maximum is exceeded. Both the calves and the adult cows presented serum levels of Cu, Zn and Na below the adequate levels, while the adult animals showed deficiencies of P and, despite the fact that the level of this element in the calves was higher than that of the cows, the deficiency was persistent, since the adequate range of P for young bovines is 60 - 90 mg kg-1(24). Similarly, the calves presented slight deficiency of Mg, probably due to the milk having a low content of this element (0.1 to 0.2 g L-1; (6)); whereas, for both types of animals, the concentration of K in blood serum was higher than the appropriate ranges.

Conclusions and implications The variations in the mineral concentration in the soil of the evaluated ranches, in relation to the season of the year, can originate from the management of each production system and from the environmental conditions, so the similarity of temperature and precipitation is not enough to explain the differences in the concentrations of the minerals evaluated, therefore, additional studies are recommended. Except for Fe, the concentrations of the minerals dissolved in drinking water do not meet the requirements of animals. The association of Leucaena leucocephala and Megathyrsus maximus var. Tanzania complement each other and contribute to improving the mineral balance of the diet of dairy cows, however, edaphic differences of each cattle ranch, the forage species and season of the year are the factors

905

Rev Mex Cienc Pecu 2021;12(3):893-909

responsible for the deficiencies of Cu, Zn and P of the animals. Serum levels of Ca, Mg and the Ca:P ratio were adequate, while levels of Cu, Zn, Na and P are lower than normal concentrations. However, the serum concentration of K is above the normal range. Because the concentrations of Cu, Zn, Na and P in forage and blood serum are low, it is convenient to implement mineral supplementation strategies to cattle that allow increasing the availability of these minerals in the diet, to meet the requirements for maintenance and production of dairy cows and their calves. Literature cited: 1.

Krishnamurthy L, Ávila M. Agroforesteria básica. México D.F. México: Programa de las naciones unidas para el medio ambiente. Serie de textos básicos No. 3;1999.

McDowell LR. Feeding minerals to cattle on pasture. Anim Feed Sci Technol 1996;60(3–4):247–271.

Mayland HF, Hankins JL. Mineral imbalances and animal health: A management puzzle. Wild Range Exp Stn. 2001;73:441–446.

McDowell LR. Minerals in animal and human nutrition. 2nd ed. Amsterdam: Elsevier.; 2003.

Gaviria X, Sossa C, Montoya C, Chará J, Lopera J, Cordoba C, et al. Producción de carne bovina en sistemas silvopastoriles intensivos en el trópico bajo colombiano. VII Congreso Latinoamericano de Sistemas Agroforestales Para la Producción Animal Sostenible. Belém do Pará, Brasil. 2012:661-665.

Suttle N. Mineral nutrition of livestock. 4th ed. Wallingford: CABI Publishing; 2010.

Givens D, Owen E, Axford RF, Omed HM. Forage evaluation in ruminant nutrition. Wallingford: CABI Publishing; 2000.

Prasad CS, Arora S, Prasad T, Chabra A, Ibrahim MNM. Mineral requirements and straw feeding systems. In: Handbook for straw feeding systems, principles and applications with emphasis on Indian livestock production. New Delhi: ICAR.: 1995;225–238.

Huerta OF, Maldonado TR, Álvarez-Sánchez E. Evaluación nutrimental del suelo y limón mexicano con manejo convencional y silvopastoril, Apatzingán, Michoacán. En: Álvarez-Sánchez E, Vásquez-Alarcón A. editores. Agroforestería para la conservación de los recursos naturales y productividad. Chapingo: Universidad Autónoma Chapingo, Chapingo. 2018.

10. INEGI. Anuario estadístico y geográfico de Michoacán de Ocampo. 2017.

906

Rev Mex Cienc Pecu 2021;12(3):893-909

11. INEGI. Prontuario de información geográfica municipal de los Estados Unidos Mexicanos Apatzingán, Michoacán de Ocampo 9. 2009. 12. INEGI. Prontuario de información geográfica municipal de los Estados Unidos Mexicanos Tepalcatepec, Michoacán de Ocampo 9. 2009. 13. Bacab-Pérez HM, Solorio-Sánchez FJ. Oferta y consumo de forraje y producción de leche en ganado doble propósito manejado en sistemas silvopastoriles en Tepalcatepec, Michoacán. Trop Subtrop Agroec 2011;13:271-278. 14. Fick K, McDowell R, Miles LR, Wilkinson PH, Funk NS, Conrad JD, Valdivia R. Methods of mineral analysis for plant and animal tissues. 2nd ed. Gainesville: University of Florida; 1979. 15. SAS (Statistical Analysis System). SAS/STAT User’s Guide (Release 6.4). SAS Inst. 2017. Cary, NC, USA. 16. Jackson RS. Site selection and climate. En: Wine Science. USA: Academic Press; 2014: 307-346. 17. Altieri MA. The ecological role of biodiversity in agroecosystems. Agric Ecosyst Environ 1999;74:19–31. 18. Dollinger J, Jose S. Agroforestry for soil health. Agrofor Systems 2018;92(2):213–219. 19. Kabata-Pendias A, Pendias H. Trace elements in soils and plants. 3rd ed. CRC press; 2001. 20. Maldonado TR, Etchevers JD, Alcántar GG, Rodríguez AJ, Colinas LMT. Estado nutrimental del limón mexicano en suelos calcimorficos. Terra 2001;19(2):163–174. 21. Roca N, Pazos MS, Bech J. Disponibilidad de cobre, hierro, manganeso y zinc en suelos del NO Argentino. Ciencia del suelo. 2007;25(1):31-42. 22. McCauley A, Jones C, Jacobsen J. Soil pH and organic matter. Nutrient management module. 2009;8(2):1-12. 23. Havlin JL. Fertility. In: Encyclopedia of soils in the environment. USA: Academic Press; 2013:10 -19. 24. Roberts AHC. Seasonal variation in soil tests and nutrient of pasture at two sites in Taranaki, N Z J Exp Agr 1987;(3):283-294. 25. Hooda PS. Trace elements in soils. USA: Wiley; 2010.

907

Rev Mex Cienc Pecu 2021;12(3):893-909

26. Rayment G. Total potassium to exchangeable potassium ratios as a guide to sustainable soil Potassium supply. Commun Soil Sci Plant Anal 2013;44:113–119. 27. Marx ES, JH, Stevens RG. Soil test interpretation guide. Oregon State Univ Ext Serv. 1999;(3):1–8. 28. Crespo G, Rodríguez I, Lok S. Contribution to the study of soil fertility and its relation to pastures and forages production. Cuban J Agric Sci 2015;49(2):2011-2019. 29. Rodríguez I, Crespo G, Torres V, Calero B, Morales A, Otero L, Hernández L, Fraga S, Santillán B. Integral evaluation and soil/plant compound in a dairy unit with silvopastoral system in Havana province, Cuba. Cuban J Agric Sci 2008;42(4):403-410. 30. Puls R. Mineral levels in animal health, diagnosis data. Clearbook: Sherpa international; 1988. 31. Mcdowell LR. Nutrition of grazing ruminants in warm climates. Orlando, Florida: Academic press, Inc; 1985. 32. Minson DJ. Forage in ruminant nutrition. USA: Academic press, Inc; 1990. 33. Blair GJ, Lithgow KB, Orchard PW. The effects of pH and calcium on the growth of Leucaena leucocephala in an oxisol and ultisol soil. Plant Soil 1988;214:209–214. 34. Aye PA, Adegun MK. Chemical composition and some functional properties of Moringa, Leucaena and Gliricidia leaf meals. Agric Biol J North Am 2013;4(1):71–77. 35. García M, Wencomo G, Gonzáles C, Medina R, Cova O. Caracterización de diez cultivares forrjeros de Leucaea leucocephala basada en la composición química y la degradabilidad. Rev MVZ Córdoba 2008;13(2):1294–303. 36. Kambashi B, Picron P, Boudry C, Théwis A, Kiatoko H, Bindelle J. Nutritive value of tropical forage plants fed to pigs in the Western provinces of the Democratic Republic of the Congo. Anim Feed Sci Technol 2014;191:47–56. 37. NRC. Nutrient Requirements of Dairy Cattle. 7th ed. Washington, DC: National Academic Press; 2001. 38. Fisher LJ, Waldern DE. Minerals and vitamins for dairy cows. Otawa: Agriculture Canada Publication; 1988. 39. Morales AE, Domínguez VI, González-Ronquillo M, Jaramillo EG, Castelán OO, Pescador SN, Huerta BM. Diagnóstico mineral en forraje y suero sanguíneo de bovinos lecheros en dos épocas en el Valle Central de México. Tec Pecu Méx 2007;45(3),329344.

908

Rev Mex Cienc Pecu 2021;12(3):893-909

40. Aguirre-Medina JF, Gálvez-López AL, Ibarra-Puón JC. Crecimiento de Leucaena leucocephala (Lam.) de Wit biofertilizada con hongos micorrízicos arbusculares en vivero. Rev Chapingo Ser Cienc For Amb 2018;24(1):49–58. 41. Domínguez MT, Marañon T, Murillo JM, Schulin R, Robinson BH. Trace element accumulation in woody plants of the Guadiamar Valley, SW Spain: A large-scale phytomanagement case study. Environ Pollut 2008;152:50–59. 42. Santiago FI, Lara BA, Miranda RL, Huerta BM, Krishnamurthy L, Muñoz-González JC. Composición química y mineral de leucaena asociada con pasto estrella durante la estación de lluvias. Rev Mex Cienc Agr. Pub Esp 2016;(16):3173–83. 43. Uemura E, Hayashuda M, Orden EA, Fujihara T. Tree legume supplementation improves mineral status of grazing does and growth performance of their kids. Livestock Res Rural Develop 2014;26(3).

909

https://doi.org/10.22319/rmcp.v12i3.5624 Review

Thermoregulation and reproductive responses of rams under heat stress. Review

Alejandra Barragán Sierra a Leonel Avendaño-Reyes a Juan A. Hernández Rivera b Ricardo Vicente-Pérez c Abelardo Correa-Calderón a Miguel Mellado d Cesar A. Meza-Herrera e Ulises Macías-Cruz a,*

Universidad Autónoma de Baja California. Instituto de Ciencias Agrícolas, Valle de Mexicali, Baja California, México. b

Universidad de Colima. Facultad de Medicina Veterinaria y Zootecnia, Tecomán, Colima, México. c

Universidad de Guadalajara. Departamento de Producción Agrícola, CUCSUR, Autlán de Navarro, Jalisco, México. d

Universidad Autónoma Agraria Antonio Narro. Departamento de Nutrición, Saltillo, Coahuila, México. e

Universidad Autónoma Chapingo. Unidad Regional Universitaria de Zonas Áridas, Bermejillo, Durango, México.

*Corresponding author: umacias@uabc.edu.mx, ulisesmacias1988@hotmail.com

910

Rev Mex Cienc Pecu 2021;12(3):910-931

Abstract: The high temperatures recorded during the summer season in hot regions compromise the reproductive capacity of domestic animals. In rams, heat stress (HS) causes in the body a series of physiological, metabolic, endocrine and molecular adjustments in order to maintain normothermia and survive; however, several of these changes are negatively associated with their fertility, mainly endocrine ones. HS in rams causes a decrease in blood testosterone concentrations through different mechanisms, and this is negatively reflected on the process of spermatogenesis and sexual behavior. Consequently, heat-stressed rams exhibit low seminal quality and libido; at the sperm level, structural and DNA damage has been observed. Given this situation, the use of HS mitigation strategies during the summer in sheep farms in hot regions is recommended, such as the use of shades in pens, administration of antioxidants or modifications in the diet. Therefore, the objective of this document is to review the current knowledge regarding the effect of HS on the thermoregulation and reproductive capacity of rams, as well as the application of strategies for its mitigation. Key words: Ram, Male sheep, Libido, Seminal quality, Sperm damage.

Received: 18/02/2020 Accepted: 28/09/2020

Introduction Regions with hot climates are characterized by high ambient temperatures (Ta) and relative humidity (RH) in summer, which generally exceeds the upper limit of the thermoneutral zone for production animals (≤ 30 °C), causing them the presence of environmental conditions of heat stress (HS)(1,2). The productive and reproductive impact generated by HS in animals varies among species, with small ruminants showing the best adaptation to these environmental conditions(3). Some reviews have described the thermoregulation mechanisms used by sheep to avoid hyperthermia under HS(1,2,4,5), but little attention is paid to the effect it has on ram reproduction. In hot climates, the reproductive success of the flock depends largely on the adaptation and proper reproductive functioning of the rams. The organism of heat-stressed rams presents a series of changes to avoid hyperthermia(1,6-8). Thus, the reproductive capacity of rams decreases while making physiological, metabolic and endocrinological efforts to stay in normothermia(3,7,9-11). HS can negatively affect the

911

Rev Mex Cienc Pecu 2021;12(3):910-931

reproduction of the ram by different mechanisms, the main ones being: 1) decrease in testosterone concentrations, and 2) direct damage in the morphometry and content of genetic material of the sperm(12,13). This is reflected in failures in the process of spermatogenesis, as well as in low seminal quality, reproductive behavior and fertility(7,14-16). However, the implementation of HS mitigation strategies improves the reproductive capacity of the ram in these climatic conditions(1,8,17). It is worth mentioning that the results of the effects of HS on ram reproduction are not consistent among studies. Differences between breeds in the level of adaptation to HS largely explain these discrepancies(3). Therefore, this review aims to describe the current knowledge that exists in relation to the effect of HS on the thermoregulation and reproductive capacity of rams, as well as the application of strategies for its mitigation.

Sheep in hot climates In recent decades, the excessive accumulation of greenhouse gases (GHG) in the atmosphere is causing an increase in the Ta of the earth’s surface(1), so climate change worldwide is eminent, mainly with tendencies to promote a greater presence of hot climates and, consequently, the desertification of more regions of the terrestrial globe(11). Sheep exposed to high environmental Ta, as well as any other production animal, experience HS (2), which represents a physiological-metabolic challenge for the organism to stay in conditions of homeothermy(6). In the search for strategies that help to maintain the production of food of animal origin under this adverse climate scenario, some authors propose sheep production as an alternative(1,10,18), mainly because they are able to maintain their productive performance under HS conditions(3). Adaptability characteristics possessed by sheep include resistance to parasites, diseases and scarcity of drinking water(15,19); also ability to take advantage of poor quality agricultural fodder and wastes, and maintenance of the reproductive capacity of the flock and lamb growth under HS scenarios(1,3,5). It is worth mentioning that the adaptation level of sheep varies widely among breeds, since there is a great diversity of them developed from cold to hot climatic conditions.

912

Rev Mex Cienc Pecu 2021;12(3):910-931

Heat stress and sheep production Stress is generated by the presence of an external event causing alterations in a biological system(20). In production animals, there is stress when some external factor alters their health, basal metabolism and productive capacity(3). In this sense, sheep can develop symptoms of stress from facing drastic changes in climatic conditions, and in fact, they develop HS when the combination of environmental factors cause an increase in the Ta above the upper limit of their thermoneutral zone(1). Climatic variables that can promote the HS environment are Ta, RH, solar radiation, wind speed and precipitation; however, Ta and RH are the main factors associated with presence of HS(5), and consequently, both are used to construct the temperature-humidity index (THI= Ta – [(0.31 – 0.31*RH)(Ta – 14.4)])(4). It should be clarified that this index was not developed for sheep, however, it is currently widely used to define the degree of HS in this species, since to date there is no specific one for them. Based on that THI, sheep are considered to begin experiencing HS at 22.2 units, being of moderate type between 22.2 and <23.3 units, severe between 23.3 and <25.6 units, and extreme severe at THI ≥25.6 units(4). The thermoneutral zone for most sheep breeds is between 5 and 25 °C(1), however, there are adapted breeds that begin to experience HS above 30 °C(5,15). This suggests that, despite being homeotherms, sheep’s tolerance to HS varies widely among breeds, and specific studies for each breed should be conducted to assess their tolerance to high Ta. In the world, there are more than 1,000 sheep breeds, which vary in their ability to thermoregulate in hyperthermia environments, and this is due to their climatic origin(3). In Mexico, there are both wool and hair breeds, but the latter are more tolerant to HS, since they originated in hot climates, while wool breeds originated in cold or temperate climates(5). This does not mean that there are no HS-tolerant wool breeds in other countries; in Australia, the Merino breed shows great adaptability to warm regions(1). The thermoregulatory response of sheep to HS also varies with sex, and within sex with age, physiological state and reproductive activity(5,21). While negative effects of HS are more noticeable in offspring and pregnant and lactating ewes(21,22), rams seem to be less noticeable since their metabolic heat production is lower compared to ewes, and even more so when they are in reproductive rest(1). The latter could be the cause that most studies are developed in ewes and consider that the topic is of little relevance for research in rams. However, testicular reproductive processes are very sensitive to changes in Ta, which is associated with low fertility in rams during the hot season. In this sense, the rest of the literature review will focus on analyzing the effects of HS on ram reproduction.

913

Rev Mex Cienc Pecu 2021;12(3):910-931

Heat stress and thermoregulation of the ram The thermoregulation of rams under thermoneutral conditions is essentially due to the activation of non-evaporative mechanisms, without this implying metabolic, endocrine or maintenance energy alterations(1,3). However, under HS conditions, rams activate a series of thermoregulation mechanisms that favor homeothermy in the face of thermal challenge. The HS in warm regions increases the average values of physiological variables, such as rectal temperature (RT), respiratory rate (RR), heart rate, and sweat rate (Table 1)(10,18,23). Thus, rams maintain their normothermia, although it is important to note that the increase in the number of breaths is the main mechanism used by rams to lose the body heat load (21). In fact, sheep under HS can eliminate between 60 and 90 % of the thermal load through the respiratory system(4). Another activated physiological mechanism, which is more evident in hair-breed rams subject to HS, is the redistribution of blood flow to peripheral tissues to dissipate body heat by radiation through the skin(5,15). As the temperature gradient between the skin and the environment decreases, RR increases until it becomes the main route of body heat dissipation(24). Table 1: Changes in the physiological variables of heat-stressed rams Air Findings during the Treatment / Source Breed temperature season/treatment with season (°C) higher temperature Winter 14.5 (52) Suffolk ↑ RT, ST Summer 28.2 Winter 19.8 ± 0.4 (45) Najdi ↑ RT, RR and HR Summer 38.4 ± 0.3 Winter 7.0 - 25.5 (72) Malpura ↑ RR and HR Summer 23.0 - 40.0 Winter ~ 12.5 - 28.0 (15) Santa Inés ↑ RT, HR and SR Summer ~ 18.0 - 32.0 Morada Winter ~ 12.5 - 28.0 ↑ RT, HR and SR Nova Summer ~ 18.0 - 32.0 Winter ~ 12.5 - 27.0 (73) Santa Inés No changes Summer ~ 19.0 - 31.0 Morada Winter ~ 12.5 - 27.0 ↓ RR and ↑ TMT Nova Summer ~ 19.0 - 31.0 Winter ~ 12.5 - 27.0 Texel No changes Summer ~ 19.0 - 31.0 Winter ~ 12.5 - 27.0 Dorper ↓ RR and ↑ TMT Summer ~ 19.0 - 31.0

914

Rev Mex Cienc Pecu 2021;12(3):910-931

(18) (74)

Small-tailed Han Polish Merino

(10)

Merino

(24)

Malpura Malpura Garole

Thermoneutral Heat stress Thermoneutral Heat stress Thermoneutral Heat stress х Thermoneutral x Heat stress

~ 22.0 - 23.0 ~ 30.0 - 35.0 16.5 ± 1.0 50.0 ± 1.0 20.1 - 20.9 28.6 - 30.6 33.6 ± 0.7 44.2 ± 0.2

↑ RR ↑ RT and RR ↑ RR and HR

↑ RT and RR

RT= rectal temperature, RR= respiratory rate, HR= heart rate, ST= scrotal temperature, TMT= testicular mean temperature; SR= sweat rate.

In rams, the scrotum functions as a thermoregulation organ under both thermoneutral and HS conditions(1). In hot summer environmental conditions, the scrotum is one of the body regions that most dissipates heat load due to the large vascularization (pampiniform plexus) on the testicular surface, and the large number of sweat glands(15,16). There is a high correlation between body core and scrotal temperatures, so knowing the variability of scrotal temperature allows evaluating the thermoregulation efficiency in rams(15). The activation of evaporative mechanisms demands a large amount of body water, so water intake can increase between 19 and 25% in rams during the summer(25). In consequence, feed intake is decreased by a substitution effect(26). However, in hair sheep, it was shown that feed intake remained similar in summer and spring, regardless of the increase in water intake recorded during summer(5). This suggests that the substitution effect of water intake for feed intake occurs mainly in rams with less tolerance to HS. Thus, the reduction in feed consumption is the result of the ram’s effort to reduce endogenous heat production, by partially suppressing metabolic and rumen activity(1,4,27). All the physiological adjustments presented by the rams as a result of HS cause an increase in the maintenance energy requirements, while the reduction in the feed intake alters its availability(5). Consequently, high summer Ta alter the metabolism of rams, firstly to distribute energy to thermoregulation processes, and secondly to reduce endogenous heat production, while making the use of energy substrates more efficient(28,29). However, the results of the effect of HS on serum concentrations of metabolites and metabolic hormones are not consistent among studies (Table 2).

915

Rev Mex Cienc Pecu 2021;12(3):910-931

Source

(44)

(45) (24)

(10)

(25)

(74) (18)

Table 2: Changes in blood metabolites of heat-stressed rams Findings during the Air Treatment / season/treatment Breed temperature season with higher (°C) temperature Winter

24.1

Summer

33.7

Winter

19.8 ± 0.4

Summer

38.3 ± 0.3

Ossimi

Najdi Malpura Malpura Garole

x Thermoneutral x Heat stress

33.6 ± 0.7

Thermoneutral

20.1 - 20.9

Heat stress

28.6 - 30.6

Thermoneutral

21.0

Heat stress

40.0

Thermoneutral

16.5 ± 1.0

Heat stress

50.0 ± 1.0

Thermoneutral

~ 22.0 - 23.0

Heat stress

~ 30.0 - 35.0

44.2 ± 0.2

Merino Fat-tailed Iranian Polish Merino Small-tailed Han

↑ GLU ↓CHOL and LIPT ↑ GLU and PROT ↓ PROT and T3 ↑ COR ↑ COR ↓ GLU, TRIG, T3 and T4 ↑ PROT and COR ↓ GLU ↑ COR ↓ TRIG, PROT

GLU= glucose, CHOL= cholesterol, TRIG= triglycerides, PROT= total protein, LIPT= total lipids, COR= cortisol, T3= triiodothyronine, T4 =thyroxine.

The high RR observed in heat-stressed rams demands an excessive amount of glucose as an energy source for the functioning of the muscles of the respiratory system (3). Consequently, the rams in summer increase blood glucose concentrations compared to thermoneutral seasons, which is because cortisol concentrations also increase in response to HS(1,3). Cortisol promotes gluconeogenesis and hepatic glycolysis(28). According to this, Ossimi(30) and Najdi(31) breed rams registered higher blood cortisol and glucose concentrations in summer than in winter. Nevertheless, there are studies where serum glucose concentrations decreased(18,32) or did not change(10,23) due to HS in rams. This could be associated with an increase in plasma insulin concentrations(28). In sheep exposed to chronic HS conditions, mainly those of breeds adapted to hot climates, blood insulin concentrations increase as an adaptive mechanism to maintain proper metabolic functioning, improve energy use efficiency and reduce fatty tissue catabolism (28,29). 916

Rev Mex Cienc Pecu 2021;12(3):910-931

Particularly, high insulin levels allow heat-stressed rams to: 1) avoid apoptosis of pancreatic β cells by increasing the production of non-esterified fatty acids; 2) promote the circulating glucose cellular uptake for its metabolism; and 3) maintain anabolism and prevent catabolism, mainly of fatty tissue(3,28). This last point has been associated with tower serum concentrations of triglycerides, cholesterol and total lipids in rams subjected to chronic HS(18,30). Additionally, a reduction in blood concentrations of these lipid metabolites is partially associated with the mobilization of fatty acids to meet energy requirements when the glucose-saving system is activated(1,28). Macías-Cruz et al(33) mention that, in sheep, serum concentrations of glucose, cholesterol, triglycerides, total protein and urea vary according to the type of HS. Chronic HS reduces serum metabolite concentrations associated with energy metabolism (i.e., glucose, cholesterol, and triglyceride), but increases metabolite concentrations associated with protein metabolism (i.e., total protein and urea). In the case of acute HS, variations in blood concentrations of these metabolites show an effect contrary to that observed in chronic HS, which is due to the fact that energy metabolism changes to ensure greater availability of energy substrates when making physiological adjustments(3). Finally, the thyroid gland also plays an important role in the thermoregulation of all species, including rams(13). The HS causes a reduction in the release of thyroid hormones, which favors lower metabolic heat production and body heat load(23,32). Notoriously, triiodothyronine has a shorter half-life and is more thermo-sensitive than thyroxine, as demonstrated in a study of Malpura breed rams(23).

Heat stress and reproductive endocrinology of the ram Environmental factors play an important role in controlling the reproductive capacity of rams. An inadequate environment can cause stress to the ram and this triggers alterations in the neuroendocrine function of the reproductive axis(34). In hot regions, high summer Tas generate a HS environment for rams, leading them to prioritize activities associated with thermoregulation processes rather than reproductive functions(13). In fact, their reproductive capacity could be totally inhibited in breeds susceptible to HS, while such inhibition could be partial or non-existent in adapted breeds(1,15,23). Rams, in response to HS conditions, activate the sympatho-adrenal-medullary (SAM) system and the hypothalamic-pituitary-adrenal (HHA) axis(12). The SAM system stimulates the release of catecholamines (adrenaline and noradrenaline) in the medulla of the adrenal glands(9), which induce peripheral vasodilation and increase energy availability through gluconeogenesis and lipolysis(1,13). For its part, the HHA axis begins its activation with the hypothalamic secretion of corticotropin-releasing hormones (CRH), which in turn stimulate

917

Rev Mex Cienc Pecu 2021;12(3):910-931

the secretion of adrenocorticotropic hormone (ACTH) in the adenohypophysis(12,13,17). Additionally, catecholamines together with CRH cause the hypothalamic release of βendorphin, whose precursor is the proopiomelanocortin polypeptide, which is also a precursor of ACTH(17,34). ACTH via endocrine stimulates the synthesis of glucocorticoids (cortisol and corticosterone) and mineralocorticoid (aldosterone) in the adrenal cortex from cholesterol(13,17,32). The release of cortisol is the main mechanism through which the HHA axis inhibits the functioning of the hypothalamic-pituitary-gonadal (HHG) axis(9,11), and consequently, the degree of reproductive activity in rams exposed to HS(34). The activity levels of HHA and HHG axes are negatively related, in such a way that lower testosterone concentrations and, consequently, reproductive activity are commonly observed in heat-stressed rams(1). The increase in cortisol in the blood causes the levels of testosterone available in the seminiferous tubules to decrease, which in turn reduces sperm production and quality due to low activity in the process of spermatogenesis(35,36). Also, libido and mounting ability is reduced due to low testosterone concentrations(37-39). Testosterone is synthesized and released by Leydig testicular cells, which respond to the stimulation of luteinizing hormone (LH) for such action(9,40). Sertoli cells, in response to follicle-stimulating hormone (FSH) stimuli, synthesize and release the androgen-binding protein, which is responsible for binding with circulating testosterone to introduce it to the seminiferous tubules(40). Once inside the seminiferous tubules, testosterone is responsible for synchronizing the entire process of spermatogenesis(12). However, the activation of the HHA axis in response to HS may negatively compromise the correct functioning of this mechanism at different points. It has been widely documented that cortisol generates negative feedback on GnRH at the hypothalamus level(1,34), a situation that in turn prevents the adenohypophysis from synthesizing and releasing gonadotropin hormones (FSH and LH)(12,13); both essential to ensure the presence of sufficient testosterone concentrations within the seminiferous tubules, to carry out spermatogenesis. Some studies also indicate that testosterone concentrations may decrease by different mechanisms than those associated with the functioning of the hypothalamus and hypophysis in heat-stressed rams(9,12,41). Testosterone concentrations may decrease because glucocorticoids reduce the expression of receptors for LH into Leydig cells(41-43). It has also been reported that Leydig cells require certain cytokinins such as IL-1 and IL-6 for the testosterone release, however, an increase in glucocorticoid synthesis showed to decrease the immune response and, therefore, the production of these cytokinins(12,44). Other evidence indicates that the production of androgen-binding protein in Sertoli cells may decrease due to a low production of thyroid hormones(22,45). Similarly, germ cell damages and low expresion of the protein Conexin-43 (responsible for the union among Sertoli cells) are attributed to the direct effect of testicular hyperthermia(46). These alterations at the level of Sertoli cells could lead to a low availability

918

Rev Mex Cienc Pecu 2021;12(3):910-931

of testosterone within the seminiferous tubules(12). Note that some of these studies were not done in rams, so they may be the reason for future lines of research.

Heat stress and reproductive capacity of the ram Effects on seminal quality

Seminal quality in rams decreases under HS conditions due to the activation of neuroendocrine, physiological and metabolic mechanisms, as well as the increase in maintenance energy expenditure to preserve normothermia conditions(1). Generally, the damage caused to the sperm by HS becomes visible between 14 and 21 d after the start of exposure of the rams to high Tas(47), therefore, a decrease in seminal quality is detected until then. The most affected seminal characteristics are progressive motility, sperm abnormalities, plasma membrane integrity, sperm concentration, and ejaculate volume (Table 3)(1,48). Progressive and mass motility decrease between 5 and 25 %(49,50), which is associated with an increase in the percentage of abnormal sperm(16). The sperm abnormalities predominating due to HS are head and acrosomal defects(51). It is worth mentioning that these abnormalities are less frequent in native breed rams of warm regions, in such a way that these breeds adapted to HS present between 1 and 5 % of abnormal sperm(49,52).

Source (49)

Table 3: Changes in semen characteristics of heat-stressed rams Air Findings during the Treatment / Breed temperature season/treatment with season (°C) higher temperature Chios Autumn 9.7 - 18.3 ↓ MOT and CON ↑ SA Summer 19.1 - 30.6 Friesian

(54)

Persian Karakul

(52)

Suffolk

Autumn Summer Winter Summer Winter Summer

9.7 - 18.3 19.1 - 30.6 5.8 ± 3.8 26.0 ± 4.8 14.5 28.2

919

↓ MOT and CON ↑ MP and SA ↓ VOL ↑ VIT and TES ↓ SC, MM, VIT and CON ↑ seminal pH, SA and acrosomal damage

Rev Mex Cienc Pecu 2021;12(3):910-931

(55)

Hamari (not Winter sheared) Summer

14.1 - 32.4 22.9 - 43.3

Hamari (sheared)

14.1 - 32.4 22.9 - 43.3 18.0 - 26.0 26.0 - 32.0

(50)

Dorper

(27)

Zulu

(15)

(14) (56) (53) (24)

Winter Summer Winter Summer

Winter Summer Morada Nova Winter Summer Santa Inés Winter Summer Pelibuey Winter Autumn Ouled Djellal Spring Summer Malpura Thermoneutral Heat stress Malpura x Thermoneutral Malpura x Heat stress Garole

23.3 28.3 ~ 12.5 - 28.0 ~ 18.0 - 32.0 ~ 12.5 - 28.0 ~ 18.0 - 32.0 -26.0 - 27.8 -33.0 - 40.0 -42.0 33.6 ± 0.7 44.2 ± 0.2

↓ VOL, VIT, MM and MP ↑ SA ↓ VOL, MM and VIT ↑ SA ↓ SC, CON, MM and MP ↑ SA ↓ VOL, CON and PMI ↑ SC ↑ CON and SSA ↓ PMI ↑ CON ↓ SC and CON ↑ SA ↓ SC, VIT and TES ↓ SC, VOL, MM, CON and TES ↓ MOT

SC= scrotal circumference, MOT= sperm motility, MM= mass motility, PM= progressive motility, CON= sperm concentration, VOL= ejaculate volume, VIT= sperm vitality, PMI= plasma membrane integrity, SA= sperm abnormalities, SSA= secondary sperm abnormalities, TES= serum testosterone.

The scrotal perimeter and sperm concentration have also shown to decrease due to HS(16), which is possibly related to less sperm cell proliferation and greater apoptosis of cells of testicular parenchyma(47). Some studies indicate a decrease of 2 to 7 cm in the scrotal perimeter and 3,000 million sperm per milliliter of ejaculate, after subjecting the rams to HS conditions(52,53). On the other hand, the secretory activity of the accessory glands decreases in heat-stressed rams, which is directly reflected in lower ejaculate volume(36,53-55). The lower secretion of seminal plasma in the accessory glands is associated with serum testosterone concentrations(12,56). Additionally, the composition of seminal plasma is modified by HS conditions, mainly at the level of electrolyte and protein concentrations, compounds that maintain the seminal pH between neutral and slightly alkaline (7.0 to 7.3)(11). In general, HS

920

Rev Mex Cienc Pecu 2021;12(3):910-931

increases the seminal pH of rams(52,57), which reduces the number of sperm per ejaculate and increases the percentage of abnormalities(36). In summary, elevated environmental Tas negatively affects ram fertility, essentially because they decrease sperm production, as well as the seminal plasma quantity and quality. This ends up having a negative impact on the microscopic characteristics of the semen. Note that heat-stressed rams do not immediately regain their optimal fertility when switching to a thermoneutral environment; in fact, they require staying between 9 and 11 wk in this environment to ejaculate a semen of normal quality(47).

Effects on sexual behavior

The sexual behavior of rams has been little evaluated under HS conditions, and the results are contradictory so far. Considering that the service of females is mostly given by natural mounting in the different production systems, it is imperative to elucidate in future research the impact of HS on the mounting capacity of rams. In Malpura breed rams (adapted to hot climates), the HS induced in thermo-environmental chamber (42 °C) reduced libido and mounting capacity, which was deduced because heatstressed rams took more time to perform a mount with ejaculation, as well as a higher number of mounting attempts to the first and second ejaculate(53). Likewise, Rembi breed rams exhibited lower libido during the summer season in an arid region(38). The reduction in sexual behavior shown by rams exposed to HS was associated with a lower ability to secrete testosterone. However, there are other studies conducted on purebreed(23) or crossed(7) rams from Malpura genotype, where the effects of HS on sexual behavior were minimal without any difference in serum testosterone concentrations. In hair breed rams used in Mexico, one study reported only an increase in the reaction time of mounting by the effect of the dry and hot season compared to the cool-humid season of a tropical climate(39). Discrepancies between results could be due to the fact that in those studies where there were no effects(7,23), the differences in Ta were not so marked. Other important factors to consider are body condition (CC) and reproductive seasonality. Rams with optimal CC (3.0 on a 1-5 scale) have better sexual behavior than rams with low (≤ 2 points) or high (≥ 4 points) CC under HS conditions(37). On the other hand, the summer season represents a transition period between the end of the anoestrus period and the beginning of the natural reproductive period(58). Therefore, rams of breeds with greater sensitivity to reproductive seasonality could present a reduction in sexual behavior during the summer in hot regions, not only because of

921

Rev Mex Cienc Pecu 2021;12(3):910-931

high temperatures, but also because of their natural reproductive circannual rhythm. In the case of Mexican hair sheep breeds, which are characterized by low reproductive seasonality but high adaptation to hot climates(5), the expected negative effects of HS on their sexual behavior could be minimal, as demonstrated in tropical conditions(39). However, little research has been done on this topic in hair breed rams and existing studies are still superficial. Hair breeds in Mexico have great relevance for meat production in warm climates, so it is necessary to investigate in depth the impact that HS has on the behavior of these rams.

Effects on sperm damage

Sperm damage due to HS begins to be generated from sperm cells that are in differentiation within the seminiferous tubules until sperm that are in transit in the epididymis. Ram sperm last between 13 and 15 d in epididymal maturation, so they are the first to show damage from hyperthermia(59). Previous studies report that rams exposed to Ta greater than 35 °C can cause 17.5 % of pyriform heads(60), 18.5 % of abnormalities in acrosome(61) and about 30 % of tailless sperm(35). Overall, chronic HS (> 60 d) is estimated to cause 43.4 % of minor abnormalities in sperm (e.g., presence of distal cytoplasmic droplet, coiled tip or fully coiled tail, and free normal heads) and 3.6 % of major abnormalities (e.g., proximal cytoplasmic droplet and microcephalic sperm)(57). Another study indicated that head ellipticity appears in the ejaculates of rams from d 42 after testicular hyperthermia, which is associated with direct damage from HS to sperm in the spermiogenesis phase, although the mechanism that leads to this head malformation is unclear(62). It is worth mentioning that the sperm damage generated by HS becomes constant while such environmental conditions remain, and is usually projected for several more weeks after the thermal challenge ends(1,50). The testicles must remain between 2 and 8 °C below body temperature for proper functioning, otherwise testicular hyperthermia causes damage to testicular somatic and germ cells(63). Spermatocytes and spermatids are considered more susceptible to apoptosis due to the effect of HS because of their high meiotic rate(1,47), although degeneration can also occur in spermatogonia, and Leydig and Sertoli cells(23,64). Chronic HS, but not acute, appears to affect sperm that have already completed their formation and are in the epididymis(63,64). Sperm located in the epididymis increase their level of oxidative stress and decrease their antioxidant capacity in response to continuous and prolonged exposure to HS(63). The latter has been widely demonstrated in mice, so research is required in rams. On the other hand, blood flow in the testicles of heat-stressed rams is insufficient, which causes testicular hypoxia and, together with direct hyperthermia, it promotes oxidative stress 922

Rev Mex Cienc Pecu 2021;12(3):910-931

conditions due to an increase in reactive oxygen species (ROS)(63). Excessive testicular production of ROS leads to peroxidation of sperm membrane phospholipids, triggering direct damage at the level of membrane integrity (20 % degradation) and DNA(23). These damages can decrease the expression of the PH-20 protein in the membrane, which is associated with the activity of binding of the sperm with zona pellucida(65). In addition, they make sperm from rams more susceptible to damage to chromatin conformation(11), and to the presence of DNA fragmentation(47,65). This damage to sperm DNA can cause subfertility or infertility in rams(11), as well as a decrease in sperm resistance when used in artificial insemination and in vitro fertilization programs(51).

Mitigation of heat stress in rams

The use of HS mitigation strategies is a necessity to improve the reproductive capacity of rams in warm climates. There is a wide variety of strategies that can be implemented; however, they are not equally efficient in all climates and production systems. For example, in wool breeds, shearing in the summer months is a widely used strategy to improve thermoregulation capacity in rams, however, in Argentina, it was reported that the incidence of elliptical sperm heads increased (76 %) in Australian Merino rams for shearing them completely in an HS environment(62). Similarly, shearing in Desert Hamari hair breed rams was shown to be effective in improving thermoregulation, but counterproductive to seminal quality during the summer season(60). For his part, Rathore(61) found 16 % for sperm abnormalities when testicular wool was sheared in rams. These findings suggest the need for further studies that determine the effectiveness of this HS mitigation strategy in improving ram fertility. In Morada Nova and Santa Inés rams, thermoregulation capacity and scrotal circumference and testicular firmness improved, in addition, sperm abnormalities decreased below 4% due to the shade installation(66). Similarly, the implementation of asbesto shade improved the maintenance of normothermia in Barki breed rams(67). On the other hand, an increase in airflow under high Ta provided advantages in physiological variables of rams(10). In addition, the use of straw beds in rams’ housing pens improved body heat loss by conduction(1); however, the effect of cooling systems or the use of different bedding materials on ram reproductive activity is not known. Dietary supplementation with proteins, lipids, antioxidants and minerals has been shown to improve the ability of adult sheep and lambs to cope with HS(1,68,69). Nevertheless, in rams, there is only information on the use of antioxidants as a strategy to mitigate the effects of HS. Dietary supplementation of the antioxidant -oryzanol in rams decreased ROS production by 923

Rev Mex Cienc Pecu 2021;12(3):910-931

26 % and increased the percentage of sperm with intact membrane after testicular hyperthermia; however, there was also an increase in sperm abnormalities(59). Parenteral administration of vitamin E or vitamin E plus selenium improved the seminal quality and libido of Awassi rams subjected to Ta from 43 to 54 °C(70). Research needs to be developed on some nutritional strategies that can help minimize the negative effects of HS on the reproduction of rams. On the other hand, with the intention of improving the thermoregulation capacity in the offspring, it has been chosen to select progenitors of autochthonous breeds that show thermoresistance capacity and adaptation to the environment in which they have developed(27). In this way, interest in the identification of genetic markers, such as the Booroola fertility gene (FecB), is growing, which apart from increasing the prolificacy of ewes, also positively influences the ability to produce semen of desirable quality under conditions of hot semi-arid climate in purebred Garole rams or crosses with Malpura(23,71).

Conclusions

Despite the characteristics of resistance and natural rusticity having sheep, HS causes a series of physiological and metabolic changes in the ram that modify energy and reproductive hormonal balance, which finally has a negative impact on blood testosterone concentrations and, therefore, on seminal quality and sexual behavior. In addition, hyperthermia causes direct damage at the level of the membrane and DNA of the sperm, decreasing its fertilizing capacity. Therefore, the use of HS mitigation strategies in rams is a necessity to maintain fertility in the flock, particularly in the hot season of the year of hot climates. The HS mitigation strategy to be used will depend on HS type (acute or chronic) and intensity (moderate or severe) to which the ram is exposed, as well as its degree of adaptation, so it could be used from a simple shaded area with or without fans, to the supplementation of additives such as antioxidants. Literature cited: 1. Sejian V, Bhatta R, Gaughan J, Malik PK, Naqvi S, Lal R. Sheep production adapting to climate change. Singapore: Springer Nature Singapore Pte Ltd; 2017. 2. Bernabucci U, Lacetera N, Baumgard LH, Rhoads RP, Ronchi B, Nardone A. Metabolic and hormonal acclimation to heat stress in domesticated ruminants. Animal 2010;4(7):1167-1183.

924

Rev Mex Cienc Pecu 2021;12(3):910-931

3. Al-Dawood A. Towards heat stress management in small ruminants–a review. Ann Anim Sci 2017;17(1):59-88. 4. Marai IFM, El-Darawany AA, Fadiel A, Abdel-Hafez MAM. Physiological traits as affected by heat stress in sheep — A review. Small Ruminant Res 2007;71(1):1-12. 5. Vicente-Pérez R, Macías-Cruz U, Avendaño-Reyes L, Correa-Calderón A, López-Baca MA, Lara-Rivera AL. Impacto del estrés por calor en la producción de ovinos de pelo. Rev Mex Cienc Pecu 2020;11(1):205-222. 6. Bett B, Kiunga P, Gachohi J, Sindato C, Mbotha D, Robinson T, et al. Effects of climate change on the occurrence and distribution of livestock diseases. Prev Vet Med 2017;137:119-129. 7. Kumar D, Sejian V, Gaughan JB, Naqvi SMK. Biological functions as affected by summer season-related multiple environmental stressors (heat, nutritional and walking stress) in Malpura rams under semi-arid tropical environment. Biol Rhythm Res 2017;48(4):593606. 8. Belhadj SI, Mohamed C, Najar T, Ghram A. Meta-analysis of some physiologic, metabolic and oxidative responses of sheep exposed to environmental heat stress. Livest Sci 2019;229:179–187. 9. Tort L, Teles M. The endocrine response to stress-a comparative view. In: Akin F editor. Basic and clinical endocrinology up-to-date. InTech; 2011:263-286. 10. Wojtas K, Cwynar P, Kołacz R. Effect of thermal stress on physiological and blood parameters in merino sheep. Bull Vet Inst Pulawy 2014;58(2):283-288. 11. Rahman MB, Schellander K, Luceno NL, Van Soom A. Heat stress responses in spermatozoa: Mechanisms and consequences for cattle fertility. Theriogenology 2018;113:102-112. 12. Damián JP, Bausero M, Bielli A. Acute stress, hypothalamic-hypophyseal-gonadal axis and testicular function–A review. Ann Anim Sci 2015;15(1):31-50. 13. Binsiya T, Sejian V, Bagath M, Krishnan G, Hyder I, Manimaran A, et al. Significance of hypothalamic-pituitary-adrenal axis to adapt to climate change in livestock. Int Res J Agri Food Sci 2017;2(1):1-20. 14. Aké-López J, Aké-Villanueva N, Segura-Correa J, Aké-Villanueva J, Montes-Pérez R. Effect of age and season on semen traits and serving capacity of Pelibuey rams under tropical conditions. Livest Res Rural Dev 2016;28(9):166. http://www.lrrd.org/lrrd28/9/akel28166.htm. Accessed Nov 25, 2019.

925

Rev Mex Cienc Pecu 2021;12(3):910-931

15. Kahwage PR, Esteves SN, Jacinto MAC, Junior WB, Machado R, Romanello N, et al. Assessment of body and scrotal thermoregulation and semen quality of hair sheep rams throughout the year in a tropical environment. Small Ruminant Res 2018;160:72-80. 16. Moura ABB, Brandao FZ, Esteves SN, de Souza GN, da Fonseca JF, Pantoja MHA, et al. Differences in the thermal sensitivity and seminal quality of distinct ovine genotypes raised in tropical conditions. Theriogenology 2019;123:123-131. 17. Inbaraj S, Sejian V, Bagath M, Bhatta R. Impact of heat stress on immune responses of livestock: a review. Pertanika J Trop Agric Sci 2016;39(4):459-482. 18. Li FK, Yang Y, Jenna K, Xia CH, Lv SJ, Wei WH. Effect of heat stress on the behavioral and physiological patterns of Small-tail Han sheep housed indoors. Trop Anim Health Prod 2018;50(8):1893-1901. 19. Leite PG, Marques JI, Furtado DA, Lopes Neto JP, de Souza BB, do Nascimento JWB. Ethology, physiological, and ingestive responses of sheep subjected to different temperatures and salinity levels of water. Int J Biometeorol 2019;63(8):1091-1098. 20. Collier RJ, Baumgard LH, Zimbelman RB, Xiao Y. Heat-stress: physiology of acclimation and adaptation. Anim Frontier 2019;9(1):12-19. 21. Macías-Cruz U, Correa-Calderón A, Mellado M, Meza-Herrera CA, Aréchiga CF, Avendaño-Reyes L. Thermoregulatory response to outdoor heat stress of hair sheep females at different physiological state. Int J Biometeorol 2018;62(12):2151-2160. 22. Macías-Cruz U, Álvarez-Valenzuela FD, Correa-Calderón A, Díaz-Molina R, Mellado M, Meza-Herrera CA, et al. Thermoregulation of nutrient-restricted hair ewes subjected to heat stress during late pregnancy. J Therm Biol 2013;38(1):1-9. 23. De K, Kumar D, Balaganur K, Kumar Saxena V, Thirumurugan P, Khursheed Naqvi SM. Effect of thermal exposure on physiological adaptability and seminal attributes of rams under semi-arid environment. J Therm Biol 2017;65:113-118. 24. Fonsêca VFC, Maia ASC, Saraiva EP, de Melo Costa CC, da Silva RG, Abdoun KA, et al. Bio-thermal responses and heat balance of a hair coat sheep breed raised under an equatorial semi-arid environment. J Therm Biol 2019;84:83-91. 25. Cain IJW, Krausman PR, Rosenstock S, Turner JC. Mechanisms of thermoregulation and water balance in desert ungulates. Wildl Soc Bull 2006;34(3):570-581. 26. NRC. National Research Council. Nutrient requirements of sheep. 6th ed. Washington, DC, USA: National Academy Press; 1985.

926

Rev Mex Cienc Pecu 2021;12(3):910-931

27. Berihulay H, Abied A, He X, Jiang L, Ma Y. Adaptation mechanisms of small ruminants to environmental heat stress. Animals 2019;9(3):75. 28. Baumgard LH, Rhoads RP, Jr. Effects of heat stress on postabsorptive metabolism and energetics. Annu Rev Anim Biosci 2013;1:311-337. 29. Mahjoubi E, Yazdi MH, Aghaziarati N, Noori GR, Afsarian O, Baumgard LH. The effect of cyclical and severe heat stress on growth performance and metabolism in Afshari lambs. J Anim Sci 2015;93(4):1632-1640. 30. Khalek TMMA. Thermoregulatory responses of sheep to starvation and heat stress conditions. Egyptian J Anim Prod 2007;44(2):137-150. 31. Al-Haidary A, Aljumaah R, Alshaikh M, Abdoun K, Samara E, Okab A, et al. Thermoregulatory and physiological responses of Najdi sheep exposed to environmental heat load prevailing in Saudi Arabia. Pak Vet J 2012;32(4):515-519. 32. Nazifi S, Saeb M, Rowghani E, Kaveh K. The influences of thermal stress on serum biochemical parameters of Iranian fat-tailed sheep and their correlation with triiodothyronine (T 3), thyroxine (T 4) and cortisol concentrations. Comp Clin Path 2003;12(3):135-139. 33. Macías-Cruz U, López-Baca MA, Vicente R, Mejía A, Álvarez FD, Correa-Calderón A, et al. Effects of seasonal ambient heat stress (spring vs. summer) on physiological and metabolic variables in hair sheep located in an arid region. Int J Biometeorol 2016;60(8):1279-1286. 34. Charmandari E, Tsigos C, Chrousos G. Endocrinology of the stress response. Annu Rev Physiol 2005;67:259-284. 35. Braden A, Mattner P. The effects of scrotal heating in the ram on semen characteristics, fecundity, and embryonic mortality. Aust J Agric Res 1970;21(3):509-518. 36. Chella L, Kunene N, Lehloenya K. A comparative study on the quality of semen from Zulu rams at various ages and during different seasons in KwaZulu-Natal, South Africa. Small Ruminant Res 2017;151:104-109. 37. Maurya VP, Sejian V, Kumar D, Naqvi SM. Effect of induced body condition score differences on sexual behavior, scrotal measurements, semen attributes and endocrine responses in Malpura rams under hot semi-arid environment. J Anim Physiol Anim Nutr (Berl) 2010;94(6):e308-e317. 38. Benia A, Taibi K, Ait-Amrane A, Belhamiti T, Hammoudi S, Kaidi R. Study of seasonal sexual activity variations in Algerian rams: Sexual behaviour, testosterone concentration control and environmental factors. Afr J Biotechnol 2013;12(41):6042-6048. 927

Rev Mex Cienc Pecu 2021;12(3):910-931

39. Cárdenas-Gallegos M, Aké-López J, Magaña-Monforte J, Centurión-Castro F. Libido and serving capacity of mature hair rams under tropical environmental conditions. Arch Med Vet 2015;47(1):39-44. 40. Senger PL. Pathways to pregnancy and parturition. 3rd ed. Pullman, Washington: Current conceptions, Inc; 2012. 41. Byers SW, Glover TD. Effect of scrotal insulation on the pituitary-testicular axis of the ram. J Reprod Fertil 1984;71(1):23-31. 42. Huanca W, Coronado L, Galloway DB. Efecto de la manipulación de la temperatura escrotal sobre las características clínicas, seminales y endocrinas en carneros. Rev Inv Vet Perú 2015;26(4):604-613. 43. Narayan E, Parisella S. Influences of the stress endocrine system on the reproductive endocrine axis in sheep (Ovis aries). Ital J Anim Sci 2017;16(4):640-651. 44. Tsigos C, Papanicolaou DA, Kyrou I, Raptis SA, Chrousos GP. Dose-dependent effects of recombinant human interleukin-6 on the pituitary-testicular axis. J Interferon Cytokine Res 1999;19(11):1271-1276. 45. Patel N, Kashanian JA. Thyroid dysfunction and male reproductive physiology. Semin Reprod Med 2016;34(6):356-360. 46. Hassanpour H, Kadivar A, Mirshokraei P, Nazari H, Afzali A, Badisanaye M. Connexin43: A possible mediator of heat stress effects on ram Sertoli cells. Vet Res Forum 2015;6(2):125-130. 47. Alves MB, Andrade AF, Arruda RP, Batissaco L, Florez-Rodriguez SA, Oliveira BM, et al. Recovery of normal testicular temperature after scrotal heat stress in rams assessed by infrared thermography and its effects on seminal characteristics and testosterone blood serum concentration. Theriogenology 2016;86(3):795-805.e2. 48. Saab SA, Sleiman FT, Kallassy N, Darweesh WY, Aad PY. Effect of adaptation and heat stress on reproductive performances of fat-tail Awassi rams in eastern mediterranean. Leban Sci J 2011;12(1):31-44. 49. Karagiannidis A, Varsakeli S, Alexopoulos C, Amarantidis II. Seasonal variation in semen characteristics of Chios and Friesian rams in Greece. Small Ruminant Res 2000;37(1):125-130. 50. Panyaboriban S, Suwimonteerabutr J, Swangchan-Uthai T, Tharasanit T, Phutikanit N, Techakumphu M. Effect of heat stress on reproductive performance of an imported dorper ram: a case study in Thailand. Thai J Vet Med 2016;46(4):671-677.

928

Rev Mex Cienc Pecu 2021;12(3):910-931

51. Francis JR, Javvaji PK, Dhali A, Kolte AP, Roy SC, Giridhar K, et al. Seasonal variations in quality, preservability and fertilizing ability of ovine spermatozoa. Biol Rhythm Res 2019:1-12. 52. Marai IFM, El-Darawany AHA, Ismail ESAF, Abdel-Hafez MAM. Tunica dartos index as a parameter for measurement of adaptability of rams to subtropical conditions of Egypt. Anim Sci J 2006;77(5):487-494. 53. Maurya VP, Sejian V, Kumar D, Naqvi SMK. Impact of heat stress, nutritional restriction and combined stresses (heat and nutritional) on growth and reproductive performance of Malpura rams under semi-arid tropical environment. J Anim Physiol Anim Nutr (Berl) 2016;100(5):938-946. 54. Kafi M, Safdarian M, Hashemi M. Seasonal variation in semen characteristics, scrotal circumference and libido of Persian Karakul rams. Small Ruminant Res 2004;53(1):133139. 55. Suhair SM, Abdalla MA. Effects of seasonal changes and shearing on thermoregulation, blood constituents and semen characteristics of desert rams (Ovis aries). Pak J Biol Sci 2013;16(24):1884-1893. 56. Belkadi S, Safsaf B, Heleili N, Tlidjane M, Belkacem L, Oucheriah Y. Seasonal influence on sperm parameters, scrotal measurements, and serum testosterone in Ouled Djellal breed rams in Algeria. Vet World 2017;10(12):1486-1492. 57. Moreira EP, Moura AdAA, Araújo AAd. Efeitos da insulação escrotal sobre a biometria testicular e parâmetros seminais em carneiros da raça Santa Inês criados no estado do Ceará. R Bras Zootec 2001;30(6):1704-1711. 58. Gastelum-Delgado MA, Avendaño-Reyes L, Álvarez-Valenzuela FD, Correa-Calderón A, Meza-Herrera CA, Mellado M, et al. Conducta estral circanual en ovejas Pelibuey bajo condiciones áridas del noroeste de México. Rev Mex Cienc Pecu 2015;6(1):109118. 59. Escobar E, Lopes S, Malavolta C, Ramalho JB, Missio D, Pinto HF, et al. Effect of gamma-oryzanol on testicular degeneration induced by scrotal insulation in rams. Theriogenology 2019;128:167-175. 60. Rathore AK. A note on the effect of scrotal wool cover on morphological changes in ram spermatozoa due to heat stress. Anim Prod 1969;11(4):561-563. 61. Rathore AK. Acrosomal abnormality in ram spermatozoa due to heat stress. Br Vet J 1970;126(8):440-443.

929

Rev Mex Cienc Pecu 2021;12(3):910-931

62. Armengol MF, Sabino GA, Forquera JC, de la Casa A, Aisen EG. Sperm head ellipticity as a heat stress indicator in Australian Merino rams (Ovis aries) in Northern Patagonia, Argentina. Theriogenology 2015;83(4):553-559.e2. 63. Hamilton TR, Mendes CM, de Castro LS, de Assis PM, Siqueira AF, Delgado JdC, et al. Evaluation of lasting effects of heat stress on sperm profile and oxidative status of ram semen and epididymal sperm. Oxid Med Cell Longev 2016:12. 64. Silva LKX, Sousa JS, Silva AOA, Lourenco Junior JB, Faturi C, Martorano LG, et al. Testicular thermoregulation, scrotal surface temperature patterns and semen quality of water buffalo bulls reared in a tropical climate. Andrologia 2018;50(2):e12836. 65. Fleming JS, Yu F, McDonald RM, Meyers SA, Montgomery GW, Smith JF, et al. Effects of scrotal heating on sperm surface protein PH-20 expression in sheep. Mol Reprod Dev 2004;68(1):103-114. 66. Kahwage PR, Esteves SN, Jacinto MAC, Junior WB, Pezzopane JRM, de AndradePantoja MH, et al. High systemic and testicular thermolytic efficiency during heat tolerance test reflects better semen quality in rams of tropical breeds. Int J Biometeorol 2017;61(10):1819-1829. 67. Hassanin S, Abdalla E, Kotby E, Abd-Elaziz A, El-Fouly M. Efficiency of asbestos shading for growth of Barki rams during hot summer. Small Ruminant Res 1996;20(3):199-203. 68. Can A, Denek N, Yazgan K. Effect of replacing urea with fish meal in finishing diet on performance of Awassi lamb under heat stress. Small Ruminant Res 2005;59(1):1-5. 69. Sejian V, Singh AK, Sahoo A, Naqvi SM. Effect of mineral mixture and antioxidant supplementation on growth, reproductive performance and adaptive capability of Malpura ewes subjected to heat stress. J Anim Physiol Anim Nutr (Berl) 2014;98(1):7283. 70. Talib AAB, Bomboi G, Floris B. Does vitamin E or vitamin E plus selenium improve reproductive performance of rams during hot weather? Ital J Anim Sci 2009;8(4):743754. 71.Kumar D, Naqvi SMK, Kumar S. Sperm motion characteristics of FecBBB and FecBB+ Garole x Malpura rams during the non-breeding season under hot semi-arid environment. Livest Sci 2012;150(1):337-341. 72. De K, Kumar D, Saxena VK, Naqvi SM. Study of circadian rhythmicity of physiological response and skin temperature of sheep during summer and winter in semi-arid tropical environment. Physiol Behav 2017;169:16-21.

930

Rev Mex Cienc Pecu 2021;12(3):910-931

73. Pantoja MHA, Esteves SN, Jacinto MAC, Pezzopane JRM, Paz CCP, Silva J, et al. Thermoregulation of male sheep of indigenous or exotic breeds in a tropical environment. J Therm Biol 2017;69:302-310. 74. Cwynar P, Kolacz R, Czerski A. Effect of heat stress on physiological parameters and blood composition in Polish Merino rams. Berl Munch Tierarztl Wochenschr 2014;127(5/6):177-182.

931

https://doi.org/10.22319/rmcp.v12i3.5178 Technical note

Evaluation of disease-predisposing conditions in small-scale swine farms in an urban environment in northwestern Mexico City

Roberto Martínez Gamba a* Gerardo Ramírez Hernández a

Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia, Departamento de Medicina y Zootecnia de Cerdos, Ciudad de México, México.

Corresponding author: rmgamba@yahoo.com.mx

Abstract: The objective of the work was to develop and apply an instrument to identify the predisposing conditions to the occurrence of diseases in 12 small-scale swine farms in an urban environment. The percentage of negative points obtained in general and by type of farm was analyzed according to its production, fattening (T1) or full cycle (T2), where the highest percentage was for T1 (50 %) and for T2 (66.0 %). Likewise, the data were analyzed to compare the farms T1 and T2 in relation to the percentages of each section that makes up the survey, where only a difference in the “health state” section (P<0.0001) was found. The relationship between the population density per m2 with respect to the maximum percentage of points reached by farms showed no difference (R2, 0.03; P=0.854). No correlation was found between the percentage of points obtained with the number of animals (R2, 0.13; P=0.722). In relation to the average percentage per section by population size, only a difference in the “feeding” section (P<0.0006) was detected, indicating that farms with 10 to 40 swine obtained fewer points in this section. It is concluded that the methodology for the evaluation of conditions predisposing to diseases in this type of farms proved to be applicable. It was determined that farm size and population density are not a predisposing factor in these farms, but the predisposing conditions to the occurrence of diseases differ between full-cycle and fattening farms. Key words: Swine, Diseases, Urban swine farming.

932

Rev Mex Cienc Pecu 2021;12(3):932-943

Received: 04/12/2018 Accepted: 22/10/2020 By way of introduction, it can be mentioned that urban and peri-urban animal production exists in different countries of the world(1,2), it is a source of occupation in which interrelations between social, cultural, economic, religious and health factors are established(3), within it swine farming is a strategy to mitigate poverty(4), since the swine is an ideal animal for urban environments with minimum space requirements, versatility in food consumption and easy commercialization. Many of the swine producers located in urban environments are considered small-scale swine producers, that is, those who own up to 575 animals or up to 50 sows(4). These small-scale farms (SSF) in urban conditions are associated with disease transmission, environmental pollution, lack of animal welfare and causing negative effects on public health(5). Although there are several factors that may predispose these types of farms to the occurrence of diseases(6), little is known regarding the biosafety factors to prevent them from the presence of diseases(7). This determines the importance of having a correct diagnosis of the situation in these farms, especially in health and environmental impact aspects, since, to guarantee the production of these farms, it is necessary to know the potential impact on animal health. In the northwest area of Mexico City, there are SSFs that have been immersed in urbanization, a specific example are 14 swine producers located in the borough of Azcapotzalco, who years ago began raising their animals in a rural environment but are currently in a critical situation regarding the impact of their activity on neighbors and the authorities, who assume negative aspects in health, animal welfare and environmental impact. As an objective of this work, it is considered basic to establish a guide to carry out the process of quantitative evaluation of zootechnical, biosafety and preventive medicine practices that may be a health risk for this type of farms, in order to subsequently establish palliative measures or administrative decision-making(2). The instrument has been modified for use on small-scale urban farms and is the first exercise of its kind. The work was carried out in 12 small-scale swine farms (SSF) located in the borough Azcapotzalco of Mexico City, which represent 85 % of the total number of farms registered with the local association of swine producers. The farms selected were those where producers assumed the status of cooperators, upon request and interview, and which are registered in the International Livestock Individual Identification System (SINIIGA, for its acronym in Spanish). The units evaluated had a minimum of 10 animals and a maximum of 299 and represent a percentage of the swine population consistent with what was indicated by other authors(1,8). Initially, the information obtained was that regarding the time of operation of the farm, the space of the farm, if it adjoins houses, who cares for the farm and if it has veterinary 933

Rev Mex Cienc Pecu 2021;12(3):932-943

advisory. Subsequently, one or more visits were made to each farm accompanied by the application of an in situ evaluation instrument, carried out by a single evaluator according to the methodology used in similar studies(9,10). The farms were classified into fattening (T1) or full cycle (Type 2). In addition, they were classified into three groups based on the number of animals: A those with 1 to 40 animals, B from 41 to 100 and C from 101 to 300 animals(10). The instrument was applied on a farm as a test to determine its operability but was not previously validated. This was designed with seven sections with a total of 55 questions; each item was confirmed by the evaluator in the physical inspection he made on the farm; each item had a value of 0 when the response indicated a high health risk, 1 when it was intermediate and 2 low; some items, due to their characteristics, only had the options of 0 and 2. The maximum value of points obtained for each section was: biosafety (B) 12 points, preventive medicine (PM) 20, facilities (F) 12, feeding (Fe) 14, management (M) 12, health state of swine (H) 16 and environment (E) 14 points, giving a total of 100 points for T1 and 92 for T2. During the visit, the inventory of animals was checked and the population density in each farm was calculated. Because farms could obtain a different number of points depending on their type (T1 or T2), the percentage of points obtained in general and by section was calculated for each farm. To establish the difference between the percentage of points of T1 and T2 in general and for each section, the transformation of the percentages was made obtaining the square root of the arcsine; the data thus obtained were analyzed by means of a Wilcoxon test. Similarly, the differences in percentage of points for the three population levels (A, B, C) were analyzed using the Kruskall-Wallis test, and in case of finding statistical differences, a mean difference test was performed using the honest Tukey test(11). Correlations between the percentage and total points obtained with the number for each farm, as well as between the population density with the percentage of points and the total points obtained, were made by means of the Spearman correlation coefficient(10). Data were analyzed using the JMP.8 statistical package(12). As results, the general conditions of the farms are initially presented, which are detailed in Table 1, where it is summarized that the farms have been operating for a minimum of 18 yr, with a variable space below 600 m2, only one has workers hired, 90 % are surrounded by houses and 40 % of them do not receive any type of technical advisory.

934

Rev Mex Cienc Pecu 2021;12(3):932-943

Farm 1 2 3 4 5 6 7 8 9 10 11 12

Table 1: General conditions of farms Years* Space / Houses Type Cared for 2 farm m 50 49.2 Yes T1 Owner 70 200 Yes T2 Family 40 315 Yes T2 Family 30 63 Yes T2 Family 18 100 Yes T2 Family 20 11.25 No T1 Family 44 600 Yes T1 Family 42 400 Yes T1 Employees 38 80 Yes T1 Family 40 300 Yes T2 Family 70 150 Yes T2 Family 20 200 No T2 Family

Veterinary advisory No No Yes Yes No Yes Yes Yes No Yes No Yes

*Age of the farm.

Data from five farms T1 and seven farms T2 were obtained. Table 2 presents the total points and the percentage of points obtained in general in each farm, as well as the type of farm according to its production, where it is observed that the lowest percentage of points obtained occurred in farm 6 with 31.52 and the highest in farm 12 with 66.00. By type of farm, the highest percentage of points for T1 was 50 % and for T2 66.0 %. The percentage of points obtained by each farm is shown in Table 3. Table 2: Number of animals, points obtained and percentage of points in general by farm Farm

Type

Animals

Points

% Points

1 2 3 4 5 6 7 8 9 10 11 12

1 2 2 2 2 1 1 1 1 2 2 2

19 50 45 53 33 10 299 188 28 113 86 73

37 61 48 56 45 29 46 39 46 58 44 66

37.00 66.00 48.00 56.00 45.00 31.52 50.00 42.39 50.00 58.00 44.00 66.00

935

Rev Mex Cienc Pecu 2021;12(3):932-943

Table 3: Percentage of points obtained by farm and section of the instrument Farm

Type

1 2 3 4 5 6 7 8 9 10 11 12

1 2 2 2 2 1 1 1 1 2 2 2

15.34 41.67 58.33 41.67 66.67 23.01 30.67 7.67 38.34 33.33 41.67 41.67

57.50 80.00 60.00 40.00 65.00 28.75 57.50 51.75 40.25 80.00 30.00 90.00

46.01 66.67 41.67 66.67 25.00 15.34 53.68 53.68 61.35 66.67 25.00 66.67

18.40 57.14 42.86 71.43 21.43 9.20 46.00 46.00 27.60 57.14 50.00 50.00

46.01 50.00 33.33 41.67 16.67 46.01 61.35 38.34 38.34 16.67 41.67 50.00

51.72 87.50 75.00 87.50 87.50 57.47 57.47 45.98 68.97 87.50 87.50 87.50

13.14 28.57 14.29 42.86 14.29 13.14 13.14 26.28 39.42 42.86 28.57 57.14

B= biosafety; PM= preventive medicine; F= facilities; Fe= feeding; M= management; H= health; E= environment.

No differences were found between farms T1 and T2 in terms of B, PM, F, Fe, M and E; however, a difference (P= 0.002) was found between farms T1 and T2 in the section focused on health state (H) (Table 4). Table 4: Average and standard deviation of the percentages of each section of the instrument by type of farm Section

Type 1 (5 farms)

Type 2 (7 farms)

B PM F Fe M H E

23.01 ± 12.12 47.15 ± 12.47 46.01 ± 17.9 29.44 ± 16.46 46.01 ± 7.39 56.32 ± 8.53 21.03 ± 11.75

46.43 ± 11.65 63.57 ± 22.12 51.19 ± 20.0 50.00 ± 14.46 35.71 ± 19.68 85.71 ± 17.18 32.65 ± 28.11

0.116 0.121 0.361 0.369 0.367 0.002 0.058

B= biosafety; PM= preventive medicine; F= facilities; Fe= feeding; M= management; H= health; E= environment.

The relationship between the population density per m2 with respect to the total maximum points reached by the 12 farms was analyzed, without finding an effect (R2, 0.03; P=0.854). In the correlation between the percentage of points obtained and the number of animals existing on the farm, no effect was found both generally and by sections (R2, 0.13; P=0.722). In relation to the average percentage per section for each classification of population size, only a difference in section A was detected (Table 5).

936

Rev Mex Cienc Pecu 2021;12(3):932-943

Table 5: Average and standard deviation of the percentage of points in each section of the instrument in relation to the number of animals by farm size A (n= 5)

B (n= 4)

C (n= 3)

35.84 ± 3.03

45.00 ± 0.78

23.89 ± 11.8

0.228

47.88 ± 22.06

60.00 ± 25.5

63.09 ± 13.06

0.584

36.92 ± 15.23

53.33 ± 18.0

58.01 ± 7.9

0.286

19.16a ± 18.06

54.29b ±8.75

49.71b ± 7.33

0.0006

36.76 ± 12.51

43.33 ±4.17

38.79 ± 18.7

0.777

66.42 ± 12.3

85.00 ± 0.13

63.65 ± 15.2

0.106

20.00 ± 14.2

34.29 ±11.8

27.43 ± 13.46

0.399

B= biosafety; PM= preventive medicine; F= facilities; Fe= feeding; M= management; H= health; E= environment.

The items that obtained a score of 0 and 1 were considered as deficiencies in the production process of the farm, they may indicate a risk for the occurrence of diseases and are areas of opportunity for work on the farm. Table 6 shows the number of producers who have weaknesses based on each of the questions of the instrument. Table 6: Items of the instrument by section and number of farms that presented deficiencies (1 or zero points) in each question of the instrument Section Question B

2 points

Location with respect to other farms Origin of animals Quarantine area Farm visits Use of work clothes There is a bathroom/dressing room Washing and disinfection Breeding stock vaccination Vaccination in weaning Vaccination in fattening Breeding stock deworming Deworming in weaning Deworming in fattening Preventive medications Pest control Presence of other animals on the farm Proper farm design Space per animal Suitable feeders Suitable drinkers Ventilation control Characteristics of the floor

937

2 8 0 5 2 6 5 4 6 6 6 2 7 8 11 1 5

1 point 3 2 3 6 6 5 3 4 1 6 4 10 1 10 4 1 5 5 1 8

0 points 7 2 12 4 4 6 1 2 5 8

2 4 2

6 7 6 4

Rev Mex Cienc Pecu 2021;12(3):932-943

Type of feed (balanced, alternative) Storage conditions Alternative feeding treatment is used Adequate feed supply for piglets Food supply in maternity/females Feed supply in weaning Feed supply in fattening Management system in general Swine are regrouped Grouping by size/weight There is an infirmary area Treatment is given to the sick Records are used General morbidity on the farm in the last month General mortality on the farm in the last month Presence of diarrhea Presence of respiratory signs Presence of systemic signs Presence of nervous signs Presence of locomotor or skin disorders Presence of reproductive problems Liquid excreta are treated Solid excreta are treated Presence of odors Noise level on the farm How is the disposal of biological waste How is the disposal of inorganic waste How is the disposal of chemical waste

3 1 3 7 7

9 6 1 2 2 1 2 1

5 11 2 5 4 3 11 2 2 11 11 9

10 10 1 1 9 11 6 2 11 12 10 11 4 6 10 3

1 6 10 1 2 1 12 8 6 2 12 9 12

B= biosafety; PM= preventive medicine; F= facilities; Fe= feeding; M= management; H= health; E= environment.

When analyzing the items that obtained a score of 0 or 1 in B, no farm has quarantine and half of the producers do not have a bathroom or dressing room. In PM, the fact that in all farms there is the presence of other domestic species stands out. In Fe, the design, installation, quality of feeders and drinkers was considered as a planning deficiency, since only one producer has suitable feeders, and none of the farms had suitable drinkers. On no farm were the floors dry and with a finish suitable for the comfort of the animals found. In Fe, only two farms use a combination of alternative and balanced feed for the breeders, while the rest only supply alternative feed and no producer performs a treatment of this type of feed. In M, only in a farm there is an "all-in all-out system" and an infirmary area. In H, it is a risk factor that 83 % of the farms presented respiratory signs in various areas of production and in 50 % diarrhea was observed. Finally, in E, it was observed as the main deficiency that none of the producers treats excreta and does not have an adequate

938

Rev Mex Cienc Pecu 2021;12(3):932-943

disposal of biological and chemical waste. As for inorganic waste, only a quarter gives treatment, the rest is disposed of as urban garbage. By way of discussion and based on the results presented, it is suggested that the information obtained from the application of the evaluation instrument may present biases as it happens with this type of works and as reported by other authors(1,6,10). Similarly, the lack of validation of the instrument in urban and small-scale farms establishes limitations in the interpretation of the results. Most of these farms are dedicated to the full cycle, contrary to expectations, since it is pointed out that the breeding of fattening swine requires a minimum of facilities and the cost of accommodation for the full cycle is the most expensive part of the system, since specific constructions are needed for all the biological stages of the swine(13). On the other hand, these results correspond to what was presented by authors who reported that fullcycle farms have better economic returns than piglet-producing and fattening farms(14). The tasks of the farms evaluated coincide with other authors who point out that the work is carried out by family members and in most cases the breeding of animals is not the only economic activity(14,15), but it was found that they were elderly people, which contrasts with what was mentioned by the same authors in other non-urban farms in central Mexico, whose owners are of economically active age and have higher schooling(14). Deficiencies in biosafety, facilities, vaccination and transport, among others, increase the risk of introduction of pathogens to the farm(10), so it is necessary to detect critical points on each farm to increase biosafety and reduce disease transmission(16). The fact that no farm has quarantine increases the risk of disease transmission to the population and represents a fundamental failure in biosafety(17) and is the greatest risk for the introduction of pathogens to the farm. Similarly, the absence of dressing rooms represents a break in biosafety protocols(18). Although it is understood that the income of this type of farm limits investment in biosafety measures, it is important that each of them establishes practices that mitigate the risk of disease transmission; perhaps the most important thing is to raise awareness among producers to buy animals of the same origin and prevent the entry and exit of people to the farm without basic hygienic measures. Deficiencies in the quantity and design of drinkers and feeders affect water consumption and the obtaining of nutrients, which can affect the health of animals(19). The conditions of high humidity and low temperature found in 50 % of farms predispose to pneumonia, skin diseases, presence of parasites, feed consumption and hoof injuries(20). Another condition that predisposes to the existence of diseases is the state of the floor, which can be a factor in the occurrence of diseases because a floor with cracks makes it difficult to wash and disinfect it(21).

939

Rev Mex Cienc Pecu 2021;12(3):932-943

Another aspect that can be associated with the existence and transmission of diseases is the almost widespread use of kitchen waste in swine feeding; this type of practice increases the appearance of zoonotic diseases, a risk that is run when animals are raised near houses, especially when used without treatment(22). The low score in management aspects indicates that modern practices based on the physiology of the animals are not used in the SSFs in swine care, which is in agreement with various authors(6,23); this idea is reinforced in this study, since most of the producers do not have an infirmary and the sick swine are distributed among the population. A point in favor of the farms evaluated is that not regrouping reduces the stress that this represents and therefore the immune status of the swine could be better, which reduces the possibility that they get sick and can transmit pathogens to other populations (24,25). The space required per animal in the farms evaluated was correct and does not represent a situation that predisposes to the occurrence of diseases(26). The difference in the percentage of points obtained between fattening and full-cycle farms in the section “Health state" indicates that the purpose of the farm influences the occurrence of diseases, the main disadvantage of the fattening system lies in having animals of different age and origin(24), since the risks of buying from several suppliers of piglets(17) are known. Based on the results of the study, it can be thought that SSFs are a risk for disease transmission, since the absence of protocols for biological, inorganic and chemical wastes and the lack of treatment of solid or liquid excreta represents a risk to public health and other swine populations(27,28). In addition, the management of waste in a small space and close to houses impacts the environment by dispersing or pouring uncontrollably(22). Although the size of the farms did not influence the score obtained in Fe, a negative difference was found in farms with less than 40 animals; this is explained by the fact that producers with few animals use alternative feed without treatment, do not invest in feeders and feed in a rationed form, which decreases the health state(29). It is concluded that the methodology for the evaluation of the conditions predisposing to diseases in SSF in an urban environment by means of a numerical score proved to be applicable to the farms. As advantages of the application of the instrument, the following can be cited: establishing an orderly structure to carry out the inspection of the farm and having basic information for the detection of areas of opportunity to mitigate these risks and implement more accurate diagnostic methods. The disadvantages of the instrument are that it can offer varying results from one farm to another and that the evaluation of the farms would have to be carried out in a higher number of farms and validate the information of the instrument. Preliminarily, it was observed that the type of production, the size of the farms and the population density are not a factor in terms of the numerical score that was obtained, but the health state differs if the farm is full cycle or fattening; it 940

Rev Mex Cienc Pecu 2021;12(3):932-943

was identified that in farms with a smaller population, feeding aspects are a risk factor for the occurrence of diseases. The authors declare that they have no conflict of interest. Literature cited: 1. Wabacha JK, Maribei JM, Mulei CM, Kyule MN, Zessin KH, Oluoch-Kosura W. Characterisation of smallholder pig production in Kikuyu Division, central Kenya. Prev Vet Med 2004;63:183-195. 2. Costard S, Porphyre V, Messad S, Rakotondrahanta S, Vidon H, Roger F, Pfeiffer DU. Multivariate analysis of management and biosecurity practices in smallholder pig farms in Madagascar. Prev Vet Med 2009;92:199-209. 3. Riethmuller P. The social impact of livestock: A developing country perspective. Animal Sci J 2003;74:245-253. 4. Rivera J, Hermenegildo L, Cortés J, Vieyera J, Castillo A, González O. Cerdos de traspatio como estrategia para aliviar pobreza en dos municipios conurbados al oriente de la Ciudad de México. Livest Res Rural Dev 2007;19:7. http://www.lrrd.org/lrrd19/7/rive19096.htm. 5. Correia GC, Henry MK, Auty H, Gunn GJ. Exploring the role of small-scale livestock keepers for national biosecurity-The pig case. Prev Vet Med 2017;145:7-15. 6. Riedel S, Schiborra A, Hülsebusch C, Schlecht E. The productivity of traditional smallholder pig production and possible improvement strategies in Xishuangbanna, South Western China. Livest Sci 2014;160:151-162. 7. Schembri N, Hernandez-Jover M, Toribio AMLN, Holyoake PK. On-farm characteristics and biosecurity protocols for small-scale swine producers in Eastern Australia. Prev Vet Med 2015;118:104-116. 8. Hayes L, Woodgate R, Rast L, Toribio ALML, Hernandez-Jover M. Understanding animal health communication networks among smallholders livestock producers in Australia using stakeholder analysis. Prev Vet Med 2017;144:189-101. 9. Simon-Grifé M, Martin-Valls GE, Vilar MJ, García-Bocanegra I, Martín M, Mateu E, Casal J. Biosecurity practices in Spanish pig herds: Perceptions of farmers and veterinarians of the most important biosecurity measures. Prev Vet Med 2013;110: 223-231. 10. Alawneh J, Barnes T, Parke C, Lapuz E, David E, Basinang V, Baluyut A, Villar E, Lopez E, Blackall P. Description of the pig production systems, biosecurity practices and herd health providers in two provinces with high swine density in the Philippines. Prev Vet Med 2014;114:73-87.

941

Rev Mex Cienc Pecu 2021;12(3):932-943

11. Marques MJ. Probabilidad y estadística para ciencias Químico-Biológicas. México: Editorial McGraw-Hill; 1996. 12. SPSS Inc. Released 2009. PASW Statistics for windows, version 18.0. Chicago: SPSS Inc. 2009. 13. Padilla M. Manual de porcicultura. Ministerio de Agricultura y Ganadería. Programa Nacional de Cerdos. Fundación para el fomento y promoción de la investigación y transferencia de tecnología agropecuaria en Costa Rica. San José, Costa Rica; 2007. 14. Losada EN, Mercadillo SA, Martínez-Gamba RG. Costos de producción y evaluación

del impacto de diversos insumos sobre la rentabilidad de unidades productoras de cerdos de traspatio en la zona metropolitana de la Ciudad de México. Livest Res Rural Dev 2014;26, Article 205. http://www.lrrd.org/lrrd26/11/losa26205. Consultado Nov 12, 2017. 15. Enríquez-Lorenzo C, Martínez-Castañeda FE. Producción porcina en pequeña escala y su aportación a la economía familiar. Ganadería y seguridad alimentaria en tiempo de crisis. UACH-CP; 2009. 16. Ouma E, Dione M, Lule P, Roesel K, Pezo D. Characterization of smallholder pig production systems in Uganda: constraints and opportunities for engaging with market systems. Livest Res Rural Dev 2014;26, Article 3. http://www.lrrd.org/lrrd26/3/ouma26056.htm. Accessed Feb 15, 2018. 17. Morilla A. Manual de bioseguridad para empresas porcinas. Universidad Nacional Autónoma de México. Facultad de Medicina Veterinaria y Zootecnia. Ciudad Universitaria. México; 2009. 18. Pitkin A, Otake S, Dee S. A one-night downtime period prevents the spread of porcine reproductive and respiratory syndrome virus and Mycoplasma hyopneumoniae by personnel and fomites (boots and coveralls). J Swine Health Prod 2011;19(6):345348. 19. Huerta R, Gasa J. Manual de buenas prácticas de producción porcina. Lineamientos generales para el pequeño y mediano productor de cerdos. Red Porcina Iberoamericana 2012;10:1-13. 20. INTA. Manejo sanitario eficiente de los cerdos. Programa Especial Para la Seguridad Alimentaria (PESA). Instituto Nicaragüense de Tecnología Agropecuaria, Managua, Nicaragua. 2010. 21. Guatirojo Y. Manual de bioseguridad en granjas porcícolas [tesis de grado]. Jalapa, Veracruz, México. Universidad Veracruzana. Facultad de Medicina Veterinaria y Zootecnia; 2012.

942

Rev Mex Cienc Pecu 2021;12(3):932-943

22. Seija C. Revisión de experiencias urbanas y periurbanas de cría animal como alternativa de seguridad alimentaria. Revista de Investigación Agraria y Animal 2011;2:51-63. 23. Alarcón G, Camacho J, Gallegos J. Manual del participante: Producción de Cerdos. Institución de enseñanza e investigación en ciencias agrícolas México-Puebla-San Luis Potosí-Tabasco-Veracruz. Secretaria de la Reforma Agraria. Fondo de tierras e instalación del joven emprendedor rural; 2005. 24. Laws J, Amusquivar E, Laws A, Herrera E, Lean I, Dodds P, Clarke L. Supplementation of sow diets with oil during gestation: Sow body condition, milk yield and milk composition. Livest Sci 2008;123:88-96. 25. Pérez PE, Roldan SP, Trujillo OM, Martínez RR, Orozco GH, Becerril HM, Mota RD. Factores estresantes en lechones. Jornada de Estrés Animal. Centro de Enseñanza Investigación y Extensión en Producción Porcina-Jilotepec. FMVZ UNAM. 2012:15-21. 26. Mota D, Roldán P, Pérez E, Martínez R, Hernández E, Trujillo M. Factores estresantes en lechones destetados comercialmente. Rev Vet Méx 2014;4:37-51. 27. Arce B, Valencia C, Warnaars M, Prain G, Valle R. The farmer field school (FFS) method in an urban setting: A case study in Lima, Peru. En: van Veenhuizen R. editor. Cities farming for the future, urban agriculture for green and productive cities. Leusden (Netherlands). ETC - Urban Agriculture. 2006:299-303. 28. Martinez R, Pradal P, Castrejon F, Herradora M, Galvan E, Mercado C. Persistence of Escherichia coli, Salmonella choleraesusis, Aujeszky´s disease virus and blue eye disease virus in ensilage base on the solid fraction of pig feaces. J Applied Microbiol 2001;91:750-758. 29. Campabadal C. Guía técnica para la alimentación de cerdos. Nutrición Animal. Asociación Americana de la Soya-IM. Ministerio de Agricultura y Ganadería. 2009;(1):1-16.

943

https://doi.org/10.22319/rmcp.v12i3.5530 Technical note

Determination of aflatoxins in spices, ingredients and spice mixtures used in the formulation of meat products marketed in Mexico City

Montserrat Lizeth Ríos Barragán a José Fernando González Sánchez a Rey Gutiérrez Tolentino a Arturo Camilo Escobar Medina ab José Jesús Pérez González a Salvador Vega y León a*

Universidad Autónoma Metropolitana. Unidad Xochimilco. Departamento de Producción Agrícola y Animal. Calzada del Hueso No. 1100, Colonia Villa Quietud, Alcaldía Coyoacán, 04960, Ciudad de México, México. b

Centro Nacional de Sanidad Agropecuaria (CENSA). La Habana, Cuba.

*Corresponding author: svega@correo.xoc.uam.mx

Abstract: Aflatoxins are toxic substances produced by some species of fungi that pose a serious danger to human health, especially aflatoxin B1, which is one of the main analytes found in foods and is classified as carcinogenic. The objective of this study was to provide information on the presence of total aflatoxins in spices, ingredients and spice mixtures used for the formulation of meat products and meat products marketed in Mexico City, using an enzymelinked immunosorbent assay (ELISA) method. Fifty samples were analyzed for total aflatoxins. Sixty-one percent of spices and ingredients were positive for total aflatoxins in concentrations of 0.07 to 4.24 μg/kg; 75 % of spice mixtures were positive, in quantities of 0.6 to 1.9 μg/kg and only 3.5 % of meat products were positive for total aflatoxins. The samples with the highest prevalence of total aflatoxins were chili and paprika. All results 944

Rev Mex Cienc Pecu 2021;12(3):944-957

showed concentrations below the maximum limit set by the European Union of 10 to 20 μg/kg for total aflatoxins, which does not constitute a current public health problem under the conditions analyzed. It is recommended to use the ELISA system as a screening method and subsequent confirmation by liquid chromatography with fluorescence detection, as well as to have a monitoring program to evaluate the presence of aflatoxins and other mycotoxins; there is also a need for an official Mexican regulation for mycotoxins in spices considering the high consumption of chili in the Mexican population. Key words: Aflatoxins, Spices, Meat products, ELISA.

Received 05/10/2019 Accepted:06/01/2021

According to the Food and Agriculture Organization of the United Nations (FAO), meat is a product of animal origin that provides nutrients of great value to the diet, among which are proteins, essential amino acids, fats, vitamins and minerals(1). With the production of meat products, the meat and the by-products of the slaughter are used to the maximum because the meat trimmings, with a lower quality, mixed with non-meat ingredients generate an important source of proteins of animal origin for the human diet. In the formulation of meat products, a wide variety of non-meat products such as spices are used, which are vegetable derivatives (dried seeds, fruits, roots, tree bark) used for the preparation of food due to their gastronomic properties such as flavor, color or aroma and even for their medicinal properties and some with antimicrobial properties(2,3,4). FAO documented that 25 % of crops are contaminated with at least some mycotoxin(5). Spices are not exempt from this problem, and can be contaminated within the production chain (preharvest, harvest, processing, storage, drying or transport) due to poor handling practices (6,7,8) and when environmental conditions such as temperature and humidity are favorable for fungal growth(6,9). Mycotoxins are toxic secondary metabolites of certain genera of fungi, such as Aspergillus, Fusarium and Penicillium and more than 400 mycotoxins are known. Aflatoxins are the most commonly found in foods, in concentrations that exceed the maximum levels (NM) for human and animal consumption, in addition, aflatoxin B1 is carcinogenic, teratogenic, immunosuppressive, hepatotoxic and mutagenic(3,6,8,10,11), so the International Agency for Research on Cancer (IARC) classifies it in group 1 of carcinogenic to humans(2).

945

Rev Mex Cienc Pecu 2021;12(3):944-957

The Codex Alimentarius Commission, the body that regulates food safety, has reported that some of its member countries have established NM for mycotoxins in spices between 5 and 30 μg/kg. Mexico has not set the NM for total aflatoxins (AFT) in spices, although it has set the NM for cereals. Among the laboratory techniques used for the analysis of aflatoxins are: immunoassays (6,8,12), high-performance liquid chromatography (HPLC) with ultraviolet and fluorescence detectors(9-14) and thin layer chromatography (TLC)(4,15), being the immunoassays of the most used and reported methods in the scientific literature. The use of spice mixtures and other condiments in meat derivatives has been increasing and they run the risk of being contaminated, which poses a potential risk to public health(10). People need safe and good quality food. The objective of this study was to provide information on the presence of AFT in spices, ingredients and spice mixtures used for the formulation of meat products and meat products marketed in Mexico City. A total of 50 samples were randomly collected(2,12,14) in Mexico City, between December 2015 and January 2017, from the following matrices: Spices and ingredients commonly used for the formulation of meat products (n= 18): onion powder, garlic powder, paprika powder, guajillo chili powder, potato starch, corn starch, texturized soybean and peanuts. Spice mixtures for the formulation of meat products (n= 4): salami, peperoni, Argentinian chorizo, smoked chistorra. Meat products (n= 28): pork ham, turkey ham, turkey sausage, hamburger meat, skirt steak, chicken wings, chicken nuggets and enchilada meat. The samples of spices and texturized soybean came from two specialized companies with the highest sales volume in Mexico City, sold in sealed packaging and stored in refrigeration at 4 °C, protected from light until analysis. The sample of peanuts was taken from a place of sale in bulk, and the branded meat products packaged and with information on the labeling were obtained in supermarkets, such as hams (pork and turkey), sausages and meat for hamburger, skirt steak, chicken wings and nuggets, in addition to unbranded bulk enchilada meat.

946

Rev Mex Cienc Pecu 2021;12(3):944-957

The samples were dried in an oven (Felisa) at 50 °C for 72 h, then ground and passed through a 0.1 mm sieve. All samples were placed in sealed bags in refrigeration at 4 °C, protected from light until analysis. Samples were analyzed with quantitative tests based on an enzyme-linked immunosorbent assay (ELISA), using Neogen® Veratox® reagent set (No 8031). For which 5 g of each sample were weighed; the extraction of aflatoxins was performed with 70% methanol. The sample mixture with methanol was stirred vigorously for 3 min in a vortex (Velp Scientifica) and 5 ml of the extract was filtered on No. 4 filter paper (Whatman). In mixture wells, 100 μl of the conjugate, used to compete with aflatoxins or controls for antibody binding sites, was added; subsequently, 100 μl of the controls (0, 1, 2, 4 and 8 μl) and samples were placed, the contents were mixed by suctioning and releasing it three times. 100 μl was transferred to the wells covered with aflatoxin-specific antibodies, mixed for 20 sec and incubated at ambient temperature in the wells for 10 min. After that period, the Stop solution was poured, 100 μl into each well and the absorbance was measured at 450 nm in an ELISA (Biorad) reader. The results were analyzed using Neogen® Veratox® Software V3.6. The Veratox® Neogen® Reagent Set (No 8031) presented reactivity for AFT (B1, B2, G1, G2) and a working range between 1 to 8 μg/kg. The specificity of the test was evaluated through the study with different matrices (paprika, garlic, corn starch, spice mixture for the formulation of salami and turkey sausage) corresponding to the sample groups (spices and ingredients commonly used for the formulation of meat products, spice mixtures for the formulation of meat products and meat products). The extracts obtained from each matrix were contaminated with the points of the calibration curve mentioned above. The curves of the different matrices showed a correlation above 0.98 and the error at each point of the curve, considering the matrices studied, ranged between 7 and 11%. The recovery in the matrices studied ranged between 72 and 94 %. The limit of detection and the limit of quantification are 0.5 μg/kg and 1 μg/kg respectively, reported by the manufacturer when the same curve is used and there are no differences between the matrix curve (P= 0.909). The total number of positive samples was 40 %. The highest percentage of AFT was found in spices and ingredients commonly used for the formulation of meat products and in spice mixtures for the formulation of meat products with 61 and 75 % respectively, while meat products only had 3.5 % of AFT-positive samples. Figure 1 shows the average concentration of AFT for the three groups analyzed, the average value does not exceed the value of 2 μg/kg, lower than the maximum level established by other countries with national standards for spices and their mixtures, which range from 5 to 30 μg/kg(16). Mexico has not established a specific standard for the presence of aflatoxins in spices, so in this work for the comparison of results, the European standard was used, which

947

Rev Mex Cienc Pecu 2021;12(3):944-957

is the most exigent and proposes maximum limits for the sum of aflatoxins in spices of 10 μg/kg(17). Figure 1: Average concentration of total aflatoxins (μg/kg) in the groups of samples analyzed

As for the spices and ingredients commonly used in the formulation of meat products, guajillo chili was the one with the highest total aflatoxin content, 4.24 μg/kg (Table 1). Similar results were reported in a study carried out in the market of Doha, in Qatar, where 14 samples of spices were analyzed, the presence of aflatoxins was detected in five spices and their mixtures (black pepper, chili, tandoori, masala, turmeric and garam masala), finding the highest value of aflatoxin B1 in chili, with a concentration of 69.28 ± 1.08 μg/kg(9). In another study carried out in Pakistan, 170 samples of chili in different presentations (chili sauce, crushed chili and chili powder) were analyzed, the presence of aflatoxins was detected in an interval of 39 to 59 % of the samples analyzed, with a maximum value of 27.5 and 21.1 μg/kg, in samples from the market and restaurants respectively(18). The aforementioned results corroborate that dried chili is a spice susceptible to fungal development and formation of aflatoxins if the humidity and temperature conditions are conducive during its production and storage.

948

Rev Mex Cienc Pecu 2021;12(3):944-957

Table 1: Concentration of total aflatoxins (AFT) in spices and ingredients commonly used in the formulation of meat products Contamination interval No. of samples analyzed Spices and ingredients (μg/kg) Onion 3 Nd – 1.61 Paprika 2 2 – 3.05 Garlic 3 1 – 2.05 Guajillo chili 1 4.24 Texturized soybean 2 Nd - 0.07 Peanut 1 1.57 Corn starch 2 Nd Potato starch 4 Nd – 2.75 Nd= Not detected.

Paprika samples are the second with the highest concentration of AFT, from 2.0 to 3.05 μg/kg in 100 % of the samples analyzed. In a study conducted on seventy paprika samples collected in the city of São Paulo, Brazil, from January to April 2006, aflatoxins were detected in 82.9 % of the samples and aflatoxin B1 in 61.4 %, in a concentration range of 0.5 to 7.3 μg/kg, with an average concentration of 3.4 μg/kg(19). Another study on 130 spice preparations that were obtained at various points of sale in Ireland (including supermarkets, shops and market stalls), found that 20 % of the samples were contaminated with aflatoxin B1, in an interval of 0.40 to 6.40 μg/kg(10). On the other hand, in a study where the presence of aflatoxins and ochratoxin A in red paprika for retail sale in Spain was evaluated, it was found that the samples that presented aflatoxins were well below the two legal limits, of 5 μg/kg for aflatoxin B1 and 10 μg/kg for total aflatoxins, established by the European Union(17); not so ochratoxin A, which was found more frequently, with an average of 11.8 μg/kg and in a more varied interval (SD 18.9 μ/kg)(20). As for onion, the presence of AFT of 1.61 μg/kg was found in this, lower than that obtained in a study carried out in agricultural products in Nigeria, where the presence of AFT in onion was 3.14 μg/kg(21). Another study found aflatoxin-producing fungi in garlic powder from China, onion powder and granules from France(22). Regarding garlic samples, maximum values of 2.05 μg/kg were detected, a concentration much lower than that reported in a study carried out in Egypt, where values of 224.4 μg/kg were determined in whole garlic, while in peeled garlic no aflatoxins were detected(23). On the other hand, Sahar et al(15) analyzed three garlic samples where they did not detect the presence of aflatoxins. The high levels found in whole garlic by Refai et al(23) may be debatable, the antifungal effect of garlic has been demonstrated in in vitro studies, where it decreases the production of aflatoxins from 5.94 to 0.15 μg/kg(24). While another study shows that there is an inhibition of mycelial growth of 61.94 % in a liquid SMKY medium and in 949

Rev Mex Cienc Pecu 2021;12(3):944-957

corn kernels inoculated with Aspegrillus flavus(25), in another in vitro study using YES medium inoculated with Aspergillus flavus, the mycelial growth, sporulation and production of aflatoxins were evaluated with different concentrations of garlic and onion and a moderate effect of inhibition and production of aflatoxins was demonstrated(26). The aforementioned studies could explain the low values of aflatoxins found in garlic and onions in this work. The aflatoxin content in peanuts was similar to that reported in other studies in Mexico, where AFT values range from 0.11 to 79.69 μg/kg(27). In this work, the presence of aflatoxin in corn starch was not detected, which may be due in the first place to the process of obtaining it, where the husk is separated from the rest of the grain. In a study where the quality of starch was evaluated during the spontaneous fermentation process (21 d), no aflatoxins above 5 μg/kg were found(28) and in another study where the fate of aflatoxins during the wet grinding process and their distribution in products and by-products were analyzed, only 8.7 % of the total aflatoxins in the initial corn was found in the starch fraction, which represents 61 % of the ground corn, and it is concluded then that the aflatoxins were destroyed during the conversion to starch(29). A second aspect may be that the corn starch analyzed does not present aflatoxins or presents them in quantities below the maximum permissible limit for consumption due to the existence of good production practices(30). Fifty percent of the potato starch samples registered positive results to AFT with concentrations of 0.92 to 2.75 μg/kg, this result is debatable since the presence of aflatoxins in harvested potato has not been reported; however, root crops are susceptible to Aspergillus growth and therefore to possible aflatoxin contamination(31). The presence of aflatoxins has been reported in potatoes inoculated with an average of 8 μg/kg of total aflatoxins (mainly B1 and G1) at 27 °C and 95 to 97 % relative humidity in 20 d(32). In sweet potato, aflatoxin concentrations in the order of 0.01-0.18 μg/kg(33) have been reported. In starchy, raw and cooked foods, after storage aflatoxin levels in the order of 3-25 μg/kg were found in Ipomoea batatas(31). Although there are no studies in harvested potatoes, studies in sweet potato and its starch corroborate in some way the results of this study, and that unsuitable conditions during storage can also contribute to the presence of aflatoxins, considering that potato starch is used in different culture media for the production of aflatoxins. In the sample of texturized soybean analyzed, AFT was found with a value of 0.07 μg/kg, the amount of AFT is minimal, this is because it has been reported by various authors that soybean contains substances that inhibit fungal growth and the synthesis of aflatoxins(34,35). In a study conducted in Serbia, 63 soybean samples were analyzed and no aflatoxins were found(36), corroborating that soybean is less susceptible to fungal infection and mycotoxin formation than larger grains such as corn. In all cases, the value of 10 μg/kg established by the European Union(17) was not exceeded. 950

Rev Mex Cienc Pecu 2021;12(3):944-957

In meat products, of the 28 samples analyzed, only one sample of enchilada meat was positive, representing 3.5 % (Table 2). The presence of aflatoxins in meat products has been reported by several authors, for example, Markov et al(37) conducted a study in 90 meat products (sausages, dry products) evaluating three mycotoxins (aflatoxins, ochratoxin and citrinin), the first two by ELISA and the last by HPLC, the results showed the presence of aflatoxins in 10 % of the samples analyzed, with an average concentration of 3.0 μg/kg, however, the highest incidence in the samples was ochratoxin with 64.44 %. Similar results in relation to the abundance of ochratoxin and aflatoxins were reported in a study conducted in Croatia, where 410 samples were analyzed: hams (n= 105), dried fermented sausages (n= 208), bacon (n= 62) and cooked sausages (n= 35)(38). Table 2: Concentration of total aflatoxins (AFT) in meat products No. of samples Contamination interval Meat product analyzed (μg/kg) Enchilada meat 2 Nd- 0.4 Pork ham 6 Nd Turkey ham 6 Nd Turkey sausage 3 Nd Chicken nuggets 4 Nd Chorizo 4 Nd Chicken wings 1 Nd Skirt steak 1 Nd Hamburger meat 1 Nd Nd= not detected.

The presence of mycotoxins in meat products can occur at different points in the production chain, in the field, where the animal is exposed to contaminated food(39), in the process of making the product, using contaminated spices or spice mixtures or during final storage(40). In a study conducted in Spain during the maturation of cured hams, the effect of temperature and water activity on fungal growth and aflatoxin production was evaluated, where a water activity greater than 0.9 and a temperature greater than 15 °C produce aflatoxins(41). Unlike spices, for which there are maximum permissible limits for aflatoxins, in meat products there are no regulations in this regard, only in Italy, the Ministry of Health has recommended, since 1999, the maximum value of 1 μg/kg of ochratoxin A in meat or meat products(42), considering that this appears more frequently and in concentrations of 1 to 10 μg/kg, while aflatoxins appear below 1 μg/kg(38). For spice mixtures used for the formulation of meat products, 75 % of the samples were positive (Table 3). Some studies conducted in Qatar and Turkey, in spice mixtures from markets, report AFT in an interval of 0.16 to 5.12 μg/kg and 0.1-0.9 μg/kg respectively(43,44). 951

Rev Mex Cienc Pecu 2021;12(3):944-957

These results are similar to what was found in this paper. The results are as expected if it is considered that, in the composition of the mixtures, spices such as paprika are present, which is one of the spices most susceptible to contamination(19). Table 3: Concentration of total aflatoxins (AFT) in spice mixtures for the formulation of meat products Spice mixture for the formulation of: AFT concentration (µ𝐠/𝐤𝐠) Pepperoni Argentinian chorizo Smoked chistorra Salami

1.9 0.6 Nd 1.77 Nd= not detected.

In the case of the mixture of spices for chistorra, it gave a negative result to the presence of aflatoxins and paprika is present in the mixture, the result may be contradictory, however, within this mixture garlic is also present, which has been shown to be an inhibitor of fungal contamination and the synthesis of aflatoxins(24), so it can be inferred that there was no fungal growth or production of toxins. As in spices and ingredients commonly used for the formulation of meat products, the values found do not exceed the permissible limit of the EU, so it can be inferred that their use in the formulation of meat products does not constitute a risk to public health(17). Immunoenzymatic systems in the determination of mycotoxins in different matrices have been widely used as a screening tool for subsequent confirmation by chromatographic techniques(38). The results obtained in this study in different matrices (spices, ingredients and mixtures of spices used for the formulation of meat products and meat products), applying the benefits of ELISA for the determination of AFT constitute the first report in Mexico and guide subsequent studies in those spices, ingredients or mixtures of species that presented a higher prevalence of AFT, in such a way that a complete validation of the technique is carried out in the matrix to be studied. On the other hand, those samples that exceed the NM of AFT in spices must be confirmed by chromatographic techniques. In conclusion, the presence of total aflatoxins in spices, ingredients and spice mixtures used for the formulation of meat products and meat products is reported for the first time in Mexico, being found in concentrations ranging between 0.4 and 4.24 μg/kg. The spices of highest prevalence to AFTs are chili and paprika of high consumption in the Mexican population. The ELISA methodology used to detect AFT in spices, ingredients, spice mixtures used for the formulation of meat products and meat products makes it possible to use it as a screening test; those with concentrations above the maximum level must be

952

Rev Mex Cienc Pecu 2021;12(3):944-957

confirmed by chromatographic techniques. The results obtained in this research alert national regulatory bodies of the need to implement a standard for the presence of aflatoxins in spices, considering the high national consumption of many of the spices studied.

Acknowledgements

To the National Council for Science and Technology (CONACyT) for the scholarship granted during postgraduate studies in the Master's Degree in Agricultural Sciences of the Metropolitan Autonomous University, Xochimilco Unit, belonging to the National Quality Postgraduate Program. Literature cited: 1. FAO. Food and Agriculture Organization. Carne y productos cárnicos. 2014. Disponible en: http://www.fao.org/ag/againfo/themes/es/meat/home.html Consultado 25 Ago, 2017. 2. Ozbey F, Kabak B. Natural co-ocurrence of aflatoxins and ochratoxin A in spices. Food Control 2012;28(1):354-361. 3. Asghar MA, Zahir E, Rantilal S, Ahmed A, Iqbal J. Aflatoxins in composite spices collected from local markets of Karachi, Pakistan. Food Addit Contam: Part A 2016;9(2):113–119. 4. Zahra N, Khan M, Mehmood Z, Saeed MK, Kalim I, Ahmad I, et al. Determination of aflatoxins in spices and dried fruits. J Sci Res 2018;10(3):315-321. 5. OMS. Organización Mundial de la Salud. Resumen sobre inocuidad de los alimentos. Aflatoxinas. 2018: https://www.who.int/foodsafety/FSDigest_Aflatoxins_SP.pdf Consultado: 5 jul, 2019. 6. Ardic M, Karakaya Y, Atasever M, Durmaz H. Determination of aflatoxin B1 levels in deep-red ground pepper (isot) using immunoaffinity column combined with ELISA. Food Chem Toxicol 2008;46(1):1596–1599. 7. Khayoon WS, Saad B, Lee TP, Salleh B. High performance liquid chromatographic determination of aflatoxins in chili, peanut and rice using silica based monolithic column. Food Chem 2012;133(1):489-496.

953

Rev Mex Cienc Pecu 2021;12(3):944-957

8. Tosun H, Arslan R. Determination of aflatoxin B1 levels in organic spices and herbs. Sci World J 2013;(4):874093. 9. Hammami W, Fiori S, Thani RA, Kali N A, Balmas V, Migheli Q, et al. Fungal and aflatoxin contamination of marketed spices. Food Control 2014;37(1):177–181. 10. O’ Riordan MJ, Wilkinson MG. A survey of the incidence and level of aflatoxin contamination in a range of imported spice preparations on the Irish retail market. Food Chem 2008;107(1):1429–1435. 11. Akpo-Djènontin DOO, Gbaguidi F, Soumanou MM, Anihouvi VB. Mold infestation and aflatoxins production in traditionally processed spices and aromatic herbs powder mostly used in West Africa. Food Sci Nutr 2018;6(1):541–548. 12. Gojković VS, Grujić RD, Ivanović MM, Marjanović-Balaban ZR, Vujadinović DP, Vukić MS. The frequency of presence of aflatoxin B1 in foodstuffs of vegetable origin. Matica Srpska J Nat Sci 2017;133(1):29–36. 13. Cho SH, Lee CH, Jang MR, Son YW, Lee SM, Choi IS, et al. Aflatoxins contamination in spices and processed spice products commercialized in Korea. Food Chem 2008;107(1):1283-1288. 14. Ali N, Hashim NH, Shuib NS. Natural occurrence of aflatoxins and ochratoxin A in processed spices marketed in Malaysia. Food Addit Contam: Part A 2015;32(4):518– 532. 15. Sahar N, Ahmed M, Parveen Z, Ilyas A, Bhutto A. Screening of mycotoxins in wheat, fruits and vegetables grown in Sindh, Pakistan. Pakistan J Bot 2009;41(1):337–341. 16. Comité del Codex sobre contaminantes de los alimentos. Documento de debate sobre los niveles máximos para las micotoxinas en las especias. Comisión del Codex Alimentarius 2017. http://www.fao.org/fao-who-codexalimentarius/shproxy/en/?lnk=1&url=https%253A%252F%252Fworkspace.fao.org%252Fsites%252F codex%252FMeetings%252FCX-735-11%252FWD%252Fcf11_11s.pdf Consultado: 13 jun, 2019. 17. UE. Unión Europea (2010) Reglamento No. 165/2010 de la comisión de 26 de febrero de 2010 que modifica, en lo que respecta a las aflatoxinas, el Reglamento (CE) No. 1881/2006 por el que se fija el contenido máximo de determinados contaminantes en los productos alimenticios. https://eur-lex.europa.eu/legalcontent/ES/TXT/PDF/?uri=CELEX:32010R0165&qid=1567559548605&from=EN Consultado: 6 Sept, 2017.

954

Rev Mex Cienc Pecu 2021;12(3):944-957

18. Iqbal SZ, Asi MR, Zuber M, Akhtar J, Jawwad MS. Natural occurrence of aflatoxins and ochratoxin A in comercial chilli and chilli sauce samples. Food Control 2013;30(2):621– 625. 19. Shundo L, De-Almeida AP, Alaburda J, Lamardo LC, Navas SA, Ruvieri V et al. Aflatoxins and ochratoxin A in Brazilian paprika. Food Control 2009;20(12):1099-1102 20. Hernández-Hierro J, Garcia-Villanova R, Rodríguez-Torrero P, Toruño-Fonseca IM. Aflatoxins and ochratoxin A in red paprika for retail sale in Spain: occurrence and evaluation of a simultaneous analytical method. J Agri Food Chem 2008;56(3):751-756. 21. Arowora KA, Abiodun AA, Adetunji CO, Sanu FT, Afolayan SS, Ogundele BA. Levels of aflatoxins in some agricultural commodities sold at Baboko Market in Ilorin, Nigeria. Global J Sci Front Res 2012;12(10): 31-33. 22. Tančinová D, Mokrý M, Barboráková Z, Mašková Z. Mycobiota of spices and aromatic herbs. Potravinarstvo Scie J Food Ind 2014;8(1):172-177. 23. Refai MK, Niazi ZM, Aziz NH, Khafaga NEM. Incidence of aflatoxin B1 in the Egyptain cured meat basterma and control by γ irradiation. Food/Nahrung 2003;47(6):377-382. 24. Thanaboripat D, Nontabenjawan K, Leesin K, Teerapiannont D, Sukcharoen O, Ruangrattanamatee R. Inhibitory effect of garlic, clove and carrot on growth of Aspergillus flavus and aflatoxin production. J Forestry Res 1997;8(1):39-42. 25. Bilgrami KS, Sinha KK, Sinha AK. Inhibition of aflatoxin production & growth of Aspergillus flavus by eugenol & onion & garlic extracts. Indian J Med Res 1992;96(1):171-175. 26. Chalfoun SM, Pereira MC, Resende MLV, Angélico CL, Silva RA. Effect of powdered spice treatments on mycelial growth, sporulation and production of aflatoxins by toxigenic fungi. Ciênc Agrotec 2004;28(4):856-862. 27. Alvarado-Hernández JR, Carvajal-Moreno M, Rojo-Callejas F, Ruiz-Velasco S. Aflatoxins in natural peanuts (Arachis hypogaea L.) of Mexico: Validation of the biochemical methods for extraction and quantification. J Plant Biochem Physiol 2016;4(1):1000168. 28. Yuan ML, Lu ZH, Cheng YQ, Li LT. Effect of spontaneous fermentation on the physical properties of corn starch and rheological characteristics of corn starch noodle. J Food Engin 2008;85(1):12-17.

955

Rev Mex Cienc Pecu 2021;12(3):944-957

29. Aly SE. Distribution of aflatoxins in product and by products during glucose production from contaminated corn. Food/Nahrung 2002;46(5):341-344. 30. Sekiyama BL, Ribeiro AB, Machinski PA, Machinski JM. Aflatoxins, ochratoxin A and zearalenone in maize-based food products. Braz J Microbiol 2005;36(3):289-294. 31. Lovelace CE, Aalbersberg WG. Aflatoxin levels in foodstuffs in Fiji and Tonga islands. Plant Foods Hum Nutr 1989;39(4):393-399. 32. Swamlnathan B, Koehler PE. Isolation of an inhibitor of Aspergillus parasiticus from white potatoes (Solanum tuberosum). J Food Sci 1976;41(2):313-319. 33. Tung TC, Ling KH. Study on aflatoxin of foodstuffs in Taiwan. J Vitam 1968;14(1):4852. 34. Strange RN. Natural occurrence of mycotoxins in groundnuts, cottonseed, soya, and cassava. Mycotoxins Anim Foods 1991;341-362. 35. Winter G, Pereg L. A review on the relation between soil and mycotoxins: Effect of aflatoxin on field, food and finance. Eur J Soil Sci 2019;70(4):882-897 36. Jakić-Dimić D, Nešić K, Petrović M. Contamination of cereals with aflatoxins, metabolites of fungi Aspergillus flavus. Biotech Anim Husbandry 2009;25(5-6):12031208. 37. Markov K, Pleadin J, Bevardi M, Vahčić N, Sokolić-Mihalak D, Frece J. Natural occurrence of aflatoxin B1, ochratoxin A and citrinin in Croatian fermented meat products. Food Control 2013;34(1):312-317. 38. Pleadin J, Satver MM, Vahčić N, Kovačević D, Milone S, Saftić L, et al. Survey of aflatoxin B1 and ochratoxin A ocurrence in traditional meat products coming from Croatian households and markets. Food Control 2013;52(1):71-77. 39. Bailly J, Guerre P. Mycotoxins in meat and processed meat products. In: Safety of meat and processed meat. Toldrá F. editor. New York, USA: Springer Science & Business Media; 2009;83-124. 40. Abd-Elghany SM, Sallam KI. Rapid determination of total aflatoxins and ochratoxins A in meat products by inmuno-affinity fluorimetry. Food Chem 2015;179(1):253-256. 41. Peromingo B, Rodríguez A, Bernáldez V, Delgado J, Rodríguez M. Effect of temperature and water activity on growth and aflatoxin production by Aspergillus flavus and Aspergillus parasiticus on cured meat model systems. Meat Sci 2016;122(1):76-83.

956

Rev Mex Cienc Pecu 2021;12(3):944-957

42. Montanha FP, Anater A, Burchard JF, Luciano FB, Meca G, Manyes L, et al. Mycotoxins in dry-cured meats: A review. Food Chem Toxicol 2018;111(1):494-502. 43. Abdulkadar A, Al-Ali A, Al-Kildi A, Al-Jedah J. Mycotoxins in food products available in Qatar. Food Control 2004;15(7):543-548. 44. Cavus S, Tornuk F, Sarioglu K, Yetim H. Determination of mold contamination and aflatoxin levels of the meat products/ingredients collected from Turkey market. J Food Safety 2018;38(5):e12494.

957

https://doi.org/10.22319/rmcp.v12i3.5724 Thecnical note

Effect of the cutting height of sorghum at harvest on forage yield and nutritional value of silage

Jorge A. Granados-Niño a David G. Reta-Sánchez b Omar I. Santana b Arturo Reyes-González b Esmeralda Ochoa-Martinez b Fernando Díaz c Juan I. Sánchez-Duarte b*

Universidad Juárez del Estado de Durango. Facultad de Agricultura y Zootecnia. Carretera Gómez Palacio - Tlahualilo Km. 32. Ej. Venecia, Gómez Palacio, Dgo. México. b

Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuarias. México.

Dairy Research Center, LLC, Brookings, SD. USA.

*Corresponding author: sanchez.juan@inifap.com.mx

Abstract: The objective was to identify an optimal cutting height at harvest of sorghum forage (Sorghum bicolor L.) to improve the nutritional quality of silage, without reducing the dry matter (DM) yield of the forage. The effect of cutting height at 10, 20, 30, 40, 50 and 60 cm on DM yield and nutritional value of silage was evaluated. The forage was harvested when the grain reached a milky-dough state. The plants were crushed to a particle size of 2 cm and the forage was compacted to 261 kg of MS/m3 in mini silos. The DM yield reduced from harvesting at 40 cm above the ground. The neutral detergent fiber (NDF) and lignin of silage

958

Rev Mex Cienc Pecu 2021;12(3):958-968

were superior when harvested at 10 cm, but lignin reduced by 1.4 % when the cut was greater than 20 cm. The NDF digestibility and total digestible nutrient (TDN) concentration increased when harvested at 40 cm. The highest content of non-fibrous carbohydrates (NFC) was obtained when harvested at 40 and 50 cm. The net lactation energy (NLE) of silage increased from harvesting at 20 cm. The optimal pH of silage was obtained when harvested at 30 cm. In conclusion, harvesting the sorghum fodder between 20 and 40 cm allows obtaining a silage with lower lignin content and, therefore, greater digestibility and energy concentration without negatively affecting the DM yield of the forage. Key words: Sorghum bicolor (L.), Dry matter yield, Silage, Cutting height, Nutritional value.

Received: 02/07/2020 Accepted: 19/10/2020

Forage sorghum is a viable alternative for producing silage on dairy farms located in regions with arid and semi-arid environments. This crop has been shown to grow well under conditions of limited water (1) and high temperatures(2); in addition to having moderate tolerance to soil salinity(3). Under these conditions, sorghum has the advantage of being able to produce larger amounts of dry matter (DM) compared to forage maize(4,5). However, the lignin content in the forage of conventional sorghum varieties (up to 9.1 % of DM) is associated with silages that have low NDF digestibility (NDFD); therefore, when used in the diets of dairy cows, it limits the consumption of DM and milk production(6,7). A practical option to reduce lignin concentration and improve the digestibility of the silage fiber of different forages is to increase the cutting height. In this regard, it has been reported that increasing the cutting height from 15 to 45 cm in black sorghum (Sorghum almum) reduces lignin contents from 7.7 to 6.4 %(8). In forage maize, it was found that lignin decreased from 3.0 to 2.6 %, while NDFD increased 2.3 % when cutting height at harvest increased from 12 to 45 cm(9). Similarly, the increase in cutting height in forage maize from 15 to 45 cm increased NDFD by 5.0 %, which was attributed to decreasing the proportion of basal stems containing the most lignified part of the plant(10). When the cutting height of the forage increases, the nutrient composition of silage improves; however, DM yield losses can become very significant if very high cutting heights are used. The above causes that this harvesting strategy is not accepted by producers. Yield losses in DM of sorghum forage can be between 10 and 20 % when increasing the cutting height above 20 cm(11,12) and from 3 to 16 % when increasing the cutting height to more than 40 cm in

959

Rev Mex Cienc Pecu 2021;12(3):958-968

forage maize(10,13). Therefore, it is necessary to identify the best cutting height in forage sorghum, which allows having an optimal balance between the nutritional composition of silage and the DM yield per hectare at harvest. The objective of the present work was to identify the optimal cutting height in forage sorghum to improve the nutritional quality of silage without affecting the DM yield. The experiment was established during the spring 2018 production cycle in the Ejido Venecia, located in the Municipality of Gómez Palacio, Durango. The experimental site is located at 25º46'56" N and 103º21'02" W at an altitude of 1,100 m above sea level. The soil has a clay texture, with a bulk density of 1.07 g cm-3, an organic matter content of 1.5 % and a pH of 8.3. Precipitation and air temperatures during crop development are shown in Figure 1. The accumulated precipitation during the cycle was 22.4 mm. Maximum temperatures ranged from 28.7 to 43.1 °C and minimum temperatures from 13.1 to 27 °C. The highest temperatures that exceeded the optimal growth range in sorghum (6 - 37.7 °C)(3) occurred between 41 and 52 d after sowing (DAS). Figure 1: Maximum, minimum and average temperature and precipitation recorded during the experimental period (April 18 to August 10, 2018)

960

Rev Mex Cienc Pecu 2021;12(3):958-968

The effect of six cutting heights (10, 20, 30, 40, 50 and 60 cm from the soil surface) on forage yield, nutrient composition and nutrient yield of forage sorghum silage was evaluated. The preparation of the land consisted of a fallow, double harrowing and leveling with scraper. The sowing was carried out in moist soil on April 18, 2018 with a Gaspardo precision seeder (model SPLC-4F) using a sowing density of 12 kg ha-1 of seed of the Silo Miel variety (Agricenter Zevilla, Torreón, Coahuila). Four furrows per treatment of 0.8 m in length at a distance of 0.75 m were sown using a completely randomized block design with four repetitions. There was an average density of 195,000 plants ha-1. The fertilization was carried out with 134 kg ha-1 of N and 43 kg ha-1 of P2O5. The total phosphorus was applied at sowing, while the N was fractionated, applying 40 % of the total dose at sowing and 60 % before the first supplemental irrigation; 48 DAS. At sowing, 8 kg ha-1 of K and 10 kg ha-1 of S were also applied and, before the first supplemental irrigation, 18 kg ha-1 of Ca and 12 kg ha-1 of Mg were applied. Yara Mila Star® and Yara Bela Nitromag® were used as fertilizer sources (Yara, Guadalajara, Jalisco). Four irrigations were applied including a pre-sowing irrigation and three supplemental irrigations at 48, 65 and 85 DAS. A furrow irrigation system was used. At 25 and 46 DAS, applications of chlorpyrifos ethyl (Lorsban 480 EM®, BASF Inc., Germany) were made at the rate of 0.75 L ha-1 for the control of fall armyworm (Spodoptera frugiperda). Subsequently, at 50 and 83 DAS, applications were made for the control of yellow sugarcane aphids (Melanaphis sacchari) using Imidacloprid + Betacyfluthrin (Muralla Max®, Bayer, Mexico) and Sulfoxaflor (Toretto Isoclast® Active, Corteva Agrosciences, Guadalajara) at a rate of 0.25 ml ha-1 and 100 ml ha-1, respectively. Weed control was performed manually. The harvest of the crop was carried out on August 10, 2018, at 105 DAS when the grain reached the milky-dough stage, accumulating 2,118 heat-hours. The two central furrows were used as a useful plot, removing 1 m from each end to exclude the edge effect. In total, six meters in length for each of the treatments (9.12 m2) were harvested. Each useful plot was harvested considering the different cutting heights of each treatment (10, 20, 30, 40, 50 and 60 cm) based on the soil surface. Fresh forage of each useful plot was weighed to estimate the green forage yield. From the total plants cut per plot, 15 plants were randomly selected and ground to a theoretical particle size of 2 cm using a mill Model JF5. From the fresh ground forage of each plot, three random samples of 500 g each were taken and dried at 60 °C until constant weight in a forced air stove to determine the DM content. The DM yield was determined by multiplying the green-based forage yield per hectare by the DM content of the forage before silage. To make the mini silos, the first three repetitions of the chopped fresh forage of each treatment were used. Glass jars with an airtight lid of 1 L capacity were used, where the chopped fresh forage was compacted to a density of 261 kg of DM m-3(14) in each mini silo considering the content of DM at the harvest of each treatment. The estimation of the DM content to determine the density in the mini silos was made with the microwave oven and an 961

Rev Mex Cienc Pecu 2021;12(3):958-968

average DM percentage of 29.67 ± 0.42 % was estimated. Compaction of the forage in each mini silo was carried out manually with a macho meat tenderizer (Metaltex 779-012). All mini silos were stored in the laboratory at ambient temperature for 90 d. When opening the mini silos, the first 5 cm were discarded. Subsequently, in each mini silo a sample of 20 g of fresh silage was taken to which 200 ml of distilled-deionized water was added and it was mixed for 30 sec in a high-speed blender. The diluted sample was filtered through three layers of cheese gauze and the pH was measured in the liquid with a portable potentiometer (OHAUS Model ST2100, Parsippany, NJ, USA)(15). From the remnant of the fresh silage, 400 g was taken and sent to a private commercial laboratory (GAQSA, Querétaro, Mexico) to be analyzed using near-infrared spectroscopy (NIR; Mod. 951, Foss Electric, Hillerod, Denmark). Each fresh silage sample was homogenized and dried in an airflow furnace at 66.7 °C until constant weight. Subsequently, the samples were crushed in a blender, and consecutively, in a mill using a 1 mm mesh. In these samples, the contents of crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), lignin, in vitro digestibility of NDF at 30 h (NDFD-30h), TND, NFC, NEL and ashes were analyzed. The determination of nutritional values was based on prediction equations and databases generated by the “Cumberland Valley Analytical Services (CVAS)”. The calibration of the equipment considers the following procedure: selection of the sample at random, taking of the spectra of the sample, selection of the spectra representing the samples, laboratory analysis of the selected sample using the reference methodology, comparison of the results of the reference methodology with their respective spectra, internal validation with the samples and carrying out the analysis by the reference methodology and validation of the calibration equation with the reference results of the internal validation samples. Once the calibration equation with the reference results of the internal validation was satisfactory, it was used for the analysis of all samples. The yields of NDF, NDFD-30h, TDN and NEL were estimated considering the content of these nutrients in the silage and the dry forage yield per hectare of each treatment. The analysis of the information was carried out with the statistical program SAS version 9.3 (SAS Institute Inc., Cary, NC. USA). The results were analyzed by ANOVA using a randomized block design, with six treatments, of four and three repetitions for the variables of forage yield and silage quality, respectively. When significant differences were found (P˂0.05), Fisher's protected least significant difference test was applied to compare means between treatments at the same level of significance.

962

Rev Mex Cienc Pecu 2021;12(3):958-968

Plant height after applying the treatments and forage yields are shown in Table 1. As expected, the plant height at harvest was higher when a cutting height of 10 cm was used and lower when the forage was harvested at 60 cm. Yield results indicated that fresh and DM productions can decrease from a cutting height of 40 and 50 cm, respectively, from the soil surface. These reductions can be considerable up to 12 % when the cutting height reaches 60 cm compared to cutting heights between 10 and 40 cm. In this regard, other works have reported that the DM yield reduces as the cutting height increases, and that the losses in yield can range from 10 to 20 % when the cutting height is greater than 20 cm in forage sorghum(11,12). Table 1: Plant height and yields of fresh forage and DM of forage sorghum, in response to harvest height Cutting height (cm) Concept

Plant height, m

3.4a

30 3.3ab

3.3

LSD

3.3ab

3.2b

0.2

Fresh forage yield, t ha-1

63.6a

62.8a

61.9a

60.2ab

58.2ab

54.5b

5.8

DM yield, t ha-1

18.7a

18.5a

18.1a

17.8a

17.3ab

16.1b

1.6

Means with different superscript between rows are significantly different (P˂0.05).

The nutritional value of sorghum silage altered as the cutting height increased (Table 2). The NFD content reduced from 74.1 % to 66.9 % when increasing the cutting height from 10 to 20 cm, respectively, but no significant reduction was observed from 20 cm to the cutting height of 60 cm. The lignin content reduced from 8.1 % to 6.4 % when the cutting height increased from 10 to 30 cm, but there were no significant changes from 30 cm to the cutting height of 60 cm.

963

Rev Mex Cienc Pecu 2021;12(3):958-968

Table 2: Nutrient content and yield of sorghum silage at different harvest heights Cutting height (cm) Variable

LSD

29.4

29.5

29.3

29.5

29.7

29.6

0.6

6.4

6.5

6.1

7.2

6.3

6.4

1.4

NDF

74.1a

66.9b

66.2b

64.0b

63.0b

62.9b

5.6

ADF

52.1a

49.3ab

47.8ab

44.8b

43.6b

43.3b

6.0

8.1a

7.7a

6.4b

6.9b

6.4b

6.5b

0.8

27.4d

29.3cd

35.6b

38.6a

2.1

Nutrients (% of DM) DM (% of silage) CP

Lignin

30.2c

34.2b

9.1bc

11.9abc

15.9ab

18.4a

18.2a

8.0

45.9b

49.4ab

49.8ab

52.5a

53.3a

52.7a

5.1

1.0b

1.1ab

1.2a

0.1

13.7a

12.5ab

12.4ab

11.5b

11.1b

10.9b

1.8

13.9a

12.4ab

11.9b

11.4bc

10.9bc

10.2c

1.5

NDFD-30 h

3.8

3.6

3.9

0.7

TDN

8.6

9.1

9.3

9.1

8.5

1.1

18,659

20,094

19,808

20,548

20,371

NDFD-30 h (% NDF) NFC

4.5c

TDN NEL (Mcal DM) Ashes

kg-1

1.2a

Nutrient yield (t ha-1) NDF

NEL (Mcal ha-1)

18,684

2,448

DM= dry matter, CP= crude protein, NDF= neutral detergent fiber, ADF= acid detergent fiber, NDFD-30h= in vitro digestibility of NDF at 30 hours, NFC= non-fibrous carbohydrates, TDN= total digestible nutrients, NEL= net lactation energy. abcd Means with different superscript between rows are significantly different (P˂0.05).

As a result of the observed changes in NDF and lignin contents, NDFD and the TDN concentration of the silage may increase after the forage was harvested at cutting heights of 40 and 20 cm, respectively. Similarly, the NFC content of sorghum silage increased as the cutting height increased, where the treatments of cutting height of 50 and 60 cm were the ones with the highest concentration of carbohydrates. This is probably associated with the lower lignification of the fiber and its greater digestibility, which in turn influenced the increase in the concentration of NEL of the silage from the cutting height of 40 cm(6,7).

964

Rev Mex Cienc Pecu 2021;12(3):958-968

The reduction in lignin content observed in the present study had a positive impact by improving fiber digestibility and energy availability in silage, which has been a strategy to improve the digestibility of fibrous forages(16). In a study where the cutting height was increased from 15 to 45 cm in the forage of Creole maize, black sorghum and King grass, the concentrations of lignin and NDF in maize and grass did not change; however, the highest cutting height reduced the concentration of NDF by 4.2 % and lignin by 1.3 % in sorghum forage(8). In another similar study, in forage maize, increasing cutting height from 12 to 45 cm at harvest reduced lignin content by 0.5 %, which contributed to the increase in fiber digestibility by 2.4 % in maize silage(9). It has been reported that for every percentage unit that NDFD increases in forage, DM consumption and milk production in cows increases by 0.17 and 0.25 kg d-1, respectively(17). Regarding nutrient production, it was found that the NDF yield decreased as the cutting height of forage at harvest increased (Table 2). This is due to the decrease in the concentration of NDF of silage and the increase in yield of DM of forage as the cutting height of the forage increases. However, the cutting height did not affect NDFD, TDN NEL NLE yields. The pH of sorghum silage in response to the cutting height of the forage at harvest is shown in Figure 2. Cutting sorghum forage at a height of 30 cm from the base of the soil could favor better fermentation of silage, as a lower pH was observed (3.9). In contrast, silage of sorghum forage cut at a height of 20 cm registers the highest value (4.8). In relation to the other cutting heights, 10, 40, 50 and 60 cm were not statistically different, and cutting at 10 cm could lead to a pH in silage similar to harvesting forage at 30 cm. The final pH of silage can be affected by many factors, but it is mostly related to the concentration of carbohydrates in the forage(13). In the present study, the concentration of NFC in silage begins to increase after the forage was cut at 30 cm (Table 2), which coincides with the reduced pH of silage in this treatment. However, it is important to analyze, in future studies, other organic compounds and final products of fermentation that help confirm this effect. In forage maize, increasing the cutting height of the forage from 12 to 45 cm did not change the pH of the silage but increased the concentration of NFC such as starch(9).

965

Rev Mex Cienc Pecu 2021;12(3):958-968

Figure 2: pH of sorghum silage in response to cutting height in sorghum forage at harvest

Means with different letters are significantly different (P˂0.05).

In conclusion, by cutting the sorghum forage between 20 and 40 cm from the soil surface, a silage with lower lignin content, greater fiber digestibility and good energy content was obtained, without compromising the yield of DM per hectare. In addition, harvesting the forage 30 cm from the base of the soil promotes a good fermentation of the silage. Therefore, increasing the cutting height of sorghum forage up to 40 cm above the soil basis improves the nutritional quality of silage without significantly reducing the DM yield. Literature cited: 1.

Jahanzad E, Jorat M, Moghadam H, Sadeghpour A, Chaichi MR, Dashtaki M. Response of a new and a commonly grown forage sorghum cultivar to limited irrigation and planting density. Agric Water Managen 2013;117:62-69. https://doi.org/10.1016/j.agwat.2012.11.001.

Peacock JM. Response and tolerance of sorghum to temperature stress. Sorghum in the Eighties. Proc Int Symp Sorghum, Patancheru, India 1982;1981:143-159.

Saberi AR, Siti AH, Halim RA, Zharah AR. Morphological responses of forage sorghums to salinity and irrigation frequency. African J Biotechnol 2011;10:9647-9656. DOI: 10.5897/AJB11.778.

Singh BR, Singh DP. Agronomic and physiological responses of sorghum, maize and pearl millet to irrigation. Field Crop Res 1995;42:57-67. https://doi.org/10.1016/03784290(95)00025-L.

966

Rev Mex Cienc Pecu 2021;12(3):958-968

Pedersen JF. Annual forages: New approaches for C-4 forages. In: Janick J. editor. Progress in new crops. ASHS Press, Alexandria, VA 1996;246-251.

Grant RJ, Haddad SG, Moore KJ, Pedersen JF. Brown midrib sorghum silage for midlactation dairy cows. J Dairy Sci 1995;78:1970-1980. https://doi.org/10.3168/jds.S0022-0302(95)76823-0.

Miron J, Zuckerman E, Adin G, Solomon R, Shoshani E, Nikbachat M, et al. Comparison of two forage sorghum varieties with corn and the effect of feeding their silages on eating behavior and lactation performance of dairy cows. Anim Feed Sci Technol 2007;139:23-39. https://doi.org/10.1016/j.anifeedsci.2007.01.011.

Elizondo-Salazar JA. Producción de biomasa y calidad nutricional de tres forrajes cosechados a dos alturas. Agron Mesoam 2017;28(2):329-340. doi 10.15517/ma.v28i2.23418.

Neylon JM, Kung Jr L. Effect of cutting height and maturity on the nutritive value of corn silage for lactating dairy cows. J Dairy Sci 2003;86:2163-2169. https://doi.org/10.3168/jds.S0022-0302(03)73806-5.

10. Gonzalez FC, Peña RA, Núñez HG, Jiménez GCA. Efecto de la densidad y altura de corte en el rendimiento y calidad del forraje de maíz. Rev Fitotec Mex 2005;28(4):393397. 11. Creel RJ, Fribourg HA. Interaction between forage sorghum cultivars and defoliation managements. Agronomy J 1981;73(3):463-469. https://doi.org/10.2134/agronj1981.00021962007300030018x 12. Iptas S, Brohi AR. Effect of nitrogen rate and stubble height on dry matter yield, crude protein content and crude protein yield of a sorghum-sudangrass hybrid [Sorghum bicolor (L) Moench × Sorghum sudanse (Piper) Stapf.] in the three cutting systems. J Agron & Crop Sci 2003;189:227-232. https://doi.org/10.1046/j.1439037X.2003.00001.x. 13. Kung Jr L, Moulder BM, Mulroney CM, Teller RS, Schmidt RJ. The effect of silage cutting height on the nutritive value of a normal corn silage hybrid compared with brown midrib corn silage fed to lactating cow. J Dairy Sci 2008;91:1451-1457. https://doi.org/10.3168/jds.2007-0236. 14. Sucu E, Kalkan H, Canbolat O, Filya I. Effects of ensiling density on nutritive value of maiz and sorghum silage. Rev Bras Zoo 2016;45(10):596-603. https://doi.org/10.1590/S1806-92902016001000003.

967

Rev Mex Cienc Pecu 2021;12(3):958-968

15. Contreras-Govea FE, Albrecht KA, Muck RE. Spring yield and silage characteristics of kura clover, winter wheat, and mixtures. Agron J 2006;98:781-787. https://doi.org/10.2134/agronj2005.0248. 16. Adesogan AT, Arriola KG, Jiang Y, Oyebade A, Paula EM, Pech-Cervantes AA, et al. Symposium review: Technologies for improving fiber utilization. J Dairy Sci 2019;102:5726-15334. https://doi.org/10.3168/jds.2018-15334. 17. Oba M, Allen MS. Evaluation of the importance of the digestibility of neutral detergent fiber from forage: effects on dry matter intake and milk yield of dairy cows. J Dairy Sci 1999;82:589-596. https://doi.org/10.3168/jds.S0022-0302(99)75271-9.

968

https://doi.org/10.22319/rmcp.v12i3.5014 Technical note

The effects of Pyrantel-Oxantel on the Dipylidium caninum tapeworm: An in vitro study

Jair Millán-Orozco a¥*, Jersson Millán-Orozco a‡, Miguel Ángel Betancourt-Alonso b, América Ivette Barrera-Molina c, María Soledad Valledor d, Virginia Méndez d, Alejandra Larrea d, Martín Sebastián Lima d, Javier Morán-Martínez e, Nadia Denys Betancourt-Martínez e, Liliana Aguilar-Marcelino f,

Universidad Autónoma del Estado de Morelos, Facultad de Ciencias Agropecuarias. Av. Universidad No. 1001, Col. Chamilpa . 62209, Cuernavaca, Morelos, México. b

Escuela de Medicina Veterinaria y Zootecnia en Pequeñas Especies, Federación Canófila Mexicana A.C. Ciudad de México, México. c

Universidad Autónoma del Estado de Morelos, Facultad de Nutrición. Cuernavaca, Morelos, México. d

Universidad de la República. Facultad de Veterinaria. Montevideo, Uruguay.

Universidad Autónoma de Coahuila. Facultad de Medicina. Torreón, Coahuila, México.

969

Rev Mex Cienc Pecu 2021;12(3):969-986 f

Instituto Nacional de Investigaciones Forestales Agrícolas y Pecuarias. Centro Nacional de Investigación Disciplinaria en Salud Animal e Inocuidad, Jiutepec, Morelos, México. ¥

Universidad Autónoma Agraria Antonio Narro. Departamento de Ciencias Médico Veterinarias. Torreón, Coahuila, México. ‡

Asociación de Médicos Veterinarios Zootecnistas Especialistas en Bovinos de la Comarca Lagunera, A.C. Gómez Palacio, Durango, México.

*Corresponding author: jmillan.orozco@uaaan.edu.mx

Abstract: The present study aimed to evaluate, in vitro, the cestocidal effect of Pyrantel-Oxantel on the Dipylidium caninum tapeworm. Each intestine sample was obtained by means of a transversal incision of the abdominal area of each euthanized canine subject, individually dissected via longitudinal incision, and examined for the presence of D. caninum. An optical microscope was used to identify and verify proglottid morphology and viability based on its macroscopic appearance. The cestocidal effects of Pyrantel-Oxantel (75 mg pyrantel pamoate; 75 mg oxantel pamoate) were assessed in adult tapeworms (treated group, n= 21; control group, n= 21) placed on Petri dishes and incubated at 37 °C. One-hour post-incubation, the D. caninum cestodes treated with Pyrantel-Oxantel presented a 28 % decrease (P=0.001) in motility, which rose to a 52 % (P=0.0001) decrease by the end of the second hour. The control group (P=0.0001) presented 55.7 % motility for at least the first six hours of incubation and 4.2 % (P=0.001) motility by the end of the study, while 0 % motility was observed in the treated group by the end of the study. Pyrantel-Oxantel had a lethal effect (P=0.0001) on adult D. caninum, with 100 % mortality observed 6 h after in vitro post-incubation, while the control group presented 55.7 % viability after the same time period. In addition, Pyrantel-Oxantel reduced (P=0.001) tegument thickness by 42.5 % (10.24 ± 0.21 µm), while this was 17.81 ± 0.33 µm for the control group. The results of this study indicate that Pyrantel-Oxantel has a therapeutic effect on the presence of D. caninum, inducing both a reduction of the tegument thickness and increased mortality. Key words: Dipylidium caninum, Helminths, Zoonosis, Motility, Morphology, Cestocidal effect.

Received: 11/08/2018 Accepted: 09/11/2020 970

Rev Mex Cienc Pecu 2021;12(3):969-986

Dipylidium caninum (D. caninum) is the causal agent of dipilidiasis, a parasitical disease caused by the adult cestode in dogs, cats, foxes, coyotes, and other wild carnivores (1-7) and well known as a zoonotic disease affecting humans(8,9). The control of cestodes with potential zoonotic risk for pet animals is of great importance for public health worldwide(2,10,11) given the close contact both dogs and cats have with humans(12), with the risk of infection even higher in children(8,9). The adult D. caninum cestode grows to a length of 50 cm, while its macroscopic structure has the appearance of rosary beads or a grouping of cucumber seeds(13). Unlike nematodes, cestode parasites do not have a digestive system and grow from proliferating cells in the neck, producing several hundred segments known as proglottids and obtaining food via the tegument or body wall(13). Located in the small intestine of the host, D. caninum absorbs digested material and obtains the nutrients necessary for survival, reproducing without the difficulty undergone by other parasites, because, as a hermaphrodite parasite, it forms gravid proglottids full of infective eggs via continuous differentiation(9,14,15). Pyrantel (E-1,4,5,6-tetrahydro-1-methyl-2-pyrimidine) is an imidazothiazole anti-helminthic derived from the tetrahydropyrimidines and used widely by veterinarians on small species (dogs and cats), given its wide spectrum of action against mature and immature gastrointestinal parasites that infect domestic animals(16). Oxantel (1 methyl-2-(3hydroxyphenyl-ethenyl) 1,4,5,6-tetrahydropyrimidine) is an m-oxyphenol derivative of pyrantel(17) that activates the N-subtype, a nicotine and methyridine-sensitive subtype. Pyrantel activates the L-subtype, a levamisole- and pyrantel-sensitive subtype, which explains why differences in their target nematodes have been reported(16). Tetrahydropyrimidines comprise a wide variety of pyrantel, morantel, and oxantel salts, all of which have nicotinic agonist effects which alter the parasite’s neuromuscular system, affecting muscular contraction and causing tonic paralysis. The nicotinic acetylcholine receptors (nAchRs) are essential to the parasite’s nervous function, presenting a different distribution and physiology than that found in mammals(9). Nicotinic agonist anti-helminthics act on the nicotinic acetylcholine in the parasite’s neuromuscular junction, causing neuromuscular depolarization and spastic paralysis(18,19). Parasite nAchRs have five glycoprotein subunits located around a central ion channel(20), comprising a pentameral ligand-gated ion channels, which is a structure with significant pharmacological effects(16). Moreover, nAchRs are functionally diverse due to their extensive gene families encoding subunits and three pharmacological sub-populations of receptors(16). The activation of the acetylcholine receptor in nematodes has been divided into three pharmacological subtypes according to the degree of nicotinic affinity(21,22), characterized and defined as follows: the N-subtype, with significant sensitivity to nicotine, methyridine, and oxantel; the L-subtype, with affinity to levamisole and pyrantel; and, the B-subtype, with a greater sensitivity to bephenium.

971

Rev Mex Cienc Pecu 2021;12(3):969-986

Pyrantel’s mechanism of action functions by blocking muscular excitation via the activation of an agonist of the nAchR(18,19), altering the neuromuscular system and, thus, provoking muscular contraction and paralysis, which result in the death of the parasite(9). Oxantel (moxyphenol) has been shown to be effective against gastrointestinal nematodes of great impact on both animal and public health(23,24). While the effect of pyrantel-oxantel (P-O), as a combined treatment, on nematode parasites has been reported previously(25), there are no scientific reports on the effects of a P-O combination, either in vivo or in vitro, on motility, tegument thickness, or other anatomical structures in tapeworms. Therefore, the present study aimed to evaluate the in vitro cestocidal effect of P-O on the motility and tegument thickness of adult Dipylidium caninum cestodes and to describe the histological changes in the organisms’ gravid proglottids. All the euthanasia procedures applied in the present study were performed following the guidelines recommended and approved by the Ethics Committee for Animal Experimentation of the Faculty of Agricultural and Livestock Sciences at the Autonomous University of the State of Morelos and the Code of Ethics of the World Medical Association (Declaration of Helsinki). Two hundred and sixty-six (266) naturally infected stray dogs were sampled at the Canine and Feline Control Center in the municipality of Tlahuac, Mexico City, after capture by the municipal animal control brigade. The animals were euthanized by authorized personnel via an anesthetic overdose, with the small intestine of each subject then obtained via a transversal incision on their abdomen. The small intestines obtained, still connected via the gastroduodenal and ileocecal valves, were stored in plastic bags, labelled with progressive numbers, and transported to the Animal Production Laboratory at the Faculty of Agricultural and Livestock Sciences at the Autonomous University of the State of Morelos, located in the city of Cuernavaca(26). Each intestine sample was individually dissected via longitudinal incision and examined for the presence of D. caninum cestodes, which were identified via the macroscopic appearance of the proglottids and allocated using an optical microscope to verify their morphology(27). Direct observation was carried out under a microscope to determine the viability of the parasites at 40X objective, with cestodes presenting full motility for a one-minute period considered viable for subsequent experimentation(28-30). The cestocidal effect of P-O on adult parasites was assessed (treated group (P-O), n= 21; control group (CG), n= 21), with the individuals placed in 90x60 mm Petri dishes containing 10 mL of RPMI (Roswell Park Memorial Institute) 1640 and incubated at 37 °C for 10 h. Distilled water and PMSF (phenylmethane sulfonyl fluoride) were used as a protease inhibitor vehicle for the control group, in order to maintain the structural anatomy and physiology of the cestodes. For the treated group, a commercial deworming drug (75 mg 972

Rev Mex Cienc Pecu 2021;12(3):969-986

Pyrantel Pamoate and 75 mg Oxantel Pamoate (Vermiplex), Holland Animal Health Laboratories, Jiutepec, Morelos, Mexico) was used, wherein macerated tablets were added to distilled water in the Petri dishes. After incubation, direct observation was carried out in a stereoscopic microscope every hour to determine the cestocidal effects. The motility test was conducted in triplicate(26), wherein cestode motility was evaluated on scale of 0 to 5, as follows: 0 indicated completely motionless tapeworms that did not respond to manual stimulation; 1 indicated movement only when prodded; 2 indicated spontaneous activity, but solely at either end of the organism, namely the scolex and the end of strobila; 3 indicated slow and spontaneous activity throughout the assessment; 4 indicated that the subject was more active; and, 5 indicated that the subject was highly active(28-30). Adult parasite segments (gravid proglottids) were obtained and fixed in 10% paraformaldehyde and kept under refrigeration at 4 °C until the histological procedure was carried out. In order to observe the histological structure and quantify the height of the secretory epithelium and the thickness of the lamina propria, tissue sections were obtained and placed on glass slides previously treated with poly-l-lysine. The paraffin was removed from the sections with xylol, hydrated with alcohols of different concentrations, and made permeable with 0.1% triton X-100 in sodium citrate for 20 min, while endogenous peroxidase activity was then inhibited by incubating the tissue for 25 min in a 0.3% H2O2 solution at an ambient temperature. The preparations were washed with a phosphate buffer solution (PBS1X) and marked with a hydrophobic pencil around the tissue(31-33). D. caninum cestode segments were processed, obtaining 5-µm semi-serial sections. Hematoxylin and eosin staining was used to evaluate the histological structure and tegument thickness(27). For each histological section, six microscope fields were observed using a 40X objective, while six tegument thickness measurements were carried out using the Motic 2.0 image analyzer and then photographed(26,27). The experimental data corresponding to in vitro motility observations were analyzing using a Z-test, while the tegument thickness measurements were compared via a Student’s t-test(34). Differences were considered statistically significant when P<0.05, while the in vitro motility results are expressed as a percentage and the histology results are expressed as both mean and standard error. Results for the efficacy of P-O in terms of the motility of D. caninum parasites are available in Table 1. At the beginning (Hour 0) of the experiment, both groups presented total motion (P=0.07). The P-O showed progressive motility reduction (from 72.0 to 4.8 %) from the first to the fifth hour post-incubation, thus achieving a mean hourly reduction of 19 %, while, from hours six to ten, 0 % motility was observed. In the control group (CG), 100 % motility

973

Rev Mex Cienc Pecu 2021;12(3):969-986

was observed for the first 2 h post-incubation, while motility reduced from 96.2 to 4.2 % from the third hour to the end of the experiment, giving a mean reduction of 10 % per hour. Table 1: In vitro motility (%) of Dipylidium caninum adult cestodes treated with PyrantelOxantel Groups

Incubation (h) 0

Pyrantel-Oxantel 100a 72.0a 48.0a 25.0a 15.8a 4.8a 0.0a 0.0a 0.0a 0.0a 0.0a Control 100a 100b 100b 96.2b 85.3b 72.7b 55.7b 41.5b 31.5b 20.0b 4.2b Three replicates were carried out for each group, using one hundred and twenty-six tapeworms. ab Different letters show significant diﬀerences (P=0.0001).

A (P=0.0001) difference was observed between the treated and CG groups between the first hour and the end of the experiment. In the first hour post-incubation, the motility of the treated group was 72.0 %, while this was 100 % for the CG (P=0.0001). Motility of 55.7, 41.5, 31.5, 20.0, and 4.2 % was observed at hours 6, 7, 8, 9 and 10 post-incubation, while 0.0 % motility was observed in the treated group from the sixth hour onward post-incubation (P=0.0001). The effects of P-O on the tegument thickness (P=0.001) of adult D. caninum cestodes are shown in Figures 1 and 2, wherein P-O reduced tegument thickness by 42.5 % (10.24 ± 0.21 µm) (Figure 2b; grey arrowhead), while this was 17.81 ± 0.33 µm for the CG (Figure 2a; grey arrowhead). Figure 1: Effect of Pyrantel-Oxantel on tegument thickness (mean ± SEM) in Dipylidium caninum adult cestodes

**Significant diﬀerences among groups (P=0.001).

974

Rev Mex Cienc Pecu 2021;12(3):969-986

The effects of P-O on the general structure of D. caninum, as compared to the structure presented by the CG, are shown in Figures 2a and b. A significant finding regarding the histology of the gravid proglottids observed was the concentration of immature calcareous corpuscles (CCs) (black arrowheads) along the surface and near the tegument (Figure 2a, b). In the CG, the immature CCs concentration was higher than that observed in the proglottids treated with P-O (Figure 2a; black arrowhead), while mature CCs were only observed in the P-O group (Figure 2b; blue arrowhead), in which an alteration of the D. caninum eggs was also observed. In the group treated with P-O, the morphology and distribution of egg sacs was found to have been altered, while, in the CG, the egg sacs presented a normal morphology and distribution (Figure 2b; purple arrowhead). Finally, the embryophore, vitelline layer, and embryo remained almost completely intact in the CG, while, in the P-O group, such structures were distended (Figure 2a; red arrowhead). Figure 2: Histological sections of Dipylidium caninum tapeworms. Tegument thickness obtained in untreated cestodes (A) and those treated with Pyrantel-Oxantel (B)

A) Intact tegument thickness (grey arrowhead), immature calcareous corpuscles along the surface and near the tegument (black arrowheads), intact embryophore and vitelline layer (purple arrowhead), and the embryo (red arrowheads). B) Reduction in tegument thickness (grey arrowhead), reduction in numbers of immature calcareous corpuscles (black arrowhead), the appearance of mature calcareous corpuscles (blue arrowhead), morphology and distribution of egg sacs (purple arrowhead), embryophore, vitelline layer, embryo, and distended structures (purple and red arrowheads).

The present study shows the effects of P-O on the motility and tegument thickness of adult D. caninum cestodes, as well as other histological structures such as calcareous corpuscles, egg sacs, embryophore, the vitelline layer, and the embryo. The motility results obtained in the present study show that P-O has a direct effect on motility, causing 100 % motility 975

Rev Mex Cienc Pecu 2021;12(3):969-986

inhibition 6 h post-incubation. Some drugs have a rapid effect on the neuromuscular transmission of some parasites, with, for example, pyrantel and oxantel acting as agonists on the synaptic and extra-synaptic nAchRs in the nematode muscle cells, producing contraction and spastic paralysis(35). Early studies evaluated the effects of pyrantel pamoate against Caenorhabditis elegans(36), while pamoate pyrantel and pamoate oxantel, used in combination, have been found to be effective against Trichuris muris(37) Ascaris lumbricoides(38), although this treatment has been found to be ineffective against Ancylostoma ceylanicum and Necator americanus(37). The effects of pyrantel pamoate and oxantel pamoate, 24 h after exposure, include muscle contraction, motility inhibition, and a reduction in the size of the parasite(36,37), in both infective larvae and adult organisms. While the effects found in these studies concur with the findings of the present study, the P-O treatment applied caused 100% mortality in D. caninum tapeworms from the sixth hour postexposure onward. The effects of pyrantel pamoate (in paste form) were evaluated in the common horse tapeworm A. perfoliata(39-41), with a 92-98 % reduction in motility obtained in adult tapeworms after 7 to 16 d of treatment in naturally-infected horses examined at necropsy(40). Said results concur with the 100% mortality observed in vitro in the present study 6 h postincubation. As pyrantel pamoate salt is practically insoluble in water, it is absorbed at a reduced rate in the gastrointestinal tract, thus enabling it to reach microenvironmental sites on the target parasites more easily than other pyrantel salts such as tartrate, which is more soluble in water and more rapidly absorbed via the gastrointesinal tract, to be then metabolized and excreted in both urine and, in small quantities, in feces(40). Therefore, the present study shows, in vivo, the advantage of the P-O treatment applied in the present study in dogs naturally infected with D. caninum tapeworm, as, at least, a lethal effect was observed in vitro. The combination of pyrantel with other drugs has been found to have a limited anthelmintic potential, as observed in A. ceylanicum and N. americanus(37) in vitro, which presented antagonistic and non-lethal effects. However, the present study found a synergetic effect and an increased potency via the combination of pamoate pyrantel and pamoate oxantel, obtaining 100 % mortality in the D. caninum adult cestode. A similar effect was observed in an earlier study using a combination of embonate pyrantel, embonate oxantel, and praziquantel, obtaining 100 % mortality in vitro eight hours post-incubation(33). While the foregoing results concur with those obtained by the present study, these results show 100 % mortality in vitro 6 h post-incubation. The effect of P-O observed in the present study is due to the capacity of the drug to remain in microsites on the parasites, thus increasing its absorption by the cestode along the length of the tegument and shortening the time in which it takes effect, thereby increasing mortality.

976

Rev Mex Cienc Pecu 2021;12(3):969-986

The tegument is one of the major structures in a cestode, which requires this anatomical feature both for absorbing semi-digested material from the small intestine of the host and improving the cestode’s physiological function and reproduction, given that, unlike nematodes, cestodes have no digestive tract. Therefore, the absorption capacity of the tegument in cestodes is higher than that found in nematodes. In relation to the foregoing, during their establishment, helminth parasites produce increased levels of pro-inflammatory cytokines in the host(42), producing, in consequence, cachexia. The present study found that P-O substantially reduced tegument thickness in the D. caninum tapeworm. There are reports in the literature of this treatment affecting the tegument to different degrees, causing changes and irreversible morphological damage to the tegument and parenchyma, alterations in muscular organization, the absence of tegumentary microvilli, the loss of membrane cells in subtegumental tissue, the development of a dense granular tegument, and large vacuoles generating a patchy and porous appearance, in the following organisms: the rodent tapeworms Hymenolepis nana(43,44), Hymenolepis microstoma(44), Taenia taeniformis(44,45), Echinococcus multilocularis(44,45), and Hymenolepis diminuta(29,44,45); Taenia solium in experimentally-infected hamsters(46); Taenia crassiceps(4749) ; Mesocestoides corti(50); Raillietina echinobothrida(51-54) in domestic fowl; Anoplocephala perfoliata(30) in horses; D. caninum(33) in dogs, cats, and humans; the trematode Fasciola hepatica in rats(55); Artyfechinostomum sufrartyfex(56) in humans; Fasciolopsis buski(53,56); the gastrointestinal swine nematode Ascaris suum(53); the gastrointestinal canine hookworm nematode Ancylostoma ceylanicum(57); the gastrointestinal rodent nematodes Rodentolepis microstoma(57), Trichuris muris(58), and Heligmosomoides polygyrus(59); and the parasitic plant nematodes of the genera Meloidogyne and Globodera(60). The results of the present study concur with the results mentioned above, such as the reduction (thinning) of the tegument by 42.5 % in D. caninum parasites treated with P-O after 6 h of in vitro incubation. The effect of this treatment on tegument thickness may be more pronounced in parasites incubated for more than six hours, as shown by the histological results; however, histological results were not obtained from the treated subjects more than 6 h post-incubation. The present study showed the presence of CCs in gravid segments in both the CG or P-O groups; however, in the P-O group, the number of CCs was lower than that observed in the CG. Biomineralization is a widespread phenomenon in invertebrates, with calcium carbonate one of the most abundant biominerals involved in said process(61). In cestodes, minerals produce CCs, the function of which has been the subject of scientific speculation, with some hypotheses proposed, one of which positing that the CCs represent approximately 10 % of the parasites’ body weight and that they are to be commonly found in the parenchyma of many metacestodes and adult cestodes(61,62). Another hypotheses is that CCs play an important role in detoxification(63), as, because they are mainly produced in the absence of oxygen, they are thought to anaerobically buffer acids and serve as a reservoir for inorganic 977

Rev Mex Cienc Pecu 2021;12(3):969-986

ions(64). It should be noted that CCs are, in part, an excretory product that serves to remove metabolic waste from the body by passing through the tegument(62). Calcareous corpuscles are composed of an organic base coupled with inorganic substances, such as potassium, sodium, magnesium, silicate, calcium, phosphate(61), and sulfate in different cysticercus larvae and adult cestodes(64). Their organic base includes DNA, RNA(65), proteins(66,67), and glycogen(46,68). Therefore, in the present study, the decreased number of immature CCs distributed near the tegument in the P-O group was due to both a high level of absorption via the tegument of the D. caninum cestodes and the length of in vitro incubation. Moreover, the 100 % mortality obtained by the present study is also due to both a loss of the protein and glycogen required by the metabolic process in the cells and a probable disintegration of the organism’s DNA. As few studies have been conducted on the density and location of CCs in different parts of the strobila of D. caninum cestodes, Khalifa et al(27) conducted a comparative histochemical and ultrastructural study to ascertain the differences in the location, distribution, composition, and functions of the CCs of D. caninum and T. taeniaeformis. The results of the present study in relation to CCs concur with those obtained by Khalifa et al(27) as the distribution of the CCs was concentrated on the lateral sides of the gravid segments of the D. caninum cestode and were affected by the P-O treatment. Hematoxilin and eosin staining of the gravid segments showed that, in the CG, the D. caninum eggs were grouped in sacs as observed by Khalifa et al(27) while the P-O group presented signs of morphological alterations, such as distention of the eggs, embryophore, embryo, and vitelline layer. While few studies have observed the structure of the gravid segments of D. caninum, Peña et al(33) observed the effects of the toxins of B. thuringiensis on D. caninum, with their results concurring with those of the present study in showing effects on motility, tegument thickness, and the eggs, effects which reduce the percentage of motility, thin the tegument, and damage the organism’s eggs. However, Peña et al(33) used a commercial drug containing pyrantel embonate, oxantel embonate and praziquantel as a positive control. Other strategies have been used to decrease the infectivity of D. caninum eggs, with a study conducted in Brazil by Araujo et al(69) evaluating the effect of the nematophagous fungi Poconia chlamydospora, Duddingtonia flagrans, and Monacrosporium thaumasium on egg capsules. Their results showed that Poconia chlamydospora isolates had an ovicidal activity (type 2 and 3) for between 5 and 15 d after in vitro incubation. However, to date, the activity of a synthetized drug is found to have faster and more pronounced effects, as observed with the P-O treatment used in the present study.

978

Rev Mex Cienc Pecu 2021;12(3):969-986

Based on the results of the present study, P-O has in vitro cestocidal effects against the D. caninum tapeworm, showing a lethal effect and decreasing motility by 100 % within the first 6 h after in vitro incubation. Moreover, P-O has a direct effect on tegument thickness, reducing it by 42 %. The present study is the first conducted on the in vitro effects of P-O on mortality, the reduction of tegument thickness, and alterations in histological structures, such as the eggs, embryophore, embryo, and vitelline layer of the D. caninum tapeworm. The use of a P-O combination is an optional drug therapy for the control of D. caninum in naturallyinfected dogs and cats.

Acknowledgements

The authors would like to thank the following: the Canine and Feline Control Center, Tlahuac, Mexico City, for the help in the collection of the small intestine samples from naturally-infected dogs; Maribel Nieto Miranda from the Faculty of Veterinary and Zoological Medicine at the National Autonomous University of Mexico (FMVZ-UNAM), for the great help with the histological procedures; to SEP-PROMEP for the financial support provided to Jair Millán-Orozco (School fee: 422006-0708) for the completion of the Master of Sciences at the Faculty of Agricultural and Livestock Sciences at the Autonomous University of the State of Morelos (FCA-UAEM); and, finally, to Adriana Silva de Oliveira for the technical assistance.

Conflicts of interest

The authors declare no conflict of interest.

Literature cited: 1.

Dalimi A, Sattari A, Motamedi GH. A study on intestinal helminthes of dogs, foxes and jackals in the western part of Iran. Vet Parasitol 2006;142(1-2):129-133.

Hernández MR, Núñez FA, Pelayo DL. Potencial zoonótico de las infecciones por helmintos intestinales en perros callejeros de Ciudad de La Habana. Rev Cub Med Trop 2007;59(3):234-240.

979

Rev Mex Cienc Pecu 2021;12(3):969-986

Ziadinov I, Deplazes P, Mathis A, Mutunova B, Abdykerimov K, Nurgaziev R, Torgerson PR. Frequency distribution of Echinococcus multilocularis and other helminths of foxes in Kyrgyzstan. Vet Parasitol 2010;171(3-4):286-292.

Xhaxhiu D, Kusi I, Rapti D, Kondi E, Postoli R, Rinaldi L, et al. Principal intestinal parasites of dogs in Tirana, Albania. Parasitol Res 2011;108(2):341-353.

Cantó GJ, Guerrero RI, Olvera-Ramírez AM, Milián F, Mosqueda J, Aguilar-Tipacamú G. Prevalence of fleas and gastrointestinal parasites in free-roaming cats in Central Mexico. Plos One 2013;8(4):1-6.

Adolph C, Barnett S, Beall M, Drake J, Elsemore D, Thomas J, Little S. Diagnostic strategies to reveal covert infections with intestinal helminths in dogs. Vet Parasitol 2017;247:108-112. dx.doi.org/10.1016/j.vetpar.2017.10.002.

Figueiredo PP, da Silva BA, Pereira de Moura AP, Leitão VM, Antunes UCA, Pereira BOM, Reis AMR. Gastrointestinal parasites in stray and shelter cats in the municipality of Rio de Janeiro, Brazil. Braz J Vet Parasitol 2017;26(3):383-388.

Molina CP, Ogburn J, Adegboyega P. Infection by Dipylidium caninum in an infant. Arch Pathol Lab Med 2003;127(3):157-159.

Bowman DD. Georgis’ Parasitología para Veterinarios. 8ª ed. Madrid, España: Elsevier; 2004.

10. Charles SD, Altreuther G, Reinemeyer CR, Buch J, Settje T, Cruthers L, et al. Evaluation of the efficacy of emodepside+prazicuantel topical solution against cestode (Dipylidium caninum, Taenia taeniaeformis, and Echinococcus multilocularis) infection in cats. Parasitol Res 2005;97(1):33-40. 11. Rodríguez-Vivas RI, Gutiérrez-Ruiz E, Bolio-González ME, Ruiz-Piña H, OrtegaPacheco A, Reyes-Novelo E, et al. An Epidemiological study of intestinal parasites of dogs from Yucatan, Mexico, and their risk to public health. Vector-Borne Zoon Dis 2011;11(8):1141-1144. 12. Eguía-Aguilar P, Cruz-Reyes A, Martínez-Maya JJ. Ecological analysis and description of the intestinal helminths present in dogs in Mexico City. Vet Parasitol 2005;127(2):139-146. 13. Hendrix CM. Diagnostic veterinary parasitology. 2nd ed. St. Louis, MO, USA: Mosby; 1998.

980

Rev Mex Cienc Pecu 2021;12(3):969-986

14. Merchant MT, Aguilar L, Avila G, Robert L, Flisser A, Willms K. Taenia solium: description of the intestinal implantation sites in experimental hamster infections. J Parasitol 1998;84(4):681-685. 15. Domínguez MF, Koziol U, Porro V, Costábile A, Estrade S, Tort J, Bollati-Fologin F, Castillo E. A new approach for the characterization of proliferative cells in cestodes. Exp Parasitol 2014;138:25-29. dx.doi.org/10.1016/j.exppara.2014.01.005. 16. Martin RJ, Clark CL, Trailovic SM, Robertson AP. Oxantel is an N-type (methyridine and nicotine) agonist not an L-type (levamisole and pyrantel) agonist: classification of cholinergic anthelmintics in Ascaris. Int J Parasitol 2004;34(9):1083-1090. 17. McFarland JW, Howes HL. Novel anthelmintic agents. 6. Pyrantel analogues with activity against whipworm. J Med Chem 1972;15(4):365-368. 18. Robertson SJ, Pennington AJ, Evans AM, Martin RJ. The action of pyrantel as an agonist and an open channel blocker at acetylcholine receptors in isolated Ascaris suum muscle vesicles. Eur J Pharmacol 1994;271(2-3):273-282. 19. Kopp SR, Kotze AC, McCarthy JS, Traub RJ, Coleman GT. Pyrantel in small animal medicine: 30 years on. Vet J 2008;178(2):177-184. 20. Conti-Tronconi BM, McLane KE, Raftery MA, Grando SA, Protti MA. The nicotinic acetylcholine receptor: Structure and autoimmune pathology. Crit Rev Biochem Mol Biol 1994;29(2):69-123. 21. Robertson AP, Clark CL, Burns TA, Thompson DP, Geary TG, Trailovic SM, Martin RJ. Paraherquamide and 2-deoxyparaherquamide distinguish cholinergic receptor subtypes in Ascaris muscle. J Pharmacol Exp Ther 2002;302(3):853-860. 22. Martin RJ, Bai G, Clark CL, Robertson AP. Methyridine (2- [2-methoxyethyl]-pyridine) and levamisole activate different Ach receptor subtypes in nematode parasites: a new lead for levamisole resistance. Brit J Pharm 2003;140(6):1068-1076. 23. Howes Jr HL. Trans-1,4,5,6-tetrahydro-2-(3-hydroxystyryl)-1-methyl pyrimidine (CP14,445), a new antiwhipworm agent. Proc Soc Exp Biol Med 1972;139:394-398. 24. Robinson M, Hooke F, Iverson KE. Efficacy of oxantel pamoate and pyrantel pamoate in combination against Trichuris vulpis, Ancylostoma caninum and Toxocara canis in dogs. Aust Vet Pract 1976;6:173-176.

981

Rev Mex Cienc Pecu 2021;12(3):969-986

25. Albonico M, Bickle Q, Haji HJ, Ramsan M, Khatib KJ, Montresor A, Savioli L, Taylor M. Evaluation of the efficacy of pyrantel-oxantel for the treatment of soil-transmitted nematode infections. Trans R Soc Trop Med Hyg 2002;96(6):685-690. 26. Millán OJ. Evaluación in vitro de cepas nativas de Bacillus thuringiensis contra el cestodo adulto de perros Dipylidium caninum [tesis maestría] Cuernavaca, Morelos, México: Facultad de Ciencias Agropecuarias, Universidad Autónoma del Estado de Morelos; 2009. 27. Khalifa RMA, Mazen NAM, Marawan AMA, Thabit HTM. Histochemical and ultrastructural studies on the calcareous corpuscles and eggs of Taenia teaniformis and Dipylidium caninum. J Egypt Soc Parasitol 2011;41(2):513-528. 28. Stepek G, Buttle DJ, Duce IR, Lowe A, Behnke JM. Assessment of the anthelmintic effect of natural plant cysteine proteinases against the gastrointestinal nematode, Heligmosomoides polygyrus, in vitro. Parasitology 2005;130(2):203-211. 29. Mansur F, Luoga W, Buttle DJ, Duce IR, Lowe A, Behnke JM. The anthelmintic efficacy of natural plant cysteine proteinases against two rodent cestodes Hymenolepis diminuta and Hymenolepis microstoma in vitro. Vet Parasitol 2014;201(1-2):48-58. 30. Mansur F, Luoga W, Buttle DJ, Duce IR, Lowe AE, Behnke JM. The anthelmintic efficacy of natural plant cysteine proteinases against the equine tapeworm, Anoplocephala perfoliata in vitro. J Helminthol 2016;90(5):561-568. 31. Flores-Pérez FI, de Aluja AS, Martínez-Maya JJ. Efectos en el desarrollo del metacestodo de Taenia solium inducidos por dosis bajas de radiación gamma. Vet Méx 2006;37(3):303-311. 32. Rosas-Velasco C, Pérez-Martínez M, Castillo-Juárez H, Flores-Pérez FI. Cambios histológicos inducidos por el acetato de medroxiprogesterona en el útero de conejas ovariectomizadas. Vet Méx 2007;38(2):207-214. 33. Peña G, Aguilar Jiménez FA, Hallal-Calleros C, Morales-Montor J, HernándezVelázquez VM, Flores-Pérez FI. In vitro ovicidal and cestocidal effects of toxins from Bacillus thuringiensis on the canine and human parasite Dipylidium caninum. BioMed Res Int 2013. dx.doi.org/10.1155/2013/174619. 34. Wayne WD. Bioestadística. Base para el análisis de las ciencias de la salud. 4ª ed. México, D.F: Limusa; 2006. 35. Martin RJ. Modes of action of anthelmintic drugs. Vet J 1997;154(1):11-34.

982

Rev Mex Cienc Pecu 2021;12(3):969-986

36. Hu Y, Xiao SH, Aroian RV. The new anthelmintic tribendimidine is an L-type (levamisole and pyrantel) nicotinic acetylcholine receptor agonist. Plos Neglected Trop Dis 2009;3(8):1-9. 37. Keiser J, Tritten L, Silbereisen A, Speich B, Adelfio R, Vargas M. Activity of oxantel pamoate monotherapy and combination chemotherapy against Trichuris muris and hookworms: Revival of an old drug. Plos Neglected Trop Dis 2013;7(3):1-8. 38. Choi WY, Lee OR, Lee WK, Kim WK, Chung CS, Ough BO. A clinical trial of Oxantel and Pyrantel against intestinal nematodes infections. Korean J Parasitol 1979;17(1):6066. 39. Slocombe JOD. A modified critical test for the efficacy of pyrantel pamoate for Anoplocephala perfoliata in equids. Can J Vet Res 2004;68(2):112-117. 40. Marchiondo AA, White GW, Smith LL, Creinemeyer CR, Dascanio JJ, Johnson EG, Shugart JI. Clinical field efficacy and safety of pyrantel pamoate paste (19.13% w/w pyrantel base) against Anoplocephala perfoliata in naturally infected horses. Vet Parasitol 2006;137(1-2):94-102. 41. Reinemeyer CR, Hutchens DE, Eckblad WP, Marchiondo AA, Shugart JI. Doseconfirmation studies of the cestocidal activity of pyrantel pamoate paste in horses. Vet Parasitol 2006;138(3-4):234-239. 42. Reyes JL, González MI, Ledesma-Soto Y, Satoskar AR, Terrazas LI. TLR2 mediates immunity to experimental cysticercosis. Int J Biol Sci 2011;7(9):1323-1333. 43. Becker B, Mehlhorn H, Andrews P, Thomas H. Scanning and transmission electron microscope studies on the efficacy of praziquantel on Hymenolepis nana (Cestoda) in vitro. Z, Parasitenkd 1980;61(2):121-133. 44. Mehlhorn H, Becker B, Andrews P, Thomas H. On the nature of the proglottids of cestodes: A light and electron microscopic study on Taenia, Hymenolepis, and Echinococcus. Z Parasitenkd 1981;65(3):243-259. 45. Becker B, Mehlhorn H, Andrews P, Thomas H. Ultrastructural investigations on the effect of praziquantel on the tegument of five species of Cestodes. Z Parasitenkd 1981;64(3):257-269. 46. Willms K, Robert L, Caro JA. Ultrastructure of smooth muscle, gap junctions and glycogen distribution in Taenia solium tapeworms from experimentally infected hamsters. Parasitol Res 2003;89(4):308-316.

983

Rev Mex Cienc Pecu 2021;12(3):969-986

47. Willms K, Robert L, Jiménez JA, Everhart M, Kuhn RE. Ultrastructure of spermiogenesis and the spermatozoon in Taenia crassiceps strobilae WFU strain (Cestoda, Cyclophyllidea, Taeniidae) from golden hamsters. Parasitol Res 2004;93:262267. dx.doi.org/10.1007/s00436-004-1125-5. 48. Willms K, Robert L. Ultrastructure of a spermatid transport system in the mature proglottids of experimental Taenia crassiceps (WFU strain). Parasitol Res 2007;101:967-973. dx.doi.org/10.1007/s00436-007-0570-3. 49. Willms K, Zurabian R. Taenia crassiceps: in vivo and in vitro models. Parasitology 2010;137(3):335-346. 50. Maggiore M, Elissondo MC. In vitro cestocidal activity of thymol on Mesocestoides corti Tetrathyridia and adult worms. Interdisciplinary Perspectives on Infect Dis 2014. dx.doi.org/10.1155/2014/268135. 51. Tandon V, Pal P, Roy B, Rao HSP, Reddy KS. In vitro anthelmintic activity of roottuber extract of Flemingia vestita, an indigenous plant in Shillong, India. Parasitol Res 1997;83(5):492-498. 52. Roy B, Dasgupta S, Tandon V. Ultrastructural observations on tegumental surface of Raillietina echinobothrida and its alterations caused by root-peel extract of Millettia pachycarpa. Microscopy Res Tech 2008;71(1):810-815. 53. Challam M, Roy B, Tandon V. Effect of Lysimachia ramosa (Primulaceae) on helmint parasites: Motility, mortality and scanning electron microscopic observations on surface topography. Vet Parasitol 2010;169(1-2):214-218. 54. Dasgupta S, Roy B, Tandon V. Ultrastructural alterations of the tegument of Raillietina echinobothrida with the stem bark of Acacia oxyphylla (Leguminosae). J Ethnopharmacol 2010;127(2):568-571. 55. Meaney M, Fairweather I, Brennan GP, Forbes AB. Transmission electron microscope study of the ultrastructural changes induced in the tegument and gut of Fasciola hepatica following in vivo drug treatment with clorsulon. Parasitol Res 2004;92:232-241. dx.oi.org/10.1007/s00436-003-1036-x. 56. Roy B, Tandon V. Effect of root-tuber extract of Flemingia vestita, a leguminous plant, on Artyfechinostomum sufrartyfex and Fasciolopsis buski: A scanning electron microscopy study. Parasitol Res 1996;82:248-252. dx.doi.org/10.1007/s004360050104.

984

Rev Mex Cienc Pecu 2021;12(3):969-986

57. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. In vitro anthelmintic effects of cysteine proteinases from plants against intestinal helminths of rodents. J Helminthol 2007;81(4):353-360. 58. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. In vitro and in vivo anthelmintic efficacy of plant cysteine proteinases against the rodent gastrointestinal nematode, Trichuris muris. Parasitology 2006;132(5):681-689. 59. Stepek G, Lowe AE, Buttle DJ, Duce IR, Behnke JM. The anthelmintic efficacy of plantderived cysteine proteinases against the rodent gastrointestinal nematode, Heligmosomoides polygyrus, in vivo. Parasitology 2007;134(10):1409-1419. 60. Stepek G, Curtis RHC, Kerry BR, Shewry PR, Clark SJ, Lowe AE, Duce IR, Buttel DJ, Behnke JM. Nematicidal effects of cysteine proteinases against sedentary plant parasitic nematodes. Parasitology 2007;134(12):1831-1838. 61. Chalar C, Salomé M, Señolare-Pose M, Marín M, Williams CT, Dauphin Y. A high resolution analysis of the structure and chemical composition of the calcareous corpuscles from Mesocestoides corti. Micron 2013;44:185-192. dx.doi.org/10.1016/j.micron.2012.06.008. 62. Etges FJ, Marinakis V. Formation and excretion of calcareous bodies by the metacestode (Tetrathyridium) of Mesocestoides vogae. J Parasitol 1991;77(4):595-602. 63. Vargas-Parada L, Laclette JP. Role of calcareous corpuscles in cestode physiology: A review. Rev Latinoam Microbiol 1999;41(4):303-307. 64. Khin SS, Kitazawa R, Htet K, Htike HM, Yee TT, Aung M, Haraguchi R, Kitazawa S. Intestinal inflammatory pseudotumor caused by taeniasis: Calcareous corpuscles as a diagnostic clue. Pathol Int 2013;63(3):193-194. 65. Loos JA, Caparros PA, Nicolao MC, Denegri GM, Cumino AC. Identification and pharmacological induction of autophagy in the larval stages of Echinococcus granulosus: an active catabolic process in calcareous corpuscles. Int J Parasitol 2014;44(4):415-427. 66. Yang HJ. Immunoblot findings of calcareous corpuscles binding proteins in cyst fluid of Taenia solium metacestode. Korean J Parasitol 2004;42(3):141-143. 67. Park YK, Park JH, Guk SM, Shin EH, Chai JY. A new method for concentration of proteins in the calcareous corpuscles separated from the spargana of Spirometra erinacei. Korean J Parasitol 2005;43(3):119-122.

985

Rev Mex Cienc Pecu 2021;12(3):969-986

68. Willms K, Fernández PAM, Jiménez JA, Landa A, Zurabián R, Juárez UME, Robert L. Taeniid tapeworm responses to in vitro glucose. Parasitol Res 2005;96: 296-301. dx.doi.org/10.1007/s00436-005-1348-0. 69. Araujo JM, de Araújo JV, Braga FR, Carvalho RO, Ferreira SR. Activity of the nematophagous fungi Poconia chlamydospora, Duddingtonia flagrans and Monacrosporium thaumasium on egg capsules of Dipylidium caninum. Vet Parasitol 2009;166(1-2):86-89.

986

https://doi.org/10.22319/rmcp.v12i3.5771 Technical note

Definition and analysis of the panel of SNPs to be used in paternity tests for three breeds of cattle

Joel Domínguez-Viveros a* Adán Medellín-Cazares a Nelson Aguilar-Palma a Francisco Joel Jahuey-Martínez a Felipe Alonso Rodríguez-Almeida a

Universidad Autónoma de Chihuahua. Facultad de Zootecnia y Ecología. Periférico Francisco R. Almada km 1. 31453, Chihuahua, Chih. México.

*Corresponding author: joeldguezviveros@yahoo.com.mx; jodominguez@uach.mx

Abstract: In order to define the SNP panel for paternity tests in cattle, genotypes were analyzed in three breeds (number of SNPs evaluated and individuals sampled): Hereford (HER; 202; 1317), Brangus (BRA; 217; 3431) and Limousin (LIM; 151; 8205). Within breed, SNPs with a percentage of genotyped individuals (PGI) less than 90 %, with Hardy-Weinberg disequilibrium (HW; P<0.05), with allele frequency less than 0.10 or less and with linkage disequilibrium, where the correlation between genotypic frequencies was greater than 0.25, were discarded. The levels of expected (He) and observed (Ho) heterozygosity, polymorphic information content (PIC) were estimated; as well as the Shannon index, the fixation index and effective population size (Ne). The combined exclusion probability (CEP) and identity probability (CIP) were calculated. The final panel was 121, 188 and 113 SNPs in HER, BRA and LIM, respectively; the main source of discard was HW followed by PGI. Levels of Ho and He were above 0.40; CIP was greater than 0.32 and Ne presented estimates above 181.3. The results for CEP were higher than 0.999999; for CIP, they were below 1 x 10-20.

987

Rev Mex Cienc Pecu 2021;12(3):987-995

Key words: Heterozygosity, Exclusion probability, Identity probability, Polymorphism, Shannon Index.

Received: 17/08/2020 Accepted: 03/12/2020

In Mexico, genetic evaluations (GEEV) in beef cattle have been carried out since 2001; around 25 breeds, arranged in national associations of registered cattle breeders, GEEVs combine the genealogical and productive information contained in the registration books(1). Genealogical information, which makes up the genealogical record of breed purity or degrees of purity, defines the parentage relationships of the entire population through the pedigree of each individual. Errors in the veracity and integrity of the pedigree have effects on the certainty of breed purity; in the definition of founding ancestors and assignment of individuals to generations, as well as in the calculations of the levels of consanguinity and parentage(2,3,4). In GEEV, errors in genealogical information have consequences in the estimation of variance components and genetic parameters, as well as in the prediction of genetic values and hierarchization of sires; consequently, they also affect the response to genetic selection and progress(5,6,7,8). Genetic markers (GEMA) express the polymorphism of DNA, their evolution and use have strengthened animal genetic improvement programs(9,10,11). In cattle, paternity tests have evolved with the development of GEMAs(12); the International Society for Animal Genetics (ISAG) initially proposed a panel of 121 SNPs (Single-Nucleotide Polymorphism) developed in Bos taurus breeds, later, 100 SNPs derived from Bos indicus breeds(13,14) were added. In Mexico, paternity tests have been implemented in the Brangus, Limousin and Hereford breeds based on the SNP panel proposed by ISAG; however, it is necessary to validate the SNP panel by populations, since the functionality and veracity of a GEMA in genetic tests depends on the Hardy-Weinberg equilibrium, the possible linkage disequilibrium, the polymorphic information content, among other components; in addition, in a set of GEMA, the test power is validated by the exclusion probability(14,15). In this regard, studies have been carried out validating the SNP panel developed by ISAG to be used in cattle paternity tests in Brazil(16), Argentina(17), China(18,19), the United States(20,21), Japan(22.23) and Europe(24,25,26). Based on the above, the objectives of this study were to validate the SNP panel defined by the International Society for Animal Genetics for genetic tests in Mexican cattle populations.

988

Rev Mex Cienc Pecu 2021;12(3):987-995

The genotypes of SNP for cattle were analyzed: Brangus (BRA), Hereford (HER) and Limousin (LIM); Table 1 describes the database analyzed. In a first edition, a quality control of the database was carried out; the information of the individual and the sample was verified, as well as Mendelian conflict, duplicate and identical genotypes by state. The panel evaluated in each breed is a subset of the general panel proposed by ISAG; for LIM, the processing of the samples was carried out by the Labogena laboratory based on the SNPs used in France; for the other breeds, the process was carried out by the Neogen GeneSeek laboratory with the set of SNPs used in the US. The analyses were developed within breed in four stages: 1. Assessment of the percentage of individuals (call rate) with identified genotype (PGI); estimation of allelic and genotypic frequencies, as well as Hardy-Weinberg (HW) equilibrium analysis. 2. Discarding the SNPs with HW disequilibrium (P< 0.05) and PGI less than 90 %, the possible linkage disequilibrium (LD) was analyzed based on the correlation (r2) between genotypic frequencies through SNP, the expected (He) and observed heterozygosity (Ho), the polymorphic information content (PIC), the Shannon index (SI) and the fixation index (FIS) were estimated. With the average r2 and adjusted for the sample size, the effective population size (Ne) was estimated, based on the Waples approach(27). 3. A panel of SNPs by breed was integrated, discarding SNPs with HW disequilibrium (p< 0.05), with lesser allele frequency (LAF) equal to or less than 0.10, with LD(26) where r2 was greater than 0.25 and PGI less than 0.90 %. 4. With the subset of SNPs for each breed, they were sorted in descending order by PIC and the exclusion probability (EP) was calculated in three modalities(28,29,30): (a) with one candidate parent and another known parent, to exclude the candidate parent [EP1 = 1 – 2*∑𝑛𝑖=1 𝑝𝑖 2 + ∑𝑛𝑖=1 𝑝𝑖 3 + 2*∑𝑛𝑖=1 𝑝𝑖 4 – 3*∑𝑛𝑖=1 𝑝𝑖 5 – 2*(∑𝑛𝑖=1 𝑝𝑖 2 )2 + 3*∑𝑛𝑖=1 𝑝𝑖 2 *∑𝑛𝑖=1 𝑝𝑖 3 ]; (b) given a candidate parent and the progeny, to be able to exclude the relationship between them [EP2 = 1 – 4*∑𝑛𝑖=1 𝑝𝑖 2 + 2*(∑𝑛𝑖=1 𝑝𝑖 2 )2 + 4*∑𝑛𝑖=1 𝑝𝑖 3 – 3*∑𝑛𝑖=1 𝑝𝑖 4 ]; and, (c) with two candidate parents, exclusion of one or both [EP3 = 1 + 4*∑𝑛𝑖=1 𝑝𝑖 4 - 4∑𝑛𝑖=1 𝑝𝑖 5 – 3*∑𝑛𝑖=1 𝑝𝑖 6 – 8*(∑𝑛𝑖=1 𝑝𝑖 2)2 + 8*(∑𝑛𝑖=1 𝑝𝑖 2 )*( ∑𝑛𝑖=1 𝑝𝑖 3) + 2*(∑𝑛𝑖=1 𝑝𝑖 3)2. The combined exclusion probability for each situation was (CEP= 1 - (1 – EPi). In addition, two identity probabilities (IP) were estimated(31): the probability of identity of two individuals taken at random, present identical genotypes [IP1 = ∑𝑛𝑖=1 𝑝𝑖 4 + ∑𝑛𝑖=1 ∑𝑛𝑖=1(2𝑝𝑖𝑝𝑗)2 ]; and, the probability of identity for two full siblings, taken at random, present identical genotypes [IP2 = 0.25 + (0.5*∑𝑛𝑖=1 𝑝𝑖 2) + (0.5*(∑𝑛𝑖=1 𝑝𝑖 2 )2) – (0.25*∑𝑛𝑖=1 𝑝𝑖 4 )]. The combined identity probability (CIP) for each situation was calculated with the product of the probabilities of identity of each marker. The analyses were performed with the programs FSTAT(32), LDNE(33) and GenAlex(34). Table 1 summarizes the process of selecting and discarding SNPs by breed, as well as the structure of the final panel. The total number of SNPs removed by breed, as a percentage of

989

Rev Mex Cienc Pecu 2021;12(3):987-995

the total evaluated, fluctuated from 13.4 % (BRA) to 40.0 % (HER), where the main cause of discarding was the HW disequilibrium (P<0.05). In the process of discarding SNPs, no trend or association between markers was observed, the set of SNPs separated by breeds was different. The final number of SNPs per breed fluctuated from 113 (LIM) to 188 (BRA), which are within the guidelines of ISAG(13), which stipulates that the panel per breed must be made up of at least 100 SNPs. Table 1: Definition of the SNP panel by breed based on discard criteria Breed Herford Brangus Limousin

SNPn

PGI

LAF

SNPf

1,317 3,431 8,205

202 217 151

41 2 9

30 19 28

8 2 1

2 6 0

121 188 113

N= number of individuals sampled. SNPn= number of SNPs evaluated. PGI= number of SNPs removed due to percentage of individuals with identified genotypes less than 90 %. HW= number of SNPs discarded for presenting Hardy-Weinberg disequilibrium (P<0.05). LAF= number of SNPs separated due to lesser allele frequency, less than 0.10. LD = number of SNPs discarded due to linkage disequilibrium, since the correlation between frequencies was greater than 0.25. SNPf= total SNPs that make up the panel by breed.

Table 2 presents the results for Ho, He, PIC, FIS and Ne. No differences between Ho and He are observed, which reflects that the selected SNP set is in HW equilibrium. For SI, the results in all three populations were below one, which can be associated with homogeneity in the populations and the uncertainty to predict the probability of assigning an individual to the population that will belong reduces. For FIS, all results tend to zero, indicating a stability in the relationship of homozygotes and heterozygotes. With Ne estimates, within the framework of the HW equilibrium, the expected increases in consanguinity (ΔF = 1 / 2Ne) per generation range from 0.08 to 0.27 %. He, Ho, and PIC levels determine whether or not a genetic marker is informative and its potential for use in genetic variability studies; however, the hierarchization or ordering of SNPs by the capacity of use may be different between populations. Table 2: Indicators of genetic variability (average values) based on the SNP panel selected for each breed Breed

PIC

FIS

Herford Brangus Limousin

0.416 0.433 0.451

0.419 0.434 0.452

0.328 0.337 0.348

0.607 0.623 0.643

0.008 0.002 0.004

181.3 246.9 629.8

Observed (Ho) and expected (He) heterozygosity. PIC= polymorphic information content. SI= Shannon Index. FIS= fixation index. Ne= effective size.

With the total number of SNPs selected in each breed, the results for CEP in the three modalities were greater than 0.999999; for CIP, they were below 1 x 10-39 and 1 x 10-20 in

990

Rev Mex Cienc Pecu 2021;12(3):987-995

PI1 and PI2, respectively. Table 3 describes the results for the alternate forms of CEP and CIP, partially achieved with 50 SNPs. Given the genetic structure of the populations and the forces that affect the genetics of populations, the conformation and arrangement of a panel of SNPs to verify paternity in cattle can have different dimensions and probability values: Heaton et al(20), with a panel of 32 SNPs by 17 breeds, published a CEP greater than 0.994 and a CIP of 1.9 x 10-13; Van Eenennaam et al(21), with 28 SNPs, LAF greater than 0.40 in commercial herds, obtained a CEP of 0.956; Hara et al(29), with 29 SNPs for a breed native to Japan reported a CIP of 2.73 x 10-12 and a CEP of 0.96929 to 0.99693. In other related studies, Werner et al(24) published a CEP greater than 0.9999 and a CIP of 1 x 10-13 with 37 SNPs. Fernández et al(17), in Angus with an arrangement of 116 SNPs, reported combined non-exclusion probabilities (CNEP = 1 – CEP) in the range of 2.1 x 10-4 to 1.4 x 10-9, as well as CIP of 4.1 x 10-15. Panetto et al(16), for the Sindhi breed from Brazil, with 71 SNPs where LAF was higher than 0.35, published CNEP of 1 x 10-8. Zhang et al(18), in Simmental cattle with 50 SNPs and LAF greater than 0.40, reported CEP greater than 0.9989; Hu et al(19), in crossbred cattle from China, with 50 SNPs where the average LAF value was 0.43, obtained CEP from 0.99797 to 0.999999. Table 3: Exclusion and identity probability values, obtained with 50 SNPs within the total panel selected by breed Breed

CEP1

CEP2

CEP3

SNPi

CIP1

CIP2

Hereford Brangus Limousin

0.99996 0.99996 0.99996

0.99831 0.99861 0.99849

0.99999 0.99999 0.99999

113 91 97

1.0E-21 6.2E-22 7.7E-22

8.2E-12 5.7E-12 6.6E-12

CEP1= combined exclusion probability, with a candidate parent and another known parent. CEP2= combined exclusion probability, given a candidate parent and progeny. CEP3= combined exclusion probability with two candidate parents. CIP1= combined identity probability for two individuals taken at random. CIP2= combined identity probability, for two full siblings taken at random. SNPi= number of SNPs required to obtain a value greater than 0.999999 in the probabilities of exclusion.

For Brangus, Hereford and Limousin cattle, the number of SNPs that make up the panel for paternity tests was greater than 100; selected based on the criteria associated with genetic variability and population structure, with values of exclusion probability greater than 0.999999 and identity probability below 6.6 x 10-12.

991

Rev Mex Cienc Pecu 2021;12(3):987-995

Acknowledgements

Thanks to the National Association of Brangus and Limousin Cattle Breeders; as well as the Mexican Hereford Association, for providing the database of the present study. Thanks to the National Council for Science and Technology for the scholarship for postgraduate studies provided. All authors declare that there is no conflict of interest. Literature cited: 1.

CONARGEN. Guía técnica de programas de control de producción y mejoramiento genético en bovinos. Consejo Nacional de los Recursos Genéticos Pecuarios. México. 2010.

Banos G, Wiggans GR, Powell RL. Impact of paternity errors in cow’s identification on genetic evaluations and international comparisons. J Dairy Sci 2001;84:2523-2529.

Atkin FC, Dieters MJ, Stringer JK. Impact of depth of pedigree and inclusion of historical data on the estimation of additive variance and breeding values in a sugarcane breeding program. Theo Appl Gen 2009;119:555-565.

Ramírez-Valverde R, Delgadillo-Zapata AR, Domínguez-Viveros J, Hidalgo-Moreno JA, Núñez-Domínguez R, Rodríguez-Almeida FA, et al. Análisis del pedigrí en la determinación de la diversidad genética de poblaciones bovinas para carne mexicana. Rev Mex Cienc Pecu 2018;9:614-635.

Visscher PM, Woolliams JA, Smith D, Williams JL. Estimation of pedigree errors in the UK dairy population using microsatellite markers and the impact on selection. J Dairy Sci 2002;85:2368-2375.

Sanders K, Bennewitz J, Kalm E. Wrong and missing sire information affects genetic gain in the Angeln dairy cattle population. J Dairy Sci 2006;89:315-321.

Parlato E, Van Vleck LD. Effect of parentage misidentification on estimates of genetic parameters for milk yield in the Mediterranean Italian buffalo population. J Dairy Sci 2012;95:4059-4064.

Raoul J, Palhiere I, Astruc JM, Elsen JM. Genetic and economic effects of the increase in female paternal filiations by parentage assignment in sheep and goat breeding programs. J Anim Sci 2016;94:3663–3683.

992

Rev Mex Cienc Pecu 2021;12(3):987-995

Vignal A, Milan D, SanCristobal M, Eggen A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet Sel Evol 2002;34:275-305.

10. Cañón J. Using molecular information in animal improvement programs. Rev Corpoica 2006;7:5-15. 11. Dekkers, JCM. Application of genomics tools to animal breeding. Current Genomics 2012;13:207-212. 12. Flanagan SP, Jones AG. The future of parentage analysis: from microsatellites to SNPs and beyond. Mol Ecol 2019;28:544-567. 13. Morrin R, Boscher M. Cattle molecular markers and parentage testing workshop. ISAG Conference 2012;1-7. 14. Strucken EM, Lee SH, Lee HK, Song KD, Gibson JP, Gondro C. How many markers are enough? Factors influencing parentage testing in different livestock populations. J Anim Breed Genet 2016;133:13-23. 15. Baruch E, Weller J. Estimation of the number of SNP genetic markers required for parentage verification. Anim Genet 2008;39:474-479. 16. Panetto JCD, Machado MA, da Silva MVG, Barbosa RS, dos Santos GG, Leite RMHR, Peixoto MGC. Parentage assignment using SNP markers, inbreeding and population size for the Brazilian Red Sindhi cattle. Livest Sci 2017;204:33-38. 17. Fernández ME, Goszczynski DE, Liron JP, Villegas-Castagnasso EE, Cariño MH, Ripoli MV, et al. Comparison of the effectiveness of microsatellites and SNP panels for genetic identification, traceability, and assessment parentage in an inbred Angus herd. Genet Mol Biol 2013;36:185-191. 18. Zhang T, Guo L, Shi M, Xu L, Chen Y, Zhang L, Gao H, Li J, Gao X. Selection and effectiveness of informative SNPs for paternity in Chinese Simmental cattle based on a high-density SNP array. Gene 2018;673:211-216. 19. Hu L, Li D, Chu Q, Wang Y, Zhou L, Yu Y, Zhang Y, et al. Selection and implementation of SNP markers for parentage analysis in a Chinese crossbred cattle population. Res Square 2020;e30446/v1. 20. Heaton MP, Harhay GP, Bennett GL, Stone RT, Grosse WM, Casas E, et al. Selection and use of SNP markers for animal identification and paternity analysis in U.S. beef cattle. Mamm Gen 2002;13:272-281.

993

Rev Mex Cienc Pecu 2021;12(3):987-995

21. Van Eenennaam AL, Weaber RL, Draker DJ, Penedo MCT, Quaas RL, Garrick DJ, Pollak EJ. DNA-based paternity analysis and genetic evaluation in a large commercial cattle ranch setting. J Anim Sci 2007;85:3159-3169. 22. Honda T, Katsuta T, Mukai F. Simulation study on parentage analysis with SNPs in the Japanese cattle population. Asian-Aust J Anim Sci 2009;10:1351-1358. 23. Strucken EM, Gudex B, Ferdosi MH, Lee HK, Song KD, Gibson JP, et al. Performance of different SNP panels for parentage testing in two East Asian cattle breeds. Anim Genet 2014;45:572-575. 24. Werner FAO, Durstewitz G, Habemann FA, Thaller G, Kramer W, Kollers S, et al. Detection, and characterization of SNP useful for identity control and parentage testing in major European dairy breeds. Anim Genet 2004;35:44-49. 25. Negrini R, Nicoloso L, Crepaldi P, Milanesi E, Colli L, Chegdani F, et al. Assessing SNP markers for assigning individuals to cattle populations. Anim Genet 2009;40:1826. 26. Allen AR, Taylor M, McKeown B, Curry AI, Lavery JF, Mitchell A, et al. Compilation of a panel of informative single nucleotide polymorphisms for bovine identification in the Northern Iris cattle population. BMC Genet 2010;11:Art 5. 27. Waples RS. A bias correction for estimate of effective population size base on linkage disequilibrium at unlinked loci. Conserv Genet 2006;7:167-184. 28. Jamieson A, Taylor SC. Comparisons of three probability formulae for parentage exclusion. Anim Genet 1997;28:397-400. 29. Hara K, Watabe H, Sasazaki S, Mukai F, Mannen H. Development of SNP markers for individual identification and parentage test in Japanese black cattle population. Anim Sci J 2010;81:152-157. 30. Olenski K, Kaminski S, Tokarska M, Hering DM. Subset of SNPs for parental identification in European bison Lowland-Bialowieza line (Bison bonasus bonasus). Conserv Genet Res 2018;10:73-78. 31. Waits L, Luikart G, Taberlet P. Estimating the probability of identity among genotypes in natural populations cautions and guidelines. Mol Ecol 2001;10:249-256. 32. Goudet J. FSTAT: A computer program to calculate F-Statistics. J Heredity 1995;86:485-486.

994

Rev Mex Cienc Pecu 2021;12(3):987-995

33. Waples RS, Do Chi. LDNE: a program for estimating effective population size from data on linkage disequilibrium. Mol Ecol 2008;8:753-756. 34. Peakall R, Smouse PE. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research – an update. Bioinformatics 2012;28:2537-2539.

995

Revista Mexicana de Ciencias Pecuarias

Edición Bilingüe Bilingual Edition

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

ISSN: 2448-6698

Pags. Diversidad genética y factores de virulencia de cepas de Staphylococcus aureus aisladas de la piel de ubre bovina

Genetic diversity and virulence factors of Staphylococcus aureus strains isolated from bovine udder skin Roberto Adame-Gómez, Jeiry Toribio-Jimenez, Na vidad Castro-Alarcón, Karina Talavera-Alarcón, Jacqueline Flores-Gavilan, Sandra-Alheli Pineda-Rodríguez, Arturo Ramírez-Peralta ………………….….…665

Molecular prediction of serotypes of Streptococcus suis isolated from pig’s farms in Mexico

Predicción molecular de serotipos de Streptococcus suis aislados de granjas porcinas en México Arianna Romero Flores, Marcelo Go schalk, Gabriela Bárcenas Morales, Víctor Quintero Ramírez, Rosario Esperanza Galván Pérez, Rosalba Carreón Nápoles, Ricardo Ramírez R., José Iván Sánchez Betancourt, Abel Ciprián Carrasco, Susana Mendoza Elvira ….…………………........………...…...………………..681

La coexistencia de Desmodus rotundus con la población humana en San Luis Potosí, México

The coexistence of Desmodus rotundus with the human population in San Luis Potosí, Mexico Ximena Torres-Mejía, Juan José Pérez-Rivero, Luis Alberto Olvera-Vargas, Evaristo Álvaro Barragán-Hernández, José Juan Mar nez-Maya, Álvaro Aguilar-Se én…………….....……..……..….....……..…………….694

Detection of Pasteurella multocida, Mannhemia haemolytica, Histophilus somni and Mycoplasma bovis in cattle lung

Detección de Pasteurella multocida, Mannhemia haemolytica, Histophilus somni y Mycoplasma bovis en pulmón de bovinos Seyda Cengiz, M. Cemal Adıgüzel, Gökçen Dinç..........……..…….....……...……..…….....…...……..…….....…...……..…….....…...……..…….....…...……..…………………….....…...……….....…….....…….....…….....…..…….......………710

Treating horse chronic laminitis with allogeneic bone marrow mesenchymal stem cells

Tratamiento de la laminitis crónica en equinos utilizando células troncales mesenquimales alogénicas de la médula ósea Alma A García-Lascuráin, Gabriela Aranda-Contreras, Margarita Gómez-Chavarín, Ricardo Gómez, Adriana Méndez-Bernal, Gabriel Gu érrez-Ospina, María Masri ......…………..…………..………………….…..721

Composición nutricional de la carne equina y grado de sustitución de la carne bovina por equina en expendios de la Ciudad de México

Nutritional composition of equine meat and degree of substitution of bovine for equine meat in stores in Mexico City Guillermo Reséndiz González, Baldomero Alarcón Zúñiga, Itzel Villegas Velázquez, Samuel Albores Moreno, Gilberto Aranda Osorio ……..………………………………………………………........…………………...………..742

Supplementation with Agave fourcroydes powder on growth performance, carcass traits, organ weights, gut morphometry, and blood biochemistry in broiler rabbits

Suplementación con polvo de Agave fourcroydes en el crecimiento, características de la canal, peso de los órganos, morfometría intestinal y bioquímica sanguínea en conejos de engorda Yordan Mar nez, Maidelys Iser, Manuel Valdivié, Jorge Galindo, David Sánchez……………………………………………………....……………………………………………………………………………………………………...…….…….….......756

Evaluación de los componentes del manejo antes, durante y después de la matanza y su asociación con la presencia de carne DFD en bovinos del noreste de México

Evaluation of the components of management before, during and after slaughter and their association with the presence of DFD beef in cattle from northeastern Mexico Gabriela Palomares Resendiz, Francisco Aguilar Romero, Carlos Flores Pérez, Luis Gómez Núñez, Jorge Loredo Os , Eduardo Sánchez López, Alberto Barreras Serrano, Fernando Figueroa Saavedra, Cris na Pérez Linares, Miguel Ruiz Albarrán …………………..……..………………………………………......………..773

In vitro methane production and fermentative parameters of wild sunflower and elephant grass silage mixtures, either inoculated or not with epiphytic lactic acid bacteria strains

Producción de metano in vitro y parámetros fermentativos de mezclas de ensilado de girasol silvestre y pasto elefante, inoculadas o no con cepas de bacterias ácido-lácticas epífitas Vilma Amparo-Holguín, Mario Cuchillo-Hilario, Johanna Mazabel, Steven Quintero, Siriwan Martens, Jairo Mora-Delgado ……………………………………………..…….....…….....…….....…….....….…………..…………..789

Fases de desarrollo y propagación de ecotipos destacados de Tithonia diversifolia (Hemsl.) A. Gray

Phases of development and propagation of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray Phases of development and propaga on of outstanding ecotypes of Tithonia diversifolia (Hemsl.) A. Gray……..……..……..……..……..……..……..……..……………………………..……………………………………….…………...811

Structure of forage sward with Urochloa brizantha cultivars under shading

Estructura del pasto forrajero con cultivares de Urochloa brizantha bajo sombra Estella Rosseto Janusckiewicz, Luísa Melville Paiva, Henrique Jorge Fernandes, Alex Coene Fleitas, Patricia dos Santos Gomes …………………………………………………………………....……….....…….....…….....……...828

Características de la producción de leche en La Frailesca, Chiapas, México

Characteristics of milk production in La Frailesca, Chiapas, Mexico Joaquín Huitzilihuitl Camacho-Vera, Juan Manuel Vargas-Canales, Le cia Quintero-Salazar, Gregorio Wenceslao Apan-Salcedo …………..………………....…………………..…………..…………..…………..…………..…..…845

Análisis de la demanda de bovinos carne en pie en los centros de sacrificio de México, 2000-2018

Analysis of the demand for live beef cattle in slaughter centers in Mexico, 2000-2018 Nicolás Callejas Juárez, Samuel Rebollar Rebollar ……………………………………..………………....…………………..…………..…………..…………..……………….....…….....…….....…….....…….....…….....…….....…….....……....…………..861

Effect of two phantom parent grouping strategies on the genetic evaluation of growth traits in Mexican Braunvieh cattle

Efecto de dos estrategias de agrupación de padres fantasmas en la evaluación genética de rasgos de crecimiento en el ganado Braunvieh mexicano Luis Antonio Saavedra-Jiménez, Rodolfo Ramírez-Valverde, Rafael Núñez-Domínguez, Agus n Ruíz-Flores, José Guadalupe García-Muñiz, Mohammad Ali Nilforooshan …..…………..…………..…………..…..878

Evaluación mineral de los componentes del sistema silvopastoril intensivo con Leucaena leucocephala en tres épocas del año

Mineral evaluation of the components of the intensive silvopastoral system with Leucaena leucocephala in three seasons of the year Andrés Camilo Rodríguez-Serrano, Alejandro Lara-Bueno, José Guadalupe García-Muñiz, Maximino Huerta-Bravo, Citlalli Celeste González-Aricega …..…………..…………..………….…….....……..........…………..893

Termorregulación y respuestas reproductivas de carneros bajo estrés por calor. Revisión

Thermoregulation and reproductive responses of rams under heat stress. Review Alejandra Barragán Sierra, Leonel Avendaño-Reyes, Juan A. Hernández Rivera, Ricardo Vicente-Pérez, Abelardo Correa-Calderón, Miguel Mellado, Cesar A. Meza-Herrera, Ulises Macías-Cruz ……..……910

Evaluación de las condiciones predisponentes a enfermedades en granjas porcinas a pequeña escala en un ambiente urbano en el noroeste de la Ciudad de México

Evaluation of disease-predisposing conditions in small-scale swine farms in an urban environment in northwestern Mexico City Roberto Mar nez Gamba, Gerardo Ramírez Hernández ……………………………………..………………....…………………..…………..…………..…………..…………..……………….....…….....…….....…….....…….....…….....…….....……..932

Determinación de aflatoxinas en especias, ingredientes y mezclas de especias usados en la formulación de productos cárnicos comercializados en la Ciudad de México

Determination of aflatoxins in spices, ingredients and spice mixtures used in the formulation of meat products marketed in Mexico City Montserrat Lizeth Ríos Barragán, José Fernando González Sánchez, Rey Gu érrez Tolen no, Arturo Camilo Escobar Medina, José Jesús Pérez González, Salvador Vega y León………………..……………….…..944

Efecto de la altura de corte de sorgo a la cosecha sobre el rendimiento de forraje y el valor nutritivo del ensilaje

Effect of the cutting height of sorghum at harvest on forage yield and nutritional value of silage Jorge A. Granados-Niño, David G. Reta-Sánchez, Omar I. Santana, Arturo Reyes-González, Esmeralda Ochoa-Mar nez, Fernando Díaz, Juan I. Sánchez-Duarte……....…………………………………………………….958

The effects of Pyrantel-Oxantel on the Dipylidium caninum tapeworm: An in vitro study

Efecto del Pyrantel-Oxantel en la tenia Dipylidium caninum: estudio in vitro Jair Millán-Orozco, Jersson Millán-Orozco, Miguel Ángel Betancourt-Alonso, América Ive e Barrera-Molina, María Soledad Valledor, Virginia Méndez, Alejandra Larrea, Mar n Sebas án Lima, Javier Morán-Mar nez, Nadia Denys Betancourt-Mar nez, Liliana Aguilar-Marcelino …… …..…………...………..…………..969

Definición y análisis del panel de polimorfismos de nucleótido simple a utilizar en pruebas de paternidad para tres razas de bovinos

Definition and analysis of the panel of SNPs to be used in paternity tests for three breeds of cattle Joel Domínguez-Viveros, Adán Medellín-Cazares, Nelson Aguilar-Palma, Francisco Joel Jahuey-Mar nez, Felipe Alonso Rodríguez-Almeida ..…………..…………..…………………………………………………..…………..987

Revista Mexicana de Ciencias Pecuarias Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021

CONTENIDO CONTENTS

Rev. Mex. Cienc. Pecu. Vol. 12 Núm. 3, pp. 665-995, JULIO-SEPTIEMBRE-2021